Sample records for micrococcus

  1. Taxonomic dissection of the genus Micrococcus: Kocuria gen. nov., Nesterenkonia gen. nov., Kytococcus gen. nov., Dermacoccus gen. nov., and Micrococcus Cohn 1872 gen. emend.

    PubMed

    Stackebrandt, E; Koch, C; Gvozdiak, O; Schumann, P

    1995-10-01

    The results of a phylogenetic and chemotaxonomic analysis of the genus Micrococcus indicated that it is significantly heterogeneous. Except for Micrococcus lylae, no species groups phylogenetically with the type species of the genus, Micrococcus luteus. The other members of the genus form three separate phylogenetic lines which on the basis of chemotaxonomic properties can be assigned to four genera. These genera are the genus Kocuria gen. nov. for Micrococcus roseus, Micrococcus varians, and Micrococcus kristinae, described as Kocuria rosea comb. nov., Kocuria varians comb. nov., and Kocuria kristinae comb. nov., respectively; the genus Nesterenkonia gen. nov. for Micrococcus halobius, described as Nesterenkonia halobia comb. nov.; the genus Nesterenkonia gen. nov. for Micrococcus halobius, described as Nesterenkonia halobia comb. nov.; the genus Dermacoccus gen. nov. for Micrococcus nishinomiyaensis, described as Dermacoccus nishinomiyaensis comb. nov.; and the genus Kytocossus gen. nov. for Micrococcus sedentarius, described as Kytococcus sedentarius comb. nov. M. luteus and M. lylae, which are closely related phylogenetically but differ in some chemotaxonomic properties, are the only species that remain in the genus Micrococcus Cohn 1872. An emended description of the genus Micrococcus is given [corrected].

  2. 21 CFR 173.135 - Catalase derived from Micrococcus lysodeikticus.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Catalase derived from Micrococcus lysodeikticus... Micrococcus lysodeikticus. Bacterial catalase derived from Micrococcus lysodeikticus by a pure culture... cheese, in accordance with the following conditions. (a) The organism Micrococcus lysodeikticus from...

  3. Micrococcus species-related peritonitis in patients receiving peritoneal dialysis.

    PubMed

    Kao, Chih-Chin; Chiang, Chih-Kang; Huang, Jenq-Wen

    2014-01-01

    Peritonitis is a major complication of peritoneal dialysis (PD) and remains the most common cause of PD failure. Micrococci are catalase-positive, coagulase-negative, and gram-positive cocci that are spherical, often found in tetrad, and belong to the family Micrococcaceae. Micrococcus species are commonly found in the environment, and it is now recognized that Micrococcus species can be opportunistic pathogens in immunocompromised patients. The only consistent predisposing factor for Micrococcus infection is an immunocompromised state. We report three cases of Micrococcus PD peritonitis. Improper practice of PD may have been the causative factor. Although Micrococcus species are low-virulence pathogens, infection could result in refractory peritonitis and subsequent PD failure. Intraperitoneal administration of vancomycin for at least 2 weeks is recommended for Micrococcus peritonitis.

  4. 21 CFR 173.135 - Catalase derived from Micrococcus lysodeikticus.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 21 Food and Drugs 3 2011-04-01 2011-04-01 false Catalase derived from Micrococcus lysodeikticus... FOOD FOR HUMAN CONSUMPTION Enzyme Preparations and Microorganisms § 173.135 Catalase derived from Micrococcus lysodeikticus. Bacterial catalase derived from Micrococcus lysodeikticus by a pure culture...

  5. Fluorescence of Bacteria, Pollens, and Naturally Occurring Airborne Particles: Excitation/Emission Spectra

    DTIC Science & Technology

    2009-02-01

    EEM spectra of Micrococcus lysodeikticus vegetative cells, dry............................... 24 Figure 18. EEM spectra of Micrococcus lysodeikticus...tryptophan, B. subtilis (vegetative cells) ATCC 6633, Pseudomonas fluorescens, Micrococcus lysodeikticus, Staphylococcus aureus, and Clostridium...present the EEM spectra of Pseudomonas fluorescens (dry), Yersinia pestis (dry and in water), Micrococcus lysodeikticus (dry and in water

  6. Standardized Procedures for Use of Nucleic Acid-Based Tools

    DTIC Science & Technology

    2008-08-01

    Dhc size or cell wall characteristics including Brevundimonas diminuta (small), Micrococcus sp. (small coccoid) and Halobacterium sp. (Dhc-like cell...Halobacterium species as a Dhc surrogate. Another potential surrogate based on size and shape is Micrococcus species including Micrococcus luteus... Micrococcus luteus (ATCC-4442) are relatively small (1,000 nm) spherical bacteria (Madigan et al., 2006). Due to the fact that introduction and

  7. Micrococcus lactis sp. nov., isolated from dairy industry waste.

    PubMed

    Chittpurna; Singh, Pradip K; Verma, Dipti; Pinnaka, Anil Kumar; Mayilraj, Shanmugam; Korpole, Suresh

    2011-12-01

    A Gram-positive, yellow-pigmented, actinobacterial strain, DW152(T), was isolated from a dairy industry effluent treatment plant. 16S rRNA gene sequence analysis indicated that strain DW152(T) exhibited low similarity with many species with validly published names belonging to the genera Micrococcus and Arthrobacter. However, phenotypic properties including chemotaxonomic markers affiliated strain DW152(T) to the genus Micrococcus. Strain DW152(T) had ai-C(15:0) and i-C(15:0) as major cellular fatty acids, and MK-8(H(2)) as the major menaquinone. The cell-wall peptidoglycan of strain DW152(T) had l-lysine as the diagnostic amino acid and the type was A4α. The DNA G+C content of strain DW152(T) was 68.0 mol%. In 16S rRNA gene sequence analysis, strain DW152(T) exhibited significant similarity with Micrococcus terreus NBRC 104258(T), but the mean value of DNA-DNA relatedness between these strains was only 42.3%. Moreover, strain DW152(T) differed in biochemical and chemotaxonomic characteristics from M. terreus and other species of the genus Micrococcus. Based on the above differences, we conclude that strain DW152(T) should be treated as a novel species of the genus Micrococcus, for which the name Micrococcus lactis sp. nov. is proposed. The type strain of Micrococcus lactis sp. nov. is DW152(T) (=MTCC10523(T) =DSM 23694(T)).

  8. [Preparation and characterization of monoclonal antibodies against Micrococcus luteus Rpf domain].

    PubMed

    Fan, Ai-lin; Shi, Chang-hong; Su, Ming-quan; Ma, Jing; Bai, Yin-lan; Cheng, Xiao-dong; Xu, Zhi-kai; Hao, Xiao-ke

    2008-05-01

    To express Micrococcus luteus Rpf domain in prokaryotic cells and prepare monoclonal antibodies against Rpf domain. The gene encoding Micrococcus luteus Rpf domain was amplified from genome of Micrococcus luteus by polymerase chain reaction(PCR), and inserted into cloning vector pUC-19. After sequenced, Micrococcus luteus Rpf domain gene was subcloned into the expression vector pPro-EXHT and transfected into E.coli DH5alpha. After induced by IPTG, the bacteria controlled by T7 promoter expressed the fused Micrococcus luteus Rpf domain protein with a hexahistidine tail at its N-terminal and the target protein was purified under denaturing conditions. Using this protein as antigen to immunize the BALB/c mice and prepare monoclonal antibodies against Micrococcus luteus Rpf domain. Then specifities and relative affinities of mAbs were identified by ELISA. The fusion protein was purified by metal chelate affinity chromatography under denaturing condition. Three cloned mAbs were prepared from the mice immunized by Rpf domain. All of them could recognize Rpf domain. specifically. The prepared mAbs against Rpf domain have strong specificity with high titers, which provides useful tools for further study of the function of Rpf domain in TB prevention.

  9. Radiation and Heat Resistance of Moraxella-Acinetobacter in Meats

    DTIC Science & Technology

    1978-01-23

    Parrish, and D. Duggan. 1956. Studies on a radiation-resistant Micrococcus . I. Isolation, morphology, cul- tural characteristics, and resistance to...Anderson, and P. R. Elliker. 1965. Ecology of Micrococcus radiodurans. Appl. Microbiol. 13: 1030. Lewis, N. F. 1973. Radio-resistant Micrococcus

  10. Description of Micrococcus aloeverae sp. nov., an endophytic actinobacterium isolated from Aloe vera.

    PubMed

    Prakash, Om; Nimonkar, Yogesh; Munot, Hitendra; Sharma, Avinash; Vemuluri, Venkata Ramana; Chavadar, Mahesh S; Shouche, Yogesh S

    2014-10-01

    A yellow Gram-stain-positive, non-motile, non-endospore -forming, spherical endophytic actinobacterium, designated strain AE-6(T), was isolated from the inner fleshy leaf tissues of Aloe barbadensis (Aloe vera) collected from Pune, Maharashtra, India. Strain AE-6(T) grew at high salt concentrations [10% (w/v) NaCl], temperatures of 15-41 °C and a pH range of 5-12. It showed highest (99.7%) 16S rRNA gene sequence similarity with Micrococcus yunnanensis YIM 65004(T) followed by Micrococcus luteus NCTC 2665(T) (99.6%) and Micrococcus endophyticus YIM 56238(T) (99.0%). Ribosomal protein profiling by MALDI-TOF/MS also showed it was most closely related to M. yunnanensis YIM 65004(T) and M. luteus NCTC 2665(T). Like other members of the genus Micrococcus, strain AE-6(T) had a high content of branched chain fatty acids (iso-C15:0 and anteiso-C15:0). MK-8(H2) and MK-8 were the predominant isoprenoid quinones. Cell wall analysis showed an 'A2 L-Lys-peptide subunit' type of peptidoglycan and ribose to be the major cell wall sugar. The DNA G+C content was 70 mol%. Results of DNA-DNA hybridization of AE-6(T) with its closest relatives from the genus Micrococcus produced a value of less than 70%. Based on the results of this study, strain AE-6(T) could be clearly differentiated from other members of the genus Micrococcus. We propose that it represents a novel species of the genus Micrococcus and suggest the name Micrococcus aloeverae sp. nov., with strain AE-6(T) ( = MCC 2184(T) = DSM 27472(T)) as the type strain of the species. © 2014 IUMS.

  11. Optimization of Nutrients and Culture Conditions for Alkaline Protease Production Using Two Endophytic Micrococci: Micrococcus aloeverae and Micrococcus yunnanensis.

    PubMed

    Prakash, Om; Nimonkar, Yogesh; Chavadar, Mahesh S; Bharti, Nidhi; Pawar, Shrikant; Sharma, Ashutosh; Shouche, Yogesh S

    2017-06-01

    An endophytic species of Micrococcus was isolated from Aloe vera leaf (syn. Aloe barbadensis ) and screened for protease production with five other species of Micrococcus . Data indicated that endophytic Micrococcus aloeverae AE-6 MCC 2184 T and Micrococcus yunnanensis DSM 21948 T showed efficient protease production potential and secreted active protease at high salt (10%), temperature (40 °C) and in wide range of pH 8-10. Unlike M . yunnanensis DSM 21948 T , protease production by M . aloeverae AE-6 MCC 2184 T was stringently controlled by pH. Protease induction study using different group of peptides, peptide carbohydrates and peptide macronutrient combinations showed variable response with both the organisms. Result indicated that the amount of protease was not directly related to cell biomass but it depends on nature of inducible peptides. In this study we also developed a modified agar-well assay for semi-quantitative data from large number of replicates.

  12. Novel Compounds from Shark and Stingray Epidermal Mucus With Antimicrobial Activity Against Wound Infection Pathogens

    DTIC Science & Technology

    2013-03-01

    530-E6 MSSA, MRSA, E. coli, VRE, E. faecalis, B. subtilis 530-E7 MSSA, MRSA, E. coli, VRE, E. faecalis, B. subtilis B. anthracis, Micrococcus sp...530-E10 MSSA, MRSA, E. coli, VRE, E. faecalis, B. subtilis Micrococcus sp. 530-A5 VRE 530-B12 VRE 530-C12 VRE B. anthracis 530-D12 VRE 530-E12...VRE Micrococcus sp. 530-F11 VRE Micrococcus sp. 530-F12 VRE Enterococcus. faecium Figure 9. Pathogen overlay assay plates showing

  13. Whole-Genome Sequence of the Soil Bacterium Micrococcus sp. KBS0714.

    PubMed

    Kuo, V; Shoemaker, W R; Muscarella, M E; Lennon, J T

    2017-08-10

    We present here a draft genome assembly of Micrococcus sp. KBS0714, which was isolated from agricultural soil. The genome provides insight into the strategies that Micrococcus spp. use to contend with environmental stressors such as desiccation and starvation in environmental and host-associated ecosystems. Copyright © 2017 Kuo et al.

  14. Nisin Migration in Shelf Stable, Tuna-Filled Tortillas During Storage

    DTIC Science & Technology

    2014-09-22

    RATIONS SHELF LIFE ACCEPTABILITY MICROCOCCUS LUTEUS STORAGE INHIBITION MILITARY RATIONS...7 Figure 3. The assay of nisin against Micrococcus luteus ATCC 10240 in tuna enrobed in a tortilla wrap...METHODS 2.1 BACTERIAL STRAINS, MEDIA, AND BUFFER The nisin-sensitive test organism, Micrococcus luteus ATCC® 10240, was obtained from the American

  15. Urinary infection caused by Micrococcus subgroup 3

    PubMed Central

    Kerr, Helen

    1973-01-01

    The laboratory findings and clinical presentations in urinary infections in 23 nurses, 10 caused by Micrococcus subgroup 3 and 13 by Escherichia coli, were studied, and the symptoms and possible predisposing factors compared. There were no important differences between the two groups. The infections caused by Micrococcus subgroup 3 were symptomatically severe, as were those caused by Escherichia coli. PMID:4593863

  16. Production of gluconic acid using Micrococcus sp.: optimisation of carbon and nitrogen sources.

    PubMed

    Joshi, V D; Sreekantiah, K R; Manjrekar, S P

    1996-01-01

    A process for production of gluconic acid from glucose by a Micrococcus sp. is described. More than 400 bacterial cultures isolated from local soil were tested for gluconic acid production. Three isolates, were selected on basis of their ability to produce gluconic acid and high titrable acidity. These were identified as Micrococcus sp. and were named M 27, M 54 and M 81. Nutritional and other parameters for maximum production of gluconic acid by the selected isolates were optimised. It was found that Micrococcus sp. isolate M 27 gave highest yield of 8.19 g gluconic acid from 9 g glucose utilised giving 91% conversion effeciency.

  17. Micrococcus yunnanensis sp. nov., a novel actinobacterium isolated from surface-sterilized Polyspora axillaris roots.

    PubMed

    Zhao, Guo-Zhen; Li, Jie; Qin, Sheng; Zhang, Yu-Qin; Zhu, Wen-Yong; Jiang, Cheng-Lin; Xu, Li-Hua; Li, Wen-Jun

    2009-10-01

    In this study, strain YIM 65004(T), isolated from roots of Polyspora axillaris, was shown to represent a novel species of the genus Micrococcus by means of a polyphasic approach. Chemotaxonomic data gathered for peptidoglycan type, menaquinones, phospholipids and fatty acids strongly supported the classification of this strain within the genus Micrococcus: the cell-wall peptidoglycan contained lysine, glutamic acid, alanine, glycine and aspartic acid, the predominant menaquinones were MK-8(H(2)) (66.97 %) and MK-7(H(2)) (23.26 %), the phospholipids were diphosphatidylglycerol, phosphatidylglycerol, phosphatidylinositol and an unknown ninhydrin-negative phospholipid, and the major cellular fatty acids were anteiso-C(15 : 0) (61.98 %), iso-C(16 : 0) (14.25 %) and iso-C(15 : 0) (13.04 %). The G+C content of the genomic DNA was 71.7 mol%. A number of physiological features were found that clearly distinguished strain YIM 65004(T) from recognized Micrococcus species. DNA-DNA hybridization studies suggested that the novel strain represents a separate genomic species. Based on the above data, a novel species of the genus Micrococcus, Micrococcus yunnanensis sp. nov., is proposed, with the type strain YIM 65004(T) (=CCTCC AA 208060(T)=DSM 21948(T)).

  18. Improvement of cadmium phytoremediation after soil inoculation with a cadmium-resistant Micrococcus sp.

    PubMed

    Sangthong, Chirawee; Setkit, Kunchaya; Prapagdee, Benjaphorn

    2016-01-01

    Cadmium-resistant Micrococcus sp. TISTR2221, a plant growth-promoting bacterium, has stimulatory effects on the root lengths of Zea mays L. seedlings under toxic cadmium conditions compared to uninoculated seedlings. The performance of Micrococcus sp. TISTR2221 on promoting growth and cadmium accumulation in Z. mays L. was investigated in a pot experiment. The results indicated that Micrococcus sp. TISTR2221significantly promoted the root length, shoot length, and dry biomass of Z. mays L. transplanted in both uncontaminated and cadmium-contaminated soils. Micrococcus sp. TISTR2221 significantly increased cadmium accumulation in the roots and shoots of Z. mays L. compared to uninoculated plants. At the beginning of the planting period, cadmium accumulated mainly in the shoots. With a prolonged duration of cultivation, cadmium content increased in the roots. As expected, little cadmium was found in maize grains. Soil cadmium was significantly reduced with time, and the highest percentage of cadmium removal was found in the bacterial-inoculated Z. mays L. after transplantation for 6 weeks. We conclude that Micrococcus sp. TISTR2221 is a potent bioaugmenting agent, facilitating cadmium phytoextraction in Z. mays L.

  19. COLLABORATIVE RESEARCH AND DEVELOPMENT CONTRACT. Delivery Order 0038: Microbial Biotechnology and Biocatalysis

    DTIC Science & Technology

    2010-04-01

    encapsulated lysozyme. Bacteriolytic activity was inves- tigated with Micrococcus lysodeikticus cells and by hydroly- sis of a synthetic membrane mimic...immobilized lysozyme in silica or tita- nia nanoparticles. Lysozyme activity determined by lytic assay with Micrococcus lysodeikticus cells (&) or with...voltage of 200 V and according to the manufacturer’s instruc- tions. Lysozyme activity assays were performed with Micrococcus lysodeikticus cells

  20. Survival of Microorganisms in Nature.

    DTIC Science & Technology

    1982-04-07

    number) Survival of bacteria; Death of bacteria; Cysts; Dormancy; Pseudomonas aeruginosa; Azotobacter; Chemotaxis; Micrococcus luteus; Predation...attracted to and rapidly destroys (lyses) added Micrococcus luteus cells. There is also attack of predator on predator in this system. DO 1 DIT1 473 Oor I OV...and on laboratory media. 4 1 SUMMARY OF IMPORTANT RESULTS Micrococcus luteus was shown to survive only poorly in soil (Casida, 1980a). This was

  1. Novel Compounds From Shark And Stingray Epidermal Mucus With Antimicrobial Activity Against Wound Infection Pathogens

    DTIC Science & Technology

    2012-03-01

    Staphylococcus epidermidis, Micrococcus sp., Enterococcus faecalis, Listeria monocytogenes, Shigella boydii, Shigella sonnei, Shigella flexneri...MSSA, VRE B. cereus, MSSA, MRSA, Micrococcus , E. faecalis, L. monocytogenes, Shigella, E. coli, S. enterica, Acinetobacter 505 G1 B. subtilis 505...subtilis B. cereus 506 B3 VRE B. cereus, MSSA, MRSA, Micrococcus , E. faecalis, L. monocytogenes, Shigella, E. coli, S. enterica, Acinetobacter

  2. Bioaerosol Exposure to Filtering Facepiece Respirators in a Clinical Environment (Author’s Final Manuscript)

    DTIC Science & Technology

    2013-03-11

    Gram-positive staphylococci and Micrococcus spp . 73% of the Gram-positive and 67% of the Gram-negative isolates were resistant to oxacillin...staphylococci and Micrococcus spp . 73% of the Gram-positive and 67% of the Gram-negative isolates were resistant to oxacillin. Vancomycin...identified 26 species, primarily coagulase- negative staphylococci (CNS) and Micrococcus spp. Acinetobacter baumanii/calcoaceticus and S. aureus were

  3. Systematics of a widely distributed western North American springsnail, Pyrgulopsis micrococcus (Caenogastropoda, Hydrobiidae), with descriptions of three new congeners.

    PubMed

    Hershler, Robert; Liu, Hsiu-Ping; Bradford, Corbin

    2013-01-01

    We describe three new species of springsnails (genus Pyrgulopsis) from the Amargosa River basin, California and Nevada (P. licina sp. n., P. perforata sp. n., P. sanchezi sp. n.), each of which was previously considered to be part of P. micrococcus. We also restrict P. micrococcus to its type locality area (Oasis Valley) and redefine a regional congener, P. turbatrix, to include populations from the central Death Valley region and San Bernardino Mountains that had been previously identified as P. micrococcus. The five species treated herein form genetically distinct lineages that differ from each other by 4.2-12.6% for mtCOI and 5.2-13.6% for mtNDI (based on previously published and newly obtained data), and are diagnosable by shell and/or penial characters. The new molecular data presented herein confirm sympatry of P. licina and P. sanchezi in Ash Meadows (consistent with morphological evidence) and delineate an additional lineage of P. micrococcus (in the broad sense) that we do not treat taxonomically owing to the paucity of morphological material. Conservation measures are needed to ensure the long term persistence of populations of P. micrococcus and a genetically differentiated lineage of P. sanchezi which live in disturbed habitats on private lands.

  4. Sustained Protection against Superficial Bacterial and Fungal Infection by Topical Treatment.

    DTIC Science & Technology

    1974-12-31

    from 1:100 to 1:1,000,000. The test organisms were a cutaneous micrococcus (Baird-Parker type 3), a diphtheroid, C. minutis- simum, Pseudomonas...all aluminum salts. Aluminum chlorhydroxide killed the micrococcus and diphtheroid out to the 1:1000 dilution. Aluminum chloride was lethal to the... micrococcus and diphtheroid only at the 1:100 concentration. Aluminum acetate was lethal only to the micrococcU . at the 1:100 concentration. COMMENT All

  5. Novel Compounds From Shark and Stingray Epidermal Mucus With Antimicrobial Activity Against Wound Infection Pathogens

    DTIC Science & Technology

    2014-03-01

    Micrococcus sp., Enterococcus faecalis, Enterococcus faecium, Vancomycin resistant Enterococcus, and Escherichia coli). During the second Quarter of...mm) 803 D10 Rhinoptera bonasus MRSA (9.5) MSSA (4.5) Bacillus cereus (6) Listeria monocytogenes (6) MRSA (2) Micrococcus sp (7) VRE (2) 803...E6 Rhinoptera bonasus MRSA (7.5) MSSA (8.5) VRE (4.5) Bacillus subtilis (10) MRSA (10) MRSA (10) Micrococcus (16) Listeria monocytogenes (13

  6. Alkylation Induced DNA Repair and Mutagenesis in Escherichia coli.

    DTIC Science & Technology

    1987-11-23

    III (Gates and inn, 1977), Micrococcus luteus UV endo- nuclease (Grossman et al, 1978) and bacteriophage T UV endonuclease (Warner et al, 1980) have DNA...34, Garland Publishing, Inc. New York & London USA. Ather, A., Z. Ahmed and S. Riazxxddin, 1984. Adaptive response of Micrococcus luteus to alkylating...Laval, J., 3. Pierre and F. Laval. 1981. Release of 7-nmthylguanine residues frain alkylated ENA by extracts of Micrococcus luteus and Escherichia

  7. Molecular assessment of the membrane menaquinones of irradiated micrococcus on disposable medical devices with high performance liquid chromatography (HPLC)

    NASA Astrophysics Data System (ADS)

    Ghojaie, M.

    1993-10-01

    The genus of micrococcus and its main species like; M. Roseus, M. Nishinomiyansis consist of upto 10% of microbial contamination of disposable medical devices. Chemical alteration of Menuquinones Mainly [MK-7-(H2), MK-8(H2),…] from some Irradiated species of the micrococcus at different doses (500 Gy to 25 kGy; the sterilization dose) are quantitatively evaluated by HPLC.

  8. Antimicrobial susceptibilities of Stomatococcus mucilaginosus and of Micrococcus spp.

    PubMed Central

    von Eiff, C; Herrmann, M; Peters, G

    1995-01-01

    The in vitro susceptibilities of 63 isolates of Stomatococcus mucilaginosus and of 188 isolates of Micrococcus spp. to 18 antimicrobial agents were determined by the agar dilution method. Many beta-lactams, imipenem, rifampin, and the glycopeptides were shown to be active in vitro against Stomatococcus and Micrococcus isolates, whereas the activities of antibiotics such as some aminoglycosides, erythromycin, and fosfomycin against an important number of these microorganisms are limited. PMID:7695321

  9. Draft genome sequence of Micrococcus luteus strain O'Kane implicates metabolic versatility and the potential to degrade polyhydroxybutyrates.

    PubMed

    Hanafy, Radwa A; Couger, M B; Baker, Kristina; Murphy, Chelsea; O'Kane, Shannon D; Budd, Connie; French, Donald P; Hoff, Wouter D; Youssef, Noha

    2016-09-01

    Micrococcus luteus is a predominant member of skin microbiome. We here report on the genomic analysis of Micrococcus luteus strain O'Kane that was isolated from an elevator. The partial genome assembly of Micrococcus luteus strain O'Kane is 2.5 Mb with 2256 protein-coding genes and 62 RNA genes. Genomic analysis revealed metabolic versatility with genes involved in the metabolism and transport of glucose, galactose, fructose, mannose, alanine, aspartate, asparagine, glutamate, glutamine, glycine, serine, cysteine, methionine, arginine, proline, histidine, phenylalanine, and fatty acids. Genomic comparison to other M. luteus representatives identified the potential to degrade polyhydroxybutyrates, as well as several antibiotic resistance genes absent from other genomes.

  10. Micrococcus flavus sp. nov., isolated from activated sludge in a bioreactor.

    PubMed

    Liu, Xing-Yu; Wang, Bao-Jun; Jiang, Cheng-Ying; Liu, Shuang-Jiang

    2007-01-01

    Bacterial strain LW4(T) was isolated from activated sludge of a wastewater-treatment bioreactor. Cells of strain LW4(T) were Gram-positive cocci, with a diameter of 0.7-1.0 microm. Colonies produced on LB agar plates were yellow, smooth, circular and 0.5-1.5 mm in diameter. Strain LW4(T) was aerobic and grew over the temperature range 26-34 degrees C and pH range 5-9, with optimal growth at 30.5-31.5 degrees C and pH 6.0-6.2. The cell-wall peptidoglycan of strain LW4(T) contained amino acid residues of lysine, glutamic acid, alanine, glycine and aspartic acid. The most abundant cellular fatty acids of strain LW4(T) were anteiso-C(15 : 0) (32.15 %) and iso-C(15 : 0) (31.65 %). Major respiratory quinones were MK-8(H(2)) (57.3 %) and MK-7(H(2)) (32.9 %). The DNA G+C content was 71.4 mol% (T(m)). 16S rRNA gene sequence analysis indicated that strain LW4(T) was phylogenetically related to members of the genus Micrococcus, with similarities ranging from 96.5 to 97.3 %. Levels of DNA-DNA relatedness of strain LW4(T) to Micrococcus luteus DSM 20030(T), Micrococcus lylae DSM 20315(T) and Micrococcus antarcticus AS 1.2372(T) were 55, 48 and 36 %, respectively. Based on these results, it is concluded that strain LW4(T) represents a novel species of the genus Micrococcus, for which the name Micrococcus flavus sp. nov. is proposed. The type strain is strain LW4(T) (=CGMCC 1.5361(T)=JCM 14000(T)).

  11. Micrococcus endophyticus sp. nov., isolated from surface-sterilized Aquilaria sinensis roots.

    PubMed

    Chen, Hua-Hong; Zhao, Guo-Zhen; Park, Dong-Jin; Zhang, Yu-Qin; Xu, Li-Hua; Lee, Jae-Chan; Kim, Chang-Jin; Li, Wen-Jun

    2009-05-01

    A Gram-positive bacterial strain, designated YIM 56238(T), was isolated from plant roots (Aquilaria sinensis), and characterized by using a polyphasic approach. Strain YIM 56238(T) grew optimally at pH 7.0-8.0 and at 28 degrees C. Analysis of the 16S rRNA gene sequence of strain YIM 56238(T) indicated that it belongs to the genus Micrococcus. Chemotaxonomic data strongly supported the classification of this strain within the genus Micrococcus: the cell-wall peptidoglycan contained lysine, glutamic acid, alanine and glycine; the predominant menaquinones were MK-8(H(2)) (63.6 %) and MK-7(H(2)) (21.1 %); the phospholipids were diphosphatidylglycerol, phosphatidylglycerol, phosphatidylinositol and an unknown ninhydrin-negative phospholipid; and the major cellular fatty acids were iso-C(15 : 0) (30.95 %) and anteiso-C(15 : 0) (53.75 %). The G+C content of the genomic DNA was 72.9 mol%. A number of physiological features were found that clearly distinguished strain YIM 56238(T) from recognized species of the genus Micrococcus. DNA-DNA hybridization studies suggested that the novel strain represents a separate genomic species. On the basis of the data, therefore, strain YIM 56238(T) represents a novel species of the genus Micrococcus, for which the name Micrococcus endophyticus sp. nov. is proposed. The type strain is YIM 56238(T) (=DSM 17945(T)=KCTC 19156(T)).

  12. First report of linear megaplasmids in the genus Micrococcus.

    PubMed

    Dib, Julian R; Wagenknecht, Martin; Hill, Russell T; Farías, María E; Meinhardt, Friedhelm

    2010-01-01

    High-altitude wetlands (above 4200m) in the northwest of Argentina are considered pristine and extreme environments. Micrococcus sp. A1, H5, and V7, isolated from such environments, were shown to contain linear megaplasmids, designated pLMA1, pLMH5, and pLMV7, respectively. As known from linear plasmids of other actinomycetes, all three plasmids were resistant to lambda exonuclease treatment, which is consistent with having terminal proteins covalently attached to their 5' DNA ends. Electrophoretic mobility, Southern analysis, and restriction endonuclease patterns revealed pLMA1 and pLMH5 being indistinguishable plasmids, even though they were found in different strains isolated from two distant wetlands - Laguna Azul and Laguna Huaca Huasi. Analysis of 16S rDNA sequences of Micrococcus sp. A1, H5, and V7 suggested a close relationship to Micrococcus luteus. Typing of isolates was performed using fingerprint patterns generated by BOX-PCR. Plasmid-deficient strains, generated from Micrococcus sp. A1, showed a significantly decreased resistance level for erythromycin. Copyright 2009 Elsevier Inc. All rights reserved.

  13. Endocarditis due to Micrococcus sedentarius incertae sedis.

    PubMed Central

    Old, D C; McNeill, G P

    1979-01-01

    The clinical and bacteriological features of a case of endocarditis are described in which a Gram-positive coccus, presently designated Micrococcus sedentarius incertae sedis, was repeatedly isolated. PMID:512056

  14. Factors Affecting Transformation of Micrococcus lysodeikticus

    PubMed Central

    Kloos, Wesley E.

    1969-01-01

    Relatively high transfo mation frequencies were obtained with Micrococcus lysodeikticus cells, previou[ill]sly grown in defined broth, with a tris(hydroxymethyl)-aminomethane-glutamate b uffer containing Mg++, Ca++, Ba++, or Sr++. PMID:5788710

  15. Rapid lysostaphin test to differentiate Staphylococcus and Micrococcus species.

    PubMed Central

    Geary, C; Stevens, M

    1986-01-01

    A rapid, simple lysostaphin lysis susceptibility test to differentiate the genera Staphylococcus and Micrococcus was evaluated. Of 181 strains from culture collections, 95 of 95 Staphylococcus strains were lysed, and 79 of 79 Micrococcus strains were not lysed. The seven Planococcus strains were resistant. Clinical isolates (890) were tested with lysostaphin and for the ability to produce acid from glycerol in the presence of erythromycin. Overall agreement between the methods was 99.2%. All clinical Micrococcus strains (43) were resistant to lysostaphin, and all clinical Staphylococcus strains (847) were susceptible. Seven of the Staphylococcus strains did not produce acid from glycerol in the presence of erythromycin. This lysostaphin test provides results in 2 h. It is easier to perform than previously described lysostaphin lysis methods. It is also more rapid and accurate than the glycerol-erythromycin test. PMID:3519667

  16. Stimulation of Lactic Acid Bacteria by a Micrococcus Isolate: Evidence for Multiple Effects

    PubMed Central

    Nath, K. R.; Wagner, B. J.

    1973-01-01

    Growth of, and rate of acid production by, six cultures of lactic acid bacteria were increased in the presence of Micrococcus isolate F4 or a preparation of its capsular material. Concentrations of hydrogen peroxide found in pure cultures of the lactic acid bacteria were not detectable, or were greatly reduced, in mixed culture with Micrococcus isolate F4. The capsular material was not as effective as whole cells in preventing accumulation of H2O2. Catalase stimulated growth of, and the rate of acid production by, the lactic acid bacteria, but not to the same extent as Micrococcus isolate F4 in some cultures. The existence of two mechanisms for micrococcal stimulation of the lactic acid bacteria is postulated. One mechanism involves removal of H2O2; the other has not been characterized. PMID:4199337

  17. Micrococcus cohnii sp. nov., isolated from the air in a medical practice.

    PubMed

    Rieser, Gernot; Scherer, Siegfried; Wenning, Mareike

    2013-01-01

    Three Gram-reaction-positive bacteria, isolated from the air in a medical practice (strains WS4601(T), WS4602) or a pharmaceutical clean room (strain WS4599), were characterized using a polyphasic approach. Phylogenetic analyses based on 16S rRNA and recA gene sequences of the three novel strains showed that they formed a distinct lineage within the genus Micrococcus, sharing 16S rRNA gene sequence similarities of 96.1-98.0 % with other species of this genus. Chemotaxonomic features also supported the classification of the three novel strains within the genus Micrococcus. The major cellular fatty acids of strain WS4601(T) were anteiso-C(15 : 0) and iso-C(15 : 0), the cell-wall peptidoglycan was of type A3α (L-Lys-L-Ala), and the predominant respiratory quinones were MK-7(H(2)) and MK-8(H(2)). The polar lipid profile contained diphosphatidylglycerol and phosphatidylglycerol, but no phosphatidylinositol. The G+C content of the genomic DNA was 70.4 mol%. Numerous physiological properties were found that clearly distinguished strains WS4599, WS4601(T) and WS4602 from established members of the genus Micrococcus. Based on the phenotypic and phylogenetic data, strains WS4599, WS4601(T) and WS4602 are considered to represent three different strains of a novel species of the genus Micrococcus, for which the name Micrococcus cohnii sp. nov. is proposed. The type strain is WS4601(T) (=DSM 23974(T)=LMG 26183(T)).

  18. Biodegradation of cypermethrin by immobilized cells of Micrococcus sp. strain CPN 1

    PubMed Central

    Tallur, Preeti N.; Mulla, Sikandar I.; Megadi, Veena B.; Talwar, Manjunatha P.; Ninnekar, Harichandra Z.

    2015-01-01

    Pyrethroid pesticide cypermethrin is a environmental pollutant because of its widespread use, toxicity and persistence. Biodegradation of such chemicals by microorganisms may provide an cost-effective method for their detoxification. We have investigated the degradation of cypermethrin by immobilized cells of Micrococcus sp. strain CPN 1 in various matrices such as, polyurethane foam (PUF), polyacrylamide, sodium alginate and agar. The optimum temperature and pH for the degradation of cypermethrin by immobilized cells of Micrococcus sp. were found to be 30 °C and 7.0, respectively. The rate of degradation of 10 and 20 mM of cypermethrin by freely suspended cells were compared with that of immobilized cells in batches and semi-continuous with shaken cultures. PUF-immobilized cells showed higher degradation of cypermethrin (10 mM and 20 mM) than freely suspended cells and cells immobilized in other matrices. The PUF-immobilized cells of Micrococcus sp. strain CPN 1 were retain their degradation capacity. Thus, they can be reused for more than 32 cycles, without losing their degradation capacity. Hence, the PUF-immobilized cells of Micrococcus sp. could potentially be used in the bioremediation of cypermethrin contaminated water. PMID:26413046

  19. Biodegradation of cypermethrin by immobilized cells of Micrococcus sp. strain CPN 1.

    PubMed

    Tallur, Preeti N; Mulla, Sikandar I; Megadi, Veena B; Talwar, Manjunatha P; Ninnekar, Harichandra Z

    2015-01-01

    Pyrethroid pesticide cypermethrin is a environmental pollutant because of its widespread use, toxicity and persistence. Biodegradation of such chemicals by microorganisms may provide an cost-effective method for their detoxification. We have investigated the degradation of cypermethrin by immobilized cells of Micrococcus sp. strain CPN 1 in various matrices such as, polyurethane foam (PUF), polyacrylamide, sodium alginate and agar. The optimum temperature and pH for the degradation of cypermethrin by immobilized cells of Micrococcus sp. were found to be 30 °C and 7.0, respectively. The rate of degradation of 10 and 20 mM of cypermethrin by freely suspended cells were compared with that of immobilized cells in batches and semi-continuous with shaken cultures. PUF-immobilized cells showed higher degradation of cypermethrin (10 mM and 20 mM) than freely suspended cells and cells immobilized in other matrices. The PUF-immobilized cells of Micrococcus sp. strain CPN 1 were retain their degradation capacity. Thus, they can be reused for more than 32 cycles, without losing their degradation capacity. Hence, the PUF-immobilized cells of Micrococcus sp. could potentially be used in the bioremediation of cypermethrin contaminated water.

  20. 21 CFR 610.12 - Sterility.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    .... Non-spore-formers 3. Candida albicans (ATCC No. 10231) Do. 4. Micrococcus luteus (ATCC No. 9341) Do. 5.... 6633) 20 to 25 °C. Non-spore-formers 2. Candida albicans (ATCC No. 10231) Do. 3. Micrococcus luteus...

  1. Halophilic Amylase from a Moderately Halophilic Micrococcus

    PubMed Central

    Onishi, Hiroshi

    1972-01-01

    A moderately halophilic Micrococcus sp., isolated from unrefined solar salt, produced a considerable amount of extracellular dextrinogenic amylase when cultivated aerobically in media containing 1 to 3 m NaCl. The Micrococcus amylase had maximal activity at pH 6 to 7 in 1.4 to 2 m NaCl or KCl at 50 C. Calcium ion and a high concentration of NaCl or KCl were essential for activity and stability of the amylase. The salt response of the amylase depended greatly on the pH and temperature of the enzyme assay. PMID:5058445

  2. Restriction of the anti-bovine serum albumin response in rabbits immunized with Micrococcus lysodeikticus.

    PubMed Central

    De Baetselier, P; Hamers-Casterman, C; Van der Loo, W; Hamers, R

    1977-01-01

    Rabbits capable of producing antibodies of restricted heterogeneity in response to Micrococcus lysodeikticus are equally capable of producing antibodies of restricted heterogeneity to bovine serum albumin. These antibodies are produced when animals are simultaneously injected with micrococcus and BSA and their specificity is restricted to a small number of epitopes. These results suggest that micrococcal vaccines can induce the restriction of heterogeneity in antibodies raised against totally unrelated antigens. Images Figure 4 Figure 5 Figure 2 Figure 6 Figure 7 Figure 8 PMID:71263

  3. A marine bacterium, Micrococcus MCCB 104, antagonistic to vibrios in prawn larval rearing systems.

    PubMed

    Jayaprakash, N S; Pai, S Somnath; Anas, A; Preetha, R; Philip, Rosamma; Singh, I S Bright

    2005-12-30

    A marine bacterium, Micrococcus MCCB 104, isolated from hatchery water, demonstrated extracellular antagonistic properties against Vibrio alginolyticus, V. parahaemolyticus, V. vulnificus, V. fluviallis, V. nereis, V. proteolyticus, V. mediterranei, V cholerae and Aeromonas sp., bacteria associated with Macrobrachium rosenbergii larval rearing systems. The isolate inhibited the growth of V. alginolyticus during co-culture. The antagonistic component of the extracellular product was heat-stable and insensitive to proteases, lipase, catalase and alpha-amylase. Micrococcus MCCB 104 was demonstrated to be non-pathogenic to M. rosenbergii larvae.

  4. Effect of Hydroxyurea on Staphylococcus epidermidis and Micrococcus lysodeikticus: Thickening of the Cell Wall

    PubMed Central

    Feiner, Rose R.; Coward, Joe E.; Rosenkranz, Herbert S.

    1973-01-01

    Hydroxyurea-sensitive strains of Staphylococcus epidermidis and Micrococcus lysodeikticus showed marked thickening of cell walls and reduction in deoxyribonucleic acid synthesis when grown in the presence of hydroxyurea. Images PMID:4790602

  5. Cobalt Complexes as Antiviral and Antibacterial Agents

    DTIC Science & Technology

    2010-01-01

    observed. Complex 26 has antibacterial activity against E. coli, S. aureus and Micrococcus lysodeikiticus, showing better growth inhibitory activity in...complexes exhibited activity towards E. coli, B. subtilis, S. aureus and Micrococcus lysodeikiticus. Figure 15. Selenium containing and

  6. Proposal for creation of a new genus Neomicrococcus gen. nov. to accommodate Zhihengliuella aestuarii Baik et al. 2011 and Micrococcus lactis Chittpurna et al. 2011 as Neomicrococcus aestuarii comb. nov. and Neomicrococcus lactis comb. nov.

    PubMed

    Prakash, Om; Sharma, Avinash; Nimonkar, Yogesh; Shouche, Yogesh S

    2015-11-01

    Micrococcus lactis and Zhihengliuella aestuarii were described independently in 2011. Their type strains showed high levels of 16S rRNA gene sequence similarity (99.3%). Phylogenetic analysis revealed that M. lactis MCC 2278T and Z. aestuarii JCM 16166T formed a monophyletic group and showed distant relationships to other members of closely related genera such as Micrococcus, Zhihengliuella, Arthrobacter and Citricoccus. The presence of large proportions of iso-C14:0 and iso-C16:0 with small amounts of iso-C15:0 distinguished M. lactis MCC 2278T and Z. aestuarii JCM 16166T from other members of the genera Micrococcus and Zhihengliuella. Unlike other members of the genera Zhihengliuella and Micrococcus, M. lactis MCC 2278T and Z. aestuarii JCM 16166T showed growth at low concentrations of NaCl. Thus, based on distinctive phylogenetic, chemotaxonomic and physiological features of these two organisms in comparison with other members of the genera Micrococcus and Zhihengliuella, it is clear that they do not fit within the existing classification and deserve separate status. DNA-DNA hybridization between the two type strains was 63%, indicating that they represent separate species. In this study, we propose the creation of a novel genus, Neomicrococcus gen. nov., to accommodate the two species with Neomicrococcus aestuarii gen. nov., comb. nov. (type strain JCM 16166T = KCTC 19557T) as the type species. Neomicrococcus lactis comb. nov. (type strain MCC 2278T = DSM 23694T) is also proposed.

  7. Problem Definition Studies on Potential Environmental Pollutants. II. Physical, Chemical, Toxicological, and Biological Properties of 16 Substances

    DTIC Science & Technology

    1975-12-01

    Micrococcus sp., capable of reducing 10- 3M sodium arsenate o Tarsenite--Th-s property was possessed by growing cells, resting cells, and the soluble...Corynebacterium, and Micrococcus sp. K-29 KA4 TABLE K-12. Microorgani ms Producing Water-Soluble Metabolites from Dieldrin - 14C, Isolated after 8 Weeks... Micrococcus 0 0 0 1 1 11.5 Bacillus 1 1 3.4 0 0 0 Yeasts 1 1 8.0 2 2 5.5 Total 73 35 104 56 *Per cent increase in water soluble activity brought about

  8. Extrachromosomal genetic elements in Micrococcus.

    PubMed

    Dib, Julián Rafael; Liebl, Wolfgang; Wagenknecht, Martin; Farías, María Eugenia; Meinhardt, Friedhelm

    2013-01-01

    Micrococci are Gram-positive G + C-rich, nonmotile, nonspore-forming actinomycetous bacteria. Micrococcus comprises ten members, with Micrococcus luteus being the type species. Representatives of the genus play important roles in the biodegradation of xenobiotics, bioremediation processes, production of biotechnologically important enzymes or bioactive compounds, as test strains in biological assays for lysozyme and antibiotics, and as infective agents in immunocompromised humans. The first description of plasmids dates back approximately 28 years, when several extrachromosomal elements ranging in size from 1.5 to 30.2 kb were found in Micrococcus luteus. Up to the present, a number of circular plasmids conferring antibiotic resistance, the ability to degrade aromatic compounds, and osmotolerance are known, as well as cryptic elements with unidentified functions. Here, we review the Micrococcus extrachromosomal traits reported thus far including phages and the only quite recently described large linear extrachromosomal genetic elements, termed linear plasmids, which range in size from 75 kb (pJD12) to 110 kb (pLMA1) and which confer putative advantageous capabilities, such as antibiotic or heavy metal resistances (inferred from sequence analyses and curing experiments). The role of the extrachromosomal elements for the frequently proven ecological and biotechnological versatility of the genus will be addressed as well as their potential for the development and use as genetic tools.

  9. A CASE OF ACUTE ENDOCARDITIS CAUSED BY MICROCOCCUS ZYMOGENES (NOV. SPEC.), WITH A DESCRIPTION OF THE MICROORGANISM

    PubMed Central

    MacCallum, William G.; Hastings, Thomas W.

    1899-01-01

    From a case of acute endocarditis of the aortic and mitral valves with infarctions m the spleen and kidneys a micrococcus was twice isolated in pure culture from the blood during life and was demonstrated after death both microscopically and in pure culture in large numbers in the valvular vegetations, the infarctions and other parts. No other species of microorganism was found. This micrococcus is very small, occurs mainly in pairs, sometimes in short chains, stains by Gram's method, grows in small, pale, grayish-white colonies on gelatine and agar, at first clouds bouillon, which then becomes clear with a whitish sediment, does not produce gas in glucose media, liquefies gelatine slowly and to some extent also blood serum, and is especially characterized by its behavior in milk, which it acidifies, coagulates and subsequently liquefies. It produces a milk-curdling ferment and also a proteolytic ferment, each of which is separable from the bacterial cells. It remains viable for months in old cultures and is tolerably resistant to the action of heat and antiseptics. The micrococcus is pathogenic for mice and rabbits, causing either abscesses or general infections. Typical acute vegetative endocarditis was experimentally produced by intravenous inoculation of the organism in a rabbit and a dog, and the cocci were demonstrated in pure culture in the vegetations and other parts of these animals after death. Although the micrococcus here described has some points of resemblance to the pneumococcus and Streptococcus pyogenes on the one hand and to the pyogenic staphylococci on the other, it is readily distinguished from each of these species by cultural features which have been described and which are so obvious that the differentiation of these species from our micrococcus need not be discussed in detail. We have searched through the records concerning microorganisms described in association with endocarditis and other diseases, as well as those isolated from water, soil and other sources, and have been unable to find a description of a micrococcus identical in all particulars with that here described. Such points as staining by Gram, liquefaction of gelatine, coagulation and peptonization of milk, served singly or in combination to distinguish our micrococcus from other forms which in some respects might resemble it. We feel justified, therefore, in recognizing this organism as a new species and from its fermentative properties propose for it the name "Micrococcus zymogenes." Micrococcus zymogenes must be added to the already considerable list of bacteria which have been found as the specific infective agents in endocarditis. That it was the cause of this affection in our case was conclusively demonstrated by its repeated isolation in pure culture from the blood during life, by its presence in pure culture and large numbers after death in the cardiac vegetations, the infarctions, and other parts of the body, and by the experimental proof of its pathogenic properties, and notably its capacity to produce vegetative endocarditis by intravenous inoculation in animals. PMID:19866921

  10. A CASE OF ACUTE ENDOCARDITIS CAUSED BY MICROCOCCUS ZYMOGENES (NOV. SPEC.), WITH A DESCRIPTION OF THE MICROORGANISM.

    PubMed

    Maccallum, W G; Hastings, T W

    1899-09-01

    From a case of acute endocarditis of the aortic and mitral valves with infarctions m the spleen and kidneys a micrococcus was twice isolated in pure culture from the blood during life and was demonstrated after death both microscopically and in pure culture in large numbers in the valvular vegetations, the infarctions and other parts. No other species of microorganism was found. This micrococcus is very small, occurs mainly in pairs, sometimes in short chains, stains by Gram's method, grows in small, pale, grayish-white colonies on gelatine and agar, at first clouds bouillon, which then becomes clear with a whitish sediment, does not produce gas in glucose media, liquefies gelatine slowly and to some extent also blood serum, and is especially characterized by its behavior in milk, which it acidifies, coagulates and subsequently liquefies. It produces a milk-curdling ferment and also a proteolytic ferment, each of which is separable from the bacterial cells. It remains viable for months in old cultures and is tolerably resistant to the action of heat and antiseptics. The micrococcus is pathogenic for mice and rabbits, causing either abscesses or general infections. Typical acute vegetative endocarditis was experimentally produced by intravenous inoculation of the organism in a rabbit and a dog, and the cocci were demonstrated in pure culture in the vegetations and other parts of these animals after death. Although the micrococcus here described has some points of resemblance to the pneumococcus and Streptococcus pyogenes on the one hand and to the pyogenic staphylococci on the other, it is readily distinguished from each of these species by cultural features which have been described and which are so obvious that the differentiation of these species from our micrococcus need not be discussed in detail. We have searched through the records concerning microorganisms described in association with endocarditis and other diseases, as well as those isolated from water, soil and other sources, and have been unable to find a description of a micrococcus identical in all particulars with that here described. Such points as staining by Gram, liquefaction of gelatine, coagulation and peptonization of milk, served singly or in combination to distinguish our micrococcus from other forms which in some respects might resemble it. We feel justified, therefore, in recognizing this organism as a new species and from its fermentative properties propose for it the name "Micrococcus zymogenes." Micrococcus zymogenes must be added to the already considerable list of bacteria which have been found as the specific infective agents in endocarditis. That it was the cause of this affection in our case was conclusively demonstrated by its repeated isolation in pure culture from the blood during life, by its presence in pure culture and large numbers after death in the cardiac vegetations, the infarctions, and other parts of the body, and by the experimental proof of its pathogenic properties, and notably its capacity to produce vegetative endocarditis by intravenous inoculation in animals.

  11. In Vitro Repair of UV-Irradiated Micrococcus luteus Bacteriophage N1 Transfecting DNA 1

    PubMed Central

    Mahler, Inga; George, Jeanne; Grossman, Lawrence

    1974-01-01

    Calcium-treated UV-sensitive, host cell reactivation− strains of Micrococcus luteus are infected with UV-irradiated N1 DNA. In strains lacking UV endonuclease, in vitro treatment of the irradiated DNA results in transfection enhancement. PMID:4823319

  12. Bioaugmentation with cadmium-resistant plant growth-promoting rhizobacteria to assist cadmium phytoextraction by Helianthus annuus.

    PubMed

    Prapagdee, Benjaphorn; Chanprasert, Maesinee; Mongkolsuk, Skorn

    2013-07-01

    Micrococcus sp. MU1 and Klebsiella sp. BAM1, the cadmium-resistant plant growth-promoting rhizobacteria (PGPR), produce high levels of indole-3-acetic acid (IAA) during the late stationary phase of their growth. The ability of PGPR to promote root elongation, plant growth and cadmium uptake in sunflowers (Helianthus annuus) was evaluated. Both species of bacteria were able to remove cadmium ions from an aqueous solution and enhanced cadmium mobilization in contaminated soil. Micrococcus sp. and Klebsiella sp. use aminocyclopropane carboxylic acid as a nitrogen source to support their growth, and the minimum inhibitory concentrations of cadmium for Micrococcus sp. and Klebsiella sp. were 1000 and 800mM, respectively. These bacteria promoted root elongation in H. annuus seedlings in both the absence and presence of cadmium compared to uninoculated seedlings. Inoculation with these bacteria was found to increase the root lengths of H. annuus that had been planted in cadmium-contaminated soil. An increase in dry weight was observed for H. annuus inoculated with Micrococcus sp. Moreover, Micrococcus sp. enhanced the accumulation of cadmium in the root and leaf of H. annuus compared to untreated plants. The highest cadmium accumulation in the whole plant was observed when the plants were treated with EDTA following the treatment with Micrococcus sp. In addition, the highest translocation of cadmium from root to the above-ground tissues of H. annuus was found after treatment with Klebsiella sp. in the fourth week after planting. Our results show that plant growth and cadmium accumulation in H. annuus was significantly enhanced by cadmium-resistant PGPRs, and these bacterial inoculants are excellent promoters of phytoextraction for the rehabilitation of heavy metal-polluted environments. Copyright © 2013 Elsevier Ltd. All rights reserved.

  13. University Research Initiative Program for Combat Readiness

    DTIC Science & Technology

    1999-05-01

    found in sponge-associated bacteria Micrococcus luteus (Bultel-Ponce et al., 1998). Such compounds have antimicrobial activity. Water contact angles...Guyot, M. 1998. Metabolites from the sponge-associated bacterium Micrococcus luteus. J. Mar. Biotechnol. 6:233-236. 3. Incze, B.I., Sea Technol. 1996, 37

  14. Environmental conditions affecting exopolysaccharide production by Pseudomonas aeruginosa, Micrococcus sp., and Ochrobactrum sp.

    PubMed

    Kiliç, Nur Koçberber; Dönmez, Gönül

    2008-06-15

    Three different chromium-resistant microorganisms (Pseudomonas aeruginosa, Micrococcus sp., and Ochrobactrum sp.) were tested with regard to their EPS production at different pH levels, temperatures, Cr(VI) concentrations, and incubation periods. The optimum pH level was 7 for P. aeruginosa and Micrococcus sp., while it was 8 for Ochrobactrum sp. according to the highest EPS amount at 100 mg/L Cr(VI) concentration. The highest production of EPSs by the three bacteria was obtained under different environmental conditions. P. aeruginosa produced the highest EPS (863.3 mg/L) after incubation for 96 h on media with 50 mg/L Cr(VI) at 20 degrees C, Micrococcus sp. gave the highest yield (444.6 mg/L) after incubation for 72 h on media with 100 mg/L Cr(VI) at the same temperature, and Ochrobactrum sp. had the highest production (430.5 mg/L) on media with 150 mg/L Cr(VI) at 30 degrees C at the end of 48 h of incubation.

  15. Amino acids in cell wall of Gram-positive bacterium Micrococcus sp. hsn08 with flocculation activity on Chlorella vulgaris biomass.

    PubMed

    Li, Yi; Xu, Yanting; Zheng, Tianling; Wang, Hailei

    2018-02-01

    The aim of this work was to investigate the flocculation mechanism by Gram-positive bacterium, Micrococcus sp. hsn08 as a means for harvesting Chlorella vulgaris biomass. Bacterial cells of Micrococcus sp. hsn08 were added into algal culture to harvest algal cells through direct contacting with algae to form flocs. Viability dependence test confirmed that flocculation activity does not depend on live bacteria, but on part of the peptidoglycan. The further investigation has determined that amino acids in cell wall play an important role to flocculate algal cells. Positively charged calcium can combine bacterial and algal cells together, and form a bridge between them, thereby forming the flocs, suggesting that ions bridging is the main flocculation mechanism. These results suggest that bacterial cells of Micrococcus sp. hsn08 can be applied to harvest microalgae biomass with the help of amino acids in cell wall. Copyright © 2017 Elsevier Ltd. All rights reserved.

  16. Identification of Staphylococcus and Micrococcus species with the STAPHYtest system.

    PubMed

    Sedlácek, I; Kocur, M

    1991-01-01

    A collection of 216 well-characterized strains of Staphylococcus, Micrococcus and Stomatococcus was examined by a commercially available STAPHYtest system (Lachema, Brno, Czechoslovakia). The results of STAPHYtest agreed with those of conventional tests. The STAPHYtest permitted a clear-cut separation of Staphylococcus from Micrococcus and Stomatococcus strains and correctly identified 104 of 145 (72%) Staphylococcus strains after 24 h of incubation. However, it allowed the identification only of 19 of 29 validly published Staphylococcus species. The STAPHYtest proved to be a simple and rapid system for the separation of staphylococci from micrococci and for the identification of most frequent clinically significant staphylococci.

  17. Micrococcus sedentarius bacteraemia presenting with haemophagocytic syndrome in previously healthy boy.

    PubMed

    Kuskonmaz, Baris; Kara, Ates; Ozen, Maide; Cengiz, A Bülent; Ozen, Metehan; Seçmeer, Gülten; Gürgey, Aytemiz

    2006-01-01

    Haemophagocytic syndromes are the clinical manifestation of an increased macrophagic activity with haemophagocytosis. Infection-associated HS was originally described by Risdall in 1979, in viral disease. Since the initial description HS has also been documented in patients with bacterial, parasitic or fungal infections. We describe a case of Micrococcus sedentarius bacteraemia in a previously healthy 10-y-old boy with haemophagocytic syndrome. Species of micrococci are generally considered as non-pathogenic commensals that colonize the skin, mucosae and oropharynx. We report the first case of Microccoccus sedentarius bacteraemia in an immunocompetent host and first case of HS associated with Micrococcus species.

  18. Protein Localization in Silica Nanospheres Derived via Biomimetic Mineralization (POSTPRINT)

    DTIC Science & Technology

    2010-01-01

    lyse the cell wall of the bac- terial strain Micrococcus lysodeikticus demonstrating that its native hydrolase activity is retained. The K m (M) for...manufacturer’s instructions (Pierce, Rockford, IL). Lysozyme activity assays were performed with Micrococcus lysodeikticus cells according to the supplier’s

  19. Endocarditis associated with cardiac catheterization due to a Gram-positive coccus designated Micrococcus mucilaginosus incertae sedis.

    PubMed Central

    Rubin, S J; Lyons, R W; Murcia, A J

    1978-01-01

    A gram-positive coccus, presently named Micrococcus mucilaginosus incertae sedis, was isolated from 14 blood cultures from a patient with endocarditis. The first positive blood culture was drawn 5 days after the patient underwent cardiac catheterization. PMID:670378

  20. Emended descriptions of the genus Micrococcus, Micrococcus luteus (Cohn 1872) and Micrococcus lylae (Kloos et al. 1974).

    PubMed

    Wieser, Monika; Denner, Ewald B M; Kämpfer, Peter; Schumann, Peter; Tindall, Brian; Steiner, Ulrike; Vybiral, Dietmar; Lubitz, Werner; Maszenan, A M; Patel, B K C; Seviour, Robert J; Radax, Christian; Busse, Hans-Jürgen

    2002-03-01

    Nine yellow-pigmented, spherical bacterial strains isolated from a medieval wall painting (strain D7), from indoor air (strains 3, 6, 7, 13C2, 38, 83 and 118) and from an activated-sludge plant (strain Ballarat) were classified by a polyphasic approach. Analyses of the 16S rRNA gene sequences of three representatives (strains D7, 118 and Ballarat) indicated that they all belong to the genus Micrococcus. The three isolates shared the highest sequence similarities with Micrococcus luteus DSM 20030T (97.9-98%), Micrococcus antarcticus AS 1.2372T (97.9-98.3%) and Micrococcus lylae DSM 20315T (97.5-97.9%). DNA-DNA reassociation studies clearly demonstrated that all nine isolates belong to the species M. luteus. However, neither their chemotaxonomic features nor their physiological and biochemical properties were consistent with those of M. luteus DSM 20030T. In contrast to M. luteus DSM 20030T, all isolates investigated possessed MK-8(H2) as the major respiratory quinone, and strain Ballarat had an A4alpha peptidoglycan type. On the basis of analyses of their Fourier transform-infrared spectroscopy spectra, isolates D7, 3, 6, 7, 13C2, 38, 83 and 118 could be grouped into a single cluster separate from M. luteus DSM 20030T, strain Ballarat and M. lylae DSM 20315T. In addition, all these isolates could be distinguished from M. luteus DSM 20030T by their ability to assimilate D-maltose, D-trehalose, DL-3-hydroxybutyrate, DL-lactate, pyruvate and L-histidine and to hydrolyse casein. Strains D7, 3, 6, 7, 13C2, 38, 83 and 118 differed from both M. luteus DSM 20030T and strain Ballarat by their ability to assimilate acetate, L-phenylalanine, L-serine and phenylacetate. Furthermore, REP-PCR fingerprinting yielded one common band for these strains, whereas this band was not observed for M. luteus DSM 20030T, strain Ballarat or M. lylae DSM 20315T. On the basis of these data, the species M. luteus can be divided into three biovars that are distinguished by several chemotaxonomic and biochemical traits: biovar I, represented by M. luteus DSM 20030T; biovar II, represented by strains D7 (= DSM 14234 = CCM 4959), 3, 6, 7, 13C2, 38, 83 and 118; and biovar III, represented by strain Ballarat (= DSM 14235 = CCM 4960). On the basis of the results generated in this study, emended descriptions of the genus Micrococcus and the species M. luteus and M. lylae are given.

  1. 21 CFR 173.135 - Catalase derived from Micrococcus lysodeikticus.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 21 Food and Drugs 3 2013-04-01 2013-04-01 false Catalase derived from Micrococcus lysodeikticus. 173.135 Section 173.135 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) FOOD FOR HUMAN CONSUMPTION (CONTINUED) SECONDARY DIRECT FOOD ADDITIVES PERMITTED IN...

  2. 21 CFR 173.135 - Catalase derived from Micrococcus lysodeikticus.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 21 Food and Drugs 3 2012-04-01 2012-04-01 false Catalase derived from Micrococcus lysodeikticus. 173.135 Section 173.135 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) FOOD FOR HUMAN CONSUMPTION (CONTINUED) SECONDARY DIRECT FOOD ADDITIVES PERMITTED IN...

  3. 21 CFR 173.135 - Catalase derived from Micrococcus lysodeikticus.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 21 Food and Drugs 3 2014-04-01 2014-04-01 false Catalase derived from Micrococcus lysodeikticus. 173.135 Section 173.135 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) SECONDARY DIRECT FOOD ADDITIVES PERMITTED IN FOOD FOR HUMAN CONSUMPTION Enzyme...

  4. ROLE OF POTASSIUM IN THE OXIDATIVE METABOLISM OF MICROCOCCUS SODONENSIS1

    PubMed Central

    Perry, Jerome J.; Evans, James B.

    1961-01-01

    Perry, Jerome J. (The University of Chicago, Chicago, Ill.), and James B. Evans. Role of potassium in the oxidative metabolism of Micrococcus sodonensis. J. Bacteriol. 82:551–555. 1961.—An absolute potassium requirement has been established for the growth of Micrococcus sodonensis with lactate or pyruvate as substrate. Potassium at 0.67 × 10−2m concentration was necessary for maximal growth. Resting cell and cell-free preparations from cells grown on minimal levels of potassium were stimulated by potassium but, due to residual or bound cation, did not show an absolute requirement. Rubidium and cesium replaced potassium in these cells although cesium is much less effective. PMID:14485577

  5. Natural History of Multi-Drug Resistant Organisms in a New Military Medical Facility

    DTIC Science & Technology

    2012-10-01

    Enterobacter cloacae  Maternity Ward  05.312  Sink top  Micrococcus  luteus  Maternity Ward  05.312  Telephone  Pantoea agglomerans  Maternity Ward...Acinetobacter baumannii  Surgical Ward  06.316  Call box  Acinetobacter  baumannii/calcoaceticus complex  Surgical Ward  06.316  Sink top  Micrococcus  luteus...Medical Ward  07.216  Sink top  Micrococcus  luteus  Medical Ward  07.216  Room Sink  Staphylococcus sciuri  ICU  02.123  Toilet seat  Staphylococcus

  6. Sterilization effects of atmospheric cold plasma brush

    NASA Astrophysics Data System (ADS)

    Yu, Q. S.; Huang, C.; Hsieh, F.-H.; Huff, H.; Duan, Yixiang

    2006-01-01

    This study investigated the sterilization effects of a brush-shaped plasma created at one atmospheric pressure. A population of 1.0×104-1.0×105 Escherichia coli or Micrococcus luteus bacteria was seeded in filter paper media and then subjected to Ar and/or Ar +O2 plasmas. A complete kill of the Micrococcus luteus required about 3 min argon plasma exposures. With oxygen addition into the argon plasma gas streams, a complete kill of the bacteria needed only less than 1 min plasma exposure for Micrococcus luteus and about 2 min exposure for Escherichia coli. The plasma treatment effects on the different bacteria cell structures were examined using scanning electron microscopy.

  7. The Role of Inducible DNA Repair in W-Reactivation and Related Phenomena.

    DTIC Science & Technology

    1981-10-14

    unexcised dimers in X DNA. This was consistent with the finding of Tomilin and Mosevitskaya (1975) which showed that the UV-endonuclease from Micrococcus ...of DNA in vitro with UV-endonuclease from Micrococcus luteus. Mutat. Res. 27, 147-156 (1975) Tomizawa, J., Ogawa, T.: Effect of ultraviolet irradiation

  8. The nucleotide sequence of 5S ribosomal RNA from Micrococcus lysodeikticus.

    PubMed Central

    Hori, H; Osawa, S; Murao, K; Ishikura, H

    1980-01-01

    The nucleotide sequence of ribosomal 5S RNA from Micrococcus lysodeikticus is pGUUACGGCGGCUAUAGCGUGGGGGAAACGCCCGGCCGUAUAUCGAACCCGGAAGCUAAGCCCCAUAGCGCCGAUGGUUACUGUAACCGGGAGGUUGUGGGAGAGUAGGUCGCCGCCGUGAOH. When compared to other 5S RNAs, the sequence homology is greatest with Thermus aquaticus, and these two 5S RNAs reveal several features intermediate between those of typical gram-positive bacteria and gram-negative bacteria. PMID:6780979

  9. Purification and Properties of Clostridium perfringens Spore Lytic Enzymes.

    DTIC Science & Technology

    1983-01-01

    Morita et aL, 1978; Ochi et aL, 1978). However, it is not a true lysozyme (N-acetylmuramidase) since it is ineffective against Micrococcus lysodeikticus...previously reported, in the N-Fthylinaleimide (5) 9S 99 inability of initiation protein to lyse Micrococcus ’ Concentration in mM given in parenthesis

  10. Bacteriology of War Wounds at the Time of Injury

    DTIC Science & Technology

    2006-09-01

    Micrococcus (1)a,b 0 0 Chest, back, and abdomen IED (1) 1 0 0 0 0 0 Total 20 6 0 8 5 6 1 IED, improvised explosive device; CNS, coagulase-negative...hominis 6 Staphylococcus warneri 2 Staphylococcus cohnii cohnii 1 Staphylococcus saprophyticus 1 Staphylococcus aureus 4a Micrococcus sp. 1 a Two isolates

  11. Sterilization effects of atmospheric cold plasma brush

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Yu, Q.S.; Huang, C.; Hsieh, F.-H.

    2006-01-02

    This study investigated the sterilization effects of a brush-shaped plasma created at one atmospheric pressure. A population of 1.0x10{sup 4}-1.0x10{sup 5} Escherichia coli or Micrococcus luteus bacteria was seeded in filter paper media and then subjected to Ar and/or Ar+O{sub 2} plasmas. A complete kill of the Micrococcus luteus required about 3 min argon plasma exposures. With oxygen addition into the argon plasma gas streams, a complete kill of the bacteria needed only less than 1 min plasma exposure for Micrococcus luteus and about 2 min exposure for Escherichia coli. The plasma treatment effects on the different bacteria cell structuresmore » were examined using scanning electron microscopy.« less

  12. Biodegradation of 2-nitrotoluene by Micrococcus sp. strain SMN-1.

    PubMed

    Mulla, Sikandar I; Hoskeri, Robertcyril S; Shouche, Yogesh S; Ninnekar, Harichandra Z

    2011-02-01

    A bacterial consortium capable of degrading nitroaromatic compounds was isolated from pesticide-contaminated soil samples by selective enrichment on 2-nitrotoluene as a sole source of carbon and energy. The three different bacterial isolates obtained from bacterial consortium were identified as Bacillus sp. (A and C), Bacillus flexus (B) and Micrococcus sp. (D) on the basis of their morphological and biochemical characteristics and by phylogenetic analysis based on 16S rRNA gene sequences. The pathway for the degradation of 2-nitrotoluene by Micrococcus sp. strain SMN-1 was elucidated by the isolation and identification of metabolites, growth and enzymatic studies. The organism degraded 2-nitrotoluene through 3-methylcatechol by a meta-cleavage pathway, with release of nitrite.

  13. Distribution and Persistence of Staphylococcus and Micrococcus Species and Other Aerobic Bacteria on Human Skin1

    PubMed Central

    Kloos, Wesley E.; Musselwhite, Margaret S.

    1975-01-01

    The distribution of Staphylococcus and Micrococcus species and associated coryneform bacteria, Acinetobacter, Klebsiella, Enterobacter, Bacillus, and Streptomyces on skin was determined during October 1971 from samples collected on persons living in North Carolina and New Jersey. Persistence of these organisms on skin was estimated in temporal studies conducted during the period from June 1971 to June 1972 on persons living in North Carolina. Staphylococci and coryneforms were the most predominant and persistent bacteria isolated from the nares and axillae. Staphylococci, coryneforms, micrococci, and Bacillus were the most predominant and persistent bacteria isolated from the head, legs, and arms. Acinetobacters were most frequently isolated during the warmer months of the years. Staphylococcus aureus and S. epidermidis were the most predominant and persistent staphylococci isolated from the nares, whereas S. epidermidis and S. hominis were the most predominant and persistent staphylococci isolated from the axillae, head, legs, and arms. S. capitis was often isolated from the head and arms and S. haemolyticus was often isolated from the head, legs, and arms. S. simulans, S. xylosus, S. cohnii, S. saprophyticus, S. warneri, and an unclassified coagulase-positive species were only occasionally isolated from skin. Micrococcus luteus was the most predominant and persistent Micrococcus isolated from skin and preferred regions of the head, legs, and arms. M. varians was the second most frequent Micrococcus isolated. M. lylae, M. sedentarius, M. roseus, M. kristinae, and M. nishinomiyaensis were only occasionally isolated from skin. M. lylae was most frequently isolated during the colder months of the years. PMID:810086

  14. [Cloning and expression of Micrococcus luteus IAM 14879 Rpf and its role in the recovery of the VBNC state in Rhodococcus sp. DS471].

    PubMed

    Ding, Linxian; Zhang, Pinghua; Hong, Huachang; Lin, Hongjun; Yokota, Akira

    2012-01-01

    The purpose of the present study was to produce the Rpf (resuscitation promoting factor) protein by cloning and expressing the rpf gene, secreted by Micrococcus luteus IAM 14879, in Escherichia coli and to evaluate its role in the recovery of the VBNC (viable but non-culturable) state in high-GC Gram-positive bacteria. Genomic DNA was extracted from Micrococcus luteus IAM 14879 and the rpf gene was amplified by PCR using specific primers. The PCR products was purified, cloned into a pET15b expression vector, and transformed into Escherichia coli BL21 (DE3). Then the pET15b plasmid expression vector was used to confirm the purification of the recombinant proteins via SDS-PAGE. The VBNC state cells from the high-GC Gram-positive bacteria, Rhodococcus sp. DS471, were used to confirm the promotion and recovery of growth capacity. Rhodococcus sp. DS471 were isolated from soil and closely related to Micrococcus luteus IAM 14879. The gene sequences confirmed that the rpf gene from Micrococcus luteus IAM 14879 that was expressed in Escherichia coli, was 672 bp. SDS-PAGE analysis showed that the recombinant Rpf protein was obtained successfully, and further studies showed it capable of promoting the recovery of the VBNC state by about 100-fold relative to the control. Rpf of Micrococus luteus IAM 14879 can be successfully cloned and expressed in Escherichia coli and shows a strong ability to promote the recovery of the VBNC state of cells of Rhodococcus sp. DS471.

  15. Bacterial populations associated with the dirty area of a South African poultry abattoir.

    PubMed

    Geornaras, I; de Jesus, A E; von Holy, A

    1998-06-01

    Bacterial populations associated with three sample types from the neck region of poultry carcasses in the dirty area of an abattoir were characterized. Sample types before and after scalding were skin only, feathers only, and a skin and feather combination. The neck skin of carcasses after the defeathering processing stage was also sampled. Bacterial populations associated with water from the scald tank, rubber fingers at the exit of the defeathering machine, and air in the dirty area were also characterized. Bacterial colonies (751) were randomly isolated from yeast extract-supplemented tryptone soya agar plates exhibiting 30 to 300 colonies. Micrococcus spp. were isolated in the highest proportion from pre-and postscalded carcass samples (63.5 to 86.1% of isolates), regardless of the sample type. Conversely, Enterobacteriaceae (40.3%), Acinetobacter (19.4%), and Aeromonas/Vibrio (12.5%) species predominated on neck skin samples taken from mechanically defeathered carcasses. Isolates from the rubber fingers were, however, predominantly Micrococcus spp. (94.4%). Bacterial groups isolated in the highest proportion from scald tank water samples were Micrococcus spp. (38.3%), species of Enterobacteriaceae (29.1%), and lactic acid bacteria (17.0%). Corynebacterium spp., species of Enterobacteriaceae, and Micrococcus spp. were dominant on air settle plates.

  16. Phylogenetic and Biochemical Studies on Stomatococcus mucilaginosus.

    PubMed

    Stackebrandt, E; Scheuerlein, C; Schleifer, K H

    1983-01-01

    The degree of relatedness of nine strains of Stomatococcus mucilaginosus (formerly classified as 'Micrococcus mucilaginosus') was investigated by deoxyribonucleic acid hybridization. We confirm that all strains are highly related. Differences in the peptidoglycan type and the cytochrome pattern between S. mucilaginosus and members of Micrococcus, together with the results of 23 S ribosomal ribonucleic acid cistron similarity studies and the analysis of the 16S ribosomal ribonucleic acid support the exclusion of this species from the genus Micrococcus and justifies its reclassification as a member of a new genus, Stomatococcus (Bergan and Kocur, 1982). Phylogenetically, S. mucilaginosus represents an independent line of descent within a broad group of Gram-positive bacteria that contains arthrobacteria, micrococci, cellulomonads, brevibacteria and microbacteria. Copyright © 1983 Gustav Fischer Verlag, Stuttgart/New York. Published by Elsevier GmbH.. All rights reserved.

  17. Draft Genome Sequence of Micrococcus sp. Strain MS-AsIII-49, an Arsenate-Reducing Isolate from Tropical Metal-Rich Sediment

    PubMed Central

    Costa, Patrícia S.; Tschoeke, Diogo A.; Silva, Bruno S. O.; Thompson, Fabiano; Reis, Mariana P.; Chartone-Souza, Edmar

    2015-01-01

    Micrococcus sp. strain MS-AsIII-49, which was isolated from a tropical metal-polluted stream sediment in Brazil, has the ability to reduce AsV to AsIII. Analysis of its draft genome revealed 186 contigs with a total size of 2,440,924 bp encoding several metal resistance genes. PMID:25883272

  18. Characterization of Micrococcus strains isolated from indoor air.

    PubMed

    Kooken, Jennifer M; Fox, Karen F; Fox, Alvin

    2012-02-01

    The characterization of microbes, such as opportunists and pathogens (e.g., methicillin resistant Staphylococcus aureus [MRSA]), in indoor air is important for understanding disease transmission from person-to-person. Common genera found in the human skin microbiome include Micrococcus and Staphylococcus, but there only a limited number of tests to differentiate these genera and/or species. Both genera are believed to be released into indoor air from the shedding of human skin and are morphologically difficult to distinguish. In the current work, after the extraction of proteins from micrococci and the separation of these proteins on one dimensional electrophoretic gels, tryptic peptides were analyzed by MALDI TOF MS and the mass profiles compared with those of a reference strain (ATCC 4698). The results confirmed that all strains were consistent in identity with Micrococcus luteus. Copyright © 2011 Elsevier Ltd. All rights reserved.

  19. Characterization of Micrococcus strains isolated from indoor air

    PubMed Central

    Kooken, Jennifer M.; Fox, Karen F.; Fox, Alvin

    2014-01-01

    The characterization of microbes, such as of opportunists and pathogens (e.g. methicillin resistant Staphylococcus aureus [MRSA]), in indoor air is important for understanding disease transmission from person-to-person. Common genera found in the human skin microbiome include Micrococcus and Staphylococcus, but there only a limited number of tests to differentiate these genera and/or species. Both genera are believed to be released into indoor air from the shedding of human skin and are morphologically difficult to distinguish. In the current work, after the extraction of proteins from micrococci and the separation of these proteins on one dimensional electrophoretic gels, tryptic peptides were analyzed by MALDI TOF MS and the mass profiles compared with those of a reference strain (ATCC 4698). The results confirmed that all strains were consistent in identity with Micrococcus luteus. PMID:21963944

  20. Effect of physiological age on radiation resistance of some bacteria that are highly radiation resistant. [Micrococcus radiodurans; Micrococcus sp. isolate C-3; Moraxella sp isolate 4; Escherichia coli

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Keller, L.C.; Maxcy, R.B.

    1984-05-01

    Physiological age-dependent variation in radiation resistance was studied for three bacteria that are highly radiation resistant: Micrococcus radiodurans, Micrococcus sp. isolate C-3, and Moraxella sp. isolate 4. Stationary-phase cultures of M. radiodurans and isolate C-3 were much more resistant to gamma radiation than were log-phase cultures. This pattern of relative resistance was reversed for isolate 4. Resistance of isolate 4 to UV light was also greater during log phase, although heat resistance and NaCl tolerance after heat stresses were greater during stationary phase. Radiation-induced injury of isolate 4 compared with injury of Escherichia coli B suggested that the injury process,more » as well as the lethal process, was affected by growth phase. The hypothesis that growth rate affects radiation resistance was tested, and results were interpreted in light of the probable confounding effect of methods used to alter growth rates of bacteria. These results indicate that dose-response experiments should be designed to measure survival during the most resistant growth phase of the organism under study. The timing is particularly important when extrapolations of survival results might be made to potential irradiation processes for foods. 17 references.« less

  1. Metabolism of dimethylphthalate by Micrococcus sp. strain 12B.

    PubMed Central

    Eaton, R W; Ribbons, D W

    1982-01-01

    During growth of Micrococcus sp. strain 12B with dimethylphthalate, 4-carboxy-2-hydroxymuconate lactone (CHML, X) and 3,4-dihydroxyphthalate-2-methyl ester (XI) were isolated from culture filtrates. CHML is the lactone of intermediate 4-carboxy-2-hydroxymuconate (IX). Accumulation of XI which is not a substrate for 3,4-dihydroxyphthalate-2-decarboxylase in strain 12B afforded an easy access to the preparation of 3,4-dihydroxyphthalate. PMID:7085569

  2. Application of halophilic nuclease H of Micrococcus varians subsp. halophilus to commercial production of flavoring agent 5'-GMP.

    PubMed Central

    Kamekura, M; Hamakawa, T; Onishi, H

    1982-01-01

    RNA was degraded at 60 degrees C for 24 h by halophilic nuclease H in supernatants from broth cultures of Micrococcus varians subsp. halophilus containing 12% NaCl. Since contaminating 5'-nucleotidase exhibited almost no activity under these conditions, the 5'-GMP formed could be recovered from the reaction mixture, and the yield was 805 mg from 5 g of RNA. PMID:6184020

  3. Clearing of suspensions of Micrococcus lysodeikticus catalysed by lysozymes from hen, goose, and turkey egg whites, human milk, and phage T4. Assessment of potential as signal generators for homogeneous enzyme immunoassays for urinary steroids.

    PubMed

    Cooke, Delwyn G; Blackwell, Leonard F

    2007-01-01

    Lysozymes (3.2.1.17) from goose (Anser anser) egg white, turkey (Melagris gallopavo) egg white, phage T4 and human milk were compared with hen egg white lysozyme in their ability to clear a suspension of Micrococcus lysodeikticus. All of the lysozymes, except hen egg white lysozyme, catalysed the clearing of the Micrococcus lysodeikticus suspension in a biphasic fashion. Compared to hen egg white lysozyme, the total absorbance or transmission change over 5 and 20 minutes was less in all cases, except for human lysozyme. Human lysozyme was, therefore, a potential alternative, more rapid signal generator for the measurement of urinary estrone glucuronide excretion rates because of its structural similarity to hen egg white lysozyme. The apparent K(M) values for hen egg white lysozyme increased with the enzyme concentration.

  4. Secondary structure and phylogeny of Staphylococcus and Micrococcus 5S rRNAs.

    PubMed Central

    Dekio, S; Yamasaki, R; Jidoi, J; Hori, H; Osawa, S

    1984-01-01

    Nucleotide sequences of 5S rRNAs from four bacteria, Staphylococcus aureus Smith (diffuse), Staphylococcus epidermidis ATCC 14990, Micrococcus luteus ATCC 9341 and Micrococcus luteus ATCC 4698, were determined. The secondary structural models of S. aureus and S. epidermidis sequences showed characteristics of the gram-positive bacterial 5S rRNA (116-N type [H. Hori and S. Osawa, Proc. Natl. Acad. Sci. U.S.A. 76:381-385, 1979]). Those of M. luteus ATCC 9341 and M. luteus ATCC 4698 together with that of Streptomyces griseus (A. Simoncsits, Nucleic Acids Res. 8:4111-4124, 1980) showed intermediary characteristics between the gram-positive and gram-negative (120-N type [H. Hori and S. Osawa, 1979]) 5S rRNAs. This and previous studies revealed that there exist at least three major groups of eubacteria having distinct 5S rRNA and belonging to different stems in the 5S rRNA phylogenic tree. PMID:6735981

  5. Micrococcus-associated central venous catheter infection in patients with pulmonary arterial hypertension.

    PubMed

    Oudiz, Ronald J; Widlitz, Allison; Beckmann, X Joy; Camanga, Daisy; Alfie, Jose; Brundage, Bruce H; Barst, Robyn J

    2004-07-01

    To determine the incidence of catheter-related infection in patients with pulmonary arterial hypertension (PAH) receiving epoprostenol (EPO), and to note an etiologic role for Micrococcus spp, which is rarely reported as a pathogen in the medical literature. Observational study. Two PAH specialty treatment centers, Harbor-UCLA Medical Center (Torrance, CA), and the College of Physicians and Surgeons, Columbia University (New York, NY). A total of 192 patients with PAH receiving continuous therapy with IV EPO. From 1987 to 2000, 192 patients with PAH received infusions of EPO via central venous catheter. Catheter care included regular dressing changes with dry gauze using a sterile procedure, without the use of flushes. Patients were asked to report on known infections and treatments, and symptoms. All infections were verified by a telephone call to the patient, care provider, and microbiology laboratory whenever possible. There were 335,285 catheter days (mean +/- SD, 1,325 +/- 974 catheter days). There were 88 clinical catheter infections with 51 blood culture-positive infections, necessitating catheter removal in 38 instances. The following pathogens were isolated: Staphylococcus aureus (25); Micrococcus spp (14); mixed flora (3); coagulase-negative Staphylococcus spp (2); Corynebacterium spp (2); Serratia marcessens (1); Enterobacter spp (1); Pseudomonas aeruginosa (1); enterococci (1); and unidentified Gram-positive cocci (1). The catheter infection rate was 0.26 per 1,000 catheter days. The use of long-term therapy with continuous EPO appears to be associated with a low incidence of catheter-related infections. Micrococcus spp were the second most common etiologic agent. Caregivers managing patients with PAH must be aware of the risk of catheter infection, as it may contribute to the morbidity and mortality associated with the use of EPO. When isolated, Micrococcus spp should not be viewed as a contaminant, but rather as a true pathogen that may require therapeutic intervention.

  6. Comparative analysis of Micrococcus luteus isolates from blood cultures of patients with pulmonary hypertension receiving epoprostenol continuous infusion.

    PubMed

    Hirata, Yoshinori; Sata, Makoto; Makiuchi, Yuko; Morikane, Keita; Wada, Akihito; Okabe, Nobuhiko; Tomoike, Hitonobu

    2009-12-01

    During the period 2002-2008, at the National Cardiovascular Center, Osaka, 28 Micrococcus luteus isolates and one Kocuria spp. isolate were obtained from blood cultures of pulmonary hypertension (PH) patients who were receiving continuous infusion therapy with epoprostenol. Pulsed-field gel electrophoresis patterns of the isolates were unrelated, suggesting that the infections had multiple origins. The preparation of epoprostenol solution by patients themselves was thought to be a risk factor.

  7. Whole genome sequences and annotation of Micrococcus luteus SUBG006, a novel phytopathogen of mango.

    PubMed

    Rakhashiya, Purvi M; Patel, Pooja P; Thaker, Vrinda S

    2015-12-01

    Actinobaceria, Micrococcus luteus SUBG006 was isolated from infected leaves of Mangifera indica L. vr. Nylon in Rajkot, (22.30°N, 70.78°E), Gujarat, India. The genome size is 3.86 Mb with G + C content of 69.80% and contains 112 rRNA sequences (5S, 16S and 23S). The whole genome sequencing has been deposited in DDBJ/EMBL/GenBank under the accession number JOKP00000000.

  8. [Occurrence of bacteria in the mouth from genera of Micrococcus, Kocuria, Nesterenkonia, Kytococcus and Dermacoccus].

    PubMed

    Szczerba, Izabela; Krzemiński, Zbigniew

    2002-01-01

    The aim of the study was to assess the prevalence of different bacteria in the oral cavity. The bacteria were present in the oral cavities of 73 (48.7%) of 150 individuals. Nesterenkonia halobia, the most frequently isolated species, was found in 20 (27%) individuals, Micrococcus luteus in 16 (22%), Kocuria kristinae in 12 (16%), Kocuria varians in 10 (14%), Dermacoccus sedentarius in 9 (12%), Micrococcus lylae in 8 (11%), and Kytococcus nishinomiyaensis in 3 (4%). Mean counts of these microorganisms were relatively low and amounted in log10 CFU/ml saliva for M. luteus 1.87 +/- 0.52, for M. lylae 2.03 +/- 0.39, for N. halobia 2.14 +/- 0.56, for K. kristinae 2.20 +/- 0.69, for K. varians 2.19 +/- 0.67, for K. nishinomiyaensis 1.72 +/- 0.39, and for D. sedentarius 2.27 +/- 0.55. The factor limiting the population sizes of these microorganisms was most probably the antagonistic activity of the bacteria living in oral cavity.

  9. ORIGIN OF PALMITIC ACID CARBON IN PALMITATES FORMED FROM HEXADECANE-1-C14 AND TETRADECANE-1-C14 BY MICROCOCCUS CERIFICANS

    PubMed Central

    Finnerty, W. R.; Kallio, R. E.

    1964-01-01

    Finnerty, W. R. (University of Iowa, Iowa City), and R. E. Kallio. Origin of palmitic acid carbon in palmitates formed from hexadecane-1-C14 and tetradecane-1-C14 by Micrococcus cerificans. J. Bacteriol. 87:1261–1265. 1964.—Degradation of the palmitic acid moiety of cetyl palmitate and myristyl palmitate formed from hexadecane-1-C14 and tetradecane-1-C14 by Micrococcus cerificans was carried out. The patterns of C14 labeling in palmitic acid from cetyl palmitate showed that hexadecane is oxidized at the C1 position, and cetyl alcohol and palmitic acid thus formed are directly esterified. Palmitic acid arising from tetradecane and esterified to tetradecanol appeared to have been synthesized by the addition of two carbon atoms to an existing 14-carbon atom skeleton. Considerable mixing of C14 occurred in the C1 and C2 positions of palmitic acid thus synthesized. PMID:14188700

  10. Evaluation of enhanced thermostability and operational stability of carbonic anhydrase from Micrococcus species.

    PubMed

    Bhattacharya, Abhishek; Shrivastava, Ankita; Sharma, Anjana

    2013-06-01

    Carbonic anhydrase (CA) was purified from Micrococcus lylae and Micrococcus luteus with 49.90 and 53.8 % yield, respectively, isolated from calcium carbonate kilns. CA from M. lylae retained 80 % stability in the pH and temperature range of 6.0-8.0 and 35-45 °C, respectively. However, CA from M. luteus was stable in the pH and temperature range of 7.5-10.0 and 35-55 °C, respectively. Cross-linked enzyme aggregates (CLEAs) raised the transition temperature of M. lylae and M. luteus CA up to 67.5 and 74.0 °C, while the operational stability (T(1/20) of CA at 55 °C was calculated to be 7.7 and 12.0 h, respectively. CA from both the strains was found to be monomeric in nature with subunit molecular weight and molecular mass of 29 kDa. Ethoxozolamide was identified as the most potent inhibitor based on both IC(50) values and inhibitory constant measurement (K(i)). The K(m) and V(max) for M. lylae CA (2.31 mM; 769.23 μmol/mg/min) and M. luteus CA (2.0 mM; 1,000 μmol/mg/min) were calculated from Lineweaver-Burk plots in terms of esterase activity. Enhanced thermostability of CLEAs alleviates its role in operational stability for application at an on-site scrubber. The characteristic profile of purified CA from Micrococcus spp. advocates its effective application in biomimetic CO(2) sequestration.

  11. Isolation and Identification of Echinenone from Micrococcus roseus

    PubMed Central

    Schwartzel, E. H.; Cooney, J. J.

    1970-01-01

    An orange carotenoid from Micrococcus roseus was purified by solvent partitioning followed by column and thin-layer chromatography. Absorption spectra, chromatographic mobility, and partition coefficient suggested that the pigment was echinenone (4-keto-β-carotene). Reduction yielded a pigment with the spectral and polar properties of isocryptoxanthin (4-hydroxy-β-carotene), the expected product. The orange pigment and its reduction product co-chromatographed with the respective authentic pigments, confirming the original pigment as echinenone. To our knowledge echinenone has not been identified previously as a bacterial pigment. PMID:5473895

  12. Comparison on conjunctival sac bacterial flora of the seniors with dry eye in Ganzi autonomous prefecture

    PubMed Central

    Zhang, Yue; Liu, Zhi-Rong; Chen, Hui; Fan, Ying-Chuan; Duo, Ji; Zheng, Hong; Wang, Guang-Jin; Li, Yu-Chan; Jiachu, Dan-Ba; Zewang, Ge-Ma

    2013-01-01

    AIM To compare the bacterial flora in palpebral conjunctiva of xerophthalmia seniors of Tibetan, Yi and Han, and analyze the differences and similarities of the bacteria. METHODS The test subjects were selected from 2 Tibetan, 2 Yi and 3 Han populated places, respectively. Total 222 seniors (444 eyes) with dry eye were examined. Secretion was collected from the palpebral conjunctiva of the subjects and then inoculated onto a blood agar plate. After 48h of incubation, the bacteria were examined for the differences and similarities between different ethnics. RESULTS There was no significant difference (P>0.05) of Gram stain characterization, dominant bacteria and number of the bacterial species present in oxrophthalmia patients among Tibetan, Yi and Han nationalities. The bacteria presented in all groups include staphylococcus epidermidis, corynebacterium, micrococcus luteu, intracellular bacteria sphingomonas, pseudomonas aeruginosa. The bacteria detected from the two of three ethnic groups were staphylococcus aureus, staphylococcus haemolyticus, escherichia coli, kytococcus sedentarius, streptococcus angina, micrococcus lylae, and staphylococcus heads. The incidence rate of bacteria-associated dry eye in Tibetan population was significantly lower than that of Han and Yi population. CONCLUSION There is no significant difference in the bacteria flora of palpebral conjunctiva observed among dry eye elder populations of Tibetan, Yi and Han people. All of staphylococcus epidermidis, corynebacterium, micrococcus luteu, intracellular bacteria sphingomonas, pseudomonas aeruginosa, staphylococcus aureus, staphylococcus haemolyticus, escherichia coli, kytococcus sedentarius, streptococcus angina, micrococcus lylae and staphylococcus heads are common bacteria flora of the three nationalities inhibiting in this area. PMID:23991377

  13. Evaluation of autochthonous micrococcus strains as starter cultures for the production of Kedong sufu.

    PubMed

    Feng, Z; Huang, S; Ai, Z W; Zhang, M; Zhai, S; Chen, X

    2016-03-01

    The technological properties of 22 micrococcus strains from traditional fermented Kedong sufu were evaluated in order to develop autochthonous starter cultures. The proteolytic, autolytic and lipolytic activity, salt tolerance, production and degradation of the biogenic amines of six Micrococcus luteus, nine Kocuria kristinae and seven Kocuria rosea were evaluated. The results indicated that these micrococcus strains exhibited a certain technological diversity, and the results also indicated the best properties to be used in mixed starter cultures. Based on the above findings, two sets of autochthonous starters were formulated. Considering the physicochemical properties and sensory characteristics of sufu, the maturation period of sufu was shortened by 30 days. The profiles of free amino acids and peptides partly revealed the mechanism of sensory quality and shorter ripening time of sufu manufactured using autochthonous mixed starters. Compared to back-slopping fermentation, sufu manufactured with selected autochthonous starter cultures exhibited lower levels of total biogenic amines. The selected strains could be used as starter to avoid the accumulation of high concentrations of biogenic amines while also maintaining typical sensory characteristics and preserving the autochthonous strains of the traditional Kedong sufu. The maturation times of Kedong sufu were shortened by 30 days with application of the autochthonous starter. Autochthonous mixed starters can reduce the generation of biogenic amines, speed up the sufu maturation process and preserve typical sensory quality. Furthermore, the rotation of two sets of mixed starter cultures can effectively resist phage attack during the production of sufu. © 2015 The Society for Applied Microbiology.

  14. Structures Containing Polyphosphate in Micrococcus lysodeikticus1

    PubMed Central

    Friedberg, Ilan; Avigad, Gad

    1968-01-01

    Granular structures containing inorganic polyphosphate were found in Micrococcus lysodeikticus. These structures were isolated by fractionation of the bacterial extract obtained by lysing the organisms with lysozyme. The composition of the fraction which was enriched with these structures was found to be: protein, 24%; lipids, 30%; and polyphosphate, 27%. This fraction also contained small amounts of ribonucleic acids, carbohydrate, and polyvalent cations. The effect of different reagents and enzymes on the integrity of the granules was examined. It was noticed that they accumulate in the bacteria during the logarithmic phase of growth but disappear gradually during the stationary phase. Images PMID:5674060

  15. Antibiotic Sensitivity of Micrococcus radiodurans

    PubMed Central

    Hawiger, J.; Jeljaszewicz, J.

    1967-01-01

    A wild-type strain of Micrococcus radiodurans and its nonpigmented mutant W1 were tested for sensitivity to 10 antibiotics selected from the standpoint of their mechanism of action. Representatives of groups of antibiotics inhibiting deoxyribonucleic acid (DNA) synthesis, DNA-dependent ribonucleic acid synthesis, protein synthesis, and cell wall synthesis were selected. M. radiodurans and its mutant exhibited full susceptibility to all antibiotics tested (mitomycin C, actinomycin D, chloramphenicol, dihydrostreptomycin, erythromycin, neomycin, kanamycin, benzylpenicillin, bacitracin, and vancomycin), the degree of susceptibility being of the same order as that of a standard strain of Staphylococcus aureus 209 P, with the exception of dihydrostreptomycin. PMID:4166078

  16. Halophilic Nuclease from a Moderately Halophilic Micrococcus varians

    PubMed Central

    Kamekura, Masahiro; Onishi, Hiroshi

    1974-01-01

    The moderately halophilic bacterium Micrococcus varians, isolated from soy sauce mash, produced extracellular nuclease when cultivated aerobically in media containing 1 to 4 M NaCl or KCl. The enzyme, purified to an electrophoretically homogeneous state, had both ribonuclease and deoxyribonuclease activities. The nuclease had maximal activity in the presence of 2.9 M NaCl or 2.1 M KCl at 40 C. The enzymatic activity was lost by dialysis against low-salt buffer, whereas when the inactivated enzyme was dialyzed against 3.4 M NaCl buffer as much as 77% of the initial activity could be restored. Images PMID:4852218

  17. Interconversion of large packets and small groups of cells of Micrococcus rubens: dependence upon magnesium and phosphate.

    PubMed Central

    Yamada, M; Koyama, T; Matsuhashi, M

    1977-01-01

    Micrococcus rubens, a gram-positive occus, usually forms large, cubic packets of more than 500 cells that are regularly arranged in three-dimensional cell groups. In medium with extremely low concentration of Mg2+ and phosphate, in which the cells can only grow on a agar surface, it formed small groups of 2 to 20 cells. Irregularly arraged cell groups of intermediated size were obtained in culture media containing intermediated concentrations of Mg2+ and phosphate. Mutants that formed irregular cell groups of intermediate size under normal culture conditions were also obtained. Images PMID:845123

  18. REDUCTION OF INORGANIC COMPOUNDS WITH MOLECULAR HYDROGEN BY MICROCOCCUS LACTILYTICUS I.

    PubMed Central

    Woolfolk, C. A.; Whiteley, H. R.

    1962-01-01

    Woolfolk, C. A. (University of Washington, Seattle) and H. R. Whiteley. Reduction of inorganic compounds with molecular hydrogen by Micrococcus lactilyticus. I. Stoichiometry with compounds of arsenic, selenium, tellurium, transition and other elements. J. Bacteriol. 84:647–658. 1962.—Extracts of Micrococcus lactilyticus (Veillonella alcalescens) oxidize molecular hydrogen at the expense of certain compounds of arsenic, bismuth, selenium, tellurium, lead, thallium, vanadium, manganese, iron, copper, molybdenum, tungsten, osmium, ruthenium, gold, silver, and uranium, as well as molecular oxygen. Chemical and manometric data indicate that the following reductions are essentially quantitative: arsenate to arsenite, pentavalent and trivalent bismuth to the free element, selenite via elemental selenium to selenide, tellurate and tellurite to tellurium, lead dioxide and manganese dioxide to the divalent state, ferric to ferrous iron, osmium tetroxide to osmate ion, osmium dioxide and trivalent osmium to the metal, uranyl uranium to the tetravalent state, vanadate to the level of vanadyl, and polymolybdate ions to molybdenum blues with an average valence for molybdenum of +5. The results of a study of certain other hydrogenase-containing bacteria with respect to their ability to carry out some of the same reactions are also presented. PMID:14001842

  19. Efficient biotransformation of herbicide diuron by bacterial strain Micrococcus sp. PS-1.

    PubMed

    Sharma, Priyanka; Chopra, Adity; Cameotra, Swaranjit Singh; Suri, C Raman

    2010-11-01

    A Gram-positive, Micrococcus sp. strain PS-1 capable of utilizing phenylurea herbicide diuron as a sole carbon source at a high concentration (up to 250 ppm) was isolated from diuron storage site by selective enrichment study. The taxonomic characterization with 16S rRNA gene sequencing (1,477 bp) identified PS-1 as a member of Micrococcus sp. It was studied for the degradation of diuron and a range of its analogues (monuron, linuron, monolinuron, chlortoluron and fenuron). The shake flasks experiments demonstrated fast degradation of diuron (up to 96% at 250 ppm within 30 h incubation) with the addition of small quantity (0.01%) of non-ionic detergent. The relative degradation profile by the isolate was in the order of fenuron > monuron > diuron > linuron > monolinuron > chlortoluron. Further, the biochemical characterization of catabolic pathway by spectroscopic and chromatographic techniques demonstrated that the degradation proceeded via formation of dealkylated metabolites to form 3,4-dichloroaniline (3,4-DCA). It was the major metabolite formed, associated with profound increase in degradation kinetics in presence of appropriate additive.

  20. Optimization of culture conditions and medium composition for the production of micrococcin GO5 by Micrococcus sp. GO5.

    PubMed

    Kim, Mi-Hee; Kong, Yoon-Jung; Baek, Hong; Hyun, Hyung-Hwan

    2006-01-02

    To enhance the production of micrococcin GO5, a bacteriocin produced by Micrococcus sp. GO5, cultivation conditions and medium composition were optimized. The optimal initial pH and temperature for bacteriocin production were 7.0-9.0 and 37 degrees C, respectively. Micrococcus sp. GO5 displayed the highest micrococcin GO5 activity when grown in modified MRS medium that contained lactose or sucrose, rather than glucose, as a carbon source. The maximum bacteriocin activity was obtained in modified MRS medium containing 0.5% tryptone and 1.0% yeast extract as nitrogen sources instead of the other nitrogen sources present in MRS medium. Bacteriocin production was greatly affected by the concentration of K(2)HPO(4); strain GO5 produced eight-fold more bacteriocin in medium containing 2.0-2.5% K(2)HPO(4) than in medium containing 0.2% K(2)HPO(4). The optimal concentration of MgSO(4).7H(2)O for bacteriocin production was 0.5%. The production of micrococcin GO5 was increased 32-fold in shake flask culture and 16-fold in a bioreactor using the optimized medium (TY medium), compared with culturing in MRS medium.

  1. Pitting failure of copper pipings for emergency fire sprinkler in ground water

    NASA Astrophysics Data System (ADS)

    Baek, Seung-won; Lee, Jong-kwon; Kim, Jong-jip; Kim, Kyung-ja

    2015-05-01

    The possibility of microbiologically influenced corrosion was investigated in the early pitted copper pipes. The pipes were installed for less than 6 months as an immergency fire sprinkler. The bacteria were cultured by sampling of corrosion by-product near pits on failed copper pipes for the aerobic as well as anaerobic bacteria. However, only aerobic bacteria was found, which were Micrococcus Luteus and Bacillus sp.. The corrosion rate of copper pipes were studied by weight loss in the groundwater and polarization method. In immersion test as well as the electrochemical polarization test in ground water, only Micrococcus Luteus could activate corrosion of copper by 20% and 15%, respectively. On the other hand, Bacillus sp. showed little effect on corrosion in the above two tests. The shape and characteristics of failed copper pipes as well as simulated copper were investigated using stereoscope, optical microscopy, scanning electron microscope and EDS. The cause of pits were discussed, related with the dissolved copper concentrations, pH, and optical density. It could be concluded that the early failure of copper pipings could be ascribed to the acceration of copper in the presence of bacteria, i.e., Micrococcus Luteus.

  2. Enhanced degradation of 2-nitrotoluene by immobilized cells of Micrococcus sp. strain SMN-1.

    PubMed

    Mulla, Sikandar I; Talwar, Manjunatha P; Bagewadi, Zabin K; Hoskeri, Robertcyril S; Ninnekar, Harichandra Z

    2013-02-01

    Nitrotoluenes are the toxic pollutants of the environment because of their large scale use in the production of explosives. Biodegradation of such chemicals by microorganisms may provide an effective method for their detoxification. We have studied the degradation of 2-nitrotoluene by cells of Micrococcus sp. strain SMN-1 immobilized in various matrices such as polyurethane foam (PUF), sodium alginate (SA), sodium alginate-polyvinyl alcohol (SA-PVA), agar and polyacrylamide. The rate of degradation of 15 and 30 mM 2-nitrotoluene by freely suspended cells and immobilized cells in batches and fed-batch with shaken cultures were compared. The PUF-immobilized cells achieved higher degradation of 15 and 30 mM 2-nitrotoluene than freely suspended cells and the cells immobilized in SA-PVA, polyacrylamide, SA and agar. The PUF-immobilized cells could be reused more than 24 cycles without loosing their degradation capacity and showed more tolerance to pH and temperature changes than freely suspended cells. These results revealed the enhanced rate of degradation of 2-nitrotoluene by PUF-immobilized cells of Micrococcus sp. strain SMN-1. Copyright © 2012 Elsevier Ltd. All rights reserved.

  3. The deoxyribonucleic acid of Micrococcus radiodurans

    PubMed Central

    Schein, Arnold H.

    1966-01-01

    The DNA of Micrococcus radiodurans was prepared by three methods. Although the recovery of DNA varied considerably, the percentage molar base ratios of the DNA from the three preparations were essentially the same: guanine, 33±2; adenine, 18±1; cytosine, 33±2; thymine, 17±1. Base compositions calculated from Tm values and from density in caesium chloride gradients also yielded guanine+cytosine contents of 66 and 68% of total bases respectively. No unusual bases were observed. The S20,w values were characteristic of high-molecular-weight DNA. Electron microscopy showed the purified DNA in long strands; occasionally these were coiled. Images(a)(b)(c)(d)(e)Fig. 1. PMID:16742439

  4. Biodegradation of cypermethrin by Micrococcus sp. strain CPN 1.

    PubMed

    Tallur, Preeti N; Megadi, Veena B; Ninnekar, Harichandra Z

    2008-02-01

    A bacterium capable of utilizing pyrethroid pesticide cypermethrin as sole source of carbon was isolated from soil and identified as a Micrococcus sp. The organism also utilized fenvalerate, deltamethrin, perimethrin, 3-phenoxybenzoate, phenol, protocatechuate and catechol as growth substrates. The organism degraded cypermethrin by hydrolysis of ester linkage to yield 3-phenoxybenzoate, leading to loss of its insecticidal activity. 3-Phenoxybenzoate was further metabolized by diphenyl ether cleavage to yield protocatechuate and phenol as evidenced by isolation and identification of metabolites and enzyme activities in the cell-free extracts. Protocatechuate and phenol were oxidized by ortho-cleavage pathway. Thus, the organism was versatile in detoxification and complete mineralization of pyrethroid cypermethrin.

  5. New antibacterial xanthone from the marine sponge-derived Micrococcus sp. EG45.

    PubMed

    Eltamany, Enas E; Abdelmohsen, Usama Ramadan; Ibrahim, Amany K; Hassanean, Hashim A; Hentschel, Ute; Ahmed, Safwat A

    2014-11-01

    Microluside A [4 (19-para-hydroxy benzoyloxy-O-β-D-cellobiosyl), 5 (30-para-hydroxy benzoyloxy-O-β-D-glucopyranosyl) xanthone (1)] is a unique O-glycosylated disubstituted xanthone isolated from the broth culture of Micrococcus sp. EG45 cultivated from the Red Sea sponge Spheciospongia vagabunda. The structure of microluside A was determined by 1D- and 2D-NMR techniques as well as high resolution tandem mass spectrometry. The antimicrobial activity evaluation showed that 1 exhibited antibacterial potential against Enterococcus faecalis JH212 and Staphylococcus aureus NCTC 8325 with MIC values of 10 and 13 μM, respectively. Copyright © 2014 Elsevier Ltd. All rights reserved.

  6. Isolation and characterization of aerobic culturable arsenic-resistant bacteria from surfacewater and groundwater of Rautahat District, Nepal.

    PubMed

    Shakya, S; Pradhan, B; Smith, L; Shrestha, J; Tuladhar, S

    2012-03-01

    Arsenic (As) contamination of groundwater is a serious Environmental Health Management issue of drinking water sources especially in Terai region of Nepal. Many studies have reported that due to natural abundance of arsenic in the environment, various bacteria have developed different resistance mechanisms for arsenic compound. In this study, the culturable arsenic-resistant bacteria indigenous to surfacewater as well as groundwater from Rautahat District of Nepal were randomly isolated by standard plate count method on the basis of viable growth on plate count agar amended with arsenate ranging from 0, 0.5, 10, 40, 80 to 160 milligram per liter (mg/l). With respect to the morphological and biochemical tests, nine morphologically distinct potent arsenate tolerant bacteria showed relatedness with Micrococcus varians, Micrococcus roseus, Micrococcus luteus, Pseudomonas maltophilia, Pseudomonas sp., Vibrio parahaemolyticus, Bacillus cereus, Bacillus smithii 1 and Bacillus smithii 2. The isolates were capable of tolerating more than 1000 mg/l of arsenate and 749 mg/l of arsenite. Likewise, bioaccumulation capability was highest with M. roseus (85.61%) and the least with B. smithii (47.88%) indicating the potential of the organisms in arsenic resistance and most probably in bioremediation. Copyright © 2011 Elsevier Ltd. All rights reserved.

  7. Enhanced cadmium phytoremediation of Glycine max L. through bioaugmentation of cadmium-resistant bacteria assisted by biostimulation.

    PubMed

    Rojjanateeranaj, Pongsarun; Sangthong, Chirawee; Prapagdee, Benjaphorn

    2017-10-01

    This study examined the potential of three strains of cadmium-resistant bacteria, including Micrococcus sp., Pseudomonas sp. and Arthrobacter sp., to promote root elongation of Glycine max L. seedlings, soil cadmium solubility and cadmium phytoremediation in G. max L. planted in soil highly polluted with cadmium with and without nutrient biostimulation. Micrococcus sp. promoted root length in G. max L. seedlings under toxic cadmium conditions. Soil inoculation with Arthrobacter sp. increased the bioavailable fraction of soil cadmium, particularly in soil amended with a C:N ratio of 20:1. Pot culture experiments observed that the highest plant growth was in Micrococcus sp.-inoculated plants with nutrient biostimulation. Cadmium accumulation in the roots, stems and leaves of G. max L. was significantly enhanced by Arthrobacter sp. with nutrient biostimulation. A combined use of G. max L. and Arthrobacter sp. with nutrient biostimulation accelerated cadmium phytoremediation. In addition, cadmium was retained in roots more than in stems and leaves and G. max L. had the lowest translocation factor at all growth stages, suggesting that G. max L. is a phytostabilizing plant. We concluded that biostimulation-assisted bioaugmentation is an important strategy for improving cadmium phytoremediation efficiency. Copyright © 2017 Elsevier Ltd. All rights reserved.

  8. Whole Genome Sequence Analysis of an Alachlor and Endosulfan Degrading Micrococcus sp. strain 2385 Isolated from Ochlockonee River, Florida

    PubMed Central

    Pathak, Ashish; Chauhan, Ashvini; Ewida, Ayman Y.I.; Stothard, Paul

    2016-01-01

    We recently isolated Micrococcus sp. strain 2385 from Ochlockonee River, Florida and demonstrated potent biodegradative activity against two commonly used pesticides- alachlor [(2-chloro-2`,6`-diethylphenyl-N (methoxymethyl)acetanilide)] and endosulfan [(6,7,8,9,10,10-hexachloro-1,5,5a,6,9,9a-hexahydro-6,9methano-2,3,4-benzo(e)di-oxathiepin-3-oxide], respectively. To further identify the repertoire of metabolic functions possessed by strain 2385, a draft genome sequence was obtained, assembled, annotated and analyzed. The genome sequence of Micrococcus sp. strain 2385 consisted of 1,460,461,440 bases which assembled into 175 contigs with an N50 contig length of 50,109 bases and a coverage of 600x. The genome size of this strain was estimated at 2,431,226 base pairs with a G+C content of 72.8 and a total number of 2,268 putative genes. RAST annotated a total of 340 subsystems in the genome of strain 2385 along with the presence of 2,177 coding sequences. A genome wide survey indicated that that strain 2385 harbors a plethora of genes to degrade other pollutants including caprolactam, PAHs (such as naphthalene), styrene, toluene and several chloroaromatic compounds. PMID:27672405

  9. Oxidation and Assimilation of Carbohydrates by Micrococcus sodonensis1

    PubMed Central

    Perry, Jerome J.; Evans, James B.

    1966-01-01

    Perry, Jerome J. (North Carolina State University, Raleigh), and James B. Evans. Oxidation and assimilation of carbohydrates by Micrococcus sodonensis. J. Bacteriol. 91:33–38. 1966.—Micrococcus sodonensis is a biotin-requiring strict aerobe that cannot utilize carbohydrates as sole sources of carbon and energy. However, addition of mannose, glucose, sucrose, or maltose to a medium on which the organism can grow resulted in an increase in total growth. M. sodonensis oxidized these sugars without induction, thus indicating the presence of constitutive enzymes for their transport, activation, and metabolism. Under appropriate nonproliferating cell conditions, glucose was readily incorporated into essential constituents of the cell. When glucose-1-C14 and glucose-6-C14 were oxidized by nonproliferating cells, the label was found in both the protein and nucleic acid fractions of the cell. The respiratory quotients of cells oxidizing glucose in saline and in phosphate buffer indicated assimilation of sugar carbon in buffer and virtually no assimilation in saline. The ability of M. sodonensis to completely oxidize glucose and to grow on intermediates of glucose oxidation but not on glucose suggests that glucose may suppress or repress some reaction(s) necessary for growth, and that growth substrates either derepress or circumvent this block. PMID:5903100

  10. Extraction, purification and characterization of a protease from Micrococcus sp. VKMM 037.

    PubMed

    Manikandan, Muthu; Kannan, Vijayaraghavan; Pasić, Lejla

    2011-10-01

    The haloalkaliphilic bacterium Micrococcus sp. VKMM 037, isolated from an effluent of the caustic soda industry, was found to produce a protease. Maximal proteolytic activity was observed in cell culture grown at 40 degrees C using 2% (w/v) glycerol, 2% (w/v) beef extract and 2% (w/v) peptone as nutrients in medium also containing 0.85 M NaCl with a pH of 10.0. An efficient purification procedure combining ammonium sulphate precipitation and Q-Sepharose ion-exchange chromatography was developed. The purified 41 kDa protease was stable in a temperature range between 20 degrees C and 60 degrees C. The protease remained active over a wide range of pH values (4.0-12.0) and NaCl concentrations (0-3.42 M) with an optimum at pH 10.0 and 0.85 M NaCl, respectively. Furthermore, the enzyme remained stable or was only marginally inhibited in the presence of various organic solvents, surfactants and reducing agents. The purified protease of Micrococcus sp. VKMM 037 efficiently removed blood stains within 40 minutes of treatment. Given the biochemical characteristics determined, this novel protease could be exploited as an additive in the detergent industry and also for the synthesis of biomolecules and the degradation of protein.

  11. Whole Genome Sequence Analysis of an Alachlor and Endosulfan Degrading Micrococcus sp. strain 2385 Isolated from Ochlockonee River, Florida.

    PubMed

    Pathak, Ashish; Chauhan, Ashvini; Ewida, Ayman Y I; Stothard, Paul

    2016-01-01

    We recently isolated Micrococcus sp. strain 2385 from Ochlockonee River, Florida and demonstrated potent biodegradative activity against two commonly used pesticides- alachlor [(2-chloro-2`,6`-diethylphenyl-N (methoxymethyl)acetanilide)] and endosulfan [(6,7,8,9,10,10-hexachloro-1,5,5a,6,9,9a-hexahydro-6,9methano-2,3,4-benzo(e)di-oxathiepin-3-oxide], respectively. To further identify the repertoire of metabolic functions possessed by strain 2385, a draft genome sequence was obtained, assembled, annotated and analyzed. The genome sequence of Micrococcus sp. strain 2385 consisted of 1,460,461,440 bases which assembled into 175 contigs with an N50 contig length of 50,109 bases and a coverage of 600x. The genome size of this strain was estimated at 2,431,226 base pairs with a G+C content of 72.8 and a total number of 2,268 putative genes. RAST annotated a total of 340 subsystems in the genome of strain 2385 along with the presence of 2,177 coding sequences. A genome wide survey indicated that that strain 2385 harbors a plethora of genes to degrade other pollutants including caprolactam, PAHs (such as naphthalene), styrene, toluene and several chloroaromatic compounds.

  12. Characterization and antioxidative activities of rare C(50) carotenoids-sarcinaxanthin, sarcinaxanthin monoglucoside, and sarcinaxanthin diglucoside-obtained from Micrococcus yunnanensis.

    PubMed

    Osawa, Ayako; Ishii, Yoko; Sasamura, Nao; Morita, Marie; Kasai, Hiroaki; Maoka, Takashi; Shindo, Kazutoshi

    2010-01-01

    While screening for antioxidative carotenoids from marine bacteria, we isolated and identified sarcinaxanthin and its glucosylated compounds (sarcinaxanthin monoglucoside and sarcinaxanthin diglucoside) from a moderately halophilic bacterium-Micrococcus yunnanensis strain AOY-1. In the singlet oxygen ((¹O₂) quenching model, the IC(50) values of the antioxidative activities of these carotenoids were as follows: sarcinaxanthin , 57 µM; sarcinaxanthin monoglucoside, 54 µM; and sarcinaxanthin diglucoside, 74 µM. In addition, the complete proton nuclear magnetic resonance (¹H NMR) assignments of sarcinaxanthin monoglucoside pentaacetate and sarcinaxanthin diglucoside octaacetate, and fast atom bombardment mass spectrometry/mass spectrometry (FAB-MS/MS) analyses of sarcinaxanthin and sarcinaxanthin monoglucoside are reported for the first time.

  13. Influence of Culture Media on the Radiation Resistance of Micrococcus radiodurans

    PubMed Central

    Krabbenhoft, K. L.; Anderson, A. W.; Elliker, P. R.

    1967-01-01

    The addition of NZ-case (a tryptic digest of casein) to a growth medium (PC) consisting of tryptone, glucose, and yeast extract caused a significant decrease in γ radiation resistance of Micrococcus radiodurans. The level of radiation resistance was inversely related to the concentration of NZ-case. The ld50 for this organism was approximately 700 krad when grown in tryptone, glucose, yeast extract, and dl-methionine (TGYM) broth, but it was approximately one-half as resistant when grown in a PC medium containing 0.5% NZ-case (PCNZ). The resistance to ultraviolet light was also reduced. Cultures transferred from PCNZ to TGYM media regained the high level of resistance. Images Fig. 2 Fig. 3 PMID:5340165

  14. Development of a rapid optic bacteria detecting system based on ATP bioluminescence

    NASA Astrophysics Data System (ADS)

    Liu, Jun Tao; Luo, JinPing; Liu, XiaoHong; Cai, XinXia

    2014-12-01

    A rapid optic bacteria detecting system based on the principle of Adenosine triphosphate(ATP) bioluminescence was presented in this paper. This system consisted of bioluminescence-based biosensor and the high-sensitivity optic meter. A photon counting photomultiplier tube (PMT) module was used to improve the detection sensitivity, and a NIOS II/f processor based on a Field Programmable Gate Array(FPGA) was used to control the system. In this work, Micrococcus luteus were chosen as the test sample. Several Micrococcus luteus suspension with different concentration was tested by both T2011 and plate counting method. By comparing the two group results, an calibration curve was obtained from the bioluminescence intensity for Micrococcus luteus in the range of 2.3×102 ~ 2.3×106 CFU/mL with a good correlation coefficient of 0.960. An impacting Air microorganism sampler was used to capture Airborne Bacteria, and 8 samples were collected in different place. The TBC results of 8 samples by T2011 were between 10 ~ 2×103 cfu/mL, consistent with that of plate counting method, which indicated that 8 samples were between 10 ~ 3×103 cfu/mL. For total airborne bacteria count was small, correlation coefficient was poor. Also no significant difference was found between T2011 and plate counting method by statistical analyses.

  15. [Secondary metabolites from a deep-sea-derived actinomycete Micrococcus sp. R21].

    PubMed

    Peng, Kun; Su, Rui-qiang; Zhang, Gai-yun; Cheng, Xuan-xuan; Yang, Quan; Liu, Yong-hong; Yang, Xian-wen

    2015-06-01

    To investigate cytotoxic secondary metabolites of Micrococcus sp. R21, an actinomycete isolated from a deep-sea sediment (-6 310 m; 142 degrees 19. 9' E, 10 degrees 54. 6' N) of the Western Pacific Ocean, column chromatography was introduced over silica gel, ODS, and Sephadex LH-20. As a result, eight compounds were obtained. By mainly detailed analysis of the NMR data, their structures were elucidated as cyclo(4-hydroxy-L-Pro-L-leu) (1), cyclo(L-Pro-L-Gly) (2), cyclo( L-Pro-L-Ala) (3), cyclo( D-Pro-L-Leu) (4), N-β-acetyltryptamine (5), 2-hydroxybenzoic acid (6), and phenylacetic acid (7). Compound 1 exhibited weak cytotoxic activity against RAW264. 7 cells with IC50 value of 9.1 μmol x L(-1).

  16. Agrococcus terreus sp. nov. and Micrococcus terreus sp. nov., isolated from forest soil.

    PubMed

    Zhang, Jia-Yue; Liu, Xing-Yu; Liu, Shuang-Jiang

    2010-08-01

    Two bacterial strains, DNG5T and V3M1T, isolated from forest soil of the Changbai mountains in China, were characterized using a polyphasic approach. Analysis of their 16S rRNA gene sequences indicated that strains DNG5T and V3M1T were phylogenetically related to members of the genus Agrococcus (96.0-98.4% similarity) and Micrococcus (96.7-98.0% similarity), respectively, within the order Actinomycetales. Strains DNG5T and V3M1T were Gram-stain-positive and strictly aerobic and formed yellow colonies on LB agar. Cells of strain DNG5T were short, non-motile rods, 0.4-0.5x0.8-1.0 microm. Strain DNG5T contained MK-10 and MK-11 as the major respiratory quinones and anteiso-C15:0 (49.2%) and iso-C16:0 (22.4%) as the major fatty acids. The diamino acid in the peptidoglycan of strain DNG5T was 2,4-diaminobutyric acid and the murein was of the acetyl type. Cells of strain V3M1T were cocci, 0.6-0.7 microm in diameter. The cell-wall peptidoglycan of strain V3M1T contained the amino acids lysine, glutamic acid, alanine and glycine. Strain V3M1T contained MK-7, MK-7(H2), MK-8 and MK-8(H2) as respiratory quinones and anteiso-C15:0 (78.2%) and iso-C15:0 (13.1%) as the major cellular fatty acids. The DNA G+C contents of strains DNG5T and V3M1T were 75.9 and 67.2 mol%, respectively. The DNA-DNA relatedness of strain DNG5T to Agrococcus jejuensis DSM 22002T, A. jenensis JCM 9950T, A. baldri JCM 12132T and A. citreus JCM 12398T was 58.3, 43.9, 36.1 and 54.1%, respectively. The DNA-DNA relatedness of strain V3M1T to Micrococcus luteus CGMCC 1.2299T, M. antarcticus CGMCC 1.2373T and M. lylae CGMCC 1.2300T was 57.5, 45.4 and 39.0%, respectively. Combining phenotypic and genotypic traits, strain DNG5T represents a novel species of the genus Agrococcus, for which the name Agrococcus terreus sp. nov. is proposed, with DNG5T (=CGMCC 1.6960T =NBRC 104260T) as the type strain. Strain V3M1T represents a novel species of the genus Micrococcus, for which the name Micrococcus terreus sp. nov. is proposed, with V3M1T (=CGMCC 1.7054T =NBRC 104258T) as the type strain.

  17. Identification and Quantitation of the Microbiological Flora of the Food Packet, Long Range Patrol under Simulated Field Conditions,

    DTIC Science & Technology

    MILITARY RATIONS, *MICROORGANISMS), (*FOOD, *BIOLOGICAL CONTAMINATION), DETECTION, IDENTIFICATION, STORAGE, PROCESSING, FREEZE DRYING, MICROCOCCUS , STREPTOCOCCUS, YEASTS, MOLDS(ORGANISMS), TEMPERATURE, HIGH ALTITUDE

  18. Endonuclease from Micrococcus luteus Which Has Activity Toward Ultraviolet-Irradiated Deoxyribonucleic Acid: Its Action on Transforming Deoxyribonucleic Acid

    PubMed Central

    Setlow, R. B.; Setlow, Jane K.; Carrier, W. L.

    1970-01-01

    An endonuclease purified from Micrococcus luteus makes single-strand breaks in ultraviolet (UV)-irradiated, native deoxyribonucleic acid (DNA). The purified endonuclease is able to reactivate UV-inactivated transforming DNA of Haemophilus influenzae, especially when the DNA is assayed on a UV-sensitive mutant of H. influenzae. After extensive endonuclease action, there is a loss of transforming DNA when assayed on both UV-sensitive and -resistant cells. The endonuclease does not affect unirradiated DNA. The results indicate that the endonuclease function is involved in the repair of biological damage resulting from UV irradiation and that the UV-sensitive mutant is deficient in this step. We interpret the data as indicating that the various steps in the repair of DNA must be well coordinated if repair is to be effective. PMID:4314478

  19. [Expression in E.coli and bioactivity assay of Micrococcus luteus resuscitation promoting factor domain and its mutants].

    PubMed

    Yue, Chen-Li; Shi, Jie-Ran; Shi, Chang-Hong; Zhang, Hai; Zhao, Lei; Zhang, Ting-Fen; Zhao, Yong; Xi, Li

    2008-10-01

    To express Micrococcus luteus resuscitation promoting factor (Rpf) domain and its mutants in prokaryotic cells, and to investigate their bioactivity. The gene of Rpf domain and its mutants (E54K, E54A) were amplified by polymerase chain reaction (PCR) from the genome of Micrococcus luteus and cloned into pMD18-T vector. After sequenced, the Rpf domain and its mutant gene were subcloned into expression vector PGEX-4T-1, and transfected into E. coli DH5alpha. The expressed product was purified by affinity chromatography using GST Fusion Protein Purification bead. The aim proteins were identified by SDS-PAGE analysis and by Western blot with monoclonal antibodies against Rpf domain (mAb). The bioactivity of the proteins was analyzed by stimulating the resuscitation of Mycobacterium smegmatis. The sequences of the PCR products were identical to those of the Rpf domain and its mutant gene in GenBank. The relative molecular mass identified by SDS-PAGE analysis was consistent with that had been reported, which was also confirmed by Western blot analysis that there were specific bindings at 32 000 with Rpf domain mAb. The purified GST-Rpf domain could stimulate resuscitation of Mycobacterium smegmatis. Replacements E54A and especially E54K resulted in inhibition of Rpf resuscitation activity. Rpf domain and two kinds of its mutant protein were obtained, and its effects on the resuscitation of dormant Mycobacterium smegmatis were clarified.

  20. Successful immunotherapy with micrococcus, BCG or related polysaccharides on L1210 leukaemia after BCNU chemotherapy.

    PubMed Central

    Verloes, R.; Atassi, G.; Dumont, P.; Kanarek, L.

    1981-01-01

    The experiments aimed at evaluating the optimal parameters in the chemo-immunotherapeutic treatment of the L1210 lymphoid leukaemia grafted to [female BALB/c (H2d) X male DBA/2 (H2d)]F1 hybrid mice, hereafter referred to as CDF1 mice. In vitro irradiation of leukaemic ascites cells by X- or gamma-rays and subsequent inoculation in mice showed that optimum immunogenicity is radiation dose-dependent. Grafting mice with 10(7) leukaemic ascites cells irradiated at optimum dose (80 GyX- or gamma-rays) delays mortality of the animals when challenged later with untreated L1210 cells, but is unable to cure mice. By contrast, specific immunoprophylaxis induced by Micrococcus, complement-triggering polysaccharides or BCG and irradiated leukaemic cells was able to protect mice against grafts of 10(4) L1210 cells. The i.p. route was notably superior to the i.v. route. When mice bearing advanced L1210 tumour were treated by chemotherapy (12 mg/kg of BCNU) on Day 6.5 after grafting 10(4) L1210 cells and subsequently treated by immunotherapy, a very high percentage (up to 90%) of mice with 10(8) leukaemic cells could be cured by repeated 1mg injections of bacterium or polysaccharide, and challenge with irradiated leukaemic cells was unnecessary. Because of the high cure rate obtained, the very regular response pattern and the non-pathogenicity, the bacterium Micrococcus lysodeikticus would seem a promising new candidate for chemo-immunotherapeutic antitumour strategies. PMID:7470382

  1. Crystal structure of salt-tolerant glutaminase from Micrococcus luteus K-3 in the presence and absence of its product L-glutamate and its activator Tris.

    PubMed

    Yoshimune, Kazuaki; Shirakihara, Yasuo; Wakayama, Mamoru; Yumoto, Isao

    2010-02-01

    Glutaminase from Micrococcus luteus K-3 [Micrococcus glutaminase (Mglu); 456 amino acid residues (aa); 48 kDa] is a salt-tolerant enzyme. Our previous study determined the structure of its major 42-kDa fragment. Here, using new crystallization conditions, we determined the structures of the intact enzyme in the presence and absence of its product L-glutamate and its activator Tris, which activates the enzyme by sixfold. With the exception of a 'lid' part (26-29 aa) and a few other short stretches, the structures were all very similar over the entire polypeptide chain. However, the presence of the ligands significantly reduced the length of the disordered regions: 41 aa in the unliganded structure (N), 21 aa for L-glutamate (G), 8 aa for Tris (T) and 6 aa for both L-glutamate and Tris (TG). L-glutamate was identified in both the G and TG structures, whereas Tris was only identified in the TG structure. Comparison of the glutamate-binding site between Mglu and salt-labile glutaminase (YbgJ) from Bacillus subtilis showed significantly smaller structural changes of the protein part in Mglu. A comparison of the substrate-binding pocket of Mglu, which is highly specific for L-glutamine, with that of Erwinia carotovora asparaginase, which has substrates other than L-glutamine, shows that Mglu has a larger substrate-binding pocket that prevents the binding of L-asparagine with proper interactions.

  2. ANAEROBIC NON-CLOSTRIDIAL FLORA OF THE SKIN AND/OR THE MUCOUS MEMBRANES OF MEN

    DTIC Science & Technology

    addition, there were 15 strains of anaerobic streptococci, 5 of Propionibacterium acnes , 58 of M. saccharolyticus, and 80 strains bearing no relationship to any previously described anaerobic micrococcus.

  3. Repair of Ultraviolet Radiation Damage in Sensitive Mutants of Micrococcus radiodurans

    PubMed Central

    Moseley, B. E. B.

    1969-01-01

    Various aspects of the repair of ultraviolet (UV) radiation-induced damage were compared in wild-type Micrococcus radiodurans and two UV-sensitive mutants. Unlike the wild type, the mutants are more sensitive to radiation at 265 nm than at 280 nm. The delay in deoxyribonucleic acid (DNA) synthesis following exposure to UV is about seven times as long in the mutants as in the wild type. All three strains excise UV-induced pyrimidine dimers from their DNA, although the rate at which cytosine-thymine dimers are excised is slower in the mutants. The three strains also mend the single-strand breaks that appear in the irradiated DNA as a result of dimer excision, although the process is less efficient in the mutants. It is suggested that the increased sensitivity of the mutants to UV radiation may be caused by a partial defect in the second step of dimer excision. PMID:5773016

  4. [Occurrence and number of bacteria from the Micrococcus, Kocuria, Nesterenkonia, Kytococcus and Dermacoccus genera on skin and mucous membranes in humans].

    PubMed

    Szczerba, Izabela

    2003-01-01

    The aim of work was to evaluate the frequency of occurrence of bacteria from genera of Micrococcus, Kocuria, Nesterenkonia, kytococcus and Dermatococcus on human skin and mucous membranes in healthy population. Among 150 investigated persons these bacteria were found in 122 (81.3%). The frequency of isolation was similar in both sex (82.4% in female and 79.7% in male). Most often the strains were isolated from oral cavity (48.7%), and from skin of palm and forearm (40.7% and 37.3%). Least frequency of occurrence was observed in vestibule of nose (26%). The predominant isolated strains were: M. luteus (26.2%), and N. halobia (21%) followed by K. varians (16.4%), M. lylae (12.2%), D. sedentarius (9.1%), K. kristinae (7.3%), K. nishinomiyaensis (7.3%), K. rosea (0.3%).

  5. Effect of radiolytic products on bacteria in a food system. [Escherichia coli; Pediococcus cerevisiae; Moraxella-Acinetobacter; Micrococcus sp

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Dickson, J.S.; Maxcy, R.B.

    Inhibitory effects of radiolytic products were studied using Escherichia coli, Pediococcus cerevisiae, and two radiation-resistant microorganisms, an isolate of Moraxella-Acinetobacter and a Micrococcus sp. End Products of an irradiation dose of 300 Krads completely inhibited resistant organisms on an experimental medium with a very low concentration of nutrients. Plate count agar, with higher nutrient concentration, required 600 Krads to produce the same inhibition. On the same medium, radiation-sensitive organisms could tolerate products generated by a 1000 Krad dose. However, no inhibition could be detected when either Escherichia coli or Moraxella-Acinetobacter was incubated at 5/sup 0/C on the surface of freshmore » meat irradiated to 1500 Krad. The effects of inhibitory products in culture media could be mitigated by the addition of catalase or sodium pyruvate. 19 references, 2 figures, 4 tables.« less

  6. Patterns of cell division, DNA base compositions, and fine structures of some radiation-resistant vegetative bacteria found in food

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sanders, S.W.; Maxcy, R.B.

    1979-01-01

    Representative highly radiation-resistant Moraxella-Acinetobacter (M-A), Pseudomonas radiora, Micrococcus radiodurans, and Micrococcus radiophilus exhibited a wide variety of division systems and cell wall characteristics. However, the more resistant M-A possessed unusually thick cell walls, indicating a possible role of the cell wall in radiation resistance in the M-A. Thick septation was present in most of the bacteria studied, but was absent in P. radiora, thus excluding this as a necessity for high resistance. Reliable determination of the number of division planes of the M-A for use as a taxonomic criterion was achieved by the direct observation of dividing cells. The highlymore » resistant M-A were found to divide in multiple planes and had base compositions of 54.0 to 57.5%, unlike typical Moraxella and/or Acinetobacter species. The taxonomic position of most highly resistant bacteria remains unclear.« less

  7. Characterization of the Membrane-Bound Succinic Dehydrogenase of Micrococcus lysodeikticus

    PubMed Central

    Pollock, Jerry J.; Linder, Regina; Salton, Milton R. J.

    1971-01-01

    The occurrence of succinic dehydrogenase [succinic:(acceptor) oxidoreductase, EC 1.3.99.1] in membrane fractions of Micrococcus lysodeikticus was investigated. The enzyme could be purified 10-fold, by deoxycholate treatment. Butanol extraction of membranes yielded an active fraction, nonsedimentable at 130,000 × g for 2 hr and altered in its phospholipid content relative to membranes. The activity of the enzyme in particulate preparations was decreased in the presence of competitive inhibitors and by compounds known to react with iron, sulfhydryl groups, and flavine. In this respect, the bacterial succinic dehydrogenase is similar to the enzyme derived from yeast and mammalian sources. In certain membrane fractions, Ca2+ and Mg2+ exhibited inhibitory effects whereas Triton X-100 caused activation. The enzyme could also be activated by substrate. In the phenazine reductase assay, incomplete reduction of electron acceptor was observed upon addition of divalent cations and iron binding agents. Images PMID:4327510

  8. Use of Antibody to Membrane Adenosine Triphosphatase in the Study of Bacterial Relationships1

    PubMed Central

    Whiteside, Theresa L.; De Siervo, August J.; Salton, Milton R. J.

    1971-01-01

    An antiserum to Ca2+-activated adenosine triphosphatase from membranes of Micrococcus lysodeikticus cross-reacted in agar gels with membrane adenosine triphosphatases from other pigmented micrococci and related species. Species of Micrococcus and Sarcina showed different levels of inhibition of adenosine triphosphatase activities in heterologous reactions with antiserum. Inter- and intraspecific relationships based on the inhibition reaction were compared with an independent parameter, namely the quantitative and qualitative composition of the bacterial membrane phospholipids and fatty acids. The guanine plus cytosine contents in the deoxyribonucleic acid of the species studied correlated well with the serological cross-reactivity of adenosine triphosphatases from their membranes. The types of cross-bridges found in the peptidoglycans of these cocci were also compared with the other properties. The results suggest that an antiserum specific for a major membrane protein may be a reliable and most useful adjunct in studying bacterial serotaxonomy. Images PMID:4323299

  9. Characterization of the membrane-bound succinic dehydrogenase of Micrococcus lysodeikticus.

    PubMed

    Pollock, J J; Linder, R; Salton, M R

    1971-07-01

    The occurrence of succinic dehydrogenase [succinic:(acceptor) oxidoreductase, EC 1.3.99.1] in membrane fractions of Micrococcus lysodeikticus was investigated. The enzyme could be purified 10-fold, by deoxycholate treatment. Butanol extraction of membranes yielded an active fraction, nonsedimentable at 130,000 x g for 2 hr and altered in its phospholipid content relative to membranes. The activity of the enzyme in particulate preparations was decreased in the presence of competitive inhibitors and by compounds known to react with iron, sulfhydryl groups, and flavine. In this respect, the bacterial succinic dehydrogenase is similar to the enzyme derived from yeast and mammalian sources. In certain membrane fractions, Ca(2+) and Mg(2+) exhibited inhibitory effects whereas Triton X-100 caused activation. The enzyme could also be activated by substrate. In the phenazine reductase assay, incomplete reduction of electron acceptor was observed upon addition of divalent cations and iron binding agents.

  10. Use of antibody to membrane adenosine triphosphatase in the study of bacterial relatioships.

    PubMed

    Whiteside, T L; De Siervo, A J; Salton, M R

    1971-03-01

    An antiserum to Ca(2+)-activated adenosine triphosphatase from membranes of Micrococcus lysodeikticus cross-reacted in agar gels with membrane adenosine triphosphatases from other pigmented micrococci and related species. Species of Micrococcus and Sarcina showed different levels of inhibition of adenosine triphosphatase activities in heterologous reactions with antiserum. Inter- and intraspecific relationships based on the inhibition reaction were compared with an independent parameter, namely the quantitative and qualitative composition of the bacterial membrane phospholipids and fatty acids. The guanine plus cytosine contents in the deoxyribonucleic acid of the species studied correlated well with the serological cross-reactivity of adenosine triphosphatases from their membranes. The types of cross-bridges found in the peptidoglycans of these cocci were also compared with the other properties. The results suggest that an antiserum specific for a major membrane protein may be a reliable and most useful adjunct in studying bacterial serotaxonomy.

  11. Immunological properties of Micrococcus lysodeikticus membranes.

    PubMed

    Fukui, Y; Nachbar, M S; Salton, M R

    1971-01-01

    Membranes of Micrococcus lysodeikticus possess antigens which are distinct from other cellular components such as cytoplasm, ribosomes, and cell walls. Only a few (two to three) components are found when dissociated membranes are examined by immunodiffusion and immunoelectrophoresis techniques. Membranes treated with 0.3% sodium dodecyl sulfate, 0.3% Triton X-100, trypsin, phospholipase A or C, or by sonic oscillation at pH 9.0, all showed the same pattern (three major bands) when examined against membrane antisera by immunoelectrophoresis. Immunological analysis of fractions isolated by sucrose gradient centrifugation or by polyacrylamide gel electrophoresis suggests that individual components cross-react. Antibodies to adenosine triphosphatase (EC 3.6.1.3) and fast-moving component are not removed by absorption with protoplasts. Removal of antibody to one of the membrane antigens by protoplast absorption indicated a surface location. Glutaraldehyde fixation of protoplasts resulted in the loss of membrane antigens detectable by immunodiffusion.

  12. Surface interactions and fouling properties of Micrococcus luteus with microfiltration membranes.

    PubMed

    Feng, Lei; Li, Xiufen; Song, Ping; Du, Guocheng; Chen, Jian

    2011-11-01

    This study was conducted to investigate microbial adhesion of Micrococcus luteus to polypropylene (PP) and polyvinylidene fluoride (PVDF) membranes in relation to the variation of the interfacial energies in the membrane-bacteria systems, for revealing effects of short-range surface interactions on filtration behavior. Both the membranes and M. luteus showed typical strong electron donors and hydrophilic properties. The AB component was dominant in the interfacial energies of the two membrane-bacteria systems. M. luteus presented larger negative U(mlb)(XDLVO) to the PP membrane than to the PVDF membrane. The adhesion experiments also proved that M. luteus had higher adhesion percentage to the PP membrane. This study demonstrated that the adhesion potentials of M. luteus to the PP and PVDF membranes might be explained in terms of bacterium, membrane, and intervening medium surface properties, which are mainly determined by the interfacial energies in the systems according to the XDLVO theory.

  13. The utilization of aconate and itaconate by Micrococcus sp

    PubMed Central

    Cooper, R. A.; Itiaba, K.; Kornberg, H. L.

    1965-01-01

    1. An organism, identified as Micrococcus sp., was isolated by elective culture on aconate; it also grew on itaconate. 2. Washed suspensions of the aconate-grown organism readily oxidized intermediates of the tricarboxylic acid cycle, aconate and succinic semialdehyde, but not itaconate. Itaconate-grown cells oxidized tricarboxylic acid-cycle intermediates, succinic semialdehyde and itaconate, but not aconate. Succinate-grown cells oxidized neither itaconate nor aconate. 3. Extracts of aconate-grown cells catalysed the formation of succinic semialdehyde and carbon dioxide, in equimolar amounts, from aconate. In the presence of NAD or NADP, succinic semialdehyde was oxidized to succinate with concomitant reduction of the coenzyme. 4. Extracts of itaconate-grown cells catalysed the formation of pyruvate and acetyl-CoA from itaconyl-CoA. 5. Key enzymes involved in the formation of succinate from aconate, and of pyruvate and acetyl-CoA from itaconate, were distinct and inducible: their formation preceded growth on the appropriate substrate. PMID:14342240

  14. Surface Plasmon Resonance based sensing of lysozyme in serum on Micrococcus lysodeikticus-modified graphene oxide surfaces.

    PubMed

    Vasilescu, Alina; Gáspár, Szilveszter; Gheorghiu, Mihaela; David, Sorin; Dinca, Valentina; Peteu, Serban; Wang, Qian; Li, Musen; Boukherroub, Rabah; Szunerits, Sabine

    2017-03-15

    Lysozyme is an enzyme found in biological fluids, which is upregulated in leukemia, renal diseases as well as in a number of inflammatory gastrointestinal diseases. We present here the development of a novel lysozyme sensing concept based on the use of Micrococcus lysodeikticus whole cells adsorbed on graphene oxide (GO)-coated Surface Plasmon Resonance (SPR) interfaces. M. lysodeikticus is a typical enzymatic substrate for lysozyme. Unlike previously reported sensors which are based on the detection of lysozyme through bioaffinity interactions, the bioactivity of lysozyme will be used here for sensing purposes. Upon exposure to lysozyme containing serum, the integrity of the bacterial cell wall is affected and the cells detach from the GO based interfaces, causing a characteristic decrease in the SPR signal. This allows sensing the presence of clinically relevant concentrations of lysozyme in undiluted serum samples. Copyright © 2016 Elsevier B.V. All rights reserved.

  15. Multiplicity of genome equivalents in the radiation-resistant bacterium Micrococcus radiodurans.

    PubMed Central

    Hansen, M T

    1978-01-01

    The complexity of the genome of Micrococcus radiodurans was determined to be (2.0 +/- 0.3) X 10(9) daltons by DNA renaturation kinetics. The number of genome equivalents of DNA per cell was calculated from the complexity and the content of DNA. A lower limit of four genome equivalents per cell was approached with decreasing growth rate. Thus, no haploid stage appeared to be realized in this organism. The replication time was estimated from the kinetics and amount of residual DNA synthesis after inhibiting initiation of new rounds of replication. From this, the redundancy of terminal genetic markers was calculated to vary with growth rate from four to approximately eight copies per cell. All genetic material, including the least abundant, is thus multiply represented in each cell. The potential significance of the maintenance in each cell of multiple gene copies is discussed in relation to the extreme radiation resistance of M. radiodurans. PMID:649572

  16. Functional gene-based discovery of phenazines from the actinobacteria associated with marine sponges in the South China Sea.

    PubMed

    Karuppiah, Valliappan; Li, Yingxin; Sun, Wei; Feng, Guofang; Li, Zhiyong

    2015-07-01

    Phenazines represent a large group of nitrogen-containing heterocyclic compounds produced by the diverse group of bacteria including actinobacteria. In this study, a total of 197 actinobacterial strains were isolated from seven different marine sponge species in the South China Sea using five different culture media. Eighty-seven morphologically different actinobacterial strains were selected and grouped into 13 genera, including Actinoalloteichus, Kocuria, Micrococcus, Micromonospora, Mycobacterium, Nocardiopsis, Prauserella, Rhodococcus, Saccharopolyspora, Salinispora, Serinicoccus, and Streptomyces by the phylogenetic analysis of 16S rRNA gene. Based on the screening of phzE genes, ten strains, including five Streptomyces, two Nocardiopsis, one Salinispora, one Micrococcus, and one Serinicoccus were found to be potential for phenazine production. The level of phzE gene expression was highly expressed in Nocardiopsis sp. 13-33-15, 13-12-13, and Serinicoccus sp. 13-12-4 on the fifth day of fermentation. Finally, 1,6-dihydroxy phenazine (1) from Nocardiopsis sp. 13-33-15 and 13-12-13, and 1,6-dimethoxy phenazine (2) from Nocardiopsis sp. 13-33-15 were isolated and identified successfully based on ESI-MS and NMR analysis. The compounds 1 and 2 showed antibacterial activity against Bacillus mycoides SJ14, Staphylococcus aureus SJ51, Escherichia coli SJ42, and Micrococcus luteus SJ47. This study suggests that the integrated approach of gene screening and chemical analysis is an effective strategy to find the target compounds and lays the basis for the production of phenazine from the sponge-associated actinobacteria.

  17. BACTERIAL INHIBITORS IN LAKE WATER

    EPA Science Inventory

    The populations of six bacterial genera fell rapidly after their addition to sterile lake water but not after their addition to buffer. The decline in numbers of two species that were studied further, Klebsiella pneumoniae and Micrococcus flavus, occurred even when the buffer was...

  18. Production, purification, and characterization of micrococcin GO5, a bacteriocin produced by Micrococcus sp. GO5 isolated from kimchi.

    PubMed

    Kim, Mi-Hee; Kong, Yoon-Jung; Baek, Hong; Hyun, Hyung-Hwan

    2005-01-01

    Strain GO5, a bacteriocin-producing bacterium, was isolated from green onion kimchi and identified as Micrococcus sp. The bacteriocin, micrococcin GO5, displayed a broad spectrum of inhibitory activity against a variety of pathogenic and nonpathogenic microorganisms, as tested by the spot-on-lawn method; its activity spectrum was almost identical to that of nisin. Micrococcin GO5 was inactivated by trypsin (whereas nisin was not) and was completely stable at 100 degrees C for 30 min and in the pH range of 2.0 to 7.0. Micrococcin GO5 exhibited a typical mode of bactericidal activity against Micrococcus flavus ATCC 10240. It was purified to homogeneity through ammonium sulfate precipitation, ultrafiltration, and CM-Sepharose column chromatography. The molecular mass of micrococcin GO5 was estimated to be about 5.0 kDa by tricine-sodium dodecyl sulfate-polyacrylamide gel electrophoresis and in situ activity assay with the indicator organism. The amino acid sequence of micrococcin GO5 lacks lanthionine and beta-methyllanthionine and is rich in hydrophobic amino acids and glycine, providing the basis for the high heat stability of this bacteriocin. The N-terminal amino acid sequence of micrococcin GO5 is Lys-Lys-Ser-Phe-Cys-Gln-Lys, and no homology to bacteriocins reported previously was observed in the amino acid composition or N-terminal amino acid sequence. Based on the physicochemical properties, small molecular size, and inhibition of Listeria monocytogenes, micrococcin GO5 has been placed with the class II bacteriocins, but its broad spectrum of activity differs from that of other bacteriocins in this class.

  19. Highly efficient decolorization of Malachite Green by a novel Micrococcus sp. strain BD15.

    PubMed

    Du, Lin-Na; Zhao, Ming; Li, Gang; Zhao, Xiao-Ping; Zhao, Yu-Hua

    2011-08-01

    Malachite Green (MG) is used for a variety of applications but is also known to be carcinogenic and mutagenic. In this study, a novel Micrococcus sp. (strain BD15) was observed to efficiently decolorize MG. The purposes of this study were to explore the optimal conditions for decolorization and to evaluate the potential use of this strain for MG decolorization. Optical microscope and UV-visible analyses were carried out to determine whether the decolorization was due to biosorption or biodegradation. A Plackett-Burman design was employed to investigate the effect of various parameters on decolorization, and response surface methodology was then used to explore the optimal decolorization conditions. Kinetics analysis and antimicrobial activity tests were also performed. The results indicated that the decolorization by the strain was mainly due to biodegradation. Concentrations of MG, urea, and yeast extract and inoculum size had significantly positive effects on MG decolorization, while concentrations of CuCl(2) and MgCl(2), and temperature had significantly negative effects. The interaction between different parameters could significantly affect decolorization, and the optimal conditions for decolorization were 1.0 g/L urea, 0.9 g/L yeast extract, 100 mg/L MG, 0.1 g/L inoculums (dry weight), and incubation at 25.2°C. Under the optimal conditions, 96.9% of MG was removed by the strain within 1 h, which represents highly efficient microbial decolorization. Moreover, the kinetic data for decolorization fit a second-order model well, and the strain showed a good MG detoxification capability. Based on the results of this study, we propose Micrococcus sp. strain BD15 as an excellent candidate strain for MG removal from wastewater.

  20. EFFECT OF IMPACT STRESS ON MICROBIAL RECOVERY ON AN AGAR SURFACE

    EPA Science Inventory

    Microbial stress due to the impaction of microorganisms onto an agar collection surface was studied experimentally. he relative recovery rates of aerosolized Pseudomonas fluorescens and Micrococcus luteus were determined as a function of the impaction velocity by using a moving a...

  1. Effect of Nisin's Controlled Release on Microbial Growth as Modeled for Micrococcus luteus.

    PubMed

    Balasubramanian, Aishwarya; Lee, Dong Sun; Chikindas, Michael L; Yam, Kit L

    2011-06-01

    The need for safe food products has motivated food scientists and industry to find novel technologies for antimicrobial delivery for improving food safety and quality. Controlled release packaging is a novel technology that uses the package to deliver antimicrobials in a controlled manner and sustain antimicrobial stress on the targeted microorganism over the required shelf life. This work studied the effect of controlled release of nisin to inhibit growth of Micrococcus luteus (a model microorganism) using a computerized syringe pump system to mimic the release of nisin from packaging films which was characterized by an initially fast rate and a slower rate as time progressed. The results show that controlled release of nisin was strikingly more effective than instantly added ("formulated") nisin. While instant addition experiments achieved microbial inhibition only at the beginning, controlled release experiments achieved complete microbial inhibition for a longer time, even when as little as 15% of the amount of nisin was used as compared to instant addition.

  2. Screening of the constituents, antimicrobial and antioxidant activity of endemic Origanum hypericifolium O. Schwartz & P.H. Davis.

    PubMed

    Celik, Ali; Nur Herken, E; Arslan, Idris; Zafer Ozel, M; Mercan, Nazime

    2010-10-01

    The chemical compositions, total phenol content, antioxidant and antimicrobial activities with oxidant status of the essential oil from an endemic Turkish species, Origanum hypericifolium, were investigated. Steam distillation (SD) was used to isolate the essential oils, and the chemical analyses were performed by gas chromatography-mass spectrometry (GC-MS). The antimicrobial activity was tested by agar disc diffusion method against Morganella morganii (clinic isolate), Micrococcus flavus (clinic isolate), Micrococcus luteus NRLL B-4375, Proteus vulgaris RSKK 96026, Escherichia coli ATCC 11230, Escherichia coli ATCC 25922, Yersinia enterecolitica RSKK 1501, Staphylococcus aureus ATCC 25923, S. aureus ATCC 25933, S. aureus ATCC 12598, S. aureus (clinic isolate), MRSA 1 (clinic isolate), MRSA 2 (clinic isolate), MRSA 3 (clinic isolate) and MRSA 4 (clinic isolate). The major compounds found in volatiles of O. hypericifolium were p-cymene, carvacrol and γ-terpinene. Results showed that O. hypericifolium has the potential for being used in food and medicine because of its antioxidant and antibacterial activity.

  3. Presence of a new cytochrome b - like pigment with a peak at 567 nm in various aerobic bacteria.

    PubMed

    Jacobs, N J; O'Hara, J; Gray, C T

    1983-09-01

    Several physiological groups of bacteria were examined for the presence of a cytochrome b - like pigment which is demonstrable in dithionite-reduced minus substrate-reduced difference spectra. This pigment is characterized by an unusually high alpha band at 567 nm, a low concentration relative to conventional cytochromes, and an inability to be fully reduced by endogenous substrates or NADH. Previous studies with one denitrifying and nondenitrifying species of the genus Pseudomonas, in Paracoccus denitrificans, in Alcaligenes faecalis, in Azotobacter vinelandii, in Branhamella catarrhalis, and in Neisseria lactamicus. In all these organisms, the peak of the 567-nm pigment is accompanied by a peak of about equal height at approximately 559 nm, which exhibits similar properties to the 567-nm pigment. The 567-nm pigment was not demonstrable by this technique in Gluconobacter oxydans subspecies suboxydans, Bacillus subtilis, Bacillus licheniformis, Aeromonas hydrophilia, Escherichia coli, a Klebsiella species, Moraxella osloensis, Aquaspirillum itersonii, Micrococcus lysodeikticus, Micrococcus luteus, Agrobacterium tumefaciens, or Rhizobium meliloti.

  4. Regioselective synthesis of 3-benzyl substituted pyrimidino chromen-2-ones and evaluation of anti-microbial and anti-biofilm activities.

    PubMed

    Emmadi, Narender Reddy; Atmakur, Krishnaiah; Bingi, Chiranjeevi; Godumagadda, Narender Reddy; Chityal, Ganesh Kumar; Nanubolu, Jagadeesh Babu

    2014-01-15

    Regioselective synthesis of a number of highly functionalized 3-benzylpyrimidino chromen-2-ones (4) were accomplished in a one pot three component reaction in acetic acid and determined their anti-microbial and anti-biofilm activities. Compounds 4o and 4p showed an excellent anti-microbial activity against Micrococcus luteus MTCC 2470 at a par with standard control (Ciprofloxacin) and exhibited best activity against Staphylococcus aureus MTCC 96 and Bacillus subtilis MTCC 121. Further, compounds 4h, 4i, 4m, 4n and 4q showed promising activity against Micrococcus luteus MTCC 2470, Staphylococcus aureus MTCC 96 and Bacillus subtilis MTCC 121. Whereas, compounds 4m showed very promising biofilm inhibition activity against Staphylococcus aureus MLS 16 MTCC 2940 and 4o, 4p showed very potent activity against Staphylococcus aureus MTCC 96 at a par with Ciprofloxacin used as standard control. Copyright © 2013 Elsevier Ltd. All rights reserved.

  5. Exposure level and distribution characteristics of airborne bacteria and fungi in Seoul metropolitan subway stations.

    PubMed

    Kim, Ki Youn; Kim, Yoon Shin; Kim, Daekeun; Kim, Hyeon Tae

    2011-01-01

    The exposure level and distribution characteristics of airborne bacteria and fungi were assessed in the workers' activity areas (station office, bedroom, ticket office and driver's seat) and passengers' activity areas (station precinct, inside the passenger carriage, and platform) of the Seoul metropolitan subway. Among investigated areas, the levels of airborne bacteria and fungi in the workers' bedroom and station precincts were relatively high. No significant difference was found in the concentration of airborne bacteria and fungi between the underground and above ground activity areas of the subway. The genera identified in all subway activity areas with a 5% or greater detection rate were Staphylococcus, Micrococcus, Bacillus and Corynebacterium for airborne bacteria and Penicillium, Cladosporium, Chrysosporium, Aspergillus for airborne fungi. Staphylococcus and Micrococcus comprised over 50% of the total airborne bacteria and Penicillium and Cladosporium comprised over 60% of the total airborne fungi, thus these four genera are the predominant genera in the subway station.

  6. Effect of simulated microgravity on growth and production of exopolymeric substances of Micrococcus luteus space and earth isolates.

    PubMed

    Mauclaire, Laurie; Egli, Marcel

    2010-08-01

    Microorganisms tend to form biofilms on surfaces, thereby causing deterioration of the underlaying material. In addition, biofilm is a potential health risk to humans. Therefore, microorganism growth is not only an issue on Earth but also in manned space habitats like the International Space Station (ISS). The aim of the study was to identify physiological processes relevant for Micrococcus luteus attachment under microgravity conditions. The results demonstrate that simulated microgravity influences physiological processes which trigger bacterial attachment and biofilm formation. The ISS strains produced larger amounts of exopolymeric substances (EPS) compared with a reference strain from Earth. In contrast, M. luteus strains were growing faster, and Earth as well as ISS isolates produced a higher yield of biomass under microgravity conditions than under normal gravity. Furthermore, microgravity caused a reduction of the colloidal EPS production of ISS isolates in comparison with normal gravity, which probably influences biofilm thickness and stability as well.

  7. Sponge-Derived Kocuria and Micrococcus spp. as Sources of the New Thiazolyl Peptide Antibiotic Kocurin

    PubMed Central

    Palomo, Sara; González, Ignacio; de la Cruz, Mercedes; Martín, Jesús; Tormo, José Rubén; Anderson, Matthew; Hill, Russell T.; Vicente, Francisca; Reyes, Fernando; Genilloud, Olga

    2013-01-01

    Forty four marine actinomycetes of the family Microccocaceae isolated from sponges collected primarily in Florida Keys (USA) were selected from our strain collection to be studied as new sources for the production of bioactive natural products. A 16S rRNA gene based phylogenetic analysis showed that the strains are members of the genera Kocuria and Micrococcus. To assess their biosynthetic potential, the strains were PCR screened for the presence of secondary metabolite genes encoding nonribosomal synthetase (NRPS) and polyketide synthases (PKS). A small extract collection of 528 crude extracts generated from nutritional microfermentation arrays was tested for the production of bioactive secondary metabolites against clinically relevant strains (Bacillus subtilis, methicillin-resistant Staphylococcus aureus (MRSA), Acinetobacter baumannii and Candida albicans). Three independent isolates were shown to produce a new anti-MRSA bioactive compound that was identified as kocurin, a new member of the thiazolyl peptide family of antibiotics emphasizing the role of this family as a prolific resource for novel drugs. PMID:23538871

  8. Biosorption of lead and copper by heavy-metal tolerant Micrococcus luteus DE2008.

    PubMed

    Puyen, Zully M; Villagrasa, Eduard; Maldonado, Juan; Diestra, Elia; Esteve, Isabel; Solé, Antoni

    2012-12-01

    Micrococcus luteus DE2008 has the ability to absorb lead and copper. The effect of these metals on biomass and viability of this microorganism were investigated and removal of the metals from culture media was determined. Lead had no effect on the biomass expressed as mg Carbon/cm(3) of M. Iuteus DE2008, but in the case of copper, the minimum metal concentration that affected the biomass was 0.1 mM Cu(II). According to these results this microorganism shows a greater tolerance for lead. The minimum metal concentration that affected viability (expressed as the percentage of live cells) was 0.5 mM for both metals. M. luteus DE2008 exhibited a specific removal capacity of 408 mg/g for copper and 1965 mg/g for lead. This microorganism has a greater ability to absorb Pb(II) than Cu(II). M. luteus DE2008 could be seen as a microorganism capable of restoring environments polluted by lead and copper. Copyright © 2012 Elsevier Ltd. All rights reserved.

  9. Ecofriendly degradation of sulfonated diazo dye C.I. Reactive Green 19A using Micrococcus glutamicus NCIM-2168.

    PubMed

    Saratale, R G; Saratale, G D; Chang, J S; Govindwar, S P

    2009-09-01

    Micrococcus glutamicus NCIM-2168 exhibited complete decolorization and degradation of C.I. Reactive Green 19A (an initial concentration of 50 mg l(-1)) within 42 h at temperature 37 degrees C and pH 8, under static condition. Extent of mineralization was determined with total organic carbon (TOC) and chemical oxygen demand (COD) measurement, showing a satisfactory reduction of TOC (72%) and COD (66%) within 42 h. Enzyme studies shows involvement of oxidoreductive enzymes in decolorization/degradation process. Analytical studies of the extracted metabolites confirmed the significant degradation of Reactive Green 19A into various metabolites. The microbial toxicity and phytotoxicity assay revealed that the degradation of Reactive Green 19A produced nontoxic metabolites. In addition, the M. glutamicus strain was applied to decolorize a mixture of ten reactive dyes showing a 63% decolorization (in terms of decrease in ADMI value) within 72 h, along with 48% and 42% reduction in TOC and COD under static condition.

  10. Isolation, characterization and chromatography based purification of antibacterial compound isolated from rare endophytic actinomycetes Micrococcus yunnanensis.

    PubMed

    Ranjan, Ravi; Jadeja, Vasantba

    2017-10-01

    Endophytic actinomycetes are considered as one of the relatively unexplored potential sources in search of antibiotic producer against antibiotic resistant pathogens. A potent strain isolated from Catharanthus roseus that displays antibacterial potential against antibiotic resistant human pathogen Staphylococcus aureus was characterized and designated as Micrococcus yunnanensis strain rsk5. Rsk5 is capable of producing optimum antibacterial metabolites on starch casein medium at 30 °C, pH 5 and 2% NaCl condition. The crude antibacterial agent was extracted from fermentation broth by ethyl acetate and separated by TLC using chloroform-methanol (24:1, v/v) solvent system with R f value of 0.26. It was partially purified by flash chromatography, followed by HPLC and analyzed by ultraviolet visible spectrophotometer to get absorption maxima at 208.4 nm. The ESI-MS spectra showed molecular ion peaks at m / z 472.4 [M-H], which does not match with any known antibacterial compound.

  11. Primary structure of inorganic polyphosphate/ATP-NAD kinase from Micrococcus flavus, and occurrence of substrate inorganic polyphosphate for the enzyme.

    PubMed

    Kawai, Shigeyuki; Mori, Shigetarou; Murata, Kousaku

    2003-08-01

    The gene encoding an inorganic polyphosphate/ATP-NAD kinase was cloned from Micrococcus flavus, and its primary structure was analyzed. Alignment of the primary structure with those of other characterized NAD kinases revealed candidate amino acid residues, mainly charged ones, that would be related to inorganic polyphosphate use. The alignment also showed that the primary structure found carried a protruding C-terminal polypeptide. Although the C-terminal polypeptide was demonstrated to be dispensable for the kinase activities, and was proposed to be removed in M. flavus, the entire primary structure including the C-terminal polypeptide was homologous with that of the ATP synthase beta chain. The inorganic polyphosphate used by the inorganic polyphosphate/ATP-NAD kinase as a phosphoryl donor was isolated from cells of M. flavus, suggesting that the ability of the enzyme to use inorganic polyphosphate is of physiological significance and is not an evolutionary trait alone.

  12. Expression levels of chaperones influence biotransformation activity of recombinant Escherichia coli expressing Micrococcus luteus alcohol dehydrogenase and Pseudomonas putida Baeyer-Villiger monooxygenase.

    PubMed

    Baek, A-Hyong; Jeon, Eun-Yeong; Lee, Sun-Mee; Park, Jin-Byung

    2015-05-01

    We demonstrated for the first time that the archaeal chaperones (i.e., γ-prefoldin and thermosome) can stabilize enzyme activity in vivo. Ricinoleic acid biotransformation activity of recombinant Escherichia coli expressing Micrococcus luteus alcohol dehydrogenase and the Pseudomonas putida KT2440 Baeyer-Villiger monooxygenase improved significantly with co-expression of γ-prefoldin or recombinant themosome originating from the deep-sea hyperthermophile archaea Methanocaldococcus jannaschii. Furthermore, the degree of enhanced activity was dependent on the expression levels of the chaperones. For example, whole-cell biotransformation activity was highest at 12 µmol/g dry cells/min when γ-prefoldin expression level was approximately 46% of the theoretical maximum. This value was approximately two-fold greater than that in E. coli, where the γ-prefoldin expression level was zero or set to the theoretical maximum. Therefore, it was assumed that the expression levels of chaperones must be optimized to achieve maximum biotransformation activity in whole-cell biocatalysts. © 2014 Wiley Periodicals, Inc.

  13. A novel approach to enhance biological nutrient removal using a culture supernatant from Micrococcus luteus containing resuscitation-promoting factor (Rpf) in SBR process.

    PubMed

    Liu, Yindong; Su, Xiaomei; Lu, Lian; Ding, Linxian; Shen, Chaofeng

    2016-03-01

    A culture supernatant from Micrococcus luteus containing resuscitation-promoting factor (SRpf) was used to enhance the biological nutrient removal of potentially functional bacteria. The obtained results suggest that SRpf accelerated the start-up process and significantly enhanced the biological nutrient removal in sequencing batch reactor (SBR). PO4 (3-)-P removal efficiency increased by over 12 % and total nitrogen removal efficiency increased by over 8 % in treatment reactor acclimated by SRpf compared with those without SRpf addition. The Illumina high-throughput sequencing analysis showed that SRpf played an essential role in shifts in the composition and diversity of bacterial community. The phyla of Proteobacteria and Actinobacteria, which were closely related to biological nutrient removal, were greatly abundant after SRpf addition. This study demonstrates that SRpf acclimation or addition might hold great potential as an efficient and cost-effective alternative for wastewater treatment plants (WWTPs) to meet more stringent operation conditions and legislations.

  14. Sponge-derived Kocuria and Micrococcus spp. as sources of the new thiazolyl peptide antibiotic kocurin.

    PubMed

    Palomo, Sara; González, Ignacio; de la Cruz, Mercedes; Martín, Jesús; Tormo, José Rubén; Anderson, Matthew; Hill, Russell T; Vicente, Francisca; Reyes, Fernando; Genilloud, Olga

    2013-03-28

    Forty four marine actinomycetes of the family Microccocaceae isolated from sponges collected primarily in Florida Keys (USA) were selected from our strain collection to be studied as new sources for the production of bioactive natural products. A 16S rRNA gene based phylogenetic analysis showed that the strains are members of the genera Kocuria and Micrococcus. To assess their biosynthetic potential, the strains were PCR screened for the presence of secondary metabolite genes encoding nonribosomal synthetase (NRPS) and polyketide synthases (PKS). A small extract collection of 528 crude extracts generated from nutritional microfermentation arrays was tested for the production of bioactive secondary metabolites against clinically relevant strains (Bacillus subtilis, methicillin-resistant Staphylococcus aureus (MRSA), Acinetobacter baumannii and Candida albicans). Three independent isolates were shown to produce a new anti-MRSA bioactive compound that was identified as kocurin, a new member of the thiazolyl peptide family of antibiotics emphasizing the role of this family as a prolific resource for novel drugs.

  15. Comprehensive update of dalbavancin activity when tested against uncommonly isolated streptococci, Corynebacterium spp., Listeria monocytogenes, and Micrococcus spp. (1357 strains).

    PubMed

    Jones, Ronald N; Stilwell, Matthew G

    2013-06-01

    Dalbavancin is an investigational lipoglycopeptide having an extended serum elimination half-life allowing once-weekly dosing. Data from testing 1357 strains of uncommonly isolated species expand the dalbavancin spectrum details as follows (MIC50/90): β-haemolytic streptococcal serogroups C, F, and G (≤0.03/≤0.03 μg/mL), 7 viridans group of streptococci (≤0.03/≤0.03-0.06 μg/mL), 5 Corynebacterium spp. (0.06/0.12 μg/mL), Listeria monocytogenes (0.06/0.12 μg/mL), and Micrococcus spp. (≤0.03/≤0.03 μg/mL). Among all reported isolates, 99.8% of tested strains were inhibited at dalbavancin MIC values at ≤0.12 μg/mL. Dalbavancin remains very potent against rarer Gram-positive pathogens, using in vitro test experience with organisms cultured through 2011. Copyright © 2013 Elsevier Inc. All rights reserved.

  16. Characterization of a bioflocculant produced by a consortium of Halomonas sp. Okoh and Micrococcus sp. Leo.

    PubMed

    Okaiyeto, Kunle; Nwodo, Uchechukwu U; Mabinya, Leonard V; Okoh, Anthony I

    2013-10-16

    The physicochemical and flocculating properties of a bioflocculant produced by a bacterial consortium composed of Halomonas sp. Okoh and Micrococcus sp. Leo were investigated. The purified bioflocculant was cation and pH dependent, and optimally flocculated kaolin clay suspension at a dosage of 0.1 mg/mL. The flocculating activity of the bioflocculant was stimulated in the presence of Ca2+, Mn2+, Al3+ and had a wide pH range of 2-10, with the highest flocculating activity of 86% at pH 8. The bioflocculant was thermostable and retained more than 70% of its flocculating activity after being heated at 80 °C for 30 min. Thermogravimetric analyses revealed a partial thermal decomposition of the biofloculant at 400 °C. The infrared spectrum showed the presence of hydroxyl, carboxyl and amino moieties as functional groups. The bioflocculant produced by the bacterial consortium appears to hold promising alternative to inorganic and synthetic organic flocculants that are widely used in wastewater treatment.

  17. Characterization of a Bioflocculant Produced by a Consortium of Halomonas sp. Okoh and Micrococcus sp. Leo

    PubMed Central

    Okaiyeto, Kunle; Nwodo, Uchechukwu U.; Mabinya, Leonard V.; Okoh, Anthony I.

    2013-01-01

    The physicochemical and flocculating properties of a bioflocculant produced by a bacterial consortium composed of Halomonas sp. Okoh and Micrococcus sp. Leo were investigated. The purified bioflocculant was cation and pH dependent, and optimally flocculated kaolin clay suspension at a dosage of 0.1 mg/mL. The flocculating activity of the bioflocculant was stimulated in the presence of Ca2+, Mn2+, Al3+ and had a wide pH range of 2–10, with the highest flocculating activity of 86% at pH 8. The bioflocculant was thermostable and retained more than 70% of its flocculating activity after being heated at 80 °C for 30 min. Thermogravimetric analyses revealed a partial thermal decomposition of the biofloculant at 400 °C. The infrared spectrum showed the presence of hydroxyl, carboxyl and amino moieties as functional groups. The bioflocculant produced by the bacterial consortium appears to hold promising alternative to inorganic and synthetic organic flocculants that are widely used in wastewater treatment. PMID:24135818

  18. Biosynthetic elongation of isolated teichuronic acid polymers via glucosyl- and N-acetylmannosaminuronosyltransferases from solubilized cytoplasmic membrane fragments of Micrococcus luteus.

    PubMed Central

    Hildebrandt, K M; Anderson, J S

    1990-01-01

    Cytoplasmic membrane fragments of Micrococcus luteus catalyze in vitro biosynthesis of teichuronic acid from uridine diphosphate D-glucose (UDP-glucose), uridine diphosphate N-acetyl-D-mannosaminuronic acid (UDP-ManNAcA), and uridine diphosphate N-acetyl-D-glucosamine. Membrane fragments solubilized with Thesit (dodecyl alcohol polyoxyethylene ether) can utilize UDP-glucose and UDP-ManNAcA to effect elongation of teichuronic acid isolated from native cell walls. When UDP-glucose is the only substrate supplied, the detergent-solubilized glucosyltransferase incorporates a single glucosyl residue onto each teichuronic acid acceptor. When both UDP-glucose and UDP-ManNAcA are supplied, the glucosyltransferase and the N-acetylmannosaminuronosyltransferase act cooperatively to elongate the teichuronic acid acceptor by multiple additions of the disaccharide repeat unit. As shown by polyacrylamide gel electrophoresis, low-molecular-weight fractions of teichuronic acid are converted to higher-molecular-weight polymers by the addition of as many as 17 disaccharide repeat units. Images PMID:2118507

  19. Physicochemical properties and membrane biofouling of extra-cellular polysaccharide produced by a Micrococcus luteus strain.

    PubMed

    Feng, Lei; Li, Xiufen; Song, Ping; Du, Guocheng; Chen, Jian

    2014-07-01

    The physicochemical properties of the extra-cellular polysaccharide (EPS) produced by a Micrococcus luteus strain, a dominating strain isolated from membrane biofouling layer, were determined in this study. The EPS isolated from this strain was measured to have an average molecular weight of 63,540 Da and some typical polysaccharide absorption peaks in Fourier transform infrared spectrum. Monosaccharide components of the EPS contained rhamnose, fucose, arabinose, xylose, mannose, galactose and glucose in a molar ratio of 0.2074:0.0454:0.0262:0.0446:1.7942:1.2086:0.4578. Pseudo plastic properties were also observed for the EPS through the rheological measurement. The EPS was further characterized for its behavior to cause membrane flux decline. The results showed that both flux declines for polyvinylidenefluoride (PVDF) and polypropylene membranes became more severe as EPS feed concentration increased. A higher irreversible fouling for the PVDF membrane suggested that the EPS had the larger fouling potential to this microfiltration membrane.

  20. Antimicrobial activity of Bryum argenteum.

    PubMed

    Sabovljevic, Aneta; Sokovic, Marina; Sabovljevic, Marko; Grubisic, Dragoljub

    2006-02-01

    The antimicrobial activity of Bryum argenteum ethanol extracts was evaluated by microdilution method against four bacterial (Escherichia coli, Bacillus subtilis, Micrococcus luteus and Staphilococcus aureus) and four fungal species (Aspergillus niger, Penicillium ochrochloron, Candida albicans and Trichophyton mentagrophyes). All the investigated ethanol extracts have been proved to be active against all bacteria and fungi tested.

  1. Binding of Dissolved Strontium by Micrococcus luteus

    PubMed Central

    Faison, Brendlyn D.; Cancel, Carmen A.; Lewis, Susan N.; Adler, Howard I.

    1990-01-01

    Resting cells of Micrococcus luteus have been shown to remove strontium (Sr) from dilute aqueous solutions of SrCl2 at pH 7. Loadings of 25 mg of Sr per g of cell dry weight were achieved by cells exposed to a solution containing 50 ppm (mg/liter) of Sr. Sr binding occurred in the absence of nutrients and did not require metabolic activity. Initial binding was quite rapid (<0.5 h), although a slow, spontaneous release of Sr was observed over time. Sr binding was inhibited in the presence of polyvalent cations but not monovalent cations. Ca and Sr were bound preferentially over all other cations tested. Sr-binding activity was localized on the cell envelope and was sensitive to various chemical and physical pretreatments. Bound Sr was displaced by divalent ions or by H+. Other monovalent ions were less effective. Bound Sr was also removed by various chelating agents. It was concluded that Sr binding by M. luteus is a reversible equilibrium process. Both ion exchange mediated by acidic cell surface components and intracellular uptake may be involved in this activity. PMID:16348370

  2. Antibacterial properties of the skin mucus of the freshwater fishes, Rita rita and Channa punctatus.

    PubMed

    Kumari, U; Nigam, A K; Mitial, S; Mitial, A K

    2011-07-01

    The skin mucus of Rita rita and Channa punctatus was investigated to explore the possibilities of its antibacterial properties. Skin mucus was extracted in acidic solvents (0.1% trifluoroacetic acid and 3% acetic acid) and in triple distilled water (aqueous medium). The antibacterial activity of the mucus extracts was analyzed, using disc diffusion method, against five strains of bacteria--the Gram-positive Staphylococcus aureus and Micrococcus luteus; and the Gram negative Escherichia coli, Pseudomonas aeruginosa and Salmonella typhi. In both Rita rita and Channa punctatus, the skin mucus extracted in acidic solvents as well as in aqueous medium show antibacterial activity against Staphylococcus aureus and Micrococcus luteus. Nevertheless, the activity is higher in acidic solvents than that in aqueous medium. The acidic mucus extracts of Rita rita, show antibacterial activity against Salmonella typhi as well. The results suggest that fish skin mucus have bactericidal properties and thus play important role in the protection of fish against the invasion of pathogens. Fish skin mucus could thus be regarded as a potential source of novel antibacterial components.

  3. In vitro antibacterial activity of selected medicinal plants from lower Himalayas.

    PubMed

    Zulqarnain; Rahim, Abdur; Ahmad, Khalid; Ullah, Faizan; Ullah, Hamid; Nishan, Umar

    2015-03-01

    The present studies cover antibacterial activity of the crude methanolic extracts of 11 medicinal plants viz. Adhatoda vasica, Bauhenia variegate, Bombax ceiba, Carrisa opaca, Caryopteris grata, Debregeasia salicifolia, Lantana camara, Melia azedarach, Phyllanthus emblica, Pinus roxburghii and Olea ferruginea collected from lower Himalayas against two Gram positive (Staphylococcus aureus, Micrococcus luteus) and two Gram negative (Escherichia coli, Pseudomonas aureginosa) bacterial strains. The extracts were applied at four different concentrations (120 mg/mL, 90mg/mL, 60mg/mL and 30mg/mL) in dimethyl sulfoxide (DMSO) by using agar well diffusion method. Antibacterial activities against Staphylococcus aureus and Micrococcus luteus were observed formethanolic extracts of all the above mentioned plants. Greater antibacterial activity against Pseudomonas aeruginosa was only exhibited by Phyllanthus emblica, Pinus roxburghii, Debregeasia salicifolia and Lantana camara. Escherichia coli was highly resistant to all the plant extracts at all concentrations. It is inferred that methanolic crude extracts of the above mentioned plantsexhibitantibacterial activities against pathogenic bacteria, which proved the ethnobotanical importance of the selected plants that indigenous people use for cure against various diseases.

  4. Contribution of the microbial and meat endogenous enzymes to the free amino acid and amine contents of dry fermented sausages.

    PubMed

    Hierro, E; de La Hoz, L; Ordóñez, J A

    1999-03-01

    The role of the starter culture and meat endogenous enzymes on the free amino acid and amine contents of dry fermented sausages was studied. Five batches of sausages were prepared. The control batch was manufactured with aseptic ingredients without microbial inoculation. The other four experimental batches were manufactured with aseptic ingredients inoculated with Lactobacillus plantarum 4045 or Micrococcus-12 or L. plantarum 4045 and Micrococcus-12 or L. plantarum 4045 and Staphylococcus sp. Their effects on pH, a(w), myofibrillar proteins, and free amino acid and amine contents were studied. Sausages inoculated only with L. plantarum 4045 or with this starter combined with a Micrococcaceae had the lowest pH as a result of carbohydrate fermentation. In all batches similar patterns were observed for myofibrillar proteins and free amino acids which could indicate that meat endogenous proteases play an important role in proteolytic phenomena. No changes were observed in the amine fraction, indicating that the strains used as starter cultures did not show amino acid decarboxylase activity.

  5. Micrococcus luteus mediated dual mode synthesis of gold nanoparticles: involvement of extracellular α-amylase and cell wall teichuronic acid.

    PubMed

    Arunkumar, Pichaimani; Thanalakshmi, Muthukrishnan; Kumar, Priyadarsini; Premkumar, Kumpati

    2013-03-01

    In the present study we have utilized the bioreductive potential of Micrococcus luteus for the synthesis of gold nanoparticles. Biochemical and physiological analysis indicate that the biosynthesized GNPs were achieved by dual mode, involving extracellular α-amylase and cell wall teichuronic acid (TUA) of M. luteus. The biosynthetic potential of both α-amylase and TUA, after isolation from bacterium, was examined. Under optimum conditions, these biomolecules reduces Au(3+) into Au(0) and the resulting GNPs were found to be stable for 1 month. The synthesized GNPs were characterized by UV-VIS spectrometry, transmission electron microscopy (TEM), Fourier transform infrared spectroscopy (FTIR) and dynamic light scattering (DLS). Results demonstrated that the synthesized GNPs were found to be monodispersive and spherical in shape with an average size of ∼6 nm and ∼50 nm for α-amylase and teichuronic acid, respectively. These findings suggest that M. luteus can be exploited as a potential biosource for the eco-friendly synthesis of gold nanoparticles. Copyright © 2012 Elsevier B.V. All rights reserved.

  6. Isolation and characterization of a novel nitrobenzene-degrading bacterium with high salinity tolerance: Micrococcus luteus.

    PubMed

    Zheng, Chunli; Qu, Baocheng; Wang, Jing; Zhou, Jiti; Wang, Jing; Lu, Hong

    2009-06-15

    Strain Z3 was isolated from nitrobenzene-contaminated sludge. Strain Z3 was able to utilize nitrobenzene as a sole source of carbon, nitrogen and energy under aerobic condition. Based on the morphology, physiological biochemical characteristics, and 16S rDNA sequence, strain Z3 was identified as Micrococcus luteus. Strain Z3 completely degraded nitrobenzene with initial concentration of 100, 150, 200, and 250 mg L(-1) within 70, 96, 120 and 196 h, respectively. Kinetics of nitrobenzene degradation was described using the Andrews equation. The kinetic parameters were as follows: q(max)=1.19 h(-1), K(s)=29.11 mg L(-1), and K(i)=94.00 mg L(-1). Strain Z3 had a high salinity tolerance. It degraded 200 mg L(-1) nitrobenzene completely in 5% NaCl (w/w%). Strain Z3 therefore could be an excellent candidate for the bio-treatment of nitrobenzene industrial wastewaters with high salinity. This is the first report on the degradation of nitrobenzene by M. luteus and the degradation of nitrobenzene achieved in such a high salinity.

  7. The Structure of Resting Bacterial Populations in Soil and Subsoil Permafrost

    NASA Astrophysics Data System (ADS)

    Soina, Vera S.; Mulyukin, Andrei L.; Demkina, Elena V.; Vorobyova, Elena A.; El-Registan, Galina I.

    2004-09-01

    The structure of individual cells in microbial populations in situ of the Arctic and Antarctic permafrost was studied by scanning and transmission electron microscopy methods and compared with that of cyst-like resting forms generated under special conditions by the non-sporeforming bacteria Arthrobacter and Micrococcus isolated from the permafrost. Electron microscopy examination of microorganisms in situ revealed several types of bacterial cells having no signs of damage, including "dwarf" curved forms similar to nanoforms. Intact bacterial cells in situ and frozen cultures of the permafrost isolates differed from vegetative cells by thickened cell walls, the altered structure of cytoplasm, and the compact nucleoid, and were similar in these features to cyst-like resting forms of non-spore-forming "permafrost" bacterial strains of Arthrobacter and Micrococcus spp. Cyst-like cells, being resistant to adverse external factors, are regarded as being responsible for survival of the non-spore-formers under prolonged exposure to subzero temperatures and can be a target to search for living microorganisms in natural environments both on the Earth and on extraterrestrial bodies.

  8. Limazepines A-F, pyrrolo[1,4]benzodiazepine Antibiotics from an Indonesian Micrococcus sp.

    PubMed

    Fotso, Serge; Zabriskie, T Mark; Proteau, Philip J; Flatt, Patricia M; Santosa, Dwi Andreas; Mahmud, Taifo

    2009-04-01

    In our screening of Indonesian microorganisms for novel bioactive natural products we have isolated seven new compounds, designated as limazepines A, B1 and B2 (isolated as an isomeric mixture), C, D, E, and F, from the culture broth of Micrococcus sp. strain ICBB 8177. In addition, the known natural products prothracarcin and 7-O-succinylmacrolactin A, as well as two previously reported synthetic compounds, 2-amino-3-hydroxy-4-methoxybenzoic acid methyl ester and 4-ethylpyrrole-2-carboxaldehyde, were obtained from the extract. Chemical structures were determined by spectroscopic methods and by comparison with the NMR data of structurally related compounds. The limazepines belong to the growing group of the pyrrolo[1,4]benzodiazepine antitumor antibiotics isolated from various soil bacteria. Limazepines B1/B2 mixture, C, and E were active against the Gram-positive bacterium Staphylococcus aureus and the Gram-negative bacterium Escherichia coli. Limazepine D was also active against S. aureus, but was not active against E. coli. Interestingly, only the limazepines B1/B2 mixture and D were active against Pseudomonas aeruginosa.

  9. Protein synthesis in vitro by Micrococcus luteus.

    PubMed Central

    Farwell, M A; Rabinowitz, J C

    1991-01-01

    Bacillus subtilis and related gram-positive bacteria which have low to moderate genomic G + C contents are unable to efficiently translate mRNA derived from gram-negative bacteria, whereas Escherichia coli and other gram-negative bacteria are able to translate mRNA from both types of organisms. This phenomenon has been termed translational species specificity. Ribosomes from the low-G + C-content group (low-G + C group) of gram-positive organisms (B. subtilis and relatives) lack an equivalent to Escherichia ribosomal protein S1. The requirement for S1 for translation in E. coli (G. van Dieijen, P. H. van Knippenberg, J. van Duin, B. Koekman, and P. H. Pouwels, Mol. Gen. Genet. 153:75-80, 1977) and its specific role (A.R. Subramanian, Trends Biochem. Sci. 9:491-494, 1984) have been proposed. The group of gram-positive bacteria characterized by high genomic G + C content (formerly Actinomyces species and relatives) contain S1, in contrast to the low-G + C group (K. Mikulik, J. Smardova, A. Jiranova, and P. Branny, Eur. J. Biochem. 155:557-563, 1986). It is not known whether members of the high-G + C group are translationally specific, although there is evidence that one genus, Streptomyces, can express Escherichia genes in vivo (M. J. Bibb and S. N. Cohen, Mol. Gen. Genet. 187:265-277, 1985; J. L. Schottel, M. J. Bibb, and S. N. Cohen, J. Bacteriol. 146:360-368, 1981). In order to determine whether the organisms of this group are translationally specific, we examined the in vitro translational characteristics of a member of the high-G + C group, Micrococcus luteus, whose genomic G + C content is 73%. A semipurified coupled transcription-translation system of M. luteus translates Escherichia mRNA as well as Bacillus and Micrococcus mRNA. Therefore, M. luteus is translationally nonspecific and resembles E. coli rather than B. subtilis in its translational characteristics. Images PMID:2045372

  10. Microorganisms as Analytical Indicators. Experimental Methods and Techniques,

    DTIC Science & Technology

    1980-01-01

    Representa- tives of the genera Bacillus, Micrococcus, Escherichia, Pseudomonas, Aspergillus , and Penicillium are most frequently encountered...necessary for synthesis of prodigiosin, and magnesium is required for synthesis of bacteriochlorophylls. A change in the color of aspergillus spores...mesentericus niger and Bac. subtilis niger as a function of the concentration of phosphonium salts in the nutrient medium. The degree of

  11. Dose modification in e.coli by a constitutive radioprotective agent isolated from m. radiodurans

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Goldstein, Lawrence S.

    1972-01-01

    A constitutive low molecular weight radioprotective agent has been isolated from a colorless mutant of Micrococcus radiodurans. The effect of radioprotective extract was also investigated in three mutant strains of E.coli B/r differing from one another at a given locus concerned with the repair of radiation induced damage/

  12. [Features of interaction bacterial strains Micrococcus luteus LBK1 from plants varieties/hybrids cucumber and sweet pepper and with fungus Fusarium oxysporum Scelecht].

    PubMed

    Parfeniuk, A; Sterlikova, O; Beznosko, I; Krut', V

    2014-01-01

    The article presents the results of studying the impact of bacterial strain M. luteus LBK1, stimulating the growth and development of plant varieties/hybrids of cucumber and sweet pepper on the intensity of sporulation of the fungus F. oxysporum Scelecht--fusariose rot pathogen.

  13. A New Perspective on Radiation Resistance Based on Deinococcus radiodurans

    DTIC Science & Technology

    2009-03-01

    Halobacterium sp. NRc-1 | Lactobacillus plantarum | Micrococcus luteus | Pyrococcus furiosus | Shewanella oneidensis | Synechocystis sp. Pcc... Lactobacillus plantarum16,47, which lacks the enzyme superoxide dismutase, and Synechocystis sp. PCC 68034 (Ref. 48) accumulated exceptionally high levels...high specificity for Mn2+, has been detected in L. plantarum , but has not been found in D. radiodurans. Manganese transport in D. radiodurans is

  14. Unique antimicrobial spectrum of ophiobolin K produced by Aspergillus ustus.

    PubMed

    Sohsomboon, Natthapat; Kanzaki, Hiroshi; Nitoda, Teruhiko

    2018-03-01

    A co-cultivation study of two fungal strains showed that Aspergillus ustus could inhibit Aspergillus repens growth. The bioactive compound responsible for the observed activity was purified and identified as a sesterterpene, ophiobolin K. Ophiobolin K exhibited marked inhibition against both fungi and bacteria, especially A. repens, A. glaucus and gram-positive bacteria including Bacillus subtilis, Staphylococcus aureus, and Micrococcus luteus.

  15. [Quantitative and qualitative analysis of oral microbiota by orthopedic rehabilitation with full and partial removable dentures].

    PubMed

    Stafeev, A A; Chesnokova, M G; Chesnokov, V A

    2015-01-01

    Microbiological analysis of biomaterial surface in dental prosthesis showed the most common colonizing gram-positive species to be S. aureus, Micrococcus spp., S. haemolyticus, E. faecalis, mainly massive colonization with S. aureus was seen. The highest concentration of C. albicans colonization was found in removable dentures and may have a destructive effect on prosthetic material.

  16. Culturable bacteria present in the fluid of the hooded-pitcher plant Sarracenia minor based on 16S rDNA gene sequence data.

    PubMed

    Siragusa, Alex J; Swenson, Janice E; Casamatta, Dale A

    2007-08-01

    The culturable microbial community within the pitcher fluid of 93 Sarracenia minor carnivorous plants was examined over a 2-year study. Many aspects of the plant/bacterial/insect interaction within the pitcher fluid are minimally understood because the bacterial taxa present in these pitchers have not been identified. Thirteen isolates were characterized by 16S rDNA sequencing and subsequent phylogenetic analysis. The Proteobacteria were the most abundant taxa and included representatives from Serratia, Achromobacter, and Pantoea. The Actinobacteria Micrococcus was also abundant while Bacillus, Lactococcus, Chryseobacterium, and Rhodococcus were infrequently encountered. Several isolates conformed to species identifiers (>98% rDNA gene sequence similarity) including Serratia marcescens (isolates found in 27.5% of pitchers), Achromobacter xylosoxidans (37.6%), Micrococcus luteus (40.9%), Bacillus cereus (isolates found in 10.2%), Bacillus thuringiensis (5.4%), Lactococcus lactis (17.2%), and Rhodococcus equi (2.2%). Species-area curves suggest that sampling efforts were sufficient to recover a representative culturable bacterial community. The bacteria present represent a diverse community probably as a result of introduction by insect vectors, but the ecological significance remains under explored.

  17. [Bacterial flora of the conjunctival sac of the horse].

    PubMed

    Cattabiani, F; Cabassi, E; Allodi, C; Gianelli, F

    1976-01-01

    The AA. report the results of taxonomic research conducted on the conjunctival sac of 59 horses for identification of the present bacterial flora. In the controlled animals, it was observed, at the level of the considered niche, a community constituted of normal bacterial populations, but not autochtonous in the significance they attributed from DUBOS et al., relative to the characterization of the indigenous microbiota of the intestine. The isolated normal bacterial flora seems to be constituted of: Micrococcus (subgroup 6 of Baird-Parker, M. luteus, Micrococcus spp.) isolated in 49,15% of the samples; Staphylococcus aureus and St. epidermidis (18,64%); Moraxella osloensis, M. phenylpiruvica, M. equi and Moraxella spp. (11,86%); Bacillus cereus (11,86%); Neisseria catarrhalis (8,47%); Streptococcus equi and Str. zooepidemicus (6,77%); Corynebacterium spp. (6,77%) and Acinetobacter lwoffi (5,08%). The AA. have found, besides, a particular group of bacteria of uncertain classification, attributed to the coryneforms and found in 30,50% of the examined horses. So-called transient bacteria taxa have been considered are Streptomyces spp., isolated in the 10,16% of the controlled subjects, Aerococcus viridans and Bacillus spp. found in only one equine.

  18. Nurses’ uniforms: How many bacteria do they carry after one shift?

    PubMed Central

    Sanon, Marie-Anne; Watkins, Sally

    2013-01-01

    This pilot study investigated the pathogens that nurses are potentially bringing into the public and their home when they wear work uniforms outside of the work environment. To achieve this, sterilized uniforms were distributed to 10 nurses at a local hospital in Washington State at the beginning of their shift. Worn uniforms were collected at the end of the shifts and sent to a laboratory for analysis. Four tests were conducted: 1) a heterotrophic growth plate count, 2) methicillin-resistant Staphylococcus aureus (MRSA) growth, 3) vancomycin-resistant Enterococci (VRE), and 4) identification of the heterotrophic plate counts. Each participant completed a questionnaire and a survey. The results showed that the average bacteria colony growth per square inch was 1,246 and 5,795 for day and night shift, respectively. After 48 h, MRSA positives were present on 4 of the day shift and 3 of the night shift uniforms. Additional bacteria identified include: Bacillus sp., Micrococcus luteus, Staphylococcus aureus, Staphylococcus epidermidis, and Micrococcus roseus. The significant presence of bacteria on the uniforms 48 h after the shift ended necessitates further study, discussions and policy consideration regarding wearing health care uniforms outside of the work environment. PMID:25285235

  19. Nurses' uniforms: How many bacteria do they carry after one shift?

    PubMed

    Sanon, Marie-Anne; Watkins, Sally

    2012-12-01

    This pilot study investigated the pathogens that nurses are potentially bringing into the public and their home when they wear work uniforms outside of the work environment. To achieve this, sterilized uniforms were distributed to 10 nurses at a local hospital in Washington State at the beginning of their shift. Worn uniforms were collected at the end of the shifts and sent to a laboratory for analysis. Four tests were conducted: 1) a heterotrophic growth plate count, 2) methicillin-resistant Staphylococcus aureus (MRSA) growth, 3) vancomycin-resistant Enterococci (VRE), and 4) identification of the heterotrophic plate counts. Each participant completed a questionnaire and a survey. The results showed that the average bacteria colony growth per square inch was 1,246 and 5,795 for day and night shift, respectively. After 48 h, MRSA positives were present on 4 of the day shift and 3 of the night shift uniforms. Additional bacteria identified include: Bacillus sp., Micrococcus luteus, Staphylococcus aureus, Staphylococcus epidermidis, and Micrococcus roseus. The significant presence of bacteria on the uniforms 48 h after the shift ended necessitates further study, discussions and policy consideration regarding wearing health care uniforms outside of the work environment.

  20. Isolation and properties of mesosomal membrane fractions from Micrococcus lysodeikticus

    PubMed Central

    Owen, Peter; Freer, John H.

    1972-01-01

    1. A method is described for the isolation of pure mesosomal membrane fractions from Micrococcus lysodeikticus. 2. Plasmolysis of cells, before wall digestion, was necessary for effective mesosome release. 3. The effect of mild shearing forces, temperature and time upon the release of mesosomal membrane from protoplasts was investigated. 4. The optimum yield of mesosomal membranes from stable protoplasts was achieved at 10mm-Mg2+. 5. Mesosomal membrane vesicle fractions prepared at differing Mg2+ concentrations above 10mm were similar in chemical composition. 6. Comparison of the properties of peripheral and mesosomal membrane fractions revealed major differences in the distribution of protein components, membrane phosphorus, mannose and dehydrogenase activities between the two fractions. 7. Only cytochrome b556 was detected in mesosomal membranes, whereas peripheral membranes contained a full complement of cytochromes. 8. Preliminary investigations suggested the localization of an autolytic enzyme(s) in the mesosomal vesicles. 9. The anatomy of mesosomal and peripheral membrane have been compared by the negative-staining and freeze-fracture technique. 10. The results are discussed in relation to a plausible role for the mesosome. ImagesPLATE 1PLATE 2PLATE 3PLATE 4 PMID:4655825

  1. Numerical approach to reference identification of Staphylococcus, Stomatococcus, and Micrococcus spp.

    PubMed

    Rhoden, D L; Hancock, G A; Miller, J M

    1993-03-01

    A numerical-code system for the reference identification of Staphylococcus species, Stomatococcus mucilaginosus, and Micrococcus species was established by using a selected panel of conventional biochemicals. Results from 824 cultures (289 eye isolate cultures, 147 reference strains, and 388 known control strains) were used to generate a list of 354 identification code numbers. Each six-digit code number was based on results from 18 conventional biochemical reactions. Seven milliliters of purple agar base with 1% sterile carbohydrate solution added was poured into 60-mm-diameter agar plates. All biochemical tests were inoculated with 1 drop of a heavy broth suspension, incubated at 35 degrees C, and read daily for 3 days. All reactions were read and interpreted by the method of Kloos et al. (G. A. Hebert, C. G. Crowder, G. A. Hancock, W. R. Jarvis, and C. Thornsberry, J. Clin. Microbiol. 26:1939-1949, 1988; W. E. Kloos and D. W. Lambe, Jr., P. 222-237, in A. Balows, W. J. Hansler, Jr., K. L. Herrmann, H. D. Isenberg, and H. J. Shadomy, ed., Manual of Clinical Microbiology, 5th ed., 1991). This modified reference identification method was 96 to 98% accurate and could have value in reference and public health laboratory settings.

  2. Resonance scattering spectra of micrococcus lysodeikticus and its application to assay of lysozyme activity.

    PubMed

    Jiang, Zhi-Liang; Huang, Guo-Xia

    2007-02-01

    Several methods, including turbidimetric and colorimetric methods, have been reported for the detection of lysozyme activity. However, there is no report about the resonance scattering spectral (RSS) assay, which is based on the catalytic effect of lysozyme on the hydrolysis of micrococcus lysodeikticus (ML) and its resonance scattering effect. ML has 5 resonance scattering peaks at 360 400, 420, 470, and 520 nm with the strongest one at 470 nm. The concentration of ML in the range of 2.0x10(6)-9.3x10(8) cells/ml is proportional to the RS intensity at 470 nm (I(470 nm)). A new catalytic RSS method has been proposed for 0.24-40.0 U/ml (or 0.012-2.0 mug/ml) lysozyme activity, with a detection limit (3sigma) of 0.014 U/ml (or 0.0007 microg/ml). Saliva samples were assayed by this method, and it is in agreement with the results of turbidimetric method. The slope, intercept and the correlation coefficient of the regression analysis of the 2 assays were 0.9665, -87.50, and 0.9973, respectively. The assay has high sensitivity and simplicity.

  3. Functional Micrococcus lysodeikticus layers deposited by laser technique for the optical sensing of lysozyme.

    PubMed

    Dinca, Valentina; Zaharie-Butucel, Diana; Stanica, Luciana; Brajnicov, Simona; Marascu, Valentina; Bonciu, Anca; Cristocea, Andra; Gaman, Laura; Gheorghiu, Mihaela; Astilean, Simion; Vasilescu, Alina

    2018-02-01

    Whole cell optical biosensors, made by immobilizing whole algal, bacterial or mammalian cells on various supports have found applications in several fields, from ecology and ecotoxicity testing to biopharmaceutical production or medical diagnostics. We hereby report the deposition of functional bacterial layers of Micrococcus lysodeikticus (ML) via Matrix-Assisted Pulsed Laser Evaporation (MAPLE) on poly(diallyldimethylamonium) (PDDA)-coated-glass slides and their application as an optical biosensor for the detection of lysozyme in serum. Lysozyme is an enzyme upregulated in inflammatory diseases and ML is an enzymatic substrate for this enzyme. The MAPLE-deposited bacterial interfaces were characterised by Scanning Electron Microscopy (SEM), Atomic Force Microscopy (AFM), Fourier-Transformed Infrared Spectroscopy (FTIR), Raman and optical microscopy and were compared with control interfaces deposited via layer-by-layer on the same substrate. After MAPLE deposition and coating with graphene oxide (GO), ML-modified interfaces retained their functionality and sensitivity to lysozyme's lytic action. The optical biosensor detected lysozyme in undiluted serum in the clinically relevant range up to 10μgmL -1 , in a fast and simple manner. Copyright © 2017 Elsevier B.V. All rights reserved.

  4. Bioremediation of contaminated surface water by immobilized Micrococcus roseus.

    PubMed

    Li, H; Li, P; Hua, T; Zhang, Y; Xiong, X; Gong, Z

    2005-08-01

    The problems caused by contaminated surface water have gradually become more serious in recent years. Although various remediation technologies were investigated, unfortunately, no efficient method was developed. In this paper, a new bioremediation technology was studied using Micrococcus roseus, which was immobilized in porous spherical beads by an improved polyvinyl alcohol (PVA) - sodium alginate (SA) embedding method. The experimental results indicated that COD removal rate could reach 64.7 % within 72 hours when immobilized M. roseus beads were used, which was ten times as high as that of free cells. The optimum inoculation rate of immobilized M. roseus beads was 10 % (mass percent of the beads in water sample, g g(-1)). Suitable aeration was proved necessary to enhance the bioremediation process. The immobilized cells had an excellent tolerance to pH and temperature changes, and were also more resistant to heavy metal stress compared with free cells. The immobilized M. roseus beads had an excellent regeneration capacity and could be reused after 180-day continuous usage. The Scanning Electronic Microscope (SEM) analysis showed that the bead microstructure was suitable for M. roseus growth, however, some defect structures should still be improved.

  5. Phytoremediation of fuel oil and lead co-contaminated soil by Chromolaena odorata in association with Micrococcus luteus.

    PubMed

    Jampasri, Kongkeat; Pokethitiyook, Prayad; Kruatrachue, Maleeya; Ounjai, Puey; Kumsopa, Acharaporn

    2016-10-02

    Phytoremediation is widely promoted as a cost-effective technology for treating heavy metal and total petroleum hydrocarbon (TPH) co-contaminated soil. This study investigated the concurrent removal of TPHs and Pb in co-contaminated soil (27,000 mg kg(-1) TPHs, 780 mg kg(-1) Pb) by growing Siam weed (Chromolaena odorata) in a pot experiment for 90 days. There were four treatments: co-contaminated soil; co-contaminated soil with C. odorata only; co-contaminated soil with C. odorata and Micrococcus luteus inoculum; and co-contaminated soil with M. luteus only. C. odorata survived and grew well in the co-contaminated soil. C. odorata with M. luteus showed the highest Pb accumulation (513.7 mg kg(-1)) and uptake (7.7 mg plant(-1)), and the highest reduction percentage of TPHs (52.2%). The higher TPH degradation in vegetated soils indicated the interaction between the rhizosphere microorganisms and plants. The results suggested that C. odorata together with M. luteus and other rhizosphere microorganisms is a promising candidate for the removal of Pb and TPHs in co-contaminated soils.

  6. Isolation and characterization of novel plant growth promoting Micrococcus sp NII-0909 and its interaction with cowpea.

    PubMed

    Dastager, Syed G; Deepa, C K; Pandey, Ashok

    2010-12-01

    A phosphate-solubilizing bacterial strain NII-0909 isolated from the Western ghat forest soil in India was identified as Micrococcus sp on the basis of phenotypic characteristics, carbon source utilization pattern, fatty acid methyl esters analysis, and 16S rRNA gene sequence. The strain exhibited the plant growth-promoting attributes of phosphate solubilization, auxin production, 1-aminocyclopropane-1-carboxylate deaminase activity, and siderophore production. It was able to solubilize (122.4μg of Ca(3)PO(4) ml(-1)), and produce IAA (109μgml(-1)) at 30°C. P-solubilizing activity of the strain NII-0909 was associated with the release of organic acids and a drop in the pH of the NBRIP medium. HPLC analysis detected two organic acids in the course of P-solubilization. A significant increase in the growth of cow pea was recorded for inoculations under controlled conditions. Scanning electron microscopic study revealed the root colonization of strain on cow pea seedlings. These results demonstrate that isolates NII-0909 has the promising PGPR attributes to be develop as a biofertilizer to enhance soil fertility and promote the plant growth. Copyright © 2010 Elsevier Masson SAS. All rights reserved.

  7. Some biological activities of pigments extracted from Micrococcus roseus (PTCC 1411) and Rhodotorula glutinis (PTCC 5257).

    PubMed

    Rostami, Hossein; Hamedi, Hassan; Yolmeh, Mahmoud

    2016-12-01

    The importance of replacing synthetic pigments with natural types is increasing day by day in the food industry due to the harmful effects of some synthetic pigments. Microorganisms are a major source of natural pigments, which nowadays have attracted the attention of researchers. In this study, carotenoid pigments were produced by Micrococcus roseus and Rhodotorula glutinis, and some of their biological properties such as antimicrobial, antioxidant, anticancer, and anti-inflammatory activities were evaluated. Given the results, bacteria, especially gram-positive bacteria, had higher sensitivity to the pigments extracted from M. roseus (PEM) and R. glutinis (PER) compared to molds so that Bacillus cereus and Alternaria citri had the highest and the lowest sensitivity, respectively. PER showed a higher antioxidant activity compared with PEM in the various methods of measuring antioxidant activity. In vitro and in vivo anti-tumor-promoting activities of PER were measured significantly more than PEM (P <0.05). Both pigment extracts remarkably inhibited the 12-O-tetradecanoylphorbol-13-acetate (TPA)-induced inflammation, so that ID 50 (50% inhibitory dose) of PEM and PER were 0.22 and 0.09 mg/ear, respectively. © The Author(s) 2016.

  8. Some biological activities of pigments extracted from Micrococcus roseus (PTCC 1411) and Rhodotorula glutinis (PTCC 5257)

    PubMed Central

    Rostami, Hossein; Hamedi, Hassan; Yolmeh, Mahmoud

    2016-01-01

    The importance of replacing synthetic pigments with natural types is increasing day by day in the food industry due to the harmful effects of some synthetic pigments. Microorganisms are a major source of natural pigments, which nowadays have attracted the attention of researchers. In this study, carotenoid pigments were produced by Micrococcus roseus and Rhodotorula glutinis, and some of their biological properties such as antimicrobial, antioxidant, anticancer, and anti-inflammatory activities were evaluated. Given the results, bacteria, especially gram-positive bacteria, had higher sensitivity to the pigments extracted from M. roseus (PEM) and R. glutinis (PER) compared to molds so that Bacillus cereus and Alternaria citri had the highest and the lowest sensitivity, respectively. PER showed a higher antioxidant activity compared with PEM in the various methods of measuring antioxidant activity. In vitro and in vivo anti-tumor-promoting activities of PER were measured significantly more than PEM (P <0.05). Both pigment extracts remarkably inhibited the 12-O-tetradecanoylphorbol-13-acetate (TPA)-induced inflammation, so that ID50 (50% inhibitory dose) of PEM and PER were 0.22 and 0.09 mg/ear, respectively. PMID:27895288

  9. Purification and characterization of vanillin dehydrogenases from alkaliphile Micrococcus sp. TA1 and neutrophile Burkholderia cepacia TM1.

    PubMed

    Mitsui, Ryoji; Hirota, Mizuho; Tsuno, Takuo; Tanaka, Mitsuo

    2010-02-01

    Vanillin dehydrogenases (VDHs) were purified and characterized from two bacterial strains that have different pH dependencies for growth. The alkaliphile Micrococcus sp. TA1, isolated from an alkaline spa, can grow on several aromatic compounds such as ferulic acid, vanillin, vanillic acid, and protocatechuic acid under alkaline conditions. The neutrophile Burkholderia cepacia TM1, which was isolated previously, also grew on the above-mentioned compounds because they functioned as the sole carbon source under neutral conditions. Purified VDHs showed activities toward some aromatic aldehydes. These enzymes have the same subunit molecular mass of about 57 kDa as determined by sodium dodecyl sulfate-polyacrylamide gel electrophoresis, but differed in some of their observed properties. Native molecular masses also differed between the purified enzymes. These were 250 kDa for the enzyme from alkaliphilic strain TA1 and 110 kDa for that from neutrophilic strain TM1, as determined by gel filtration. The enzyme from strain TA1 required NADP(+) as a coenzyme for its activity, but that from strain TM1 required NAD(+). These results are important because this is the first report of an alkaliphilic bacterium consuming lignin monomers.

  10. Detection of Micrococcus luteus biofilm formation in microfluidic environments by pH measurement using an ion-sensitive field-effect transistor.

    PubMed

    Matsuura, Koji; Asano, Yuka; Yamada, Akira; Naruse, Keiji

    2013-02-18

    Biofilm formation in microfluidic channels is difficult to detect because sampling volumes are too small for conventional turbidity measurements. To detect biofilm formation, we used an ion-sensitive field-effect transistor (ISFET) measurement system to measure pH changes in small volumes of bacterial suspension. Cells of Micrococcus luteus (M. luteus) were cultured in polystyrene (PS) microtubes and polymethylmethacrylate (PMMA)-based microfluidic channels laminated with polyvinylidene chloride. In microtubes, concentrations of bacteria and pH in the suspension were analyzed by measuring turbidity and using an ISFET sensor, respectively. In microfluidic channels containing 20 μL of bacterial suspension, we measured pH changes using the ISFET sensor and monitored biofilm formation using a microscope. We detected acidification and alkalinization phases of M. luteus from the ISFET sensor signals in both microtubes and microfluidic channels. In the alkalinization phase, after 2 day culture, dense biofilm formation was observed at the bottom of the microfluidic channels. In this study, we used an ISFET sensor to detect biofilm formation in clinical and industrial microfluidic environments by detecting alkalinization of the culture medium. 

  11. A Repeating Sulfated Galactan Motif Resuscitates Dormant Micrococcus luteus Bacteria.

    PubMed

    Böttcher, Thomas; Szamosvári, Dávid; Clardy, Jon

    2018-07-01

    Only a small fraction of bacteria can autonomously initiate growth on agar plates. Nongrowing bacteria typically enter a metabolically inactive dormant state and require specific chemical trigger factors or signals to exit this state and to resume growth. Micrococcus luteus has become a model organism for this important yet poorly understood phenomenon. Only a few resuscitation signals have been described to date, and all of them are produced endogenously by bacterial species. We report the discovery of a novel type of resuscitation signal that allows M. luteus to grow on agar but not agarose plates. Fractionation of the agar polysaccharide complex and sulfation of agarose allowed us to identify the signal as highly sulfated saccharides found in agar or carrageenans. Purification of hydrolyzed κ-carrageenan ultimately led to the identification of the signal as a small fragment of a large linear polysaccharide, i.e., an oligosaccharide of five or more sugars with a repeating disaccharide motif containing d-galactose-4-sulfate (G4S) 1,4-linked to 3,6-anhydro-α-d-galactose (DA), G4S-(DA-G4S) n ≥2 IMPORTANCE Most environmental bacteria cannot initiate growth on agar plates, but they can flourish on the same plates once growth is initiated. While there are a number of names for and manifestations of this phenomenon, the underlying cause appears to be the requirement for a molecular signal indicating safe growing conditions. Micrococcus luteus has become a model organism for studying this growth initiation process, often called resuscitation, because of its apparent connection with the persistent or dormant form of Mycobacterium tuberculosis , an important human pathogen. In this report, we identify a highly sulfated saccharide from agar or carrageenans that robustly resuscitates dormant M. luteus on agarose plates. We identified and characterized the signal as a small repeating disaccharide motif. Our results indicate that signals inherent in or absent from the polysaccharide composition of solid growth media can have major effects on bacterial growth. Copyright © 2018 American Society for Microbiology.

  12. Indoleacetic acid production and plant growth promoting potential of bacterial endophytes isolated from rice (Oryza sativa L.) seeds.

    PubMed

    Shahzad, Raheem; Waqas, Muhammad; Khan, Abdul Latif; Al-Hosni, Khadija; Kang, Sang-Mo; Seo, Chang-Woo; Lee, In-Jung

    2017-06-01

    Bacterial endophytes from the phyllosphere and rhizosphere have been used to produce bioactive metabolites and to promote plant growth. However, little is known about the endophytes residing in seeds. This study aimed to isolate and identify seed-borne bacterial endophytes from rice and elucidate their potential for phytohormone production and growth enhancement. The isolated endophytes included Micrococcus yunnanensis RWL-2, Micrococcus luteus RWL-3, Enterobacter soli RWL-4, Leclercia adecarboxylata RWL-5, Pantoea dispersa RWL-6, and Staphylococcus epidermidis RWL-7, which were identified using 16S rRNA sequencing and phylogenetic analysis. These strains were analyzed for indoleacetic acid (IAA) production by using GC-MS and IAA was found in the range of 11.50 ± 0.77 μg ml -1 to 38.80 ± 1.35 μg ml -1 . We also assessed the strains for plant growth promoting potential because these isolates were able to produce IAA in pure culture. Most of the growth attributes of rice plants (shoot and root length, fresh and dry biomass, and chlorophyll content) were significantly increased by bacterial endophytes compared to the controls. These results show that IAA producing bacterial endophytes can improve hostplant growth traits and can be used as bio-fertilizers.

  13. Airborne Bacteria in an Urban Environment

    PubMed Central

    Mancinelli, Rocco L.; Shulls, Wells A.

    1978-01-01

    Samples were taken at random intervals over a 2-year period from urban air and tested for viable bacteria. The number of bacteria in each sample was determined, and each organism isolated was identified by its morphological and biochemical characteristics. The number of bacteria found ranged from 0.013 to 1.88 organisms per liter of air sampled. Representatives of 19 different genera were found in 21 samples. The most frequently isolated organisms and their percent of occurence were Micrococcus (41%), Staphylococcus (11%), and Aerococcus (8%). The bacteria isolated were correlated with various weather and air pollution parameters using the Pearson product-moment correlation coefficient method. Statistically significant correlations were found between the number of viable bacteria isolated and the concentrations of nitric oxide (−0.45), nitrogen dioxide (+0.43), and suspended particulate pollutants (+0.56). Calculated individually, the total number of Micrococcus, Aerococcus, and Staphylococcus, number of rods, and number of cocci isolated showed negative correlations with nitric oxide and positive correlations with nitrogen dioxide and particulates. Statistically significant positive correlations were found between the total number of rods isolated and the concentration of nitrogen dioxide (+0.54) and the percent relative humidity (+0.43). The other parameters tested, sulfur dioxide, hydrocarbons, and temperature, showed no significant correlations. Images PMID:677875

  14. Molecular identification and nanoremediation of microbial contaminants in algal systems using untreated wastewater.

    PubMed

    Limayem, Alya; Gonzalez, Francisco; Micciche, Andrew; Haller, Edward; Nayak, Bina; Mohapatra, Shyam

    2016-12-01

    Wastewater-algal biomass is a promising option to biofuel production. However, microbial contaminants constitute a substantial barrier to algal biofuel yield. A series of algal strains, Nannochloris oculata and Chlorella vulgaris samples (n = 30), were purchased from the University of Texas, and were used for both stock flask cultures and flat-panel vertical bioreactors. A number of media were used for isolation and differentiation of potential contaminants according to laboratory standards (CLSI). Conventional PCR amplification was performed followed by 16S rDNA sequencing to identify isolates at the species level. Nanotherapeutics involving a nanomicellar combination of natural chitosan and zinc oxide (CZNPs) were tested against the microbial lytic groups through Minimum Inhibitory Concentration (MIC) tests and Transmission Electronic Microscopy (TEM). Results indicated the presence of Pseudomonas spp., Bacillus pumilus/ safensis, Cellulosimicrobium cellulans, Micrococcus luteus and Staphylococcus epidermidis strains at a substantial level in the wastewater-fed algal reactors. TEM confirmed the effectiveness of CZNPs on the lytic group while the average MICs (mg/mL) detected for the strains, Pseudomonas spp, Micrococcus luteus, and Bacillus pumilus were 0.417, 3.33, and 1.458, respectively. Conclusively, CZNP antimicrobials proved to be effective as inhibitory agents against currently identified lytic microbial group, did not impact algae cells, and shows promise for in situ interventions.

  15. Oil removal from petroleum sludge using bacterial culture with molasses substrate at temperature variation

    NASA Astrophysics Data System (ADS)

    Ni'matuzahroh, Puspitasari, Alvin Oktaviana; Pratiwi, Intan Ayu; Fatimah, Sumarsih, Sri; Surtiningsih, Tini; Salamun

    2016-03-01

    The study aims to reveal the potency of biosurfactant-producing bacterial culture with molasses as substrate growth in releasing oil from the petroleum sludge at temperature variations. Bacteria used consisted of (Acinetobacter sp. P2(1), Pseudomonas putida T1(8), Bacillus subtilis 3KP and Micrococcus sp. L II 61). The treatments were tested at 40°C, 50°C and 60 °C for 7 days of incubation. Synthetic surfactant (Tween 20) was used as a positive control and molasses as a negative control. Release of petroleum hydrocarbons from oil sludge was expressed in percentage of oil removal from oil sludge (%). Data were analyzed statistically using the Analysis of Variance (α = 0.05) and continued with Games-Howell test. The kinds of bacterial cultures, incubation temperature and combination of both affected the percentage of oil removal. The abilities of Bacillus subtilis 3KP and Micrococcus sp. LII 61cultures in oil removal from oil sludge at the temperature exposure of 60°C were higher than Tween 20. Both of bacterial cultures grown on molasses can be proposed as a replacement for synthetic surfactant to clean up the accumulation of oil sludge in a bottom of oil refinery tank.

  16. Culture-dependent and culture-independent characterization of potentially functional biphenyl-degrading bacterial community in response to extracellular organic matter from Micrococcus luteus.

    PubMed

    Su, Xiao-Mei; Liu, Yin-Dong; Hashmi, Muhammad Zaffar; Ding, Lin-Xian; Shen, Chao-Feng

    2015-05-01

    Biphenyl (BP)-degrading bacteria were identified to degrade various polychlorinated BP (PCB) congers in long-term PCB-contaminated sites. Exploring BP-degrading capability of potentially useful bacteria was performed for enhancing PCB bioremediation. In the present study, the bacterial composition of the PCB-contaminated sediment sample was first investigated. Then extracellular organic matter (EOM) from Micrococcus luteus was used to enhance BP biodegradation. The effect of the EOM on the composition of bacterial community was investigated by combining with culture-dependent and culture-independent methods. The obtained results indicate that Proteobacteria and Actinobacteria were predominant community in the PCB-contaminated sediment. EOM from M. luteus could stimulate the activity of some potentially difficult-to-culture BP degraders, which contribute to significant enhancement of BP biodegradation. The potentially difficult-to-culture bacteria in response to EOM addition were mainly Rhodococcus and Pseudomonas belonging to Gammaproteobacteria and Actinobacteria respectively. This study provides new insights into exploration of functional difficult-to-culture bacteria with EOM addition and points out broader BP/PCB degrading, which could be employed for enhancing PCB-bioremediation processes. © 2015 The Authors. Microbial Biotechnology published by John Wiley & Sons Ltd and Society for Applied Microbiology.

  17. Inactivation of the Radiation-Resistant Spoilage Bacterium Micrococcus radiodurans

    PubMed Central

    Duggan, D. E.; Anderson, A. W.; Elliker, P. R.

    1963-01-01

    A simplified technique permitting the pipetting of raw puréed meats for quantitative bacteriological study is described for use in determining survival of these non-sporing bacteria, which are exceptionally resistant to radiation. Survival curves, using gamma radiation as the sterilizing agent, were determined in raw beef with four strains of Micrococcus radiodurans. Survival curves of the R1 strain in other meat substrates showed that survival was significantly greater in raw beef and raw chicken than in raw fish or in cooked beef. Resistance was lowest in the buffer. Cells grown in broth (an artificial growth medium) and resuspended in beef did not differ in resistance from cells that had been grown and irradiated in beef. Survival rate was statistically independent of the initial cell concentration, even though there appeared to be a correlation between lower death rate and lower initial cell concentrations. The initial viable count of this culture of the domesticated R1 strain in beef was reduced by a factor of about 10-5 by 3.0 megarad, and 4.0 megarad reduced the initial count by a factor of more than 10-9. Data suggest that M. radiodurans R1 is more resistant to radiation than spore-forming spoilage bacteria for which inactivation rates have been published. PMID:14063780

  18. Physicochemical parameters influencing coaggregation between the freshwater bacteria Sphingomonas natatoria 2.1 and Micrococcus luteus 2.13.

    PubMed

    Min, K R; Zimmer, M N; Rickard, A H

    2010-11-01

    The aim of this study was to explore the physicochemical parameters that influence coaggregation between the freshwater bacteria Sphingomonas natatoria 2.1 and Micrococcus luteus 2.13. Using visual coaggregation assays, the effect of different buffers, solutions of differing ionic strength, pH, temperature, and viscosity on the degree of coaggregation was assessed. Coaggregation occurred maximally in distilled water but was inhibited when coaggregates were suspended in a commonly-used oral bacterial coaggregation buffer, saline solutions, and Tris-Cl buffers. Coaggregation was weakly expressed in standard laboratory buffers. The ionic strength of inorganic salt solutions required to inhibit coaggregation depended upon the inorganic salt being tested. Coaggregation occurred at a pH of 3-10, between 5 and 80°C and was inhibited in solutions with a viscosity of 22.5 centipoises at 20°C. Inhibition of coaggregation with NaCl impaired biofilm development. When developing buffers to test for coaggregation, the natural liquid environment should be considered. Coaggregation between S. natatoria 2.1 and M. luteus 2.13 is only affected by physicochemical conditions beyond those typically found in natural freshwater ecosystems. Such a robust ability to coaggregate may enhance the ability of S. natatoria 2.1 and M. luteus 2.13 to develop a niche in freshwater biofilms.

  19. Phenolic glycosides and ionone glycoside from the stem of Sargentodoxa cuneata.

    PubMed

    Chang, Jun; Case, Ryan

    2005-12-01

    Four phenolic glycosides, cuneatasides A-D (1-4), and one ionone glycoside cuneataside E (5), together with seven known phenolic compounds (6-12) were isolated from the water-soluble constituents of the stem of Sargentodoxa cuneata (Sargentodoxaceae). Their structures were elucidated by spectroscopic analysis. In vitro tests for antimicrobial activity showed compounds 1 and 2 to possess significant activity against two Gram-positive organisms, Staphylococcus aureus and Micrococcus epidermidis.

  20. Evaluation of antibacterial properties of some medicinal plants used in Iran.

    PubMed

    Bonjar, Shahidi

    2004-10-01

    Forty-five species of 29 plant families used in the traditional medicine by Iranian people, showed antibacterial activities against one or more of the bacterial species: Bacillus cereus, Bacillus pumilus, Bordetella bronchiseptica, Escherichia coli, Klebsiella pneumoniae, Micrococcus luteus, Pseudomonas aeruginosa, Pseudomonas fluorescens, Serratia marcescens, Staphylococcus aureus and Staphylococcus epidermidis. No plant showed activity against Serratia marcescens; Bordetella bronchiseptica being the most susceptible species. All extracts showed the same activity 18 months later.

  1. Devices for monitoring content of microparticles and bacterium in injection solutions in pharmaceutical production

    NASA Astrophysics Data System (ADS)

    Bilyi, Olexander I.; Getman, Vasyl B.; Konyev, Fedir A.; Sapunkov, Olexander; Sapunkov, Pavlo G.

    2001-06-01

    The devices for monitoring of parameters of efficiency of water solutions filtration, which are based on the analysis of scattered light by microparticles are considered in this article. The efficiency of using of devices in pharmaceutics in technological processes of manufacturing medical injection solutions is shown. The examples of monitoring of contents of bacterial cultures Pseudomonas aeruginosa, Escherichia coli, and Micrococcus luteus in water solutions of glucose are indicated.

  2. Failure Analysis of Pitted Copper Pipes Used in Underground Water and Preventive Measures

    NASA Astrophysics Data System (ADS)

    Nam, Gi-ho; Lee, Jong-kwon; Kim, Kyung-ja

    2018-05-01

    This study performed an experiment on the causes of pitting corrosion in a copper tubing used for a sprinkler system. Corrosion products of a copper tubing that sustained pitting corrosion were collected and cultured in Culture medium [Luria-Bertani, Brain heart infusion, Tryptic soy broth (TSB), R2A]. Four types of bacteria were found through identification: Micrococcus luteus sp (species)., Staphylococcus sp., Sphingomonas sp., and Bacillus sp. The copper toxicity test was performed for each microorganism. Among the four microorganisms, Micrococcus luteus sp. showed good growth in the environment containing copper ions. On the immersion test, changes in pH and Optical density were measured; On the inductively coupled plasma optical emission spectrometry test, the copper concentration of each culture medium was measured. The surface of each copper sample was observed using a scanning electron microscope. The corrosion potential of a copper sample, after 48 h exposure of the TSB medium containing Micrococcus luteus sp., was measured using a potentiodynamic polarization experiment. The next experiment was conducted to prevent microbial corrosion by suppressing the growth of microorganisms. Six 30 ml TSB culture media with controlled pH value of 4, 5, 6, 7, 8, and 9 through HCl and NaOH were manufactured. Then the microorganisms were cultured in 37 °C 133 rpm, of which the growth status was checked every 24 h for 3 days. It was found that microorganisms did not grow on culture media with the pH value of 6 and lower. The same experiment conducted on culture media controlled with acetic acid, nitric acid, and sulfuric acid, also showed no growth of microorganisms on media with pH value of 6 and lower. Six 5 ml TSB culture media each containing 0.5, 0.25, 0.125, 0.0625, 0.0312%, and 0.0156% NaOCl and NaOBr as germicides were manufactured. 0.01 μl of microorganisms were inoculated on the media and cultured in 37 °C for 48 h. It was found that microorganisms did not grow in media with NaOCl and NaOBr concentration of 0.0625% and higher. Therefore, it can be suggested that in environments with pH value of 6 or lower, or NaOCl and NaOBr concentration of higher than 0.0625% suppresses microbial growth, thereby preventing microbial corrosion.

  3. Failure Analysis of Pitted Copper Pipes Used in Underground Water and Preventive Measures

    NASA Astrophysics Data System (ADS)

    Nam, Gi-ho; Lee, Jong-kwon; Kim, Kyung-ja

    2018-03-01

    This study performed an experiment on the causes of pitting corrosion in a copper tubing used for a sprinkler system. Corrosion products of a copper tubing that sustained pitting corrosion were collected and cultured in Culture medium [Luria-Bertani, Brain heart infusion, Tryptic soy broth (TSB), R2A]. Four types of bacteria were found through identification: Micrococcus luteus sp (species)., Staphylococcus sp., Sphingomonas sp., and Bacillus sp. The copper toxicity test was performed for each microorganism. Among the four microorganisms, Micrococcus luteus sp. showed good growth in the environment containing copper ions. On the immersion test, changes in pH and Optical density were measured; On the inductively coupled plasma optical emission spectrometry test, the copper concentration of each culture medium was measured. The surface of each copper sample was observed using a scanning electron microscope. The corrosion potential of a copper sample, after 48 h exposure of the TSB medium containing Micrococcus luteus sp., was measured using a potentiodynamic polarization experiment. The next experiment was conducted to prevent microbial corrosion by suppressing the growth of microorganisms. Six 30 ml TSB culture media with controlled pH value of 4, 5, 6, 7, 8, and 9 through HCl and NaOH were manufactured. Then the microorganisms were cultured in 37 °C 133 rpm, of which the growth status was checked every 24 h for 3 days. It was found that microorganisms did not grow on culture media with the pH value of 6 and lower. The same experiment conducted on culture media controlled with acetic acid, nitric acid, and sulfuric acid, also showed no growth of microorganisms on media with pH value of 6 and lower. Six 5 ml TSB culture media each containing 0.5, 0.25, 0.125, 0.0625, 0.0312%, and 0.0156% NaOCl and NaOBr as germicides were manufactured. 0.01 μl of microorganisms were inoculated on the media and cultured in 37 °C for 48 h. It was found that microorganisms did not grow in media with NaOCl and NaOBr concentration of 0.0625% and higher. Therefore, it can be suggested that in environments with pH value of 6 or lower, or NaOCl and NaOBr concentration of higher than 0.0625% suppresses microbial growth, thereby preventing microbial corrosion.

  4. A Proteomic Signature of Dormancy in the Actinobacterium Micrococcus luteus.

    PubMed

    Mali, Sujina; Mitchell, Morgan; Havis, Spencer; Bodunrin, Abiodun; Rangel, Jonathan; Olson, Gabriella; Widger, William R; Bark, Steven J

    2017-07-15

    Dormancy is a protective state in which diverse bacteria, including Mycobacterium tuberculosis , Staphylococcus aureus , Treponema pallidum (syphilis), and Borrelia burgdorferi (Lyme disease), curtail metabolic activity to survive external stresses, including antibiotics. Evidence suggests dormancy consists of a continuum of interrelated states, including viable but nonculturable (VBNC) and persistence states. VBNC and persistence contribute to antibiotic tolerance, reemergence from latent infections, and even quorum sensing and biofilm formation. Previous studies indicate that the protein mechanisms regulating persistence and VBNC states are not well understood. We have queried the VBNC state of Micrococcus luteus NCTC 2665 (MI-2665) by quantitative proteomics combining gel electrophoresis, high-performance liquid chromatography, and tandem mass spectrometry to elucidate some of these mechanisms. MI-2665 is a nonpathogenic actinobacterium containing a small (2.5-Mb), high-GC-content genome which exhibits a well-defined VBNC state induced by nutrient deprivation. The MI-2665 VBNC state demonstrated a loss of protein diversity accompanied by increased levels of 18 proteins that are conserved across actinobacteria, 14 of which have not been previously identified in VNBC. These proteins implicate an anaplerotic strategy in the transition to VBNC, including changes in the glyoxylate shunt, redox and amino acid metabolism, and ribosomal regulatory processes. Our data suggest that MI-2665 is a viable model for dissecting the protein mechanisms underlying the VBNC stress response and provide the first protein-level signature of this state. We expect that this protein signature will enable future studies deciphering the protein mechanisms of dormancy and identify novel therapeutic strategies effective against antibiotic-tolerant bacterial infections. IMPORTANCE Dormancy is a protective state enabling bacteria to survive antibiotics, starvation, and the immune system. Dormancy is comprised of different states, including persistent and viable but nonculturable (VBNC) states that contribute to the spread of bacterial infections. Therefore, it is imperative to identify how bacteria utilize these different dormancy states to survive antibiotic treatment. The objective of our research is to eliminate dormancy as a route to antibiotic tolerance by understanding the proteins that control dormancy in Micrococcus luteus NCTC 2665. This bacterium has unique advantages for studying dormancy, including a small genome and a well-defined and reproducible VBNC state. Our experiments implicate four previously identified and 14 novel proteins upregulated in VBNC that may regulate this critical survival mechanism. Copyright © 2017 American Society for Microbiology.

  5. Umbilical Sepsis Caused by Multidrug Resistant Strain of Kocuria kristinae in a New Born: A Case Report

    PubMed Central

    Subramanian, Pramodhini; Ramakrishnan, Kalaivani; Seetha, K.S

    2016-01-01

    Kocuria species were placed previously under the genus Micrococcus, are skin and oropharynx commensals in mammals, including man. A rare bacteria, Kocuria kristinae isolated from a new born with umbilical sepsis. Identification and antibiotic susceptibility was done by Vitek 2 compact system (Biomerieux). The isolate was sensitive to higher antibiotics like vancomycin, teicoplanin and linezolid. As this new pathogen resembles coagulase negative staphylococcus, it should not be misidentified. PMID:27190805

  6. Umbilical Sepsis Caused by Multidrug Resistant Strain of Kocuria kristinae in a New Born: A Case Report.

    PubMed

    Sivaraman, Umadevi; Subramanian, Pramodhini; Ramakrishnan, Kalaivani; Seetha, K S

    2016-04-01

    Kocuria species were placed previously under the genus Micrococcus, are skin and oropharynx commensals in mammals, including man. A rare bacteria, Kocuria kristinae isolated from a new born with umbilical sepsis. Identification and antibiotic susceptibility was done by Vitek 2 compact system (Biomerieux). The isolate was sensitive to higher antibiotics like vancomycin, teicoplanin and linezolid. As this new pathogen resembles coagulase negative staphylococcus, it should not be misidentified.

  7. Immunochemical analysis of Micrococcus lysodeikticus (luteus) F1-ATPase and its subunits.

    PubMed

    Urban, C; Salton, M R

    1983-08-31

    The F1-ATPase from Micrococcus lysodeikticus has been purified to 95% protein homogeneity in this laboratory and as all other bacterial F1S, possesses five distinct subunits with molecular weights ranging from 60 000 to 10 000 (Huberman, M. and Salton, M.R.J. (1979) Biochim. Biophys. Acta 547, 230-240). In this communication, we demonstrate the immunochemical reactivities of antibodies to native and SDS-dissociated subunits with the native and dissociated F1-ATPase and show that: (1) the antibodies generated to the native or SDS-dissociated subunits react with the native molecule; (2) all of the subunits comprising the F1 are antigenically unique as determined by crossed immunoelectrophoresis and the Ouchterlony double-diffusion techniques; (3) antibodies to the SDS-denatured individual delta- and epsilon-subunits can be used to destabilize the interaction of these specific subunits with the rest of the native F1; and (4) all subunit antibodies as well as anti-native F1 were found to inhibit ATPase activity to varying degrees, the strongest inhibition being seen with antibodies to the total F1 and anti-alpha- and anti-beta-subunit antibodies. The interaction of specific subunit antibodies may provide a new and novel way to study further and characterize the catalytic portions of F1-ATPases and in general may offer an additional method for the examination of multimeric proteins.

  8. D-alanine carboxypeptidase activity of Micrococcus lysodeikticus released into the protoplasting medium.

    PubMed

    Linder, R; Salton, M R

    1975-06-16

    Conversion of whole cells of Micrococcus lysodeikticus to protoplasts allowed the release of a soluble form of a D-alanine carboxypeptidase into the protoplasting medium. The enzyme cleaves the terminal D-alanine from the radioactively labelled UDP-N-acetylmuramyl-pentapeptide containing L-lysine as the diamino acid. However, the enzyme is only minimally active in this fraction so that it had to be enriched and partially purified before its properties could be studied. Chromatography on carboxymethyl-Sephadex removed the lysozyme used in the protoplasting of the cells. The material which was unadsorbed to the column was applied to an affinity chromatography column of Ampicillin-Sepharose. Most of the contaminating protein was washed from the column while the D-alanine carboxypeptidase adhered to the resin and could be eluted with 0.5 M Tris-HCl buffer pH 8.6. Some of the properties of the enzymic activity were studied using this preparation. The enzyme was activated by Mg2+ ions with a broad optimum from 15--35 mM. It was maximally active when NaCl at a concentrations of 0.06--0.08 M was added to the assay, and the pH curve was biphasic with an alkaline optimum. The Km for substrate was found to be 0.118 mM. Enzymic activity was completely inhibited by low concentrations of Ampicillin and penicillin G.

  9. Microbial diversity in firework chemical exposed soil and water samples collected in Virudhunagar district, Tamil Nadu, India.

    PubMed

    Dhasarathan, P; Theriappan, P; Ashokraja, C

    2010-03-01

    Microbial diversity of soil and water samples collected from pyrochemicals exposed areas of Virdhunagar district (Tamil Nadu, India) was studied. Soil and water samples from cultivable area, waste land and city area of the same region were also studied for a comparative acount. There is a remarkable reduction in total heterotrophic bacterial population (THB) in pyrochemicals exposed soil and water samples (42 × 10(4) CFU/g and 5.6 × 10(4) CFU/ml respectively), compared to the THB of cultivable area soil and water samples (98 × 10(7) CFU/g and 38.6 × 10(7) CFU/ml). The generic composition the THB of the pyrochemicals exposed samples too exhibited considerable change compared to other samples. Pseudomonas sp. was the predominant one (41.6%) followed by Achromobacter sp. (25%) in pyrochemical exposed soil and Pseudomonas sp. was the predominant one (25%) in pyrochemical exposed water samples followed by Bacillus sp. (25%) and Micrococcus sp. (16.6%). It was observed that Cornybacterium sp. and Micrococcus sp. were absent completely in pyrochemical exposed soil and Achromobacter sp. was missing in the pyrochemical exposed water samples, which were present in the other samples. The outcome of this study clearly demonstrates that pollutants such as chemicals used in pyrotechniques affect the microbial biodiversity and suitable measures have to be taken to control the pollution level and to save biodiversity.

  10. Irradiation of Microbes from Spent Nuclear Fuel Storage Pool Environments

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Breckenridge, C.R.; Watkins, C.S.; Bruhn, D.F.

    Microbes have been isolated and identified from spent nuclear fuel storage pools at the Idaho National Engineering and Environmental Laboratory (INEEL). Included among these are Corynebacterium aquaticum, Pseudomonas putida, Comamonas acidovorans, Gluconobacter cerinus, Micrococcus diversus, Rhodococcus rhodochrous, and two strains of sulfate-reducing bacteria (SRB). We examined the sensitivity of these microbes to a variety of total exposures of radiation generated by a 6-MeV linear accelerator (LINAC). The advantage of using a LINAC is that it provides a relatively quick screen of radiation tolerance. In the first set of experiments, we exposed each of the aforementioned microbes along with four additionalmore » microbes, pseudomonas aeruginosa, Micrococcus luteus, Escherchia coli, and Deinococcus radiodurans to exposures of 5 x 10{sup 3} and 6 x 10{sup 4} rad. All microbial specimens withstood the lower exposure with little or no reduction in cell population. Upon exposing the microbes to the larger dose of 6 x 10{sup 4} rad, we observed two distinct groupings: microbes that demonstrate resistance to radiation, and microbes that display intolerance through a dramatic reduction from their initial population. Microbes in the radiation tolerant grouping were exposed to 1.1 x 10{sup 5} rad to examine the extent of their resistance. We observe a correlation between radiation resistance and gram stain. The gram-positive species we examined seem to demonstrate a greater radiation resistance.« less

  11. Peroxiredoxin 1 protects the pea aphid Acyrthosiphon pisum from oxidative stress induced by Micrococcus luteus infection.

    PubMed

    Zhang, Yongdong; Lu, Zhiqiang

    2015-05-01

    Reactive oxygen species (ROSs) are generated in organisms in response to infections caused by invading microbes. However, excessive ROSs will inflict oxidative damage on the host. Peroxiredoxins (Prxs) are antioxidative enzymes that may eliminate ROSs efficiently. In this study, ApPrx1 from the pea aphid Acyrthosiphon pisum was cloned, and its function was investigated in vitro and in vivo. In the presence of DTT, recombinant ApPrx1 protein from Escherichia coli showed antioxidative activity by eliminating H2O2 effectively. The H2O2 levels were significantly higher in Micrococcus luteus-infected aphids than in uninfected aphids, and ApPrx1 expression was remarkably up-regulated when the aphids were infected with M. luteus or injected with H2O2. When ApPrx1 expression was reduced by dsRNA injection, the survival of the aphids decreased significantly after M. luteus infection. Knockdown of ApPrx1 decreased M. luteus loads inside the aphids 48h post-infection. While under infection conditions, the H2O2 levels were much higher in ApPrx1 knockdown aphids than in dsGFP-injected aphids, indicating that the decreased survival of the aphids was caused by increased oxidative stress. Taken together, our results reveal that ApPrx1 plays a protective role in oxidative stress caused by bacterial infection. Copyright © 2015 Elsevier Inc. All rights reserved.

  12. Keratinolytic abilities of Micrococcus luteus from poultry waste.

    PubMed

    Laba, Wojciech; Choinska, Anna; Rodziewicz, Anna; Piegza, Michal

    2015-01-01

    Keratinolytic microorganisms have become the subject of scientific interest due to their ability to biosynthesize specific keratinases and their prospective application in keratinic waste management. Among several bacterial classes, actinobacteria remain one of the most important sources of keratin-degrading strains, however members of the Micrococcaceae family are rarely scrutinized in regard to their applicatory keratinolytic potential. The tested Micrococcus sp. B1pz isolate from poultry feather waste was identified as M. luteus. The strain, grown in the medium with 1-2% chicken feathers and a yeast extract supplement, produced keratinases of 32 KU and lower level of proteases, 6 PU. It was capable to effectively decompose feathers or "soft" keratin of stratum corneum, in contrast to other "hard" hair-type keratins. The produced keratinolytic enzymes were mainly a combination of alkaline serine or thiol proteases, active at the optimum pH 9.4, 55 °C. Four main protease fractions of 62, 185, 139 and 229 kDa were identified in the crude culture fluid. The research on the auxiliary role of reducing factors revealed that reducing sulfur compounds could be applied in keratinolysis enhancement during enzymatic digestion of keratin, rather than in culture conditions. The presented M. luteus isolate exhibits a significant keratinolytic potential, which determines its feasible applicatory capacity towards biodegradation of poultry by-products or formulation of keratin-based feed components.

  13. [The effect of nitrofurans on the membrane apparatus of coccal bacteria].

    PubMed

    Kutsmako, R T; Kuliash, Iu V; Rudzit, E A; Ermachenko, V A; Simakova, I M

    1984-01-01

    Secondary membrane effects on the membrane apparatus of coccus bacteria were being studied. Cultivation of Micrococcus lysodeikticus and Staphylococcus aureus cells on subbacteriostatic concentrations of nitrofurans results in a lower biosynthesis of many membrane proteins, as well as in inhibiting the activity of respiratory enzymes, i. e. the specific concentration of cytochromes and specific activity of NADH-, malate-, lactate oxidases and some reductases drop. Some cytological changes were revealed, when cells were grown on solafur, furazolidone, and furacriline.

  14. [Production and characteristics of bacteria-labeled talc dust for experimental air hygiene studies].

    PubMed

    Ohgke, H; Oldenburg, B; Gropengiesser, R; Herbst, M

    1983-04-01

    Freeze-drying of suspensions of Micrococcus luteus together with talc yields bacteria-labelled dust. This material can be used in experimental air hygiene. Loss of viability due to drying in air during experiments can be expected to be negligible. A wide range of particle diameters (1 to greater than 23 micron) is available. Scanning electron microscopy shows the bacteria sticking on talc particles after freeze-drying (Fig. 3a + b). Viable counts of the material decreased very slowly on storage.

  15. One-pot and two-step synthesis of novel carbonylthioureas and dicarbonyldithioureas derivatives

    NASA Astrophysics Data System (ADS)

    Banaei, Alireza; Shiran, Jafar Abbasi; Saadat, Afshin; Ardabili, Farnaz Fazlalizadeh; McArdle, Patrick

    2015-11-01

    One-pot, two-step synthesis of several 1-cyclopropanecarbonyl-3-(substituted phenyl)-thioureas and 1-(phenylene-1,4-dione)-3,3‧-(substituted phenyl)-dithioureas have been successfully prepared. The structures of the synthesized compounds were confirmed by elemental analysis, FT-IR spectroscopy and NMR. Also the crystal structure one of these compounds was determined by X-ray crystallography. All synthesized compounds were evaluated for antibacterial activity using Salmonella enterica (SE), Micrococcus luteus (ML), Bacillus subtilis (BS) and Pseudomonas aeruginosa (PS).

  16. New method for investigation of cells and other biological objects in analytical cytology

    NASA Astrophysics Data System (ADS)

    Bilyi, Olexander I.; Getman, Vasyl B.; Kostyukevych, Sergey A.

    2001-05-01

    New method and instrument intended for checking the content of biology particles in dimension band 0.1-10.0 mkm in water flow is described in this report. The instrument measures the intensity of light scattered by the particles suspended in liquid flow when they are crossing the laser beam. The results of studying light scattered by platelet and bacterium's such a Pseudomonas aeruginosa, Escherichia coli, Micrococcus lutteus in such a liquid mediums as physiological solution and glucose solution are described.

  17. Synthesis, characterization, and controlled release antibacterial behavior of antibiotic intercalated Mg–Al layered double hydroxides

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wang, Yi; Zhang, Dun, E-mail: zhangdun@qdio.ac.cn

    Graphical abstract: The antibiotic anion released from Mg–Al LDHs provides a controlled release antibacterial activity against the growth of Micrococcus lysodeikticus in 3.5% NaCl solution. Highlights: ► Antibiotic anion intercalated LDHs were synthesized and characterized. ► The ion-exchange one is responsible for the release process. ► The diffusion through particle is the release rate limiting step. ► LDHs loaded with antibiotic anion have high antibacterial capabilities. -- Abstract: Antibiotic–inorganic clay composites including four antibiotic anions, namely, benzoate (BZ), succinate (SU), benzylpenicillin (BP), and ticarcillin (TC) anions, intercalated Mg–Al layered double hydroxides (LDHs) were synthesized via ion-exchange. Powder X-ray diffraction andmore » Fourier transform infrared spectrum analyses showed the successful intercalation of antibiotic anion into the LDH interlayer. BZ and BP anions were accommodated in the interlayer region as a bilayer, whereas SU and TC anions were intercalated in a monolayer arrangement. Kinetic simulation of the release data indicated that ion-exchange was responsible for the release process, and the diffusion through the particles was the rate-limiting step. The antibacterial capabilities of LDHs loaded with antibiotic anion toward Micrococcus lysodeikticus growth were analyzed using a turbidimetric method. Significant high inhibition rate was observed when LDH nanohybrid was introduced in 3.5% NaCl solution. Therefore, this hybrid material may be applied as nanocontainer in active antifouling coating for marine equipment.« less

  18. In vitro antioxidant, anticholinesterase and antimicrobial activity studies on three Agaricus species with fatty acid compositions and iron contents: a comparative study on the three most edible mushrooms.

    PubMed

    Öztürk, Mehmet; Duru, Mehmet Emin; Kivrak, Seyda; Mercan-Doğan, Nazime; Türkoglu, Aziz; Özler, Mehmet Ali

    2011-06-01

    The fatty acids of Agaricus essettei, Agaricus bitorquis and Agaricus bisporus were investigated by using GC and GC-MS. The dominant fatty acids were found to be linoleic (61.82-67.29%) and palmitic (12.67-14.71%) acids among the 13 fatty acids detected in the oils. Total unsaturation for the oils was calculated as 77.50%, 77.44%, and 79.72%, respectively. In vitro antioxidant, anticholinesterase and antimicrobial activities were also studied. The ethyl acetate extract of Agaricus bitorquis showed the highest activity in β-carotene-linoleic acid, DPPH(·) and ABTS(·)(+) assays, while the hexane extract of Agaricus bisporus exhibited the best metal chelating activity. The ethyl acetate and hexane extract of Agaricus bitorquis and the hexane extract of Agaricus essettei showed meaningful butyrylcholinesterase activity being close to that of galantamine. The extracts were found to be effective on Gram (+) bacteria, especially against Micrococcus luteus, Micrococcus flavus, Bacillus subtilis and Bacillus cereus. In conclusion, Agaricus bitorquis and Agaricus essettei demonstrated higher iron content, and better antioxidant, anticholinesterase and antimicrobial activities than those of Agaricus bisporus commonly consumed mushroom. Hence, Agaricus species, particularly Agaricus bitorquis might be useful as antioxidant agents and moderate anticholinesterase agents, and their extracts will probably be used for development of dietary foods, food products and additives. Copyright © 2011 Elsevier Ltd. All rights reserved.

  19. Bioremediation potential of microorganisms derived from petroleum reservoirs.

    PubMed

    Dellagnezze, Bruna Martins; de Sousa, Gabriel Vasconcelos; Martins, Laercio Lopes; Domingos, Daniela Ferreira; Limache, Elmer E G; de Vasconcellos, Suzan Pantaroto; da Cruz, Georgiana Feitosa; de Oliveira, Valéria Maia

    2014-12-15

    Bacterial strains and metagenomic clones, both obtained from petroleum reservoirs, were evaluated for petroleum degradation abilities either individually or in pools using seawater microcosms for 21 days. Gas Chromatography-Flame Ionization Detector (GC-FID) and Gas Chromatography-Mass Spectrometry (GC-MS) analyses were carried out to evaluate crude oil degradation. The results showed that metagenomic clones 1A and 2B were able to biodegrade n-alkanes (C14 to C33) and isoprenoids (phytane and pristane), with rates ranging from 31% to 47%, respectively. The bacteria Dietzia maris CBMAI 705 and Micrococcus sp. CBMAI 636 showed higher rates reaching 99% after 21 days. The metagenomic clone pool biodegraded these compounds at rates ranging from 11% to 45%. Regarding aromatic compound biodegradation, metagenomic clones 2B and 10A were able to biodegrade up to 94% of phenanthrene and methylphenanthrenes (3-MP, 2-MP, 9-MP and 1-MP) with rates ranging from 55% to 70% after 21 days, while the bacteria Dietzia maris CBMAI 705 and Micrococcus sp. CBMAI 636 were able to biodegrade 63% and up to 99% of phenanthrene, respectively, and methylphenanthrenes (3-MP, 2-MP, 9-MP and 1-MP) with rates ranging from 23% to 99% after 21 days. In this work, isolated strains as well as metagenomic clones were capable of degrading several petroleum compounds, revealing an innovative strategy and a great potential for further biotechnological and bioremediation applications. Copyright © 2014 Elsevier Ltd. All rights reserved.

  20. Coral-Associated Actinobacteria: Diversity, Abundance, and Biotechnological Potentials

    PubMed Central

    Mahmoud, Huda M.; Kalendar, Aisha A.

    2016-01-01

    Marine Actinobacteria, particularly coral-associated Actinobacteria, have attracted attention recently. In this study, the abundance and diversity of Actinobacteria associated with three types of coral thriving in a thermally stressed coral reef system north of the Arabian Gulf were investigated. Coscinaraea columna, Platygyra daedalea and Porites harrisoni have been found to harbor equivalent numbers of culturable Actinobacteria in their tissues but not in their mucus. However, different culturable actinobacterial communities have been found to be associated with different coral hosts. Differences in the abundance and diversity of Actinobacteria were detected between the mucus and tissue of the same coral host. In addition, temporal and spatial variations in the abundance and diversity of the cultivable actinobacterial communities were detected. In total, 19 different actinobacterial genera, namely Micrococcus, Brachybacterium, Brevibacterium, Streptomyces, Micromonospora, Renibacterium, Nocardia, Microbacterium, Dietzia, Cellulomonas, Ornithinimicrobium, Rhodococcus, Agrococcus, Kineococcus, Dermacoccus, Devriesea, Kocuria, Marmoricola, and Arthrobacter, were isolated from the coral tissue and mucus samples. Furthermore, 82 isolates related to Micromonospora, Brachybacterium, Nocardia, Micrococcus, Arthrobacter, Rhodococcus, and Streptomyces showed antimicrobial activities against representative Gram-positive and/or Gram-negative bacteria. Even though Brevibacterium and Kocuria were the most dominant actinobacterial isolates, they failed to show any antimicrobial activity, whereas less dominant genera, such as Streptomyces, did show antimicrobial activity. Focusing on the diversity of coral-associated Actinobacteria may help to understand how corals thrive under harsh environmental conditions and may lead to the discovery of novel antimicrobial metabolites with potential biotechnological applications. PMID:26973601

  1. [Micrococcus sp.--the pathogen of leaf necrosis of horse-chestnuts (Aesculus L.) in Kiev].

    PubMed

    Iakovleva, L M; Makhinia, L V; Shcherbina, T N; Ogorodnik, L E

    2013-01-01

    A group of phytopathogenic bacteria was isolated from patterns of drying horse-chestnuts (Aesculus L.), which grow in Kyiv. The properties of slowly growing, highly aggressive microorganisms have been described in the paper. They grow up on the 8-10th day after sowing. The investigated microorganisms form very small (0.5-1 mm in diameter) colonies on the potato agar. Bacteria are protuberant, shining, smooth with flat edges, they are pale yellow, yellow, or pink. The bacteria are Gram-positive, spherical, are disposed in smears singly, in pairs, as accumulations, or netting. They are aerobes, do not form spores, are not mobile. They are inert in respect of different sources of carbon. They reduce nitrates, do not dilute gelatin, do not hydrolyze starch, do not release hydrogen sulphide and indole. The bacteria are catalase-positive, oxidase-negative. They do not cause potato and carrot rot. They lose quickly their viability under the laboratory conditions. The saturated acids C 14:0; C 15:0; C16:0; C18:0 have been revealed in the composition of cellular fatty acids. Microorganisms are identified as Micrococcus sp. Under artificial inoculation this highly aggressive pathogen causes drying of the horse-chestnut buds and necrosis, which occupies 1/3-1/2 of the leaf plate. A wide zone of chlorosis, surrounding necrosis, may occupy the whole leaf surface. The infected leaves use to twist up from the top (apex) or along a midrib and to dry.

  2. Structure of FabH and factors affecting the distribution of branched fatty acids in Micrococcus luteus.

    PubMed

    Pereira, Jose H; Goh, Ee-Been; Keasling, Jay D; Beller, Harry R; Adams, Paul D

    2012-10-01

    Micrococcus luteus is a Gram-positive bacterium that produces iso- and anteiso-branched alkenes by the head-to-head condensation of fatty-acid thioesters [coenzyme A (CoA) or acyl carrier protein (ACP)]; this activity is of interest for the production of advanced biofuels. In an effort to better understand the control of the formation of branched fatty acids in M. luteus, the structure of FabH (MlFabH) was determined. FabH, or β-ketoacyl-ACP synthase III, catalyzes the initial step of fatty-acid biosynthesis: the condensation of malonyl-ACP with an acyl-CoA. Analysis of the MlFabH structure provides insights into its substrate selectivity with regard to length and branching of the acyl-CoA. The most structurally divergent region of FabH is the L9 loop region located at the dimer interface, which is involved in the formation of the acyl-binding channel and thus limits the substrate-channel size. The residue Phe336, which is positioned near the catalytic triad, appears to play a major role in branched-substrate selectivity. In addition to structural studies of MlFabH, transcriptional studies of M. luteus were also performed, focusing on the increase in the ratio of anteiso:iso-branched alkenes that was observed during the transition from early to late stationary phase. Gene-expression microarray analysis identified two genes involved in leucine and isoleucine metabolism that may explain this transition.

  3. Effects of artificial infection of Litopenaeus vannamei by Micrococcus lysodeikticus and WSSV on the activity of immunity related enzymes.

    PubMed

    Sun, Cheng-Bo; Wang, Gang; Chan, Siuming F

    2015-10-01

    In this study, the activities of 5 immunity related enzymes namely acid phosphatase (ACP), alkaline phosphatase (AKP), phenoloxidase (PO), peroxidase (POD) and lysozyme phosphatase (LZM)) of Litopenaeus vannamei after they have been injected with different concentrations of Micrococcus lysodeikticus and the white spot syndrome virus (WSSV) were examined. The cumulative mortality at 0, 24, 48, 72, 96 h was obtained. Copy numbers of WSSV in L. vannamei after a single infection, secondary infection and concurrent infection were measured. Hemolymph samples of M. lysodeikticus and WSSV injected shrimp were collected at 0, 6, 12 24, 48, 72, 78, 84, 96 and 120 h. The results were: (i) The cumulative mortality of L. vannamei increased as the shrimp were infected with higher concentration of the bacteria; (ii) The most sensitive changes of ACP, AKP and LZM were in the 6.2 × 10(5), 6.2 × 10(6), 6.2 × 10(7) cfu/mL M. lysodeikticus group; (iii) ACP but LZM were more sensitive to M. lysodeikticus than WSSV, and AKP, PO and POD is more sensitive to WSSV; (iv) The copies of WSSV in the co-injected group were higher than WSSV-single infection and WSSV-bacteria-secondary infection group at 48 h. The amount of WSSV in L. vannamei of concurrent infection and WSSV-bacteria-secondary infection groups were higher than that of the WSSV-single infection group. Copyright © 2015. Published by Elsevier Ltd.

  4. Purification and characterization of an alkaline protease from Micrococcus sp. isolated from the South China Sea

    NASA Astrophysics Data System (ADS)

    Hou, Enling; Xia, Tao; Zhang, Zhaohui; Mao, Xiangzhao

    2017-04-01

    Protease is wildly used in various fields, such as food, medicine, washing, leather, cosmetics and other industrial fields. In this study, an alkaline protease secreted by Micrococcus NH54PC02 isolated from the South China Sea was purified and characterized. The growth curve and enzyme activity curve indicated that the cell reached a maximum concentration at the 30th hour and the enzyme activity reached the maximum value at the 36th hour. The protease was purified with 3 steps involving ammonium sulfate precipitation, ion-exchange chromatography and hydrophobic chromatography with 8.22-fold increase in specific activity and 23.68% increase in the recovery. The molecular mass of the protease was estimated to be 25 kDa by SDS-PAGE analysis. The optimum temperature and pH for the protease activity were 50°C and pH 10.0, respectively. The protease showed a strong stability in a wide range of pH values ranging from 6.0-11.0, and maintained 90% enzyme activity in strong alkaline environment with pH 11.0. Inhibitor trials indicated that the protease might be serine protease. But it also possessed the characteristic of metalloprotease as it could be strongly inhibited by EDTA and strongly stimulated by Mn2+. Evaluation of matrix-assisted laser desorption ionization/time-of-flight MS (MALDI-TOF-TOF/MS) showed that the protease might belong to the peptidase S8 family.

  5. Effects of the combination between bio-surfactant product types and washing times on the removal of crude oil in nonwoven fabric

    NASA Astrophysics Data System (ADS)

    Triawan, Agus; Ni'matuzahroh, Supriyanto, Agus

    2017-06-01

    This research aimed to characterize bio-surfactants produced by Bacillus subtilis 3KP, Pseudomonas putida T1-8, Micrococcus sp. L II 61 and Acinetobacter sp. P 2(1) and to investigate its combination's effects on the removal of crude oil in nonwoven fabric with different washing times vary from 12, 24 to 36 hours. The production of bio-surfactants was done on Synthetic Mineral Water mixed with molasses 4% within four days. The bio-surfactant products were characterized by measuring the Surface Tension (ST) (mN/m) and Emulsion Activity (EA) (%). Oil removal experiment was done by mixing 10 mL bio-surfactant with nonwoven fabric that contains crude oil into 50 mL bottle inside a shaker. The removed crude oil was extracted with n-hexane and measured gravimetrically. The results were then being analyzed with two ways ANOVA and Duncan test. Bio-surfactant produced by four bacteria has variations of Surface Tension and Emulsion Activity values. Bio-surfactant produced by Bacillus subtilis 3KP and Pseudomonas putida T1-8 showed the increasing of crude oil removal as washing times increase, while bio-surfactant produced by Micrococcus sp. L II 61 and Acinetobacter sp. P2(1) showed the decreasing result at 36 hours. However, the combination that showed the best result was Acinetobacter sp. P 2(1) at 24 hours valued 65,3%.

  6. Gene cloning and characterization of a cold-adapted β-glucosidase belonging to glycosyl hydrolase family 1 from a psychrotolerant bacterium Micrococcus antarcticus.

    PubMed

    Fan, Hong-Xia; Miao, Li-Li; Liu, Ying; Liu, Hong-Can; Liu, Zhi-Pei

    2011-06-10

    The gene bglU encoding a cold-adapted β-glucosidase (BglU) was cloned from Micrococcus antarcticus. Sequence analysis revealed that the bglU contained an open reading frame of 1419 bp and encoded a protein of 472 amino acid residues. Based on its putative catalytic domains, BglU was classified as a member of the glycosyl hydrolase family 1 (GH1). BglU possessed lower arginine content and Arg/(Arg+Lys) ratio than mesophilic GH1 β-glucosidases. Recombinant BglU was purified with Ni2+ affinity chromatography and subjected to enzymatic characterization. SDS-PAGE and native staining showed that it was a monomeric protein with an apparent molecular mass of 48 kDa. BglU was particularly thermolabile since its half-life time was only 30 min at 30°C and it exhibited maximal activity at 25°C and pH 6.5. Recombinant BglU could hydrolyze a wide range of aryl-β-glucosides and β-linked oligosaccharides with highest activity towards cellobiose and then p-nitrophenyl-β-d-glucopyranoside (pNPG). Under the optimal conditions with pNPG as substrate, the K(m) and k(cat) were 7 mmol/L and 7.85 × 103/s, respectively. This is the first report of cloning and characterization of a cold-adapted β-glucosidase belonging to GH1 from a psychrotolerant bacterium. Copyright © 2011 Elsevier Inc. All rights reserved.

  7. Kocuria varians infection associated with brain abscess: a case report.

    PubMed

    Tsai, Cheng-Yu; Su, Shou-hsin; Cheng, Yu-Hsin; Chou, Yu-lin; Tsai, Tai-Hsin; Lieu, Ann-Shung

    2010-04-27

    Kocuria, established by Stackebrandt et al., previously was classified into Micrococcus. Only two species, K. rosea and K. kristinae are reported to be associated as pathogenic and found with catheter-related bacteremia and acute cholecystitis. We herein report the first case of brain abscess caused by Kocuria varians, a gram-positive microorganism, in a 52-year-old man. Hematogenous spread is the probable pathogenesis. This report presents a case of Kocuria varians brain abscess successfully treated with surgical excision combined with antimicrobial therapy. In addition, Vitek 2 system has been used to identify and differentiate between coagulase-negative staphylococcus.

  8. Functional recognition imaging using artificial neural networks: applications to rapid cellular identification via broadband electromechanical response

    NASA Astrophysics Data System (ADS)

    Nikiforov, M. P.; Reukov, V. V.; Thompson, G. L.; Vertegel, A. A.; Guo, S.; Kalinin, S. V.; Jesse, S.

    2009-10-01

    Functional recognition imaging in scanning probe microscopy (SPM) using artificial neural network identification is demonstrated. This approach utilizes statistical analysis of complex SPM responses at a single spatial location to identify the target behavior, which is reminiscent of associative thinking in the human brain, obviating the need for analytical models. We demonstrate, as an example of recognition imaging, rapid identification of cellular organisms using the difference in electromechanical activity over a broad frequency range. Single-pixel identification of model Micrococcus lysodeikticus and Pseudomonas fluorescens bacteria is achieved, demonstrating the viability of the method.

  9. Structural studies of 4-aminoantipyrine derivatives

    NASA Astrophysics Data System (ADS)

    Cunha, Silvio; Oliveira, Shana M.; Rodrigues, Manoel T.; Bastos, Rodrigo M.; Ferrari, Jailton; de Oliveira, Cecília M. A.; Kato, Lucília; Napolitano, Hamilton B.; Vencato, Ivo; Lariucci, Carlito

    2005-10-01

    Reaction of 4-aminoantipyrine with acetylacetone, ethyl acetoacetate, benzoyl isothiocyanate, phenyl isothiocyanate, maleic anhydride and methoxymethylene Meldrum's acid afforded a series of new antipyrine derivatives. The antibacterial activity of the synthesized compounds against Micrococcus luteus ATCC 9341, Staphilococcus aureus ATCC 29737, and Escherichia coli ATCC 8739 was evaluated and the minimal inhibitory concentration determined. Modest activity was found only to the maleamic acid obtained from the reaction of 4-aminoantipyrine and maleic anhydride. 1H NMR investigation of this maleamic acid showed that it is slowly converted to the corresponding toxic maleimide. The structures of three derivatives were determined by X-ray diffraction analysis.

  10. Regioselective synthesis of novel 3-allyl-2-(substituted imino)-4-phenyl-3H-thiazole and 2,2‧-(1,3-phenylene)bis(3-substituted-2-imino-4-phenyl-3H-thiazole) derivatives as antibacterial agents

    NASA Astrophysics Data System (ADS)

    Abbasi Shiran, Jafar; Yahyazadeh, Asieh; Mamaghani, Manouchehr; Rassa, Mehdi

    2013-05-01

    Several novel 3-allyl-2-(substituted imino)-4-phenyl-3H-thiazole derivatives were synthesized by the reaction of allyl-thioureas and 2-bromoacetophenone. We also report the synthesis of bis-allyl-3H thiazoles using the reaction of various isothiocyanates and 1,3-phenylenediamine. The structures of all compounds were characterized by spectral and elemental analysis. Most of the synthesized compounds exhibited efficient antibacterial activities against Salmonella enterica, Micrococcus luteus, Bacillus subtilis and Pseudomonas aeruginosa.

  11. Some diseases and parasites of captive woodcocks

    USGS Publications Warehouse

    Locke, L.N.; Stickel, W.H.; Geis, S.A.

    1965-01-01

    Observations were made concerning the diseases and parasites of a group of woodcocks (Philohela minor) caught in Massachusetts in the summer of 1960 and kept in captivity in Maryland, and of another group caught and kept in Louisiana in the winter of 1960-61. Bumblefoot, a granulomatous swelling of the foot caused by Micrococcus sp., is reported for woodcocks for the first time. Six of 31 woodcocks were infected with a renal coccidium of an undetermined species. Tetrameres sp. was found in 4 of 31 birds examined. Sarcocystis was found in one bird. Aerosaculitis was found in several.

  12. Growth study and hydrocarbonoclastic potential of microorganisms isolated from aviation fuel spill site in Ibeno, Nigeria.

    PubMed

    Etuk, C U; John, R C; Ekong, U E; Akpan, M M

    2012-10-01

    The growth study and hydrocarbonoclastic potential of microorganisms isolated from aviation fuel spill sites at Inua-eyet Ikot in Ibeno, Nigeria were examined using standard microbiological methods. The results of the analysis revealed that the viable plate count of microorganisms in the polluted soil ranged from 2.2 ± 0.04 × 10(3) to 3.4 ± 0.14 × 10(6) cfu/g for bacteria and 1.4 ± 0.5 × 10(2) to 2.3 ± 0.4 × 10(4) cfu/g for fungi while count of biodegraders ranged from 1.2 ± 0.4 × 10(3) to 2.1 ± 0.8 × 10(5) cfu/g. A total of 11 microbial isolates comprising of Micrococcus, Klebsiella, Flavobacterium, Bacillus, Pseudomonas, Candida, Aspergillus, Cladosporium, Penicillium, Saccharomyces and Fusarium were characterized. The ability of the selected isolates to utilize the pollutant (aviation fuel) as their sole source of carbon and energy was examined and noticed to vary in growth profiles between the isolates. The results of their degradability after 28 days of incubation shows that species of Cladosporium, Pseudomonas, Candida, Bacillus, Micrococcus and Penicillium were the most efficient Aviation fuel degraders with percentage weight loss of 86.2, 78.4, 78, 56, 53 and 50.6 respectively. Flavobacterium, Saccharomyces and Aspergillus exhibited moderate growth with percentage weight loss of 48, 45.8 and 43.4 respectively while Klebsiella and Fusarium species showed minimal growth with percentage weight loss of 20 and 18.5 respectively. The results imply that the most efficient biodegraders like Cladosporium, Pseudomonas, Candida, Bacillus and Microoccus could tolerate and remove aviation fuel from the environment.

  13. The Effect of Chronic Alcoholism on the Conjunctival Flora.

    PubMed

    Gunduz, Göksel; Gunduz, Abuzer; Polat, Nihat; Cumurcu, Birgul Elbozan; Yakupogulları, Yusuf

    2016-06-01

    We aimed to investigate the effect of alcohol abuse on the conjunctival flora. The cases were evaluated as two groups. The study group consisted of 55 heavy-drinking males diagnosed with alcohol abuse, while the control group consisted of 55 males without a history of alcohol abuse. Samples were taken from the inferior fornix conjunctiva with sterile cotton-tipped swabs (Amies transport medium) for culture. The samples were inoculated into blood agar, chocolate agar, eosine methylene blue agar and Saboraud-Dextrose agar (Oxoid/UK) with the dilution method. The microorganisms that grew in study group subjects were Coagulase Negative Staphylococcus (CNS) in 30 (54.5%), Staphylococcus aureus in 14 (25.5%), Moraxella spp. in 3 (5.5%), Streptococcus spp. in 3 (5.5), Bacillus spp. in 3 (5.5%), Corynebacterium spp. in 3 (5.5%), Candida spp. in 3 (5.5%), Haemophilus spp. in 2 (3.6%), Acinetobacter spp. in 2 (3.6%), Neisseria spp. in 1 (1.8%) and Micrococcus spp. in 1 (1.8%). The results for control group were CNS in 31 (56.4%), Bacillus spp. in 7 (12.7%), S. aureus in 5 (9.1%), and Corynebacterium spp. in 2 (3.6%). Moraxella spp., Streptococcus spp., Candida spp., Haemophilus spp., Acinetobacter spp., Neisseria spp. and Micrococcus spp. microorganisms grew in the conjunctival flora samples of the study group but not in the control group. S. aureus colonization was significantly higher in the study group than the control group (p < 0.05). The S. aureus colonization rate was statistically significantly higher in the study group. Some microorganisms only grew in the conjunctival flora samples of the study group. These findings indicate that the conjunctival flora in persons with chronic alcoholism is different than the normal population.

  14. Biosynthetic pathway for γ-cyclic sarcinaxanthin in Micrococcus luteus: heterologous expression and evidence for diverse and multiple catalytic functions of C(50) carotenoid cyclases.

    PubMed

    Netzer, Roman; Stafsnes, Marit H; Andreassen, Trygve; Goksøyr, Audun; Bruheim, Per; Brautaset, Trygve

    2010-11-01

    We report the cloning and characterization of the biosynthetic gene cluster (crtE, crtB, crtI, crtE2, crtYg, crtYh, and crtX) of the γ-cyclic C(50) carotenoid sarcinaxanthin in Micrococcus luteus NCTC2665. Expression of the complete and partial gene cluster in Escherichia coli hosts revealed that sarcinaxanthin biosynthesis from the precursor molecule farnesyl pyrophosphate (FPP) proceeds via C(40) lycopene, C(45) nonaflavuxanthin, C(50) flavuxanthin, and C(50) sarcinaxanthin. Glucosylation of sarcinaxanthin was accomplished by the crtX gene product. This is the first report describing the biosynthetic pathway of a γ-cyclic C(50) carotenoid. Expression of the corresponding genes from the marine M. luteus isolate Otnes7 in a lycopene-producing E. coli host resulted in the production of up to 2.5 mg/g cell dry weight sarcinaxanthin in shake flasks. In an attempt to experimentally understand the specific difference between the biosynthetic pathways of sarcinaxanthin and the structurally related ε-cyclic decaprenoxanthin, we constructed a hybrid gene cluster with the γ-cyclic C(50) carotenoid cyclase genes crtYg and crtYh from M. luteus replaced with the analogous ε-cyclic C(50) carotenoid cyclase genes crtYe and crtYf from the natural decaprenoxanthin producer Corynebacterium glutamicum. Surprisingly, expression of this hybrid gene cluster in an E. coli host resulted in accumulation of not only decaprenoxanthin, but also sarcinaxanthin and the asymmetric ε- and γ-cyclic C(50) carotenoid sarprenoxanthin, described for the first time in this work. Together, these data contributed to new insight into the diverse and multiple functions of bacterial C(50) carotenoid cyclases as key catalysts for the synthesis of structurally different carotenoids.

  15. Structural changes and cellular localization of resuscitation-promoting factor in environmental isolates of Micrococcus luteus.

    PubMed

    Koltunov, Viktoria; Greenblatt, Charles L; Goncharenko, Anna V; Demina, Galya R; Klein, Benjamin Y; Young, Michael; Kaprelyants, Arseny S

    2010-02-01

    Dormancy among nonsporulating actinobacteria is now a widely accepted phenomenon. In Micrococcus luteus, the resuscitation of dormant cells is caused by a small secreted protein (resuscitation-promoting factor, or Rpf) that is found in "spent culture medium." Rpf is encoded by a single essential gene in M. luteus. Homologs of Rpf are widespread among the high G + C Gram-positive bacteria, including mycobacteria and streptomycetes, and most organisms make several functionally redundant proteins. M. luteus Rpf comprises a lysozyme-like domain that is necessary and sufficient for activity connected through a short linker region to a LysM motif, which is present in a number of cell-wall-associated enzymes. Muralytic activity is responsible for resuscitation. In this report, we characterized a number of environmental isolates of M. luteus, including several recovered from amber. There was substantial variation in the predicted rpf gene product. While the lysozyme-like and LysM domains showed little variation, the linker region was elongated from ten amino acid residues in the laboratory strains to as many as 120 residues in one isolate. The genes encoding these Rpf proteins have been characterized, and a possible role for the Rpf linker in environmental adaptation is proposed. The environmental isolates show enhanced resistance to lysozyme as compared with the laboratory strains and this correlates with increased peptidoglycan acetylation. In strains that make a protein with an elongated linker, Rpf was bound to the cell wall, rather than being released to the growth medium, as occurs in reference strains. This rpf gene was introduced into a lysozyme-sensitive reference strain. Both rpf genes were expressed in transformants which showed a slight but statistically significant increase in lysozyme resistance.

  16. Viability and biomass of Micrococcus luteus DE2008 at different salinity concentrations determined by specific fluorochromes and CLSM-image analysis.

    PubMed

    Puyen, Zully M; Villagrasa, Eduard; Maldonado, Juan; Esteve, Isabel; Solé, Antonio

    2012-01-01

    In previous studies, our group developed a method based on Confocal Laser Scanning Microscopy and Image Analysis (CLSM-IA) to analyze the diversity and biomass of cyanobacteria in microbial mats. However, this method cannot be applied to heterotrophic microorganisms, as these do not have autofluorescence. In this article, we present a method that combines CLSM-IA and Hoechst 33342 and SYTOX Green fluorochromes (FLU-CLSM-IA) to determine the viability and biomass of Micrococcus luteus DE2008, isolated from a saline microbial mat (Ebro Delta, Tarragona, Spain). The method has been applied to assess the effect of salinity on this microorganism. A reduction in viability and biomass (live cells) was observed as the salt concentration increases. The largest effect was at 100‰ NaCl with a cell death of 27.25% and a decrease in total and individual biomass of 39.75 and 0.009 mgC/cm(3), respectively, both with respect to optimal growth (10 ‰ NaCl). On the other hand, another important contribution of this article was that combining the FLU-CLSM-IA results with those achieved by plate counts enabled us to determine, for first time, the viability and the total biomass of the "dormant cells" (66.75% of viability and 40.59 mgC/cm(3) of total biomass at 100‰ NaCl). FLU-CLSM-IA is an efficient, fast, and reliable method for making a total count of cells at pixel level, including the dormant cells, to evaluate the viability and the biomass of a hetetrophic microorganism, M. luteus DE2008.

  17. Radiation-Resistant Micrococcus luteus SC1204 and Its Proteomics Change Upon Gamma Irradiation.

    PubMed

    Deng, Wuyuan; Yang, Yang; Gao, Peng; Chen, Hao; Wen, Wenting; Sun, Qun

    2016-06-01

    To explore the radiation-resistance mechanisms in bacteria, a radiation-resistant strain SC1204 was isolated from the surrounding area of a (60)Co-γ radiation facility. SC1204 could survive up to 8 kGy dose of gamma irradiation and was identified as Micrococcus luteus by phylogenetic analysis of 16S rRNA gene sequences. Its proteomic changes under 2-kGy irradiation were examined by two-dimensional electrophoresis followed by MALDI-TOF-TOF/MS analysis. The results showed that at least 24 proteins displayed significant changes (p < 0.05) at expression level under the radiation stress, among which 22 were successfully identified and classified into the major functional categories of metabolism, energy production and conservation, translation, ribosomal structure, and biogenesis. Among these proteins, leucyl aminopeptidase involved in synthesis of glutathione was the most abundant induced protein during postirradiation recovery, indicating that anti-oxidation protection was the most important line of defense in SC1204 against radiation. The next abundant protein was phosphoribosyl aminoimidazole carboxamide formyltransferase/IMP cyclohydrolase (AICAR Tfase/IMPCH), the key enzyme in the biosynthetic pathway of purine that is anti-radiation compound. Other proteins changing significantly (p < 0.05) after radiation exposure included urocanate hydratase, dihydrolipoyl dehydrogenase, succinyl-CoA synthetase subunit alpha, phosphoglycerate kinase, cell division protein FtsZ, elongation factor Ts and Tu, translation elongation factor Tu and G, 30S ribosomal protein S1, histidyl-tRNA synthetase, and arginyl-tRNA synthetase, which were considered to be the key proteins in urocanate metabolism, tricarboxylic acid cycle, glycolysis, cell division process, and synthesis process of proteins. Therefore, these proteins may also play important roles in radiation resistance in M. luteus.

  18. [Optimization of fermentation conditions for cold-adapted amylase production by Micrococcus antarcticus and its enzymatic properties].

    PubMed

    Fan, Hong-xi; Liu, Ying; Liu, Zhi-pei

    2009-08-15

    By single factor experiments, the fermentation conditions for cold-adapted amylase production from Micrococcus antarcticus were determined as follows(medium g/L): Na2 HPO4 2.0, KH2PO4 1.0, MgSO4 x 7H2O 0.1, NaCl 5.0, (NH4)2SO4 2.5, maltose 5.0, trace element solution 5.0 mL, pH 8.0, 100 mL/Erlenmeyer flask (500 mL); cultivation was in a rotating shaker at 12 degrees C and 160 r/min for 64 h.Under those conditions,the highest total enzyme activity (2.6 U/mL) was obtained and increased by 10.8 fold compared with the original value of 0.24 U/mL before optimization. This amylase was purified by concentration with ultrafiltration membrane module, Hitrap Q anion exchange chromatography and Superdex 200 gel filtration chromatography. The optimal temperature and pH for the purified amylase were 30 degrees C and 6.0, respectively.It still showed high activity at low temperature 10-15 degrees C. It was sensitive to high temperature but was stable at pH 6.0-10.0 with at least 70% activity remained. These results indicated that it was a typical cold-adapted enzyme. The enzyme activity was stimulated by Ca2+, Mn2+, Co2+ and Mg2+; but inhibited by Zn2+, Ba2+, Ag+, Cu2+, Al3+, Fe2, Fe3+, Hg2+, EDTA and citrate. This cold-adapted amylase showed resistance to inactivation of 0.1% nonionic surfactants such as Tween 80, TrintonX-100, etc. Its Km was 0.90 mg/mL.

  19. Proteomic and metabolomic responses in hepatopancreas of Mytilus galloprovincialis challenged by Micrococcus luteus and Vibrio anguillarum.

    PubMed

    Wu, Huifeng; Ji, Chenglong; Wei, Lei; Zhao, Jianmin; Lu, Hongjian

    2013-12-06

    The outbreak of pathogens can induce diseases and lead to massive mortalities of aquaculture animals including fish, mollusk and shrimp. In this work, the responses induced by Micrococcus luteus and Vibrio anguillarum were investigated in hepatopancreas of mussel Mytilus galloprovincialis using proteomics and metabolomics. Metabolic biomarkers demonstrated that M. luteus and V. anguillarum injections could induce osmotic stress and disturbance in energy metabolism. And the uniquely and more markedly altered metabolic biomarkers (glutamine, succinate, aspartate, glucose, ATP, homarine and tyrosine) indicated that V. anguillarum could cause more severe disturbances in osmotic regulation and energy metabolism. The differentially altered proteins meant that M. luteus and V. anguillarum induced different effects in mussels. However, the common proteomic biomarkers, arginine kinase and small heat shock protein, demonstrated that these two bacteria induced similar effects including oxidative stress and disturbance in energy metabolism in M. galloprovincialis. In addition, some metabolic biomarkers, ATP and glutamine, were confirmed by related proteins including arginine kinase, ATP synthase, nucleoside diphosphate kinase and glutamine synthetase in bacteria-challenged mussels. This study demonstrated that proteomics and metabolomics could provide an insightful view into the effects of environmental pathogens to the marine mussel M. galloprovincialis. The outbreak of pathogens can lead to diseases and massive mortalities of aquaculture animals including fish, mollusk and shrimp. The mussel M. galloprovincialis distributes widely along the Bohai coast and is popularly consumed as delicious seafood by local residents. This bivalve has become one of the important species in marine aquaculture industry in China. Therefore a study on pathogen-induced effects is necessary. In the present study, an integrated metabolomic and proteomic approach was used to elucidate the differential effects induced by the representative Gram-positive (M. luteus) and Gram-negative (V. anguillarum) bacteria in M. galloprovincialis. © 2013.

  20. Specific amino acids responsible for the cold adaptedness of Micrococcus antarcticus β-glucosidase BglU.

    PubMed

    Miao, Li-Li; Fan, Hong-Xia; Qu, Jie; Liu, Ying; Liu, Zhi-Pei

    2017-03-01

    Psychrophilic enzymes display efficient activity at moderate or low temperatures (4-25 °C) and are therefore of great interest in biotechnological industries. We previously examined the crystal structure of BglU, a psychrophilic β-glucosidase from the bacterium Micrococcus antarcticus, at 2.2 Å resolution. In structural comparison and sequence alignment with mesophilic (BglB) and thermophilic (GlyTn) counterpart enzymes, BglU showed much lower contents of Pro residue and of charged amino acids (particularly positively charged) on the accessible surface area. In the present study, we investigated the roles of specific amino acid residues in the cold adaptedness of BglU. Mutagenesis assays showed that the mutations G261R and Q448P increased optimal temperature (from 25 to 40-45 °C) at the expense of low-temperature activity, but had no notable effects on maximal activity or heat lability. Mutations A368P, T383P, and A389E significantly increased optimal temperature (from 25 to 35-40 °C) and maximal activity (~1.5-fold relative to BglU). Thermostability of A368P and A389E increased slightly at 30 °C. Mutations K163P, N228P, and H301A greatly reduced enzymatic activity-almost completely in the case of H301A. Low contents of Pro, Arg, and Glu are important factors contributing to BglU's psychrophilic properties. Our findings will be useful in structure-based engineering of psychrophilic enzymes and in production of mutants suitable for a variety of industrial processes (e.g., food production, sewage treatment) at cold or moderate temperatures.

  1. Kocuria varians infection associated with brain abscess: A case report

    PubMed Central

    2010-01-01

    Background Kocuria, established by Stackebrandt et al., previously was classified into Micrococcus. Only two species, K. rosea and K. kristinae are reported to be associated as pathogenic and found with catheter-related bacteremia and acute cholecystitis. Case presentation We herein report the first case of brain abscess caused by Kocuria varians, a gram-positive microorganism, in a 52-year-old man. Hematogenous spread is the probable pathogenesis. Conclusions This report presents a case of Kocuria varians brain abscess successfully treated with surgical excision combined with antimicrobial therapy. In addition, Vitek 2 system has been used to identify and differentiate between coagulase-negative staphylococcus. PMID:20423506

  2. Antimicrobial activity of 9-O-acyl- and 9-O-benzoyl-substituted berberrubines.

    PubMed

    Hong, S W; Kim, S H; Jeun, J A; Lee, S J; Kim, S U; Kim, J H

    2000-05-01

    In the course of a structure-activity relationship study on berberrubine derivatives, a series of compounds bearing 9-O-acyl-(4-6) and 9-O-benzoyl- (7) substituents was synthesized with the expectation of increasing the antimicrobial activity. One of the berberrubine derivatives, 9-lauroylberberrubine chloride was the most active against Gram-positive bacteria Enterococcus faecalis, Staphylococcus aureus, Staphylococcus epidermidis, Micrococcus luteus, Bacillus subtilis as well as the Gram-negative bacterium Klebsiella pneumoniae in comparison to berberine, the currently used antibiotic in clinic. This result suggested that the presence of lipophilic substituents of certain structures and sizes might be crucial for the optimal antimicrobial activity.

  3. Antimicrobial and anticancer efficacy of antineoplastic agent capped gold nanoparticles.

    PubMed

    Selvaraj, V; Grace, A Nirmala; Alagar, M; Hamerton, I

    2010-04-01

    Synthesis of thioguanine (TG)-capped Au nanoparticles (Au@TG) and their enhanced in vitro antimicrobial and anticancer efficacy against Micrococcus luteus, Staphylococcus aureus, Pseudomonas aeruginosa, E. coli, Aspergillus fumigatus, Aspergillus niger and Hep2 cancer cell (Human epidermiod cell) have been reported. The nature of binding between 6-TG and the gold nanoparticles via complexation is investigated using ultraviolet-visible spectrum, cyclic voltammetry, transmission electron microscopy, fluorescence and Fourier transform infrared (FT-IR) spectroscopy. The present experimental studies suggests that Au@TG are more potential than TG towards antimicrobial and anticancer activities. Hence, gold nanoparticles have the potential to be used as effective carriers for anticancer drug.

  4. Bioactive Components of the Traditionally used Mushroom Podaxis pistillaris

    PubMed Central

    Al-Fatimi, M. A. A.; Jülich, W.-D.; Jansen, R.; Lindequist, U.

    2006-01-01

    In the course of an ethnobotanical study on fungi used in Yemeni ethnomedicine the fungus Podaxis pistillaris (Podaxales, Podaxaceae, Basidiomycetes) was found to exhibit antibacterial activity against Staphylococcus aureus, Micrococcus flavus, Bacillus subtilis, Proteus mirabilis, Serratia marcescens and Escherichia coli. In the culture medium of P. pistillaris three epidithiodiketopiperazines were identified by activity-guided isolation. Based on spectral data (NMR, ESI-MS and DCI-MS) their identity was established as epicorazine A (1), epicorazine B (2) and epicorazine C (3, antibiotic F 3822), which have not been reported as constituents of P. pistillaris previously. It is assumed that the identified compounds contribute to the antibacterial activity of the extract. PMID:16550228

  5. Branimycins B and C, Antibiotics Produced by the Abyssal Actinobacterium Pseudonocardia carboxydivorans M-227.

    PubMed

    Braña, Alfredo F; Sarmiento-Vizcaíno, Aida; Pérez-Victoria, Ignacio; Otero, Luis; Fernández, Jonathan; Palacios, Juan José; Martín, Jesús; de la Cruz, Mercedes; Díaz, Caridad; Vicente, Francisca; Reyes, Fernando; García, Luis A; Blanco, Gloria

    2017-02-24

    Two new antibiotics, branimycins B (2) and C (3), were produced by fermentation of the abyssal actinobacterium Pseudonocardia carboxydivorans M-227, isolated from deep seawater of the Avilés submarine Canyon. Their structures were elucidated by HRMS and NMR analyses. These compounds exhibit antibacterial activities against a panel of Gram-positive bacteria, including Corynebacterium urealyticum, Clostridium perfringens, and Micrococcus luteus, and against the Gram-negative bacterium Neisseria meningitidis. Additionally, branimycin B displayed moderate antibacterial activity against other Gram-negative bacteria such as Bacteroides fragilis, Haemophilus influenzae, and Escherichia coli, and branimycin C against the Gram-positive Enterococcus faecalis and methicillin-sensitive and methicillin-resistant Staphylococcus aureus.

  6. Spätzle-Processing Enzyme-independent Activation of the Toll Pathway in Drosophila Innate Immunity.

    PubMed

    Yamamoto-Hino, Miki; Goto, Satoshi

    2016-05-07

    The Toll pathway regulates innate immunity in insects and vertebrates. The Drosophila Toll receptor is activated by a processed form of a ligand, Spätzle. Spätzle-processing enzyme (SPE) is the only enzyme identified to date that functions in converting Spätzle to an active form during the immune response. In the present study, Toll activation induced by immune challenge was almost suppressed in spätzle mutant larvae and adults, whereas it was present in SPE mutant larvae challenged with Micrococcus luteus and adults challenged with Bacillus subtilis. Our data suggest that an unidentified protease besides SPE processes Spätzle under conditions of microbial challenge.

  7. One-pot synthesis of biologically active 1,2,3-trisubstituted pyrrolo[2,3-b]quinoxalines through a palladium-catalyzed reaction with internal alkyne moieties.

    PubMed

    Keivanloo, Ali; Besharati-Seidani, Tayebeh; Kaboudin, Babak; Yoshida, Akihiro; Yokomatsu, Tsutomu

    2018-06-16

    Synthesis of 2,3-disubstituted 1-alkylpyrrolo[2,3-b]quinoxalines was accomplished through the reaction of 3-chloroquinoxalin-2-amines with internal alkynes in the presence of Pd(OAc)[Formula: see text], NaOAc, and KOtBu in DMSO. This method afforded desired pyrrolo[2,3-b]quinoxalines in 65-92% reaction yields. The minimum inhibition concentration and minimum bactericidal concentration determinations against Micrococcus luteus and Pseudomonas aeruginosa revealed that some of the synthesized compounds showed the same values compared to tetracycline. These compounds could be used in the future research for the development of new antibiotics.

  8. Planetary quarantine in the solar system. Survival rates of some terrestrial organisms under simulated space conditions by proton irradiation

    NASA Astrophysics Data System (ADS)

    Koike, J.; Oshima, T.

    We have been studying the survival rates of some species of terrestrial unicellular and multicellular organism (viruses, bacteria, yeasts, fungi, algae, etc.) under simulated interstellar conditions, in connection with planetary quarantine. The interstellar environment in the solar system has been simulated by low temperature, high vacuum (77 K, 4 × 10 -8 torr), and proton irradiation from a Van de Graaff generator. After exposure to a barrage of protons corresponding to about 250 years of irradiation in solar space, tobacco mosaic virus, Bacillus subtilis spores, Staphylococcus aureus, Micrococcus flavus, Aspergillus niger spores, and Clostridium mangenoti spores showed survival rates of 82, 45, 74, 13, 28, and 25%, respectively.

  9. Construction of a metagenomic DNA library of sponge symbionts and screening of antibacterial metabolites

    NASA Astrophysics Data System (ADS)

    Chen, Juan; Zhu, Tianjiao; Li, Dehai; Cui, Chengbin; Fang, Yuchun; Liu, Hongbing; Liu, Peipei; Gu, Qianqun; Zhu, Weiming

    2006-04-01

    To study the bioactive metabolites produced by sponge-derived uncultured symbionts, a metagenomic DNA library of the symbionts of sponge Gelliodes gracilis was constructed. The average size of DNA inserts in the library was 20 kb. This library was screened for antibiotic activity using paper dise assaying. Two clones displayed the antibacterial activity against Micrococcus tetragenus. The metabolites of these two clones were analyzed through HPLC. The result showed that their metabolites were quite different from those of the host E. coli DH5α and the host containing vector pHZ132. This study may present a new approach to exploring bioactive metabolites of sponge symbionts.

  10. The examinations of microorganisms by correlation optics method

    NASA Astrophysics Data System (ADS)

    Bilyi, Olexander I.

    2004-06-01

    In report described methods of correlation optics, which are based on the analysis of intensity changes of quasielastic light scattering by micro-organisms and allow the type of correlation function to obtain information about the size of dispersive particles. The principle of new optical method of verification is described. In this method the gauging of intensity of an indirect illumination is carried out by static spectroscopy and processing of observed data by a method of correlation spectroscopy. The given mode of gauging allows measuring allocation of micro-organisms in size interval of 0.1 - 10.0 microns. In the report results of examinations of cultures Pseudomonas aeruginosa, Escherichia coli, Micrococcus lutteus, Lamprocystis and Triocapsa bacteriachlorofil are considered.

  11. Exposure to culturable airborne bioaerosols during noodle manufacturing in central Taiwan.

    PubMed

    Tsai, Min-Yi; Liu, Hui-Ming

    2009-02-15

    Biological hazards associated with the manufacturing of noodles have not been well characterized in Taiwan. This is an issue that flour workers can be exposed to bioaerosols (airborne fungi and bacteria) resulting flour-induced occupational asthma or allergic diseases. This study is to survey the species and concentrations of bioaerosols at different sites within a noodle factory for one year, and to investigate the effects of environmental factors on concentrations of bioaerosols. Air samples were taken twice a day, one day each month using a MAS-100 bioaerosol sampler. Nine species of culturable fungi were identified, with the main airborne fungi being Cladosporium, Penicillium, Aspergillus spp., non-sporing isolates and yeasts. Cladosporium, Penicillium and Aspergillus were the dominant fungal isolates in the indoor and outdoor air samples. Micrococcus spp. and Staphylococcus xylosus were the dominant bacterial isolates. Peak fungal and bacterial concentrations occurred at the crushing site, with mean values of 3082 and 12,616 CFU/m3. Meanwhile, the most prevalent fungi and bacteria at the crushing site were in ranges of 2.1-1.1 microm and 1.1-0.65 microm, respectively. Significant seasonal differences in total bacterial concentration were observed at all sampling sites (P<0.05). Moreover, significant seasonal differences were observed for most of the fungal genera except Fusarium. Levels of Aspergillus and Rhizopus differed significantly during the two sampling times, as did levels of Micrococcus spp. and Staphylococcus arlettae. Regarding the same operation procedures, relative humidity affected fungi levels more than temperature did. However, crushing generated the highest concentration of bioaerosols among all operation procedures. Furthermore, levels of bacteria at sites fitted with ventilation systems were lower than at sites without ventilation systems, especially at the crushing site. Therefore, we recommend these workers at the crushing site wear breathing protection and improve the local ventilation systems to minimize the biological hazards.

  12. Microbiological characteristics of "androlla", a Spanish traditional pork sausage.

    PubMed

    García Fontán, María C; Lorenzo, José M; Parada, Ana; Franco, Inmaculada; Carballo, Javier

    2007-02-01

    Counts of total aerobic mesophilic microflora, lactic acid bacteria, salt-tolerant microflora, Enterobacteriaceae, enterococci, moulds and yeasts, and staphylococci, and some physico-chemical parameters (total solids, NaCl and nitrate contents and pH and aw values) were determined in 20 units of "androlla", a traditional dry-fermented sausage made in the NW of Spain. In general, high counts of all the investigated microbial groups were observed, with average values of 8.99 +/- 0.46 log cfu/g for the total aerobic mesophilic microflora, 9.11 +/- 0.16 log cfu/g for the lactic acid bacteria, 6.87 +/- 0.68 log cfu/g for the salt-tolerant microflora, 2.80+/-1.85 log cfu/g for the Enterobacteriaceae, 3.25 +/- 1.86 log cfu/g for the enterococci, 4.30 +/- 1.73 log cfu/g for the moulds and yeasts, and 3.62 +/- 0.60 log cfu/g for the staphylococci. From MRS agar, SPC agar + 7.5% NaCl, VRBG agar, and KAA agar, 10 colonies were randomly taken from each androlla unit and from each culture medium. A total of 200 strains per culture medium were then identified using the classical methods. Among the isolates from MRS agar, Lactobacillus sakei predominated, followed by Lactobacillus curvatus, Lactobacillus alimentarius and Lactobacillus plantarum. Of the 200 isolates obtained from SPC agar + 7.5% NaCl, only 56 strains belonged to the Staphylococcaceae or Micrococcaceae families. Among the Staphylococcaceae, Staphylococcus xylosus was the main species, followed by Staph. epidermidis; Staph. equorum, Staph. capitis and Staph. saprophyticus were isolated in very low proportions. Among the Micrococcaceae, Micrococcus luteus predominated, followed by Micrococcus lylae, Kocuria varians and Kocuria kristinae. Of the 150 isolates obtained from VRBG agar, Hafnia alvei was the main species, followed by Serratia liquefaciens and Enterobacter amnigenus; six isolates were identified as Salmonella. Among the 190 isolates obtained from KAA agar, 122 were considered enterococci; 20 isolates were identified as Enterococcus faecium, one as Enterococcus faecalis and 101 as Enterococcus inter faecalis-faecium.

  13. Dynamic miRNA-mRNA regulations are essential for maintaining Drosophila immune homeostasis during Micrococcus luteus infection.

    PubMed

    Wei, Guanyun; Sun, Lianjie; Li, Ruimin; Li, Lei; Xu, Jiao; Ma, Fei

    2018-04-01

    Pathogen bacteria infections can lead to dynamic changes of microRNA (miRNA) and mRNA expression profiles, which may control synergistically the outcome of immune responses. To reveal the role of dynamic miRNA-mRNA regulation in Drosophila innate immune responses, we have detailedly analyzed the paired miRNA and mRNA expression profiles at three time points during Drosophila adult males with Micrococcus luteus (M. luteus) infection using RNA- and small RNA-seq data. Our results demonstrate that differentially expressed miRNAs and mRNAs represent extensively dynamic changes over three time points during Drosophila with M. luteus infection. The pathway enrichment analysis indicates that differentially expressed genes are involved in diverse signaling pathways, including Toll and Imd as well as orther signaling pathways at three time points during Drosophila with M. luteus infection. Remarkably, the dynamic change of miRNA expression is delayed by compared to mRNA expression change over three time points, implying that the "time" parameter should be considered when the function of miRNA/mRNA is further studied. In particular, the dynamic miRNA-mRNA regulatory networks have shown that miRNAs may synergistically regulate gene expressions of different signaling pathways to promote or inhibit innate immune responses and maintain homeostasis in Drosophila, and some new regulators involved in Drosophila innate immune response have been identified. Our findings strongly suggest that miRNA regulation is a key mechanism involved in fine-tuning cooperatively gene expressions of diverse signaling pathways to maintain innate immune response and homeostasis in Drosophila. Taken together, the present study reveals a novel role of dynamic miRNA-mRNA regulation in immune response to bacteria infection, and provides a new insight into the underlying molecular regulatory mechanism of Drosophila innate immune responses. Copyright © 2017 Elsevier Ltd. All rights reserved.

  14. Isolation and characterization of a mannan from mesosomal membrane vesicles of Micrococcus lysodeikticus.

    PubMed

    Owen, P; Salton, M R

    1975-10-06

    The carbohydrate content of mesosomal membranes of Micrococcus lysodeikticus has been shown to be consistently higher (about four times) than that of corresponding plasma membrane preparations. Analysis of washed membrane fractions by gas-liquid chromatography indicated that mannose was the major neutral sugar of both types of membrane (accounting for 95 and 89%, respectively, of the mesosomal and plasma membrane carbohydrate). Small amounts of inositol, glucose and ribose were also detected. We have shown by polyacrylamide gel electrophoresis in sodium dodecylsulphate and by precipitation and agar gel diffusion experiments with concanavalin A that a mannan is the major carbohydrate component of both types of membrane. This polymer can be selectively released from mesosomal membranes by a simple procedure involving low ionic strength-shock and heating to 80 degrees C for 1 min, and purified by ultrafiltration and ethanol precipitation. The mannan contains mannose as the only neutral carbohydrate, is not phosphorylated and does not contain significant amounts of amino sugars or uronic acids. Agar gel electrophoresis experiments, however, indicate an anionic polymer whose acidic properties are eliminated upon mild base hydrolysis. Analysis of native mannan by infrared spectroscopy reveals absorption bands attributable to ester carbonyl groups and to carboxylate ions, consistent with the presence of succinyl residues in the polymer (Owen, P. and Salton, M.R.J. (1975) Biochem, Biophys. Res. Commun. 63, 875--800). A sedimentation coefficient of 1.39 S was obtained by analytical ultracentrifugation in 1.0 M NaCl and a value of one reducing equivalent per 50 mannose residues by reduction with NaB3H4. The polysaccharide was only slightly degraded (2%) by jack bean alpha-mannosidase and could precipitate 15 times its own weight of concanavalin A. The acidic polymers was also detected in the cell "periplasm" and was secreted from cells grown in defined media during the period of decelerating growth.

  15. Pitfalls in efficacy testing--how important is the validation of neutralization of chlorhexidine digluconate?

    PubMed

    Reichel, Mirja; Heisig, Peter; Kampf, Günter

    2008-12-02

    Effective neutralization of active agents is essential to obtain valid efficacy results, especially when non-volatile active agents like chlorhexidine digluconate (CHG) are tested. The aim of this study was to determine an effective and non-toxic neutralizing mixture for a propan-1-ol solution containing 2% CHG. Experiments were carried out according to ASTM E 1054-02. The neutralization capacity was tested separately with five challenge microorganisms in suspension, and with a rayon swab carrier. Either 0.5 mL of the antiseptic solution (suspension test) or a saturated swab with the antiseptic solution (carrier test) was added to tryptic soy broth containing neutralizing agents. After the samples were mixed, aliquots were spread immediately and after 3 h of storage at 2 - 8 degrees C onto tryptic soy agar containing a neutralizing mixture. The neutralizer was, however, not consistently effective in the suspension test. Immediate spread yielded a valid neutralization with Staphylococcus aureus, Staphylococcus epidermidis and Corynebacterium jeikeium but not with Micrococcus luteus (p < 0.001) and Candida albicans (p < 0.001). A 3-h storage period of the neutralized active agents in suspension resulted in significant carry-over activity of CHG in addition against Staphylococcus epidermidis (p < 0.001) and Corynebacterium jeikeium (p = 0.044). In the carrier test, the neutralizing mixture was found to be effective and non toxic to all challenge microorganisms when spread immediately. However, after 3 h storage of the neutralized active agents significant carry-over activity of CHG against Micrococcus luteus (p = 0.004; Tukey HSD) was observed. Without effective neutralization in the sampling fluid, non-volatile active ingredients will continue to reduce the number of surviving microorganisms after antiseptic treatment even if the sampling fluid is kept cold straight after testing. This can result in false-positive antiseptic efficacy data. Attention should be paid during the neutralization validation process to the amount of antiseptic solution, the storage time and to the choice of appropriate and sensitive microorganisms.

  16. Genome sequence of the Fleming strain of Micrococcus luteus, a simple free- living actinobacterium

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Young, Michael; Artsatbanov, Vladislav; Beller, Harry R.

    Micrococcus luteus (NCTC2665, Fleming strain) has one of the smallest genomes of free living actinobacteria sequenced to date, comprising a single circular chromosome of 2,501,097 bp (G+C content 73%) predicted to encode 2403 proteins. The genome shows extensive synteny with that of the closely related organism, Kocuria rhizophila, from which it was taxonomically separated relatively recently. Despite its small size, the genome harbors 73 IS elements, almost all of which are closely related to elements found in other actinobacteria. An IS element is inserted into the rrs gene of one of only two rrn operons found in M. luteus. Themore » genome encodes only four sigma factors and fourteen response regulators, indicative of adaptation to a rather strict ecological niche (mammalian skin). The high sensitivity of M. luteus to {Beta}-lactam antibiotics may result from the presence of a reduced set of penicillin binding proteins and the absence of a wblC gene, which plays an important role in antibiotic resistance in other actinobacteria. Consistent with the restricted range of compounds it can use as a sole source of carbon for energy and growth, M. luteus has a minimal complement of genes concerned with carbohydrate transport and metabolism and its inability to utilize glucose as a sole carbon source may be due to the apparent absence of a gene encoding glucokinase. Uniquely among characterized bacteria, M. luteus appears to be able to metabolize glycogen only via trehalose, and to make trehalose only via glycogen. It has very few genes associated with secondary metabolism. In contrast to other actinobacteria, M. luteus encodes only one resuscitation-promoting factor (Rpf) required for emergence from dormancy and its complement of other dormancy-related proteins is also much reduced. M. luteus is capable of long-chain alkene biosynthesis, which is of interest for advanced biofuel production; a three gene cluster essential for this metabolism has been identified in the genome.« less

  17. Genes involved in long-chain alkene biosynthesis in Micrococcus luteus

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Beller, Harry R.; Goh, Ee-Been; Keasling, Jay D.

    2010-01-07

    Aliphatic hydrocarbons are highly appealing targets for advanced cellulosic biofuels, as they are already predominant components of petroleum-based gasoline and diesel fuels. We have studied alkene biosynthesis in Micrococcus luteus ATCC 4698, a close relative of Sarcina lutea (now Kocuria rhizophila), which four decades ago was reported to biosynthesize iso- and anteiso branched, long-chain alkenes. The underlying biochemistry and genetics of alkene biosynthesis were not elucidated in those studies. We show here that heterologous expression of a three-gene cluster from M. luteus (Mlut_13230-13250) in a fatty-acid overproducing E. coli strain resulted in production of long-chain alkenes, predominantly 27:3 and 29:3more » (no. carbon atoms: no. C=C bonds). Heterologous expression of Mlut_13230 (oleA) alone produced no long-chain alkenes but unsaturated aliphatic monoketones, predominantly 27:2, and in vitro studies with the purified Mlut_13230 protein and tetradecanoyl-CoA produced the same C27 monoketone. Gas chromatography-time of flight mass spectrometry confirmed the elemental composition of all detected long-chain alkenes and monoketones (putative intermediates of alkene biosynthesis). Negative controls demonstrated that the M. luteus genes were responsible for production of these metabolites. Studies with wild-type M. luteus showed that the transcript copy number of Mlut_13230-13250 and the concentrations of 29:1 alkene isomers (the dominant alkenes produced by this strain) generally corresponded with bacterial population over time. We propose a metabolic pathway for alkene biosynthesis starting with acyl-CoA (or -ACP) thioesters and involving decarboxylative Claisen condensation as a key step, which we believe is catalyzed by OleA. Such activity is consistent with our data and with the homology (including the conserved Cys-His-Asn catalytic triad) of Mlut_13230 (OleA) to FabH (?-ketoacyl-ACP synthase III), which catalyzes decarboxylative Claisen condensation during fatty acid biosynthesis.« less

  18. Molecular Structural Basis for the Cold Adaptedness of the Psychrophilic β-Glucosidase BglU in Micrococcus antarcticus

    PubMed Central

    Miao, Li-Li; Hou, Yan-Jie; Fan, Hong-Xia; Qu, Jie; Qi, Chao; Liu, Ying

    2016-01-01

    Psychrophilic enzymes play crucial roles in cold adaptation of microbes and provide useful models for studies of protein evolution, folding, and dynamic properties. We examined the crystal structure (2.2-Å resolution) of the psychrophilic β-glucosidase BglU, a member of the glycosyl hydrolase 1 (GH1) enzyme family found in the cold-adapted bacterium Micrococcus antarcticus. Structural comparison and sequence alignment between BglU and its mesophilic and thermophilic counterpart enzymes (BglB and GlyTn, respectively) revealed two notable features distinct to BglU: (i) a unique long-loop L3 (35 versus 7 amino acids in others) involved in substrate binding and (ii) a unique amino acid, His299 (Tyr in others), involved in the stabilization of an ordered water molecule chain. Shortening of loop L3 to 25 amino acids reduced low-temperature catalytic activity, substrate-binding ability, the optimal temperature, and the melting temperature (Tm). Mutation of His299 to Tyr increased the optimal temperature, the Tm, and the catalytic activity. Conversely, mutation of Tyr301 to His in BglB caused a reduction in catalytic activity, thermostability, and the optimal temperature (45 to 35°C). Loop L3 shortening and H299Y substitution jointly restored enzyme activity to the level of BglU, but at moderate temperatures. Our findings indicate that loop L3 controls the level of catalytic activity at low temperatures, residue His299 is responsible for thermolability (particularly heat lability of the active center), and long-loop L3 and His299 are jointly responsible for the psychrophilic properties. The described structural basis for the cold adaptedness of BglU will be helpful for structure-based engineering of new cold-adapted enzymes and for the production of mutants useful in a variety of industrial processes at different temperatures. PMID:26801571

  19. Genes involved in long-chain alkene biosynthesis in Micrococcus luteus.

    PubMed

    Beller, Harry R; Goh, Ee-Been; Keasling, Jay D

    2010-02-01

    Aliphatic hydrocarbons are highly appealing targets for advanced cellulosic biofuels, as they are already predominant components of petroleum-based gasoline and diesel fuels. We have studied alkene biosynthesis in Micrococcus luteus ATCC 4698, a close relative of Sarcina lutea (now Kocuria rhizophila), which 4 decades ago was reported to biosynthesize iso- and anteiso-branched, long-chain alkenes. The underlying biochemistry and genetics of alkene biosynthesis were not elucidated in those studies. We show here that heterologous expression of a three-gene cluster from M. luteus (Mlut_13230-13250) in a fatty acid-overproducing Escherichia coli strain resulted in production of long-chain alkenes, predominantly 27:3 and 29:3 (no. carbon atoms: no. C=C bonds). Heterologous expression of Mlut_13230 (oleA) alone produced no long-chain alkenes but unsaturated aliphatic monoketones, predominantly 27:2, and in vitro studies with the purified Mlut_13230 protein and tetradecanoyl-coenzyme A (CoA) produced the same C(27) monoketone. Gas chromatography-time of flight mass spectrometry confirmed the elemental composition of all detected long-chain alkenes and monoketones (putative intermediates of alkene biosynthesis). Negative controls demonstrated that the M. luteus genes were responsible for production of these metabolites. Studies with wild-type M. luteus showed that the transcript copy number of Mlut_13230-13250 and the concentrations of 29:1 alkene isomers (the dominant alkenes produced by this strain) generally corresponded with bacterial population over time. We propose a metabolic pathway for alkene biosynthesis starting with acyl-CoA (or-ACP [acyl carrier protein]) thioesters and involving decarboxylative Claisen condensation as a key step, which we believe is catalyzed by OleA. Such activity is consistent with our data and with the homology (including the conserved Cys-His-Asn catalytic triad) of Mlut_13230 (OleA) to FabH (beta-ketoacyl-ACP synthase III), which catalyzes decarboxylative Claisen condensation during fatty acid biosynthesis.

  20. Molecular Structural Basis for the Cold Adaptedness of the Psychrophilic β-Glucosidase BglU in Micrococcus antarcticus.

    PubMed

    Miao, Li-Li; Hou, Yan-Jie; Fan, Hong-Xia; Qu, Jie; Qi, Chao; Liu, Ying; Li, De-Feng; Liu, Zhi-Pei

    2016-01-22

    Psychrophilic enzymes play crucial roles in cold adaptation of microbes and provide useful models for studies of protein evolution, folding, and dynamic properties. We examined the crystal structure (2.2-Å resolution) of the psychrophilic β-glucosidase BglU, a member of the glycosyl hydrolase 1 (GH1) enzyme family found in the cold-adapted bacterium Micrococcus antarcticus. Structural comparison and sequence alignment between BglU and its mesophilic and thermophilic counterpart enzymes (BglB and GlyTn, respectively) revealed two notable features distinct to BglU: (i) a unique long-loop L3 (35 versus 7 amino acids in others) involved in substrate binding and (ii) a unique amino acid, His299 (Tyr in others), involved in the stabilization of an ordered water molecule chain. Shortening of loop L3 to 25 amino acids reduced low-temperature catalytic activity, substrate-binding ability, the optimal temperature, and the melting temperature (Tm). Mutation of His299 to Tyr increased the optimal temperature, the Tm, and the catalytic activity. Conversely, mutation of Tyr301 to His in BglB caused a reduction in catalytic activity, thermostability, and the optimal temperature (45 to 35°C). Loop L3 shortening and H299Y substitution jointly restored enzyme activity to the level of BglU, but at moderate temperatures. Our findings indicate that loop L3 controls the level of catalytic activity at low temperatures, residue His299 is responsible for thermolability (particularly heat lability of the active center), and long-loop L3 and His299 are jointly responsible for the psychrophilic properties. The described structural basis for the cold adaptedness of BglU will be helpful for structure-based engineering of new cold-adapted enzymes and for the production of mutants useful in a variety of industrial processes at different temperatures. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  1. Crystal structure of heterodimeric hexaprenyl diphosphate synthase from Micrococcus luteus B-P 26 reveals that the small subunit is directly involved in the product chain length regulation.

    PubMed

    Sasaki, Daisuke; Fujihashi, Masahiro; Okuyama, Naomi; Kobayashi, Yukiko; Noike, Motoyoshi; Koyama, Tanetoshi; Miki, Kunio

    2011-02-04

    Hexaprenyl diphosphate synthase from Micrococcus luteus B-P 26 (Ml-HexPPs) is a heterooligomeric type trans-prenyltransferase catalyzing consecutive head-to-tail condensations of three molecules of isopentenyl diphosphates (C(5)) on a farnesyl diphosphate (FPP; C(15)) to form an (all-E) hexaprenyl diphosphate (HexPP; C(30)). Ml-HexPPs is known to function as a heterodimer of two different subunits, small and large subunits called HexA and HexB, respectively. Compared with homooligomeric trans-prenyltransferases, the molecular mechanism of heterooligomeric trans-prenyltransferases is not yet clearly understood, particularly with respect to the role of the small subunits lacking the catalytic motifs conserved in most known trans-prenyltransferases. We have determined the crystal structure of Ml-HexPPs both in the substrate-free form and in complex with 7,11-dimethyl-2,6,10-dodecatrien-1-yl diphosphate ammonium salt (3-DesMe-FPP), an analog of FPP. The structure of HexB is composed of mostly antiparallel α-helices joined by connecting loops. Two aspartate-rich motifs (designated the first and second aspartate-rich motifs) and the other characteristic motifs in HexB are located around the diphosphate part of 3-DesMe-FPP. Despite the very low amino acid sequence identity and the distinct polypeptide chain lengths between HexA and HexB, the structure of HexA is quite similar to that of HexB. The aliphatic tail of 3-DesMe-FPP is accommodated in a large hydrophobic cleft starting from HexB and penetrating to the inside of HexA. These structural features suggest that HexB catalyzes the condensation reactions and that HexA is directly involved in the product chain length control in cooperation with HexB.

  2. Antibacterial effects of the essential oils of commonly consumed medicinal herbs using an in vitro model.

    PubMed

    Soković, Marina; Glamočlija, Jasmina; Marin, Petar D; Brkić, Dejan; van Griensven, Leo J L D

    2010-10-27

    The chemical composition and antibacterial activity of essential oils from 10 commonly consumed herbs: Citrus aurantium, C. limon, Lavandula angustifolia, Matricaria chamomilla, Mentha piperita, M. spicata, Ocimum basilicum, Origanum vulgare, Thymus vulgaris and Salvia officinalis have been determined. The antibacterial activity of these oils and their main components; i.e. camphor, carvacrol, 1,8-cineole, linalool, linalyl acetate, limonene, menthol, a-pinene, b-pinene, and thymol were assayed against the human pathogenic bacteria Bacillus subtilis, Enterobacter cloacae, Escherichia coli O157:H7, Micrococcus flavus, Proteus mirabilis, Pseudomonas aeruginosa, Salmonella enteritidis, S. epidermidis, S. typhimurium, and Staphylococcus aureus. The highest and broadest activity was shown by O. vulgare oil. Carvacrol had the highest antibacterial activity among the tested components.

  3. [In vitro studies on antioxidant and antimicrobial activities of polysaccharide from Lycoris aurea].

    PubMed

    Ru, Qiao-Mei; Pei, Zhen-Ming; Zheng, Hai-Lei

    2008-10-01

    To study the preliminary antioxidant and antimicrobial activities of polysaccharide extracted from Lycoris aurea. The scavenging activities of the polysaccharide in vitro on superoxide radical (O2-*), hydroxyl radical (*OH), alkyl radical (R*) and hydrogen peroxide (H2O2) were investigated by modified chemical systems. Meanwhile, the antimicrobial activities were tested using paper-discagar diffusion method. In general, the antioxidant activities of the polysaccharide were lower compared with Vc. However, the scavenging effects to *OH and H2O2 were parallel to Vc. Meanwhile, polysaccharide from Lycoris aurea had strong antimicrobial activities against Micrococcus luteus, Bacillus pumilus and Staphylococcus aureus. The polysaccharide extracted from L. aurea can scavenge *OH and H2O2 effectively and inhibit Gram-positive bacterias.

  4. A novel antibacterial and antifungal phenolic compound from the endophytic fungus Pestalotiopsis mangiferae.

    PubMed

    Subban, Kamalraj; Subramani, Ramesh; Johnpaul, Muthumary

    2013-01-01

    A novel phenolic compound, 4-(2,4,7-trioxa-bicyclo[4.1.0]heptan-3-yl) phenol (1), was isolated from Pestalotiopsis mangiferae, an endophytic fungus associated with Mangifera indica Linn. The structure of the compound was elucidated on the basis of comprehensive spectral analysis (UV, IR, ¹H-, ¹³C- and 2D-NMR, as well as HRESI-MS). Compound (1) shows potent antibacterial and antifungal activity against Bacillus subtilis, Klebsiella pneumoniae, Escherichia coli, Micrococcus luteus, Pseudomonas aeruginosa and Candida albicans. The transmission electron microscope study for the mode of inhibition of compound (1) on bacterial pathogens revealed the destruction of bacterial cells by cytoplasm agglutination with the formation of pores in cell wall membranes.

  5. Characterization of Staphylococcus spp. and Micrococcus spp. isolated from Iberian ham throughout the ripening process.

    PubMed

    Rodríguez, M; Núñez, F; Córdoba, J J; Sanabria, C; Bermúdez, E; Asensio, M A

    1994-12-01

    The Iberian dry cured ham is an uncooked meat product highly appreciated because of its characteristic flavour. This product is obtained from highly marbled Iberian pig hindlegs after 18-24 months of maturation under natural environmental conditions. The role of Micrococcaceae in the development of the aroma characteristics of this products remains unclear. Identification of Gram-positive, catalase-positive cocci isolated from Mannitol Salt Agar plates showed that Staphylococcus xylosus followed by Staphylococcus equorum are the predominant organisms, even after 16 months of maturing. A remarkable variety of types of both staphylococci and micrococci are detected at any sampling time. The metabolic activities of these organisms could contribute to the characteristics of the final product.

  6. Analytical detection and biological assay of antileukemic drug 5-fluorouracil using gold nanoparticles as probe.

    PubMed

    Selvaraj, Vaithilingam; Alagar, Muthukaruppan

    2007-06-07

    Gold nanoparticles are reported and evaluated as probes for the detection of anticancer drug 5-fluorouracil (5FU). The nature of binding between 5FU and gold nanoparticles via complexation is investigated using ultraviolet visible spectrophotometry, cyclic voltammetry, transmission electron microscopy, fluorescence and Fourier transform infrared (FTIR) spectroscopy. The bound antileukemic drug is fluorescent and the quenching property of gold nanoparticles could be exploited for biological investigations. The 5FU-colloidal gold complex (Au@5FU) is observed to have appreciable antibacterial and antifungal activity against Micrococcus luteus, Staphylococcus aureus, Pseudomonas aeruginosa, Escherichia coli, Aspergillus fumigatus, and Aspergillus niger. The experimental studies suggest that gold nanoparticles have the potential to be used as effective carriers for anticancer drugs.

  7. Isoelectric focusing analysis of antibody clonotype changes occurring during immune responses using immobilized pH gradients

    NASA Technical Reports Server (NTRS)

    Knisley, Keith A.; Rodkey, L. Scott

    1988-01-01

    Serum was collected from rabbits at 2-day intervals following a single injection with tetanus toxoid or at weekly intervals following multiple injections with Micrococcus lysodeikticus cell walls. These sera were analyzed for the presence of individual clonotypes of specific antitetanus or antimicrococcal antibodies by isoelectric focusing in immobilized pH gradients with added carrier ampholytes followed by affinity immunoblotting. The affinity immunoblots obtained clearly defined both the rapid disappearance and late appearance of distinct subsets of antibody clonotypes during the response. These data demonstrate the application of affinity immunoblotting combined with immobilized pH gradients for detecting the subtle changes in specific antibody clonotype patterns which occur during an immune response.

  8. Unmineralized fossil bacteria

    USGS Publications Warehouse

    Bradley, W.H.

    1963-01-01

    Unmineralized bacterial cells, mostly Micrococcus sp., but including also Streptococcus sp. and Actinomyces sp., were found in enormous numbers in lake beds of the Newark Canyon Formation of Early Cretaceous age, Eureka County, Nevada. The micrococci are black, and have an average diameter about 0.5 ??. Similar black micrococci (0.4 to 0.7 ??.) were found in profusion in the bottom mud of Green Lake, New York. About 80 percent of this mud consists of minute idiomorphic calcite crystals and about 20 percent of these contain enormous numbers of the black micrococci. It is suggested that the Early Cretaceous bacterial cells owe their preservation to occlusion in calcite crystals that grew in a black, bacterial mud in a meromictic lake in which part of the Newark Canyon Formation accumulated.

  9. Synthesis, spectral features and biological activity of some novel hetarylazo dyes derived from 6-amino-1,3-dimethyluracil

    NASA Astrophysics Data System (ADS)

    Yousefi, Hessamoddin; Yahyazadeh, Asieh; Yazdanbakhsh, Mohammad Reza; Rassa, Mehdi; Moradi-e-Rufchahi, Enayat O.'llah

    2012-05-01

    A series of hetarylazoaminouracil dyes were prepared by coupling of 6-amino-1,3-dimethyluracil with eight diazotized heterocyclic amines in nitrosyl sulphuric acid. The prepared azo dyes were characterized by UV-Vis, FT-IR, 13C NMR, 1H NMR spectroscopic techniques and elemental analysis. The solvatochromism of dyes was evaluated with respect to wavelength of maximum absorption (λmax) in seven solvents with different polarities: acetic acid, methanol, water, chloroform, acetonitrile, dimethyl sulfoxide and dimethyl formamide. The effects of acid, base and concentration of the dye on the visible absorption spectra were also reported. In addition, the antimicrobial activity of the synthesized dyes was evaluated on Escherichia coli, Bacillus subtilis, Micrococcus leuteus and Pseudomonas aeruginosa.

  10. Chemical composition and antimicrobial activity of the essential oil of the leaves of Feronia elephantum (Rutaceae) from north west Karnataka.

    PubMed

    Joshi, Rajesh K; Badakar, Vijayalaxmi M; Kholkute, Sanjiva D; Khatib, Nayeem

    2011-01-01

    The essential oil of the leaves of Feronia elephantum Corr. was analyzed by gas chromatography and gas chromatography/mass spectrometry. The main constituents were beta-pinene (28.4%), Z-anethole (22.1%), methyl chavicol (12.0%) and E-anethole (8.1%), among thirty-three identified compounds, which represented 92.6% of the total oil. The antimicrobial activity was tested against five Gram-positive and eight Gram-negative bacteria, and four fungi. The oil was active against Micrococcus luteus (Gram-positive bacterium), Proteus mirabilis (Gram-negative bacterium), Penicillium chrysogenum and Aspergillus niger (fungi) with MIC values of 0.31 +/- 0.06, 0.52 +/- 0.10, 0.20 +/- 0.50 and 0.26 +/- 0.52 mg/mL, respectively.

  11. Peroxidatic Activity of Mycobacteria and Relation to Catalase

    PubMed Central

    Winder, Frank G.

    1966-01-01

    Winder, Frank G. (Trinity College, Dublin, Ireland). Peroxidatic activity of mycobacteria and relation to catalase. J. Bacteriol. 92:413–417. 1966.—Catalase from Mycobacterium smegmatis was purified about 50-fold. All fractions showed a ratio of peroxidatic activity to catalatic activity approximately the same as that of the crude extract, a ratio only about four times that given by catalase from Micrococcus lysodeikticus. This and other evidence strongly suggest that the peroxidatic activity of M. smegmatis is due to its catalase. Less complete evidence suggests that this is true in the case of Mycobacterium tuberculosis also. It is suggested that in the context of the mycobacteria the term “peroxidatic activity” should replace the term “peroxidase” unless evidence is found that a true peroxidase exists in these organisms. PMID:16562129

  12. Degradable Polymer with Protein Resistance in a Marine Environment.

    PubMed

    Ma, Jielin; Ma, Chunfeng; Zhang, Guangzhao

    2015-06-16

    Protein resistance is the central issue in marine antibiofouling. We have prepared poly(ε-caprolactone) (PCL)-based polyurethane with 2-(dimethylamino) ethyl methacrylate (DEM) as pendant groups by a combination of the thiol-ene click reaction and the condensation reaction. By the use of quartz crystal microbalance with dissipation (QCM-D) and surface plasmon resonance (SPR), we have investigated the adsorption of fibrinogen, bovine serum albumin (BSA), and lysozyme on the polymer surface. The polymer exhibits protein resistance in seawater but not in fresh water because DEM pendant groups carry net neutral charges in the former. The evaluation of antibacterial adhesion of the polymer by using Micrococcus luteus demonstrates that the polymer can effectively inhibit the settlement of marine bacteria. Our studies also show that the polymer is degradable in marine environments.

  13. Genome Sequence of the Fleming Strain of Micrococcus luteus, a Simple Free-Living Actinobacterium▿ †‡

    PubMed Central

    Young, Michael; Artsatbanov, Vladislav; Beller, Harry R.; Chandra, Govind; Chater, Keith F.; Dover, Lynn G.; Goh, Ee-Been; Kahan, Tamar; Kaprelyants, Arseny S.; Kyrpides, Nikos; Lapidus, Alla; Lowry, Stephen R.; Lykidis, Athanasios; Mahillon, Jacques; Markowitz, Victor; Mavromatis, Konstantinos; Mukamolova, Galina V.; Oren, Aharon; Rokem, J. Stefan; Smith, Margaret C. M.; Young, Danielle I.; Greenblatt, Charles L.

    2010-01-01

    Micrococcus luteus (NCTC2665, “Fleming strain”) has one of the smallest genomes of free-living actinobacteria sequenced to date, comprising a single circular chromosome of 2,501,097 bp (G+C content, 73%) predicted to encode 2,403 proteins. The genome shows extensive synteny with that of the closely related organism, Kocuria rhizophila, from which it was taxonomically separated relatively recently. Despite its small size, the genome harbors 73 insertion sequence (IS) elements, almost all of which are closely related to elements found in other actinobacteria. An IS element is inserted into the rrs gene of one of only two rrn operons found in M. luteus. The genome encodes only four sigma factors and 14 response regulators, a finding indicative of adaptation to a rather strict ecological niche (mammalian skin). The high sensitivity of M. luteus to β-lactam antibiotics may result from the presence of a reduced set of penicillin-binding proteins and the absence of a wblC gene, which plays an important role in the antibiotic resistance in other actinobacteria. Consistent with the restricted range of compounds it can use as a sole source of carbon for energy and growth, M. luteus has a minimal complement of genes concerned with carbohydrate transport and metabolism and its inability to utilize glucose as a sole carbon source may be due to the apparent absence of a gene encoding glucokinase. Uniquely among characterized bacteria, M. luteus appears to be able to metabolize glycogen only via trehalose and to make trehalose only via glycogen. It has very few genes associated with secondary metabolism. In contrast to most other actinobacteria, M. luteus encodes only one resuscitation-promoting factor (Rpf) required for emergence from dormancy, and its complement of other dormancy-related proteins is also much reduced. M. luteus is capable of long-chain alkene biosynthesis, which is of interest for advanced biofuel production; a three-gene cluster essential for this metabolism has been identified in the genome. PMID:19948807

  14. Membrane Asymmetry and Expression of Cell Surface Antigens of Micrococcus lysodeikticus Established by Crossed Immunoelectrophoresis

    PubMed Central

    Owen, Peter; Salton, Milton R. J.

    1977-01-01

    Crossed immunoelectrophoresis of Triton X-100-solubilized plasma membranes of Micrococcus lysodeikticus established the presence of 27 discrete antigens. Individual antigens were identified as membrane components possessing enzyme activity by zymogram staining procedures and by reactivity of certain antigens with a selection of four lectins in the crossed-immunoelectrophoresis (immunoaffinoelectrophoresis) system. Absorption experiments with intact, stable protoplasts and isolated membranes established the asymmetric nature of the M. lysodeikticus plasma membranes. Of the 14 antigens with determinants accessible solely on the cytoplasmic face of the membrane, four possessed individual dehydrogenase activities, and a fifth was identifiable as a component possessing adenosine triphosphatase (EC 3.6.1.3) activity. Evidence from absorption studies with isolated membranes suggested that antigens such as the adenosine triphosphatase complex were more readily accessible to reaction with antibodies than was succinate dehydrogenase (EC 1.3.99.1), for example. Twelve antigens were located on the protoplast surface as determined by antibody absorption, and the succinylated lipomannan was identified as a major antigen. At least five other antigens possessed sugar residues that interacted with concanavalin A. With the antisera generated to isolated membranes, there was no evidence suggesting that any of these antigens was not detectable on either surface of the plasma membrane. From absorption experiments with washed, whole cells of M. lysodeikticus, it was concluded that the immunogens on the protoplast surface were also detectable on the surface of the intact cell. However, some of the components such as the succinylated lipomannan appeared to be exposed to a greater extent than others. The cytoplasmic fraction from M. lysodeikticus was used as an antigen source to generate antibodies, and 97 immunoprecipitates were resolvable by crossed immunoelectrophoresis. In the cytoplasm-anticytoplasm reference immunoelectrophoresis pattern of precipitates, three of the immunoprecipitates unique to the cytoplasmic fraction were identifiable by zymogram staining procedures as catalase (EC 1.11.1.6), isocitrate dehydrogenase (EC 1.1.1.42), and polynucleotide phosphorylase (EC 2.3.7.8). The identification of membrane and cytoplasmic antigens (including the above-mentioned enzymes) provides a sensitive analytical system for monitoring cross-contamination and antigen distribution in cellular fractions. Images PMID:144722

  15. Membrane asymmetry and expression of cell surface antigens of Micrococcus lysodeikticus established by crossed immunoelectrophoresis.

    PubMed

    Owen, P; Salton, M R

    1977-12-01

    Crossed immunoelectrophoresis of Triton X-100-solubilized plasma membranes of Micrococcus lysodeikticus established the presence of 27 discrete antigens. Individual antigens were identified as membrane components possessing enzyme activity by zymogram staining procedures and by reactivity of certain antigens with a selection of four lectins in the crossed-immunoelectrophoresis (immunoaffinoelectrophoresis) system. Absorption experiments with intact, stable protoplasts and isolated membranes established the asymmetric nature of the M. lysodeikticus plasma membranes. Of the 14 antigens with determinants accessible solely on the cytoplasmic face of the membrane, four possessed individual dehydrogenase activities, and a fifth was identifiable as a component possessing adenosine triphosphatase (EC 3.6.1.3) activity. Evidence from absorption studies with isolated membranes suggested that antigens such as the adenosine triphosphatase complex were more readily accessible to reaction with antibodies than was succinate dehydrogenase (EC 1.3.99.1), for example. Twelve antigens were located on the protoplast surface as determined by antibody absorption, and the succinylated lipomannan was identified as a major antigen. At least five other antigens possessed sugar residues that interacted with concanavalin A. With the antisera generated to isolated membranes, there was no evidence suggesting that any of these antigens was not detectable on either surface of the plasma membrane. From absorption experiments with washed, whole cells of M. lysodeikticus, it was concluded that the immunogens on the protoplast surface were also detectable on the surface of the intact cell. However, some of the components such as the succinylated lipomannan appeared to be exposed to a greater extent than others. The cytoplasmic fraction from M. lysodeikticus was used as an antigen source to generate antibodies, and 97 immunoprecipitates were resolvable by crossed immunoelectrophoresis. In the cytoplasm-anticytoplasm reference immunoelectrophoresis pattern of precipitates, three of the immunoprecipitates unique to the cytoplasmic fraction were identifiable by zymogram staining procedures as catalase (EC 1.11.1.6), isocitrate dehydrogenase (EC 1.1.1.42), and polynucleotide phosphorylase (EC 2.3.7.8). The identification of membrane and cytoplasmic antigens (including the above-mentioned enzymes) provides a sensitive analytical system for monitoring cross-contamination and antigen distribution in cellular fractions.

  16. Pitfalls in efficacy testing – how important is the validation of neutralization of chlorhexidine digluconate?

    PubMed Central

    Reichel, Mirja; Heisig, Peter; Kampf, Günter

    2008-01-01

    Background Effective neutralization of active agents is essential to obtain valid efficacy results, especially when non-volatile active agents like chlorhexidine digluconate (CHG) are tested. The aim of this study was to determine an effective and non-toxic neutralizing mixture for a propan-1-ol solution containing 2% CHG. Methods Experiments were carried out according to ASTM E 1054-02. The neutralization capacity was tested separately with five challenge microorganisms in suspension, and with a rayon swab carrier. Either 0.5 mL of the antiseptic solution (suspension test) or a saturated swab with the antiseptic solution (carrier test) was added to tryptic soy broth containing neutralizing agents. After the samples were mixed, aliquots were spread immediately and after 3 h of storage at 2 – 8°C onto tryptic soy agar containing a neutralizing mixture. Results The neutralizer was, however, not consistently effective in the suspension test. Immediate spread yielded a valid neutralization with Staphylococcus aureus, Staphylococcus epidermidis and Corynebacterium jeikeium but not with Micrococcus luteus (p < 0.001) and Candida albicans (p < 0.001). A 3-h storage period of the neutralized active agents in suspension resulted in significant carry-over activity of CHG in addition against Staphylococcus epidermidis (p < 0.001) and Corynebacterium jeikeium (p = 0.044). In the carrier test, the neutralizing mixture was found to be effective and non toxic to all challenge microorganisms when spread immediately. However, after 3 h storage of the neutralized active agents significant carry-over activity of CHG against Micrococcus luteus (p = 0.004; Tukey HSD) was observed. Conclusion Without effective neutralization in the sampling fluid, non-volatile active ingredients will continue to reduce the number of surviving microorganisms after antiseptic treatment even if the sampling fluid is kept cold straight after testing. This can result in false-positive antiseptic efficacy data. Attention should be paid during the neutralization validation process to the amount of antiseptic solution, the storage time and to the choice of appropriate and sensitive microorganisms. PMID:19046465

  17. INFLUENCE OF INTRAMUSCULAR FAT LEVEL ON ORGANOLEPTIC, PHYSICAL, AND CHEMICAL CHARACTERISTICS OF IRRADIATED PORK. II. LOW-TEMPERATURE LONG-TIME PRE-IRRADIATION HEAT TREATMENT

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bray, R.W.; Weckel, K.G.; Evans, G.W.

    1964-02-01

    Pork muscle (longissimus dorsi) was graded in three marbling levels by both visual appraisal and ether-extraction analysis of total fat. A low- temperature (121 deg F, gradually increasing to 191 deg F), long-time (19-hr) heat treatment was used for enzyme inactivation. Samples were packed under vacuum in rigid containers and irradiated to 4.5 Mrad with gamma radiation. Irradiated and frozen control samples were evaluated at intervals over a 180-day period. The heat treatment caused excessive connective-tissue breakdown as evidenced by a soft, dry texture. Marbling level had no significant effect on consumer-panel judgments of irradiated or frozen control samples (servedmore » plain, without bread). Lower degrees of marbling were preferred in irradiated sandwich items. Irradiated samples were less preferred than frozen control samples in both plain and sandwich form. Hunter L (color) values a/sub L/ (redness), hue, and saturation attributes were increased by irradiation treatment. Hunter L and b/sub L/ (yellowness) values of highly marbled irradiated sample-s were elevated. Highly marbled samples displayed greater tenderness qualities, as evidenced by mechanical tenderness measurements. Expressible moisture values were decreased by marbling degree and radiation treatment and increased by advancing storage time. As a measure of oxidation rancidity, thiobarbituric acid values were increased by increasing levels of marbling and advancing storage time, but were not influenced by preservation method. No significant differences in pH values due to marbling level or preservation method were detected. Bacteriologic counts of randomly selected irradiated samples indicated that they were commercially sterile (average of 57 colonies/g of sample). Methylene blue stains of colonles revealed Micrococcus. Frozen (control) samples contained moderate numbers of colonies (av. 2300 colonies per g of sample). Micrococcus colonies were again predominant, but a few colonles of film yeasts were also seen. Irradiated samples were negative for thermophilic anaerobic spores producing gas. Control samples were positive, containing gram-negative rods, Escherichia coli, and gram- positive cocci. (BBB)« less

  18. Diversity of Culturable Thermophilic Actinobacteria in Hot Springs in Tengchong, China and Studies of their Biosynthetic Gene Profiles.

    PubMed

    Liu, Lan; Salam, Nimaichand; Jiao, Jian-Yu; Jiang, Hong-Chen; Zhou, En-Min; Yin, Yi-Rui; Ming, Hong; Li, Wen-Jun

    2016-07-01

    The class Actinobacteria has been a goldmine for the discovery of antibiotics and has attracted interest from both academics and industries. However, an absence of novel approaches during the last few decades has limited the discovery of new microbial natural products useful for industries. Scientists are now focusing on the ecological aspects of diverse environments including unexplored or underexplored habitats and extreme environments in the search for new metabolites. This paper reports on the diversity of culturable actinobacteria associated with hot springs located in Tengchong County, Yunnan Province, southwestern China. A total of 58 thermophilic actinobacterial strains were isolated from the samples collected from ten hot springs distributed over three geothermal fields (e.g., Hehua, Rehai, and Ruidian). Phylogenetic positions and their biosynthetic profiles were analyzed by sequencing 16S rRNA gene and three biosynthetic gene clusters (KS domain of PKS-I, KSα domain of PKS-II and A domain of NRPS). On the basis of 16S rRNA gene phylogenetic analysis, the 58 strains were affiliated with 12 actinobacterial genera: Actinomadura Micromonospora, Microbispora, Micrococcus, Nocardiopsis, Nonomuraea, Promicromonospora, Pseudonocardia, Streptomyces, Thermoactinospora, Thermocatellispora, and Verrucosispora, of which the two novel genera Thermoactinospora and Thermocatellisopora were recently described from among these strains. Considering the biosynthetic potential of these actinobacterial strains, 22 were positive for PCR amplification of at least one of the three biosynthetic gene clusters (PKS-I, PKS-II, and NRPS). These actinobacteria were further subjected to antimicrobial assay against five opportunistic human pathogens (Acinetobacter baumannii, Escherichia coli, Micrococcus luteus, Staphylococcus aureus and Streptococcus faecalis). All of the 22 strains that were positive for PCR amplification of at least one of the biosynthetic gene domains exhibited antimicrobial activities against at least one of the five test organisms. Among the remaining 36 actinobacteria that are negative for PCR amplification of the domains for the biosynthetic genes, 33 strains showed antimicrobial activities against at least one of the five test pathogens. In summary, the findings presented in this study emphasized the importance of underexplored habitats such as Tengchong hot springs as potential sources for search of bioactive molecules.

  19. Impact of Branched-Chain Amino Acid Catabolism on Fatty Acid and Alkene Biosynthesis in Micrococcus luteus.

    PubMed

    Surger, Maximilian J; Angelov, Angel; Stier, Philipp; Übelacker, Maria; Liebl, Wolfgang

    2018-01-01

    Micrococcus luteus naturally produces alkenes, unsaturated aliphatic hydrocarbons, and represents a promising host to produce hydrocarbons as constituents of biofuels and lubricants. In this work, we identify the genes for key enzymes of the branched-chain amino acid catabolism in M. luteus , whose first metabolic steps lead also to the formation of primer molecules for branched-chain fatty acid and olefin biosynthesis, and demonstrate how these genes can be used to manipulate the production of specific olefins in this organism. We constructed mutants of several gene candidates involved in the branched-chain amino acid metabolism or its regulation and investigated the resulting changes in the cellular fatty acid and olefin profiles by GC/MS. The gene cluster encoding the components of the branched-chain α-keto acid dehydrogenase (BCKD) complex was identified by deletion and promoter exchange mutagenesis. Overexpression of the BCKD gene cluster resulted in about threefold increased olefin production whereas deletion of the cluster led to a drastic reduction in branched-chain fatty acid content and a complete loss of olefin production. The specificities of the acyl-CoA dehydrogenases of the branched amino acid degradation pathways were deduced from the fatty acid and olefin profiles of the respective deletion mutant strains. In addition, growth experiments with branched amino acids as the only nitrogen source were carried out with the mutants in order to confirm our annotations. Both the deletion mutant of the BCKD complex, responsible for the further degradation of all three branched-chain amino acids, as well as the deletion mutant of the proposed isovaleryl-CoA dehydrogenase (specific for leucine degradation) were not able to grow on leucine in contrast to the parental strain. In conclusion, our experiments allow the unambigous assignment of specific functions to the genes for key enzymes of the branched-chain amino acid metabolism of M. luteus . We also show how this knowledge can be used to engineer the isomeric composition and the chain lengths of the olefins produced by this organism.

  20. HSP70 gene expression in Mytilus galloprovincialis hemocytes is triggered by moderate heat shock and Vibrio anguillarum, but not by V. splendidus or Micrococcus lysodeikticus.

    PubMed

    Cellura, Cinzia; Toubiana, Mylène; Parrinello, Nicolo; Roch, Philippe

    2006-01-01

    Complete sequence of HSP70 cDNA from the mussel, Mytilus galloprovincialis was established before quantifying its expression following moderate heat shock or injection of heat-killed bacteria. HSP70 cDNA is comprised of 2378 bp including one ORF of 654 aa, with a predicted 70 bp 5'-UTR and a 343 bp 3'-UTR (GenBank, 18 Jan 05, AY861684). Alignment identity ranged from 89% for Crassostrea ariakensis to 72% for C. virginica. Curiously, HSP70 gene and cDNA sequences from M. galloprovincialis, deposited later (03 and 27 May), show only 73% identity with the present sequence. Meanwhile, characteristic motifs of the HSP70 family were located in conserved positions. Expression of HSP70 gene was quantified on circulating hemocyte mRNA using Q-PCR after RT using random hexaprimers. Housekeeping gene was 28S rRNA. Four stresses were applied: heat shock that consisted of immersing mussels for 90 min at 30 degrees C and returning them to 20 degrees C sea water, one injection of heat-killed Gram-negative bacteria, Vibrio splendidus LGP32, one injection of heat-killed Gram-negative bacteria Vibrio anguillarum, one injection of heat-killed Gram-positive bacteria Micrococcus lysodeikticus. We found no significant modification of 28S rRNA gene expression. Significant increase of 5.2 +/- 0.4 fold the ratio HSP70/28S rRNA was observed 6 h after heat shock and was maximum at 15 h (6.1 +/- 1.1), and still significant after 24 h (1.7 +/- 0.03). Similarly, injecting V. anguillarum resulted in a significant increase of 2.7 +/- 0.1 after 12 h. Expression was maximum after 48 h (5.2 +/- 0.05) and returned to baseline after 72 h. In contrast, injecting V. splendidus or M. lysodeikticus failed to significantly modulate HSP70 gene expression at least during the first 3 days post-injection. Consequently, mussel hemocytes appeared to discriminate between pathogenic and non-pathogenic Vibrios, as well as between Gram-negative and Gram-positive bacteria.

  1. Electromechanical and Elastic Probing of Bacteria in Cell Culture Medium

    PubMed Central

    Thompson, G.L.; Reukov, V.V.; Nikiforov, M.P.; Jesse, S.; Kalinin, S.V.; Vertegel, A.A.

    2012-01-01

    Rapid phenotype characterization and identification of cultured cells, which is needed for progress in tissue engineering and drug testing, requires an experimental technique that measures physical properties of cells with sub-micron resolution. Recently, band excitation piezoresponse force microscopy (BEPFM) has been proven useful for recognition and imaging of different types of bacteria in pure water. Here, the BEPFM method is performed for the first time in physiologically-relevant electrolyte media, such as Dulbecco’s phosphate-buffered saline (DPBS) and Dulbecco’s modified Eagle’s medium (DMEM). Distinct electromechanical responses for Micrococcus lysodeikticus (Gram-positive) and Pseudomonas fluorescens (Gram-negative) bacteria are demonstrated in DPBS. The results suggest that mechanical properties of the outer surface coating each bacterium, as well as the electrical double layer around them, are responsible for the BEPFM image formation mechanism in electrolyte media. PMID:22641388

  2. Kocuria kristinae infection associated with acute cholecystitis

    PubMed Central

    Ma, Edmond SK; Wong, Chris LP; Lai, Kristi TW; Chan, Edmond CH; Yam, WC; Chan, Angus CW

    2005-01-01

    Background Kocuria, previously classified into the genus of Micrococcus, is commonly found on human skin. Two species, K. rosea and K. kristinae, are etiologically associated with catheter-related bacteremia. Case presentation We describe the first case of K. kristinae infection associated with acute cholecystitis. The microorganism was isolated from the bile of a 56-year old Chinese man who underwent laparoscopic cholecystectomy. He developed post-operative fever that resolved readily after levofloxacin treatment. Conclusion Our report of K. kristinae infection associated with acute cholecystitis expands the clinical spectrum of infections caused by this group of bacteria. With increasing number of recent reports describing the association between Kocuria spp. and infectious diseases, the significance of their isolation from clinical specimens cannot be underestimated. A complete picture of infections related to Kocuria spp. will have to await the documentation of more clinical cases. PMID:16029488

  3. Kocuria kristinae infection associated with acute cholecystitis.

    PubMed

    Ma, Edmond S K; Wong, Chris L P; Lai, Kristi T W; Chan, Edmond C H; Yam, W C; Chan, Angus C W

    2005-07-19

    Kocuria, previously classified into the genus of Micrococcus, is commonly found on human skin. Two species, K. rosea and K. kristinae, are etiologically associated with catheter-related bacteremia. We describe the first case of K. kristinae infection associated with acute cholecystitis. The microorganism was isolated from the bile of a 56-year old Chinese man who underwent laparoscopic cholecystectomy. He developed post-operative fever that resolved readily after levofloxacin treatment. Our report of K. kristinae infection associated with acute cholecystitis expands the clinical spectrum of infections caused by this group of bacteria. With increasing number of recent reports describing the association between Kocuria spp. and infectious diseases, the significance of their isolation from clinical specimens cannot be underestimated. A complete picture of infections related to Kocuria spp. will have to await the documentation of more clinical cases.

  4. An antibacterial ortho-quinone diterpenoid and its derivatives from Caryopteris mongolica.

    PubMed

    Saruul, Erdenebileg; Murata, Toshihiro; Selenge, Erdenechimeg; Sasaki, Kenroh; Yoshizaki, Fumihiko; Batkhuu, Javzan

    2015-06-15

    To identify antibacterial components in traditional Mongolian medicinal plant Caryopteris mongolica, an ortho-quinone abietane caryopteron A (1) and three its derivatives caryopteron B-D (2-4) were isolated from the roots of the plant together with three known abietanes demethylcryptojaponol (5), 6α-hydroxydemethyl cryptojaponol (6), and 14-deoxycoleon U (7). The chemical structures of these abietane derivatives were elucidated on the basis of spectroscopic data. Compounds 1-4 had C-13 methylcyclopropane substructures, and 2-4 had a hexanedioic anhydride ring C instead of ortho-quinone in 1. The stereochemistry of these compound was assumed from NOE spectra and ECD Cotton effects. Compounds 1 and 5-7 showed antibacterial activities against the Gram-positive bacteria Staphylococcus aureus, Staphylococcus epidermidis, Enterococcus faecalis, and Micrococcus luteus, being 1 the more potent. Copyright © 2015 Elsevier Ltd. All rights reserved.

  5. Development of a simple and low cost microbioreactor for high-throughput bioprocessing.

    PubMed

    Rahman, Pattanathu K S M; Pasirayi, Godfrey; Auger, Vincent; Ali, Zulfiqur

    2009-02-01

    A simple microbioreactor for high-throughput bioprocessing made from low cost polymer polytetrafluoroethylene (PTFE) tubes with a working volume of 1.5 ml is described. We have developed a microfluidic system that handles a small population of cells of a model microorganism, Pseudomonas aeruginosa DS10-129. Under the conditions of the microbioreactor, the organism produced extracellular secondary metabolites by using nutrient broth modified with glycerol. Pyocyanins were isolated from the fermented medium as a metabolite of interest. Antibiotic properties of pyocyanin were effective against a number of microorganisms such as Staphylococcus aureus, S. epidermis, Bacillus subtilis, Micrococcus luteus and Saccharomyces cerevisiae. Batch fermentation of the model organism in the microbioreactor was compared to shake-flask and conventional bench fermenter methods. Results obtained from the microbioreactor compared favourably with the conventional processes.

  6. Violacein-producing Collimonas sp. from the sea surface microlayer of costal waters in Trøndelag, Norway.

    PubMed

    Hakvåg, Sigrid; Fjaervik, Espen; Klinkenberg, Geir; Borgos, Sven Even F; Josefsen, Kjell D; Ellingsen, Trond E; Zotchev, Sergey B

    2009-11-12

    A new strain belonging to the genus Collimonas was isolated from the sea surface microlayer off the coast of Trøndelag, Norway. The bacterium, designated Collimonas CT, produced an antibacterial compound active against Micrococcus luteus. Subsequent studies using LC-MS identified this antibacterial compound as violacein, known to be produced by several marine-derived bacteria. Fragments of the violacein biosynthesis genes vioA and vioB were amplified by PCR from the Collimonas CT genome and sequenced. Phylogenetic analysis of these sequences demonstrated close relatedness of the Collimonas CT violacein biosynthetic gene cluster to those in Janthinobacterium lividum and Duganella sp., suggesting relatively recent horizontal gene transfer. Considering diverse biological activities of violacein, Collimonas CT shall be further studied as a potential producer of this compound.

  7. [Typing of skin staphylococci using the commercial identification system Staphy-Test].

    PubMed

    Pospísil, L; Pospísilova, A; Kocur, M

    1989-01-01

    The authors examined 150 strains of S. aureus and 180 strains of S. epidermidis isolated from different dermatoses. The determination of S. aureus and S. epidermidis was based on common routine tests as plasmacoagulase, production of hemolysin, acid production from mannitol and production of pigment. This determination was verified with the aid of a new identification system STAPHYtest. The STAPHYtest confirmed the previous diagnosis of S. aureus in 60.66% and that of S. epidermidis in 31.66% of strains only. The remaining strains were identified by means of STAPHYtest as S. simulans, S. xylosus, S. hominis, S. haemolyticus, S. warneri, S. auricularis, S. sciuri and Micrococcus sp. The authors discuss the importance of an curate identification of skin staphylococci by means of STAPHYtest for taxonomic purposes and for classification of staphylococci influence on different dermatoses.

  8. A novel carbohydrate-binding surface layer protein from the hyperthermophilic archaeon Pyrococcus horikoshii.

    PubMed

    Goda, Shuichiro; Koga, Tomoyuki; Yamashita, Kenichiro; Kuriura, Ryo; Ueda, Toshifumi

    2018-04-08

    In Archaea and Bacteria, surface layer (S-layer) proteins form the cell envelope and are involved in cell protection. In the present study, a putative S-layer protein was purified from the crude extract of Pyrococcus horikoshii using affinity chromatography. The S-layer gene was cloned and expressed in Escherichia coli. Isothermal titration calorimetry analyses showed that the S-layer protein bound N-acetylglucosamine and induced agglutination of the gram-positive bacterium Micrococcus lysodeikticus. The protein comprised a 21-mer structure, with a molecular mass of 1,340 kDa, as determined using small-angle X-ray scattering. This protein showed high thermal stability, with a midpoint of thermal denaturation of 79 °C in dynamic light scattering experiments. This is the first description of the carbohydrate-binding archaeal S-layer protein and its characteristics.

  9. Composition and antimicrobial activity of Marrubium incanum Desr. (Lamiaceae) essential oil.

    PubMed

    Petrović, Silvana; Pavlović, Milica; Maksimović, Zoran; Milenković, Marina; Couladis, Maria; Tzakouc, Olga; Niketić, Marjan

    2009-03-01

    The essential oil from the aerial parts of Marrubium incanum Desr. (Lamiaceae), obtained by hydrodistillation, was analyzed by GC and GC-MS. Forty-six compounds were identified, representing 96.3% of the total oil. The main components of the oil were (E)-caryophyllene (27.0%), germacrene D (26.2%) and bicyclogermacrene (11.5%). The microbial growth inhibitory properties of the isolated essential oil were determined using the agar diffusion and broth microdilution method against seven bacterial species (Staphylococcus aureus ATCC 25923, S. epidermidis ATCC 12228, Micrococcus flavus ATCC 10240, Enterococcus faecalis ATCC 29212, Escherichia coli ATCC 25922, Klebsiella pneumoniae NCIMB 9111, and Pseudomonas aeruginosa ATCC 27853), and two strains of the yeast Candida albicans (ATCC 10259 and ATCC24433). The essential oil showed activity against all the microorganisms tested, but differences in microbial susceptibility were registered.

  10. Violacein-Producing Collimonas sp. from the Sea Surface Microlayer of Costal Waters in Trøndelag, Norway

    PubMed Central

    Hakvåg, Sigrid; Fjærvik, Espen; Klinkenberg, Geir; Borgos, Sven Even F.; Josefsen, Kjell D.; Ellingsen, Trond E.; Zotchev, Sergey B.

    2009-01-01

    A new strain belonging to the genus Collimonas was isolated from the sea surface microlayer off the coast of Trøndelag, Norway. The bacterium, designated Collimonas CT, produced an antibacterial compound active against Micrococcus luteus. Subsequent studies using LC-MS identified this antibacterial compound as violacein, known to be produced by several marine-derived bacteria. Fragments of the violacein biosynthesis genes vioA and vioB were amplified by PCR from the Collimonas CT genome and sequenced. Phylogenetic analysis of these sequences demonstrated close relatedness of the Collimonas CT violacein biosynthetic gene cluster to those in Janthinobacterium lividum and Duganella sp., suggesting relatively recent horizontal gene transfer. Considering diverse biological activities of violacein, Collimonas CT shall be further studied as a potential producer of this compound. PMID:20098599

  11. Microbial growth associated with granular activated carbon in a pilot water treatment facility.

    PubMed Central

    Wilcox, D P; Chang, E; Dickson, K L; Johansson, K R

    1983-01-01

    The microbial dynamics associated with granular activated carbon (GAC) in a pilot water treatment plant were investigated over a period of 16 months. Microbial populations were monitored in the influent and effluent waters and on the GAC particles by means of total plate counts and ATP assays. Microbial populations between the influent and effluent waters of the GAC columns generally increased, indicating microbial growth. The dominant genera of microorganisms isolated from interstitial waters and GAC particles were Achromobacter, Acinetobacter, Aeromonas, Alcaligenes, Bacillus, Chromobacterium, Corynebacterium, Micrococcus, Microcyclus, Paracoccus, and Pseudomonas. Coliform bacteria were found in small numbers in the effluents from some of the GAC columns in the later months of the study. Oxidation of influent waters with ozone and maintenance of aerobic conditions on the GAC columns failed to appreciably enhance the microbial growth on GAC. PMID:6625567

  12. Antibacterial properties of grapefruit seed extract against Paenibacillus larvae subsp. larvae.

    PubMed

    Semprini, P; Langella, V; Pasini, B; Falda, M T; Calvarese, S

    2004-01-01

    Twenty-one samples of grapefruit seed extract (GSE) either from marketed products or provided by an apiculturist were analysed to verify their inhibition activity, in particular against Paenibacillus larvae subsp. larvae, responsible for American foulbrood. The bactericide capacity of GSE has been measured in Bacillus subtilis BGA, Bacillus cereus 11778, Bacillus cereus K250 and Micrococcus luteus 9341a; these bacteria are normally used in the laboratory to study inhibitors. The results showed that not all GSE have the same inhibitory activity and two of those analysed do not inhibit the five bacteria used. Considering that 19 samples inhibited American foulbrood bacillus, the authors conclude that the use of a natural product (such as GSE) to control this important disease of bees, can be used as a substitute for chemotherapeutic products, after appropriate expedients.

  13. Chemometric formulation of bacterial consortium-AVS for improved decolorization of resonance-stabilized and heteropolyaromatic dyes.

    PubMed

    Kumar, Madhava Anil; Kumar, Vaidyanathan Vinoth; Premkumar, Manickam Periyaraman; Baskaralingam, Palanichamy; Thiruvengadaravi, Kadathur Varathachary; Dhanasekaran, Anuradha; Sivanesan, Subramanian

    2012-11-01

    A bacterial consortium-AVS, consisting of Pseudomonas desmolyticum NCIM 2112, Kocuria rosea MTCC 1532 and Micrococcus glutamicus NCIM 2168 was formulated chemometrically, using the mixture design matrix based on the design of experiments methodology. The formulated consortium-AVS decolorized acid blue 15 and methylene blue with a higher average decolorization rate, which is more rapid than that of the pure cultures. The UV-vis spectrophotometric, Fourier transform infra red spectrophotometric and high performance liquid chromatographic analysis confirm that the decolorization was due to biodegradation by oxido-reductive enzymes, produced by the consortium-AVS. The toxicological assessment of plant growth parameters and the chlorophyll pigment concentrations of Phaseolus mungo and Triticum aestivum seedlings revealed the reduced toxic nature of the biodegraded products. Copyright © 2012 Elsevier Ltd. All rights reserved.

  14. Enzymatic synthesis of polymers containing nicotinamide mononucleotide

    NASA Technical Reports Server (NTRS)

    Liu, Rihe

    1995-01-01

    Nicotinamide mononucleoside 5'-diphosphate in its reduced form is an excellent substrate for polynucleotide phosphorylase from Micrococcus luteus both in de novo polymerization reactions and in primer extension reactions. The oxidized form of the diphosphate is a much less efficient substrate; it can be used to extend primers but does not oligomerize in the absence of a primer. The cyanide adduct of the oxidized substrate, like the reduced substrate, polymerizes efficiently. Loss of cyanide yields high molecular weight polymers of the oxidized form. Terminal transferase from calf thymus accepts nicotinamide mononucleoside 5'-triphosphate as a substrate and efficiently adds one residue to the 3'-end of an oligodeoxynucleotide. T4 polynucleotide kinase accepts oligomers of nicotinamide mononucleotide as substrates. However, RNA polymerases do not incorporate nicotinamide mononucleoside 5'-triphosphate into products on any of the templates that we used.

  15. The Effect of Temperature on the Survival of Microorganisms in a Deep Space Vacuum

    NASA Technical Reports Server (NTRS)

    Hagen, C. A.; Godfrey, J. F.; Green, R. H.

    1971-01-01

    A space molecular sink research facility (Molsink) was used to evaluate the ability of microorganisms to survive the vacuum of outer space. This facility could be programmed to simulate flight spacecraft vacuum environments at pressures in the .1 nanotorr range and thermal gradients (30 to 60 C) closely associated to surface temperatures of inflight spacecraft. Initial populations of Staphylococcus epidermidis and a Micrococcus sp. were reduced approximately 1 log while exposed to -105 and 34 C, and approximately 2 logs while exposed to 59 C for 14 days in the vacuum environment. Spores of Bacillus subtilis var. niger were less affected by the environment. Initial spore populations were reduced 0.2, 0.3, and 0.8 log during the 14-day vacuum exposure at -124, 34, and 59 C, respectively.

  16. Enzymatic Synthesis of Polymers Containing Nicotinamide Mononucleotide

    NASA Technical Reports Server (NTRS)

    Liu, Rihe; Orgel, Leslie E.

    1995-01-01

    Nicotinamide mononucleoside 5'-diphosphate in its reduced form is an excellent substrate for polynucleotide phosphorylase from Micrococcus luteus both in de novo polymerization reactions and in primer extension reactions. The oxidized form of the diphosphate is a much less efficient substrate; it can be used to extend primers but does not oligomerize in the absence of a primer. The cyanide adduct of the oxidized substrate, like the reduced substrate, polymerizes efficiently. Loss of cyanide yields high molecular weight polymers of the oxidized form. Terminal transferase from calf thymus accepts nicotinamide mononucleoside 5'-triphosphate as a substrate and efficiently adds one residue to the 3'-end of an oligodeoxynucleotide. T4 polynucleotide kinase accepts oligomers of nicotinamide mononucleotide as substrates. However, RNA polymerases do not incorporate nicotinamide mononucleoside 5'-triphosphate into products on any of the templates that we used.

  17. A novel green one-step synthesis of silver nanoparticles using chitosan: catalytic activity and antimicrobial studies

    NASA Astrophysics Data System (ADS)

    Venkatesham, Maragoni; Ayodhya, Dasari; Madhusudhan, Alle; Veera Babu, Nagati; Veerabhadram, Guttena

    2014-01-01

    Stable silver nanoparticles were synthesized using chitosan acting as both reducing and stabilizing agent without using any toxic chemicals. This reaction was carried out in an autoclave at a pressure of 15 psi and 120 °C temperature by varying the time. The influence of different parameters such as time, change of concentration of silver nitrate and concentration of chitosan on the formation of silver nanoparticles were studied. The synthesized silver nanoparticles were characterized by UV-visible spectroscopy, Fourier transform infrared, X-ray diffraction and transmission electron microscopy. The results of catalytic reduction of 4-nitrophenol by sodium borohydride in the presence of green synthesized silver nanoparticles were presented. The antimicrobial activity of silver nanoparticles was tested against Escherichia coli and Micrococcus luteus and was found to be possessing inhibiting property.

  18. Electromechanical and elastic probing of bacteria in a cell culture medium

    NASA Astrophysics Data System (ADS)

    Thompson, G. L.; Reukov, V. V.; Nikiforov, M. P.; Jesse, S.; Kalinin, S. V.; Vertegel, A. A.

    2012-06-01

    Rapid phenotype characterization and identification of cultured cells, which is needed for progress in tissue engineering and drug testing, requires an experimental technique that measures physical properties of cells with sub-micron resolution. Recently, band excitation piezoresponse force microscopy (BEPFM) has been proven useful for recognition and imaging of bacteria of different types in pure water. Here, the BEPFM method is performed for the first time on physiologically relevant electrolyte media, such as Dulbecco’s phosphate-buffered saline (DPBS) and Dulbecco’s modified Eagle’s medium (DMEM). Distinct electromechanical responses for Micrococcus lysodeikticus (Gram-positive) and Pseudomonas fluorescens (Gram-negative) bacteria in DPBS are demonstrated. The results suggest that mechanical properties of the outer surface coating each bacterium, as well as the electrical double layer around them, are responsible for the BEPFM image formation mechanism in electrolyte media.

  19. Biodegradation of naphthalene and anthracene by chemo-tactically active rhizobacteria of populus deltoides

    PubMed Central

    Bisht, Sandeep; Pandey, Piyush; Sood, Anchal; Sharma, Shivesh; Bisht, N. S.

    2010-01-01

    Several naphthalene and anthracene degrading bacteria were isolated from rhizosphere of Populus deltoides, which were growing in non-contaminated soil. Among these, four isolates, i.e. Kurthia sp., Micrococcus varians, Deinococcus radiodurans and Bacillus circulans utilized chrysene, benzene, toluene and xylene, in addition to anthracene and naphthalene. Kurthia sp and B. circulans showed positive chemotactic response for naphthalene and anthracene. The mean growth rate constant (K) of isolates were found to increase with successive increase in substrate concentration (0.5 to 1.0 mg/50ml). B. circulans SBA12 and Kurthia SBA4 degraded 87.5% and 86.6% of anthracene while, Kurthia sp. SBA4, B. circulans SBA12, and M. varians SBA8 degraded 85.3 %, 95.8 % and 86.8 % of naphthalene respectively after 6 days of incubation as determined by HPLC analysis. PMID:24031572

  20. Bioprospecting highly diverse endophytic Pestalotiopsis spp. with antibacterial properties from Maytenus ilicifolia, a medicinal plant from Brazil.

    PubMed

    Gomes-Figueiredo, Josiane; Pimentel, Ida C; Vicente, Vânia A; Pie, Marcio R; Kava-Cordeiro, Vanessa; Galli-Terasawa, Lygia; Pereira, José O; de Souza, Antonia Q L; Glienke, Chirlei

    2007-10-01

    Thirteen endophytic fungal strains of the genus Pestalotiopsis were isolated from the medicinal plant Maytenus ilicifolia Mart. ex. Reiss (commonly known as "espinheira santa") and their antimicrobial properties were investigated. Two isolates were successful in inhibiting the growth of the tested microorganisms (Escherichia coli, Klebsiella pneumoniae, Micrococcus luteus, Staphylococcus aureus, and methicillin-resistant Staphylococcus aureus (MRSA)) using the technique of bioautographic thin-layer chromatography (TLC) agar overlay assay. An analysis based on a polyphasic approach integrating taxonomic information, morphological traits, RAPD markers, and the sequencing of the ITS1-5.8S-ITS2 of the rDNA led to the assignment of the isolates as belonging to the species Pestalotiopsis microspora, Pestalotiopsis vismiae, and Pestalotiopsis leucothoes. Therefore, the present study presents a new approach to the study of endophytic fungi of the genus Pestalotiopsis.

  1. Interactions between yeasts and bacteria in the smear surface-ripened cheeses.

    PubMed

    Corsetti, A; Rossi, J; Gobbetti, M

    2001-09-19

    In the initial phase of ripening, the microflora of bacterial smear surface-ripened cheeses such as Limburger, Taleggio, Brick, Münster and Saint-Paulin and that of surface mould-ripened cheeses such as Camembert and Brie may be similar, but at the end of the ripening, bacteria such as Brevibacterium spp., Arthrobacter spp., Micrococcus spp., Corynebacterium spp. and moulds such as Penicillium camemberti are, respectively, the dominant microorganisms. Yeasts such as Candida spp., Cryptococcus spp., Debaryomyces spp., Geotrichum candidum, Pichia spp., Rhodotorula spp., Saccharomyces spp. and Yarrowia lipolytica are often and variably isolated from the smear surface-ripened cheeses. Although not dominant within the microorganisms of the smear surface-ripened cheeses, yeasts establish significant interactions with moulds and especially bacteria, including surface bacteria and lactic acid bacteria. Some aspects of the interactions between yeasts and bacteria in such type of cheeses are considered in this paper.

  2. Whole Microorganisms Studied by Pyrolysis-Gas Chromatography-Mass Spectrometry: Significance for Extraterrestrial Life Detection Experiments 1

    PubMed Central

    Simmonds, Peter G.

    1970-01-01

    Pyrolysis-gas chromatography-mass spectrometric studies of two microorganisms, Micrococcus luteus and Bacillus subtilis var. niger, indicate that the majority of thermal fragments originate from the principal classes of bio-organic matter found in living systems such as protein and carbohydrate. Furthermore, there is a close qualitative similarity between the type of pyrolysis products found in microorganisms and the pyrolysates of other biological materials. Conversely, there is very little correlation between microbial pyrolysates and comparable pyrolysis studies of meteoritic and fossil organic matter. These observations will aid in the interpretation of a soil organic analysis experiment to be performed on the surface of Mars in 1975. The science payload of this landed mission will include a combined pyrolysis-gas chromatography-mass spectrometry instrument as well as several “direct biology experiments” which are designed to search for extraterrestrial life. PMID:16349890

  3. Autolytic defective mutant of Streptococcus faecalis.

    PubMed Central

    Cornett, J B; Redman, B E; Shockman, G D

    1978-01-01

    Properties of a variant of Streptococcus faecalis ATCC 9790 with defective cellular autolysis are described. The mutant strain was selected as a survivor from a mutagenized cell population simultaneously challenged with two antibiotics which inhibit cell wall biosynthesis, penicillin G and cycloserine. Compared to the parental strain, the mutant strain exhibited: (i) a thermosensitive pattern of cellular autolysis; (ii) an autolytic enzyme activity that had only a slightly increased thermolability when tested in solution in the absence of wall substrate; and (iii) an isolated autolysin that had hydrolytic activity on isolated S. faecalis wall substrate indistinguishable from that of the parental strain, but that was inactive when tested on walls of Micrococcus lysodeikticus as a substrate. These data indicate an alteration in the substrate specificity of the autolytic enzyme of the mutant which appears to result from the synthesis of an altered form of autolytic enzyme. PMID:415045

  4. THE CYTOLOGY AND GENETICS OF RADIATION RESISTANCE IN BACTERIA. Progress Report for the Period of November 1, 1956 to November 1, 1957

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    None

    1960-10-31

    >The effects of various chemical mutugens on the radiosensitivity of Nocardia corallina were investigated. The application of the unpaired defect theory of Tobias and the ploidy stute in N. corallina were also studied. Nocardia corallina was used as a diploid cell and Micrococcus aureus and Escherichia coli were used as haploid cells for comparative purposes. Chemicals used included nitrogen mustard, sodium azide, copper sulfate, caffeine, ascorbic acid, mercuric chloride, manganous chloride, and hydrogen peroxide. Data are tabulated on the effects of pretreatment with the chemicals on response to ultraviolet and x radiations. Results are also included from a study ofmore » the effects of ultraviolet radiation on the cytology snd colony development of Nocardia corallina. The effects of pigment on radiosensitivity and factors involved in the development of radiation-resistant strains are discussed. (For preceding period see ORO-283.) (C.H.)« less

  5. Antimicrobial and antifungal activities of the extracts and essential oils of Bidens tripartita.

    PubMed

    Tomczykowa, Monika; Tomczyk, Michał; Jakoniuk, Piotr; Tryniszewska, Elzbieta

    2008-01-01

    The aim of this study was to determine the antibacterial and antifungal properties of the extracts, subextracts and essential oils of Bidens tripartita flowers and herbs. In the study, twelve extracts and two essential oils were investigated for activity against different Gram-positive Bacillus subtilis, Micrococcus luteus, Staphylococcus aureus, Gram-negative bacteria Escherichia coli, E. coli (beta-laktamase+), Klebsiella pneumoniae (ESBL+), Pseudomonas aeruginosa and some fungal organisms Candida albicans, C. parapsilosis, Aspergillus fumigatus, A. terreus using a broth microdilution and disc diffusion methods. The results obtained indicate antimicrobial activity of the tested extracts (except butanolic extracts), which however did not inhibit the growth of fungi used in this study. Bacteriostatic effect of both essential oils is insignificant, but they have strong antifungal activity. These results support the use of B. tripartita to treat a microbial infections and it is indicated as an antimicrobial and antifungal agent, which may act as pharmaceuticals and preservatives.

  6. [Study on the inhibitory activity, in vitro, of baicalein and baicalin against skin fungi and bacteria].

    PubMed

    Yang, D; Hu, H; Huang, S; Chaumont, J P; Millet, J

    2000-05-01

    In this paper, we concentrated in examining, in vitro, the antiseptic activity of the baicalein and baicalin upon the seventeen pathogenic skin fungal and sixteen skin bacterial strains, these two flavonic compounds were known principally as the biosubstances of a traditional Chinese medicinal plant: Scutellaria baicalensis. In agar media, the baicalein possessed potent specific activity against the pathogenic yeasts with MICs of 70-100 micrograms/ml; But in the same condition, no inhibitory effect was observed upon dermatophytes and filamentous imperfect fungi for baicalein, and upon all used strains for baicalin. According to the antibacterial test of baicalein, a high efficacy was achieved against certain causative specie of axillary and foot's odour such as Micrococcus sedentarius, Staphylococcus epidermidis, S. hominis and C. xerosis with a MICs inferior to 250 micrograms/ml. The good inhibitory activity of baicalein could be linked to the group hydroxyl (-OH) in position seven of the molecule.

  7. Antimicrobial activity of honokiol and magnolol isolated from Magnolia officinalis.

    PubMed

    Ho, K Y; Tsai, C C; Chen, C P; Huang, J S; Lin, C C

    2001-03-01

    The antimicrobial activity of honokiol and magnolol, the main constituents of Magnolia officinalis was investigated. The antimicrobial activity was assayed by the agar dilution method using brain heart infusion medium and the minimum inhibitory concentration (MIC) were determined for each compound using a twofold serial dilution assay. The results showed that honokiol and magnolol have a marked antimicrobial effect (MIC = 25 microg/mL) against Actinobacillus actinomycetemcomitans, Porphyromonas gingivalis, Prevotella intermedia, Micrococcus luteus and Bacillus subtilis, but did not show antimicrobial activity (MIC > or = 100 microg/mL) for Shigella flexneii, Staphylococcus epidermidis, Enterobacter aerogenes, Proteus vulgaris, Escherichia coli and Pseudomonas aeruginosa. Our results indicate that honokiol and magnolol, although less potent than tetracycline, show a significant antimicrobial activity for periodontal pathogens. Hence we suggest that honokiol and magnolol might have the potential to be an adjunct in the treatment of periodontitis. Copyright 2001 John Wiley & Sons, Ltd.

  8. Potential of the essential oil from Pimenta pseudocaryophyllus as an antimicrobial agent.

    PubMed

    Suzuki, Érika Yoko; Baptista, Edilene Bolutari; Resende Do Carmo, Antônio Márcio; Miranda Chaves, Maria Das Graças Afonso; Chicourel, Elizabeth Lemos; Barbosa Raposo, Nádia Rezende

    2014-09-01

    This study evaluated the effectiveness of the essential oil of Pimenta pseudocaryophyllus in inhibiting the growth of the main bacteria responsible for bad perspiration odor (Staphylococcus epidermidis, Proteus hauseri, Micrococcus yunnanensis and Corynebacterium xerosis). The chemical profile of the essential oil was evaluated by high-resolution gas chromatography (HR-GC) and four constituents were identified, eugenol being the major component (88.6%). The antimicrobial activity was evaluated by means of the turbidimetric method, using the microdilution assay. The minimum inhibitory concentration (MIC) values of the essential oil ranged from 500 to 1,000 μg mL⁻¹. Scanning electron microscope (SEM) observations confirmed the physical damage and morphological alteration of the test bacteria treated with the essential oil, reference drugs and eugenol. The findings of the study demonstrated that this essential oil can be used in the formulation of personal care products.

  9. Chemical constituents and antimicrobial activity of the essential oil of Lantana xenica.

    PubMed

    Juliani, Hector R; Biurrun, Fernando; Koroch, Adolfina R; Oliva, M M; Demo, Mirta S; Trippi, Victorio S; Zygadlo, Julio A

    2002-08-01

    The aim of this work was to evaluate the chemical composition of Lantana xenica essential oil and its antimicrobial activity. The oil from the aerial parts of Lantana xenica Mold. (Verbenacea) was obtained by steam distillation and analyzed by gas chromatography/mass spectrometry. The major constituent of the oil was (E)-caryophyllene (35.2 %), with minor amounts of gamma-cadinene (13.3 %), alpha-pinene (9.3 %), ocimene (9.2 %) and germacrene D (6.6 %). The antimicrobial assays showed that the essential oil of L. xenica inhibited the growth of Bacillus cereus and Proteus mirabilis and both bacteria were inhibited by (E)-caryophyllene, the major component of the oil. Enterococcus faecalis, Staphylococcus epidermidis and S. aureus showed a lower inhibition. The bacteria Micrococcus luteus, Klebsiella sp., Escherichia coli and the yeast Candida albicans were insensitive to both the oil and (E)-caryophyllene.

  10. Construction of probe of the plant growth-promoting bacteria Bacillus subtilis useful for fluorescence in situ hybridization.

    PubMed

    Posada, Luisa F; Alvarez, Javier C; Hu, Chia-Hui; de-Bashan, Luz E; Bashan, Yoav

    2016-09-01

    Strains of Bacillus subtilis are plant growth-promoting bacteria (PGPB) of many crops and are used as inoculants. PGPB colonization is an important trait for success of a PGPB on plants. A specific probe, based on the 16 s rRNA of Bacillus subtilis, was designed and evaluated to distinguishing, by fluorescence in situ hybridization (FISH), between this species and the closely related Bacillus amyloliquefaciens. The selected target for the probe was between nucleotides 465 and 483 of the gene, where three different nucleotides can be identified. The designed probe successfully hybridized with several strains of Bacillus subtilis, but failed to hybridize not only with B. amyloliquefaciens, but also with other strains such as Bacillus altitudinis, Bacillus cereus, Bacillus gibsonii, Bacillus megaterium, Bacillus pumilus; and with the external phylogenetic strains Azospirillum brasilense Cd, Micrococcus sp. and Paenibacillus sp. The results showed the specificity of this molecular probe for B. subtilis.

  11. New Benzophenones and Xanthones from Cratoxylum sumatranum ssp. neriifolium and Their Antibacterial and Antioxidant Activities.

    PubMed

    Tantapakul, Cholpisut; Maneerat, Wisanu; Sripisut, Tawanun; Ritthiwigrom, Thunwadee; Andersen, Raymond J; Cheng, Ping; Cheenpracha, Sarot; Raksat, Achara; Laphookhieo, Surat

    2016-11-23

    Two new benzophenones (1 and 2) and four new xanthones (4-6 and 17) together with 24 known compounds (3, 7-16, and 18-30) were isolated from the roots and twigs of Cratoxylum sumatranum ssp. neriifolium. Their structures were elucidated by spectroscopic methods. Compounds 5 and 26 showed antibacterial activity against Micrococcus luteus, Bacillus cereus, and Staphylococcus epidermis with minimum inhibitory concentrations ranging from 4 to 8 μg/mL, whereas compounds 7, 20, and 26 displayed selective antibacterial activities against Staphylococcus aureus (8 μg/mL), Salmonella typhimurium (4 μg/mL), and Pseudomonas aeruginosa (4 μg/mL), respectively. The radical scavenging effects of some isolated compounds were investigated. Compounds 11 and 21 exhibited potent activity against 2,2-diphenyl-1-picrylhydrazyl (DPPH) with IC 50 values of 7.0 ± 1.0 and 6.0 ± 0.2 μM, respectively.

  12. Characterizing the Catalytic Potential of Deinococcus, Arthrobacter and other Robust Bacteria in Contaminated Subsurface Environments of the Hanford Site

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Daly, Michael J.

    2006-05-01

    Ionizing Radiation (IR) Resistance in Bacteria. Until recently, there have been no clear physiologic predictors of a cell's ability to recover from ionizing radiation (IR) and other DOE-relevant oxidative stress conditions. In general, the most resistant bacteria have been Gram-positive (e.g., Deinococcus, Arthrobacter, Lactobacillus & Enterococcus spp.) and the most sensitive have been Gram-negative (e.g., Pseudomonas, Shewanella & Neisseria spp.). However, there are several reported exceptions to this paradigm, the Gram-negative cyanobacterium Chroococcidiopsis is extremely resistant to IR, whereas the Gram-positive Micrococcus luteus is sensitive. We have identified biomolecular signatures for radiation sensitivity and resistance which are independent of phylogeny,more » where very high and very low intracellular Mn/Fe concentration ratios correlated with very high and very low resistances, respectively; and restricting Mn(II) in the famously resistant Deinococcus radiodurans sensitized this eubacterium to IR.« less

  13. Characterizing the Catalytic Potential of Deinococcus, Arthrobacter and other Robust Bacteria in Contaminated Subsurface Environments of the Hanford Site

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Fredrickson, Jim K.; Daly, Michael J.

    2006-06-01

    Until recently, there have been no clear physiologic predictors of a cell's ability to recover from ionizing radiation (IR), desiccation, and other DOE-relevant oxidative stress conditions. In general, the most resistant bacteria have been Gram-positive (e.g., Deinococcus, Arthrobacter, Lactobacillus & Enterococcus spp.) and the most sensitive have been Gram-negative (e.g., Pseudomonas, Shewanella & Neisseria spp.). However, there are several reported exceptions to this paradigm, the Gram-negative cyanobacterium Chroococcidiopsis is extremely resistant to IR, whereas the Gram-positive Micrococcus luteus is sensitive. We have identified biomolecular signatures for radiation sensitivity and resistance which are independent of phylogeny, where very high and verymore » low intracellular Mn/Fe concentration ratios correlated with very high and very low resistances, respectively; and restricting Mn(II) in the famously resistant Deinococcus radiodurans sensitized this eubacterium to IR (http://cfyn.ifas.ufl.edu/radiation.pdf).« less

  14. Indoor/outdoor relationships of bioaerosol concentrations in a retirement home and a school dormitory.

    PubMed

    Faridi, Sasan; Hassanvand, Mohammad Sadegh; Naddafi, Kazem; Yunesian, Masud; Nabizadeh, Ramin; Sowlat, Mohammad Hossein; Kashani, Homa; Gholampour, Akbar; Niazi, Sadegh; Zare, Ahad; Nazmara, Shahrokh; Alimohammadi, Mahmood

    2015-06-01

    The concentrations of bacterial and fungal bioaerosols were measured in a retirement home and a school dormitory from May 2012 to May 2013. In the present work, two active and passive methods were used for bioaerosol sampling. The results from the present work indicated that Bacillus spp., Micrococcus spp., and Staphylococcus spp. were the dominant bacterial genera, while the major fungal genera were Penicillium spp., Cladosporium spp., and Aspergillus spp. The results also indicated that the indoor-to-outdoor (I/O) ratios for total bacteria were 1.77 and 1.44 in the retirement home and the school dormitory, respectively; the corresponding values for total fungal spores were 1.23 and 1.08. The results suggested that in addition to outdoor sources, indoor sources also played a significant role in emitting bacterial and fungal bioaerosols in the retirement home and the school dormitory indoor.

  15. Identification of Chromium Resistant Bacteria from Dry Fly Ash Sample of Mejia MTPS Thermal Power Plant, West Bengal, India.

    PubMed

    Roychowdhury, Roopali; Mukherjee, Pritam; Roy, Madhumita

    2016-02-01

    Eight chromium resistant bacteria were isolated from a dry fly ash sample of DVC-MTPS thermal power plant located in Bankura, West Bengal, India. These isolates displayed different degrees of chromate reduction under aerobic conditions. According to 16S rDNA gene analysis, five of them were Staphylococcus, two were Bacillus and one was Micrococcus. The minimum inhibitory concentration towards chromium and the ability to reduce hexavalent chromium to trivalent chromium was highest in Staphylococcus haemolyticus strain HMR17. All the strains were resistant to multiple heavy metals (As, Cu, Cd, Co, Zn, Mn, Pb and Fe) and reduced toxic hexavalent chromium to relatively non toxic trivalent chromium even in the presence of these multiple heavy metals. All of them showed resistance to different antibiotics. In a soil microcosm study, S. haemolyticus strain HMR17 completely reduced 4 mM hexavalent chromium within 7 days of incubation.

  16. Influence of environmental factors on composition of volatile constituents and biological activity of Helichrysum italicum (Roth) Don (Asteraceae).

    PubMed

    Tundis, R; Statti, G A; Conforti, F; Bianchi, A; Agrimonti, C; Sacchetti, G; Muzzoli, M; Ballero, M; Menichini, F; Poli, F

    2005-06-01

    The biovariability of Helichrysum italicum (Roth) Don grown wild in Calabria and Sardinia (Italy) was reported. This species has been characterized through the detection, isolation and quantitative evaluation of chemical markers (alpha-terpinolene, trans-cariophyllene and neryl acetate) by GC and GC-MS. Antioxidant activity of the methanolic H. italicum extracts using DPPH and beta-carotene bleaching test showed that the Calabrian samples were more active than those from Sardinia. The antibacterial activity of all extracts evidenced the best performance on the Gram positive bacteria particularly on Micrococcus luteus. Moreover, antifungal activity of all extracts was also tested evidencing important results particularly on the phytopathogene fungus Pythium ultimum. In general, as regards the antifungal activity, the extracts from Sardinia were more active than those from Calabria. The phytochemical analysis and the biological activity data suggested a possible use of these plant matrices in alimentary, cosmetic and pharmaceutical fields.

  17. [The estimation of systemic chemotherapy treatment administered in breast cancer on lysozyme activity in tears--preliminary report].

    PubMed

    Wojciechowska, Katarzyna; Jurowski, Piotr; Wieckowska-Szakiel, Marzena; Rózalska, Barbara

    2012-01-01

    Estimation of cytostatics influence used in breast cancer treatment on lysozyme activity in human tears depend on time of treatment. 8 women were treated at the base of chemotherapy schema: docetaxel with doxorubicin and 4 women treated with schema CMF: cyclophosphamide, methotrexate, 5-fluorouracil. Lysozyme activity in tears was assessed by measurement of diameter zone of Micrococcus lysodeicticus growth inhibition. It was revealed that both chemotherapy schema caused statistically significant reduction of diameter zone of M. lysodeicticus growth inhibition, after first and second course of chemotherapy treatment. After second chemotherapy course CMF schema induced loss of lysozyme activity in patient's tears (zero mm of M. lysodeicticus diameter zone growth inhibition). Systemic chemotherapy administered in breast cancer induce reduction of lysozyme activity in tears, that may cause higher morbidity of ocular surface infections caused by Gram-positive bacteria.

  18. Antibacterial activity of oregano (Origanum vulgare Linn.) against gram positive bacteria.

    PubMed

    Saeed, Sabahat; Tariq, Perween

    2009-10-01

    The present investigation is focused on antibacterial potential of infusion, decoction and essential oil of oregano (Origanum vulgare) against 111 Gram-positive bacterial isolates belonging to 23 different species related to 3 genera. Infusion and essential oil exhibited antibacterial activity against Staphylococcus saprophyticus, S. aureus, Micrococcus roseus, M. kristinae, M. nishinomiyaensis, M. lylae, M. luteus, M. sedentarius, M. varians, Bacillus megaterium, B. thuringiensis, B. alvei, B. circulans, B. brevis, B. coagulans, B. pumilus, B. laterosporus, B. polymyxa, B. macerans, B. subtilis, B. firmus, B. cereus and B. lichiniformis. The infusion exhibited maximum activity against B. laterosporus (17.5 mm mean zone of inhibition+/-1.5 Standard deviation) followed by B. polymyxa (17.0 mm+/-2.0 SD) and essential oil of oregano exhibited maximum activity against S. saprophyticus (16.8 mm+/-1.8 SD) followed by B. circulans (14.5 mm+/-0.5 SD). While all these tested isolates were found resistant to decoction of oregano.

  19. Antimicrobial effects of Finnish plant extracts containing flavonoids and other phenolic compounds.

    PubMed

    Rauha, J P; Remes, S; Heinonen, M; Hopia, A; Kähkönen, M; Kujala, T; Pihlaja, K; Vuorela, H; Vuorela, P

    2000-05-25

    Plant phenolics, especially dietary flavonoids, are currently of growing interest owing to their supposed functional properties in promoting human health. Antimicrobial screening of 13 phenolic substances and 29 extracts prepared from Finnish plant materials against selected microbes was conducted in this study. The tests were carried out using diffusion methods with four to nine microbial species (Aspergillus niger, Bacillus subtilis, Candida albicans, Escherichia coli, Micrococcus luteus, Pseudomonas aeruginosa, Saccharomyces cerevisiae, Staphylococcus aureus and Staphylococcus epidermidis). Flavone, quercetin and naringenin were effective in inhibiting the growth of the organisms. The most active plant extracts were purple loosestrife (Lythrum salicaria L.) against Candida albicans, meadowsweet (Filipendula ulmaria (L.) Maxim.), willow herb (Epilobium angustifolium L.), cloudberry (Rubus chamaemorus L.) and raspberry (Rubus idaeus L.) against bacteria, and white birch (Betula pubescens Ehrh.), pine (Pinus sylvestris L.) and potato (Solanum tuberosum. L.) against gram-positive Staphylococcus aureus.

  20. Diversity and antibacterial activities of fungi derived from the Gorgonian Echinogorgia rebekka from the South China Sea.

    PubMed

    Wang, Ya-Nan; Shao, Chang-Lun; Zheng, Cai-Juan; Chen, Yi-Yan; Wang, Chang-Yun

    2011-01-01

    The diversity of symbiotic fungi associated with the gorgonian coral Echinogorgia rebekka from the Weizhou coral reef in the South China Sea was investigated. Combined with morphologic traits, ITS-rDNA sequences revealed 18 fungal strains from this gorgonian. All of the 18 fungi belonged to the phylum Ascomycota and were distributed among seven genera in five orders: Eurotiales (Aspergillus and Penicillium), Pleosporales (Alternaria), Capnodiales (Cladosporium), Trichosphaeriales (Nigrospora) and Hypocreales (Hypocrea and Nectria). Antibacterial activities of these fungal strains were investigated with five pathogenic bacteria. All of the 18 fungal strains displayed different levels of antibacterial activities, most of which exhibited moderate to high antibacterial activities to the Gram-positive pathogens Staphylococcus aureus and Micrococcus tetragenus, and showed relatively low bioactivities to other three pathogenic bacteria. Several fungal strains in the genera Penicillium and Cladosporium with strong antibacterial activities provide potential for further research on isolation of bioactive secondary metabolites.

  1. Functional properties of honey supplemented with bee bread and propolis.

    PubMed

    Kowalski, S; Makarewicz, M

    2017-11-01

    The aim of this work was characterisation of functional properties of honey enriched with propolis and beebread. In first step of experiment, soft propolis extract (SPEx) was obtained by extraction of propolis with ethanol. SPEx (0.25 to 1.0% w/w) as well as beebread (5 to 15% w/w) were implemented into natural honey. Fortified honeys were investigated in terms of total phenolic content, radical scavenging activity and ferric reducing antioxidant power, also their effects on the micro-organisms growth was examined. It was found that beebread had the most significant influence on antioxidant properties. On the other hand, all tested honeys showed antibacterial activity against Escherichia coli but not against Micrococcus luteus. Honeys with 1% of propolis addition were the most effective in this case. Research has indicated that for antioxidant and antimicrobial properties of honey, it is beneficial to enrich it in both beebread and propolis.

  2. Numerical taxonomy and ecology of petroleum-degrading bacteria.

    PubMed Central

    Austin, B; Calomiris, J J; Walker, J D; Colwell, R R

    1977-01-01

    A total of 99 strains of petroleum-degrading bacteria isolated from Chesapeake Bay water and sediment were identified by using numerical taxonomy procedures. The isolates, together with 33 reference cultures, were examined for 48 biochemical, cultural, morphological, and physiological characters. The data were analyzed by computer, using both the simple matching and the Jaccard coefficients. Clustering was achieved by the unweighted average linkage method. From the sorted similarity matrix and dendrogram, 14 phenetic groups, comprising 85 of the petroleum-degrading bacteria, were defined at the 80 to 85% similarity level. These groups were identified as actinomycetes (mycelial forms, four clusters), coryneforms, Enterobacteriaceae, Klebsiella aerogenes, Micrococcus spp. (two clusters), Nocardia species (two clusters), Pseudomonas spp. (two clusters), and Sphaerotilus natans. It is concluded that the degradation of petroleum is accomplished by a diverse range of bacterial taxa, some of which were isolated only at given sampling stations and, more specifically, from sediment collected at a given station. PMID:889329

  3. Population dynamics of transgenic strain Escherichia coli Z905/pPHL7 in freshwater and saline lake water microcosms with differing microbial community structures

    NASA Astrophysics Data System (ADS)

    Popova, L. Yu.; Kargatova, T. V.; Ganusova, E. E.; Lobova, T. I.; Boyandin, A. N.; Mogilnaya, O. A.; Pechurkin, N. S.

    Populations of Escherichia coli Z905/pPHL7, a transgenic microorganism, were heterogenic in the expression of plasmid genes when adapting to the conditions of water microcosms of various mineralization levels and structure of microbial community. This TM has formed two subpopulations (ampicillin-resistant and ampicillin-sensitive) in every microcosm. Irrespective of mineralization level of a microcosm, when E. coli Z905/pPHL7 alone was introduced, the ampicillin-resistant subpopulation prevailed, while introduction of the TM together with indigenous bacteria led to the dominance of the ampicillin-sensitive subpopulation. A high level of lux gene expression maintained longer in the freshwater microcosms than in sterile saline lake water microcosms. A horizontal gene transfer has been revealed between the jointly introduced TM and Micrococcus sp. 9/pSH1 in microcosms with the Lake Shira sterile water.

  4. Synthesis, characterization, antimicrobial activity and theoretical studies of new thiophene-based tripodal ligands

    NASA Astrophysics Data System (ADS)

    Harit, Tarik; Bellaouchi, Reda; Asehraou, Abdeslam; Rahal, Mahmoud; Bouabdallah, Ibrahim; Malek, Fouad

    2017-04-01

    The synthesis of new thiophene-tripods with different side arms was reported. These compounds were obtained in good yields and their structures were confirmed by NMR spectroscopy, elemental analysis, infrared spectroscopy and mass spectrometry. The in vitro antibacterial and antifungal activities of these products were screened against Gram positive bacteria (Micrococcus luteus and Bacillus subtilis), Gram negative bacteria (Escherichia coli) and fungi (Candida pelliculosa). The obtained results showed that tripods containing a hydroxyl group in the side arm inhibited both Gram-positive and Gram-negative bacteria, while the tripod with an isopropyl side arm inhibited only the Gram-negative bacteria. DFT calculations with B3LYP/6-31G* level have been used to analyze the electronic and geometric characteristics. The molecular electrostatic potential surface (MEPS) indicated that the presence of electrophile site in the side arm could be responsible for activities against Gram-positive bacteria.

  5. Lysozyme immobilization onto PVC catheters grafted with NVCL and HEMA for reduction of bacterial adhesion

    NASA Astrophysics Data System (ADS)

    Guadarrama-Zempoalteca, Yesica; Díaz-Gómez, Luis; Meléndez-Ortiz, H. Iván; Concheiro, Angel; Alvarez-Lorenzo, Carmen; Bucio, Emilio

    2016-09-01

    The aim of the present work was to functionalize poly(vinyl chloride) (PVC) urinary catheters with grafted copolymers that can improve the biocompatibility and serve as binding points of lysozyme. PVC catheters were modified by grafting a mixture of N-vinylcaprolactam (NVCL) and 2-hydroxyethylmethacrylate (HEMA) applying a gamma-ray pre-irradiation method. The effect of absorbed dose, monomer concentration, temperature, and reaction time on the grafting percentage was evaluated. The grafted catheters were characterized regarding surface composition (FTIR-ATR spectroscopy), thermal properties (DSC and TGA) and swelling in aqueous medium. Lysozyme was directly coupled onto PVC-g-(NVCL/HEMA) previously activated using carbonyldiimidazole. Antimicrobial lytic activity of the modified catheters over time was tested against Micrococcus lysodeikticus. Lysozyme diminished the adhesion of Staphylococcus aureus onto the functionalized catheters, which may be suitable to prevent biofilm formation.

  6. Synthesis of some metallophthalocyanines with dimethyl 5-(phenoxy)-isophthalate substituents and evaluation of their antioxidant-antibacterial activities

    NASA Astrophysics Data System (ADS)

    Salih Ağırtaş, M.; Karataş, Ceyhun; Özdemir, Sadin

    2015-01-01

    The synthesis, characterization, spectral, antioxidant and antibacterial properties of dimethyl 5-(phenoxy)-isophthalate substituted Zinc, Cobalt, Copper, and Nickel phthalocyanines are reported. The novel compounds have been characterized by using electronic absorption, nuclear magnetic resonance spectroscopy, infrared, elemental analysis and mass spectrometry. The antioxidant and antibacterial activities of newly synthesized phthalocyanines and its starting material are tested. The DPPH free radical scavenging ability of phthalocyanine Co(II) and Zn(II) complexes on DPPH are 44.8% and 40.1% at 100 mg/L concentration, respectively. The phthalocyanine Co(II) and Cu(II) complexes show very strong ferrous ion chelating activity of 91.2% and 89.3% at concentration of 100 mg/L, respectively. Compound 3 displays strong reducing power like α-tocopherol. Antibacterial activities of phthalocyanine Co(II) and Amikacin (30 μg/disk) against Micrococcus luteus (ATCC 9341) are 16 mm in diameter.

  7. Cell Based Drug Delivery: Micrococcus luteus Loaded Neutrophils as Chlorhexidine Delivery Vehicles in a Mouse Model of Liver Abscesses in Cattle.

    PubMed

    Wendel, Sebastian O; Menon, Sailesh; Alshetaiwi, Hamad; Shrestha, Tej B; Chlebanowski, Lauren; Hsu, Wei-Wen; Bossmann, Stefan H; Narayanan, Sanjeev; Troyer, Deryl L

    2015-01-01

    The recent WHO report on antibiotic resistances shows a dramatic increase of microbial resistance against antibiotics. With only a few new antibiotics in the pipeline, a different drug delivery approach is urgently needed. We have obtained evidence demonstrating the effectiveness of a cell based drug delivery system that utilizes the innate immune system as targeting carrier for antibacterial drugs. In this study we show the efficient loading of neutrophil granulocytes with chlorhexidine and the complete killing of E. coli as well as Fusobacterium necrophorum in in-vitro studies. Fusobacterium necrophorum causes hepatic abscesses in cattle fed high grain diets. We also show in a mouse model that this delivery system targets infections of F. necrophorum in the liver and reduces the bacterial burden by an order of magnitude from approximately 2•106 to 1•105.

  8. Radiation resistence of microorganisms from radiation sterilization processing environments

    NASA Astrophysics Data System (ADS)

    Sabovljev, Svetlana A.; Žunić, Zora S.

    The radiation resistance of microorganisms was examined on the samples of dust collected from the radiation sterilization processing environments including assembly, storage, and sterilization plant areas. The isolation of radiation resistant strains was performed by irradiation with screening doses ranging from 10 to 35 kGy and test pieces containing 10 6 to 10 8 CFU in dried serum-broth, representing 100 to 5000 colonies of primary cultures of microorganisms from 7 different sites. In an examination of 16900 colonies of aerobic microorganisms from 3 hygienically controlled production sites and 4 uncontrolled ones, 30 strains of bacteria were isolated. Of those 15 were classified as genus Bacillus, 9 as Micrococcus and 6 as Sarcina. All of the 15 strains of Gram positive sporeforming aerobic rods exhibited an exponential decrease in the surviving fraction as a function of dose, indicating that the inactivation of spores of aerobic rods is a consequence of a single energy deposition into the target. All strains were found to be moderately resistant to radiation with D-6 values (dose required to reduce survival to 6 log cycles) between 18 and 26 kGy. All of the isolated Gram positive cocci showed inactivation curves having a shoulder, indicating that different processes are involved in the inactivation of these cells, e.g. accumulation of sublethal lesions, or final repair capacity of potential lethal lesions. Moderate radiation resistance was observed in 13 strains with D-6 values between 16 to 30 kGy. Two slow-growing, red pigmented strains tentatively classified as genus Micrococcus isolated from uncontrolled sites (human dwellings) were exceptionally resistant with D-6 more than 45 kGy. For hygienically controlled sites, Gram positive spereforming rods composed two thirds of the resistant microflora, while Gram positive cocci comprised one third. For hygienically uncontrolled sites this ratio was reversed. An assumption is made that one isolated strain has grown up from one CFU in the original microflora. In the light of the observed proportion of radiation resistant bacteria in microflora from hygienically controlled radiation sterilization processing environments, and assuming an initial contamination of 50 CFU per product unit, there is no more than one chance of a contaminated item remaining within a population of 10 7 items subjected to sterilization by exposure to a radiation dose of 25 kGy.

  9. Chitosan/Mimosa tenuiflora films as potential cellular patch for skin regeneration.

    PubMed

    Valencia-Gómez, Laura Elizabeth; Martel-Estrada, Santos Adriana; Vargas-Requena, Claudia; Rivera-Armenta, José Luis; Alba-Baena, Noe; Rodríguez-González, Claudia; Olivas-Armendáriz, Imelda

    2016-12-01

    Bio-composites films were prepared by casting and drying of aqueous solutions containing different weight ratios of chitosan and bark of Mimosa tenuiflora. The physico-chemical and functional properties of the films were characterized by scanning electron microscopy, dynamical mechanical analysis, wettability, cytotoxicity and in vitro antibacterial activities. The morphology studies confirmed that the presence of Mimosa tenuiflora change the surface of films. Moreover, the incorporation of Mimosa tenuiflora improved the thermal stability of the films, as it was indicated by the changes in the glass temperatures obtained. Water-uptake ability changed in relation to polymeric composition of film. This property increased by the addition of Mimosa tenuiflora to the film. Improved antibacterial properties were measured against Escherichia Coli and Micrococcus lysodeikticus or luteus. Finally, cytotoxicity was studied by MTT assay and the films were non-toxic. These preliminary results provide a cheap way to prepare chitosan/Mimosa tenuiflora films for wound healing and skin regeneration. Copyright © 2016 Elsevier B.V. All rights reserved.

  10. Synthesis of novel antimicrobial aryl himachalene derivatives from naturally occurring himachalenes

    PubMed Central

    Chaudhary, Abha; Sood, Swati; Das, Pralay; Kaur, Pushpinder; Mahajan, Isha; Gulati, Arvind; Singh, Bikram

    2014-01-01

    Five new 2,9,9-trimethyl-6,7,8,9-tetrahydro-benzocyclohepten-5-ylidene-amine derivatives (16a-16e) were synthesized from α-dehydro-ar-himachalene (11) that was originally prepared from an isomeric mixture of α, β and γ himachalenes (10), the abundant sesquiterpenes of Cedrus deodara essential oil. In addition, different aryl himachalenes derivatives (9, 12, 14 and 15) were also formed from 11. The structures of the synthesized compounds were confirmed on the basis of their NMR, IR and mass spectral data. The prepared compounds were tested against a group of sixteen organisms including gram positive and gram negative bacterial and fungal strains. The introduction of a series of substituted imine groups into aryl himachalenes at 5th position (16a-16e) enhanced antimicrobial activity as compared to the aromatized derivatives (9, 12, 14 and 15) against gram-positive bacteria Bacillus subtilis, Micrococcus luteus and Staphylococcus aureus, and mycotoxigenic fungi Aspergillus parasiticus, A. ochraceous and A. sydowii. graphical Abstract, Figure 1(Fig. 1) PMID:26417335

  11. Synthesis, Spectral Characterization, In-vitro Antibacterial and Antifungal Activities of Novel (2e)-Ethyl-2-(2-(2, 4-Dinitrophenyl) Hydrazono)-4-(Naphthalen-2-yl)-6-Arylcyclohex-3-Enecarboxylates

    PubMed Central

    Kanagarajan, V; Thanusu, J; Gopalakrishnan, M

    2011-01-01

    In a search for new leads towards potent antimicrobial agents, an array of novel (2E)-ethyl-2-(2-(2,4-dinitrophenyl)hydrazono)-4-(naphthalen-2-yl)-6-arylcyclohex-3-ene carboxylates 17-24 were synthesized and characterized through their melting point, elemental analysis, MS, FT-IR, one-dimensional NMR (1H, D2O exchanged 1H and 13C), two dimensional HOMOCOR and HSQC spectroscopic data. In-vitro microbiological evaluations were carried out for all the newly synthesized compounds 17-24 against clinically isolated bacterial strains namely Salmonella typhii, Klebsiellapneumoniae, Escherichia coli, Pseudomonas aeruginosa, Staphylococcus aureus, β-Hemolytic streptococcus and Micrococcus luteusand also fungal strains namely Aspergillusflavus, Aspergillusniger, Mucor, Rhizopus and Microsporumgypseumand finally, the results of their structure activity relationship were discussed. The obtained results can be used as the key step for the building of novel chemical compounds with interesting antimicrobial profiles comparable to that of the standard drugs. PMID:24250406

  12. Synthesis, Spectral Characterization, In-vitro Antibacterial and Antifungal Activities of Novel (2e)-Ethyl-2-(2-(2, 4-Dinitrophenyl) Hydrazono)-4-(Naphthalen-2-yl)-6-Arylcyclohex-3-Enecarboxylates.

    PubMed

    Kanagarajan, V; Thanusu, J; Gopalakrishnan, M

    2011-01-01

    In a search for new leads towards potent antimicrobial agents, an array of novel (2E)-ethyl-2-(2-(2,4-dinitrophenyl)hydrazono)-4-(naphthalen-2-yl)-6-arylcyclohex-3-ene carboxylates 17-24 were synthesized and characterized through their melting point, elemental analysis, MS, FT-IR, one-dimensional NMR ((1)H, D2O exchanged (1)H and (13)C), two dimensional HOMOCOR and HSQC spectroscopic data. In-vitro microbiological evaluations were carried out for all the newly synthesized compounds 17-24 against clinically isolated bacterial strains namely Salmonella typhii, Klebsiellapneumoniae, Escherichia coli, Pseudomonas aeruginosa, Staphylococcus aureus, β-Hemolytic streptococcus and Micrococcus luteusand also fungal strains namely Aspergillusflavus, Aspergillusniger, Mucor, Rhizopus and Microsporumgypseumand finally, the results of their structure activity relationship were discussed. The obtained results can be used as the key step for the building of novel chemical compounds with interesting antimicrobial profiles comparable to that of the standard drugs.

  13. Bacteria Present in Comadia redtenbacheri Larvae (Lepidoptera: Cossidae).

    PubMed

    Hernández-Flores, L; Llanderal-Cázares, C; Guzmán-Franco, A W; Aranda-Ocampo, S

    2015-09-01

    The external and internal culturable bacterial community present in the larvae of Comadia redtenbacheri Hammerschmidt, an edible insect, was studied. Characterization of the isolates determined the existence of 18 morphotypes and phylogenetic analysis of the 16S rRNA gene revealed the existence of Paenibacillus sp., Bacillus safensis, Pseudomonas sp., Bacillus pseudomycoides, Corynebacterium variabile, Enterococcus sp., Gordonia sp., Acinetobacter calcoaceticus, Arthrobacter sp., Micrococcus sp., and Bacillus cereus. Greater diversity of bacteria was found in those larvae obtained from vendors than in those directly taken from Agave plants in nature. Many of the larvae obtained from vendors presented signs of potential disease, and after the analysis, results showed a greater bacterial community compared with the larvae with a healthy appearance. This indicates that bacterial flora can vary in accordance with how the larvae are handled during extraction, collection, and transport. © The Authors 2015. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  14. Oxygenated N-Acyl Alanine Methyl Esters (NAMEs) from the Marine Bacterium Roseovarius tolerans EL-164.

    PubMed

    Bruns, Hilke; Herrmann, Jennifer; Müller, Rolf; Wang, Hui; Wagner Döbler, Irene; Schulz, Stefan

    2018-01-26

    The marine bacterium Roseovarius tolerans EL-164 (Rhodobacteraceae) can produce unique N-acylalanine methyl esters (NAMEs) besides strucutrally related N-acylhomoserine lactones (AHLs), bacterial signaling compounds widespread in the Rhodobacteraceae. The structures of two unprecedented NAMEs carrying a rare terminally oxidized acyl chain are reported here. The compounds (Z)-N-16-hydroxyhexadec-9-enoyl-l-alanine methyl ester (Z9-16-OH-C16:1-NAME, 3) and (Z)-N-15-carboxypentadec-9-enoyl-l-alanine methyl ester (16COOH-C16:1-NAME, 4) were isolated, and the structures were determined by NMR and MS experiments. Both compounds were synthesized to prove assignments and to test their biological activity. Finally, non-natural, structurally related Z9-3-OH-C16:1-NAME (18) was synthesized to investigate the mass spectroscopy of structurally related NAMEs. Compound 3 showed moderate antibacterial activity against microorganisms such as Bacillus, Streptococcus, Micrococcus, or Mucor strains. In contrast to AHLs, quorum-sensing or quorum-quenching activity was not observed.

  15. Chemical composition, antimicrobial, insecticidal, phytotoxic and antioxidant activities of Mediterranean Pinus brutia and Pinus pinea resin essential oils.

    PubMed

    Ulukanli, Zeynep; Karabörklü, Salih; Bozok, Fuat; Ates, Burhan; Erdogan, Selim; Cenet, Menderes; Karaaslan, Merve Göksin

    2014-12-01

    Essential oils of the resins of Pinus brutia and Pinus pinea were evaluated for their biological potential. Essential oils were characterized using GC-MS and GC/FID. in vitro antimicrobial, phytotoxic, antioxidant, and insecticidal activities were carried out using the direct contact and the fumigant assays, respectively. The chemical profile of the essential oils of the resins of P. pinea and P. brutia included mainly α-pinene (21.39% and 25.40%), β-pinene (9.68% and 9.69%), and caryophyllene (9.12% and 4.81%). The essential oils of P. pinea and P. brutia exerted notable antimicrobial activities on Micrococcus luteus and Bacillus subtilis, insecticidal activities on Ephestia kuehniella eggs, phytotoxic activities on Lactuca sativa, Lepidium sativum, and Portulaca oleracea, as well as antioxidant potential. Indications of the biological activities of the essential oils suggest their use in the formulation of ecofriendly and biocompatible pharmaceuticals. Copyright © 2014 China Pharmaceutical University. Published by Elsevier B.V. All rights reserved.

  16. Numerical taxonomy and ecology of petroleum-degrading bacteria

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Austin, B.; Calomiris, J.J.; Walker, J.D.

    1977-07-01

    A total of 99 strains of petroleum-degrading bacteria isolated from Chesapeake Bay water and sediment were identified by using numerical taxonomy procedures. The isolates, together with 33 reference cultures, were examined for 48 biochemical, cultural, morphological, and physiological characters. The data were analyzed by computer, using both the simple matching and the Jaccard coefficients. Clustering was achieved by the unweighted average linkage method. From the sorted similarity matrix and dendrogram, 14 phenetic groups, comprising 85 of the petroleum-degrading bacteria, were defined at the 80 to 85% similarity level. These groups were identified as actinomycetes (mycelial forms, four clusters), coryneforms, Enterobacteriaceae,more » Klebsiella aerogenes, Micrococcus spp. (two clusters), Nocardia species (two clusters), Pseudomonas spp. (two clusters), and Sphaerotilus natans. It is concluded that the degradation of petroleum is accomplished by a diverse range of bacterial taxa, some of which were isolated only at given sampling stations and, more specifically, from sediment collected at a given station.« less

  17. [The effect of dexamethoxin on the integrity of cytoplasmic membrane in gram-positive and gram-negative microorganisms].

    PubMed

    Shchetina, V N; Belanov, E F; Starobinets, Z G; Volianskiĭ, Iu L

    1990-01-01

    Decamethoxin is shown to be able to increase membrane permeability of Pseudomonas aeruginosa, Escherichia coli and Micrococcus lysodeikticus, that is confirmed by a loss of compounds with the absorption maximum at 260 nm by cells. Parallel with this the number of viable individuals has fallen and activity of dehydrogenases has been inhibited. The aspartate and alanine aminotransferase activity was not inhibited by decamethoxin and even increased. Decamethoxin lysed the protoplasts of the tested microorganisms. At high decamethoxin concentrations (over 500 micrograms/ml for P. aeruginosa and over 200 mu/ml--for E. coli) the outflow of components from the cells of gram-negative bacteria ceased, that may be associated with the coagulation changes in the cytoplasm. A loss of the low-molecular components by M. lysodeikticus cells and lysis of protoplasts proceeded less intensely than the same processes in the gram-negative microorganisms, that is explained by a less resistance of M. lysodeikticus to decamethoxin and earlier coagulation of the cytoplasm preventing lysis.

  18. Antimicrobial activity of antihypertensive food-derived peptides and selected alanine analogues.

    PubMed

    McClean, Stephen; Beggs, Louise B; Welch, Robert W

    2014-03-01

    This study evaluated four food-derived peptides with known antihypertensive activities for antimicrobial activity against pathogenic microorganisms, and assessed structure-function relationships using alanine analogues. The peptides (EVSLNSGYY, barley; PGTAVFK, soybean; TTMPLW, α-casein; VHLPP, α-zein) and the six alanine substitution peptides of PGTAVFK were synthesised, characterised and evaluated for antimicrobial activity using the bacteria, Escherichia coli, Staphylococcus aureus, and Micrococcus luteus and the yeast, Candida albicans. The peptides TTMPLW and PGTAVFK inhibited growth of all four microorganisms tested, with activities of a similar order of magnitude to ampicillin and ethanol controls. EVSLNSGYY inhibited the growth of the bacteria, but VHLPP showed no antimicrobial activity. The alanine analogue, PGAAVFK showed the highest overall antimicrobial activity and PGTAVFA showed no activity; overall, the activities of the analogues were consistent with their structures. Some peptides with antihypertensive activity also show antimicrobial activity, suggesting that food-derived peptides may exert beneficial effects via a number of mechanisms. Copyright © 2013 Elsevier Ltd. All rights reserved.

  19. Glycosidases in Brachionus plicatilis (Rotifera).

    PubMed

    Kühle, K; Kleinow, W

    1990-01-01

    1. Tests for glycosidases were performed in homogenates of Brachionus plicatilis. 2. Hydrolytic activity was detected with the following substrates: (a) with synthetic substrates (NP = 4-nitrophenyl): NP-alpha- and NP-beta-D-glucopyranoside, NP-alpha- and NP-beta-D-galactopyranoside, NP-N-acetyl-beta-D-glucosaminide, NP-N-acetyl-beta-D-galactosaminide, NP-alpha- and NP-beta-D-mannopyranoside and NP-alpha-L-fucopyranoside; (b) with disaccharides: sucrose, maltose, trehalose, isomaltose, cellobiose, gentiobiose and lactose; (c) with polysaccharides: laminarine, carboxymethyl-cellulose, avicel, Micrococcus luteus (for lysozyme) and 4-nitrophenyl-alpha-D-maltoheptaoside (for amylase). 3. The pH dependence of the glycosidase activities was determined. 4. The distribution of enzyme activities within fractions from the homogenate was studied in order to localize them within the cell. 5. Proteins from Brachionus homogenate were separated by SDS-gel electrophoresis and the positions of the following glycosidase activities were detected by assays performed on the gels (estimated molecular weights in parentheses): alpha-glucosidase (250,000); beta-glucosidase (200,000); beta-galactosidase (70,000); N-acetyl-beta-glucosaminidase (60,000).

  20. Antibacterial Activity of the Alkaloid-Enriched Extract from Prosopis juliflora Pods and Its Influence on in Vitro Ruminal Digestion

    PubMed Central

    dos Santos, Edilene T.; Pereira, Mara Lúcia A.; da Silva, Camilla Flávia P.G.; Souza-Neta, Lourdes C.; Geris, Regina; Martins, Dirceu; Santana, Antônio Euzébio G.; Barbosa, Luiz Cláudio A.; Silva, Herymá Giovane O.; Freitas, Giovana C.; Figueiredo, Mauro P.; de Oliveira, Fernando F.; Batista, Ronan

    2013-01-01

    The purpose of this study was to assess the in vitro antimicrobial activity of alkaloid-enriched extracts from Prosopis juliflora (Fabaceae) pods in order to evaluate them as feed additives for ruminants. As only the basic chloroformic extract (BCE), whose main constituents were juliprosopine (juliflorine), prosoflorine and juliprosine, showed Gram-positive antibacterial activity against Micrococcus luteus (MIC = 25 μg/mL), Staphylococcus aureus (MIC = 50 μg/mL) and Streptococcus mutans (MIC = 50 μg/mL), its influence on ruminal digestion was evaluated using a semi-automated in vitro gas production technique, with monensin as the positive control. Results showed that BCE has decreased gas production as efficiently as monensin after 36 h of fermentation, revealing its positive influence on gas production during ruminal digestion. Since P. juliflora is a very affordable plant, this study points out this alkaloid enriched extract from the pods of Prosopis juliflora as a potential feed additive to decrease gas production during ruminal digestion. PMID:23595000

  1. Arthritis in ducks. I. Aetiology and public health aspects.

    PubMed

    Bisgaard, M

    1981-01-01

    A pure culture of potentially pathogenic bacteria was obtained from 90% of 233 joints examined, originating from 232 ducks condemned due to arthritis at slaughter. S. typhi-murium and Staph. aureus were isolated from 61% and 18% of the joints respectively. E. coli was obtained from 6% of the cases, serogroup 078 being most prevalent. E. rhusiopathiae, Y. pseudo-tuberculosis, P. vulgaris, Micrococcus sp., Streptococcus sp., Acinetobacter sp., Flavobacterium sp., Pseudomonas sp. and Ae. formicans made up 12 cases. Serotypes other than S. typhi-murium were prevalent among ducks from all farms investigated, but S. typhi-murium was the only serotype demonstrated in arthritis. A high incidence of S. typhi-murium in the intestinal tract of ducks maintained on free range or in open houses suggests that these sites are sources of infection and that the intestinal tract is the portal of entry for S. typhi-murium causing arthritis. Ducks with arthritis at slaughter should always be totally condemned because of the public health hazard from the organisms most often associated with this condition.

  2. Production of human lactoferrin in animal milk.

    PubMed

    Goldman, I L; Georgieva, S G; Gurskiy, Ya G; Krasnov, A N; Deykin, A V; Popov, A N; Ermolkevich, T G; Budzevich, A I; Chernousov, A D; Sadchikova, E R

    2012-06-01

    Genetic constructs containing the human lactoferrin (hLf) gene were created within a joint program of Russian and Belorussian scientists. Using these constructs, transgenic mice were bred (the maximum hLf concentration in their milk was 160 g/L), and transgenic goats were also generated (up to 10 g/L hLf in their milk). Experimental goatherds that produced hLf in their milk were also bred, and the recombinant hLf was found to be identical to the natural protein in its physical and chemical properties. These properties included electrophoretic mobility, isoelectric point, recognition by polyclonal and monoclonal antibodies, circular dichroic spectra, interaction with natural ligands (DNA, lipopolysaccharides, and heparin), the binding of iron ions, the sequence of the 7 terminal amino acids, and its biological activity. The latter was assessed by the agglutination of Micrococcus luteus protoplasts, bactericidal activity against Escherichia coli and Listeria monocytogenes , and fungicidal activity against Candida albicans . We also demonstrated a significant increase in the activity of antibiotics when used in combination with Lf.

  3. Dose Limits for Man do not Adequately Protect the Ecosystem

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Higley, Kathryn A.; Alexakhin, Rudolf M.; McDonald, Joseph C.

    2004-08-01

    It has been known for quite some time that different organisms display differing degrees of sensitivity to the effects of ionizing radiations. Some microorganisms such as the bacterium Micrococcus radiodurans, along with many species of invertebrates, are extremely radio-resistant. Humans might be categorized as being relatively sensitive to radiation, and are a bit more resistant than some pine trees. Therefore, it could be argued that maintaining the dose limits necessary to protect humans will also result in the protection of most other species of flora and fauna. This concept is usually referred to as the anthropocentric approach. In other words,more » if man is protected then the environment is also adequately protected. The ecocentric approach might be stated as; the health of humans is effectively protected only when the environment is not unduly exposed to radiation. The ICRP is working on new recommendations dealing with the protection of the environment, and this debate should help to highlight a number of relevant issues concerning that topic.« less

  4. Emerging Bacterial Infection: Identification and Clinical Significance of Kocuria Species

    PubMed Central

    Palange, Padmavali; Vaish, Ritu; Bhatti, Adnan Bashir; Kale, Vinod; Kandi, Maheshwar Reddy; Bhoomagiri, Mohan Rao

    2016-01-01

    Recently there have been reports of gram-positive cocci which are morphologically similar to both Staphylococci and the Micrococci. These bacteria have been identified as Kocuria species with the help of automated identification system and other molecular methods including 16S rRNA (ribosomal ribonucleic acid) evaluation. Kocuria belongs to the family Micrococcaceae which also includes Staphylococcus species and Micrococcus species. Isolation and clinical significance of these bacteria from human specimens warrant great caution as it does not necessarily confirm infection due to their ubiquitous presence, and as a normal flora of skin and mucous membranes in human and animals. Most clinical microbiology laboratories ignore such bacteria as laboratory and specimen contaminants. With increasing reports of infections associated with these bacteria, it is now important for clinical microbiologists to identify and enumerate the virulence and antibiotic susceptibility patterns of such bacteria and assist clinicians in improving the patient care and management. We review the occurrence and clinical significance of Kocuria species. PMID:27630804

  5. Self-leveling mortar as a possible cause of symptoms associated with "sick building syndrome".

    PubMed

    Lundholm, M; Lavrell, G; Mathiasson, L

    1990-01-01

    In newly constructed houses and buildings in which self-leveling mortar containing casein has been used, residents and office employees have noted a bad odor and have complained of headache, eye and throat irritation, and tiredness. These problems were suspected to result from the degradation products emitted from the mortar. Samples obtained from dry mortar powder and from mortar in buildings where casein was used and from control buildings were found to contain microorganisms (mean of 10(2) culture forming units/g). Environmental species were predominantly found, e.g., Bacillus, Clostridium, Micrococcus, and Propionibacterium. Fungi were found occasionally; no evidence of bacterial degradation was found. Headspace and gas chromatographic-mass spectrometric analysis of air from the newly constructed houses and from hydroxide-degraded casein revealed the presence of amines in the 0.003-0.013 ppm range and the presence of ammonia and sulfhydryl compounds, all of which in low concentrations can cause the symptoms observed. These substances, however, were not detected in control buildings.

  6. Assessment of the bacterial contamination of hand air dryer in washrooms.

    PubMed

    Alharbi, Sulaiman Ali; Salmen, Saleh Hussein; Chinnathambi, Arunachalam; Alharbi, Naiyf S; Zayed, M E; Al-Johny, Bassam O; Wainwright, Milton

    2016-03-01

    The present study was carried out, using standard techniques, to identify and count the bacterial contamination of hand air dryers, used in washrooms. Bacteria were isolated from the air flow, outlet nozzle of warm air dryers in fifteen air dryers used in these washrooms. Bacteria were found to be relatively numerous in the air flows. Bacterially contaminated air was found to be emitted whenever a warm air dryer was running, even when not being used for hand drying. Our investigation shows that Staphylococcus haemolyticus, Micrococcus luteus, Pseudomonas alcaligenes, Bacillus cereus and Brevundimonad diminuta/vesicularis were emitted from all of the dryers sampled, with 95% showing evidence of the presence of the potential pathogen S. haemolyticus. It is concluded that hot air dryers can deposit pathogenic bacteria onto the hands and body of users. Bacteria are distributed into the general environment whenever dryers are running and could be inhaled by users and none-users alike. The results provide an evidence base for the development and enhancement of hygienic hand drying practices.

  7. Assessment of the bacterial contamination of hand air dryer in washrooms

    PubMed Central

    Alharbi, Sulaiman Ali; Salmen, Saleh Hussein; Chinnathambi, Arunachalam; Alharbi, Naiyf S.; Zayed, M.E.; Al-Johny, Bassam O.; Wainwright, Milton

    2015-01-01

    The present study was carried out, using standard techniques, to identify and count the bacterial contamination of hand air dryers, used in washrooms. Bacteria were isolated from the air flow, outlet nozzle of warm air dryers in fifteen air dryers used in these washrooms. Bacteria were found to be relatively numerous in the air flows. Bacterially contaminated air was found to be emitted whenever a warm air dryer was running, even when not being used for hand drying. Our investigation shows that Staphylococcus haemolyticus, Micrococcus luteus, Pseudomonas alcaligenes, Bacillus cereus and Brevundimonad diminuta/vesicularis were emitted from all of the dryers sampled, with 95% showing evidence of the presence of the potential pathogen S. haemolyticus. It is concluded that hot air dryers can deposit pathogenic bacteria onto the hands and body of users. Bacteria are distributed into the general environment whenever dryers are running and could be inhaled by users and none-users alike. The results provide an evidence base for the development and enhancement of hygienic hand drying practices. PMID:26981009

  8. Chemical and biological evaluation of Ranunculus muricatus.

    PubMed

    Khan, Farhat Ali; Zahoor, Muhammad; Khan, Ezzat

    2016-03-01

    Ranunculus muricatus is commonly known as spiny fruit buttercup and is used in the treatment of intermittent fevers, gout and asthma. Qualitative analysis of phytochemicals of Ranunculus muricatus indicated the presence of saponins, tannins, phenols, flavonoids and alkaloids. Saponins were present in high amount as compared with other chemicals. Inorganic and heavy metals constituents were determined. Heavy metals estimation in the sample showed that iron was present in high amount followed by zinc even then the concentration of these metals is below acceptable limit. The physical parameters, antioxidant and antimicrobial activities of the extracts were determined. Acetone extract fraction showed optimal antioxidant activity as compared to ethanol and chloroform fractions of the candidate plant. The antimicrobial and antifungal activities of the crude extract and extract fractions were determined by well agar diffusion method. Highest zone of inhibitions were observed for crude extract followed by acetone extract fraction against Micrococcus luteus. Antifungal activities were high for crude extracts against Candida Albican. Findings of this study show that Ranunculus muricatus has a good medicinal impact.

  9. Extracellular polymeric substances govern the development of biofilm and mass transfer of polycyclic aromatic hydrocarbons for improved biodegradation.

    PubMed

    Zhang, Yinping; Wang, Fang; Zhu, Xiaoshu; Zeng, Jun; Zhao, Qiguo; Jiang, Xin

    2015-10-01

    The hypothesis that extracellular polymeric substances (EPS) affect the formation of biofilms for subsequent enhanced biodegradation of polycyclic aromatic hydrocarbons was tested. Controlled formation of biofilms on humin particles and biodegradation of phenanthrene and pyrene were performed with bacteria and EPS-extracted bacteria of Micrococcus sp. PHE9 and Mycobacterium sp. NJS-P. Bacteria without EPS extraction developed biofilms on humin, in contrast the EPS-extracted bacteria could not attach to humin particles. In the subsequent biodegradation of phenanthrene and pyrene, the biodegradation rates by biofilms were significantly higher than those of EPS-extracted bacteria. Although, both the biofilms and EPS-extracted bacteria showed increases in EPS contents, only the EPS contents in biofilms displayed significant correlations with the biodegradation efficiencies of phenanthrene and pyrene. It is proposed that the bacterial-produced EPS was a key factor to mediate bacterial attachment to other surfaces and develop biofilms, thereby increasing the bioavailability of poorly soluble PAH for enhanced biodegradation. Copyright © 2015. Published by Elsevier Ltd.

  10. [Isolation and antimicrobial activities of actinomycetes from vermicompost].

    PubMed

    Wang, Xue-jun; Yan, Shuang-lin; Min, Chang-li; Yang, Yan

    2015-02-01

    In this paper, actinomycetes were isolated from vermicompost by tablet coating method. Antimicrobial activities of actinomycetes were measured by the agar block method. Strains with high activity were identified based on morphology and biochemical characteristics, as well as 16S rDNA gene sequence analysis. The results showed that 26 strains of actinomycetes were isolated, 16 of them had antimicrobial activities to the test strains which accounts for 61.54% of all strains. Among the 16 strains, the strain QYF12 and QYF22 had higher antimicrobial activity to Micrococcus luteus, with a formed inhibition zone of 27 mm and 31 mm, respectively. While the strain QYF26 had higher antimicrobial activity to Bacillus subtilis, and the inhibition zone diameter was 21 mm. Based on the identification of strains with high activity, the strain QYF12 was identified as Streptomyces chartreusis, the strain QYF22 was S. ossamyceticus and the strain QYF26 was S. gancidicus. This study provided a theoretical basis for further separate antibacterial product used for biological control.

  11. [Pattern of growth and metabolism of thermotolerant microorganisms on media containing carbohydrates and hydrocarbons].

    PubMed

    Kvasnikov, E I; Isakova, D M; Eliseeva, G S; Loiko, Z I

    1977-01-01

    Experiments were carried out to examine the growth and metabolism of thermotolerant yeast Candida tropicalis K-41 and bacteria Micrococcus freudenreichii that do not have a single temperature point but instead have an optimal temperature plateau at which the growth rate and biosynthetic activity remain unaltered or change insignificantly. Upon transition from the carbohydrate to the hydrocarbon pattern of nutrition these microorganisms show significant changes in metabolic processes: optimal concentration of biotin in the medium decreases significantly; the synthesis of riboflavin, nicotinic and pantothenic acids increases in yeast; the synthesis of nicotinic acid, biotin and vitamin B12 increases in bacteria. During microbial cultivation on hydrocarbons the content of cell lipids grows; yeast accumulate actively phospholipids and free fatty acids; bacteria build up intensively waxes and phospholipids. With the near-maximal growth rate the total synthesis of lipids decreases on carbohydrates and increases drastically on hydrocarbons, primarily at the expense of the above fractions.

  12. Characterization of the gut bacterial community in Manduca sexta and effect of antibiotics on bacterial diversity and nematode reproduction.

    PubMed

    van der Hoeven, Ransome; Betrabet, Geeta; Forst, Steven

    2008-09-01

    The tobacco hornworm, Manduca sexta, is a model lepidopteran insect used to study the pathogenic and mutualistic phases of entomopathogenic nematodes (EPNs) and their bacterial symbionts. While intestinal microbial communities could potentially compete with the EPN and its bacterial partner for nutrient resources of the insect, the microbial gut community had not been characterized previously. Here, we show that the midgut of M. sexta raised on an artificial diet contained mostly Gram-positive cocci and coryneforms including Staphylococcus, Pediococcus, Micrococcus and Corynebacterium. Major perturbation in the gut community was observed on addition of antibiotics to the diet. Paenibacillus and several Proteobacteria such as Methylobacterium, Sphingomonas and Acinetobacter were primary genera identified under these conditions. Furthermore, the reproduction of the nematode Steinernema carpocapsae was less efficient, and the level of nematode colonization by its symbiont Xenorhabdus nematophila reduced, in insects reared on a diet containing antibiotics. The effect of antibiotics and perturbation of gut microbiota on nematode reproduction is discussed.

  13. Alkaliphilic and halophilic hydrocarbon-utilizing bacteria from Kuwaiti coasts of the Arabian Gulf.

    PubMed

    Al-Awadhi, H; Sulaiman, Rasha H D; Mahmoud, Huda M; Radwan, S S

    2007-11-01

    Green animate materials from the intertidal zone of the Arabian Gulf coast accommodated more alkaliphilic and halophilic bacteria than inanimate materials. The alkaliphilic oil-utilizing bacteria, as identified by their 16S ribonucleic acid sequences, belonged to the following genera arranged in decreasing frequences: Marinobacter, Micrococcus, Dietzia, Bacillus, Oceanobacillus, and Citricoccus. The halophilic oil-utilizing bacteria belonged to the genera: Marinobacter, Georgenia, Microbacterium, Stappia, Bacillus, Isoptericola, and Cellulomonas. Most isolates could grow on a wide range of pure n-alkanes and aromatic compounds, as sole sources of carbon and energy. Quantitative gas liquid chromatographic analysis showed that individual isolates attenuated crude oil and representative pure hydrocarbons in culture. The optimum pH for most of the alkaliphilic genera was pH 10, and the optimum salinity for the halophiles ranged between 2.5 and 5% NaCl (w/v). It was concluded that as far as their microbial makeup is concerned, oily alkaline and saline intertidal areas of the Kuwaiti coasts have a self-cleaning potential.

  14. An easy, rapid and inexpensive method to monitor tributyltin (TBT) toxicity in the laboratory.

    PubMed

    Cruz, Andreia; Moreira, Rafael; Mendo, Sónia

    2014-05-01

    Tributyltin (TBT) contamination remains a major problem worldwide. Many laboratories are committed to the development of remediation methodologies that could help reduce the negative impact of this compound in the environment. Furthermore, it is important to have at hand simple methodologies for evaluating TBT toxicity in the laboratory, besides the use of complex and costly analytical instrumentation. With that purpose, a method was adapted that is based on the inhibition of growth of an indicator strain, Micrococcus luteus ATCC 9341, under TBT. Different types of matrices, of TBT concentrations and sample treatments were tested. The results herein reported show that the bioassay method can be applied for both aqueous and soil samples and also for a high range of TBT concentrations (at least up to 500 μmol/L). Besides being cheap and easy to perform, it can be performed in any laboratory. Additionally, one possible application of the method to monitor TBT degradation is presented as an example.

  15. Search for antibacterial and antifungal agents from selected Indian medicinal plants.

    PubMed

    Kumar, V Prashanth; Chauhan, Neelam S; Padh, Harish; Rajani, M

    2006-09-19

    A series of 61 Indian medicinal plants belonging to 33 different families used in various infectious disorders, were screened for their antimicrobial properties. Screening was carried out at 1000 and 500 microg/ml concentrations by agar dilution method against Bacillus cereus var mycoides, Bacillus pumilus, Bacillus subtilis, Bordetella bronchiseptica, Micrococcus luteus, Staphylococcus aureus, Staphylococcus epidermidis, Escherichia coli, Klebsiella pneumoniae, Pseudomonas aeruginosa, Streptococcus faecalis, Candida albicans, Aspergillus niger and Saccharomyces cerevisiae. Twenty-eight plant extracts showed activity against at least one of the test organisms used in the screening. On the basis of the results obtained, we conclude that the crude extracts of Dorema ammoniacum, Sphaeranthus indicus, Dracaena cinnabari, Mallotus philippinensis, Jatropha gossypifolia, Aristolochia indica, Lantana camara, Nardostachys jatamansi, Randia dumetorum and Cassia fistula exhibited significant antimicrobial activity and properties that support folkloric use in the treatment of some diseases as broad-spectrum antimicrobial agents. This probably explains the use of these plants by the indigenous people against a number of infections.

  16. Experimental investigation of microbiologically influenced corrosion of selected steels in sugarcane juice environment.

    PubMed

    Wesley, Sunil Bala; Maurya, Devendra Prasad; Goyal, Hari Sharan; Negi, Sangeeta

    2013-12-01

    In the current study, ferritic stainless grades AISI 439 and AISI 444 were investigated as possible construction materials for machinery and equipment in the cane-sugar industry. Their performance in corrosive cane-sugar juice environment was compared with the presently used low carbon steel AISI 1010 and austenitic stainless steel AISI 304. The Tafel plot electrochemical technique was used to evaluate general corrosion performance. Microbiologically influenced corrosion (MIC) behaviour in sugarcane juice environment was studied. Four microbial colonies were isolated from the biofilms on the metal coupon surfaces on the basis of their different morphology. These were characterized as Brevibacillus parabrevis, Bacillus azotoformans, Paenibacillus lautus and Micrococcus sp. The results of SEM micrographs showed that AISI 439 and AISI 304 grades had suffered maximum localized corrosion. MIC investigations revealed that AISI 444 steel had the best corrosion resistance among the tested materials. However from the Tafel plots it was evident that AISI 1010 had the least corrosion resistance and AISI 439 the best corrosion resistance.

  17. Population dynamics of transgenic strain Escherichia coli Z905/pPHL7 in freshwater and saline lake water microcosms with differing microbial community structures

    NASA Technical Reports Server (NTRS)

    Popova, L. Yu; Kargatova, T. V.; Ganusova, E. E.; Lobova, T. I.; Boyandin, A. N.; Mogilnaya, O. A.; Pechurkin, N. S.

    2005-01-01

    Populations of Escherichia coli Z905/pPHL7, a transgenic microorganism, were heterogenic in the expression of plasmid genes when adapting to the conditions of water microcosms of various mineralization levels and structure of microbial community. This TM has formed two subpopulations (ampicillin-resistant and ampicillin-sensitive) in every microcosm. Irrespective of mineralization level of a microcosm, when E. coli Z905/pPHL7 alone was introduced, the ampicillin-resistant subpopulation prevailed, while introduction of the TM together with indigenous bacteria led to the dominance of the ampicillin-sensitive subpopulation. A high level of lux gene expression maintained longer in the freshwater microcosms than in sterile saline lake water microcosms. A horizontal gene transfer has been revealed between the jointly introduced TM and Micrococcus sp. 9/pSH1 in microcosms with the Lake Shira sterile water. c2005 COSPAR. Published by Elsevier Ltd. All rights reserved.

  18. Antimicrobial activity of Chinese bayberry extract for the preservation of surimi.

    PubMed

    Li, Jianrong; Han, Qiang; Chen, Wei; Ye, Libin

    2012-08-30

    Chemical preservatives such as sodium nitrite and potassium sorbate have been widely used to keep surimi products fresh. However, the potential harmfulness to human health cannot be ignored. This study was conducted to develop natural preservatives for the storage of Collichthys surimi. Among the eight Chinese traditional herbs and fruits, Chinese bayberry extract showed the greatest inhibitory effect against surimi spoilage bacteria Serratia marcescens and Pseudomonas aeruginosa. Moreover, N-butanol phase extract of bayberry (NB) showed the greatest activity among the different phases of bayberry extract. When Chinese bayberry extract was combined with tea polyphenol, an additive inhibitory effect was observed on growth of Hansenula anomala, Micrococcus luteus, Staphylococcus aureus, Pseudomonas aeruginosa, and Escherichia coli. Our results further indicated that the shelf life of surimi products stored at room temperature can be extended when supplemented with Chinese bayberry extract. Our results suggest that Chinese bayberry extract can be used as a natural preservative for the storage of Collichthys surimi. Copyright © 2012 Society of Chemical Industry.

  19. Microbiological Safety of Kitchen Sponges Used in Food Establishments

    PubMed Central

    Bacha, Ketema

    2016-01-01

    Kitchen sponges are among the possible sources of contaminants in food establishments. The main purpose of the current study was, therefore, to assess the microbiological safety of sponges as it has been used in selected food establishments of Jimma town. Accordingly, the microbiological safety of a total of 201 kitchen sponges randomly collected from food establishments was evaluated against the total counts of aerobic mesophilic bacteria (AMB), Enterobacteriaceae, coliforms, and yeast and molds. The mean counts of aerobic mesophilic bacteria ranged from 7.43 to 12.44 log CFU/mm3. The isolated genera were dominated by Pseudomonas (16.9%), Bacillus (11.1%), Micrococcus (10.6%), Streptococcus (7.8%), and Lactobacillus (6%) excluding the unidentified Gram positive rods (4.9%) and Gram negative rods (9.9%). The high microbial counts (aerobic mesophilic bacteria, coliforms, Enterobacteriaceae, and yeast and molds) reveal the existence of poor kitchen sponge sanitization practice. Awareness creation training on basic hygienic practices to food handlers and periodic change of kitchen sponges are recommended. PMID:27840819

  20. Is there a potential consumer market for low-sodium fermented sausages?

    PubMed

    Dos Santos, Bibiana A; Campagnol, Paulo C B; da Cruz, Adriano G; Morgano, Marcelo A; Wagner, Roger; Pollonio, Marise A R

    2015-05-01

    The NaCl levels in dry fermented sausages were reduced by 50% or were substituted with KCl, CaCl2 , or a blend of KCl and CaCl2 (1:1). The quality, safety, and the potential consumer market of dry fermented sausages were assessed. Neither 50% reduction of the NaCl content nor the substitution of 50% of the NaCl with KCl influenced the fermentation and maturation process. However, when CaCl2 was used as the substitute salt (50%), there was a significant decrease in pH, an increase in the water activity, and a decrease in lactic acid and micrococcus bacterial counts. Overall, the sensory acceptance decreased in dry fermented sausages with reduced sodium content. However, cluster analysis and internal preference mapping revealed potential for commercialization of samples with 50% of the NaCl content substituted with KCl or with a mixture of KCl and CaCl2 (1:1). © 2015 Institute of Food Technologists®

  1. Characterization of Light Non-Methane Hydrocarbons, Surface Water DOC, and Aerosols over the Nordic Seas

    NASA Astrophysics Data System (ADS)

    Hudson, E. D.; Ariya, P. A.

    2006-12-01

    Whole air, size-fractionated marine aerosols, and surface ocean water DOC were sampled together during June-July 2004 on the Nordic seas, in order to explore factors leading to the formation of volatile organic compounds (VOCs) at the sea surface and their transfer to the atmosphere. High site-to-site variability in 19 non-methane hydrocarbon concentrations suggests highly variable, local sources for these compounds. Acetone, C5 and C6 hydrocarbons, and dimethylsulfide were identified in the seawater samples using solid-phase microextraction/GC-MS. The aerosols were analysed by SEM-EDX and contained primarily inorganic material (sea salt, marine sulfates, and carbonates) and little organic matter. However, a culturable bacterium was isolated from the large (9.9 - 18 μ m) fraction at one site, and identified as Micrococcus luteus. We will discuss the implication of these results on potential exchange processes at the ocean-atmosphere interface and the impact of bioaerosols in transferring marine organic carbon to atmospheric organic carbon.

  2. In Vitro Structural and Functional Evaluation of Gold Nanoparticles Conjugated Antibiotics

    NASA Astrophysics Data System (ADS)

    Saha, Biswarup; Bhattacharya, Jaydeep; Mukherjee, Ananda; Ghosh, Anup Kumar; Santra, Chitta Ranjan; Dasgupta, Anjan K.; Karmakar, Parimal

    2007-12-01

    Bactericidal efficacy of gold nanoparticles conjugated with ampicillin, streptomycin and kanamycin were evaluated. Gold nanoparticles (Gnps) were conjugated with the antibiotics during the synthesis of nanoparticles utilizing the combined reducing property of antibiotics and sodium borohydride. The conjugation of nanoparticles was confirmed by dynamic light scattering (DLS) and electron microscopic (EM) studies. Such Gnps conjugated antibiotics showed greater bactericidal activity in standard agar well diffusion assay. The minimal inhibitory concentration (MIC) values of all the three antibiotics along with their Gnps conjugated forms were determined in three bacterial strains, Escherichia coli DH5α, Micrococcus luteus and Staphylococcus aureus. Among them, streptomycin and kanamycin showed significant reduction in MIC values in their Gnps conjugated form whereas; Gnps conjugated ampicillin showed slight decrement in the MIC value compared to its free form. On the other hand, all of them showed more heat stability in their Gnps conjugated forms. Thus, our findings indicated that Gnps conjugated antibiotics are more efficient and might have significant therapeutic implications.

  3. Antioxidant, electrochemical, thermal, antimicrobial and alkane oxidation properties of tridentate Schiff base ligands and their metal complexes

    NASA Astrophysics Data System (ADS)

    Ceyhan, Gökhan; Çelik, Cumali; Uruş, Serhan; Demirtaş, İbrahim; Elmastaş, Mahfuz; Tümer, Mehmet

    2011-10-01

    In this study, two Schiff base ligands (HL 1 and HL 2) and their Cu(II), Co(II), Ni(II), Pd(II) and Ru(III) metal complexes were synthesized and characterized by the analytical and spectroscopic methods. Alkane oxidation activities of the metal complexes were studied on cyclohexane as substrate. The ligands and their metal complexes were evaluated for their antimicrobial activity against Corynebacterium xerosis, Bacillus brevis, Bacillus megaterium, Bacillus cereus, Mycobacterium smegmatis, Staphylococcus aureus, Micrococcus luteus and Enterococcus faecalis (as Gram-positive bacteria) and Pseudomonas aeruginosa, Klebsiella pneumoniae, Escherichia coli, Yersinia enterocolitica, Klebsiella fragilis, Saccharomyces cerevisiae, and Candida albicans (as Gram-negative bacteria). The antioxidant properties of the Schiff base ligands were evaluated in a series of in vitro tests: 1,1-diphenyl-2-picrylhydrazyl (DPPH rad ) free radical scavenging and reducing power activity of superoxide anion radical generated non-enzymatic systems. Electrochemical and thermal properties of the compounds were investigated.

  4. Pure and zinc doped nano-hydroxyapatite: Synthesis, characterization, antimicrobial and hemolytic studies

    NASA Astrophysics Data System (ADS)

    Tank, Kashmira P.; Chudasama, Kiran S.; Thaker, Vrinda S.; Joshi, Mihir J.

    2014-09-01

    The structural, antimicrobial, and hemolytic properties and bioactivity have been studied of pure hydroxyapatite (HAP) and zinc doped hydroxyapatite (Zn-HAP) nano-particles for their medical applications. Pure HAP and Zn-HAP nano-particles were synthesized by the surfactant mediated approach. The doping of zinc was estimated by EDAX. The average particle size was determined by applying Scherrer's formula to powdered XRD patterns. The nano-particle morphology was studied by TEM and the presence of various functional groups was identified by FTIR spectroscopy. Good antimicrobial activity of nano-HAP and nano-Zn-HAP was found against five organisms, viz., Pseudomonas aeruginosa and Shigella flexneri as Gram negative as well as Micrococcus luteus, Staphylococcous aureus and Bacillus cereus as Gram positive. The ability of new apatite formation on the surface of pure and doped HAP samples was studied by using Simulated Body Fluid (SBF) in vitro. Hemolytic study indicated that all samples were non-hemolytic and suggesting potential application as bone implant material.

  5. Microbiological assay for the determination of meropenem in pharmaceutical dosage form.

    PubMed

    Mendez, Andreas S L; Weisheimer, Vanessa; Oppe, Tércio P; Steppe, Martin; Schapoval, Elfrides E S

    2005-04-01

    Meropenem is a highly active carbapenem antibiotic used in the treatment of a wide range of serious infections. The present work reports a microbiological assay, applying the cylinder-plate method, for the determination of meropenem in powder for injection. The validation method yielded good results and included linearity, precision, accuracy and specificity. The assay is based on the inhibitory effect of meropenem upon the strain of Micrococcus luteus ATCC 9341 used as the test microorganism. The results of assay were treated statistically by analysis of variance (ANOVA) and were found to be linear (r=0.9999) in the range of 1.5-6.0 microg ml(-1), precise (intra-assay: R.S.D.=0.29; inter-assay: R.S.D.=0.94) and accurate. A preliminary stability study of meropenem was performed to show that the microbiological assay is specific for the determination of meropenem in the presence of its degradation products. The degraded samples were also analysed by the HPLC method. The proposed method allows the quantitation of meropenem in pharmaceutical dosage form and can be used for the drug analysis in routine quality control.

  6. The growth, properties and interactions of yeasts and bacteria associated with the maturation of Camembert and blue-veined cheeses.

    PubMed

    Addis, E; Fleet, G H; Cox, J M; Kolak, D; Leung, T

    2001-09-19

    The growth of yeasts and bacteria were monitored during the maturation of Camembert and blue-veined cheese produced in Australia. Yeasts were prominent throughout maturation, growing to 10(5)-10(9)/g, depending on the manufacturer. Debaryomyces hansenii predominated, but there were lesser, inconsistent contributions from Yarrowia lipolytica. Of the non-lactic acid bacteria, Acinetobacter species were significant during the maturation of Camembert but not blue-veined cheeses, and grew to 10(6)-10(8) cfu/g. Staphylococcus and Micrococcus species were consistently isolated from the cheeses with Staphylococcus xylosus growing to 10(5)-10(9) cfu/g, depending on the product. Lactic acid bacteria (10(7)-10(9) cfu/g) were present throughout maturation but were not identified. Interactions between the various yeasts and bacterial isolates were examined. Several strains of D. hansenii exhibited killer activity but not against Y. lipolytica. None of the yeasts were antagonistic towards the bacteria but some strains of D. hansenii enhanced the growth of Y. lipolytica and S. xylosus. The yeast and bacterial isolates exhibited various degrees of extracellular proteolytic and lipolytic activities.

  7. Characterization of Cladosporols from the Marine Algal-Derived Endophytic Fungus Cladosporium cladosporioides EN-399 and Configurational Revision of the Previously Reported Cladosporol Derivatives.

    PubMed

    Li, Hong-Lei; Li, Xiao-Ming; Mándi, Attila; Antus, Sándor; Li, Xin; Zhang, Peng; Liu, Yang; Kurtán, Tibor; Wang, Bin-Gui

    2017-10-06

    Four new cladosporol derivatives, cladosporols F-I (1-4), the known cladosporol C (5), and its new epimer, cladosporol J (6), were isolated and identified from the marine algal-derived endophytic fungus Cladosporium cladosporioides EN-399. Their structures were determined by detailed interpretation of NMR and MS data, and the absolute configurations were established on the basis of TDDFT-ECD and OR calculations. The configurational assignment of cladosporols F (1) and G (2) showed that the previously reported absolute configuration of cladosporol A and all the related cladosporols need to be revised from (4'R) to (4'S). Compounds 1-6 showed antibacterial activity against Escherichia coli, Micrococcus luteus, and Vibrio harveyi with MIC values ranging from 4 to 128 μg/mL. Compound 3 showed significant cytotoxicity against A549, Huh7, and LM3 cell lines with IC 50 values of 5.0, 1.0, and 4.1 μM, respectively, and compound 5 showed activity against H446 cell line with IC 50 value of 4.0 μM.

  8. Identification of Streptomyces sp. KH29, which produces an antibiotic substance processing an inhibitory activity against multidrug-resistant Acinetobacter baumannii.

    PubMed

    Lee, Keyong Ho; Kim, Kye-Woong; Rhee, Ki-Hyeong

    2010-12-01

    The Actinomycete strain KH29 is antagonistic to the multidrug-resistant Acinetobacter baumannii. Based on the diaminopimelic acid (DAP) type, and the morphological and physiological characteristics observed through the use of scanning electron microscopy (SEM), KH29 was confirmed as belonging to the genus Streptomyces. By way of its noted 16S rDNA nucleotide sequences, KH29 was found to have a relationship with Streptomyces cinnamonensis. The production of an antibiotic from this strain was found to be most favorable when cultured with glucose, polypeptone, and yeast extract (PY) medium for 6 days at 27 degrees C. The antibiotic produced was identified, through comparisons with reported spectral data including MS and NMR as a cyclo(L-tryptophanyl-L-tryptophanyl). Cyclo(L-Trp-L-Trp), from the PY cultures of KH29, was seen to be highly effective against 41 of 49 multidrugresistant Acinetobacter baumannii. Furthermore, cyclo(LTrp- L-Trp) had antimicrobial activity against Bacillus subtilis, Micrococcus luteus, Staphylococcus aureus, Saccharomyces cerevisiae, Aspergillus niger, and Candida albicans, However, it was ineffective against Streptomyces murinus.

  9. [Preparation and characterization of polyhydroxyalkanoate bioplastics with antibacterial activity].

    PubMed

    Lou, Qiuli; Ma, Yiming; Che, Xuemei; Zhong, Jin; Sun, Xiaoxia; Zhang, Haoqian

    2016-08-25

    Polyhydroxyalkanoates (PHAs), as a novel class of biopolymer, are attracting more attention due to their diverse material properties and environment-independent biodegradability. Here we report the preparation of PHA exhibiting efficient antibacterial activity by embedding Nisin, a food additive generally recognized as safe, into poly(3-hydroxybutyrate-co-3-hydroxyhexanoate) (PHBHHx), a type of PHA with high biocompatibility. We first prepared Nisin-containing PHBHHx films using solvent casting method. Confocal laser scanning microscopy analysis showed that a well-mixed integrated structure of the films with an even distribution of the Nisin particles in the PHBHHx matrices. Then the antimicrobial activity of PHBHHx/Nisin films against Micrococcus luteus was quantified on agar plate by measuring the size of inhibition zone. Cultivation in liquid media further confirmed the releasing of Nisin from the films and the long-time antibacterial activity. Results showed that the threshold of Nisin concentration for long-time and effective inhibition against bacteria growth is 25 μg/g. These results altogether establish a technological foundation for the application of PHA in biomedicine and food industry.

  10. Comparative Pharmacokinetics of Cefquinome (Cobactan 2.5%) following Repeated Intramuscular Administrations in Sheep and Goats

    PubMed Central

    El-Hewaity, Mohamed; Abd El Latif, Amera

    2014-01-01

    The comparative pharmacokinetic profile of cefquinome was studied in sheep and goats following repeated intramuscular (IM) administrations of 2 mg/kg body weight. Cefquinome concentrations in serum were determined by microbiological assay technique using Micrococcus luteus (ATCC 9341) as test organism. Following intramuscular injection of cefquinome in sheep and goats, the disposition curves were best described by two-compartment open model in both sheep and goats. The pharmacokinetics of cefquinome did not differ significantly between sheep and goats; similar intramuscular dose rate of cefquinome should therefore be applicable to both species. On comparing the data of serum levels of repeated intramuscular injections with first intramuscular injection, it was revealed that repeated intramuscular injections of cefquinome have cumulative effect in both species sheep and goats. The in vitro serum protein-binding tendency was 15.65% in sheep and 14.42% in goats. The serum concentrations of cefquinome along 24 h after injection in this study were exceeding the MICs of different susceptible microorganisms responsible for serious disease problems. These findings indicate successful use of cefquinome in sheep and goats. PMID:26464946

  11. Antibiotics production by an actinomycete isolated from the termite gut.

    PubMed

    Matsui, Toru; Tanaka, Junichi; Namihira, Tomoyuki; Shinzato, Naoya

    2012-12-01

    As well as the search for new antibiotics, a new resource or strains for the known antibiotics is also important. Microbial symbionts in the gut of termites could be regarded as one of the feasible resource for such purpose. In this study, antibiotic-producing actinomycetes were screened from symbionts of the termite gut. 16SrRNA sequence analysis for the 10 isolates revealed that they belong to actinomycetes such as Streptomyces sp., Kitasatospora sp., and Mycobacterium sp. A culture broth from one of the isolate, namely strain CA1, belonging to the genera Streptomyces exhibited antagonistic activity against actinomycetes (Micrococcus spp.), gram-positive bacteria (Bacillus spp.), and yeast (Candida spp.). The structures of 2 compounds isolated from the culture broth of the strain CA1 were identified as those of actinomycin X2 and its analog, D. This study is the first to report that some symbionts of the termite gut are antibiotic-producing actinomycetes, and suggest that the termite gut is a feasible resource for bioprospecting. Copyright © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  12. Elution kinetics, antimicrobial activity, and mechanical properties of 11 different antibiotic loaded acrylic bone cement.

    PubMed

    Gálvez-López, Ruben; Peña-Monje, Alejandro; Antelo-Lorenzo, Ramón; Guardia-Olmedo, Juan; Moliz, Juan; Hernández-Quero, José; Parra-Ruiz, Jorge

    2014-01-01

    Antibiotic-loaded acrylic bone cements (ALABC) spacers are routinely used in the treatment of prosthetic joint infections. The objectives of our study were to evaluate different ALABC for elution kinetics, thermal stability, and mechanical properties. A 10 or 20% mixture (w/w) beads of medium viscosity bone cement (DePuy, Inc) and vancomycin (VAN), gentamycin (GM), daptomycin (DAP), moxifloxacin (MOX), rifampicin (RIF), cefotaxime (CTX), cefepime (FEP), amoxicillin clavulanate (AmC), ampicillin (AMP), meropenem (MER), and ertapenem (ERT) were formed and placed into wells filled with phosphate-buffered saline. Antibiotic concentrations were determined using high-performance liquid chromatography. Antimicrobial activity was tested against Micrococcus luteus ATCC 9341 or Escherichia coli ATCC 25922. AmC, AMP, and FEP concentration rapidly decreased after day 2, being almost undetectable at day 4. Sustained and high elution rates were observed with VAN, GM, MOX, and RIF for the 30-day duration of the experiment. DAP, MER, ERT, and CTX elution rates constantly decreased from day 4. All antibiotics tested retained antimicrobial activity proving thermal stability. Mechanical properties of ALABC were maintained except when RIF was used. © 2013.

  13. Detailed Investigations on the Solid Cell Culture and Antimicrobial Activities of the Iranian Arnebia euchroma

    PubMed Central

    Haghbeen, K.; Pourmolaei, S.; Mareftjo, M. J.; Mousavi, A.; Akbari Noghabi, K.; Hosseini Shirazi, F.; Meshkat, A.

    2011-01-01

    In pursuit of strong shikalkin-producing cell lines, seeds of the Iranian Arnebia euchroma were collected from Dena altitudes in the central Zagross. Chemical analysis showed that the dried root of the plant contained about 8.5% (w/w) shikalkin pigment. The root explants of the young plantlets, obtained from the germinated seeds, were used for establishing callus. Then, parameters effective on proliferation and pigment production of the resulting calli were studied in detail. Accordingly, two modified media called mLS and mM9 were optimized for propagation and pigment production, respectively. Using these media, the biomass of the A.euchroma calli was increased to 600%, and the pigment production reached to a maximum of 16.3 mg per gram of the wet biomass in a period of a subculture (21 days). Parallel to these experiments, the antimicrobial activity of shikalkin pigment was examined on some fungi and Gram-positive and Gram-negative bacteria. Results indicated that the pigment was almost ineffective on fungi and Gram-negative bacteria, but it was meaningfully effective against Micrococcus luteus. PMID:21772789

  14. UV-Resistant Actinobacteria from High-Altitude Andean Lakes: Isolation, Characterization and Antagonistic Activities.

    PubMed

    Rasuk, María Cecilia; Ferrer, Gabriela Mónica; Kurth, Daniel; Portero, Luciano Raúl; Farías, María Eugenia; Albarracín, Virginia Helena

    2017-05-01

    Polyextremophiles are present in a wide variety of extreme environments in which they must overcome various hostile conditions simultaneously such as high UVB radiation, extreme pHs and temperatures, elevated salt and heavy-metal concentration, low-oxygen pressure and scarce nutrients. High-altitude Andean lakes (HAALs; between 2000 and 4000 m) are one example of these kinds of ecosystems suffering from the highest total solar and UVB radiation on Earth where an abundant and diverse polyextremophilic microbiota was reported. In this work, we performed the first extensive isolation of UV-resistant actinobacteria from soils, water, sediments and modern stromatolites at HAALs. Based on the 16S rRNA sequence, the strains were identified as members of the genera Streptomyces, Micrococcus, Nesterenkonia, Rhodococcus, Microbacterium, Kocuria, Arthrobacter, Micromonospora, Blastococcus, Citrococcus and Brevibacterium. Most isolates displayed resistance to multiple environmental stress factors confirming their polyextremophilic nature and were able to produce effective antimicrobial compounds. HAALs constitute a largely unexplored repository of UV-resistant actinobacteria, with high potential for the biodiscovery of novel natural products. © 2017 The American Society of Photobiology.

  15. Lipopeptide biosurfactants from Paenibacillus polymyxa inhibit single and mixed species biofilms.

    PubMed

    Quinn, Gerry A; Maloy, Aaron P; McClean, Stephen; Carney, Brian; Slater, John W

    2012-01-01

    Although biofilms are recognised as important in microbial colonisation, solutions to their inhibition are predominantly based on planktonic assays. These solutions have limited efficacy against biofilms. Here, a series of biofilm-orientated tests were used to identify anti-biofilm compounds from marine micro-flora. This led to the isolation of a complex of anti-biofilm compounds from an extract of Paenibacillus polymyxa (PPE). A combination of rpHPLC and mass spectrometry identified the principle components of PPE as fusaricidin B (LI-FO4b) and polymyxin D1, with minor contributions from surfactins. This complex (PPE) reduced the biofilm biomass of Bacillus subtilis, Micrococcus luteus, Pseudomonas aeruginosa, Staphylococcus aureus and Streptococcus bovis. In contrast, ampicillin was only effective against S. aureus. PPE also inhibited a self-assembling marine biofilm (SAMB) in co-incubation assays by 99.3% ± 1.9 and disrupted established SAMB by 72.4% ± 4.4, while ampicillin showed no significant reduction. The effectiveness of this complex of lipopeptides against single and multispecies biofilms suggests a future role in biofilm prevention strategies.

  16. High-Throughput Identification of Antimicrobial Peptides from Amphibious Mudskippers

    PubMed Central

    You, Xinxin; Bian, Chao; Chen, Shixi; Lv, Zhao; Qiu, Limei; Shi, Qiong

    2017-01-01

    Widespread existence of antimicrobial peptides (AMPs) has been reported in various animals with comprehensive biological activities, which is consistent with the important roles of AMPs as the first line of host defense system. However, no big-data-based analysis on AMPs from any fish species is available. In this study, we identified 507 AMP transcripts on the basis of our previously reported genomes and transcriptomes of two representative amphibious mudskippers, Boleophthalmus pectinirostris (BP) and Periophthalmus magnuspinnatus (PM). The former is predominantly aquatic with less time out of water, while the latter is primarily terrestrial with extended periods of time on land. Within these identified AMPs, 449 sequences are novel; 15 were reported in BP previously; 48 are identically overlapped between BP and PM; 94 were validated by mass spectrometry. Moreover, most AMPs presented differential tissue transcription patterns in the two mudskippers. Interestingly, we discovered two AMPs, hemoglobin β1 and amylin, with high inhibitions on Micrococcus luteus. In conclusion, our high-throughput screening strategy based on genomic and transcriptomic data opens an efficient pathway to discover new antimicrobial peptides for ongoing development of marine drugs. PMID:29165344

  17. Nonspecific Bacterial Flora Isolated from the Body Surface and Inside Ixodes ricinus Ticks.

    PubMed

    Okła, Hubert; Sosnowska, Malwina; Jasik, Krzysztof P; Słodki, Jan; Wojtyczka, Robert D

    2012-09-28

    Ixodes ricinus and other representatives of the order Ixodida are vectors of typical pathogens: Borrelia burgdorferi sensu lato, Anaplasma phagocytophilium, Babesia spp., a tick-borne encephalitis virus, and other microorganisms which are important from a medical and veterinary point of view. The presented study focuses on the verification of nonspecific bacterial flora of I. ricinus. We analyzed ticks collected in a forest region in Silesia, an industrial district in Poland. Methods of classical microbiology and biochemical assays (API 20 NE test, API Staph test and MICRONAUT System) were used for isolation and identification of microorganisms living on the body surface of I. ricinus and inside ticks. The results show the presence of various bacteria on the surface and inside ticks' bodies. During the study, we isolated Acinetobacter lwoffi, Pseudomonas fluorescens, Aeromonas hydrophila, Achromobacter denitrificans, Alcaligenes faecalis, Stenotrophomonas maltophilia, Pseudomonas oryzihabitans, Micrococcus spp., Kocuria varians, Staphylococcus lentus, Kocuria kristinae, Streptococcus pneumoniae, Rhizobium radiobacter, Staphylococcus xylosus. Majority of the isolated species are non-pathogenic environmental microorganisms, but some of the isolated bacterial strains could cause severe infections.

  18. [Microfloral study of bull seminal fluid stored at low temperatures].

    PubMed

    Korudzhiĭski, N

    1979-01-01

    Hundred twenty three samples of bull semen fluid frozen at 196 degrees C including 83 plastic ampules, 20 granules and 20 plastic straws obtained from the containers of the insemination stations of 10 farms from the Sofia district were investigated. Two hundred twelve strains were isolated and identified as: Escherichia coli--25 strains, Hafnia--16 strains, Citrobacter, Enterobacter and Proteus mirabilis--9 strains of each. The remaining Gram-negative genera and species were more rarely encountered. Gram positive bacteria: Micrococcus--19 strains, Staphylococcus aureus--17 strains, Staph. epidermidis--15 strains, Bacillus cereus--15 strains, B. subtilis--12 strains. Other representatives of Gram-positive bacteria were also found but in lower percentages. Least bacteria were observed in semen fluid frozen in plastic straws and most--in plastic ampules which were mainly used until recently for cow insemination. It was established that the same bacteria isolated by other authors from fresh sperm were encountered in semen fluid stored at minus temperatures. The conclusion is made that semen fluid stored at low temperature is contaminated with bacteria. It is only natural that these bacteria are introduced in cow genitals by insemination.

  19. Lysozyme as a recognition element for monitoring of bacterial population.

    PubMed

    Zheng, Laibao; Wan, Yi; Yu, Liangmin; Zhang, Dun

    2016-01-01

    Bacterial infections remain a significant challenge in biomedicine and environment safety. Increasing worldwide demand for point-of-care techniques and increasing concern on their safe development and use, require a simple and sensitive bioanalysis for pathogen detection. However, this goal is not yet achieved. A design for fluorescein isothiocyanate-labeled lysozyme (FITC-LYZ), which provides quantitative binding information for gram-positive bacteria, Micrococcus luteus, and detects pathogen concentration, is presented. The functional lysozyme is used not only as the pathogenic detection platform, but also as a tracking reagent for microbial population in antibacterial tests. A nonlinear relationship between the system response and the logarithm of the bacterial concentration was observed in the range of 1.2×10(2)-1.2×10(5) cfu mL(-1). The system has a potential for further applications and provides a facile and simple method for detection of pathogenic bacteria. Meanwhile, the fluorescein isothiocyanate -labeled lysozyme is also employed as the tracking agent for antibacterial dynamic assay, which show a similar dynamic curve compared with UV-vis test. Copyright © 2015 Elsevier B.V. All rights reserved.

  20. [Bacterial contamination of the indoor air in a transplant unit].

    PubMed

    Matoušková, Ivanka; Holý, Ondřej

    2013-12-01

    For one year (August 2010 to July 2011), microbial contamination of the indoor air in the Transplant Unit of the Haemato-Oncology Clinic, Olomouc University Hospital was monitored monthly. Twenty sampling sites were singled out and a total of 240 indoor air samples were collected. An MAS-100 air sampler (Merck, GER) was used, air flow rate of 100 liters per minute, 1 minute. The measured values of indoor air temperature were stable. The relative air humidity ranged from 17% to 68%. The highest average value of microbial air contamination was found in the "staff entry room" (1170 CFU/m3). The lowest microbial air contamination (150-250 CFU/m3) was measured in the patient isolation units. The most frequently isolated bacterial strains were coagulase-negative staphylococci (94.3%), followed by Micrococcus spp. (67%) and Bacillus subtilis (11%). It can be assumed that the -source of these airborne bacterial strains are both patients and medical staff. They are classified as -opportunistic pathogens and as such can cause hospital infections among haemato-oncology patients.

  1. Study of Antibacterial Activity and Bacteriology of Latex from Asclepias syriaca L

    PubMed Central

    McCay, Steven; Mahlberg, Paul

    1973-01-01

    Whole and fractionated latex of Asclepias syriaca was tested for antimicrobial or growth-promoting activity with 16 genera and species of bacteria. Latex and extracted fractions (distilled water, acetic acid, sodium bicarbonate, sulfuric acid, and ethyl ether) possessed no detectable antimicrobial activity. Comparison of growth curves of selected bacteria incubated with serum and rubber fractions, as well as controls, revealed no detectable inhibition of growth, except for a slight inhibitory response to autoclaved serum. Most bacteria were capable of utilizing latex for a substrate as indicated by the increased growth rate in the exponential phase. The stationary phase was entered simultaneously by both the treated cultures and the controls. Various bacteria cultured in a litmus latex mixture yielded populations which ranged from <104 organisms/ml for Lactobacillus casei, Staphylococcus aureus and Micrococcus lysodeikticus to 1.1 × 1010 organisms/ml for Clostridium acetobutylicum. Whole latex, as well as the serum and rubber fractions, support the growth of various bacteria, but under field conditions there is no evidence for systemic infection of this type of cell by bacteria. PMID:4790590

  2. EOR by stimulated microflora

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Svarovskaya, L.I.; Altunina, L.K.; Rozhenkova, Z.A.

    1995-12-31

    A combined microbiological and physico-chemical method for EOR has been developed for flooded West Siberia oil fields with formation temperature of 45{degrees}-95{degrees}C (318-365K). Formation water includes rich and various biocenoses numbering up to 2 x 10{sup 7} cells per ml. Representatives of genera, i.e, Pseudomonas, Bacillus, Actinomyces, Micrococcus, Mycobacterium, Sarcina, etc. were found to be the most widely distributed microorganisms. The method is based on injection of systems exhibiting high oil displacing capacity and at the same time being an additional nitrous nutrient for endemic populations of microorganisms. Their injection into formation water favors biomass growth by 4-6 orders andmore » promotes syntheses of biosurfactants, biopolymers, acids, etc., and gaseous products. The features of residual oil displacement have been studied on laboratory models using a combined microbiological and physico-chemical method. A curve for the yield of residual oil is presented by two peaks. The first peak is stipulated by the washing action of oil displacement system, and the second one by the effect of metabolites produced at stimulation of biogenic processes. Oil displacement index increases by 15%-30%.« less

  3. Agreement Between Deoxyribonucleic Acid Base Composition and Taxometric Classification of Gram-Positive Cocci1

    PubMed Central

    Silvestri, L. G.; Hill, L. R.

    1965-01-01

    Silvestri, L. G. (Università Statale, Milan, Italy), and L. R. Hill. Agreement between deoxyribonucleic acid base composition and taxometric classification of gram-positive cocci. J. Bacteriol. 90:136–140. 1965.—It had been previously proposed, from taxometric analyses, that gram-positive, catalase-positive cocci be divided into two subgroups. Thirteen strains, representative of both subgroups, were examined for deoxyribonucleic acid (DNA) base composition, determined from melting temperatures. Per cent GC (guanine + cytosine/total bases) values fell into two groups: 30.8 to 36.5% GC and 69 to 75% GC. Strains with low per cent GC values belonged to the Staphylococcus aureus–S. saprophyticus–S. lactis taxometric subgroups, and those with high per cent GC values belonged to the S. roseus–S. afermentans subgroup. The hypothetical nature of any classification is emphasized, and, in the present work, the hypothesis derived from taxometric analyses of division into two subgroups is confirmed by the study of DNA base ratios. The two subgroups correspond, respectively, to the genera Staphylococcus and Micrococcus. PMID:16562008

  4. STABILIZATION OF PROTOPLASTS AND SPHEROPLASTS BY SPERMINE AND OTHER POLYAMINES

    PubMed Central

    Tabor, Celia W.

    1962-01-01

    Tabor, Celia W. (National Institute of Arthritis and Metabolic Diseases, Bethesda, Md.). Stabilization of protoplasts and spheroplasts by spermine and other polyamines. J. Bacteriol. 83:1101–1111. 1962.—Spermine (10−3m) or spermidine prevents lysis of lysozyme-produced protoplasts of Escherichia coli W, E. coli B, and Micrococcus lysodeikticus in hypotonic media. Spheroplasts prepared by the action of penicillin are also stabilized by these concentrations of spermine and spermidine, but the protection is not as complete. Streptomycin, polylysine, and Ca++ are also effective or partially effective stabilizers, but 1,4-diaminobutane, 1,5-diaminopentane, ornithine, Mg++, and monovalent cations have no protective action at 10−3m concentration, and only a slight effect at higher concentrations. The osmotic stability conferred on protoplasts by spermine is irreversible. However, the protective effect of polyamines against lysis is not accompanied by restoration of viability to lysozyme protoplasts. There is a marked reduction in the loss of ultra-violet-absorbing material from the protoplasts to the medium when 10−3m spermine is present. PMID:16561942

  5. High-Throughput Identification of Antimicrobial Peptides from Amphibious Mudskippers.

    PubMed

    Yi, Yunhai; You, Xinxin; Bian, Chao; Chen, Shixi; Lv, Zhao; Qiu, Limei; Shi, Qiong

    2017-11-22

    Widespread existence of antimicrobial peptides (AMPs) has been reported in various animals with comprehensive biological activities, which is consistent with the important roles of AMPs as the first line of host defense system. However, no big-data-based analysis on AMPs from any fish species is available. In this study, we identified 507 AMP transcripts on the basis of our previously reported genomes and transcriptomes of two representative amphibious mudskippers, Boleophthalmus pectinirostris (BP) and Periophthalmus magnuspinnatus (PM). The former is predominantly aquatic with less time out of water, while the latter is primarily terrestrial with extended periods of time on land. Within these identified AMPs, 449 sequences are novel; 15 were reported in BP previously; 48 are identically overlapped between BP and PM; 94 were validated by mass spectrometry. Moreover, most AMPs presented differential tissue transcription patterns in the two mudskippers. Interestingly, we discovered two AMPs, hemoglobin β1 and amylin, with high inhibitions on Micrococcus luteus . In conclusion, our high-throughput screening strategy based on genomic and transcriptomic data opens an efficient pathway to discover new antimicrobial peptides for ongoing development of marine drugs.

  6. Antifouling potentials of eight deep-sea-derived fungi from the South China Sea.

    PubMed

    Zhang, Xiao-Yong; Xu, Xin-Ya; Peng, Jiang; Ma, Chun-Feng; Nong, Xu-Hua; Bao, Jie; Zhang, Guang-Zhao; Qi, Shu-Hua

    2014-04-01

    Marine-derived microbial secondary metabolites are promising potential sources of nontoxic antifouling agents. The search for environmentally friendly and low-toxic antifouling components guided us to investigate the antifouling potentials of eight novel fungal isolates from deep-sea sediments of the South China Sea. Sixteen crude ethyl acetate extracts of the eight fungal isolates showed distinct antibacterial activity against three marine bacteria (Loktanella hongkongensis UST950701-009, Micrococcus luteus UST950701-006 and Pseudoalteromonas piscida UST010620-005), or significant antilarval activity against larval settlement of bryozoan Bugula neritina. Furthermore, the extract of Aspergillus westerdijkiae DFFSCS013 displayed strong antifouling activity in a field trial lasting 4 months. By further bioassay-guided isolation, five antifouling alkaloids including brevianamide F, circumdatin F and L, notoamide C, and 5-chlorosclerotiamide were isolated from the extract of A. westerdijkiae DFFSCS013. This is the first report about the antifouling potentials of metabolites of the deep-sea-derived fungi from the South China Sea, and the first stage towards the development of non- or low-toxic antifouling agents from deep-sea-derived fungi.

  7. Synthesis, pharmacological activities and molecular docking studies of pyrazolyltriazoles as anti-bacterial and anti-inflammatory agents.

    PubMed

    Dayakar, Cherupally; Kumar, Buddana Sudheer; Sneha, Galande; Sagarika, Gudem; Meghana, Koneru; Ramakrishna, Sistla; Prakasham, Reddy Shetty; China Raju, Bhimapaka

    2017-10-15

    A series of novel pyrazolyl alcohols (5a-h), pyrazolyl azides (6a-h), and pyrazolyltriazoles (8a-h, 10a-p and 12a-l) were prepared and evaluated for their bioactivity (anti-bacterial and anti-inflammatory) profile. The compound 5c displayed the potent anti-bacterial activity against Micrococcus luteus (MIC 3.9 and MBC 7.81µg/mL). In vitro anti-inflammatory activity data denoted that compound 8b is effective among the tested compounds against IL-6 (IC 50 6.23μM). Docking analysis of compounds 5f, 8a-b, 8e-f and 8h displayed high binding energies for the compounds 8a-b and 8h towards TNF-α dimer (2AZ5 protein) and IL-6 (1ALU protein). In vivo anti-inflammatory activity of compounds 8b and 8h with respect to LPS induced mice model indicated that compound 8h showed significant reduction in TNF-α. Copyright © 2017 Elsevier Ltd. All rights reserved.

  8. Diverse bacteria isolated from microtherm oil-production water.

    PubMed

    Sun, Ji-Quan; Xu, Lian; Zhang, Zhao; Li, Yan; Tang, Yue-Qin; Wu, Xiao-Lei

    2014-02-01

    In total, 435 pure bacterial strains were isolated from microtherm oil-production water from the Karamay Oilfield, Xinjiang, China, by using four media: oil-production water medium (Cai medium), oil-production water supplemented with mineral salt medium (CW medium), oil-production water supplemented with yeast extract medium (CY medium), and blood agar medium (X medium). The bacterial isolates were affiliated with 61 phylogenetic groups that belong to 32 genera in the phyla Actinobacteria, Firmicutes, and Proteobacteria. Except for the Rhizobium, Dietzia, and Pseudomonas strains that were isolated using all the four media, using different media led to the isolation of bacteria with different functions. Similarly, nonheme diiron alkane monooxygenase genes (alkB/alkM) also clustered according to the isolation medium. Among the bacterial strains, more than 24 % of the isolates could use n-hexadecane as the sole carbon source for growth. For the first time, the alkane-degrading ability and alkB/alkM were detected in Rhizobium, Rhodobacter, Trichococcus, Micrococcus, Enterococcus, and Bavariicoccus strains, and the alkM gene was detected in Firmicutes strains.

  9. Ecological effects of a deodorant and a plain soap upon human skin bacteria.

    PubMed Central

    Bibel, D. J.

    1977-01-01

    The effects of a commercial trichlorocarbanilide-containing deodorant soap and a commercial plain soap upon the cutaneous flora of individuals were compared. Using a cross-over design, 21 volunteers (10 women and 11 men) washed their forearms at least once a day with one soap for 3 weeks and then switched soaps for another 4 weeks use. By analysis of variance no significant difference in total colony counts was noted among individuals in their use of the two soaps. With the exception of individual variation, neither sequence of use, sex, nor any combination was influential. However, in 20 of 21 subjects an alteration in the composition of skin flora was observed. The deodorant soap, which in six cases increased total flora, tended to reduce or eliminate diphtheroids in 12 to 17 carriers (71%). Fewer kinds of bacteria were also noted. More Staphylococcus epidermidis was seen with the plain soap, but washing with the deodorant soap seemed to favour Acinetobacter calcoaceticus and Micrococcus luteus. The impact of this alteration and the use of total counts to measure effectiveness of deodorant soaps were brought into question. PMID:264493

  10. Self-leveling morter as a possible cause of symptoms associated with sick building syndrome

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lundholm, M.; Lavrell, G.; Mathiasson, L.

    In newly constructed houses and buildings in which self-leveling mortar containing casein has been used, residents and office employees have noted a bad odor and have complained of headache, eye and throat irritation, and tiredness. These problems were suspected to result from the degradation products emitted from the mortar. Samples obtained from dry mortar powder and from mortar in buildings where casein was used and from control buildings were found to contain microorganisms (mean of 10{sup 2} culture forming units/g). Environmental species were predominantly found, e.g., Bacillus, Clostridium, Micrococcus, and Propionibacterium. Fungi were found occasionally; no evidence of bacterial degradationmore » was found. Headspace and gas chromatographic-mass spectrometric analysis of air from the newly constructed houses and from hydroxide-degraded casein revealed the presence of amines in the 0.003-0.013 ppm range and the presence of ammonia and sulfhydryl compounds, all of which in low concentrations can cause the symptoms observed. These substances, however, were not detected in control buildings.« less

  11. Bombyx mori Serpin6 regulates prophenoloxidase activity and the expression of antimicrobial proteins.

    PubMed

    Li, Bing; Yu, Hai-Zhong; Ye, Chong-Jun; Ma, Yan; Li, Xing; Fan, Tao; Chen, Fu-Sheng; Xu, Jia-Ping

    2017-04-30

    Serpins are a family of serine protease inhibitors that are found widely in insects. They play an important role in insect physiological responses, such as innate immunity and development. In this study, we obtained the Bombyx mori serpin6 (BmSerpin6) sequence from National Center for Biotechnology Information (NCBI) and the silkworm genome database (SilkDB). Reverse transcription PCR (RT-PCR) results showed that BmSerpin6 was expressed highly in hemocytes, the midgut, and the fat body. After challenging with Micrococcus luteus (Mi) and Serratia marcescens (Sm), the BmSerpin6 expression level was induced significantly. Transcript levels of gloverin2 and prophenoloxidase (PPO) activity were reduced significantly in the fat body and hemocytes after injecting the recombinant BmSerpin6 protein into silkworm larvae. A BmSerpin6 recombinant plasmid (BmSerpin6-pAC 5.1) was constructed successfully and transfected into Drosophila S2 cells, which resulted in significantly reduced expression of the drosomycin protein. These results indicated that BmSerpin6 might regulate silkworm immune responses. Copyright © 2017 Elsevier B.V. All rights reserved.

  12. The constituents of essential oil: antimicrobial and antioxidant activity of Micromeria congesta Boiss. & Hausskn. ex Boiss. from East Anatolia.

    PubMed

    Herken, Emine Nur; Celik, Ali; Aslan, Mustafa; Aydınlık, Nilüfer

    2012-09-01

    The chemical composition, antimicrobial activity, total phenol content, total antioxidant activity, and total oxidant status of the essential oil from Micromeria congesta Boiss. & Hausskn. ex Boiss. were investigated. Steam distillation was used to obtain the essential oil, and the chemical analyses were performed by gas chromatography-mass spectrometry. The antimicrobial activity was tested by an agar disc diffusion method against the tested microorganisms: Bacillus subtilis NRRL B-744, Bacillus cereus NRRL B-3711, Staphylococcus aureus ATCC 12598, S. aureus ATCC 25923, S. aureus ATCC 25933, Escherichia coli 0157H7, E. coli ATCC25922, Micrococcus luteus NRLL B-4375, Enterococcus faecalis ATCC 19433, Proteus vulgaris RSKK 96026, and Yersinia enterecolitica RSKK 1501. The major compounds found in volatiles of M. congesta were piperitone oxide, linalool oxide, veratrole, pulegone, dihydro carvone, naphthalene, iso-menthone, para-menthone, and cyclohexanone. Compared to that of reference antibiotics, the antibacterial activity of the essential oil is considered as significant. Results showed that M. congesta has the potential for being used in food and medicine depending on its antioxidant and antibacterial activity.

  13. Evaluation of dermal wound healing activity and in vitro antibacterial and antioxidant activities of a new exopolysaccharide produced by Lactobacillus sp.Ca6.

    PubMed

    Trabelsi, Imen; Ktari, Naourez; Ben Slima, Sirine; Triki, Mehdi; Bardaa, Sana; Mnif, Hela; Ben Salah, Riadh

    2017-10-01

    The present study aimed to evaluate the in vitro antibacterial and antioxidant activities and the in vivo wound healing performance of a noval exopolysaccharides (EPS-Ca 6 ) produced by Lactobacillus sp.Ca 6 strain. The results showed that EPS-Ca 6 had a potential antioxidant activity determined through four different assays: DPPH scavenging activity, reducing power, β-carotene bleaching by linoleic acid assay, and Metal chelating activities. It also exhibited significant antibacterial activity against pathogenic bacteria Salmonella enterica and Micrococcus luteus. The wound healing activity of the EPS-Ca 6 , using excision wound model in rats, showed that this novel EPS accelerated significantly wound healing activity as compared to the control group, and a total closure was achieved after 14days of wound induction. Furthermore, histological examination of biopsies showed fully re-epithelialized wound with a complete epidermal regeneration. Overall the finding indicates that the EPS-Ca 6 might be useful as a wound healing agent in modern medicine. Copyright © 2017 Elsevier B.V. All rights reserved.

  14. Standoff detection and classification of bacteria by multispectral laser-induced fluorescence

    NASA Astrophysics Data System (ADS)

    Duschek, Frank; Fellner, Lea; Gebert, Florian; Grünewald, Karin; Köhntopp, Anja; Kraus, Marian; Mahnke, Peter; Pargmann, Carsten; Tomaso, Herbert; Walter, Arne

    2017-04-01

    Biological hazardous substances such as certain fungi and bacteria represent a high risk for the broad public if fallen into wrong hands. Incidents based on bio-agents are commonly considered to have unpredictable and complex consequences for first responders and people. The impact of such an event can be minimized by an early and fast detection of hazards. The presented approach is based on optical standoff detection applying laser-induced fluorescence (LIF) on bacteria. The LIF bio-detector has been designed for outdoor operation at standoff distances from 20 m up to more than 100 m. The detector acquires LIF spectral data for two different excitation wavelengths (280 and 355 nm) which can be used to classify suspicious samples. A correlation analysis and spectral classification by a decision tree is used to discriminate between the measured samples. In order to demonstrate the capabilities of the system, suspensions of the low-risk and non-pathogenic bacteria Bacillus thuringiensis, Bacillus atrophaeus, Bacillus subtilis, Brevibacillus brevis, Micrococcus luteus, Oligella urethralis, Paenibacillus polymyxa and Escherichia coli (K12) have been investigated with the system, resulting in a discrimination accuracy of about 90%.

  15. Evaluation of portable air samplers for monitoring airborne culturable bacteria

    NASA Technical Reports Server (NTRS)

    Mehta, S. K.; Bell-Robinson, D. M.; Groves, T. O.; Stetzenbach, L. D.; Pierson, D. L.

    2000-01-01

    Airborne culturable bacteria were monitored at five locations (three in an office/laboratory building and two in a private residence) in a series of experiments designed to compare the efficiency of four air samplers: the Andersen two-stage, Burkard portable, RCS Plus, and SAS Super 90 samplers. A total of 280 samples was collected. The four samplers were operated simultaneously, each sampling 100 L of air with collection on trypticase soy agar. The data were corrected by applying positive hole conversion factors for the Burkard portable, Andersen two-stage, and SAS Super 90 air samplers, and were expressed as log10 values prior to statistical analysis by analysis of variance. The Burkard portable air sampler retrieved the highest number of airborne culturable bacteria at four of the five sampling sites, followed by the SAS Super 90 and the Andersen two-stage impactor. The number of bacteria retrieved by the RCS Plus was significantly less than those retrieved by the other samplers. Among the predominant bacterial genera retrieved by all samplers were Staphylococcus, Bacillus, Corynebacterium, Micrococcus, and Streptococcus.

  16. Study of Bacterial Samples Using Laser Induced Breakdown Spectroscopy

    NASA Astrophysics Data System (ADS)

    W, A. Farooq; M, Atif; W, Tawfik; M, S. Alsalhi; Z, A. Alahmed; M, Sarfraz; J, P. Singh

    2014-12-01

    Laser-induced breakdown spectroscopy (LIBS) technique has been applied to investigate two different types of bacteria, Escherichia coli (B1) and Micrococcus luteus (B2) deposited on glass slides using Spectrolaser 7000. LIBS spectra were analyzed using spectrolaser software. LIBS spectrum of glass substrate was compared with bacteria spectra. Ca, Mg, Na, K, P, S, Cl, Fe, Al, Mn, Cu, C, H and CN-band appeared in bacterial samples in air. Two carbon lines at 193.02 nm, 247.88 nm and one hydrogen line at 656.28 nm with intensity ratios of 1.9, 1.83 and 1.53 appeared in bacterial samples B1 and B2 respectively. Carbon and hydrogen are the important components of the bio-samples like bacteria and other cancer cells. Investigation on LIBS spectra of the samples in He and Ar atmospheres is also presented. Ni lines appeared only in B2 sample in Ar atmosphere. From the present experimental results we are able to show that LIBS technique has a potential in the identification and discrimination of different types of bacteria.

  17. Cobalt-doped nanohydroxyapatite: synthesis, characterization, antimicrobial and hemolytic studies

    NASA Astrophysics Data System (ADS)

    Tank, Kashmira P.; Chudasama, Kiran S.; Thaker, Vrinda S.; Joshi, Mihir J.

    2013-05-01

    Hydroxyapatite (Ca10(PO4)6(OH)2; HAP) is a major mineral component of the calcified tissues, and it has various applications in medicine and dentistry. In the present investigation, cobalt-doped hydroxyapatite (Co-HAP) nanoparticles were synthesized by surfactant-mediated approach and characterized by different techniques. The EDAX was carried out to estimate the amount of doping in Co-HAP. The transmission electron microscopy result suggested the transformation of morphology from needle shaped to spherical type on increasing the doping concentration. The powder XRD study indicated the formation of a new phase of brushite for higher concentration of cobalt. The average particle size and strain were calculated using Williamson-Hall analysis. The average particle size was found to be 30-60 nm. The FTIR study confirmed the presence of various functional groups in the samples. The antimicrobial activity was evaluated against four organisms Pseudomonas aeruginosa and Shigella flexneri as Gram negative as well as Micrococcus luteus and Staphylococcus aureus as Gram positive. The hemolytic test result suggested that all samples were non-hemolytic. The photoluminescence study was carried out to identify its possible applicability as a fluorescent probe.

  18. Medical Significance of Microorganisms in Spacecraft Environment

    NASA Technical Reports Server (NTRS)

    Pierson, Duane L.; Ott, C. Mark

    2007-01-01

    Microorganisms can spoil food supplies, contaminate drinking water, release noxious volatile compounds, initiate allergic responses, contaminate the environment, and cause infectious diseases. International acceptability limits have been established for bacterial and fungal contaminants in air and on surfaces, and environmental monitoring is conducted to ensure compliance. Allowable levels of microorganism in water and food have also been established. Environmental monitoring of the space shuttle, the Mir, and the ISS have allowed for some general conclusions. Generally, the bacteria found in air and on interior surfaces are largely of human origin such as Staphylococcus spp., Micrococcus spp. Common environmental genera such as Bacillus spp. are the most commonly isolated bacteria from all spacecraft. Yeast species associated with humans such as Candida spp. are commonly found. Aspergillus spp., Penicillium spp., and Cladosporium spp. are the most commonly isolated filamentous fungi. Microbial levels in the environment differ significantly depending upon humidity levels, condensate accumulation, and availability of carbon sources. However, human "normal flora" of bacteria and fungi can result in serious, life-threatening diseases if human immunity is compromised. Disease incidence is expected to increase as mission duration increases.

  19. Prokaryotic complex of newly formed soils on nepheline-containing industrial waste

    NASA Astrophysics Data System (ADS)

    Evdokimova, G. A.; Kalmykova, V. V.

    2010-06-01

    The characteristics are given of the prokaryotic complex participating in the processes of the primary soil formation on nepheline-containing waste and depending on the time of the waste disposal and degree of reclamation. The total population density of the bacteria determined with the method of fluorescent microscopy in “pure” sand ranged within 0.34—0.60 billion CFU/g soil; in the reclaimed sand under different vegatation communities, from 2.6 to 7.2 billion CFU/g soil. Gram-positive bacteria dominate in the prokaryotic complex of the nepheline sands, whereas the Grarrmegative ones dominate in the zonal soils. The bacteria predominating in the nepheline sands were classified on the basis of the comparative analysis of the nucleotide sequences in the 16S rRNA genes within the Actinobacteria class (Arthrobacter boritolerans, A. ramosus, Rhodococcusfascians, Micrococcus luteus, and Streptomyces spp.). The evolution of the microbial community in the nepheline sands in the course of their reclamation and in the course of their overgrowing by plants proceeds in way toward the microbial communities of the zonal soils on moraine deposits.

  20. Synthesis, structural characterisation and antibacterial activity of Ag+-doped fluorapatite nanomaterials prepared by neutralization method

    NASA Astrophysics Data System (ADS)

    Stanić, Vojislav; Radosavljević-Mihajlović, Ana S.; Živković-Radovanović, Vukosava; Nastasijević, Branislav; Marinović-Cincović, Milena; Marković, Jelena P.; Budimir, Milica D.

    2015-05-01

    Silver doped fluorapatite nanopowders were synthesised by neutralization method, which consists of dissolving Ag2O in solution of HF and H3PO4 and addition to suspension of Ca(OH)2. The powder XRD, SEM and FTIR studies indicated the formation of a fluorapatite nanomaterials with average length of the particles is about 80 nm and a width of about 15 nm. The FTIR studies show that carbonate content in samples is very small and carbonte ions substitute both phosphate and hydroxyl groups in the crystal structure of samples, forming AB-type fluorapatite. Antibacterial studies have demonstrated that all Ag+-doped fluorapatite samples exhibit bactericidal effect against pathogens: Staphylococcus aureus, Micrococcus luteus and Kllebsiela pneumoniae. Antibacterial activity increased with the increase of Ag+ in the samples. The atomic force microscopy studies revealed extensive damage to the bacterial cell envelops in the presence of Ag+-doped fluorapatite particles which may lead to their death. The synthesized Ag+-doped fluorapatite nanomaterials are promising as antibacterial biomaterials in orthopedics and dentistry.

  1. Enhancement of antidandruff activity of shampoo by biosynthesized silver nanoparticles from Solanum trilobatum plant leaf

    NASA Astrophysics Data System (ADS)

    Pant, Gaurav; Nayak, Nitesh; Gyana Prasuna, R.

    2013-10-01

    The present investigation describes simple and effective method for synthesis of silver nanoparticles via green route. Solanum trilobatum Linn extract were prepared by both conventional and homogenization method. We optimized the production of silver nanoparticles under sunlight, microwave and room temperature. The best results were obtained with sunlight irradiation, exhibiting 15-20 nm silver nanoparticles having cubic and hexagonal shape. Biosynthesized nanoparticles were highly toxic to various bacterial strains tested. In this study we report antibacterial activity against various Gram negative ( Klebsiella pneumoniae, Vibrio cholerae and Salmonella typhi) and Gram positive ( Staphylococcus aureus, Bacillus cereus and Micrococcus luteus) bacterial strains. Screening was also performed for any antifungal properties of the nanoparticles against human pathogenic fungal strains ( Candida albicans and Candida parapsilosis). We also demonstrated that these nanoparticles when mixed with shampoo enhance the anti-dandruff effect against dandruff causing fungal pathogens ( Pityrosporum ovale and Pityrosporum folliculitis). The present study showed a simple, rapid and economical route to synthesize silver nanoparticles and their applications hence has a great potential in biomedical field.

  2. The affect of low-coherent light on microbial colony forming ability and morphology of some gram-positive and gram-negative bacteria

    NASA Astrophysics Data System (ADS)

    Popov, Denis E.; Tuchina, Elena S.; Chernova, Julia A.; Podshibyakin, Dmitry; Rudik, Dmitry V.; Samsonova, Maria; Gromov, Igor; Tuchin, Valery V.

    2005-06-01

    Gram-negative E. coli, gram-positive facultative anaerobe cocci Staphylococcus lugdensis, Micrococcus halobius, and Stomatococcus mucilaginosus as subjects of study were chosen. LEDs with spectrum maxima at 405 nm (without any exogenous sensitizer) and 660 nm (in conjunction with methylene blue) and power densities of 23 mW/cm2 and 5.7 mW/cm2 accordingly as continuous light sources were chosen. Photosensitized light's affect by methylene blue was studied on E. coli only. The original scheme of experiment set up was developed. It permits one to increase expositions quantity in each experiment for more certain trend's construction over dose curves and decrease parasite flora sowing. As a result of accomplished studies it was established that blue low-coherent light have unalike weak light's dose depending suppressing effect on cocci whereas red low-coherent light have a moderate dose-depended suppressing effect at low irradiation doses and a moderate dose-depended stimulating effect at high irradiation doses on sensitized by MeBlue E. coli. For all ofthis, but Staphylococcus morphology changes were observed.

  3. Heterogeneous precipitation of silver nanoparticles on kaolinite plates

    NASA Astrophysics Data System (ADS)

    Cabal, B.; Torrecillas, R.; Malpartida, F.; Moya, J. S.

    2010-11-01

    Two different methods to obtain silver nanoparticles supported on kaolin crystals have been performed: the first one followed a thermal reduction and the second one a chemical reduction. In both cases, the silver nanoparticles with two different average particles size (ca.12 and 30 nm) were perfectly isolated and attached to the surface of the kaolin plates. The silver nanoparticles were localized mainly at the edge of the single crystal plates, the hydroxyl groups being the main centres of adsorption. The samples were fully characterized by XRD, UV-vis spectroscopy and TEM. The antimicrobial benefits of the composites were evaluated as antibacterial against common Gram-positive and Gram-negative bacteria, and antifungal activity against yeast. The results indicated a high antimicrobial activity for Escherichia coli JM 110 and Micrococcus luteus, while being inactive against yeast under our experimental conditions. The chemical analysis of Ag in the fermentation broths show that only a small portion of metal (<9 ppm) is released from the kaolin/metakaolin particles. Therefore, the risk of toxicity due to a high concentration of metal in the medium is minimized.

  4. Hemocyte-mediated phagocytosis and melanization in the mosquito Armigeres subalbatus following immune challenge by bacteria.

    PubMed

    Hillyer, Julián F; Schmidt, Shelley L; Christensen, Bruce M

    2003-07-01

    Mosquitoes are important vectors of disease. These insects respond to invading organisms with strong cellular and humoral immune responses that share many similarities with vertebrate immune systems. The strength and specificity of these responses are directly correlated to a mosquito's ability to transmit disease. In the current study, we characterized the hemocytes (blood cells) of Armigeres subalbatus by morphology (ultrastructure), lectin binding, enzyme activity, immunocytochemistry, and function. We found four hemocyte types: granulocytes, oenocytoids, adipohemocytes, and thrombocytoids. Granulocytes contained acid phosphatase activity and bound the exogenous lectins Helix pomatia agglutinin, Galanthus nivalis lectin, and wheat germ agglutinin. Following bacteria inoculation, granulocytes mounted a strong phagocytic response as early as 5 min postexposure. Bacteria also elicited a hemocyte-mediated melanization response. Phenoloxidase, the rate-limiting enzyme in the melanization pathway, was present exclusively in oenocytoids and in many of the melanotic capsules enveloping bacteria. The immune responses mounted against different bacteria were not identical; gram(-) Escherichia coli were predominantly phagocytosed and gram(+) Micrococcus luteus were melanized. These studies implicate hemocytes as the primary line of defense against bacteria.

  5. Antimicrobial activity, cytotoxicity, and phytochemical screening of Voacanga globosa (Blanco) Merr. leaf extract (Apocynaceae).

    PubMed

    Vital, Pierangeli G; Rivera, Windell L

    2011-10-01

    To determine the antibacterial, antifungal, antiprotozoal, cytotoxic, and phytochemical properties of ethanol extracts of leaves of Voacanga globosa (Blanco) Merr. (V. globosa). The extracts were tested against bacteria and fungus through disc diffusion assay; against protozoa through growth curve determination, antiprotozoal and cytotoxicity assays. The extract revealed antibacterial activities, inhibiting the growth of Staphylococcus aureus, Bacillus cereus, Pseudomonas aeruginosa, Micrococcus luteus, and Salmonella typhimurium. Antifungal assay showed that it inhibited Candida albicans. The antiprotozoal assay against Trichomonas vaginalis and Entamoeba histolytica showed that V. globosa can inhibit the parasites, wherein the action can be comparable to metronidazole. With the in situ cell death detection kit, Trichomonas vaginalis and Entamoeba histolytica exposed to V. globosa leaf extract was observed to fluoresce simultaneously in red and yellow signals signifying apoptotic-like changes. Preliminary phytochemical screening revealed the chemical composition of plant extract containing alkaloids, saponins, 2-deoxysugars, and hydrolysable tannins. Thus, this study provides scientific evidence on the traditional use of V. globosa leaf extract in treating microbial diseases. Further, the leaf extract can possibly be used to produce alternative forms of antimicrobials. Copyright © 2011 Hainan Medical College. Published by Elsevier B.V. All rights reserved.

  6. Bacterial amelioration of bauxite residue waste of industrial alumina plants.

    PubMed

    Hamdy, M K; Williams, F S

    2001-10-01

    The high alkali content of bauxite residue deposits from alumina production plants in industrial nations poses a challenge to reestablish flora and fauna at the deposit sites. The present study demonstrated that low levels of injured bacterial cells in the bauxite residue actively grew using various added nutrients and/or hay. The organisms grew from less than 10 to more than 10(9) cells g(-1) bauxite residue and formed organic acids that lowered the pH from 13 to about 7.0. A total of 150 cultures was isolated from treated bauxite residue and included species of Bacillus, Lactobacillus, Leuconostoc, Micrococcus, Staphylococcus, Pseudomonas, Flavobacterium and Enterobacter. Scanning electron micrographs demonstrated that untreated particles (control) of the bauxite residue were clumped together, and in treated bauxite residue these particles were highly dispersed with microcolonial structures. Furthermore, the treated bauxite residue supported growth of several plants and earthworms that survived for over 300 days. In a test plot bioremediation on a residue deposit at Alcoa Point Comfort, TX, the Bermuda grass hay used was effective mulch material and encouraged water filtration, leading to establishment and growth of salt-tolerant vegetative species.

  7. Bacteria associated with Amblyomma cajennense tick eggs

    PubMed Central

    Machado-Ferreira, Erik; Vizzoni, Vinicius Figueiredo; Piesman, Joseph; Gazeta, Gilberto Salles; Soares, Carlos Augusto Gomes

    2015-01-01

    Abstract Ticks represent a large group of pathogen vectors that blood feed on a diversity of hosts. In the Americas, the Ixodidae ticks Amblyomma cajennense are responsible for severe impact on livestock and public health. In the present work, we present the isolation and molecular identification of a group of culturable bacteria associated with A. cajennense eggs from females sampled in distinct geographical sites in southeastern Brazil. Additional comparative analysis of the culturable bacteria from Anocentor nitens, Rhipicephalus sanguineus and Ixodes scapularis tick eggs were also performed. 16S rRNA gene sequence analyses identified 17 different bacterial types identified as Serratia marcescens, Stenotrophomonas maltophilia, Pseudomonas fluorescens, Enterobacter spp., Micrococcus luteus, Ochrobactrum anthropi, Bacillus cereus and Staphylococcus spp., distributed in 12 phylogroups. Staphylococcus spp., especially S. sciuri, was the most prevalent bacteria associated with A. cajennense eggs, occurring in 65% of the samples and also frequently observed infecting A. nitens eggs. S. maltophilia, S. marcescens and B. cereus occurred infecting eggs derived from specific sampling sites, but in all cases rising almost as pure cultures from infected A. cajennense eggs. The potential role of these bacterial associations is discussed and they possibly represent new targets for biological control strategies of ticks and tick borne diseases. PMID:26537602

  8. Hexapeptide Derivatives of Glycopeptide Antibiotics: Tools for Mechanism of Action Studies

    PubMed Central

    Allen, Norris E.; LeTourneau, Deborah L.; Hobbs, Joe N.; Thompson, Richard C.

    2002-01-01

    Hexapeptide (des-N-methylleucyl) derivatives of LY264826 were prepared in order to examine further the role of N-substituted hydrophobic side chains in defining the mechanisms of action of semisynthetic glycopeptide antibiotics. The hexapeptide of LY264826 binds to the cell wall intermediate analog l-Lys-d-Ala-d-Ala with a 100-fold lower affinity than LY264826 and inhibits Micrococcus luteus almost 200-fold more poorly than LY264826 does. Alkylation of the 4-epi-vancosamine moiety of the disaccharide significantly enhanced the antibacterial activity of the hexapeptide. Alkylation did not affect the binding affinity for d-alanyl-d-alanine residues; however, it did enhance dimerization 7,000-fold and enhanced binding to bacterial membrane vesicles noticeably compared with the levels of dimerization and binding for the unsubstituted hexapeptide. The findings from this study complement those presented in an earlier report (N. E. Allen, D. L. LeTourneau, and J. N. Hobbs, Jr., J. Antibiot. 50:677-684, 1997) and are consistent with the conclusion that the enhanced antibacterial activities of semisynthetic glycopeptide antibiotics derive from the ability of the hydrophobic side chain to markedly affect both dimerization and binding to bacterial membranes. PMID:12121903

  9. [Bacteriological quality of air in a ward for sterile pharmaceutical preparations].

    PubMed

    Caorsi P, Beatriz; Sakurada Z, Andrea; Ulloa F, M Teresa; Pezzani V, Marcela; Latorre O, Paz

    2011-02-01

    An extremely clean area is required for preparation of sterile pharmaceutical compounds, in compliance with international standards, to minimize the probability of microbial contamination. To evaluate the bacteriological quality of the air in the Sterile Pharmaceutical Preparation Unit of the University of Chile's Clinical Hospital and to set up alerts and action levels of bacterial growth. We studied eight representative sites of our Unit on a daily basis from January to February 2005 and twice a week from June 2005 to February 2006. We collected 839 samples of air by impact in the Petri dish. 474 (56.5%) samples were positive; 17 (3.5%) of them had an inappropriate bacterial growth (2% of total samples). The samples from sites 1 and 2 (big and small biosafety cabinets) were negative. The countertop and transfer area occasionally exceeded the bacterial growth limits. The most frequently isolated bacteria were coagulase-negative staphylococci, Micrococcus spp and Corynebacterium spp, from skin microbiota, and Bacillus spp, an environmental bacteria. From a microbiological perspective, the air quality in our sterile preparation unit complied with international standards. Setting institutional alerts and action levels and appropriately identifying bacteria in sensitive areas permits quantification of the microbial load and application of preventive measures.

  10. A new laboratory cultivation of Paramecium bursaria using non-pathogenic bacteria strains.

    PubMed

    Bator, Tomasz

    2010-01-01

    In most studies dealing with the laboratory cultivation of paramecia (Paramecium bursaria), Klebsiella pneumoniae bacteria are used to inoculate the medium. However, Klebsiella pneumoniae is a typical pathogen, and its use is always associated with a risk of infection. The aim of the present research was to examine non-pathogenic bacteria strains as components of the medium for Paramecium bursaria. The paramecia were incubated on lettuce infusions bacterized with different bacteria strains: Bacillus subtilis DSM 10, Bacillus megaterium DSM 32, Escherichia coli DSM 498, Micrococcus luteus DSM 348. A strain derived from the natural habitat of Paramecium bursaria was used as the control one. Experiments were conducted under constant light and in the dark. Paramecia cells were counted under a stereomicroscope on consecutive days of incubation. The obtained results show that the most intensive growth of Paramecium bursaria occurs in the presence of Escherichia coli DSM 498. The use of this strain as a component of the medium allows one to obtain a high number of ciliates regardless of the light conditions. It can be concluded that the Paramecium bursaria cultivation procedure can be modified by using the non-pathogenic bacteria strain Escherichia coli DSM 498 instead of Klebsiella pneumoniae.

  11. Antimicrobial and free radical scavenging activities of five Palestinian medicinal plants.

    PubMed

    Qabaha, Khaled Ibraheem

    2013-01-01

    Extracts from five indigenous Palestinian medicinal plants including Rosmarinus officinalis, Pisidium guajava, Punica granatum peel, grape seeds and Teucrium polium were investigated for antimicrobial and free radical scavenging activities against eight microorganisms, using well diffusion method. The microorganisms included six bacterial isolates (i.e. Staphylococcus aureus, Escherichia coli, Pseudomonas aeruginos, Klebsiella pneumonia, Bacillus subtilis and Micrococcus luteus) and two fungal isolates (i.e. Candida albicans and Aspergillus niger). A standard antioxidant assay was performed on the plant extracts to assess their capability in scavenging 2,2-diphenyl-1-picrylhydrazyl (DPPH). Of the five tested plant extract, only Rosmarinus offcinalis extract contained significant antimicrobial activity against all eight microbial isolates including Pseudomonas aeruginosa. Extracts from other four plants exhibited a variable antimicrobial activity against all microorganisms, except Pseudomonas aeruginosa. Significant antioxidant activity was detected in all plant extracts. However, extracts from Pisidium guajava leaves contained significantly higher antioxidant activity compared to the other extracts tested. The antimicrobial and scavenging activities detected in this in vitro study in extracts from the five Palestinian medicinal plants suggest that further study is needed to identify active compounds to target diseases caused by a wide-spectrum pathogens.

  12. Protein encapsulation and release from PEO-b-polyphosphoester templated calcium carbonate particles.

    PubMed

    Ergul Yilmaz, Zeynep; Cordonnier, Thomas; Debuigne, Antoine; Calvignac, Brice; Jerome, Christine; Boury, Frank

    2016-11-20

    Calcium carbonate particles are promising candidates as proteins carriers for their controlled delivery in the body. The present paper aims at investigating the protein encapsulation by in situ precipitation of calcium carbonate particles prepared by a process based on supercritical CO 2 and using a new type of degradable well-defined double hydrophilic block copolymers composed of poly(ethylene oxide) and polyphosphoester blocks acting as templating agent for the calcium carbonate. For this study, lysozyme was chosen as a model for therapeutic protein for its availability and ease of detection. It was found that by this green process, loading into the CaCO 3 microparticles with a diameter about 2μm can be obtained as determined by scanning electron microscopy. A protein loading up to 6.5% active lysozyme was measured by a specific bioassay (Micrococcus lysodeikticus). By encapsulating fluorescent-labelled lysozyme (lysozyme-FITC), the confocal microscopy images confirmed its encapsulation and suggested a core-shell distribution of lysozyme into CaCO 3 , leading to a release profile reaching a steady state at 59% of release after 90min. Copyright © 2016. Published by Elsevier B.V.

  13. Species diversity and molecular analysis of Staphylococcus in confectioneries of a developing country, Iran.

    PubMed

    Hoveida, Laleh; Ataei, Behrooz; Amirmozafari, Nour; Noormohammadi, Zahra

    2018-06-01

    Confectionery is one of the potential sources of contamination and transmission of gastrointestinal infections to humans. Staphylococcus species, and particularly the coagulase-positive ones, have the remarkable capability to produce high amounts of enterotoxin in food. In the present study, the frequency and diversity of Staphylococcus in confectioneries in Iran were assessed by using a combination of conventional and molecular methods. A total of 55 confection samples were collected from 30 confectioneries of Isfahan. They were analyzed for the presence of Staphylococcus using standard protocols for isolation and characterization of the isolates. The conventional tests were used for primary identification and the sequence analysis of 16S rRNA was used for the species identification. A total of 47 out of 55 samples were gram-positive cocci (85.45%). They belonged to 39 Staphylococcus spp., 7 Macrococcus spp., and one Micrococcus spp. The most prevalent 11 various Staphylococcus species were S. aureus 30.8 %, S. warneri 20.5% and S. succinus 17.9. Identification and characterization of Staphylococcus species can be important for epidemiological investigations and assessment of virulence factors such as enterotoxin production and development of specific management practices to prevent staphylococcal food poisoning.

  14. Endophytic bacterial flora in root and stem tissues of black pepper (Piper nigrum L.) genotype: isolation, identification and evaluation against Phytophthora capsici.

    PubMed

    Aravind, R; Kumar, A; Eapen, S J; Ramana, K V

    2009-01-01

    To isolate and identify black pepper (Piper nigrum L) associated endophytic bacteria antagonistic to Phytophthora capsici causing foot rot disease. Endophytic bacteria (74) were isolated, characterized and evaluated against P. capsici. Six genera belong to Pseudomonas spp (20 strains), Serratia (1 strain), Bacillus spp. (22 strains), Arthrobacter spp. (15 strains), Micrococcus spp. (7 strains), Curtobacterium sp. (1 strain) and eight unidentified strains were isolated from internal tissues of root and stem. Three isolates, IISRBP 35, IISRBP 25 and IISRBP 17 were found effective for Phytophthora suppression in multilevel screening assays which recorded over 70% disease suppression in greenhouse trials. A species closest match (99% similarity) of IISRBP 35 was established as Pseudomonas aeruginosa (Pseudomonas EF568931), IISRBP 25 as P. putida (Pseudomonas EF568932), and IISRBP 17 as Bacillus megaterium (B. megaterium EU071712) based on 16S rDNA sequencing. Black pepper associated P. aeruginosa, P. putida and B. megaterium were identified as effective antagonistic endophytes for biological control of Phytophthora foot rot in black pepper. This work provides the first evidence for endophytic bacterial diversity in black pepper stem and roots, with biocontrol potential against P. capsici infection.

  15. Pathogenic bacteria carried by companion animals and their susceptibility to antibacterial agents.

    PubMed

    Buma, Ryoko; Maeda, Takuya; Kamei, Masaharu; Kourai, Hiroki

    2006-03-01

    Results of the investigation showed that there was a difference in the bacteria isolated from dogs, cats and their living environment. The number and species isolated from the hair and front paw samples from dogs kept outdoors and from cats were greater and more varied than those from the samples from dogs kept indoors. Staphylococcus, Micrococcus and Bacillus were frequently detected from skin surfaces. On the other hand, Escherichia, Pseudomonas, Proteus and others were detected on each sampling area on dogs kept outdoors and on cats. About 60% of the bacteria commonly causes infectious diseases and carries a risk of food poisoning. Moreover, Pasteurella multocida, which causes pasteurellasis, a kind of zoonosis, was isolated from dogs and cats. These pathogenic bacteria were transmitted from animals to humans by direct contact. This result suggests that direct contact with dogs and cats and contact with aerosols can possibly transmit infectious diseases. Most of the isolates (75.9%, 60/79) were resistant to antibacterial agents. We then investigated the effect of household detergents and pet care deodorant sprays containing antibacterial agents on isolates from dogs and cats. They were effective in preventing the transmission of pathogens from dogs and cats to humans.

  16. N-O chemistry for antibiotics: discovery of N-alkyl-N-(pyridin-2-yl)hydroxylamine scaffolds as selective antibacterial agents using nitroso Diels-Alder and ene chemistry.

    PubMed

    Wencewicz, Timothy A; Yang, Baiyuan; Rudloff, James R; Oliver, Allen G; Miller, Marvin J

    2011-10-13

    The discovery, syntheses, and structure-activity relationships (SAR) of a new family of heterocyclic antibacterial compounds based on N-alkyl-N-(pyridin-2-yl)hydroxylamine scaffolds are described. A structurally diverse library of ∼100 heterocyclic molecules generated from Lewis acid-mediated nucleophilic ring-opening reactions with nitroso Diels-Alder cycloadducts and nitroso ene reactions with substituted alkenes was evaluated in whole cell antibacterial assays. Compounds containing the N-alkyl-N-(pyridin-2-yl)hydroxylamine structure demonstrated selective and potent antibacterial activity against the Gram-positive bacterium Micrococcus luteus ATCC 10240 (MIC(90) = 2.0 μM or 0.41 μg/mL) and moderate activity against other Gram-positive strains including antibiotic resistant strains of Staphylococcus aureus (MRSA) and Enterococcus faecalis (VRE). A new synthetic route to the active core was developed using palladium-catalyzed Buchwald-Hartwig amination reactions of N-alkyl-O-(4-methoxybenzyl)hydroxylamines with 2-halo-pyridines that facilitated SAR studies and revealed the simplest active structural fragment. This work shows the value of using a combination of diversity-oriented synthesis (DOS) and parallel synthesis for identifying new antibacterial scaffolds.

  17. N-O Chemistry for Antibiotics: Discovery of N-Alkyl-N-(pyridin-2-yl)hydroxylamine Scaffolds as Selective Antibacterial Agents Using Nitroso Diels-Alder and Ene Chemistry

    PubMed Central

    Wencewicz, Timothy A.; Yang, Baiyuan; Rudloff, James R.; Oliver, Allen G.; Miller, Marvin J.

    2011-01-01

    The discovery, syntheses, and structure-activity relationships (SAR) of a new family of heterocyclic antibacterial compounds based on N-alkyl-N-(pyridin-2-yl)hydroxylamine scaffolds are described. A structurally diverse library of ~100 heterocyclic molecules generated from Lewis acid-mediated nucleophilic ring opening reactions with nitroso Diels-Alder cycloadducts and nitroso ene reactions with substituted alkenes was evaluated in whole cell antibacterial assays. Compounds containing the N-alkyl-N-(pyridin-2-yl)hydroxylamine structure demonstrated selective and potent antibacterial activity against the Gram-positive bacterium Micrococcus luteus ATCC 10240 (MIC90 = 2.0 μM or 0.41 μg/mL) and moderate activity against other Gram-positive strains including antibiotic resistant strains of Staphylococcus aureus (MRSA) and Enterococcus faecalis (VRE). A new synthetic route to the active core was developed using palladium-catalyzed Buchwald-Hartwig amination reactions of N-alkyl-O-(4-methoxybenzyl)hydroxylamines with 2-halo-pyridines that facilitated SAR studies and revealed the simplest active structural fragment. This work shows the value of using a combination of diversity-oriented synthesis (DOS) and parallel synthesis for identifying new antibacterial scaffolds. PMID:21859126

  18. Assessment of microbiological indoor air quality in an Italian office building equipped with an HVAC system.

    PubMed

    Bonetta, Sa; Bonetta, Si; Mosso, S; Sampò, S; Carraro, E

    2010-02-01

    The purpose of this study was to evaluate the level and composition of bacteria and fungi in the indoor air of an Italian office building equipped with a heating, ventilation and air conditioning (HVAC) system. Airborne bacteria and fungi were collected in three open-space offices during different seasons. The microbial levels in the outdoor air, supply air diffusers, fan coil air flow and air treatment unit humidification water tank were used to evaluate the influence of the HVAC system on indoor air quality (IAQ). A medium-low level of bacterial contamination (50-500 CFU/m(3)) was found in indoor air. Staphylococcus and Micrococcus were the most commonly found genera, probably due to human presence. A high fungal concentration was measured due to a flood that occurred during the winter. The indoor seasonal distribution of fungal genera was related to the fungal outdoor distribution. Significant seasonal and daily variation in airborne microorganisms was found, underlining a relationship with the frequency of HVAC system switching on/off. The results of this monitoring highlight the role of the HVAC system on IAQ and could be useful to better characterise bacterial and fungal population in the indoor air of office buildings.

  19. Bacteriological assessment of stethoscopes used by healthcare workers in a tertiary care centre of Nepal.

    PubMed

    Thapa, Sangita; Sapkota, Lokendra Bahadur

    2017-07-28

    Stethoscope is a medical device universally used by health care workers. Stethoscope may transmit pathogens among patients and health care workers if it is not disinfected. The objective of this study was to, determine the level of stethoscope contamination used by health care workers, survey the practices of disinfecting the stethoscope, identify various microorganisms and assess their role as potential pathogens and determine the effectiveness of 70% ethanol as a disinfecting agent. This was a cross-sectional study conducted in the department of Microbiology, Chitwan Medical College, Bharatpur, Nepal. Stethoscopes of 122 health care workers from different departments were included in this study. Out of a total 122 diaphragms, 88 (72.1%) were colonized. Only 71 (58.1%) bells and 152 earpieces (66.2%) were contaminated. Micrococcus and coagulase negative staphylococci were predominantly isolated species. The contamination was lowest among stethoscopes cleaned after touching every patient (11.5%) and the difference is statistically significant (P < 0.0001). Significantly lower level of contamination (13.6%) were found on stethoscopes cleaned everyday (P < 0.0001). Only 8.5% stethoscope showed growth with decreased number of colonies after disinfecting the stethoscopes with 70% ethanol. Thus, demonstrating the effectiveness of disinfection.

  20. Isolation and characterization of onion degrading bacteria from onion waste produced in South Buenos Aires province, Argentina.

    PubMed

    Rinland, María Emilia; Gómez, Marisa Anahí

    2015-03-01

    Onion production in Argentina generates a significant amount of waste. Finding an effective method to recycle it is a matter of environmental concern. Among organic waste reuse techniques, anaerobic digestion could be a valuable alternative to current practices. Substrate inoculation with appropriate bacterial strains enhances the rate-limiting step (hydrolysis) of anaerobic digestion of biomass wastes. Selection of indigenous bacteria with the ability to degrade onion waste could be a good approach to find a suitable bioaugmentation or pretreatment agent. We isolated bacterial strains from onion waste in different degradation stages and from different localities. In order to characterize and select the best candidates, we analyzed the growth patterns of the isolates in a medium prepared with onion juice as the main source of nutrients and we evaluated carbon source utilization. Nine strains were selected to test their ability to grow using onion tissue and the five most remarkable ones were identified by 16S rRNA gene sequencing. Strains belonged to the genera Pseudoxanthomonas, Bacillus, Micrococcus and Pseudomonas. Two strains, Bacillus subtilis subsp. subtillis MB2-62 and Pseudomonas poae VE-74 have characteristics that make them promising candidates for bioaugmentation or pretreatment purposes.

  1. Cloning and heterologous expression of plnE, -F, -J and -K genes derived from soil metagenome and purification of active plantaricin peptides.

    PubMed

    Pal, Gargi; Srivastava, Sheela

    2014-02-01

    Plantaricin gene-specific primers were used to obtain plnE, -F, -J and -K structural gene amplicons from soil metagenome. These amplicons were cloned and expressed in pET32a (+) vector in Escherichia coli BL21 (DE3). PlnE, -F, -J and -K peptides were expressed as His-tagged-fusion proteins and were separated by Ni(2+) -chelating affinity chromatography. The peptides were released from the fusion by enterokinase cleavage and separated from the carrier thioredoxin. The cleaved peptides were further analysed for antimicrobial activity and found to be active against Listeria innocua NRRL B33314, Micrococcus luteus MTCC 106 and lactic acid bacteria, such as Enterococcus casseliflavus NRRL B3502, Lactococcus lactis lactis NRRL 1821, Lactobacillus curvatus NRRL B4562 and Lactobacillus plantarum NRRL B4496. E. coli has been successfully exploited as a host for heterologous expression with a significant yield of fused and cleaved peptides in the range of 8-12 and 1-1.5 mg/l of the culture, respectively. Heterologous expression, therefore, can be used to overcome the constraints of low yield often reported from a native strain.

  2. Responses of Mytilus galloprovincialis to bacterial challenges by metabolomics and proteomics.

    PubMed

    Ji, Chenglong; Wu, Huifeng; Wei, Lei; Zhao, Jianmin; Wang, Qing; Lu, Hongjian

    2013-08-01

    Pathogens can cause diseases and lead to massive mortalities of aquaculture animals and substantial economic loss. In this work, we studied the responses induced by Micrococcus luteus and Vibrio anguillarum in gill of mussel Mytilus galloprovincialis at protein and metabolite levels. Metabolic biomarkers (e.g., amino acids, betaine, ATP) suggested that both M. luteus and V. anguillarum induced disturbances in energy metabolism and osmotic regulation. The unique and some more remarkably altered metabolic biomarkers (threonine, alanine, aspartate, taurine, succinate) demonstrated that V. anguillarum could cause more severe disturbances in osmotic regulation and energy metabolism. Proteomic biomarkers (e.g., goose-type lysozyme 2, matrilin, ependymin-related protein, peptidyl-prolyl cis-trans isomerases) indicated that M. luteus caused immune stress, and disturbances in signaling pathways and protein synthesis. However, V. anguillarum mainly induced oxidative stress and disturbance in energy metabolism in mussel gills indicated by altered procollagen-proline dioxygenase, protein disulfide isomerase, nucleoside diphosphate kinases, electron transfer flavoprotein and glutathione S-transferase. This work confirmed that an integration of proteomics and metabolomics could provide an insightful view into the effects of pathogens to the marine mussel M. galloprovincialis. Copyright © 2013 Elsevier Ltd. All rights reserved.

  3. Diversity of pigmented Gram-positive bacteria associated with marine macroalgae from Antarctica.

    PubMed

    Leiva, Sergio; Alvarado, Pamela; Huang, Ying; Wang, Jian; Garrido, Ignacio

    2015-12-01

    Little is known about the diversity and roles of Gram-positive and pigmented bacteria in Antarctic environments, especially those associated with marine macroorganisms. This work is the first study about the diversity and antimicrobial activity of culturable pigmented Gram-positive bacteria associated with marine Antarctic macroalgae. A total of 31 pigmented Gram-positive strains were isolated from the surface of six species of macroalgae collected in the King George Island, South Shetland Islands. On the basis of 16S rRNA gene sequence similarities ≥99%, 18 phylotypes were defined, which were clustered into 11 genera of Actinobacteria (Agrococcus, Arthrobacter, Brachybacterium, Citricoccus, Kocuria, Labedella, Microbacterium, Micrococcus, Rhodococcus, Salinibacterium and Sanguibacter) and one genus of the Firmicutes (Staphylococcus). It was found that five isolates displayed antimicrobial activity against a set of macroalgae-associated bacteria. The active isolates were phylogenetically related to Agrococcus baldri, Brachybacterium rhamnosum, Citricoccus zhacaiensis and Kocuria palustris. The results indicate that a diverse community of pigmented Gram-positive bacteria is associated with Antartic macroalgae and suggest its potential as a promising source of antimicrobial and pigmented natural compounds. © FEMS 2015. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  4. [Diversity and antimicrobial activities of cultivable bacteria isolated from Jiaozhou Bay].

    PubMed

    Wang, Yiting; Zhang, Chuanbo; Qi, Lin; Jia, Xiaoqiang; Lu, Wenyu

    2016-12-04

    Marine microorganisms have a great potential in producing biologically active secondary metabolites. In order to study the diversity and antimicrobial activity, we explored 9 sediment samples in different observation sites of Jiaozhou bay. We used YPD and Z2216E culture medium to isolate bacteria from the sediments; 16S rRNA was sequenced for classification and identification of the isolates. Then, we used Oxford cup method to detect antimicrobial activities of the isolated bacteria against 7 test strains. Lastly, we selected 16 representatives to detect secondary-metabolite biosynthesis genes:PKSI, NRPS, CYP, PhzE, dTGD by PCR specific amplification. A total of 76 bacterial strains were isolated from Jiaozhou bay; according to the 16S rRNA gene sequence analysis. These strains could be sorted into 11 genera belonging to 8 different families:Aneurinibacillus, Brevibacillus, Microbacterium, Oceanisphae, Bacillus, Marinomonas, Staphylococcus, Kocuria, Arthrobacters, Micrococcus and Pseudoalteromonas. Of them 34 strains showed antimicrobial activity against at least one of the tested strains. All 16 strains had at least one function genes, 5 strains possessed more than three function genes. Jiaozhou bay area is rich in microbial resources with potential in providing useful secondary metabolites.

  5. Antimicrobial Activities of Bacteria Associated with the Brown Alga Padina pavonica

    PubMed Central

    Ismail, Amel; Ktari, Leila; Ahmed, Mehboob; Bolhuis, Henk; Boudabbous, Abdellatif; Stal, Lucas J.; Cretoiu, Mariana Silvia; El Bour, Monia

    2016-01-01

    Macroalgae belonging to the genus Padina are known to produce antibacterial compounds that may inhibit growth of human- and animal pathogens. Hitherto, it was unclear whether this antibacterial activity is produced by the macroalga itself or by secondary metabolite producing epiphytic bacteria. Here we report antibacterial activities of epiphytic bacteria isolated from Padina pavonica (Peacocks tail) located on northern coast of Tunisia. Eighteen isolates were obtained in pure culture and tested for antimicrobial activities. Based on the 16S rRNA gene sequences the isolates were closely related to Proteobacteria (12 isolates; 2 Alpha- and 10 Gammaproteobacteria), Firmicutes (4 isolates) and Actinobacteria (2 isolates). The antimicrobial activity was assessed as inhibition of growth of 12 species of pathogenic bacteria (Aeromonas salmonicida, A. hydrophila, Enterobacter xiangfangensis, Enterococcus faecium, Escherichia coli, Micrococcus sp., Salmonella typhimurium, Staphylococcus aureus, Streptococcus sp., Vibrio alginoliticus, V. proteolyticus, V. vulnificus) and one pathogenic yeast (Candida albicans). Among the Firmicutes, isolate P8, which is closely related to Bacillus pumilus, displayed the largest spectrum of growth inhibition of the pathogenic bacteria tested. The results emphasize the potential use of P. pavonica associated antagonistic bacteria as producers of novel antibacterial compounds. PMID:27462308

  6. Two-stage phyto-microremediation of tannery effluent by Spirodela polyrrhiza (L.) Schleid. and chromium resistant bacteria.

    PubMed

    Singh, Asha; Vyas, Dhiraj; Malaviya, Piyush

    2016-09-01

    Two-stage sequential treatment of tannery effluent was conducted employing a wetland plant, Spirodela polyrrhiza (L.) Schleid., and chromium (Cr) resistant bacterial strains. The bacterial strains were isolated from Cr-enriched environmental matrices and rhizosphere of Spirodela polyrrhiza. The phyto-rhizoremediation of tannery effluent by Spirodela and its rhizospheric bacteria (Cellulomonas biazotea APBR1-6, Bacillus safensis APBR2-12, Staphylococcus warneri APBR3-5, Microbacterium oleivorans APBR2-6), followed by microremediation by Cr resistant bacteria (Micrococcus luteus APBS5-1, Bacillus pumilus APBS5-2, Bacillus flexus APBE3-1, Virgibacillus sediminis APBS6-1) resulted in reduction of pollution parameters [COD (81.2%), total Cr (97.3%), Cr(VI) (99.3%), Pb(II) (97.0%), Ni (95.7%)]. The LC-MS analysis showed that many pollutants detected in untreated tannery effluent were diminished after bioremediation or long chains of alcohol polyethoxylates viz. C18EO6 in untreated effluent were broken down into smaller unit of alcohol polyethoxylate ((+)HHO[CH2CH2O]H), indicating that bacteria and Spirodela polyrrhiza, alongwith its rhizospheric associates utilized them as carbon and energy source. Copyright © 2016 Elsevier Ltd. All rights reserved.

  7. Antibacterial and antioxidant cassane diterpenoids from Caesalpinia benthamiana.

    PubMed

    Dickson, Rita A; Houghton, Peter J; Hylands, Peter J

    2007-05-01

    Bioactivity-guided fractionation of the light petroleum extract of Caesalpinia benthamiana (=Mezoneuron benthamianum) root bark has led to the isolation of two cassane diterpenoids, designated as benthaminin 1 and 2. A third compound, a deoxy form of caesaldekarin C (also referred to as methyl vouacapenate) which has previously been isolated from Caesalpinia major, C. bonducella, Vouacapoua americana and V. macropetala, was also isolated, together with beta-sitosterol and stigmastenone. The antibacterial and antioxidant activities of these cassane diterpenoids have been assessed using the microdilution assay method and DPPH spectrophotometric and TBA lipid peroxidation assays. Benthaminin 1 was the more active antibacterial compound with MIC values of 47.8 microM for both Staphylococcus aureus and Micrococcus flavus. Benthaminin 2 was the more active antioxidant compound and showed IC50 values of 42.7 microM and 74.2 microM for the DPPH and TBA assays, respectively. Deoxycaesaldekarin C possessed both antibacterial and antioxidant activities. The presence of methyl ester and methyl functional groups as well as an unsaturated furan ring appears to confer antibacterial activity. On the other hand, the relatively stronger antioxidant activity of benthaminin 2 may be associated with the presence of an exocyclic methylene function.

  8. Antibacterial activity of antibacterial cutting boards in household kitchens.

    PubMed

    Kounosu, Masayuki; Kaneko, Seiichi

    2007-12-01

    We examined antibacterial cutting boards with antibacterial activity values of either "2" or "4" in compliance with the JIS Z 2801 standard, and compared their findings with those of cutting boards with no antibacterial activity. These cutting boards were used in ten different households, and we measured changes in the viable cell counts of several types of bacteria with the drop plate method. We also identified the detected bacterial flora and measured the minimum antimicrobial concentrations of several commonly used antibacterial agents against the kinds of bacteria identified to determine the expected antibacterial activity of the respective agents. Cutting boards with activity values of both "2" and "4" proved to be antibacterial in actual use, although no correlation between the viable cell counts and the antibacterial activity values was observed. In the kitchen environment, large quantities of Pseudomonas, Flavobacterium, Micrococcus, and Bacillus were detected, and it was confirmed that common antibacterial agents used in many antibacterial products are effective against these bacterial species. In addition, we measured the minimum antimicrobial concentrations of the agents against lactobacillus, a typical good bacterium, and discovered that this bacterium is less sensitive to these antibacterial agents compared to more common bacteria.

  9. Antioxidant and Antimicrobial Properties of the Essential Oil and Extracts of Zanthoxylum alatum Grown in North-Western Himalaya

    PubMed Central

    Tiku, A. K.; Koul, Apurva; Gupta, Sahil; Singh, Gurjinder; Razdan, V. K.

    2013-01-01

    The essential oil obtained from the fresh leaves of Zanthoxylum alatum was analysed by gas chromatography/mass spectrometry (GC/MS). Fourteen components were identified, and linalool (30.58%), 2-decanone (20.85%), β-fenchol (9.43%), 2-tridecanone (8.86%), β-phellandrene (5.99%), Sabinene (4.82%), and α-pinene (4.11%) were the main components. The EO and methanolic extract of Z. alatum exhibited potent antifungal activity against Alternaria alternata, Alternaria brassicae, and Curvularia lunata. The EO also showed significant antibacterial activity against Bacillus subtilis, Micrococcus luteus, Staphylococcus aureus, and Escherichia coli. Further, antimicrobial constituents of the EO were isolated by bioautography and preparative thin layer chromatography (PTLC) and identified as β-fenchol and linalool using GC/MS analysis. In addition to this, the free radical scavenging activity and antioxidant potential of EO and methanolic extract/fractions of Z. alatum were also investigated using in vitro assays including scavenging ability against DPPH•, reducing power and chelating ability on Fe2+ ions. Our results demonstrate that Z. alatum could be used as a resource of antioxidant and antimicrobial compounds which may find applications in food and pesticide industries. PMID:23781160

  10. Isolation of DNA methyltransferase from plants

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ehrlich, K.; Malbroue, C.

    1987-05-01

    DNA methyltransferases (DMT) were isolated from nuclei of cauliflower, soybean, and pea by extraction with 0.35 M NaCl. Assays were performed on hemimethylated Micrococcus luteus DNA or on M. luteus DNA to test for maintenance or de novo methylase activity, respectively. Fully methylated DNA was used as a substrate to determine background levels of methylation. Based on these tests, yields of maintenance DMT activity in the crude extract from pea hypocotyl, soybean hypocotyl, and cauliflower inflorescence were 2.8, 0.9, and 1.6 units per g wet tissue (one unit equals 1 pmol of methyl from (/sup 3/H)AdoMet incorporated into acid precipitablemore » material per h at 30/sup 0/). Two peaks of DMT activity were detected in the soybean nuclear extract following phosphocellulose chromatography. One eluted at 0.4 M and the other at 0.8 M KCl. With both fractions maintenance activity was approximately 2 times that of the de novo activity. Using gel filtration the DMT eluted at 220,000 Daltons. The optimal pH for activity was between 6.5 and 7.0, and the optimal temperature was 30/sup 0/.« less

  11. Aspects of the antimicrobial efficacy of grapefruit seed extract and its relation to preservative substances contained.

    PubMed

    von Woedtke, T; Schlüter, B; Pflegel, P; Lindequist, U; Jülich, W D

    1999-06-01

    The antimicrobial efficacy as well as the content of preservative agents of six commercially available grapefruit seed extracts were examined. Five of the six extracts showed a high growth inhibiting activity against the test germs Bacillus subtilis SBUG 14, Micrococcus flavus SBUG 16, Staphylococcus aureus SBUG 11, Serratia marcescens SBUG 9, Escherichia coli SBUG 17, Proteus mirabilis SBUG 47, and Candida maltosa SBUG 700. In all of the antimicrobial active grapefruit seed extracts, the preservative benzethonium chloride was detected by thin layer chromatography. Additionally, three extracts contained the preserving substances triclosan and methyl parabene. In only one of the grapefruit seed extracts tested no preservative agent was found. However, with this extract as well as with several self-made extracts from seed and juiceless pulp of grapefruits (Citrus paradisi) no antimicrobial activity could be detected (standard serial broth dilution assay, agar diffusion test). Thus, it is concluded that the potent as well as nearly universal antimicrobial activity being attributed to grapefruit seed extract is merely due to the synthetic preservative agents contained within. Natural products with antimicrobial activity do not appear to be present.

  12. Air quality monitoring of the post-operative recovery room and locations surrounding operating theaters in a medical center in Taiwan.

    PubMed

    Tang, Chin-Sheng; Wan, Gwo-Hwa

    2013-01-01

    To prevent surgical site infection (SSI), the airborne microbial concentration in operating theaters must be reduced. The air quality in operating theaters and nearby areas is also important to healthcare workers. Therefore, this study assessed air quality in the post-operative recovery room, locations surrounding the operating theater area, and operating theaters in a medical center. Temperature, relative humidity (RH), and carbon dioxide (CO2), suspended particulate matter (PM), and bacterial concentrations were monitored weekly over one year. Measurement results reveal clear differences in air quality in different operating theater areas. The post-operative recovery room had significantly higher CO2 and bacterial concentrations than other locations. Bacillus spp., Micrococcus spp., and Staphylococcus spp. bacteria often existed in the operating theater area. Furthermore, Acinetobacter spp. was the main pathogen in the post-operative recovery room (18%) and traumatic surgery room (8%). The mixed effect models reveal a strong correlation between number of people in a space and high CO2 concentration after adjusting for sampling locations. In conclusion, air quality in the post-operative recovery room and operating theaters warrants attention, and merits long-term surveillance to protect both surgical patients and healthcare workers.

  13. Utilization of Industrial Waste for the Production of Bio-Preservative from Bacillus licheniformis Me1 and Its Application in Milk and Milk-Based Food Products.

    PubMed

    Nithya, Vadakedath; Prakash, Maya; Halami, Prakash M

    2018-06-01

    The bio-preservative efficacy of a partially purified antibacterial peptide (ppABP) produced by Bacillus licheniformis Me1 in an economical medium developed using agro-industry waste was evaluated by direct application in milk and milk-based food products. The addition of ppABP in milk samples stored at 4 ± 2 °C and 28 ± 2 °C resulted in the growth inhibition of pathogens Listeria monocytogenes Scott A, Micrococcus luteus ATCC 9341, and Staphylococcus aureus FRI 722. The shelf life of milk samples with added ppABP increased to 4 days at 28 ± 2 °C, whereas curdling and off-odor were noticed in samples without ppABP. Furthermore, the milk samples with ppABP were sensorily acceptable. Antilisterial effect was also observed in cheese and paneer samples treated with ppABP. These results clearly indicate that the ppABP of B. licheniformis Me1 can be utilized as a bio-preservative to control the growth of spoilage and pathogenic bacteria, thereby reducing the risk of food-borne diseases.

  14. Microbial degradation of [C14C]polystyrene and 1,3-diphenylbutane.

    PubMed

    Sielicki, M; Focht, D D; Martin, J P

    1978-07-01

    Microbial degradation of [beta-14C]polystyrene and 1,3-diphenylbutane, a compound structurally representing the smallest repeating unit of styrene (dimer), was investigated in soil and liquid enrichment cultures. Degradation rates in soil, as determined by 14CO2 evolution from applied [14C]polystyrene, varied from 1.5 to 3.0% for a 4-month period. Although relatively low, these percentages were 15 to 30 times greater than values previously reported. Enrichment cultures, containing 1,3-diphenylbutane as the only carbon souce, were used to determine the mechanisms of microbial oxidation of the polymer chain ends. Metabolism of 1,3-diphenylbutane appeared to involve the attack by a monooxygenease to form 2-phenyl-4-hydroxyphenylbutane followed by a further oxidation and subsequent fission of the benzene ring to yield 4-phenylvaleric acid and an unidentified 5-carbon fragment via the classic meta-fission pathway. Phenylacetic acid was probably formed from 4-phenylvaleric acid by subsequent beta-oxidation of the side chain, methyl-oxidation and decarboxylation. An initial examination of the population of microorganisms in the diphenylbutane enrichment cultures indicated that these oxidative reactions are carried out by common soil microorganism of the genera Bacillus, Pseudomonas, Micrococcus, and Nocardia.

  15. Phylogenetic diversity of actinobacteria associated with soft coral Alcyonium gracllimum and stony coral Tubastraea coccinea in the East China Sea.

    PubMed

    Yang, Shan; Sun, Wei; Tang, Cen; Jin, Liling; Zhang, Fengli; Li, Zhiyong

    2013-07-01

    Actinobacteria are widely distributed in the marine environment. To date, few studies have been performed to explore the coral-associated Actinobacteria, and little is known about the diversity of coral-associated Actinobacteria. In this study, the actinobacterial diversity associated with one soft coral Alcyonium gracllimum and one stony coral Tubastraea coccinea collected from the East China Sea was investigated using both culture-independent and culture-dependent approaches. A total of 19 actinobacterial genera were detected in these two corals, among which nine genera (Corynebacterium, Dietzia, Gordonia, Kocuria, Microbacterium, Micrococcus, Mycobacterium, Streptomyces, and Candidatus Microthrix) were common, three genera (Cellulomonas, Dermatophilus, and Janibacter) were unique to the soft coral, and seven genera (Brevibacterium, Dermacoccus, Leucobacter, Micromonospora, Nocardioides, Rhodococcus, and Serinicoccus) were unique to the stony coral. This finding suggested that highly diverse Actinobacteria were associated with different types of corals. In particular, five actinobacterial genera (Cellulomonas, Dermacoccus, Gordonia, Serinicoccus, and Candidatus Microthrix) were recovered from corals for the first time, extending the known diversity of coral-associated Actinobacteria. This study shows that soft and stony corals host diverse Actinobacteria and can serve as a new source of marine actinomycetes.

  16. Diversity, ecological distribution and biotechnological potential of Actinobacteria inhabiting seamounts and non-seamounts in the Tyrrhenian Sea.

    PubMed

    Ettoumi, Besma; Chouchane, Habib; Guesmi, Amel; Mahjoubi, Mouna; Brusetti, Lorenzo; Neifar, Mohamed; Borin, Sara; Daffonchio, Daniele; Cherif, Ameur

    2016-01-01

    In the present study, the ecological distribution of marine Actinobacteria isolated from seamount and non-seamount stations in the Tyrrhenian Sea was investigated. A collection of 110 isolates was analyzed by Automated Ribosomal Intergenic Spacer Analysis (ARISA) and 16S rRNA gene sequencing of representatives for each ARISA haplotype (n=49). Phylogenetic analysis of 16S rRNA sequences showed a wide diversity of marine isolates and clustered the strains into 11 different genera, Janibacter, Rhodococcus, Arthrobacter, Kocuria, Dietzia, Curtobacterium, Micrococcus, Citricoccus, Brevibacterium, Brachybacterium and Nocardioides. Interestingly, Janibacter limosus was the most encountered species particularly in seamounts stations, suggesting that it represents an endemic species of this particular ecosystem. The application of BOX-PCR fingerprinting on J. limosus sub-collection (n=22), allowed their separation into seven distinct BOX-genotypes suggesting a high intraspecific microdiversity among the collection. Furthermore, by screening the biotechnological potential of selected actinobacterial strains, J. limosus was shown to exhibit the most important biosurfactant activity. Our overall data indicates that Janibacter is a major and active component of seamounts in the Tyrrhenian Sea adapted to low nutrient ecological niche. Copyright © 2016 Elsevier GmbH. All rights reserved.

  17. DNA-binding studies and biological activities of new nitrosubstituted acyl thioureas

    NASA Astrophysics Data System (ADS)

    Tahir, Shaista; Badshah, Amin; Hussain, Raja Azadar; Tahir, Muhammad Nawaz; Tabassum, Saira; Patujo, Jahangir Ali; Rauf, Muhammad Khawar

    2015-11-01

    Four new nitrosubstituted acylthioureas i.e. 1-acetyl-3-(4-nitrophenyl)thiourea (TU1), 1-acetyl-3-(2-methyl-4-nitrophenyl)thiourea (TU2), 1-acetyl-3-(2-methoxy-4-nitrophenyl)thiourea (TU3) and 1-acetyl-3-(4-chloro-3-nitrophenyl)thiourea (TU4) have been synthesized and characterized (by C13 and H1 nuclear magnetic resonance, Fourier transform infrared spectroscopy and single crystal X-ray diffraction). As a preliminary investigation of the anti-cancer potencies of the said compounds, DNA interaction studies have been carried out using cyclic voltammetry and UV-vis spectroscopy along with verification from computational studies. The drug-DNA binding constants are found to be in the order, KTU3 9.04 × 106 M-1 > KTU4 8.57 × 106 M-1 > KTU2 6.05 × 106 M-1 > KTU1 1.16 × 106 M-1. Furthermore, the antioxidant, cytotoxic, antibacterial and antifungal activities have been carried out against DPPH (1,1-diphenyl-2-dipicrylhydrazyl), Brine shrimp eggs, gram positive (Micrococcus luteus, Staphylococcus aureus) and gram negative (Bordetella bronchiseptica, Salmonella typhimurium, Enterobacter aerogens) and fungal cultures (Aspergillus fumigatus, Mucor species, Aspergillus niger, Aspergillus flavus) respectively.

  18. Speleothems from Mawsmai and Krem Phyllut caves, Meghalaya, India: some evidences on biogenic activities

    NASA Astrophysics Data System (ADS)

    Baskar, Sushmitha; Baskar, R.; Lee, Natuschka; Theophilus, P. K.

    2009-05-01

    The Mawsmai cave and Krem Phyllut caves, East Khasi hills, Meghalaya, India has so far not yet attracted the attention of geomicrobiologists. Observations and hypotheses on the possible influence of identified microorganisms for speleothem formations in Meghalaya are reported for the first time. XRD studies identified calcite in speleothems and gypsum in cave wall deposits as the dominant minerals. SEM-EDAX showed interesting microfabric features showing strong resemblance with fossilised bacteria, calcified filaments, needle calcite and numerous nano scale calcite crystals, highly weathered and disintegrated crystals of calcite, that point towards a significant microbial influence in its genesis. Thin section petrography showed laminated stromatolitic features. The microorganisms identified by conventional isolation and further evaluation of isolates by molecular techniques include Bacillus cereus, Bacillus mycoides, Bacillus licheniformis, Micrococcus luteus, and Actinomycetes. Microscopic observations also showed unidentifiable cocci and four unidentifiable strains of CaSO4 (gypsum) precipitating bacteria. Experimental studies confirmed that these bacteria are able to precipitate calcium minerals (calcite, gypsum, minor amounts of dolomite) in the laboratory. These results allow us to postulate that species like these may contribute to active biogenic influence in the cave formations at Meghalaya.

  19. Characterization of 15 selected coccal bacteria isolated from Antarctic rock and soil samples from the McMurdo-Dry Valleys (South-Victoria Land)

    NASA Technical Reports Server (NTRS)

    Siebert, J.; Hirsch, P.; Friedmann, E. I. (Principal Investigator)

    1988-01-01

    Approximately 1500 cultures of microorganisms were isolated from rocks and soils of the Ross Desert (McMurdo-Dry Valleys). From these, 15 coccoid strains were chosen for more detailed investigation. They were characterized by morphological, physiological and chemotaxonomical properties. All isolates were Gram-positive, catalase-positive and nonmotile. Six strains showed red pigmentation and could be identified as members of the genera Micrococcus (M. roseus, M. agilis) or Deinococcus. In spite of their coccoid morphology, the remaining nine strains had to be associated with coryneform bacteria (Arthrobacter, Brevibacterium), because of their cell wall composition and G+C ratios. Most of the strains were psychrotrophic, but one strain was even obligately psychrophilic, with a temperature maximum below 20 degrees C. Red cocci had in vitro pH optima above 9.0 although they generally originated from acid samples. Most isolates showed a preference for sugar alcohols and organic acids, compounds which are commonly known to be released by lichens, molds and algae, the other components of the cryptoendolithic ecosystem. These properties indicate that our strains are autochthonous members of the natural Antarctic microbial population.

  20. Formation of resting cells by non-spore-forming microorganisms as a strategy of long-term survival in the environment

    NASA Astrophysics Data System (ADS)

    Mulyukin, Andrei L.; Soina, Vera S.; Demkina, Elena V.; Kozlova, Alla N.; Suzina, Natalia E.; Dmitriev, Vladimir V.; Duda, Vitalii I.; El'-Registan, Galina I.

    2003-01-01

    Non-spore-forming bacteria of the genera Micrococcus and Arthrobacter, including the isolates from permafrost sediments, were found to be able to form cystlike cells under special conditions. Cystlike cells maintained the viability during long-term storage (for up to several years), had undetectable respiratory activity and the elevated resistance to heating and other unfavorable conditions, possessed the specific fine structure and morphology, and were formed in the life cycles of the microorganism. These properties allow cystlike cells to be attributed to a new type of resting microbial forms. Furthermore, the distinctive feature of resting cystlike cells was their low P/S ratios and high Ca/K ratios in comparison to vegetative cells as shown by X-ray microanalysis. The experimentally obtained bacterial cystlike cells with thickened and laminated cell walls and altered texture of the cytoplasm were similar to the cells abundant in native microbial populations isolated from permafrost sediments and ancient soils of the Kolyma lowland (Siberia, Russia). Due to the inherent elevated resistance to adverse conditions and maintenance of viability for prolonged periods, resting cystlike cells are likely to ensure long-term survival of non-spore-forming bacteria in cold environments.

  1. Isolation and characterization of a c-type lysozyme from the nurse shark.

    PubMed

    Hinds Vaughan, Nichole; Smith, Sylvia L

    2013-12-01

    Lysozyme is a ubiquitous antibacterial enzyme that occurs in numerous invertebrate and vertebrate species. Three forms have been described c-type, g-type and i-type which differ in primary structure. Shark lysozyme has not been characterized; here we report on the isolation and characterization of lysozyme from unstimulated shark (Ginglymostoma cirratum) leukocytes and provide amino acid sequence data across the highly conserved active site of the molecule identifying it to be a c-type lysozyme. A leukocyte lysate was applied either (a) to the first of two sequential DE-52 cellulose columns or alternatively, (b) to a DEAE-Sepharose column. Lysozyme activity in lysate and active fractions was identified by zones of lysis of Micrococcus lysodeikticus cell walls on lysoplates and zones of growth inhibition in agar diffusion assays using Planococcus citreus as the target organism. SDS-PAGE analysis revealed a 14 kDa protein which was identified as lysozyme by mass spectroscopic analysis of peptides, reactivity against anti-HEWL antibodies on a Western blot, hydrolysis of M. lysodeikticus cell walls, and inhibition of growth of P. citreus on AU-gel blots in which the area of growth inhibition correlated to a 14 kDa protein. Copyright © 2013 Elsevier Ltd. All rights reserved.

  2. Development of a colourimetric assay for glycosynthases.

    PubMed

    Hayes, Marc R; Bochinsky, Kevin A; Seibt, Lisa S; Elling, Lothar; Pietruszka, Jörg

    2017-09-10

    The synthesis of glycosidic structures by catalysis via glycosynthases has gained much interest due to the potential high product yields and specificity of the enzymes. Nevertheless, the characterisation and implementation of new glycosynthases is greatly hampered by the lack of high-throughput methods for reaction analysis and screening of potential glycosynthase variants. Fluoride detection, via silyl ether chemosensors, has recently shown high potential for the identification of glycosynthase mutants in a high-throughput manner, though limited by the low maximal detection concentration. In the present paper, we describe a new version of a glycosynthase activity assay using a silyl ether of p-nitrophenol, allowing fast reliable detection of fluoride even at concentrations of 4mM and higher. This improvement of detection allows not only screening and identification but also kinetic characterisation of glycosynthases and synthetic reactions in a fast microtiter plate format. The applicability of the assay was successfully demonstrated by the biochemical characterisation of the mesophilic β-glucosynthase of Abg-E358S (Rhizobium radiobacter) and psychrotolerant β-glucosynthase BglU-E377A (Micrococcus antarcticus). The limitation of hyperthermophilic glycosidases as potential glycosynthases, when using glycosyl fluoride donors, was also illustrated by the example of the putative β-galactosidase GalPf from Pyrococcus furiosus. Copyright © 2017 Elsevier B.V. All rights reserved.

  3. Purification and Characterization of Bacteriocin Produced by Weissella confusa A3 of Dairy Origin

    PubMed Central

    Goh, Hweh Fen; Philip, Koshy

    2015-01-01

    A dramatic increase in bacterial resistance towards currently available antibiotics has raised worldwide concerns for public health. Therefore, antimicrobial peptides (AMPs) have emerged as a promisingly new group of therapeutic agents for managing infectious diseases. The present investigation focusses on the isolation and purification of a novel bacteriocin from an indigenous sample of cow milk and it’s mode of action. The bacteriocin was isolated from Weissella confusa A3 that was isolated from the sample and was shown to have inhibitory activity towards pathogenic bacteria namely Bacillus cereus, Escherichia coli, Pseudomonas aeruginosa and Micrococcus luteus. The bacteriocin was shown to be heat stable and functioned well at low pH (2 to 6). Reduction of activity was shown after treatment with proteinase K, trypsin and peptidase that confirmed the proteinaceous nature of the compound. MALDI-TOF analysis of the sample gave a mass approximating 2.7 kDa. The membrane of the bacteria was disrupted by the bacteriocin causing SYTOX® green dye to enter the cell and bind to the bacterial DNA giving fluorescence signal. Bacterial cell treated with the bacteriocin also showed significant morphological changes under transmission electron microscope. No virulence and disease related genes can be detected from the genome of the strain. PMID:26474074

  4. Commercial probiotic bacteria and prebiotic carbohydrates: a fundamental study on prebiotics uptake, antimicrobials production and inhibition of pathogens.

    PubMed

    Cruz-Guerrero, Alma; Hernández-Sánchez, Humberto; Rodríguez-Serrano, Gabriela; Gómez-Ruiz, Lorena; García-Garibay, Mariano; Figueroa-González, Ivonne

    2014-08-01

    Probiotics and prebiotics are among the most important functional food ingredients worldwide. The proven benefits of such ingredients to human health have encouraged the development of functional foods containing both probiotics and prebiotics. In this work, the production of antimicrobial compounds coupled to the uptake of commercial prebiotics by probiotic bacteria was investigated. The probiotic bacteria studied were able to take up commercial prebiotic carbohydrates to the same or higher extent than that observed for lactose (control carbohydrate). The growth of probiotic bacteria was coupled to the production of antimicrobials such as short-chain fatty acids (SCFA), H2 O2 and bacteriocins. A higher production of antimicrobial compounds was recorded with Oligomate 55® compared with Regulact® and Frutafit® (3-5 and 10-115 times higher SCFA and H2 O2 production, respectively). The probiotic bacteria grown with Oligomate 55® also produced bacteriocins and other non-identified antimicrobial compounds. The antimicrobials produced by the probiotic bacteria inhibited up to 50% the growth of model pathogens such as Escherichia coli, Listeria innocua and Micrococcus luteus compared with control cultures. The results here obtained are useful for the adequate selection of probiotic/prebiotics pairs and therefore in the development of efficient functional foods. © 2013 Society of Chemical Industry.

  5. Synergistic activity of biocides and antibiotics on resistant bacteria from organically produced foods.

    PubMed

    Fernández Fuentes, Miguel Angel; Abriouel, Hikmate; Gadea, Rebeca; Pérez Pulido, Rubén; Gálvez, Antonio; Ortega, Elena

    2014-10-01

    Synergism between biocides and antibiotics was investigated in 20 biocide and antibiotic-resistant bacterial strains that were previously isolated from organically produced foods, according to their antimicrobial resistance profiles. Most of the antibiotic/biocide combinations yielded synergistic interactions, reducing the inhibitory concentrations of biocides and antibiotics by 4- to 16-fold. Among enterococci, synergism with biocides was detected for amoxicillin (AM), cefuroxime (CX), erythromycin (EM), ciprofloxacin (CP), and trimethoprim/sulphametoxazol (T/S). Among staphylococci, interactions were synergistic (AM) and either synergistic or indifferent (CX and EM, depending on biocide). Among the three methicillin-resistant Staphylococcus aureus clinical strains included in the study, the combinations of methicillin and triclosan or hexachlorophene acted synergistically in all strains, but interactions were either synergistic or indifferent for the other biocides, depending on the strain. All combinations tested were synergistic for Lactobacillus (AM, CX, EM, and CP) and Micrococcus (AM, EM). In Salmonella, interactions were indifferent (AM, CX, EM, and CP) or synergistic (T/S). Synergism with biocides was also detected in Klebsiella isolates (AM, CX, and T/S), Enterobacter sp. (AM, CX, EM, and T/S), Pantoea (AM, CX, EM, CP, and T/S), and Chryseobacterium sp. (EM). These results suggest that combinations of biocides and antibiotics may open new possibilities to combat antimicrobial resistance.

  6. Community structure and PAH ring-hydroxylating dioxygenase genes of a marine pyrene-degrading microbial consortium.

    PubMed

    Gallego, Sara; Vila, Joaquim; Tauler, Margalida; Nieto, José María; Breugelmans, Philip; Springael, Dirk; Grifoll, Magdalena

    2014-07-01

    Marine microbial consortium UBF, enriched from a beach polluted by the Prestige oil spill and highly efficient in degrading this heavy fuel, was subcultured in pyrene minimal medium. The pyrene-degrading subpopulation (UBF-Py) mineralized 31 % of pyrene without accumulation of partially oxidized intermediates indicating the cooperation of different microbial components in substrate mineralization. The microbial community composition was characterized by culture dependent and PCR based methods (PCR-DGGE and clone libraries). Molecular analyses showed a highly stable community composed by Alphaproteobacteria (84 %, Breoghania, Thalassospira, Paracoccus, and Martelella) and Actinobacteria (16 %, Gordonia). The members of Thalasosspira and Gordonia were not recovered as pure cultures, but five additional strains, not detected in the molecular analysis, that classified within the genera Novosphingobium, Sphingopyxis, Aurantimonas (Alphaproteobacteria), Alcanivorax (Gammaproteobacteria) and Micrococcus (Actinobacteria), were isolated. None of the isolates degraded pyrene or other PAHs in pure culture. PCR amplification of Gram-positive and Gram-negative dioxygenase genes did not produce results with any of the cultured strains. However, sequences related to the NidA3 pyrene dioxygenase present in mycobacterial strains were detected in UBF-Py consortium, suggesting the representative of Gordonia as the key pyrene degrader, which is consistent with a preeminent role of actinobacteria in pyrene removal in coastal environments affected by marine oil spills.

  7. The effects of different processing conditions on biogenic amine formation and some qualitative properties in pastırma.

    PubMed

    Hazar, Fatma Yağmur; Kaban, Güzin; Kaya, Mükerrem

    2017-11-01

    Pastırma, a Turkish dry-cured meat product, was cured at two different temperatures (4 or 10 °C) with two different curing agents (150 mg/kg NaNO 2 or 300 mg/kg KNO 3 ). The aim of this research was to determine the effects of these factors on biogenic amine content and other qualitative properties (pH, a w , color, residual nitrite, TBARS, NPN-M, microbiological properties). Residual nitrite was below 10 mg/kg in all samples. Both the curing agent and temperature were found to have a very significant effect on the TBARS value, and the curing agent had a significant effect on the NPN-M content. Curing at 10 °C increased the L* value; the use of nitrate increased the a* value. The use of nitrite had a negative effect on the growth of lactic acid bacteria. Micrococcus/Staphylococcus showed good growth in the presence of nitrate. In all samples, Enterobacteriaceae counts were below detectable levels. Neither temperature nor curing agent had significant effects on the amounts of tryptamine, cadaverine, histamine, tyramine, or spermine. There were very significant effects of temperature on the amount of putrescine and of the curing agent on the amount of spermidine.

  8. [Normal microflora of the pharyngeal mucosa].

    PubMed

    Kolotilova, L V; Akishina, T M; Zargarian, O P; Lomnitskaia, V B; Pruzhniak, O V; Lutsik, T S

    1989-10-01

    Aerobic microflora of the throat mucosa was studied in 518 healthy persons aged 1 to 50 years. On the basis of the study results, criteria for estimating microbiocenoses of the upper respiratory tracts were defined. It was shown that the throat symbiotic flora included three groups of microorganisms playing different roles in the development of microbiocenosis. The indigenous group consisted of representatives of Streptococcus and Neisseria and was characterized by permanent (90-100 per cent) and intensive (3-8 lg CFU/ml) colonization, broad species spectrum, associations of 2-3 and more species and no significant influence of sociological, age and season factors. The representatives of the facultative group i.e. bacteria belonging to Staphylococcus, Corynebacterium and Haemophilus were less frequent (25-50 per cent). The intensity of their isolation was lower (1-4 lg CFU/ml) and their species spectrum was narrow. The microorganisms of the transitory group were characterized by low frequency (5-20 per cent) and insignificant contamination of the throat mucosa (1-2 lg CFU/ml). The nature of the colonization was monospecific. The group was more numerous by generic composition (Candida, Escherichia, Klebsiella, Citrobacter, Enterobacter, Pseudomonas, Branhamella, Moraxella and Micrococcus). However, it was generally limited by one colonization type. The facultative and transitory groups were subject to age and season variation. They were also different in urban and rural populations.

  9. Antimicrobial, wound healing and antioxidant activity of Plagiochasma appendiculatum Lehm. et Lind.

    PubMed

    Singh, Meenakshi; Govindarajan, Raghavan; Nath, Virendra; Rawat, Ajay Kumar Singh; Mehrotra, Shanta

    2006-08-11

    Plagiochasma appendiculatum (Aytoniaceae) of the order Marchantiales is widely used in the form of paste ethnomedicinally by Gaddi tribe in Kangra valley for treating skin diseases. In this context, antimicrobical potential of Plagiochasma appendiculatum against a wide range of microorganisms was studied. To validate the ethnotherapeutic claims of the plant in skin diseases, wound healing activity was studied, besides antioxidant activity to understand the mechanism of wound healing activity. The plant (alchoholic and aqueous extract) showed significant antibacterial and antifungal activity against almost all the organisms: Micrococcus luteus, Bacillus subtilis, Bacillus cereus, Staphylococcus aureus, Streptococcus pneumoniae, Enterobacter aerogenes, Escherichia coli, Klebsiella pneumoniae, Proteus mirabilis, Pseudomonas aeruginosa, Salmonella typhimurium, and eight fungi Candida albicans and Cryptococcus albidus-dimorphic fungi, Trichophyton rubrum-dermatophyte fungi, Aspergillus niger, Aspergillus flavus, Aspergillus spinulosus, Aspergillus terreus and Aspergillus nidulans-systemic fungi, with especially good activity against the dermatophyte (Trichophyton rubrum) and some infectious bacteria (Escherichia coli, Proteus mirabilis and Salmonella typhimurium) with an MIC of 2.5 microg/disc. The results show that Plagiochasma appendiculatum extract has potent wound healing capacity as evident from the wound contraction and increased tensile strength. The results also indicated that Plagiochasma appendiculatum extract possesses potent antioxidant activity by inhibiting lipid peroxidation and increase in the superoxide dismutase (SOD) and Catalase activity.

  10. [Residues of chloramphenicol in the calf organism following parenteral administration of the Czechoslovak preparation Chronicin inj].

    PubMed

    Malíková, M; Habrda, J

    1976-03-01

    Using two biological methods the chloramphenicol content in various tissues of 11 calves aged 3--18 days was determined after a single-dose therapeutical administration of the Czechoslovak preparation of Chronicin inj. in the quantity of 12 mg kg-1 body mass. Of four test strains, solely Micrococcus flavus (ATCC 10240) strain proved suitable. Chloramphenicol was quantitatively determined by reading from transformed standard curves. An evalua tion of the two approximately equally sensitive methods yielded the following results: three days after the injection all calves were positive, at 5 and 10 days, one of three calves in each group was negativ similarly to both calves slaughtered 15 days post injection. The residues appeared most frequently in the liver, at the site of injection, and in the fore and hind musculature. Maximum detectable concentrations were recorded in the liver. Culinary and technological treatment of positive meat and liver samples revealed that 15 minutes' boiling and 30 minutes' roasting destroyed the microbiologically active chloramphenicol residues in the samples. Neither deep freezing nor salting was sufficient for residue inactivation, although in some samples a decrease in biological chloramphenicol activity by circa 20--30% was recorded. a preslaughter withdrawal time of 15 days is recommended.

  11. Nature, nomenclature and taxonomy of obligate methanol utilizing strains.

    PubMed

    Cercel, M

    1999-01-01

    In a screening program, a number of different bacterial strains with the ability to utilize methanol as a sole carbon and energy source were isolated and described. They are well known methanol utilizing genera Pseudomonas, Klebsiella, Micrococcus, Methylomonas or, on the contrary, the new, unknown genera and species of methylotrophic bacteria. In the last category, Acinetobacter and Alcaligenes are the new reported genera of organisms able to use methanol as a sole carbon and energy source. The present paper reports the very complex physiological and biochemical modifications when very versatile bacteria such as Pseudomonas aeruginosa and Acinetobacter calcoaceticus are cultured on methanol and when the obligate methylotrophic state is compared with the facultative methylotrophic state of the same bacterial strain. Based on experiments and comparisons with literature data, it seems that Methylomonas methanica is the obligate methylotrophic state of Pseudomonas aeruginosa and that Acinetobacter calcoaceticus is the facultative methylotrophic state of Methylococcus capsulatus, an obligate methylotroph. The relationship of the obligate to the facultative and of the facultative to the obligate methylotrophy were established. These new methylotrophic genera and species, the profound physiological and biochemical modifications as well as the new data concerning nature, nomenclature and taxonomy of methanol utilizing bateria were reported for the first time in 1983.

  12. Growth and biosurfactant synthesis by Nigerian hydrocarbon-degrading estuarine bacteria.

    PubMed

    Adebusoye, Sunday A; Amund, Olukayode O; Ilori, Matthew O; Domeih, Dupe O; Okpuzor, Joy

    2008-12-01

    The ability of microorganisms to degrade petroleum hydrocarbons is important for finding an environmentally-friendly method to restoring contaminated environmental matrices. Screening of hydrocarbon-utilizing and biosurfactant-producing abilities of organisms from an estuarine ecosystem in Nigeria, Africa, resulted in the isolation of five microbial strains identified as Corynebacterium sp. DDV1, Flavobacterium sp. DDV2, Micrococcus roseus DDV3, Pseudomonas aeruginosa DDV4 and Saccharomyces cerevisae DDV5. These isolates grew readily on several hydrocarbons including hexadecane, dodecane, crude oil and petroleum fractions. Axenic cultures of the organisms utilized diesel oil (1.0% v/v) with generation times that ranged significantly (t-test, P < 0.05) between 3.25 and 3.88 day, with concomitant production of biosurfactants. Kinetics of growth indicates that biosurfactant synthesis occurred predominantly during exponential growth phase, suggesting that the bioactive molecules are primary metabolites. Strains DDV1 and DDV4 were evidently the most metabolically active in terms of substrate utilization and biosurfactant synthesis compared to other strains with respective emulsification index of 63 and 78%. Preliminary biochemical characterization indicates that the biosurfactants are heteropolymers consisting of lipid, protein and carbohydrate moieties. The hydrocarbon catabolic properties coupled with biosurfactant-producing capabilities is an asset that could be exploited for cleanup of oil-contaminated matrices and also in food and cosmetic industries.

  13. Application of Lactic Acid Bacteria (LAB) in freshness keeping of tilapia fillets as sashimi

    NASA Astrophysics Data System (ADS)

    Cao, Rong; Liu, Qi; Chen, Shengjun; Yang, Xianqing; Li, Laihao

    2015-08-01

    Aquatic products are extremely perishable food commodities. Developing methods to keep the freshness of fish represents a major task of the fishery processing industry. Application of Lactic Acid Bacteria (LAB) as food preservative is a novel approach. In the present study, the possibility of using lactic acid bacteria in freshness keeping of tilapia fillets as sashimi was examined. Fish fillets were dipped in Lactobacillus plantarum 1.19 (obtained from China General Microbiological Culture Collection Center) suspension as LAB-treated group. Changes in K-value, APC, sensory properties and microbial flora were analyzed. Results showed that LAB treatment slowed the increase of K-value and APC in the earlier storage, and caused a smooth decrease in sensory score. Gram-negative bacteria dominated during refrigerated storage, with Pseudomonas and Aeromonas being relatively abundant. Lactobacillus plantarum 1.19 had no obvious inhibitory effect against these Gram-negatives. However, Lactobacillus plantarum 1.19 changed the composition of Gram-positive bacteria. No Micrococcus were detected and the proportion of Staphylococcus decreased in the spoiled LAB-treated samples. The period that tilapia fillets could be used as sashimi material extended from 24 h to 48 h after LAB treatment. The potential of using LAB in sashimi processing was confirmed.

  14. Rapid High-Throughput Assessment of Aerobic Bacteria in Complex Samples by Fluorescence-Based Oxygen Respirometry

    PubMed Central

    O'Mahony, Fiach C.; Papkovsky, Dmitri B.

    2006-01-01

    A simple method has been developed for the analysis of aerobic bacteria in complex samples such as broth and food homogenates. It employs commercial phosphorescent oxygen-sensitive probes to monitor oxygen consumption of samples containing bacteria using standard microtiter plates and fluorescence plate readers. As bacteria grow in aqueous medium, at certain points they begin to deplete dissolved oxygen, which is seen as an increase in probe fluorescence above baseline signal. The time required to reach threshold signal is used to either enumerate bacteria based on a predetermined calibration or to assess the effects of various effectors on the growth of test bacteria by comparison with an untreated control. This method allows for the sensitive (down to a single cell), rapid (0.5 to 12 h) enumeration of aerobic bacteria without the need to conduct lengthy (48 to 72 h) and tedious colony counts on agar plates. It also allows for screening a wide range of chemical and environmental samples for their toxicity. These assays have been validated with different bacteria, including Escherichia coli, Micrococcus luteus, and Pseudomonas fluorescens, with the enumeration of total viable counts in broth and industrial food samples (packaged ham, chicken, and mince meat), and comparison with established agar plating and optical-density-at-600-nm assays has been given. PMID:16461677

  15. Innate immune system capabilities of the Asian citrus psyllid, Diaphorina citri.

    PubMed

    Arp, Alex P; Martini, Xavier; Pelz-Stelinski, Kirsten S

    2017-09-01

    Citrus production worldwide is currently threatened by Huanglongbing, or citrus greening disease. The associated pathogen, Candidatus Liberibacter asiaticus (CLas), is transmitted by the Asian citrus psyllid, Diaphorina citri. Annotation of the D. citri genome revealed a reduced innate immune system lacking a number of antimicrobial peptides and the Imd pathway associated with defense against Gram-negative bacteria. We characterized this apparent immune reduction in survival assays in which D. citri were exposed to Gram-negative or Gram-positive bacteria. D. citri experienced significant mortality when exposed to Serratia marcescens (Gram-negative) through oral ingestion or by septic injury. Escherichia coli (Gram-negative) also caused significant D. citri mortality, but only when inoculated at high concentrations through oral ingestion or by septic injury. Neither Micrococcus luteus (Gram-positive) or Bacillus subtilis (Gram-positive) caused significant mortality as compared to controls in any experiment. E. coli titers increased rapidly following exposure, while M. luteus titer remained stable for 72 h. We demonstrate that D. citri is capable of defending against E. coli, a Gram-negative bacterium, despite lacking the Imd defense pathway. The tolerance of D. citri to M. luteus infection, yet inability to effectively clear infections, presents questions to efficacy of D. citri immune response to effectively clear Gram-positive infections. Copyright © 2017. Published by Elsevier Inc.

  16. Chemical constituents of essential oil of endemic Rhanterium suaveolens Desf. growing in Algerian Sahara with antibiofilm, antioxidant and anticholinesterase activities.

    PubMed

    Chemsa, Ahmed Elkhalifa; Erol, Ebru; Öztürk, Mehmet; Zellagui, Amar; Özgür, Ceylan; Gherraf, Noureddine; Duru, Mehmet Emin

    2016-09-01

    Twenty compounds were detected in the essential oil of Rhanterium suaveolens representing 98.01% of the total oil content. Perillaldehyde (45.79%), caryophyllene oxide (24.82%) and β-cadinol (5.61%) were identified as the main constituents. In β-carotene-linoleic acid assay, both the oil and the methanol extract exhibited good lipid peroxidation inhibition activity, with IC50 values of 17.97 ± 5.40 and 11.55 ± 3.39 μg/mL, respectively. In DPPH and CUPRAC assays, however, the methanol extract exhibited a good antioxidant activity. The highest antibiofilm activity has been found 50.30% against Staphylococcus epidermidis (MU 30) at 20 μg/mL for essential oil and 58.34% against Micrococcus luteus (NRRL B-4375) at 25 mg/mL concentration for methanol extract. The in vitro anticholinesterase activity of methanol extract showed a moderate acetylcholinesterase inhibitory (IC50 = 168.76 ± 0.62 μg/mL) and good butyrylcholinesterase inhibitory (IC50 = 54.79 ± 1.89 μg/mL) activities. The essential oil was inactive against both enzymes.

  17. Characterization of Catalase from Psychrotolerant Psychrobacter piscatorii T-3 Exhibiting High Catalase Activity

    PubMed Central

    Kimoto, Hideyuki; Yoshimune, Kazuaki; Matsuyma, Hidetoshi; Yumoto, Isao

    2012-01-01

    A psychrotolerant bacterium, strain T-3 (identified as Psychrobacter piscatorii), that exhibited an extraordinarily high catalase activity was isolated from the drain pool of a plant that uses H2O2 as a bleaching agent. Its cell extract exhibited a catalase activity (19,700 U·mg protein−1) that was higher than that of Micrococcus luteus used for industrial catalase production. Catalase was approximately 10% of the total proteins in the cell extract of the strain. The catalase (PktA) was purified homogeneously by only two purification steps, anion exchange and hydrophobic chromatographies. The purified catalase exhibited higher catalytic efficiency and higher sensitivity of activity at high temperatures than M. luteus catalase. The deduced amino acid sequence showed the highest homology with catalase of Psycrobacter cryohalolentis, a psychrotolelant bacterium obtained from Siberian permafrost. These findings suggest that the characteristics of the PktA molecule reflected the taxonomic relationship of the isolate as well as the environmental conditions (low temperatures and high concentrations of H2O2) under which the bacterium survives. Strain T-3 efficiently produces a catalase (PktA) at a higher rate than Exiguobacterium oxidotolerans, which produces a very strong activity of catalase (EktA) at a moderate rate, in order to adapt to high concentration of H2O2. PMID:22408420

  18. Antibacterial potential of Calotropis procera (flower) extract against various pathogens.

    PubMed

    Ali, Abid; Ansari, Asma; Qader, Shah Ali Ul; Mumtaz, Majid; Saied, Sumayya; Mahboob, Tabassum

    2014-09-01

    Increased bacterial resistance towards commonly used antibiotics has become a debated issue all over the world in a last few decades. Due to this, consumer demand towards natural anti-microbial agents is increasing day by day. Natural anti-microbial agents have gained enormous attention as an alternative therapeutic agent in pharmaceutical industry. Current study is an effort to explore and identify a bactericidal potential of various solvent extracts of Calotropis procera flower. Flowers of C. procera were extracted with hexane, butanol, ethyl acetate and aqua to evaluate the antibacterial activity by agar well diffusion method against the various human pathogens. The microorganisms used in this study includes Salmonella typhi, Escherichia coli (O157:H7), Micrococcus luteus KIBGE-IB20 (Gen Bank accession: JQ250612) and methicillin resistant Staphylococcus aureus (MRSA) KIBGE-IB23 (Gen Bank accession: KC465400). Zones of inhibition were observed against all four pathogenic strains. Fraction soluble in hexane showed broad spectrum of inhibition against all the studied pathogens. However, fractions soluble in ethyl acetate inhibited the growth of E. coli, MRSA, and M. luteus. In case of butanol and aqueous extracts only growth of M. luteus was inhibited. Results revealed that the flower extracts of C. procera have a potential to be used as an antibacterial agent against these pathogenic organisms.

  19. Microbiological assay for the analysis of certain macrolides in pharmaceutical dosage forms.

    PubMed

    Mahmoudi, A; Fourar, R E-A; Boukhechem, M S; Zarkout, S

    2015-08-01

    Clarithromycin (CLA) and roxithromycin (ROX) are macrolide antibiotics with an expanded spectrum of activity that are commercially available as tablets. A microbiological assay, applying the cylinder-plate method and using a strain of Micrococcus luteus ATCC 9341 as test organism, has been used and validated for the quantification of two macrolide drugs; CLA and ROX in pure and pharmaceutical formulations. The validation of the proposed method was carried out for linearity, precision, accuracy and specificity. The linear dynamic ranges were from 0.1 to 0.5μg/mL for both compounds. Logarithmic calibration curve was obtained for each macrolide (r>0.989) with statistically equal slopes varying from 3.275 to 4.038, and a percentage relative standard deviation in the range of 0.24-0.92%. Moreover, the method was applied successfully for the assay of the studied drugs in pharmaceutical tablet dosage forms. Recovery from standard addition experiments in commercial products was 94.71-96.91% regarding clarithromycin and 93.94-98.12% regarding roxithromycin, with a precision (%RSD) 1.32-2.11%. Accordingly, this microbiological assay can be used for routine quality control analysis of titled drugs in tablet formulations. Copyright © 2015 Elsevier B.V. All rights reserved.

  20. Phylogenetic analyses of bacteria associated with the processing of iru and ogiri condiments.

    PubMed

    Ademola, Oluwatoyin M; Adeyemi, Taiwo E; Ezeokoli, Obinna T; Ayeni, Kolawole I; Obadina, Adewale O; Somorin, Yinka M; Omemu, Adebukola M; Adeleke, Rasheed A; Nwangburuka, Cyril C; Oluwafemi, Flora; Oyewole, Olusola B; Ezekiel, Chibundu N

    2018-06-27

    Analysis of the bacterial community dynamics during the production of traditional fermented condiments is important for food safety assessment, quality control and development of starter culture technology. In this study, bacteria isolated during the processing of iru and ogiri, two commonly consumed condiments in Nigeria, were characterised based on phylogenetic analyses of the bacterial 16S rRNA gene. A total of 227 isolates were obtained and clustered into 12 operational taxonomic units (OTUs) based on 97% 16S rRNA gene similarity. The OTUs spanned three phyla (Firmicutes, Actinobacteria and Proteobacteria), and nine genera: Acinetobacter, Aerococcus, Bacillus, Enterococcus, Enterobacter, Lysinibacillus, Micrococcus, Proteus and Staphylococcus. OTUs closely related to species of Bacillus dominated the processing stages of both condiments. Although no single OTU occurred throughout iru processing stages, an OTU (mostly related to B. safensis) dominated the ogiri processing stages indicating potentials for the development of starter culture. However, other isolates such as those of Enterococcus spp. and Lysinibacillus spp. may be potential starters for iru fermentation. Presumptive foodborne pathogens were also detected at some stages of the condiments' processing, possibly due to poor hygienic practices. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

  1. Purification and Characterization of Bacteriocin Produced by Weissella confusa A3 of Dairy Origin.

    PubMed

    Goh, Hweh Fen; Philip, Koshy

    2015-01-01

    A dramatic increase in bacterial resistance towards currently available antibiotics has raised worldwide concerns for public health. Therefore, antimicrobial peptides (AMPs) have emerged as a promisingly new group of therapeutic agents for managing infectious diseases. The present investigation focusses on the isolation and purification of a novel bacteriocin from an indigenous sample of cow milk and it's mode of action. The bacteriocin was isolated from Weissella confusa A3 that was isolated from the sample and was shown to have inhibitory activity towards pathogenic bacteria namely Bacillus cereus, Escherichia coli, Pseudomonas aeruginosa and Micrococcus luteus. The bacteriocin was shown to be heat stable and functioned well at low pH (2 to 6). Reduction of activity was shown after treatment with proteinase K, trypsin and peptidase that confirmed the proteinaceous nature of the compound. MALDI-TOF analysis of the sample gave a mass approximating 2.7 kDa. The membrane of the bacteria was disrupted by the bacteriocin causing SYTOX® green dye to enter the cell and bind to the bacterial DNA giving fluorescence signal. Bacterial cell treated with the bacteriocin also showed significant morphological changes under transmission electron microscope. No virulence and disease related genes can be detected from the genome of the strain.

  2. Air Quality Monitoring of the Post-Operative Recovery Room and Locations Surrounding Operating Theaters in a Medical Center in Taiwan

    PubMed Central

    Tang, Chin-Sheng; Wan, Gwo-Hwa

    2013-01-01

    To prevent surgical site infection (SSI), the airborne microbial concentration in operating theaters must be reduced. The air quality in operating theaters and nearby areas is also important to healthcare workers. Therefore, this study assessed air quality in the post-operative recovery room, locations surrounding the operating theater area, and operating theaters in a medical center. Temperature, relative humidity (RH), and carbon dioxide (CO2), suspended particulate matter (PM), and bacterial concentrations were monitored weekly over one year. Measurement results reveal clear differences in air quality in different operating theater areas. The post-operative recovery room had significantly higher CO2 and bacterial concentrations than other locations. Bacillus spp., Micrococcus spp., and Staphylococcus spp. bacteria often existed in the operating theater area. Furthermore, Acinetobacter spp. was the main pathogen in the post-operative recovery room (18%) and traumatic surgery room (8%). The mixed effect models reveal a strong correlation between number of people in a space and high CO2 concentration after adjusting for sampling locations. In conclusion, air quality in the post-operative recovery room and operating theaters warrants attention, and merits long-term surveillance to protect both surgical patients and healthcare workers. PMID:23573296

  3. Antimicrobial peptide gene induction, involvement of Toll and IMD pathways and defense against bacteria in the red flour beetle, Tribolium castaneum.

    PubMed

    Yokoi, Kakeru; Koyama, Hiroaki; Minakuchi, Chieka; Tanaka, Toshiharu; Miura, Ken

    2012-01-01

    Using Tribolium castaneum, we quantitatively investigated the induction of nine antimicrobial peptide (AMP) genes by live gram-negative bacteria (Escherichia coli and Enterobacter cloacae), gram-positive bacteria (Micrococcus luteus and Bacillus subtilis) and the budding yeast (Saccharomyces cerevisiae). Then, five representative AMP genes were selected, and the involvement of the Toll and IMD pathways in their induction by E. coli, M. luteus and S. cerevisiae was examined by utilizing RNA interference of either MyD88 or IMD. Results indicated: Robust and acute induction of three genes by the two bacterial species was mediated mainly by the IMD pathway; slow and sustained induction of one gene by the two bacteria was mediated mainly by the Toll pathway; induction of the remaining one gene by the two bacteria was mediated by both pathways; induction of the five genes by the yeast was mediated by the Toll and/or IMD pathways depending on respective genes. These results suggest that more promiscuous activation and usage of the two pathways may occur in T. castaneum than in Drosophila melanogaster. In addition, the IMD pathway was revealed to dominantly contribute to defense against two bacterial species, gram-negative E. cloacae and gram-positive B. subtilis that possesses DAP-type peptidoglycan.

  4. Antioxidant and antimicrobial potentials of Serbian red wines produced from international Vitis vinifera grape varieties.

    PubMed

    Radovanović, Aleksandra N; Jovančićević, Branimir S; Radovanović, Blaga C; Mihajilov-Krstev, Tatjana; Zvezdanović, Jelena B

    2012-08-15

    Antioxidant and antimicrobial potentials of Serbian red wines produced from different international Vitis vinifera grape varieties and their correlation with contents of phenolic compounds were studied by spectrophotometric and chromatographic methods. The antioxidant activity of red wines was estimated through their ability to scavenge 2,2'-diphenyl-1-picrylhydrazyl free radical (DPPH(•) ). The red wines, gallic acid, (+)-catechin and quercetin were screened in vitro for antimicrobial activity against Gram-positive and Gram-negative strains using microdilution and disc diffusion techniques. Excellent correlations between the contents of quercetin-3-glucoside (R(2) = 0.9463) and quercetin (R(2) = 0.9337) and DPPH(•) -scavenging ability of the red wines were found. Serbian red wines exhibited significant activity against Staphylococcus aureus, Listeria inocua, Micrococcus flavus, Sarcina lutea, Bacillus subtilis, Escherichia coli, Pseudomonas aeruginosa, Salmonella enteritidis and Shigella sonnei strains, which was in correlation with their phenolic composition and antioxidant activity. The compounds gallic acid, quercetin and (+)-catechin showed high activity against B. subtilis, S. aureus, S. lutea and M. flavus Gram-positive and S. enteritidis and P. aeruginosa Gram-negative strains. The results show that quercetin-3-glucoside and quercetin concentrations can be used as markers for the determination of antioxidant and antimicrobial potentials of red wines. Copyright © 2012 Society of Chemical Industry.

  5. Comparative study of antibiotic-containing polymethylmetacrylate capsules and beads.

    PubMed

    Borzsei, László; Mintál, Tibor; Horváth, Aranka; Koós, Zoltán; Kocsis, Béla; Nyárády, József

    2006-01-01

    This study aimed at making local antibiotic therapy wider in cases of chronic suppurations by administering antibiotics which previously could not be given in this way through the conventional polymethylmetacrylate (PMMA) carrier techniques. Capsules from this material were produced with a pressing machine designed and laid out by us. The characteristics of antibiotic penetration from this novel carrier were compared to those of PMMA beads. The time-dependent outflow of amikacin, clindamycin, pefloxacin, piperacillin + tazobactam, amoxicillin + clavulanic acid and cefotaxime was examined from the capsules and the beads with standard microbiological techniques using the Micrococcus luteus ATCC9341 test strain. The diameter of the inhibitory zones was measured after 24 h incubation at 37 degrees C and converted to mug/ml antibiotic concentrations. Our results revealed that all antibiotics showed longer-lasting and higher concentration outflow from the PMMA capsules than from the beads. Therefore, these capsules can provide a more promising new opportunity for specific local antimicrobial treatment in cases of chronic suppurative bone and soft tissue injuries. In these cases the polymerization has already been completed and the heat does not influence the structure of the antibiotics; therefore, it can be inserted into the capsules in powder or solution form. Copyright 2006 S. Karger AG, Basel.

  6. Intersubunit structure within heterodimers of medium-chain prenyl diphosphate synthases. Formation of a hybrid-type heptaprenyl diphosphate synthase.

    PubMed

    Koike-Takeshita, A; Koyama, T; Ogura, K

    1998-10-01

    Among prenyltransferases that catalyze the sequential condensation of isopentenyl diphosphate with allylic diphosphate to produce prenyl diphosphates with various chain lengths and stereochemistries, medium-chain prenyl diphosphate synthases are exceptional in that they comprise two dissociable heteromeric protein components. These components exist without binding with each other under physiological conditions, and neither of them has any prenyltransferase activity by itself. In order to elucidate the precise molecular mechanism underlying expression of the catalytic function by such a unique two-component system, we examined the possibility of forming a hybrid between two of the components of three different medium-chain prenyl diphosphate synthases, components I and II of heptaprenyl diphosphate synthase from Bacillus subtilis, components I' and II' of heptaprenyl diphosphate synthase from Bacillus stearothermophilus, and components A and B of hexaprenyl diphosphate synthase from Micrococcus luteus B-P 26. As a result, only the hybrid-type combination of component I and component II' gave distinct prenyltransferase activity. The hybrid-type enzyme catalyzed the synthesis of heptaprenyl diphosphate and showed moderate heat stability, which lay between those of the natural enzymes from B. subtilis and B. stearothermophilus. There is no possibility of forming a hybrid between the heptaprenyl and hexaprenyl diphosphate synthases.

  7. Isolation, Characterization, and Antibacterial Activity of Hard-to-Culture Actinobacteria from Cave Moonmilk Deposits.

    PubMed

    Adam, Delphine; Maciejewska, Marta; Naômé, Aymeric; Martinet, Loïc; Coppieters, Wouter; Karim, Latifa; Baurain, Denis; Rigali, Sébastien

    2018-03-22

    Cave moonmilk deposits host an abundant and diverse actinobacterial population that has a great potential for producing novel natural bioactive compounds. In our previous attempt to isolate culturable moonmilk-dwelling Actinobacteria, only Streptomyces species were recovered, whereas a metagenetic study of the same deposits revealed a complex actinobacterial community including 46 actinobacterial genera in addition to streptomycetes. In this work, we applied the rehydration-centrifugation method to lessen the occurrence of filamentous species and tested a series of strategies to achieve the isolation of hard-to-culture and rare Actinobacteria from the moonmilk deposits of the cave "Grotte des Collemboles". From the "tips and tricks" that were tested, separate autoclaving of the components of the International Streptomyces Project (ISP) medium number 5 (ISP5) medium, prolonged incubation time, and dilution of the moonmilk suspension were found to most effectively improve colony forming units. Taxonomic analyses of the 40 isolates revealed new representatives of the Agromyces , Amycolatopsis , Kocuria , Micrococcus , Micromonospora , Nocardia , and Rhodococcus species, as well as additional new streptomycetes. The applied methodologies allowed the isolation of strains associated with both the least and most abundant moonmilk-dwelling actinobacterial operational taxonomic units. Finally, bioactivity screenings revealed that some isolates displayed high antibacterial activities, and genome mining uncovered a strong potential for the production of natural compounds.

  8. Activity of Fusion Prophenoloxidase-GFP and Its Potential Applications for Innate Immunity Study

    PubMed Central

    Yang, Bing; Lu, Anrui; Peng, Qin; Ling, Qing-Zhi; Ling, Erjun

    2013-01-01

    Insect prophenoloxidase (PPO) is essential for physiological functions such as melanization of invading pathogens, wound healing and cuticle sclerotization. The insect PPO activation pathway is well understood. However, it is not very clear how PPO is released from hemocytes and how PPO takes part in cellular immunity. To begin to assess this, three Drosophila melanogaster PPO genes were separately fused with GFP at the C-terminus (rPPO-GFP) and were over-expressed in S2 cells. The results of staining and morphological observation show that rPPO-GFP expressed in S2 cells has green fluorescence and enzyme activity if Cu2+ was added during transfection. Each rPPO-GFP has similar properties as the corresponding rPPO. However, cells with rPPO-GFP over-expressed are easier to trace without PO activation and staining. Further experiments show that rPPO1-GFP is cleaved and activated by Drosophila serine protease, and rPPO1-GFP binds to Micrococcus luteus and Beauveria bassiana spores as silkworm plasma PPO. The above research indicates that the GFP-tag has no influence on the fusion enzyme activation and PPO-involved innate immunity action in vitro. Thus, rPPO-GFP may be a convenient tool for innate immunity study in the future if it can be expressed in vivo. PMID:23717543

  9. Characterization of microbial contamination in United States Air Force aviation fuel tanks.

    PubMed

    Rauch, Michelle E; Graef, Harold W; Rozenzhak, Sophie M; Jones, Sharon E; Bleckmann, Charles A; Kruger, Randell L; Naik, Rajesh R; Stone, Morley O

    2006-01-01

    Bacteria and fungi, isolated from United States Air Force (USAF) aviation fuel samples, were identified by gas chromatograph fatty acid methyl ester (GC-FAME) profiling and 16S or 18S rRNA gene sequencing. Thirty-six samples from 11 geographically separated USAF bases were collected. At each base, an above-ground storage tank, a refueling truck, and an aircraft wing tank were sampled at the lowest sample point, or sump, to investigate microbial diversity and dispersion within the fuel distribution chain. Twelve genera, including four Bacillus species and two Staphylococcus species, were isolated and identified. Bacillus licheniformis, the most prevalent organism isolated, was found at seven of the 11 bases. Of the organisms identified, Bacillus sp., Micrococcus luteus, Sphinogmonas sp., Staphylococcus sp., and the fungus Aureobasidium pullulans have previously been isolated from aviation fuel samples. The bacteria Pantoea ananatis, Arthrobacter sp., Alcaligenes sp., Kocuria rhizophilia, Leucobacter komagatae, Dietza sp., and the fungus Discophaerina fagi have not been previously reported in USAF aviation fuel. Only at two bases were the same organisms isolated from all three sample points in the fuel supply distribution chain. Isolation of previously undocumented organisms suggests either, changes in aviation fuel microbial community in response to changes in aviation fuel composition, additives and biocide use, or simply, improvements in isolation and identification techniques.

  10. Isolation of Viable but Non-culturable Bacteria from Printing and Dyeing Wastewater Bioreactor Based on Resuscitation Promoting Factor.

    PubMed

    Jin, Yi; Gan, Guojuan; Yu, Xiaoyun; Wu, Dongdong; Zhang, Li; Yang, Na; Hu, Jiadan; Liu, Zhiheng; Zhang, Lixin; Hong, Huachang; Yan, Xiaoqing; Liang, Yan; Ding, Linxian; Pan, Yonglong

    2017-07-01

    Printing and dyeing wastewater with high content of organic matters, high colority, and poor biochemical performance is hard to be degraded. In this study, we isolated viable but non-culturable (VBNC) bacteria from printing and dyeing wastewater with the culture media contained resuscitation promoting factor (Rpf) protein secreted by Micrococcus luteus, counted the culturable cells number with the most probable number, sequenced 16S rRNA genes, and performed polymerase chain reaction-denaturing gradient gel electrophoresis. It is obviously that the addition of Rpf in the enrichment culture could promote growth and resuscitation of bacteria in VBNC state to obtain more fastidious bacteria significantly. The identified bacteria were assigned to nine genera in the treatment group, while the two strains of Ochrobactrum anthropi and Microbacterium sp. could not be isolated from the control group. The function of isolated strains was explored and these strains could degrade the dye of Congo red. This study provides a new sight into the further study including the present state, composition, formation mechanism, and recovery mechanism about VBNC bacteria in printing and dyeing wastewater, which would promote to understand bacterial community in printing and dyeing wastewater, and to obtain VBNC bacteria from ecological environment.

  11. Antimicrobial activity in the common seawhip, Leptogorgia virgulata (Cnidaria: Gorgonaceae).

    PubMed

    Shapo, Jacqueline L; Moeller, Peter D; Galloway, Sylvia B

    2007-09-01

    Antimicrobial activity was examined in the gorgonian Leptogorgia virgulata (common seawhip) from South Carolina waters. Extraction and assay protocols were developed to identify antimicrobial activity in crude extracts of L. virgulata. Detection was determined by liquid growth inhibition assays using Escherichia coli BL21, Vibrio harveyii, Micrococcus luteus, and a Bacillus sp. isolate. This represents the first report of antimicrobial activity in L. virgulata, a temperate/sub-tropical coral of the western Atlantic Ocean. Results from growth inhibition assays guided a fractionation scheme to identify active compounds. Reverse-phase HPLC, HPLC-mass spectrometry, and 1H and 13C NMR spectroscopy were used to isolate, purify, and characterize metabolites in antimicrobial fractions of L. virgulata. Corroborative HPLC-MS/NMR evidence validated the presence of homarine and a homarine analog, well-known emetic metabolites previously isolated from L. virgulata, in coral extracts. In subsequent assays, partially-purified L. virgulata fractions collected from HPLC-MS fractionation were shown to contain antimicrobial activity using M. luteus and V. harveyii. This study provides evidence that homarine is an active constituent of the innate immune system in L. virgulata. We speculate it may act synergistically with cofactors and/or congeners in this octocoral to mount a response to microbial invasion and disease.

  12. Biotechnological methods for chalcone reduction using whole cells of Lactobacillus, Rhodococcus and Rhodotorula strains as a way to produce new derivatives.

    PubMed

    Stompor, Monika; Kałużny, Mateusz; Żarowska, Barbara

    2016-10-01

    Microbial strains of the genera Dietzia, Micrococcus, Pseudomonas, Rhodococcus, Gordonia, Streptomyces, Pseudomonas, Bacillus, Penicillium, Rhodotorula and Lactobacillus were screened for the ability to convert chalcones. Synthesis of chalcones was performed by the Claisen-Schmidt reaction. There were three groups of chalcones obtained as the products, which included the derivatives containing 4-substituted chalcone, 2'-hydroxychalcone and 4'-methoxychalcone. The B ring of the chalcones was substituted in the para position with different groups, such as halide, hydroxyl, nitro, methyl, ethyl and ethoxy one. The structure-activity relationship of the tested chalcones in biotransformation processes was studied. It has been proven that Gram-positive bacterial strains Rhodococcus and Lactobacillus catalyzed reduction of C=C bond in the chalcones to give respective dihydrochalcones. The strain Rhodotorula rubra AM 82 transformed chalcones into dihydrochalcones and respective secondary alcohols. These results suggest that the probiotic strain of Lactobacillus can be used for biotransformations of chalcones, which has not been described before. The structure of new metabolites 14a and 15b were established as 4-ethoxy-4'-methoxydihydrochalcone and 3-(4-bromophenyl)-1-(4'-O-methylphenyl)-2-propan-1-ol, respectively, which was confirmed by (1)H NMR and (13)C NMR analysis.

  13. Insights into the skin microbiome dynamics of leprosy patients during multi-drug therapy and in healthy individuals from Brazil.

    PubMed

    Silva, Paulo E S; Reis, Mariana P; Ávila, Marcelo P; Dias, Marcela F; Costa, Patrícia S; Suhadolnik, Maria L S; Kunzmann, Bárbara G; Carmo, Anderson O; Kalapotakis, Evanguedes; Chartone-Souza, Edmar; Nascimento, Andréa M A

    2018-06-08

    Leprosy is a chronic infectious peripheral neuropathy that is caused by Mycobacterium leprae, and the skin is one of its preferred target sites. However, the effects of this infection on the skin microbiome remain largely unexplored. Here, we characterize and compare the lesional and non-lesional skin microbiomes of leprosy patients and healthy individuals through the deep sequencing of 16 S rRNA genes. Additionally, a subset of patients was monitored throughout the multi-drug therapy to investigate its effect on the leprous skin microbiome. Firmicutes-associated OTUs (primarily Staphylococcus) prevailed in healthy individuals. By contrast, Firmicutes was underrepresented and Proteobacteria was enriched in the patients' skin, although a single dominant taxon has not been observed at a finer taxonomic resolution. These differences can be explained by the significant decrease in Staphylococcus and Streptococcus as well as the enrichment in Brevundimonas. The overrepresentation of Micrococcus in patients is also remarkable. Genus-level compositional profiles revealed no significant intrapersonal difference between lesional and non-lesional sites. Treatment-associated changes indicated a loss of diversity and a shift in the community composition, with stronger impacts on the OTUs that are considered indigenous bacteria. Therefore, the molecular signatures associated with leprosy identified herein might be of importance for early diagnostics.

  14. Microbial quality of some vegetables sold in ED DueimTwon, Sudan.

    PubMed

    Goja, Arafat Mohammed; Mahmoud, Mohamed Salih Osman

    2013-06-15

    This study was probably the first research carried out to investigate the microbiological quality of some vegetables sold in ED DueimTwon, Sudan. Four species of vegetables were used, Arugula (Eruca sativa), Mloukhia (Corchorus olitorius), Tomato (Lycopersicon esculentum) and Green pepper (Capsicum annuum). The samples were collected and examined according to standardized methods for total viable bacteria, coliforms and fecal coliform count. The average of total viable count ranged from 1.2 x 105-5.6 x 105 CFU mL(-1) for Arugula; 2.1 x 105-2.8 x 107 CFU mL(-1) for Mloukhia; 3.4 x 105-4.8 x 105 for Tomato and 2.3 x 105-8.0 x 106 CFU mL(-1) for Green pepper. However, the maximum level of total and fecal coliform were (93, 21); (28, 11); (75, 15) and (150, 20) MPN 100 mL(-1), respectively. Twelve bacteria belonging to five genera were isolated. Staphylococcus (33%) was the most predominant isolated followed by Enterobacteriaceae (25%), Bacillus (17%) and Streptococcus (17%). Micrococcus (8%) was the least dominant isolated. The results of microbial counts of these vegetable samples in this study indicate that, the agricultural practices, harvesting, hygiene, transporting and selling points are poor and therefore, the higher microbial load could be risked for public health.

  15. Composition and antimicrobial activity of the essential oils of Laserpitium latifolium L. and L. ochridanum Micevski (Apiaceae).

    PubMed

    Popović, Višnja B; Petrović, Silvana D; Milenković, Marina T; Drobac, Milica M; Couladis, Maria A; Niketić, Marjan S

    2015-01-01

    The chemical composition and antimicrobial activity of essential oils of Laserpitium latifolium and L. ochridanum were investigated. The essential oils were isolated by steam distillation and characterized by GC-FID and GC/MS analyses. All essential oils were distinguished by high contents of monoterpenes, and α-pinene was the most abundant compound in the essential oils of L. latifolium underground parts and fruits (contents of 44.4 and 44.0%, resp.). The fruit essential oil was also rich in sabinene (26.8%). Regarding the L. ochridanum essential oils, the main constituents were limonene in the fruit oil (57.7%) and sabinene in the herb oil (25.9%). The antimicrobial activity of these essential oils as well as that of L. ochridanum underground parts, whose composition was reported previously, was tested by the broth-microdilution method against four Gram-positive and three Gram-negative bacteria and two Candida albicans strains. Except the L. latifolium underground-parts essential oil, the other investigated oils showed a high antimicrobial potential against Staphylococcus aureus, S. epidermidis, Micrococcus luteus, or Candida albicans (minimal inhibitory concentrations of 13.0-73.0 μg/ml), comparable to or even higher than that of thymol, which was used as reference compound. Copyright © 2015 Verlag Helvetica Chimica Acta AG, Zürich.

  16. Facile fabrication and characterization of chitosan-based zinc oxide nanoparticles and evaluation of their antimicrobial and antibiofilm activity

    NASA Astrophysics Data System (ADS)

    Dhillon, Gurpreet Singh; Kaur, Surinder; Brar, Satinder Kaur

    2014-06-01

    The present investigation deals with the facile synthesis and characterization of chitosan (CTS)-based zinc oxide (ZnO) nanoparticles (NPs) and their antimicrobial activities against pathogenic microorganisms. ZnO-CTS NPs were synthesized through two different methods: nano spray drying and precipitation, using various organic compounds (citric acid, glycerol, starch and whey powder) as stabilizers. Both the synthesis methods were simple and were devoid of any chemical usage. The detailed characterization of the NPs was carried out using UV-Vis spectroscopy, dynamic light scattering particle size analysis, zeta potential measurements and scanning electron microscopy, which confirmed the fabrication of NPs with different shapes and sizes. Antimicrobial assay of synthesized ZnO-CTS NPs was carried out against different pathogenic microbial strains ( Candida albicans, Micrococcus luteus and Staphylococcus aureus). The significant ( p < 0.05) inhibition of growth was observed for both M. luteus and S. aureus with ZnO-CTS NPs (with a concentration ranging from 0.625 to 0.156 mg/ml) as compared to control treatment. ZnO-CTS NPs also showed significant biofilm inhibition activity ( p < 0.05) against M. luteus and S. aureus. The study demonstrated the potential of ZnO-CTS NPs as antimicrobial and antibiofilm agents.

  17. Potential impact of Andrassy bentonite microbial diversity in the long-term performance of a deep nuclear waste repository

    NASA Astrophysics Data System (ADS)

    Tadza, M. Y. Mohd; Tadza, M. A. Mohd; Bag, R.; Harith, N. S. H.

    2018-01-01

    Copper and steel canning and bentonite buffer are normally forseen as the primary containment component of a deep nuclear waste repository. Distribution of microbes in subsurface environments have been found to be extensive and directly or indirectly may exert influence on waste canister corrosion and the mobility of radionuclides. The understanding of clays and microbial interaction with radionuclides will be useful in predicting the microbial impacts on the performance of the waste repositories. The present work characterizes the culture-dependent microbial diversity of Andrassy bentonite recovered from Tawau clay deposits. The evaluation of microbial populations shows the presence of a number of cultivable microbes (e.g. Staphylococcus, Micrococcus, Achromobacter, Bacillus, Paecilomyces, Trichoderma, and Fusarium). Additionally, a pigmented yeast strain Rhodotorula mucilaginosa was also recovered from the formation. Both Bacillus and Rhodotorula mucilaginosa have high tolerance towards U radiation and toxicity. The presence of Rhodotorula mucilaginosa in Andrassy bentonite might be able to change the speciation of radionuclides (e.g. uranium) in a future deep repository. However, concern over the presence of Fe (III) reduction microbes such as Bacillus also found in the formation could lead to corrosion of copper steel canister and affect the overall performance of the containment system.

  18. Antagonistic intestinal microflora produces antimicrobial substance inhibitory to Pseudomonas species and other spoilage organisms.

    PubMed

    Hatew, Bayissa; Delessa, Tenagne; Zakin, Vered; Gollop, Natan

    2011-10-01

    Chicken intestine harbors a vast number of bacterial strains. In the present study, antimicrobial substance produced by lactic acid bacteria (LAB) isolated from the gastrointestinal tract of healthy chicken was detected, characterized, and purified. Based on 16S rRNA sequencing, the bacteria were identified as Lactobacillus plantarum vN. The antimicrobial substance produced by this bacterium was designated vN-1 and exhibited a broad-spectrum of activity against many important pathogenic and spoilage microorganisms, including Pseudomonas aeruginosa, Staphylococcus aureus, Micrococcus luteus, Salmonella Typhimurium, and Erwinia amylovova. vN-1 was determined to be thermostable, insensitive to pH values ranging from 2.0 to 8.0, resistant to various organic solvents and to enzymatic inactivation. The inhibition kinetics displayed a bactericidal mode of action. This study revealed an antimicrobial substance with low molecular mass of less than 1 kDa as determined by ultrafiltration and having features not previously reported for LAB isolated from chicken intestines. The detection of this antimicrobial substance addresses an important aspect of biotechnological control agents of spoilage caused by Pseudomonas spp. and promises the possibility for preservation of refrigerated poultry meat. Practical Application:  The newly characterized antimicrobial substance and designated as vN-1 may have the potential to be used in food preservation. © 2011 Institute of Food Technologists®

  19. Heat treatment effects on the antimicrobial activity of macrolide and lincosamide antibiotics in milk.

    PubMed

    Zorraquino, M A; Althaus, R L; Roca, M; Molina, M P

    2011-02-01

    Antibiotic residues in milk can cause serious problems for consumers and the dairy industry. Heat treatment of milk may diminish the antimicrobial activity of these antibiotic residues. This study analyzed the effect of milk processing (60 °C for 30 min, 120 °C for 20 min, and 140 °C for 10 s) on the antimicrobial activity of milk samples fortified with three concentrations of three macrolides (erythromycin: 20, 40 and 80 μg/liter; spiramycin: 100, 200, and 400 μg/liter; and tylosin: 500, 1,000, and 2,000 μg/liter) and one lincosamide (lincomycin: 1,000, 2,000, and 4,000 μg/liter). To measure the loss of antimicrobial activity, a bioassay based on the growth inhibition of Micrococcus luteus was done. The data were analyzed using a multiple linear regression model. The results indicate that treatment at 120 °C for 20 min produces inactivation percentages of 93% (erythromycin), 64% (spiramycin), 51% (tylosin), and 5% (lincomycin), while treatment at 140 °C for 10 s results in generally lower percentages (30% erythromycin, 35% spiramycin, 12% tylosin, and 5% lincomycin). The lowest loss or lowest reduction of antimicrobial activity (21% erythromycin and 13% spiramycin) was obtained by treatment at 60 °C for 30 min. Copyright ©, International Association for Food Protection

  20. Seasonal variability in size-segregated airborne bacterial particles and their characterization at different source-sites.

    PubMed

    Agarwal, Smita

    2017-05-01

    Size-segregated aerosol samplings were carried out near the potential sources of airborne biological particles i.e. at a landfill site, an agricultural field and a road side restaurant-cluster site in winter, spring and summer seasons during 2013-2015 in New Delhi. The culturable airborne bacterial (CAB) concentrations showed significant seasonal variation from higher to moderate in spring and winter seasons and lowest during summer. Highest CAB concentrations were observed at the Okhla landfill site followed by restaurant-cluster area and agriculture site. The CAB particles showed bimodal size distribution, abundant in the size ranges of 1.1-2.1, 2.1-3.3 and 4.7-5.8 μm. However, substantial concentrations were also observed in the size bins of 0.43-0.65 and <0.43 μm, which are important for cloud condensation nuclei (CCN) activity of aerosols in addition to their adverse health effects. In spring, bacterial particles were also maximized in size ranges between 5.8 and >9.0 μm. Fine mode proportions of CAB were found to be higher in winter than other two seasons. Bacterial identification was done by 16s rDNA sequencing, and most abundant identified strains were Bacillus cereus (16%), Bacillus licheniformis (11%), Bacillus thuringiensis (9%), Micrococcus sp. (7%) and Acinetobacter sp. (9%).

  1. Microencapsulation, Chemical Characterization, and Antimicrobial Activity of Mexican (Lippia graveolens H.B.K.) and European (Origanum vulgare L.) Oregano Essential Oils

    PubMed Central

    Regalado-González, Carlos; Vázquez-Landaverde, Pedro; Guerrero-Legarreta, Isabel; García-Almendárez, Blanca E.

    2014-01-01

    The effect of solvent polarity (methanol and pentane) on the chemical composition of hydrodistilled essential oils (EO's) of Lippia graveolens H.B.K. (MXO) and Origanum vulgare L. (EUO) was studied by GC-MS. Composition of modified starch microencapsulated EO's was conducted by headspace-solid-phase microextraction (HS-SPME). The antimicrobial activity of free and microencapsulated EO's was evaluated. They were tested against Salmonella sp., Brochothrix thermosphacta, Pseudomonas fragi, Lactobacillus plantarum, and Micrococcus luteus. Thymol and carvacrol were among the main components of EO's and their free and microencapsulated inhibitory activity was tested against M. luteus, showing an additive combined effect. Chemical composition of EO's varied according to the solvent used for GC analysis and to volatile fraction as evaluated by HS-SPME. Thymol (both solvents) was the main component in essential oil of MXO, while carvacrol was the main component of the volatile fraction. EUO showed α-pinene (methanol) and γ-terpinene (pentane) as major constituents, the latter being the main component of the volatile fraction. EO's showed good stability after 3 months storage at 4°C, where antimicrobial activity of microencapsulated EO's remained the same, while free EO's decreased 41% (MXO) and 67% (EUO) from initial activity. Microencapsulation retains most antimicrobial activity and improves stability of EO's from oregano. PMID:25177730

  2. COAGGREGATION OCCURS AMONGST BACTERIA WITHIN AND BETWEEN DOMESTIC SHOWERHEAD BIOFILMS

    PubMed Central

    Vornhagen, Jay; Stevens, Michael; McCormick, David; Dowd, Scot E.; Eisenberg, Joseph N.S.; Boles, Blaise R.; Rickard, Alexander H.

    2014-01-01

    Showerheads support the development multi-species biofilms that can be unsightly, produce malodor, and may harbor pathogens. The outer surface spray plates of many showerheads support visible biofilms that likely contain a mixture of bacteria from freshwater and potentially from human users. Coaggregation, a mechanism by which genetically distinct bacteria specifically recognize one another, may contribute to the retention and enrichment of different species within these biofilms. The aim of this work was to identify the bacterial composition of outer spray plate biofilms of three domestic shower heads and to determine the inter- and intra-biofilm coaggregation ability of each culturable isolate. The bacterial composition of the three biofilms was determined by using bacterial tag-encoded FLX amplicon pyrosequencing (bTEFAP) and by culturing on R2A medium. An average of 31 genera per biofilm were identified using bTEFAP and a total of 30 isolates were cultured. Even though the microbial diversity of each showerhead biofilm differed, every cultured isolate was able to coaggregate with at least one other isolate from the same or different showerhead biofilm. Promiscuous coaggregating isolates belonged to the genera Brevundimonas, Micrococcus, and Lysobacter. This work suggests that coaggregation may be a common feature of showerhead biofilms. Characterization of the mechanisms mediating coaggregation, and the inter-species interactions they facilitate, may allow for novel strategies to inhibit biofilm development. PMID:23194413

  3. Exploring multi potential uses of marine bacteria; an integrated approach for PHB production, PAHs and polyethylene biodegradation.

    PubMed

    Mohanrasu, K; Premnath, N; Siva Prakash, G; Sudhakar, Muniyasamy; Boobalan, T; Arun, A

    2018-05-19

    There are copious of bacteria exist in marine environment and it is very important to screen the potential microbes that has the ability to produce biopolymer polyhydroxybutyrate (PHB) as well as polycyclic aromatic hydrocarbons (PAHs) degradation and conventional plastic high density polyethylene (HDPE) biodegradation. Numerous studies have been investigated individually on either one of characteristic feature like PHB production, PAHs and high density polyethylene (HDPE) degradation, but not all together. Hence, in this study, we tried to screen potential marine microbes that have the ability to perform all three features. We have isolated 203 phenotyphicaly different colonies from 19 different sites (marine soil sediments, marine water and oil spilled marine water) which cover the north east to down south seashore regions of Tamilnadu, India. Of the 203 microbial isolates, the best PHB producing (Micrococcus luteus), PAHs degradation (Klebsiella pneumonia) and HDPE degradation (Brevibacillus borstelensis) microorganisms were identified through 16S rRNA sequencing. Analytical studies confirmed PHB production by fourier transform infrared spectroscopy (FT-IR) and nuclear magnetic resonance ( 1 H & 13 C NMR); PAHs degradation by high performance liquid chromatography (HPLC), confocal laser scanning microscopy (CLSM), scanning electron microscopy (SEM); HDPE degradation by CLSM, FT-IR and SEM which cover the spectroscopy studies on biological systems. Copyright © 2018. Published by Elsevier B.V.

  4. Experimental evidence of chemical defence mechanisms in Antarctic bryozoans.

    PubMed

    Figuerola, Blanca; Angulo-Preckler, Carlos; Núñez-Pons, Laura; Moles, Juan; Sala-Comorera, Laura; García-Aljaro, Cristina; Blanch, Anicet R; Avila, Conxita

    2017-08-01

    Bryozoans are among the most abundant and diverse members of the Antarctic benthos, however the role of bioactive metabolites in ecological interactions has been scarcely studied. To extend our knowledge about the chemical ecology of Antarctic bryozoans, crude ether extracts (EE) and butanol extracts (BE) obtained from two Antarctic common species (Cornucopina pectogemma and Nematoflustra flagellata), were tested for antibacterial and repellent activities. The extracts were screened for quorum quenching and antibacterial activities against four Antarctic bacterial strains (Bacillus aquimaris, Micrococcus sp., Oceanobacillus sp. and Paracoccus sp.). The Antarctic amphipod Cheirimedon femoratus and the sea star Odontaster validus were selected as sympatric predators to perform anti-predatory and substrate preference assays. No quorum quenching activity was detected in any of the extracts, while all EE exhibited growth inhibition towards at least one bacterium strain. Although the species were not repellent against the sea star, they caused repellence to the amphipods in both extracts, suggesting that defence activities against predation derive from both lipophilic and hydrophilic metabolites. In the substrate preference assays, one EE and one BE deriving from different specimens of the species C. pectogemma were active. This study reveals intraspecific variability of chemical defences and supports the fact that chemically mediated interactions are common in Antarctic bryozoans as means of protection against fouling and predation. Copyright © 2017 Elsevier Ltd. All rights reserved.

  5. Microbiological and biochemical origins of human axillary odour.

    PubMed

    James, A Gordon; Austin, Corrine J; Cox, Diana S; Taylor, David; Calvert, Ralph

    2013-03-01

    The generation of malodour on various sites of the human body is caused by the microbial biotransformation of odourless natural secretions into volatile odorous molecules. On the skin surface, distinctive odours emanate, in particular, from the underarm (axilla), where a large and permanent population of microorganisms thrives on secretions from the eccrine, apocrine and sebaceous glands. Traditional culture-based microbiological studies inform us that this resident microbiota consists mainly of Gram-positive bacteria of the genera Staphylococcus, Micrococcus, Corynebacterium and Propionibacterium. Among the molecular classes that have been implicated in axillary malodour are short- and medium-chain volatile fatty acids, 16-androstene steroids and, most recently, thioalcohols. Most of the available evidence suggests that members of the Corynebacterium genus are the primary causal agents of axillary odour, with the key malodour substrates believed to originate from the apocrine gland. In this article, we examine, in detail, the microbiology and biochemistry of malodour formation on axillary skin, focussing on precursor-product relationships, odour-forming enzymes and metabolic pathways and causal organisms. As well as reviewing the literature, some relevant new data are presented and considered alongside that already available in the public domain to reach an informed view on the current state-of-the-art, as well as future perspectives. © 2012 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

  6. The inhibitory effects of wine phenolics on lysozyme activity against lactic acid bacteria.

    PubMed

    Guzzo, F; Cappello, M S; Azzolini, M; Tosi, E; Zapparoli, G

    2011-08-15

    The lysozyme of hen's egg white is used in winemaking to control spontaneous lactic acid bacteria (LAB). A total of eight LAB strains, isolated from grape must and wine, were used to assess the inhibitory effects of wine phenolics on lysozyme activity. The presence of phenolics, extracted from grape pomace, in growth medium reduced the mortality rate due to the lysozyme activity. This effect was especially clear in the case of strains belonging to Lactobacillus uvarum, Pediococcus parvulus and Oenococccus oeni, which are more sensitive to lysozyme than L. plantarum and L. hilgardii strains. Cell lysis assays carried out on four strains sensitive to lysozyme and Micrococcus lysodeikticus ATCC 4698, used as a reference strain, confirmed the inhibition of grape pomace phenolics on the muramidase. There was no interference from non-flavonoids, flavanols and flavonol compounds, when they were tested individually, on the lysozyme activity against the strains. Anthocyanins extracted from grape skins slightly inhibited the activity only against M. lysodeikticus. However, proanthocyanidins extracted from seed berries, strongly inhibited the lysozyme. In this extract, dimers were the predominant oligomers of flavan-3-ol. The study demonstrated that the effectiveness of lysozyme against LAB in red winemaking is related to the amount of low molecular weight proanthocyanidins that are released when the grapes are macerating. Copyright © 2011 Elsevier B.V. All rights reserved.

  7. Studies on interaction of colloidal silver nanoparticles (SNPs) with five different bacterial species.

    PubMed

    Khan, S Sudheer; Mukherjee, Amitava; Chandrasekaran, N

    2011-10-01

    Silver nanoparticles (SNPs) are being increasingly used in many consumer products like textile fabrics, cosmetics, washing machines, food and drug products owing to its excellent antimicrobial properties. Here we have studied the adsorption and toxicity of SNPs on bacterial species such as Pseudomonas aeruginosa, Micrococcus luteus, Bacillus subtilis, Bacillus barbaricus and Klebsiella pneumoniae. The influence of zeta potential on the adsorption of SNPs on bacterial cell surface was investigated at acidic, neutral and alkaline pH and with varying salt (NaCl) concentrations (0.05, 0.1, 0.5, 1 and 1.5 M). The survival rate of bacterial species decreased with increase in adsorption of SNPs. Maximum adsorption and toxicity was observed at pH 5, and NaCl concentration of <0.5 M. A very less adsorption was observed at pH 9 and NaCl concentration >0.5 M, there by resulting in less toxicity. The zeta potential study suggests that, the adsorption of SNPs on the cell surface was related to electrostatic force of attraction. The equilibrium and kinetics of the adsorption process were also studied. The adsorption equilibrium isotherms fitted well to the Langmuir model. The kinetics of adsorption fitted best to pseudo-first-order. These findings form a basis for interpreting the interaction of nanoparticles with environmental bacterial species. Copyright © 2011 Elsevier B.V. All rights reserved.

  8. Nitrite pickling salt as an alternative to formaldehyde for embalming in veterinary anatomy--A study based on histo- and microbiological analyses.

    PubMed

    Janczyk, Pawel; Weigner, Janet; Luebke-Becker, Antina; Kaessmeyer, Sabine; Plendl, Johanna

    2011-02-20

    Formaldehyde, the traditional embalming agent has negative health effects. Nitrite pickling salt has been reported to be a good and inexpensive alternative when supplemented with antioxidants, but the antioxidants caused yellowish colouration of cadavers, and damaged corrosion-resistant steel tables and stone floors. Here, nitrite pickling salt was supplemented with ethanol and Pluriol(®) and tested for effectiveness as an embalming agent of twenty dog cadavers: 10 with open, and 10 with closed abdominal cavity. The texture of the tissue was monitored intermittently for 12 months throughout the course of an anatomical dissection class. Histological and microbiological analysis of samples from muscles, lungs, duodenum and colon were performed. Dogs with an open abdomen remained suitable for dissection purposes during the entire course. The abdominal organs of the closed cadavers lost their natural features, without histological signs of autolysis. Enterococcus spp., Staphylococcus spp., Micrococcus spp., Bacillus spp. and Clostridium perfringens were recorded after 24 weeks. The open cadavers underwent additional maintenance via renewed treatment with ethanol and Pluriol(®) after each dissection. After 30 weeks, C. perfringens was massively reduced in the colon of the open cadavers. The tested solution successfully embalms open bodies, carries no health risks and is environmentally friendly and cost effective. Copyright © 2010 Elsevier GmbH. All rights reserved.

  9. Recovery and screening for antibiotic susceptibility of potential bacterial pathogens from the oral cavity of shark species involved in attacks on humans in Recife, Brazil.

    PubMed

    Interaminense, J A; Nascimento, D C O; Ventura, R F; Batista, J E C; Souza, M M C; Hazin, F H V; Pontes-Filho, N T; Lima-Filho, J V

    2010-08-01

    The number of incidents involving sharks and humans at beaches in Recife, on the north-eastern Brazilian coast, is among the highest worldwide. In addition, wound infections in survivors are common; but the nature and risk of the aetiological agents is unknown. In the present study, 81 potential bacterial pathogens were identified in the oral cavity of sharks involved in attacks in Recife, and were subjected to antibiotic susceptibility tests using the standardized disc-diffusion method. The majority were enterobacteria such as Enterobacter spp., Citrobacter spp., Proteus spp., Providencia alcalifaciens, Escherichia coli, Moellerella wisconcensis and Leclercia adecarboxylata. Other Gram-negative bacteria included Vibrio spp., Burkholderia cepacia, Acinetobacter spp. and Pseudomonas spp. In addition, coagulase-positive and coagulase-negative Staphylococcus spp., Enterococcus spp. and Micrococcus spp. were identified, besides Streptococcus spp. from the viridans group. Resistance was especially found in the Proteus mirabilis and Citrobacter freundii, and ranged from 4 to 6 antibiotics out of the 13 tested. Gentamicin and vancomycin were the most effective against Gram-positive cocci strains, whereas levofloxacin was fully inhibitory against Gram-positive and Gram-negative bacteria. These data are discussed in light of a retrospective evaluation of the medical records of three shark victims treated at Restauração Hospital in Recife.

  10. Biochemical Properties and Mechanism of Action of Enterocin LD3 Purified from Enterococcus hirae LD3.

    PubMed

    Gupta, Aabha; Tiwari, Santosh Kumar; Netrebov, Victoria; Chikindas, Michael L

    2016-09-01

    Enterocin LD3 was purified using activity-guided multistep chromatography techniques such as cation-exchange and gel-filtration chromatography. The preparation's purity was tested using reverse-phase ultra-performance liquid chromatography. The specific activity was tested to be 187.5 AU µg(-1) with 13-fold purification. Purified enterocin LD3 was heat stable up to 121 °C (at 15 psi pressure) and pH 2-6. The activity was lost in the presence of papain, reduced by proteinase K, pepsin and trypsin, but was unaffected by amylase and lipase, suggesting proteinaceous nature of the compound and no role of carbohydrate and lipid moieties in the activity. MALDI-TOF/MS analysis of purified enterocin LD3 resolved m/z 4114.6, and N-terminal amino acid sequence was found to be H2NQGGQANQ-COOH suggesting a new bacteriocin. Dissipation of membrane potential, loss of internal ATP and bactericidal effect were recorded when indicator strain Micrococcus luteus was treated with enterocin LD3. It inhibited Gram-positive and Gram-negative bacteria including human pathogens such as Staphylococcus aureus, Pseudomonas fluorescens, Pseudomonas aeruginosa, Salmonella typhi, Shigella flexneri, Listeria monocytogenes, Escherichia coli O157:H7, E. coli (urogenic, a clinical isolate) and Vibrio sp. These properties of purified enterocin LD3 suggest its applications as a food biopreservative and as an alternative to clinical antibiotics.

  11. Leptoglycin: a new Glycine/Leucine-rich antimicrobial peptide isolated from the skin secretion of the South American frog Leptodactylus pentadactylus (Leptodactylidae).

    PubMed

    Sousa, Juliana C; Berto, Raquel F; Gois, Elicélia A; Fontenele-Cardi, Nauíla C; Honório, José E R; Konno, Katsuhiro; Richardson, Michael; Rocha, Marcos F G; Camargo, Antônio A C M; Pimenta, Daniel C; Cardi, Bruno A; Carvalho, Krishnamurti M

    2009-07-01

    Antimicrobial peptides are components of innate immunity that is the first-line defense against invading pathogens for a wide range of organisms. Here, we describe the isolation, biological characterization and amino acid sequencing of a novel neutral Glycine/Leucine-rich antimicrobial peptide from skin secretion of Leptodactylus pentadactylus named leptoglycin. The amino acid sequence of the peptide purified by RP-HPLC (C(18) column) was deduced by mass spectrometric de novo sequencing and confirmed by Edman degradation: GLLGGLLGPLLGGGGGGGGGLL. Leptoglycin was able to inhibit the growth of Gram-negative bacteria Pseudomonas aeruginosa, Escherichia coli and Citrobacter freundii with minimal inhibitory concentrations (MICs) of 8 microM, 50 microM, and 75 microM respectively, but it did not show antimicrobial activity against Gram-positive bacteria (Staphylococcus aureus, Micrococcus luteus and Enterococcus faecalis), yeasts (Candida albicans and Candida tropicalis) and dermatophytes fungi (Microsporum canis and Trichophyton rubrum). No hemolytic activity was observed at the 2-200 microM range concentration. The amino acid sequence of leptoglycin with high level of glycine (59.1%) and leucine (36.4%) containing an unusual central proline suggests the existence of a new class of Gly/Leu-rich antimicrobial peptides. Taken together, these results suggest that this natural antimicrobial peptide could be a tool to develop new antibiotics.

  12. Activity and immunodetection of lysozyme in earthworm Dendrobaena veneta (Annelida).

    PubMed

    Fiołka, Marta J; Zagaja, Mirosław P; Hułas-Stasiak, Monika; Wielbo, Jerzy

    2012-01-01

    In the present study, lysozyme-like activity against Micrococcus luteus was detected in the coelomic fluid, the extract from coelomocytes, intestine and in the homogenates from cocoons of Dendrobaena veneta. Four hours after immunization with Escherichia coli, the lysozyme activity in the coelomic fluid increased about three times and in the extract of coelomocytes - four times, in comparison to the control. In three cases: of the coelomic fluid, the homogenates from cocoons and the extract from coelomocytes, the antibody against HEWL (hen egg white lysozyme) recognized only one protein with a molecular mass of about 14.4 kDa. In the coelomic fluid, apart from the protein with molecular mass of 14.4 kDa the antibody directed against human lysozyme recognized an additional protein of 22 kDa. Using the bioautography technique after electrophoretic resolution of native proteins in acidic polyacrylamide gels, two lytic zones of M. luteus were observed in the case of the coelomic fluid and three after the analysis of the extract of coelomocytes and the egg homogenates. The results indicated the existence of several forms of lysozyme with a different electric charge in the analyzed D. veneta samples. The highest lysozyme activity in the intestine of D. veneta was observed in the midgut. The antibody directed against human lysozyme indicated a strong positive signal in epidermal and midgut cells of earthworm. Copyright © 2011 Elsevier Inc. All rights reserved.

  13. Comparative Study of Hydroalcoholic Extracts of Momordica charantia L. against Foodborne Pathogens

    PubMed Central

    Rakholiya, Kalpna; Vaghela, P.; Rathod, T.; Chanda, Sumitra

    2014-01-01

    The antimicrobial effect of 24 different hydroalcoholic extracts (100, 75, 50 and 25% methanol and water) obtained from four parts (leaf+stem (aerial), peel, pulp and seed) of Momordica charantia L. were investigated against five Gram-positive, six Gram-negative and four fungal strains. The extraction was done by individual cold percolation method using hexane, different hydroalcoholic solvent (100, 75, 50 and 25% methanol) and water. The antimicrobial activity was done by agar well diffusion assay. The extracts, which showed >15 mm zone of inhibition, were further screened to determine minimum inhibitory concentration and minimum bactericidal concentration using a broth dilution method performed in 96-well microtitre plate. The extractive yield was highest in aqueous extracts of all the four parts closely followed by 25% methanol. Micrococcus flavus was the most susceptible Gram-positive bacteria and Pseudomonas testosteroni was the most susceptible Gram-negative bacteria. The highest antibacterial activity was shown by 100% methanol. The Gram-negative Pseudomonas spp. was more susceptible towards all the extracts than the Gram-positive bacteria or fungal strains investigated. One hundred percent and 50% methanol extracts of seed showed lowest minimum inhibitory concentration and minimum bactericidal concentration values, that is <39 and 625 μg/ml, respectively, against Pseudomonas pictorum. Therefore, these extracts would be of interest in the control of Pseudomonas spp. in food industry as well as used for therapeutic purposes. PMID:24843188

  14. The effects of garlic-supplemented diets on skin mucosal immune responses, stress resistance and growth performance of the Caspian roach (Rutilus rutilus) fry.

    PubMed

    Ghehdarijani, Mahbubeh Salmanian; Hajimoradloo, Abdolmajid; Ghorbani, Rasol; Roohi, Zahra

    2016-02-01

    This study was conducted to evaluate the effects of garlic supplementation on some skin mucus immune parameters, mucus antimicrobial activity and growth performance of the Caspian roach (Rutilus rutilus caspicus) fry. Fish (1 ± 0.07 g) were divided into four groups fed diets containing 0 (control), 5, 10 and 15 g kg(-1) garlic for 8 weeks. The results showed that there was a significant increase in weight gain and specific growth rate in those fish fed garlic diets compared with the control (P < 0.05). Condition factor was not significantly affected by garlic dosage. At the end of trial, the epidermal mucus protein level, alkaline phosphatase and antimicrobial activity against 2 g-negative bacteria (Escherichia coli and Serratia marcescens) and gram-positive bacteria (Streptococcus faecium and Micrococcus luteus) were measured. Skin mucus alkaline phosphatase, protein levels and antimicrobial activity were increased following garlic administration, and the bacterial growth inhibition zones were significantly elevated in garlic-fed fish (P < 0.05). In salinity stress experiment, no differences were observed for survival rate among the experimental diets. No mortality was recorded during the feeding trial. These results indicated that dietary garlic beneficially affects the skin mucus immune parameters and growth performance of the Caspian roach fry. Copyright © 2015 Elsevier Ltd. All rights reserved.

  15. Normal flora of conjunctiva and lid margin, as well as its antibiotic sensitivity, in patients undergoing cataract surgery at Phramongkutklao Hospital.

    PubMed

    Ratnumnoi, Ravee; Keorochana, Narumon; Sontisombat, Chavalit

    2017-01-01

    This study aimed to evaluate the normal flora of conjunctiva and lid margin, as well as its antibiotic sensitivity. This was a prospective cross-sectional study. A prospective study was conducted on 120 patients who underwent cataract surgery at the Phramongkutklao Hospital from September 2014 to October 2014. Conjunctival and lid margin swabs were obtained from patients before they underwent cataract surgery. These swabs were used to inoculate blood agar and chocolate agar plates for culturing. After growth of the normal flora, the antibiotic sensitivity method using tobramycin, moxifloxacin, levofloxacin, and cefazolin was applied. Normal flora of conjunctiva and lid margin, along with its antibiotic sensitivity, from patients who underwent cataract surgery was assessed. A total of 120 eyes were included in this study, and bacterial isolation rates were identified. Five bacteria from the lid margin were cultured, namely, coagulase-negative staphylococcus (58.33%), Streptococcus spp. (2.5%), Corynebacterium (1.67%), Micrococcus spp. (1.67%), and Staphylococcus aureus (0.83%). Two bacteria from the conjunctiva were cultured, namely, coagulase-negative staphylococcus (30%) and Streptococcus spp. (0.83%). Results of antibiotic sensitivity test showed that all isolated bacteria are sensitive to cefazolin 100%, tobramycin 98.67%, levofloxacin 100%, and moxifloxacin 100%. Coagulase-negative staphylococci are the most common bacteria isolated from conjunctiva and lid margin.

  16. Application of autochthonous mixed starter for controlled Kedong sufu fermentation in pilot plant tests.

    PubMed

    Feng, Zhen; Xu, Miao; Zhai, Shuang; Chen, Hong; Li, Ai-li; Lv, Xin-tong; Deng, Hong-ling

    2015-01-01

    Traditional sufu is fermented by back-slopping and back-slopping has many defects. The objective of this study was to apply autochthonous mixed starter to control Kedong sufu fermentation. Sufu was manufactured using back-slopping (batch A) and autochthonous mixed starter (batch B) with Kocuria kristinae F7, Micrococcus luteus KDF1, and Staphylococcus carnosus KDFR1676. Considering physicochemical properties of sufu, 150-day sufu samples from batch A and 90-day sufu samples from batch B met the standard requirements, respectively. Considering sensory characteristics of sufu, 150-day sufu samples from batch A and 90-day sufu samples from batch B showed no significant differences (P > 0.05). The maturation period of sufu was shortened by 60 d. Profiles of free amino acids and peptides partly revealed the mechanism of typical sensory quality and shorter ripening time of sufu manufactured by autochthonous mixed starter. In final products, content of total biogenic amines was reduced by 48%. Autochthonous mixed starter performed better than back-slopping. Fermentation had a positive influence on the quality, safety, and sensory properties of sufu. The application of autochthonous mixed starter does not change the sensory characteristics of traditional fermented sufu. In addition, it reduces maturation period and improves their homogeneity and safety. It is possible to substitute autochthonous mixed starter for back-slopping in the manufacture of sufu. © 2014 Institute of Food Technologists®

  17. Binding of the Biogenic Polyamines to Deoxyribonucleic Acids of Varying Base Composition: Base Specificity and the Associated Energetics of the Interaction

    PubMed Central

    Kabir, Ayesha; Suresh Kumar, Gopinatha

    2013-01-01

    Background The thermodynamics of the base pair specificity of the binding of the polyamines spermine, spermidine, putrescine, and cadaverine with three genomic DNAs Clostridium perfringens, 27% GC, Escherichia coli, 50% GC and Micrococcus lysodeikticus, 72% GC have been studied using titration calorimetry and the data supplemented with melting studies, ethidium displacement and circular dichroism spectroscopy results. Methodology/Principal Findings Isothermal titration calorimetry, differential scanning calorimetry, optical melting studies, ethidium displacement, circular dichroism spectroscopy are the various techniques employed to characterize the interaction of four polyamines, spermine, spermidine, putersine and cadaverine with the DNAs. Polyamines bound stronger with AT rich DNA compared to the GC rich DNA and the binding varied depending on the charge on the polyamine as spermine>spermidine >putrescine>cadaverine. Thermodynamics of the interaction revealed that the binding was entropy driven with small enthalpy contribution. The binding was influenced by salt concentration suggesting the contribution from electrostatic forces to the Gibbs energy of binding to be the dominant contributor. Each system studied exhibited enthalpy-entropy compensation. The negative heat capacity changes suggested a role for hydrophobic interactions which may arise due to the non polar interactions between DNA and polyamines. Conclusion/Significance From a thermodynamic analysis, the AT base specificity of polyamines to DNAs has been elucidated for the first time and supplemented by structural studies. PMID:23894663

  18. Molecular and biochemical characterizations of human oral lactobacilli as putative probiotic candidates.

    PubMed

    Strahinic, I; Busarcevic, M; Pavlica, D; Milasin, J; Golic, N; Topisirovic, L

    2007-04-01

    The objective of this study was to characterize the lactobacilli from the human oral cavity as a potential source of probiotic strains. Samples were collected from four different locations within the oral cavity: surface of healthy tooth, oral mucous membrane, surface of tooth decay and deep tooth decay. On the basis of morphological and biochemical properties eight categories were formed and 26 isolates were selected for further characterization. The isolates were determined as Lactobacillus sp. using primers specific for 16S rDNA. Sequencing of 16S rDNA genes and repetitive sequence-based polymerase chain reactions were used for determination to species and subspecies levels. Predominant species were Lactobacillus fermentum, Lactobacillus plantarum, Lactobacillus salivarius and Lactobacillus paracasei subsp. paracasei, while Lactobacillus acidophilus, Lactobacillus cellobiosus, Lactobacillus delbrueckii subsp. lactis and Lactobacillus gasseri were also present. The isolates Lactobacillus salivarius BGHO1, Lactobacillus fermentum BGHO36 and BGHO64, Lactobacillus gasseri BGHO89 and Lactobacillus delbrueckii subsp. lactis BGHO99 exhibited antagonistic action on the growth of Staphylococcus aureus, Enterococcus faecalis, Micrococcus flavus, Salmonella enteritidis, Streptococcus pneumoniae and Streptococcus mutans, but not on growth of Candida albicans. Moreover, the isolates L. salivarius BGHO1 and L. gasseri BGHO89 were tolerant to low pH and high concentration of bile salts. Taken together, these findings imply that L. salivarius BGHO1 and L. gasseri BGHO89 might be subjects for additional investigation as potential probiotic strains.

  19. Bioprospection of actinobacteria derived from freshwater sediments for their potential to produce antimicrobial compounds.

    PubMed

    Zothanpuia; Passari, Ajit Kumar; Leo, Vincent Vineeth; Chandra, Preeti; Kumar, Brijesh; Nayak, Chandra; Hashem, Abeer; Abd Allah, Elsayed Fathi; Alqarawi, Abdulaziz A; Singh, Bhim Pratap

    2018-05-05

    Actinobacteria from freshwater habitats have been explored less than from other habitats in the search for compounds of pharmaceutical value. This study highlighted the abundance of actinobacteria from freshwater sediments of two rivers and one lake, and the isolates were studied for their ability to produce antimicrobial bioactive compounds. 16S rRNA gene sequencing led to the identification of 84 actinobacterial isolates separated into a common genus (Streptomyces) and eight rare genera (Nocardiopsis, Saccharopolyspora, Rhodococcus, Prauserella, Amycolatopsis, Promicromonospora, Kocuria and Micrococcus). All strains that showed significant inhibition potentials were found against Gram-positive, Gram-negative and yeast pathogens. Further, three biosynthetic genes, polyketide synthases type II (PKS II), nonribosomal peptide synthetases (NRPS) and aminodeoxyisochorismate synthase (phzE), were detected in 38, 71 and 29% of the strains, respectively. Six isolates based on their antimicrobial potentials were selected for the detection and quantification of standard antibiotics using ultra performance liquid chromatography (UPLC-ESI-MS/MS) and volatile organic compounds (VOCs) using gas chromatography mass spectrometry (GC/MS). Four antibiotics (fluconazole, trimethoprim, ketoconazole and rifampicin) and 35 VOCs were quantified and determined from the methanolic crude extract of six selected Streptomyces strains. Infectious diseases still remain one of the leading causes of death globally and bacterial infections caused millions of deaths annually. Culturable actinobacteria associated with freshwater lake and river sediments has the prospects for the production of bioactive secondary metabolites.

  20. Identification and catabolic activity of well-derived gasoline-degrading bacteria from a contaminated aquifer.

    PubMed Central

    Ridgway, H F; Safarik, J; Phipps, D; Carl, P; Clark, D

    1990-01-01

    Approximately 300 gasoline-degrading bacteria were isolated from well water and core material from a shallow coastal aquifer contaminated with unleaded gasoline. Identification of 244 isolates revealed four genera: Pseudomonas, Alcaligenes, Nocardia, and Micrococcus, with pseudomonads making up 86.9% of bacteria identified. A total of 297 isolates was sorted into 111 catabolic groups on the basis of aerobic growth responses on 15 gasoline hydrocarbons. Each test hydrocarbon was degraded by at least one isolate. Toluene, p-xylene, ethylbenzene, and 1,2,4-trimethylbenzene were most frequently utilized as growth substrates, whereas cyclic and branched alkanes were least utilized. Most isolates were able to grow on 2 or 3 different hydrocarbons, and nearly 75% utilized toluene as a sole source of carbon and energy. Isolates were remarkably specific for hydrocarbon usage, often catabolizing only one of several closely related compounds. A subset of 220 isolates was sorted into 51 groups by polyacrylamide gel electrophoresis. Pseudomonas aeruginosa was partitioned into 16 protein-banding groups (i.e., subspecies) whose catabolic activities were largely restricted to substituted aromatics. Different members of subspecies groups defined by protein-banding pattern analysis often exhibited different growth responses on the same hydrocarbon, implying marked strain diversity. The catabolic activities of well-derived, gasoline-degrading bacteria associated with this contaminated aquifer are consonant with in situ adaptation at the site. PMID:2268163

Top