Jia, Weiyi; Wang, Xiaojun; Yen, William; Yen, Laurel C.; Jia, George D.
2012-12-04
Compositions, methods of making compositions, materials including compositions, crayons including compositions, paint including compositions, ink including compositions, waxes including compositions, polymers including compositions, vesicles including the compositions, methods of making each, and the like are disclosed.
Jia, Weiyi; Wang, Xiaojun; Jia, George D.; Lewis, Linda; Yen, Laurel C.
2014-06-24
Compositions, methods of making compositions, materials including compositions, crayons including compositions, paint including compositions, ink including compositions, waxes including compositions, polymers including compositions, vesicles including the compositions, methods of making each, and the like are disclosed.
Lillo, Thomas M.; Chu, Henry S.; Harrison, William M.; Bailey, Derek
2013-01-22
Methods of forming composite materials include coating particles of titanium dioxide with a substance including boron (e.g., boron carbide) and a substance including carbon, and reacting the titanium dioxide with the substance including boron and the substance including carbon to form titanium diboride. The methods may be used to form ceramic composite bodies and materials, such as, for example, a ceramic composite body or material including silicon carbide and titanium diboride. Such bodies and materials may be used as armor bodies and armor materials. Such methods may include forming a green body and sintering the green body to a desirable final density. Green bodies formed in accordance with such methods may include particles comprising titanium dioxide and a coating at least partially covering exterior surfaces thereof, the coating comprising a substance including boron (e.g., boron carbide) and a substance including carbon.
Bio-inspired method to obtain multifunctional dynamic nanocomposites
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kushner, Aaron M.; Guan, Zhibin; Williams, Gregory
A method for a polymeric or nanocomposite material. The method includes assembling a multiphase hard-soft structure, where the structure includes a hard micro- or nano-phase, and a soft micro- or nano-phase that includes a polymeric scaffold. In the method, the polymeric scaffold includes dynamically interacting motifs and has a glass transition temperature (T.sub.g) lower than the intended operating temperature of the material.
Methods for globally treating silica optics to reduce optical damage
Miller, Philip Edward; Suratwala, Tayyab Ishaq; Bude, Jeffrey Devin; Shen, Nan; Steele, William Augustus; Laurence, Ted Alfred; Feit, Michael Dennis; Wong, Lana Louie
2012-11-20
A method for preventing damage caused by high intensity light sources to optical components includes annealing the optical component for a predetermined period. Another method includes etching the optical component in an etchant including fluoride and bi-fluoride ions. The method also includes ultrasonically agitating the etching solution during the process followed by rinsing of the optical component in a rinse bath.
Compositions and methods for treating nuclear fuel
Soderquist, Chuck Z; Johnsen, Amanda M; McNamara, Bruce K; Hanson, Brady D; Smith, Steven C; Peper, Shane M
2013-08-13
Compositions are provided that include nuclear fuel. Methods for treating nuclear fuel are provided which can include exposing the fuel to a carbonate-peroxide solution. Methods can also include exposing the fuel to an ammonium solution. Methods for acquiring molybdenum from a uranium comprising material are provided.
Compositions and methods for treating nuclear fuel
DOE Office of Scientific and Technical Information (OSTI.GOV)
Soderquist, Chuck Z; Johnsen, Amanda M; McNamara, Bruce K
Compositions are provided that include nuclear fuel. Methods for treating nuclear fuel are provided which can include exposing the fuel to a carbonate-peroxide solution. Methods can also include exposing the fuel to an ammonium solution. Methods for acquiring molybdenum from a uranium comprising material are provided.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Mansfield, Lorelle; Ramanathan, Kannan
2017-09-19
Methods for forming CIGS films are provided. According to an aspect of the invention, a method of forming a CIGS film includes a precursor step, which includes simultaneously evaporating Cu, In, Ga, Se, and Sb onto a substrate. The Se is incident on the substrate at a rate of at least 20 .ANG./s. The method also includes a selenization step, which includes evaporating Se over the substrate after the precursor step.
Methods and systems to facilitate reducing NO.sub.x emissions in combustion systems
Lacy, Benjamin Paul [Greer, SC; Kraemer, Gilbert Otto [Greer, SC; Varatharajan, Balachandar [Clifton Park, NY; Yilmaz, Ertan [Albany, NY; Lipinski, John Joseph [Simpsonville, SC; Ziminsky, Willy Steve [Simpsonville, SC
2011-02-15
A method for assembling a gas turbine combustor system is provided. The method includes providing a combustion liner including a center axis, an outer wall, a first end, and a second end. The outer wall is orientated substantially parallel to the center axis. The method also includes coupling a transition piece to the liner second end. The transition piece includes an outer wall. The method further includes coupling a plurality of lean-direct injectors along at least one of the liner outer wall and the transition piece outer wall such that the injectors are spaced axially apart along the wall.
Plastic phase change material and articles made therefrom
DOE Office of Scientific and Technical Information (OSTI.GOV)
Abhari, Ramin
The present invention generally relates to a method for manufacturing phase change material (PCM) pellets. The method includes providing a melt composition, including paraffin and a polymer. The paraffin has a melt point of between about 10.degree. C. and about 50.degree. C., and more preferably between about 18.degree. C. and about 28.degree. C. In one embodiment, the melt composition includes various additives, such as a flame retardant. The method further includes forming the melt composition into PCM pellets. The method further may include the step of cooling the melt to increase the melt viscosity before pelletizing. Further, PCM compounds aremore » provided having an organic PCM and a polymer. Methods are provided to convert the PCM compounds into various form-stable PCMs. A method of coating the PCMs is included to provide PCMs with substantially no paraffin seepage and with ignition resistance properties.« less
System and method of designing models in a feedback loop
Gosink, Luke C.; Pulsipher, Trenton C.; Sego, Landon H.
2017-02-14
A method and system for designing models is disclosed. The method includes selecting a plurality of models for modeling a common event of interest. The method further includes aggregating the results of the models and analyzing each model compared to the aggregate result to obtain comparative information. The method also includes providing the information back to the plurality of models to design more accurate models through a feedback loop.
Geophysical methods in Geology. Second edition
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sharma, P.V.
This book presents an introduction to the methods of geophysics and their application to geological problems. The text emphasizes the broader aspects of geophysics, including the way in which geophysical methods help solve structural, correlational, and geochromological problems. Stress is laid on the principles and applications of methods rather than on instrumental techniques. This edition includes coverage of recent developments in geophysics and geology. New topics are introduced, including paleomagnetic methods, electromagnetic methods, microplate tectronics, and the use of multiple geophysical techniques.
Updates to Selected Analytical Methods for Environmental Remediation and Recovery (SAM)
View information on the latest updates to methods included in EPA's Selected Analytical Methods for Environmental Remediation and Recovery (SAM), including the newest recommended methods and publications.
Motion Estimation System Utilizing Point Cloud Registration
NASA Technical Reports Server (NTRS)
Chen, Qi (Inventor)
2016-01-01
A system and method of estimation motion of a machine is disclosed. The method may include determining a first point cloud and a second point cloud corresponding to an environment in a vicinity of the machine. The method may further include generating a first extended gaussian image (EGI) for the first point cloud and a second EGI for the second point cloud. The method may further include determining a first EGI segment based on the first EGI and a second EGI segment based on the second EGI. The method may further include determining a first two dimensional distribution for points in the first EGI segment and a second two dimensional distribution for points in the second EGI segment. The method may further include estimating motion of the machine based on the first and second two dimensional distributions.
Method for alignment of microwires
DOE Office of Scientific and Technical Information (OSTI.GOV)
Beardslee, Joseph A.; Lewis, Nathan S.; Sadtler, Bryce
2017-01-24
A method of aligning microwires includes modifying the microwires so they are more responsive to a magnetic field. The method also includes using a magnetic field so as to magnetically align the microwires. The method can further include capturing the microwires in a solid support structure that retains the longitudinal alignment of the microwires when the magnetic field is not applied to the microwires.
The 5-Step Method: Principles and Practice
ERIC Educational Resources Information Center
Copello, Alex; Templeton, Lorna; Orford, Jim; Velleman, Richard
2010-01-01
This article includes a description of the 5-Step Method. First, the origins and theoretical basis of the method are briefly described. This is followed by a discussion of the general principles that guide the delivery of the method. Each step is then described in more detail, including the content and focus of each of the five steps that include:…
Transparent ceramics and methods of preparation thereof
Hollingsworth, Joel P [Oakland, CA; Kuntz, Joshua D [Livermore, CA; Seeley, Zachary M [Pullman, WA; Soules, Thomas F [Livermore, CA
2011-10-18
According to one embodiment, a method for forming a transparent ceramic preform includes forming a suspension of oxide particles in a solvent, adding the suspension to a mold of a desired shape, and uniformly curing the suspension in the mold for forming a preform. The suspension includes a dispersant but does not include a gelling agent. In another embodiment, a method includes creating a mixture without a gelling agent, the mixture including: inorganic particles, a solvent, and a dispersant. The inorganic particles have a mean diameter of less than about 2000 nm. The method also includes agitating the mixture, adding the mixture to a mold, and curing the mixture in the mold at a temperature of less than about 80.degree. C. for forming a preform. Other methods for forming a transparent ceramic preform are also described according to several embodiments.
Fliermans,; Carl, B [Augusta, GA
2012-08-07
Some or all of the needs above can be addressed by embodiments of the invention. According to embodiments of the invention, systems and methods for facilitating hydrogen storage using naturally occurring nanostructure assemblies can be implemented. In one embodiment, a method for storing hydrogen can be provided. The method can include providing diatoms comprising diatomaceous earth or diatoms from a predefined culture. In addition, the method can include heating the diatoms in a sealed environment in the presence of at least one of titanium, a transition metal, or a noble metal to provide a porous hydrogen storage medium. Furthermore, the method can include exposing the porous hydrogen storage medium to hydrogen. In addition, the method can include storing at least a portion of the hydrogen in the porous hydrogen storage medium.
Methods, systems and devices for detecting and locating ferromagnetic objects
Roybal, Lyle Gene [Idaho Falls, ID; Kotter, Dale Kent [Shelley, ID; Rohrbaugh, David Thomas [Idaho Falls, ID; Spencer, David Frazer [Idaho Falls, ID
2010-01-26
Methods for detecting and locating ferromagnetic objects in a security screening system. One method includes a step of acquiring magnetic data that includes magnetic field gradients detected during a period of time. Another step includes representing the magnetic data as a function of the period of time. Another step includes converting the magnetic data to being represented as a function of frequency. Another method includes a step of sensing a magnetic field for a period of time. Another step includes detecting a gradient within the magnetic field during the period of time. Another step includes identifying a peak value of the gradient detected during the period of time. Another step includes identifying a portion of time within the period of time that represents when the peak value occurs. Another step includes configuring the portion of time over the period of time to represent a ratio.
Temperature analysis with voltage-current time differential operation of electrochemical sensors
DOE Office of Scientific and Technical Information (OSTI.GOV)
Woo, Leta Yar-Li; Glass, Robert Scott; Fitzpatrick, Joseph Jay
A method for temperature analysis of a gas stream. The method includes identifying a temperature parameter of an affected waveform signal. The method also includes calculating a change in the temperature parameter by comparing the affected waveform signal with an original waveform signal. The method also includes generating a value from the calculated change which corresponds to the temperature of the gas stream.
Test methods for optical disk media characteristics (for 356 mm ruggedized magneto-optic media)
NASA Technical Reports Server (NTRS)
Podio, Fernando L.
1991-01-01
Standard test methods for computer storage media characteristics are essential and allow for conformance to media interchange standards. The test methods were developed for 356 mm two-sided laminated glass substrate with a magneto-optic active layer media technology. These test methods may be used for testing other media types, but in each case their applicability must be evaluated. Test methods are included for a series of different media characteristics, including operational, nonoperational, and storage environments; mechanical and physical characteristics; and substrate, recording layer, and preformat characteristics. Tests for environmental qualification and media lifetimes are also included. The best methods include testing conditions, testing procedures, a description of the testing setup, and the required calibration procedures.
Recent progress in invariant pattern recognition
NASA Astrophysics Data System (ADS)
Arsenault, Henri H.; Chang, S.; Gagne, Philippe; Gualdron Gonzalez, Oscar
1996-12-01
We present some recent results in invariant pattern recognition, including methods that are invariant under two or more distortions of position, orientation and scale. There are now a few methods that yield good results under changes of both rotation and scale. Some new methods are introduced. These include locally adaptive nonlinear matched filters, scale-adapted wavelet transforms and invariant filters for disjoint noise. Methods using neural networks will also be discussed, including an optical method that allows simultaneous classification of multiple targets.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Cooks, Robert Graham; Li, Anyin; Luo, Qingjie
The invention generally relates to systems and methods for producing metal clusters; functionalized surfaces; and droplets including solvated metal ions. In certain aspects, the invention provides methods that involve providing a metal and a solvent. The methods additionally involve applying voltage to the solvated metal to thereby produce solvent droplets including ions of the metal containing compound, and directing the solvent droplets including the metal ions to a target. In certain embodiments, once at the target, the metal ions can react directly or catalyze reactions.
Cruz-Perez, Patricia; Buttner, Mark P.
2004-05-11
A method for detecting the fungus Stachybotrys chartarum includes isolating DNA from a sample suspected of containing the fungus Stachybotrys chartarum. The method further includes subjecting the DNA to polymerase chain reaction amplification utilizing at least one of several primers, the several primers each including one of the base sequences 5'GTTGCTTCGGCGGGAAC3', 5'TTTGCGTTTGCCACTCAGAG3', 5'ACCTATCGTTGCTTCGGCG3', and 5'GCGTTTGCCACTCAGAGAATACT3'. The method additionally includes detecting the fungus Stachybotrys chartarum by visualizing the product of the polymerase chain reaction.
Cooks, Robert Graham; Li, Anyin; Luo, Qingjie
2017-01-24
The invention generally relates to systems and methods for producing metal clusters; functionalized surfaces; and droplets including solvated metal ions. In certain aspects, the invention provides methods that involve providing a metal and a solvent. The methods additionally involve applying voltage to the solvated metal to thereby produce solvent droplets including ions of the metal containing compound, and directing the solvent droplets including the metal ions to a target. In certain embodiments, once at the target, the metal ions can react directly or catalyze reactions.
Graph modeling systems and methods
Neergaard, Mike
2015-10-13
An apparatus and a method for vulnerability and reliability modeling are provided. The method generally includes constructing a graph model of a physical network using a computer, the graph model including a plurality of terminating vertices to represent nodes in the physical network, a plurality of edges to represent transmission paths in the physical network, and a non-terminating vertex to represent a non-nodal vulnerability along a transmission path in the physical network. The method additionally includes evaluating the vulnerability and reliability of the physical network using the constructed graph model, wherein the vulnerability and reliability evaluation includes a determination of whether each terminating and non-terminating vertex represents a critical point of failure. The method can be utilized to evaluate wide variety of networks, including power grid infrastructures, communication network topologies, and fluid distribution systems.
Military applications and examples of near-surface seismic surface wave methods (Invited)
NASA Astrophysics Data System (ADS)
sloan, S.; Stevens, R.
2013-12-01
Although not always widely known or publicized, the military uses a variety of geophysical methods for a wide range of applications--some that are already common practice in the industry while others are truly novel. Some of those applications include unexploded ordnance detection, general site characterization, anomaly detection, countering improvised explosive devices (IEDs), and security monitoring, to name a few. Techniques used may include, but are not limited to, ground penetrating radar, seismic, electrical, gravity, and electromagnetic methods. Seismic methods employed include surface wave analysis, refraction tomography, and high-resolution reflection methods. Although the military employs geophysical methods, that does not necessarily mean that those methods enable or support combat operations--often times they are being used for humanitarian applications within the military's area of operations to support local populations. The work presented here will focus on the applied use of seismic surface wave methods, including multichannel analysis of surface waves (MASW) and backscattered surface waves, often in conjunction with other methods such as refraction tomography or body-wave diffraction analysis. Multiple field examples will be shown, including explosives testing, tunnel detection, pre-construction site characterization, and cavity detection.
Hickam, Christopher Dale [Glasford, IL
2008-03-18
A power system includes a prime mover, a transmission, and a fluid coupler having a selectively engageable lockup clutch. The fluid coupler may be drivingly connected between the prime mover and the transmission. Additionally, the power system may include a motor/generator drivingly connected to at least one of the prime mover and the transmission. The power-system may also include power-system controls configured to execute a control method. The control method may include selecting one of a plurality of modes of operation of the power system. Additionally, the control method may include controlling the operating state of the lockup clutch dependent upon the mode of operation selected. The control method may also include controlling the operating state of the motor/generator dependent upon the mode of operation selected.
Speaker verification system using acoustic data and non-acoustic data
Gable, Todd J [Walnut Creek, CA; Ng, Lawrence C [Danville, CA; Holzrichter, John F [Berkeley, CA; Burnett, Greg C [Livermore, CA
2006-03-21
A method and system for speech characterization. One embodiment includes a method for speaker verification which includes collecting data from a speaker, wherein the data comprises acoustic data and non-acoustic data. The data is used to generate a template that includes a first set of "template" parameters. The method further includes receiving a real-time identity claim from a claimant, and using acoustic data and non-acoustic data from the identity claim to generate a second set of parameters. The method further includes comparing the first set of parameters to the set of parameters to determine whether the claimant is the speaker. The first set of parameters and the second set of parameters include at least one purely non-acoustic parameter, including a non-acoustic glottal shape parameter derived from averaging multiple glottal cycle waveforms.
Ultrasensitive surveillance of sensors and processes
Wegerich, Stephan W.; Jarman, Kristin K.; Gross, Kenneth C.
2001-01-01
A method and apparatus for monitoring a source of data for determining an operating state of a working system. The method includes determining a sensor (or source of data) arrangement associated with monitoring the source of data for a system, activating a method for performing a sequential probability ratio test if the data source includes a single data (sensor) source, activating a second method for performing a regression sequential possibility ratio testing procedure if the arrangement includes a pair of sensors (data sources) with signals which are linearly or non-linearly related; activating a third method for performing a bounded angle ratio test procedure if the sensor arrangement includes multiple sensors and utilizing at least one of the first, second and third methods to accumulate sensor signals and determining the operating state of the system.
Ultrasensitive surveillance of sensors and processes
Wegerich, Stephan W.; Jarman, Kristin K.; Gross, Kenneth C.
1999-01-01
A method and apparatus for monitoring a source of data for determining an operating state of a working system. The method includes determining a sensor (or source of data) arrangement associated with monitoring the source of data for a system, activating a method for performing a sequential probability ratio test if the data source includes a single data (sensor) source, activating a second method for performing a regression sequential possibility ratio testing procedure if the arrangement includes a pair of sensors (data sources) with signals which are linearly or non-linearly related; activating a third method for performing a bounded angle ratio test procedure if the sensor arrangement includes multiple sensors and utilizing at least one of the first, second and third methods to accumulate sensor signals and determining the operating state of the system.
Method of forming aluminum oxynitride material and bodies formed by such methods
Bakas, Michael P [Ammon, ID; Lillo, Thomas M [Idaho Falls, ID; Chu, Henry S [Idaho Falls, ID
2010-11-16
Methods of forming aluminum oxynitride (AlON) materials include sintering green bodies comprising aluminum orthophosphate or another sacrificial material therein. Such green bodies may comprise aluminum, oxygen, and nitrogen in addition to the aluminum orthophosphate. For example, the green bodies may include a mixture of aluminum oxide, aluminum nitride, and aluminum orthophosphate or another sacrificial material. Additional methods of forming aluminum oxynitride (AlON) materials include sintering a green body including a sacrificial material therein, using the sacrificial material to form pores in the green body during sintering, and infiltrating the pores formed in the green body with a liquid infiltrant during sintering. Bodies are formed using such methods.
Methods, systems and devices for detecting threatening objects and for classifying magnetic data
Kotter, Dale K [Shelley, ID; Roybal, Lyle G [Idaho Falls, ID; Rohrbaugh, David T [Idaho Falls, ID; Spencer, David F [Idaho Falls, ID
2012-01-24
A method for detecting threatening objects in a security screening system. The method includes a step of classifying unique features of magnetic data as representing a threatening object. Another step includes acquiring magnetic data. Another step includes determining if the acquired magnetic data comprises a unique feature.
Including Exceptional Students in Your Instrumental Music Program
ERIC Educational Resources Information Center
Mixon, Kevin
2005-01-01
This article describes the method and adaptations used by the author in including students with special needs in an instrumental music program. To ensure success in the program, the author shares the method he uses to include exceptional students and enumerates some possible adaptations. There are certainly other methods and modifications that…
Method for generating hydrogen for fuel cells
Ahmed, Shabbir; Lee, Sheldon H. D.; Carter, John David; Krumpelt, Michael
2004-03-30
A method of producing a H.sub.2 rich gas stream includes supplying an O.sub.2 rich gas, steam, and fuel to an inner reforming zone of a fuel processor that includes a partial oxidation catalyst and a steam reforming catalyst or a combined partial oxidation and stream reforming catalyst. The method also includes contacting the O.sub.2 rich gas, steam, and fuel with the partial oxidation catalyst and the steam reforming catalyst or the combined partial oxidation and stream reforming catalyst in the inner reforming zone to generate a hot reformate stream. The method still further includes cooling the hot reformate stream in a cooling zone to produce a cooled reformate stream. Additionally, the method includes removing sulfur-containing compounds from the cooled reformate stream by contacting the cooled reformate stream with a sulfur removal agent. The method still further includes contacting the cooled reformate stream with a catalyst that converts water and carbon monoxide to carbon dioxide and H.sub.2 in a water-gas-shift zone to produce a final reformate stream in the fuel processor.
Fuel processor and method for generating hydrogen for fuel cells
Ahmed, Shabbir [Naperville, IL; Lee, Sheldon H. D. [Willowbrook, IL; Carter, John David [Bolingbrook, IL; Krumpelt, Michael [Naperville, IL; Myers, Deborah J [Lisle, IL
2009-07-21
A method of producing a H.sub.2 rich gas stream includes supplying an O.sub.2 rich gas, steam, and fuel to an inner reforming zone of a fuel processor that includes a partial oxidation catalyst and a steam reforming catalyst or a combined partial oxidation and stream reforming catalyst. The method also includes contacting the O.sub.2 rich gas, steam, and fuel with the partial oxidation catalyst and the steam reforming catalyst or the combined partial oxidation and stream reforming catalyst in the inner reforming zone to generate a hot reformate stream. The method still further includes cooling the hot reformate stream in a cooling zone to produce a cooled reformate stream. Additionally, the method includes removing sulfur-containing compounds from the cooled reformate stream by contacting the cooled reformate stream with a sulfur removal agent. The method still further includes contacting the cooled reformate stream with a catalyst that converts water and carbon monoxide to carbon dioxide and H.sub.2 in a water-gas-shift zone to produce a final reformate stream in the fuel processor.
Sublimation systems and associated methods
Turner, Terry D.; McKellar, Michael G.; Wilding, Bruce M.
2016-02-09
A system for vaporizing and sublimating a slurry comprising a fluid including solid particles therein. The system includes a first heat exchanger configured to receive the fluid including solid particles and vaporize the fluid and a second heat exchanger configured to receive the vaporized fluid and solid particles and sublimate the solid particles. A method for vaporizing and sublimating a fluid including solid particles therein is also disclosed. The method includes feeding the fluid including solid particles to a first heat exchanger, vaporizing the fluid, feeding the vaporized fluid and solid particles to a second heat exchanger and sublimating the solid particles. In some embodiments the fluid including solid particles is liquid natural gas or methane including solid carbon dioxide particles.
VanDersarl, Jules J.; Xu, Alexander M.; Melosh, Nicholas A.; Tayebi, Noureddine
2016-02-23
In accordance with the purpose(s) of the present disclosure, as embodied and broadly described herein, embodiments of the present disclosure, in one aspect, relate to methods of making a structure including nanotubes, a structure including nanotubes, methods of delivering a fluid to a cell, methods of removing a fluid to a cell, methods of accessing intracellular space, and the like.
NASA Technical Reports Server (NTRS)
Hofmann, Douglas C. (Inventor); Kennett, Andrew (Inventor)
2018-01-01
Systems and methods to fabricate objects including metallic glass-based materials using low-pressure casting techniques are described. In one embodiment, a method of fabricating an object that includes a metallic glass-based material includes: introducing molten alloy into a mold cavity defined by a mold using a low enough pressure such that the molten alloy does not conform to features of the mold cavity that are smaller than 100 microns; and cooling the molten alloy such that it solidifies, the solid including a metallic glass-based material.
NASA Technical Reports Server (NTRS)
Hofmann, Douglas C. (Inventor); Roberts, Scott N. (Inventor)
2017-01-01
Systems and methods in accordance with embodiments of the invention fabricate objects including metallic glass-based materials using ultrasonic welding. In one embodiment, a method of fabricating an object that includes a metallic glass-based material includes: ultrasonically welding at least one ribbon to a surface; where at least one ribbon that is ultrasonically welded to a surface has a thickness of less than approximately 150.mu.m; and where at least one ribbon that is ultrasonically welded to a surface includes a metallic glass-based material.
Cast B2-phase iron-aluminum alloys with improved fluidity
Maziasz, Philip J.; Paris, Alan M.; Vought, Joseph D.
2002-01-01
Systems and methods are described for iron aluminum alloys. A composition includes iron, aluminum and manganese. A method includes providing an alloy including iron, aluminum and manganese; and processing the alloy. The systems and methods provide advantages because additions of manganese to iron aluminum alloys dramatically increase the fluidity of the alloys prior to solidification during casting.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Toth, James J.; Wall, Donald; Wittman, Richard S.
Target assemblies are provided that can include a uranium-comprising annulus. The assemblies can include target material consisting essentially of non-uranium material within the volume of the annulus. Reactors are disclosed that can include one or more discrete zones configured to receive target material. At least one uranium-comprising annulus can be within one or more of the zones. Methods for producing isotopes within target material are also disclosed, with the methods including providing neutrons to target material within a uranium-comprising annulus. Methods for modifying materials within target material are disclosed as well as are methods for characterizing material within a targetmore » material.« less
Prediction of forces and moments for hypersonic flight vehicle control effectors
NASA Technical Reports Server (NTRS)
Maughmer, Mark D.; Long, Lyle N.; Guilmette, Neal; Pagano, Peter
1993-01-01
This research project includes three distinct phases. For completeness, all three phases of the work are briefly described in this report. The goal was to develop methods of predicting flight control forces and moments for hypersonic vehicles which could be used in a preliminary design environment. The first phase included a preliminary assessment of subsonic/supersonic panel methods and hypersonic local flow inclination methods for such predictions. While these findings clearly indicated the usefulness of such methods for conceptual design activities, deficiencies exist in some areas. Thus, a second phase of research was conducted in which a better understanding was sought for the reasons behind the successes and failures of the methods considered, particularly for the cases at hypersonic Mach numbers. This second phase involved using computational fluid dynamics methods to examine the flow fields in detail. Through these detailed predictions, the deficiencies in the simple surface inclination methods were determined. In the third phase of this work, an improvement to the surface inclination methods was developed. This used a novel method for including viscous effects by modifying the geometry to include the viscous/shock layer.
Colquhoun, Heather L; Squires, Janet E; Kolehmainen, Niina; Fraser, Cynthia; Grimshaw, Jeremy M
2017-03-04
Systematic reviews consistently indicate that interventions to change healthcare professional (HCP) behaviour are haphazardly designed and poorly specified. Clarity about methods for designing and specifying interventions is needed. The objective of this review was to identify published methods for designing interventions to change HCP behaviour. A search of MEDLINE, Embase, and PsycINFO was conducted from 1996 to April 2015. Using inclusion/exclusion criteria, a broad screen of abstracts by one rater was followed by a strict screen of full text for all potentially relevant papers by three raters. An inductive approach was first applied to the included studies to identify commonalities and differences between the descriptions of methods across the papers. Based on this process and knowledge of related literatures, we developed a data extraction framework that included, e.g. level of change (e.g. individual versus organization); context of development; a brief description of the method; tasks included in the method (e.g. barrier identification, component selection, use of theory). 3966 titles and abstracts and 64 full-text papers were screened to yield 15 papers included in the review, each outlining one design method. All of the papers reported methods developed within a specific context. Thirteen papers included barrier identification and 13 included linking barriers to intervention components; although not the same 13 papers. Thirteen papers targeted individual HCPs with only one paper targeting change across individual, organization, and system levels. The use of theory and user engagement were included in 13/15 and 13/15 papers, respectively. There is an agreement across methods of four tasks that need to be completed when designing individual-level interventions: identifying barriers, selecting intervention components, using theory, and engaging end-users. Methods also consist of further additional tasks. Examples of methods for designing the organisation and system-level interventions were limited. Further analysis of design tasks could facilitate the development of detailed guidelines for designing interventions.
Bayramian, Andy J; Ebbers, Christopher A; Chen, Diana C
2014-05-20
A method of manufacturing a plurality of diffractive optical elements includes providing a partially transmissive slide, providing a first piece of PTR glass, and directing first UV radiation through the partially transmissive slide to impinge on the first piece of PTR glass. The method also includes exposing predetermined portions of the first piece of PTR glass to the first UV radiation and thermally treating the exposed first piece of PTR glass. The method further includes providing a second piece of PTR glass and directing second UV radiation through the thermally treated first piece of PTR glass to impinge on the second piece of PTR glass. The method additionally includes exposing predetermined portions of the second piece of PTR glass to the second UV radiation, thermally treating the exposed second piece of PTR glass, and repeating providing and processing of the second piece of PTR glass using additional pieces of PTR glass.
Fluorine compounds for doping conductive oxide thin films
Gessert, Tim; Li, Xiaonan; Barnes, Teresa M; Torres, Jr., Robert; Wyse, Carrie L
2013-04-23
Methods of forming a conductive fluorine-doped metal oxide layer on a substrate by chemical vapor deposition are described. The methods may include heating the substrate in a processing chamber, and introducing a metal-containing precursor and a fluorine-containing precursor to the processing chamber. The methods may also include adding an oxygen-containing precursor to the processing chamber. The precursors are reacted to deposit the fluorine-doped metal oxide layer on the substrate. Methods may also include forming the conductive fluorine-doped metal oxide layer by plasma-assisted chemical vapor deposition. These methods may include providing the substrate in a processing chamber, and introducing a metal-containing precursor, and a fluorine-containing precursor to the processing chamber. A plasma may be formed that includes species from the metal-containing precursor and the fluorine-containing precursor. The species may react to deposit the fluorine-doped metal oxide layer on the substrate.
Long lasting decontamination foam
Demmer, Ricky L.; Peterman, Dean R.; Tripp, Julia L.; Cooper, David C.; Wright, Karen E.
2010-12-07
Compositions and methods for decontaminating surfaces are disclosed. More specifically, compositions and methods for decontamination using a composition capable of generating a long lasting foam are disclosed. Compositions may include a surfactant and gelatin and have a pH of less than about 6. Such compositions may further include affinity-shifting chemicals. Methods may include decontaminating a contaminated surface with a composition or a foam that may include a surfactant and gelatin and have a pH of less than about 6.
Phytometric intelligence sensors
NASA Technical Reports Server (NTRS)
Seelig, Hans-Dieter (Inventor); Stoner, II, Richard J. (Inventor); Hoehn, Alexander (Inventor); Adams, III, William Walter (Inventor)
2010-01-01
Methods and apparatus for determining when plants require watering, and methods of attending to the watering of plants including signaling the grower that the plants are in need of hydration are provided. The novel methods include real-time measurement of plant metabolics and phytometric physiology changes of intrinsic physical or behavioral traits within the plant such as determining physiological flux measurement of enzyme flux due to environmental changes such as the wind and drought stress, soil and plant mineral deficiencies, or the interaction with a bio-control for organic disease control including, cell movement, signal transduction, internal chemical processes and external environmental processes including when plants require watering, and methods of attending to the watering of plants including signaling the grower that the plants are in need of hydration.
Hollow fiber membranes and methods for forming same
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bhandari, Dhaval Ajit; McCloskey, Patrick Joseph; Howson, Paul Edward
2016-03-22
The invention provides improved hollow fiber membranes having at least two layers, and methods for forming the same. The methods include co-extruding a first composition, a second composition, and a third composition to form a dual layer hollow fiber membrane. The first composition includes a glassy polymer; the second composition includes a polysiloxane; and the third composition includes a bore fluid. The dual layer hollow fiber membranes include a first layer and a second layer, the first layer being a porous layer which includes the glassy polymer of the first composition, and the second layer being a polysiloxane layer whichmore » includes the polysiloxane of the second composition.« less
System for testing properties of a network
Rawle, Michael; Bartholomew, David B.; Soares, Marshall A.
2009-06-16
A method for identifying properties of a downhole electromagnetic network in a downhole tool sting, including the step of providing an electromagnetic path intermediate a first location and a second location on the electromagnetic network. The method further includes the step of providing a receiver at the second location. The receiver includes a known reference. The analog signal includes a set amplitude, a set range of frequencies, and a set rate of change between the frequencies. The method further includes the steps of sending the analog signal, and passively modifying the signal. The analog signal is sent from the first location through the electromagnetic path, and the signal is modified by the properties of the electromagnetic path. The method further includes the step of receiving a modified signal at the second location and comparing the known reference to the modified signal.
NASA Technical Reports Server (NTRS)
Farley, Gary L. (Inventor)
1995-01-01
A method for fabricating composite structures at a low-cost, moderate-to-high production rate is disclosed. A first embodiment of the method includes employing a continuous press forming fabrication process. A second embodiment of the method includes employing a pultrusion process for obtaining composite structures. The methods include coating yarns with matrix material, weaving the yarn into fabric to produce a continuous fabric supply, and feeding multiple layers of net-shaped fabrics having optimally oriented fibers into a debulking tool to form an undebulked preform. The continuous press forming fabrication process includes partially debulking the preform, cutting the partially debulked preform, and debulking the partially debulked preform to form a netshape. An electron-beam or similar technique then cures the structure. The pultrusion fabric process includes feeding the undebulked preform into a heated die and gradually debulking the undebulked preform. The undebulked preform in the heated die changes dimension until a desired cross-sectional dimension is achieved. This process further includes obtaining a net-shaped infiltrated uncured preform, cutting the uncured preform to a desired length, and electron-beam curing (or similar technique) the uncured preform. These fabrication methods produce superior structures formed at higher production rates, resulting in lower cost and high structural performance.
simulation methods for materials physics and chemistry, with particular expertise in post-DFT, high accuracy methods such as the GW approximation for electronic structure and random phase approximation (RPA) total the art in computational methods, including efficient methods for including the effects of substrates
Method and Device for Extraction of Liquids from a Solid Particle Material
NASA Technical Reports Server (NTRS)
deMayo, Benjamin (Inventor)
2017-01-01
A method, system, and device for separating oil from oil sands or oil shale is disclosed. The method includes heating the oil sands, spinning the heated oil sands, confining the sand particles mechanically, and recovering the oil substantially free of the sand. The method can be used without the addition of chemical extraction agents. The system includes a source of centrifugal force, a heat source, a separation device, and a recovery device. The separation device includes a method of confining the sands while allowing the oil to escape, such as through an aperture.
Composition and methods for improved fuel production
Steele, Philip H.; Tanneru, Sathishkumar; Gajjela, Sanjeev K.
2015-12-29
Certain embodiments of the present invention are configured to produce boiler and transportation fuels. A first phase of the method may include oxidation and/or hyper-acidification of bio-oil to produce an intermediate product. A second phase of the method may include catalytic deoxygenation, esterification, or olefination/esterification of the intermediate product under pressurized syngas. The composition of the resulting product--e.g., a boiler fuel--produced by these methods may be used directly or further upgraded to a transportation fuel. Certain embodiments of the present invention also include catalytic compositions configured for use in the method embodiments.
Method for Fabricating Composite Structures Using Pultrusion Processing
NASA Technical Reports Server (NTRS)
Farley, Gary L. (Inventor)
2000-01-01
A method for fabricating composite structures at a low-cost, moderate-to-high production rate. A first embodiment of the method includes employing a continuous press forming fabrication process. A second embodiment of the method includes employing a pultrusion process for obtaining composite structures. The methods include coating yarns with matrix material, weaving the yarn into fabric to produce a continuous fabric supply and feeding multiple layers of net-shaped fabrics having optimally oriented fibers into a debulking tool to form an undebulked preform. The continuous press forming fabrication process includes partially debulking the preform, cutting the partially debulked preform and debulking the partially debulked preform to form a net-shape. An electron-beam or similar technique then cures the structure. The pultrusion fabric process includes feeding the undebulked preform into a heated die and gradually debulking the undebulked preform. The undebulked preform in the heated die changes dimension until a desired cross-sectional dimension is achieved. This process further includes obtaining a net-shaped infiltrated uncured preform, cutting the uncured preform to a desired length and electron-beam curing (or similar technique) the uncured preform. These fabrication methods produce superior structures formed at higher production rates, resulting in lower cost and high structural performance.
Method for Fabricating Composite Structures Using Continuous Press Forming
NASA Technical Reports Server (NTRS)
Farley, Gary L. (Inventor)
1997-01-01
A method for fabricating composite structures at a low-cost. moderate-to-high production rate. A first embodiment of the method includes employing a continuous press forming fabrication process. A second embodiment of the method includes employing a pultrusion process for obtaining composite structures. The methods include coating yarns with matrix material, weaving the yarn into fabric to produce a continuous fabric supply and feeding multiple layers of net-shaped fabrics having optimally oriented fibers into a debulking tool to form an undebulked preform. The continuous press forming fabrication process includes partially debulking the preform, cutting the partially debulked preform and debulking the partially debulked preform to form a net-shape. An electron-beam or similar technique then cures the structure. The pultrusion fabric process includes feeding the undebulked preform into a heated die and gradually debulking the undebulked preform. The undebulked preform in the heated die changes dimension until a desired cross-sectional dimension is achieved. This process further includes obtaining a net-shaped infiltrated uncured preform, cutting the uncured preform to a desired length and electron-beam curing (or similar technique) the uncured preform. These fabrication methods produce superior structures formed at higher production rates. resulting in lower cost and high structural performance.
Method for Fabricating Composite Structures Using Pultrusion Processing
NASA Technical Reports Server (NTRS)
Farley, Gary L. (Inventor)
2000-01-01
A method for fabricating composite structures at a low-cost, moderate-to-high production rate. A first embodiment of the method includes employing a continuous press forming fabrication process. A second embodiment of the method includes employing a pultrusion process for obtaining composite structures. The methods include coating yarns with matrix material, weaving the yarn into fabric to produce a continuous fabric supply and feeding multiple layers of net-shaped fabrics having optimally oriented fibers into a debulking tool to form an undebulked preform. The continuous press forming fabrication process includes partially debulking the preform, cutting the partially debulked preform and debulking the partially debulked preform to form a netshape. An electron-beam or similar technique then cures the structure. The pultrusion fabric process includes feeding the undebulked preform into a heated die and gradually debulking the undebulked preform. The undebulked preform in the heated die changes dimension until a desired cross-sectional dimension is achieved. This process further includes obtaining a net-shaped infiltrated uncured preform, cutting the uncured preform to a desired length and electronbeam curing (or similar technique) the uncured preform. These fabrication methods produce superior structures formed at higher production rates, resulting in lower cost and high structural performance.
Method and System for Producing Full Motion Media to Display on a Spherical Surface
NASA Technical Reports Server (NTRS)
Starobin, Michael A. (Inventor)
2015-01-01
A method and system for producing full motion media for display on a spherical surface is described. The method may include selecting a subject of full motion media for display on a spherical surface. The method may then include capturing the selected subject as full motion media (e.g., full motion video) in a rectilinear domain. The method may then include processing the full motion media in the rectilinear domain for display on a spherical surface, such as by orienting the full motion media, adding rotation to the full motion media, processing edges of the full motion media, and/or distorting the full motion media in the rectilinear domain for instance. After processing the full motion media, the method may additionally include providing the processed full motion media to a spherical projection system, such as a Science on a Sphere system.
Control methods and systems for indirect evaporative coolers
Woods, Jason; Kozubal, Erik
2015-09-22
A control method for operating an indirect evaporative cooler to control temperature and humidity. The method includes operating an airflow control device to provide supply air at a flow rate to a liquid desiccant dehumidifier. The supply air flows through the dehumidifier and an indirect evaporative cooler prior to exiting an outlet into a space. The method includes operating a pump to provide liquid desiccant to the liquid desiccant dehumidifier and sensing a temperature of an airstream at the outlet of the indirect evaporative cooler. The method includes comparing the temperature of the airstream at the outlet to a setpoint temperature at the outlet and controlling the pump to set the flow rate of the liquid desiccant. The method includes sensing space temperature, comparing the space temperature with a setpoint temperature, and controlling the airflow control device to set the flow rate of the supply air based on the comparison.
Marine asset security and tracking (MAST) system
Hanson, Gregory Richard [Clinton, TN; Smith, Stephen Fulton [Loudon, TN; Moore, Michael Roy [Corryton, TN; Dobson, Eric Lesley [Charleston, SC; Blair, Jeffrey Scott [Charleston, SC; Duncan, Christopher Allen [Marietta, GA; Lenarduzzi, Roberto [Knoxville, TN
2008-07-01
Methods and apparatus are described for marine asset security and tracking (MAST). A method includes transmitting identification data, location data and environmental state sensor data from a radio frequency tag. An apparatus includes a radio frequency tag that transmits identification data, location data and environmental state sensor data. Another method includes transmitting identification data and location data from a radio frequency tag using hybrid spread-spectrum modulation. Another apparatus includes a radio frequency tag that transmits both identification data and location data using hybrid spread-spectrum modulation.
Method and apparatus for ceramic analysis
Jankowiak, Ryszard J.; Schilling, Chris; Small, Gerald J.; Tomasik, Piotr
2003-04-01
The present invention relates to a method and apparatus for ceramic analysis, in particular, a method for analyzing density, density gradients and/or microcracks, including an apparatus with optical instrumentation for analysis of density, density gradients and/or microcracks in ceramics. The method provides analyzing density of a ceramic comprising exciting a component on a surface/subsurface of the ceramic by exposing the material to excitation energy. The method may further include the step of obtaining a measurement of an emitted energy from the component. The method may additionally include comparing the measurement of the emitted energy from the component with a predetermined reference measurement so as to obtain a density for said ceramic.
Methods and apparatuses for reagent delivery, reactive barrier formation, and pest control
Gilmore, Tyler [Pasco, WA; Kaplan, Daniel I [Aiken, SC; Last, George [Richland, WA
2002-07-09
A reagent delivery method includes positioning reagent delivery tubes in contact with soil. The tubes can include a wall that is permeable to a soil-modifying reagent. The method further includes supplying the reagent in the tubes, diffusing the reagent through the permeable wall and into the soil, and chemically modifying a selected component of the soil using the reagent. The tubes can be in subsurface contact with soil, including groundwater, and can be placed with directional drilling equipment independent of groundwater well casings. The soil-modifying reagent includes a variety of gases, liquids, colloids, and adsorbents that may be reactive or non-reactive with soil components. The method may be used inter alia to form reactive barriers, control pests, and enhance soil nutrients for microbes and plants.
Methods for suppressing isomerization of olefin metathesis products
Firth, Bruce E.; Kirk, Sharon E.
2015-10-27
A method for suppressing isomerization of an olefin metathesis product produced in a metathesis reaction includes adding an isomerization suppression agent that includes nitric acid to a mixture that includes the olefin metathesis product and residual metathesis catalyst from the metathesis reaction under conditions that are sufficient to passivate at least a portion of the residual metathesis catalyst. Methods of refining a natural oil are described.
Composites comprising novel RTIL-based polymers, and methods of making and using same
Gin, Douglas; Carlisle, Trevor; Noble, Richard; Nicodemus, Garret; McDanel, William; Cowan, Matthew
2017-06-27
The invention includes compositions comprising curable imidazolium-functionalized poly(room-temperature ionic liquid) copolymers and homopolymers. The invention further includes methods of preparing and using the compositions of the invention. The invention further includes novel methods of preparing thin, supported, room-temperature ionic liquid-containing polymeric films on a porous support. In certain embodiments, the methods of the invention avoid the use of a gutter layer, which greatly reduces the overall gas permeance and selectivity of the composite membrane. In other embodiments, the films of the invention have increased gas selectivity and permeance over films prepared using methods described in the prior art.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Adzic, Radoslav R.; Gong, Kuanping; Cai, Yun
A method of synthesizing activated electrocatalyst, preferably having a morphology of a nanostructure, is disclosed. The method includes safely and efficiently removing surfactants and capping agents from the surface of the metal structures. With regard to metal nanoparticles, the method includes synthesis of nanoparticle(s) in polar or non-polar solution with surfactants or capping agents and subsequent activation by CO-adsorption-induced surfactant/capping agent desorption and electrochemical oxidation. The method produces activated macroparticle or nanoparticle electrocatalysts without damaging the surface of the electrocatalyst that includes breaking, increasing particle thickness or increasing the number of low coordination sites.
NASA Technical Reports Server (NTRS)
Thomsen, III, Donald Laurence (Inventor); Cano, Roberto J. (Inventor); Jensen, Brian J. (Inventor); Hales, Stephen J. (Inventor); Alexa, Joel A. (Inventor)
2014-01-01
Methods of building Z-graded radiation shielding and covers. In one aspect, the method includes: providing a substrate surface having about medium Z-grade; plasma spraying a first metal having higher Z-grade than the substrate surface; and infusing a polymer layer to form a laminate. In another aspect, the method includes electro/electroless plating a first metal having higher Z-grade than the substrate surface. In other aspects, the methods include improving an existing electronics enclosure to build a Z-graded radiation shield by applying a temperature controller to at least part of the enclosure and affixing at least one layer of a first metal having higher Z-grade from the enclosure.
Engine and method for operating an engine
Lauper, Jr., John Christian; Willi, Martin Leo [Dunlap, IL; Thirunavukarasu, Balamurugesh [Peoria, IL; Gong, Weidong [Dunlap, IL
2008-12-23
A method of operating an engine is provided. The method may include supplying a combustible combination of reactants to a combustion chamber of the engine, which may include supplying a first hydrocarbon fuel, hydrogen fuel, and a second hydrocarbon fuel to the combustion chamber. Supplying the second hydrocarbon fuel to the combustion chamber may include at least one of supplying at least a portion of the second hydrocarbon fuel from an outlet port that discharges into an intake system of the engine and supplying at least a portion of the second hydrocarbon fuel from an outlet port that discharges into the combustion chamber. Additionally, the method may include combusting the combustible combination of reactants in the combustion chamber.
Method and Pd/V2 O5 device for H2 detection
Liu, Ping [San Diego, CA; Tracy, C Edwin [Golden, CO; Pitts, J Roland [Lakewood, CO; Smith, II, R. Davis; Lee, Se-Hee [Lakewood, CO
2011-12-27
Methods and Pd/V.sub.2O.sub.5 devices for hydrogen detection are disclosed. An exemplary method of preparing an improved sensor for chemochromic detection of hydrogen gas over a wide response range exhibits stability during repeated coloring/bleaching cycles upon exposure and removal of hydrogen gas. The method may include providing a substrate. The method may also include depositing a V.sub.20.sub.5 layer that functions as a H.sub.2 insertion host in a Pd/V.sub.20.sub.5 hydrogen sensor to be formed on said substrate. The method may also include depositing a Pd layer onto said V.sub.20.sub.5 layer; said Pd layer functioning as an optical modulator.
Wilding, Bruce M; Turner, Terry D
2014-12-02
A method of natural gas liquefaction may include cooling a gaseous NG process stream to form a liquid NG process stream. The method may further include directing the first tail gas stream out of a plant at a first pressure and directing a second tail gas stream out of the plant at a second pressure. An additional method of natural gas liquefaction may include separating CO.sub.2 from a liquid NG process stream and processing the CO.sub.2 to provide a CO.sub.2 product stream. Another method of natural gas liquefaction may include combining a marginal gaseous NG process stream with a secondary substantially pure NG stream to provide an improved gaseous NG process stream. Additionally, a NG liquefaction plant may include a first tail gas outlet, and at least a second tail gas outlet, the at least a second tail gas outlet separate from the first tail gas outlet.
Vertebrate species introductions in the United States and its territories
Witmer, Gary W.; Fuller, Pam L.
2011-01-01
At least 1,065 introduced vertebrate species have been introduced in the United States and its territories, including at least 86 mammalian, 127 avian, 179 reptilian/amphibian, and 673 fish species. Examples in each major taxonomic group include domestic cat, small Indian mongoose, red fox, goat, pig, rabbit, rats, house mouse, gray squirrel, nutria, starling, Indian common myna, red-vented bulbul, brown treesnake, red-eared slider, brown trout, tilapia, and grass carp. We briefly review some of these species and the types of damage they cause. We then review the basic types of methods used for control or eradication of each taxonomic group, including physical, chemical, biological, and cultural methods. We discuss some of the challenges in managing these species, including issues with the use of toxicants, land access, public attitudes, and monitoring difficulties. Finally, we list some ongoing research and future research needs, including improved detection methods, improved attractants, improved barriers, improved capture methods, fertility control, and risk assessment methods.
Treatment of addiction and addiction-related behavior
DOE Office of Scientific and Technical Information (OSTI.GOV)
Dewey, S.L.; Brodie, J.D.; Ashby, C.R. Jr.
2000-05-02
The present invention provides a highly efficient method for treating substance addiction and for changing addiction-related behavior of a primate suffering from substance addiction. The method includes administering to a primate an effective amount of a pharmaceutical composition including gamma vinylGABA. The present invention also provides a method of treatment of nicotine addiction by treating a patient with an effective amount of a composition including gamma vinylGABA.
Treatment of addiction and addiction-related behavior
Dewey, Stephen L.; Brodie, Jonathan D.; Ashby, Jr., Charles R.
2000-01-01
The present invention provides a highly efficient method for treating substance addiction and for changing addiction-related behavior of a primate suffering from substance addiction. The method includes administering to a primate an effective amount of a pharmaceutical composition including gamma vinylGABA. The present invention also provides a method of treatment of nicotine addiction by treating a patient with an effective amount of a composition including gamma vinylGABA.
Educating Instructional Designers: Different Methods for Different Outcomes.
ERIC Educational Resources Information Center
Rowland, Gordon; And Others
1994-01-01
Suggests new methods of teaching instructional design based on literature reviews of other design fields including engineering, architecture, interior design, media design, and medicine. Methods discussed include public presentations, visiting experts, competitions, artifacts, case studies, design studios, and internships and apprenticeships.…
NASA Technical Reports Server (NTRS)
Hofmann, Douglas (Inventor)
2017-01-01
Systems and methods in accordance with embodiments of the invention fabricate objects including amorphous metals using techniques akin to additive manufacturing. In one embodiment, a method of fabricating an object that includes an amorphous metal includes: applying a first layer of molten metallic alloy to a surface; cooling the first layer of molten metallic alloy such that it solidifies and thereby forms a first layer including amorphous metal; subsequently applying at least one layer of molten metallic alloy onto a layer including amorphous metal; cooling each subsequently applied layer of molten metallic alloy such that it solidifies and thereby forms a layer including amorphous metal prior to the application of any adjacent layer of molten metallic alloy; where the aggregate of the solidified layers including amorphous metal forms a desired shape in the object to be fabricated; and removing at least the first layer including amorphous metal from the surface.
Wafer characteristics via reflectometry
Sopori, Bhushan L.
2010-10-19
Various exemplary methods (800, 900, 1000, 1100) are directed to determining wafer thickness and/or wafer surface characteristics. An exemplary method (900) includes measuring reflectance of a wafer and comparing the measured reflectance to a calculated reflectance or a reflectance stored in a database. Another exemplary method (800) includes positioning a wafer on a reflecting support to extend a reflectance range. An exemplary device (200) has an input (210), analysis modules (222-228) and optionally a database (230). Various exemplary reflectometer chambers (1300, 1400) include radiation sources positioned at a first altitudinal angle (1308, 1408) and at a second altitudinal angle (1312, 1412). An exemplary method includes selecting radiation sources positioned at various altitudinal angles. An exemplary element (1650, 1850) includes a first aperture (1654, 1854) and a second aperture (1658, 1858) that can transmit reflected radiation to a fiber and an imager, respectfully.
Risch, John S [Kennewick, WA; Dowson, Scott T [West Richland, WA
2012-03-06
A method of displaying correlations among information objects includes receiving a query against a database; obtaining a query result set; and generating a visualization representing the components of the result set, the visualization including one of a plane and line to represent a data field, nodes representing data values, and links showing correlations among fields and values. Other visualization methods and apparatus are disclosed.
Current Progress in Gene Delivery Technology Based on Chemical Methods and Nano-carriers
Jin, Lian; Zeng, Xin; Liu, Ming; Deng, Yan; He, Nongyue
2014-01-01
Gene transfer methods are promising in the field of gene therapy. Current methods for gene transfer include three major groups: viral, physical and chemical methods. This review mainly summarizes development of several types of chemical methods for gene transfer in vitro and in vivo by means of nano-carriers like; calcium phosphates, lipids, and cationic polymers including chitosan, polyethylenimine, polyamidoamine dendrimers, and poly(lactide-co-glycolide). This review also briefly introduces applications of these chemical methods for gene delivery. PMID:24505233
Decker, David L; Lyles, Brad F; Purcell, Richard G; Hershey, Ronald Lee
2014-05-20
An apparatus and method for supporting a tubing bundle during installation or removal. The apparatus includes a clamp for securing the tubing bundle to an external wireline. The method includes deploying the tubing bundle and wireline together, The tubing bundle is periodically secured to the wireline using a clamp.
Hydrogenation of passivated contacts
Nemeth, William; Yuan, Hao-Chih; LaSalvia, Vincenzo; Stradins, Pauls; Page, Matthew R.
2018-03-06
Methods of hydrogenation of passivated contacts using materials having hydrogen impurities are provided. An example method includes applying, to a passivated contact, a layer of a material, the material containing hydrogen impurities. The method further includes subsequently annealing the material and subsequently removing the material from the passivated contact.
Systems and methods for detecting a failure event in a field programmable gate array
NASA Technical Reports Server (NTRS)
Ng, Tak-Kwong (Inventor); Herath, Jeffrey A. (Inventor)
2009-01-01
An embodiment generally relates to a method of self-detecting an error in a field programmable gate array (FPGA). The method includes writing a signature value into a signature memory in the FPGA and determining a conclusion of a configuration refresh operation in the FPGA. The method also includes reading an outcome value from the signature memory.
Extracellular secretion of recombinant proteins
Linger, Jeffrey G.; Darzins, Aldis
2014-07-22
Nucleic acids encoding secretion signals, expression vectors containing the nucleic acids, and host cells containing the expression vectors are disclosed. Also disclosed are polypeptides that contain the secretion signals and methods of producing polypeptides, including methods of directing the extracellular secretion of the polypeptides. Exemplary embodiments include cellulase proteins fused to secretion signals, methods to produce and isolate these polypeptides, and methods to degrade lignocellulosic biomass.
Assessment methods for the evaluation of vitiligo.
Alghamdi, K M; Kumar, A; Taïeb, A; Ezzedine, K
2012-12-01
There is no standardized method for assessing vitiligo. In this article, we review the literature from 1981 to 2011 on different vitiligo assessment methods. We aim to classify the techniques available for vitiligo assessment as subjective, semi-objective or objective; microscopic or macroscopic; and as based on morphometry or colorimetry. Macroscopic morphological measurements include visual assessment, photography in natural or ultraviolet light, photography with computerized image analysis and tristimulus colorimetry or spectrophotometry. Non-invasive micromorphological methods include confocal laser microscopy (CLM). Subjective methods include clinical evaluation by a dermatologist and a vitiligo disease activity score. Semi-objective methods include the Vitiligo Area Scoring Index (VASI) and point-counting methods. Objective methods include software-based image analysis, tristimulus colorimetry, spectrophotometry and CLM. Morphometry is the measurement of the vitiliginous surface area, whereas colorimetry quantitatively analyses skin colour changes caused by erythema or pigment. Most methods involve morphometry, except for the chromameter method, which assesses colorimetry. Some image analysis software programs can assess both morphometry and colorimetry. The details of these programs (Corel Draw, Image Pro Plus, AutoCad and Photoshop) are discussed in the review. Reflectance confocal microscopy provides real-time images and has great potential for the non-invasive assessment of pigmentary lesions. In conclusion, there is no single best method for assessing vitiligo. This review revealed that VASI, the rule of nine and Wood's lamp are likely to be the best techniques available for assessing the degree of pigmentary lesions and measuring the extent and progression of vitiligo in the clinic and in clinical trials. © 2012 The Authors. Journal of the European Academy of Dermatology and Venereology © 2012 European Academy of Dermatology and Venereology.
Method and apparatus for vibrating a substrate during material formation
Bailey, Jeffrey A [Richland, WA; Roger, Johnson N [Richland, WA; John, Munley T [Benton City, WA; Walter, Park R [Benton City, WA
2008-10-21
A method and apparatus for affecting the properties of a material include vibrating the material during its formation (i.e., "surface sifting"). The method includes the steps of providing a material formation device and applying a plurality of vibrations to the material during formation, which vibrations are oscillations having dissimilar, non-harmonic frequencies and at least two different directions. The apparatus includes a plurality of vibration sources that impart vibrations to the material.
System and method for evaluating a wire conductor
Panozzo, Edward; Parish, Harold
2013-10-22
A method of evaluating an electrically conductive wire segment having an insulated intermediate portion and non-insulated ends includes passing the insulated portion of the wire segment through an electrically conductive brush. According to the method, an electrical potential is established on the brush by a power source. The method also includes determining a value of electrical current that is conducted through the wire segment by the brush when the potential is established on the brush. The method additionally includes comparing the value of electrical current conducted through the wire segment with a predetermined current value to thereby evaluate the wire segment. A system for evaluating an electrically conductive wire segment is also disclosed.
Methods of refining natural oils, and methods of producing fuel compositions
Firth, Bruce E.; Kirk, Sharon E.
2015-10-27
A method of refining a natural oil includes: (a) providing a feedstock that includes a natural oil; (b) reacting the feedstock in the presence of a metathesis catalyst to form a metathesized product that includes olefins and esters; (c) passivating residual metathesis catalyst with an agent that comprises nitric acid; (d) separating the olefins in the metathesized product from the esters in the metathesized product; and (e) transesterifying the esters in the presence of an alcohol to form a transesterified product and/or hydrogenating the olefins to form a fully or partially saturated hydrogenated product. Methods for suppressing isomerization of olefin metathesis products produced in a metathesis reaction, and methods of producing fuel compositions are described.
Conformal coating of highly structured surfaces
Ginley, David S.; Perkins, John; Berry, Joseph; Gennett, Thomas
2012-12-11
Method of applying a conformal coating to a highly structured substrate and devices made by the disclosed methods are disclosed. An example method includes the deposition of a substantially contiguous layer of a material upon a highly structured surface within a deposition process chamber. The highly structured surface may be associated with a substrate or another layer deposited on a substrate. The method includes depositing a material having an amorphous structure on the highly structured surface at a deposition pressure of equal to or less than about 3 mTorr. The method may also include removing a portion of the amorphous material deposited on selected surfaces and depositing additional amorphous material on the highly structured surface.
Characterization of dielectric materials
DOE Office of Scientific and Technical Information (OSTI.GOV)
King, Danny J.; Babinec, Susan; Hagans, Patrick L.
2017-06-27
A system and a method for characterizing a dielectric material are provided. The system and method generally include applying an excitation signal to electrodes on opposing sides of the dielectric material to evaluate a property of the dielectric material. The method can further include measuring the capacitive impedance across the dielectric material, and determining a variation in the capacitive impedance with respect to either or both of a time domain and a frequency domain. The measured property can include pore size and surface imperfections. The method can still further include modifying a processing parameter as the dielectric material is formedmore » in response to the detected variations in the capacitive impedance, which can correspond to a non-uniformity in the dielectric material.« less
2017-01-01
Amplicon (targeted) sequencing by massively parallel sequencing (PCR-MPS) is a potential method for use in forensic DNA analyses. In this application, PCR-MPS may supplement or replace other instrumental analysis methods such as capillary electrophoresis and Sanger sequencing for STR and mitochondrial DNA typing, respectively. PCR-MPS also may enable the expansion of forensic DNA analysis methods to include new marker systems such as single nucleotide polymorphisms (SNPs) and insertion/deletions (indels) that currently are assayable using various instrumental analysis methods including microarray and quantitative PCR. Acceptance of PCR-MPS as a forensic method will depend in part upon developing protocols and criteria that define the limitations of a method, including a defensible analytical threshold or method detection limit. This paper describes an approach to establish objective analytical thresholds suitable for multiplexed PCR-MPS methods. A definition is proposed for PCR-MPS method background noise, and an analytical threshold based on background noise is described. PMID:28542338
Young, Brian; King, Jonathan L; Budowle, Bruce; Armogida, Luigi
2017-01-01
Amplicon (targeted) sequencing by massively parallel sequencing (PCR-MPS) is a potential method for use in forensic DNA analyses. In this application, PCR-MPS may supplement or replace other instrumental analysis methods such as capillary electrophoresis and Sanger sequencing for STR and mitochondrial DNA typing, respectively. PCR-MPS also may enable the expansion of forensic DNA analysis methods to include new marker systems such as single nucleotide polymorphisms (SNPs) and insertion/deletions (indels) that currently are assayable using various instrumental analysis methods including microarray and quantitative PCR. Acceptance of PCR-MPS as a forensic method will depend in part upon developing protocols and criteria that define the limitations of a method, including a defensible analytical threshold or method detection limit. This paper describes an approach to establish objective analytical thresholds suitable for multiplexed PCR-MPS methods. A definition is proposed for PCR-MPS method background noise, and an analytical threshold based on background noise is described.
Fabrication of contacts for silicon solar cells including printing burn through layers
Ginley, David S; Kaydanova, Tatiana; Miedaner, Alexander; Curtis, Calvin J; Van Hest, Marinus Franciscus Antonius Maria
2014-06-24
A method for fabricating a contact (240) for a solar cell (200). The method includes providing a solar cell substrate (210) with a surface that is covered or includes an antireflective coating (220). For example, the substrate (210) may be positioned adjacent or proximate to an outlet of an inkjet printer (712) or other deposition device. The method continues with forming a burn through layer (230) on the coating (220) by depositing a metal oxide precursor (e.g., using an inkjet or other non-contact printing method to print or apply a volume of liquid or solution containing the precursor). The method includes forming a contact layer (240) comprising silver over or on the burn through layer (230), and then annealing is performed to electrically connect the contact layer (240) to the surface of the solar cell substrate (210) through a portion of the burn through layer (230) and the coating (220).
Schaef, Herbert T.; McGrail, B. Peter
2015-07-28
Downhole fluid injection systems are provided that can include a first well extending into a geological formation, and a fluid injector assembly located within the well. The fluid injector assembly can be configured to inject a liquid CO2/H2O-emulsion into the surrounding geological formation. CO2 sequestration methods are provided that can include exposing a geological formation to a liquid CO2/H2O-emulsion to sequester at least a portion of the CO2 from the emulsion within the formation. Hydrocarbon material recovery methods are provided that can include exposing a liquid CO2/H2O-emulsion to a geological formation having the hydrocarbon material therein. The methods can include recovering at least a portion of the hydrocarbon material from the formation.
Method and system for processing optical elements using magnetorheological finishing
Menapace, Joseph Arthur; Schaffers, Kathleen Irene; Bayramian, Andrew James; Molander, William A
2012-09-18
A method of finishing an optical element includes mounting the optical element in an optical mount having a plurality of fiducials overlapping with the optical element and obtaining a first metrology map for the optical element and the plurality of fiducials. The method also includes obtaining a second metrology map for the optical element without the plurality of fiducials, forming a difference map between the first metrology map and the second metrology map, and aligning the first metrology map and the second metrology map. The method further includes placing mathematical fiducials onto the second metrology map using the difference map to form a third metrology map and associating the third metrology map to the optical element. Moreover, the method includes mounting the optical element in the fixture in an MRF tool, positioning the optical element in the fixture; removing the plurality of fiducials, and finishing the optical element.
Methods for separating particles and/or nucleic acids using isotachophoresis
Jung, Byoungsok; Ness, Kevin; Rose, Klint A.
2016-03-15
According to one embodiment, a method includes co-feeding fluids comprising a leading electrolyte, a trailing electrolyte, and at least one of DNA and RNA to a channel, and applying an electric field to the fluids in a direction perpendicular to an axis of the channel for inducing transverse isotachophoresis. In another embodiment, a method includes co-feeding fluids to a channel. The fluids include a leading electrolyte, a trailing electrolyte, biological objects, at least one of DNA and RNA, and a spacer electrolyte having an electrophoretic mobility that is between an electrophoretic mobility of at least some of the biological objects and an electrophoretic mobility of the at least one of the DNA and the RNA. The method also includes applying an electric field to the fluids in a direction perpendicular to an axis of the channel for inducing transverse isotachophoresis. Other methods of isotachophoresis are disclosed in addition to these.
Augmented reality building operations tool
Brackney, Larry J.
2014-09-09
A method (700) for providing an augmented reality operations tool to a mobile client (642) positioned in a building (604). The method (700) includes, with a server (660), receiving (720) from the client (642) an augmented reality request for building system equipment (612) managed by an energy management system (EMS) (620). The method (700) includes transmitting (740) a data request for the equipment (612) to the EMS (620) and receiving (750) building management data (634) for the equipment (612). The method (700) includes generating (760) an overlay (656) with an object created based on the building management data (634), which may be sensor data, diagnostic procedures, or the like. The overlay (656) is configured for concurrent display on a display screen (652) of the client (642) with a real-time image of the building equipment (612). The method (700) includes transmitting (770) the overlay (656) to the client (642).
Method and system for laser-based formation of micro-shapes in surfaces of optical elements
Bass, Isaac Louis; Guss, Gabriel Mark
2013-03-05
A method of forming a surface feature extending into a sample includes providing a laser operable to emit an output beam and modulating the output beam to form a pulse train having a plurality of pulses. The method also includes a) directing the pulse train along an optical path intersecting an exposed portion of the sample at a position i and b) focusing a first portion of the plurality of pulses to impinge on the sample at the position i. Each of the plurality of pulses is characterized by a spot size at the sample. The method further includes c) ablating at least a portion of the sample at the position i to form a portion of the surface feature and d) incrementing counter i. The method includes e) repeating steps a) through d) to form the surface feature. The sample is free of a rim surrounding the surface feature.
Using liquid desiccant as a regenerable filter for capturing and deactivating contaminants
Slayzak, Steven J.; Anderson, Ren S.; Judkoff, Ronald D.; Blake, Daniel M.; Vinzant, Todd B.; Ryan, Joseph P.
2007-12-11
A method, and systems for implementing such method, for purifying and conditioning air of weaponized contaminants. The method includes wetting a filter packing media with a salt-based liquid desiccant, such as water with a high concentration of lithium chloride. Air is passed through the wetted filter packing media and the contaminants in are captured with the liquid desiccant while the liquid desiccant dehumidifies the air. The captured contaminants are then deactivated in the liquid desiccant, which may include heating the liquid desiccant. The liquid desiccant is regenerated by applying heat to the liquid desiccant and then removing moisture. The method includes repeating the wetting with the regenerated liquid desiccant which provides a regenerable filtering process that captures and deactivates contaminants on an ongoing basis while also conditioning the air. The method may include filtration effectiveness enhancement by electrostatic or inertial means.
TECHNIQUES FOR TEACHING CONSERVATION EDUCATION.
ERIC Educational Resources Information Center
BROWN, ROBERT E.; MOUSER, G.W.
CONSERVATION PRINCIPLES, FIELD METHODS AND TECHNIQUES, AND SPECIFIC FIELD LEARNING ACTIVITIES ARE INCLUDED IN THIS REFERENCE VOLUME FOR TEACHERS. CONSERVATION PRINCIPLES INCLUDE STATEMENTS PERTAINING TO (1) SOIL, (2) WATER, (3) FOREST, AND (4) WILDLIFE. FIELD METHODS AND TECHNIQUES INCLUDE (1) PREPARING FOR A FIELD TRIP, (2) GETTING STUDENT…
40 CFR 53.52 - Leak check test.
Code of Federal Regulations, 2014 CFR
2014-07-01
... MONITORING REFERENCE AND EQUIVALENT METHODS Procedures for Testing Physical (Design) and Performance Characteristics of Reference Methods and Class I and Class II Equivalent Methods for PM 2.5 or PM 10-2.5 § 53.52... to include the facility, including components, instruments, operator controls, a written procedure...
26 CFR 20.2032-1 - Alternate valuation.
Code of Federal Regulations, 2010 CFR
2010-04-01
... alternate valuation method under section 2032, the property included in the decedent's gross estate on the..., the alternate valuation method applies to all property included in the gross estate and cannot be... elects the alternate valuation method under section 2432, all property interests existing at the date of...
Methods of producing adsorption media including a metal oxide
Mann, Nicholas R; Tranter, Troy J
2014-03-04
Methods of producing a metal oxide are disclosed. The method comprises dissolving a metal salt in a reaction solvent to form a metal salt/reaction solvent solution. The metal salt is converted to a metal oxide and a caustic solution is added to the metal oxide/reaction solvent solution to adjust the pH of the metal oxide/reaction solvent solution to less than approximately 7.0. The metal oxide is precipitated and recovered. A method of producing adsorption media including the metal oxide is also disclosed, as is a precursor of an active component including particles of a metal oxide.
Heating production fluids in a wellbore
Orrego, Yamila; Jankowski, Todd A.
2016-07-12
A method for heating a production fluid in a wellbore. The method can include heating, using a packer fluid, a working fluid flowing through a first medium disposed in a first section of the wellbore, where the first medium transfers heat from the packer fluid to the working fluid. The method can also include circulating the working fluid into a second section of the wellbore through a second medium, where the second medium transfers heat from the working fluid to the production fluid. The method can further include returning the working fluid to the first section of the wellbore through the first medium.
Imaging indicator for ESD safety testing.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Whinnery, LeRoy L.,; Nissen, April; Keifer, Patrick N.
2013-05-01
This report describes the development of a new detection method for electrostatic discharge (ESD) testing of explosives, using a single-lens reflex (SLR) digital camera and a 200-mm macro lens. This method has demonstrated several distinct advantages to other current ESD detection methods, including the creation of a permanent record, an enlarged image for real-time viewing as well as extended periods of review, and ability to combine with most other Go/No-Go sensors. This report includes details of the method, including camera settings and position, and results with wellcharacterized explosives PETN and RDX, and two ESD-sensitive aluminum powders.
Microfabricated instruments and methods to treat recurrent corneal erosions
Britton, Jr., Charles L.; D'urso, Brian R.; Chaum, Edward; Simpson, John T.; Baba, Justin S.; Ericson, M. Nance; Warmack, Robert J.
2015-06-02
In one embodiment, the present invention provides a device and method for treating recurrent corneal erosion. In one embodiment, the method includes the steps of contacting an epithelium layer of a cornea with an array of glass micro-rods including a plurality of sharp features having a length that penetrates a Bowman's layer of the eye, wherein the plurality of sharp features of the array of glass micro-rods produces a plurality of punctures in the Bowman's layer of the eye that are of micro-scale or less. In another embodiment, the present invention provides a method and device for drug delivery. In one embodiment, the device includes an array of glass micro-rods, wherein at least one glass micro-rod of the array of glass micro-rods includes a sharp feature opposite a base of the array of glass micro-rods, wherein the sharp feature includes a treated surface for delivering a chemical compound to the eye.
Microfabricated instruments and methods to treat recurrent corneal erosion
Britton, Charles L; D& #x27; Urso, Brian R; Chaum, Edward; Simpson, John T; Baba, Justin S; Ericson, M. Nance; Warmack, Robert J
2013-11-26
In one embodiment, the present invention provides a device and method for treating recurrent corneal erosion. In one embodiment, the method includes the steps of contacting an epithelium layer of a cornea with an array of glass micro-rods including a plurality of sharp features having a length that penetrates a Bowman's layer of the eye, wherein the plurality of sharp features of the array of glass micro-rods produces a plurality of punctures in the Bowman's layer of the eye that are of micro-scale or less. In another embodiment, the present invention provides a method and device for drug delivery. In one embodiment, the device includes an array of glass micro-rods, wherein at least one glass micro-rod of the array of glass micro-rods includes a sharp feature opposite a base of the array of glass micro-rods, wherein the sharp feature includes a treated surface for delivering a chemical compound to the eye.
Tauke-Pedretti, Anna; Nielson, Gregory N; Cederberg, Jeffrey G; Cruz-Campa, Jose Luis
2015-05-12
A method includes etching a release layer that is coupled between a plurality of semiconductor devices and a substrate with an etch. The etching includes etching the release layer between the semiconductor devices and the substrate until the semiconductor devices are at least substantially released from the substrate. The etching also includes etching a protuberance in the release layer between each of the semiconductor devices and the substrate. The etch is stopped while the protuberances remain between each of the semiconductor devices and the substrate. The method also includes separating the semiconductor devices from the substrate. Other methods and apparatus are also disclosed.
Heap/stack guard pages using a wakeup unit
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gooding, Thomas M; Satterfield, David L; Steinmacher-Burow, Burkhard
A method and system for providing a memory access check on a processor including the steps of detecting accesses to a memory device including level-1 cache using a wakeup unit. The method includes invalidating level-1 cache ranges corresponding to a guard page, and configuring a plurality of wakeup address compare (WAC) registers to allow access to selected WAC registers. The method selects one of the plurality of WAC registers, and sets up a WAC register related to the guard page. The method configures the wakeup unit to interrupt on access of the selected WAC register. The method detects access ofmore » the memory device using the wakeup unit when a guard page is violated. The method generates an interrupt to the core using the wakeup unit, and determines the source of the interrupt. The method detects the activated WAC registers assigned to the violated guard page, and initiates a response.« less
Review of Artificial Abrasion Test Methods for PV Module Technology
DOE Office of Scientific and Technical Information (OSTI.GOV)
Miller, David C.; Muller, Matt T.; Simpson, Lin J.
This review is intended to identify the method or methods--and the basic details of those methods--that might be used to develop an artificial abrasion test. Methods used in the PV literature were compared with their closest implementation in existing standards. Also, meetings of the International PV Quality Assurance Task Force Task Group 12-3 (TG12-3, which is concerned with coated glass) were used to identify established test methods. Feedback from the group, which included many of the authors from the PV literature, included insights not explored within the literature itself. The combined experience and examples from the literature are intended tomore » provide an assessment of the present industry practices and an informed path forward. Recommendations toward artificial abrasion test methods are then identified based on the experiences in the literature and feedback from the PV community. The review here is strictly focused on abrasion. Assessment methods, including optical performance (e.g., transmittance or reflectance), surface energy, and verification of chemical composition were not examined. Methods of artificially soiling PV modules or other specimens were not examined. The weathering of artificial or naturally soiled specimens (which may ultimately include combined temperature and humidity, thermal cycling and ultraviolet light) were also not examined. A sense of the purpose or application of an abrasion test method within the PV industry should, however, be evident from the literature.« less
Group IV nanocrystals with ion-exchangeable surface ligands and methods of making the same
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wheeler, Lance M.; Nichols, Asa W.; Chernomordik, Boris D.
Methods are described that include reacting a starting nanocrystal that includes a starting nanocrystal core and a covalently bound surface species to create an ion-exchangeable (IE) nanocrystal that includes a surface charge and a first ion-exchangeable (IE) surface ligand ionically bound to the surface charge, where the starting nanocrystal core includes a group IV element.
Bell, Zane William [Oak Ridge, TN; Boatner, Lynn Allen [Oak Ridge, TN
2011-05-31
A method of detecting an activator, the method including impinging a receptor material that is not predominately water and lacks a photoluminescent material with an activator and generating Cherenkov effect light due to the activator impinging the receptor material. The method further including identifying a characteristic of the activator based on the light.
40 CFR 53.52 - Leak check test.
Code of Federal Regulations, 2011 CFR
2011-07-01
... MONITORING REFERENCE AND EQUIVALENT METHODS Procedures for Testing Physical (Design) and Performance Characteristics of Reference Methods and Class I and Class II Equivalent Methods for PM2.5 or PM10â2.5 § 53.52... to include the facility, including components, instruments, operator controls, a written procedure...
40 CFR 53.52 - Leak check test.
Code of Federal Regulations, 2012 CFR
2012-07-01
... MONITORING REFERENCE AND EQUIVALENT METHODS Procedures for Testing Physical (Design) and Performance Characteristics of Reference Methods and Class I and Class II Equivalent Methods for PM2.5 or PM10â2.5 § 53.52... to include the facility, including components, instruments, operator controls, a written procedure...
40 CFR 53.52 - Leak check test.
Code of Federal Regulations, 2010 CFR
2010-07-01
... MONITORING REFERENCE AND EQUIVALENT METHODS Procedures for Testing Physical (Design) and Performance Characteristics of Reference Methods and Class I and Class II Equivalent Methods for PM2.5 or PM10â2.5 § 53.52... to include the facility, including components, instruments, operator controls, a written procedure...
Rapid synthesis of beta zeolites
Fan, Wei; Chang, Chun -Chih; Dornath, Paul; Wang, Zhuopeng
2015-08-18
The invention provides methods for rapidly synthesizing heteroatom containing zeolites including Sn-Beta, Si-Beta, Ti-Beta, Zr-Beta and Fe-Beta. The methods for synthesizing heteroatom zeolites include using well-crystalline zeolite crystals as seeds and using a fluoride-free, caustic medium in a seeded dry-gel conversion method. The Beta zeolite catalysts made by the methods of the invention catalyze both isomerization and dehydration reactions.
Infra-red signature neutron detector
Bell, Zane William [Oak Ridge, TN; Boatner, Lynn Allen [Oak Ridge, TN
2009-10-13
A method of detecting an activator, the method including impinging with an activator a receptor material that includes a photoluminescent material that generates infrared radiation and generation a by-product of a nuclear reaction due to the activator impinging the receptor material. The method further includes generating light from the by-product via the Cherenkov effect, wherein the light activates the photoluminescent material so as to generate the infrared radiation. Identifying a characteristic of the activator based on the infrared radiation.
1990-08-01
the spectral domain is extended to include the effects of two-dimensional, two-component current flow in planar transmission line discontinuities 6n...PROFESSOR: Tatsuo Itoh A deterministic formulation of the method of moments carried out in the spectral domain is extended to include the effects of...two-dimensional, two- component current flow in planar transmission line discontinuities on open substrates. The method includes the effects of space
Determining postural stability
NASA Technical Reports Server (NTRS)
Forth, Katharine E. (Inventor); Paloski, William H. (Inventor); Lieberman, Erez (Inventor)
2011-01-01
A method for determining postural stability of a person can include acquiring a plurality of pressure data points over a period of time from at least one pressure sensor. The method can also include the step of identifying a postural state for each pressure data point to generate a plurality of postural states. The method can include the step of determining a postural state of the person at a point in time based on at least the plurality of postural states.
Method for analyzing the chemical composition of liquid effluent from a direct contact condenser
Bharathan, Desikan; Parent, Yves; Hassani, A. Vahab
2001-01-01
A computational modeling method for predicting the chemical, physical, and thermodynamic performance of a condenser using calculations based on equations of physics for heat, momentum and mass transfer and equations of equilibrium thermodynamics to determine steady state profiles of parameters throughout the condenser. The method includes providing a set of input values relating to a condenser including liquid loading, vapor loading, and geometric characteristics of the contact medium in the condenser. The geometric and packing characteristics of the contact medium include the dimensions and orientation of a channel in the contact medium. The method further includes simulating performance of the condenser using the set of input values to determine a related set of output values such as outlet liquid temperature, outlet flow rates, pressures, and the concentration(s) of one or more dissolved noncondensable gas species in the outlet liquid. The method may also include iteratively performing the above computation steps using a plurality of sets of input values and then determining whether each of the resulting output values and performance profiles satisfies acceptance criteria.
A Critical Review of Methods to Evaluate the Impact of FDA Regulatory Actions
Briesacher, Becky A.; Soumerai, Stephen B.; Zhang, Fang; Toh, Sengwee; Andrade, Susan E.; Wagner, Joann L.; Shoaibi, Azadeh; Gurwitz, Jerry H.
2013-01-01
Purpose To conduct a synthesis of the literature on methods to evaluate the impacts of FDA regulatory actions, and identify best practices for future evaluations. Methods We searched MEDLINE for manuscripts published between January 1948 and August 2011 that included terms related to FDA, regulatory actions, and empirical evaluation; the review additionally included FDA-identified literature. We used a modified Delphi method to identify preferred methodologies. We included studies with explicit methods to address threats to validity, and identified designs and analytic methods with strong internal validity that have been applied to other policy evaluations. Results We included 18 studies out of 243 abstracts and papers screened. Overall, analytic rigor in prior evaluations of FDA regulatory actions varied considerably; less than a quarter of studies (22%) included control groups. Only 56% assessed changes in the use of substitute products/services, and 11% examined patient health outcomes. Among studies meeting minimal criteria of rigor, 50% found no impact or weak/modest impacts of FDA actions and 33% detected unintended consequences. Among those studies finding significant intended effects of FDA actions, all cited the importance of intensive communication efforts. There are preferred methods with strong internal validity that have yet to be applied to evaluations of FDA regulatory actions. Conclusions Rigorous evaluations of the impact of FDA regulatory actions have been limited and infrequent. Several methods with strong internal validity are available to improve trustworthiness of future evaluations of FDA policies. PMID:23847020
Dopant ink composition and method of fabricating a solar cell there from
Loscutoff, Paul; Wu, Kahn; Molesa, Steven Edward
2017-10-25
Dopant ink compositions and methods of fabricating solar cells there from are described. A dopant ink composition may include a cross-linkable matrix precursor, a bound dopant species, and a solvent. A method of fabricating a solar cell may include delivering a dopant ink composition to a region above a substrate. The dopant ink composition includes a cross-linkable matrix precursor, a bound dopant species, and a solvent. The method also includes baking the dopant ink composition to remove a substantial portion of the solvent of the dopant ink composition, curing the baked dopant ink composition to cross-link a substantial portion of the cross-linkable matrix precursor of the dopant ink composition, and driving dopants from the cured dopant ink composition toward the substrate.
Dopant ink composition and method of fabricating a solar cell there from
Loscutoff, Paul; Wu, Kahn; Molesa, Steven Edward
2015-03-31
Dopant ink compositions and methods of fabricating solar cells there from are described. A dopant ink composition may include a cross-linkable matrix precursor, a bound dopant species, and a solvent. A method of fabricating a solar cell may include delivering a dopant ink composition to a region above a substrate. The dopant ink composition includes a cross-linkable matrix precursor, a bound dopant species, and a solvent. The method also includes baking the dopant ink composition to remove a substantial portion of the solvent of the dopant ink composition, curing the baked dopant ink composition to cross-link a substantial portion of the cross-linkable matrix precursor of the dopant ink composition, and driving dopants from the cured dopant ink composition toward the substrate.
Hamann, Hendrik F.; Hwang, Youngdeok; van Kessel, Theodore G.; Khabibrakhmanov, Ildar K.; Muralidhar, Ramachandran
2016-10-18
A method and a system to perform multi-model blending are described. The method includes obtaining one or more sets of predictions of historical conditions, the historical conditions corresponding with a time T that is historical in reference to current time, and the one or more sets of predictions of the historical conditions being output by one or more models. The method also includes obtaining actual historical conditions, the actual historical conditions being measured conditions at the time T, assembling a training data set including designating the two or more set of predictions of historical conditions as predictor variables and the actual historical conditions as response variables, and training a machine learning algorithm based on the training data set. The method further includes obtaining a blended model based on the machine learning algorithm.
Compositions, antibodies, asthma diagnosis methods, and methods for preparing antibodies
DOE Office of Scientific and Technical Information (OSTI.GOV)
Jin, Hongjun; Zangar, Richard C.
Methods for preparing an antibody are provided with the method including incorporating 3-bromo-4-hydroxy-benzoic acid into a protein to form an antigen, immunizing a mammalian host with the antigen, and recovering an antibody having an affinity for the antigen from the host. Antibodies having a binding affinity for a monohalotyrosine are provided as well as composition comprising an antibody bound with monohalotyrosine. Compositions comprising a protein having a 3-bromo-4-hydroxy-benzoic acid moiety are also provided. Methods for evaluating the severity of asthma are provide with the methods including analyzing sputum of a patient using an antibody having a binding affinity for monohalotyrosine,more » and measuring the amount of antibody bound to protein. Methods for determining eosinophil activity in bodily fluid are also provided with the methods including exposing bodily fluid to an antibody having a binding affinity for monohalotyrosine, and measuring the amount of bound antibody to determine the eosinophil activity.« less
Numerical solution methods for viscoelastic orthotropic materials
NASA Technical Reports Server (NTRS)
Gramoll, K. C.; Dillard, D. A.; Brinson, H. F.
1988-01-01
Numerical solution methods for viscoelastic orthotropic materials, specifically fiber reinforced composite materials, are examined. The methods include classical lamination theory using time increments, direction solution of the Volterra Integral, Zienkiewicz's linear Prony series method, and a new method called Nonlinear Differential Equation Method (NDEM) which uses a nonlinear Prony series. The criteria used for comparison of the various methods include the stability of the solution technique, time step size stability, computer solution time length, and computer memory storage. The Volterra Integral allowed the implementation of higher order solution techniques but had difficulties solving singular and weakly singular compliance function. The Zienkiewicz solution technique, which requires the viscoelastic response to be modeled by a Prony series, works well for linear viscoelastic isotropic materials and small time steps. The new method, NDEM, uses a modified Prony series which allows nonlinear stress effects to be included and can be used with orthotropic nonlinear viscoelastic materials. The NDEM technique is shown to be accurate and stable for both linear and nonlinear conditions with minimal computer time.
A Comparison of PSD Enveloping Methods for Nonstationary Vibration
NASA Technical Reports Server (NTRS)
Irvine, Tom
2015-01-01
There is a need to derive a power spectral density (PSD) envelope for nonstationary acceleration time histories, including launch vehicle data, so that components can be designed and tested accordingly. This paper presents the results of the three methods for an actual flight accelerometer record. Guidelines are given for the application of each method to nonstationary data. The method can be extended to other scenarios, including transportation vibration.
Methods of manipulating stressed epistructures
Wanlass, Mark W
2014-04-08
A method of processing an epistructure or processing a semiconductor device including associating a conformal and flexible handle with the epistructure and removing the epistructure and handle as a unit from the parent substrate. The method further includes causing the epistructure and handle unit to conform to a shape that differs from the shape the epistructure otherwise inherently assumes upon removal from the parent substrate. A device prepared according to the disclosed methods.
Aquilante, Francesco; Autschbach, Jochen; Carlson, Rebecca K; Chibotaru, Liviu F; Delcey, Mickaël G; De Vico, Luca; Fdez Galván, Ignacio; Ferré, Nicolas; Frutos, Luis Manuel; Gagliardi, Laura; Garavelli, Marco; Giussani, Angelo; Hoyer, Chad E; Li Manni, Giovanni; Lischka, Hans; Ma, Dongxia; Malmqvist, Per Åke; Müller, Thomas; Nenov, Artur; Olivucci, Massimo; Pedersen, Thomas Bondo; Peng, Daoling; Plasser, Felix; Pritchard, Ben; Reiher, Markus; Rivalta, Ivan; Schapiro, Igor; Segarra-Martí, Javier; Stenrup, Michael; Truhlar, Donald G; Ungur, Liviu; Valentini, Alessio; Vancoillie, Steven; Veryazov, Valera; Vysotskiy, Victor P; Weingart, Oliver; Zapata, Felipe; Lindh, Roland
2016-02-15
In this report, we summarize and describe the recent unique updates and additions to the Molcas quantum chemistry program suite as contained in release version 8. These updates include natural and spin orbitals for studies of magnetic properties, local and linear scaling methods for the Douglas-Kroll-Hess transformation, the generalized active space concept in MCSCF methods, a combination of multiconfigurational wave functions with density functional theory in the MC-PDFT method, additional methods for computation of magnetic properties, methods for diabatization, analytical gradients of state average complete active space SCF in association with density fitting, methods for constrained fragment optimization, large-scale parallel multireference configuration interaction including analytic gradients via the interface to the Columbus package, and approximations of the CASPT2 method to be used for computations of large systems. In addition, the report includes the description of a computational machinery for nonlinear optical spectroscopy through an interface to the QM/MM package Cobramm. Further, a module to run molecular dynamics simulations is added, two surface hopping algorithms are included to enable nonadiabatic calculations, and the DQ method for diabatization is added. Finally, we report on the subject of improvements with respects to alternative file options and parallelization. © 2015 Wiley Periodicals, Inc.
Melendez-Torres, G J; Grant, Sean; Bonell, Chris
2015-12-01
Reciprocal translation, the understanding of one study's findings in terms of another's, is the foundation of most qualitative metasynthetic methods. In light of the proliferation of metasynthesis methods, the current review sought to create a taxonomy of operations of reciprocal translation using recently published qualitative metasyntheses. On 19 August 2013, MEDLINE, Embase and PsycINFO were searched. Included articles were full reports of metasyntheses of qualitative studies published in 2012 in English-language peer-reviewed journals. Two reviewers, working independently, screened records, assessed full texts for inclusion and extracted data on methods from each included metasynthesis. Systematic review methods used were summarised, and metasynthetic methods were inductively analysed to develop the taxonomy. Of 61 included metasyntheses, 21 (34%) reported fully replicable search strategies and 51 (84%) critically appraised included studies. Based on methods in these metasyntheses, we developed a taxonomy of reciprocal translation with four overlapping categories: visual representation; key paper integration; data reduction and thematic extraction; and line-by-line coding. This systematic review presents an update on methods and reporting currently used in qualitative metasynthesis. It also goes beyond the proliferation of approaches to offer a parsimonious approach to understanding how reciprocal translations are accomplished across metasynthetis methods. Copyright © 2015 John Wiley & Sons, Ltd.
Method of making metal-polymer composite catalysts
Zelena, Piotr [Los Alamos, NM; Bashyam, Rajesh [Los Alamos, NM
2009-06-23
A metal-polymer-carbon composite catalyst for use as a cathode electrocatalyst in fuel cells. The catalyst includes a heteroatomic polymer; a transition metal linked to the heteroatomic polymer by one of nitrogen, sulfur, and phosphorus, and a recast ionomer dispersed throughout the heteroatomic polymer-carbon composite. The method includes forming a heteroatomic polymer-carbon composite and loading the transition metal onto the composite. The invention also provides a method of making a membrane electrode assembly for a fuel cell that includes the metal-polymer-carbon composite catalyst.
Electrorheological fluids and methods
Green, Peter F.; McIntyre, Ernest C.
2015-06-02
Electrorheological fluids and methods include changes in liquid-like materials that can flow like milk and subsequently form solid-like structures under applied electric fields; e.g., about 1 kV/mm. Such fluids can be used in various ways as smart suspensions, including uses in automotive, defense, and civil engineering applications. Electrorheological fluids and methods include one or more polar molecule substituted polyhedral silsesquioxanes (e.g., sulfonated polyhedral silsesquioxanes) and one or more oils (e.g., silicone oil), where the fluid can be subjected to an electric field.
Wang, Yifeng; Miller, Andy; Bryan, Charles R.; Kruichak, Jessica Nicole
2015-11-17
Methods of capturing and immobilizing radioactive nuclei with metal fluorite-based inorganic materials are described. For example, a method of capturing and immobilizing radioactive nuclei includes flowing a gas stream through an exhaust apparatus. The exhaust apparatus includes a metal fluorite-based inorganic material. The gas stream includes a radioactive species. The radioactive species is removed from the gas stream by adsorbing the radioactive species to the metal fluorite-based inorganic material of the exhaust apparatus.
Localized surface plasmon resonance mercury detection system and methods
James, Jay; Lucas, Donald; Crosby, Jeffrey Scott; Koshland, Catherine P.
2016-03-22
A mercury detection system that includes a flow cell having a mercury sensor, a light source and a light detector is provided. The mercury sensor includes a transparent substrate and a submonolayer of mercury absorbing nanoparticles, e.g., gold nanoparticles, on a surface of the substrate. Methods of determining whether mercury is present in a sample using the mercury sensors are also provided. The subject mercury detection systems and methods find use in a variety of different applications, including mercury detecting applications.
Method and apparatus for synthesizing filamentary structures
Height, Murray J [Somerville, MA; Howard, Jack B [Winchester, MA; Vandersande, John B [Newbury, MA
2008-02-26
Method and apparatus for producing filamentary structures. The structures include single-walled nanotubes. The method includes combusting hydrocarbon fuel and oxygen to establish a non-sooting flame and providing an unsupported catalyst to synthesize the filamentary structure in a post-flame region of the flame. Residence time is selected to favor filamentary structure growth.
Methods for the evaluation of alternative disaster warning systems
NASA Technical Reports Server (NTRS)
Agnew, C. E.; Anderson, R. J., Jr.; Lanen, W. N.
1977-01-01
For each of the methods identified, a theoretical basis is provided and an illustrative example is described. The example includes sufficient realism and detail to enable an analyst to conduct an evaluation of other systems. The methods discussed in the study include equal capability cost analysis, consumers' surplus, and statistical decision theory.
Power systems utilizing the heat of produced formation fluid
Lambirth, Gene Richard [Houston, TX
2011-01-11
Systems, methods, and heaters for treating a subsurface formation are described herein. At least one method includes treating a hydrocarbon containing formation. The method may include providing heat to the formation; producing heated fluid from the formation; and generating electricity from at least a portion of the heated fluid using a Kalina cycle.
ERIC Educational Resources Information Center
Potoczak, Kathryn; Carr, James E.; Michael, Jack
2007-01-01
Two distinct analytic methods have been used to identify the function of problem behavior. The antecedent-behavior-consequence (ABC) method (Iwata, Dorsey, Slifer, Bauman, & Richman, 1982/1994) includes the delivery of consequences for problem behavior. The AB method (Carr & Durand, 1985) does not include consequence delivery, instead relying…
Enhancing hydrogen spillover and storage
Yang, Ralph T [Ann Arbor, MI; Li, Yingwel [Ann Arbor, MI; Lachawiec, Jr., Anthony J.
2011-05-31
Methods for enhancing hydrogen spillover and storage are disclosed. One embodiment of the method includes doping a hydrogen receptor with metal particles, and exposing the hydrogen receptor to ultrasonification as doping occurs. Another embodiment of the method includes doping a hydrogen receptor with metal particles, and exposing the doped hydrogen receptor to a plasma treatment.
Enhancing hydrogen spillover and storage
Yang, Ralph T; Li, Yingwei; Lachawiec, Jr., Anthony J
2013-02-12
Methods for enhancing hydrogen spillover and storage are disclosed. One embodiment of the method includes doping a hydrogen receptor with metal particles, and exposing the hydrogen receptor to ultrasonication as doping occurs. Another embodiment of the method includes doping a hydrogen receptor with metal particles, and exposing the doped hydrogen receptor to a plasma treatment.
Comparing Two Methods for Reducing Variability in Voice Quality Measurements
ERIC Educational Resources Information Center
Kreiman, Jody; Gerratt, Bruce R.
2011-01-01
Purpose: Interrater disagreements in ratings of quality plague the study of voice. This study compared 2 methods for handling this variability. Method: Listeners provided multiple breathiness ratings for 2 sets of pathological voices, one including 20 male and 20 female voices unselected for quality and one including 20 breathy female voices.…
Filter desulfation system and method
Lowe, Michael D.; Robel, Wade J.; Verkiel, Maarten; Driscoll, James J.
2010-08-10
A method of removing sulfur from a filter system of an engine includes continuously passing an exhaust flow through a desulfation leg of the filter system during desulfation. The method also includes sensing at least one characteristic of the exhaust flow and modifying a flow rate of the exhaust flow during desulfation in response to the sensing.
Neutron detector and fabrication method thereof
Bhandari, Harish B.; Nagarkar, Vivek V.; Ovechkina, Olena E.
2016-08-16
A neutron detector and a method for fabricating a neutron detector. The neutron detector includes a photodetector, and a solid-state scintillator operatively coupled to the photodetector. In one aspect, the method for fabricating a neutron detector includes providing a photodetector, and depositing a solid-state scintillator on the photodetector to form a detector structure.
Method and tool to reverse the charges in anti-reflection films used for solar cell applications
Sharma, Vivek; Tracy, Clarence
2017-01-31
A method is provided for making a solar cell. The method includes providing a stack including a substrate, a barrier layer disposed on the substrate, and an anti-reflective layer disposed on the barrier layer, where the anti-reflective layer has charge centers. The method also includes generating a corona with a charging tool and contacting the anti-reflective layer with the corona thereby injecting charge into at least some of the charge centers in the anti-reflective layer. Ultra-violet illumination and temperature-based annealing may be used to modify the charge of the anti-reflective layer.
Method and apparatus for wavefront sensing
Bahk, Seung-Whan
2016-08-23
A method of measuring characteristics of a wavefront of an incident beam includes obtaining an interferogram associated with the incident beam passing through a transmission mask and Fourier transforming the interferogram to provide a frequency domain interferogram. The method also includes selecting a subset of harmonics from the frequency domain interferogram, individually inverse Fourier transforming each of the subset of harmonics to provide a set of spatial domain harmonics, and extracting a phase profile from each of the set of spatial domain harmonics. The method further includes removing phase discontinuities in the phase profile, rotating the phase profile, and reconstructing a phase front of the wavefront of the incident beam.
Silicon release coating, method of making same, and method of using same
Jonczyk, Ralf [Wilmington, DE
2011-11-22
A method of making a release coating includes the following steps: forming a mixture that includes (a) solid components comprising (i) 20-99% silicon by weight and (ii) 1-80% silicon nitride by weight and (b) a solvent; applying the mixture to an inner portion of a crucible or graphite board adapted to form an ingot or wafer comprising silicon; and annealing the mixture in a nitrogen atmosphere at a temperature ranging from 1000 to 2000.degree. C. The invention may also relate to release coatings and methods of making a silicon ingot or wafer including the use of a release coating.
Shermeyer, Jacob S.; Haack, Barry N.
2015-01-01
Two forestry-change detection methods are described, compared, and contrasted for estimating deforestation and growth in threatened forests in southern Peru from 2000 to 2010. The methods used in this study rely on freely available data, including atmospherically corrected Landsat 5 Thematic Mapper and Moderate Resolution Imaging Spectroradiometer (MODIS) vegetation continuous fields (VCF). The two methods include a conventional supervised signature extraction method and a unique self-calibrating method called MODIS VCF guided forest/nonforest (FNF) masking. The process chain for each of these methods includes a threshold classification of MODIS VCF, training data or signature extraction, signature evaluation, k-nearest neighbor classification, analyst-guided reclassification, and postclassification image differencing to generate forest change maps. Comparisons of all methods were based on an accuracy assessment using 500 validation pixels. Results of this accuracy assessment indicate that FNF masking had a 5% higher overall accuracy and was superior to conventional supervised classification when estimating forest change. Both methods succeeded in classifying persistently forested and nonforested areas, and both had limitations when classifying forest change.
Modified carbohydrate-chitosan compounds, methods of making the same and methods of using the same
Venditti, Richard A; Pawlak, Joel J; Salam, Abdus; El-Tahlawy, Khaled Fathy
2015-03-10
Compositions of matter are provided that include chitosan and a modified carbohydrate. The modified carbohydrate includes a carbohydrate component and a cross linking agent. The modified carbohydrate has increased carboxyl content as compared to an unmodified counterpart carbohydrate. A carboxyl group of the modified carbohydrate is covalently bonded with an amino group of chitosan. The compositions of matter provided herein may include cross linked starch citrate-chitosan and cross linked hemicellulose citrate-chitosan, including foams thereof. These compositions yield excellent absorbency and metal chelation properties. Methods of making cross linked modified carbohydrate-chitosan compounds are also provided.
Dual phase magnetic material component and method of forming
Dial, Laura Cerully; DiDomizio, Richard; Johnson, Francis
2017-04-25
A magnetic component having intermixed first and second regions, and a method of preparing that magnetic component are disclosed. The first region includes a magnetic phase and the second region includes a non-magnetic phase. The method includes mechanically masking pre-selected sections of a surface portion of the component by using a nitrogen stop-off material and heat-treating the component in a nitrogen-rich atmosphere at a temperature greater than about 900.degree. C. Both the first and second regions are substantially free of carbon, or contain only limited amounts of carbon; and the second region includes greater than about 0.1 weight % of nitrogen.
Catalysts for converting syngas into liquid hydrocarbons and methods thereof
Yu, Fei; Yan, Qiangu; Batchelor, William
2016-03-15
The presently-disclosed subject matter includes methods for producing liquid hydrocarbons from syngas. In some embodiments the syngas is obtained from biomass and/or comprises a relatively high amount of nitrogen and/or carbon dioxide. In some embodiments the present methods can convert syngas into liquid hydrocarbons through a one-stage process. Also provided are catalysts for producing liquid hydrocarbons from syngas, wherein the catalysts include a base material, a transition metal, and a promoter. In some embodiments the base material includes a zeolite-iron material or a cobalt-molybdenum carbide material. In still further embodiments the promoter can include an alkali metal.
Photovoltaic cell module and method of forming
Howell, Malinda; Juen, Donnie; Ketola, Barry; Tomalia, Mary Kay
2017-12-12
A photovoltaic cell module, a photovoltaic array including at least two modules, and a method of forming the module are provided. The module includes a first outermost layer and a photovoltaic cell disposed on the first outermost layer. The module also includes a second outermost layer disposed on the photovoltaic cell and sandwiching the photovoltaic cell between the second outermost layer and the first outermost layer. The method of forming the module includes the steps of disposing the photovoltaic cell on the first outermost layer, disposing a silicone composition on the photovoltaic cell, and compressing the first outermost layer, the photovoltaic cell, and the second layer to form the photovoltaic cell module.
Domain epitaxy for thin film growth
Narayan, Jagdish
2005-10-18
A method of forming an epitaxial film on a substrate includes growing an initial layer of a film on a substrate at a temperature T.sub.growth, said initial layer having a thickness h and annealing the initial layer of the film at a temperature T.sub.anneal, thereby relaxing the initial layer, wherein said thickness h of the initial layer of the film is greater than a critical thickness h.sub.c. The method further includes growing additional layers of the epitaxial film on the initial layer subsequent to annealing. In some embodiments, the method further includes growing a layer of the film that includes at least one amorphous island.
Finite elements and finite differences for transonic flow calculations
NASA Technical Reports Server (NTRS)
Hafez, M. M.; Murman, E. M.; Wellford, L. C.
1978-01-01
The paper reviews the chief finite difference and finite element techniques used for numerical solution of nonlinear mixed elliptic-hyperbolic equations governing transonic flow. The forms of the governing equations for unsteady two-dimensional transonic flow considered are the Euler equation, the full potential equation in both conservative and nonconservative form, the transonic small-disturbance equation in both conservative and nonconservative form, and the hodograph equations for the small-disturbance case and the full-potential case. Finite difference methods considered include time-dependent methods, relaxation methods, semidirect methods, and hybrid methods. Finite element methods include finite element Lax-Wendroff schemes, implicit Galerkin method, mixed variational principles, dual iterative procedures, optimal control methods and least squares.
Methods for the additive manufacturing of semiconductor and crystal materials
Stowe, Ashley C.; Speight, Douglas
2016-11-22
A method for the additive manufacturing of inorganic crystalline materials, including: physically combining a plurality of starting materials that are used to form an inorganic crystalline compound to be used as one or more of a semiconductor, scintillator, laser crystal, and optical filter; heating or melting successive regions of the combined starting materials using a directed heat source having a predetermined energy characteristic, thereby facilitating the reaction of the combined starting materials; and allowing each region of the combined starting materials to cool in a controlled manner, such that the desired inorganic crystalline compound results. The method also includes, prior to heating or melting the successive regions of the combined starting materials using the directed heat source, heating the combined starting materials to facilitate initial reaction of the combined starting materials. The method further includes translating the combined starting materials and/or the directed heat source between successive locations. The method still further includes controlling the mechanical, electrical, photonic, and/or optical properties of the inorganic crystalline compound.
Method for forming silicon on a glass substrate
McCarthy, Anthony M.
1995-01-01
A method by which single-crystal silicon microelectronics may be fabricated on glass substrates at unconventionally low temperatures. This is achieved by fabricating a thin film of silicon on glass and subsequently forming the doped components by a short wavelength (excimer) laser doping procedure and conventional patterning techniques. This method may include introducing a heavily boron doped etch stop layer on a silicon wafer using an excimer laser, which permits good control of the etch stop layer removal process. This method additionally includes dramatically reducing the remaining surface roughness of the silicon thin films after etching in the fabrication of silicon on insulator wafers by scanning an excimer laser across the surface of the silicon thin film causing surface melting, whereby the surface tension of the melt causes smoothing of the surface during recrystallization. Applications for this method include those requiring a transparent or insulating substrate, such as display manufacturing. Other applications include sensors, actuators, optoelectronics, radiation hard and high temperature electronics.
Method for forming silicon on a glass substrate
McCarthy, A.M.
1995-03-07
A method by which single-crystal silicon microelectronics may be fabricated on glass substrates at unconventionally low temperatures. This is achieved by fabricating a thin film of silicon on glass and subsequently forming the doped components by a short wavelength (excimer) laser doping procedure and conventional patterning techniques. This method may include introducing a heavily boron doped etch stop layer on a silicon wafer using an excimer laser, which permits good control of the etch stop layer removal process. This method additionally includes dramatically reducing the remaining surface roughness of the silicon thin films after etching in the fabrication of silicon on insulator wafers by scanning an excimer laser across the surface of the silicon thin film causing surface melting, whereby the surface tension of the melt causes smoothing of the surface during recrystallization. Applications for this method include those requiring a transparent or insulating substrate, such as display manufacturing. Other applications include sensors, actuators, optoelectronics, radiation hard and high temperature electronics. 15 figs.
Multigrid Methods for Aerodynamic Problems in Complex Geometries
NASA Technical Reports Server (NTRS)
Caughey, David A.
1995-01-01
Work has been directed at the development of efficient multigrid methods for the solution of aerodynamic problems involving complex geometries, including the development of computational methods for the solution of both inviscid and viscous transonic flow problems. The emphasis is on problems of complex, three-dimensional geometry. The methods developed are based upon finite-volume approximations to both the Euler and the Reynolds-Averaged Navier-Stokes equations. The methods are developed for use on multi-block grids using diagonalized implicit multigrid methods to achieve computational efficiency. The work is focused upon aerodynamic problems involving complex geometries, including advanced engine inlets.
Energy Decision Science and Informatics | Integrated Energy Solutions |
Science Advanced decision science methods include multi-objective and multi-criteria decision support. Our decision science methods, including multi-objective and multi-criteria decision support. For example, we
Energy storage cell impedance measuring apparatus, methods and related systems
Morrison, John L.; Morrison, William H.; Christophersen, Jon P.
2017-12-26
Energy storage cell impedance testing devices, circuits, and related methods are disclosed. An energy storage cell impedance measuring device includes a sum of sinusoids (SOS) current excitation circuit including differential current sources configured to isolate a ground terminal of the differential current sources from a positive terminal and a negative terminal of an energy storage cell. A method includes applying an SOS signal comprising a sum of sinusoidal current signals to the energy storage cell with the SOS current excitation circuit, each of the sinusoidal current signals oscillating at a different one of a plurality of different frequencies. The method also includes measuring an electrical signal at a positive terminal and a negative terminal of the energy storage cell, and computing an impedance of the energy storage cell at each of the plurality of different frequencies using the measured electrical signal.
Method Development in Forensic Toxicology.
Peters, Frank T; Wissenbach, Dirk K; Busardo, Francesco Paolo; Marchei, Emilia; Pichini, Simona
2017-01-01
In the field of forensic toxicology, the quality of analytical methods is of great importance to ensure the reliability of results and to avoid unjustified legal consequences. A key to high quality analytical methods is a thorough method development. The presented article will provide an overview on the process of developing methods for forensic applications. This includes the definition of the method's purpose (e.g. qualitative vs quantitative) and the analytes to be included, choosing an appropriate sample matrix, setting up separation and detection systems as well as establishing a versatile sample preparation. Method development is concluded by an optimization process after which the new method is subject to method validation. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.
NASA Technical Reports Server (NTRS)
Baxes, Gregory A. (Inventor); Linger, Timothy C. (Inventor)
2011-01-01
Systems and methods are provided for progressive mesh storage and reconstruction using wavelet-encoded height fields. A method for progressive mesh storage includes reading raster height field data, and processing the raster height field data with a discrete wavelet transform to generate wavelet-encoded height fields. In another embodiment, a method for progressive mesh storage includes reading texture map data, and processing the texture map data with a discrete wavelet transform to generate wavelet-encoded texture map fields. A method for reconstructing a progressive mesh from wavelet-encoded height field data includes determining terrain blocks, and a level of detail required for each terrain block, based upon a viewpoint. Triangle strip constructs are generated from vertices of the terrain blocks, and an image is rendered utilizing the triangle strip constructs. Software products that implement these methods are provided.
NASA Technical Reports Server (NTRS)
Baxes, Gregory A. (Inventor)
2010-01-01
Systems and methods are provided for progressive mesh storage and reconstruction using wavelet-encoded height fields. A method for progressive mesh storage includes reading raster height field data, and processing the raster height field data with a discrete wavelet transform to generate wavelet-encoded height fields. In another embodiment, a method for progressive mesh storage includes reading texture map data, and processing the texture map data with a discrete wavelet transform to generate wavelet-encoded texture map fields. A method for reconstructing a progressive mesh from wavelet-encoded height field data includes determining terrain blocks, and a level of detail required for each terrain block, based upon a viewpoint. Triangle strip constructs are generated from vertices of the terrain blocks, and an image is rendered utilizing the triangle strip constructs. Software products that implement these methods are provided.
Description and use of LSODE, the Livermore Solver for Ordinary Differential Equations
NASA Technical Reports Server (NTRS)
Radhakrishnan, Krishnan; Hindmarsh, Alan C.
1993-01-01
LSODE, the Livermore Solver for Ordinary Differential Equations, is a package of FORTRAN subroutines designed for the numerical solution of the initial value problem for a system of ordinary differential equations. It is particularly well suited for 'stiff' differential systems, for which the backward differentiation formula method of orders 1 to 5 is provided. The code includes the Adams-Moulton method of orders 1 to 12, so it can be used for nonstiff problems as well. In addition, the user can easily switch methods to increase computational efficiency for problems that change character. For both methods a variety of corrector iteration techniques is included in the code. Also, to minimize computational work, both the step size and method order are varied dynamically. This report presents complete descriptions of the code and integration methods, including their implementation. It also provides a detailed guide to the use of the code, as well as an illustrative example problem.
[Recent advances in sample preparation methods of plant hormones].
Wu, Qian; Wang, Lus; Wu, Dapeng; Duan, Chunfeng; Guan, Yafeng
2014-04-01
Plant hormones are a group of naturally occurring trace substances which play a crucial role in controlling the plant development, growth and environment response. With the development of the chromatography and mass spectroscopy technique, chromatographic analytical method has become a widely used way for plant hormone analysis. Among the steps of chromatographic analysis, sample preparation is undoubtedly the most vital one. Thus, a highly selective and efficient sample preparation method is critical for accurate identification and quantification of phytohormones. For the three major kinds of plant hormones including acidic plant hormones & basic plant hormones, brassinosteroids and plant polypeptides, the sample preparation methods are reviewed in sequence especially the recently developed methods. The review includes novel methods, devices, extractive materials and derivative reagents for sample preparation of phytohormones analysis. Especially, some related works of our group are included. At last, the future developments in this field are also prospected.
Methods of refining natural oils and methods of producing fuel compositions
Firth, Bruce E; Kirk, Sharon E; Gavaskar, Vasudeo S
2015-11-04
A method of refining a natural oil includes: (a) providing a feedstock that includes a natural oil; (b) reacting the feedstock in the presence of a metathesis catalyst to form a metathesized product that includes olefins and esters; (c) passivating residual metathesis catalyst with an agent selected from the group consisting of phosphorous acid, phosphinic acid, and a combination thereof; (d) separating the olefins in the metathesized product from the esters in the metathesized product; and (e) transesterifying the esters in the presence of an alcohol to form a transesterified product and/or hydrogenating the olefins to form a fully or partially saturated hydrogenated product. Methods for suppressing isomerization of olefin metathesis products produced in a metathesis reaction, and methods of producing fuel compositions are described.
Multifidelity Analysis and Optimization for Supersonic Design
NASA Technical Reports Server (NTRS)
Kroo, Ilan; Willcox, Karen; March, Andrew; Haas, Alex; Rajnarayan, Dev; Kays, Cory
2010-01-01
Supersonic aircraft design is a computationally expensive optimization problem and multifidelity approaches over a significant opportunity to reduce design time and computational cost. This report presents tools developed to improve supersonic aircraft design capabilities including: aerodynamic tools for supersonic aircraft configurations; a systematic way to manage model uncertainty; and multifidelity model management concepts that incorporate uncertainty. The aerodynamic analysis tools developed are appropriate for use in a multifidelity optimization framework, and include four analysis routines to estimate the lift and drag of a supersonic airfoil, a multifidelity supersonic drag code that estimates the drag of aircraft configurations with three different methods: an area rule method, a panel method, and an Euler solver. In addition, five multifidelity optimization methods are developed, which include local and global methods as well as gradient-based and gradient-free techniques.
Basic analytical methods for identification of erythropoiesis-stimulating agents in doping control
NASA Astrophysics Data System (ADS)
Postnikov, P. V.; Krotov, G. I.; Efimova, Yu A.; Rodchenkov, G. M.
2016-02-01
The design of new erythropoiesis-stimulating agents for clinical use necessitates constant development of methods for detecting the abuse of these substances, which are prohibited under the World Anti-Doping Code and are included in the World Anti-Doping Agency (WADA) prohibited list. This review integrates and describes systematically the published data on the key methods currently used by WADA-accredited anti-doping laboratories around the world to detect the abuse of erythropoiesis-stimulating agents, including direct methods (various polyacrylamide gel electrophoresis techniques, enzyme-linked immunosorbent assay, membrane enzyme immunoassay and mass spectrometry) and indirect methods (athlete biological passport). Particular attention is given to promising approaches and investigations that can be used to control prohibited erythropoietins in the near future. The bibliography includes 122 references.
NASA Astrophysics Data System (ADS)
Godfrey-Kittle, Andrew; Cafiero, Mauricio
We present density functional theory (DFT) interaction energies for the sandwich and T-shaped conformers of substituted benzene dimers. The DFT functionals studied include TPSS, HCTH407, B3LYP, and X3LYP. We also include Hartree-Fock (HF) and second-order Møller-Plesset perturbation theory calculations (MP2), as well as calculations using a new functional, P3LYP, which includes PBE and HF exchange and LYP correlation. Although DFT methods do not explicitly account for the dispersion interactions important in the benzene-dimer interactions, we find that our new method, P3LYP, as well as HCTH407 and TPSS, match MP2 and CCSD(T) calculations much better than the hybrid methods B3LYP and X3LYP methods do.
System and method of self-properties for an autonomous and automatic computer environment
NASA Technical Reports Server (NTRS)
Sterritt, Roy (Inventor); Hinchey, Michael G. (Inventor)
2010-01-01
Systems, methods and apparatus are provided through which in some embodiments self health/urgency data and environment health/urgency data may be transmitted externally from an autonomic element. Other embodiments may include transmitting the self health/urgency data and environment health/urgency data together on a regular basis similar to the lub-dub of a heartbeat. Yet other embodiments may include a method for managing a system based on the functioning state and operating status of the system, wherein the method may include processing received signals from the system indicative of the functioning state and the operating status to obtain an analysis of the condition of the system, generating one or more stay alive signals based on the functioning status and the operating state of the system, transmitting the stay-alive signal, transmitting self health/urgency data, and transmitting environment health/urgency data. Still other embodiments may include an autonomic element that includes a self monitor, a self adjuster, an environment monitor, and an autonomic manager.
NOx reduction methods and apparatuses
Tonkyn, Russell G.; Barlow, Stephan E.; Balmer, M. Lou; Maupin, Gary D.
2004-10-26
A NO.sub.x reduction method includes treating a first gas containing NO.sub.x, producing a second gas containing NO.sub.2, reducing a portion of the NO.sub.2 in the second gas to N.sub.2, and producing a third gas containing less NO.sub.x than the first gas, substantially all of the third gas NO.sub.x being NO. The method also includes treating the third gas, producing a fourth gas containing NO.sub.2, reducing a portion of the NO.sub.2 in the fourth gas to N.sub.2, and producing a fifth gas containing less NO.sub.x than the third gas, substantially all of the fifth gas NO.sub.x being NO. Treating the first and/or third gas can include treatment with a plasma. Reducing a portion of the NO.sub.2 in the second and/or fourth gas can include reducing with a catalyst. The method can further include controlling energy consumption of the plasmas independent of each other.
Monte Carlo approaches to sampling forested tracts with lines or points
Harry T. Valentine; Jeffrey H. Gove; Timothy G. Gregoire
2001-01-01
Several line- and point-based sampling methods can be employed to estimate the aggregate dimensions of trees standing on a forested tract or pieces of coarse woody debris lying on the forest floor. Line methods include line intersect sampling, horizontal line sampling, and transect relascope sampling; point methods include variable- and fixed-radius plot sampling, and...
Spectral multigrid methods for elliptic equations 2
NASA Technical Reports Server (NTRS)
Zang, T. A.; Wong, Y. S.; Hussaini, M. Y.
1983-01-01
A detailed description of spectral multigrid methods is provided. This includes the interpolation and coarse-grid operators for both periodic and Dirichlet problems. The spectral methods for periodic problems use Fourier series and those for Dirichlet problems are based upon Chebyshev polynomials. An improved preconditioning for Dirichlet problems is given. Numerical examples and practical advice are included.
Method of forming emitters for a back-contact solar cell
Li, Bo; Cousins, Peter J.; Smith, David D.
2015-09-29
Methods of forming emitters for back-contact solar cells are described. In one embodiment, a method includes forming a first solid-state dopant source above a substrate. The first solid-state dopant source includes a plurality of regions separated by gaps. Regions of a second solid-state dopant source are formed above the substrate by printing.
Method of forming emitters for a back-contact solar cell
Li, Bo; Cousins, Peter J; Smith, David D
2014-12-16
Methods of forming emitters for back-contact solar cells are described. In one embodiment, a method includes forming a first solid-state dopant source above a substrate. The first solid-state dopant source includes a plurality of regions separated by gaps. Regions of a second solid-state dopant source are formed above the substrate by printing.
Method or forming emitters for a back-contact solar cell
Li, Bo; Cousins, Peter J.; Smith, David D.
2014-08-12
Methods of forming emitters for back-contact solar cells are described. In one embodiment, a method includes forming a first solid-state dopant source above a substrate. The first solid-state dopant source includes a plurality of regions separated by gaps. Regions of a second solid-state dopant source are formed above the substrate by printing.
Ni modified ceramic anodes for direct-methane solid oxide fuel cells
Xiao, Guoliang; Chen, Fanglin
2016-01-19
In accordance with certain embodiments of the present disclosure, a method for fabricating a solid oxide fuel cell is described. The method includes synthesizing a composition having a perovskite present therein. The method further includes applying the composition on an electrolyte support to form an anode and applying Ni to the composition on the anode.
System and method for diagnosing EGR performance using NOx sensor
Mazur, Christopher John
2003-12-23
A method and system for diagnosing a condition of an EGR valve used in an engine system. The EGR valve controls the portion exhaust gases produced by such engine system and fed back to an intake of such engine system. The engine system includes a NOx sensor for measuring NOx in such exhaust. The method includes: determining a time rate of change in NOx measured by the NOx sensor; comparing the determined time rate of change in the measured NOx with a predetermined expected time rate of change in measured NOx; and determining the condition of the EGR valve as a function of such comparison. The method also includes: determining from NOx measured by the NOx sensor and engine operating conditions indications of instances when samples of such measured NOx are greater than an expected maximum NOx level for such engine condition and less than an expected minimum NOx level for such engine condition; and determining the condition of the EGR valve as a function of a statistical analysis of such indications. The method includes determining whether the NOx sensor is faulty and wherein the EGR condition determining includes determining whether the NOx sensor is faulty.
Interagency comparison of iodometric methods for ozone determination
NASA Technical Reports Server (NTRS)
Demore, W. B.; Romanovsky, J. C.; Feldstein, M.; Mueller, P. K.; Hamming, W. J.
1976-01-01
The California Air Resources Board appointed an Oxidant Calibration Committee for the purpose of evaluating the accuracy of the different agency calibration procedures. The committee chose UV absorption photometry as the reference method for ozone measurement. Interagency comparisons of the various iodometric methods were conducted relative to the ultraviolet standard. The tests included versions of the iodometric methods as employed by the Air Resources Board, the Los Angeles Air Pollution Control District, and the EPA. An alternative candidate reference method for ozone measurement, gas phase titration, was also included in the test series.
Inventory of research methods for librarianship and informatics.
Eldredge, Jonathan D
2004-01-01
This article defines and describes the rich variety of research designs found in librarianship and informatics practice. Familiarity with the range of methods and the ability to make distinctions between those specific methods can enable authors to label their research reports correctly. The author has compiled an inventory of methods from a variety of disciplines, but with attention to the relevant applications of a methodology to the field of librarianship. Each entry in the inventory includes a definition and description for the particular research method. Some entries include references to resource material and examples.
Web-based emergency response exercise management systems and methods thereof
Goforth, John W.; Mercer, Michael B.; Heath, Zach; Yang, Lynn I.
2014-09-09
According to one embodiment, a method for simulating portions of an emergency response exercise includes generating situational awareness outputs associated with a simulated emergency and sending the situational awareness outputs to a plurality of output devices. Also, the method includes outputting to a user device a plurality of decisions associated with the situational awareness outputs at a decision point, receiving a selection of one of the decisions from the user device, generating new situational awareness outputs based on the selected decision, and repeating the sending, outputting and receiving steps based on the new situational awareness outputs. Other methods, systems, and computer program products are included according to other embodiments of the invention.
Neural networks: Application to medical imaging
NASA Technical Reports Server (NTRS)
Clarke, Laurence P.
1994-01-01
The research mission is the development of computer assisted diagnostic (CAD) methods for improved diagnosis of medical images including digital x-ray sensors and tomographic imaging modalities. The CAD algorithms include advanced methods for adaptive nonlinear filters for image noise suppression, hybrid wavelet methods for feature segmentation and enhancement, and high convergence neural networks for feature detection and VLSI implementation of neural networks for real time analysis. Other missions include (1) implementation of CAD methods on hospital based picture archiving computer systems (PACS) and information networks for central and remote diagnosis and (2) collaboration with defense and medical industry, NASA, and federal laboratories in the area of dual use technology conversion from defense or aerospace to medicine.
NASA Technical Reports Server (NTRS)
Parrott, T. L.
1973-01-01
An improved method for the design of expansion-chamber mufflers is described and applied to the task of reducing exhaust noise generated by a helicopter. The method is an improvement of standard transmission-line theory in that it accounts for the effect of the mean exhaust-gas flow on the acoustic-transmission properties of a muffler system, including the termination boundary condition. The method has been computerized, and the computer program includes an optimization procedure that adjusts muffler component lengths to achieve a minimum specified desired transmission loss over a specified frequency range. A printout of the program is included together with a user-oriented description.
Gas stream analysis using voltage-current time differential operation of electrochemical sensors
DOE Office of Scientific and Technical Information (OSTI.GOV)
Woo, Leta Yar-Li; Glass, Robert Scott; Fitzpatrick, Joseph Jay
A method for analysis of a gas stream. The method includes identifying an affected region of an affected waveform signal corresponding to at least one characteristic of the gas stream. The method also includes calculating a voltage-current time differential between the affected region of the affected waveform signal and a corresponding region of an original waveform signal. The affected region and the corresponding region of the waveform signals have a sensitivity specific to the at least one characteristic of the gas stream. The method also includes generating a value for the at least one characteristic of the gas stream basedmore » on the calculated voltage-current time differential.« less
Templated synthesis of metal nanorods in silica nanotubes
DOE Office of Scientific and Technical Information (OSTI.GOV)
Yin, Yadong; Gao, Chuanbo
A method of preparing a metal nanorod. The method includes seeding a metal nanoparticle within the lumen of a nanotube, and growing a metal nanorod from the seeded metal nanoparticle to form a metal nanorod-nanotube composite. In some cases, the nanotube includes metal binding ligands attached to the inner surface. Growing of the metal nanorod includes incubating the seeded nanotube in a solution that includes: a metal source for the metal in the metal nanorod, the metal source including an ion of the metal; a coordinating ligand that forms a stable complex with the metal ion; a reducing agent formore » reducing the metal ion, and a capping agent that stabilizes atomic monomers of the metal. Compositions derived from the method are also provided.« less
Radio Frequency Power Load and Associated Method
NASA Technical Reports Server (NTRS)
Srinivasan, V. Karthik (Inventor); Freestone, Todd M. (Inventor); Sims, William Herbert, III (Inventor)
2014-01-01
A radio frequency power load and associated method. A radio frequency power load apparatus may include a container with an ionized fluid therein. The apparatus may include one conductor immersed in a fluid and another conductor electrically connected to the container. A radio frequency transmission system may include a radio frequency transmitter, a radio frequency amplifier connected to the transmitter and a radio frequency power load apparatus connected to the amplifier. The apparatus may include a fluid having an ion source therein, one conductor immersed in a fluid, and another conductor electrically connected to the container. A method of dissipating power generated by a radio frequency transmission system may include constructing a waveguide with ionized fluid in a container and connecting the waveguide to an amplifier of the transmission system.
Formulation and method for preparing gels comprising hydrous aluminum oxide
Collins, Jack L.
2014-06-17
Formulations useful for preparing hydrous aluminum oxide gels contain a metal salt including aluminum, an organic base, and a complexing agent. Methods for preparing gels containing hydrous aluminum oxide include heating a formulation to a temperature sufficient to induce gel formation, where the formulation contains a metal salt including aluminum, an organic base, and a complexing agent.
Formulation and method for preparing gels comprising hydrous cerium oxide
Collins, Jack L; Chi, Anthony
2013-05-07
Formulations useful for preparing hydrous cerium oxide gels contain a metal salt including cerium, an organic base, and a complexing agent. Methods for preparing gels containing hydrous cerium oxide include heating a formulation to a temperature sufficient to induce gel formation, where the formulation contains a metal salt including cerium, an organic base, and a complexing agent.
Methods and systems to thermally protect fuel nozzles in combustion systems
Helmick, David Andrew; Johnson, Thomas Edward; York, William David; Lacy, Benjamin Paul
2013-12-17
A method of assembling a gas turbine engine is provided. The method includes coupling a combustor in flow communication with a compressor such that the combustor receives at least some of the air discharged by the compressor. A fuel nozzle assembly is coupled to the combustor and includes at least one fuel nozzle that includes a plurality of interior surfaces, wherein a thermal barrier coating is applied across at least one of the plurality of interior surfaces to facilitate shielding the interior surfaces from combustion gases.
Neutron absorbers and methods of forming at least a portion of a neutron absorber
Guillen, Donna P; Porter, Douglas L; Swank, W David; Erickson, Arnold W
2014-12-02
Methods of forming at least a portion of a neutron absorber include combining a first material and a second material to form a compound, reducing the compound into a plurality of particles, mixing the plurality of particles with a third material, and pressing the mixture of the plurality of particles and the third material. One or more components of neutron absorbers may be formed by such methods. Neutron absorbers may include a composite material including an intermetallic compound comprising hafnium aluminide and a matrix material comprising pure aluminum.
Roelofs, Andreas; Hong, Seungbum
2018-02-06
A method for rapid imaging of a material specimen includes positioning a tip to contact the material specimen, and applying a force to a surface of the material specimen via the tip. In addition, the method includes moving the tip across the surface of the material specimen while removing electrical charge therefrom, generating a signal produced by contact between the tip and the surface, and detecting, based on the data, the removed electrical charge induced through the tip during movement of the tip across the surface. The method further includes measuring the detected electrical charge.
Solar cell contact formation using laser ablation
Harley, Gabriel; Smith, David D.; Cousins, Peter John
2015-07-21
The formation of solar cell contacts using a laser is described. A method of fabricating a back-contact solar cell includes forming a poly-crystalline material layer above a single-crystalline substrate. The method also includes forming a dielectric material stack above the poly-crystalline material layer. The method also includes forming, by laser ablation, a plurality of contacts holes in the dielectric material stack, each of the contact holes exposing a portion of the poly-crystalline material layer; and forming conductive contacts in the plurality of contact holes.
Solar cell contact formation using laser ablation
Harley, Gabriel; Smith, David; Cousins, Peter
2012-12-04
The formation of solar cell contacts using a laser is described. A method of fabricating a back-contact solar cell includes forming a poly-crystalline material layer above a single-crystalline substrate. The method also includes forming a dielectric material stack above the poly-crystalline material layer. The method also includes forming, by laser ablation, a plurality of contacts holes in the dielectric material stack, each of the contact holes exposing a portion of the poly-crystalline material layer; and forming conductive contacts in the plurality of contact holes.
Solar cell contact formation using laser ablation
Harley, Gabriel; Smith, David D.; Cousins, Peter John
2014-07-22
The formation of solar cell contacts using a laser is described. A method of fabricating a back-contact solar cell includes forming a poly-crystalline material layer above a single-crystalline substrate. The method also includes forming a dielectric material stack above the poly-crystalline material layer. The method also includes forming, by laser ablation, a plurality of contacts holes in the dielectric material stack, each of the contact holes exposing a portion of the poly-crystalline materiat layer; and forming conductive contacts in the plurality of contact holes.
Apparatus and method to enhance X-ray production in laser produced plasmas
Augustoni, Arnold L.; Gerardo, James B.; Raymond, Thomas D.
1992-01-01
Method and apparatus for generating x-rays for use in, for instance, x-ray photolithography. The method of generating x-rays includes the steps of providing a target and irradiating the target with a laser system which produces a train of sub-pulses to generate an x-ray producing plasma. The sub-pulses are of both high intensity and short duration. The apparatus for generating x-rays from a plasma includes a vacuum chamber, a target supported within the chamber and a laser system, including a short storage time laser.
Systems and methods for data quality control and cleansing
Wenzel, Michael; Boettcher, Andrew; Drees, Kirk; Kummer, James
2016-05-31
A method for detecting and cleansing suspect building automation system data is shown and described. The method includes using processing electronics to automatically determine which of a plurality of error detectors and which of a plurality of data cleansers to use with building automation system data. The method further includes using processing electronics to automatically detect errors in the data and cleanse the data using a subset of the error detectors and a subset of the cleansers.
Senroy, Nilanjan [New Delhi, IN; Suryanarayanan, Siddharth [Littleton, CO
2011-03-15
A computer-implemented method of signal processing is provided. The method includes generating one or more masking signals based upon a computed Fourier transform of a received signal. The method further includes determining one or more intrinsic mode functions (IMFs) of the received signal by performing a masking-signal-based empirical mode decomposition (EMD) using the at least one masking signal.
Nanocomposite and method of making thereof
Tangirala, Ravisubhash; Milliron, Delia J.; Llordes, Anna
2016-03-15
An embodiment of an inorganic nanocomposite includes a nanoparticle phase and a matrix phase. The nanoparticle phase includes nanoparticles that are arranged in a repeating structure. In an embodiment, the nanoparticles have a spherical or pseudo-spherical shape and are incompatible with hydrazine. In another embodiment, the nanoparticles have neither a spherical nor pseudo-spherical shape. The matrix phase lies between the nanoparticles of the nanoparticle phase. An embodiment of a method of making an inorganic nanocomposite of the present invention includes forming a nanoparticle superlattice on a substrate. The nanoparticle superlattice includes nanoparticles. Each nanoparticle has organic ligands attached to a surface of the nanoparticle. The organic ligands separate adjacent nanoparticles within the nanoparticle superlattice. The method also includes forming a solution that includes an inorganic precursor. The nanoparticle superlattice is placed in the solution for a sufficient time for the inorganic precursor to replace the organic ligands.
Nutritional assessment in intravenous drug users with HIV/AIDS.
Smit, E; Tang, A
2000-10-01
Studying metabolic, endocrine, and gastrointestinal (MEG) disorders in drug abuse and HIV infection is important. Equally important, however, are the tools we use to assess these disorders. Assessment of nutritional status may include any combination of biochemical and body composition measurements, dietary intake assessment, and metabolic studies. Each method has its strengths and weaknesses and there is no perfect tool. When assessing nutritional status in injection drug users (IDU) and in HIV-infected people, the decision on which method or methods to use becomes even more complex. A review of studies reported during the XII World Conference on AIDS reveals that of 64 abstracts on the topic of nutrition in HIV-infected adults, only 11 assessed diet, 41 assessed anthropometry, and 24 assessed some form of biochemical measure. The most commonly reported methods for dietary intake included 24-hour recalls, food records, and food frequencies. The commonest methods used for measuring body composition included height, weight, bioimpedance, and dual-energy x-ray absorptiometry (DEXA). Biochemical measurements included various blood nutrients, lipids, and albumin. Methods varied greatly between studies, and caution should be taken when trying to compare results across studies, especially among those using different methods. Currently, few studies deal with the development of methods that can be used for research in HIV-infected and IDU populations. We need to work toward better tools in dietary intake assessment, body composition, and biochemical measurements, especially methods that will allow us to track changes in nutritional status over time.
Transparent ceramics and methods of preparation thereof
Hollingsworth, Joel P.; Kuntz, Joshua D.; Seeley, Zachary M.; Soules, Thomas F.
2012-12-25
A method for forming a transparent ceramic preform in one embodiment includes forming a suspension of oxide particles in a solvent, wherein the suspension includes a dispersant, with the proviso that the suspension does not include a gelling agent; and uniformly curing the suspension for forming a preform of gelled suspension. A method according to another embodiment includes creating a mixture of inorganic particles, a solvent and a dispersant, the inorganic particles having a mean diameter of less than about 2000 nm; agitating the mixture; adding the mixture to a mold; and curing the mixture in the mold for gelling the mixture, with the proviso that no gelling agent is added to the mixture.
AN EULERIAN-LAGRANGIAN LOCALIZED ADJOINT METHOD FOR THE ADVECTION-DIFFUSION EQUATION
Many numerical methods use characteristic analysis to accommodate the advective component of transport. Such characteristic methods include Eulerian-Lagrangian methods (ELM), modified method of characteristics (MMOC), and operator splitting methods. A generalization of characteri...
Wireless autonomous device data transmission
NASA Technical Reports Server (NTRS)
Sammel, Jr., David W. (Inventor); Mickle, Marlin H. (Inventor); Cain, James T. (Inventor); Mi, Minhong (Inventor)
2013-01-01
A method of communicating information from a wireless autonomous device (WAD) to a base station. The WAD has a data element having a predetermined profile having a total number of sequenced possible data element combinations. The method includes receiving at the WAD an RF profile transmitted by the base station that includes a triggering portion having a number of pulses, wherein the number is at least equal to the total number of possible data element combinations. The method further includes keeping a count of received pulses and wirelessly transmitting a piece of data, preferably one bit, to the base station when the count reaches a value equal to the stored data element's particular number in the sequence. Finally, the method includes receiving the piece of data at the base station and using the receipt thereof to determine which of the possible data element combinations the stored data element is.
Devices, systems, and methods for harvesting energy and methods for forming such devices
Kotter, Dale K.; Novack, Steven D.
2012-12-25
Energy harvesting devices include a substrate coupled with a photovoltaic material and a plurality of resonance elements associated with the substrate. The resonance elements are configured to collect energy in at least visible and infrared light spectra. Each resonance element is capacitively coupled with the photovoltaic material, and may be configured to resonate at a bandgap energy of the photovoltaic material. Systems include a photovoltaic material coupled with a feedpoint of a resonance element. Methods for harvesting energy include exposing a resonance element having a resonant electromagnetic radiation having a frequency between approximately 20 THz and approximately 1,000 THz, absorbing at least a portion of the electromagnetic radiation with the resonance element, and resonating the resonance element at a bandgap energy of an underlying photovoltaic material. Methods for forming an energy harvesting device include forming resonance elements on a substrate and capacitively coupling the resonance elements with a photovoltaic material.
Apparatus and method for controlling autotroph cultivation
Fuxman, Adrian M; Tixier, Sebastien; Stewart, Gregory E; Haran, Frank M; Backstrom, Johan U; Gerbrandt, Kelsey
2013-07-02
A method includes receiving at least one measurement of a dissolved carbon dioxide concentration of a mixture of fluid containing an autotrophic organism. The method also includes determining an adjustment to one or more manipulated variables using the at least one measurement. The method further includes generating one or more signals to modify the one or more manipulated variables based on the determined adjustment. The one or more manipulated variables could include a carbon dioxide flow rate, an air flow rate, a water temperature, and an agitation level for the mixture. At least one model relates the dissolved carbon dioxide concentration to one or more manipulated variables, and the adjustment could be determined by using the at least one model to drive the dissolved carbon dioxide concentration to at least one target that optimize a goal function. The goal function could be to optimize biomass growth rate, nutrient removal and/or lipid production.
NASA Astrophysics Data System (ADS)
Aldrin, John C.; Lindgren, Eric A.
2018-04-01
This paper expands on the objective and motivation for NDE-based characterization and includes a discussion of the current approach using model-assisted inversion being pursued within the Air Force Research Laboratory (AFRL). This includes a discussion of the multiple model-based methods that can be used, including physics-based models, deep machine learning, and heuristic approaches. The benefits and drawbacks of each method is reviewed and the potential to integrate multiple methods is discussed. Initial successes are included to highlight the ability to obtain quantitative values of damage. Additional steps remaining to realize this capability with statistical metrics of accuracy are discussed, and how these results can be used to enable probabilistic life management are addressed. The outcome of this initiative will realize the long-term desired capability of NDE methods to provide quantitative characterization to accelerate certification of new materials and enhance life management of engineered systems.
False alarm recognition in hyperspectral gas plume identification
Conger, James L [San Ramon, CA; Lawson, Janice K [Tracy, CA; Aimonetti, William D [Livermore, CA
2011-03-29
According to one embodiment, a method for analyzing hyperspectral data includes collecting first hyperspectral data of a scene using a hyperspectral imager during a no-gas period and analyzing the first hyperspectral data using one or more gas plume detection logics. The gas plume detection logic is executed using a low detection threshold, and detects each occurrence of an observed hyperspectral signature. The method also includes generating a histogram for all occurrences of each observed hyperspectral signature which is detected using the gas plume detection logic, and determining a probability of false alarm (PFA) for all occurrences of each observed hyperspectral signature based on the histogram. Possibly at some other time, the method includes collecting second hyperspectral data, and analyzing the second hyperspectral data using the one or more gas plume detection logics and the PFA to determine if any gas is present. Other systems and methods are also included.
Method of forming a hardened surface on a substrate
Branagan, Daniel J.
2010-08-31
The invention includes a method of producing a hard metallic material by forming a mixture containing at least 55% iron and at least one of B, C, Si and P. The mixture is formed into an alloy and cooled to form a metallic material having a hardness of greater than about 9.2 GPa. The invention includes a method of forming a wire by combining a metal strip and a powder. The metal strip and the powder are rolled to form a wire containing at least 55% iron and from two to seven additional elements including at least one of C, Si and B. The invention also includes a method of forming a hardened surface on a substrate by processing a solid mass to form a powder, applying the powder to a surface to form a layer containing metallic glass, and converting the glass to a crystalline material having a nanocrystalline grain size.
Force measuring valve assemblies, systems including such valve assemblies and related methods
DeWall, Kevin George [Pocatello, ID; Garcia, Humberto Enrique [Idaho Falls, ID; McKellar, Michael George [Idaho Falls, ID
2012-04-17
Methods of evaluating a fluid condition may include stroking a valve member and measuring a force acting on the valve member during the stroke. Methods of evaluating a fluid condition may include measuring a force acting on a valve member in the presence of fluid flow over a period of time and evaluating at least one of the frequency of changes in the measured force over the period of time and the magnitude of the changes in the measured force over the period of time to identify the presence of an anomaly in a fluid flow and, optionally, its estimated location. Methods of evaluating a valve condition may include directing a fluid flow through a valve while stroking a valve member, measuring a force acting on the valve member during the stroke, and comparing the measured force to a reference force. Valve assemblies and related systems are also disclosed.
Superconducting transition edge sensors and methods for design and manufacture thereof
NASA Technical Reports Server (NTRS)
Sadleir, John E. (Inventor)
2013-01-01
Methods for forming sensors using transition edge sensors (TES) and sensors therefrom are described. The method includes forming a plurality of sensor arrays includes at least one TES device. The TES device includes a TES device body, a first superconducting lead contacting a first portion of the TES device body, and a second superconducting lead contacting of a second portion of the TES device body, where the first and second superconducting leads separated on the TES device body by a lead spacing. The lead spacing can be selected to be different for at least two of the plurality of sensor arrays. The method also includes determining a transition temperature for each of the plurality of sensor arrays and generating a signal responsive to detecting a change in the electrical characteristics of one of the plurality of sensor arrays meeting a transition temperature criterion.
System for controlling a hybrid energy system
Hoff, Brian D.; Akasam, Sivaprasad
2013-01-29
A method includes identifying a first operating sequence of a repeated operation of at least one non-traction load. The method also includes determining first and second parameters respectively indicative of a requested energy and output energy of the at least one non-traction load and comparing the determined first and second parameters at a plurality of time increments of the first operating sequence. The method also includes determining a third parameter of the hybrid energy system indicative of energy regenerated from the at least one non-traction load and monitoring the third parameter at the plurality of time increments of the first operating sequence. The method also includes determining at least one of an energy deficiency or an energy surplus associated with the non-traction load of the hybrid energy system and selectively adjusting energy stored within the storage device during at least a portion of a second operating sequence.
Engineered high expansion glass-ceramics having near linear thermal strain and methods thereof
DOE Office of Scientific and Technical Information (OSTI.GOV)
Dai, Steve Xunhu; Rodriguez, Mark A.; Lyon, Nathanael L.
The present invention relates to glass-ceramic compositions, as well as methods for forming such composition. In particular, the compositions include various polymorphs of silica that provide beneficial thermal expansion characteristics (e.g., a near linear thermal strain). Also described are methods of forming such compositions, as well as connectors including hermetic seals containing such compositions.
Power generation method including membrane separation
Lokhandwala, Kaaeid A.
2000-01-01
A method for generating electric power, such as at, or close to, natural gas fields. The method includes conditioning natural gas containing C.sub.3+ hydrocarbons and/or acid gas by means of a membrane separation step. This step creates a leaner, sweeter, drier gas, which is then used as combustion fuel to run a turbine, which is in turn used for power generation.
Substrate comprising a nanometer-scale projection array
Cui, Yi; Zhu, Jia; Hsu, Ching-Mei; Connor, Stephen T; Yu, Zongfu; Fan, Shanhui; Burkhard, George
2012-11-27
A method for forming a substrate comprising nanometer-scale pillars or cones that project from the surface of the substrate is disclosed. The method enables control over physical characteristics of the projections including diameter, sidewall angle, and tip shape. The method further enables control over the arrangement of the projections including characteristics such as center-to-center spacing and separation distance.
26 CFR 1.481-4 - Adjustments taken into account with consent.
Code of Federal Regulations, 2010 CFR
2010-04-01
... effecting a change in method of accounting, including the taxable year or years in which the amount of the... Commissioner's consent to a change in method of accounting. (b) An agreement to the terms and conditions of a change in method of accounting under § 1.446-1(e)(3), including the taxable year or years prescribed by...
Method and apparatus for controlling LCL converters using asymmetric voltage cancellation techniques
Wu, Hunter; Sealy, Kylee Devro; Sharp, Bryan Thomas; Gilchrist, Aaron
2016-01-26
A method and apparatus for LCL resonant converter control utilizing Asymmetric Voltage Cancellation is described. The methods to determine the optimal trajectory of the control variables are discussed. Practical implementations of sensing load parameters are included. Simple PI, PID and fuzzy logic controllers are included with AVC for achieving good transient response characteristics with output current regulation.
NASA Astrophysics Data System (ADS)
Riedinger, Kelly; Marbach-Ad, Gili; Randy McGinnis, J.; Hestness, Emily; Pease, Rebecca
2011-02-01
We investigated curricular and pedagogical innovations in an undergraduate science methods course for elementary education majors at the University of Maryland. The goals of the innovative elementary science methods course included: improving students' attitudes toward and views of science and science teaching, to model innovative science teaching methods and to encourage students to continue in teacher education. We redesigned the elementary science methods course to include aspects of informal science education. The informal science education course features included informal science educator guest speakers, a live animal demonstration and a virtual field trip. We compared data from a treatment course ( n = 72) and a comparison course ( n = 26). Data collection included: researchers' observations, instructors' reflections, and teacher candidates' feedback. Teacher candidate feedback involved interviews and results on a reliable and valid Attitudes and Beliefs about the Nature of and the Teaching of Science instrument. We used complementary methods to analyze the data collected. A key finding of the study was that while benefits were found in both types of courses, the difference in results underscores the need of identifying the primary purpose for innovation as a vital component of consideration.
Analysis of Environmental Contamination resulting from ...
Catastrophic incidents can generate a large number of samples with analytically diverse types including forensic, clinical, environmental, food, and others. Environmental samples include water, wastewater, soil, air, urban building and infrastructure materials, and surface residue. Such samples may arise not only from contamination from the incident but also from the multitude of activities surrounding the response to the incident, including decontamination. This document summarizes a range of activities to help build laboratory capability in preparation for analysis following a catastrophic incident, including selection and development of fit-for-purpose analytical methods for chemical, biological, and radiological contaminants. Fit-for-purpose methods are those which have been selected to meet project specific data quality objectives. For example, methods could be fit for screening contamination in the early phases of investigation of contamination incidents because they are rapid and easily implemented, but those same methods may not be fit for the purpose of remediating the environment to safe levels when a more sensitive method is required. While the exact data quality objectives defining fitness-for-purpose can vary with each incident, a governing principle of the method selection and development process for environmental remediation and recovery is based on achieving high throughput while maintaining high quality analytical results. This paper illu
Orientation of airborne laser scanning point clouds with multi-view, multi-scale image blocks.
Rönnholm, Petri; Hyyppä, Hannu; Hyyppä, Juha; Haggrén, Henrik
2009-01-01
Comprehensive 3D modeling of our environment requires integration of terrestrial and airborne data, which is collected, preferably, using laser scanning and photogrammetric methods. However, integration of these multi-source data requires accurate relative orientations. In this article, two methods for solving relative orientation problems are presented. The first method includes registration by minimizing the distances between of an airborne laser point cloud and a 3D model. The 3D model was derived from photogrammetric measurements and terrestrial laser scanning points. The first method was used as a reference and for validation. Having completed registration in the object space, the relative orientation between images and laser point cloud is known. The second method utilizes an interactive orientation method between a multi-scale image block and a laser point cloud. The multi-scale image block includes both aerial and terrestrial images. Experiments with the multi-scale image block revealed that the accuracy of a relative orientation increased when more images were included in the block. The orientations of the first and second methods were compared. The comparison showed that correct rotations were the most difficult to detect accurately by using the interactive method. Because the interactive method forces laser scanning data to fit with the images, inaccurate rotations cause corresponding shifts to image positions. However, in a test case, in which the orientation differences included only shifts, the interactive method could solve the relative orientation of an aerial image and airborne laser scanning data repeatedly within a couple of centimeters.
Orientation of Airborne Laser Scanning Point Clouds with Multi-View, Multi-Scale Image Blocks
Rönnholm, Petri; Hyyppä, Hannu; Hyyppä, Juha; Haggrén, Henrik
2009-01-01
Comprehensive 3D modeling of our environment requires integration of terrestrial and airborne data, which is collected, preferably, using laser scanning and photogrammetric methods. However, integration of these multi-source data requires accurate relative orientations. In this article, two methods for solving relative orientation problems are presented. The first method includes registration by minimizing the distances between of an airborne laser point cloud and a 3D model. The 3D model was derived from photogrammetric measurements and terrestrial laser scanning points. The first method was used as a reference and for validation. Having completed registration in the object space, the relative orientation between images and laser point cloud is known. The second method utilizes an interactive orientation method between a multi-scale image block and a laser point cloud. The multi-scale image block includes both aerial and terrestrial images. Experiments with the multi-scale image block revealed that the accuracy of a relative orientation increased when more images were included in the block. The orientations of the first and second methods were compared. The comparison showed that correct rotations were the most difficult to detect accurately by using the interactive method. Because the interactive method forces laser scanning data to fit with the images, inaccurate rotations cause corresponding shifts to image positions. However, in a test case, in which the orientation differences included only shifts, the interactive method could solve the relative orientation of an aerial image and airborne laser scanning data repeatedly within a couple of centimeters. PMID:22454569
An assessment of unstructured grid technology for timely CFD analysis
NASA Technical Reports Server (NTRS)
Kinard, Tom A.; Schabowski, Deanne M.
1995-01-01
An assessment of two unstructured methods is presented in this paper. A tetrahedral unstructured method USM3D, developed at NASA Langley Research Center is compared to a Cartesian unstructured method, SPLITFLOW, developed at Lockheed Fort Worth Company. USM3D is an upwind finite volume solver that accepts grids generated primarily from the Vgrid grid generator. SPLITFLOW combines an unstructured grid generator with an implicit flow solver in one package. Both methods are exercised on three test cases, a wing, and a wing body, and a fully expanded nozzle. The results for the first two runs are included here and compared to the structured grid method TEAM and to available test data. On each test case, the set up procedure are described, including any difficulties that were encountered. Detailed descriptions of the solvers are not included in this paper.
The use of rapid review methods in health technology assessments: 3 case studies.
Kaltenthaler, Eva; Cooper, Katy; Pandor, Abdullah; Martyn-St James, Marrissa; Chatters, Robin; Wong, Ruth
2016-08-26
Rapid reviews are of increasing importance within health technology assessment due to time and resource constraints. There are many rapid review methods available although there is little guidance as to the most suitable methods. We present three case studies employing differing methods to suit the evidence base for each review and outline some issues to consider when selecting an appropriate method. Three recently completed systematic review short reports produced for the UK National Institute for Health Research were examined. Different approaches to rapid review methods were used in the three reports which were undertaken to inform the commissioning of services within the NHS and to inform future trial design. We describe the methods used, the reasoning behind the choice of methods and explore the strengths and weaknesses of each method. Rapid review methods were chosen to meet the needs of the review and each review had distinctly different challenges such as heterogeneity in terms of populations, interventions, comparators and outcome measures (PICO) and/or large numbers of relevant trials. All reviews included at least 10 randomised controlled trials (RCTs), each with numerous included outcomes. For the first case study (sexual health interventions), very diverse studies in terms of PICO were included. P-values and summary information only were presented due to substantial heterogeneity between studies and outcomes measured. For the second case study (premature ejaculation treatments), there were over 100 RCTs but also several existing systematic reviews. Data for meta-analyses were extracted directly from existing systematic reviews with new RCT data added where available. For the final case study (cannabis cessation therapies), studies included a wide range of interventions and considerable variation in study populations and outcomes. A brief summary of the key findings for each study was presented and narrative synthesis used to summarise results for each pair of interventions compared. Rapid review methods need to be chosen to meet both the nature of the evidence base of a review and the challenges presented by the included studies. Appropriate methods should be chosen after an assessment of the evidence base.
Diagnostics of Tree Diseases Caused by Phytophthora austrocedri Species.
Mulholland, Vincent; Elliot, Matthew; Green, Sarah
2015-01-01
We present methods for the detection and quantification of four Phytophthora species which are pathogenic on trees; Phytophthora ramorum, Phytophthora kernoviae, Phytophthora lateralis, and Phytophthora austrocedri. Nucleic acid extraction methods are presented for phloem tissue from trees, soil, and pure cultures on agar plates. Real-time PCR methods are presented and include primer and probe sets for each species, general advice on real-time PCR setup and data analysis. A method for sequence-based identification, useful for pure cultures, is also included.
SRC-I demonstration plant analytical laboratory methods manual. Final technical report
DOE Office of Scientific and Technical Information (OSTI.GOV)
Klusaritz, M.L.; Tewari, K.C.; Tiedge, W.F.
1983-03-01
This manual is a compilation of analytical procedures required for operation of a Solvent-Refined Coal (SRC-I) demonstration or commercial plant. Each method reproduced in full includes a detailed procedure, a list of equipment and reagents, safety precautions, and, where possible, a precision statement. Procedures for the laboratory's environmental and industrial hygiene modules are not included. Required American Society for Testing and Materials (ASTM) methods are cited, and ICRC's suggested modifications to these methods for handling coal-derived products are provided.
Tadd, Andrew R; Schwank, Johannes
2013-05-14
A catalytic reforming method is disclosed herein. The method includes sequentially supplying a plurality of feedstocks of variable compositions to a reformer. The method further includes adding a respective predetermined co-reactant to each of the plurality of feedstocks to obtain a substantially constant output from the reformer for the plurality of feedstocks. The respective predetermined co-reactant is based on a C/H/O atomic composition for a respective one of the plurality of feedstocks and a predetermined C/H/O atomic composition for the substantially constant output.
Method to fabricate high performance tubular solid oxide fuel cells
Chen, Fanglin; Yang, Chenghao; Jin, Chao
2013-06-18
In accordance with the present disclosure, a method for fabricating a solid oxide fuel cell is described. The method includes forming an asymmetric porous ceramic tube by using a phase inversion process. The method further includes forming an asymmetric porous ceramic layer on a surface of the asymmetric porous ceramic tube by using a phase inversion process. The tube is co-sintered to form a structure having a first porous layer, a second porous layer, and a dense layer positioned therebetween.
28 CFR 36.309 - Examinations and courses.
Code of Federal Regulations, 2012 CFR
2012-07-01
... include taped examinations, interpreters or other effective methods of making orally delivered materials... qualified readers for individuals with visual impairments or learning disabilities, transcribers for... and services required by this section may include taped texts, interpreters or other effective methods...
28 CFR 36.309 - Examinations and courses.
Code of Federal Regulations, 2013 CFR
2013-07-01
... include taped examinations, interpreters or other effective methods of making orally delivered materials... qualified readers for individuals with visual impairments or learning disabilities, transcribers for... and services required by this section may include taped texts, interpreters or other effective methods...
28 CFR 36.309 - Examinations and courses.
Code of Federal Regulations, 2014 CFR
2014-07-01
... include taped examinations, interpreters or other effective methods of making orally delivered materials... qualified readers for individuals with visual impairments or learning disabilities, transcribers for... and services required by this section may include taped texts, interpreters or other effective methods...
The Weakest Link: Library Catalogs.
ERIC Educational Resources Information Center
Young, Terrence E., Jr.
2002-01-01
Describes methods of correcting MARC records in online public access catalogs in school libraries. Highlights include in-house methods; professional resources; conforming to library cataloging standards; vendor services, including Web-based services; software specifically developed for record cleanup; and outsourcing. (LRW)
Non-cementitious compositions comprising vaterite and methods thereof
Devenney, Martin; Fernandez, Miguel; Morgan, Samuel O.
2015-09-15
Non-cementitious compositions and products are provided. The compositions of the invention include a carbonate additive comprising vaterite such as reactive vaterite. Additional aspects of the invention include methods of making and using the non-cementitious compositions and products.
Microfluidic devices and methods including porous polymer monoliths
Hatch, Anson V; Sommer, Gregory J; Singh, Anup K; Wang, Ying-Chih; Abhyankar, Vinay V
2014-04-22
Microfluidic devices and methods including porous polymer monoliths are described. Polymerization techniques may be used to generate porous polymer monoliths having pores defined by a liquid component of a fluid mixture. The fluid mixture may contain iniferters and the resulting porous polymer monolith may include surfaces terminated with iniferter species. Capture molecules may then be grafted to the monolith pores.
Microfluidic devices and methods including porous polymer monoliths
Hatch, Anson V.; Sommer, Gregory j.; Singh, Anup K.; Wang, Ying-Chih; Abhyankar, Vinay
2015-12-01
Microfluidic devices and methods including porous polymer monoliths are described. Polymerization techniques may be used to generate porous polymer monoliths having pores defined by a liquid component of a fluid mixture. The fluid mixture may contain iniferters and the resulting porous polymer monolith may include surfaces terminated with iniferter species. Capture molecules may then be grafted to the monolith pores.
Formulation and method for preparing gels comprising hydrous hafnium oxide
Collins, Jack L; Hunt, Rodney D; Montgomery, Frederick C
2013-08-06
Formulations useful for preparing hydrous hafnium oxide gels contain a metal salt including hafnium, an acid, an organic base, and a complexing agent. Methods for preparing gels containing hydrous hafnium oxide include heating a formulation to a temperature sufficient to induce gel formation, where the formulation contains a metal salt including hafnium, an acid, an organic base, and a complexing agent.
Guha, Subhendu; Ovshinsky, Stanford R.
1990-02-02
A method of fabricating doped microcrystalline semiconductor alloy material which includes a band gap widening element through a glow discharge deposition process by subjecting a precursor mixture which includes a diluent gas to an a.c. glow discharge in the absence of a magnetic field of sufficient strength to induce electron cyclotron resonance.
Hydrogeologic and chemical data for the O-Field area, Aberdeen Proving Ground, Maryland
Nemoff, P.R.; Vroblesky, D.A.
1989-01-01
O-Field, located at the Edgewood area of Aberdeen Proving Ground , Maryland, was periodically used for disposal of munitions, waste chemicals, and chemical-warfare agents from World War II through the 1950' s. This report includes various physical, geologic, chemical, and hydrologic data obtained from well-core, groundwater, surface water, and bottom-sediment sampling sites at and near the O-Field disposal area. The data are presented in tables and hydrographs. Three site-location maps are also included. Well-core data include lithologic logs for 11 well- cluster sites, grain-size distributions, various chemical characteristics, and confining unit characteristics. Groundwater data include groundwater chemistry, method blanks for volatile organic carbon, available data on volatile and base/neutral organics, and compilation of corresponding method blanks, chemical-warfare agents, explosive-related products, radionuclides, herbicides, and groundwater levels. Surface-water data include field-measured characteristics; concentrations of various inorganic constituents including arsenic; selected organic constituents with method blanks; detection limits of organics; and a compilation of information on corresponding acids, volatiles, and semivolatiles. Bottom- sediment data include inorganic properties and constituents; organic chemistry; detection limits for organic chemicals; a compilation of information on acids, volatiles, and semivolatiles; and method blanks corresponding to acids, volatiles, and semivolatiles. A set of 15 water- level hydrographs for the period March 1986 through September 1987 also is included in the report. (USGS)
Systems to facilitate reducing flashback/flame holding in combustion systems
Lacy, Benjamin Paul [Greer, SC; Kraemer, Gilbert Otto [Greer, SC; Varatharajan, Balachandar [Clifton Park, NY; Yilmaz, Ertan [Albany, NY; Zuo, Baifang [Simpsonville, SC
2012-02-21
A method for assembling a premixing injector is provided. The method includes providing a centerbody including a center axis and a radially outer surface, and providing an inlet flow conditioner. The inlet flow conditioner includes a radially outer wall, a radially inner wall, and an end wall coupled substantially perpendicularly between the outer wall and the inner wall. Each of the outer wall and the end wall include a plurality of openings defined therein. The outer wall, the inner wall, and the end wall define a first passage therebetween. The method also includes coupling the inlet flow conditioner to the centerbody such that the inlet flow conditioner substantially circumscribes the centerbody, such that the inner wall is substantially parallel to the centerbody outer surface, and such that a second passage is defined between the centerbody outer surface and the inner wall.
Kong, Peter C; Grandy, Jon D; Detering, Brent A; Zuck, Larry D
2013-09-17
Electrode assemblies for plasma reactors include a structure or device for constraining an arc endpoint to a selected area or region on an electrode. In some embodiments, the structure or device may comprise one or more insulating members covering a portion of an electrode. In additional embodiments, the structure or device may provide a magnetic field configured to control a location of an arc endpoint on the electrode. Plasma generating modules, apparatus, and systems include such electrode assemblies. Methods for generating a plasma include covering at least a portion of a surface of an electrode with an electrically insulating member to constrain a location of an arc endpoint on the electrode. Additional methods for generating a plasma include generating a magnetic field to constrain a location of an arc endpoint on an electrode.
Methods for removing contaminant matter from a porous material
Fox, Robert V [Idaho Falls, ID; Avci, Recep [Bozeman, MT; Groenewold, Gary S [Idaho Falls, ID
2010-11-16
Methods of removing contaminant matter from porous materials include applying a polymer material to a contaminated surface, irradiating the contaminated surface to cause redistribution of contaminant matter, and removing at least a portion of the polymer material from the surface. Systems for decontaminating a contaminated structure comprising porous material include a radiation device configured to emit electromagnetic radiation toward a surface of a structure, and at least one spray device configured to apply a capture material onto the surface of the structure. Polymer materials that can be used in such methods and systems include polyphosphazine-based polymer materials having polyphosphazine backbone segments and side chain groups that include selected functional groups. The selected functional groups may include iminos, oximes, carboxylates, sulfonates, .beta.-diketones, phosphine sulfides, phosphates, phosphites, phosphonates, phosphinates, phosphine oxides, monothio phosphinic acids, and dithio phosphinic acids.
Monitoring system and methods for a distributed and recoverable digital control system
NASA Technical Reports Server (NTRS)
Stange, Kent (Inventor); Hess, Richard (Inventor); Kelley, Gerald B (Inventor); Rogers, Randy (Inventor)
2010-01-01
A monitoring system and methods are provided for a distributed and recoverable digital control system. The monitoring system generally comprises two independent monitoring planes within the control system. The first monitoring plane is internal to the computing units in the control system, and the second monitoring plane is external to the computing units. The internal first monitoring plane includes two in-line monitors. The first internal monitor is a self-checking, lock-step-processing monitor with integrated rapid recovery capability. The second internal monitor includes one or more reasonableness monitors, which compare actual effector position with commanded effector position. The external second monitor plane includes two monitors. The first external monitor includes a pre-recovery computing monitor, and the second external monitor includes a post recovery computing monitor. Various methods for implementing the monitoring functions are also disclosed.
Apparatus and method for mixing fuel in a gas turbine nozzle
Johnson, Thomas Edward; Ziminsky, Willy Steve; Berry, Jonathan Dwight
2014-08-12
A nozzle includes a fuel plenum and an air plenum downstream of the fuel plenum. A primary fuel channel includes an inlet in fluid communication with the fuel plenum and a primary air port in fluid communication with the air plenum. Secondary fuel channels radially outward of the primary fuel channel include a secondary fuel port in fluid communication with the fuel plenum. A shroud circumferentially surrounds the secondary fuel channels. A method for mixing fuel and air in a nozzle prior to combustion includes flowing fuel to a fuel plenum and flowing air to an air plenum downstream of the fuel plenum. The method further includes injecting fuel from the fuel plenum through a primary fuel passage, injecting fuel from the fuel plenum through secondary fuel passages, and injecting air from the air plenum through the primary fuel passage.
Hughes, Dyfrig A
2012-01-01
Pharmacoeconomics is an essential component of health technology assessment and the appraisal of medicines for use by UK National Health Service (NHS) patients. As a comparatively young discipline, its methods continue to evolve. Priority research areas for development include methods for synthesizing indirect comparisons when head-to-head trials have not been performed, synthesizing qualitative evidence (for example, stakeholder views), addressing the limitations of the EQ-5D tool for assessing quality of life, including benefits not captured in quality-adjusted life years (QALYs), ways of assessing valuation methods (for determining utility scores), extrapolation of costs and benefits beyond those observed in trials, early estimation of cost-effectiveness (including mechanism-based economic evaluation), methods for incorporating the impact of non-adherence and the role of behavioural economics in influencing patients and prescribers. PMID:22360714
The method of complex characteristics for design of transonic blade sections
NASA Technical Reports Server (NTRS)
Bledsoe, M. R.
1986-01-01
A variety of computational methods were developed to obtain shockless or near shockless flow past two-dimensional airfoils. The approach used was the method of complex characteristics, which determines smooth solutions to the transonic flow equations based on an input speed distribution. General results from fluid mechanics are presented. An account of the method of complex characteristics is given including a description of the particular spaces and coordinates, conformal transformations, and numerical procedures that are used. The operation of the computer program COMPRES is presented along with examples of blade sections designed with the code. A user manual is included with a glossary to provide additional information which may be helpful. The computer program in Fortran, including numerous comment cards is listed.
Method and system to measure temperature of gases using coherent anti-stokes doppler spectroscopy
Rhodes, Mark
2013-12-17
A method of measuring a temperature of a noble gas in a chamber includes providing the noble gas in the chamber. The noble gas is characterized by a pressure and a temperature. The method also includes directing a first laser beam into the chamber and directing a second laser beam into the chamber. The first laser beam is characterized by a first frequency and the second laser beam is characterized by a second frequency. The method further includes converting at least a portion of the first laser beam and the second laser beam into a coherent anti-Stokes beam, measuring a Doppler broadening of the coherent anti-Stokes beam, and computing the temperature using the Doppler broadening.
Method Of Wire Insertion For Electric Machine Stators
Brown, David L; Stabel, Gerald R; Lawrence, Robert Anthony
2005-02-08
A method of inserting coils in slots of a stator is provided. The method includes interleaving a first set of first phase windings and a first set of second phase windings on an insertion tool. The method also includes activating the insertion tool to radially insert the first set of first phase windings and the first set of second phase windings in the slots of the stator. In one embodiment, interleaving the first set of first phase windings and the first set of second phase windings on the insertion tool includes forming the first set of first phase windings in first phase openings defined in the insertion tool, and forming the first set of second phase windings in second phase openings defined in the insertion tool.
Methodology issues in implementation science.
Newhouse, Robin; Bobay, Kathleen; Dykes, Patricia C; Stevens, Kathleen R; Titler, Marita
2013-04-01
Putting evidence into practice at the point of care delivery requires an understanding of implementation strategies that work, in what context and how. To identify methodological issues in implementation science using 4 studies as cases and make recommendations for further methods development. Four cases are presented and methodological issues identified. For each issue raised, evidence on the state of the science is described. Issues in implementation science identified include diverse conceptual frameworks, potential weaknesses in pragmatic study designs, and the paucity of standard concepts and measurement. Recommendations to advance methods in implementation include developing a core set of implementation concepts and metrics, generating standards for implementation methods including pragmatic trials, mixed methods designs, complex interventions and measurement, and endorsing reporting standards for implementation studies.
Inventory of research methods for librarianship and informatics
Eldredge, Jonathan D.
2004-01-01
This article defines and describes the rich variety of research designs found in librarianship and informatics practice. Familiarity with the range of methods and the ability to make distinctions between those specific methods can enable authors to label their research reports correctly. The author has compiled an inventory of methods from a variety of disciplines, but with attention to the relevant applications of a methodology to the field of librarianship. Each entry in the inventory includes a definition and description for the particular research method. Some entries include references to resource material and examples. PMID:14762467
DeBeer, Serena
2018-01-01
In this chapter, a brief overview of X-ray spectroscopic methods that may be utilized to obtain insight into the geometric and electronic structure of iron-sulfur proteins is provided. These methods include conventional methods, such as metal and ligand K-edge X-ray absorption, as well as more advanced methods including nonresonant and resonant X-ray emission. In each section, the basic information content of the spectra is highlighted and important experimental considerations are discussed. Throughout the chapter, recent applications to iron-sulfur-containing models and proteins are highlighted. © 2018 Elsevier Inc. All rights reserved.
Comparison of electrical conductivity calculation methods for natural waters
McCleskey, R. Blaine; Nordstrom, D. Kirk; Ryan, Joseph N.
2012-01-01
The capability of eleven methods to calculate the electrical conductivity of a wide range of natural waters from their chemical composition was investigated. A brief summary of each method is presented including equations to calculate the conductivities of individual ions, the ions incorporated, and the method's limitations. The ability of each method to reliably predict the conductivity depends on the ions included, effective accounting of ion pairing, and the accuracy of the equation used to estimate the ionic conductivities. The performances of the methods were evaluated by calculating the conductivity of 33 environmentally important electrolyte solutions, 41 U.S. Geological Survey standard reference water samples, and 1593 natural water samples. The natural waters tested include acid mine waters, geothermal waters, seawater, dilute mountain waters, and river water impacted by municipal waste water. The three most recent conductivity methods predict the conductivity of natural waters better than other methods. Two of the recent methods can be used to reliably calculate the conductivity for samples with pH values greater than about 3 and temperatures between 0 and 40°C. One method is applicable to a variety of natural water types with a range of pH from 1 to 10, temperature from 0 to 95°C, and ionic strength up to 1 m.
The importance of quality control in validating concentrations ...
A national-scale survey of 247 contaminants of emerging concern (CECs), including organic and inorganic chemical compounds, and microbial contaminants, was conducted in source and treated drinking water samples from 25 treatment plants across the United States. Multiple methods were used to determine these CECs, including six analytical methods to measure 174 pharmaceuticals, personal care products, and pesticides. A three-component quality assurance/quality control (QA/QC) program was designed for the subset of 174 CECs which allowed us to assess and compare performances of the methods used. The three components included: 1) a common field QA/QC protocol and sample design, 2) individual investigator-developed method-specific QA/QC protocols, and 3) a suite of 46 method comparison analytes that were determined in two or more analytical methods. Overall method performance for the 174 organic chemical CECs was assessed by comparing spiked recoveries in reagent, source, and treated water over a two-year period. In addition to the 247 CECs reported in the larger drinking water study, another 48 pharmaceutical compounds measured did not consistently meet predetermined quality standards. Methodologies that did not seem suitable for these analytes are overviewed. The need to exclude analytes based on method performance demonstrates the importance of additional QA/QC protocols. This paper compares the method performance of six analytical methods used to measure 174 emer
2D Quantum Simulation of MOSFET Using the Non Equilibrium Green's Function Method
NASA Technical Reports Server (NTRS)
Svizhenko, Alexel; Anantram, M. P.; Govindan, T. R.; Yan, Jerry (Technical Monitor)
2000-01-01
The objectives this viewgraph presentation summarizes include: (1) the development of a quantum mechanical simulator for ultra short channel MOSFET simulation, including theory, physical approximations, and computer code; (2) explore physics that is not accessible by semiclassical methods; (3) benchmarking of semiclassical and classical methods; and (4) study other two-dimensional devices and molecular structure, from discretized Hamiltonian to tight-binding Hamiltonian.
Waterflooding injectate design systems and methods
Brady, Patrick V.; Krumhansl, James L.
2016-12-13
A method of recovering a liquid hydrocarbon using an injectate includes recovering the liquid hydrocarbon through primary extraction. Physico-chemical data representative of electrostatic interactions between the liquid hydrocarbon and the reservoir rock are measured. At least one additive of the injectate is selected based on the physico-chemical data. The method includes recovering the liquid hydrocarbon from the reservoir rock through secondary extraction using the injectate.
Method and apparatus for wind turbine braking
Barbu, Corneliu [Laguna Hills, CA; Teichmann, Ralph [Nishkayuna, NY; Avagliano, Aaron [Houston, TX; Kammer, Leonardo Cesar [Niskayuna, NY; Pierce, Kirk Gee [Simpsonville, SC; Pesetsky, David Samuel [Greenville, SC; Gauchel, Peter [Muenster, DE
2009-02-10
A method for braking a wind turbine including at least one rotor blade coupled to a rotor. The method includes selectively controlling an angle of pitch of the at least one rotor blade with respect to a wind direction based on a design parameter of a component of the wind turbine to facilitate reducing a force induced into the wind turbine component as a result of braking.
Superconducting articles, and methods for forming and using same
Knoll, Allan Robert [Guilderland, NY; Lenseth, Kenneth Patrick [Wynantskill, NY
2007-01-09
A superconducting tape is disclosed, including a substrate having a first surface and a second surface opposite the first surface, the substrate including a plurality of indicia provided on the first surface spaced apart along a length of the substrate; and a superconductor layer overlying the second surface. Also disclosed are components incorporating superconducting tapes, methods for manufacturing same, and methods for using same.
Methods for batch fabrication of cold cathode vacuum switch tubes
Walker, Charles A [Albuquerque, NM; Trowbridge, Frank R [Albuquerque, NM
2011-05-10
Methods are disclosed for batch fabrication of vacuum switch tubes that reduce manufacturing costs and improve tube to tube uniformity. The disclosed methods comprise creating a stacked assembly of layers containing a plurality of adjacently spaced switch tube sub-assemblies aligned and registered through common layers. The layers include trigger electrode layer, cathode layer including a metallic support/contact with graphite cathode inserts, trigger probe sub-assembly layer, ceramic (e.g. tube body) insulator layer, and metallic anode sub-assembly layer. Braze alloy layers are incorporated into the stacked assembly of layers, and can include active metal braze alloys or direct braze alloys, to eliminate costs associated with traditional metallization of the ceramic insulator layers. The entire stacked assembly is then heated to braze/join/bond the stack-up into a cohesive body, after which individual switch tubes are singulated by methods such as sawing. The inventive methods provide for simultaneously fabricating a plurality of devices as opposed to traditional methods that rely on skilled craftsman to essentially hand build individual devices.
NASA Technical Reports Server (NTRS)
Carlson, Harry W.; Darden, Christine M.
1987-01-01
Low-speed experimental force and data on a series of thin swept wings with sharp leading edges and leading and trailing-edge flaps are compared with predictions made using a linearized-theory method which includes estimates of vortex forces. These comparisons were made to assess the effectiveness of linearized-theory methods for use in the design and analysis of flap systems in subsonic flow. Results demonstrate that linearized-theory, attached-flow methods (with approximate representation of vortex forces) can form the basis of a rational system for flap design and analysis. Even attached-flow methods that do not take vortex forces into account can be used for the selection of optimized flap-system geometry, but design-point performance levels tend to be underestimated unless vortex forces are included. Illustrative examples of the use of these methods in the design of efficient low-speed flap systems are included.
A class of high resolution explicit and implicit shock-capturing methods
NASA Technical Reports Server (NTRS)
Yee, H. C.
1989-01-01
An attempt is made to give a unified and generalized formulation of a class of high resolution, explicit and implicit shock capturing methods, and to illustrate their versatility in various steady and unsteady complex shock wave computations. Included is a systematic review of the basic design principle of the various related numerical methods. Special emphasis is on the construction of the basis nonlinear, spatially second and third order schemes for nonlinear scalar hyperbolic conservation laws and the methods of extending these nonlinear scalar schemes to nonlinear systems via the approximate Riemann solvers and the flux vector splitting approaches. Generalization of these methods to efficiently include equilibrium real gases and large systems of nonequilibrium flows are discussed. Some issues concerning the applicability of these methods that were designed for homogeneous hyperbolic conservation laws to problems containing stiff source terms and shock waves are also included. The performance of some of these schemes is illustrated by numerical examples for 1-, 2- and 3-dimensional gas dynamics problems.
Multi-parametric centrality method for graph network models
NASA Astrophysics Data System (ADS)
Ivanov, Sergei Evgenievich; Gorlushkina, Natalia Nikolaevna; Ivanova, Lubov Nikolaevna
2018-04-01
The graph model networks are investigated to determine centrality, weights and the significance of vertices. For centrality analysis appliesa typical method that includesany one of the properties of graph vertices. In graph theory, methods of analyzing centrality are used: in terms by degree, closeness, betweenness, radiality, eccentricity, page-rank, status, Katz and eigenvector. We have proposed a new method of multi-parametric centrality, which includes a number of basic properties of the network member. The mathematical model of multi-parametric centrality method is developed. Comparison of results for the presented method with the centrality methods is carried out. For evaluate the results for the multi-parametric centrality methodthe graph model with hundreds of vertices is analyzed. The comparative analysis showed the accuracy of presented method, includes simultaneously a number of basic properties of vertices.
Replica amplification of nucleic acid arrays
Church, George M.; Mitra, Robi D.
2010-08-31
Disclosed are improved methods of making and using immobilized arrays of nucleic acids, particularly methods for producing replicas of such arrays. Included are methods for producing high density arrays of nucleic acids and replicas of such arrays, as well as methods for preserving the resolution of arrays through rounds of replication. Also included are methods which take advantage of the availability of replicas of arrays for increased sensitivity in detection of sequences on arrays. Improved methods of sequencing nucleic acids immobilized on arrays utilizing single copies of arrays and methods taking further advantage of the availability of replicas of arrays are disclosed. The improvements lead to higher fidelity and longer read lengths of sequences immobilized on arrays. Methods are also disclosed which improve the efficiency of multiplex PCR using arrays of immobilized nucleic acids.
Method and apparatus for controlling hybrid powertrain system in response to engine temperature
Martini, Ryan D; Spohn, Brian L; Lehmen, Allen J; Cerbolles, Teresa L
2014-10-07
A method for controlling a hybrid powertrain system including an internal combustion engine includes controlling operation of the hybrid powertrain system in response to a preferred minimum coolant temperature trajectory for the internal combustion engine.
8. VIEW OF RADIOGRAPHY EQUIPMENT, TEST METHODS INCLUDED RADIOGRAPHY AND ...
8. VIEW OF RADIOGRAPHY EQUIPMENT, TEST METHODS INCLUDED RADIOGRAPHY AND BETA BACKSCATTERING. (7/13/56) - Rocky Flats Plant, Non-Nuclear Production Facility, South of Cottonwood Avenue, west of Seventh Avenue & east of Building 460, Golden, Jefferson County, CO
Synthesis of nanosized sodium titanates
Hobbs, David T.; Taylor-Pashow, Kathryn M. L.; Elvington, Mark C.
2015-09-29
Methods directed to the synthesis and peroxide-modification of nanosized monosodium titanate are described. Methods include combination of reactants at a low concentration to a solution including a nonionic surfactant. The nanosized monosodium titanate can exhibit high selectivity for sorbing various metallic ions.
Systems and methods for displaying data in split dimension levels
Stolte, Chris; Hanrahan, Patrick
2015-07-28
Systems and methods for displaying data in split dimension levels are disclosed. In some implementations, a method includes: at a computer, obtaining a dimensional hierarchy associated with a dataset, wherein the dimensional hierarchy includes at least one dimension and a sub-dimension of the at least one dimension; and populating information representing data included in the dataset into a visual table having a first axis and a second axis, wherein the first axis corresponds to the at least one dimension and the second axis corresponds to the sub-dimension of the at least one dimension.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Raman, Santhanam; Xi, Xiaomei; Ye, Xiang-Rong
A method of pre-doping an anode of an energy storage device can include immersing the anode and a dopant source in an electrolyte, and coupling a substantially constant current between the anode and the dopant source. A method of pre-doping an anode of an energy storage device can include immersing the anode and a dopant source in an electrolyte, and coupling a substantially constant voltage across the anode and the dopant source. An energy storage device can include an anode having a lithium ion pre-doping level of about 60% to about 90%.
Method and apparatus to selectively reduce NO.sub.x in an exhaust gas feedstream
Schmieg, Steven J [Troy, MI; Blint, Richard J [Shelby Township, MI; Den, Ling [Sterling Heights, MI; Viola, Michael B [Macomb Township, MI; Lee, Jong-Hwan [Rochester Hills, MI
2011-08-30
A method and apparatus are described to selectively reduce NO.sub.x emissions of an internal combustion engine. An exhaust aftertreatment system includes an injection device operative to dispense a hydrocarbon reductant upstream of a silver-alumina catalytic reactor device. A control system determines a NO.sub.x concentration and hydrocarbon/NOx ratio based upon selected parameters of the exhaust gas feedstream and dispenses hydrocarbon reductant during lean engine operation. Included is a method to control elements of the feedstream during lean operation. The hydrocarbon reductant may include engine fuel.
Synthesis of soluble conducting polymers by acoustic mixing
Kane, Marie C.
2016-09-13
A method including combining an aniline monomer, an oxidant, water and an organic solvent; subjecting the combination to acoustic mixing to form an emulsion; and recovering a polyaniliine from the combination. A method including combining a aniline monomer, an oxidant, water and an organic solvent; forming a polyaniline by acoustic mixing the combination; and recovering the polyaniliine from the combination. A method including forming a combination of an aniline monomer, an oxidant, water and an organic solvent in the absence of an emulsifier; acoustic mixing the combination for a time period to form a polyaniline; and recovering a polyaniliine from the combination.
Apparatus and method to enhance X-ray production in laser produced plasmas
Augustoni, A.L.; Gerardo, J.B.; Raymond, T.D.
1992-12-29
Method and apparatus for generating x-rays for use in, for instance, x-ray photolithography is disclosed. The method of generating x-rays includes the steps of providing a target and irradiating the target with a laser system which produces a train of sub-pulses to generate an x-ray producing plasma. The sub-pulses are of both high intensity and short duration. The apparatus for generating x-rays from a plasma includes a vacuum chamber, a target supported within the chamber and a laser system, including a short storage time laser. 8 figs.
Automatic extraction of planetary image features
NASA Technical Reports Server (NTRS)
LeMoigne-Stewart, Jacqueline J. (Inventor); Troglio, Giulia (Inventor); Benediktsson, Jon A. (Inventor); Serpico, Sebastiano B. (Inventor); Moser, Gabriele (Inventor)
2013-01-01
A method for the extraction of Lunar data and/or planetary features is provided. The feature extraction method can include one or more image processing techniques, including, but not limited to, a watershed segmentation and/or the generalized Hough Transform. According to some embodiments, the feature extraction method can include extracting features, such as, small rocks. According to some embodiments, small rocks can be extracted by applying a watershed segmentation algorithm to the Canny gradient. According to some embodiments, applying a watershed segmentation algorithm to the Canny gradient can allow regions that appear as close contours in the gradient to be segmented.
[Molecular typing methods for Pasteurella multocida-A review].
Peng, Zhong; Liang, Wan; Wu, Bin
2016-10-04
Pasteurella multocida is an important gram-negative pathogenic bacterium that could infect wide ranges of animals. Humans could also be infected by P. multocida via animal bite or scratching. Current typing methods for P. multocida include serological typing methods and molecular typing methods. Of them, serological typing methods are based on immunological assays, which are too complicated for clinical bacteriological studies. However, the molecular methods including multiple PCRs and multilocus sequence typing (MLST) methods are more suitable for bacteriological studies of P. multocida in clinic, with their simple operation, high efficiency and accurate detection compared to the traditional serological typing methods, they are therefore widely used. In the current review, we briefly describe the molecular typing methods for P. multocida. Our aim is to provide a knowledge-foundation for clinical bacteriological investigation especially the molecular investigation for P. multocida.
NASA Technical Reports Server (NTRS)
Darden, C. M.
1984-01-01
A method for analyzing shock coalescence which includes three dimensional effects was developed. The method is based on an extension of the axisymmetric solution, with asymmetric effects introduced through an additional set of governing equations, derived by taking the second circumferential derivative of the standard shock equations in the plane of symmetry. The coalescence method is consistent with and has been combined with a nonlinear sonic boom extrapolation program which is based on the method of characteristics. The extrapolation program, is able to extrapolate pressure signatures which include embedded shocks from an initial data line in the plane of symmetry at approximately one body length from the axis of the aircraft to the ground. The axisymmetric shock coalescence solution, the asymmetric shock coalescence solution, the method of incorporating these solutions into the extrapolation program, and the methods used to determine spatial derivatives needed in the coalescence solution are described. Results of the method are shown for a body of revolution at a small, positive angle of attack.
Organized energetic composites based on micro and nanostructures and methods thereof
Gash, Alexander E.; Han, Thomas Yong-Jin; Sirbuly, Donald J.
2012-09-04
An ordered energetic composite structure according to one embodiment includes an ordered array of metal fuel portions; and an oxidizer in gaps located between the metal fuel portions. An ordered energetic composite structure according to another embodiment includes at least one metal fuel portion having an ordered array of nanopores; and an oxidizer in the nanopores. A method for forming an ordered energetic composite structure according to one embodiment includes forming an ordered array of metal fuel portions; and depositing an oxidizer in gaps located between the metal fuel portions. A method for forming an ordered energetic composite structure according to another embodiment includes forming an ordered array of nanopores in at least one metal fuel portion; and depositing an oxidizer in the nanopores.
Protocol for Detection of Yersinia pestis in Environmental ...
Methods Report This is the first ever open-access and detailed protocol available to all government departments and agencies, and their contractors to detect Yersinia pestis, the pathogen that causes plague, from multiple environmental sample types including water. Each analytical method includes sample processing procedure for each sample type in a step-by-step manner. It includes real-time PCR, traditional microbiological culture, and the Rapid Viability PCR (RV-PCR) analytical methods. For large volume water samples it also includes an ultra-filtration-based sample concentration procedure. Because of such a non-restrictive availability of this protocol to all government departments and agencies, and their contractors, the nation will now have increased laboratory capacity to analyze large number of samples during a wide-area plague incident.
NASA Technical Reports Server (NTRS)
Huff, Vearl N; Gordon, Sanford; Morrell, Virginia E
1951-01-01
A rapidly convergent successive approximation process is described that simultaneously determines both composition and temperature resulting from a chemical reaction. This method is suitable for use with any set of reactants over the complete range of mixture ratios as long as the products of reaction are ideal gases. An approximate treatment of limited amounts of liquids and solids is also included. This method is particularly suited to problems having a large number of products of reaction and to problems that require determination of such properties as specific heat or velocity of sound of a dissociating mixture. The method presented is applicable to a wide variety of problems that include (1) combustion at constant pressure or volume; and (2) isentropic expansion to an assigned pressure, temperature, or Mach number. Tables of thermodynamic functions needed with this method are included for 42 substances for convenience in numerical computations.
Nanofiber electrode and method of forming same
DOE Office of Scientific and Technical Information (OSTI.GOV)
Pintauro, Peter N.; Zhang, Wenjing
In one aspect, a method of forming an electrode for an electrochemical device is disclosed. In one embodiment, the method includes the steps of mixing at least a first amount of a catalyst and a second amount of an ionomer or uncharged polymer to form a solution and delivering the solution into a metallic needle having a needle tip. The method further includes the steps of applying a voltage between the needle tip and a collector substrate positioned at a distance from the needle tip, and extruding the solution from the needle tip at a flow rate such as tomore » generate electrospun fibers and deposit the generated fibers on the collector substrate to form a mat with a porous network of fibers. Each fiber in the porous network of the mat has distributed particles of the catalyst. The method also includes the step of pressing the mat onto a membrane.« less
Method for controlling powertrain pumps
Sime, Karl Andrew; Spohn, Brian L; Demirovic, Besim; Martini, Ryan D; Miller, Jean Marie
2013-10-22
A method of controlling a pump supplying a fluid to a transmission includes sensing a requested power and an excess power for a powertrain. The requested power substantially meets the needs of the powertrain, while the excess power is not part of the requested power. The method includes sensing a triggering condition in response to the ability to convert the excess power into heat in the transmission, and determining that an operating temperature of the transmission is below a maximum. The method also includes determining a calibrated baseline and a dissipation command for the pump. The calibrated baseline command is configured to supply the fluid based upon the requested power, and the dissipation command is configured to supply additional fluid and consume the excess power with the pump. The method operates the pump at a combined command, which is equal to the calibrated baseline command plus the dissipation command.
Carbide and carbonitride surface treatment method for refractory metals
Meyer, G.A.; Schildbach, M.A.
1996-12-03
A carbide and carbonitride surface treatment method for refractory metals is provided, in steps including, heating a part formed of boron, chromium, hafnium, molybdenum, niobium, tantalum, titanium, tungsten or zirconium, or alloys thereof, in an evacuated chamber and then introducing reaction gases including nitrogen and hydrogen, either in elemental or water vapor form, which react with a source of elemental carbon to form carbon-containing gaseous reactants which then react with the metal part to form the desired surface layer. Apparatus for practicing the method is also provided, in the form of a carbide and carbonitride surface treatment system including a reaction chamber, a source of elemental carbon, a heating subassembly and a source of reaction gases. Alternative methods of providing the elemental carbon and the reaction gases are provided, as well as methods of supporting the metal part, evacuating the chamber with a vacuum subassembly and heating all of the components to the desired temperature. 5 figs.
Determination of antennae patterns and radar reflection characteristics of aircraft
NASA Astrophysics Data System (ADS)
Bothe, H.; MacDonald, D.; Pool, A.
1986-05-01
The different types of aircraft antennas, their radiation characteristics and their preferred siting on the airframe are described. Emphasis is placed on the various methods for determining aircraft antenna radiation patterns (ARP) and advantages, disadvantages and limitations of each method are indicated. Mathematical modelling, model measurements and in-flight measurements in conjunction with the applied flight test techniques are included. Examples of practical results are given. Methods of determining aircraft radar characteristics are also described, indicating advantages, disadvantages and limitations of each method. Relevant fundamentals of radar theory are included only as necessary to appreciation of the real meaning of radar cross section (RCS) and angular glint. The measuring methods included are dynamic full-scale, static full-scale, sub-scale optical, ultrasonic and radio modelling. References are made to RCS measuring facilities in the USA and Europe and the UK Radio Modelling Facility is used extensively to exemplify the sub scale technique.
Forming high efficiency silicon solar cells using density-graded anti-reflection surfaces
Yuan, Hao-Chih; Branz, Howard M.; Page, Matthew R.
2014-09-09
A method (50) is provided for processing a graded-density AR silicon surface (14) to provide effective surface passivation. The method (50) includes positioning a substrate or wafer (12) with a silicon surface (14) in a reaction or processing chamber (42). The silicon surface (14) has been processed (52) to be an AR surface with a density gradient or region of black silicon. The method (50) continues with heating (54) the chamber (42) to a high temperature for both doping and surface passivation. The method (50) includes forming (58), with a dopant-containing precursor in contact with the silicon surface (14) of the substrate (12), an emitter junction (16) proximate to the silicon surface (14) by doping the substrate (12). The method (50) further includes, while the chamber is maintained at the high or raised temperature, forming (62) a passivation layer (19) on the graded-density silicon anti-reflection surface (14).
Forming high-efficiency silicon solar cells using density-graded anti-reflection surfaces
Yuan, Hao-Chih; Branz, Howard M.; Page, Matthew R.
2015-07-07
A method (50) is provided for processing a graded-density AR silicon surface (14) to provide effective surface passivation. The method (50) includes positioning a substrate or wafer (12) with a silicon surface (14) in a reaction or processing chamber (42). The silicon surface (14) has been processed (52) to be an AR surface with a density gradient or region of black silicon. The method (50) continues with heating (54) the chamber (42) to a high temperature for both doping and surface passivation. The method (50) includes forming (58), with a dopant-containing precursor in contact with the silicon surface (14) of the substrate (12), an emitter junction (16) proximate to the silicon surface (14) by doping the substrate (12). The method (50) further includes, while the chamber is maintained at the high or raised temperature, forming (62) a passivation layer (19) on the graded-density silicon anti-reflection surface (14).
NASA Technical Reports Server (NTRS)
Dongarra, Jack (Editor); Messina, Paul (Editor); Sorensen, Danny C. (Editor); Voigt, Robert G. (Editor)
1990-01-01
Attention is given to such topics as an evaluation of block algorithm variants in LAPACK and presents a large-grain parallel sparse system solver, a multiprocessor method for the solution of the generalized Eigenvalue problem on an interval, and a parallel QR algorithm for iterative subspace methods on the CM2. A discussion of numerical methods includes the topics of asynchronous numerical solutions of PDEs on parallel computers, parallel homotopy curve tracking on a hypercube, and solving Navier-Stokes equations on the Cedar Multi-Cluster system. A section on differential equations includes a discussion of a six-color procedure for the parallel solution of elliptic systems using the finite quadtree structure, data parallel algorithms for the finite element method, and domain decomposition methods in aerodynamics. Topics dealing with massively parallel computing include hypercube vs. 2-dimensional meshes and massively parallel computation of conservation laws. Performance and tools are also discussed.
Contrast enhanced spectroscopic optical coherence tomography
NASA Technical Reports Server (NTRS)
Xu, Chenyang (Inventor); Boppart, Stephen A. (Inventor)
2010-01-01
A method of forming an image of a sample includes performing SOCT on a sample. The sample may include a contrast agent, which may include an absorbing agent and/or a scattering agent. A method of forming an image of tissue may include selecting a contrast agent, delivering the contrast agent to the tissue, acquiring SOCT data from the tissue, and converting the SOCT data into an image. The contributions to the SOCT data of an absorbing agent and a scattering agent in a sample may be quantified separately.
Lipon coatings for high voltage and high temperature Li-ion battery cathodes
Dudney, Nancy J.; Liang, Chengdu; Nanda, Jagjit; Veith, Gabriel M.; Kim, Yoongu; Martha, Surendra Kumar
2017-02-14
A lithium ion battery includes an anode and a cathode. The cathode includes a lithium, manganese, nickel, and oxygen containing compound. An electrolyte is disposed between the anode and the cathode. A protective layer is deposited between the cathode and the electrolyte. The protective layer includes pure lithium phosphorus oxynitride and variations that include metal dopants such as Fe, Ti, Ni, V, Cr, Cu, and Co. A method for making a cathode and a method for operating a battery are also disclosed.
Lipon coatings for high voltage and high temperature Li-ion battery cathodes
Dudney, Nancy J.; Liang, Chengdu; Nanda, Jagjit; Veith, Gabriel M.; Kim, Yoongu; Martha, Surendra Kumar
2017-12-05
A lithium ion battery includes an anode and a cathode. The cathode includes a lithium, manganese, nickel, and oxygen containing compound. An electrolyte is disposed between the anode and the cathode. A protective layer is deposited between the cathode and the electrolyte. The protective layer includes pure lithium phosphorus oxynitride and variations that include metal dopants such as Fe, Ti, Ni, V, Cr, Cu, and Co. A method for making a cathode and a method for operating a battery are also disclosed.
Guided-wave photodiode using through-absorber quantum-well-intermixing and methods thereof
Skogen, Erik J.
2016-10-25
The present invention includes a high-speed, high-saturation power detector (e.g., a photodiode) compatible with a relatively simple monolithic integration process. In particular embodiments, the photodiode includes an intrinsic bulk absorption region, which is grown above a main waveguide core including a number of quantum wells (QWs) that are used as the active region of a phase modulator. The invention also includes methods of fabricating integrated photodiode and waveguide assemblies using a monolithic, simplified process.
Methods And Systems For Using Reference Images In Acoustic Image Processing
Moore, Thomas L.; Barter, Robert Henry
2005-01-04
A method and system of examining tissue are provided in which a field, including at least a portion of the tissue and one or more registration fiducials, is insonified. Scattered acoustic information, including both transmitted and reflected waves, is received from the field. A representation of the field, including both the tissue and the registration fiducials, is then derived from the received acoustic radiation.
Yazdani, Ali; Ong, N. Phuan; Cava, Robert J.
2017-04-04
An interconnect is disclosed with enhanced immunity of electrical conductivity to defects. The interconnect includes a material with charge carriers having topological surface states. Also disclosed is a method for fabricating such interconnects. Also disclosed is an integrated circuit including such interconnects. Also disclosed is a gated electronic device including a material with charge carriers having topological surface states.
Low friction wear resistant graphene films
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sumant, Anirudha V.; Berman, Diana; Erdemir, Ali
A low friction wear surface with a coefficient of friction in the superlubric regime including graphene and nanoparticles on the wear surface is provided, and methods of producing the low friction wear surface are also provided. A long lifetime wear resistant surface including graphene exposed to hydrogen is provided, including methods of increasing the lifetime of graphene containing wear surfaces by providing hydrogen to the wear surface.
Method for conversion of carbohydrate polymers to value-added chemical products
Zhang, Zongchao C [Norwood, NJ; Brown, Heather M [Kennewick, WA; Su, Yu [Richland, WA
2012-02-07
Methods are described for conversion of carbohydrate polymers in ionic liquids, including cellulose, that yield value-added chemicals including, e.g., glucose and 5-hydroxylmethylfurfural (HMF) at temperatures below 120.degree. C. Catalyst compositions that include various mixed metal halides are described that are selective for specified products with yields, e.g., of up to about 56% in a single step process.
Nanoparticle-based gas sensors and methods of using the same
DOE Office of Scientific and Technical Information (OSTI.GOV)
Mickelson, William; Zettl, Alex
Gas sensors are provided. The gas sensors include a gas sensing element having metal oxide nanoparticles and a thin-film heating element. Systems that include the gas sensors, as well as methods of using the gas sensors, are also provided. Embodiments of the present disclosure find use in a variety of different applications, including detecting whether an analyte is present in a gaseous sample.
Van Norman, Staci A.; Aston, Victoria J.; Weimer, Alan W.
2017-05-09
Structures, catalysts, and reactors suitable for use for a variety of applications, including gas-to-liquid and coal-to-liquid processes and methods of forming the structures, catalysts, and reactors are disclosed. The catalyst material can be deposited onto an inner wall of a microtubular reactor and/or onto porous tungsten support structures using atomic layer deposition techniques.
Yazdani, Ali; Ong, N. Phuan; Cava, Robert J.
2016-05-03
An interconnect is disclosed with enhanced immunity of electrical conductivity to defects. The interconnect includes a material with charge carriers having topological surface states. Also disclosed is a method for fabricating such interconnects. Also disclosed is an integrated circuit including such interconnects. Also disclosed is a gated electronic device including a material with charge carriers having topological surface states.
NASA Technical Reports Server (NTRS)
Pain, Bedabrata (Inventor)
2012-01-01
An apparatus and associated method are provided. A first silicon layer having at least one of an associated passivation layer and barrier is included. Also included is a composite anti-reflection layer including a stack of layers each with a different thickness and refractive index. Such composite anti-reflection layer is disposed adjacent to the first silicon layer.
NASA Astrophysics Data System (ADS)
Haworth, Daniel
2013-11-01
The importance of explicitly accounting for the effects of unresolved turbulent fluctuations in Reynolds-averaged and large-eddy simulations of chemically reacting turbulent flows is increasingly recognized. Transported probability density function (PDF) methods have emerged as one of the most promising modeling approaches for this purpose. In particular, PDF methods provide an elegant and effective resolution to the closure problems that arise from averaging or filtering terms that correspond to nonlinear point processes, including chemical reaction source terms and radiative emission. PDF methods traditionally have been associated with studies of turbulence-chemistry interactions in laboratory-scale, atmospheric-pressure, nonluminous, statistically stationary nonpremixed turbulent flames; and Lagrangian particle-based Monte Carlo numerical algorithms have been the predominant method for solving modeled PDF transport equations. Recent advances and trends in PDF methods are reviewed and discussed. These include advances in particle-based algorithms, alternatives to particle-based algorithms (e.g., Eulerian field methods), treatment of combustion regimes beyond low-to-moderate-Damköhler-number nonpremixed systems (e.g., premixed flamelets), extensions to include radiation heat transfer and multiphase systems (e.g., soot and fuel sprays), and the use of PDF methods as the basis for subfilter-scale modeling in large-eddy simulation. Examples are provided that illustrate the utility and effectiveness of PDF methods for physics discovery and for applications to practical combustion systems. These include comparisons of results obtained using the PDF method with those from models that neglect unresolved turbulent fluctuations in composition and temperature in the averaged or filtered chemical source terms and/or the radiation heat transfer source terms. In this way, the effects of turbulence-chemistry-radiation interactions can be isolated and quantified.
Methods for describing the electromagnetic properties of silver and gold nanoparticles.
Zhao, Jing; Pinchuk, Anatoliy O; McMahon, Jeffrey M; Li, Shuzhou; Ausman, Logan K; Atkinson, Ariel L; Schatz, George C
2008-12-01
This Account provides an overview of the methods that are currently being used to study the electromagnetics of silver and gold nanoparticles, with an emphasis on the determination of extinction and surface-enhanced Raman scattering (SERS) spectra. These methods have proven to be immensely useful in recent years for interpreting a wide range of nanoscience experiments and providing the capability to describe optical properties of particles up to several hundred nanometers in dimension, including arbitrary particle structures and complex dielectric environments (adsorbed layers of molecules, nearby metal films, and other particles). While some of the methods date back to Mie's celebrated work a century ago, others are still at the forefront of algorithm development in computational electromagnetics. This Account gives a qualitative description of the physical and mathematical basis behind the most commonly used methods, including both analytical and numerical methods, as well as representative results of applications that are relevant to current experiments. The analytical methods that we discuss are either derived from Mie theory for spheres or from the quasistatic (Gans) model as applied to spheres and spheroids. In this discussion, we describe the use of Mie theory to determine electromagnetic contributions to SERS enhancements that include for retarded dipole emission effects, and the use of the quasistatic approximation for spheroidal particles interacting with dye adsorbate layers. The numerical methods include the discrete dipole approximation (DDA), the finite difference time domain (FDTD) method, and the finite element method (FEM) based on Whitney forms. We discuss applications such as using DDA to describe the interaction of two gold disks to define electromagnetic hot spots, FDTD for light interacting with metal wires that go from particle-like plasmonic response to the film-like transmission as wire dimension is varied, and FEM studies of electromagnetic fields near cubic particles.
25 CFR 900.125 - What shall a construction contract proposal contain?
Code of Federal Regulations, 2012 CFR
2012-04-01
... tribal building codes and engineering standards; (4) Structural integrity; (5) Accountability of funds..., standards and methods (including national, regional, state, or tribal building codes or construction... methods (including national, regional, state, or tribal building codes or construction industry standards...
25 CFR 900.125 - What shall a construction contract proposal contain?
Code of Federal Regulations, 2014 CFR
2014-04-01
... tribal building codes and engineering standards; (4) Structural integrity; (5) Accountability of funds..., standards and methods (including national, regional, state, or tribal building codes or construction... methods (including national, regional, state, or tribal building codes or construction industry standards...
25 CFR 900.125 - What shall a construction contract proposal contain?
Code of Federal Regulations, 2013 CFR
2013-04-01
... tribal building codes and engineering standards; (4) Structural integrity; (5) Accountability of funds..., standards and methods (including national, regional, state, or tribal building codes or construction... methods (including national, regional, state, or tribal building codes or construction industry standards...
25 CFR 900.125 - What shall a construction contract proposal contain?
Code of Federal Regulations, 2011 CFR
2011-04-01
... tribal building codes and engineering standards; (4) Structural integrity; (5) Accountability of funds..., standards and methods (including national, regional, state, or tribal building codes or construction... methods (including national, regional, state, or tribal building codes or construction industry standards...
25 CFR 900.125 - What shall a construction contract proposal contain?
Code of Federal Regulations, 2010 CFR
2010-04-01
... tribal building codes and engineering standards; (4) Structural integrity; (5) Accountability of funds..., standards and methods (including national, regional, state, or tribal building codes or construction... methods (including national, regional, state, or tribal building codes or construction industry standards...
Multi-layer articles and methods of making same
Fritzemeier, Leslie G.; Zhang, Wei; Palm, Walter C.; Rupich, Martin W.
2005-05-17
The invention relates to superconductor articles, and compositions and methods for making superconductor articles. The methods can include using a precursor solution having a relatively small concentration of total free acid. The articles can include more than one layer of superconductor material in which at least one layer of superconductor material can be formed by a solution process, such as a solution process involving the use of metalorganic precursors.
Compounds, compositions, pharmaceutical compositions, and methods of use
Hammond, Gerald B.; Jin, Zhuang; Bates, Paula J.; Reyes-Reyes, Elsa Merit
2016-11-15
Certain embodiments of the invention include compositions comprising a compound of Formula (I), and salts, isomers, and derivatives thereof. Pharmaceutical compositions of some embodiments of the present invention comprise a compound of Formula (I), and salts, isomers, and derivatives thereof. Other embodiments of this invention include methods for treating disease (e.g., cancer) and methods for administering a compound of Formula (I), and salts, isomers, and derivatives thereof.
Low temperature chemical processing of graphite-clad nuclear fuels
Pierce, Robert A.
2017-10-17
A reduced-temperature method for treatment of a fuel element is described. The method includes molten salt treatment of a fuel element with a nitrate salt. The nitrate salt can oxidize the outer graphite matrix of a fuel element. The method can also include reduced temperature degradation of the carbide layer of a fuel element and low temperature solubilization of the fuel in a kernel of a fuel element.
GneimoSim: A Modular Internal Coordinates Molecular Dynamics Simulation Package
Larsen, Adrien B.; Wagner, Jeffrey R.; Kandel, Saugat; Salomon-Ferrer, Romelia; Vaidehi, Nagarajan; Jain, Abhinandan
2014-01-01
The Generalized Newton Euler Inverse Mass Operator (GNEIMO) method is an advanced method for internal coordinates molecular dynamics (ICMD). GNEIMO includes several theoretical and algorithmic advancements that address longstanding challenges with ICMD simulations. In this paper we describe the GneimoSim ICMD software package that implements the GNEIMO method. We believe that GneimoSim is the first software package to include advanced features such as the equipartition principle derived for internal coordinates, and a method for including the Fixman potential to eliminate systematic statistical biases introduced by the use of hard constraints. Moreover, by design, GneimoSim is extensible and can be easily interfaced with third party force field packages for ICMD simulations. Currently, GneimoSim includes interfaces to LAMMPS, OpenMM, Rosetta force field calculation packages. The availability of a comprehensive Python interface to the underlying C++ classes and their methods provides a powerful and versatile mechanism for users to develop simulation scripts to configure the simulation and control the simulation flow. GneimoSim has been used extensively for studying the dynamics of protein structures, refinement of protein homology models, and for simulating large scale protein conformational changes with enhanced sampling methods. GneimoSim is not limited to proteins and can also be used for the simulation of polymeric materials. PMID:25263538
GneimoSim: a modular internal coordinates molecular dynamics simulation package.
Larsen, Adrien B; Wagner, Jeffrey R; Kandel, Saugat; Salomon-Ferrer, Romelia; Vaidehi, Nagarajan; Jain, Abhinandan
2014-12-05
The generalized Newton-Euler inverse mass operator (GNEIMO) method is an advanced method for internal coordinates molecular dynamics (ICMD). GNEIMO includes several theoretical and algorithmic advancements that address longstanding challenges with ICMD simulations. In this article, we describe the GneimoSim ICMD software package that implements the GNEIMO method. We believe that GneimoSim is the first software package to include advanced features such as the equipartition principle derived for internal coordinates, and a method for including the Fixman potential to eliminate systematic statistical biases introduced by the use of hard constraints. Moreover, by design, GneimoSim is extensible and can be easily interfaced with third party force field packages for ICMD simulations. Currently, GneimoSim includes interfaces to LAMMPS, OpenMM, and Rosetta force field calculation packages. The availability of a comprehensive Python interface to the underlying C++ classes and their methods provides a powerful and versatile mechanism for users to develop simulation scripts to configure the simulation and control the simulation flow. GneimoSim has been used extensively for studying the dynamics of protein structures, refinement of protein homology models, and for simulating large scale protein conformational changes with enhanced sampling methods. GneimoSim is not limited to proteins and can also be used for the simulation of polymeric materials. © 2014 Wiley Periodicals, Inc.
Methods of making wind turbine rotor blades
Livingston, Jamie T.; Burke, Arthur H. E.; Bakhuis, Jan Willem; Van Breugel, Sjef; Billen, Andrew
2008-04-01
A method of manufacturing a root portion of a wind turbine blade includes, in an exemplary embodiment, providing an outer layer of reinforcing fibers including at least two woven mats of reinforcing fibers, providing an inner layer of reinforcing fibers including at least two woven mats of reinforcing fibers, and positioning at least two bands of reinforcing fibers between the inner and outer layers, with each band of reinforcing fibers including at least two woven mats of reinforcing fibers. The method further includes positioning a mat of randomly arranged reinforcing fibers between each pair of adjacent bands of reinforcing fibers, introducing a polymeric resin into the root potion of the wind turbine blade, infusing the resin through the outer layer, the inner layer, each band of reinforcing fibers, and each mat of random reinforcing fibers, and curing the resin to form the root portion of the wind turbine blade.
Chemical detection system and related methods
DOE Office of Scientific and Technical Information (OSTI.GOV)
Caffrey, Augustine J.; Chichester, David L.; Egger, Ann E.
2017-06-27
A chemical detection system includes a frame, an emitter coupled to the frame, and a detector coupled to the frame proximate the emitter. The system also includes a shielding system coupled to the frame and positioned at least partially between the emitter and the detector, wherein the frame positions a sensing surface of the detector in a direction substantially parallel to a plane extending along a front portion of the frame. A method of analyzing composition of a suspect object includes directing neutrons at the object, detecting gamma rays emitted from the object, and communicating spectrometer information regarding the gammamore » rays. The method also includes presenting a GUI to a user with a dynamic status of an ongoing neutron spectroscopy process. The dynamic status includes a present confidence for a plurality of compounds being present in the suspect object responsive to changes in the spectrometer information during the ongoing process.« less
A manual for inexpensive methods of analyzing and utilizing remote sensor data
NASA Technical Reports Server (NTRS)
Elifrits, C. D.; Barr, D. J.
1978-01-01
Instructions are provided for inexpensive methods of using remote sensor data to assist in the completion of the need to observe the earth's surface. When possible, relative costs were included. Equipment need for analysis of remote sensor data is described, and methods of use of these equipment items are included, as well as advantages and disadvantages of the use of individual items. Interpretation and analysis of stereo photos and the interpretation of typical patterns such as tone and texture, landcover, drainage, and erosional form are described. Similar treatment is given to monoscopic image interpretation, including LANDSAT MSS data. Enhancement techniques are detailed with respect to their application and simple techniques of creating an enhanced data item. Techniques described include additive and subtractive (Diazo processes) color techniques and enlargement of photos or images. Applications of these processes, including mappings of land resources, engineering soils, geology, water resources, environmental conditions, and crops and/or vegetation, are outlined.
The Parker-Sochacki Method--A Powerful New Method for Solving Systems of Differential Equations
NASA Astrophysics Data System (ADS)
Rudmin, Joseph W.
2001-04-01
The Parker-Sochacki Method--A Powerful New Method for Solving Systems of Differential Equations Joseph W. Rudmin (Physics Dept, James Madison University) A new system of solving systems of differential equations will be presented, which has been developed by J. Edgar Parker and James Sochacki, of the James Madison University Mathematics Department. The method produces MacClaurin Series solutions to systems of differential equations, with the coefficients in either algebraic or numerical form. The method yields high-degree solutions: 20th degree is easily obtainable. It is conceptually simple, fast, and extremely general. It has been applied to over a hundred systems of differential equations, some of which were previously unsolved, and has yet to fail to solve any system for which the MacClaurin series converges. The method is non-recursive: each coefficient in the series is calculated just once, in closed form, and its accuracy is limited only by the digital accuracy of the computer. Although the original differential equations may include any mathematical functions, the computational method includes ONLY the operations of addition, subtraction, and multiplication. Furthermore, it is perfectly suited to parallel -processing computer languages. Those who learn this system will never use Runge-Kutta or predictor-corrector methods again. Examples will be presented, including the classical many-body problem.
Method for non-referential defect characterization using fractal encoding and active contours
Gleason, Shaun S [Knoxville, TN; Sari-Sarraf, Hamed [Lubbock, TX
2007-05-15
A method for identification of anomalous structures, such as defects, includes the steps of providing a digital image and applying fractal encoding to identify a location of at least one anomalous portion of the image. The method does not require a reference image to identify the location of the anomalous portion. The method can further include the step of initializing an active contour based on the location information obtained from the fractal encoding step and deforming an active contour to enhance the boundary delineation of the anomalous portion.
Method of forming a ceramic matrix composite and a ceramic matrix component
DOE Office of Scientific and Technical Information (OSTI.GOV)
de Diego, Peter; Zhang, James
A method of forming a ceramic matrix composite component includes providing a formed ceramic member having a cavity, filling at least a portion of the cavity with a ceramic foam. The ceramic foam is deposited on a barrier layer covering at least one internal passage of the cavity. The method includes processing the formed ceramic member and ceramic foam to obtain a ceramic matrix composite component. Also provided is a method of forming a ceramic matrix composite blade and a ceramic matrix composite component.
Mayer-Cumblidge, M. Uljana; Cao, Haishi
2013-01-15
A molecular probe comprises two arsenic atoms and at least one cyanine based moiety. A method of producing a molecular probe includes providing a molecule having a first formula, treating the molecule with HgOAc, and subsequently transmetallizing with AsCl.sub.3. The As is liganded to ethanedithiol to produce a probe having a second formula. A method of labeling a peptide includes providing a peptide comprising a tag sequence and contacting the peptide with a biarsenical molecular probe. A complex is formed comprising the tag sequence and the molecular probe. A method of studying a peptide includes providing a mixture containing a peptide comprising a peptide tag sequence, adding a biarsenical probe to the mixture, and monitoring the fluorescence of the mixture.
Mayer-Cumblidge, M Uljana [Richland, WA; Cao, Haishi [Richland, WA
2010-08-17
A molecular probe comprises two arsenic atoms and at least one cyanine based moiety. A method of producing a molecular probe includes providing a molecule having a first formula, treating the molecule with HgOAc, and subsequently transmetallizing with AsCl.sub.3. The As is liganded to ethanedithiol to produce a probe having a second formula. A method of labeling a peptide includes providing a peptide comprising a tag sequence and contacting the peptide with a biarsenical molecular probe. A complex is formed comprising the tag sequence and the molecular probe. A method of studying a peptide includes providing a mixture containing a peptide comprising a peptide tag sequence, adding a biarsenical probe to the mixture, and monitoring the fluorescence of the mixture.
Method and apparatus for wavefront sensing
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bahk, Seung-Whan
A method for performing optical wavefront sensing includes providing an amplitude transmission mask having a light input side, a light output side, and an optical transmission axis passing from the light input side to the light output side. The amplitude transmission mask is characterized by a checkerboard pattern having a square unit cell of size .LAMBDA.. The method also includes directing an incident light field having a wavelengthmore » $$ \\lamda $$ to be incident on the light input side and propagating the incident light field through the amplitude transmission mask. The method further includes producing a plurality of diffracted light fields on the light output side and detecting, at a detector disposed a distance L from the amplitude transmission mask, an interferogram associated with the plurality of diffracted light fields.« less
Conversion of 2,3-butanediol to 2-butanol, olefins and fuels
Lilga, Michael A.; Lee, Guo-Shuh; Lee, Suh-Jane
2016-12-13
Embodiments of an integrated method for step-wise conversion of 2,3-butanediol to 2-butanol, and optionally to hydrocarbons, are disclosed. The method includes providing an acidic catalyst, exposing a composition comprising aqueous 2,3-butanediol to the acidic catalyst to produce an intermediate composition comprising methyl ethyl ketone, providing a hydrogenation catalyst that is spatially separated from the acidic catalyst, and subsequently exposing the intermediate composition to the hydrogenation catalyst to produce a composition comprising 2-butanol. The method may further include subsequently exposing the composition comprising 2-butanol to a deoxygenation catalyst, and deoxygenating the 2-butanol to form hydrocarbons. In some embodiments, the hydrocarbons comprise olefins, such as butenes, and the method may further include subsequently exposing the hydrocarbons to a hydrogenation catalyst to form saturated hydrocarbons.
Control system health test system and method
Hoff, Brian D.; Johnson, Kris W.; Akasam, Sivaprasad; Baker, Thomas M.
2006-08-15
A method is provided for testing multiple elements of a work machine, including a control system, a component, a sub-component that is influenced by operations of the component, and a sensor that monitors a characteristic of the sub-component. In one embodiment, the method is performed by the control system and includes sending a command to the component to adjust a first parameter associated with an operation of the component. Also, the method includes detecting a sensor signal from the sensor reflecting a second parameter associated with a characteristic of the sub-component and determining whether the second parameter is acceptable based on the command. The control system may diagnose at least one of the elements of the work machine when the second parameter of the sub-component is not acceptable.
Stationary semi-solid battery module and method of manufacture
Slocum, Alexander; Doherty, Tristan; Bazzarella, Ricardo; Cross, III, James C.; Limthongkul, Pimpa; Duduta, Mihai; Disko, Jeffry; Yang, Allen; Wilder, Throop; Carter, William Craig; Chiang, Yet-Ming
2015-12-01
A method of manufacturing an electrochemical cell includes transferring an anode semi-solid suspension to an anode compartment defined at least in part by an anode current collector and an separator spaced apart from the anode collector. The method also includes transferring a cathode semi-solid suspension to a cathode compartment defined at least in part by a cathode current collector and the separator spaced apart from the cathode collector. The transferring of the anode semi-solid suspension to the anode compartment and the cathode semi-solid to the cathode compartment is such that a difference between a minimum distance and a maximum distance between the anode current collector and the separator is maintained within a predetermined tolerance. The method includes sealing the anode compartment and the cathode compartment.
Lattice-mismatched GaInP LED devices and methods of fabricating same
Mascarenhas, Angelo; Steiner, Myles A; Bhusal, Lekhnath; Zhang, Yong
2014-10-21
A method (100) of fabricating an LED or the active regions of an LED and an LED (200). The method includes growing, depositing or otherwise providing a bottom cladding layer (208) of a selected semiconductor alloy with an adjusted bandgap provided by intentionally disordering the structure of the cladding layer (208). A first active layer (202) may be grown above the bottom cladding layer (208) wherein the first active layer (202) is fabricated of the same semiconductor alloy, with however, a partially ordered structure. The first active layer (202) will also be fabricated to include a selected n or p type doping. The method further includes growing a second active layer (204) above the first active layer (202) where the second active layer (204) Is fabricated from the same semiconductor alloy.
Combinatorial Screening Of Inorganic And Organometallic Materials
Li, Yi , Li, Jing , Britton, Ted W.
2002-06-25
A method for differentiating and enumerating nucleated red blood cells in a blood sample is described. The method includes the steps of lysing red blood cells of a blood sample with a lytic reagent, measuring nucleated blood cells by DC impedance measurement in a non-focused flow aperture, differentiating nucleated red blood cells from other cell types, and reporting nucleated red blood cells in the blood sample. The method further includes subtracting nucleated red blood cells and other interference materials from the count of remaining blood cells, and reporting a corrected white blood cell count of the blood sample. Additionally, the method further includes measuring spectrophotometric absorbance of the sample mixture at a predetermined wavelength of a hemoglobin chromogen formed upon lysing the blood sample, and reporting hemoglobin concentration of the blood sample.
Restriction/modification polypeptides, polynucleotides, and methods
Westpheling, Janet; Chung, DaeHwan; Huddleston, Jennifer; Farkas, Joel A
2015-02-24
The present invention relates to the discovery of a novel restriction/modification system in Caldicellulosiruptor bescii. The discovered restriction enzyme is a HaeIII-like restriction enzyme that possesses a thermophilic activity profile. The restriction/modification system also includes a methyltransferase, M.CbeI, that methylates at least one cytosine residue in the CbeI recognition sequence to m.sup.4C. Thus, the invention provides, in various aspects, isolated CbeI or M.CbeI polypeptides, or biologically active fragments thereof; isolated polynucleotides that encode the CbeI or M.CbeI polypeptides or biologically active fragments thereof, including expression vectors that include such polynucleotide sequences; methods of digesting DNA using a CbeI polypeptide; methods of treating a DNA molecule using a M.CbeI polypeptide; and methods of transforming a Caldicellulosiruptor cell.
Initiation disruptor systems and methods of initiation disruption
Baum, Dennis W
2014-09-23
A system that may be used as an initiation disruption system (IDS) according to one embodiment includes an explosive charge; a plurality of particles in a layer at least partially surrounding the explosive charge; and a fire suppressant adjacent the plurality of particles. A method for disabling an object according to one embodiment includes placing the system as recited above near an object; and causing the explosive charge to initiate, thereby applying mechanical loading to the object such that the object becomes disabled. Additional systems and methods are also presented. A device according to another embodiment includes a plurality of particles bound by a binder thereby defining a sidewall having an interior for receiving an explosive; and a fire suppressant adjacent the plurality of particles and binder. Additional systems and methods are also presented.
Hughes, Douglas A.
2006-04-04
A method and system are provided for determining the torque required to launch a vehicle having a hybrid drive-train that includes at least two independently operable prime movers. The method includes the steps of determining the value of at least one control parameter indicative of a vehicle operating condition, determining the torque required to launch the vehicle from the at least one determined control parameter, comparing the torque available from the prime movers to the torque required to launch the vehicle, and controlling operation of the prime movers to launch the vehicle in response to the comparing step. The system of the present invention includes a control unit configured to perform the steps of the method outlined above.
Kotter, Dale K [Shelley, ID; Rohrbaugh, David T [Idaho Falls, ID
2010-09-07
A frequency selective surface (FSS) and associated methods for modeling, analyzing and designing the FSS are disclosed. The FSS includes a pattern of conductive material formed on a substrate to form an array of resonance elements. At least one aspect of the frequency selective surface is determined by defining a frequency range including multiple frequency values, determining a frequency dependent permittivity across the frequency range for the substrate, determining a frequency dependent conductivity across the frequency range for the conductive material, and analyzing the frequency selective surface using a method of moments analysis at each of the multiple frequency values for an incident electromagnetic energy impinging on the frequency selective surface. The frequency dependent permittivity and the frequency dependent conductivity are included in the method of moments analysis.
Pollock, Alex; Campbell, Pauline; Struthers, Caroline; Synnot, Anneliese; Nunn, Jack; Hill, Sophie; Goodare, Heather; Watts, Chris; Morley, Richard
2017-01-01
Researchers are expected to actively involve stakeholders (including patients, the public, health professionals, and others) in their research. Although researchers increasingly recognise that this is good practice, there is limited practical guidance about how to involve stakeholders. Systematic reviews are a research method in which international literature is brought together, using carefully designed and rigorous methods to answer a specified question about healthcare. We want to investigate how researchers have involved stakeholders in systematic reviews, and how involvement has potentially affected the quality and impact of reviews. We plan to bring this information together by searching and reviewing the literature for reports of stakeholder involvement in systematic reviews. This paper describes in detail the methods that we plan to use to do this. After carrying out comprehensive searches for literature, we will: 1. Provide an overview of identified reports, describing key information such as types of stakeholders involved, and how. 2. Pick out reports of involvement which include detailed descriptions of how researchers involved people in a systematic review and summarise the methods they used. We will consider who was involved, how people were recruited, and how the involvement was organised and managed. 3. Bring together any reports which have explored the effect, or impact, of involving stakeholders in a systematic review. We will assess the quality of these reports, and summarise their findings. Once completed, our review will be used to produce training resources aimed at helping researchers to improve ways of involving stakeholders in systematic reviews. Background There is an expectation for stakeholders (including patients, the public, health professionals, and others) to be involved in research. Researchers are increasingly recognising that it is good practice to involve stakeholders in systematic reviews. There is currently a lack of evidence about (A) how to do this and (B) the effects, or impact, of such involvement. We aim to create a map of the evidence relating to stakeholder involvement in systematic reviews, and use this evidence to address the two points above. Methods We will complete a mixed-method synthesis of the evidence, first completing a scoping review to create a broad map of evidence relating to stakeholder involvement in systematic reviews, and secondly completing two contingent syntheses. We will use a stepwise approach to searching; the initial step will include comprehensive searches of electronic databases, including CENTRAL, AMED, Embase, Medline, Cinahl and other databases, supplemented with pre-defined hand-searching and contacting authors. Two reviewers will undertake each review task (i.e., screening, data extraction) using standard systematic review processes. For the scoping review, we will include any paper, regardless of publication status or study design, which investigates, reports or discusses involvement in a systematic review. Included papers will be summarised within structured tables. Criteria for judging the focus and comprehensiveness of the description of methods of involvement will be applied, informing which papers are included within the two contingent syntheses. Synthesis A will detail the methods that have been used to involve stakeholders in systematic reviews. Papers from the scoping review that are judged to provide an adequate description of methods or approaches will be included. Details of the methods of involvement will be extracted from included papers using pre-defined headings, presented in tables and described narratively. Synthesis B will include studies that explore the effect of stakeholder involvement on the quality, relevance or impact of a systematic review, as identified from the scoping review. Study quality will be appraised, data extracted and synthesised within tables. Discussion This review should help researchers select, improve and evaluate methods of involving stakeholders in systematic reviews. Review findings will contribute to Cochrane training resources.
Zaugg, Steven D.; Phillips, Patrick J.; Smith, Steven G.
2014-01-01
Research on the effects of exposure of stream biota to complex mixtures of pharmaceuticals and other organic compounds associated with wastewater requires the development of additional analytical capabilities for these compounds in water samples. Two gas chromatography/mass spectrometry (GC/MS) analytical methods used at the U.S. Geological Survey National Water Quality Laboratory (NWQL) to analyze organic compounds associated with wastewater were adapted to include additional pharmaceutical and other organic compounds beginning in 2009. This report includes a description of method performance for 42 additional compounds for the filtered-water method (hereafter referred to as the filtered method) and 46 additional compounds for the unfiltered-water method (hereafter referred to as the unfiltered method). The method performance for the filtered method described in this report has been published for seven of these compounds; however, the addition of several other compounds to the filtered method and the addition of the compounds to the unfiltered method resulted in the need to document method performance for both of the modified methods. Most of these added compounds are pharmaceuticals or pharmaceutical degradates, although two nonpharmaceutical compounds are included in each method. The main pharmaceutical compound classes added to the two modified methods include muscle relaxants, opiates, analgesics, and sedatives. These types of compounds were added to the original filtered and unfiltered methods largely in response to the tentative identification of a wide range of pharmaceutical and other organic compounds in samples collected from wastewater-treatment plants. Filtered water samples are extracted by vacuum through disposable solid-phase cartridges that contain modified polystyrene-divinylbenzene resin. Unfiltered samples are extracted by using continuous liquid-liquid extraction with dichloromethane. The compounds of interest for filtered and unfiltered sample types were determined by use of the capillary-column gas chromatography/mass spectrometry. The performance of each method was assessed by using data on recoveries of compounds in fortified surface-water, wastewater, and reagent-water samples. These experiments (referred to as spike experiments) consist of fortifying (or spiking) samples with known amounts of target analytes. Surface-water-spike experiments were performed by using samples obtained from a stream in Colorado (unfiltered method) and a stream in New York (filtered method). Wastewater spike experiments for both the filtered and unfiltered methods were performed by using a treated wastewater obtained from a single wastewater treatment plant in New York. Surface water and wastewater spike experiments were fortified at both low and high concentrations and termed low- and high-level spikes, respectively. Reagent water spikes were assessed in three ways: (1) set spikes, (2) a low-concentration fortification experiment, and (3) a high-concentration fortification experiment. Set spike samples have been determined since 2009, and consist of analysis of fortified reagent water for target compounds included for each group of 10 to18 environmental samples analyzed at the NWQL. The low-concentration and high-concentration reagent spike experiments, by contrast, represent a one-time assessment of method performance. For each spike experiment, mean recoveries ranging from 60 to 130 percent indicate low bias, and relative standard deviations (RSDs) less than ( Of the compounds included in the filtered method, 21 had mean recoveries ranging from 63 to 129 percent for the low-level and high-level surface-water spikes, and had low ()132 percent]. For wastewater spikes, 24 of the compounds included in the filtered method had recoveries ranging from 61 to 130 percent for the low-level and high-level spikes. RSDs were 130 percent) or variable recoveries (RSDs >30 percent) for low-level wastewater spikes, or low recoveries ( Of the compounds included in the unfiltered method, 17 had mean spike recoveries ranging from 74 to 129 percent and RSDs ranging from 5 to 25 percent for low-level and high-level surface water spikes. The remaining compounds had poor mean recoveries (130 percent), or high RSDs (>29 percent) for these spikes. For wastewater, 14 of the compounds included in the unfiltered method had mean recoveries ranging from 62 to 127 percent and RSDs 130 percent), or low mean recoveries (33 percent) for the low-level wastewater spikes. Of the compounds found in wastewater, 24 had mean set spike recoveries ranging from 64 to 104 percent and RSDs Separate method detection limits (MDLs) were computed for surface water and wastewater for both the filtered and unfiltered methods. Filtered method MDLs ranged from 0.007 to 0.14 microgram per liter (μg/L) for the surface water matrix and from 0.004 to 0.62 μg/L for the wastewater matrix. Unfiltered method MDLs ranged from 0.014 to 0.33 μg/L for the surface water matrix and from 0.008 to 0.36 μg/L for the wastewater matrix.
Experimental methods for identifying failure mechanisms
NASA Technical Reports Server (NTRS)
Daniel, I. M.
1983-01-01
Experimental methods for identifying failure mechanisms in fibrous composites are studied. Methods to identify failure in composite materials includes interferometry, holography, fractography and ultrasonics.
Hydrolysis of biomass material
Schmidt, Andrew J.; Orth, Rick J.; Franz, James A.; Alnajjar, Mikhail
2004-02-17
A method for selective hydrolysis of the hemicellulose component of a biomass material. The selective hydrolysis produces water-soluble small molecules, particularly monosaccharides. One embodiment includes solubilizing at least a portion of the hemicellulose and subsequently hydrolyzing the solubilized hemicellulose to produce at least one monosaccharide. A second embodiment includes solubilizing at least a portion of the hemicellulose and subsequently enzymatically hydrolyzing the solubilized hemicellulose to produce at least one monosaccharide. A third embodiment includes solubilizing at least a portion of the hemicellulose by heating the biomass material to greater than 110.degree. C. resulting in an aqueous portion that includes the solubilized hemicellulose and a water insoluble solids portion and subsequently separating the aqueous portion from the water insoluble solids portion. A fourth embodiment is a method for making a composition that includes cellulose, at least one protein and less than about 30 weight % hemicellulose, the method including solubilizing at least a portion of hemicellulose present in a biomass material that also includes cellulose and at least one protein and subsequently separating the solubilized hemicellulose from the cellulose and at least one protein.
Inquiring into the Real: A Realist Phenomenological Approach
ERIC Educational Resources Information Center
Budd, John M.; Hill, Heather; Shannon, Brooke
2010-01-01
The need for postpositivist or antipositivist methods in the social sciences, including library and information science, is well documented. A promising alternative synthesizes critical realism and phenomenology. This method embraces ontological reality in all things, including human and social action. The ontology underlying the realist…
Systems and methods for sample analysis
Cooks, Robert Graham; Li, Guangtao; Li, Xin; Ouyang, Zheng
2015-01-13
The invention generally relates to systems and methods for sample analysis. In certain embodiments, the invention provides a system for analyzing a sample that includes a probe including a material connected to a high voltage source, a device for generating a heated gas, and a mass analyzer.
Teaching Data Base Search Strategies.
ERIC Educational Resources Information Center
Hannah, Larry
1987-01-01
Discusses database searching as a method for developing thinking skills, and describes an activity suitable for fifth grade through high school using a president's and vice president's database. Teaching methods are presented, including student team activities, and worksheets designed for the AppleWorks database are included. (LRW)
Montei, Carolyn; McDougal, Susan; Mozola, Mark; Rice, Jennifer
2014-01-01
The Soleris Non-fermenting Total Viable Count method was previously validated for a wide variety of food products, including cocoa powder. A matrix extension study was conducted to validate the method for use with cocoa butter and cocoa liquor. Test samples included naturally contaminated cocoa liquor and cocoa butter inoculated with natural microbial flora derived from cocoa liquor. A probability of detection statistical model was used to compare Soleris results at multiple test thresholds (dilutions) with aerobic plate counts determined using the AOAC Official Method 966.23 dilution plating method. Results of the two methods were not statistically different at any dilution level in any of the three trials conducted. The Soleris method offers the advantage of results within 24 h, compared to the 48 h required by standard dilution plating methods.
An overview of very high level software design methods
NASA Technical Reports Server (NTRS)
Asdjodi, Maryam; Hooper, James W.
1988-01-01
Very High Level design methods emphasize automatic transfer of requirements to formal design specifications, and/or may concentrate on automatic transformation of formal design specifications that include some semantic information of the system into machine executable form. Very high level design methods range from general domain independent methods to approaches implementable for specific applications or domains. Applying AI techniques, abstract programming methods, domain heuristics, software engineering tools, library-based programming and other methods different approaches for higher level software design are being developed. Though one finds that a given approach does not always fall exactly in any specific class, this paper provides a classification for very high level design methods including examples for each class. These methods are analyzed and compared based on their basic approaches, strengths and feasibility for future expansion toward automatic development of software systems.
Methods of forming semiconductor devices and devices formed using such methods
Fox, Robert V; Rodriguez, Rene G; Pak, Joshua
2013-05-21
Single source precursors are subjected to carbon dioxide to form particles of material. The carbon dioxide may be in a supercritical state. Single source precursors also may be subjected to supercritical fluids other than supercritical carbon dioxide to form particles of material. The methods may be used to form nanoparticles. In some embodiments, the methods are used to form chalcopyrite materials. Devices such as, for example, semiconductor devices may be fabricated that include such particles. Methods of forming semiconductor devices include subjecting single source precursors to carbon dioxide to form particles of semiconductor material, and establishing electrical contact between the particles and an electrode.
New Finger Biometric Method Using Near Infrared Imaging
Lee, Eui Chul; Jung, Hyunwoo; Kim, Daeyeoul
2011-01-01
In this paper, we propose a new finger biometric method. Infrared finger images are first captured, and then feature extraction is performed using a modified Gaussian high-pass filter through binarization, local binary pattern (LBP), and local derivative pattern (LDP) methods. Infrared finger images include the multimodal features of finger veins and finger geometries. Instead of extracting each feature using different methods, the modified Gaussian high-pass filter is fully convolved. Therefore, the extracted binary patterns of finger images include the multimodal features of veins and finger geometries. Experimental results show that the proposed method has an error rate of 0.13%. PMID:22163741
Method of treating contaminated HEPA filter media in pulp process
Hu, Jian S.; Argyle, Mark D.; Demmer, Ricky L.; Mondok, Emilio P.
2003-07-29
A method for reducing contamination of HEPA filters with radioactive and/or hazardous materials is described. The method includes pre-processing of the filter for removing loose particles. Next, the filter medium is removed from the housing, and the housing is decontaminated. Finally, the filter medium is processed as pulp for removing contaminated particles by physical and/or chemical methods, including gravity, flotation, and dissolution of the particles. The decontaminated filter medium is then disposed of as non-RCRA waste; the particles are collected, stabilized, and disposed of according to well known methods of handling such materials; and the liquid medium in which the pulp was processed is recycled.
NASA Technical Reports Server (NTRS)
Allen, G.
1972-01-01
The use of the theta-operator method and generalized hypergeometric functions in obtaining solutions to nth-order linear ordinary differential equations is explained. For completeness, the analysis of the differential equation to determine whether the point of expansion is an ordinary point or a regular singular point is included. The superiority of the two methods shown over the standard method is demonstrated by using all three of the methods to work out several examples. Also included is a compendium of formulae and properties of the theta operator and generalized hypergeometric functions which is complete enough to make the report self-contained.
NASA Technical Reports Server (NTRS)
Gray, D. J.
1978-01-01
Cryogenic transportation methods for providing liquid hydrogen requirements are examined in support of shuttle transportation system launch operations at Kennedy Space Center, Florida, during the time frames 1982-1991 in terms of cost and operational effectiveness. Transportation methods considered included sixteen different options employing mobile semi-trailer tankers, railcars, barges and combinations of each method. The study concludes that the most effective method of delivering liquid hydrogen from the vendor production facility in New Orleans to Kennedy Space Center includes maximum utilization of existing mobile tankers and railcars supplemented by maximum capacity mobile tankers procured incrementally in accordance with shuttle launch rates actually achieved.
Material-controlled dynamic vacuum insulation
Benson, D.K.; Potter, T.F.
1996-10-08
A compact vacuum insulation panel is described comprising a chamber enclosed by two sheets of metal, glass-like spaces disposed in the chamber between the sidewalls, and a high-grade vacuum in the chamber includes apparatus and methods for enabling and disabling, or turning ``on`` and ``off`` the thermal insulating capability of the panel. One type of enabling and disabling apparatus and method includes a metal hydride for releasing hydrogen gas into the chamber in response to heat, and a hydrogen grate between the metal hydride and the chamber for selectively preventing and allowing return of the hydrogen gas to the metal hydride. Another type of enabling and disabling apparatus and method includes a variable emissivity coating on the sheets of metal in which the emissivity is controllably variable by heat or electricity. Still another type of enabling and disabling apparatus and method includes metal-to-metal contact devices that can be actuated to establish or break metal-to-metal heat paths or thermal short circuits between the metal sidewalls. 25 figs.
Variably insulating portable heater/cooler
Potter, Thomas F.
1998-01-01
A compact vacuum insulation panel comprising a chamber enclosed by two sheets of metal, glass-like spaces disposed in the chamber between the sidewalls, and a high-grade vacuum in the chamber includes apparatus and methods for enabling and disabling, or turning "on" and "off" the thermal insulating capability of the panel. One type of enabling and disabling apparatus and method includes a metal hydride for releasing hydrogen gas into the chamber in response to heat, and a hydrogen grate between the metal hydride and the chamber for selectively preventing and allowing return of the hydrogen gas to the metal hydride. Another type of enabling and disabling apparatus and method includes a variable emissivity coating on the sheets of metal in which the emissivity is controllably variable by heat or electricity. Still another type of enabling and disabling apparatus and method includes metal-to-metal contact devices that can be actuated to establish or break metal-to-metal heat paths or thermal short circuits between the metal sidewalls.
Material-controlled dynamic vacuum insulation
Benson, David K.; Potter, Thomas F.
1996-10-08
A compact vacuum insulation panel comprising a chamber enclosed by two sheets of metal, glass-like spaces disposed in the chamber between the sidewalls, and a high-grade vacuum in the chamber includes apparatus and methods for enabling and disabling, or turning "on" and "off" the thermal insulating capability of the panel. One type of enabling and disabling apparatus and method includes a metal hydride for releasing hydrogen gas into the chamber in response to heat, and a hydrogen grate between the metal hydride and the chamber for selectively preventing and allowing return of the hydrogen gas to the metal hydride. Another type of enabling and disabling apparatus and method includes a variable emissivity coating on the sheets of metal in which the emissivity is controllably variable by heat or electricity. Still another type of enabling and disabling apparatus and method includes metal-to-metal contact devices that can be actuated to establish or break metal-to-metal heat paths or thermal short circuits between the metal sidewalls.
Radiation-controlled dynamic vacuum insulation
Benson, David K.; Potter, Thomas F.
1995-01-01
A compact vacuum insulation panel comprising a chamber enclosed by two sheets of metal, glass-like spaces disposed in the chamber between the sidewalls, and a high-grade vacuum in the chamber that includes apparatus and methods for enabling and disabling, or turning "on" and "off" the thermal insulating capability of the panel. One type of enabling and disabling apparatus and method includes a metal hydride for releasing hydrogen gas into the chamber in response to heat, and a hydrogen grate between the metal hydride and the chamber for selectively preventing and allowing return of the hydrogen gas to the metal hydride. Another type of enabling and disabling apparatus and method includes a variable emissivity coating on the sheets of metal in which the emissivity is controllably variable by heat or electricity. Still another type of enabling and disabling apparatus and method includes metal-to-metal contact devices that can be actuated to establish or break metal-to-metal heat paths or thermal short circuits between the metal sidewalls.
Radiation-controlled dynamic vacuum insulation
Benson, D.K.; Potter, T.F.
1995-07-18
A compact vacuum insulation panel is described comprising a chamber enclosed by two sheets of metal, glass-like spaces disposed in the chamber between the sidewalls, and a high-grade vacuum in the chamber that includes apparatus and methods for enabling and disabling, or turning ``on`` and ``off`` the thermal insulating capability of the panel. One type of enabling and disabling apparatus and method includes a metal hydride for releasing hydrogen gas into the chamber in response to heat, and a hydrogen grate between the metal hydride and the chamber for selectively preventing and allowing return of the hydrogen gas to the metal hydride. Another type of enabling and disabling apparatus and method includes a variable emissivity coating on the sheets of metal in which the emissivity is controllably variable by heat or electricity. Still another type of enabling and disabling apparatus and method includes metal-to-metal contact devices that can be actuated to establish or break metal-to-metal heat paths or thermal short circuits between the metal sidewalls. 25 figs.
Variably insulating portable heater/cooler
Potter, T.F.
1998-09-29
A compact vacuum insulation panel is described comprising a chamber enclosed by two sheets of metal, glass-like spaces disposed in the chamber between the sidewalls, and a high-grade vacuum in the chamber includes apparatus and methods for enabling and disabling, or turning ``on`` and ``off`` the thermal insulating capability of the panel. One type of enabling and disabling apparatus and method includes a metal hydride for releasing hydrogen gas into the chamber in response to heat, and a hydrogen grate between the metal hydride and the chamber for selectively preventing and allowing return of the hydrogen gas to the metal hydride. Another type of enabling and disabling apparatus and method includes a variable emissivity coating on the sheets of metal in which the emissivity is controllably variable by heat or electricity. Still another type of enabling and disabling apparatus and method includes metal-to-metal contact devices that can be actuated to establish or break metal-to-metal heat paths or thermal short circuits between the metal sidewalls. 25 figs.
Janke, Christopher J.; Dai, Sheng; Oyola, Yatsandra
2016-09-06
A fiber-based adsorbent and a related method of manufacture are provided. The fiber-based adsorbent includes polymer fibers with grafted side chains and an increased surface area per unit weight over known fibers to increase the adsorption of dissolved metals, for example uranium, from aqueous solutions. The polymer fibers include a circular morphology in some embodiments, having a mean diameter of less than 15 microns, optionally less than about 1 micron. In other embodiments, the polymer fibers include a non-circular morphology, optionally defining multiple gear-shaped, winged-shaped or lobe-shaped projections along the length of the polymer fibers. A method for forming the fiber-based adsorbents includes irradiating high surface area polymer fibers, grafting with polymerizable reactive monomers, reacting the grafted fibers with hydroxylamine, and conditioning with an alkaline solution. High surface area fiber-based adsorbents formed according to the present method demonstrated a significantly improved uranium adsorption capacity per unit weight over existing adsorbents.
Janke, Christopher J; Dai, Sheng; Oyola, Yatsandra
2014-05-13
A fiber-based adsorbent and a related method of manufacture are provided. The fiber-based adsorbent includes polymer fibers with grafted side chains and an increased surface area per unit weight over known fibers to increase the adsorption of dissolved metals, for example uranium, from aqueous solutions. The polymer fibers include a circular morphology in some embodiments, having a mean diameter of less than 15 microns, optionally less than about 1 micron. In other embodiments, the polymer fibers include a non-circular morphology, optionally defining multiple gear-shaped, winged-shaped or lobe-shaped projections along the length of the polymer fibers. A method for forming the fiber-based adsorbents includes irradiating high surface area polymer fibers, grafting with polymerizable reactive monomers, reacting the grafted fibers with hydroxylamine, and conditioning with an alkaline solution. High surface area fiber-based adsorbents formed according to the present method demonstrated a significantly improved uranium adsorption capacity per unit weight over existing adsorbents.
NASA Technical Reports Server (NTRS)
Park, Yeonjoon (Inventor); Kim, Hyun Jung (Inventor); Skuza, Jonathan R. (Inventor); Lee, Kunik (Inventor); Choi, Sang Hyouk (Inventor); King, Glen C. (Inventor)
2017-01-01
An X-ray defraction (XRD) characterization method for sigma=3 twin defects in cubic semiconductor (100) wafers includes a concentration measurement method and a wafer mapping method for any cubic tetrahedral semiconductor wafers including GaAs (100) wafers and Si (100) wafers. The methods use the cubic semiconductor's (004) pole figure in order to detect sigma=3/{111} twin defects. The XRD methods are applicable to any (100) wafers of tetrahedral cubic semiconductors in the diamond structure (Si, Ge, C) and cubic zinc-blend structure (InP, InGaAs, CdTe, ZnSe, and so on) with various growth methods such as Liquid Encapsulated Czochralski (LEC) growth, Molecular Beam Epitaxy (MBE), Organometallic Vapor Phase Epitaxy (OMVPE), Czochralski growth and Metal Organic Chemical Vapor Deposition (MOCVD) growth.
Langholz, Bryan; Thomas, Duncan C.; Stovall, Marilyn; Smith, Susan A.; Boice, John D.; Shore, Roy E.; Bernstein, Leslie; Lynch, Charles F.; Zhang, Xinbo; Bernstein, Jonine L.
2009-01-01
Summary Methods for the analysis of individually matched case-control studies with location-specific radiation dose and tumor location information are described. These include likelihood methods for analyses that just use cases with precise location of tumor information and methods that also include cases with imprecise tumor location information. The theory establishes that each of these likelihood based methods estimates the same radiation rate ratio parameters, within the context of the appropriate model for location and subject level covariate effects. The underlying assumptions are characterized and the potential strengths and limitations of each method are described. The methods are illustrated and compared using the WECARE study of radiation and asynchronous contralateral breast cancer. PMID:18647297
Study report on a double isotope method of calcium absorption
NASA Technical Reports Server (NTRS)
1978-01-01
Some of the pros and cons of three methods to study gastrointestinal calcium absorption are briefly discussed. The methods are: (1) a balance study; (2) a single isotope method; and (3) a double isotope method. A procedure for the double isotope method is also included.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Han, Sang Eon; Hoard, Brittany R.; Han, Sang M.
Provided is a method for fabricating a nanopatterned surface. The method includes forming a mask on a substrate, patterning the substrate to include a plurality of symmetry-breaking surface corrugations, and removing the mask. The mask includes a pattern defined by mask material portions that cover first surface portions of the substrate and a plurality of mask space portions that expose second surface portions of the substrate, wherein the plurality of mask space portions are arranged in a lattice arrangement having a row and column, and the row is not oriented parallel to a [110] direction of the substrate. The patterningmore » the substrate includes anisotropically removing portions of the substrate exposed by the plurality of spaces.« less
Vu, Cung Khac; Nihei, Kurt; Johnson, Paul A; Guyer, Robert; Ten Cate, James A; Le Bas, Pierre-Yves; Larmat, Carene S
2014-12-30
A system and a method for investigating rock formations includes generating, by a first acoustic source, a first acoustic signal comprising a first plurality of pulses, each pulse including a first modulated signal at a central frequency; and generating, by a second acoustic source, a second acoustic signal comprising a second plurality of pulses. A receiver arranged within the borehole receives a detected signal including a signal being generated by a non-linear mixing process from the first-and-second acoustic signal in a non-linear mixing zone within the intersection volume. The method also includes-processing the received signal to extract the signal generated by the non-linear mixing process over noise or over signals generated by a linear interaction process, or both.
Radio frequency power load and associated method
NASA Technical Reports Server (NTRS)
Sims, III, William Herbert (Inventor); Chavers, Donald Gregory (Inventor); Richeson, James J. (Inventor)
2010-01-01
A radio frequency power load and associated method. A radio frequency power load apparatus includes a container and a fluid having an ion source therein, the fluid being contained in the container. Two conductors are immersed in the fluid. A radio frequency transmission system includes a radio frequency transmitter, a radio frequency amplifier connected to the transmitter and a radio frequency power load apparatus connected to the amplifier. The apparatus includes a fluid having an ion source therein, and two conductors immersed in the fluid. A method of dissipating power generated by a radio frequency transmission system includes the steps of: immersing two conductors of a radio frequency power load apparatus in a fluid having an ion source therein; and connecting the apparatus to an amplifier of the transmission system.
Paranthaman, M. Parans; Aytug, Tolga; Christen, David K.
2005-10-18
An article with an improved buffer layer architecture includes a substrate having a textured metal surface, and an electrically conductive lanthanum metal oxide epitaxial buffer layer on the surface of the substrate. The article can also include an epitaxial superconducting layer deposited on the epitaxial buffer layer. An epitaxial capping layer can be placed between the epitaxial buffer layer and the superconducting layer. A method for preparing an epitaxial article includes providing a substrate with a metal surface and depositing on the metal surface a lanthanum metal oxide epitaxial buffer layer. The method can further include depositing a superconducting layer on the epitaxial buffer layer, and depositing an epitaxial capping layer between the epitaxial buffer layer and the superconducting layer.
Paranthaman, M. Parans; Aytug, Tolga; Christen, David K.
2003-09-09
An article with an improved buffer layer architecture includes a substrate having a textured metal surface, and an electrically conductive lanthanum metal oxide epitaxial buffer layer on the surface of the substrate. The article can also include an epitaxial superconducting layer deposited on the epitaxial buffer layer. An epitaxial capping layer can be placed between the epitaxial buffer layer and the superconducting layer. A method for preparing an epitaxial article includes providing a substrate with a metal surface and depositing on the metal surface a lanthanum metal oxide epitaxial buffer layer. The method can further include depositing a superconducting layer on the epitaxial buffer layer, and depositing an epitaxial capping layer between the epitaxial buffer layer and the superconducting layer.
Method and Apparatus for Creating a Topography at a Surface
Adams, David P.; Sinclair, Michael B.; Mayer, Thomas M.; Vasile, Michael J.; Sweatt, William C.
2008-11-11
Methods and apparatus whereby an optical interferometer is utilized to monitor and provide feedback control to an integrated energetic particle column, to create desired topographies, including the depth, shape and/or roughness of features, at a surface of a specimen. Energetic particle columns can direct energetic species including, ions, photons and/or neutral particles to a surface to create features having in-plane dimensions on the order of 1 micron, and a height or depth on the order of 1 nanometer. Energetic processes can include subtractive processes such as sputtering, ablation, focused ion beam milling and, additive processes, such as energetic beam induced chemical vapor deposition. The integration of interferometric methods with processing by energetic species offers the ability to create desired topographies at surfaces, including planar and curved shapes.
Method and apparatus for efficient photodetachment and purification of negative ion beams
Beene, James R [Oak Ridge, TN; Liu, Yuan [Knoxville, TN; Havener, Charles C [Knoxville, TN
2008-02-26
Methods and apparatus are described for efficient photodetachment and purification of negative ion beams. A method of purifying an ion beam includes: inputting the ion beam into a gas-filled multipole ion guide, the ion beam including a plurality of ions; increasing a laser-ion interaction time by collisional cooling the plurality of ions using the gas-filled multipole ion guide, the plurality of ions including at least one contaminant; and suppressing the at least one contaminant by selectively removing the at least one contaminant from the ion beam by electron photodetaching at least a portion of the at least one contaminant using a laser beam.
Method of forming an HTS article
Bhattacharya, Raghu N.; Zhang, Xun; Selvamanickam, Venkat
2014-08-19
A method of forming a superconducting article includes providing a substrate tape, forming a superconducting layer overlying the substrate tape, and depositing a capping layer overlying the superconducting layer. The capping layer includes a noble metal and has a thickness not greater than about 1.0 micron. The method further includes electrodepositing a stabilizer layer overlying the capping layer using a solution that is non-reactive to the superconducting layer. The superconducting layer has an as-formed critical current I.sub.C(AF) and a post-stabilized critical current I.sub.C(PS). The I.sub.C(PS) is at least about 95% of the I.sub.C(AF).
Fuzzy set methods for object recognition in space applications
NASA Technical Reports Server (NTRS)
Keller, James M.
1992-01-01
Progress on the following tasks is reported: feature calculation; membership calculation; clustering methods (including initial experiments on pose estimation); and acquisition of images (including camera calibration information for digitization of model). The report consists of 'stand alone' sections, describing the activities in each task. We would like to highlight the fact that during this quarter, we believe that we have made a major breakthrough in the area of fuzzy clustering. We have discovered a method to remove the probabilistic constraints that the sum of the memberships across all classes must add up to 1 (as in the fuzzy c-means). A paper, describing this approach, is included.
Optical control of multi-stage thin film solar cell production
DOE Office of Scientific and Technical Information (OSTI.GOV)
Li, Jian; Levi, Dean H.; Contreras, Miguel A.
2016-05-17
Embodiments include methods of depositing and controlling the deposition of a film in multiple stages. The disclosed deposition and deposition control methods include the optical monitoring of a deposition matrix to determine a time when at least one transition point occurs. In certain embodiments, the transition point or transition points are a stoichiometry point. Methods may also include controlling the length of time in which material is deposited during a deposition stage or controlling the amount of the first, second or subsequent materials deposited during any deposition stage in response to a determination of the time when a selected transitionmore » point occurs.« less
Reactor and method for production of nanostructures
Sunkara, Mahendra Kumar; Kim, Jeong H.; Kumar, Vivekanand
2017-04-25
A reactor and method for production of nanostructures, including metal oxide nanowires or nanoparticles, are provided. The reactor includes a regulated metal powder delivery system in communication with a dielectric tube; a plasma-forming gas inlet, whereby a plasma-forming gas is delivered substantially longitudinally into the dielectric tube; a sheath gas inlet, whereby a sheath gas is delivered into the dielectric tube; and a microwave energy generator coupled to the dielectric tube, whereby microwave energy is delivered into a plasma-forming gas. The method for producing nanostructures includes providing a reactor to form nanostructures and collecting the formed nanostructures, optionally from a filter located downstream of the dielectric tube.
Systems and Methods for Fabricating Carbon Nanotube-Based Vacuum Electronic Devices
NASA Technical Reports Server (NTRS)
Manohara, Harish (Inventor); Toda, Risaku (Inventor); Del Castillo, Linda Y. (Inventor); Murthy, Rakesh (Inventor)
2015-01-01
Systems and methods in accordance with embodiments of the invention proficiently produce carbon nanotube-based vacuum electronic devices. In one embodiment a method of fabricating a carbon nanotube-based vacuum electronic device includes: growing carbon nanotubes onto a substrate to form a cathode; assembling a stack that includes the cathode, an anode, and a first layer that includes an alignment slot; disposing a microsphere partially into the alignment slot during the assembling of the stack such that the microsphere protrudes from the alignment slot and can thereby separate the first layer from an adjacent layer; and encasing the stack in a vacuum sealed container.
Shaped nanocrystal particles and methods for making the same
Alivisatos, A Paul [Oakland, CA; Scher, Erik C [Menlo Park, CA; Manna, Liberato [Berkeley, CA
2011-11-22
Shaped nanocrystal particles and methods for making shaped nanocrystal particles are disclosed. One embodiment includes a method for forming a branched, nanocrystal particle. It includes (a) forming a core having a first crystal structure in a solution, (b) forming a first arm extending from the core having a second crystal structure in the solution, and (c) forming a second arm extending from the core having the second crystal structure in the solution.
Shaped nanocrystal particles and methods for making the same
Alivisatos, A. Paul; Scher, Erik C; Manna, Liberato
2013-12-17
Shaped nanocrystal particles and methods for making shaped nanocrystal particles are disclosed. One embodiment includes a method for forming a branched, nanocrystal particle. It includes (a) forming a core having a first crystal structure in a solution, (b) forming a first arm extending from the core having a second crystal structure in the solution, and (c) forming a second arm extending from the core having the second crystal structure in the solution.
Methods for creating ligand induced paramagnetism in nanocrystalline structures
Meulenberg, Robert W.; Lee, Jonathan R. I.; Van Buuren, Anthony W.; Terminello, Louis J.
2016-12-13
A method according to one general embodiment includes applying an organic surfactant to a nanoparticle having a d.sup.10 configuration for altering a magnetic property of the nanoparticle. A method according to another general embodiment includes applying an organic surfactant to a II-VI semiconductor nanoparticle having a d.sup.10 configuration for altering a magnetic property of the nanoparticle, wherein the nanoparticle has a mean radius of less than about 50 .ANG..
Improved Density Functional Tight Binding Potentials for Metalloid Aluminum Clusters
2016-06-01
simulations of the oxidation of Al4Cp * 4 show reasonable comparison with a DFT-based Car -Parrinello method, including correct prediction of hydride transfers...comparison with a DFT-based Car -Parrinello method, including correct prediction of hydride transfers from Cp* to the metal centers during the...initio molecular dynamics of the oxidation of Al4Cp * 4 using a DFT-based Car -Parrinello method. This simulation, which 43 several months on the
Shaped nanocrystal particles and methods for working the same
Alivisatos, A. Paul; Sher, Eric C.; Manna, Liberato
2007-12-25
Shaped nanocrystal particles and methods for making shaped nanocrystal particles are disclosed. One embodiment includes a method for forming a branched, nanocrystal particle. It includes (a) forming a core having a first crystal structure in a solution, (b) forming a first arm extending from the core having a second crystal structure in the solution, and (c) forming a second arm extending from the core having the second crystal structure in the solution.
Shaped Nonocrystal Particles And Methods For Making The Same
Alivisatos, A. Paul; Scher, Erik C.; Manna, Liberato
2005-02-15
Shaped nanocrystal particles and methods for making shaped nanocrystal particles are disclosed. One embodiment includes a method for forming a branched, nanocrystal particle. It includes (a) forming a core having a first crystal structure in a solution, (b) forming a first arm extending from the core having a second crystal structure in the solution, and (c) forming a second arm extending from the core having the second crystal structure in the solution.
[Essential characteristics of qualitative research and its commonly used methods].
Zhang, Hong-wei
2008-02-01
The main objectives of qualitative research lies in exploring the opinion, attitude, behavior, and experience of a person as a social role, also a patient. This essay introduces the basic characteristics of qualitative research, including its natural property, inductive method adopted, open character and wholism concept; the results of qualitative research are presented in a text form; and its commonly used methods include observation, individual interview and focus group discussion.
Pressurized Anneal of Consolidated Powders
NASA Technical Reports Server (NTRS)
Nemir, David Charles (Inventor); Rubio, Edward S. (Inventor); Beck, Jan Bastian (Inventor)
2017-01-01
Systems and methods for producing a dense, well bonded solid material from a powder may include consolidating the powder utilizing any suitable consolidation method, such as explosive shockwave consolidation. The systems and methods may also include a post-processing thermal treatment that exploits a mismatch between the coefficients of thermal expansion between the consolidated material and the container. Due to the mismatch in the coefficients, internal pressure on the consolidated material during the heat treatment may be increased.
Method for determining gene knockouts
Maranas, Costas D [Port Matilda, PA; Burgard, Anthony R [State College, PA; Pharkya, Priti [State College, PA
2011-09-27
A method for determining candidates for gene deletions and additions using a model of a metabolic network associated with an organism, the model includes a plurality of metabolic reactions defining metabolite relationships, the method includes selecting a bioengineering objective for the organism, selecting at least one cellular objective, forming an optimization problem that couples the at least one cellular objective with the bioengineering objective, and solving the optimization problem to yield at least one candidate.
Method for determining gene knockouts
Maranas, Costa D; Burgard, Anthony R; Pharkya, Priti
2013-06-04
A method for determining candidates for gene deletions and additions using a model of a metabolic network associated with an organism, the model includes a plurality of metabolic reactions defining metabolite relationships, the method includes selecting a bioengineering objective for the organism, selecting at least one cellular objective, forming an optimization problem that couples the at least one cellular objective with the bioengineering objective, and solving the optimization problem to yield at least one candidate.
Systems, methods, and apparatus of a low conductance silicon micro-leak for mass spectrometer inlet
NASA Technical Reports Server (NTRS)
Harpold, Dan N. (Inventor); Niemann, Hasso B. (Inventor); Jamieson, Brian G. (Inventor); Lynch, Bernard A. (Inventor)
2011-01-01
Systems, methods and apparatus are provided through which in some embodiments a mass spectrometer micro-leak includes a number of channels fabricated by semiconductor processing tools and that includes a number of inlet holes that provide access to the channels.
Systems, Methods, and Apparatus of a Low Conductance Silicon Micro-Leak for Mass Spectrometer Inlet
NASA Technical Reports Server (NTRS)
Harpold, Dan N. (Inventor); Niemann, Hasso B. (Inventor); Jamieson, Brian G. (Inventor); Lynch, Bernard A. (Inventor)
2013-01-01
Systems, methods and apparatus are provided through which in some embodiments a mass spectrometer micro-leak includes a number of channels fabricated by semiconductor processing tools and that includes a number of inlet holes that provide access to the channels.
Gas volume contents within a container, smart volume instrument
NASA Technical Reports Server (NTRS)
Van Buskirk, Paul D. (Inventor); Kelley, Anthony R. (Inventor)
2008-01-01
A method for determining the volume of an incompressible gas in a system including incompressible substances in a zero-gravity environment. The method includes inducing a volumetric displacement within a container and measuring the resulting pressure change. From this data, the liquid level can be determined.
78 FR 75568 - Agency Forms Undergoing Paperwork Reduction Act Review
Federal Register 2010, 2011, 2012, 2013, 2014
2013-12-12
... audiences for this research: First responders, including police, fire fighters and emergency medical service... obtain data using two qualitative data collection methods. The first method includes focus groups to... Review Office, Office of Scientific Integrity, Office of the Associate Director for Science, Office of...
Al-Kasmi, Basheer; Alsirawan, Mhd Bashir; Bashimam, Mais; El-Zein, Hind
2017-08-28
Drug taste masking is a crucial process for the preparation of pediatric and geriatric formulations as well as fast dissolving tablets. Taste masking techniques aim to prevent drug release in saliva and at the same time to obtain the desired release profile in gastrointestinal tract. Several taste masking methods are reported, however this review has focused on a group of promising methods; complexation, encapsulation, and hot melting. The effects of each method on the physicochemical properties of the drug are described in details. Furthermore, a scoring system was established to evaluate each process using recent published data of selected factors. These include, input, process, and output factors that are related to each taste masking method. Input factors include the attributes of the materials used for taste masking. Process factors include equipment type and process parameters. Finally, output factors, include taste masking quality and yield. As a result, Mechanical microencapsulation obtained the highest score (5/8) along with complexation with cyclodextrin suggesting that these methods are the most preferable for drug taste masking. Copyright © 2017 Elsevier B.V. All rights reserved.
Method for using global optimization to the estimation of surface-consistent residual statics
Reister, David B.; Barhen, Jacob; Oblow, Edward M.
2001-01-01
An efficient method for generating residual statics corrections to compensate for surface-consistent static time shifts in stacked seismic traces. The method includes a step of framing the residual static corrections as a global optimization problem in a parameter space. The method also includes decoupling the global optimization problem involving all seismic traces into several one-dimensional problems. The method further utilizes a Stochastic Pijavskij Tunneling search to eliminate regions in the parameter space where a global minimum is unlikely to exist so that the global minimum may be quickly discovered. The method finds the residual statics corrections by maximizing the total stack power. The stack power is a measure of seismic energy transferred from energy sources to receivers.
Fishman, M. J.
1993-01-01
Methods to be used to analyze samples of water, suspended sediment and bottom material for their content of inorganic and organic constituents are presented. Technology continually changes, and so this laboratory manual includes new and revised methods for determining the concentration of dissolved constituents in water, whole water recoverable constituents in water-suspended sediment samples, and recoverable concentration of constit- uents in bottom material. For each method, the general topics covered are the application, the principle of the method, interferences, the apparatus and reagents required, a detailed description of the analytical procedure, reporting results, units and significant figures, and analytical precision data. Included in this manual are 30 methods.
Determination of the transmission coefficients for quantum structures using FDTD method.
Peng, Yangyang; Wang, Xiaoying; Sui, Wenquan
2011-12-01
The purpose of this work is to develop a simple method to incorporate quantum effect in traditional finite-difference time-domain (FDTD) simulators. Witch could make it possible to co-simulate systems include quantum structures and traditional components. In this paper, tunneling transmission coefficient is calculated by solving time-domain Schrödinger equation with a developed FDTD technique, called FDTD-S method. To validate the feasibility of the method, a simple resonant tunneling diode (RTD) structure model has been simulated using the proposed method. The good agreement between the numerical and analytical results proves its accuracy. The effectness and accuracy of this approach makes it a potential method for analysis and design of hybrid systems includes quantum structures and traditional components.
Methods and apparatus for radially compliant component mounting
Bulman, David Edward [Cincinnati, OH; Darkins, Jr., Toby George; Stumpf, James Anthony [Columbus, IN; Schroder, Mark S [Greenville, SC; Lipinski, John Joseph [Simpsonville, SC
2012-03-27
Methods and apparatus for a mounting assembly for a liner of a gas turbine engine combustor are provided. The combustor includes a combustor liner and a radially outer annular flow sleeve. The mounting assembly includes an inner ring surrounding a radially outer surface of the liner and including a plurality of axially extending fingers. The mounting assembly also includes a radially outer ring coupled to the inner ring through a plurality of spacers that extend radially from a radially outer surface of the inner ring to the outer ring.
Fabrication of high thermal conductivity arrays of carbon nanotubes and their composites
Geohegan, David B [Knoxville, TN; Ivanov, Ilya N [Knoxville, TN; Puretzky, Alexander A [Knoxville, TN
2010-07-27
Methods and apparatus are described for fabrication of high thermal conductivity arrays of carbon nanotubes and their composites. A composition includes a vertically aligned nanotube array including a plurality of nanotubes characterized by a property across substantially all of the vertically aligned nanotube array. A method includes depositing a vertically aligned nanotube array that includes a plurality of nanotubes; and controlling a deposition rate of the vertically aligned nanotubes array as a function of an in situ monitored property of the plurality of nanotubes.
Dirk, Shawn M.; Cicotte, Kirsten Nicole; Wheeler, David R.; Benko, David A.
2015-08-11
A method including reducing a particle size of lignin particles to an average particle size less than 40 nanometers; after reducing the particle size, combining the lignin particles with a polymeric material; and forming a structure of the combination. A method including exposing lignin to a diazonium precursor including a functional group; modifying the lignin by introducing the functional group to the lignin; and combining the modified lignin with a polymeric material to form a composite. An apparatus including a composite of a polymer and lignin wherein the lignin has an average particle size less than 100 micrometers.
Methods for producing single crystal mixed halide perovskites
Zhu, Kai; Zhao, Yixin
2017-07-11
An aspect of the present invention is a method that includes contacting a metal halide and a first alkylammonium halide in a solvent to form a solution and maintaining the solution at a first temperature, resulting in the formation of at least one alkylammonium halide perovskite crystal, where the metal halide includes a first halogen and a metal, the first alkylammonium halide includes the first halogen, the at least one alkylammonium halide perovskite crystal includes the metal and the first halogen, and the first temperature is above about 21.degree. C.
Smoking education programs 1960-1976.
Thompson, E L
1978-01-01
This paper is a review of published reports, in English, of educational programs designed to change smoking behavior. Attempts to change the smoking behavior of young people have included anti-smoking campaigns, youth-to-youth programs, and a variety of message themes and teaching methods. Instruction has been presented both by teachers who were committed or persuasive and by teachers who were neutral or presented both sides of the issue. Didactic teaching, group discussion, individual study, peer instruction, and mass media have been employed. Health effects of smoking, both short- and long-term effects, have been emphasized. Most methods used with youth have shown little success. Studies of other methods have produced contradictory results. Educational programs for adults have included large scale anti-smoking campaigns, smoking cessation clinics, and a variety of more specific withdrawal methods. These methods have included individual counseling, emotional role playing, aversive conditioning, desensitization, and specific techniques to reduce the likelihood that smoking will occur in situations previously associated with smoking. Some of these techniques have produced poor results while studies of other methods have shown inconsistent results. The two methods showing the most promise are individual counseling and smoking withdrawal clinics. PMID:25026
Andrusyszyn, M A; Cragg, C E; Humbert, J
2001-04-01
The relationships among multiple distance delivery methods, preferred learning style, content, and achievement was sought for primary care nurse practitioner students. A researcher-designed questionnaire was completed by 86 (71%) participants, while 6 engaged in follow-up interviews. The results of the study included: participants preferred learning by "considering the big picture"; "setting own learning plans"; and "focusing on concrete examples." Several positive associations were found: learning on own with learning by reading, and setting own learning plans; small group with learning through discussion; large group with learning new things through hearing and with having learning plans set by others. The most preferred method was print-based material and the least preferred method was audio tape. The most suited method for content included video teleconferencing for counseling, political action, and transcultural issues; and video tape for physical assessment. Convenience, self-direction, and timing of learning were more important than delivery method or learning style. Preferred order of learning was reading, discussing, observing, doing, and reflecting. Recommended considerations when designing distance courses include a mix of delivery methods, specific content, outcomes, learner characteristics, and state of technology.
Smoking education programs 1960-1976.
Thompson, E L
1978-03-01
This paper is a review of published reports, in English, of educational programs designed to change smoking behavior. Attempts to change the smoking behavior of young people have included anti-smoking campaigns, youth-to-youth programs, and a variety of message themes and teaching methods. Instruction has been presented both by teachers who were committed or persuasive and by teachers who were neutral or presented both sides of the issue. Didactic teaching, group discussion, individual study, peer instruction, and mass media have been employed. Health effects of smoking, both short- and long-term effects, have been emphasized. Most methods used with youth have shown little success. Studies of other methods have produced contradictory results. Educational programs for adults have included large scale anti-smoking campaigns, smoking cessation clinics, and a variety of more specific withdrawal methods. These methods have included individual counseling, emotional role playing, aversive conditioning, desensitization, and specific techniques to reduce the likelihood that smoking will occur in situations previously associated with smoking. Some of these techniques have produced poor results while studies of other methods have shown inconsistent results. The two methods showing the most promise are individual counseling and smoking withdrawal clinics.
Mueller, Katharina Felicitas; Meerpohl, Joerg J; Briel, Matthias; Antes, Gerd; von Elm, Erik; Lang, Britta; Motschall, Edith; Schwarzer, Guido; Bassler, Dirk
2016-12-01
To systematically review methodological articles which focus on nonpublication of studies and to describe methods of detecting and/or quantifying and/or adjusting for dissemination in meta-analyses. To evaluate whether the methods have been applied to an empirical data set for which one can be reasonably confident that all studies conducted have been included. We systematically searched Medline, the Cochrane Library, and Web of Science, for methodological articles that describe at least one method of detecting and/or quantifying and/or adjusting for dissemination bias in meta-analyses. The literature search retrieved 2,224 records, of which we finally included 150 full-text articles. A great variety of methods to detect, quantify, or adjust for dissemination bias were described. Methods included graphical methods mainly based on funnel plot approaches, statistical methods, such as regression tests, selection models, sensitivity analyses, and a great number of more recent statistical approaches. Only few methods have been validated in empirical evaluations using unpublished studies obtained from regulators (Food and Drug Administration, European Medicines Agency). We present an overview of existing methods to detect, quantify, or adjust for dissemination bias. It remains difficult to advise which method should be used as they are all limited and their validity has rarely been assessed. Therefore, a thorough literature search remains crucial in systematic reviews, and further steps to increase the availability of all research results need to be taken. Copyright © 2016 Elsevier Inc. All rights reserved.
Documentation of spreadsheets for the analysis of aquifer-test and slug-test data
Halford, Keith J.; Kuniansky, Eve L.
2002-01-01
Several spreadsheets have been developed for the analysis of aquifer-test and slug-test data. Each spreadsheet incorporates analytical solution(s) of the partial differential equation for ground-water flow to a well for a specific type of condition or aquifer. The derivations of the analytical solutions were previously published. Thus, this report abbreviates the theoretical discussion, but includes practical information about each method and the important assumptions for the applications of each method. These spreadsheets were written in Microsoft Excel 9.0 (use of trade names does not constitute endorsement by the USGS). Storage properties should not be estimated with many of the spreadsheets because most are for analyzing single-well tests. Estimation of storage properties from single-well tests is generally discouraged because single-well tests are affected by wellbore storage and by well construction. These non-ideal effects frequently cause estimates of storage to be erroneous by orders of magnitude. Additionally, single-well tests are not sensitive to aquifer-storage properties. Single-well tests include all slug tests (Bouwer and Rice Method, Cooper, Bredehoeft, Papadopulos Method, and van der Kamp Method), the Cooper-Jacob straight-line Method, Theis recovery-data analysis, Jacob-Lohman method for flowing wells in a confined aquifer, and the step-drawdown test. Multi-well test spreadsheets included in this report are; Hantush-Jacob Leaky Aquifer Method and Distance-Drawdown Methods. The distance-drawdown method is an equilibrium or steady-state method, thus storage cannot be estimated.
Cheng, Ji; Pullenayegum, Eleanor; Marshall, John K; Thabane, Lehana
2016-01-01
Objectives There is no consensus on whether studies with no observed events in the treatment and control arms, the so-called both-armed zero-event studies, should be included in a meta-analysis of randomised controlled trials (RCTs). Current analytic approaches handled them differently depending on the choice of effect measures and authors' discretion. Our objective is to evaluate the impact of including or excluding both-armed zero-event (BA0E) studies in meta-analysis of RCTs with rare outcome events through a simulation study. Method We simulated 2500 data sets for different scenarios varying the parameters of baseline event rate, treatment effect and number of patients in each trial, and between-study variance. We evaluated the performance of commonly used pooling methods in classical meta-analysis—namely, Peto, Mantel-Haenszel with fixed-effects and random-effects models, and inverse variance method with fixed-effects and random-effects models—using bias, root mean square error, length of 95% CI and coverage. Results The overall performance of the approaches of including or excluding BA0E studies in meta-analysis varied according to the magnitude of true treatment effect. Including BA0E studies introduced very little bias, decreased mean square error, narrowed the 95% CI and increased the coverage when no true treatment effect existed. However, when a true treatment effect existed, the estimates from the approach of excluding BA0E studies led to smaller bias than including them. Among all evaluated methods, the Peto method excluding BA0E studies gave the least biased results when a true treatment effect existed. Conclusions We recommend including BA0E studies when treatment effects are unlikely, but excluding them when there is a decisive treatment effect. Providing results of including and excluding BA0E studies to assess the robustness of the pooled estimated effect is a sensible way to communicate the results of a meta-analysis when the treatment effects are unclear. PMID:27531725
Recruiting Adolescent Research Participants: In-Person Compared to Social Media Approaches.
Moreno, Megan A; Waite, Alan; Pumper, Megan; Colburn, Trina; Holm, Matt; Mendoza, Jason
2017-01-01
Recruiting adolescent participants for research is challenging. The purpose of this study was to compare traditional in-person recruitment methods to social media recruitment. We recruited adolescents aged 14-18 years for a pilot physical activity intervention study, including a wearable physical activity tracking device and a Facebook group. Participants were recruited (a) in person from a local high school and an adolescent medicine clinic and (b) through social media, including Facebook targeted ads, sponsored tweets on Twitter, and a blog post. Data collected included total exposure (i.e., reach), engagement (i.e., interaction), and effectiveness. Effectiveness included screening and enrollment for each recruitment method, as well as time and resources spent on each recruitment method. In-person recruitment reached a total of 297 potential participants of which 37 enrolled in the study. Social media recruitment reached a total of 34,272 potential participants of which 8 enrolled in the study. Social media recruitment methods utilized an average of 1.6 hours of staff time and cost an average of $40.99 per participant enrolled, while in-person recruitment methods utilized an average of 0.75 hours of staff time and cost an average of $19.09 per participant enrolled. Social media recruitment reached more potential participants, but the cost per participant enrolled was higher compared to traditional methods. Studies need to consider benefits and downsides of traditional and social media recruitment methods based on study goals and population.
Comparison of some optimal control methods for the design of turbine blades
NASA Technical Reports Server (NTRS)
Desilva, B. M. E.; Grant, G. N. C.
1977-01-01
This paper attempts a comparative study of some numerical methods for the optimal control design of turbine blades whose vibration characteristics are approximated by Timoshenko beam idealizations with shear and incorporating simple boundary conditions. The blade was synthesized using the following methods: (1) conjugate gradient minimization of the system Hamiltonian in function space incorporating penalty function transformations, (2) projection operator methods in a function space which includes the frequencies of vibration and the control function, (3) epsilon-technique penalty function transformation resulting in a highly nonlinear programming problem, (4) finite difference discretization of the state equations again resulting in a nonlinear program, (5) second variation methods with complex state differential equations to include damping effects resulting in systems of inhomogeneous matrix Riccatti equations some of which are stiff, (6) quasi-linear methods based on iterative linearization of the state and adjoint equation. The paper includes a discussion of some substantial computational difficulties encountered in the implementation of these techniques together with a resume of work presently in progress using a differential dynamic programming approach.
Learning spinal manipulation: A best-evidence synthesis of teaching methods*
Stainsby, Brynne E.; Clarke, Michelle C.S.; Egonia, Jade R.
2016-01-01
Objective: The purpose of this study was to evaluate the effectiveness of different reported methods used to teach spinal manipulative therapy to chiropractic students. Methods: For this best-evidence literature synthesis, 5 electronic databases were searched from 1900 to 2015. Eligible studies were critically appraised using the criteria of the Scottish Intercollegiate Guidelines Network. Scientifically admissible studies were synthesized following best-evidence synthesis principles. Results: Twenty articles were critically appraised, including 9 randomized clinical trials, 9 cohort studies, and 2 systematic reviews/meta-analyses. Eleven articles were accepted as scientifically admissible. The type of teaching method aids included a Thrust in Motion cervical manikin, instrumented cardiopulmonary reanimation manikin, padded contact with a load cell, instrumented treatment table with force sensor/transducer, and Dynadjust instrument. Conclusions: Several different methods exist in the literature for teaching spinal manipulative therapy techniques; however, future research in this developing area of chiropractic education is proposed. It is suggested that various teaching methods be included in the regular curricula of chiropractic colleges to aid in developing manipulation skills, efficiency, and knowledge of performance. PMID:26998630
Constrained CVT meshes and a comparison of triangular mesh generators
DOE Office of Scientific and Technical Information (OSTI.GOV)
Nguyen, Hoa; Burkardt, John; Gunzburger, Max
2009-01-01
Mesh generation in regions in Euclidean space is a central task in computational science, and especially for commonly used numerical methods for the solution of partial differential equations, e.g., finite element and finite volume methods. We focus on the uniform Delaunay triangulation of planar regions and, in particular, on how one selects the positions of the vertices of the triangulation. We discuss a recently developed method, based on the centroidal Voronoi tessellation (CVT) concept, for effecting such triangulations and present two algorithms, including one new one, for CVT-based grid generation. We also compare several methods, including CVT-based methods, for triangulatingmore » planar domains. To this end, we define several quantitative measures of the quality of uniform grids. We then generate triangulations of several planar regions, including some having complexities that are representative of what one may encounter in practice. We subject the resulting grids to visual and quantitative comparisons and conclude that all the methods considered produce high-quality uniform grids and that the CVT-based grids are at least as good as any of the others.« less
System and method for producing substitute natural gas from coal
Hobbs, Raymond [Avondale, AZ
2012-08-07
The present invention provides a system and method for producing substitute natural gas and electricity, while mitigating production of any greenhouse gasses. The system includes a hydrogasification reactor, to form a gas stream including natural gas and a char stream, and an oxygen burner to combust the char material to form carbon oxides. The system also includes an algae farm to convert the carbon oxides to hydrocarbon material and oxygen.
Methods of decontaminating surfaces and related compositions
Demmer, Ricky L.; Crosby, Daniel; Norton, Christopher J.
2016-11-22
A composition of matter includes water, at least one acid, at least one surfactant, at least one fluoride salt, and ammonium nitrate. A method of decontaminating a surface includes exposing a surface to such a composition and removing the composition from the surface. Other compositions of matter include water, a fatty alcohol ether sulfate, nitrilotriacetic acid, at least one of hydrochloric acid and nitric acid, sodium fluoride, potassium fluoride, ammonium nitrate, and gelatin.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Habermehl, Scott D.
Described methods are useful for depositing a silicon carbide film including Alpha-SiC at low temperatures (e.g., below about 1400.degree. C.), and resulting multi-layer structures and devices. A method includes introducing a chlorinated hydrocarbon gas and a chlorosilicon gas into a reaction chamber, and reacting the chlorinated hydrocarbon gas with the chlorosilicon gas at a temperature of less than about 1400.degree. C. to grow the silicon carbide film. The silicon carbide film so-formed includes Alpha-SiC.
NASA Technical Reports Server (NTRS)
Huston, R. J. (Compiler)
1982-01-01
The establishment of a realistic plan for NASA and the U.S. helicopter industry to develop a design-for-noise methodology, including plans for the identification and development of promising noise reduction technology was discussed. Topics included: noise reduction techniques, scaling laws, empirical noise prediction, psychoacoustics, and methods of developing and validing noise prediction methods.
40 CFR Appendix D to Part 300 - Appropriate Actions and Methods of Remedying Releases
Code of Federal Regulations, 2013 CFR
2013-07-01
...) Neutralization. (D) Equalization. (E) Chemical oxidation. (iii) Physical methods, including the following: (A... treatment. (F) Wet air oxidation. (G) Solidification. (H) Encapsulation. (I) Soil washing or flushing. (J... containment. (iv) Leachate control, including the following: (A) Subsurface drains. (B) Drainage ditches. (C...
40 CFR Appendix D to Part 300 - Appropriate Actions and Methods of Remedying Releases
Code of Federal Regulations, 2014 CFR
2014-07-01
...) Neutralization. (D) Equalization. (E) Chemical oxidation. (iii) Physical methods, including the following: (A... treatment. (F) Wet air oxidation. (G) Solidification. (H) Encapsulation. (I) Soil washing or flushing. (J... containment. (iv) Leachate control, including the following: (A) Subsurface drains. (B) Drainage ditches. (C...
40 CFR Appendix D to Part 300 - Appropriate Actions and Methods of Remedying Releases
Code of Federal Regulations, 2012 CFR
2012-07-01
...) Neutralization. (D) Equalization. (E) Chemical oxidation. (iii) Physical methods, including the following: (A... treatment. (F) Wet air oxidation. (G) Solidification. (H) Encapsulation. (I) Soil washing or flushing. (J... containment. (iv) Leachate control, including the following: (A) Subsurface drains. (B) Drainage ditches. (C...
40 CFR 63.93 - Approval of State requirements that substitute for a section 112 rule.
Code of Federal Regulations, 2011 CFR
2011-07-01
..., board and administrative orders, permits issued pursuant to permit templates, or State operating permits... respective Federal rule; (2) Levels of control (including associated performance test methods) and compliance... must include monitoring or another method for determining compliance. (ii) If a standard in the...
Method of producing purified carotenoid compounds
NASA Technical Reports Server (NTRS)
Eggink, Laura (Inventor)
2007-01-01
A method of producing a carotenoid in solid form includes culturing a strain of Chlorophyta algae cells in a minimal inorganic medium and separating the algae comprising a solid form of carotenoid. In one embodiment f the invention, the strain of Chlorophyta algae cells includes a strain f Chlamydomonas algae cells.
Arizona Indian Demographic Data: Needs and Recommendations.
ERIC Educational Resources Information Center
Taylor, Benjamin J.; Helmkamp, John
Included in this report on Arizona Indian demographic data are "an evaluation of several recent studies of Indian populations" and "an extensive analysis of methods for obtaining and maintaining accurate data in the future." Recommended methods by which accurate population data for the smaller reservations should be maintained are included in the…
Exhaust system having a gold-platinum group metal catalyst
Ragle, Christie Susan [Havana, IL; Silver, Ronald G [Peoria, IL; Zemskova, Svetlana Mikhailovna [Edelstein, IL; Eckstein, Colleen J [Metamora, IL
2011-12-06
A method of providing an exhaust treatment device is disclosed. The method includes applying a catalyst including gold and a platinum group metal to a particulate filter. The concentration of the gold and the platinum group metal is sufficient to enable oxidation of carbon monoxide and nitric oxide.
Exhaust system having a gold-platinum group metal catalyst
Ragle, Christie Susan; Silver, Ronald G.; Zemskova, Svetlana Mikhailovna; Eckstein, Colleen J.
2012-08-07
A method of providing an exhaust treatment device is disclosed. The method includes applying a catalyst including gold and a platinum group metal to a particulate filter. The concentration of the gold and the platinum group metal is sufficient to enable oxidation of carbon monoxide and nitric oxide.
78 FR 44563 - Proposed Data Collections Submitted for Public Comment and Recommendations
Federal Register 2010, 2011, 2012, 2013, 2014
2013-07-24
... audiences for this research: First responders, including police, fire fighters and emergency medical service... obtain data using two qualitative data collection methods. The first method includes focus groups to... Director for Science, Office of the Director, Centers for Disease Control and Prevention. [FR Doc. 2013...
Nature Study Tips: Native American Foods.
ERIC Educational Resources Information Center
Russell, Helen Ross
1984-01-01
Discusses Native American foods, focusing on Native American cultivated crops, methods of cooking, and methods of preserving food. Includes suggestions for 19 classroom activities, including collecting wild plants used as food, gathering/drying and eating various wild plants and plant products (such as acorns and corn), and making a garden. (JN)
A Survey of Model Evaluation Approaches with a Tutorial on Hierarchical Bayesian Methods
ERIC Educational Resources Information Center
Shiffrin, Richard M.; Lee, Michael D.; Kim, Woojae; Wagenmakers, Eric-Jan
2008-01-01
This article reviews current methods for evaluating models in the cognitive sciences, including theoretically based approaches, such as Bayes factors and minimum description length measures; simulation approaches, including model mimicry evaluations; and practical approaches, such as validation and generalization measures. This article argues…
Nanotextured Surfaces and Related Methods, Systems, and Uses
NASA Technical Reports Server (NTRS)
Greer, Harold F. (Inventor); Greer, Julia R. (Inventor)
2014-01-01
A method of controlling wetting characteristics is described. Such method includes forming and configuring nanostructures on a surface where controlling of the wetting characteristics is desired. Surfaces and methods of fabricating such surfaces are also described.
Getter materials for cracking ammonia
Boffito, Claudio; Baker, John D.
1999-11-02
A method is provided for cracking ammonia to produce hydrogen. The method includes the steps of passing ammonia over an ammonia-cracking catalyst which is an alloy including (1) alloys having the general formula Zr.sub.1-x Ti.sub.x M.sub.1 M.sub.2, wherein M.sub.1 and M.sub.2 are selected independently from the group consisting of Cr, Mn, Fe, Co, and Ni, and x is between about 0.0 and about 1.0 inclusive; and between about 20% and about 50% Al by weight. In another aspect, the method of the invention is used to provide methods for operating hydrogen-fueled internal combustion engines and hydrogen fuel cells. In still another aspect, the present invention provides a hydrogen-fueled internal combustion engine and a hydrogen fuel cell including the above-described ammonia-cracking catalyst.
Apparatus and method for routing a transmission line through a downhole tool
Hall, David R.; Hall, Jr., H. Tracy; Pixton, David S.; Briscoe, Michael; Reynolds, Jay
2006-07-04
A method for routing a transmission line through a tool joint having a primary and secondary shoulder, a central bore, and a longitudinal axis, includes drilling a straight channel, at a positive, nominal angle with respect to the longitudinal axis, through the tool joint from the secondary shoulder to a point proximate the inside wall of the centtral bore. The method further includes milling back, from within the central bore, a second channel to merge with the straight channel, thereby forming a continuous channel from the secondary shoulder to the central bore. In selected embodiments, drilling is accomplished by gun-drilling the straight channel. In other embodiments, the method includes tilting the tool joint before drilling to produce the positive, nominal angle. In selected embodiments, the positive, nominal angle is less than or equal to 15 degrees.
Diagnostic for two-mode variable valve activation device
Fedewa, Andrew M
2014-01-07
A method is provided for diagnosing a multi-mode valve train device which selectively provides high lift and low lift to a combustion valve of an internal combustion engine having a camshaft phaser actuated by an electric motor. The method includes applying a variable electric current to the electric motor to achieve a desired camshaft phaser operational mode and commanding the multi-mode valve train device to a desired valve train device operational mode selected from a high lift mode and a low lift mode. The method also includes monitoring the variable electric current and calculating a first characteristic of the parameter. The method also includes comparing the calculated first characteristic against a predetermined value of the first characteristic measured when the multi-mode valve train device is known to be in the desired valve train device operational mode.
Method of operating a thermoelectric generator
Reynolds, Michael G; Cowgill, Joshua D
2013-11-05
A method for operating a thermoelectric generator supplying a variable-load component includes commanding the variable-load component to operate at a first output and determining a first load current and a first load voltage to the variable-load component while operating at the commanded first output. The method also includes commanding the variable-load component to operate at a second output and determining a second load current and a second load voltage to the variable-load component while operating at the commanded second output. The method includes calculating a maximum power output of the thermoelectric generator from the determined first load current and voltage and the determined second load current and voltage, and commanding the variable-load component to operate at a third output. The commanded third output is configured to draw the calculated maximum power output from the thermoelectric generator.
Ion exchange materials, method of forming ion exchange materials, and methods of treating liquids
Wertsching, Alan K.; Peterson, Eric S.; Wey, John E.
2007-12-25
The invention includes an ion affinity material having an organic component which is sulfonated and which is chemically bonded to an inorganic substrate component. The invention includes a method of forming a metal binding material. A solid support material comprising surface oxide groups is provided and an organic component having at least one alkyl halide is covalently linked to at least some of the surface oxide groups to form a modified support material. The at least one alkyl halide is subsequently converted into an alkyl sulfonate. The invention further includes a method and system for extracting ions from a liquid. An ion exchange material having a sulfonated alkyl silane component covalently bonded to a metal oxide support material is provided and a liquid is exposed to the ion exchange material.
A discussion on the origin of quantum probabilities
DOE Office of Scientific and Technical Information (OSTI.GOV)
Holik, Federico, E-mail: olentiev2@gmail.com; Departamento de Matemática - Ciclo Básico Común, Universidad de Buenos Aires - Pabellón III, Ciudad Universitaria, Buenos Aires; Sáenz, Manuel
We study the origin of quantum probabilities as arising from non-Boolean propositional-operational structures. We apply the method developed by Cox to non distributive lattices and develop an alternative formulation of non-Kolmogorovian probability measures for quantum mechanics. By generalizing the method presented in previous works, we outline a general framework for the deduction of probabilities in general propositional structures represented by lattices (including the non-distributive case). -- Highlights: •Several recent works use a derivation similar to that of R.T. Cox to obtain quantum probabilities. •We apply Cox’s method to the lattice of subspaces of the Hilbert space. •We obtain a derivationmore » of quantum probabilities which includes mixed states. •The method presented in this work is susceptible to generalization. •It includes quantum mechanics and classical mechanics as particular cases.« less
Halogenated solvent remediation
Sorenson, Kent S.
2004-08-31
Methods for enhancing bioremediation of ground water contaminated with nonaqueous halogenated solvents are disclosed. A preferred method includes adding a composition to the ground water wherein the composition is an electron donor for microbe-mediated reductive dehalogenation of the halogenated solvents and enhances mass transfer of the halogenated solvents from residual source areas into the aqueous phase of the ground water. Illustrative compositions effective in these methods include surfactants such as C.sub.2 -C.sub.4 carboxylic acids and hydroxy acids, salts thereof, esters of C.sub.2 -C.sub.4 carboxylic acids and hydroxy acids, and mixtures thereof. Especially preferred compositions for use in these methods include lactic acid, salts of lactic acid, such as sodium lactate, lactate esters, and mixtures thereof. The microbes are either indigenous to the ground water, or such microbes can be added to the ground water in addition to the composition.
Finite difference and Runge-Kutta methods for solving vibration problems
NASA Astrophysics Data System (ADS)
Lintang Renganis Radityani, Scolastika; Mungkasi, Sudi
2017-11-01
The vibration of a storey building can be modelled into a system of second order ordinary differential equations. If the number of floors of a building is large, then the result is a large scale system of second order ordinary differential equations. The large scale system is difficult to solve, and if it can be solved, the solution may not be accurate. Therefore, in this paper, we seek for accurate methods for solving vibration problems. We compare the performance of numerical finite difference and Runge-Kutta methods for solving large scale systems of second order ordinary differential equations. The finite difference methods include the forward and central differences. The Runge-Kutta methods include the Euler and Heun methods. Our research results show that the central finite difference and the Heun methods produce more accurate solutions than the forward finite difference and the Euler methods do.
System and method for controlling a combustor assembly
York, William David; Ziminsky, Willy Steve; Johnson, Thomas Edward; Stevenson, Christian Xavier
2013-03-05
A system and method for controlling a combustor assembly are disclosed. The system includes a combustor assembly. The combustor assembly includes a combustor and a fuel nozzle assembly. The combustor includes a casing. The fuel nozzle assembly is positioned at least partially within the casing and includes a fuel nozzle. The fuel nozzle assembly further defines a head end. The system further includes a viewing device configured for capturing an image of at least a portion of the head end, and a processor communicatively coupled to the viewing device, the processor configured to compare the image to a standard image for the head end.
Methods and compositions using calcium carbonate
Constantz, Brent R [Portola Valley, CA; Farsad, Kasra [San Jose, CA; Camire, Chris [San Jose, CA; Patterson, Joshua [Freedom, CA; Ginder-Vogel, Matthew [Los Gatos, CA; Yaccato, Karin [San Jose, CA; Stagnaro, John [Santa Clara, CA; Devenney, Martin [Mountain View, CA; Ries, Justin [Chapel Hill, NC
2012-03-20
Provided herein are compositions and methods including hydraulic cement, supplementary cementitious material, and/or self-cementing material. Methods for making the compositions and using the compositions are provided.
Methods and compositions using calcium carbonate
Constantz, Brent R [Portola Valley, CA; Farsad, Kasra [San Jose, CA; Camire, Chris [San Jose, CA; Patterson, Joshua [Freedom, CA; Fernandez, Miguel [San Jose, CA; Yaccato, Karin [San Jose, CA; Thatcher, Ryan [Sunnyvale, CA; Stagnaro, John [Santa Clara, CA; Chen, Irvin [Santa Clara, CA; Omelon, Sidney [Willowdale, CA; Hodson, Keith [Palo Alto, CA; Clodic, Laurence [Sunnyvale, CA; Geramita, Katharine [Seattle, CA; Holland, Terence C [Auburn Township, OH; Ries, Justin [Chapel Hill, NC
2012-02-14
Provided herein are compositions and methods including hydraulic cement, supplementary cementitious material, and/or self-cementing material. Methods for making the compositions and using the compositions are provided.
Laboratories measuring target chemical, radiochemical, pathogens, and biotoxin analytes in environmental samples can use this online query tool to identify analytical methods included in EPA's Selected Analytical Methods for Environmental Remediation
Methods and compositions using calcium carbonate
Constantz, Brent R [Portola Valley, CA; Farsad, Kasra [San Jose, CA; Camire, Chris [San Jose, CA; Chen, Irvin [San Jose, CA
2011-04-12
Provided herein are compositions and methods including hydraulic cement, supplementary cementitious material, and/or self-cementing material. Methods for making the compositions and using the compositions are provided.
Methods and compositions using calcium carbonate
Constantz, Brent R [Portola Valley, CA; Farsad, Kasra [San Jose, CA; Camire, Chris [San Jose, CA; Chen, Irvin [Santa Clara, CA; Ginder-Vogel, Matthew [Los Gatos, CA; Fernandez, Miguel [San Jose, CA
2012-05-15
Provided herein are compositions and methods including hydraulic cement, supplementary cementitious material, and/or self-cementing material. Methods for making the compositions and using the compositions are provided.
Methods and compositions using calcium carbonate
Constantz, Brent R [Portola Valley, CA; Farsad, Kasra [San Jose, CA; Camire, Chris [San Jose, CA; Patterson, Joshua [Freedom, CA; Ginder-Vogel, Matthew [Los Gatos, CA; Yaccato, Karin [San Jose, CA; Stagnaro, John [Santa Clara, CA; Devenney, Martin [Mountain View, CA; Ries, Justin [Chapel Hill, NC
2011-11-22
Provided herein are compositions and methods including hydraulic cement, supplementary cementitious material, and/or self-cementing material. Methods for making the compositions and using the compositions are provided.
Methods and compositions using calcium carbonate
Chen, Irvin; Fernandez, Miguel; Patterson, Joshua; Devenney, Martin
2015-01-13
Provided herein are compositions and methods including hydraulic cement, supplementary cementitious material, and/or self-cementing material. Methods for making the compositions and using the compositions are provided.
Methods and compositions using calcium carbonate
Chen, Irvin; Fernandez, Miguel; Patterson, Joshua; Devenney, Martin
2015-06-16
Provided herein are compositions and methods including hydraulic cement, supplementary cementitious material, and/or self-cementing material. Methods for making the compositions and using the compositions are provided.
Learning spinal manipulation: A best-evidence synthesis of teaching methods.
Stainsby, Brynne E; Clarke, Michelle C S; Egonia, Jade R
2016-10-01
The purpose of this study was to evaluate the effectiveness of different reported methods used to teach spinal manipulative therapy to chiropractic students. For this best-evidence literature synthesis, 5 electronic databases were searched from 1900 to 2015. Eligible studies were critically appraised using the criteria of the Scottish Intercollegiate Guidelines Network. Scientifically admissible studies were synthesized following best-evidence synthesis principles. Twenty articles were critically appraised, including 9 randomized clinical trials, 9 cohort studies, and 2 systematic reviews/meta-analyses. Eleven articles were accepted as scientifically admissible. The type of teaching method aids included a Thrust in Motion cervical manikin, instrumented cardiopulmonary reanimation manikin, padded contact with a load cell, instrumented treatment table with force sensor/transducer, and Dynadjust instrument. Several different methods exist in the literature for teaching spinal manipulative therapy techniques; however, future research in this developing area of chiropractic education is proposed. It is suggested that various teaching methods be included in the regular curricula of chiropractic colleges to aid in developing manipulation skills, efficiency, and knowledge of performance.
Entry Debris Field Estimation Methods and Application to Compton Gamma Ray Observatory Disposal
NASA Technical Reports Server (NTRS)
Mrozinski, Richard B.
2001-01-01
For public safety reasons, the Compton Gamma Ray Observatory (CGRO) was intentionally deorbited on June 4, 2000. This deorbit was NASA's first intentional controlled deorbit of a satellite, and more will come including the eventual deorbit of the International Space Station. To maximize public safety, satellite deorbit planning requires conservative estimates of the debris footprint size and location. These estimates are needed to properly design a deorbit sequence that places the debris footprint over unpopulated areas, including protection for deorbit contingencies. This paper details a method for estimating the length (range), width (crossrange), and location of entry and breakup debris footprints. This method utilizes a three degree-of-freedom Monte Carlo simulation incorporating uncertainties in all aspects of the problem, including vehicle and environment uncertainties. The method incorporates a range of debris characteristics based on historical data in addition to any vehicle-specific debris catalog information. This paper describes the method in detail, and presents results of its application as used in planning the deorbit of the CGRO.
Word aligned bitmap compression method, data structure, and apparatus
Wu, Kesheng; Shoshani, Arie; Otoo, Ekow
2004-12-14
The Word-Aligned Hybrid (WAH) bitmap compression method and data structure is a relatively efficient method for searching and performing logical, counting, and pattern location operations upon large datasets. The technique is comprised of a data structure and methods that are optimized for computational efficiency by using the WAH compression method, which typically takes advantage of the target computing system's native word length. WAH is particularly apropos to infrequently varying databases, including those found in the on-line analytical processing (OLAP) industry, due to the increased computational efficiency of the WAH compressed bitmap index. Some commercial database products already include some version of a bitmap index, which could possibly be replaced by the WAH bitmap compression techniques for potentially increased operation speed, as well as increased efficiencies in constructing compressed bitmaps. Combined together, this technique may be particularly useful for real-time business intelligence. Additional WAH applications may include scientific modeling, such as climate and combustion simulations, to minimize search time for analysis and subsequent data visualization.
Carbide and carbonitride surface treatment method for refractory metals
Meyer, Glenn A.; Schildbach, Marcus A.
1996-01-01
A carbide and carbonitride surface treatment method for refractory metals is provided, in steps including, heating a part formed of boron, chromium, hafnium, molybdenum, niobium, tantalum, titanium, tungsten or zirconium, or alloys thereof, in an evacuated chamber and then introducing reaction gases including nitrogen and hydrogen, either in elemental or water vapor form, which react with a source of elemental carbon to form carbon-containing gaseous reactants which then react with the metal part to form the desired surface layer. Apparatus for practicing the method is also provided, in the form of a carbide and carbonitride surface treatment system (10) including a reaction chamber (14), a source of elemental carbon (17), a heating subassembly (20) and a source of reaction gases (23). Alternative methods of providing the elemental carbon (17) and the reaction gases (23) are provided, as well as methods of supporting the metal part (12), evacuating the chamber (14) with a vacuum subassembly (18) and heating all of the components to the desired temperature.
GPU computing with Kaczmarz’s and other iterative algorithms for linear systems
Elble, Joseph M.; Sahinidis, Nikolaos V.; Vouzis, Panagiotis
2009-01-01
The graphics processing unit (GPU) is used to solve large linear systems derived from partial differential equations. The differential equations studied are strongly convection-dominated, of various sizes, and common to many fields, including computational fluid dynamics, heat transfer, and structural mechanics. The paper presents comparisons between GPU and CPU implementations of several well-known iterative methods, including Kaczmarz’s, Cimmino’s, component averaging, conjugate gradient normal residual (CGNR), symmetric successive overrelaxation-preconditioned conjugate gradient, and conjugate-gradient-accelerated component-averaged row projections (CARP-CG). Computations are preformed with dense as well as general banded systems. The results demonstrate that our GPU implementation outperforms CPU implementations of these algorithms, as well as previously studied parallel implementations on Linux clusters and shared memory systems. While the CGNR method had begun to fall out of favor for solving such problems, for the problems studied in this paper, the CGNR method implemented on the GPU performed better than the other methods, including a cluster implementation of the CARP-CG method. PMID:20526446
Parham, Christopher; Zhong, Zhong; Pisano, Etta; Connor, Dean; Chapman, Leroy D.
2010-06-22
Systems and methods for detecting an image of an object using an X-ray beam having a polychromatic energy distribution are disclosed. According to one aspect, a method can include detecting an image of an object. The method can include generating a first X-ray beam having a polychromatic energy distribution. Further, the method can include positioning a single monochromator crystal in a predetermined position to directly intercept the first X-ray beam such that a second X-ray beam having a predetermined energy level is produced. Further, an object can be positioned in the path of the second X-ray beam for transmission of the second X-ray beam through the object and emission from the object as a transmitted X-ray beam. The transmitted X-ray beam can be directed at an angle of incidence upon a crystal analyzer. Further, an image of the object can be detected from a beam diffracted from the analyzer crystal.
Experimental Methods for Protein Interaction Identification and Characterization
NASA Astrophysics Data System (ADS)
Uetz, Peter; Titz, Björn; Cagney, Gerard
There are dozens of methods for the detection of protein-protein interactions but they fall into a few broad categories. Fragment complementation assays such as the yeast two-hybrid (Y2H) system are based on split proteins that are functionally reconstituted by fusions of interacting proteins. Biophysical methods include structure determination and mass spectrometric (MS) identification of proteins in complexes. Biochemical methods include methods such as far western blotting and peptide arrays. Only the Y2H and protein complex purification combined with MS have been used on a larger scale. Due to the lack of data it is still difficult to compare these methods with respect to their efficiency and error rates. Current data does not favor any particular method and thus multiple experimental approaches are necessary to maximally cover the interactome of any target cell or organism.
Review on methods for determination of metallothioneins in aquatic organisms.
Shariati, Fatemeh; Shariati, Shahab
2011-06-01
One aspect of environmental degradation in coastal areas is pollution from toxic metals, which are persistent and are bioaccumulated by marine organisms, with serious public health implications. A conventional monitoring system of environmental metal pollution includes measuring the level of selected metals in the whole organism or in respective organs. However, measuring only the metal content in particular organs does not give information about its effect at the subcellular level. Therefore, the evaluation of biochemical biomarker metallothionein may be useful in assessing metal exposure and the prediction of potential detrimental effects induced by metal contamination. There are some methods for the determination of metallothioneins including spectrophotometric method, electrochemical methods, chromatography, saturation-based methods, immunological methods, electrophoresis, and RT-PCR. In this paper, different methods are discussed briefly and the comparison between them will be presented.
Membranes, methods of making membranes, and methods of separating gases using membranes
Ho, W. S. Winston
2012-10-02
Membranes, methods of making membranes, and methods of separating gases using membranes are provided. The membranes can include at least one hydrophilic polymer, at least one cross-linking agent, at least one base, and at least one amino compound. The methods of separating gases using membranes can include contacting a gas stream containing at least one of CO.sub.2, H.sub.2S, and HCl with one side of a nonporous and at least one of CO.sub.2, H.sub.2S, and HCl selectively permeable membrane such that at least one of CO.sub.2, H.sub.2S, and HCl is selectively transported through the membrane.
Methods and systems relating to an augmented virtuality environment
Nielsen, Curtis W; Anderson, Matthew O; McKay, Mark D; Wadsworth, Derek C; Boyce, Jodie R; Hruska, Ryan C; Koudelka, John A; Whetten, Jonathan; Bruemmer, David J
2014-05-20
Systems and methods relating to an augmented virtuality system are disclosed. A method of operating an augmented virtuality system may comprise displaying imagery of a real-world environment in an operating picture. The method may further include displaying a plurality of virtual icons in the operating picture representing at least some assets of a plurality of assets positioned in the real-world environment. Additionally, the method may include displaying at least one virtual item in the operating picture representing data sensed by one or more of the assets of the plurality of assets and remotely controlling at least one asset of the plurality of assets by interacting with a virtual icon associated with the at least one asset.
[Classification of local anesthesia methods].
Petricas, A Zh; Medvedev, D V; Olkhovskaya, E B
The traditional classification methods of dental local anesthesia must be modified. In this paper we proved that the vascular mechanism is leading component of spongy injection. It is necessary to take into account the high effectiveness and relative safety of spongy anesthesia, as well as versatility, ease of implementation and the growing prevalence in the world. The essence of the proposed modification is to distinguish the methods in diffusive (including surface anesthesia, infiltration and conductive anesthesia) and vascular-diffusive (including intraosseous, intraligamentary, intraseptal and intrapulpal anesthesia). For the last four methods the common term «spongy (intraosseous) anesthesia» may be used.
Analysis of New Composite Architectures
NASA Technical Reports Server (NTRS)
Whitcomb, John D.
1996-01-01
Efficient and accurate specialty finite elements methods to analyze textile composites were developed and are described. Textile composites present unique challenges to the analyst because of the large, complex 'microstructure'. The geometry of the microstructure is difficult to model and it introduces unusual free surface effects. The size of the microstructure complicates the use of traditional homogenization methods. The methods developed constitute considerable progress in addressing the modeling difficulties. The details of the methods and attended results obtained therefrom, are described in the various chapters included in Part 1 of the report. Specific conclusions and computer codes generated are included in Part 2 of the report.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Valdez, Carlos A.; Vu, Alexander K.
Provided herein are methods for selectively detecting an alkyne-presenting molecule in a sample and related detection reagents, compositions, methods and systems. The methods include contacting a detection reagent with the sample for a time and under a condition to allow binding of the detection reagent to the one or more alkyne-presenting molecules possibly present in the matrix to the detection reagent. The detection reagent includes an organic label moiety presenting an azide group. The binding of the azide group to the alkyne-presenting molecules results in emission of a signal from the organic label moiety.
Single Cell Spectroscopy: Noninvasive Measures of Small-Scale Structure and Function
Mousoulis, Charilaos; Xu, Xin; Reiter, David A.; Neu, Corey P.
2013-01-01
The advancement of spectroscopy methods attained through increases in sensitivity, and often with the coupling of complementary techniques, has enabled real-time structure and function measurements of single cells. The purpose of this review is to illustrate, in light of advances, the strengths and the weaknesses of these methods. Included also is an assessment of the impact of the experimental setup and conditions of each method on cellular function and integrity. A particular emphasis is placed on noninvasive and nondestructive techniques for achieving single cell detection, including nuclear magnetic resonance, in addition to physical, optical, and vibrational methods. PMID:23886910
Half-heusler alloys with enhanced figure of merit and methods of making
Ren, Zhifeng; Yan, Xiao; Joshi, Giri; Chen, Shuo; Chen, Gang; Poudel, Bed; Caylor, James Christopher
2015-06-02
Thermoelectric materials and methods of making thermoelectric materials having a nanometer mean grain size less than 1 micron. The method includes combining and arc melting constituent elements of the thermoelectric material to form a liquid alloy of the thermoelectric material and casting the liquid alloy of the thermoelectric material to form a solid casting of the thermoelectric material. The method also includes ball milling the solid casting of the thermoelectric material into nanometer mean size particles and sintering the nanometer size particles to form the thermoelectric material having nanometer scale mean grain size.
Selective aerobic alcohol oxidation method for conversion of lignin into simple aromatic compounds
Stahl, Shannon S; Rahimi, Alireza
2015-03-03
Described is a method to oxidize lignin or lignin sub-units. The method includes oxidation of secondary benzylic alcohol in the lignin or lignin sub-unit to a corresponding ketone in the presence of unprotected primarily aliphatic alcohol in the lignin or lignin sub-unit. The optimal catalyst system consists of HNO.sub.3 in combination with another Bronsted acid, in the absence of a metal-containing catalyst, thereby yielding a selectively oxidized lignin or lignin sub-unit. The method may be carried out in the presence or absence of additional reagents including TEMPO and TEMPO derivatives.
Apparatuses and methods for generating electric fields
Scott, Jill R; McJunkin, Timothy R; Tremblay, Paul L
2013-08-06
Apparatuses and methods relating to generating an electric field are disclosed. An electric field generator may include a semiconductive material configured in a physical shape substantially different from a shape of an electric field to be generated thereby. The electric field is generated when a voltage drop exists across the semiconductive material. A method for generating an electric field may include applying a voltage to a shaped semiconductive material to generate a complex, substantially nonlinear electric field. The shape of the complex, substantially nonlinear electric field may be configured for directing charged particles to a desired location. Other apparatuses and methods are disclosed.
Janke, Christopher J.; Dai, Sheng; Oyola, Yatsandra
2016-05-03
A powder-based adsorbent and a related method of manufacture are provided. The powder-based adsorbent includes polymer powder with grafted side chains and an increased surface area per unit weight to increase the adsorption of dissolved metals, for example uranium, from aqueous solutions. A method for forming the powder-based adsorbent includes irradiating polymer powder, grafting with polymerizable reactive monomers, reacting with hydroxylamine, and conditioning with an alkaline solution. Powder-based adsorbents formed according to the present method demonstrated a significantly improved uranium adsorption capacity per unit weight over existing adsorbents.
NASA Technical Reports Server (NTRS)
Rosenfeld, Moshe
1990-01-01
The development, validation and application of a fractional step solution method of the time-dependent incompressible Navier-Stokes equations in generalized coordinate systems are discussed. A solution method that combines a finite-volume discretization with a novel choice of the dependent variables and a fractional step splitting to obtain accurate solutions in arbitrary geometries was previously developed for fixed-grids. In the present research effort, this solution method is extended to include more general situations, including cases with moving grids. The numerical techniques are enhanced to gain efficiency and generality.
Janke, Christopher J.; Dai, Sheng; Oyola, Yatsandra
2015-06-02
Foam-based adsorbents and a related method of manufacture are provided. The foam-based adsorbents include polymer foam with grafted side chains and an increased surface area per unit weight to increase the adsorption of dissolved metals, for example uranium, from aqueous solutions. A method for forming the foam-based adsorbents includes irradiating polymer foam, grafting with polymerizable reactive monomers, reacting with hydroxylamine, and conditioning with an alkaline solution. Foam-based adsorbents formed according to the present method demonstrated a significantly improved uranium adsorption capacity per unit weight over existing adsorbents.
Method for implementation of recursive hierarchical segmentation on parallel computers
NASA Technical Reports Server (NTRS)
Tilton, James C. (Inventor)
2005-01-01
A method, computer readable storage, and apparatus for implementing a recursive hierarchical segmentation algorithm on a parallel computing platform. The method includes setting a bottom level of recursion that defines where a recursive division of an image into sections stops dividing, and setting an intermediate level of recursion where the recursive division changes from a parallel implementation into a serial implementation. The segmentation algorithm is implemented according to the set levels. The method can also include setting a convergence check level of recursion with which the first level of recursion communicates with when performing a convergence check.
General design method for three-dimensional potential flow fields. 1: Theory
NASA Technical Reports Server (NTRS)
Stanitz, J. D.
1980-01-01
A general design method was developed for steady, three dimensional, potential, incompressible or subsonic-compressible flow. In this design method, the flow field, including the shape of its boundary, was determined for arbitrarily specified, continuous distributions of velocity as a function of arc length along the boundary streamlines. The method applied to the design of both internal and external flow fields, including, in both cases, fields with planar symmetry. The analytic problems associated with stagnation points, closure of bodies in external flow fields, and prediction of turning angles in three dimensional ducts were reviewed.
Advances in the Use of Thermography to Inspect Composite Tanks for Liquid Fuel Propulsion Systems
NASA Technical Reports Server (NTRS)
Lansing, Matthew D.; Russell, Samuel S.; Walker, James L.; Jones, Clyde S. (Technical Monitor)
2001-01-01
This viewgraph presentation gives an overview of advances in the use of thermography to inspect composite tanks for liquid fuel propulsion systems. Details are given on the thermographic inspection system, thermographic analysis method (includes scan and defect map, method of inspection, and inclusions, ply wrinkle, and delamination defects), graphite composite cryogenic feedline (including method, image map, and deep/shallow inclusions and resin rich area defects), and material degradation nondestructive evaluation.
Stevens, Fred J.
1992-01-01
A novel method of electric field flow fractionation for separating solute molecules from a carrier solution is disclosed. The method of the invention utilizes an electric field that is periodically reversed in polarity, in a time-dependent, wave-like manner. The parameters of the waveform, including amplitude, frequency and wave shape may be varied to optimize separation of solute species. The waveform may further include discontinuities to enhance separation.
Liquid-cooling technology for gas turbines - Review and status
NASA Technical Reports Server (NTRS)
Van Fossen, G. J., Jr.; Stepka, F. S.
1978-01-01
After a brief review of past efforts involving the forced-convection cooling of gas turbines, the paper surveys the state of the art of the liquid cooling of gas turbines. Emphasis is placed on thermosyphon methods of cooling, including those utilizing closed, open, and closed-loop thermosyphons; other methods, including sweat, spray and stator cooling, are also discussed. The more significant research efforts, design data, correlations, and analytical methods are mentioned and voids in technology are summarized.
Burke-Garcia, Amelia; Mathew, Sunitha
2017-06-01
Social media is increasingly being used in research, including recruitment. For the Bayley Short Form Formative Study, which was conducted under the the National Children's Study, traditional methods of recruitment proved to be ineffective. Therefore, digital media were identified as potential channels for recruitment. Results included successful recruitment of over 1800 infant and toddler participants to the Study. This paper outlines the methods, results, and future research opportunities.
Low energy milling method, low crystallinity alloy, and negative electrode composition
Le, Dihn B; Obrovac, Mark N; Kube, Robert Y; Landucci, James R
2012-10-16
A method of making nanostructured alloy particles includes milling a millbase in a pebble mill containing milling media. The millbase comprises: (i) silicon, and (ii) at least one of carbon or a transition metal, and wherein the nanostructured alloy particles are substantially free of crystalline domains greater than 50 nanometers in size. A method of making a negative electrode composition for a lithium ion battery including the nanostructured alloy particles is also disclosed.
Hladik, Michelle; McWayne, Megan M.
2012-01-01
A method for the determination of 119 pesticides in environmental sediment samples is described. The method was developed by the U.S. Geological Survey (USGS) in support of the National Water Quality Assessment (NAWQA) Program. The pesticides included in this method were chosen through prior prioritization. Herbicides, insecticides, and fungicides along with degradates are included in this method and span a variety of chemical classes including, but not limited to, chloroacetanilides, organochlorines, organophosphates, pyrethroids, triazines, and triazoles. Sediment samples are extracted by using an accelerated solvent extraction system (ASE®, and the compounds of interest are separated from co-extracted matrix interferences (including sulfur) by passing the extracts through high performance liquid chromatography (HPLC) with gel-permeation chromatography (GPC) along with the use of either stacked graphitized carbon and alumina solid-phase extraction (SPE) cartridges or packed Florisil®. Chromatographic separation, detection, and quantification of the pesticides from the sediment-sample extracts are done by using gas chromatography with mass spectrometry (GC/MS). Recoveries in test sediment samples fortified at 10 micrograms per kilogram (μg/kg) dry weight ranged from 75 to 102 percent; relative standard deviations ranged from 3 to 13 percent. Method detection limits (MDLs), calculated by using U.S. Environmental Protection Agency procedures (40 CFR 136, Appendix B), ranged from 0.6 to 3.4 μg/kg dry weight.
Sun, LiJun; Hwang, Hyeon-Shik; Lee, Kyung-Min
2018-03-01
The purpose of this study was to examine changes in registration accuracy after including occlusal surface and incisal edge areas in addition to the buccal surface when integrating laser-scanned and maxillofacial cone-beam computed tomography (CBCT) dental images. CBCT scans and maxillary dental casts were obtained from 30 patients. Three methods were used to integrate the images: R1, only the buccal and labial surfaces were used; R2, the incisal edges of the anterior teeth and the buccal and distal marginal ridges of the second molars were used; and R3, labial surfaces, including incisal edges of anterior teeth, and buccal surfaces, including buccal and distal marginal ridges of the second molars, were used. Differences between the 2 images were evaluated by color-mapping methods and average surface distances by measuring the 3-dimensional Euclidean distances between the surface points on the 2 images. The R1 method showed more discrepancies between the laser-scanned and CBCT images than did the other methods. The R2 method did not show a significant difference in registration accuracy compared with the R3 method. The results of this study indicate that accuracy when integrating laser-scanned dental images into maxillofacial CBCT images can be increased by including occlusal surface and incisal edge areas as registration areas. Copyright © 2017 American Association of Orthodontists. Published by Elsevier Inc. All rights reserved.
Ion/proton-conducting apparatus and method
Yates, Matthew; Xue, Wei
2014-12-23
A c-axis-oriented HAP thin film synthesized by seeded growth on a palladium hydrogen membrane substrate. An exemplary synthetic process includes electrochemical seeding on the substrate, and secondary and tertiary hydrothermal treatments under conditions that favor growth along c-axes and a-axes in sequence. By adjusting corresponding synthetic conditions, an HAP this film can be grown to a controllable thickness with a dense coverage on the underlying substrate. The thin films have relatively high proton conductivity under hydrogen atmosphere and high temperature conditions. The c-axis oriented films may be integrated into fuel cells for application in the intermediate temperature range of 200-600.degree. C. The electrochemical-hydrothermal deposition technique may be applied to create other oriented crystal materials having optimized properties, useful for separations and catalysis as well as electronic and electrochemical applications, electrochemical membrane reactors, and in chemical sensors. Additional high-density and gas-tight HAP film compositions may be deposited using a two-step deposition method that includes an electrochemical deposition method followed by a hydrothermal deposition method. The two-step method uses a single hydrothermal deposition solution composition. The method may be used to deposit HAP films including but not limited to at least doped HAP films, and more particularly including carbonated HAP films. In addition, the high-density and gas-tight HAP films may be used in proton exchange membrane fuel cells.
NASA Astrophysics Data System (ADS)
Clay, J.; Kent, E. R.; Leinfelder-Miles, M.; Lambert, J. J.; Little, C.; Paw U, K. T.; Snyder, R. L.
2016-12-01
Eddy covariance and surface renewal measurements were used to estimate evapotranspiration (ET) over a variety of crop fields in the Sacramento-San Joaquin River Delta during the 2016 growing season. However, comparing and evaluating multiple measurement systems and methods for determining ET was focused upon at a single alfalfa site. The eddy covariance systems included two systems for direct measurement of latent heat flux: one using a separate sonic anemometer and an open path infrared gas analyzer and another using a combined system (Campbell Scientific IRGASON). For these methods, eddy covariance was used with measurements from the Campbell Scientific CSAT3, the LI-COR 7500a, the Campbell Scientific IRGASON, and an additional R.M. Young sonic anemometer. In addition to those direct measures, the surface renewal approach included several energy balance residual methods in which net radiation, ground heat flux, and sensible heat flux (H) were measured. H was measured using several systems and different methods, including using multiple fast-response thermocouple measurements and using the temperatures measured by the sonic anemometers. The energy available for ET was then calculated as the residual of the surface energy balance equation. Differences in ET values were analyzed between the eddy covariance and surface renewal methods, using the IRGASON-derived values of ET as the standard for accuracy.
Comparison of four different reduction methods for anterior dislocation of the shoulder.
Guler, Olcay; Ekinci, Safak; Akyildiz, Faruk; Tirmik, Uzeyir; Cakmak, Selami; Ugras, Akin; Piskin, Ahmet; Mahirogullari, Mahir
2015-05-28
Shoulder dislocations account for almost 50% of all major joint dislocations and are mainly anterior. The aim is a comparative retrospective study of different reduction maneuvers without anesthesia to reduce the dislocated shoulder. Patients were treated with different reduction maneuvers, including various forms of traction and external rotation, in the emergency departments of four training hospitals between 2009 and 2012. Each of the four hospitals had different treatment protocols for reduction and applying one of four maneuvers: Spaso, Chair, Kocher, and Matsen methods. Thirty-nine patients were treated by the Spaso method, 47 by the Chair reduction method, 40 by the Kocher method, and 27 patients by Matsen's traction-countertraction method. All patients' demographic data were recorded. Dislocation number, reduction time, time interval between dislocation and reduction, and associated complications, pre- and post-reduction period, were recorded prospectively. No anesthetic method was used for the reduction. All of the methods used included traction and some external rotation. The Chair method had the shortest reduction time. All surgeons involved in the study agreed that the Kocher and Matsen methods needed more force for the reduction. Patients could contract their muscles because of the pain in these two methods. The Spaso method includes flexion of the shoulder and blocks muscle contraction somewhat. The Chair method was found to be the easiest because the patients could not contract their muscles while sitting on a chair with the affected arm at their side. We suggest that the Chair method is an effective and fast reduction maneuver that may be an alternative for the treatment of anterior shoulder dislocations. Further prospective studies with larger sample size are needed to compare safety of different reduction techniques.
Electrode assemblies, plasma generating apparatuses, and methods for generating plasma
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kong, Peter C.; Grandy, Jon D.; Detering, Brent A.
Electrode assemblies for plasma reactors include a structure or device for constraining an arc endpoint to a selected area or region on an electrode. In some embodiments, the structure or device may comprise one or more insulating members covering a portion of an electrode. In additional embodiments, the structure or device may provide a magnetic field configured to control a location of an arc endpoint on the electrode. Plasma generating modules, apparatus, and systems include such electrode assemblies. Methods for generating a plasma include covering at least a portion of a surface of an electrode with an electrically insulating membermore » to constrain a location of an arc endpoint on the electrode. Additional methods for generating a plasma include generating a magnetic field to constrain a location of an arc endpoint on an electrode.« less
Plasma spraying method for forming diamond and diamond-like coatings
Holcombe, C.E.; Seals, R.D.; Price, R.E.
1997-06-03
A method and composition is disclosed for the deposition of a thick layer of diamond or diamond-like material. The method includes high temperature processing wherein a selected composition including at least glassy carbon is heated in a direct current plasma arc device to a selected temperature above the softening point, in an inert atmosphere, and is propelled to quickly quenched on a selected substrate. The softened or molten composition crystallizes on the substrate to form a thick deposition layer comprising at least a diamond or diamond-like material. The selected composition includes at least glassy carbon as a primary constituent and may include at least one secondary constituent. Preferably, the secondary constituents are selected from the group consisting of at least diamond powder, boron carbide (B{sub 4}C) powder and mixtures thereof. 9 figs.
Graphene device and method of using graphene device
Bouchiat, Vincent; Girit, Caglar; Kessler, Brian; Zettl, Alexander K.
2015-08-11
An embodiment of a graphene device includes a layered structure, first and second electrodes, and a dopant island. The layered structure includes a conductive layer, an insulating layer, and a graphene layer. The electrodes are coupled to the graphene layer. The dopant island is coupled to an exposed surface of the graphene layer between the electrodes. An embodiment of a method of using a graphene device includes providing the graphene device. A voltage is applied to the conductive layer of the graphene device. Another embodiment of a method of using a graphene device includes providing the graphene device without the dopant island. A dopant island is placed on an exposed surface of the graphene layer between the electrodes. A voltage is applied to the conductive layer of the graphene device. A response of the dopant island to the voltage is observed.
Heat exchanger and related methods
Turner, Terry D.; McKellar, Michael G.
2015-12-22
Heat exchangers include a housing having an inlet and an outlet and forming a portion of a transition chamber. A heating member may form another portion of the transition chamber. The heating member includes a first end having a first opening and a second end having a second opening larger than the first opening. Methods of conveying a fluid include supplying a first fluid into a transition chamber of a heat exchanger, supplying a second fluid into the transition chamber, and altering a state of a portion of the first fluid with the second fluid. Methods of sublimating solid particles include conveying a first fluid comprising a material in a solid state into a transition chamber, heating the material to a gaseous state by directing a second fluid through a heating member and mixing the first fluid and the second fluid.
24 CFR 941.102 - Development methods and funding.
Code of Federal Regulations, 2011 CFR
2011-04-01
... 24 Housing and Urban Development 4 2011-04-01 2011-04-01 false Development methods and funding... URBAN DEVELOPMENT PUBLIC HOUSING DEVELOPMENT General § 941.102 Development methods and funding. (a) Methods. A PHA may use any generally accepted method of development including, but not limited to...
Using Corporate-Based Methods To Assess Technical Communication Programs.
ERIC Educational Resources Information Center
Faber, Brenton; Bekins, Linn; Karis, Bill
2002-01-01
Investigates methods of program assessment used by corporate learning sites and profiles value added methods as a way to both construct and evaluate academic programs in technical communication. Examines and critiques assessment methods from corporate training environments including methods employed by corporate universities and value added…
A review of propeller noise prediction methodology: 1919-1994
NASA Technical Reports Server (NTRS)
Metzger, F. Bruce
1995-01-01
This report summarizes a review of the literature regarding propeller noise prediction methods. The review is divided into six sections: (1) early methods; (2) more recent methods based on earlier theory; (3) more recent methods based on the Acoustic Analogy; (4) more recent methods based on Computational Acoustics; (5) empirical methods; and (6) broadband methods. The report concludes that there are a large number of noise prediction procedures available which vary markedly in complexity. Deficiencies in accuracy of methods in many cases may be related, not to the methods themselves, but the accuracy and detail of the aerodynamic inputs used to calculate noise. The steps recommended in the report to provide accurate and easy to use prediction methods are: (1) identify reliable test data; (2) define and conduct test programs to fill gaps in the existing data base; (3) identify the most promising prediction methods; (4) evaluate promising prediction methods relative to the data base; (5) identify and correct the weaknesses in the prediction methods, including lack of user friendliness, and include features now available only in research codes; (6) confirm the accuracy of improved prediction methods to the data base; and (7) make the methods widely available and provide training in their use.
42 CFR 441.472 - Budget methodology.
Code of Federal Regulations, 2011 CFR
2011-10-01
... based utilizing valid, reliable cost data. (2) The State's method is applied consistently to participants. (3) The State's method is open for public inspection. (4) The State's method includes a...
Laboratories measuring target biotoxin analytes in environmental samples can use this online query tool to identify analytical methods included in EPA's Selected Analytical Methods for Environmental Remediation and Recovery for select biotoxins.
42 CFR 441.472 - Budget methodology.
Code of Federal Regulations, 2013 CFR
2013-10-01
... based utilizing valid, reliable cost data. (2) The State's method is applied consistently to participants. (3) The State's method is open for public inspection. (4) The State's method includes a...
Apparatus and method for radioactive waste screening
Akers, Douglas W.; Roybal, Lyle G.; Salomon, Hopi; Williams, Charles Leroy
2012-09-04
An apparatus and method relating to screening radioactive waste are disclosed for ensuring that at least one calculated parameter for the measurement data of a sample falls within a range between an upper limit and a lower limit prior to the sample being packaged for disposal. The apparatus includes a radiation detector configured for detecting radioactivity and radionuclide content of the of the sample of radioactive waste and generating measurement data in response thereto, and a collimator including at least one aperture to direct a field of view of the radiation detector. The method includes measuring a radioactive content of a sample, and calculating one or more parameters from the radioactive content of the sample.
Logging-while-coring method and apparatus
Goldberg, David S.; Myers, Gregory J.
2007-11-13
A method and apparatus for downhole coring while receiving logging-while-drilling tool data. The apparatus includes core collar and a retrievable core barrel. The retrievable core barrel receives core from a borehole which is sent to the surface for analysis via wireline and latching tool The core collar includes logging-while-drilling tools for the simultaneous measurement of formation properties during the core excavation process. Examples of logging-while-drilling tools include nuclear sensors, resistivity sensors, gamma ray sensors, and bit resistivity sensors. The disclosed method allows for precise core-log depth calibration and core orientation within a single borehole, and without at pipe trip, providing both time saving and unique scientific advantages.
Logging-while-coring method and apparatus
Goldberg, David S.; Myers, Gregory J.
2007-01-30
A method and apparatus for downhole coring while receiving logging-while-drilling tool data. The apparatus includes core collar and a retrievable core barrel. The retrievable core barrel receives core from a borehole which is sent to the surface for analysis via wireline and latching tool The core collar includes logging-while-drilling tools for the simultaneous measurement of formation properties during the core excavation process. Examples of logging-while-drilling tools include nuclear sensors, resistivity sensors, gamma ray sensors, and bit resistivity sensors. The disclosed method allows for precise core-log depth calibration and core orientation within a single borehole, and without at pipe trip, providing both time saving and unique scientific advantages.
Wrapped optoelectronic devices and methods for making same
DOE Office of Scientific and Technical Information (OSTI.GOV)
Curran, Seamus; Dias, Sampath; Alley, Nigel
In various embodiments, optoelectronic devices are described herein. The optoelectronic device may include an optoelectronic cell arranged so as to wrap around a central axis wherein the cell includes a first conductive layer, a semi-conductive layer disposed over and in electrical communication with the first conductive layer, and a second conductive layer disposed over and in electrical communication with the semi-conductive layer. In various embodiments, methods for making optoelectronic devices are described herein. The methods may include forming an optoelectronic cell while flat and wrapping the optoelectronic cell around a central axis. The optoelectronic devices may be photovoltaic devices. Alternatively,more » the optoelectronic devices may be organic light emitting diodes.« less
A rapid method for the computation of equilibrium chemical composition of air to 15000 K
NASA Technical Reports Server (NTRS)
Prabhu, Ramadas K.; Erickson, Wayne D.
1988-01-01
A rapid computational method has been developed to determine the chemical composition of equilibrium air to 15000 K. Eleven chemically reacting species, i.e., O2, N2, O, NO, N, NO+, e-, N+, O+, Ar, and Ar+ are included. The method involves combining algebraically seven nonlinear equilibrium equations and four linear elemental mass balance and charge neutrality equations. Computational speeds for determining the equilibrium chemical composition are significantly faster than the often used free energy minimization procedure. Data are also included from which the thermodynamic properties of air can be computed. A listing of the computer program together with a set of sample results are included.
Method and system for detecting explosives
Reber, Edward L [Idaho Falls, ID; Jewell, James K [Idaho Falls, ID; Rohde, Kenneth W [Idaho Falls, ID; Seabury, Edward H [Idaho Falls, ID; Blackwood, Larry G [Idaho Falls, ID; Edwards, Andrew J [Idaho Falls, ID; Derr, Kurt W [Idaho Falls, ID
2009-03-10
A method of detecting explosives in a vehicle includes providing a first rack on one side of the vehicle, the rack including a neutron generator and a plurality of gamma ray detectors; providing a second rack on another side of the vehicle, the second rack including a neutron generator and a plurality of gamma ray detectors; providing a control system, remote from the first and second racks, coupled to the neutron generators and gamma ray detectors; using the control system, causing the neutron generators to generate neutrons; and performing gamma ray spectroscopy on spectra read by the gamma ray detectors to look for a signature indicative of presence of an explosive. Various apparatus and other methods are also provided.
Explosives detection system and method
Reber, Edward L.; Jewell, James K.; Rohde, Kenneth W.; Seabury, Edward H.; Blackwood, Larry G.; Edwards, Andrew J.; Derr, Kurt W.
2007-12-11
A method of detecting explosives in a vehicle includes providing a first rack on one side of the vehicle, the rack including a neutron generator and a plurality of gamma ray detectors; providing a second rack on another side of the vehicle, the second rack including a neutron generator and a plurality of gamma ray detectors; providing a control system, remote from the first and second racks, coupled to the neutron generators and gamma ray detectors; using the control system, causing the neutron generators to generate neutrons; and performing gamma ray spectroscopy on spectra read by the gamma ray detectors to look for a signature indicative of presence of an explosive. Various apparatus and other methods are also provided.
System and method for assaying radiation
DiPrete, David P; Whiteside, Tad; Pak, Donald J; DiPrete, Cecilia C
2013-11-12
A system for assaying radiation includes a sample holder configured to hold a liquid scintillation solution. A photomultiplier receives light from the liquid scintillation solution and generates a signal reflective of the light. A control circuit biases the photomultiplier and receives the signal from the photomultiplier reflective of the light. A light impermeable casing surrounds the sample holder, photomultiplier, and control circuit. A method for assaying radiation includes placing a sample in a liquid scintillation solution, placing the liquid scintillation solution in a sample holder, and placing the sample holder inside a light impermeable casing. The method further includes positioning a photomultiplier inside the light impermeable casing and supplying power to a control circuit inside the light impermeable casing.
Murphy, Thomas; Schwedock, Julie; Nguyen, Kham; Mills, Anna; Jones, David
2015-01-01
New recommendations for the validation of rapid microbiological methods have been included in the revised Technical Report 33 release from the PDA. The changes include a more comprehensive review of the statistical methods to be used to analyze data obtained during validation. This case study applies those statistical methods to accuracy, precision, ruggedness, and equivalence data obtained using a rapid microbiological methods system being evaluated for water bioburden testing. Results presented demonstrate that the statistical methods described in the PDA Technical Report 33 chapter can all be successfully applied to the rapid microbiological method data sets and gave the same interpretation for equivalence to the standard method. The rapid microbiological method was in general able to pass the requirements of PDA Technical Report 33, though the study shows that there can be occasional outlying results and that caution should be used when applying statistical methods to low average colony-forming unit values. Prior to use in a quality-controlled environment, any new method or technology has to be shown to work as designed by the manufacturer for the purpose required. For new rapid microbiological methods that detect and enumerate contaminating microorganisms, additional recommendations have been provided in the revised PDA Technical Report No. 33. The changes include a more comprehensive review of the statistical methods to be used to analyze data obtained during validation. This paper applies those statistical methods to analyze accuracy, precision, ruggedness, and equivalence data obtained using a rapid microbiological method system being validated for water bioburden testing. The case study demonstrates that the statistical methods described in the PDA Technical Report No. 33 chapter can be successfully applied to rapid microbiological method data sets and give the same comparability results for similarity or difference as the standard method. © PDA, Inc. 2015.
Semiconductor structure and recess formation etch technique
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lu, Bin; Sun, Min; Palacios, Tomas Apostol
2017-02-14
A semiconductor structure has a first layer that includes a first semiconductor material and a second layer that includes a second semiconductor material. The first semiconductor material is selectively etchable over the second semiconductor material using a first etching process. The first layer is disposed over the second layer. A recess is disposed at least in the first layer. Also described is a method of forming a semiconductor structure that includes a recess. The method includes etching a region in a first layer using a first etching process. The first layer includes a first semiconductor material. The first etching processmore » stops at a second layer beneath the first layer. The second layer includes a second semiconductor material.« less
Method to fabricate micro and nano diamond devices
Morales, Alfredo M.; Anderson, Richard J.; Yang, Nancy Y. C.; Skinner, Jack L.; Rye, Michael J.
2017-04-11
A method including forming a diamond material on the surface of a substrate; forming a first contact and a separate second contact; and patterning the diamond material to form a nanowire between the first contact and the second contact. An apparatus including a first contact and a separate second contact on a substrate; and a nanowire including a single crystalline or polycrystalline diamond material on the substrate and connected to each of the first contact and the second contact.
Method to fabricate micro and nano diamond devices
Morales, Alfredo M; Anderson, Richard J; Yang, Nancy Y. C.; Skinner, Jack L; Rye, Michael J
2014-10-07
A method including forming a diamond material on the surface of a substrate; forming a first contact and a separate second contact; and patterning the diamond material to form a nanowire between the first contact and the second contact. An apparatus including a first contact and a separate second contact on a substrate; and a nanowire including a single crystalline or polycrystalline diamond material on the substrate and connected to each of the first contact and the second contact.
Method and apparatus for operating a powertrain system upon detecting a stuck-closed clutch
Hansen, R. Anthony
2014-02-18
A powertrain system includes a multi-mode transmission having a plurality of torque machines. A method for controlling the powertrain system includes identifying all presently applied clutches including commanded applied clutches and the stuck-closed clutch upon detecting one of the torque-transfer clutches is in a stuck-closed condition. A closed-loop control system is employed to control operation of the multi-mode transmission accounting for all the presently applied clutches.
Method of generating hydrogen by catalytic decomposition of water
Balachandran, Uthamalingam; Dorris, Stephen E.; Bose, Arun C.; Stiegel, Gary J.; Lee, Tae-Hyun
2002-01-01
A method for producing hydrogen includes providing a feed stream comprising water; contacting at least one proton conducting membrane adapted to interact with the feed stream; splitting the water into hydrogen and oxygen at a predetermined temperature; and separating the hydrogen from the oxygen. Preferably the proton conducting membrane comprises a proton conductor and a second phase material. Preferable proton conductors suitable for use in a proton conducting membrane include a lanthanide element, a Group VIA element and a Group IA or Group IIA element such as barium, strontium, or combinations of these elements. More preferred proton conductors include yttrium. Preferable second phase materials include platinum, palladium, nickel, cobalt, chromium, manganese, vanadium, silver, gold, copper, rhodium, ruthenium, niobium, zirconium, tantalum, and combinations of these. More preferably second phase materials suitable for use in a proton conducting membrane include nickel, palladium, and combinations of these. The method for generating hydrogen is preferably preformed in the range between about 600.degree. C. and 1,700.degree. C.
Microcapsule and methods of making and using microcapsules
Okawa, David C.; Pastine, Stefan J.; Zettl, Alexander K.; Frechet, Jean M.J.
2014-09-02
An embodiment of a microcapsule includes a shell surrounding a space, a liquid within the shell, and a light absorbing material within the liquid. An embodiment of a method of making microcapsules includes forming a mixture of a light absorbing material and an organic solution. An emulsion of the mixture and an aqueous solution is then formed. A polymerization agent is added to the emulsion, which causes microcapsules to be formed. Each microcapsule includes a shell surrounding a space, a liquid within the shell, and light absorbing material within the liquid. An embodiment of a method of using microcapsules includes providing phototriggerable microcapsules within a bulk material. Each of the phototriggerable microcapsules includes a shell surrounding a space, a chemically reactive material within the shell, and a light absorbing material within the shell. At least some of the phototriggerable microcapsules are exposed to light, which causes the chemically reactive material to release from the shell and to come into contact with bulk material.
Deborah S. Page-Dumroese; Ann M. Abbott; Thomas M. Rice
2009-01-01
Volume I and volume II of the Forest Soil Disturbance Monitoring Protocol (FSDMP) provide information for a wide range of users, including technicians, field crew leaders, private landowners, land managers, forest professionals, and researchers. Volume I: Rapid Assessment includes the basic methods for establishing forest soil monitoring transects and consistently...
Method of doping organic semiconductors
Kloc, Christian Leo [Constance, DE; Ramirez, Arthur Penn [Summit, NJ; So, Woo-Young [New Providence, NJ
2012-02-28
A method includes the steps of forming a contiguous semiconducting region and heating the region. The semiconducting region includes polyaromatic molecules. The heating raises the semiconducting region to a temperature above room temperature. The heating is performed in the presence of a dopant gas and the absence of light to form a doped organic semiconducting region.
33 CFR Appendix B to Part 273 - Information Requirements for Aquatic Plant Control Program Reports
Code of Federal Regulations, 2012 CFR
2012-07-01
... identification by common and scientific name of the plant or plants concerned, origin of infestation and likely... control operations or engineering works, including control methods, materials, equipment and procedures... operation control, the report should include a brief statement of the special problems in control methods...
33 CFR Appendix B to Part 273 - Information Requirements for Aquatic Plant Control Program Reports
Code of Federal Regulations, 2013 CFR
2013-07-01
... identification by common and scientific name of the plant or plants concerned, origin of infestation and likely... control operations or engineering works, including control methods, materials, equipment and procedures... operation control, the report should include a brief statement of the special problems in control methods...
Instructional Basics: Oppelt Standard Method of Therapeutic and Recreational Ice Skating.
ERIC Educational Resources Information Center
Oppelt, Kurt
Detailed in the booklet is the standard ice skating method and considered are the benefits of therapeutic ice skating for the handicapped and aged. Values for the mentally retarded and physically handicapped are seen to include physiological (such as increased flexibility and improved posture), psychological (including satifaction and enhanced…
Hybrid spread spectrum radio system
Smith, Stephen F [London, TN; Dress, William B [Camas, WA
2010-02-09
Systems and methods are described for hybrid spread spectrum radio systems. A method, includes receiving a hybrid spread spectrum signal including: fast frequency hopping demodulating and direct sequence demodulating a direct sequence spread spectrum signal, wherein multiple frequency hops occur within a single data-bit time and each bit is represented by chip transmissions at multiple frequencies.
Sample detection and analysis techniques for electrophoretic separation
NASA Technical Reports Server (NTRS)
Falb, R. D.; Hughes, K. E.; Powell, T. R.
1975-01-01
Methods for detecting and analyzing biological agents suitable for space flight operations were studied primarily by literature searches which were conducted of cell separation techniques. Detection methods discussed include: photometrometric, electric, radiometric, micrometry, ultrasonic, microscopic, and photographic. A bibliography, and a directory of vendors are included along with an index of commercial hardware.
34 CFR 364.38 - What methods of evaluation must the State plan include?
Code of Federal Regulations, 2010 CFR
2010-07-01
... 34 Education 2 2010-07-01 2010-07-01 false What methods of evaluation must the State plan include? 364.38 Section 364.38 Education Regulations of the Offices of the Department of Education (Continued) OFFICE OF SPECIAL EDUCATION AND REHABILITATIVE SERVICES, DEPARTMENT OF EDUCATION STATE INDEPENDENT LIVING...
34 CFR 364.38 - What methods of evaluation must the State plan include?
Code of Federal Regulations, 2011 CFR
2011-07-01
... 34 Education 2 2011-07-01 2010-07-01 true What methods of evaluation must the State plan include? 364.38 Section 364.38 Education Regulations of the Offices of the Department of Education (Continued) OFFICE OF SPECIAL EDUCATION AND REHABILITATIVE SERVICES, DEPARTMENT OF EDUCATION STATE INDEPENDENT LIVING...
USDA-ARS?s Scientific Manuscript database
Analysis of 9 macrolides is presented, including tulathromycin A (Draxxin), in beef, poultry and pork muscle with a simple multi-residue extraction and analysis method using high performance liquid chromatography coupled to electrospray ionization tandem mass spectrometry. The extraction method inv...
Method of enhancing radiation response of radiation detection materials
Miller, Steven D.
1997-01-01
The present invention is a method of increasing radiation response of a radiation detection material for a given radiation signal by first pressurizing the radiation detection material. Pressurization may be accomplished by any means including mechanical and/or hydraulic. In this application, the term "pressure" includes fluid pressure and/or mechanical stress.
Metal halide solid-state surface treatment for nanocrystal materials
Luther, Joseph M.; Crisp, Ryan; Beard, Matthew C.
2016-04-26
Methods of treating nanocrystal and/or quantum dot devices are described. The methods include contacting the nanocrystals and/or quantum dots with a solution including metal ions and halogen ions, such that the solution displaces native ligands present on the surface of the nanocrystals and/or quantum dots via ligand exchange.
Kansas's forests, 2005: statistics, methods, and quality assurance
Patrick D. Miles; W. Keith Moser; Charles J. Barnett
2011-01-01
The first full annual inventory of Kansas's forests was completed in 2005 after 8,868 plots were selected and 468 forested plots were visited and measured. This report includes detailed information on forest inventory methods and data quality estimates. Important resource statistics are included in the tables. A detailed analysis of Kansas inventory is presented...
Laboratory maintenance of Treponema denticola.
Fenno, J Christopher
2005-10-01
This unit describes the methods, media, and equipment necessary for routine laboratory culture and handling of the anaerobic oral spirochete Treponema denticola. Topics discussed include nutrient requirements, recommended media formulations, and expected growth kinetics, as well as methods and equipment necessary to maintain anaerobic conditions. An additional protocol on isolation of T. denticola from clinical samples is included.
Passivated contact formation using ion implantation
DOE Office of Scientific and Technical Information (OSTI.GOV)
Young, David L.; Stradins, Pauls; Nemeth, William
2018-05-29
Methods for forming passivated contacts include implanting compound-forming ions into a substrate to about a first depth below a surface of the substrate, and implanting dopant ions into the substrate to about a second depth below the surface. The second depth may be shallower than the first depth. The methods also include annealing the substrate.
NASA Technical Reports Server (NTRS)
Ehret, R. M.
1974-01-01
The concepts explored in a state of the art review of those engineering fracture mechanics considered most applicable to the space shuttle vehicle include fracture toughness, precritical flaw growth, failure mechanisms, inspection methods (including proof test logic), and crack growth predictive analysis techniques.
10 CFR 905.11 - What must an IRP include?
Code of Federal Regulations, 2010 CFR
2010-01-01
... forecasting method, including but not limited to the time series, end-use, and econometric methods. The... projected durability of such savings measured over time; and must treat demand and supply resources on a... implement its IRP. (i) The IRP must state the time period that the action plan covers, and the action plan...
10 CFR 905.11 - What must an IRP include?
Code of Federal Regulations, 2011 CFR
2011-01-01
... forecasting method, including but not limited to the time series, end-use, and econometric methods. The... projected durability of such savings measured over time; and must treat demand and supply resources on a... implement its IRP. (i) The IRP must state the time period that the action plan covers, and the action plan...
10 CFR 905.11 - What must an IRP include?
Code of Federal Regulations, 2012 CFR
2012-01-01
... forecasting method, including but not limited to the time series, end-use, and econometric methods. The... projected durability of such savings measured over time; and must treat demand and supply resources on a... implement its IRP. (i) The IRP must state the time period that the action plan covers, and the action plan...
10 CFR 905.11 - What must an IRP include?
Code of Federal Regulations, 2014 CFR
2014-01-01
... forecasting method, including but not limited to the time series, end-use, and econometric methods. The... projected durability of such savings measured over time; and must treat demand and supply resources on a... implement its IRP. (i) The IRP must state the time period that the action plan covers, and the action plan...
10 CFR 905.11 - What must an IRP include?
Code of Federal Regulations, 2013 CFR
2013-01-01
... forecasting method, including but not limited to the time series, end-use, and econometric methods. The... projected durability of such savings measured over time; and must treat demand and supply resources on a... implement its IRP. (i) The IRP must state the time period that the action plan covers, and the action plan...
ERIC Educational Resources Information Center
Tipton, Elizabeth; Fellers, Lauren; Caverly, Sarah; Vaden-Kiernan, Michael; Borman, Geoffrey; Sullivan, Kate; Ruiz de Castilla, Veronica
2016-01-01
Recently, statisticians have begun developing methods to improve the generalizability of results from large-scale experiments in education. This work has included the development of methods for improved site selection when random sampling is infeasible, including the use of stratification and targeted recruitment strategies. This article provides…
Federal Register 2010, 2011, 2012, 2013, 2014
2012-05-31
... Determination Methods and Alternative Rating Methods AGENCY: Office of Energy Efficiency and Renewable Energy... proposing to revise and expand its existing regulations governing the use of particular methods as...- TP-0024, by any of the following methods: Email: to AED/[email protected] . Include EERE...
Beyond Euler's Method: Implicit Finite Differences in an Introductory ODE Course
ERIC Educational Resources Information Center
Kull, Trent C.
2011-01-01
A typical introductory course in ordinary differential equations (ODEs) exposes students to exact solution methods. However, many differential equations must be approximated with numerical methods. Textbooks commonly include explicit methods such as Euler's and Improved Euler's. Implicit methods are typically introduced in more advanced courses…