Science.gov

Sample records for mimicking human cis

  1. Cis-regulatory mutations in human disease

    PubMed Central

    2009-01-01

    Cis-acting regulatory sequences are required for the proper temporal and spatial control of gene expression. Variation in gene expression is highly heritable and a significant determinant of human disease susceptibility. The diversity of human genetic diseases attributed, in whole or in part, to mutations in non-coding regulatory sequences is on the rise. Improvements in genome-wide methods of associating genetic variation with human disease and predicting DNA with cis-regulatory potential are two of the major reasons for these recent advances. This review will highlight select examples from the literature that have successfully integrated genetic and genomic approaches to uncover the molecular basis by which cis-regulatory mutations alter gene expression and contribute to human disease. The fine mapping of disease-causing variants has led to the discovery of novel cis-acting regulatory elements that, in some instances, are located as far away as 1.5 Mb from the target gene. In other cases, the prior knowledge of the regulatory landscape surrounding the gene of interest aided in the selection of enhancers for mutation screening. The success of these studies should provide a framework for following up on the large number of genome-wide association studies that have identified common variants in non-coding regions of the genome that associate with increased risk of human diseases including, diabetes, autism, Crohn's, colorectal cancer, and asthma, to name a few. PMID:19641089

  2. Cis-regulatory mutations in human disease.

    PubMed

    Epstein, Douglas J

    2009-07-01

    Cis-acting regulatory sequences are required for the proper temporal and spatial control of gene expression. Variation in gene expression is highly heritable and a significant determinant of human disease susceptibility. The diversity of human genetic diseases attributed, in whole or in part, to mutations in non-coding regulatory sequences is on the rise. Improvements in genome-wide methods of associating genetic variation with human disease and predicting DNA with cis-regulatory potential are two of the major reasons for these recent advances. This review will highlight select examples from the literature that have successfully integrated genetic and genomic approaches to uncover the molecular basis by which cis-regulatory mutations alter gene expression and contribute to human disease. The fine mapping of disease-causing variants has led to the discovery of novel cis-acting regulatory elements that, in some instances, are located as far away as 1.5 Mb from the target gene. In other cases, the prior knowledge of the regulatory landscape surrounding the gene of interest aided in the selection of enhancers for mutation screening. The success of these studies should provide a framework for following up on the large number of genome-wide association studies that have identified common variants in non-coding regions of the genome that associate with increased risk of human diseases including, diabetes, autism, Crohn's, colorectal cancer, and asthma, to name a few.

  3. Humanlike Robots - Synthetically Mimicking Humans

    NASA Technical Reports Server (NTRS)

    Bar-Cohen, Yoseph

    2012-01-01

    Nature inspired many inventions and the field of technology that is based on the mimicking or inspiration of nature is widely known as Biomimetics and it is increasingly leading to many new capabilities. There are numerous examples of biomimetic successes including the copying of fins for swimming, and the inspiration of the insects and birds flight. More and more commercial implementations of biomimetics are appearing and behaving lifelike and applications are emerging that are important to our daily life. Making humanlike robots is the ultimate challenge to biomimetics and, for many years, it was considered science fiction, but such robots are becoming an engineering reality. Advances in producing such robot are allowing them to perform impressive functions and tasks. The development of such robots involves addressing many challenges and is raising concerns that are related to fear of their application implications and potential ethical issues. In this paper, the state-of-the-art of humanlike robots, potential applications and challenges will be reviewed.

  4. Abundant raw material for cis-regulatory evolution in humans.

    PubMed

    Rockman, Matthew V; Wray, Gregory A

    2002-11-01

    Changes in gene expression and regulation--due in particular to the evolution of cis-regulatory DNA sequences--may underlie many evolutionary changes in phenotypes, yet little is known about the distribution of such variation in populations. We present in this study the first survey of experimentally validated functional cis-regulatory polymorphism. These data are derived from more than 140 polymorphisms involved in the regulation of 107 genes in Homo sapiens, the eukaryote species with the most available data. We find that functional cis-regulatory variation is widespread in the human genome and that the consequent variation in gene expression is twofold or greater for 63% of the genes surveyed. Transcription factor-DNA interactions are highly polymorphic, and regulatory interactions have been gained and lost within human populations. On average, humans are heterozygous at more functional cis-regulatory sites (>16,000) than at amino acid positions (<13,000), in part because of an overrepresentation among the former in multiallelic tandem repeat variation, especially (AC)(n) dinucleotide microsatellites. The role of microsatellites in gene expression variation may provide a larger store of heritable phenotypic variation, and a more rapid mutational input of such variation, than has been realized. Finally, we outline the distinctive consequences of cis-regulatory variation for the genotype-phenotype relationship, including ubiquitous epistasis and genotype-by-environment interactions, as well as underappreciated modes of pleiotropy and overdominance. Ordinary small-scale mutations contribute to pervasive variation in transcription rates and consequently to patterns of human phenotypic variation.

  5. Abundant raw material for cis-regulatory evolution in humans

    NASA Technical Reports Server (NTRS)

    Rockman, Matthew V.; Wray, Gregory A.

    2002-01-01

    Changes in gene expression and regulation--due in particular to the evolution of cis-regulatory DNA sequences--may underlie many evolutionary changes in phenotypes, yet little is known about the distribution of such variation in populations. We present in this study the first survey of experimentally validated functional cis-regulatory polymorphism. These data are derived from more than 140 polymorphisms involved in the regulation of 107 genes in Homo sapiens, the eukaryote species with the most available data. We find that functional cis-regulatory variation is widespread in the human genome and that the consequent variation in gene expression is twofold or greater for 63% of the genes surveyed. Transcription factor-DNA interactions are highly polymorphic, and regulatory interactions have been gained and lost within human populations. On average, humans are heterozygous at more functional cis-regulatory sites (>16,000) than at amino acid positions (<13,000), in part because of an overrepresentation among the former in multiallelic tandem repeat variation, especially (AC)(n) dinucleotide microsatellites. The role of microsatellites in gene expression variation may provide a larger store of heritable phenotypic variation, and a more rapid mutational input of such variation, than has been realized. Finally, we outline the distinctive consequences of cis-regulatory variation for the genotype-phenotype relationship, including ubiquitous epistasis and genotype-by-environment interactions, as well as underappreciated modes of pleiotropy and overdominance. Ordinary small-scale mutations contribute to pervasive variation in transcription rates and consequently to patterns of human phenotypic variation.

  6. Distant cis Regulatory Elements in Human Skeletal Muscle Differentiation

    PubMed Central

    McCord, Rachel Patton; Zhou, Vicky W.; Yuh, Tiffany; Bulyk, Martha L.

    2011-01-01

    Identifying gene regulatory elements and their target genes in human cells remains a significant challenge. Despite increasing evidence of physical interactions between distant regulatory elements and gene promoters in mammalian cells, many studies consider only promoter-proximal regulatory regions. We identify putative cis-regulatory modules (CRMs) in human skeletal muscle differentiation by combining myogenic TF binding data before and after differentiation with histone modification data in myoblasts. CRMs that are distant (>20 kb) from muscle gene promoters are common and are more likely than proximal promoter regions to show differentiation-specific changes in myogenic TF binding. We find that two of these distant CRMs, known to activate transcription in differentiating myoblasts, interact physically with gene promoters (PDLIM3 and ACTA1) during differentiation. Our results highlight the importance of considering distal CRMs in investigations of mammalian gene regulation and support the hypothesis that distant CRM-promoter looping contacts are a general mechanism of gene regulation. PMID:21907276

  7. Fate of pathogenic bacteria in microcosms mimicking human body sites.

    PubMed

    Castellani, Francesco; Ghidini, Valentina; Tafi, Maria Carla; Boaretti, Marzia; Lleo, Maria M

    2013-07-01

    During the infectious process, pathogens may reach anatomical sites where they are exposed to substances interfering with their growth. These substances can include molecules produced by the host, and his resident microbial population, as well as exogenous antibacterial drugs. Suboptimal concentrations of inhibitory molecules and stress conditions found in vivo (high or low temperatures, lack of oxygen, extreme pH) might induce in bacteria the activation of survival mechanisms blocking their division capability but allowing them to stay alive. These "dormant" bacteria can be reactivated in particular circumstances and would be able to express their virulence traits. In this study, it was evaluated the effect of some environmental conditions, such as optimal and suboptimal temperatures, direct light and antibiotic sub-inhibitory concentrations doses of antibiotic, on the human pathogens Escherichia coli and Enterococcus faecalis when incubated in fluids accumulated in the body of patients with different pathologies. It is shown that inoculation in a number of accumulated body fluids and the presence of gentamicin, reliable conditions encountered during pathological states, induce stress-responding strategies enabling bacteria to persist in microcosms mimicking the human body. Significant differences were detected in Gram-negative and Gram-positive species with E. faecalis surviving, as starved or viable but non-culturable forms, in any microcosm and condition tested and E. coli activating a viable but non-culturable state only in some clinical samples. The persistence of bacteria under these conditions, being non-culturable, might explain some recurrent infections without isolation of the causative agent after application of the standard microbiological methods.

  8. The Influence of 13-cis Retinoic Acid on Human Meibomian Gland Epithelial Cells

    PubMed Central

    Ding, Juan; Kam, Wendy R.; Dieckow, Julia; Sullivan, David A.

    2013-01-01

    Purpose. Meibomian gland dysfunction (MGD) is a primary cause of dry eye disease. One of the risk factors for MGD is exposure to 13-cis retinoic acid (13-cis RA), a metabolite of vitamin A. However, the mechanism is not well understood. We hypothesize that 13-cis RA inhibits cell proliferation, promotes cell death, alters gene and protein expressions, and attenuates cell survival pathways in human meibomian gland epithelial cells. Methods. To test our hypotheses, immortalized human meibomian gland epithelial cells were cultured with or without 13-cis RA for varying doses and time. Cell proliferation, cell death, gene expression, and proteins involved in proliferation/survival and inflammation were evaluated. Results. We found that 13-cis RA inhibited cell proliferation, induced cell death, and significantly altered the expression of 6726 genes, including those involved in cell proliferation, cell death, differentiation, keratinization, and inflammation, in human meibomian gland epithelial cells. Further, 13-cis RA also reduced the phosphorylation of Akt and increased the generation of interleukin-1β and matrix metallopeptidase 9. Conclusions. Exposure to 13-cis RA inhibits cell proliferation, increases cell death, alters gene expression, changes signaling pathways, and promotes inflammatory mediator and protease expression in meibomian gland epithelial cells. These effects may be responsible, at least in part, for the 13-cis RA–related induction of MGD. PMID:23722388

  9. Global reorganisation of cis-regulatory units upon lineage commitment of human embryonic stem cells.

    PubMed

    Freire-Pritchett, Paula; Schoenfelder, Stefan; Várnai, Csilla; Wingett, Steven W; Cairns, Jonathan; Collier, Amanda J; García-Vílchez, Raquel; Furlan-Magaril, Mayra; Osborne, Cameron S; Fraser, Peter J; Rugg-Gunn, Peter J; Spivakov, Mikhail

    2017-03-23

    Long-range cis-regulatory elements such as enhancers coordinate cell-specific transcriptional programmes by engaging in DNA looping interactions with target promoters. Deciphering the interplay between the promoter connectivity and activity of cis-regulatory elements during lineage commitment is crucial for understanding developmental transcriptional control. Here, we use Promoter Capture Hi-C to generate a high-resolution atlas of chromosomal interactions involving ~22,000 gene promoters in human pluripotent and lineage-committed cells, identifying putative target genes for known and predicted enhancer elements. We reveal extensive dynamics of cis-regulatory contacts upon lineage commitment, including the acquisition and loss of promoter interactions. This spatial rewiring occurs preferentially with predicted changes in the activity of cis-regulatory elements, and is associated with changes in target gene expression. Our results provide a global and integrated view of promoter interactome dynamics during lineage commitment of human pluripotent cells.

  10. cis-Regulatory Mutations Are a Genetic Cause of Human Limb Malformations

    PubMed Central

    VanderMeer, Julia E.; Ahituv, Nadav

    2011-01-01

    The underlying mutations that cause human limb malformations are often difficult to determine, particularly for limb malformations that occur as isolated traits. Evidence from a variety of studies shows that cis-regulatory mutations, specifically in enhancers, can lead to some of these isolated limb malformations. Here, we provide a review of human limb malformations that have been shown to be caused by enhancer mutations and propose that cis-regulatory mutations will continue to be identified as the cause of additional human malformations as our understanding of regulatory sequences improves. PMID:21509892

  11. Mimicking the human smell sensing mechanism with an artificial nose platform.

    PubMed

    Lee, Sang Hun; Kwon, Oh Seok; Song, Hyun Seok; Park, Seon Joo; Sung, Jong Hwan; Jang, Jyongsik; Park, Tai Hyun

    2012-02-01

    Sensing smell is a highly complex biological process, and characterizing and mimicking the interaction between the olfactory receptor (OR) protein and its ligands is extremely challenging. Herein, we report a highly sensitive and selective human nose-like nanobioelectronic nose (nbe-nose), which responds to gaseous odorants sensitively and selectively, has a signal specificity pattern similar to that in the cellular signal transduction pathway, and maintains an antagonistic behavior similar to the human nose. The human olfaction mechanism was mimicked by using carboxylated polypyrrole nanotubes (CPNTs) functionalized with human OR protein. The nbe-nose was able to detect gaseous odorants at a concentration as low as 0.02 parts-per-trillion (ppt), which was comparable to a highly trained, human expert's nose. The nbe-nose can be used scientifically for smell mechanism studies. It can be also applied to various fields that rely on smell monitoring for industrial and public purposes.

  12. Humans mimicking animals: A cortical hierarchy for human vocal communication sounds

    PubMed Central

    Talkington, William J.; Rapuano, Kristina M.; Hitt, Laura; Frum, Chris A.; Lewis, James W.

    2012-01-01

    Numerous species possess cortical regions that are most sensitive to vocalizations produced by their own kind (conspecifics). In humans, the superior temporal sulci (STS) putatively represent homologous voice-sensitive areas of cortex. However, STS regions have recently been reported to represent auditory experience or “expertise” in general rather than showing exclusive sensitivity to human vocalizations per se. Using functional magnetic resonance imaging and a unique non-stereotypical category of complex human non-verbal vocalizations – human-mimicked versions of animal vocalizations – we found a cortical hierarchy in humans optimized for processing meaningful conspecific utterances. This left-lateralized hierarchy originated near primary auditory cortices and progressed into traditional speech-sensitive areas. These results suggest that the cortical regions supporting vocalization perception are initially organized by sensitivity to the human vocal tract in stages prior to the STS. Additionally, these findings have implications for the developmental time course of conspecific vocalization processing in humans as well as its evolutionary origins. PMID:22674283

  13. Enhancer divergence and cis-regulatory evolution in the human and chimp neural crest.

    PubMed

    Prescott, Sara L; Srinivasan, Rajini; Marchetto, Maria Carolina; Grishina, Irina; Narvaiza, Iñigo; Selleri, Licia; Gage, Fred H; Swigut, Tomek; Wysocka, Joanna

    2015-09-24

    cis-regulatory changes play a central role in morphological divergence, yet the regulatory principles underlying emergence of human traits remain poorly understood. Here, we use epigenomic profiling from human and chimpanzee cranial neural crest cells to systematically and quantitatively annotate divergence of craniofacial cis-regulatory landscapes. Epigenomic divergence is often attributable to genetic variation within TF motifs at orthologous enhancers, with a novel motif being most predictive of activity biases. We explore properties of this cis-regulatory change, revealing the role of particular retroelements, uncovering broad clusters of species-biased enhancers near genes associated with human facial variation, and demonstrating that cis-regulatory divergence is linked to quantitative expression differences of crucial neural crest regulators. Our work provides a wealth of candidates for future evolutionary studies and demonstrates the value of "cellular anthropology," a strategy of using in-vitro-derived embryonic cell types to elucidate both fundamental and evolving mechanisms underlying morphological variation in higher primates.

  14. Role of Human DNA Polymerase kappa in Extension Opposite from a cis-syn Thymine Dimer

    SciTech Connect

    R Vasquez-Del Carpio; T Silverstein; S Lone; R Johnson; L Prakash; S Prakash; A Aggarwal

    2011-12-31

    Exposure of DNA to UV radiation causes covalent linkages between adjacent pyrimidines. The most common lesion found in DNA from these UV-induced linkages is the cis-syn cyclobutane pyrimidine dimer. Human DNA polymerase {Kappa} (Pol{Kappa}), a member of the Y-family of DNA polymerases, is unable to insert nucleotides opposite the 3'T of a cis-syn T-T dimer, but it can efficiently extend from a nucleotide inserted opposite the 3'T of the dimer by another DNA polymerase. We present here the structure of human Pol{Kappa} in the act of inserting a nucleotide opposite the 5'T of the cis-syn T-T dimer. The structure reveals a constrained active-site cleft that is unable to accommodate the 3'T of a cis-syn T-T dimer but is remarkably well adapted to accommodate the 5'T via Watson-Crick base pairing, in accord with a proposed role for Pol{Kappa} in the extension reaction opposite from cyclobutane pyrimidine dimers in vivo.

  15. Computational identification of new structured cis-regulatory elements in the 3'-untranslated region of human protein coding genes.

    PubMed

    Chen, Xiaowei Sylvia; Brown, Chris M

    2012-10-01

    Messenger ribonucleic acids (RNAs) contain a large number of cis-regulatory RNA elements that function in many types of post-transcriptional regulation. These cis-regulatory elements are often characterized by conserved structures and/or sequences. Although some classes are well known, given the wide range of RNA-interacting proteins in eukaryotes, it is likely that many new classes of cis-regulatory elements are yet to be discovered. An approach to this is to use computational methods that have the advantage of analysing genomic data, particularly comparative data on a large scale. In this study, a set of structural discovery algorithms was applied followed by support vector machine (SVM) classification. We trained a new classification model (CisRNA-SVM) on a set of known structured cis-regulatory elements from 3'-untranslated regions (UTRs) and successfully distinguished these and groups of cis-regulatory elements not been strained on from control genomic and shuffled sequences. The new method outperformed previous methods in classification of cis-regulatory RNA elements. This model was then used to predict new elements from cross-species conserved regions of human 3'-UTRs. Clustering of these elements identified new classes of potential cis-regulatory elements. The model, training and testing sets and novel human predictions are available at: http://mRNA.otago.ac.nz/CisRNA-SVM.

  16. Identification of cis-suppression of human disease mutations by comparative genomics.

    PubMed

    Jordan, Daniel M; Frangakis, Stephan G; Golzio, Christelle; Cassa, Christopher A; Kurtzberg, Joanne; Davis, Erica E; Sunyaev, Shamil R; Katsanis, Nicholas

    2015-08-13

    Patterns of amino acid conservation have served as a tool for understanding protein evolution. The same principles have also found broad application in human genomics, driven by the need to interpret the pathogenic potential of variants in patients. Here we performed a systematic comparative genomics analysis of human disease-causing missense variants. We found that an appreciable fraction of disease-causing alleles are fixed in the genomes of other species, suggesting a role for genomic context. We developed a model of genetic interactions that predicts most of these to be simple pairwise compensations. Functional testing of this model on two known human disease genes revealed discrete cis amino acid residues that, although benign on their own, could rescue the human mutations in vivo. This approach was also applied to ab initio gene discovery to support the identification of a de novo disease driver in BTG2 that is subject to protective cis-modification in more than 50 species. Finally, on the basis of our data and models, we developed a computational tool to predict candidate residues subject to compensation. Taken together, our data highlight the importance of cis-genomic context as a contributor to protein evolution; they provide an insight into the complexity of allele effect on phenotype; and they are likely to assist methods for predicting allele pathogenicity.

  17. Interaction of Cis- and Trans-RuCl 2(DMSO)4 With Human Serum Albumin

    PubMed Central

    Kozlowski, Henryk; Katsaros, Nikolas

    2000-01-01

    The interaction between cis- and trans- RuCl2(DMSO)4 and human serum albumin have been investigated through UV-Vis, circular dichroism, fluorescence spectroscopy and inductively couplet plasma atomic emission spectroscopy (ICP(AES)) method Albumin can specifically bind 1 mole of cis-isomer and 2 moles of the trans-isomer RuCl2(DMSO)4 complex. The interaction of RuCl2(DMSO)4 with HSA causes: a conformational change with the loss of helical stability of protein; the strong quenching of the Trp 214 fluorescence indicating that the conformational change of the hydrophobic binding pocked in subdomain IIA takes place; a local perturbation of the warfarin binding site and induce some conformational changes at neighbour domains, a changing of the binding abilities towards heme. PMID:18475961

  18. Repair synthesis by human cell extracts in DNA damaged by cis- and trans-diamminedichloroplatinum(II).

    PubMed Central

    Hansson, J; Wood, R D

    1989-01-01

    DNA damage was induced in closed circular plasmid DNA by treatment with cis- or trans-diamminedichloroplatinum(II). These plasmids were used as substrates in reactions to give quantitative measurements of DNA repair synthesis mediated by cell free extracts from human lymphoid cell lines. Adducts induced by both drugs stimulated repair synthesis in a dose dependent manner by an ATP-requiring process. Measurements by an isopycnic gradient sedimentation method gave an upper limit for the average patch sizes in this in vitro system of around 140 nucleotides. It was estimated that up to 3% of the drug adducts induce the synthesis of a repair patch. The repair synthesis is due to repair of a small fraction of frequent drug adducts, rather than extensive repair of a rare subclass of lesions. Nonspecific DNA synthesis in undamaged plasmids, caused by exonucleolytic degradation and resynthesis, was reduced by repeated purification of intact circular forms. An extract made from cells belonging to xeroderma pigmentosum complementation group A was deficient in repair synthesis in response to the presence of cis- or trans-diamminedichloroplatinum(II) adducts in DNA. Images PMID:2554251

  19. Metabolism of (-)-cis- and (-)-trans-rose oxide by cytochrome P450 enzymes in human liver microsomes.

    PubMed

    Nakahashi, Hiroshi; Yamamura, Yuuki; Usami, Atsushi; Rangsunvigit, Pramoch; Malakul, Pomthong; Miyazawa, Mitsuo

    2015-12-01

    The in vitro metabolism of (-)-cis- and (-)-trans-rose oxide was investigated using human liver microsomes and recombinant cytochrome P450 (P450 or CYP) enzymes for the first time. Both isomers of rose oxide were incubated with human liver microsomes, and the formation of the respective 9-oxidized metabolite were determined using gas chromatography-mass spectrometry (GC-MS). Of 11 different recombinant human P450 enzymes used, CYP2B6 and CYP2C19 were the primary enzymes catalysing the metabolism of (-)-cis- and (-)-trans-rose oxide. CYP1A2 also efficiently oxidized (-)-cis-rose oxide at the 9-position but not (-)-trans-rose oxide. α-Naphthoflavone (a selective CYP1A2 inhibitor), thioTEPA (a CYP2B6 inhibitor) and anti-CYP2B6 antibody inhibited (-)-cis-rose oxide 9-hydroxylation catalysed by human liver microsomes. On the other hand, the metabolism of (-)-trans-rose oxide was suppressed by thioTEPA and anti-CYP2B6 at a significant level in human liver microsomes. However, omeprazole (a CYP2C19 inhibitor) had no significant effects on the metabolism of both isomers of rose oxide. Using microsomal preparations from nine different human liver samples, (-)-9-hydroxy-cis- and (-)-9-hydroxy-trans-rose oxide formations correlated with (S)-mephenytoin N-demethylase activity (CYP2B6 marker activity). These results suggest that CYP2B6 plays important roles in the metabolism of (-)-cis- and (-)-trans-rose oxide in human liver microsomes.

  20. A heterogeneous human tissue mimicking phantom for RF heating and MRI thermal monitoring verification

    NASA Astrophysics Data System (ADS)

    Yuan, Yu; Wyatt, Cory; Maccarini, Paolo; Stauffer, Paul; Craciunescu, Oana; MacFall, James; Dewhirst, Mark; Das, Shiva K.

    2012-04-01

    This paper describes a heterogeneous phantom that mimics a human thigh with a deep-seated tumor, for the purpose of studying the performance of radiofrequency (RF) heating equipment and non-invasive temperature monitoring with magnetic resonance imaging (MRI). The heterogeneous cylindrical phantom was constructed with an outer fat layer surrounding an inner core of phantom material mimicking muscle, tumor and marrow-filled bone. The component materials were formulated to have dielectric and thermal properties similar to human tissues. The dielectric properties of the tissue mimicking phantom materials were measured with a microwave vector network analyzer and impedance probe over the frequency range of 80-500 MHz and at temperatures of 24, 37 and 45 °C. The specific heat values of the component materials were measured using a differential scanning calorimeter over the temperature range of 15-55 °C. The thermal conductivity value was obtained from fitting the curves obtained from one-dimensional heat transfer measurement. The phantom was used to verify the operation of a cylindrical four-antenna annular phased array extremity applicator (140 MHz) by examining the proton resonance frequency shift (PRFS) thermal imaging patterns for various magnitude/phase settings (including settings to focus heating in tumors). For muscle and tumor materials, MRI was also used to measure T1/T2* values (1.5 T) and to obtain the slope of the PRFS phase change versus temperature change curve. The dielectric and thermal properties of the phantom materials were in close agreement to well-accepted published results for human tissues. The phantom was able to successfully demonstrate satisfactory operation of the tested heating equipment. The MRI-measured thermal distributions matched the expected patterns for various magnitude/phase settings of the applicator, allowing the phantom to be used as a quality assurance tool. Importantly, the material formulations for the various tissue types

  1. A heterogeneous human tissue mimicking phantom for RF heating and MRI thermal monitoring verification.

    PubMed

    Yuan, Yu; Wyatt, Cory; Maccarini, Paolo; Stauffer, Paul; Craciunescu, Oana; Macfall, James; Dewhirst, Mark; Das, Shiva K

    2012-04-07

    This paper describes a heterogeneous phantom that mimics a human thigh with a deep-seated tumor, for the purpose of studying the performance of radiofrequency (RF) heating equipment and non-invasive temperature monitoring with magnetic resonance imaging (MRI). The heterogeneous cylindrical phantom was constructed with an outer fat layer surrounding an inner core of phantom material mimicking muscle, tumor and marrow-filled bone. The component materials were formulated to have dielectric and thermal properties similar to human tissues. The dielectric properties of the tissue mimicking phantom materials were measured with a microwave vector network analyzer and impedance probe over the frequency range of 80-500 MHz and at temperatures of 24, 37 and 45 °C. The specific heat values of the component materials were measured using a differential scanning calorimeter over the temperature range of 15-55 °C. The thermal conductivity value was obtained from fitting the curves obtained from one-dimensional heat transfer measurement. The phantom was used to verify the operation of a cylindrical four-antenna annular phased array extremity applicator (140 MHz) by examining the proton resonance frequency shift (PRFS) thermal imaging patterns for various magnitude/phase settings (including settings to focus heating in tumors). For muscle and tumor materials, MRI was also used to measure T1/T2* values (1.5 T) and to obtain the slope of the PRFS phase change versus temperature change curve. The dielectric and thermal properties of the phantom materials were in close agreement to well-accepted published results for human tissues. The phantom was able to successfully demonstrate satisfactory operation of the tested heating equipment. The MRI-measured thermal distributions matched the expected patterns for various magnitude/phase settings of the applicator, allowing the phantom to be used as a quality assurance tool. Importantly, the material formulations for the various tissue types

  2. Cis-regulatory underpinnings of human GLI3 expression in embryonic craniofacial structures and internal organs.

    PubMed

    Abbasi, Amir A; Minhas, Rashid; Schmidt, Ansgar; Koch, Sabine; Grzeschik, Karl-Heinz

    2013-10-01

    The zinc finger transcription factor Gli3 is an important mediator of Sonic hedgehog (Shh) signaling. During early embryonic development Gli3 participates in patterning and growth of the central nervous system, face, skeleton, limb, tooth and gut. Precise regulation of the temporal and spatial expression of Gli3 is crucial for the proper specification of these structures in mammals and other vertebrates. Previously we reported a set of human intronic cis-regulators controlling almost the entire known repertoire of endogenous Gli3 expression in mouse neural tube and limbs. However, the genetic underpinning of GLI3 expression in other embryonic domains such as craniofacial structures and internal organs remain elusive. Here we demonstrate in a transgenic mice assay the potential of a subset of human/fish conserved non-coding sequences (CNEs) residing within GLI3 intronic intervals to induce reporter gene expression at known regions of endogenous Gli3 transcription in embryonic domains other than central nervous system (CNS) and limbs. Highly specific reporter expression was observed in craniofacial structures, eye, gut, and genitourinary system. Moreover, the comparison of expression patterns directed by these intronic cis-acting regulatory elements in mouse and zebrafish embryos suggests that in accordance with sequence conservation, the target site specificity of a subset of these elements remains preserved among these two lineages. Taken together with our recent investigations, it is proposed here that during vertebrate evolution the Gli3 expression control acquired multiple, independently acting, intronic enhancers for spatiotemporal patterning of CNS, limbs, craniofacial structures and internal organs.

  3. Exercise-mimicking treatment fails to increase Fndc5 mRNA & irisin secretion in primary human myotubes.

    PubMed

    Kurdiova, Timea; Balaz, Miroslav; Mayer, Alexander; Maderova, Denisa; Belan, Vitazoslav; Wolfrum, Christian; Ukropec, Jozef; Ukropcova, Barbara

    2014-06-01

    Irisin, myokine secreted by skeletal muscle, was suggested to mediate some of exercise health benefits via "browning" of white adipose tissue. However, mounting evidence contradicts the regulatory role of exercise for muscle irisin production/secretion in humans. Thus, we explored the direct effect of exercise-mimicking treatment on irisin in human primary muscle cells in vitro. Human primary muscle cell cultures were established from lean, obese prediabetic and type-2-diabetic individuals. Complex metabolic phenotyping included assessment of insulin sensitivity (euglycemic hyperinsulinemic clamp) and adiposity content&distribution (MRI&MRS). In vitro exercise-mimicking treatment (forskolin+ionomycin) was delivered in 1-h pulse/day during differentiation. Fndc5 mRNA (qRT-PCR) and secreted irisin (ELISA) were determined in cells and media. Exercise-mimicking treatment more than doubled Pgc1α mRNA in differentiated muscle cells. Nevertheless, Fndc5 mRNA was reduced by 18% and irisin in media by 20%. Moreover, Fncd5 mRNA was increased in myotubes derived from individuals with type-2-diabetes, independent on exercise-mimicking treatment. Fndc5 mRNA in cells was positively related to fasting glycemia (p=0.0001) and negatively to whole-body insulin sensitivity (p<0.05). Collectively, our data do not support the role of exercise-related signaling pathways in irisin regulation in human skeletal muscle and confirm our previous observations on increased Fndc5 expression in muscle cells from individuals with type-2-diabetes.

  4. Human chorionic gonadotropin induces human macrophages to form intracytoplasmic vacuoles mimicking Hofbauer cells in human chorionic villi.

    PubMed

    Yamaguchi, Munekage; Ohba, Takashi; Tashiro, Hironori; Yamada, Gen; Katabuchi, Hidetaka

    2013-01-01

    The most characteristic morphological feature of macrophages in the stroma of placental villi, known as Hofbauer cells, is their highly vacuolated appearance. They also show positive immunostaining for human chorionic gonadotropin (hCG) and express messenger ribonucleic acid of the luteinizing hormone/chorionic gonadotropin receptor with a deletion of exon 9 (LH/CG-R Δ9). Maternal hCG enters fetal plasma through the mesenchyme of the placental villi and promotes male sexual differentiation in early pregnancy; therefore, excess hCG may induce aberrant genital differentiation and hCG must be adjusted at the fetomaternal interface. We hypothesized that hCG is regulated by Hofbauer cells and that their peculiar vacuoles are involved in a cell-specific function. To assess the morphological modification and expression of LH/CG-R Δ9 in human macrophages after hCG exposure, the present study examined phorbol 12-myristate 13-acetate (PMA)-treated THP-1 cells, a human monocyte-macrophage cell line. hCG induced transient vacuole formation in PMA-treated THP-1 cells, morphologically mimicking Hofbauer cells. Immunocytochemistry showed that PMA-treated THP-1 cells incorporated hCG but not luteinizing hormone or follicle-stimulating hormone. Western blotting analyses demonstrated that PMA-treated THP-1 cells expressed an immunoreactive 60-kDa protein, designated as endogenous LH/CG-R Δ9. hCG induced a transient reduction in the LH/CG-R Δ9, which was synchronous with the appearance of cytoplasmic vacuoles. In conclusion, human macrophages regulating hCG via cytoplasmic LH/CG-R Δ9 mimic the morphological characteristics of Hofbauer cells. Their vacuoles may be associated with their cell-specific function to protect the fetus from exposure to excess maternal hCG during pregnancy.

  5. Pharmacokinetic correlation between experimental and clinical effects on human non-small cell lung cancers of cis-diammineglycolatoplatinum (254-S) and cis-diamminedichloroplatinum.

    PubMed

    Koenuma, M; Kasai, H; Uchida, N; Wada, T; Hattori, M; Oguma, T; Totani, T; Inaba, M

    1995-01-01

    We attempted to correlate the in vitro and in vivo antitumor activities of cis-diammineglycolatoplatinum (254-S), a novel platinum complex, and cis-diamminedichloro-platinum (CDDP) against the established culture cell lines and xenografts of human non-small cell lung cancer (NSCLC) with their clinical effects, based on the previous finding that the cytotoxicity of CDDP depends on the area under the curve (AUC). The concentration of 254-S and CDDP inhibiting the in vitro growth of 4 cultured NSCLC lines by 50% (IC50) was 0.82-7.8 and 0.53-4.2 micrograms/ml, respectively, showing a similar level. Of the 4 cell lines, only the most sensitive line, RERF-LC-AI, showed an IC50 close to a specific concentration (0.50 for 254-S and 0.32 micrograms/ml for CDDP) that reproduces in vitro the clinical AUCfree (24.8 and 5.34 micrograms-hr/ml) of the respective drugs. We treated 6 lines of human NSCLC xenografts implanted in nude mice with 254-S and CDDP at a particular dose (13.2 and 3.7 mg/kg) that is equivalent to the clinical doses with respect to the plasma AUCfree. 254-S and CDDP exhibited significant antitumor effects on 2 and 1 of the 6 lines, respectively. These in vitro and in vivo findings were considered to be relatively well correlated with the reported clinical response rates of 15-19% for 254-S and 14-15% for CDDP.

  6. Full Mimicking of Coronary Hemodynamics for Ex-Vivo Stimulation of Human Saphenous Veins.

    PubMed

    Piola, Marco; Ruiter, Matthijs; Vismara, Riccardo; Mastrullo, Valeria; Agrifoglio, Marco; Zanobini, Marco; Pesce, Maurizio; Soncini, Monica; Fiore, Gianfranco Beniamino

    2017-04-01

    After coronary artery bypass grafting, structural modifications of the saphenous vein wall lead to lumen narrowing in response to the altered hemodynamic conditions. Here we present the design of a novel ex vivo culture system conceived for mimicking central coronary artery hemodynamics, and we report the results of biomechanical stimulation experiments using human saphenous vein samples. The novel pulsatile system used an aortic-like pressure for forcing a time-dependent coronary-like resistance to obtain the corresponding coronary-like flow rate. The obtained pulsatile pressures and flow rates (diastolic/systolic: 80/120 mmHg and 200/100 mL/min, respectively) showed a reliable mimicking of the complex coronary hemodynamic environment. Saphenous vein segments from patients undergoing coronary artery bypass grafting (n = 12) were subjected to stimulation in our bioreactor with coronary pulsatile pressure/flow patterns or with venous-like perfusion. After 7-day stimulation, SVs were fixed and stained for morphometric evaluation and immunofluorescence. Results were compared with untreated segments of the same veins. Morphometric and immunofluorescence analysis revealed that 7 days of pulsatile stimulation: (i) did not affect integrity of the vessel wall and lumen perimeter, (ii) significantly decreased both intima and media thickness, (iii) led to partial endothelial denudation, and (iv) induced apoptosis in the vessel wall. These data are consistent with the early vessel remodeling events involved in venous bypass adaptation to arterial flow/pressure patterns. The pulsatile system proved to be a suitable device to identify ex vivo mechanical cues leading to graft adaptation.

  7. Bactericidal activity of the human skin fatty acid cis-6-hexadecanoic acid on Staphylococcus aureus.

    PubMed

    Cartron, Michaël L; England, Simon R; Chiriac, Alina Iulia; Josten, Michaele; Turner, Robert; Rauter, Yvonne; Hurd, Alexander; Sahl, Hans-Georg; Jones, Simon; Foster, Simon J

    2014-07-01

    Human skin fatty acids are a potent aspect of our innate defenses, giving surface protection against potentially invasive organisms. They provide an important parameter in determining the ecology of the skin microflora, and alterations can lead to increased colonization by pathogens such as Staphylococcus aureus. Harnessing skin fatty acids may also give a new avenue of exploration in the generation of control measures against drug-resistant organisms. Despite their importance, the mechanism(s) whereby skin fatty acids kill bacteria has remained largely elusive. Here, we describe an analysis of the bactericidal effects of the major human skin fatty acid cis-6-hexadecenoic acid (C6H) on the human commensal and pathogen S. aureus. Several C6H concentration-dependent mechanisms were found. At high concentrations, C6H swiftly kills cells associated with a general loss of membrane integrity. However, C6H still kills at lower concentrations, acting through disruption of the proton motive force, an increase in membrane fluidity, and its effects on electron transfer. The design of analogues with altered bactericidal effects has begun to determine the structural constraints on activity and paves the way for the rational design of new antistaphylococcal agents.

  8. Comprehensively Evaluating cis-Regulatory Variation in the Human Prostate Transcriptome by Using Gene-Level Allele-Specific Expression

    PubMed Central

    Larson, Nicholas B.; McDonnell, Shannon; French, Amy J.; Fogarty, Zach; Cheville, John; Middha, Sumit; Riska, Shaun; Baheti, Saurabh; Nair, Asha A.; Wang, Liang; Schaid, Daniel J.; Thibodeau, Stephen N.

    2015-01-01

    The identification of cis-acting regulatory variation in primary tissues has the potential to elucidate the genetic basis of complex traits and further our understanding of transcriptomic diversity across cell types. Expression quantitative trait locus (eQTL) association analysis using RNA sequencing (RNA-seq) data can improve upon the detection of cis-acting regulatory variation by leveraging allele-specific expression (ASE) patterns in association analysis. Here, we present a comprehensive evaluation of cis-acting eQTLs by analyzing RNA-seq gene-expression data and genome-wide high-density genotypes from 471 samples of normal primary prostate tissue. Using statistical models that integrate ASE information, we identified extensive cis-eQTLs across the prostate transcriptome and found that approximately 70% of expressed genes corresponded to a significant eQTL at a gene-level false-discovery rate of 0.05. Overall, cis-eQTLs were heavily concentrated near the transcription start and stop sites of affected genes, and effects were negatively correlated with distance. We identified multiple instances of cis-acting co-regulation by using phased genotype data and discovered 233 SNPs as the most strongly associated eQTLs for more than one gene. We also noted significant enrichment (25/50, p = 2E−5) of previously reported prostate cancer risk SNPs in prostate eQTLs. Our results illustrate the benefit of assessing ASE data in cis-eQTL analyses by showing better reproducibility of prior eQTL findings than of eQTL mapping based on total expression alone. Altogether, our analysis provides extensive functional context of thousands of SNPs in prostate tissue, and these results will be of critical value in guiding studies examining disease of the human prostate. PMID:25983244

  9. Comprehensively evaluating cis-regulatory variation in the human prostate transcriptome by using gene-level allele-specific expression.

    PubMed

    Larson, Nicholas B; McDonnell, Shannon; French, Amy J; Fogarty, Zach; Cheville, John; Middha, Sumit; Riska, Shaun; Baheti, Saurabh; Nair, Asha A; Wang, Liang; Schaid, Daniel J; Thibodeau, Stephen N

    2015-06-04

    The identification of cis-acting regulatory variation in primary tissues has the potential to elucidate the genetic basis of complex traits and further our understanding of transcriptomic diversity across cell types. Expression quantitative trait locus (eQTL) association analysis using RNA sequencing (RNA-seq) data can improve upon the detection of cis-acting regulatory variation by leveraging allele-specific expression (ASE) patterns in association analysis. Here, we present a comprehensive evaluation of cis-acting eQTLs by analyzing RNA-seq gene-expression data and genome-wide high-density genotypes from 471 samples of normal primary prostate tissue. Using statistical models that integrate ASE information, we identified extensive cis-eQTLs across the prostate transcriptome and found that approximately 70% of expressed genes corresponded to a significant eQTL at a gene-level false-discovery rate of 0.05. Overall, cis-eQTLs were heavily concentrated near the transcription start and stop sites of affected genes, and effects were negatively correlated with distance. We identified multiple instances of cis-acting co-regulation by using phased genotype data and discovered 233 SNPs as the most strongly associated eQTLs for more than one gene. We also noted significant enrichment (25/50, p = 2E-5) of previously reported prostate cancer risk SNPs in prostate eQTLs. Our results illustrate the benefit of assessing ASE data in cis-eQTL analyses by showing better reproducibility of prior eQTL findings than of eQTL mapping based on total expression alone. Altogether, our analysis provides extensive functional context of thousands of SNPs in prostate tissue, and these results will be of critical value in guiding studies examining disease of the human prostate.

  10. Insight into GATA1 transcriptional activity through interrogation of cis elements disrupted in human erythroid disorders

    PubMed Central

    Wakabayashi, Aoi; Ulirsch, Jacob C.; Ludwig, Leif S.; Fiorini, Claudia; Yasuda, Makiko; Choudhuri, Avik; McDonel, Patrick; Zon, Leonard I.; Sankaran, Vijay G.

    2016-01-01

    Whole-exome sequencing has been incredibly successful in identifying causal genetic variants and has revealed a number of novel genes associated with blood and other diseases. One limitation of this approach is that it overlooks mutations in noncoding regulatory elements. Furthermore, the mechanisms by which mutations in transcriptional cis-regulatory elements result in disease remain poorly understood. Here we used CRISPR/Cas9 genome editing to interrogate three such elements harboring mutations in human erythroid disorders, which in all cases are predicted to disrupt a canonical binding motif for the hematopoietic transcription factor GATA1. Deletions of as few as two to four nucleotides resulted in a substantial decrease (>80%) in target gene expression. Isolated deletions of the canonical GATA1 binding motif completely abrogated binding of the cofactor TAL1, which binds to a separate motif. Having verified the functionality of these three GATA1 motifs, we demonstrate strong evolutionary conservation of GATA1 motifs in regulatory elements proximal to other genes implicated in erythroid disorders, and show that targeted disruption of such elements results in altered gene expression. By modeling transcription factor binding patterns, we show that multiple transcription factors are associated with erythroid gene expression, and have created predictive maps modeling putative disruptions of their binding sites at key regulatory elements. Our study provides insight into GATA1 transcriptional activity and may prove a useful resource for investigating the pathogenicity of noncoding variants in human erythroid disorders. PMID:27044088

  11. Analysis of cis-elements that facilitate extrachromosomal persistence of human papillomavirus genomes

    SciTech Connect

    Pittayakhajonwut, Daraporn; Angeletti, Peter C.

    2008-05-10

    Human papillomaviruses (HPVs) are maintained latently in dividing epithelial cells as nuclear plasmids. Two virally encoded proteins, E1, a helicase, and E2, a transcription factor, are important players in replication and stable plasmid maintenance in host cells. Recent experiments in yeast have demonstrated that viral genomes retain replication and maintenance function independently of E1 and E2 [Angeletti, P.C., Kim, K., Fernandes, F.J., and Lambert, P.F. (2002). Stable replication of papillomavirus genomes in Saccharomyces cerevisiae. J. Virol. 76(7), 3350-8; Kim, K., Angeletti, P.C., Hassebroek, E.C., and Lambert, P.F. (2005). Identification of cis-acting elements that mediate the replication and maintenance of human papillomavirus type 16 genomes in Saccharomyces cerevisiae. J. Virol. 79(10), 5933-42]. Flow cytometry studies of EGFP-reporter vectors containing subgenomic HPV fragments with or without a human ARS (hARS), revealed that six fragments located in E6-E7, E1-E2, L1, and L2 regions showed a capacity for plasmid stabilization in the absence of E1 and E2 proteins. Interestingly, four fragments within E7, the 3' end of L2, and the 5' end of L1 exhibited stability in plasmids that lacked an hARS, indicating that they possess both replication and maintenance functions. Two fragments lying in E1-E2 and the 3' region of L1 were stable only in the presence of hARS, that they contained only maintenance function. Mutational analyses of HPV16-GFP reporter constructs provided evidence that genomes lacking E1 and E2 could replicate to an extent similar to wild type HPV16. Together these results support the concept that cellular factors influence HPV replication and maintenance, independently, and perhaps in conjunction with E1 and E2, suggesting a role in the persistent phase of the viral lifecycle.

  12. Identification of an intronic cis-acting element in the human dopamine transporter gene

    PubMed Central

    Zhao, Ying; Zhou, Yanhong; Lin, Zhicheng

    2017-01-01

    The human dopamine transporter gene (hDAT) encodes the dopamine transporter in dopamine (DA) neurons to regulate DA transmission. hDAT expression varies significantly from neuron to neuron, and from individual to individual so that dysregulation of hDAT is related to many neuropsychiatric disorders. It is critical to identify hDAT-specific cis-acting elements that regulate the hDAT expression. Previous studies showed that hDAT Intron 1 displayed inhibitory activity for reporter gene expression. Here we report that the hDAT Intron 1 contains a 121-bp fragment that down-regulated both SV40 and hDAT promoter activities by 80% in vitro. Subfragments of 121-bp still down-regulated the SV40 promoter but not the hDAT promoter, as supported by nuclear protein-binding activities. Collectively, 121-bp is a silencer in vitro that might coordinate with transcriptional activities both inside and outside 121-bp in regulation of hDAT. PMID:22160470

  13. Synthetic peptides mimicking the binding site of human acetylcholinesterase for its inhibitor fasciculin 2.

    PubMed

    Kafurke, Uwe; Erijman, Ariel; Aizner, Yonatan; Shifman, Julia M; Eichler, Jutta

    2015-09-01

    Molecules capable of mimicking protein binding and/or functional sites present useful tools for a range of biomedical applications, including the inhibition of protein-ligand interactions. Such mimics of protein binding sites can currently be generated through structure-based design and chemical synthesis. Computational protein design could be further used to optimize protein binding site mimetics through rationally designed mutations that improve intermolecular interactions or peptide stability. Here, as a model for the study, we chose an interaction between human acetylcholinesterase (hAChE) and its inhibitor fasciculin-2 (Fas) because the structure and function of this complex is well understood. Structure-based design of mimics of the hAChE binding site for Fas yielded a peptide that binds to Fas at micromolar concentrations. Replacement of hAChE residues known to be essential for its interaction with Fas with alanine, in this peptide, resulted in almost complete loss of binding to Fas. Computational optimization of the hAChE mimetic peptide yielded a variant with slightly improved affinity to Fas, indicating that more rounds of computational optimization will be required to obtain peptide variants with greatly improved affinity for Fas. CD spectra in the absence and presence of Fas point to conformational changes in the peptide upon binding to Fas. Furthermore, binding of the optimized hAChE mimetic peptide to Fas could be inhibited by hAChE, providing evidence for a hAChE-specific peptide-Fas interaction.

  14. A novel infant milk formula concept: Mimicking the human milk fat globule structure.

    PubMed

    Gallier, Sophie; Vocking, Karin; Post, Jan Andries; Van De Heijning, Bert; Acton, Dennis; Van Der Beek, Eline M; Van Baalen, Ton

    2015-12-01

    Human milk (HM) provides all nutrients to support an optimal growth and development of the neonate. The composition and structure of HM lipids, the most important energy provider, have an impact on the digestion, uptake and metabolism of lipids. In HM, the lipids are present in the form of dispersed fat globules: large fat droplets enveloped by a phospholipid membrane. Currently, infant milk formula (Control IMF) contains small fat droplets primarily coated by proteins. Recently, a novel IMF concept (Concept IMF) was developed with a different lipid architecture, Nuturis(®), comprising large fat droplets with a phospholipid coating. Confocal laser scanning microscopy (CLSM), with appropriate fluorescent probes, and transmission electron microscopy were used to determine and compare the interfacial composition and structure of HM fat globules, Concept IMF fat droplets and Control IMF fat droplets. The presence of a trilayer-structured HM fat globule membrane, composed of phospholipids, proteins, glycoproteins and cholesterol, was confirmed; in addition exosome-like vesicles are observed within cytoplasmic crescents. The Control IMF fat droplets had a thick protein-only interface. The Concept IMF fat droplets showed a very thin interface composed of a mixture of phospholipids, proteins and cholesterol. Furthermore, the Concept IMF contained fragments of milk fat globule membrane, which has been suggested to have potential biological functions in infants. By mimicking more closely the structure and composition of HM fat globules, this novel IMF concept with Nuturis(®) may have metabolic and digestive properties that are more similar to HM compared to Control IMF.

  15. Human immunodeficiency virus-positive secondary syphilis mimicking cutaneous T-cell lymphoma.

    PubMed

    Yamashita, Michiko; Fujii, Yoshiyuki; Ozaki, Keiji; Urano, Yoshio; Iwasa, Masami; Nakamura, Shingen; Fujii, Shiro; Abe, Masahiro; Sato, Yasuharu; Yoshino, Tadashi

    2015-10-08

    Malignant syphilis or lues maligna is a severe form of secondary syphilis that was commonly reported in the pre-antibiotic era, and has now reemerged with the advent of the human immunodeficiency virus (HIV) epidemic. However, the characteristic histopathological findings of malignant syphilis remain controversial. The aim of this case report was to clarify the clinical and histopathological findings of HIV-positive malignant secondary syphilis. A Japanese man in his forties complained of fever, skin lesions, headache, and myalgia without lymphadenopathy during the previous 4 weeks. The skin lesions manifested as erythematous, nonhealing, ulcerated papules scattered on his trunk, extremities, palm, and face. Although the skin lesions were suspected to be cutaneous T-cell lymphomas on histological analyses, they lacked T-cell receptor Jγ rearrangement; moreover, immunohistochemical analyses confirmed the presence of spirochetes. The patient was administered antibiotics and anti-retroviral therapy, which dramatically improved the symptoms. On the basis of these observations of the skin lesions, we finally diagnosed the patient with HIV-associated secondary syphilis that mimicked cutaneous T-cell lymphoma. The patient's systemic CD4+ lymphocyte count was very low, and the infiltrate was almost exclusively composed of CD8+ atypical lymphocytes; therefore, the condition was easily misdiagnosed as cutaneous lymphoma. Although the abundance of plasma cells is a good indicator of malignant syphilis on skin histological analyses, in some cases, the plasma cell count may be very low. Therefore, a diagnosis of malignant secondary syphilis should be considered before making a diagnosis of primary cutaneous peripheral T-cell lymphoma or lymphoma associated with HIV infection.

  16. Research Objectives for Human Missions in the Proving Ground of Cis-Lunar Space

    NASA Astrophysics Data System (ADS)

    Spann, James; Niles, Paul B.; Eppler, Dean B.; Kennedy, Kriss J.; Lewis, Ruthan.; Sullivan, Thomas A.

    2016-04-01

    Introduction: This talk will introduce the preliminary findings in support of NASA's Future Capabilities Team. In support of the ongoing studies conducted by NASA's Future Capabilities Team, we are tasked with collecting research objectives for the Proving Ground activities. The objectives could include but are certainly not limited to: demonstrating crew well being and performance over long duration missions, characterizing lunar volatiles, Earth monitoring, near Earth object search and identification, support of a far-side radio telescope, and measuring impact of deep space environment on biological systems. Beginning in as early as 2023, crewed missions beyond low Earth orbit will begin enabled by the new capabilities of the SLS and Orion vehicles. This will initiate the "Proving Ground" phase of human exploration with Mars as an ultimate destination. The primary goal of the Proving Ground is to demonstrate the capability of suitably long duration spaceflight without need of continuous support from Earth, i.e. become Earth Independent. A major component of the Proving Ground phase is to conduct research activities aimed at accomplishing major objectives selected from a wide variety of disciplines including but not limited to: Astronomy, Heliophysics, Fundamental Physics, Planetary Science, Earth Science, Human Systems, Fundamental Space Biology, Microgravity, and In Situ Resource Utilization. Mapping and prioritizing the most important objectives from these disciplines will provide a strong foundation for establishing the architecture to be utilized in the Proving Ground. Possible Architectures: Activities and objectives will be accomplished during the Proving Ground phase using a deep space habitat. This habitat will potentially be accompanied by a power/propulsion bus capable of moving the habitat to accomplish different objectives within cis-lunar space. This architecture can also potentially support staging of robotic and tele-robotic assets as well as

  17. Research Objectives for Human Missions in the Proving Ground of Cis-Lunar Space

    NASA Astrophysics Data System (ADS)

    Spann, James; Niles, Paul; Eppler, Dean; Kennedy, Kriss; Lewis, Ruthan; Sullivan, Thomas

    2016-07-01

    Introduction: This talk will introduce the preliminary findings in support of NASA's Future Capabilities Team. In support of the ongoing studies conducted by NASA's Future Capabilities Team, we are tasked with collecting re-search objectives for the Proving Ground activities. The objectives could include but are certainly not limited to: demonstrating crew well being and performance over long duration missions, characterizing lunar volatiles, Earth monitoring, near Earth object search and identification, support of a far-side radio telescope, and measuring impact of deep space environment on biological systems. Beginning in as early as 2023, crewed missions beyond low Earth orbit will be enabled by the new capabilities of the SLS and Orion vehicles. This will initiate the "Proving Ground" phase of human exploration with Mars as an ultimate destination. The primary goal of the Proving Ground is to demonstrate the capability of suitably long dura-tion spaceflight without need of continuous support from Earth, i.e. become Earth Independent. A major component of the Proving Ground phase is to conduct research activities aimed at accomplishing major objectives selected from a wide variety of disciplines including but not limited to: Astronomy, Heliophysics, Fun-damental Physics, Planetary Science, Earth Science, Human Systems, Fundamental Space Biology, Microgravity, and In Situ Resource Utilization. Mapping and prioritizing the most important objectives from these disciplines will provide a strong foundation for establishing the architecture to be utilized in the Proving Ground. Possible Architectures: Activities and objectives will be accomplished during the Proving Ground phase using a deep space habitat. This habitat will potentially be accompanied by a power/propulsion bus capable of moving the habitat to accomplish different objectives within cis-lunar space. This architecture can also potentially support stag-ing of robotic and tele-robotic assets as well as

  18. Powerful Identification of Cis-regulatory SNPs in Human Primary Monocytes Using Allele-Specific Gene Expression

    PubMed Central

    Almlöf, Jonas Carlsson; Lundmark, Per; Lundmark, Anders; Ge, Bing; Maouche, Seraya; Göring, Harald H. H.; Liljedahl, Ulrika; Enström, Camilla; Brocheton, Jessy; Proust, Carole; Godefroy, Tiphaine; Sambrook, Jennifer G.; Jolley, Jennifer; Crisp-Hihn, Abigail; Foad, Nicola; Lloyd-Jones, Heather; Stephens, Jonathan; Gwilliam, Rhian; Rice, Catherine M.; Hengstenberg, Christian; Samani, Nilesh J.; Erdmann, Jeanette; Schunkert, Heribert; Pastinen, Tomi; Deloukas, Panos; Goodall, Alison H.; Ouwehand, Willem H.; Cambien, François; Syvänen, Ann-Christine

    2012-01-01

    A large number of genome-wide association studies have been performed during the past five years to identify associations between SNPs and human complex diseases and traits. The assignment of a functional role for the identified disease-associated SNP is not straight-forward. Genome-wide expression quantitative trait locus (eQTL) analysis is frequently used as the initial step to define a function while allele-specific gene expression (ASE) analysis has not yet gained a wide-spread use in disease mapping studies. We compared the power to identify cis-acting regulatory SNPs (cis-rSNPs) by genome-wide allele-specific gene expression (ASE) analysis with that of traditional expression quantitative trait locus (eQTL) mapping. Our study included 395 healthy blood donors for whom global gene expression profiles in circulating monocytes were determined by Illumina BeadArrays. ASE was assessed in a subset of these monocytes from 188 donors by quantitative genotyping of mRNA using a genome-wide panel of SNP markers. The performance of the two methods for detecting cis-rSNPs was evaluated by comparing associations between SNP genotypes and gene expression levels in sample sets of varying size. We found that up to 8-fold more samples are required for eQTL mapping to reach the same statistical power as that obtained by ASE analysis for the same rSNPs. The performance of ASE is insensitive to SNPs with low minor allele frequencies and detects a larger number of significantly associated rSNPs using the same sample size as eQTL mapping. An unequivocal conclusion from our comparison is that ASE analysis is more sensitive for detecting cis-rSNPs than standard eQTL mapping. Our study shows the potential of ASE mapping in tissue samples and primary cells which are difficult to obtain in large numbers. PMID:23300628

  19. Metabolism in humans of cis-12,trans-15-octadecadienoic acid relative to palmitic, stearic, oleic and linoleic acids

    SciTech Connect

    Emken, E.A.; Rohwedder, W.K.; Adlof, R.O.; Rakoff, H.; Gulley, R.M.

    1987-07-01

    Mixtures of triglycerides containing deuterium-labeled hexadecanoic acid (16:0), octadecanoic acid (18:0), cis-9-octadecenoic acid (9c-18:1), cis-9,cis-12-octadecadienoic acid (9c, 12c-18:2) and cis-12,trans-15-octadecadienoic acid (12c,15t-18:2) were fed to two young-adult males. Plasma lipid classes were isolated from samples collected periodically over 48 hr. Incorporation and turnover of the deuterium-labeled fats in plasma lipids were followed by gas chromatography-mass spectrometry (GC-MS) analysis of the methyl ester derivatives. Absorption of the deuterated fats was followed by GC-MS analysis of chylomicron triglycerides isolated by ultracentrifugation. Results were the following: (i) endogenous fat contributed about 40% of the total fat incorporated into chylomicron triglycerides; (ii) elongation, desaturation and chain-shortened products from the deuterated fats were not detected; (iii) the polyunsaturated isomer 12c,15t-18:2 was metabolically more similar to saturated and 9c-18:1 fatty acids than to 9c,12c-18:2; (iv) relative incorporation of 9c,12c-18:2 into phospholipids did not increase proportionally with an increase of 9c,12c-18:2 in the mixture of deuterated fats fed; (v) absorption of 16:0, 18:0, 9c-18:1, 9c,12c-18:2 and 12c,15t-18:2 were similar; and (vi) data for the 1- and 2-acyl positions of phosphatidylcholine and for cholesteryl ester fractions reflected the known high specificity of phosphatidylcholine acyltransferase and lecithin:cholesteryl acyltransferase for 9c,12c-18:2. These results illustrate that incorporation of dietary fatty acids into human plasma lipid classes is selectively controlled and that incorporation of dietary 9c,12c-18:2 is limited.

  20. Allelic imbalance identifies novel tissue specific cis-regulatory variation for human UGT2B15

    PubMed Central

    Sun, Chang; Southard, Catherine; Witonsky, David B.; Olopade, Olufunmilayo I.; Di Rienzo, Anna

    2010-01-01

    Allelic imbalance (AI) is a powerful tool to identify cis-regulatory variation for gene expression. UGT2B15 is an important enzyme involved in the metabolism of multiple endobiotics and xenobiotics. In this study, we measured the relative expression of two alleles at this gene by using SNP rs1902023:G>T. An excess of the G over the T allele was consistently observed in liver (P<0.001), but not in breast (P=0.06) samples, suggesting that SNPs in strong linkage disequilibrium with G253T regulate UGT2B15 expression in liver. Seven such SNPs were identified by resequencing the promoter and exon 1, which define two distinct haplotypes. Reporter gene assays confirmed that one haplotype displayed ~20% higher promoter activity compared to the other major haplotype in liver HepG2 (P<0.001), but not in breast MCF-7 (P=0.540) cells. Reporter gene assays with additional constructs pointed to rs34010522:G>T and rs35513228:C>T as the cis-regulatory variants; both SNPs were also evaluated in LNCaP and Caco-2 cells. By ChIP, we showed that the transcription factor Nrf2 binds to the region spanning rs34010522:G>T in all four cell lines. Our results provide a good example for how AI can be used to identify cis-regulatory variation and gain insights into the tissue specific regulation of gene expression. PMID:19847790

  1. Acute post-infectious cerebellar ataxia due to co-infection of human herpesvirus-6 and adenovirus mimicking myositis.

    PubMed

    Naselli, Aldo; Pala, Giovanna; Cresta, Federico; Finetti, Martina; Biancheri, Roberta; Renna, Salvatore

    2014-11-26

    Acute cerebellar ataxia (ACA) is a relatively common neurological disease in children. Most common types of ACA are acute post-infectious (APCA) and acute disseminated encephalomyelitis (ADEM). Less common but important causes include opsoclonus-myoclonus syndrome (OMS) and acute cerebellitis. Cerebellar neoplasms and acute hydrocephalus are additional causes of paediatric ataxia. APCA is the most common cause of ACA in children, comprising about 30-50% of total cases. This is a report about an immunocompetent 4-yrs-old male affected by APCA, due to co-infection by human herpesvirus-6 (HHV-6) and adenovirus, with symptoms mimicking myositis.

  2. cis-Acting components of human papillomavirus (HPV) DNA replication: linker substitution analysis of the HPV type 11 origin.

    PubMed Central

    Russell, J; Botchan, M R

    1995-01-01

    Papillomavirus DNA replication requires the viral trans-acting factors E1 and E2 in addition to the host cell's general replication machinery. The origins of DNA replication in bovine and human papillomavirus genomes have been localized to a specific part of the upstream regulatory region (URR) which includes recognition sites for E1 and E2 proteins. To fine map cis-acting elements influencing human papillomavirus type 11 (HPV-11) DNA replication and to determine the relative contributions of such sites, we engineered consecutive linker substitution mutations across a region of 158 bp in the HPV-11 origin and tested mutant origins for replication function in a cell-based transient replication assay. Our results both confirm and extend the findings of others. E2 binding sites are the major cis components of HPV-11 DNA replication, and there is evidence for synergy between these sites. Differential capacity of the three E2 binding sites within the origin to affect replication may be attributed, at least in part, to context. At least one E2 binding site is essential for replication. The imperfect AT-rich palindrome of the E1 helicase binding site is not essential since replication occurs even in the absence of this sequence. However, replication is enhanced by the presence of the palindromic sequence in the HPV-11 origin. Sequence components adjacent to the E1 and E2 binding sites, comprising AT-rich and purine-rich elements and the consensus TATA box sequence, probably contribute to the overall efficiency of replication, though they are nonessential. None of the other cis elements of the HPV-11 origin region analyzed seems to influence replication significantly in the system described. The HPV-11 origin of DNA replication therefore differs from those of the other papovaviruses, simian virus 40 and polyomavirus, inasmuch as an intact helicase binding site and adjacent AT-rich components, while influential, are not absolutely essential. PMID:7815528

  3. Trans- and cis-2-phenylindole platinum(II) complexes as cytotoxic agents against human breast adenocarcinoma cell lines

    NASA Astrophysics Data System (ADS)

    Tomé, Maria; López, Concepción; González, Asensio; Ozay, Bahadir; Quirante, Josefina; Font-Bardía, Mercè; Calvet, Teresa; Calvis, Carme; Messeguer, Ramon; Baldomá, Laura; Badía, Josefa

    2013-09-01

    The synthesis and characterization of the new 2-phenylindole derivative: C8H3N-2-C6H5-3NOMe-5OMe (3c) and the trans- and cis-isomers of [Pt(3c)Cl2(DMSO)] complexes (4c and 5c, respectively) are described. The crystal structures of 4c·CH2Cl2 and 5c confirm: (a) the existence of a Pt-Nindole bond, (b) the relative arrangement of the Cl- ligands [trans- (in 4c) or cis- (in 5c)] and (c) the anti-(E) configuration of the oxime. The cytotoxic assessment of C8H3N-2-(C6H4-4‧R1)-3NOMe-5R2 [with R1 = R2 = H (3a); R1 = Cl, R2 = H (3b) and R1 = H, R2 = OMe (3c)] and the geometrical isomers of [Pt(L)Cl2(DMSO)] with L = 3a-3c [trans- (4a-4c) and cis- (5a-5c), respectively] against human breast adenocarcinoma cell lines (MDA-MB231 and MCF-7) is also reported and reveals that all the platinum(II) complexes (except 4a) are more cytotoxic than cisplatin in front of the MCF7 cell line. Electrophoretic DNA migration studies of the synthesized compounds in the absence and in the presence of topoisomerase-I have been performed, in order to get further insights into their mechanism of action.

  4. A Cis-acting locus determines the polymorphic parental imprinting of the human IGF2R gene

    SciTech Connect

    Xu, Y.; Polychronakos, C.

    1994-09-01

    The murine gene encoding the insulin-like growth factor receptor (IGF2R) is parentally imprinted in the mouse with exclusive maternal expression, but most humans express both gene copies. We have reported preferential expression of the maternal copy in approximately 17% of normal human pre-term placenta samples and in 50% of the kidneys of Wilms` tumor patients. Thus, IGF2R imprinting appears to be a polymorphic trait that may predispose to cancer. We explored the possibility that imprinting is associated with sequence variations of the imprinted domain itself (cis-acting locus). We studied 9 subjects with imprinted IGF2R expression that were informative for parental origin. These subjects were heterozygous for a transcribed CA repeat at the 3{prime}UTR of the gene, used for the study of the parental origin of mRNA transcripts. The two most common alleles, A162 and A164 (names refer to size in bp), were analyzed. In all cases the preferentially transcribed allele was maternal (p=0.002). In all 8 cases in which A164 was present, it was of paternal origin and was repressed (p=0.008), while A162 was maternal and preferentially expressed in 8/9 cases. Parental origin of A162 and A164 was random in individuals with biallelic expression. PCR amplification of genomic DNA after digestion with the methylation-sensitive enzyme HpaII revealed biallelic methylation at the 3{prime}UTR in both imprinting and non-imprinting individuals, making it unlikely that the imprint-controlling element (ICE) is located there. Polymorphic IGF2R imprinting depends on a cis-acting locus, at linkage disequilibrium with, but probably distinct from, our 3{prime}UTR marker. Biallelic expression in many subjects with a paternal A164 suggests that the frequency of the imprintable ICE is much lower than that of A164. Alternatively, the cis-locus is necessary but not sufficient and input in trans is additionally required for paternal-germline specific IGF2R repression.

  5. Oleic acid attenuates trans-10,cis-12 conjugated linoleic acid-mediated inflammatory gene expression in human adipocytes.

    PubMed

    Reardon, Meaghan; Gobern, Semone; Martinez, Kristina; Shen, Wan; Reid, Tanya; McIntosh, Michael

    2012-11-01

    The weight loss supplement conjugated linoleic acid (CLA) consists of an equal mixture of trans-10,cis-12 (10,12) and cis-9,trans-11 (9,11) isomers. However, high levels of mixed CLA isomers, or the 10,12 isomer, causes chronic inflammation, lipodystrophy, or insulin resistance. We previously demonstrated that 10,12 CLA decreases de novo lipid synthesis along with the abundance and activity of stearoyl-CoA desaturase (SCD)-1, a δ-9 desaturase essential for the synthesis of monounsaturated fatty acids (MUFA). Thus, we hypothesized that the 10,12 CLA-mediated decrease in SCD-1, with the subsequent decrease in MUFA, was responsible for the observed effects. To test this hypothesis, 10,12 CLA-treated human adipocytes were supplemented with oleic acid for 12 h to 7 days, and inflammatory gene expression, insulin-stimulated glucose uptake, and lipid content were measured. Oleic acid reduced inflammatory gene expression in a dose-dependent manner, and restored the lipid content of 10,12 CLA-treated adipocytes without improving insulin-stimulated glucose uptake. In contrast, supplementation with stearic acid, a substrate for SCD-1, or 9,11 CLA did not prevent inflammatory gene expression by 10,12 CLA. Notably, 10,12 CLA impacted the expression of several G-protein coupled receptors that was attenuated by oleic acid. Collectively, these data show that oleic acid attenuates 10,12 CLA-induced inflammatory gene expression and lipid content, possibly by alleviating cell stress caused by the inhibition of MUFA needed for phospholipid and neutral lipid synthesis.

  6. Précis of bayesian rationality: The probabilistic approach to human reasoning.

    PubMed

    Oaksford, Mike; Chater, Nick

    2009-02-01

    According to Aristotle, humans are the rational animal. The borderline between rationality and irrationality is fundamental to many aspects of human life including the law, mental health, and language interpretation. But what is it to be rational? One answer, deeply embedded in the Western intellectual tradition since ancient Greece, is that rationality concerns reasoning according to the rules of logic--the formal theory that specifies the inferential connections that hold with certainty between propositions. Piaget viewed logical reasoning as defining the end-point of cognitive development; and contemporary psychology of reasoning has focussed on comparing human reasoning against logical standards. Bayesian Rationality argues that rationality is defined instead by the ability to reason about uncertainty. Although people are typically poor at numerical reasoning about probability, human thought is sensitive to subtle patterns of qualitative Bayesian, probabilistic reasoning. In Chapters 1-4 of Bayesian Rationality (Oaksford & Chater 2007), the case is made that cognition in general, and human everyday reasoning in particular, is best viewed as solving probabilistic, rather than logical, inference problems. In Chapters 5-7 the psychology of "deductive" reasoning is tackled head-on: It is argued that purportedly "logical" reasoning problems, revealing apparently irrational behaviour, are better understood from a probabilistic point of view. Data from conditional reasoning, Wason's selection task, and syllogistic inference are captured by recasting these problems probabilistically. The probabilistic approach makes a variety of novel predictions which have been experimentally confirmed. The book considers the implications of this work, and the wider "probabilistic turn" in cognitive science and artificial intelligence, for understanding human rationality.

  7. Mapping cis-Regulatory Domains in the Human Genome UsingMulti-Species Conservation of Synteny

    SciTech Connect

    Ahituv, Nadav; Prabhakar, Shyam; Poulin, Francis; Rubin, EdwardM.; Couronne, Olivier

    2005-06-13

    Our inability to associate distant regulatory elements with the genes that they regulate has largely precluded their examination for sequence alterations contributing to human disease. One major obstacle is the large genomic space surrounding targeted genes in which such elements could potentially reside. In order to delineate gene regulatory boundaries we used whole-genome human-mouse-chicken (HMC) and human-mouse-frog (HMF) multiple alignments to compile conserved blocks of synteny (CBS), under the hypothesis that these blocks have been kept intact throughout evolution at least in part by the requirement of regulatory elements to stay linked to the genes that they regulate. A total of 2,116 and 1,942 CBS>200 kb were assembled for HMC and HMF respectively, encompassing 1.53 and 0.86 Gb of human sequence. To support the existence of complex long-range regulatory domains within these CBS we analyzed the prevalence and distribution of chromosomal aberrations leading to position effects (disruption of a genes regulatory environment), observing a clear bias not only for mapping onto CBS but also for longer CBS size. Our results provide a genome wide data set characterizing the regulatory domains of genes and the conserved regulatory elements within them.

  8. Research Objectives for Human Missions in the Proving Ground of Cis-Lunar Space

    NASA Technical Reports Server (NTRS)

    Niles, P. B.; Eppler, D. B.; Kennedy, K. J.; Lewis, R.; Spann, J. F.; Sullivan, T. A.

    2016-01-01

    Beginning in as early as 2023, crewed missions beyond low Earth orbit will begin enabled by the new capabilities of the SLS and Orion vehicles. This will initiate the "Proving Ground" phase of human exploration with Mars as an ultimate destination. The primary goal of the Proving Ground is to demonstrate the capability of suitably long duration spaceflight without need of continuous support from Earth, i.e. become Earth Independent. A major component of the Proving Ground phase is to conduct research activities aimed at accomplishing major objectives selected from a wide variety of disciplines including but not limited to: Astronomy, Heliophysics, Fundamental Physics, Planetary Science, Earth Science, Human Systems, Fundamental Space Biology, Microgravity, and In A major component of the Proving Ground phase is to conduct research activities aimed at accomplishing major objectives selected from a wide variety of disciplines including but not limited to: Astronomy, Heliophysics, Fundamental Physics, Planetary Science, Earth Science, Human Systems, Fundamental Space Biology, Microgravity, and In Situ Resource Utilization. Mapping and prioritizing the most important objectives from these disciplines will provide a strong foundation for establishing the architecture to be utilized in the Proving Ground.

  9. Enhancing fuzzy robot navigation systems by mimicking human visual perception of natural terrain traversibility

    NASA Technical Reports Server (NTRS)

    Tunstel, E.; Howard, A.; Edwards, D.; Carlson, A.

    2001-01-01

    This paper presents a technique for learning to assess terrain traversability for outdoor mobile robot navigation using human-embedded logic and real-time perception of terrain features extracted from image data.

  10. Insight into GATA1 transcriptional activity through interrogation of cis elements disrupted in human erythroid disorders.

    PubMed

    Wakabayashi, Aoi; Ulirsch, Jacob C; Ludwig, Leif S; Fiorini, Claudia; Yasuda, Makiko; Choudhuri, Avik; McDonel, Patrick; Zon, Leonard I; Sankaran, Vijay G

    2016-04-19

    Whole-exome sequencing has been incredibly successful in identifying causal genetic variants and has revealed a number of novel genes associated with blood and other diseases. One limitation of this approach is that it overlooks mutations in noncoding regulatory elements. Furthermore, the mechanisms by which mutations in transcriptionalcis-regulatory elements result in disease remain poorly understood. Here we used CRISPR/Cas9 genome editing to interrogate three such elements harboring mutations in human erythroid disorders, which in all cases are predicted to disrupt a canonical binding motif for the hematopoietic transcription factor GATA1. Deletions of as few as two to four nucleotides resulted in a substantial decrease (>80%) in target gene expression. Isolated deletions of the canonical GATA1 binding motif completely abrogated binding of the cofactor TAL1, which binds to a separate motif. Having verified the functionality of these three GATA1 motifs, we demonstrate strong evolutionary conservation of GATA1 motifs in regulatory elements proximal to other genes implicated in erythroid disorders, and show that targeted disruption of such elements results in altered gene expression. By modeling transcription factor binding patterns, we show that multiple transcription factors are associated with erythroid gene expression, and have created predictive maps modeling putative disruptions of their binding sites at key regulatory elements. Our study provides insight into GATA1 transcriptional activity and may prove a useful resource for investigating the pathogenicity of noncoding variants in human erythroid disorders.

  11. Liquid chromatographic analysis of the cis(Z)- and trans(E)-isomers of clopenthixol in human plasma using a novel solid phase extraction procedure.

    PubMed

    Pucci, Vincenzo; Bugamelli, Francesca; Mandrioli, Roberto; Bartoletti, Claudio; Rossi, Nicola; Raggi, Maria Augusta

    2003-07-25

    A simple and highly sensitive high-performance liquid chromatographic (HPLC) method for the simultaneous determination of cis(Z)-clopenthixol and trans(E)-clopenthixol in human plasma has been developed. The chromatographic analysis was carried out isocratically on a reversed-phase column (C(8) 150 x 4.6 mm I.D., 5 microm) using a mixture of 25 mM phosphate buffer and acetonitrile (65:35 v/v, pH* 3.0) as the mobile phase, and ultraviolet detection at 230 nm. Plasma sample pretreatment was accomplished by means of an original solid-phase extraction (SPE) procedure carried out on cyanopropyl cartridges, with a high extraction yield and good selectivity. Under the optimum conditions, calibration graphs of spiked human plasma samples were obtained over the concentration ranges 1-300 ng ml(-1) for cis(Z)-clopenthixol and 1-200 ng ml(-1) for trans(E)-clopenthixol. The limit of detection (LOD) was 0.3 ng ml(-1) for both cis(Z)- and trans(E)-isomers of clopenthixol. The method was successfully applied to the determination of cis(Z)-clopenthixol and trans(E)-clopenthixol in plasma samples of schizophrenic patients undergoing therapy with zuclopenthixol.

  12. Redox control of resistance to cis-diamminedichloroplatinum (II) (CDDP): protective effect of human thioredoxin against CDDP-induced cytotoxicity.

    PubMed Central

    Sasada, T; Iwata, S; Sato, N; Kitaoka, Y; Hirota, K; Nakamura, K; Nishiyama, A; Taniguchi, Y; Takabayashi, A; Yodoi, J

    1996-01-01

    Thioredoxin is a small ubiquitous protein with multiple biological functions, including cellular defense mechanisms against oxidative stress. In the present study, we investigated the role of human thioredoxin (hTRX) in the acquisition of cellular resistance to cis-diamminedichloroplatinum (II) (CDDP). The expression and activity of hTRX in Jurkat T cells was dose-dependently enhanced by exposure to CDDP, as determined by immunoblot analysis and insulin reducing assay. Furthermore, chloramphenicol acetyltransferase analysis using the hTRX promoter-reporter gene construct revealed that treatment of Jurkat cells with CDDP caused transcriptional activation of the hTRX gene, which might be mediated through increased generation of intracellular reactive oxygen intermediates. To examine the biological significance of hTRX induction, we established hTRX-overexpressing derivatives of L929 fibrosarcoma cells by stable transfection with the hTRX cDNA. The clones, which constitutively expressed the exogenous hTRX, displayed increased resistance to CDDP-induced cytotoxicity, compared with the control clones. After exposure to CDDP, the control cells showed a significant increase in the intracellular accumulation of peroxides, whereas the hTRX-transfected cells did not. Taken together, these results suggest that overexpressed hTRX is responsible for the development of cellular resistance to CDDP, possibly by scavenging intracellular toxic oxidants generated by this anticancer agent. PMID:8636406

  13. Long-range evolutionary constraints reveal cis-regulatory interactions on the human X chromosome

    PubMed Central

    Naville, Magali; Ishibashi, Minaka; Ferg, Marco; Bengani, Hemant; Rinkwitz, Silke; Krecsmarik, Monika; Hawkins, Thomas A.; Wilson, Stephen W.; Manning, Elizabeth; Chilamakuri, Chandra S. R.; Wilson, David I.; Louis, Alexandra; Lucy Raymond, F.; Rastegar, Sepand; Strähle, Uwe; Lenhard, Boris; Bally-Cuif, Laure; van Heyningen, Veronica; FitzPatrick, David R.; Becker, Thomas S.; Roest Crollius, Hugues

    2015-01-01

    Enhancers can regulate the transcription of genes over long genomic distances. This is thought to lead to selection against genomic rearrangements within such regions that may disrupt this functional linkage. Here we test this concept experimentally using the human X chromosome. We describe a scoring method to identify evolutionary maintenance of linkage between conserved noncoding elements and neighbouring genes. Chromatin marks associated with enhancer function are strongly correlated with this linkage score. We test >1,000 putative enhancers by transgenesis assays in zebrafish to ascertain the identity of the target gene. The majority of active enhancers drive a transgenic expression in a pattern consistent with the known expression of a linked gene. These results show that evolutionary maintenance of linkage is a reliable predictor of an enhancer's function, and provide new information to discover the genetic basis of diseases caused by the mis-regulation of gene expression. PMID:25908307

  14. Lessons learned from mice and man: mimicking human allergy through mouse models.

    PubMed

    Graham, Michelle T; Nadeau, Kari C

    2014-11-01

    The relevance of using mouse models to represent human allergic pathologies is still unclear. Recent studies suggest the limitations of using models as a standard for assessing immune response and tolerance mechanisms, as mouse models often do not sufficiently depict human atopic conditions. Allergy is a combination of aberrant responses to innocuous environmental agents and the subsequent TH2-mediated inflammatory responses. In this review, we will discuss current paradigms of allergy - specifically, TH2-mediated and IgE-associated immune responses - and current mouse models used to recreate these TH2-mediated pathologies. Our overall goal is to highlight discrepancies that exist between mice and men by examining the advantages and disadvantages of allergic mouse models with respect to the human allergic condition.

  15. Lycopene from heat-induced cis-isomer-rich tomato sauce is more bioavailable than from all-trans-rich tomato sauce in human subjects.

    PubMed

    Unlu, Nuray Z; Bohn, Torsten; Francis, David M; Nagaraja, Haikady N; Clinton, Steven K; Schwartz, Steven J

    2007-07-01

    Lycopene is present mainly as cis-isomers in human serum and tissues whereas all-trans-lycopene predominates in tomato products, suggesting that all-trans-lycopene is isomerised in the body or is less bioavailable. The objectives of the present study were to develop processing conditions for tomatoes to obtain products with different cis-trans-lycopene isomer distribution and to assess their bioavailability. Healthy adult subjects (n 12) were recruited for this randomised cross-over trial. Each intervention was preceded by a 2-week washout period. Two tomato sauces, one rich in all-trans-lycopene (32.5 mg total lycopene/100 g sauce; 5 % cis-isomers), the other high in cis-lycopene (26.4 mg total lycopene/100 g sauce; 45 % cis-isomers), were produced by different heat-processing techniques. Each sauce (150 g) was served in a standardised meal at 08.00 hours after overnight fasting. Plasma TAG-rich lipoprotein fractions over 9.5 h following test-meal consumption as a measure of lycopene absorption were obtained and expressed as baseline-corrected area under the concentration v. time curves (AUC), using HPLC-electrochemical detection. AUC values adjusted for the amount lycopene consumed showed that total, total cis-, and all-trans-lycopene responses were significantly higher from the cis-isomer-rich sauce, compared with the all-trans-rich sauce, being 7.30 (sem 1.45) v. 4.74 (sem 1.08) nmol x h/l (P = 0.002), 3.80 (sem 0.76) v. 1.98 (sem 0.37) nmol x h/l (P = 0.0005) and 3.50 (sem 0.76) v. 2.76 (sem 0.76) nmol x h/l (P = 0.01), respectively. The present study demonstrates significant lycopene bioavailability from cis-lycopene-rich tomato sauce and highlights the importance of considering isomer-distribution for lycopene bioavailability. Furthermore, processing parameters can be controlled to alter isomer patterns of tomato products and influence lycopene bioavailability.

  16. A dataset of stereoscopic images and ground-truth disparity mimicking human fixations in peripersonal space.

    PubMed

    Canessa, Andrea; Gibaldi, Agostino; Chessa, Manuela; Fato, Marco; Solari, Fabio; Sabatini, Silvio P

    2017-03-28

    Binocular stereopsis is the ability of a visual system, belonging to a live being or a machine, to interpret the different visual information deriving from two eyes/cameras for depth perception. From this perspective, the ground-truth information about three-dimensional visual space, which is hardly available, is an ideal tool both for evaluating human performance and for benchmarking machine vision algorithms. In the present work, we implemented a rendering methodology in which the camera pose mimics realistic eye pose for a fixating observer, thus including convergent eye geometry and cyclotorsion. The virtual environment we developed relies on highly accurate 3D virtual models, and its full controllability allows us to obtain the stereoscopic pairs together with the ground-truth depth and camera pose information. We thus created a stereoscopic dataset: GENUA PESTO-GENoa hUman Active fixation database: PEripersonal space STereoscopic images and grOund truth disparity. The dataset aims to provide a unified framework useful for a number of problems relevant to human and computer vision, from scene exploration and eye movement studies to 3D scene reconstruction.

  17. A dataset of stereoscopic images and ground-truth disparity mimicking human fixations in peripersonal space

    PubMed Central

    Canessa, Andrea; Gibaldi, Agostino; Chessa, Manuela; Fato, Marco; Solari, Fabio; Sabatini, Silvio P.

    2017-01-01

    Binocular stereopsis is the ability of a visual system, belonging to a live being or a machine, to interpret the different visual information deriving from two eyes/cameras for depth perception. From this perspective, the ground-truth information about three-dimensional visual space, which is hardly available, is an ideal tool both for evaluating human performance and for benchmarking machine vision algorithms. In the present work, we implemented a rendering methodology in which the camera pose mimics realistic eye pose for a fixating observer, thus including convergent eye geometry and cyclotorsion. The virtual environment we developed relies on highly accurate 3D virtual models, and its full controllability allows us to obtain the stereoscopic pairs together with the ground-truth depth and camera pose information. We thus created a stereoscopic dataset: GENUA PESTO—GENoa hUman Active fixation database: PEripersonal space STereoscopic images and grOund truth disparity. The dataset aims to provide a unified framework useful for a number of problems relevant to human and computer vision, from scene exploration and eye movement studies to 3D scene reconstruction. PMID:28350382

  18. Synergistic anti-proliferative effects of vitamin D derivatives and 9-cis retinoic acid in SH-SY5Y human neuroblastoma cells.

    PubMed

    Stio, M; Celli, A; Treves, C

    2001-06-01

    This study examines the effect of 1,25-dihydroxyvitamin D(3) [1,25(OH)(2)D(3)], 24,25-dihydroxyvitamin D(3) [24,25(OH)(2)D(3)], two vitamin D analogues (KH 1060 and EB 1089, which are 20-epi-22-oxa and 22,24-diene-analogues, respectively), 9-cis retinoic acid and all-trans retinoic acid on proliferation of SH-SY5Y human neuroblastoma cells, after treatment for 7 days. Cell number did not change when the cells were incubated with 1, 10 or 100 nM 1,25(OH)(2)D(3) or its derivatives, but significantly decreased in the presence of the two retinoids (0.001--10 microM final concentration). A synergistic inhibition was observed, when SH-SY5Y cells were treated combining 0.1 microM 9-cis retinoic acid and 10 nM 1,25(OH)(2)D(3) or 10 nM KH 1060, and 1 microM 9-cis retinoic acid and 10 nM 1,25(OH)(2)D(3) or 10 nM EB 1089. Acetylcholinesterase activity showed a significant increase, in comparison with controls, after treatment of the cells for 7 days with 0.1 or 1 microM 9-cis retinoic acid, alone or combined with 10 nM 1,25(OH)(2)D(3) or 10 nM KH 1060 or 10 nM EB 1089. This increase was synergistic, combining 1 microM 9-cis retinoic acid and 10 nM 1,25(OH)(2)D(3) or EB 1089. The levels of the c-myc encoded protein remarkably decreased after treatment of SH-SY5Y cells for 1, 3, 7 days with 0.1 and 1 microM 9-cis retinoic acid, alone or combined with 10 nM 1,25(OH)(2)D(3) or 10 nM KH 1060 or 10 nM EB 1089. In particular, the association of 1 microM 9-cis retinoic acid and 10 nM 1,25(OH)(2)D(3) or 10 nM EB 1089 resulted in a synergistic c-myc inhibition, in comparison with that obtained in the presence of the retinoid alone. These findings may have therapeutic implications in human neuroblastoma.

  19. Epithelial membrane protein 2 (EMP2) deficiency alters placental angiogenesis, mimicking features of human placental insufficiency.

    PubMed

    Williams, Carmen J; Chu, Alison; Jefferson, Wendy N; Casero, David; Sudhakar, Deepthi; Khurana, Nevil; Hogue, Claire P; Aryasomayajula, Chinmayi; Patel, Priya; Sullivan, Peggy; Padilla-Banks, Elizabeth; Mohandessi, Shabnam; Janzen, Carla; Wadehra, Madhuri

    2017-03-14

    Epithelial membrane protein-2 (EMP2) is a tetraspan protein predicted to regulate placental development. Highly expressed in secretory endometrium and trophectoderm cells, previous studies suggest that it may regulate implantation by orchestrating the surface expression of integrins and other membrane proteins. In order to test the role of EMP2 in pregnancy, mice lacking EMP2 (Emp2(-/-) ) were generated. Emp2(-/-) females are fertile but have reduced litter sizes when carrying Emp2(-/-) but not Emp2(+/-) fetuses. Placentas of Emp2(-/-) fetuses exhibit dysregulation in pathways related to neoangiogenesis, coagulation, and oxidative stress, and have increased fibrin deposition and altered vasculature. Given that these findings often occur due to placental insufficiency resulting in an oxygen-poor environment, the expression of hypoxia-inducible factor-1 alpha (HIF-1α) was examined. Placentas from Emp2(-/-) fetuses had increased total HIF-1α expression in large part through an increase in uterine NK (uNK) cells, demonstrating a unique interplay between uNK cells and trophoblasts modulated through EMP2. To determine if these results translated to human pregnancy, placentas from normal, term deliveries or those complicated by placental insufficiency resulting in intrauterine growth restriction (IUGR) were stained for EMP2. EMP2 was significantly reduced in both villous and extravillous trophoblast populations in IUGR placentas. Experiments in vitro using human trophoblast cells lines indicate that EMP2 modulates angiogenesis by altering HIF-1α expression. Our results reveal a novel role for EMP2 in regulating trophoblast function and vascular development in mice and humans and suggest it may be a new biomarker for placental insufficiency.

  20. Novel Rat Model of Repetitive Portal Venous Embolization Mimicking Human Non-Cirrhotic Idiopathic Portal Hypertension

    PubMed Central

    Klein, Sabine; Hinüber, Christian; Hittatiya, Kanishka; Schierwagen, Robert; Uschner, Frank Erhard; Strassburg, Christian P.; Fischer, Hans-Peter; Spengler, Ulrich; Trebicka, Jonel

    2016-01-01

    Background Non-cirrhotic idiopathic portal hypertension (NCIPH) is characterized by splenomegaly, anemia and portal hypertension, while liver function is preserved. However, no animal models have been established yet. This study assessed a rat model of NCIPH and characterized the hemodynamics, and compared it to human NCIPH. Methods Portal pressure (PP) was measured invasively and coloured microspheres were injected in the ileocecal vein in rats. This procedure was performed weekly for 3 weeks (weekly embolization). Rats without and with single embolization served as controls. After four weeks (one week after last embolization), hemodynamics were investigated, hepatic fibrosis and accumulation of myofibroblasts were analysed. General characteristics, laboratory analyses and liver histology were collected in patients with NCIPH. Results Weekly embolization induced a hyperdynamic circulation, with increased PP. The mesenteric flow and hepatic hydroxyproline content was significantly higher in weekly embolized compared to single embolized rats (mesenteric flow +54.1%, hydroxyproline +41.7%). Mesenteric blood flow and shunt volumes increased, whereas splanchnic vascular resistance was decreased in the weekly embolization group. Fibrotic markers αSMA and Desmin were upregulated in weekly embolized rats. Discussion This study establishes a model using repetitive embolization via portal veins, comparable with human NCIPH and may serve to test new therapies. PMID:27589391

  1. Development and Characterization of Piezoelectric Artificial Cochlear with micro Actuator mimicking Human Cochlear

    NASA Astrophysics Data System (ADS)

    Jung, Y.; Kim, S.; Kwak, J.; Kang, H.; Lee, Y. H.; Park, S.; Kim, W.; Hur, S.

    2013-12-01

    This paper presents the development of piezoelectric artificial cochlear (P-AC) capable of analyzing incoming acoustic or mechanical signals without external power source. The P-AC consists of membrane part and package part. The package part provides liquid environment through which the incoming signal is transmitted to membrane part. The membrane part responds to the transmitted signal and local area of the membrane part vibrates differently depending on its local resonant frequency. Previously in our group, we have demonstrated the feasibility of the P-AC with trapezoidal membrane part as sound analyzer by using mouth simulator as a sound input. In this research, we modified the P-AC to have the membrane part of logarithmically varying width. Also by incorporating mico-actuator into the package part that mimic the function of stapes bone in middle ear, we created similar environment to cochlear where human basilar membrane vibrates. The fabricated P-AC successfully demonstrates frequency separation of incoming mechanical signal from micro-actuator into several frequency bands within human hearing range.

  2. Human brucellosis mimicking axial spondyloarthritis: a challenge for rheumatologists when applying the 2009 ASAS criteria.

    PubMed

    Ye, Cong; Shen, Gui-Fen; Li, Shou-Xin; Dong, Ling-Li; Yu, Yi-Kai; Tu, Wei; Zhu, Ying-Zi; Hu, Shao-Xian

    2016-06-01

    Although the development of the 2009 SpA classification criteria by Assessment of SpondyloArthritis international Society (ASAS) represents an important step towards a better definition of the early disease stage particularly in axial spondyloarthritis (axSpA), the specificity of the criteria has been criticized these days. As the commonest zoonotic infection worldwide, human brucellosis can mimic a large number of diseases, including SpA. This study was performed to determine the frequency of rheumatologic manifestations in patients with brucellosis and the chance of misdiagnosing them as having axSpA in central China. The results showed that clinical manifestations of axSpA could be observed in brucellosis. Over half of patients had back pain, and one fifth of the patients with back pain were less than 45 years old at onset and had the symptom for more than 3 months. Two young males were falsely classified as suffering from axSpA according to the ASAS criteria, and one with MRI proved sacroiliitis was once given Etanercept for treatment. Therefore, differential diagnosis including human brucellosis should always be kept in mind when applying the ASAS criteria, even in traditionally non-endemic areas.

  3. Transient Expression of Transgenic IL-12 in Mouse Liver Triggers Unremitting Inflammation Mimicking Human Autoimmune Hepatitis.

    PubMed

    Gil-Farina, Irene; Di Scala, Marianna; Salido, Eduardo; López-Franco, Esperanza; Rodríguez-García, Estefania; Blasi, Mercedes; Merino, Juana; Aldabe, Rafael; Prieto, Jesús; Gonzalez-Aseguinolaza, Gloria

    2016-09-15

    The etiopathogenesis of autoimmune hepatitis (AIH) remains poorly understood. In this study, we sought to develop an animal model of human AIH to gain insight into the immunological mechanisms driving this condition. C57BL/6 mice were i.v. injected with adeno-associated viral vectors encoding murine IL-12 or luciferase under the control of a liver-specific promoter. Organ histology, response to immunosuppressive therapy, and biochemical and immunological parameters, including Ag-specific humoral and cellular response, were analyzed. Mechanistic studies were carried out using genetically modified mice and depletion of lymphocyte subpopulations. Adeno-associated virus IL-12-treated mice developed histological, biochemical, and immunological changes resembling type 1 AIH, including marked and persistent liver mononuclear cell infiltration, hepatic fibrosis, hypergammaglobulinemia, anti-nuclear and anti-smooth muscle actin Abs, and disease remission with immunosuppressive drugs. Interestingly, transgenic IL-12 was short-lived, but endogenous IL-12 expression was induced, and both IL-12 and IFN-γ remained elevated during the entire study period. IFN-γ was identified as an essential mediator of liver damage, and CD4 and CD8 T cells but not NK, NKT, or B cells were essential executors of hepatic injury. Furthermore, both MHC class I and MHC class II expression was upregulated at the hepatocellular membrane, and induction of autoreactive liver-specific T cells was detected. Remarkably, although immunoregulatory mechanisms were activated, they only partially mitigated liver damage. Thus, low and transient expression of transgenic IL-12 in hepatocytes causes loss of tolerance to hepatocellular Ags, leading to chronic hepatitis resembling human AIH type 1. This model provides a practical tool to explore AIH pathogenesis and novel therapies.

  4. A Tactile Recognition System Mimicking Human Mechanism for Recognizing Surface Roughness

    NASA Astrophysics Data System (ADS)

    Ohka, Masahiro; Kawamura, Takuya; Itahashi, Tastuya; Takayanagi, Jyun-Ichi; Miyaoka, Tetsu; Mitsuya, Yasunaga

    A mathematical model was formulated on the basis of results from psychophysical experiments in which human subjects discriminated fine steps on aluminum plates. The mathematical model emulated the real neuron discharge caused when a membrane potential exceeds a threshold. This membrane potential was determined by spatial and temporal summations of postsynaptic potential. To evaluate the mathematical model for surface texture recognition by robots, we performed a series of surface-detection experiments using a robotic manipulator equipped with an optical three-axis tactile sensor. The single sensor cell of this sensor consisted of a columnar feeler and a 2-by-2 array of conical feelers. The three-axis force was calculated from the area-sum and area-difference of the conical feelers’ contact areas. The robotic manipulator rubbed the tactile sensor on four brass plates with step heights of 0, 0.05, 0.1 and 0.2mm. Results showed that the mathematical model could distinguish these step heights in real time.

  5. Candidacidal Activity of Selected Ceragenins and Human Cathelicidin LL-37 in Experimental Settings Mimicking Infection Sites

    PubMed Central

    Durnaś, Bonita; Wnorowska, Urszula; Pogoda, Katarzyna; Deptuła, Piotr; Wątek, Marzena; Piktel, Ewelina; Głuszek, Stanisław; Gu, Xiaobo; Savage, Paul B.; Niemirowicz, Katarzyna; Bucki, Robert

    2016-01-01

    Fungal infections, especially those caused by antibiotic resistant pathogens, have become a serious public health problem due to the growing number of immunocompromised patients, including those subjected to anticancer treatment or suffering from HIV infection. In this study we assessed fungicidal activity of the ceragenins CSA-13, CSA-131 and CSA-192 against four fluconazole–resistant Candida strains. We found that ceragenins activity against planktonic Candida cells was higher than activity of human LL-37 peptide and synthetic cationic peptide omiganan. Compared to LL-37 peptide, ceragenins in the presence of DNase I demonstrated an increased ability to kill DNA-induced Candida biofilm. Microscopy studies show that treatment with LL-37 or ceragenins causes Candida cells to undergo extensive surface changes indicating surface membrane damage. This conclusion was substantiated by observation of rapid incorporation of FITC-labeled CSA-13, CSA-131 or LL-37 peptide into the more lipophilic environment of the Candida membrane. In addition to activity against Candida spp., ceragenins CSA-131 and CSA-192 display strong fungicidal activity against sixteen clinical isolates including Cryptococcus neoformans and Aspergillus fumigatus. These results indicate the potential of ceragenins for future development as new fungicidal agents. PMID:27315208

  6. A Lettuce (Lactuca sativa) Homolog of Human Nogo-B Receptor Interacts with cis-Prenyltransferase and Is Necessary for Natural Rubber Biosynthesis*

    PubMed Central

    Qu, Yang; Chakrabarty, Romit; Tran, Hue T.; Kwon, Eun-Joo G.; Kwon, Moonhyuk; Nguyen, Trinh-Don; Ro, Dae-Kyun

    2015-01-01

    Natural rubber (cis-1,4-polyisoprene) is an indispensable biopolymer used to manufacture diverse consumer products. Although a major source of natural rubber is the rubber tree (Hevea brasiliensis), lettuce (Lactuca sativa) is also known to synthesize natural rubber. Here, we report that an unusual cis-prenyltransferase-like 2 (CPTL2) that lacks the conserved motifs of conventional cis-prenyltransferase is required for natural rubber biosynthesis in lettuce. CPTL2, identified from the lettuce rubber particle proteome, displays homology to a human NogoB receptor and is predominantly expressed in latex. Multiple transgenic lettuces expressing CPTL2-RNAi constructs showed that a decrease of CPTL2 transcripts (3–15% CPTL2 expression relative to controls) coincided with the reduction of natural rubber as low as 5%. We also identified a conventional cis-prenyltransferase 3 (CPT3), exclusively expressed in latex. In subcellular localization studies using fluorescent proteins, cytosolic CPT3 was relocalized to endoplasmic reticulum by co-occurrence of CPTL2 in tobacco and yeast at the log phase. Furthermore, yeast two-hybrid data showed that CPTL2 and CPT3 interact. Yeast microsomes containing CPTL2/CPT3 showed enhanced synthesis of short cis-polyisoprenes, but natural rubber could not be synthesized in vitro. Intriguingly, a homologous pair CPTL1/CPT1, which displays ubiquitous expressions in lettuce, showed a potent dolichol biosynthetic activity in vitro. Taken together, our data suggest that CPTL2 is a scaffolding protein that tethers CPT3 on endoplasmic reticulum and is necessary for natural rubber biosynthesis in planta, but yeast-expressed CPTL2 and CPT3 alone could not synthesize high molecular weight natural rubber in vitro. PMID:25477521

  7. A lettuce (Lactuca sativa) homolog of human Nogo-B receptor interacts with cis-prenyltransferase and is necessary for natural rubber biosynthesis.

    PubMed

    Qu, Yang; Chakrabarty, Romit; Tran, Hue T; Kwon, Eun-Joo G; Kwon, Moonhyuk; Nguyen, Trinh-Don; Ro, Dae-Kyun

    2015-01-23

    Natural rubber (cis-1,4-polyisoprene) is an indispensable biopolymer used to manufacture diverse consumer products. Although a major source of natural rubber is the rubber tree (Hevea brasiliensis), lettuce (Lactuca sativa) is also known to synthesize natural rubber. Here, we report that an unusual cis-prenyltransferase-like 2 (CPTL2) that lacks the conserved motifs of conventional cis-prenyltransferase is required for natural rubber biosynthesis in lettuce. CPTL2, identified from the lettuce rubber particle proteome, displays homology to a human NogoB receptor and is predominantly expressed in latex. Multiple transgenic lettuces expressing CPTL2-RNAi constructs showed that a decrease of CPTL2 transcripts (3-15% CPTL2 expression relative to controls) coincided with the reduction of natural rubber as low as 5%. We also identified a conventional cis-prenyltransferase 3 (CPT3), exclusively expressed in latex. In subcellular localization studies using fluorescent proteins, cytosolic CPT3 was relocalized to endoplasmic reticulum by co-occurrence of CPTL2 in tobacco and yeast at the log phase. Furthermore, yeast two-hybrid data showed that CPTL2 and CPT3 interact. Yeast microsomes containing CPTL2/CPT3 showed enhanced synthesis of short cis-polyisoprenes, but natural rubber could not be synthesized in vitro. Intriguingly, a homologous pair CPTL1/CPT1, which displays ubiquitous expressions in lettuce, showed a potent dolichol biosynthetic activity in vitro. Taken together, our data suggest that CPTL2 is a scaffolding protein that tethers CPT3 on endoplasmic reticulum and is necessary for natural rubber biosynthesis in planta, but yeast-expressed CPTL2 and CPT3 alone could not synthesize high molecular weight natural rubber in vitro.

  8. Dirofilariasis Mimicking an Acute Scrotum.

    PubMed

    Bertozzi, Mirko; Rinaldi, Victoria Elisa; Prestipino, Marco; Giovenali, Paolo; Appignani, Antonino

    2015-10-01

    Human infections caused by Dirofilaria repens have been reported in many areas of the world. We describe a case of a 3-year-old child with an intrascrotal mass caused by D repens mimicking an acute scrotum. This represents the first case of scrotal dirofilariasis described in pediatric age with such an unusual presentation.

  9. Increase in cis-dichlorodiammineplatinum (II) cytotoxicity upon reversible electropermeabilization of the plasma membrane in cultured human NHIK 3025 cells.

    PubMed

    Melvik, J E; Pettersen, E O; Gordon, P B; Seglen, P O

    1986-12-01

    A series of brief electrical high-voltage discharges were given to cultured NHIK 3025 cells to render the plasma membrane transiently permeable to drugs. Using [14C]sucrose as an inert marker which normally does not cross plasma membranes, increased permeability could be demonstrated for no longer than 10 min following electrical treatment, indicating that the permeabilization was entirely reversible. The reversibility of the treatment was further demonstrated by a lack of effect on cell growth and colony-forming ability. When cells were given electrical discharges immediately before or during exposure to cis-dichlorodiammineplatinum(II)(cis-DDP) the cytotoxic drug effect increased. By using electrical discharges during a 2 hr drug treatment period the cytotoxicity was enhanced to an extent corresponding to at least a 3-fold increase in drug uptake relative to unpermeabilized cells. This increase in drug uptake was confirmed by direct measurements of the amount of cell-associated Pt by atomic absorbtion spectroscopy. The results suggest that uptake across the plasma membrane may be the rate-limiting factor in the cytotoxic effect of cis-DDP. Furthermore, the methodology applied in the present study may prove useful in assessing the influence of membrane permeability on the effect of other cytotoxic drugs.

  10. A pacemaker powered by an implantable biofuel cell operating under conditions mimicking the human blood circulatory system--battery not included.

    PubMed

    Southcott, Mark; MacVittie, Kevin; Halámek, Jan; Halámková, Lenka; Jemison, William D; Lobel, Robert; Katz, Evgeny

    2013-05-07

    Biocatalytic electrodes made of buckypaper were modified with PQQ-dependent glucose dehydrogenase on the anode and with laccase on the cathode and were assembled in a flow biofuel cell filled with serum solution mimicking the human blood circulatory system. The biofuel cell generated an open circuitry voltage, Voc, of ca. 470 mV and a short circuitry current, Isc, of ca. 5 mA (a current density of 0.83 mA cm(-2)). The power generated by the implantable biofuel cell was used to activate a pacemaker connected to the cell via a charge pump and a DC-DC converter interface circuit to adjust the voltage produced by the biofuel cell to the value required by the pacemaker. The voltage-current dependencies were analyzed for the biofuel cell connected to an Ohmic load and to the electronic loads composed of the interface circuit, or the power converter, and the pacemaker to study their operation. The correct pacemaker operation was confirmed using a medical device - an implantable loop recorder. Sustainable operation of the pacemaker was achieved with the system closely mimicking human physiological conditions using a single biofuel cell. This first demonstration of the pacemaker activated by the physiologically produced electrical energy shows promise for future electronic implantable medical devices powered by electricity harvested from the human body.

  11. Folding of barstar C40A/C82A/P27A and catalysis of the peptidyl-prolyl cis/trans isomerization by human cytosolic cyclophilin (Cyp18).

    PubMed Central

    Golbik, R.; Fischer, G.; Fersht, A. R.

    1999-01-01

    Refolding of b*C40A/C82A/P27A is comprised of several kinetically detectable folding phases. The slowest phase in refolding originates from trans-->cis isomerization of the Tyr47-Pro48 peptide bond being in cis conformation in the native state. This refolding phase can be accelerated by the peptidyl-prolyl cis/trans isomerase human cytosolic cyclophilin (Cyp18) with a kcat/K(M) of 254,000 M(-1) s(-1). The fast refolding phase is not influenced by the enzyme. PMID:10422840

  12. Replication of chromosomal and episomal DNA in X-ray-damaged human cells: A cis- or trans-acting mechanism

    SciTech Connect

    Cleaver, J.E.; Rose, R.; Mitchell, D.L. )

    1990-12-01

    Episomal plasmids and viruses in mammalian cells present small targets for X-ray-induced DNA damage. At doses up to 100 Gy, DNA strand breaks or endonuclease III-sensitive sites were not discernible in 10.3-kb Epstein-Barr virus-based plasmid DNA or in 4.9-kb defective simian virus 40 DNA. DNA replication in these small molecules, however, was inhibited strongly by X-ray doses of greater than or equal to 20 Gy, decreasing to only 20 to 40% of control values. Inhibition was relieved slightly by growth in caffeine but was increased by growth in 3-aminobenzamide. Inhibition of DNA replication in episomal DNA molecules that are too small to sustain significant damage directly to their DNA may be due to either (a) a trans-acting diffusible factor that transfers the consequences of DNA breakage to episomes and to other replicating molecules, (b) a cis-acting mechanism in which episomes are structurally linked to genomic chromatin, and replication of both episomal and chromosomal replicons is under common control, or (c) radiation damage on other cellular structures unrelated to DNA. The resolution of these cellular mechanisms may shed light on the X-ray-resistant replication in ataxia-telangiectasia and may suggest strategies for molecular characterization of potential trans- or cis-acting factors.

  13. Two cis-acting signals control ribosomal frameshift between human T-cell leukemia virus type II gag and pro genes.

    PubMed Central

    Falk, H; Mador, N; Udi, R; Panet, A; Honigman, A

    1993-01-01

    The open reading frame of the human T-cell leukemia virus type II pro gene is arranged at a -1 position relative to the gag gene. Synthesis of the Gag-Pro fusion polyprotein is facilitated by ribosomal frameshift into the reading frame of the pro gene. Cloning of a synthetic 41-bp oligonucleotide corresponding to the gag-pro junction within a heterologous gene (nef of human immunodeficiency virus type I) and mutation analysis revealed that two cis-acting signals, an adenosine residue stretch and a dyad symmetry sequence, flanking the UAA termination codon, are required for efficient ribosomal frameshifting between gag and pro. The stability of the stem-loop structure is crucial for frameshifting. Images PMID:8371359

  14. Tale of two isomers: complexities of human odor perception for cis- and trans-4-methylcyclohexane methanol from the chemical spill in West Virginia.

    PubMed

    Gallagher, Daniel L; Phetxumphou, Katherine; Smiley, Elizabeth; Dietrich, Andrea M

    2015-02-03

    Application of gas chromatography with mass spectrometric and human olfactory "sniffer" detectors reveals the nature of odorous chemicals from an industrial chemical spill. Crude 4-methylcyclohexane methanol (4-MCHM) spilled in a river and then contaminated drinking water and air for over 300000 consumers living in West Virginia. Olfactory gas chromatography allows investigators to independently measure the odor of chemical components in a mixture. Crude 4-MCHM is comprised of several major cyclohexane components, four of which have distinct isomer pairs. The cis- and trans-4-MCHM isomers are the only components to have distinct odors at the concentrations used in this study. The trans-4-MCHM is the dominant odorant with descriptors of "licorice" and "sweet". Trans-4-MCHM has an air odor threshold concentration of 0.060 ppb-v (95% CI: 0.040-0.091). The odor threshold concentrations are not influenced by gender or age but are lower by a factor of 5 for individuals with prior exposure compared to naïve subjects. Individual trans-4-MCHM odor threshold concentrations vary by more than a factor of 100. The cis-4-MCHM isomer has approximately a 2000-fold higher odor threshold concentration, different descriptors, and an even wider individual response range.

  15. Glucocorticoid regulation of mouse and human dual specificity phosphatase 1 (DUSP1) genes: unusual cis-acting elements and unexpected evolutionary divergence.

    PubMed

    Tchen, Carmen R; Martins, Joana R S; Paktiawal, Nasren; Perelli, Roberta; Saklatvala, Jeremy; Clark, Andrew R

    2010-01-22

    Anti-inflammatory effects of glucocorticoids (GCs) are partly mediated by up-regulation of DUSP1 (dual specificity phosphatase 1), which dephosphorylates and inactivates mitogen-activated protein kinases. We identified putative GC-responsive regions containing GC receptor (GR) binding site consensus sequences that are well conserved between human and mouse DUSP1 loci in position, orientation, and sequence (at least 11 of 15 positions identical) and lie within regions of extended sequence conservation (minimum 65% identity over at least 100 bp). These were located approximately 29, 28, 24, 4.6, and 1.3 kb upstream of the DUSP1 transcription start site. The homology-based approach successfully identified four cis-acting regions that mediated transcriptional responses to dexamethasone. However, there was surprising interspecies divergence in site usage. This could not be explained by variations of the GR binding sites themselves. Instead, variations in flanking sequences appear to have driven the evolutionary divergence in mechanisms of regulation of mouse and human DUSP1 genes. There was a good correlation between the ability of cis-acting elements to respond to GC in transiently transfected reporter constructs and their ability to recruit GR in the context of intact chromatin. We propose that divergence of gene regulation has involved the loss or gain of binding sites for accessory transcription factors that assist in GR recruitment. Finally, a novel GC-responsive region of the human DUSP1 gene contains a highly unusual element, in which three closely spaced GR half-sites are required for potent transcriptional activation by GC.

  16. Cis-Lunar Base Camp

    NASA Technical Reports Server (NTRS)

    Merrill, Raymond G.; Goodliff, Kandyce E.; Mazanek, Daniel D.; Reeves, John D., Jr.

    2012-01-01

    Historically, when mounting expeditions into uncharted territories, explorers have established strategically positioned base camps to pre-position required equipment and consumables. These base camps are secure, safe positions from which expeditions can depart when conditions are favorable, at which technology and operations can be tested and validated, and facilitate timely access to more robust facilities in the event of an emergency. For human exploration missions into deep space, cis-lunar space is well suited to serve as such a base camp. The outer regions of cis-lunar space, such as the Earth-Moon Lagrange points, lie near the edge of Earth s gravity well, allowing equipment and consumables to be aggregated with easy access to deep space and to the lunar surface, as well as more distant destinations, such as near-Earth Asteroids (NEAs) and Mars and its moons. Several approaches to utilizing a cis-lunar base camp for sustainable human exploration, as well as some possible future applications are identified. The primary objective of the analysis presented in this paper is to identify options, show the macro trends, and provide information that can be used as a basis for more detailed mission development. Compared within are the high-level performance and cost of 15 preliminary cis-lunar exploration campaigns that establish the capability to conduct crewed missions of up to one year in duration, and then aggregate mass in cis-lunar space to facilitate an expedition from Cis-Lunar Base Camp. Launch vehicles, chemical propulsion stages, and electric propulsion stages are discussed and parametric sizing values are used to create architectures of in-space transportation elements that extend the existing in-space supply chain to cis-lunar space. The transportation options to cis-lunar space assessed vary in efficiency by almost 50%; from 0.16 to 0.68 kg of cargo in cis-lunar space for every kilogram of mass in Low Earth Orbit (LEO). For the 15 cases, 5-year campaign

  17. Generation and Characterization of a Human/Mouse Chimeric GD2-Mimicking Anti-Idiotype Antibody Ganglidiximab for Active Immunotherapy against Neuroblastoma

    PubMed Central

    Eger, Christin; Siebert, Nikolai; Seidel, Diana; Zumpe, Maxi; Jüttner, Madlen; Brandt, Sven; Müller, Hans-Peter; Lode, Holger N.

    2016-01-01

    Vaccination with proteins mimicking GD2 that is highly expressed on neuroblastoma (NB) cells is a promising strategy in treatment of NB, a pediatric malignancy with poor prognosis. We previously showed efficacy of ganglidiomab in vivo, a murine anti-idiotype (anti-Id) IgG1. In order to tailor immune responses to variable regions, we generated a new human/mouse chimeric anti-Id antibody (Ab) ganglidiximab by replacing murine constant fragments with corresponding human IgG1 regions. DNA sequences encoding for variable regions of heavy (VH) and light chains (VL) were synthesized by RT-PCR from total RNA of ganglidiomab-producing hybridoma cells and further ligated into mammalian expression plasmids with coding sequences for constant regions of human IgG1 heavy and light chains, respectively. We established a stable production cell line using Chinese hamster ovarian (CHO) cells co-transfected with two expression plasmids driving the expression of either ganglidiximab heavy or light chain. After purification from supernatants, anti-idiotypic characteristics of ganglidiximab were demonstrated. Binding of ganglidiximab to anti-GD2 Abs of the 14.18 family as well as to NK-92tr cells expressing a GD2-specific chimeric antigen receptor (scFv(ch14.18)-zeta) was shown using standard ELISA and flow cytometry analysis, respectively. Ganglidiximab binding affinities to anti-GD2 Abs were further determined by surface plasmon resonance technique. Moreover, binding of anti-GD2 Abs to the nominal antigen GD2 as well as GD2-specific Ab-mediated cytotoxicity (ADCC, CDC) was competitively inhibited by ganglidiximab. Finally, ganglidiximab was successfully used as a protein vaccine in vivo to induce a GD2-specific humoral immune response. In summary, we report generation and characterization of a new human/mouse chimeric anti-Id Ab ganglidiximab for active immunotherapy against NB. This Ab may be useful to tailor immune responses to the paratope regions mimicking GD2 overexpressed in NB

  18. cis-Regulatory changes in Kit ligand expression and parallel evolution of pigmentation in sticklebacks and humans.

    PubMed

    Miller, Craig T; Beleza, Sandra; Pollen, Alex A; Schluter, Dolph; Kittles, Rick A; Shriver, Mark D; Kingsley, David M

    2007-12-14

    Dramatic pigmentation changes have evolved within most vertebrate groups, including fish and humans. Here we use genetic crosses in sticklebacks to investigate the parallel origin of pigmentation changes in natural populations. High-resolution mapping and expression experiments show that light gills and light ventrums map to a divergent regulatory allele of the Kit ligand (Kitlg) gene. The divergent allele reduces expression in gill and skin tissue and is shared by multiple derived freshwater populations with reduced pigmentation. In humans, Europeans and East Asians also share derived alleles at the KITLG locus. Strong signatures of selection map to regulatory regions surrounding the gene, and admixture mapping shows that the KITLG genomic region has a significant effect on human skin color. These experiments suggest that regulatory changes in Kitlg contribute to natural variation in vertebrate pigmentation, and that similar genetic mechanisms may underlie rapid evolutionary change in fish and humans.

  19. Burying Dogs in Ancient Cis-Baikal, Siberia: Temporal Trends and Relationships with Human Diet and Subsistence Practices

    PubMed Central

    Losey, Robert J.; Garvie-Lok, Sandra; Leonard, Jennifer A.; Katzenberg, M. Anne; Germonpré, Mietje; Nomokonova, Tatiana; Sablin, Mikhail V.; Goriunova, Olga I.; Berdnikova, Natalia E.; Savel’ev, Nikolai A.

    2013-01-01

    The first objective of this study is to examine temporal patterns in ancient dog burials in the Lake Baikal region of Eastern Siberia. The second objective is to determine if the practice of dog burial here can be correlated with patterns in human subsistence practices, in particular a reliance on terrestrial mammals. Direct radiocarbon dating of a suite of the region’s dog remains indicates that these animals were given burial only during periods in which human burials were common. Dog burials of any kind were most common during the Early Neolithic (∼7–8000 B.P.), and rare during all other time periods. Further, only foraging groups seem to have buried canids in this region, as pastoralist habitation sites and cemeteries generally lack dog interments, with the exception of sacrificed animals. Stable carbon and nitrogen isotope data indicate that dogs were only buried where and when human diets were relatively rich in aquatic foods, which here most likely included river and lake fish and Baikal seal (Phoca sibirica). Generally, human and dog diets appear to have been similar across the study subregions, and this is important for interpreting their radiocarbon dates, and comparing them to those obtained on the region’s human remains, both of which likely carry a freshwater old carbon bias. Slight offsets were observed in the isotope values of dogs and humans in our samples, particularly where both have diets rich in aquatic fauna. This may result from dietary differences between people and their dogs, perhaps due to consuming fish of different sizes, or even different tissues from the same aquatic fauna. This paper also provides a first glimpse of the DNA of ancient canids in Northeast Asia. PMID:23696851

  20. Burying dogs in ancient Cis-Baikal, Siberia: temporal trends and relationships with human diet and subsistence practices.

    PubMed

    Losey, Robert J; Garvie-Lok, Sandra; Leonard, Jennifer A; Katzenberg, M Anne; Germonpré, Mietje; Nomokonova, Tatiana; Sablin, Mikhail V; Goriunova, Olga I; Berdnikova, Natalia E; Savel'ev, Nikolai A

    2013-01-01

    The first objective of this study is to examine temporal patterns in ancient dog burials in the Lake Baikal region of Eastern Siberia. The second objective is to determine if the practice of dog burial here can be correlated with patterns in human subsistence practices, in particular a reliance on terrestrial mammals. Direct radiocarbon dating of a suite of the region's dog remains indicates that these animals were given burial only during periods in which human burials were common. Dog burials of any kind were most common during the Early Neolithic (∼7-8000 B.P.), and rare during all other time periods. Further, only foraging groups seem to have buried canids in this region, as pastoralist habitation sites and cemeteries generally lack dog interments, with the exception of sacrificed animals. Stable carbon and nitrogen isotope data indicate that dogs were only buried where and when human diets were relatively rich in aquatic foods, which here most likely included river and lake fish and Baikal seal (Phoca sibirica). Generally, human and dog diets appear to have been similar across the study subregions, and this is important for interpreting their radiocarbon dates, and comparing them to those obtained on the region's human remains, both of which likely carry a freshwater old carbon bias. Slight offsets were observed in the isotope values of dogs and humans in our samples, particularly where both have diets rich in aquatic fauna. This may result from dietary differences between people and their dogs, perhaps due to consuming fish of different sizes, or even different tissues from the same aquatic fauna. This paper also provides a first glimpse of the DNA of ancient canids in Northeast Asia.

  1. Cadherin 13: Human cis-Regulation and Selectively Altered Addiction Phenotypes and Cerebral Cortical Dopamine in Knockout Mice

    PubMed Central

    Drgonova, Jana; Walther, Donna; Hartstein, G Luke; Bukhari, Mohammad O; Baumann, Michael H; Katz, Jonathan; Hall, F Scott; Arnold, Elizabeth R; Flax, Shaun; Riley, Anthony; Rivero, Olga; Lesch, Klaus-Peter; Troncoso, Juan; Ranscht, Barbara; Uhl, George R

    2016-01-01

    The cadherin 13 (CDH13) gene encodes a cell adhesion molecule likely to influence development and connections of brain circuits that modulate addiction, locomotion and cognition, including those that involve midbrain dopamine neurons. Human CDH13 mRNA expression differs by more than 80% in postmortem cerebral cortical samples from individuals with different CDH13 genotypes, supporting examination of mice with altered CDH13 expression as models for common human variation at this locus. Constitutive CDH13 knockout mice display evidence for changed cocaine reward: shifted dose response relationship in tests of cocaine-conditioned place preference using doses that do not alter cocaine-conditioned taste aversion. Reduced adult CDH13 expression in conditional knockouts also alters cocaine reward in ways that correlate with individual differences in cortical CDH13 mRNA levels. In control and comparison behavioral assessments, knockout mice display modestly quicker acquisition of rotarod and water maze tasks, with a trend toward faster acquisition of 5-choice serial reaction time tasks that otherwise displayed no genotype-related differences. They display significant differences in locomotion in some settings, with larger effects in males. In assessments of brain changes that might contribute to these behavioral differences, there are selective alterations of dopamine levels, dopamine/metabolite ratios, dopaminergic fiber densities and mRNA encoding the activity dependent transcription factor npas4 in cerebral cortex of knockout mice. These novel data and previously reported human associations of CDH13 variants with addiction, individual differences in responses to stimulant administration and attention deficit hyperactivity disorder (ADHD) phenotypes suggest that levels of CDH13 expression, through mechanisms likely to include effects on mesocortical dopamine, influence stimulant reward and may contribute modestly to cognitive and locomotor phenotypes relevant to ADHD

  2. Wild-type Human γD-crystallin Promotes Aggregation of Its Oxidation-mimicking, Misfolding-prone W42Q Mutant*

    PubMed Central

    Serebryany, Eugene; King, Jonathan A.

    2015-01-01

    Non-native protein conformers generated by mutation or chemical damage template aggregation of wild-type, undamaged polypeptides in diseases ranging from amyotrophic lateral sclerosis to cancer. We tested for such interactions in the natively monomeric human eye lens protein γd-crystallin, whose aggregation leads to cataract disease. The oxidation-mimicking W42Q mutant of γd-crystallin formed non-native polymers starting from a native-like state under physiological conditions. Aggregation occurred in the temperature range 35–45 °C, in which the mutant protein began to lose the native conformation of its N-terminal domain. Surprisingly, wild-type γd-crystallin promoted W42Q polymerization in a catalytic manner, even at mutant concentrations too low for homogeneous nucleation to occur. The presence of wild-type protein also downshifted the temperature range of W42Q aggregation. W42Q aggregation required formation of a non-native intramolecular disulfide bond but not intermolecular cross-linking. Transient WT/W42Q binding may catalyze this oxidative misfolding event in the mutant. That a more stable variant in a mixture can specifically promote aggregation of a less stable one rationalizes how extensive aggregation of rare damaged polypeptides can occur during the course of aging. PMID:25787081

  3. Dynamic morphological changes in the skulls of mice mimicking human Apert syndrome resulting from gain-of-function mutation of FGFR2 (P253R).

    PubMed

    Du, Xiaolan; Weng, Tujun; Sun, Qidi; Su, Nan; Chen, Zhi; Qi, Huabing; Jin, Ming; Yin, Liangjun; He, Qifen; Chen, Lin

    2010-08-01

    Apert syndrome is caused mainly by gain-of-function mutations of fibroblast growth factor receptor 2. We have generated a mouse model (Fgfr2(+/P253R)) mimicking human Apert syndrome resulting from fibroblast growth factor receptor 2 Pro253Arg mutation using the knock-in approach. This mouse model in general has the characteristic skull morphology similar to that in humans with Apert syndrome. To characterize the detailed changes of form in the overall skull and its major anatomic structures, euclidean distance matrix analysis was used to quantitatively compare the form and growth difference between the skulls of mutants and their wild-type controls. There were substantial morphological differences between the skulls of mutants and their controls at 4 and 8 weeks of age (P < 0.01). The mutants showed shortened skull dimensions along the rostrocaudal axis, especially in their face. The width of the frontal bone and the distance between the two orbits were broadened mediolaterally. The neurocrania were significantly increased along the dorsoventral axis and slightly increased along the mediolateral axis, and also had anteriorly displayed opisthion along the rostrocaudal axis. Compared with wild-type, the mutant mandible had an anteriorly displaced coronoid process and mandibular condyle along the rostrocaudal axis. We further found that there was catch-up growth in the nasal bone, maxilla, zygomatic bone and some regions of the mandible of the mutant skulls during the 4-8-week interval. The above-mentioned findings further validate the Fgfr2(+/P253R) mouse strain as a good model for human Apert syndrome. The changes in form characterized in this study will help to elucidate the mechanisms through which the Pro253Arg mutation in fibroblast growth factor receptor 2 affects craniofacial development and causes Apert syndrome.

  4. Cis-acting sequences from a human surfactant protein gene confer pulmonary-specific gene expression in transgenic mice

    SciTech Connect

    Korfhagen, T.R.; Glasser, S.W.; Wert, S.E.; Bruno, M.D.; Daugherty, C.C.; McNeish, J.D.; Stock, J.L.; Potter, S.S.; Whitsett, J.A. )

    1990-08-01

    Pulmonary surfactant is produced in late gestation by developing type II epithelial cells lining the alveolar epithelium of the lung. Lack of surfactant at birth is associated with respiratory distress syndrome in premature infants. Surfactant protein C (SP-C) is a highly hydrophobic peptide isolated from pulmonary tissue that enhances the biophysical activity of surfactant phospholipids. Like surfactant phospholipid, SP-C is produced by epithelial cells in the distal respiratory epithelium, and its expression increases during the latter part of gestation. A chimeric gene containing 3.6 kilobases of the promoter and 5{prime}-flanking sequences of the human SP-C gene was used to express diphtheria toxin A. The SP-C-diphtheria toxin A fusion gene was injected into fertilized mouse eggs to produce transgenic mice. Affected mice developed respiratory failure in the immediate postnatal period. Morphologic analysis of lungs from affected pups showed variable but severe cellular injury confined to pulmonary tissues. Ultrastructural changes consistent with cell death and injury were prominent in the distal respiratory epithelium. Proximal components of the tracheobronchial tree were not severely affected. Transgenic animals were of normal size at birth, and structural abnormalities were not detected in nonpulmonary tissues. Lung-specific diphtheria toxin A expression controlled by the human SP-C gene injured type II epithelial cells and caused extensive necrosis of the distal respiratory epithelium. The absence of type I epithelial cells in the most severely affected transgenic animals supports the concept that developing type II cells serve as precursors to type I epithelial cells.

  5. Analysis of cis and trans Requirements for DNA Replication at the Right-End Hairpin of the Human Bocavirus 1 Genome

    PubMed Central

    Shen, Weiran; Deng, Xuefeng; Zou, Wei; Engelhardt, John F.; Yan, Ziying

    2016-01-01

    with an HBoV1 capsid has been developed to efficiently deliver the cystic fibrosis transmembrane conductance regulator gene to human airway epithelia. Here, we identified both cis-acting elements and trans-acting proteins that are required for HBoV1 DNA replication at the right-end hairpin in HEK293 cells. We localized the minimal replication origin, which contains both NS1 nicking and binding sites, to a 46-nucleotide sequence in the right-end hairpin. The identification of these essential elements of HBoV1 DNA replication acting both in cis and in trans will provide guidance to develop antiviral strategies targeting viral DNA replication at the right-end hairpin and to design next-generation recombinant HBoV1 vectors, a promising tool for gene therapy of lung diseases. PMID:27334591

  6. The dominant Anopheles vectors of human malaria in the Americas: occurrence data, distribution maps and bionomic précis

    PubMed Central

    2010-01-01

    Background An increasing knowledge of the global risk of malaria shows that the nations of the Americas have the lowest levels of Plasmodium falciparum and P. vivax endemicity worldwide, sustained, in part, by substantive integrated vector control. To help maintain and better target these efforts, knowledge of the contemporary distribution of each of the dominant vector species (DVS) of human malaria is needed, alongside a comprehensive understanding of the ecology and behaviour of each species. Results A database of contemporary occurrence data for 41 of the DVS of human malaria was compiled from intensive searches of the formal and informal literature. The results for the nine DVS of the Americas are described in detail here. Nearly 6000 occurrence records were gathered from 25 countries in the region and were complemented by a synthesis of published expert opinion range maps, refined further by a technical advisory group of medical entomologists. A suite of environmental and climate variables of suspected relevance to anopheline ecology were also compiled from open access sources. These three sets of data were then combined to produce predictive species range maps using the Boosted Regression Tree method. The predicted geographic extent for each of the following species (or species complex*) are provided: Anopheles (Nyssorhynchus) albimanus Wiedemann, 1820, An. (Nys.) albitarsis*, An. (Nys.) aquasalis Curry, 1932, An. (Nys.) darlingi Root, 1926, An. (Anopheles) freeborni Aitken, 1939, An. (Nys.) marajoara Galvão & Damasceno, 1942, An. (Nys.) nuneztovari*, An. (Ano.) pseudopunctipennis* and An. (Ano.) quadrimaculatus Say, 1824. A bionomics review summarising ecology and behaviour relevant to the control of each of these species was also compiled. Conclusions The distribution maps and bionomics review should both be considered as a starting point in an ongoing process of (i) describing the distributions of these DVS (since the opportunistic sample of occurrence

  7. Naturally occurring rhodopsin mutation in the dog causes retinal dysfunction and degeneration mimicking human dominant retinitis pigmentosa.

    PubMed

    Kijas, James W; Cideciyan, Artur V; Aleman, Tomas S; Pianta, Michael J; Pearce-Kelling, Susan E; Miller, Brian J; Jacobson, Samuel G; Aguirre, Gustavo D; Acland, Gregory M

    2002-04-30

    Rhodopsin is the G protein-coupled receptor that is activated by light and initiates the transduction cascade leading to night (rod) vision. Naturally occurring pathogenic rhodopsin (RHO) mutations have been previously identified only in humans and are a common cause of dominantly inherited blindness from retinal degeneration. We identified English Mastiff dogs with a naturally occurring dominant retinal degeneration and determined the cause to be a point mutation in the RHO gene (Thr4Arg). Dogs with this mutant allele manifest a retinal phenotype that closely mimics that in humans with RHO mutations. The phenotypic features shared by dog and man include a dramatically slowed time course of recovery of rod photoreceptor function after light exposure and a distinctive topographic pattern to the retinal degeneration. The canine disease offers opportunities to explore the basis of prolonged photoreceptor recovery after light in RHO mutations and determine whether there are links between the dysfunction and apoptotic retinal cell death. The RHO mutant dog also becomes the large animal needed for preclinical trials of therapies for a major subset of human retinopathies.

  8. Complementary DNA encoding the human T-cell FK506-binding protein, a peptidylprolyl cis-trans isomerase distinct from cyclophilin

    SciTech Connect

    Maki, Noboru; Sekiguchi, Fumiko; Nishimaki, Junichi; Miwa, Keiko; Hayano, Toshiya; Takahashi, Nobuhiro; Suzuki, Masanori )

    1990-07-01

    The recently discovered macrolide FK506 has been demonstrated to have potent immunosuppressive activity at concentrations 100-fold lower than cyclosporin A, a cyclic undecapeptide that is used to prevent rejection after transplantation of bone marrow and organs, such as kidney, heart, and liver. After the recent discovery that the cylcosporin A-binding protein cyclophilin is identical to peptidylprolyl cis-trans isomerase, a cellular binding protein for FK506 was found to be distinct from cyclophilin but to have the same enzymatic activity. In this study, the authors isolated a cDNA coding for FK506-binding protein (FKBP) from human peripheral blood T cells by using mixed 20-mer oligonucleotide probes synthesized on the basis of the sequence, Glu-Asp-Gly-Lys-Lys-Phe-Asp, reported for bovine FKBP. The DNA isolated contained an open reading frame encoding 108 amino acid residues. The first 40 residues of the deduced amino acid sequence were identical to those of the reported amino-terminal sequence of bovine FKBP, indicating that the DNA sequence isolated represents the gene coding for FKBP. This result suggests that two catalytically similar proteins, cyclophilin and FKBP, evolved independently. In Northern blot analysis, mRNA species of {approx}1.8 kilobases that hybridized with human FKBP cDNA were detected in poly(A){sup +} RNAs from brain, lung, liver, and placental cells and leukocytes. Induction of Jurkat leukemic T cells with phorbol 12-myristate 13-acetate and ionomycin did not affect the level of FKBP mRNA.

  9. New invMED1 element cis-activates human multidrug-related MDR1 and MVP genes, involving the LRP130 protein

    PubMed Central

    Labialle, Stéphane; Dayan, Guila; Gayet, Landry; Rigal, Dominique; Gambrelle, Joël; Baggetto, Loris G.

    2004-01-01

    The MDR1 gene is a key component of the cytotoxic defense network and its overexpression results in the multidrug resistance (MDR) phenotype. However, the molecular mechanisms that regulate the MDR1 gene and coordinate multiple MDR-related genes expression are poorly understood. In a previous study, we identified a new 12 bp cis-activating region in the 5′-flanking region of the human MDR1 gene, which we called inverted MED1. In the present study, we characterized the precise binding element, which we named invMED1, and revealed the presence of the LRP130 protein as the nuclear factor. Its binding intensity increases with the endogenous MDR1 geneexpression and with the MDR level of CEM leukemia cells. Interestingly, the LRP130 level did not vary with the chemoresistance level. We observed the involvement of LRP130 in the transcriptional activity of the MDR1 gene promoter, and moreover, in that of the MDR-related, invMED1-containing, MVP gene promoter. We used siRNAs and transcriptional decoys in two unrelated human cancer cell lines to show the role of the invMED1/LRP130 couple in both MDR1 and MVP endogenous genes activities. We showed that invMED1 was localized in the −105/−100 and −148/−143 regions of the MDR1 and MVP gene promoters, respectively. In addition, since the invMED1 sequence is primarily located in the −160/−100 bp region of mammalian MDR-related genes, our results present the invMED1/LRP130 couple as a potential central regulator of the transcription of these genes. PMID:15272088

  10. Mimicking human expert interpretation of remotely sensed raster imagery by using a novel segmentation analysis within ArcGIS

    NASA Astrophysics Data System (ADS)

    Le Bas, Tim; Scarth, Anthony; Bunting, Peter

    2015-04-01

    Traditional computer based methods for the interpretation of remotely sensed imagery use each pixel individually or the average of a small window of pixels to calculate a class or thematic value, which provides an interpretation. However when a human expert interprets imagery, the human eye is excellent at finding coherent and homogenous areas and edge features. It may therefore be advantageous for computer analysis to mimic human interpretation. A new toolbox for ArcGIS 10.x will be presented that segments the data layers into a set of polygons. Each polygon is defined by a K-means clustering and region growing algorithm, thus finding areas, their edges and any lineations in the imagery. Attached to each polygon are the characteristics of the imagery such as mean and standard deviation of the pixel values, within the polygon. The segmentation of imagery into a jigsaw of polygons also has the advantage that the human interpreter does not need to spend hours digitising the boundaries. The segmentation process has been taken from the RSGIS library of analysis and classification routines (Bunting et al., 2014). These routines are freeware and have been modified to be available in the ArcToolbox under the Windows (v7) operating system. Input to the segmentation process is a multi-layered raster image, for example; a Landsat image, or a set of raster datasets made up from derivatives of topography. The size and number of polygons are set by the user and are dependent on the imagery used. Examples will be presented of data from the marine environment utilising bathymetric depth, slope, rugosity and backscatter from a multibeam system. Meaningful classification of the polygons using their numerical characteristics is the next goal. Object based image analysis (OBIA) should help this workflow. Fully calibrated imagery systems will allow numerical classification to be translated into more readily understandable terms. Peter Bunting, Daniel Clewley, Richard M. Lucas and Sam

  11. The application of silicon sol-gel technology to forensic blood substitute development: Mimicking aspects of whole human blood rheology.

    PubMed

    Stotesbury, Theresa; Illes, Mike; Wilson, Paul; Vreugdenhil, Andrew J

    2017-01-01

    Solution-gelation chemistry has promising applications in forensic synthetic blood substitute development. This research offers a silicon-based sol-gel approach to creating stable materials that share similar rheological properties to that of whole human blood samples. Room temperature, high water content, silicon sol-gels were created using the organosilane precursors 3-glycidoxypropyltrimethoxysilane and tetraethylorthosilicate along with various concentrations of filler and pigment. Shear-thinning non-Newtonian properties were observed within most formulations of the presented materials. The effects of colloidal concentration, temperature, age and filler addition on the viscosity of the sol-gels were investigated. SEM-EDS analysis was used to identify the behavior of the fillers within the film and support their inclusion for basic bloodstain pattern simulation. A final proposed candidate sol-gel was assessed using a previously reported passive drip simulation test on a hard, dry surface and passed. This works represents encouraging development in providing safe material alternatives to using whole human blood for forensic training and research.

  12. K-Ras and cyclooxygenase-2 coactivation augments intraductal papillary mucinous neoplasm and Notch1 mimicking human pancreas lesions

    PubMed Central

    Chiblak, Sara; Steinbauer, Brigitte; Pohl-Arnold, Andrea; Kucher, Dagmar; Abdollahi, Amir; Schwager, Christian; Höft, Birgit; Esposito, Irene; Müller-Decker, Karin

    2016-01-01

    Mutational activation of K-Ras is an initiating event of pancreatic ductal adenocarcinomas (PDAC) that may develop either from pancreatic intraepithelial neoplasia (PanIN) or intraductal papillary mucinous neoplasms (IPMN). Cyclooxygenase-2 (COX-2)-derived prostaglandin E2 (PGE2) is causally related to pancreatic carcinogenesis. Here, we deciphered the impact of COX-2, a key modulator of inflammation, in concert with active mutant K-RasG12D on tumor burden and gene expression signature using compound mutant mouse lines. Concomitant activation of COX-2 and K-RasG12D accelerated the progression of pancreatic intraepithelial lesions predominantly with a cystic papillary phenotype resembling human IPMN. Transcriptomes derived from laser capture microdissected preneoplastic lesions of single and compound mutants revealed a signature that was significantly enriched in Notch1 signaling components. In vitro, Notch1 signaling was COX-2-dependent. In line with these findings, human IPMN stratified into intestinal, gastric and pancreatobillary types displayed Notch1 immunosignals with high prevalence, especially in the gastric lesions. In conclusion, a yet unknown link between activated Ras, protumorigenic COX-2 and Notch1 in IPMN onset was unraveled. PMID:27381829

  13. Murine Ccl2/Cx3cr1 Deficiency Results in Retinal Lesions Mimicking Human Age-Related Macular Degeneration

    PubMed Central

    Tuo, Jingsheng; Bojanowski, Christine M.; Zhou, Min; Shen, Defen; Ross, Robert J.; Rosenberg, Kevin I.; Cameron, D. Joshua; Yin, Chunyue; Kowalak, Jeffrey A.; Zhuang, Zhengping; Zhang, Kang; Chan, Chi-Chao

    2007-01-01

    Purpose Senescent Ccl2-/- mice are reported to develop cardinal features of human age-related macular degeneration (AMD). Loss-of-function single-nucleotide polymorphisms within CX3CR1 are also found to be associated with AMD. The authors generated Ccl2-/-/Cx3cr1-/- mice to establish a more characteristic and reproducible AMD model. Methods Single Ccl2- and Cx3cr1-deficient mice were crossbred to obtain Ccl2-/-/Cx3cr1-/- mice. Funduscopy, histopathology, retinal A2E quantification, proteomics, RT-PCR gene expression assay, immunochemistry, and Western blotting were used to examine the retina and to evaluate gene expression within the retinal tissue. Results By 6 weeks of age, all Ccl2-/-/Cx3cr1-/- mice developed AMD-like retinal lesions, including drusen, retinal pigment epithelium alteration, and photoreceptor degeneration. Furthermore, choroidal neovascularization occurred in 15% of the mice. These degenerative lesions progressed with age. A2E, a major lipofuscin fluorophore that accumulated during AMD progression, was significantly higher in the Ccl2-/-/Cx3cr1-/- retina than in the wild-type retina. Complement cofactor was higher in the Ccl2-/-/Cx3cr1-/- RPE. Proteomics data indicated that four proteins were differentially expressed in Ccl2-/-/Cx3cr1-/- retina compared with control. One of these proteins, ERp29, an endoplasmic reticulum protein, functions as an escort chaperone and in protein folding. Conclusions The authors concluded that Ccl2-/-/Cx3cr1-/- mice develop a broad spectrum of AMD abnormalities with early onset and high penetrance. These observations implicate certain chemokines and endoplasmic reticulum proteins in AMD pathogenesis. Similar to the mechanism of neurodegeneration caused by dysfunction of endoplasmic reticulum proteins, decreased chaperoning may cause misfolded protein accumulation, leading to drusen formation and retinal degeneration. PMID:17652758

  14. Cis-Nerolidol Induces Endoplasmic Reticulum Stress and Cell Death in Human Hepatocellular Carcinoma Cells through Extensive CYP2C19 and CYP1A2 Oxidation.

    PubMed

    Biazi, Bruna Isabela; Zanetti, Thalita Alves; Baranoski, Adrivanio; Corveloni, Amanda Cristina; Mantovani, Mário Sérgio

    2017-03-02

    Of late, many studies are attempting to find new molecules with anti-cancer properties, especially those with the capability to inhibit cell growth. The aim of this work was to evaluate nerolidol, a plant-based compound, as its cytotoxicity, genotoxicity, antiproliferative and apoptotic induction, cell cycle, mitochondrial membrane potential, and RT-qPCR of transcripts related to those pathways in the human hepatocellular carcinoma cell line (HepG2/C3A). Only cis-nerolidol (C-NER) demonstrated cytotoxicity (100 to 250 μM) activity and was selected to conduct the following experiments. C-NER did not show genotoxic activity, but altered the mitochondrial membrane potential, reduced cell proliferation by arresting cell cycle in G1 phase and induced cell death. RT-qPCR showed that C-NER down-regulated genes related to apoptosis (BAK1, BAX, CAPN1, CASP8, CASP9, PARP1 and TP53), cell cycle (CCND1, CCNE1, CDK1 and CDK2), xenobiotic metabolism (CYP2D6 and CYP3A4) and paraptosis (IGF1R receptor). Up-regulation was seen in case of genes related to cell survival (BBC3 and MYC) and reticulum stress protein response (EIF2AK3 and ERN1) and xenobiotic metabolism (CYP1A2 and CYP2C19). We deduced that the antiproliferative activity of C-NER is attributable to its modulation of the cyclins and cyclin-dependent kinases as these proteins are necessary for G1/S phase transition. EIF2AK3, ERN1, CYP2C19 and CYP1A2 up-regulation suggests that endoplasmic reticulum stress was induced owing to the increased activity of cytochrome P450 enzymes. Caspase-independent cell death was also observed, indicating that another type of cell death, paraptosis, was triggered. Our results indicate that C-NER has considerable potential in anti-cancer therapy because it modulates important molecular targets of cell survival and proliferation. This article is protected by copyright. All rights reserved.

  15. Mutagenesis in monkey cells of a vector containing a single d(GPG) cis-diamminedichloroplatinum(II) adduct placed on codon 13 of the human H-ras proto-oncogene.

    PubMed Central

    Pillaire, M J; Margot, A; Villani, G; Sarasin, A; Defais, M; Gentil, A

    1994-01-01

    Cisplatin (cis-[Pt(NH3)2Cl2]) is a widely used antitumor agent whose mutagenic activity raises the possibility of the induction of secondary cancer as a result of treatment. Mutation of the proto-oncogene H-ras is found in more than 30% of all human tumors, where it has been postulated to contribute to the initiation and progression of human cancers. Activating mutations in the H-ras gene are predominantly single-base substitutions, most frequently at codons 12, 13 and 61. In the present work we have studied the mutational spectra induced by a single cis-[Pt(NH3)2d(GpG)] adduct, the most frequent DNA crosslink formed by cisplatin. We have constructed a 25-mer-Pt oligonucleotide singly modified at codon 13 (GGT) within the human H-ras DNA sequence and we have inserted it into a single-stranded SV40-based shuttle vector able to replicate in simian COS7 cells. After replication in the mammalian host, vectors were extracted, amplified in bacteria and DNA from 124 randomly chosen colonies was sequenced. The observed mutation frequency was 21%. Base substitutions were the most frequent modification. 92% of the mutagenic events occurred at one or both of the platinated guanines of codon 13. The single G-->T transversion accounted for 65% of the total mutations scored. All single base substitutions were located at the G in the 3' position showing, for the first time, that the guanine at the 3' side of a cis-[Pt(NH3)2d(GpG)] adduct may be a preferential site for cisplatin induced mutations. The substitution G-->T at this position of the codon 13 of the H-ras proto-oncogene is known to induce the oncogenic properties of the p21ras protein. Images PMID:8041613

  16. cis-1,2-Dichloroethylene

    Integrated Risk Information System (IRIS)

    EPA / 635 / R - 09 / 006 F www.epa.gov / iris TOXICOLOGICAL REVIEW OF cis - 1,2 - DICHLOROETHYLENE and trans - 1,2 - DICHLOROETHYLENE ( CAS Nos . cis : 156 - 59 - 2 ; trans : 156 - 60 - 5 ; mixture : 540 - 59 - 0 ) In Support of Summary Information on the Integrated Risk Information System ( IRIS )

  17. Characterization of the human lipoprotein lipase (LPL) promoter: evidence of two cis-regulatory regions, LP-alpha and LP-beta, of importance for the differentiation-linked induction of the LPL gene during adipogenesis.

    PubMed Central

    Enerbäck, S; Ohlsson, B G; Samuelsson, L; Bjursell, G

    1992-01-01

    When preadipocytes differentiate into adipocytes, several differentiation-linked genes are activated. Lipoprotein lipase (LPL) is one of the first genes induced during this process. To investigate early events in adipocyte development, we have focused on the transcriptional activation of the LPL gene. For this purpose, we have cloned and fused different parts of intragenic and flanking sequences with a chloramphenicol acetyltransferase reporter gene. Transient transfection experiments and DNase I hypersensitivity assays indicate that several positive as well as negative elements contribute to transcriptional regulation of the LPL gene. When reporter gene constructs were stably introduced into preadipocytes, we were able to monitor and compare the activation patterns of different promoter deletion mutants at selected time points representing the process of adipocyte development. We could delimit two cis-regulatory elements important for gradual activation of the LPL gene during adipocyte development in vitro. These elements, LP-alpha (-702 to -666) and LP-beta (-468 to -430), contain a striking similarity to a consensus sequence known to bind the transcription factors HNF-3 and fork head. Results of gel mobility shift assays and DNase I and exonuclease III in vitro protection assays indicate that factors with DNA-binding properties similar to those of the HNF-3/fork head family of transcription factors are present in adipocytes and interact with LP-alpha and LP-beta. We also demonstrate that LP-alpha and LP-beta were both capable of conferring a differentiation-linked expression pattern to a heterolog promoter, thus mimicking the expression of the endogenous LPL gene during adipocyte differentiation. These findings indicate that interactions with LP-alpha and LP-beta could be a part of a differentiation switch governing induction of the LPL gene during adipocyte differentiation. Images PMID:1406652

  18. CisLunar Habitat Internal Architecture Design Criteria

    NASA Technical Reports Server (NTRS)

    Jones, R.; Kennedy, K.; Howard, R.; Whitmore, M.; Martin, C.; Garate, J.

    2017-01-01

    BACKGROUND: In preparation for human exploration to Mars, there is a need to define the development and test program that will validate deep space operations and systems. In that context, a Proving Grounds CisLunar habitat spacecraft is being defined as the next step towards this goal. This spacecraft will operate differently from the ISS or other spacecraft in human history. The performance envelope of this spacecraft (mass, volume, power, specifications, etc.) is being defined by the Future Capabilities Study Team. This team has recognized the need for a human-centered approach for the internal architecture of this spacecraft and has commissioned a CisLunar Phase-1 Habitat Internal Architecture Study Team to develop a NASA reference configuration, providing the Agency with a "smart buyer" approach for future acquisition. THE CISLUNAR HABITAT INTERNAL ARCHITECTURE STUDY: Overall, the CisLunar Habitat Internal Architecture study will address the most significant questions and risks in the current CisLunar architecture, habitation, and operations concept development. This effort is achieved through definition of design criteria, evaluation criteria and process, design of the CisLunar Habitat Phase-1 internal architecture, and the development and fabrication of internal architecture concepts combined with rigorous and methodical Human-in-the-Loop (HITL) evaluations and testing of the conceptual innovations in a controlled test environment. The vision of the CisLunar Habitat Internal Architecture Study is to design, build, and test a CisLunar Phase-1 Habitat Internal Architecture that will be used for habitation (e.g. habitability and human factors) evaluations. The evaluations will mature CisLunar habitat evaluation tools, guidelines, and standards, and will interface with other projects such as the Advanced Exploration Systems (AES) Program integrated Power, Avionics, Software (iPAS), and Logistics for integrated human-in-the-loop testing. The mission of the Cis

  19. Human in vitro 3D co-culture model to engineer vascularized bone-mimicking tissues combining computational tools and statistical experimental approach.

    PubMed

    Bersini, Simone; Gilardi, Mara; Arrigoni, Chiara; Talò, Giuseppe; Zamai, Moreno; Zagra, Luigi; Caiolfa, Valeria; Moretti, Matteo

    2016-01-01

    The generation of functional, vascularized tissues is a key challenge for both tissue engineering applications and the development of advanced in vitro models analyzing interactions among circulating cells, endothelium and organ-specific microenvironments. Since vascularization is a complex process guided by multiple synergic factors, it is critical to analyze the specific role that different experimental parameters play in the generation of physiological tissues. Our goals were to design a novel meso-scale model bridging the gap between microfluidic and macro-scale studies, and high-throughput screen the effects of multiple variables on the vascularization of bone-mimicking tissues. We investigated the influence of endothelial cell (EC) density (3-5 Mcells/ml), cell ratio among ECs, mesenchymal stem cells (MSCs) and osteo-differentiated MSCs (1:1:0, 10:1:0, 10:1:1), culture medium (endothelial, endothelial + angiopoietin-1, 1:1 endothelial/osteo), hydrogel type (100%fibrin, 60%fibrin+40%collagen), tissue geometry (2 × 2 × 2, 2 × 2 × 5 mm(3)). We optimized the geometry and oxygen gradient inside hydrogels through computational simulations and we analyzed microvascular network features including total network length/area and vascular branch number/length. Particularly, we employed the "Design of Experiment" statistical approach to identify key differences among experimental conditions. We combined the generation of 3D functional tissue units with the fine control over the local microenvironment (e.g. oxygen gradients), and developed an effective strategy to enable the high-throughput screening of multiple experimental parameters. Our approach allowed to identify synergic correlations among critical parameters driving microvascular network development within a bone-mimicking environment and could be translated to any vascularized tissue.

  20. Liquid chromatography-mass spectrometry of cis- and all-trans-lycopene in human serum and prostate tissue after dietary supplementation with tomato sauce.

    PubMed

    van Breemen, Richard B; Xu, Xiaoying; Viana, Marlos A; Chen, Longwen; Stacewicz-Sapuntzakis, Maria; Duncan, Claudine; Bowen, Phyllis E; Sharifi, Roohollah

    2002-04-10

    Several epidemiological studies suggest a lower incidence of prostate cancer in men who routinely consume tomato products. Tomatoes are the primary dietary source of lycopene, which is among the most potent antioxidants of the carotenoids. Men with clinical stage T1 or T2 prostate adenocarcinoma were recruited (n = 32) and consumed tomato sauce based pasta dishes for 3 weeks (equivalent to 30 mg of lycopene per day) before radical prostectomy. Prostate tissue from needle biopsy just before intervention and prostectomy after supplementation from a subset of 11 subjects was evaluated for both total lycopene and lycopene geometrical isomer ratios. A gradient HPLC system using a C(18) column with UV-vis absorbance detection was used to measure total lycopene. Because the absorbance detector was insufficiently sensitive, HPLC with a C(30) column and positive ion atmospheric pressure chemical ionization mass spectrometric (LC-MS) detection was developed as a new assay to measure the ratio of lycopene cis/trans isomers in these samples. The limit of detection of the LC-MS method was determined to be 0.93 pmol of lycopene on-column, and a linear response was obtained over 3 orders of magnitude. Total lycopene in serum increased 2.0-fold from 35.6 to 69.9 microg/dL (from 0.664 to 1.30 microM) as a result of dietary supplementation with tomato sauce, whereas total lycopene in prostate tissue increased 3.0-fold from 0.196 to 0.582 ng/mg of tissue (from 0.365 to 1.09 pmol/mg). all-trans-Lycopene and at least 14 cis-isomer peaks were detected in prostate tissue and serum. The mean proportion of all-trans-lycopene in prostate tissue was approximately 12.4% of total lycopene before supplementation but increased to 22.7% after dietary intervention with tomato sauce. In serum there was only a 2.8% but statistically significant increase in the proportion of all-trans-lycopene after intervention. These results indicate that short-term supplementation with tomato sauce containing

  1. Vibrational overtone spectrum of matrix isolated cis, cis-HOONO.

    PubMed

    Zhang, Xu; Nimlos, Mark R; Ellison, G Barney; Varner, Mychel E; Stanton, John F

    2007-05-07

    Cis, cis-peroxynitrous acid is known to be an intermediate in atmospheric reactions between OH and NO2 as well as HOO and NO. The infrared absorption spectra of matrix-isolated cc-HOONO and cc-DOONO in argon have been observed in the range of 500-8000 cm-1. Besides the seven fundamental vibrational modes that have been assigned earlier for this molecule [Zhang et al., J. Chem. Phys. 124, 084305 (2006)], more than 50 of the overtone and combination bands have been observed for cc-HOONO and cc-DOONO. Ab initio CCSD(T)/atomic natural orbital anharmonic force field calculations were used to help guide the assignments. Based on this study of the vibrational overtone transitions of cis, cis-HOONO that go as high as 8000 cm-1 and the earlier paper on the vibrational fundamentals, we conclude that the CCSD(T)/ANO anharmonic frequencies seem to correct to +/-35 cm-1. The success of the theoretically predicted anharmonic frequencies {upsilon} in assigning overtone spectra of HOONO up to 8000 cm-1 suggests that the CCSD(T)/ANO method is producing a reliable potential energy surface for this reactive molecule.

  2. Kaposi's sarcoma-associated herpesvirus (human herpesvirus 8) replication and transcription factor activates the K9 (vIRF) gene through two distinct cis elements by a non-DNA-binding mechanism.

    PubMed

    Ueda, Keiji; Ishikawa, Kayo; Nishimura, Ken; Sakakibara, Shuhei; Do, Eunju; Yamanishi, Koichi

    2002-12-01

    The replication and transcription activator (RTA) of Kaposi's sarcoma-associated herpesvirus (KSHV), or human herpesvirus 8, a homologue of Epstein-Barr virus BRLF1 or Rta, is a strong transactivator and inducer of lytic replication. RTA acting alone can induce lytic replication of KSHV in infected cell lines that originated from primary effusion lymphomas, leading to virus production. During the lytic replication process, RTA activates many kinds of genes, including polyadenylated nuclear RNA, K8, K9 (vIRF), ORF57, and so on. We focused here on the mechanism of how RTA upregulates the K9 (vIRF) promoter and identified two independent cis-acting elements in the K9 (vIRF) promoter that responded to RTA. These elements were finally confined to the sequence 5'-TCTGGGACAGTC-3' in responsive element (RE) I-2B and the sequence 5'-GTACTTAAAATA-3' in RE IIC-2, both of which did not share sequence homology. Multiple factors bound specifically with these elements, and their binding was correlated with the RTA-responsive activity. Electrophoretic mobility shift assay with nuclear extract from infected cells and the N-terminal part of RTA expressed in Escherichia coli, however, did not show that RTA interacted directly with these elements, in contrast to the RTA responsive elements in the PAN/K12 promoter region, the ORF57/K8 promoter region. Thus, it was likely that RTA could transactivate several kinds of unique cis elements without directly binding to the responsive elements, probably through cooperation with other DNA-binding factors.

  3. Genome-wide significant schizophrenia risk variation on chromosome 10q24 is associated with altered cis-regulation of BORCS7, AS3MT, and NT5C2 in the human brain.

    PubMed

    Duarte, Rodrigo R R; Troakes, Claire; Nolan, Matthew; Srivastava, Deepak P; Murray, Robin M; Bray, Nicholas J

    2016-09-01

    Chromosome 10q24.32-q24.33 is one of the most robustly supported risk loci to emerge from genome-wide association studies (GWAS) of schizophrenia. However, extensive linkage disequilibrium makes it difficult to distinguish the actual susceptibility gene(s) at the locus, limiting its value for improving biological understanding of the condition. In the absence of coding changes that can account for the association, risk is likely conferred by altered regulation of one or more genes in the region. We, therefore, used highly sensitive measures of allele-specific expression to assess cis-regulatory effects associated with the two best-supported schizophrenia risk variants (SNP rs11191419 and indel ch10_104957618_I/rs202213518) on the primary positional candidates BORCS7, AS3MT, CNNM2, and NT5C2 in the human brain. Heterozygosity at rs11191419 was associated with increased allelic expression of BORCS7 and AS3MT in the fetal and adult brain, and with reduced allelic expression of NT5C2 in the adult brain. Heterozygosity at ch10_104957618_I was associated with reduced allelic expression of NT5C2 in both the fetal and adult brain. Comparisons between cDNA ratios in heterozygotes and homozygotes for the risk alleles indicated that cis-effects on NT5C2 expression in the adult dorsolateral prefrontal cortex could be largely accounted for by genotype at these two risk variants. While not excluding effects on other genes in the region, this study implicates altered neural expression of BORCS7, AS3MT, and NT5C2 in susceptibility to schizophrenia arising from genetic variation at the chromosome 10q24 locus. © 2016 The Authors. American Journal of Medical Genetics Part B: Neuropsychiatric Genetics Published by Wiley Periodicals, Inc.

  4. Selective inhibition of human immunodeficiency viruses by racemates and enantiomers of cis-5-fluoro-1-[2-(hydroxymethyl)-1,3-oxathiolan-5-yl]cytosine.

    PubMed Central

    Schinazi, R F; McMillan, A; Cannon, D; Mathis, R; Lloyd, R M; Peck, A; Sommadossi, J P; St Clair, M; Wilson, J; Furman, P A

    1992-01-01

    2',3'-Dideoxy-5-fluoro-3'-thiacytidine (FTC) has been shown to be a potent and selective compound against human immunodeficiency virus type 1 in acutely infected primary human lymphocytes. FTC is also active against human immunodeficiency virus type 2, simian immunodeficiency virus, and feline immunodeficiency virus in various cell culture systems, including human monocytes. The antiviral activity can be prevented by 2'-deoxycytidine, but not by other natural nucleosides, suggesting that FTC must be phosphorylated to be active and 2'-deoxycytidine kinase is responsible for the phosphorylation. By using chiral columns or enzymatic techniques, the two enantiomers of FTC were separated. The (-)-beta-enantiomer of FTC was about 20-fold more potent than the (+)-beta-enantiomer against human immunodeficiency virus type 1 in peripheral blood mononuclear cells and was also effective in thymidine kinase-deficient CEM cells. Racemic FTC and its enantiomers were nontoxic to human lymphocytes and other cell lines at concentrations of up to 100 microM. Studies with human bone marrow cells indicated that racemic FTC and its (-)-enantiomer had a median inhibitory concentration of > 30 microM. The (+)-enantiomer was significantly more toxic than the (-)-enantiomer to myeloid progenitor cells. The susceptibilities to FTC of pretherapy isolates in comparison with those of posttherapy 3'-azido-3'-deoxythymidine-resistant viruses in human lymphocytes were not substantially different. Similar results were obtained with well-defined 2',3'-dideoxyinosine- and nevirapine-resistant viruses. (-)-FTC-5'-triphosphate competitively inhibited human immunodeficiency virus type 1 reverse transcriptase, with an inhibition constant of 2.9 microM, when a poly(I)n.oligo(dC)19-24 template primer was used. These results suggest that further development of the (-)-Beta-enantiomer of FTC is warranted as an antiviral agent for infections caused by human immunodeficiency viruses. Images PMID:1283296

  5. Biodegradation of cis-1,2-Dichloroethene in Simulated Underground Thermal Energy Storage Systems.

    PubMed

    Ni, Zhuobiao; van Gaans, Pauline; Smit, Martijn; Rijnaarts, Huub; Grotenhuis, Tim

    2015-11-17

    Underground thermal energy storage (UTES) use has showed a sharp rise in numbers in the last decades, with aquifer thermal energy storage (ATES) and borehole thermal energy storage (BTES) most widely used. In many urban areas with contaminated aquifers, there exists a desire for sustainable heating and cooling with UTES and a need for remediation. We investigated the potential synergy between UTES and bioremediation with batch experiments to simulate the effects of changing temperature and liquid exchange that occur in ATES systems, and of only temperature change occurring in BTES systems on cis-DCE reductive dechlorination. Compared to the natural situation (NS) at a constant temperature of 10 °C, both UTES systems with 25/5 °C for warm and cold well performed significantly better in cis-DCE (cis-1,2-dichloroethene) removal. The overall removal efficiency under mimicked ATES and BTES conditions were respectively 13 and 8.6 times higher than in NS. Inoculation with Dehalococcoides revealed that their initial presence is a determining factor for the dechlorination process. Temperature was the dominating factor when Dehalococcoides abundance was sufficient. Stimulated biodegradation was shown to be most effective in the mimicked ATES warm well because of the combined effect of suitable temperature, sustaining biomass growth, and regular cis-DCE supply.

  6. Xanthogranulomatous cholecystitis mimicking gallbladder cancer.

    PubMed

    Ewelukwa, Ofor; Ali, Omair; Akram, Salma

    2014-05-08

    Xanthogranulomatous cholecystitis (XGC) is a benign, uncommon variant of chronic cholecystitis characterised by focal or diffuse destructive inflammatory process of the gallbladder (GB). Macroscopically, it appears like yellowish tumour-like masses in the wall of the GB. This article reports on a 74-year-old woman with XGC mimicking GB cancer.

  7. Serine/Arginine-Rich Splicing Factor 3 and Heterogeneous Nuclear Ribonucleoprotein A1 Regulate Alternative RNA Splicing and Gene Expression of Human Papillomavirus 18 through Two Functionally Distinguishable cis Elements

    PubMed Central

    Ajiro, Masahiko; Tang, Shuang; Doorbar, John

    2016-01-01

    ABSTRACT Human papillomavirus 18 (HPV18) is the second most common oncogenic HPV type associated with cervical, anogenital, and oropharyngeal cancers. Like other oncogenic HPVs, HPV18 encodes two major (one early and one late) polycistronic pre-mRNAs that are regulated by alternative RNA splicing to produce a repertoire of viral transcripts for the expression of individual viral genes. However, RNA cis-regulatory elements and trans-acting factors contributing to HPV18 alternative RNA splicing remain unknown. In this study, an exonic splicing enhancer (ESE) in the nucleotide (nt) 3520 to 3550 region in the HPV18 genome was identified and characterized for promotion of HPV18 929^3434 splicing and E1^E4 production through interaction with SRSF3, a host oncogenic splicing factor differentially expressed in epithelial cells and keratinocytes. Introduction of point mutations in the SRSF3-binding site or knockdown of SRSF3 expression in cells reduces 929^3434 splicing and E1^E4 production but activates other, minor 929^3465 and 929^3506 splicing. Knockdown of SRSF3 expression also enhances the expression of E2 and L1 mRNAs. An exonic splicing silencer (ESS) in the HPV18 nt 612 to 639 region was identified as being inhibitory to the 233^416 splicing of HPV18 E6E7 pre-mRNAs via binding to hnRNP A1, a well-characterized, abundantly and ubiquitously expressed RNA-binding protein. Introduction of point mutations into the hnRNP A1-binding site or knockdown of hnRNP A1 expression promoted 233^416 splicing and reduced E6 expression. These data provide the first evidence that the alternative RNA splicing of HPV18 pre-mRNAs is subject to regulation by viral RNA cis elements and host trans-acting splicing factors. IMPORTANCE Expression of HPV18 genes is regulated by alternative RNA splicing of viral polycistronic pre-mRNAs to produce a repertoire of viral early and late transcripts. RNA cis elements and trans-acting factors contributing to HPV18 alternative RNA splicing have been

  8. Polymorphism of linoleic acid (cis-9, cis-12-octadecadienoic acid) and alpha-linolenic acid (cis-9, cis-12, cis-15-octadecatrienoic acid).

    PubMed

    Ueno, S; Miyazaki, A; Yano, J; Furukawa, Y; Suzuki, M; Sato, K

    2000-10-01

    Crystallization and polymorphic properties of linoleic acid (cis-9, cis-12-Octadecadienoic acid) (LA) and alpha-linolenic acid (cis-9, cis-12, cis-15-Octadecatrienoic acid) (alpha-LNA) have been studied by optical microscopy, differential scanning calorimetry (DSC) and X-ray diffraction (XRD). The DSC analyses presented three polymorphs in LA, and two polymorphs in alpha-LNA. The XRD patterns of the higher- and lower-temperature forms in LA and alpha-LNA showed orthorhombic O'(//)+O-like and O'(//) subcell, which were similar to those of alpha- and gamma-forms of mono-unsaturated fatty acids, respectively. From the solvent crystallization of LA and alpha-LNA in acetonitrile, single crystals of the higher temperature polymorphs have been obtained. The crystal habits of truncated rhombic shape were also similar to those of alpha-forms of the mono-unsaturated fatty acids. The enthalpy and entropy values of fusion and dissolution of the alpha-forms of LA, alpha-LNA and oleic acid showed that the two values decreased with increasing number of the cis-double bond.

  9. Multiple Functional Variants in cis Modulate PDYN Expression.

    PubMed

    Babbitt, Courtney C; Silverman, Jesse S; Haygood, Ralph; Reininga, Jennifer M; Rockman, Matthew V; Wray, Gregory A

    2010-02-01

    Understanding genetic variation and its functional consequences within cis-regulatory regions remains an important challenge in human genetics and evolution. Here, we present a fine-scale functional analysis of segregating variation within the cis-regulatory region of prodynorphin, a gene that encodes an endogenous opioid precursor with roles in cognition and disease. In order to characterize the functional consequences of segregating variation in cis in a region under balancing selection in different human populations, we examined associations between specific polymorphisms and gene expression in vivo and in vitro. We identified five polymorphisms within the 5' flanking region that affect transcript abundance: a 68-bp repeat recognized in prior studies, as well as two microsatellites and two single nucleotide polymorphisms not previously implicated as functional variants. The impact of these variants on transcription differs by brain region, sex, and cell type, implying interactions between cis genotype and the differentiated state of cells. The effects of individual variants on expression level are not additive in some combinations, implying epistatic interactions between nearby variants. These data reveal an unexpectedly complex relationship between segregating genetic variation and its expression-trait consequences and highlights the importance of close functional scrutiny of natural genetic variation within even relatively well-studied cis-regulatory regions.

  10. Missed Appendicitis: Mimicking Urologic Symptoms

    PubMed Central

    Akhavizadegan, Hamed

    2012-01-01

    Appendicitis, a common disease, has different presentations. This has made its diagnosis difficult. This paper aims to present two cases of missed appendicitis with completely urologic presentation and the way that helped us to reach the correct diagnosis. The first case with symptoms fully related to kidney and the second mimicking epididymorchitis hindered prompt diagnosis. Right site of the pain, relapsing fever, frequent physical examination, and resistance to medical treatment were main clues which help us to make correct diagnosis. PMID:23326748

  11. Human cytomegalovirus contains a tegument protein that enhances transcription from promoters with upstream ATF and AP-1 cis-acting elements.

    PubMed Central

    Liu, B; Stinski, M F

    1992-01-01

    The tegument proteins of human cytomegalovirus are introduced into cells as components of infectious virus. The tegument proteins may affect viral and cellular transcription prior to the synthesis of the immediate-early viral regulatory proteins. The phosphorylated tegument protein of 71 kDa (pp71) is reported to be encoded by the UL82 gene. The UL82 gene products transactivated promoters containing upstream ATF or AP-1 binding sites. In contrast, the phosphorylated tegument protein of 65 kDa (pp65), encoded by the UL83 gene, had no detectable effect on these promoters. Enhancement by UL82 of downstream transcription was directly proportional to the number of upstream ATF sites. Response to UL82 transactivation was abolished by mutation of the ATF site. Mutation in the carboxy-terminal region of UL82 also eliminated transactivation. Even though the major immediate-early promoter of human cytomegalovirus is a strong enhancer-containing promoter, UL82 further enhanced its transcription as much as 20-fold. The mechanism of UL82 enhancement of transcription from viral or cellular promoters is not known, but the enhancement may be mediated by triggering one of the protein kinase signaling pathways, increasing the affinity of ATF or AP-1 for the target sequence, or stabilizing the complex between the eucaryotic transcription factor and the target sequence. Images PMID:1318413

  12. Identification of cis-acting sequences responsible for phorbol ester induction of human serum amyloid A gene expression via a nuclear factor kB-like transcription factor

    SciTech Connect

    Edbrooke, M.R.; Cheshire, J.K.; Woo, P.; Burt, B.W.

    1989-05-01

    The authors have analyzed the 5'-flanking region of one of the genes coding for the human acute-phase protein, serum amyloid A (SAA). They found that SAA mRNA could be increased fivefold in transfected cells by treatment with phorbol 12-myristate 13-acetate (PMA). To analyze this observation further, they placed a 265-base-pair 5' SAA fragment upstream of the reporter chloramphenicol acetyltransferase (CAT) gene and transfected this construct into HeLa cells. PMA treatment of these transient transfectants resulted in increased CAT expression. Nuclear proteins from PMA-treated HeLa cells bound to this DNA fragment, and methylation interference analysis showed that the binding was specific to the sequence GGGACTTTCC (between -82 and -91), a sequence previously described by others as the binding site for the nuclear factor NF/kappa/B. In a cotransfection competition experiment, they could abolish PMA-induced CAT activity by using cloned human immunodeficiency virus long-terminal-repeat DNA containing the NF/kappa/B-binding sequence. The same long-terminal-repeat DNA containing mutant NF/kappa/B-binding sequences did not affect CAT expression, which suggested that binding by an NF/kappa/B-like factor is required for increased SAA transcription.

  13. Activation of the major immediate early gene of human cytomegalovirus by cis-acting elements in the promoter-regulatory sequence and by virus-specific trans-acting components.

    PubMed Central

    Stinski, M F; Roehr, T J

    1985-01-01

    Upstream of the major immediate early gene of human cytomegalovirus (Towne) is a strong promoter-regulatory region that promotes the synthesis of 1.95-kilobase mRNA (D. R. Thomsen, R. M. Stenberg, W. F. Goins, and M. F. Stinski, Proc. Natl. Acad. Sci. U.S.A. 81:659-663, 1984; M. F. Stinski, D. R. Thomsen, R. M. Stenberg, and L. C. Goldstein, J. Virol. 46:1-14, 1983). The wild-type promoter-regulatory region as well as deletions within this region were ligated upstream of the thymidine kinase, chloramphenicol acetyltransferase, or ovalbumin genes. These gene chimeras were constructed to investigate the role of the regulatory sequences in enhancing downstream expression. The regulatory region extends to approximately 465 nucleotides upstream of the cap site for the initiation of transcription. The extent and type of regulatory sequences upstream of the promoter influences the level of in vitro transcription as well as the amount of in vivo expression of the downstream gene. The regulatory elements for cis-activation appear to be repeated several times within the regulatory region. A direct correlation was established between the distribution of the 19 (5' CCCCAGTTGACGTCAATGGG 3')- and 18 (5' CACTAACGGGACTTTCCAA 3')-nucleotide repeats and the level of downstream expression. In contrast, the 16 (5' CTTGGCAGTACATCAA 3')-nucleotide repeat is not necessary for the enhancement of downstream expression. In a domain associated with the 19- or 18-nucleotide repeats are elements that can be activated in trans by a human cytomegalovirus-specified component but not a herpes simplex virus-specified component. Therefore, the regulatory sequences of the major immediate early gene of human cytomegalovirus have an important role in interacting with cellular and virus-specific factors of the transcription complex to enhance downstream expression of this critical viral gene. Images PMID:2991567

  14. Efficacy of a combination of human recombinant erythropoietin + 13-cis-retinoic acid and dihydroxylated vitamin D3 to improve moderate to severe anaemia in low/intermediate risk myelodysplastic syndromes.

    PubMed

    Ferrero, Dario; Darbesio, Antonella; Giai, Valentina; Genuardi, Mariella; Dellacasa, Chiara Maria; Sorasio, Roberto; Bertini, Marilena; Boccadoro, Mario

    2009-02-01

    The efficacy of human recombinant erythropoietin (rEPO) in myelodysplastic syndromes (MDS) has generally been best in untransfused patients with 'refractory anaemia' according to the World Health Organization (WHO). We treated 63 MDS patients [excluding refractory anaemia with excess blasts, type 2 (RAEB2)] with a previously tested combination of 13-cis-retinoic acid and dihydroxylated vitamin D3 +/- 6-thioguanine in addition to rEPO. Most patients were categorized as refractory cytopenia with multilineage dysplasia and RAEB1, with intermediate 1 International Prognostic Scoring System (IPSS) score; all had Hb <95 g/l, and 70% required regular erythrocyte transfusions. Treatment was well tolerated, and erythroid response rate according to new International Working Group criteria was 60%: 50% in RAEB1 and 64% in non-RAEB patients (P = 0.383). Response rate was not affected by transfusion requirement (63%; 58% in untransfused), IPSS and WHO Prognostic Scoring System scores, and weekly rEPO dosage (30-50 000 U vs. 80 000 U). Median response duration was 16 months. Median survival reached 14 months for RAEB1 and 55 months for non-RAEB patients, with a significant difference in the latter between responders and non-responders (median 82 months vs. 44 months; P = 0.036). Our combined therapy, independent of rEPO dosage, achieved in patients with unfavourable response predictors, a rate of anaemia improvement comparable to the best obtained in lower risk patients by high-dose rEPO.

  15. The use of cis-parinaric acid to determine lipid peroxidation in human erythrocyte membranes. Comparison of normal and sickle erythrocyte membranes.

    PubMed

    Van den Berg, J J; Kuypers, F A; Qju, J H; Chiu, D; Lubin, B; Roelofsen, B; Op den Kamp, J A

    1988-09-15

    The recently developed parinaric acid assay is shown to offer possibilities for studying peroxidation processes in biological membrane systems. Taking the human erythrocyte membrane as a model, several initiating systems were investigated, as well as the effect of residual hemoglobin in ghost membrane preparations. The effectivity of a radical generating system appeared to be strongly dependent upon whether radicals are generated at the membrane level or in the water phase. Thus, cumene hydroperoxide at concentrations of 1.0-1.5 mM was found to be a very efficient initiator of peroxidation in combination with submicromolar levels of hemin-Fe3+ as membrane-bound cofactor. In combination with cumene hydroperoxide, membrane-bound hemoglobin appeared to be about 6-times more effective in promoting peroxidation than hemoglobin in the water phase. Results comparing the behaviour of normal and sickle erythrocyte ghost suspensions in the peroxidation assay suggest that the increased oxidative stress on sickle erythrocyte membranes could be due to enhanced membrane binding of sickle hemoglobin, but also partly to a characteristically higher capability of sickle hemoglobin to promote peroxidation. The order of peroxidation-promoting capabilities that could be derived from the experiments was hemin greater than sickle hemoglobin greater than normal hemoglobin.

  16. Mimicking herpes simplex virus 1 and herpes simplex virus 2 mucosal behavior in a well-characterized human genital organ culture.

    PubMed

    Steukers, Lennert; Weyers, Steven; Yang, Xiaoyun; Vandekerckhove, Annelies P; Glorieux, Sarah; Cornelissen, Maria; Van den Broeck, Wim; Temmerman, Marleen; Nauwynck, Hans J

    2014-07-15

    We developed and morphologically characterized a human genital mucosa explant model (endocervix and ectocervix/vagina) to mimic genital herpes infections caused by herpes simplex virus types 1 (HSV-1) and 2 (HSV-2). Subsequent analysis of HSV entry receptor expression throughout the menstrual cycle in genital tissues was performed, and the evolution of HSV-1/-2 mucosal spread over time was assessed. Nectin-1 and -2 were expressed in all tissues during the entire menstrual cycle. Herpesvirus entry mediator expression was limited mainly to some connective tissue cells. Both HSV-1 and HSV-2 exhibited a plaque-wise mucosal spread across the basement membrane and induced prominent epithelial syncytia.

  17. The dominant Anopheles vectors of human malaria in Africa, Europe and the Middle East: occurrence data, distribution maps and bionomic précis

    PubMed Central

    2010-01-01

    Background This is the second in a series of three articles documenting the geographical distribution of 41 dominant vector species (DVS) of human malaria. The first paper addressed the DVS of the Americas and the third will consider those of the Asian Pacific Region. Here, the DVS of Africa, Europe and the Middle East are discussed. The continent of Africa experiences the bulk of the global malaria burden due in part to the presence of the An. gambiae complex. Anopheles gambiae is one of four DVS within the An. gambiae complex, the others being An. arabiensis and the coastal An. merus and An. melas. There are a further three, highly anthropophilic DVS in Africa, An. funestus, An. moucheti and An. nili. Conversely, across Europe and the Middle East, malaria transmission is low and frequently absent, despite the presence of six DVS. To help control malaria in Africa and the Middle East, or to identify the risk of its re-emergence in Europe, the contemporary distribution and bionomics of the relevant DVS are needed. Results A contemporary database of occurrence data, compiled from the formal literature and other relevant resources, resulted in the collation of information for seven DVS from 44 countries in Africa containing 4234 geo-referenced, independent sites. In Europe and the Middle East, six DVS were identified from 2784 geo-referenced sites across 49 countries. These occurrence data were combined with expert opinion ranges and a suite of environmental and climatic variables of relevance to anopheline ecology to produce predictive distribution maps using the Boosted Regression Tree (BRT) method. Conclusions The predicted geographic extent for the following DVS (or species/suspected species complex*) is provided for Africa: Anopheles (Cellia) arabiensis, An. (Cel.) funestus*, An. (Cel.) gambiae, An. (Cel.) melas, An. (Cel.) merus, An. (Cel.) moucheti and An. (Cel.) nili*, and in the European and Middle Eastern Region: An. (Anopheles) atroparvus, An. (Ano

  18. Recycling Of Cis Photovoltaic Waste

    DOEpatents

    Drinkard, Jr., William F.; Long, Mark O.; Goozner; Robert E.

    1998-07-14

    A method for extracting and reclaiming metals from scrap CIS photovoltaic cells and associated photovoltaic manufacturing waste by leaching the waste with dilute nitric acid, skimming any plastic material from the top of the leaching solution, separating glass substrate from the leachate, electrolyzing the leachate to plate a copper and selenium metal mixture onto a first cathode, replacing the cathode with a second cathode, re-electrolyzing the leachate to plate cadmium onto the second cathode, separating the copper from selenium, and evaporating the depleted leachate to yield a zinc and indium containing solid.

  19. Norwegian scabies mimicking rupioid psoriasis*

    PubMed Central

    Costa, Juliana Bastos; de Sousa, Virna Lygia Lobo Rocha; da Trindade Neto, Pedro Bezerra; Paulo Filho, Thomás de Aquino; Cabral, Virgínia Célia Dias Florêncio; Pinheiro, Patrícia Moura Rossiter

    2012-01-01

    Norwegian scabies is a highly contagious skin infestation caused by an ectoparasite, Scarcoptes scabiei var. Hominis, which mainly affects immunosuppressed individuals. Clinically, it may simulate various dermatoses such as psoriasis, Darier's disease, seborrheic dermatitis, among others. This is a case report of a 33-year-old woman, immunocompetent, diagnosed with generalized anxiety disorder (cancer phobia), who had erythematous, well-defined plaques, covered with rupioid crusts, on her neck, axillary folds, breast, periumbilical region, groin area, besides upper back and elbows, mimicking an extremely rare variant of psoriasis, denominated rupioid psoriasis. PMID:23197214

  20. Megakaryocytes mimicking metastatic breast carcinoma.

    PubMed

    Hoda, Syed A; Resetkova, Erika; Yusuf, Yasmin; Cahan, Anthony; Rosen, Paul P

    2002-05-01

    False-positive diagnosis of lymph nodes occurs when a benign element in a lymph node, or in its capsule, is interpreted as metastatic carcinoma. This report describes a patient with breast carcinoma who had megakaryocytes in axillary sentinel lymph nodes mimicking metastatic carcinoma. The patient had no history of a hematologic disease, and we found no evidence of a concurrent hematopoietic disorder. The megakaryocytes were reactive for CD31, CD61, and von Willebrand factor, but not for cytokeratin (AE1/AE3). Megakaryocytes should be added to the list of benign histologic abnormalities that may simulate metastatic carcinoma in a sentinel lymph node.

  1. The great mimickers of rosacea.

    PubMed

    Olazagasti, Jeannette; Lynch, Peter; Fazel, Nasim

    2014-07-01

    Although rosacea is one of the most common conditions treated by dermatologists, it also is one of the most misunderstood. It is a chronic disorder affecting the central parts of the face and is characterized by frequent flushing; persistent erythema (ie, lasting for at least 3 months); telangiectasia; and interspersed episodes of inflammation with swelling, papules, and pustules. Understanding the clinical variants and disease course of rosacea is important to differentiate this entity from other conditions that can mimic rosacea. Herein we present several mimickers of rosacea that physicians should consider when diagnosing this condition.

  2. Tissue-Mimicking Geometrical Constraints Stimulate Tissue-Like Constitution and Activity of Mouse Neonatal and Human-Induced Pluripotent Stem Cell-Derived Cardiac Myocytes

    PubMed Central

    Pilarczyk, Götz; Raulf, Alexandra; Gunkel, Manuel; Fleischmann, Bernd K.; Lemor, Robert; Hausmann, Michael

    2016-01-01

    The present work addresses the question of to what extent a geometrical support acts as a physiological determining template in the setup of artificial cardiac tissue. Surface patterns with alternating concave to convex transitions of cell size dimensions were used to organize and orientate human-induced pluripotent stem cell (hIPSC)-derived cardiac myocytes and mouse neonatal cardiac myocytes. The shape of the cells, as well as the organization of the contractile apparatus recapitulates the anisotropic line pattern geometry being derived from tissue geometry motives. The intracellular organization of the contractile apparatus and the cell coupling via gap junctions of cell assemblies growing in a random or organized pattern were examined. Cell spatial and temporal coordinated excitation and contraction has been compared on plain and patterned substrates. While the α-actinin cytoskeletal organization is comparable to terminally-developed native ventricular tissue, connexin-43 expression does not recapitulate gap junction distribution of heart muscle tissue. However, coordinated contractions could be observed. The results of tissue-like cell ensemble organization open new insights into geometry-dependent cell organization, the cultivation of artificial heart tissue from stem cells and the anisotropy-dependent activity of therapeutic compounds. PMID:26751484

  3. Beta-human chorionic gonadotropin expression in recurrent and metastatic giant cell tumors of bone: a potential mimicker of germ cell tumor.

    PubMed

    Lawless, Margaret E; Jour, George; Hoch, Benjamin L; Rendi, Mara H

    2014-10-01

    Giant cell tumors of bone (GCTs) are generally benign, locally aggressive neoplasms that rarely metastasize. The beta subunit of human chorionic gonadotropin (beta-hCG) is expressed in syncytiotrophoblasts and several nongynecologic neoplasms but has not been described in GCT. At our institution, we observed cases of elevated beta-hCG in patients with GCT leading to diagnostic difficulty and in one case, concern for metastatic choriocarcinoma. This study aims to determine the frequency of beta-hCG expression in GCT and any relationship to clinical aggressiveness. We evaluated tissue expression of beta-hCG by immunohistochemistry with 58% of cases staining for beta-hCG. Additionally, 2 of 11 patients with available serum and/or urine beta-hCG measurements demonstrated elevated beta-hCG due to tumor. It is important to be aware of beta-hCG expression by GCT and the potential for elevated urine and serum beta-hCG levels in patients with GCT so as to avoid misdiagnosis of pregnancy or gestational trophoblastic disease.

  4. Interaction of a peptide derived from C-terminus of human TRPA1 channel with model membranes mimicking the inner leaflet of the plasma membrane.

    PubMed

    Witschas, Katja; Jobin, Marie-Lise; Korkut, Dursun Nizam; Vladan, Maria Magdalena; Salgado, Gilmar; Lecomte, Sophie; Vlachova, Viktorie; Alves, Isabel D

    2015-05-01

    The transient receptor potential ankyrin 1 channel (TRPA1) belongs to the TRP cation channel superfamily that responds to a panoply of stimuli such as changes in temperature, calcium levels, reactive oxygen and nitrogen species and lipid mediators among others. The TRP superfamily has been implicated in diverse pathological states including neurodegenerative disorders, kidney diseases, inflammation, pain and cancer. The intracellular C-terminus is an important regulator of TRP channel activity. Studies with this and other TRP superfamily members have shown that the C-terminus association with lipid bilayer alters channel sensitivity and activation, especially interactions occurring through basic residues. Nevertheless, it is not yet clear how this process takes place and which regions in the C-terminus would be responsible for such membrane recognition. With that in mind, herein the first putative membrane interacting region of the C-terminus of human TRPA1, (corresponding to a 29 residue peptide, IAEVQKHASLKRIAMQVELHTSLEKKLPL) named H1 due to its potential helical character was chosen for studies of membrane interaction. The affinity of H1 to lipid membranes, H1 structural changes occurring upon this interaction as well as effects of this interaction in lipid organization and integrity were investigated using a biophysical approach. Lipid models systems composed of zwitterionic and anionic lipids, namely those present in the lipid membrane inner leaflet, where H1 is prone to interact, where used. The study reveals a strong interaction and affinity of H1 as well as peptide structuration especially with membranes containing anionic lipids. Moreover, the interactions and peptide structure adoption are headgroup specific.

  5. Evidence of Sulfur Mustard Exposure in Human Plasma by LC-ESI-MS-MS Detection of the Albumin-Derived Alkylated HETE-CP Dipeptide and Chromatographic Investigation of Its Cis/Trans Isomerism.

    PubMed

    Gandor, Felix; Gawlik, Michael; Thiermann, Horst; John, Harald

    2015-05-01

    Sulfur mustard (SM) is a chemical warfare agent that causes painful blisters and chemically modifies endogenous biomacromolecules by alkylation to hydroxyethylthioethyl (HETE) adducts representing valuable long-term markers for post-exposure analysis. The albumin adduct formed in human plasma in vitro (HETE bound to the side chain of cysteine 34) was isolated and cleaved by current lots of pronase primarily generating the internal modified dipeptide (HETE-cysteine-proline, HETE-CP) instead of the formerly reported HETE-CPF tripeptide. The analyte was detected by liquid chromatography-electrospray ionization tandem-mass spectrometry (LC-ESI-MS-MS). In principle, HETE-CP undergoes a dynamic on-column equilibrium of cis-trans isomerism thus requiring separation at 50°C to obtain one narrow peak. Accordingly, we developed both a novel longer lasting but more sensitive microbore (1 mm i.d., flow 30 µL/min, cycle time 60 min, LOD 50 nM) and a faster, less sensitive narrowbore (2.1 mm i.d., 200 µL/min, cycle time 16 min, LOD 100 nM, both on Atlantis T3 material at 50°C) LC-ESI-MS-MS method suitable for verification analysis. The corresponding tri- and tetrapeptide, Q(HETE)-CPF were monitored simultaneously. HETE-CP peak areas were directly proportional to SM concentrations added to plasma in vitro (0.05-100 µM). Albumin adducts formed by deuterated SM (d8-SM) served as internal standard.

  6. Advanced research on cis-Neonicotinoids.

    PubMed

    Shao, Xusheng; Ye, Zhejun; Bao, Haibo; Liu, Zewen; Xu, Xiaoyong; Li, Zhong; Qian, Xuhong

    2011-01-01

    cis-Neonicotinoids are a type of neonicotinoid, in which the nitro or the cyano group are in cis-configuration relative to heteroaromatic moiety, which show excellent activities against a range of insect species. This review covers cis-neonicotinoids with commercialization perspectives, structural optimization (phenylazoneonicotinoids and chlorothiazolyl analogues of Paichongding), modes of action studies, radiao-synthesis of Paichongding and Cycloxaprid, and photostability of neonicotinoids.

  7. IRIS Toxicological Review of Cis-& Trans-1,2-Dichloroethylene (External Review Draft)

    EPA Science Inventory

    EPA is conducting a peer review of the scientific basis supporting the human health hazard and dose-response assessment of cis- and trans-1,2-dichloroethylene that will appear in the Integrated Risk Information System (IRIS) database.

  8. Reactive arthritis mimicking inflammatory bowel disease arthritis: a challenging diagnosis.

    PubMed

    Trabulo, D; Mangualde, J; Cremers, I; Oliveira, A P

    2014-01-01

    Reactive arthritis comprises a subgroup of infection-associated arthritis which occurs after genitourinary or gastrointestinal tract infection in genetically susceptible hosts. Studies have proposed Salmonella, Shigella or Yersinia infection as the microorganisms responsible for the post-dysenteric form. The human leukocyte antigen (HLA)-B27 is a well recognised best-known predisposing factor. We report a case of HLA-B27-associated reactive arthritis after Salmonella goldcoast enteritis, mimicking inflammatory bowel disease arthritis.

  9. Challenging mimickers of primary systemic vasculitis.

    PubMed

    Miloslavsky, Eli M; Stone, John H; Unizony, Sebastian H

    2015-01-01

    The need to distinguish true primary systemic vasculitis from its multiple potential mimickers is one of the most challenging diagnostic conundrums in clinical medicine. This article reviews 9 challenging vasculitis mimickers: fibromuscular dysplasia, calciphylaxis, segmental arterial mediolysis, antiphospholipid syndrome, hypereosinophilic syndrome, lymphomatoid granulomatosis, malignant atrophic papulosis, livedoid vasculopathy, and immunoglobulin G4-related disease.

  10. Inverse heat mimicking of given objects

    NASA Astrophysics Data System (ADS)

    Alwakil, Ahmed; Zerrad, Myriam; Bellieud, Michel; Amra, Claude

    2017-03-01

    We address a general inverse mimicking problem in heat conduction. The objects to cloak and mimic are chosen beforehand; these objects identify a specific set of space transformations. The shapes that can be mimicked are derived from the conductivity matrices. Numerical calculation confirms all of the analytical predictions. The technique provides key advantages for applications and can be extended to the field of waves.

  11. Black hole mimickers: Regular versus singular behavior

    SciTech Connect

    Lemos, Jose P. S.; Zaslavskii, Oleg B.

    2008-07-15

    Black hole mimickers are possible alternatives to black holes; they would look observationally almost like black holes but would have no horizon. The properties in the near-horizon region where gravity is strong can be quite different for both types of objects, but at infinity it could be difficult to discern black holes from their mimickers. To disentangle this possible confusion, we examine the near-horizon properties, and their connection with far away asymptotic properties, of some candidates to black mimickers. We study spherically symmetric uncharged or charged but nonextremal objects, as well as spherically symmetric charged extremal objects. Within the uncharged or charged but nonextremal black hole mimickers, we study nonextremal {epsilon}-wormholes on the threshold of the formation of an event horizon, of which a subclass are called black foils, and gravastars. Within the charged extremal black hole mimickers we study extremal {epsilon}-wormholes on the threshold of the formation of an event horizon, quasi-black holes, and wormholes on the basis of quasi-black holes from Bonnor stars. We elucidate whether or not the objects belonging to these two classes remain regular in the near-horizon limit. The requirement of full regularity, i.e., finite curvature and absence of naked behavior, up to an arbitrary neighborhood of the gravitational radius of the object enables one to rule out potential mimickers in most of the cases. A list ranking the best black hole mimickers up to the worst, both nonextremal and extremal, is as follows: wormholes on the basis of extremal black holes or on the basis of quasi-black holes, quasi-black holes, wormholes on the basis of nonextremal black holes (black foils), and gravastars. Since in observational astrophysics it is difficult to find extremal configurations (the best mimickers in the ranking), whereas nonextremal configurations are really bad mimickers, the task of distinguishing black holes from their mimickers seems to

  12. Cis-elements governing trinucleotide repeat instability in Saccharomyces cerevisiae.

    PubMed Central

    Rolfsmeier, M L; Dixon, M J; Pessoa-Brandão, L; Pelletier, R; Miret, J J; Lahue, R S

    2001-01-01

    Trinucleotide repeat (TNR) instability in humans is governed by unique cis-elements. One element is a threshold, or minimal repeat length, conferring frequent mutations. Since thresholds have not been directly demonstrated in model systems, their molecular nature remains uncertain. Another element is sequence specificity. Unstable TNR sequences are almost always CNG, whose hairpin-forming ability is thought to promote instability by inhibiting DNA repair. To understand these cis-elements further, TNR expansions and contractions were monitored by yeast genetic assays. A threshold of approximately 15--17 repeats was observed for CTG expansions and contractions, indicating that thresholds function in organisms besides humans. Mutants lacking the flap endonuclease Rad27p showed little change in the expansion threshold, suggesting that this element is not altered by the presence or absence of flap processing. CNG or GNC sequences yielded frequent mutations, whereas A-T rich sequences were substantially more stable. This sequence analysis further supports a hairpin-mediated mechanism of TNR instability. Expansions and contractions occurred at comparable rates for CTG tract lengths between 15 and 25 repeats, indicating that expansions can comprise a significant fraction of mutations in yeast. These results indicate that several unique cis-elements of human TNR instability are functional in yeast. PMID:11290713

  13. Bone tumor mimickers: A pictorial essay

    PubMed Central

    Mhuircheartaigh, Jennifer Ni; Lin, Yu-Ching; Wu, Jim S

    2014-01-01

    Focal lesions in bone are very common and many of these lesions are not bone tumors. These bone tumor mimickers can include numerous normal anatomic variants and non-neoplastic processes. Many of these tumor mimickers can be left alone, while others can be due to a significant disease process. It is important for the radiologist and clinician to be aware of these bone tumor mimickers and understand the characteristic features which allow discrimination between them and true neoplasms in order to avoid unnecessary additional workup. Knowing which lesions to leave alone or which ones require workup can prevent misdiagnosis and reduce patient anxiety. PMID:25114385

  14. Measurement of guided mode wavenumbers in soft tissue-bone mimicking phantoms using ultrasonic axial transmission

    NASA Astrophysics Data System (ADS)

    Chen, Jiangang; Foiret, Josquin; Minonzio, Jean-Gabriel; Talmant, Maryline; Su, Zhongqing; Cheng, Li; Laugier, Pascal

    2012-05-01

    Human soft tissue is an important factor that influences the assessment of human long bones using quantitative ultrasound techniques. To investigate such influence, a series of soft tissue-bone phantoms (a bone-mimicking plate coated with a layer of water, glycerol or silicon rubber) were ultrasonically investigated using a probe with multi-emitter and multi-receiver arrays in an axial transmission configuration. A singular value decomposition signal processing technique was applied to extract the frequency-dependent wavenumbers of several guided modes. The results indicate that the presence of a soft tissue-mimicking layer introduces additional guided modes predicted by a fluid waveguide model. The modes propagating in the bone-mimicking plate covered by the soft-tissue phantom are only slightly modified compared to their counterparts in the free bone-mimicking plate, and they are still predicted by an elastic transverse isotropic two-dimensional waveguide. Altogether these observations suggest that the soft tissue-bone phantoms can be modeled as two independent waveguides. Even in the presence of the overlying soft tissue-mimicking layer, the modes propagating in the bone-mimicking plate can still be extracted and identified. These results suggest that our approach can be applied for the purpose of the characterization of the material and structural properties of cortical bone.

  15. Combining anti-cancer drugs with artificial sweeteners: synthesis and anti-cancer activity of saccharinate (sac) and thiosaccharinate (tsac) complexes cis-[Pt(sac)2(NH3)2] and cis-[Pt(tsac)2(NH3)2].

    PubMed

    Al-Jibori, Subhi A; Al-Jibori, Ghassan H; Al-Hayaly, Lamaan J; Wagner, Christoph; Schmidt, Harry; Timur, Suna; Baris Barlas, F; Subasi, Elif; Ghosh, Shishir; Hogarth, Graeme

    2014-12-01

    The new platinum(II) complexes cis-[Pt(sac)2(NH3)2] (sac=saccharinate) and cis-[Pt(tsac)2(NH3)2] (tsac=thiosaccharinate) have been prepared, the X-ray crystal structure of cis-[Pt(sac)2(NH3)2] x H2O reveals that both saccharinate anions are N-bound in a cis-arrangement being inequivalent in both the solid-state and in solution at room temperature. Preliminary anti-cancer activity has been assessed against A549 human alveolar type-II like cell lines with the thiosaccharinate complex showing good activity.

  16. Plant growth inhibition by cis-cinnamoyl glucosides and cis-cinnamic acid.

    PubMed

    Hiradate, Syuntaro; Morita, Sayaka; Furubayashi, Akihiro; Fujii, Yoshiharu; Harada, Jiro

    2005-03-01

    Spiraea thunbergii Sieb. contains 1-O-cis-cinnamoyl-beta-D-glucopyranose (CG) and 6-O-(4'-hydroxy-2'-methylene-butyroyl)-1-O-cis-cinnamoyl-beta-D-glucopyranose (BCG) as major plant growth inhibiting constituents. In the present study, we determined the inhibitory activity of CG and BCG on root elongation of germinated seedlings of lettuce (Lactuca sativa), pigweed (Amaranthus retroflexus), red clover (Trifolium pratense), timothy (Phleum pratense), and bok choy (Brassica rapa var chinensis) in comparison with that of two well-known growth inhibitors, 2,4-dichlorophenoxyacetic acid (2,4-D) and (+)-2-cis-4-trans-abscisic acid (cis-ABA), as well as two related chemicals of CG and BCG, cis-cinnamic acid (cis-CA) and trans-cinnamic acid (trans-CA). The EC50 values for CG and BCG on lettuce were roughly one-half to one-quarter of the value for cis-ABA. cis-Cinnamic acid, which is a component of CG and BCG, possessed almost the same inhibitory activity of CG and BCG, suggesting that the essential chemical structure responsible for the inhibitory activity of CG and BCG is cis-CA. The cis-stereochemistry of the methylene moiety is apparently needed for high inhibitory activity, as trans-CA had an EC50 value roughly 100 times that of CG, BCG, and cis-CA. Growth inhibition by CG, BCG, and cis-CA was influenced by the nature of the soil in the growing medium: alluvial soil preserved the bioactivity, whereas volcanic ash and calcareous soils inhibited bioactivity. These findings indicate a potential role of cis-CA and its glucosides as allelochemicals for use as plant growth regulators in agricultural fields.

  17. Tracheobronchial Amyloidosis Mimicking Tracheal Tumor.

    PubMed

    Tanrıverdi, Elif; Özgül, Mehmet Akif; Uzun, Oğuz; Gül, Şule; Çörtük, Mustafa; Yaşar, Zehra; Acat, Murat; Arda, Naciye; Çetinkaya, Erdoğan

    2016-01-01

    Tracheobronchial amyloidosis is a rare presentation and accounts for about 1% of benign tumors in this area. The diagnosis of disease is delayed due to nonspecific pulmonary symptoms. Therapeutic approaches are required to control progressive pulmonary symptoms for most of the patients. Herein, we report a case of a 68-year-old man admitted with progressive dyspnea to our institution for further evaluation and management. He was initially diagnosed with and underwent management for bronchial asthma for two years but had persistent symptoms despite optimal medical therapy. Pulmonary computed tomography scan revealed severe endotracheal stenosis. Bronchoscopy was performed and showed endotracheal mass obstructing 70% of the distal trachea and mimicking a neoplastic lesion. The mass was successfully resected by mechanical resection, argon plasma coagulation (APC), and Nd-YAG laser during rigid bronchoscopy. Biopsy materials showed deposits of amorphous material by hematoxylin and eosin staining and these deposits were selectively stained with Congo Red. Although this is a rare clinical condition, this case indicated that carrying out a bronchoscopy in any patient complaining of atypical bronchial symptoms or with uncontrolled asthma is very important.

  18. Tracheobronchial Amyloidosis Mimicking Tracheal Tumor

    PubMed Central

    Özgül, Mehmet Akif; Uzun, Oğuz; Yaşar, Zehra; Acat, Murat; Arda, Naciye; Çetinkaya, Erdoğan

    2016-01-01

    Tracheobronchial amyloidosis is a rare presentation and accounts for about 1% of benign tumors in this area. The diagnosis of disease is delayed due to nonspecific pulmonary symptoms. Therapeutic approaches are required to control progressive pulmonary symptoms for most of the patients. Herein, we report a case of a 68-year-old man admitted with progressive dyspnea to our institution for further evaluation and management. He was initially diagnosed with and underwent management for bronchial asthma for two years but had persistent symptoms despite optimal medical therapy. Pulmonary computed tomography scan revealed severe endotracheal stenosis. Bronchoscopy was performed and showed endotracheal mass obstructing 70% of the distal trachea and mimicking a neoplastic lesion. The mass was successfully resected by mechanical resection, argon plasma coagulation (APC), and Nd-YAG laser during rigid bronchoscopy. Biopsy materials showed deposits of amorphous material by hematoxylin and eosin staining and these deposits were selectively stained with Congo Red. Although this is a rare clinical condition, this case indicated that carrying out a bronchoscopy in any patient complaining of atypical bronchial symptoms or with uncontrolled asthma is very important. PMID:27594885

  19. Fibrosing mediastinitis mimicking bronchogenic carcinoma

    PubMed Central

    Bayiz, Hulya; Mutluay, Neslihan; Koyuncu, Adem; Demirag, Funda; Dagli, Gulfidan; Berktas, Bahadir; Berkoglu, Mine

    2013-01-01

    Fibrosing mediastinitis is a rare but benign disorder characterized by an excessive fibrotic reaction in the mediastinum which can result in compromise of airways, great vessels, and other mediastinal structures. In this paper we presented a patient with fibrosing mediastinitis mimicking bronchogenic carcinoma. The patient was a 32-year-old diabetic male admitting with cough and hemoptysis. There was a right hilar mass and multiple mediastinal conglomerated lymph nodes on chest computed tomography. Positron emission tomography with computed tomography (PET/CT) scan demonstrated increased fluorodeoxyglucose (FDG) uptake at the right hilar mass lesion and mediastinal lymph nodes. Fiberoptic bronchoscopy showed mucosal distortion of right upper lobe. Pathologic examination of the mucosal biopsy revealed inflammation. Endobronchial ultrasound guided transbronchial needle and cervical mediastinoscopic lymph node biopsies were undiagnostic. Diagnostic thoracotomy confirmed the diagnosis fibrosing mediastinitis. Administration of six months of systemic corticosteroid and antituberculous therapy was not beneficial. In conclusion, despite being a rare clinical entity, fibrosing mediastinitis should be kept in mind in the differential diagnosis of mediastinal mass lesions of unknown etiology. The diagnosis is exceptionally difficult in the presence of atypical radiological findings. The treatment is particularly challenging without any proven effective therapy. PMID:23372962

  20. Inverse heat mimicking of given objects

    PubMed Central

    Alwakil, Ahmed; Zerrad, Myriam; Bellieud, Michel; Amra, Claude

    2017-01-01

    We address a general inverse mimicking problem in heat conduction. The objects to cloak and mimic are chosen beforehand; these objects identify a specific set of space transformations. The shapes that can be mimicked are derived from the conductivity matrices. Numerical calculation confirms all of the analytical predictions. The technique provides key advantages for applications and can be extended to the field of waves. PMID:28252031

  1. Substrate influences on CIS device performance

    SciTech Connect

    Dawson-Elli, D.F.; Moore, C.B.; Gay, R.R.; Jensen, C.L.

    1994-12-31

    It has been reported that the substrate plays an active role in copper indium diselenide (CIS) devices. The physical properties of the substrate, i.e., thermal expansion coefficient, chemical composition, strain point, surface quality and cleanliness may all play a role in device efficiency and process reproducibility. For example, sodium is known to influence the conductivity of CIS, and that soda lime glass (SLG) introduces sodium into the CIS. In the experiments reported here, the sodium level in the CIS was varied by (a) changing the substrate composition and (b) the use of SiO{sub x}N{sub y} and SiN{sub x} barrier layers. Cells were fabricated on the candidate substrate and barrier layer combinations. V{sub oc} was observed to drop with the addition of barrier layers to sodium containing glasses. The films were also analyzed for sodium by SIMS. The cell performance and SIMS analysis are presented and their significance is discussed.

  2. Surface hopping dynamics of direct trans --> cis photoswitching of an azobenzene derivative in constrained adsorbate geometries

    NASA Astrophysics Data System (ADS)

    Floß, Gereon; Granucci, Giovanni; Saalfrank, Peter

    2012-12-01

    With ongoing miniaturization of electronic devices, the need for individually addressable, switchable molecules arises. An example are azobenzenes on surfaces which have been shown to be switchable between trans and cis forms. Here, we examine the "direct" (rather than substrate-mediated) channel of the trans → cis photoisomerization after ππ* excitation of tetra-tert-butyl-azobenzene physisorbed on surfaces mimicking Au(111) and Bi(111), respectively. In spirit of the direct channel, the electronic structure of the surface is neglected, the latter merely acting as a rigid platform which weakly interacts with the molecule via Van-der-Waals forces. Starting from thermal ensembles which represent the trans-form, sudden excitations promote the molecules to ππ*-excited states which are non-adiabatically coupled among themselves and to a nπ*-excited and the ground state, respectively. After excitation, relaxation to the ground state by internal conversion takes place, possibly accompanied by isomerization. The process is described here by "on the fly" semiclassical surface hopping dynamics in conjunction with a semiempirical Hamiltonian (AM1) and configuration-interaction type methods. It is found that steric constraints imposed by the substrate lead to reduced but non-vanishing, trans → cis reaction yields and longer internal conversion times than for the isolated molecule. Implications for recent experiments for azobenzenes on surfaces are discussed.

  3. Coronavirus cis-Acting RNA Elements.

    PubMed

    Madhugiri, R; Fricke, M; Marz, M; Ziebuhr, J

    2016-01-01

    Coronaviruses have exceptionally large RNA genomes of approximately 30 kilobases. Genome replication and transcription is mediated by a multisubunit protein complex comprised of more than a dozen virus-encoded proteins. The protein complex is thought to bind specific cis-acting RNA elements primarily located in the 5'- and 3'-terminal genome regions and upstream of the open reading frames located in the 3'-proximal one-third of the genome. Here, we review our current understanding of coronavirus cis-acting RNA elements, focusing on elements required for genome replication and packaging. Recent bioinformatic, biochemical, and genetic studies suggest a previously unknown level of conservation of cis-acting RNA structures among different coronavirus genera and, in some cases, even beyond genus boundaries. Also, there is increasing evidence to suggest that individual cis-acting elements may be part of higher-order RNA structures involving long-range and dynamic RNA-RNA interactions between RNA structural elements separated by thousands of nucleotides in the viral genome. We discuss the structural and functional features of these cis-acting RNA elements and their specific functions in coronavirus RNA synthesis.

  4. Cis and Trans Isomers of Cycloalkenes

    NASA Astrophysics Data System (ADS)

    Barrows, Susan E.; Eberlein, Thomas H.

    2005-09-01

    As a rule, a trans disubstituted alkene is more stable than the corresponding cis isomer. For cycloalkenes of fewer than eleven members, cis isomers are more stable than their trans counterparts. Although this exception to the normal rule is occasionally noted in beginning organic chemistry textbooks, it is often done without a careful analysis of the reasons behind it. The purpose of this article is to provide that analysis. In order for a cycloalkene to accommodate a trans double bond one or more of the following nonideal geometries must occur: a twisted π bond; pyramidal sp 2 -carbon atoms; nonideal sp 3 bond angles; or longer than normal C C single and double bonds. This article provides a list of experimentally determined relative energies of the cis and trans isomers within the series cycloheptene cycloundecene, along with computationally derived energies at several levels of theory. It also examines the geometric distortions through which cycloalkenes relieve the strain introduced by a trans double bond.

  5. Advances in the CIS research at NREL

    SciTech Connect

    Ramanathan, K.; Bhattacharya, R.N.; Granata, J.; Webb, J.; Niles, D.; Contreras, M.A.; Wiesner, H.; Hasoon, F.S.; Noufi, R.

    1997-12-31

    This paper summarizes the research of the CIS Team at NREL in three major areas: absorber deposition; understanding the role of chemical bath deposited (CBD) CdS in CIS junctions; and in the development of devices without CdS. Low cost, scaleable processes chosen for absorber fabrication include sputtering, electrodeposition (ED), and close spaced sublimation (CSS). The interaction between the CBD and the CIS has been investigated and the results show that Cd might be instrumental in shaping the interface. The authors have also developed a process to fabricate a 13.5% efficiency ZnO/CuInGaSe{sub 2} device without CdS or other buffer layers.

  6. Recurrent epiploic appendagitis mimicking appendicitis and cholecystitis

    PubMed Central

    Hearne, Christopher B.; Taboada, Jorge

    2017-01-01

    Epiploic appendagitis (EA) is a rare cause of acute abdominal pain caused by inflammation of an epiploic appendage. It has a nonspecific clinical presentation that may mimic other acute abdominal pathologies on physical exam, such as appendicitis, diverticulitis, or cholecystitis. However, EA is usually benign and self-limiting and can be treated conservatively. We present the case of a patient with two episodes of EA, the first mimicking acute appendicitis and the second mimicking acute cholecystitis. Although recurrence of EA is rare, it should be part of the differential diagnosis of acute, localized abdominal pain. A correct diagnosis of EA will prevent unnecessary hospitalization, antibiotic use, and surgical procedures. PMID:28127129

  7. Binding of the human nucleotide excision repair proteins XPA and XPC/HR23B to the 5R-thymine glycol lesion and structure of the cis-(5R,6S) thymine glycol epimer in the 5'-GTgG-3' sequence: destabilization of two base pairs at the lesion site.

    PubMed

    Brown, Kyle L; Roginskaya, Marina; Zou, Yue; Altamirano, Alvin; Basu, Ashis K; Stone, Michael P

    2010-01-01

    The 5R thymine glycol (5R-Tg) DNA lesion exists as a mixture of cis-(5R,6S) and trans-(5R,6R) epimers; these modulate base excision repair. We examine the 7:3 cis-(5R,6S):trans-(5R,6R) mixture of epimers paired opposite adenine in the 5'-GTgG-3' sequence with regard to nucleotide excision repair. Human XPA recognizes the lesion comparably to the C8-dG acetylaminoflourene (AAF) adduct, whereas XPC/HR23B recognition of Tg is superior. 5R-Tg is processed by the Escherichia coli UvrA and UvrABC proteins less efficiently than the C8-dG AAF adduct. For the cis-(5R, 6S) epimer Tg and A are inserted into the helix, remaining in the Watson-Crick alignment. The Tg N3H imine and A N(6) amine protons undergo increased solvent exchange. Stacking between Tg and the 3'-neighbor G*C base pair is disrupted. The solvent accessible surface and T(2) relaxation of Tg increases. Molecular dynamics calculations predict that the axial conformation of the Tg CH(3) group is favored; propeller twisting of the Tg*A pair and hydrogen bonding between Tg OH6 and the N7 atom of the 3'-neighbor guanine alleviate steric clash with the 5'-neighbor base pair. Tg also destabilizes the 5'-neighbor G*C base pair. This may facilitate flipping both base pairs from the helix, enabling XPC/HR23B recognition prior to recruitment of XPA.

  8. Stereoselective synthesis of cis-p-menth-8-ene-1,7-diol, cis-p-menthane-1,7-diol, and cis-p-menthane-1,7,8-triol.

    PubMed

    Kobler, Christoph; Effenberger, Franz

    2005-04-22

    The natural products cis-p-menthane-1,7-diol (cis-IV), cis-p-menth-8-ene-1,7-diol (cis-I) and cis-p-menthane-1,7,8-triol (cis-II) are obtained starting from the corresponding cis-cyanohydrins, cis-2 and cis-7, respectively, by chemical transformation of the cyano into the hydroxymethyl group. The key step of the synthesis is the very high cis-selectivity (> or = 96 %) of the MeHNL-catalyzed HCN addition to 4-alkylcyclohexanones. From 4-isopropylcyclohexanone (1) the cyanohydrin cis-2 and from 4-(1-methylvinyl)cyclohexanone (6) the cyanohydrin cis-7 result almost quantitatively. Regioselective hydroxylation of cis-I affords the triol cis-II. X-ray crystal structure determinations of the final products confirm their cis-configuration.

  9. Systemic sarcoidosis mimicking malignant metastatic disease

    PubMed Central

    Hammen, Irena; Sherson, David Lee; Davidsen, Jesper Roemhild

    2015-01-01

    We present a case of systemic sarcoidosis involving the liver, pancreas, lungs, mediastinal and intraabdominal lymph nodes and bones. Multiple organ system manifestations mimicked malignant metastatic disease. The diagnosis was established with clinical, radiological, and pathological findings after neoplasm was ruled out by pathological tests. The patient showed rapid symptom remission with systemic steroid treatment. PMID:26672956

  10. Lymphomatoid granulomatosis mimicking interstitial lung disease.

    PubMed

    Braham, Emna; Ayadi-Kaddour, Aïda; Smati, Belhassen; Ben Mrad, Sonia; Besbes, Mohammed; El Mezni, Faouzi

    2008-11-01

    Lymphoid granulomatosis is a rare form of pulmonary angiitis. This case report presents a patient with lymphoid granulomatosis in whom the clinical presentation, radiological features and the partial response to corticosteroid therapy mimicked interstitial lung disease. Lymphoid granulomatosis was only diagnosed at post-mortem examination. The range of reported clinical presentations, diagnostic approaches and outcomes are described.

  11. An ideal blood mimicking fluid for doppler ultrasound phantoms.

    PubMed

    Samavat, H; Evans, J A

    2006-10-01

    In order to investigate the problems of detecting tumours by ultrasound it is very important to have a portable Doppler flow test object to use as a standardising tool. The flow Doppler test objects are intended to mimic the flow in human arteries. To make the test meaningful, the acoustic properties of the main test object components (tissue and blood mimic) should match closely the properties of the corresponding human tissues, while the tube should ideally have little influence. The blood mimic should also represent the haemodynamic properties of blood. An acceptable flow test object has been designed to closely mimic blood flow in arteries. We have evaluated the properties of three blood mimicking fluid: two have been described recently in the literature, the third is a local design. One of these has emerged as being particularly well matched to the necessary characteristics for in-vitro work.

  12. Long-term follow-up of myelodysplastic syndrome patients with moderate/severe anaemia receiving human recombinant erythropoietin + 13-cis-retinoic acid and dihydroxylated vitamin D3: independent positive impact of erythroid response on survival.

    PubMed

    Crisà, Elena; Foli, Cristina; Passera, Roberto; Darbesio, Antonella; Garvey, Kimberly B; Boccadoro, Mario; Ferrero, Dario

    2012-07-01

    We previously reported a 60% erythroid response rate with recombinant erythropoietin + 13-cis retinoic acid + dihydroxylated vitamin D3 in 63 elderly myelodysplastic patients (median age 75 years) with unfavourable features for response to erythropoietin alone [70% transfusion-dependent, 35% refractory anaemia with ring sideroblasts/refractory anaemia with excess of blasts type 1 (RAEB1), 70% with International Prognostic Scoring System (IPSS) Intermediate-1 or -2]. This report updates that case study at a 7-year follow-up, and compared the impact on overall survival of erythroid response to known prognostic factors. The erythroid response duration (median 17 months; 22 in non-RAEB patients, with 20% patients in response after 6 years of therapy) was longer than in most studies with erythropoietin alone. Overall survival (median 55 months in non-RAEB, 15 in RAEB1 patients) was negatively affected by RAEB1 diagnosis, IPSS and WPSS intermediate scores and transfusion-dependence. In the multivariate analysis, erythroid response maintained an independent positive impact on survival, particularly in non-RAEB patients in the first 3 years from diagnosis (90% survival compared to 50% of non-responders). In conclusion, the long-term follow-up confirmed the achievement, by our combined treatment, of fairly long-lasting erythroid response in the majority of MDS patients with unfavourable prognostic features for response to erythropoietin: this translated in a survival benefit that was independent from other prognostic features.

  13. DNA unwinding produced by site-specific intrastrand cross-links of the antitumor drug cis-diamminedichloroplatinum(II)

    SciTech Connect

    Bellon, S.F.; Coleman, J.H.; Lippard, S.J. )

    1991-08-13

    The DNA unwinding produced by specific adducts of the antitumor drug cis-diamminedi-chloroplatinum(II) has been quantitatively determined. Synthetic DNA duplex oligonucleotides of varying lengths with two base pair cohesive ends were synthesized and characterized that contained site-specific intrastrand N7-purine/N7-purine cross-links. Included are cis-(Pt(NH{sub 3}){sub 2}(d(GpG))), cis-(Pt(NH){sub 3}{sub 2}(d(ApG))), and cis-(Pt(NH{sub 3}){sub 2}(d(GpTpG))) adducts, respectively referred to as cis-GG, cis-AG, and cis-GTG. Local DNA distortions at the site of platination were amplified by polymerization of these monomers and quantitatively evaluated by using polyacrylamide gel electrophoresis. The extent of DNA unwinding was determined by systematically varying the interplatinum distance, or phasing, in polymers containing the adducts. The multimer that migrates most slowly gives the optimal phasing for cooperative bending, from which the degree of unwinding can be obtained. The authors find that the cis-GG and cis-AG adducts both unwind DNA by 13{degrees}, while the cis-GTG adduct unwinds DNA by 23{degrees}. In addition, experiments are presented that support previous studies revealing that a hinge joint forms at the sites of platination in DNA molecules containing trans-GTG adducts. On the basis of an analysis of the present and other published studies of site-specifically modified DNA. The authors propose that local duplex unwinding is a major determinant in the recognition of DNA damage by the Escherichia coli (A)BC excinuclease. In addition, local duplex unwinding of 13{degrees} and bending by 35{degrees} are shown to correlate well with the recognition of platinated DNA by a previously identified damage recognition protein (DRP) in human cells.

  14. Status of flexible CIS research at ISET

    NASA Technical Reports Server (NTRS)

    Basol, B. M.; Kapur, V. K.; Minnick, A.; Halani, A.; Leidholm, C. R.

    1994-01-01

    Polycrystalline thin film solar cells fabricated on light-weight, flexible substrates are very attractive for space applications. In this work CulnSe2 (CIS) based thin film devices were processed on metallic foil substrates using the selenization technique. CIS deposition method involved reaction of electron-bean evaporated Cu-In precursor layers with a selenizing atmosphere at around 400 C. Several metallic foils such as Mo, Ti, Al, Ni, and Cu were evaluated as possible substrates for these devices. Solar cells with AM1.5 efficiencies of 9.0-9.34 percent and good mechanical integrity were demonstrated on Mo and Ti foils. Monolithic integration of these devices was also demonstrated up to 4 in x 4 in size.

  15. cis-Regulatory control circuits in development.

    PubMed

    Howard, Meredith L; Davidson, Eric H

    2004-07-01

    During development, an organism undergoes many rounds of pattern formation, generating ever-greater complexity with each ensuing round of cell division and specification. The instructions for executing this process are encoded in the cis-regulatory modules that direct the expression of developmental transcription factors and signaling molecules. Each transcription factor binding site within a cis-regulatory module contributes information about when, where, or how much a gene is turned on, and by dissecting the modules driving a given gene, all the inputs governing expression of the gene can be accurately identified. Furthermore, by mapping the output of each gene to the inputs of other genes, it is possible to reverse engineer developmental circuits and even whole networks. At this higher level of organization, common bilaterian strategies for specifying progenitor fields, locking down regulatory states, and driving development forward emerge.

  16. Intramedullary cervical neurenteric cyst mimicking an abscess.

    PubMed

    Muzumdar, D; Bhatt, Y; Sheth, J

    2008-01-01

    We describe a cervical intramedullary neurenteric cyst in a 12-year-old male patient who presented with gradual onset and progressively worsening neck pain, spastic quadriparesis and impaired sensation in the C(2) dermatome. MR imaging revealed a well-defined peripherally enhancing cystic intramedullary lesion with a posteroinferior enhancing nodule at the C(2)-C(3) level mimicking an abscess. There was no evidence of spinal dysraphism. The lesion was completely resected through a posterior approach and the patient showed radical improvement in his symptomatology. At follow-up after 3 years, he was asymptomatic and the MR imaging showed no evidence of any residual or recurrent cyst. The case presented here is unique, since a spinal neurenteric cyst showing intense peripheral contrast enhancement mimicking an abscess is unusual. The radiological features, pathogenesis and surgical considerations in cervical intramedullary neurenteric cysts are discussed and the relevant literature is briefly reviewed.

  17. Spherical boson stars as black hole mimickers

    SciTech Connect

    Guzman, F. S.; Rueda-Becerril, J. M.

    2009-10-15

    We present spherically symmetric boson stars as black hole mimickers based on the power spectrum of a simple accretion disk model. The free parameters of the boson star are the mass of the boson and the fourth-order self-interaction coefficient in the scalar field potential. We show that even if the mass of the boson is the only free parameter, it is possible to find a configuration that mimics the power spectrum of the disk due to a black hole of the same mass. We also show that for each value of the self-interaction a single boson star configuration can mimic a black hole at very different astrophysical scales in terms of the mass of the object and the accretion rate. In order to show that it is possible to distinguish one of our mimickers from a black hole, we also study the deflection of light.

  18. PDSS/IMC CIS user's guide

    NASA Technical Reports Server (NTRS)

    1984-01-01

    The Spacelab Payload Development Support System PDSS Image Motion Compensator (IMC) computer interface simulation (CIS) user's manual is given. The software provides a real time interface simulation for the following IMC subsystems: the Dry Rotor Reference Unit, the Advanced Star/Target Reference Optical sensor, the Ultra Violet imaging telescope, the Wisconson Ultraviolet Photopolarimetry Experiment, the Cruciform Power distributor, and the Spacelab Experiment Computer Operating System.

  19. Combinatorial Cis-regulation in Saccharomyces Species.

    PubMed

    Spivak, Aaron T; Stormo, Gary D

    2016-01-15

    Transcriptional control of gene expression requires interactions between the cis-regulatory elements (CREs) controlling gene promoters. We developed a sensitive computational method to identify CRE combinations with conserved spacing that does not require genome alignments. When applied to seven sensu stricto and sensu lato Saccharomyces species, 80% of the predicted interactions displayed some evidence of combinatorial transcriptional behavior in several existing datasets including: (1) chromatin immunoprecipitation data for colocalization of transcription factors, (2) gene expression data for coexpression of predicted regulatory targets, and (3) gene ontology databases for common pathway membership of predicted regulatory targets. We tested several predicted CRE interactions with chromatin immunoprecipitation experiments in a wild-type strain and strains in which a predicted cofactor was deleted. Our experiments confirmed that transcription factor (TF) occupancy at the promoters of the CRE combination target genes depends on the predicted cofactor while occupancy of other promoters is independent of the predicted cofactor. Our method has the additional advantage of identifying regulatory differences between species. By analyzing the S. cerevisiae and S. bayanus genomes, we identified differences in combinatorial cis-regulation between the species and showed that the predicted changes in gene regulation explain several of the species-specific differences seen in gene expression datasets. In some instances, the same CRE combinations appear to regulate genes involved in distinct biological processes in the two different species. The results of this research demonstrate that (1) combinatorial cis-regulation can be inferred by multi-genome analysis and (2) combinatorial cis-regulation can explain differences in gene expression between species.

  20. Combinatorial Cis-regulation in Saccharomyces Species

    PubMed Central

    Spivak, Aaron T.; Stormo, Gary D.

    2016-01-01

    Transcriptional control of gene expression requires interactions between the cis-regulatory elements (CREs) controlling gene promoters. We developed a sensitive computational method to identify CRE combinations with conserved spacing that does not require genome alignments. When applied to seven sensu stricto and sensu lato Saccharomyces species, 80% of the predicted interactions displayed some evidence of combinatorial transcriptional behavior in several existing datasets including: (1) chromatin immunoprecipitation data for colocalization of transcription factors, (2) gene expression data for coexpression of predicted regulatory targets, and (3) gene ontology databases for common pathway membership of predicted regulatory targets. We tested several predicted CRE interactions with chromatin immunoprecipitation experiments in a wild-type strain and strains in which a predicted cofactor was deleted. Our experiments confirmed that transcription factor (TF) occupancy at the promoters of the CRE combination target genes depends on the predicted cofactor while occupancy of other promoters is independent of the predicted cofactor. Our method has the additional advantage of identifying regulatory differences between species. By analyzing the S. cerevisiae and S. bayanus genomes, we identified differences in combinatorial cis-regulation between the species and showed that the predicted changes in gene regulation explain several of the species-specific differences seen in gene expression datasets. In some instances, the same CRE combinations appear to regulate genes involved in distinct biological processes in the two different species. The results of this research demonstrate that (1) combinatorial cis-regulation can be inferred by multi-genome analysis and (2) combinatorial cis-regulation can explain differences in gene expression between species. PMID:26772747

  1. Isolated giant molluscum contagiosum mimicking epidermoid cyst

    PubMed Central

    Uzuncakmak, Tugba K.; Kuru, Burce C.; Zemheri, Ebru I.; Zindanci, Ilkin; Turkoglu, Zafer; Kavala, Mukaddes

    2016-01-01

    Molluscum contagiosum is a benign cutaneous viral infection which is caused by double- stranded DNA poxvirus. It affects mainly children and young adults and usually presents with single or multiple umblicated papules or nodules on face, arms, legs and anogenital regions. It may present in atypical size and clinical appearance in patients with altered or impaired immunity and rarely in immuncompetent patients. Herein we present an immuncompetent young adult patient with isolated giant molluscum contagiosum, which was mimicking epidermoid cyst clinically. PMID:27648389

  2. A Pilocytic Astrocytoma Mimicking a Clinoidal Meningioma

    PubMed Central

    Hong, Christopher S.; Lehman, Norman L.; Sauvageau, Eric

    2014-01-01

    Pilocytic astrocytomas and meningiomas are benign, primary brain tumors that may involve the optic tract. Classically, the presence of a dural “tail” sign may differentiate a meningioma from other intracranial lesions. In this report, we describe a mass with the typical appearance of a clinoidal meningioma on magnetic resonance imaging (MRI) but postoperatively diagnosed as a pilocytic astrocytoma. This case illustrates the rare occurrence of a pilocytic astrocytoma mimicking a meningioma on MRI. PMID:24744944

  3. Mad honey intoxication mimicking acute coronary syndrome.

    PubMed

    Dur, Ali; Sonmez, Ertan; Civelek, Cemil; AhmetTurkdogan, Kenan; AkifVatankulu, Mehmet; Sogut, Ozgur

    2014-09-01

    Mad honey intoxication or grayanotoxin poisoning is caused by consumption of grayanotoxin-containing toxic honey produced from leaves and flowers of the Rhododendron family. Despite the rarity of intoxication cases, the correct diagnosis and treatment are required because of the significance of haemodynamic disturbance and confounding of symptoms for disease identification. We report herein a case of a patient with mad honey intoxication mimicking acute non-ST segment elevation myocardial infarction and review the pathophysiology and diagnostic considerations.

  4. Pulmonary diseases with imaging findings mimicking aspergilloma.

    PubMed

    Gazzoni, Fernando Ferreira; Severo, Luiz Carlos; Marchiori, Edson; Guimarães, Marcos Duarte; Garcia, Tiago Severo; Irion, Klaus L; Camargo, José Jesus; Felicetti, José Carlos; de Mattos Oliveira, Flavio; Hochhegger, Bruno

    2014-06-01

    Patients with preexisting lung cavities are at risk of developing intracavitary fungal colonization. Because Aspergillus spp. are the most commonly implicated fungi, these fungal masses are called aspergillomas. Their characteristic "ball-in-hole" appearance, however, may be found in a variety of other conditions that can produce radiologic findings mimicking aspergilloma. In this paper, we review the main diseases that may mimic the radiographic findings of aspergilloma, with brief descriptions of clinical, radiologic, and histopathologic findings.

  5. Rare Mimickers of Exostosis: A Case Series

    PubMed Central

    Perubhotla, Lakshmi Manasa

    2016-01-01

    Exophytic growths from bones are a common entity. Osteochondroma is the most common benign exophytic lesion and we tend to diagnose every benign looking exophytic lesion as osteochondroma. Here we reported two entities of cases, one was Nora’s lesion and another one was supracondylar process of humerus, both of which were mimickers of osteochondroma and their salient and differentiating features from osteochondromas. PMID:27630926

  6. Options for Staging Orbits in Cis-Lunar Space

    NASA Technical Reports Server (NTRS)

    Whitley, Ryan; Martinez, Roland

    2015-01-01

    NASA has been studying options to conduct missions beyond Low Earth Orbit, but within the Earth-Moon system, in preparation for deep space exploration including human missions to Mars. Referred to as the Proving Ground, this arena of exploration activities will enable the development of human spaceflight systems and operations to satisfy future exploration objectives beyond the cis-lunar environment. One option being considered includes the deployment of a habitable element or elements, which could be used as a central location for aggregation of supplies and resources for human missions in cis-lunar space and beyond. Characterizing candidate orbit locations for this asset and the impacts on system design and mission operations is important in the overall assessment of the options being considered. The orbits described in this paper were initially selected by taking advantage of previous studies conducted by NASA and the work of other authors. In this paper orbits are assessed for their relative attractiveness based on various factors. First, a set of constraints related to the capability of the combined Orion and SLS system to deliver humans and cargo to and from the orbit are evaluated. Second, the ability to support potential lunar surface activities is considered. Finally, deployed assets intended to spend multiple years in the Proving Ground would ideally require minimal station keeping costs to reduce the mass budget allocated to this function. Additional mission design drivers include potential for uninterrupted communication with deployed assets, thermal, communications, and other operational implications. The results of the characterization and evaluation of the selected orbits indicate a Near Rectilinear Orbit (NRO) is an attractive candidate as an aggregation point or staging location for operations. In this paper, the NRO is further described in terms which balance a number of key attributes that favor a variety of mission classes to meet multiple

  7. Options for Staging Orbits in Cis-Lunar Space

    NASA Technical Reports Server (NTRS)

    Martinez, Roland; Whitley, Ryan

    2016-01-01

    NASA has been studying options to conduct missions beyond Low Earth Orbit, but within the Earth-Moon system, in preparation for deep space exploration including human missions to Mars. Referred to as the Proving Ground, this arena of exploration activities will enable the development of human spaceflight systems and operations to satisfy future exploration objectives beyond the cis-lunar environment. One option being considered includes the deployment of a habitable element or elements, which could be used as a central location for aggregation of supplies and resources for human missions in cis-lunar space and beyond. Characterizing candidate orbit locations for this asset and the impacts on system design and mission operations is important in the overall assessment of the options being considered. The orbits described in this paper were initially selected by taking advantage of previous studies conducted by NASA and the work of other authors. In this paper orbits are assessed for their relative attractiveness based on various factors. A set of constraints related to the capability of the combined Orion and SLS system to deliver humans and cargo to and from the orbit are evaluated. Deployed assets intended to spend multiple years in the Proving Ground would ideally require minimal station keeping costs to reduce the mass budget allocated to this function. Additional mission design drivers include eclipse frequency, potential for uninterrupted communication with deployed assets, thermal, attitude control, communications, and other operational implications. Also the ability to support potential lunar surface activities and excursion missions beyond Earth-Moon space is considered. The results of the characterization and evaluation of the selected orbits indicate a Near Rectilinear Orbit (NRO) is an attractive candidate as an aggregation point or staging location for operations. In this paper, the NRO is further described in terms which balance a number of key

  8. IRIS Toxicological Review of Cis-& Trans-1,2-Dichloroethylene (Final Report)

    EPA Science Inventory

    EPA has finalized the Toxicological Review of cis- & trans-1,2-Dichloroethylene: in support of the Integrated Risk Information System (IRIS). Now final, this assessment may be used by EPA’s program and regional offices to inform decisions to protect human health.

  9. Characterization of cis-regulatory elements of the c-myc promoter responding to human GM-CSF or mouse interleukin 3 in mouse proB cell line BA/F3 cells expressing the human GM-CSF receptor.

    PubMed

    Watanabe, S; Ishida, S; Koike, K; Arai, K

    1995-06-01

    Interleukin 3 (IL-3) or granulocyte macrophage colony-stimulating factor (GM-CSF) activates c-fos, c-jun, and c-myc genes and proliferation in both hematopoietic and nonhematopoietic cells. Using a series of deletion mutants of the beta subunit of human GM-CSF receptor (hGMR) and inhibitors of tyrosine kinase, two distinct signaling pathways, one for activation of c-fos and c-jun genes, and the other for cell proliferation and activation of c-myc gene have been elucidated. In contrast to wealth of information on the pathway leading to activation of c-fos/c-jun genes, knowledge of the latter is scanty. To clarify the mechanisms of activation of c-myc gene by cytokines, we established a transient transfection assay in mouse proB cell line BA/F3 cells expressing hGMR. Analyses of hGMR beta subunit mutants revealed two cytoplasmic regions involved in activation of the c-myc promoter, one is essential and the other is dispensable but enhances the activity. These regions are located at the membrane proximal and the distal regions covering amino acid positions 455-544 and 544-589, respectively. Characterization of cis-acting regulatory elements of the c-myc gene showed that the region containing the P2 promoter initiation site is sufficient to mediate the response to mIL-3 or hGM-CSF. Electrophoretic mobility shift assay using an oligonucleotide corresponding to the distal putative E2F binding site revealed that p107/E2F complex, the negative regulator of E2F, decreased, and free E2F increased after mIL-3 stimulation. These results support the thesis that mIL-3 or hGM-CSF regulates the c-myc promoter by altering composition of the E2F complexes at E2F binding site.

  10. Randomized Subspace Learning for Proline Cis-Trans Isomerization Prediction.

    PubMed

    Al-Jarrah, Omar Y; Yoo, Paul D; Taha, Kamal; Muhaidat, Sami; Shami, Abdallah; Zaki, Nazar

    2015-01-01

    Proline residues are common source of kinetic complications during folding. The X-Pro peptide bond is the only peptide bond for which the stability of the cis and trans conformations is comparable. The cis-trans isomerization (CTI) of X-Pro peptide bonds is a widely recognized rate-limiting factor, which can not only induces additional slow phases in protein folding but also modifies the millisecond and sub-millisecond dynamics of the protein. An accurate computational prediction of proline CTI is of great importance for the understanding of protein folding, splicing, cell signaling, and transmembrane active transport in both the human body and animals. In our earlier work, we successfully developed a biophysically motivated proline CTI predictor utilizing a novel tree-based consensus model with a powerful metalearning technique and achieved 86.58 percent Q2 accuracy and 0.74 Mcc, which is a better result than the results (70-73 percent Q2 accuracies) reported in the literature on the well-referenced benchmark dataset. In this paper, we describe experiments with novel randomized subspace learning and bootstrap seeding techniques as an extension to our earlier work, the consensus models as well as entropy-based learning methods, to obtain better accuracy through a precise and robust learning scheme for proline CTI prediction.

  11. The Role of Cis-Lunar Space in Future Global Space Exploration

    NASA Technical Reports Server (NTRS)

    Bobskill, Marianne R.; Lupisella, Mark L.

    2012-01-01

    Cis-lunar space offers affordable near-term opportunities to help pave the way for future global human exploration of deep space, acting as a bridge between present missions and future deep space missions. While missions in cis-lunar space have value unto themselves, they can also play an important role in enabling and reducing risk for future human missions to the Moon, Near-Earth Asteroids (NEAs), Mars, and other deep space destinations. The Cis-Lunar Destination Team of NASA's Human Spaceflight Architecture Team (HAT) has been analyzing cis-lunar destination activities and developing notional missions (or "destination Design Reference Missions" [DRMs]) for cis-lunar locations to inform roadmap and architecture development, transportation and destination elements definition, operations, and strategic knowledge gaps. The cis-lunar domain is defined as that area of deep space under the gravitational influence of the earth-moon system. This includes a set of earth-centered orbital locations in low earth orbit (LEO), geosynchronous earth orbit (GEO), highly elliptical and high earth orbits (HEO), earth-moon libration or "Lagrange" points (E-ML1 through E-ML5, and in particular, E-ML1 and E-ML2), and low lunar orbit (LLO). To help explore this large possibility space, we developed a set of high level cis-lunar mission concepts in the form of a large mission tree, defined primarily by mission duration, pre-deployment, type of mission, and location. The mission tree has provided an overall analytical context and has helped in developing more detailed design reference missions that are then intended to inform capabilities, operations, and architectures. With the mission tree as context, we will describe two destination DRMs to LEO and GEO, based on present human space exploration architectural considerations, as well as our recent work on defining mission activities that could be conducted with an EML1 or EML2 facility, the latter of which will be an emphasis of this

  12. cis p-tau: early driver of brain injury and tauopathy blocked by antibody

    PubMed Central

    Mannix, Rebekah; Qiu, Jianhua; Moncaster, Juliet; Chen, Chun-Hau; Yao, Yandan; Lin, Yu-Min; Driver, Jane A; Sun, Yan; Wei, Shuo; Luo, Man-Li; Albayram, Onder; Huang, Pengyu; Rotenberg, Alexander; Ryo, Akihide; Goldstein, Lee E; Pascual-Leone, Alvaro; McKee, Ann C.; Meehan, William; Zhou, Xiao Zhen; Lu, Kun Ping

    2015-01-01

    Traumatic brain injury (TBI), characterized by acute neurological dysfunction, is one of the best known environmental risk factors for chronic traumatic encephalopathy (CTE) and Alzheimer's disease (AD), whose defining pathologic features include tauopathy made of phosphorylated tau (p-tau). However, tauopathy has not been detected in early stages after TBI and how TBI leads to tauopathy is unknown. Here we find robust cis p-tau pathology after sport- and military-related TBI in humans and mice. Acutely after TBI in mice and stress in vitro, neurons prominently produce cis p-tau, which disrupts axonal microtubule network and mitochondrial transport, spreads to other neurons, and leads to apoptosis. This process, termed “cistauosis”, appears long before other tauopathy. Treating TBI mice with cis antibody blocks cistauosis, prevents tauopathy development and spread, and restores many TBI-related structural and functional sequelae. Thus, cis p-tau is a major early driver after TBI and leads to tauopathy in CTE and AD, and cis antibody may be further developed to detect and treat TBI, and prevent progressive neurodegeneration after injury. PMID:26176913

  13. Antibody against early driver of neurodegeneration cis P-tau blocks brain injury and tauopathy.

    PubMed

    Kondo, Asami; Shahpasand, Koorosh; Mannix, Rebekah; Qiu, Jianhua; Moncaster, Juliet; Chen, Chun-Hau; Yao, Yandan; Lin, Yu-Min; Driver, Jane A; Sun, Yan; Wei, Shuo; Luo, Man-Li; Albayram, Onder; Huang, Pengyu; Rotenberg, Alexander; Ryo, Akihide; Goldstein, Lee E; Pascual-Leone, Alvaro; McKee, Ann C; Meehan, William; Zhou, Xiao Zhen; Lu, Kun Ping

    2015-07-23

    Traumatic brain injury (TBI), characterized by acute neurological dysfunction, is one of the best known environmental risk factors for chronic traumatic encephalopathy and Alzheimer's disease, the defining pathologic features of which include tauopathy made of phosphorylated tau protein (P-tau). However, tauopathy has not been detected in the early stages after TBI, and how TBI leads to tauopathy is unknown. Here we find robust cis P-tau pathology after TBI in humans and mice. After TBI in mice and stress in vitro, neurons acutely produce cis P-tau, which disrupts axonal microtubule networks and mitochondrial transport, spreads to other neurons, and leads to apoptosis. This process, which we term 'cistauosis', appears long before other tauopathy. Treating TBI mice with cis antibody blocks cistauosis, prevents tauopathy development and spread, and restores many TBI-related structural and functional sequelae. Thus, cis P-tau is a major early driver of disease after TBI and leads to tauopathy in chronic traumatic encephalopathy and Alzheimer's disease. The cis antibody may be further developed to detect and treat TBI, and prevent progressive neurodegeneration after injury.

  14. Rotational spectroscopy and dipole moment of cis-cis HOONO and DOONO.

    PubMed

    Fry, Juliane L; Drouin, Brian J; Miller, Charles E

    2006-02-28

    The rotational spectrum of cis-cis HOONO has been studied over a broad range of frequencies, 13-840 GHz, using pulsed beam Fourier-transform microwave spectroscopy and room-temperature flow cell submillimeter spectroscopy. The rotational spectrum of the deuterated isotopomer, cis-cis DOONO, has been studied over a subset of this range, 84-640 GHz. Improved spectroscopic constants have been determined for HOONO, and the DOONO spectrum is analyzed for the first time. Weak-field Stark effect measurements in the region of 84-110 GHz have been employed to determine the molecular dipole moments of cis-cis HOONO [mu(a) = 0.542(8) D, mu(b) = 0.918(15) D, mu = 1.07(2) D] and DOONO [mu(a) = 0.517(9) D, mu(b) = 0.930(15) D, mu = 1.06(2) D]. The quadrupole coupling tensor in the principal inertial axis system for the 14N nucleus has been determined to be chi(aa) = 1.4907(25) MHz, chi(bb) = -4.5990(59) MHz, chi(ab) = 3.17(147) MHz, and chi(cc) = 3.1082(59) MHz. Coordinates of the H atom in the center-of-mass frame have been determined with use of the Kraitchman equations, /aH/ = 0.516 A and /bH/ = 1.171 A. The inertial defects of HOONO and DOONO are consistent with a planar equilibrium structure with significant out-of-plane H atom torsional motion. Comparisons of the present results are made to ab initio calculations.

  15. Environmental testing of CIS based modules

    SciTech Connect

    Willett, D.

    1995-11-01

    This report describes environmental testing of Siemen`s CIS modules. Charts and diagrams are presented on data concerning: temporary power loss of laminated mini-modules; the 50 thermal cycle test; the 10 humidity freeze cycle test; results after 1000 hours of exposure to damp heat; and interconnect test structures in damp heat testing. It is concluded that moisture ingress causes permanent increases in the series resistance of modules, and that improved packaging is needed for better high humidity reliability. Also, dry dark heat caused temporary power losses which were recovered in sunlight.

  16. Nontuberculous mycobacterial pulmonary disease mimicking lung cancer

    PubMed Central

    Hong, Su Jin; Kim, Tae Jung; Lee, Jae-Ho; Park, Jeong-Soo

    2016-01-01

    Abstract To describe the features and clinical implications of computed tomography (CT), positron emission tomography (PET), and percutaneous needle aspiration biopsy (PCNB) in pulmonary nontuberculous mycobacterial (NTM) disease manifesting as a solitary nodule, mass, or mass-like consolidation mimicking malignancy. Among a cohort of 388 patients with NTM pulmonary disease, 14 patients with clinically and radiologically suspected lung cancer were included in our study. Two chest radiologists evaluated CT features, including lesion type (nodule, mass, or mass-like consolidation), morphologic features (margin, degree of enhancement, calcification), and presence of accompanying findings suggestive of NTM pulmonary disease (bronchiectasis with clustered centrilobular nodules or upper-lobe cavitary lesions) by consensus. Diagnostic procedures for microbiologic diagnosis of NTM disease and clinical outcome were reviewed. Incidence of NTM pulmonary disease presenting as solitary nodule/mass (n = 8) or mass-like consolidation (n = 6) was 3.6% (14 of 388). Most lesions were detected incidentally during routine health check-up or evaluation of other disease (11 of 14, 79%). Lesions typically showed poor contrast-enhancement (9 of 12) and internal calcification (6 of 14). No lesions had CT features suggestive of NTM pulmonary disease. All 4 lesions for which PET/CT imaging was performed showed strong fluorodeoxyglucose uptake simulating malignant lesions (mean, 4.9; range, 3.6–7.8). PCNB revealed mycobacterial histology in 6 of 11 specimens and positive culture results were obtained for 7 of 7 specimens. NTM pulmonary disease may present as a solitary nodule, mass, or mass-like consolidation mimicking malignancy. CT features and PCNB are important to diagnose NTM disease mimicking lung cancer to avoid unnecessary surgery. PMID:27367996

  17. TFM-Explorer: mining cis-regulatory regions in genomes

    PubMed Central

    Tonon, Laurie; Varré, Jean-Stéphane

    2010-01-01

    DNA-binding transcription factors (TFs) play a central role in transcription regulation, and computational approaches that help in elucidating complex mechanisms governing this basic biological process are of great use. In this perspective, we present the TFM-Explorer web server that is a toolbox to identify putative TF binding sites within a set of upstream regulatory sequences of genes sharing some regulatory mechanisms. TFM-Explorer finds local regions showing overrepresentation of binding sites. Accepted organisms are human, mouse, rat, chicken and drosophila. The server employs a number of features to help users to analyze their data: visualization of selected binding sites on genomic sequences, and selection of cis-regulatory modules. TFM-Explorer is available at http://bioinfo.lifl.fr/TFM. PMID:20522509

  18. Intradural Extramedullary Tuberculoma Mimicking En Plaque Meningioma

    PubMed Central

    Shim, Dae Moo; Kim, Tae Kyun; Chae, Soo Uk

    2010-01-01

    A 24-year-old man with tuberculosis meningitis developed acute paraplegia and sensory disturbances 5 weeks after receiving conventional antituberculous therapy. Magnetic resonance imaging revealed an intradural extramedullary long segmental mass mimicking en plaque meningioma at the T2-T6 vertebrae levels. Prompt surgical decompression was performed. A histology examination of the mass revealed a tuberculoma. After surgery, the patient showed improved motor power and a normal bladder function. Intradural extramedullary tuberculoma of the spinal cord is rare complication of tuberculosis meningitis, which can occur as a response to conventional antituberculous therapy. PMID:21119945

  19. Chondroblastoma of the acromion mimicking fibrous dysplasia.

    PubMed

    Gebert, Carsten; Hardes, Jendrik; Streitbürger, Arne; Vieth, Volker; Bürger, Horst; Winkelmann, Winfried; Gosheger, Georg

    2004-12-01

    The authors report the case of a 65-year-old man who presented with an expansive osteolytic lesion in the right acromion, mimicking cystic fibrous dysplasia. Magnetic resonance imaging showed a lesion with intermediate-signal intensity on T1-weighted images and a high-signal intensity on fat suppressed T2-weighted images. The biopsy led to the diagnosis of chondroblastoma. This tumour is rare in flat bones, and may mimic other benign or malignant lesions. It is therefore essential to perform a biopsy in order to obtain a definite diagnosis. The acromion was excised, and replaced with an iliac crest graft.

  20. Post-pancreatitis Fat Necrosis Mimicking Carcinomatosis.

    PubMed

    Smith, Joshua P; Arnoletti, J Pablo; Varadarajulu, Shyam; Morgan, Desiree E

    2008-01-01

    Acute pancreatitis can result in retroperitoneal fat necrosis, typically occurring in the peripancreatic region, with extension into the transverse mesocolon, omentum and mesenteric root. When evaluated with contrast enhanced computed tomography (CECT), acute peripancreatic post necrotic collections typically become lower in attenuation over time, and often appear as homogeneous fluid collections. Saponification as a complication of fat necrosis in patients with acute pancreatitis is a well recognized clinical entity. While retroperitonal fat necrosis is commonly seen on CECT, saponification is not a prominent imaging feature. We present a case of acute pancreatitis complicated by extensive saponification of fat throughout the retroperitoneum and peritoneal lining, mimicking carcinomatosis.

  1. Thymic Langerhans cell histiocytosis mimicking lymphoma.

    PubMed

    Yağci, Begül; Varan, Ali; Uner, Aysegül; Akyüz, Canan; Büyükpamukçu, Münevver

    2008-12-01

    Langerhans cell histiocytosis (LCH) is a rare disorder characterized by clonal expansion of antigen presenting Langerhans cells. Different clinical features can be seen according to the involved organs and systems. Multisystem disease with organ dysfunction is more common in infants, whereas single system disease is usually observed in older children. The disease can affect any system or organ throughout the body. Thymus is a rarely involvement site reported in LCH and usually is accompanied by skin, bone or lung disease. Here we report a 12-year-old male with thymic involvement by LCH clinically mimicking lymphoma.

  2. Brucellosis in spondyloarthritis mimicking an exacerbation.

    PubMed

    Garip, Y; Eser, F; Erten, S; Yilmaz, O; Yildirim, P

    2014-01-01

    Spondyloarthritis are a group of chronic inflammatory diseases that affect the axial skeleton, entheses and peripheral joints and may have extraarticular manifestations such as uveitis, psoriasis and inflammatory bowel disease. Brucellosis is a systemic infectious disease, endemic in Middle East, Latin America, and Mediterranean countries, which may present manifestations that resemble other diseases posing serious problems of differential diagnosis. Some hallmarks of Brucellosis may mimic a spondyloarthritis flare. In this paper, authors present a clinical case of brucellosis occurring in a patient with spondyloarthritis. Clinical symptoms initially mimicked exacerbation of spondyloarthritis.

  3. 9-cis-retinoic acid promotes cell adhesion through integrin dependent and independent mechanisms across immune lineages.

    PubMed

    Whelan, Jarrett T; Chen, Jianming; Miller, Jabin; Morrow, Rebekah L; Lingo, Joshuah D; Merrell, Kaitlin; Shaikh, Saame Raza; Bridges, Lance C

    2013-05-01

    Retinoids are essential in the proper establishment and maintenance of immunity. Although retinoids are implicated in immune related processes, their role in immune cell adhesion has not been well established. In this study, the effect of 9-cis-retinoic acid (9-cis-RA) on human hematopoietic cell adhesion was investigated. 9-cis-RA treatment specifically induced cell adhesion of the human immune cell lines HuT-78, NB4, RPMI 8866 and U937. Due to the prominent role of integrin receptors in mediating immune cell adhesion, we sought to evaluate if cell adhesion was integrin-dependent. By employing a variety of integrin antagonist including function-blocking antibodies and EDTA, we establish that 9-cis-RA prompts immune cell adhesion through established integrin receptors in addition to a novel integrin-independent process. The novel integrin-independent adhesion required the presence of retinoid and was attenuated by treatment with synthetic corticosteroids. Finally, we demonstrate that 9-cis-RA treatment of primary murine B-cells induces ex vivo adhesion that persists in the absence of integrin function. Our study is the first to demonstrate that 9-cis-RA influences immune cell adhesion through at least two functionally distinct mechanisms.

  4. A cis-regulatory module activating transcription in the suspensor contains five cis-regulatory elements.

    PubMed

    Henry, Kelli F; Kawashima, Tomokazu; Goldberg, Robert B

    2015-06-01

    Little is known about the molecular mechanisms by which the embryo proper and suspensor of plant embryos activate specific gene sets shortly after fertilization. We analyzed the upstream region of the Scarlet Runner Bean (Phaseolus coccineus) G564 gene in order to understand how genes are activated specifically in the suspensor during early embryo development. Previously, we showed that a 54-bp fragment of the G564 upstream region is sufficient for suspensor transcription and contains at least three required cis-regulatory sequences, including the 10-bp motif (5'-GAAAAGCGAA-3'), the 10 bp-like motif (5'-GAAAAACGAA-3'), and Region 2 motif (partial sequence 5'-TTGGT-3'). Here, we use site-directed mutagenesis experiments in transgenic tobacco globular-stage embryos to identify two additional cis-regulatory elements within the 54-bp cis-regulatory module that are required for G564 suspensor transcription: the Fifth motif (5'-GAGTTA-3') and a third 10-bp-related sequence (5'-GAAAACCACA-3'). Further deletion of the 54-bp fragment revealed that a 47-bp fragment containing the five motifs (the 10-bp, 10-bp-like, 10-bp-related, Region 2 and Fifth motifs) is sufficient for suspensor transcription, and represents a cis-regulatory module. A consensus sequence for each type of motif was determined by comparing motif sequences shown to activate suspensor transcription. Phylogenetic analyses suggest that the regulation of G564 is evolutionarily conserved. A homologous cis-regulatory module was found upstream of the G564 ortholog in the Common Bean (Phaseolus vulgaris), indicating that the regulation of G564 is evolutionarily conserved in closely related bean species.

  5. Inflammatory Myofibroblastic Tumor Mimicking Apical Periodontitis.

    PubMed

    Adachi, Makoto; Kiho, Kazuki; Sekine, Genta; Ohta, Takahisa; Matsubara, Makoto; Yoshida, Takakazu; Katsumata, Akitoshi; Tanuma, Jun-ichi; Sumitomo, Shinichiro

    2015-12-01

    Inflammatory myofibroblastic tumors (IMTs) are rare. IMTs of the head and neck occur in all age groups, from neonates to old age, with the highest incidence occurring in childhood and early adulthood. An IMT has been defined as a histologically distinctive lesion of uncertain behavior. This article describes an unusual case of IMT mimicking apical periodontitis in the mandible of a 42-year-old man. At first presentation, the patient showed spontaneous pain and percussion pain at teeth #28 to 30, which continued after initial endodontic treatment. Panoramic radiography revealed a radiolucent lesion at the site. Cone-beam computed tomographic imaging showed osteolytic lesions, suggesting an aggressive neoplasm requiring incisional biopsy. Histopathological examination indicated an IMT. The lesion was removed en bloc under general anesthesia, and the patient manifested no clinical evidence of recurrence for 24 months. Lesions of nonendodontic origin should be included in the differential diagnosis of apical periodontitis. Every available diagnostic tool should be used to confirm the diagnosis. Cone-beam computed tomographic imaging is very helpful for differential diagnosis in IMTs mimicking apical periodontitis.

  6. The Role of cis Regulatory Evolution in Maize Domestication

    PubMed Central

    Lemmon, Zachary H.; Bukowski, Robert; Sun, Qi; Doebley, John F.

    2014-01-01

    Gene expression differences between divergent lineages caused by modification of cis regulatory elements are thought to be important in evolution. We assayed genome-wide cis and trans regulatory differences between maize and its wild progenitor, teosinte, using deep RNA sequencing in F1 hybrid and parent inbred lines for three tissue types (ear, leaf and stem). Pervasive regulatory variation was observed with approximately 70% of ∼17,000 genes showing evidence of regulatory divergence between maize and teosinte. However, many fewer genes (1,079 genes) show consistent cis differences with all sampled maize and teosinte lines. For ∼70% of these 1,079 genes, the cis differences are specific to a single tissue. The number of genes with cis regulatory differences is greatest for ear tissue, which underwent a drastic transformation in form during domestication. As expected from the domestication bottleneck, maize possesses less cis regulatory variation than teosinte with this deficit greatest for genes showing maize-teosinte cis regulatory divergence, suggesting selection on cis regulatory differences during domestication. Consistent with selection on cis regulatory elements, genes with cis effects correlated strongly with genes under positive selection during maize domestication and improvement, while genes with trans regulatory effects did not. We observed a directional bias such that genes with cis differences showed higher expression of the maize allele more often than the teosinte allele, suggesting domestication favored up-regulation of gene expression. Finally, this work documents the cis and trans regulatory changes between maize and teosinte in over 17,000 genes for three tissues. PMID:25375861

  7. Profiling of conserved non-coding elements upstream of SHOX and functional characterisation of the SHOX cis-regulatory landscape

    PubMed Central

    Verdin, Hannah; Fernández-Miñán, Ana; Benito-Sanz, Sara; Janssens, Sandra; Callewaert, Bert; Waele, Kathleen De; Schepper, Jean De; François, Inge; Menten, Björn; Heath, Karen E.; Gómez-Skarmeta, José Luis; Baere, Elfride De

    2015-01-01

    Genetic defects such as copy number variations (CNVs) in non-coding regions containing conserved non-coding elements (CNEs) outside the transcription unit of their target gene, can underlie genetic disease. An example of this is the short stature homeobox (SHOX) gene, regulated by seven CNEs located downstream and upstream of SHOX, with proven enhancer capacity in chicken limbs. CNVs of the downstream CNEs have been reported in many idiopathic short stature (ISS) cases, however, only recently have a few CNVs of the upstream enhancers been identified. Here, we set out to provide insight into: (i) the cis-regulatory role of these upstream CNEs in human cells, (ii) the prevalence of upstream CNVs in ISS, and (iii) the chromatin architecture of the SHOX cis-regulatory landscape in chicken and human cells. Firstly, luciferase assays in human U2OS cells, and 4C-seq both in chicken limb buds and human U2OS cells, demonstrated cis-regulatory enhancer capacities of the upstream CNEs. Secondly, CNVs of these upstream CNEs were found in three of 501 ISS patients. Finally, our 4C-seq interaction map of the SHOX region reveals a cis-regulatory domain spanning more than 1 Mb and harbouring putative new cis-regulatory elements. PMID:26631348

  8. Polarons and bipolarons in cis-polyacetylene

    NASA Astrophysics Data System (ADS)

    Utz, Wolfram; Förner, Wolfgang

    1998-05-01

    We present a parametrization for the Pariser-Parr-Pople Hamiltonian for the description of cis-polyacetylene (cPA). In contrast to trans-polyacetylene, we have to include symmetry breaking between neighboring sites into the Su-Schrieffer-Heeger-type one-electron part of the Hamiltonian. Our parametrization is based on correlated ab initio calculations on cis-hexatriene and on the results of independent calculations found in the literature. For open-shell systems (singly charged polarons) we use the annihilated unrestricted Hartree-Fock method to avoid the artificial spin contaminations inherent in UHF (unrestricted HF) calculations, which lead to the inclusion of fractions of the correlation energy in UHF total energies which cannot be controlled and are different for different systems and even for different geometries of the same system. Thus UHF is useless for the calculation of potential hypersurfaces and thus in turn for dynamical simulations. We find that in cPA singly-charged polarons are formed, while in doubly-charged chains stable bipolarons are found, although of a quite large width. This is in contrast to recent results reported by Shimoi and Abe [Y. Shimoi and S. Abe, Synth. Met. 69, 687 (1995) and Phys. Rev. B 50, 14 781 (1994)] who found that two singly-charged polarons are more stable for realistic parameter values than a doubly-charged bipolaron. We further find that the charged polarons are mobile in the chain and thus we conclude that polarons and bipolarons can serve as charge carriers (the latter ones spinless) in doped cPA.

  9. Prepare dispersed CIS nano-scale particles and spray coating CIS absorber layers using nano-scale precursors

    NASA Astrophysics Data System (ADS)

    Liou, Jian-Chiun; Diao, Chien-Chen; Lin, Jing-Jenn; Chen, Yen-Lin; Yang, Cheng-Fu

    2014-01-01

    In this study, the Mo-electrode thin films were deposited by a two-stepped process, and the high-purity copper indium selenide-based powder (CuInSe2, CIS) was fabricated by hydrothermal process by Nanowin Technology Co. Ltd. From the X-ray pattern of the CIS precursor, the mainly crystalline phase was CIS, and the almost undetectable CuSe phase was observed. Because the CIS powder was aggregated into micro-scale particles and the average particle sizes were approximately 3 to 8 μm, the CIS power was ground into nano-scale particles, then the 6 wt.% CIS particles were dispersed into isopropyl alcohol to get the solution for spray coating method. Then, 0.1 ml CIS solution was sprayed on the 20 mm × 10 mm Mo/glass substrates, and the heat treatment for the nano-scale CIS solution under various parameters was carried out in a selenization furnace. The annealing temperature was set at 550°C, and the annealing time was changed from 5 to 30 min, without extra Se content was added in the furnace. The influences of annealing time on the densification, crystallization, resistivity ( ρ), hall mobility ( μ), and carrier concentration of the CIS absorber layers were well investigated in this study.

  10. CisMols Analyzer: identification of compositionally similar cis-element clusters in ortholog conserved regions of coordinately expressed genes

    PubMed Central

    Jegga, Anil G.; Gupta, Ashima; Gowrisankar, Sivakumar; Deshmukh, Mrunal A.; Connolly, Steven; Finley, Kevin; Aronow, Bruce J.

    2005-01-01

    Combinatorial interactions of sequence-specific trans-acting factors with localized genomic cis-element clusters are the principal mechanism for regulating tissue-specific and developmental gene expression. With the emergence of expanding numbers of genome-wide expression analyses, the identification of the cis-elements responsible for specific patterns of transcriptional regulation represents a critical area of investigation. Computational methods for the identification of functional cis-regulatory modules are difficult to devise, principally because of the short length and degenerate nature of individual cis-element binding sites and the inherent complexity that is generated by combinatorial interactions within cis-clusters. Filtering candidate cis-element clusters based on phylogenetic conservation is helpful for an individual ortholog gene pair, but combining data from cis-conservation and coordinate expression across multiple genes is a more difficult problem. To approach this, we have extended an ortholog gene-pair database with additional analytical architecture to allow for the analysis and identification of maximal numbers of compositionally similar and phylogenetically conserved cis-regulatory element clusters from a list of user-selected genes. The system has been successfully tested with a series of functionally related and microarray profile-based co-expressed ortholog pairs of promoters and genes using known regulatory regions as training sets and co-expressed genes in the olfactory and immunohematologic systems as test sets. CisMols Analyzer is accessible via a Web interface at . PMID:15980500

  11. 2,3-cis-2R,3R-(−)-epiafzelechin-3-O-p-coumarate, a novel flavan-3-ol isolated from Fallopia convolvulus seed, is an estrogen receptor agonist in human cell lines

    PubMed Central

    2013-01-01

    Background The plant genus Fallopia is well-known in Chinese traditional medicine and includes many species that contain bioactive compounds, namely phytoestrogens. Consumption of phytoestrogens may be linked to decreased incidence of breast and prostate cancers therefore discovery of novel phytoestrogens and novel sources of phytoestrogens is of interest. Although phytoestrogen content has been analyzed in the rhizomes of various Fallopia sp., seeds of a Fallopia sp. have never been examined for phytoestrogen presence. Methods Analytical chemistry techniques were used with guidance from an in vitro estrogen receptor bioassay (a stably transfected human ovarian carcinoma cell line) to isolate and identify estrogenic components from seeds of Fallopia convolvulus. A transiently transfected human breast carcinoma cell line was used to characterize the biological activity of the isolated compounds on estrogen receptors (ER) α and β. Results Two compounds, emodin and the novel flavan-3-ol, (−)-epiafzelechin-3-O-p-coumarate (rhodoeosein), were identified to be responsible for estrogenic activity of F. convolvulus seed extract. Absolute stereochemistry of rhodoeosein was determined by 1 and 2D NMR, optical rotation and circular dichroism. Emodin was identified by HPLC/DAD, LC/MS/MS, and FT/ICR-MS. When characterizing the ER specificity in biological activity of rhodoeosein and emodin, rhodoeosein was able to exhibit a four-fold greater relative estrogenic potency (REP) in breast cells transiently-transfected with ERβ as compared to those transfected with ERα, and emodin exhibited a six-fold greater REP in ERβ-transfected breast cells. Cell type-specific differences were observed with rhodoeosein but not emodin; rhodoeosein produced superinduction of reporter gene activity in the human ovarian cell line (> 400% of maximum estradiol [E2] induction) but not in the breast cell line. Conclusion This study is the first to characterize the novel flavan-3-ol compound

  12. Probing the cis-arrangement of prototype tight junction proteins claudin-1 and claudin-3.

    PubMed

    Milatz, Susanne; Piontek, Jörg; Schulzke, Jörg-Dieter; Blasig, Ingolf E; Fromm, Michael; Günzel, Dorothee

    2015-06-15

    Claudins form a large family of TJ (tight junction) proteins featuring four transmembrane segments (TM1-TM4), two extracellular loops, one intracellular loop and intracellular N- and C-termini. They form continuous and branched TJ strands by homo- or heterophilic interaction within the same membrane (cis-interaction) and with claudins of the opposing lateral cell membrane (trans-interaction). In order to clarify the molecular organization of TJ strand formation, we investigated the cis-interaction of two abundant prototypic claudins. Human claudin-1 and claudin-3, fused to ECFP or EYFP at the N- or C-terminus, were expressed in the TJ-free cell line HEK (human embryonic kidney)-293. Using FRET analysis, the proximity of claudin N- and C-termini integrated in homopolymeric strands composed of claudin-3 or of heteropolymeric strands composed of claudin-1 and claudin-3 were determined. The main results are that (i) within homo- and heteropolymers, the average distance between the cytoplasmic ends of the TM1s of cis-interacting claudin molecules is shorter than the average distance between their TM4s, and (ii) TM1 segments of neighbouring claudins are oriented towards each other as the cytoplasmic end of TM1 is in close proximity to more other TM1 segments than TM4 is to other TM4 segments. The results indicate at least two different cis-interaction interfaces within claudin-3 homopolymers as well as within claudin-1/claudin-3 heteropolymers. The data provide novel insight into the molecular TJ architecture consistent with a model with an antiparallel double-row cis-arrangement of classic claudin protomers within strands.

  13. Inherited cardiomyopathies mimicking arrhythmogenic right ventricular cardiomyopathy.

    PubMed

    Roberts, Jason D; Veinot, John P; Rutberg, Julie; Gollob, Michael H

    2010-01-01

    Arrhythmogenic right ventricular cardiomyopathy (ARVC) represents an inherited cardiomyopathy that manifests clinically with malignant ventricular arrhythmias, sudden cardiac death, and less commonly heart failure. The condition is characterized by replacement of the myocardium, primarily of the right ventricle, with fibrofatty tissue. Extensive fibrofatty replacement of the myocardium has been previously thought to be pathognomonic of ARVC; however, this report details two other forms of inherited cardiomyopathy, namely hypertrophic cardiomyopathy (HCM) and the PRKAG2 cardiac syndrome, that were found to have significant fibrofatty myocardial replacement at pathologic examination. This report represents the first documentation of inherited cardiomyopathies mimicking ARVC and highlights the concept that other cardiac conditions can be associated with fibrofatty replacement of the myocardium.

  14. A subtle mimicker in emergency department

    PubMed Central

    Angelis, Maria Vittoria De; Giacomo, Roberta Di; Muzio, Antonio Di; Onofrj, Marco; Bonanni, Laura

    2016-01-01

    Abstract Background: Movement disorder emergencies include any movement disorder which develops over hours to days, in which failure to appropriately diagnose and manage can result in patient morbidity or mortality. Movement disorder emergencies include acute dystonia: sustained or intermittent muscle contractions causing abnormal, often repetitive, movements. Acute dystonia is a serious challenge for emergency room doctors and neurologists, because of the high probability of misdiagnosis, due to the presence of several mimickers including partial seizures, meningitis, localized tetanus, serum electrolyte level abnormalities, strychnine poisoning, angioedema, malingering, catatonia, and conversion. Methods: We describe 2 examples, accompanied by videos, of acute drug-induced oro-mandibular dystonia, both subsequent to occasional haloperidol intake. Results: Management and treatment of this movement disorder are often difficult: neuroleptics withdrawal, treatment with benzodiazepines, and anticholinergics are recommended. Conclusion: Alternative treatment options are also discussed. PMID:27741141

  15. Tentorium schwannoma mimicking meningioma: an unusual location.

    PubMed

    Calişaneller, Tarkan; Ozen, Ozlem; Altinörs, Nur; Caner, Hakan

    2008-07-01

    A 60-year-old female was admitted to our clinic complaining of a long-lasting headache. Cranial magnetic resonance imagining examination of the patient revealed a 22x24 mm extra-axial, well-demarcated, mass lesion based on the left tentorium. The patient underwent a craniotomy and the tumor was totally excised with the adjacent tentorium. The histopathological examination of the tumor complied with the diagnosis of schwannoma. The rest of the clinical course was uneventful and the patient was released from the hospital without any neurological deficit. Intracranial schwannomas can rarely originate from atypical dural locations and radiological techniques are not always helpful in distinguishing tentorial schwannoma from tentorial meningioma. We presented a patient with a tentorium schwannoma mimicking meningioma and discussed the current literature.

  16. Pulmonary artery sarcoma mimicking pulmonary thromboembolism.

    PubMed

    Celik, Gökhan; Ciledağ, Aydin; Yüksel, Cabir; Yenigün, Bülent Mustafa; Kutlay, Hakan; Yazicıoğlu, Levent; Perçinel, Sibel; Kaya, Akin

    2011-01-01

    A 30 years old male patient was referred to our hospital with a diagnosis of pulmonary thromboembolism due to thorax-computerized tomography (CT) angiography, revealing a thrombus totally occluding left main pulmonary artery. The lesion was evaluated as tumoural mass. Positron emission tomography (PET)-CT revealed pathologic uptake at pulmonary artery mass. Due to localization of tumour, left pneumonectomy was performed. The pathological diagnosis revealed to be pulmonary artery sarcoma. The patient was presented because pulmonary artery sarcomas are very rare tumors and can mimick pulmonary thromboembolism. The true prevalence is underestimated as many pulmonary artery sarcomas are misdiagnosed as pulmonary thromboembolism. PET-CT may help to make a differential diagnosis.

  17. High-altitude cerebral oedema mimicking stroke

    PubMed Central

    Yanamandra, Uday; Gupta, Amul; Patyal, Sagarika; Varma, Prem Prakash

    2014-01-01

    High-altitude cerebral oedema (HACO) is the most fatal high-altitude illness seen by rural physicians practising in high-altitude areas. HACO presents clinically with cerebellar ataxia, features of raised intracranial pressure (ICP) and coma. Early identification is important as delay in diagnosis can be fatal. We present two cases of HACO presenting with focal deficits mimicking stroke. The first patient presented with left-sided hemiplegia associated with the rapid deterioration in the sensorium. Neuroimaging revealed features suggestive of vasogenic oedema. The second patient presented with monoplegia of the lower limb. Neuroimaging revealed perfusion deficit in anterior cerebral artery territory. Both patients were managed with dexamethasone and they improved dramatically. Clinical picture and neuroimaging closely resembled acute ischaemic stroke in both cases. Thrombolysis in these patients would have been disastrous. Recent travel to high altitude, young age, absence of atherosclerotic risk factors and features of raised ICP concomitantly directed the diagnosis to HACO. PMID:24671373

  18. Infant botulism mimicking an acute abdomen.

    PubMed

    Pisanti, R; Vitiello, R; Formicola, S; Pisanti, A

    2009-12-01

    Botulism is the acute, flaccid paralysis caused by a neurotoxin produced by Clostridium botulinum. In the infant, clinical symptoms are usually unspecific such as poor feeding, weak suck, feeble cry, drooling, followed by a symmetric, descending, flaccid paralysis beginning with the cranial nerve musculature. The initial symptoms of the disease are often similar to several diseases and therefore differential diagnosis is very difficult and rarely suspected by the physician. Since 2004 only 22 cases of infant botulism have been reported in Italy. Since most paediatricians are unfamiliar with the clinical manifestations of infant botulism, the diagnosis can be easily missed. Hence the disease may well be underestimated and underreported. We report a clinical case of botulism presenting initially with abdominal distention, thereby mimicking acute abdomen.

  19. New probabilistic risk assessment of ethylhexyl methoxycinnamate: Comparing the genotoxic effects of trans- and cis-EHMC.

    PubMed

    Nečasová, Anežka; Bányiová, Katarína; Literák, Jaromír; Čupr, Pavel

    2017-02-01

    Ethylhexyl methoxycinnamate (EHMC) is a widely used UV filter present in a large number of personal care products (PCPs). Under normal conditions, EHMC occurs in a mixture of two isomers: trans-EHMC and cis-EHMC in a ratio of 99:1. When exposed to sunlight, the trans isomer is transformed to the less stable cis isomer and the efficiency of the UV filter is reduced. To date, the toxicological effects of the cis-EHMC isomer remain largely unknown. We developed a completely new method for preparing cis-EHMC. An EHMC technical mixture was irradiated using a UV lamp and 98% pure cis-EHMC was isolated from the irradiated solution using column chromatography. The genotoxic effects of the isolated cis-EHMC isomer and the nonirradiated trans-EHMC were subsequently measured using two bioassays (SOS chromotest and UmuC test). In the case of trans-EHMC, significant genotoxicity was observed using both bioassays at the highest concentrations (0.5 - 4 mg mL(-1) ). In the case of cis-EHMC, significant genotoxicity was only detected using the UmuC test at concentrations of 0.25 - 1 mg mL(-1) . Based on these results, the NOEC was calculated for both cis- and trans-EHMC, 0.038 and 0.064 mg mL(-1) , respectively. Risk assessment of dermal, oral and inhalation exposure to PCPs containing EHMC was carried out for a female population using probabilistic simulation and by using Quantitative in vitro to in vivo extrapolation (QIVIVE). The risk of cis-EHMC was found to be ∼1.7 times greater than trans-EHMC. In the case of cis-EHMC, a hazard index of 1 was exceeded in the 92nd percentile. Based on the observed differences between the isomers, EHMC application in PCPs requires detailed reassessment. Further exploration of the toxicological effects and properties of cis-EHMC is needed in order to correctly predict risks posed to humans and the environment. © 2016 Wiley Periodicals, Inc. Environ Toxicol 32: 569-580, 2017.

  20. U.S./CIS eye joint nuclear rocket venture

    NASA Technical Reports Server (NTRS)

    Clark, John S.; Mcilwain, Melvin C.; Smetanikov, Vladimir; D'Yakov, Evgenij K.; Pavshuk, Vladimir A.

    1993-01-01

    An account is given of the significance for U.S. spacecraft development of a nuclear thermal rocket (NTR) reactor concept that has been developed in the (formerly Soviet) Commonwealth of Independent States (CIS). The CIS NTR reactor employs a hydrogen-cooled zirconium hydride moderator and ternary carbide fuels; the comparatively cool operating temperatures associated with this design promise overall robustness.

  1. Short asymmetric synthesis of (-)- and (+)-cis-lauthisan.

    PubMed

    Carreño, M Carmen; Des Mazery, Renaud; Urbano, Antonio; Colobert, Françoise; Solladié, Guy

    2005-05-12

    The asymmetric synthesis of both enantiomers of cis-lauthisan (3) is achieved in only six steps from diethyl pimelate (4), the key steps being the diastereodivergent reduction of beta-ketosulfoxide 7 and the highly cis-stereoselective Et(3)SiH/TMSOTf-promoted reductive cyclization of enantiopure hydroxy sulfinyl ketones (S)-14 and (R)-14.

  2. Peptidyl-prolyl cis-trans isomerases: structure and functions.

    PubMed

    Pliyev, B K; Gurvits, B Y

    1999-07-01

    Peptidyl-prolyl cis-trans isomerases (PPI) catalyze cis-trans isomerization of imide bonds in peptides and proteins. This review summarizes the literature on the structure and functions of PPIs, their involvement in protein folding, and organization of PPI-containing receptors and membrane channels. A possible role of several PPIs in distant interactions between cells is discussed.

  3. Hypoxia-Mimicking Nanofibrous Scaffolds Promote Endogenous Bone Regeneration.

    PubMed

    Yao, Qingqing; Liu, Yangxi; Tao, Jianning; Baumgarten, Keith M; Sun, Hongli

    2016-11-30

    Utilizing biomimetic materials to potentiate endogenous cell growth or signaling is superior to relying on exogenous cells or signals for bone formation. Desferoxamine (DFO), which is a hypoxia-mimetic agent that chelates iron (Fe(3+)), mimics hypoxia to encourage bone healing. However, high cytotoxicity, off-target effects, and the short half-life of DFO have significantly impeded its further applications. We mitigated these side effects by locally immobilizing DFO onto a gelatin nanofibrous (GF) scaffold that retained DFO's ability to chelate Fe(3+). Moreover, DFO-functionalized GF (GF-DFO) scaffolds, which have similar micro/macrostructures to GF scaffolds, not only demonstrated decreased cytotoxicity on both human umbilical vein endothelial cells and human mesenchymal stem cells but also significantly increased vascular endothelial growth factor (VEGF) expression in vitro. Most importantly, in our in vivo experiments on a critical-sized cranial bone defect mouse model, a significant amount of bone was formed in most of the GF-DFO scaffolds after six weeks, while very little new bone was observed in the GF scaffolds. These data suggest that use of a hypoxia-mimicking nanofibrous scaffold is a promising strategy for promoting endogenous bone formation.

  4. Mimicking cellular transport mechanism in stem cells through endosomal escape of new peptide-coated quantum dots

    NASA Astrophysics Data System (ADS)

    Narayanan, Karthikeyan; Yen, Swee Kuan; Dou, Qingqing; Padmanabhan, Parasuraman; Sudhaharan, Thankiah; Ahmed, Sohail; Ying, Jackie Y.; Selvan, Subramanian Tamil

    2013-07-01

    Protein transport is an important phenomenon in biological systems. Proteins are transported via several mechanisms to reach their destined compartment of cell for its complete function. One such mechanism is the microtubule mediated protein transport. Up to now, there are no reports on synthetic systems mimicking the biological protein transport mechanism. Here we report a highly efficient method of mimicking the microtubule mediated protein transport using newly designed biotinylated peptides encompassing a microtubule-associated sequence (MTAS) and a nuclear localization signaling (NLS) sequence, and their final conjugation with streptavidin-coated CdSe/ZnS quantum dots (QDs). Our results demonstrate that these novel bio-conjugated QDs enhance the endosomal escape and promote targeted delivery into the nucleus of human mesenchymal stem cells via microtubules. Mimicking the cellular transport mechanism in stem cells is highly desirable for diagnostics, targeting and therapeutic applications, opening up new avenues in the area of drug delivery.

  5. Occupational Neurobrucellosis Mimicking a Brain Tumor: A Case Report and Review of the Literature

    PubMed Central

    Abdulghani, Dina; Farhan, Roiya; Algahtani, Raghad

    2017-01-01

    Brucellosis is a zoonotic bacterial infection which is transmitted to humans from infected animals and is endemic in many parts of the world including Saudi Arabia. In this article, we report a case of occupational neurobrucellosis that presented with a space-occupying lesion mimicking a brain tumor. We stress on the importance of obtaining detailed social history including occupation to reach the diagnosis in several conditions including brucellosis. We also stress on taking universal precautions when handling any specimens. It may be advisable that manipulation of all unknown specimens arriving at the laboratory should occur in biological safety cabinet until a highly infectious organism is ruled out. Neurobrucellosis should be included in the differential diagnosis in patients presenting with solitary mass lesion mimicking brain tumor especially in endemic areas or high occupational risk group. PMID:28299214

  6. Possible neuro-Sweet disease mimicking brain tumor in the medulla oblongata--case report.

    PubMed

    Akiba, Chihiro; Esaki, Takanori; Ando, Maya; Furuya, Tsuyoshi; Noda, Kazuyuki; Nakao, Yasuaki; Yamamoto, Takuji; Okuma, Yasuyuki; Mori, Kentaro

    2011-01-01

    A 62-year-old male presented with a rare case of possible neuro-Sweet Disease (NSD) mimicking brain tumor in the medulla oblongata, manifesting as numbness in the bilateral upper and lower extremities, gait disturbance, dysarthria, and swallowing disturbance which gradually deteriorated over 3 months. Magnetic resonance imaging showed a mass lesion in the medulla oblongata, extending to the upper cervical cord with rim enhancement by gadolinium. The preoperative diagnosis was brain tumor, such as glioma, or inflammatory disease. His neurological symptoms gradually deteriorated, so biopsy was performed through the midline suboccipital approach. Histological examination showed infiltration of inflammatory cells, mainly lymphocytes and macrophages. Human leukocyte antigen typing showed Cw1 and B54 which strongly suggested possible NSD. Steroid pulse therapy was started after surgery and the clinical symptoms improved. Neurosurgeons should be aware of inflammatory disorders such as NSD mimicking brain tumor.

  7. Oxylipin Signaling: A Distinct Role for the Jasmonic Acid Precursor cis-(+)-12-Oxo-Phytodienoic Acid (cis-OPDA)

    PubMed Central

    Dave, Anuja; Graham, Ian A.

    2012-01-01

    Oxylipins are lipid-derived compounds, many of which act as signals in the plant response to biotic and abiotic stress. They include the phytohormone jasmonic acid (JA) and related jasmonate metabolites cis-(+)-12-oxo-phytodienoic acid (cis-OPDA), methyl jasmonate, and jasmonoyl-L-isoleucine (JA-Ile). Besides the defense response, jasmonates are involved in plant growth and development and regulate a range of processes including glandular trichome development, reproduction, root growth, and senescence. cis-OPDA is known to possess a signaling role distinct from JA-Ile. The non-enzymatically derived phytoprostanes are structurally similar to cis-OPDA and induce a common set of genes that are not responsive to JA in Arabidopsis thaliana. A novel role for cis-OPDA in seed germination regulation has recently been uncovered based on evidence from double mutants and feeding experiments showing that cis-OPDA interacts with abscisic acid (ABA), inhibits seed germination, and increases ABA INSENSITIVE5 (ABI5) protein abundance. Large amounts of cis-OPDA are esterified to galactolipids in A. thaliana and the resulting compounds, known as Arabidopsides, are thought to act as a rapidly available source of cis-OPDA. PMID:22645585

  8. [Enzymatic formation of a cis,cis-muconic acid derivative using pyrazon-degrading bacteria (author's transl)].

    PubMed

    Blobel, F; Eberspächer, J; Haug, S; Lingens, F

    1976-01-01

    The cis,cis-muconic acid derivative of pyrazon, which was formerly isolated from the medium of pyrazon-degrading bacteria, was formed enzymatically by incubation of the catechol derivative of pyrazon with partially purified ortho pyrocatechase from pyrazon-degrading bacteria.

  9. In vitro effects of combinations of cis-amminedichloro (2-methylpyridine) platinum (II) (ZD0473) with other novel anticancer drugs on the growth of SBC-3, a human small cell lung cancer cell line.

    PubMed

    Kanzawa, F; Akiyama, Y; Saijo, N; Nishio, K

    2003-06-01

    Among numerous clinical regimens of combination chemotherapy, synergy has been observed to be particularly marked with combinations containing cisplatin (CDDP). However, the clinical use of CDDP has sometimes been limited by acquired resistance. The new-generation platinum drug, ZD0473, was synthesized with the aim of hindering the reaction of the drug with thiols, by the introduction of a 2-methylpyridine ligand. This enables the drug to exert antitumor activity against cisplatin-resistant cancer cells with elevated glutathione and/or metallothionein levels. The drug was also shown experimentally to overcome cisplatin resistance due to impaired drug accumulation, and enhanced DNA repair/tolerance to platinum-DNA adducts. We investigated the effects of combinations of ZD0473 with other anticancer drugs on the growth of a human small-cell lung cancer cell line (SBC-3). Six novel anticancer drugs were tested: docetaxel (TXT), paclitaxel (TXL), vinorelbine (VNB), irinotecan (CPT-11), gemcitabine (GEM) and pemetrexed (MTA). The growth inhibitory effect of the drugs was measured by MTT assay and the effects of the combination regimens were evaluated by the combination index analysis method developed by Chou and Talalay. Synergy was demonstrated for the combination regimens of ZD0473-GEM and ZD0473-TXL, while an additive effect was observed with combinations containing TXT, VNB, CPT-11 or MTA. In the case of the ZD0473-GEM combination, synergy was observed over a wide range of inhibition levels at dose ratios of 50:1, 100:1 and 250:1. The level of synergy was equivalent to that observed for combinations of CDDP-etoposide, CDDP-GEM and nedaplatin-CPT-11. The results suggest that the combination of ZD0473 with GEM merits further investigation in small cell lung cancer.

  10. 21 CFR 573.637 - Methyl esters of conjugated linoleic acid (cis-9, trans-11 and trans-10, cis-12-octadecadienoic...

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 21 Food and Drugs 6 2012-04-01 2012-04-01 false Methyl esters of conjugated linoleic acid (cis-9... § 573.637 Methyl esters of conjugated linoleic acid (cis-9, trans-11 and trans-10, cis-12-octadecadienoic acids). The food additive, methyl esters of conjugated linoleic acid (cis-9, trans-11 and...

  11. Germinating the 2050 Cis-Lunar Econosphere

    NASA Technical Reports Server (NTRS)

    Scott, David W.; Curreri, Peter A.; Ferguson, Cynthia K.; Nall, Mark E.; Tinker, Michael L.; Wright, Gregory M.

    2015-01-01

    In early 2013, Marshall Space Flight Center's upper management chartered a diverse team for a six-week 'sprint' to speculate (in a disciplined manner) and paint (with broad brush strokes) a picture of how earth, space, and public/private entities might be operating and relating to each other... in the year 2100. Two 12-person groups of civil servants, one with members having 15 years or less of NASA experience and the other with more senior members, worked independently and then compared and integrated their conclusions. In 2014, the 'Space 2100' team, with some new team members and different group boundaries, ran a longer sprint to a) develop more detailed estimates of the operations and economics of space activities in the vicinity of the Earth and Moon in the 2050 time frame, b) identify evolutionary paths, barriers, and opportunities, and c) suggest actions and philosophies to enable and invigorate progress towards the vision. This paper explores Space 2100's first two sprints and their projections of NASA's role in what will likely be a highly networked, international space industry and cis-lunar infrastructure.

  12. Germinating the 2050 Cis-Lunar Econosphere

    NASA Technical Reports Server (NTRS)

    Scott, David W.; Tinker, Michael L.; Nall, Mark E.; Wright, Gregory M.

    2015-01-01

    In early 2013, the Marshall Space Flight Center (MSFC) Director and MSFC's Office of Strategic Analysis and Communications (OSAC) chartered a diverse team for a six-week "sprint" to speculate (in a disciplined manner) and paint (with broad brush strokes) a picture of how earth, space, and public/private entities might be operating and relating to each other...in the year 2100. Two 12-person groups of civil servants, one with members having 15 years or less of NASA experience and the other with more senior members, worked independently and then compared and integrated their conclusions. In 2014, the "Space 2100" team, with some new team members and different group boundaries, ran a longer sprint to a) develop more detailed estimates of the operations and economics of space activities in the vicinity of the Earth and Moon in the 2050 time frame, b) identify evolutionary steps and viable paths needed to make that a reality, and c) recommend actions to enable and invigorate those steps. This paper explores Space 2100's first two sprints and their projections of NASA's role in what will likely be a highly networked international space industry and cis-lunar infrastructure.

  13. Multi-phase back contacts for CIS solar cells

    DOEpatents

    Rockett, Angus A.; Yang, Li-Chung

    1995-01-01

    Multi-phase, single layer, non-interdiffusing M-Mo back contact metallized films, where M is selected from Cu, Ga, or mixtures thereof, for CIS cells are deposited by a sputtering process on suitable substrates, preferably glass or alumina, to prevent delamination of the CIS from the back contact layer. Typical CIS compositions include CuXSe.sub.2 where X is In or/and Ga. The multi-phase mixture is deposited on the substrate in a manner to provide a columnar microstructure, with micro-vein Cu or/and Ga regions which partially or fully vertically penetrate the entire back contact layer. The CIS semiconductor layer is then deposited by hybrid sputtering and evaporation process. The Cu/Ga-Mo deposition is controlled to produce the single layer two-phase columnar morphology with controllable Cu or Ga vein size less than about 0.01 microns in width. During the subsequent deposition of the CIS layer, the columnar Cu/Ga regions within the molybdenum of the Cu/Ga-Mo back layer tend to partially leach out, and are replaced by columns of CIS. Narrower Cu and/or Ga regions, and those with fewer inner connections between regions, leach out more slowly during the subsequent CIS deposition. This gives a good mechanical and electrical interlock of the CIS layer into the Cu/Ga-Mo back layer. Solar cells employing In-rich CIS semiconductors bonded to the multi-phase columnar microstructure back layer of this invention exhibit vastly improved photo-electrical conversion on the order of 17% greater than Mo alone, improved uniformity of output across the face of the cell, and greater Fill Factor.

  14. Multi-phase back contacts for CIS solar cells

    DOEpatents

    Rockett, A.A.; Yang, L.C.

    1995-12-19

    Multi-phase, single layer, non-interdiffusing M-Mo back contact metallized films, where M is selected from Cu, Ga, or mixtures thereof, for CIS cells are deposited by a sputtering process on suitable substrates, preferably glass or alumina, to prevent delamination of the CIS from the back contact layer. Typical CIS compositions include CuXSe{sub 2} where X is In or/and Ga. The multi-phase mixture is deposited on the substrate in a manner to provide a columnar microstructure, with micro-vein Cu or/and Ga regions which partially or fully vertically penetrate the entire back contact layer. The CIS semiconductor layer is then deposited by hybrid sputtering and evaporation process. The Cu/Ga-Mo deposition is controlled to produce the single layer two-phase columnar morphology with controllable Cu or Ga vein size less than about 0.01 microns in width. During the subsequent deposition of the CIS layer, the columnar Cu/Ga regions within the molybdenum of the Cu/Ga-Mo back layer tend to partially leach out, and are replaced by columns of CIS. Narrower Cu and/or Ga regions, and those with fewer inner connections between regions, leach out more slowly during the subsequent CIS deposition. This gives a good mechanical and electrical interlock of the CIS layer into the Cu/Ga-Mo back layer. Solar cells employing In-rich CIS semiconductors bonded to the multi-phase columnar microstructure back layer of this invention exhibit vastly improved photo-electrical conversion on the order of 17% greater than Mo alone, improved uniformity of output across the face of the cell, and greater Fill Factor. 15 figs.

  15. Mammary analogue secretory carcinoma mimicking salivary adenoma.

    PubMed

    Williams, Lindsay; Chiosea, Simion I

    2013-12-01

    Mammary analogue secretory carcinoma (MASC) is a recently described salivary gland tumor characterized by ETV6 translocation. It appears that prior studies have identified MASC by reviewing salivary gland carcinomas, such as acinic cell carcinoma and adenocarcinoma, not otherwise specified. To address the possibility of MASC mimicking benign salivary neoplasms we reviewed 12 salivary gland (cyst)adenomas diagnosed prior to the discovery of MASC. One encapsulated (cyst)adenoma of the parotid gland demonstrated features of MASC. The diagnosis was confirmed by fluorescence in situ hybridization with an ETV6 break-apart probe. An unusual complex pattern of ETV6 rearrangement with duplication of the telomeric/distal ETV6 probe was identified. This case illustrates that MASC may mimic salivary (cyst)adenomas. To more accurately assess true clinical and morphologic spectrum of MASC, future studies may have to include review of salivary (cyst)adenomas. The differential diagnosis of MASC may have to be expanded to include cases resembling salivary (cyst)adenomas.

  16. Vitamin D Deficiency Rickets Mimicking Pseudohypoparathyroidism

    PubMed Central

    Kurtoğlu, Selim; Yıldız, Aysel; Akın, Mustafa Ali; Kendirici, Mustafa

    2010-01-01

    Vitamin D deficiency rickets (VDDR) is a disorder biochemically characterized by elevated serum alkaline phosphatase (ALP) activity, normal or decreased serum calcium (Ca) and inorganic phosphate concentrations, secondary hyperparathyroidism and decreased serum 25−hydroxyvitamin D (25(OH)D) levels. In stage 1 VDDR, urinary amino acid and phosphate excretion are normal with minimal or no findings of rickets on radiographs. Pseudohypoparathyroidism (PHP) is an inherited disorder characterized by end−organ resistance to parathormone (PTH). VDDR occasionally resembles PHP type 2 in clinical presentation and biochemical features, creating difficulties in the differential diagnosis of these two entities. Here we report an infant diagnosed with VDDR. In addition to inadequate vitamin D intake, usage of antiepileptic drugs (AED) may have led to the worsening of the vitamin D deficiency. The patient presented with a history of febrile convulsions, for which he received phenobarbital treatment. The initial findings of hypocalcemia, hyperphosphatemia and normal tubular reabsorption of phosphate, mimicking PHP 2, responded well to vitamin D and oral Ca treatment with normalization of serum Ca, phosphorus (P), ALP and PTH levels Conflict of interest:None declared. PMID:21274319

  17. Pontine lesions mimicking acute peripheral vestibulopathy

    PubMed Central

    Thomke, F.; Hopf, H. C.

    1999-01-01

    OBJECTIVES—Clinical signs of acute peripheral vestibulopathy (APV) were repeatedly reported with pontine lesions. The clinical relevance of such a mechanism is not known, as most studies were biased by patients with additional clinical signs of brainstem dysfunction.
METHODS—Masseter reflex (MassR), blink reflex (BlinkR), brainstem auditory evoked potentials (BAEPs), and DC electro-oculography (EOG) were tested in 232 consecutive patients with clinical signs of unilateral APV.
RESULTS—Forty five of the 232 patients (19.4%) had at least one electrophysiological abnormality suggesting pontine dysfunction mainly due to possible vertebrobasilar ischaemia (22 patients) and multiple sclerosis (eight patients). MassR abnormalities were seen in 24patients, and EOG abnormalities of saccades and following eye movements occurred in 22 patients. Three patients had BlinkR-R1 abnormalities, and one had delayed BAEP waves IV and V. Clinical improvement was almost always (32 of 34 re-examined patients) associated with improvement or normalisation of at least one electrophysiological abnormality. Brain MRI was done in 25 of the 44 patients and confirmed pontine lesions in six (two infarcts, three inflammations, one tumour).
CONCLUSIONS—Pontine dysfunction was suggested in 45 of 232 consecutive patients with clinical signs of APV on the basis of abnormal electrophysiological findings, and was mainly attributed to brainstem ischaemia and multiple sclerosis. The frequency of pontine lesions mimicking APV is underestimated if based on MRI established lesions only.

 PMID:10084533

  18. Egg white ovalbumin digestion mimicking physiological conditions.

    PubMed

    Martos, Gustavo; Contreras, Patricia; Molina, Elena; López-Fandiño, Rosina

    2010-05-12

    Gastrointestinal digestion of ovalbumin (OVA) was simulated using an in vitro system in two steps, which mimicked digestion in the stomach and duodenum, to assess the effect of different gastric pHs, different concentrations of proteases, and the presence of surfactants, such as phosphatidylcholine (PC) and bile salts (BS). OVA was very resistant to pepsin action at an enzyme/substrate ratio that would resemble a physiological situation (1:20 w/w, 172 units/mg) at pH values equal or above 2. The presence of PC did not change the susceptibility of OVA to proteolysis with pepsin. Fluorescence experiments showed that OVA interacted with PC vesicles, particularly at acidic pH, but it is likely that the protein maintained a high degree of conformational stability, resisting pepsin action. The presence of BS at physiological concentrations considerably increased the proteolysis of OVA by a mixture of pancreatic enzymes. The addition of PC made OVA even more sensitive to proteolytic degradation, suggesting that OVA could associate with the surfactants under duodenal conditions, increasing its exposure to pancreatic proteinases. Immunoreactivity against IgE from sera of allergic patients was retained after in vitro gastric digestion, depending on the reactivity of the sera, but it decreased considerably after in vitro duodenal digestion.

  19. Deformed Skull Morphology Is Caused by the Combined Effects of the Maldevelopment of Calvarias, Cranial Base and Brain in FGFR2-P253R Mice Mimicking Human Apert Syndrome

    PubMed Central

    Luo, Fengtao; Xie, Yangli; Xu, Wei; Huang, Junlan; Zhou, Siru; Wang, Zuqiang; Luo, Xiaoqing; Liu, Mi; Chen, Lin; Du, Xiaolan

    2017-01-01

    Apert syndrome (AS) is a common genetic syndrome in humans characterized with craniosynostosis. Apert patients and mouse models showed abnormalities in sutures, cranial base and brain, that may all be involved in the pathogenesis of skull malformation of Apert syndrome. To distinguish the differential roles of these components of head in the pathogenesis of the abnormal skull morphology of AS, we generated mouse strains specifically expressing mutant FGFR2 in chondrocytes, osteoblasts, and progenitor cells of central nervous system (CNS) by crossing Fgfr2+/P253R-Neo mice with Col2a1-Cre, Osteocalcin-Cre (OC-Cre), and Nestin-Cre mice, respectively. We then quantitatively analyzed the skull and brain morphology of these mutant mice by micro-CT and micro-MRI using Euclidean distance matrix analysis (EDMA). Skulls of Col2a1-Fgfr2+/P253R mice showed Apert syndrome-like dysmorphology, such as shortened skull dimensions along the rostrocaudal axis, shortened nasal bone, and evidently advanced ossification of cranial base synchondroses. The OC-Fgfr2+/P253R mice showed malformation in face at 8-week stage. Nestin-Fgfr2+/P253R mice exhibited increased dorsoventral height and rostrocaudal length on the caudal skull and brain at 8 weeks. Our study indicates that the abnormal skull morphology of AS is caused by the combined effects of the maldevelopment in calvarias, cranial base, and brain tissue. These findings further deepen our knowledge about the pathogenesis of the abnormal skull morphology of AS, and provide new clues for the further analyses of skull phenotypes and clinical management of AS. PMID:28123344

  20. Auditory-motor entrainment in vocal mimicking species

    PubMed Central

    2010-01-01

    We have recently found robust evidence of motor entrainment to auditory stimuli in multiple species of non-human animal, all of which were capable of vocal mimicry. In contrast, the ability remained markedly absent in many closely related species incapable of vocal mimicry. This suggests that vocal mimicry may be a necessary precondition for entrainment. However, within the vocal mimicking species, entrainment appeared non-randomly, suggesting that other components besides vocal mimicry play a role in the capacity and tendency to entrain. Here we discuss potential additional factors involved in entrainment. New survey data show that both male and female parrots are able to entrain, and that the entrainment capacity appears throughout the lifespan. We suggest routes for future study of entrainment, including both developmental studies in species known to entrain and further work to detect entrainment in species not well represented in our dataset. These studies may shed light on additional factors necessary for entrainment in addition to vocal mimicry. PMID:20714417

  1. Non-harmful insertion of data mimicking computer network attacks

    DOEpatents

    Neil, Joshua Charles; Kent, Alexander; Hash, Jr, Curtis Lee

    2016-06-21

    Non-harmful data mimicking computer network attacks may be inserted in a computer network. Anomalous real network connections may be generated between a plurality of computing systems in the network. Data mimicking an attack may also be generated. The generated data may be transmitted between the plurality of computing systems using the real network connections and measured to determine whether an attack is detected.

  2. Assessing Computational Methods of Cis-Regulatory Module Prediction

    PubMed Central

    Su, Jing; Teichmann, Sarah A.; Down, Thomas A.

    2010-01-01

    Computational methods attempting to identify instances of cis-regulatory modules (CRMs) in the genome face a challenging problem of searching for potentially interacting transcription factor binding sites while knowledge of the specific interactions involved remains limited. Without a comprehensive comparison of their performance, the reliability and accuracy of these tools remains unclear. Faced with a large number of different tools that address this problem, we summarized and categorized them based on search strategy and input data requirements. Twelve representative methods were chosen and applied to predict CRMs from the Drosophila CRM database REDfly, and across the human ENCODE regions. Our results show that the optimal choice of method varies depending on species and composition of the sequences in question. When discriminating CRMs from non-coding regions, those methods considering evolutionary conservation have a stronger predictive power than methods designed to be run on a single genome. Different CRM representations and search strategies rely on different CRM properties, and different methods can complement one another. For example, some favour homotypical clusters of binding sites, while others perform best on short CRMs. Furthermore, most methods appear to be sensitive to the composition and structure of the genome to which they are applied. We analyze the principal features that distinguish the methods that performed well, identify weaknesses leading to poor performance, and provide a guide for users. We also propose key considerations for the development and evaluation of future CRM-prediction methods. PMID:21152003

  3. High-resolution analysis of cis-acting regulatory networks at the α-globin locus.

    PubMed

    Hughes, Jim R; Lower, Karen M; Dunham, Ian; Taylor, Stephen; De Gobbi, Marco; Sloane-Stanley, Jacqueline A; McGowan, Simon; Ragoussis, Jiannis; Vernimmen, Douglas; Gibbons, Richard J; Higgs, Douglas R

    2013-01-01

    We have combined the circular chromosome conformation capture protocol with high-throughput, genome-wide sequence analysis to characterize the cis-acting regulatory network at a single locus. In contrast to methods which identify large interacting regions (10-1000 kb), the 4C approach provides a comprehensive, high-resolution analysis of a specific locus with the aim of defining, in detail, the cis-regulatory elements controlling a single gene or gene cluster. Using the human α-globin locus as a model, we detected all known local and long-range interactions with this gene cluster. In addition, we identified two interactions with genes located 300 kb (NME4) and 625 kb (FAM173a) from the α-globin cluster.

  4. Advances in research on cis-9, trans-11 conjugated linoleic acid: a major functional conjugated linoleic acid isomer.

    PubMed

    Wang, Tao; Lee, Hong Gu

    2015-01-01

    Conjugated linoleic acid (CLA) consists of a group of positional and geometric conjugated isomers of linoleic acid. Since the identification of CLA as a factor that can inhibit mutagenesis and carcinogenesis, thousands of studies have been conducted in the last several decades. Among the many isomers discovered, cis-9, trans-11 CLA is the most intensively studied because of its multiple, isomer-specific effects in humans and animals. This paper provides an overview of the available data on cis-9, trans-11 CLA, including its isomer-specific effects, biosynthesis, in vivo/in vitro research models, quantification, and the factors influencing its content in ruminant products.

  5. A videomicroscopic study of the effect of l-cis-diltiazem on the photobehavior of Stentor coeruleus.

    PubMed

    Walerczyk, Miroslawa; Fabczak, Hanna; Fabczak, Stanislaw

    2003-03-01

    The protozoan ciliate Stentor coeruleus displays a step-up photophobic response to an increase in light intensity in its environment. The motile response consists of a delayed stop of ciliary beating and transient ciliary reversal period. Such light-avoiding behavior was significantly influenced by an incubation of cells with l-cis-diltiazem, a common blocker of cyclic guanosine monophosphate (cGMP)-gated ion channel conductance. The introduction of l-cis-diltiazem to the medium induced ciliary reversal in control cells, mimicking the step-up photophobic response. In light-stimulated ciliates, the presence of this inhibitor caused a substantial decrease of the latency of ciliary stop response, prolongation of the ciliary reversal duration and also an increase of cell photoresponsiveness in a dose- and time-dependent manner. The obtained behavioral results support the suggestion that the photosensitive ciliate S. coeruleus possesses cGMP-gated channels, which may be involved in the process of light signal transduction for the motile photophobic response.

  6. The metabolism of cis- and trans-decalin

    PubMed Central

    Elliott, T. H.; Robertson, J. S.; Williams, R. T.

    1966-01-01

    1. The metabolism of cis- and trans-decalin in the rabbit has been investigated. 2. Both hydrocarbons were oxidized to racemic secondary alcohols and excreted as ether glucuronides in amounts equal to about 60% of the dose administered. The principal glucuronides were isolated as triacetyl methyl esters and as sodium salts. 3. cis-Decalin gave rise mainly to (±)-cis–cis-2-decalol, together with a little cis–trans-2-decalol, and trans-decalin mainly to (±)-trans–cis-2-decalol and a small amount of trans–trans-2-decalol. 4. These results suggest that biological oxidation of the decalins does not occur via a free-radical mechanism. An attempt is made to explain why racemic alcohols are obtained, rather than the more typical optically active products of enzymic reaction, and a mechanism is proposed. It is suggested that enzymes similar to steroid hydroxylases are involved. PMID:5968538

  7. Trans-cis molecular photoswitching in interstellar Space.

    PubMed

    Cuadrado, S; Goicoechea, J R; Roncero, O; Aguado, A; Tercero, B; Cernicharo, J

    2016-12-01

    As many organic molecules, formic acid (HCOOH) has two conformers (trans and cis). The energy barrier to internal conversion from trans to cis is much higher than the thermal energy available in molecular clouds. Thus, only the most stable conformer (trans) is expected to exist in detectable amounts. We report the first interstellar detection of cis-HCOOH. Its presence in ultraviolet (UV) irradiated gas exclusively (the Orion Bar photodissociation region), with a low trans-to-cis abundance ratio of 2.8 ± 1.0, supports a photoswitching mechanism: a given conformer absorbs a stellar photon that radiatively excites the molecule to electronic states above the interconversion barrier. Subsequent fluorescent decay leaves the molecule in a different conformer form. This mechanism, which we specifically study with ab initio quantum calculations, was not considered in Space before but likely induces structural changes of a variety of interstellar molecules submitted to UV radiation.

  8. Trans-cis molecular photoswitching in interstellar Space*

    PubMed Central

    Cuadrado, S.; Goicoechea, J. R.; Roncero, O.; Aguado, A.; Tercero, B.; Cernicharo, J.

    2016-01-01

    As many organic molecules, formic acid (HCOOH) has two conformers (trans and cis). The energy barrier to internal conversion from trans to cis is much higher than the thermal energy available in molecular clouds. Thus, only the most stable conformer (trans) is expected to exist in detectable amounts. We report the first interstellar detection of cis-HCOOH. Its presence in ultraviolet (UV) irradiated gas exclusively (the Orion Bar photodissociation region), with a low trans-to-cis abundance ratio of 2.8 ± 1.0, supports a photoswitching mechanism: a given conformer absorbs a stellar photon that radiatively excites the molecule to electronic states above the interconversion barrier. Subsequent fluorescent decay leaves the molecule in a different conformer form. This mechanism, which we specifically study with ab initio quantum calculations, was not considered in Space before but likely induces structural changes of a variety of interstellar molecules submitted to UV radiation. PMID:28003686

  9. New cis-clerodane diterpenoids from Croton schiedeanus.

    PubMed

    Puebla, Pilar; Correa, Sofía Ximena; Guerrero, Mario; Carron, Rosalía; San Feliciano, Arturo

    2005-03-01

    The acid fraction of extracts from the aerial part of Croton schiedeanus afforded six cis-clerodane type diterpenoids. Two of them (1 and 4) are new natural compounds. Structural elucidation was achieved on the basis of their spectral data.

  10. Workstation Designs for a Cis-Lunar Deep Space Habitat

    NASA Technical Reports Server (NTRS)

    Howe, A. Scott

    2014-01-01

    Using the International Standard Payload Rack (ISPR) system, a suite of workstations required for deep space missions have been proposed to fill out habitation functions in an International Space Station (ISS) derived Cis-lunar Deep Space Habitat. This paper introduces the functional layout of the Cis-lunar habitat design, and describes conceptual designs for modular deployable work surfaces, General Maintenance Workstation (GMWS), In-Space Manufacturing Workstation (ISMW), Intra-Vehicular Activity Telerobotics Work Station (IVA-TRWS), and Galley / Wardroom.

  11. Noncavernous arteriovenous shunts mimicking carotid cavernous fistulae

    PubMed Central

    Kobkitsuksakul, Chai; Jiarakongmun, Pakorn; Chanthanaphak, Ekachat; Singhara Na Ayudya, Sirintara (Pongpech)

    2016-01-01

    PURPOSE The classic symptoms and signs of carotid cavernous sinus fistula or cavernous sinus dural arteriovenous fistula (AVF) consist of eye redness, exophthalmos, and gaze abnormality. The angiography findings typically consist of arteriovenous shunt at cavernous sinus with ophthalmic venous drainage with or without cortical venous reflux. In rare circumstances, the shunts are localized outside the cavernous sinus, but mimic symptoms and radiography of the cavernous shunt. We would like to present the other locations of the arteriovenous shunt, which mimic the clinical presentation of carotid cavernous fistulae, and analyze venous drainages. METHODS We retrospectively examined the records of 350 patients who were given provisional diagnoses of carotid cavernous sinus fistulae or cavernous sinus dural AVF in the division of Interventional Neuroradiology, Ramathibodi Hospital, Bangkok between 2008 and 2014. Any patient with cavernous arteriovenous shunt was excluded. RESULTS Of those 350 patients, 10 patients (2.85%) were identified as having noncavernous sinus AVF. The angiographic diagnoses consisted of three anterior condylar (hypoglossal) dural AVF, two traumatic middle meningeal AVF, one lesser sphenoid wing dural AVF, one vertebro-vertebral fistula (VVF), one intraorbital AVF, one direct dural artery to cortical vein dural AVF, and one transverse-sigmoid dural AVF. Six cases (60%) were found to have venous efferent obstruction. CONCLUSION Arteriovenous shunts mimicking the cavernous AVF are rare, with a prevalence of only 2.85% in this series. The clinical presentation mainly depends on venous outflow. The venous outlet of the arteriovenous shunts is influenced by venous afferent-efferent patterns according to the venous anatomy of the central nervous system and the skull base, as well as by architectural disturbance, specifically, obstruction of the venous outflow. PMID:27767958

  12. Vpr Protein of Human Immunodeficiency Virus Type 1 Forms Cation-Selective Channels in Planar Lipid Bilayers

    NASA Astrophysics Data System (ADS)

    Piller, S. C.; Ewart, G. D.; Premkumar, A.; Cox, G. B.; Gage, P. W.

    1996-01-01

    A small (96-aa) protein, virus protein R (Vpr), of human immunodeficiency virus type 1 contains one hydrophobic segment that could form a membrane-spanning helix. Recombinant Vpr, expressed in Escherichia coli and purified by affinity chromatography, formed ion channels in planar lipid bilayers when it was added to the cis chamber and when the trans chamber was held at a negative potential. The channels were more permeable to Na+ than to Cl- ions and were inhibited when the trans potential was made positive. Similar channel activity was caused by Vpr that had a truncated C terminus, but the potential dependence of channel activity was no longer seen. Antibody raised to a peptide mimicking part of the C terminus of Vpr (AbC) inhibited channel activity when added to the trans chamber but had no effect when added to the cis chamber. Antibody to the N terminus of Vpr (AbN) increased channel activity when added to the cis chamber but had no effect when added to the trans chamber. The effects of potential and antibodies on channel activity are consistent with a model in which the positive C-terminal end of dipolar Vpr is induced to traverse the bilayer membrane when the opposite (trans) side of the membrane is at a negative potential. The C terminus of Vpr would then be available for interaction with AbC in the trans chamber, and the N terminus would be available for interaction with AbN in the cis chamber. The ability of Vpr to form ion channels in vitro suggests that channel formation by Vpr in vivo is possible and may be important in the life cycle of human immunodeficiency virus type 1 and/or may cause changes in cells that contribute to AIDS-related pathologies.

  13. The tomato cis-prenyltransferase gene family.

    PubMed

    Akhtar, Tariq A; Matsuba, Yuki; Schauvinhold, Ines; Yu, Geng; Lees, Hazel A; Klein, Samuel E; Pichersky, Eran

    2013-02-01

    cis-prenyltransferases (CPTs) are predicted to be involved in the synthesis of long-chain polyisoprenoids, all with five or more isoprene (C5) units. Recently, we identified a short-chain CPT, neryl diphosphate synthase (NDPS1), in tomato (Solanum lycopersicum). Here, we searched the tomato genome and identified and characterized its entire CPT gene family, which comprises seven members (SlCPT1-7, with NDPS1 designated as SlCPT1). Six of the SlCPT genes encode proteins with N-terminal targeting sequences, which, when fused to GFP, mediated GFP transport to the plastids of Arabidopsis protoplasts. The SlCPT3-GFP fusion protein was localized to the cytosol. Enzymatic characterization of recombinant SlCPT proteins demonstrated that SlCPT6 produces Z,Z-FPP, and SlCPT2 catalyzes the formation of nerylneryl diphosphate while SlCPT4, SlCPT5 and SlCPT7 synthesize longer-chain products (C25-C55). Although no in vitro activity was demonstrated for SlCPT3, its expression in the Saccharomyces cerevisiae dolichol biosynthesis mutant (rer2) complemented the temperature-sensitive growth defect. Transcripts of SlCPT2, SlCPT4, SlCPT5 and SlCPT7 are present at low levels in multiple tissues, SlCPT6 is exclusively expressed in red fruit and roots, and SlCPT1, SlCPT3 and SlCPT7 are highly expressed in trichomes. RNAi-mediated suppression of NDPS1 led to a large decrease in β-phellandrene (which is produced from neryl diphosphate), with greater reductions achieved with the general 35S promoter compared to the trichome-specific MKS1 promoter. Phylogenetic analysis revealed CPT gene families in both eudicots and monocots, and showed that all the short-chain CPT genes from tomato (SlCPT1, SlCPT2 and SlCPT6) are closely linked to terpene synthase gene clusters.

  14. Nozomi Cis-Lunar Phase Orbit Determination

    NASA Technical Reports Server (NTRS)

    Ryne, Mark; Criddle, Kevin

    2000-01-01

    Japan's Institute of Space and Astronautical Science (ISAS) launched Nozomi, its first mission to the planet Mars using the newly developed M-V launch vehicle on July 3, 1998. Scientific objectives of the mission are to study the structure and dynamics of the Martian upper atmosphere and its interaction with the solar wind. Nozomi is a cooperative mission between ISAS and the National Aeronautics and Space Administration (NASA). The NASA contribution includes navigation and tracking services provided by the Jet Propulsion Laboratory (JPL). The spacecraft also serves as an engineering demonstration of basic technology for planetary exploration. One of the new technologies was a unique trajectory, developed by ISAS, which used solar gravitational perturbations at the weak stability boundary as an aid to achieve an Earth-Mars transfer orbit. This trajectory saves approximately 120 m/s of Delta V compared to direct hyperbolic insertion and is considered an enabling technology for the mission. Nozomi was the first spacecraft to employ this trajectory and provided on-orbit validation of the technique. The trajectory was achieved by initially placing the spacecraft in a highly elliptical cis-lunar phasing orbit. Six maneuvers were performed during this period to correct injection errors and target an outbound lunar swingby in September 1998. The gravity assist from the lunar swingby raised apogee to the vicinity of the weak stability boundary. After three more targeting maneuvers, Nozomi performed an inbound lunar swingby followed immediately by a powered Earth swingby in late December 1998. A 420 m/s Trans Mars Insertion (TMI) burn at the final Earth periapsis was intended to place the spacecraft on a heliocentric trajectory leading to Mars orbit insertion in October 1999. Orbit determination for Nozomi is performed in parallel by both ISAS and the Multi-Mission Navigation (MMNAV) group at JPL. This was an advantage for the mission because each group would generate

  15. Restless legs syndrome mimicking S1 radiculopathy.

    PubMed

    Zambelis, Th; Wolgamuth, B R; Papoutsi, S N; Economou, N T

    2016-01-01

    mimicking several pathological conditions, Restless Legs Syndrome prevalence on general population according to various large epidemiological studies and pathogenic hypotheses on the issue of Restless Legs Syndrome are discussed. Finally, by presenting another possible "RLS-mimic" our aim is to highlight the common misdiagnosis of Restless Legs Syndrome, which can mimic a variety of disorders, some of which are very common, such as an S1 radiculopathy, thus raising concern among doctors of various specialties addressed to by Restless Legs Syndrome sufferers, on the importance of proper diagnosis of the syndrome.

  16. Glucose intolerance following cis-platinum treatment in rats.

    PubMed

    Goldstein, R S; Mayor, G H; Rosenbaum, R W; Hook, J B; Santiago, J V; Bond, J T

    1982-01-01

    cis-Dichlorodiammineplatinum (cis-Pt) is a heavy metal complex used in cancer chemotherapy. Since this drug has been shown to induce hyperglycemia in rats, these studies were initiated to elucidate the effects of cis-Pt on carbohydrate tolerance and insulin and glucagon secretion. Two days following i.v. cis-Pt (2.5 or 7.5 mg/kg, 5 ml/kg) or vehicle administration to male F-344 rats, plasma glucose, immunoreactive insulin (IRI) and glucagon (IRG) concentrations were determined in the basal state and serially following a glucose load (2 g/kg, i.p.). Since cis-Pt induces a dose-related anorexia, a pair-fed control group was also studied. Administration of 7.5 mg/kg cis-Pt was associated with plasma glucose concentrations 2.5-5 times greater than ad-libitum and pair-fed controls at every time point during the 2-h glucose tolerance test. Although basal plasma IRI concentrations of the 7.5-mg/kg group were comparable to ad-libitum fed controls, they were significantly greater than those of pair-fed partners. Furthermore, the appropriate IRI response to a glucose stimulus observed in both controls and the 2.5-mg/kg group was absent in the 7.5-mg/kg group. Basal plasma IRG concentrations of the 7.5-mg/kg group were approximately 3-4 times greater than ad-libitum and pair-fed controls and were not suppressed following a glucose load. These results suggest that cis-Pt induces marked glucose intolerance in association with an impaired IRI response and abnormal glucagon response to a glucose stimulus.

  17. The identification of cis-regulatory elements: A review from a machine learning perspective.

    PubMed

    Li, Yifeng; Chen, Chih-Yu; Kaye, Alice M; Wasserman, Wyeth W

    2015-12-01

    The majority of the human genome consists of non-coding regions that have been called junk DNA. However, recent studies have unveiled that these regions contain cis-regulatory elements, such as promoters, enhancers, silencers, insulators, etc. These regulatory elements can play crucial roles in controlling gene expressions in specific cell types, conditions, and developmental stages. Disruption to these regions could contribute to phenotype changes. Precisely identifying regulatory elements is key to deciphering the mechanisms underlying transcriptional regulation. Cis-regulatory events are complex processes that involve chromatin accessibility, transcription factor binding, DNA methylation, histone modifications, and the interactions between them. The development of next-generation sequencing techniques has allowed us to capture these genomic features in depth. Applied analysis of genome sequences for clinical genetics has increased the urgency for detecting these regions. However, the complexity of cis-regulatory events and the deluge of sequencing data require accurate and efficient computational approaches, in particular, machine learning techniques. In this review, we describe machine learning approaches for predicting transcription factor binding sites, enhancers, and promoters, primarily driven by next-generation sequencing data. Data sources are provided in order to facilitate testing of novel methods. The purpose of this review is to attract computational experts and data scientists to advance this field.

  18. Control of carotenoid biosynthesis through a heme-based cis-trans isomerase

    PubMed Central

    Beltrán, Jesús; Kloss, Brian; Hosler, Jonathan P.; Geng, Jiafeng; Liu, Aimin; Modi, Anuja; Dawson, John H.; Sono, Masanori; Shumskaya, Maria; Ampomah-Dwamena, Charles; Love, James D.; Wurtzel, Eleanore T.

    2015-01-01

    Plants synthesize carotenoids essential for plant development and survival. These metabolites also serve as essential nutrients for human health. The biosynthetic pathway leading to all plant carotenoids occurs in chloroplasts and other plastids and requires 15-cis-ζ-carotene isomerase (Z-ISO). It was not certain whether isomerization was achieved by Z-ISO alone or in combination with other enzymes. Here we show that Z-ISO is a bona fide enzyme and integral membrane protein. Z-ISO independently catalyzes the cis-to-trans isomerization of the 15–15′ C=C bond in 9,15,9′-cis-ζ-carotene to produce the substrate required by the following biosynthetic pathway enzyme. We discovered that isomerization depends upon a ferrous heme b cofactor that undergoes redox-regulated ligand-switching between the heme iron and alternate Z-ISO amino acid residues. Heme b-dependent isomerization of a large, hydrophobic compound in a membrane is unprecedented. As an isomerase, Z-ISO represents a new prototype for heme b proteins and potentially utilizes a novel chemical mechanism. PMID:26075523

  19. A Cis-Lunar Propellant Infrastructure for Flexible Path Exploration and Space Commerce

    NASA Technical Reports Server (NTRS)

    Oeftering, Richard C.

    2012-01-01

    This paper describes a space infrastructure concept that exploits lunar water for propellant production and delivers it to users in cis-lunar space. The goal is to provide responsive economical space transportation to destinations beyond low Earth orbit (LEO) and enable in-space commerce. This is a game changing concept that could fundamentally affect future space operations, provide greater access to space beyond LEO, and broaden participation in space exploration. The challenge is to minimize infrastructure development cost while achieving a low operational cost. This study discusses the evolutionary development of the infrastructure from a very modest robotic operation to one that is capable of supporting human operations. The cis-lunar infrastructure involves a mix of technologies including cryogenic propellant production, reusable lunar landers, propellant tankers, orbital transfer vehicles, aerobraking technologies, and electric propulsion. This cislunar propellant infrastructure replaces Earth-launched propellants for missions beyond LEO. It enables users to reach destinations with smaller launchers or effectively multiplies the user s existing payload capacity. Users can exploit the expanded capacity to launch logistics material that can then be traded with the infrastructure for propellants. This mutually beneficial trade between the cis-lunar infrastructure and propellant users forms the basis of in-space commerce.

  20. Evaluating cis-2,6-dimethylpiperidide (cis-DMP) as a base component in lithium-mediated zincation chemistry.

    PubMed

    Armstrong, David R; Garden, Jennifer A; Kennedy, Alan R; Leenhouts, Sarah M; Mulvey, Robert E; O'Keefe, Philip; O'Hara, Charles T; Steven, Alan

    2013-09-27

    Most recent advances in metallation chemistry have centred on the bulky secondary amide 2,2,6,6-tetramethylpiperidide (TMP) within mixed metal, often ate, compositions. However, the precursor amine TMP(H) is rather expensive so a cheaper substitute would be welcome. Thus this study was aimed towards developing cheaper non-TMP based mixed-metal bases and, as cis-2,6-dimethylpiperidide (cis-DMP) was chosen as the alternative amide, developing cis-DMP zincate chemistry which has received meagre attention compared to that of its methyl-rich counterpart TMP. A new lithium diethylzincate, [(TMEDA)LiZn(cis-DMP)Et2] (TMEDA=N,N,N',N'-tetramethylethylenediamine) has been synthesised by co-complexation of Li(cis-DMP), Et2Zn and TMEDA, and characterised by NMR (including DOSY) spectroscopy and X-ray crystallography, which revealed a dinuclear contact ion pair arrangement. By using N,N-diisopropylbenzamide as a test aromatic substrate, the deprotonative reactivity of [(TMEDA)LiZn(cis-DMP)Et2] has been probed and contrasted with that of the known but previously uninvestigated di-tert-butylzincate, [(TMEDA)LiZn(cis-DMP)tBu2]. The former was found to be the superior base (for example, producing the ortho-deuteriated product in respective yields of 78% and 48% following D2O quenching of zincated benzamide intermediates). An 88% yield of 2-iodo-N,N-diisopropylbenzamide was obtained on reaction of two equivalents of the diethylzincate with the benzamide followed by iodination. Comparisons are also drawn using 1,1,1,3,3,3-hexamethyldisilazide (HMDS), diisopropylamide and TMP as the amide component in the lithium amide, Et2Zn and TMEDA system. Under certain conditions, the cis-DMP base system was found to give improved results in comparison to HMDS and diisopropylamide (DA), and comparable results to a TMP system. Two novel complexes isolated from reactions of the di-tert-butylzincate and crystallographically characterised, namely the pre-metallation complex [{(iPr)2N(Ph)C=O}LiZn(cis

  1. Evaluating cis-2,6-Dimethylpiperidide (cis-DMP) as a Base Component in Lithium-Mediated Zincation Chemistry

    PubMed Central

    Armstrong, David R; Garden, Jennifer A; Kennedy, Alan R; Leenhouts, Sarah M; Mulvey, Robert E; O'Keefe, Philip; O'Hara, Charles T; Steven, Alan

    2013-01-01

    Most recent advances in metallation chemistry have centred on the bulky secondary amide 2,2,6,6-tetramethylpiperidide (TMP) within mixed metal, often ate, compositions. However, the precursor amine TMP(H) is rather expensive so a cheaper substitute would be welcome. Thus this study was aimed towards developing cheaper non-TMP based mixed-metal bases and, as cis-2,6-dimethylpiperidide (cis-DMP) was chosen as the alternative amide, developing cis-DMP zincate chemistry which has received meagre attention compared to that of its methyl-rich counterpart TMP. A new lithium diethylzincate, [(TMEDA)LiZn(cis-DMP)Et2] (TMEDA=N,N,N′,N′-tetramethylethylenediamine) has been synthesised by co-complexation of Li(cis-DMP), Et2Zn and TMEDA, and characterised by NMR (including DOSY) spectroscopy and X-ray crystallography, which revealed a dinuclear contact ion pair arrangement. By using N,N-diisopropylbenzamide as a test aromatic substrate, the deprotonative reactivity of [(TMEDA)LiZn(cis-DMP)Et2] has been probed and contrasted with that of the known but previously uninvestigated di-tert-butylzincate, [(TMEDA)LiZn(cis-DMP)tBu2]. The former was found to be the superior base (for example, producing the ortho-deuteriated product in respective yields of 78 % and 48 % following D2O quenching of zincated benzamide intermediates). An 88 % yield of 2-iodo-N,N-diisopropylbenzamide was obtained on reaction of two equivalents of the diethylzincate with the benzamide followed by iodination. Comparisons are also drawn using 1,1,1,3,3,3-hexamethyldisilazide (HMDS), diisopropylamide and TMP as the amide component in the lithium amide, Et2Zn and TMEDA system. Under certain conditions, the cis-DMP base system was found to give improved results in comparison to HMDS and diisopropylamide (DA), and comparable results to a TMP system. Two novel complexes isolated from reactions of the di-tert-butylzincate and crystallographically characterised, namely the pre-metallation complex [{(iPr)2N(Ph)C=O}LiZn(cis

  2. Time-dependent inhibition of peptidylprolyl cis-trans-isomerases by FK506 is probably due to cis-trans isomerization of the inhibitor's imide bond.

    PubMed Central

    Zarnt, T; Lang, K; Burtscher, H; Fischer, G

    1995-01-01

    Free in solution, the immunosuppressive compounds cyclosporin A (CsA), FK506, ascomycin and rapamycin are present in many solvents in various slowly interconverting conformations. Together with their cellular receptor proteins, cyclophilin (CyP) and FK506-binding protein (FKBP), however, these inhibitors have been shown to have a homogeneous conformation. The existence of a slow cis-trans interconversion of an imidic bond in the inhibitor molecule during the course of the formation of the CsA-CyP18cy complex (where CyP18cy is human 18 kDa cytosolic CyP) prompted us to investigate the reaction of the peptidomacrolides FK506, ascomycin and rapamycin with two specific binding-proteins in more detail. Since formation of the FK506-FKBP complex results in the inhibition of the peptidylprolyl cis-trans-isomerase activity of the binding protein, we used the enzyme's decrease in enzymic activity to monitor binding of the inhibitors to their enzyme targets. For FK506, the kinetics of inhibition of human 12 kDa cytosolic FKBP (FKBP12cy) were clearly dependent on time. Subsequent to a rapid inactivation reaction, not resolved in its kinetics due to manual mixing, a slow dominant first-order inactivation process with a relaxation time of 1163 s at 10 degrees C was observed. Concomitantly the Ki value of the slow phase dropped 2.6-fold within the first 60 min of incubation. Using the FKBP12cy homologue 25 kDa membrane FKBP (FKBP25mem), a bacterial peptidylprolyl cis-trans-isomerase, the rate and amplitudes of the inhibition reactions were very similar to FKBP12cy. On the other hand, the kinetics and amplitudes of the inhibition of FKBP12cy varied significantly if rapamycin was used as an inhibitor instead of FK 506. Owing to reduced conformation transition in rapamycin upon binding to FKBP12cy, the slow phase during inhibition was significantly decreased in amplitude. A likely reason for this became apparent when the activation-enthalpy and the pH-dependence of the rate

  3. Unusual reactivity of cytotoxic cis-dihydrazide Pt(II) complexes in aqueous solution.

    PubMed

    Kushev, Daniel; Grünert, Renate; Spassovska, Nadejda; Golovinsky, Evgeny; Bednarski, Patrick J

    2003-09-01

    Complexes of the general structure cis-[PtX(2)(hydrazide)(2)] and cis-[PtX(2)NH(3)(hydrazide)], where X=Cl(-), Br(-) and I(-), and hydrazide=cyclohexylcarboxylic acid hydrazide (chcah), cyclopentylcarboxylic acid hydrazide (cpcah), 3-aminocyclohexanspiro-5-hydantoin (achsh) and 3-aminocyclopentanspiro-5-hydantoin (acpsh), were investigated with respect to aqueous stability, DNA platination rates and cytotoxic activity on a panel of seven human cancer cell lines as well as a cisplatin-resistant cell line. Stabilities in aqueous solution, determined by RP-HPLC and UV-Vis methods, were highly dependent on the type of halide ligand, with stability decreasing in the order I(-)>Cl(-)>Br(-). Added chloride (100 mM) only stabilized the dichloro-Pt(II) complexes containing the hydrazide as part of a hydantoin ring (i.e., achsh). Platination of calf thymus DNA determined by AAS was most rapid with dichloro-Pt(II) complexes containing achsh ligand. The mixed-amine dichloro-Pt(II) complexes with either chcah or cpcah ligands also platinated DNA >80%, but at a slower rate, while dihydrazide dichloro-Pt(II) complexes with either chcah or cpcah ligands resulted in <25% DNA platination at 24 h. cis-[PtX(2)(hydrazide)(2)], where hydrazide=chcah or cpcah, were the most potent compounds (chcah>cpcah), but activity was independent of the halide ligand (I(-)=Cl(-)=Br(-)). These complexes showed no cross-resistance with cisplatin, but they also showed little differentiation in potency over the seven cell lines. Complexes with the hydantoin ligands achsh and acpsh were inactive in all cell lines. Thus, neither stability in aqueous media nor covalent binding to DNA are correlated with biological activity, suggesting that cis-dihydrazide Pt(II) complexes act by a unique mechanism of action.

  4. Cis-Lunar Reusable In-Space Transportation Architecture for the Evolvable Mars Campaign

    NASA Technical Reports Server (NTRS)

    McVay, Eric S.; Jones, Christopher A.; Merrill, Raymond G.

    2016-01-01

    Human exploration missions to Mars or other destinations in the solar system require large quantities of propellant to enable the transportation of required elements from Earth's sphere of influence to Mars. Current and proposed launch vehicles are incapable of launching all of the requisite mass on a single vehicle; hence, multiple launches and in-space aggregation are required to perform a Mars mission. This study examines the potential of reusable chemical propulsion stages based in cis-lunar space to meet the transportation objectives of the Evolvable Mars Campaign and identifies cis-lunar propellant supply requirements. These stages could be supplied with fuel and oxidizer delivered to cis-lunar space, either launched from Earth or other inner solar system sources such as the Moon or near Earth asteroids. The effects of uncertainty in the model parameters are evaluated through sensitivity analysis of key parameters including the liquid propellant combination, inert mass fraction of the vehicle, change in velocity margin, and change in payload masses. The outcomes of this research include a description of the transportation elements, the architecture that they enable, and an option for a campaign that meets the objectives of the Evolvable Mars Campaign. This provides a more complete understanding of the propellant requirements, as a function of time, that must be delivered to cis-lunar space. Over the selected sensitivity ranges for the current payload and schedule requirements of the 2016 point of departure of the Evolvable Mars Campaign destination systems, the resulting propellant delivery quantities are between 34 and 61 tonnes per year of hydrogen and oxygen propellant, or between 53 and 76 tonnes per year of methane and oxygen propellant, or between 74 and 92 tonnes per year of hypergolic propellant. These estimates can guide future propellant manufacture and/or delivery architectural analysis.

  5. Isolated neurosarcoidosis mimicking multifocal meningiomas: a diagnosis pitfall

    PubMed Central

    Wang, Kun; He, Xiaoying; Wang, Wei; Niu, Huanjiang; Wang, Yirong; Cai, Xiujun; Yang, Shuxu

    2016-01-01

    Abstract Introduction: Neurosarcoidosis accounts for approximately 5% of the sarcoidosis, which develops exclusively in the nervous system and is always difficult to diagnose. We describe a rare case of isolated neurosarcoidosis mimicking as multifocal meningiomas. A 27-year-old male was admitted to our hospital with a history of unconsciousness and convulsion 1 month ago, which was suspected as a seizure. The results showed no abnormalities in complete blood count; serum electrolytes; erythrocyte sedimentation rate and ultrasonography of the liver, pancreas, spleen, kidney and parotid gland, and so on. Chest radiograph and electroencephalogram were also normal. Serum-angiotensin-converting enzyme slightly increased. Normal opening pressure was shown in cerebrospinal fluid sampling, which includes 8/μL white blood cells, 0.93 g/L protein, and 3.03 mmol/L glucose. Enhanced magnetic resonance imaging revealed multifocal enhancement lesions, including left sphenoid wing region, left temporal and bilateral occipitoparietal region, which were suspected as multiple “meningioma”. A left frontotemporal craniotomy was further performed. Both necrotizing and non-necrotizing granulomas were revealed in the pathological specimen, most of which were associated with multinucleated giant cells and macrophages. We could also see the fibrosis and inflammatory reaction in the sample composed of lymphocytes, histiocytes, and plasma cells. Histopathological examination showed that the cells were positive for human CD68 (KP1), CD68 (PGM1), and CD163; however, they were negative for the AF, epithelial membrane antigen, and glial fibrillary acidic protein. Tuberculosis-deoxyribonucleic acid test and special stains for acid-fast bacilli and fungi were negative. The diagnosis was finally made as isolated neurosarcoidosis. Then the patient was treated with additional corticosteroid therapy. Serial imaging examination 4 months later revealed that the lesions extremely decreased

  6. DBMS UTILIZATION: A Corporate Information System (CIS) development approach

    NASA Technical Reports Server (NTRS)

    Rozett, P.

    1983-01-01

    The Corporate Information System (CIS), an integrated information system intended to tie the corporation together as a functioning entity, is described. In addition to being a major upgraded automated data processing system, the CIS is a management philosophy which recognizes data as a valuable corporate resource and which distinguishes between data and selected data, or information. It further recognizes that different users need different kinds of information. Plans for CIS development are discussed. It will offer its users not just after-the-fact data, but timely information in a format that is meaningful and useful to the particular user, so that the information can be applied in planning, controlling, and decision making by all levels of management. In effect, CIS will help the corporation itself to function as a total, integrated system by typing together administrative activities through information exchange. The CIS supports the operational, tactical control, and strategic planning functions of the corporation. Operational functions are the day-to-day processing necessary to support the corporation's work, such as purchasing and payroll.

  7. Cis-regulatory mechanisms governing stem and progenitor cell transitions

    PubMed Central

    Johnson, Kirby D.; Kong, Guangyao; Gao, Xin; Chang, Yuan-I; Hewitt, Kyle J.; Sanalkumar, Rajendran; Prathibha, Rajalekshmi; Ranheim, Erik A.; Dewey, Colin N.; Zhang, Jing; Bresnick, Emery H.

    2015-01-01

    Cis-element encyclopedias provide information on phenotypic diversity and disease mechanisms. Although cis-element polymorphisms and mutations are instructive, deciphering function remains challenging. Mutation of an intronic GATA motif (+9.5) in GATA2, encoding a master regulator of hematopoiesis, underlies an immunodeficiency associated with myelodysplastic syndrome (MDS) and acute myeloid leukemia (AML). Whereas an inversion relocalizes another GATA2 cis-element (−77) to the proto-oncogene EVI1, inducing EVI1 expression and AML, whether this reflects ectopic or physiological activity is unknown. We describe a mouse strain that decouples −77 function from proto-oncogene deregulation. The −77−/− mice exhibited a novel phenotypic constellation including late embryonic lethality and anemia. The −77 established a vital sector of the myeloid progenitor transcriptome, conferring multipotentiality. Unlike the +9.5−/− embryos, hematopoietic stem cell genesis was unaffected in −77−/− embryos. These results illustrate a paradigm in which cis-elements in a locus differentially control stem and progenitor cell transitions, and therefore the individual cis-element alterations cause unique and overlapping disease phenotypes. PMID:26601269

  8. Munchausen syndrome mimicking psychiatric disease with concomitant genuine physical illness

    PubMed Central

    Almeida, Jaime; da Silva, Joaquim Alves; Xavier, Miguel; Gusmão, Ricardo

    2010-01-01

    Munchausen syndrome is a disorder in which patients intentionally produce symptoms mimicking physical or psychiatric illnesses with the aim to assume the sick role and to gain medical attention. Once a patient receives a Munchausen syndrome diagnosis every complaint made thence tends to be regarded with scepticism by clinical staff. However, it is possible that a bona fide illness, which might be disregarded, may coexist in these patients. We report a case of MS mimicking psychiatric disease with concomitant genuine acute physical illness. Despite the initial doubts about the veracity of the latter, due to its prompt recognition, treatment was successful. PMID:22798096

  9. cisExpress: motif detection in DNA sequences

    PubMed Central

    Triska, Martin; Grocutt, David; Southern, James; Murphy, Denis J.; Tatarinova, Tatiana

    2013-01-01

    Motivation: One of the major challenges for contemporary bioinformatics is the analysis and accurate annotation of genomic datasets to enable extraction of useful information about the functional role of DNA sequences. This article describes a novel genome-wide statistical approach to the detection of specific DNA sequence motifs based on similarities between the promoters of similarly expressed genes. This new tool, cisExpress, is especially designed for use with large datasets, such as those generated by publicly accessible whole genome and transcriptome projects. cisExpress uses a task farming algorithm to exploit all available computational cores within a shared memory node. We demonstrate the robust nature and validity of the proposed method. It is applicable for use with a wide range of genomic databases for any species of interest. Availability: cisExpress is available at www.cisexpress.org. Contact: tatiana.tatarinova@usc.edu Supplementary information: Supplementary data are available at Bioinformatics online. PMID:23793750

  10. Mediation analysis demonstrates that trans-eQTLs are often explained by cis-mediation: a genome-wide analysis among 1,800 South Asians.

    PubMed

    Pierce, Brandon L; Tong, Lin; Chen, Lin S; Rahaman, Ronald; Argos, Maria; Jasmine, Farzana; Roy, Shantanu; Paul-Brutus, Rachelle; Westra, Harm-Jan; Franke, Lude; Esko, Tonu; Zaman, Rakibuz; Islam, Tariqul; Rahman, Mahfuzar; Baron, John A; Kibriya, Muhammad G; Ahsan, Habibul

    2014-12-01

    A large fraction of human genes are regulated by genetic variation near the transcribed sequence (cis-eQTL, expression quantitative trait locus), and many cis-eQTLs have implications for human disease. Less is known regarding the effects of genetic variation on expression of distant genes (trans-eQTLs) and their biological mechanisms. In this work, we use genome-wide data on SNPs and array-based expression measures from mononuclear cells obtained from a population-based cohort of 1,799 Bangladeshi individuals to characterize cis- and trans-eQTLs and determine if observed trans-eQTL associations are mediated by expression of transcripts in cis with the SNPs showing trans-association, using Sobel tests of mediation. We observed 434 independent trans-eQTL associations at a false-discovery rate of 0.05, and 189 of these trans-eQTLs were also cis-eQTLs (enrichment P<0.0001). Among these 189 trans-eQTL associations, 39 were significantly attenuated after adjusting for a cis-mediator based on Sobel P<10-5. We attempted to replicate 21 of these mediation signals in two European cohorts, and while only 7 trans-eQTL associations were present in one or both cohorts, 6 showed evidence of cis-mediation. Analyses of simulated data show that complete mediation will be observed as partial mediation in the presence of mediator measurement error or imperfect LD between measured and causal variants. Our data demonstrates that trans-associations can become significantly stronger or switch directions after adjusting for a potential mediator. Using simulated data, we demonstrate that this phenomenon is expected in the presence of strong cis-trans confounding and when the measured cis-transcript is correlated with the true (unmeasured) mediator. In conclusion, by applying mediation analysis to eQTL data, we show that a substantial fraction of observed trans-eQTL associations can be explained by cis-mediation. Future studies should focus on understanding the mechanisms underlying

  11. The role of cis-carotenoids in abscisic acid biosynthesis.

    PubMed

    Parry, A D; Babiano, M J; Horgan, R

    1990-08-01

    Evidence has been obtained which is consistent with 9'-cis-neoxanthin being a major precursor of abscisic acid (ABA) in higher plants. A mild, rapid procedure was developed for the extraction and analysis of carotenoids from a range of tissues. Once purified the carotenoids were identified from their light-absorbance properties, reactions with dilute acid, high-performance liquid chromatography Rts, mass spectra and the quasiequilibria resulting from iodine-catalysed or chlorophyllsensitised photoisomerisation. Two possible ABA precursors, 9'-cis-neoxanthin and 9-cis-violaxanthin, were identified in extracts of light-grown and etiolated leaves (of Lycopersicon esculentum, Phaseolus vulgaris, Vicia faba, Pisum sativum, Cicer arietinum, Zea mays, Nicotiana plumbaginifolia, Plantago lanceolata and Digitalis purpurea), and roots of light-grown and etiolated plants (Lycopersicon, Phaseolus and Zea). The 9,9'-di-cisisomer of violaxanthin was synthesised but its presence was not detected in any extracts. Levels of 9'-cis-neoxanthin and all-trans-violaxanthin were between 20- to 100-fold greater than those of ABA in light-grown leaves. The levels of 9-cis-violaxanthin were similar to those of ABA but unaffected by water stress. Etiolated Phaseolus leaves contained reduced amounts of carotenoids (15-20% compared with light-grown leaves) but retained the ability to synthesise large amounts of ABA. The amounts of ABA synthesised, measured as increases in ABA and its metabolites phaseic acid and dihydrophaseic acid, were closely matched by decreases in the levels of 9'-cis-neoxanthin and all-trans-violaxanthin. In etiolated seedlings grown on 50% D2O, deuterium incorporation into ABA was similar to that into the xanthophylls. Relative levels of carotenoids in roots and light-grown and etiolated leaves of the ABA-deficient mutants, notabilis, flacca and sitiens were the same as those found in wild-type tomato tissues.

  12. The (+)-cis- and (+)-trans-Olibanic Acids: Key Odorants of Frankincense.

    PubMed

    Cerutti-Delasalle, Céline; Mehiri, Mohamed; Cagliero, Cecilia; Rubiolo, Patrizia; Bicchi, Carlo; Meierhenrich, Uwe J; Baldovini, Nicolas

    2016-10-24

    Frankincense (olibanum) is one of the oldest aromatic materials used by humans, but the key molecular constituents contributing to its characteristic odor remained unknown. Reported herein is the discovery that (1S,2S)-(+)-trans- and (1S,2R)-(+)-cis-2-octylcyclopropyl-1-carboxylic acids are highly potent and substantive odorants occurring in ppm amounts in all of the frankincense samples analyzed, even those showing radically different volatile compositions. These cyclopropyl-derived acids provide the very characteristic old churchlike endnote of the frankincense odor.

  13. Mimicking Neurotransmitter Release in Chemical Synapses via Hysteresis Engineering in MoS2 Transistors.

    PubMed

    Arnold, Andrew J; Razavieh, Ali; Nasr, Joseph R; Schulman, Daniel S; Eichfeld, Chad M; Das, Saptarshi

    2017-03-28

    Neurotransmitter release in chemical synapses is fundamental to diverse brain functions such as motor action, learning, cognition, emotion, perception, and consciousness. Moreover, improper functioning or abnormal release of neurotransmitter is associated with numerous neurological disorders such as epilepsy, sclerosis, schizophrenia, Alzheimer's disease, and Parkinson's disease. We have utilized hysteresis engineering in a back-gated MoS2 field effect transistor (FET) in order to mimic such neurotransmitter release dynamics in chemical synapses. All three essential features, i.e., quantal, stochastic, and excitatory or inhibitory nature of neurotransmitter release, were accurately captured in our experimental demonstration. We also mimicked an important phenomenon called long-term potentiation (LTP), which forms the basis of human memory. Finally, we demonstrated how to engineer the LTP time by operating the MoS2 FET in different regimes. Our findings could provide a critical component toward the design of next-generation smart and intelligent human-like machines and human-machine interfaces.

  14. trans,cis,cis-bis(benzoato)dichlorido(cyclohexane-1R,2R-diamine)platinum(IV): a prodrug candidate for the treatment of oxaliplatin-refractory colorectal cancer.

    PubMed

    Gandin, Valentina; Marzano, Cristina; Pelosi, Giorgio; Ravera, Mauro; Gabano, Elisabetta; Osella, Domenico

    2014-06-01

    The gold standard for the treatment of metastatic colorectal cancer consists of combination chemotherapy. Over time, however, the development of chemoresistant tumor clones leads to relapse. It may be possible to overcome oxaliplatin chemoresistance in colorectal cancer cells by exploiting a complex obtained from the insertion of the cyclohexane-1R,2R-diamine carrier ligand (the same diamine present in oxaliplatin) into an octahedral Pt(IV) scaffold with high lipophilicity conferred by two benzoate axial ligands. Herein we report the synthesis, characterization (including X-ray structure), biological activity, and cellular accumulation of trans,cis,cis-bis(benzoato)dichlorido(cyclohexane-1R,2R-diamine)platinum(IV) complex in a panel of several human cancer cell lines, including a colon carcinoma cell line resistant to oxaliplatin. The compound under investigation shows the best performance in terms of in vitro anti-proliferative activity and ability to overcome chemoresistance, with respect to oxaliplatin and some other Pt(II) reference complexes. This result is likely related to the high lipophilicity shown by the title compound that favors its cellular accumulation by passive diffusion.

  15. In vitro antiprotozoal activity of (S)-cis-Verbenol against Leishmania spp. and Trypanosoma cruzi.

    PubMed

    Yaluff, Gloria; Vega, Celeste; Alvarenga, Nelson

    2017-04-01

    (S)-cis-Verbenol, a monoterpene frequently found as a component of essential oils, was assayed against Leishmania amazonensis, Leishmania infantum, Leishmania brasiliensis and against two strains of Trypanosoma cruzi. The cytotoxicity of the compound was also assayed against human fibroblast cells using a colorimetric method. Benznidazole was used as reference drug against T. cruzi and amphotericin B was used against Leishmania spp. The compound showed good activity against the trypanosomes, being more active against the CL Brenner strain, with an IC50 value of 8.3μg/mL. Against Leishmania, the IC50 values were between 2.1 and 3.8μg/mL. The compound showed no cytotoxicity against human fibroblasts at the concentrations assayed and was 100-500 times more toxic for the parasites than for the human cells, as indicated by the selectivity indexes. The results open interesting perspectives about the potential of (S)-cis-Verbenol and other individual components of essential oils for the treatment of these diseases.

  16. Deriving a blood-mimicking fluid for particle image velocimetry in Sylgard-184 vascular models.

    PubMed

    Yousif, Majid Y; Holdsworth, David W; Poepping, Tamie L

    2009-01-01

    A new blood-mimicking fluid (BMF) has been developed for particle image velocimetry (PIV), which enables flow studies in vascular models (phantoms). A major difficulty in PIV that affects measurement accuracy is the refraction and distortion of light passing through the interface between the model and the fluid, due to the difference in refractive index (n) between the two materials. The problem can be eliminated by using a fluid with a refractive index matching that of the model. Such fluids are not commonly available, especially for vascular research where the fluid should also have a viscosity similar to human blood. In this work, a blood-mimicking fluid, composed of water (47.38% by weight), glycerol (36.94% by weight) and sodium iodide salt (15.68% by weight), was developed for compatibility with our silicone (Sylgard 184; n = 1.414) phantoms. The fluid exhibits a dynamic viscosity of 4.31+/-0.03 cP which lies within the range of human blood viscosity (4.4+/-0.6 cP). Both refractive index and viscosity were attained at 22.2+/-0.2 degrees C, which is a feasible room temperature, thus eliminating the need for a temperature-control system. The fluid will be used to study hemodynamics in vascular flow models fabricated from Sylgard 184.

  17. Pre-university Chemistry Students in a Mimicked Scholarly Peer Review

    NASA Astrophysics Data System (ADS)

    van Rens, Lisette; Hermarij, Philip; Pilot, Albert; Beishuizen, Jos; Hofman, Herman; Wal, Marjolein

    2014-10-01

    Peer review is a significant component in scientific research. Introducing peer review into inquiry processes may be regarded as an aim to develop student understanding regarding quality in inquiries. This study examines student understanding in inquiry peer reviews among pre-university chemistry students, aged 16-17, when they enact a design of a mimicked scholarly peer review. This design is based on a model of a human activity system. Twenty-five different schools in Brazil, Germany, Poland and The Netherlands participated. The students (n = 880) conducted in small groups (n = 428) open inquiries on fermentation. All groups prepared an inquiry report for peer review. These reports were published on a website. Groups were randomly paired in an internet symposium, where they posted review comments to their peers. These responses were qualitatively analyzed on small groups' level of understanding regarding seven categories: inquiry question, hypothesis, management of control variables, accurate measurement, presenting results, reliability of results, discussion and conclusion. The mimicked scholarly review prompted a collective practice. Student understanding was significantly well on presenting results, discussion and conclusion, and significantly less on inquiry question and reliability of results. An enacted design, based on a model of a human activity system, created student understanding of quality in inquiries as well as an insight in a peer-reviewing practice. To what extent this model can be applied in a broader context of design research in science education needs further study.

  18. Cutaneous lymphoid hyperplasia mimicking cutaneous lymphoma in a hyperthyroid cat.

    PubMed

    Snead, Elisabeth; Kerr, Moira; Macdonald, Valerie

    2013-10-01

    A 12-year-old neutered male domestic shorthair cat presented for chronic, localized, swelling and crusting of the left upper lip, weight loss, sporadic vomiting, and focal alopecia between the scapulae was diagnosed with hyperthyroidism and regional eosinophilic lymphadenitis. Treatment with methimazole exacerbated an underlying hypersensitivity disorder leading to marked generalized lymphadenopathy that histologically mimicked lymphoma.

  19. Osteoid osteoma of the radial styloid mimicking de quervain tenosynovitis.

    PubMed

    Chloros, George D; Themistocleous, George S; Papagelopoulos, Panayiotis J; Khaldi, Lubna; Efstathopoulos, Dimitrios G; Soucacos, Panayotis N

    2007-10-01

    A very unusual location of osteoid osteoma arising in the radial styloid is presented, which strongly mimicked de Quervain tenosynovitis, thereby resulting in the patient undergoing an additional unnecessary operation and a substantial delay of more than 2 years in diagnosis.

  20. [Ectopic pancreas mimicking advanced gastric malignancy--case report].

    PubMed

    Zawada, Iwona; Lewosiuk, Agnieszka; Hnatyszyn, Krzysztof; Patalan, Michał; Woyke, Stanisław; Kostyrka, Roman; Marlicz, Krzysztof; Starzyńska, Teresa

    2012-04-01

    Ectopic pancreas is the most common type of ectopic tissue in gastrointestinal tract. It is typically asymptomatic, presenting as a small submucosal lesion in prepyloric region of stomach. The diagnosis is usually incidental, during gastroscopy. The patient with symptomatic heterotropic pancreas, mimicking gastric malignancy was described.

  1. Headache attributed to unruptured saccular aneurysm, mimicking hemicrania continua.

    PubMed

    Vikelis, Michail; Xifaras, Michail; Magoufis, Georgios; Gekas, Georgios; Mitsikostas, Dimos Dimitrios

    2005-06-01

    Unruptured cerebral arterial aneurysms most often remain asymptomatic, but they may cause headache or other symptoms or signs. We describe herewith a case of headache attributed to an unruptured internal carotid artery aneurysm, clearly mimicking the phenotype of hemicrania continua. Potential pathophysiological explanations and recommendations for recognition of similar cases are discussed.

  2. Organic diseases mimicking acral lick dermatitis in six dogs.

    PubMed

    Denerolle, Philippe; White, Stephen D; Taylor, Tara S; Vandenabeele, Sophie I J

    2007-01-01

    Acral lick dermatitis ("lick granuloma") in dogs is often thought to have a behavioral etiology. However, other diseases may cause lesions on the distal legs, mimicking acral lick dermatitis. In this report, six dogs were presented with acral lick dermatitis-like lesions from different underlying causes-namely lymphoma, an orthopedic pin, deep pyoderma, mast cell tumor, leishmaniasis, and (presumptive) sporotrichosis.

  3. Rectal diverticulitis mimicking rectal carcinoma with intestinal obstruction: case report.

    PubMed

    Özçelik, Ümit; Bircan, Hüseyin Yüce; Eren, Eryiğit; Demiralay, Ebru; Işıklar, İclal; Demirağ, Alp; Moray, Gökhan

    2015-01-01

    Although diverticular disease of the colon is common, the occurrence of rectal diverticula is extremely rare with only sporadic reports in the literature since 1911. Symptomatic rectal diverticula are seen even less frequently, and surgical intervention is needed for only complicated cases. Here we report the case of a 63-year-old woman presenting with rectal diverticulitis mimicking rectal carcinoma with intestinal obstruction.

  4. Trichophyton Schoenleinii-induced widespread tinea corporis mimicking parapsoriasis.

    PubMed

    Mansouri, P; Farshi, S; Khosravi, A R; Naraghi, Z S; Chalangari, R

    2012-06-01

    We report a case of extensive tinea corporis in an 80-year-old woman on her forearms, thighs, legs, buttocks and trunk, mimicking parapsoriasis due to Trichophyton schoenleinii, without scalp involvement. Diagnosis of Trichophyton schoenleinii was confirmed by microscopy and mycological culture specimens.

  5. Retroperitoneal bronchogenic cyst mimicking hydatid liver: a case report.

    PubMed

    Parray, Fazl Q; Sherwani, Afak Yusuf; Dangroo, Sajad Ahmad; Bisati, Rafia Aziz; Malik, Nighat Shaffi

    2012-01-01

    Bronchogenic cysts frequently occur in the mediastinum. They may be rarely encountered in the abdomen and retroperitoneum. Bronchogenic cysts can in fact mimic hydatid cysts. We report a case of retroperitoneal bronchogenic cyst below the right hemidiaphragm mimicking a hydatid cyst of the liver in a 30-year-old female.

  6. Retroperitoneal Bronchogenic Cyst Mimicking Hydatid Liver: A Case Report

    PubMed Central

    Parray, Fazl Q.; Sherwani, Afak Yusuf; Dangroo, Sajad Ahmad; Bisati, Rafia Aziz; Malik, Nighat Shaffi

    2012-01-01

    Bronchogenic cysts frequently occur in the mediastinum. They may be rarely encountered in the abdomen and retroperitoneum. Bronchogenic cysts can in fact mimic hydatid cysts. We report a case of retroperitoneal bronchogenic cyst below the right hemidiaphragm mimicking a hydatid cyst of the liver in a 30-year-old female. PMID:22606600

  7. Cutaneous lymphoid hyperplasia mimicking cutaneous lymphoma in a hyperthyroid cat

    PubMed Central

    Snead, Elisabeth; Kerr, Moira; MacDonald, Valerie

    2013-01-01

    A 12-year-old neutered male domestic shorthair cat presented for chronic, localized, swelling and crusting of the left upper lip, weight loss, sporadic vomiting, and focal alopecia between the scapulae was diagnosed with hyperthyroidism and regional eosinophilic lymphadenitis. Treatment with methimazole exacerbated an underlying hypersensitivity disorder leading to marked generalized lymphadenopathy that histologically mimicked lymphoma. PMID:24155419

  8. Bronchial Aneurysms Mimicking Aortic Aneurysms: Endovascular Treatment in Two Patients

    SciTech Connect

    Vernhet, Helene; Bousquet, Claudine; Jean, Betty; Lesnik, Alvian; Durand, Gerard; Giron, Jacques; Senac, Jean Paul

    1999-05-15

    Bronchial artery dilatation and aneurysm formation is a potential complication of local inflammation, especially in bronchiectasis. When the bronchial artery has an ectopic origin from the inferior segment of the aortic arch, aneurysms may mimick aortic aneurysms. Despite this particular location, endovascular treatment is possible. We report two such aneurysms that were successfully embolized with steel coils.

  9. Giant cell myocarditis mimicking idiopathic fascicular ventricular tachycardia.

    PubMed

    Weidenbach, Michael; Springer, Tina; Daehnert, Ingo; Klingel, Karin; Doll, Susanne; Janousek, Jan

    2008-02-01

    We report an adolescent with giant cell myocarditis (GCM) mimicking tachycardia-induced cardiomyopathy. His electrocardiogram (ECG) was typical for an incessant form of fascicular ventricular tachycardia. The patient rapidly deteriorated and required support using extracorporeal membrane oxygenation (ECMO). Biopsy revealed GCM with massive myocyte necrosis. He was successfully heart transplanted 6 days after admission.

  10. Diffuse Large B Cell Lymphoma Mimicking Granulomatosis with Polyangiitis

    PubMed Central

    Horowitz, Netanel; Ben-Itzhak, Ofer; Braun-Moscovici, Yolanda

    2016-01-01

    In a patient with systemic multiorgan disease with overlapping features, the differential diagnosis included infectious diseases, malignancies, and systemic autoimmune or inflammatory diseases. We present an unusual case of a young male with B cell lymphoma who presented with symptoms mimicking systemic vasculitis and review the existing literature. PMID:27293945

  11. Précis of implicit nationalism.

    PubMed

    Hassin, Ran R; Ferguson, Melissa J; Kardosh, Rasha; Porter, Shanette C; Carter, Travis J; Dudareva, Veronika

    2009-06-01

    While the study of nationalism has received much attention throughout the social sciences and humanities, the experimental investigation of it lags behind. In this paper we review recent advances in the examination of implicit nationalism. In the first set of experiments we survey, the Palestinian, Israeli, Italian, and Russian flags were primed (or not, in the control conditions) and their effects on political thought and behavior were tested. In the second set the American or the Israeli flag was primed (or not) and prejudice toward African-Americans or Palestinians (respectively) was examined. The results of all experiments suggest that the implicit activation of national cues has far-reaching implications on political thought and behavior as well as on attitudes toward minorities. Under the assumption that the image of national flags is associated in memory with national ideologies, these results suggest that national ideologies can be implicitly pursued in a way that significantly affects our thoughts and behaviors.

  12. Efficient direct ZnO/CIS solar cells

    SciTech Connect

    Olsen, L.C.; William Addis, F.; Lei, W.; Li, J.

    1996-01-01

    This paper describes investigations of CIS solar cells with ZnO window layers deposited by MOCVD. These studies have been conducted with graded absorber CIS substrates obtained from Siemens Solar. Cell fabrication involves surface preparation of the Siemens substrate, growth of 200 to 400 A of undoped ZnO by MOCVD, deposition of a highly conducting ZnO top contact layer and deposition of a Ni/Ag collector grid. MOCVD growth of ZnO is accomplished in a SPIRE 500XT reactor by reacting a zinc adduct and tetrahydrofuran. Processing development has been conducted by forming test cells on ZnO/CIS structures by depositing thin, transparent Al contacts 2.8 mm in diameter on top of the ZnO window layer to serve as contacts. Several cells have been completed with a total area efficiency {ge}11.0{percent}, with the best result being 11.3{percent}. The best active area efficiency is approximately 12{percent}. Other topics discussed include current-voltage characteristics of direct ZnO/CIS cells. {copyright} {ital 1996 American Institute of Physics.}

  13. Trans-cis molecular photoswitching in interstellar space

    NASA Astrophysics Data System (ADS)

    Cuadrado, S.; Goicoechea, J. R.; Roncero, O.; Aguado, A.; Tercero, B.; Cernicharo, J.

    2016-11-01

    As many organic molecules, formic acid (HCOOH) has two conformers (trans and cis). The energy barrier to internal conversion from trans to cis is much higher than the thermal energy available in molecular clouds. Thus, only the most stable conformer (trans) is expected to exist in detectable amounts. We report the first interstellar detection of cis-HCOOH. Its presence in ultraviolet (UV) irradiated gas exclusively (the Orion Bar photodissociation region), with a low trans-to-cis abundance ratio of 2.8 ± 1.0, supports a photoswitching mechanism: a given conformer absorbs a stellar photon that radiatively excites the molecule to electronic states above the interconversion barrier. Subsequent fluorescent decay leaves the molecule in a different conformer form. This mechanism, which we specifically study with ab initio quantum calculations, was not considered in Space before but likely induces structural changes of a variety of interstellar molecules submitted to UV radiation. This paper makes use of observations obtained with the IRAM-30 m telescope. IRAM is supported by INSU/CNRS (France), MPG (Germany), and IGN (Spain).

  14. Creating a Collaborative Learning Community in the CIS Sandbox

    ERIC Educational Resources Information Center

    Frydenberg, Mark

    2013-01-01

    Purpose: The purpose of this paper is to investigate the impact of transforming a traditional university computer lab to create a collaborative learning community known as the CIS Sandbox, by remodeling a physical space and supporting it with a virtual presence through the use of social media tools. The discussion applies Selander's "designs for…

  15. cis- and trans-Stilbenes: Chromatographic Separation and Photochemical Isomerization.

    ERIC Educational Resources Information Center

    Levine, Samuel G.; And Others

    1988-01-01

    Describes an experiment that is to be performed midway in the first semester of an undergraduate organic chemistry laboratory coinciding with the students' introduction to cis-trans isomerism in the study of alkenes. Discusses the apparatus, materials, experimental procedure, historical significance, and results. (CW)

  16. Epistatic Interactions in the Arabinose Cis-Regulatory Element.

    PubMed

    Lagator, Mato; Igler, Claudia; Moreno, Anaísa B; Guet, Călin C; Bollback, Jonathan P

    2016-03-01

    Changes in gene expression are an important mode of evolution; however, the proximate mechanism of these changes is poorly understood. In particular, little is known about the effects of mutations within cis binding sites for transcription factors, or the nature of epistatic interactions between these mutations. Here, we tested the effects of single and double mutants in two cis binding sites involved in the transcriptional regulation of the Escherichia coli araBAD operon, a component of arabinose metabolism, using a synthetic system. This system decouples transcriptional control from any posttranslational effects on fitness, allowing a precise estimate of the effect of single and double mutations, and hence epistasis, on gene expression. We found that epistatic interactions between mutations in the araBAD cis-regulatory element are common, and that the predominant form of epistasis is negative. The magnitude of the interactions depended on whether the mutations are located in the same or in different operator sites. Importantly, these epistatic interactions were dependent on the presence of arabinose, a native inducer of the araBAD operon in vivo, with some interactions changing in sign (e.g., from negative to positive) in its presence. This study thus reveals that mutations in even relatively simple cis-regulatory elements interact in complex ways such that selection on the level of gene expression in one environment might perturb regulation in the other environment in an unpredictable and uncorrelated manner.

  17. 7 CFR 272.10 - ADP/CIS Model Plan.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... Regulations of the Department of Agriculture (Continued) FOOD AND NUTRITION SERVICE, DEPARTMENT OF AGRICULTURE FOOD STAMP AND FOOD DISTRIBUTION PROGRAM REQUIREMENTS FOR PARTICIPATING STATE AGENCIES § 272.10 ADP/CIS... automate their food stamp program operations and computerize their systems for obtaining,...

  18. A cis-Regulatory Signature for Chordate Anterior Neuroectodermal Genes

    PubMed Central

    Christiaen, Lionel; Joly, Jean-Stéphane

    2010-01-01

    One of the striking findings of comparative developmental genetics was that expression patterns of core transcription factors are extraordinarily conserved in bilaterians. However, it remains unclear whether cis-regulatory elements of their target genes also exhibit common signatures associated with conserved embryonic fields. To address this question, we focused on genes that are active in the anterior neuroectoderm and non-neural ectoderm of the ascidian Ciona intestinalis. Following the dissection of a prototypic anterior placodal enhancer, we searched all genomic conserved non-coding elements for duplicated motifs around genes showing anterior neuroectodermal expression. Strikingly, we identified an over-represented pentamer motif corresponding to the binding site of the homeodomain protein OTX, which plays a pivotal role in the anterior development of all bilaterian species. Using an in vivo reporter gene assay, we observed that 10 of 23 candidate cis-regulatory elements containing duplicated OTX motifs are active in the anterior neuroectoderm, thus showing that this cis-regulatory signature is predictive of neuroectodermal enhancers. These results show that a common cis-regulatory signature corresponding to K50-Paired homeodomain transcription factors is found in non-coding sequences flanking anterior neuroectodermal genes in chordate embryos. Thus, field-specific selector genes impose architectural constraints in the form of combinations of short tags on their target enhancers. This could account for the strong evolutionary conservation of the regulatory elements controlling field-specific selector genes responsible for body plan formation. PMID:20419150

  19. Structural Brain Network Characteristics Can Differentiate CIS from Early RRMS

    PubMed Central

    Muthuraman, Muthuraman; Fleischer, Vinzenz; Kolber, Pierre; Luessi, Felix; Zipp, Frauke; Groppa, Sergiu

    2016-01-01

    Focal demyelinated lesions, diffuse white matter (WM) damage, and gray matter (GM) atrophy influence directly the disease progression in patients with multiple sclerosis. The aim of this study was to identify specific characteristics of GM and WM structural networks in subjects with clinically isolated syndrome (CIS) in comparison to patients with early relapsing-remitting multiple sclerosis (RRMS). Twenty patients with CIS, 33 with RRMS, and 40 healthy subjects were investigated using 3 T-MRI. Diffusion tensor imaging was applied, together with probabilistic tractography and fractional anisotropy (FA) maps for WM and cortical thickness correlation analysis for GM, to determine the structural connectivity patterns. A network topology analysis with the aid of graph theoretical approaches was used to characterize the network at different community levels (modularity, clustering coefficient, global, and local efficiencies). Finally, we applied support vector machines (SVM) to automatically discriminate the two groups. In comparison to CIS subjects, patients with RRMS were found to have increased modular connectivity and higher local clustering, highlighting increased local processing in both GM and WM. Both groups presented increased modularity and clustering coefficients in comparison to healthy controls. SVM algorithms achieved 97% accuracy using the clustering coefficient as classifier derived from GM and 65% using WM from probabilistic tractography and 67% from modularity of FA maps to differentiate between CIS and RRMS patients. We demonstrate a clear increase of modular and local connectivity in patients with early RRMS in comparison to CIS and healthy subjects. Based only on a single anatomic scan and without a priori information, we developed an automated and investigator-independent paradigm that can accurately discriminate between patients with these clinically similar disease entities, and could thus complement the current dissemination-in-time criteria for

  20. Cis-trans isomerization in the S1 state of acetylene: identification of cis-well vibrational levels.

    PubMed

    Merer, Anthony J; Steeves, Adam H; Baraban, Joshua H; Bechtel, Hans A; Field, Robert W

    2011-06-28

    A systematic analysis of the S(1)-trans (Ã(1)A(u)) state of acetylene, using IR-UV double resonance along with one-photon fluorescence excitation spectra, has allowed assignment of at least part of every single vibrational state or polyad up to a vibrational energy of 4200 cm(-1). Four observed vibrational levels remain unassigned, for which no place can be found in the level structure of the trans-well. The most prominent of these lies at 46 175 cm(-1). Its (13)C isotope shift, exceptionally long radiative lifetime, unexpected rotational selection rules, and lack of significant Zeeman effect, combined with the fact that no other singlet electronic states are expected at this energy, indicate that it is a vibrational level of the S(1)-cis isomer (Ã(1)A(2)). Guided by ab initio calculations [J. H. Baraban, A. R. Beck, A. H. Steeves, J. F. Stanton, and R. W. Field, J. Chem. Phys. 134, 244311 (2011)] of the cis-well vibrational frequencies, the vibrational assignments of these four levels can be established from their vibrational symmetries together with the (13)C isotope shift of the 46 175 cm(-1) level (assigned here as cis-3(1)6(1)). The S(1)-cis zero-point level is deduced to lie near 44 900 cm(-1), and the ν(6) vibrational frequency of the S(1)-cis well is found to be roughly 565 cm(-1); these values are in remarkably good agreement with the results of recent ab initio calculations. The 46 175 cm(-1) vibrational level is found to have a 3.9 cm(-1) staggering of its K-rotational structure as a result of quantum mechanical tunneling through the isomerization barrier. Such tunneling does not give rise to ammonia-type inversion doubling, because the cis and trans isomers are not equivalent; instead the odd-K rotational levels of a given vibrational level are systematically shifted relative to the even-K rotational levels, leading to a staggering of the K-structure. These various observations represent the first definite assignment of an isomer of

  1. Functionally conserved cis-regulatory elements of COL18A1 identified through zebrafish transgenesis.

    PubMed

    Kague, Erika; Bessling, Seneca L; Lee, Josephine; Hu, Gui; Passos-Bueno, Maria Rita; Fisher, Shannon

    2010-01-15

    Type XVIII collagen is a component of basement membranes, and expressed prominently in the eye, blood vessels, liver, and the central nervous system. Homozygous mutations in COL18A1 lead to Knobloch Syndrome, characterized by ocular defects and occipital encephalocele. However, relatively little has been described on the role of type XVIII collagen in development, and nothing is known about the regulation of its tissue-specific expression pattern. We have used zebrafish transgenesis to identify and characterize cis-regulatory sequences controlling expression of the human gene. Candidate enhancers were selected from non-coding sequence associated with COL18A1 based on sequence conservation among mammals. Although these displayed no overt conservation with orthologous zebrafish sequences, four regions nonetheless acted as tissue-specific transcriptional enhancers in the zebrafish embryo, and together recapitulated the major aspects of col18a1 expression. Additional post-hoc computational analysis on positive enhancer sequences revealed alignments between mammalian and teleost sequences, which we hypothesize predict the corresponding zebrafish enhancers; for one of these, we demonstrate functional overlap with the orthologous human enhancer sequence. Our results provide important insight into the biological function and regulation of COL18A1, and point to additional sequences that may contribute to complex diseases involving COL18A1. More generally, we show that combining functional data with targeted analyses for phylogenetic conservation can reveal conserved cis-regulatory elements in the large number of cases where computational alignment alone falls short.

  2. Fabrication of double layer optical tissue phantom by spin coating method: mimicking epidermal and dermal layer

    NASA Astrophysics Data System (ADS)

    Park, Jihoon; Bae, Yunjin; Bae, Youngwoo; Kang, Heesung; Lee, Kyoung-Joung; Jung, Byungjo

    2013-02-01

    Methodologies to fabricate a solid optical tissue phantom (OTP) mimicking epidermal thin-layer have been developed for in vitro human skin experiment. However, there are cumbersome and time-consuming efforts in fabrication process such as a custom-made casting and calculation of solvent volume before curing process. In a previous study, we introduced a new methodology based on spin coating method (SCM) which is utilized to fabricate a thin-layer OTP analogous to epidermal thickness. In this study, a double layer solid OTP which has epidermal and dermal layers was fabricated to mimic the morphological and optical similarity of human tissue. The structural characteristic and optical properties of fabricated double layer OTP were measured using optical coherence tomography and inverse adding doubling algorithms, respectively. It is expected that the new methodology based on the SCM may be usefully used in the fabrication of double layer OTP.

  3. Raloxifene protects against seizures and neurodegeneration in a mouse model mimicking epilepsy in postmenopausal woman.

    PubMed

    Pottoo, F H; Bhowmik, M; Vohora, D

    2014-12-18

    Epilepsy in menopausal women presents several challenges in the treatment including an increased risk of seizures due to hormone replacement therapy. We investigated the hypothesis if raloxifene, a selective oestrogen receptor modulator, could be employed to prevent behavioural seizures and morphological alterations in a mouse model mimicking epilepsy in postmenopausal women. Female mice were made ovotoxic by treatment with 4-vinylcyclohexene diepoxide (VCD) to mimic a postmenopausal state. They were then subjected to kainic acid (KA)-induced seizures and neurotoxicity, as assessed by microscopic examination of hippocampus, relevant to human temporal lobe epilepsy. VCD administration (for 15days followed by a drug-free period of 30days) induced ovotoxicity in mice as evidenced by reduced number of primary ovarian follicles. This was accompanied by a 62.4% reduction in serum oestradiol levels. The bone mineral density of ovotoxic mice, however, remained unaffected. Raloxifene (8mg/kg) reduced the seizure severity score in both normal and ovotoxic mice and protected against degeneration induced by KA in the CA3, CA1 sub-fields and hilus of the DG. Hippocampal TGF-β3 levels were not affected by any of the treatments. We show the potential protective role of raloxifene in preventing seizures and neuronal damage in a mouse model mimicking epilepsy in postmenopausal women which was found unrelated to hippocampal TGF-β3. Raloxifene might represent a novel therapeutic option for postmenopausal temporal lobe epileptic woman.

  4. Amitraz: a mimicker of organophosphate poisoning.

    PubMed

    Dhooria, Sahajal; Behera, Digambar; Agarwal, Ritesh

    2015-10-01

    Amitraz is used as an ectoparasiticide for dogs and cattle. Human poisoning due to amitraz may be misdiagnosed as organophosphate/carbamate (OPC) toxicity, since amitraz poisoning shares several clinical features (miosis, bradycardia and hypotension) encountered with OPC poisoning. A 19-year-old man with an alleged history of suicidal ingestion of a pesticide presented with drowsiness and was found to have constricted pupils, hypotension and bradycardia. He was diagnosed as a case of OPC poisoning and was treated with atropine and pralidoxime prior to presentation to our centre. Absence of a hypersecretory state, and the presence of hyperglycaemia and hypothermia along with a normal serum cholinesterase level suggested an alternate possibility. Retrieval of the poison container confirmed the diagnosis of amitraz poisoning. The patient made a rapid recovery with supportive management. Clinician awareness is key to successful management of this poisoning, which carries a good prognosis.

  5. Granuloma inguinale mimicking as squamous cell carcinoma of penis

    PubMed Central

    Pilani, Abhishek; Vora, Rita; Anjaneyan, Gopikrishnan

    2014-01-01

    Granuloma inguinale (GI) is an acquired chronic, slowly progressive, mildly contagious disease of venereal origin, characterized by granulomatous ulceration of the genitalia and neighboring sites, with little or no tendency to spontaneous healing caused by Klebsiella (Calymmatobacterium) granulomatis. A 55-year-old male presented with fissured, foul smelling, fungating growth over prepuce with phimosis mimicking squamous cell carcinoma (SCC) without lymphadenopathy. It started with painless papulonodular showed pseudoepitheliomatous hyperplasia, infiltration in dermis, acanthosis and vacuolated macrophages suggestive of GI and not showing any histopathological features of SCC. Patient was successfully treated by giving cotrimoxazole twice a day for 21 days. Here, we presented a case of GI mimicking SCC of penis, which was diagnosed on basis of histopathology and treated with excision followed by medical therapy with cotrimoxazole. PMID:24958990

  6. Rational Design of Pathogen-Mimicking Amphiphilic Materials as Nanoadjuvants

    NASA Astrophysics Data System (ADS)

    Ulery, Bret D.; Petersen, Latrisha K.; Phanse, Yashdeep; Kong, Chang Sun; Broderick, Scott R.; Kumar, Devender; Ramer-Tait, Amanda E.; Carrillo-Conde, Brenda; Rajan, Krishna; Wannemuehler, Michael J.; Bellaire, Bryan H.; Metzger, Dennis W.; Narasimhan, Balaji

    2011-12-01

    An opportunity exists today for cross-cutting research utilizing advances in materials science, immunology, microbial pathogenesis, and computational analysis to effectively design the next generation of adjuvants and vaccines. This study integrates these advances into a bottom-up approach for the molecular design of nanoadjuvants capable of mimicking the immune response induced by a natural infection but without the toxic side effects. Biodegradable amphiphilic polyanhydrides possess the unique ability to mimic pathogens and pathogen associated molecular patterns with respect to persisting within and activating immune cells, respectively. The molecular properties responsible for the pathogen-mimicking abilities of these materials have been identified. The value of using polyanhydride nanovaccines was demonstrated by the induction of long-lived protection against a lethal challenge of Yersinia pestis following a single administration ten months earlier. This approach has the tantalizing potential to catalyze the development of next generation vaccines against diseases caused by emerging and re-emerging pathogens.

  7. A patient with plaque type morphea mimicking systemic lupus erythematosus.

    PubMed

    Wardhana; Datau, E A

    2015-04-01

    Morphea is an uncommon connective tissue disease with the most prominent feature being thickening or fibrosis of the dermal without internal organ involvement. It is also known as a part of localized scleroderma. Based on clinical presentation and depth of tissue involvement, morphea is classified into several forms, and about two thirds of adults with morphea have plaque type. Overproduction of collagen production by fibroblast is the cause of abnormality in morphea, and the hyperactivity mechanism of fibroblast is still unknown, although there are several mechanisms already proposed. Plaque type morphea is actually a benign and self limited. Plaque type morphea that mimicking systemic lupus erythematosus in clinical appearance, such as alopecia and oral mucosal ulcers, is uncommon. A case of plaque type morphea mimicking systemic lupus erythematosus in a 20 year old woman was discussed. The patient was treated with local and systemic immunosuppressant and antioxydant. The patient's condition is improved without any significant side effects.

  8. Absorption of CIS Immigrants into Israeli Schools: A Semipermeable Enclave Model.

    ERIC Educational Resources Information Center

    Resnik, Julia; Sabar, Naama; Shoham, Edna; Shapira, Rina

    2001-01-01

    Examined how immigrants from the Commonwealth of Independent States (CIS) assimilated into Israeli society and schools. Data from observations, interviews, and surveys indicated that educational policies and school arrangements, and CIS immigrants' high self-esteem, produced a semipermeable enclave. CIS students acquired the Hebrew language and…

  9. Cis-Selective Ring-Opening Metathesis Polymerization with Ruthenium Catalysts

    PubMed Central

    Keitz, Benjamin K.; Fedorov, Alexey; Grubbs, Robert H.

    2012-01-01

    Using a C-H activated, ruthenium-based metathesis catalyst, the cis selective ROMP of several monocyclic alkenes, as well as norbornene and oxanorbornene-type monomers is reported. The cis content of the isolated polymers depended heavily on monomer structure and temperature. By lowering the temperature, cis content as high as 96% could be obtained. PMID:22239675

  10. Testicular Schistosomiasis Mimicking Malignancy in a Child: A Case Report.

    PubMed

    Ekenze, Sebastian O; Modekwe, Victor O; Nzegwu, Martin A; Ekpemo, Samuel C; Ezomike, Uchechukwu O

    2015-08-01

    Schistosomiasis is an important communicable disease in the developing world. However, testicular schistosomiasis is an extremely rare condition. We report a case of testicular schistosomiasis mimicking testicular tumour in a 13 year old who presented with huge unilateral testicular mass. The dilemma encountered in the diagnosis and treatment of this child is presented to highlight the need for high index of suspicion of this pathology in children with testicular mass presenting from schistosomiasis-endemic areas.

  11. Osteofibrous dysplasia of clavicle clinically mimicking chronic osteomyelitis

    PubMed Central

    Gopinathan, Nirmal Raj; Prakash, Mahesh; Saibaba, Balaji; Das, Ashim

    2016-01-01

    Osteofibrous dysplasia or ossifying fibroma is an uncommon benign fibro-osseous lesion of childhood, commonly described in the maxilla and the mandible. Among long bones, it usually presents in the tibia as a painless swelling or anterior bowing. Ossifying fibroma of clavicle has never been reported in English literature, to the best of our knowledge. Here, we would like to present an unusual case of osteofibrous dysplasia of clavicle clinically mimicking chronic osteomyelitis. PMID:27413281

  12. Cartilage Delamination Flap Mimicking a Torn Medial Meniscus

    PubMed Central

    Bin Abd Razak, Hamid Rahmatullah; Amit Kanta, Mitra

    2016-01-01

    We report a case of a chondral delamination lesion due to medial parapatellar plica friction syndrome involving the medial femoral condyle. This mimicked a torn medial meniscus in clinical and radiological presentation. Arthroscopy revealed a chondral delamination flap, which was debrided. Diagnosis of chondral lesions in the knee can be challenging. Clinical examination and MRI have good accuracy for diagnosis and should be used in tandem. Early diagnosis and treatment of chondral lesions are important to prevent progression to early osteoarthritis. PMID:28070434

  13. Mimicking biological functionality with polymers for biomedical applications

    NASA Astrophysics Data System (ADS)

    Green, Jordan J.; Elisseeff, Jennifer H.

    2016-12-01

    The vast opportunities for biomaterials design and functionality enabled by mimicking nature continue to stretch the limits of imagination. As both biological understanding and engineering capabilities develop, more sophisticated biomedical materials can be synthesized that have multifaceted chemical, biological and physical characteristics designed to achieve specific therapeutic goals. Mimicry is being used in the design of polymers for biomedical applications that are required locally in tissues, systemically throughout the body, and at the interface with tissues.

  14. Intracranial subdural empyema mimicking a recurrent chronic subdural hematoma

    PubMed Central

    Doan, Ninh; Patel, Mohit; Nguyen, Ha Son; Mountoure, Andrew; Shabani, Saman; Gelsomino, Michael; Janich, Karl; Kurpad, Shekar

    2016-01-01

    Intracranial subdural empyema (ISDE) is a life-threatening condition. The risk for ISDE increases in patients that have undergone prior intracranial procedures. The non-specificity in its clinical presentation often makes ISDE difficult to diagnose. Here, we present a rare case of ISDE mimicking a recurrent chronic subdural hematoma, emphasizing the significance of obtaining early magnetic resonance images of the brain for early diagnosis and treatment to achieve the optimal outcome. PMID:27651110

  15. Localized IgG4-related Cholecystitis Mimicking Gallbladder Cancer.

    PubMed

    Inoue, Tadahisa; Okumura, Fumihiro; Mizushima, Takashi; Nishie, Hirotada; Iwasaki, Hiroyasu; Anbe, Kaiki; Ozeki, Takanori; Kachi, Kenta; Fukusada, Shigeki; Suzuki, Yuta; Watanabe, Kazuko; Sano, Hitoshi

    2015-01-01

    We encountered a case of localized IgG4-cholecystitis mimicking gallbladder cancer with focal/segmental type1 autoimmune pancreatitis (AIP). In this case, we were unable to exclude a diagnosis of gallbladder cancer and thus performed radical cholecystectomy. Type1 AIP is often associated with gallbladder lesions, accompanied by generally diffuse, circumferential thickening of the gallbladder wall. Although localized IgG4-related cholecystitis is extremely rare, differentiating this condition from gallbladder cancer is often very difficult.

  16. A giant ancient schwannoma mimicking an adnexal mass

    PubMed Central

    Karaköse, Oktay; Pülat, Hüseyin; Oğuz, Serhat; Zihni, İsmail; Özçelik, Kazım Çağlar; Yalta, Tülin Deniz; Eken, Hüseyin

    2016-01-01

    Abstract Introduction: Ancient schwannoma is a rare tumor of the peripheral nerve sheath. As degenerative properties are defined histologically, it can be wrongly interpreted as malignant. Case presentation: The case presented here is of a giant ancient schwannoma with a pelvic retroperitoneal location, which was mimicking an adnexal mass. Conclusion: In the rarely seen cases in the retroperitoneum, it may reach very large dimensions. PMID:27472696

  17. Regional bone change in intramuscular haemangioma mimicking primary bone tumour.

    PubMed

    Shikhare, Sumer; Chacko, Julio K; Chuah, Khoon L

    2015-04-01

    Intramuscular haemangiomas are benign soft-tissue tumours, commonly located in the extremities. We present a right-leg intramuscular haemangioma with florid periosteal reaction in adjacent tibia, mimicking a primary bone tumour. Plain radiograph and magnetic resonance imaging features are illustrated with the surgical and histopathological findings. Radiologists need to be familiar with reactive bone changes secondary to deep-seated intramuscular haemangiomas to avoid potential misdiagnosis.

  18. Annotation of cis-regulatory elements by identification, subclassification, and functional assessment of multispecies conserved sequences

    PubMed Central

    Hughes, Jim R.; Cheng, Jan-Fang; Ventress, Nicki; Prabhakar, Shyam; Clark, Kevin; Anguita, Eduardo; De Gobbi, Marco; de Jong, Pieter; Rubin, Eddy; Higgs, Douglas R.

    2005-01-01

    An important step toward improving the annotation of the human genome is to identify cis-acting regulatory elements from primary DNA sequence. One approach is to compare sequences from multiple, divergent species. This approach distinguishes multispecies conserved sequences (MCS) in noncoding regions from more rapidly evolving neutral DNA. Here, we have analyzed a region of ≈238kb containing the human α globin cluster that was sequenced and/or annotated across the syntenic region in 22 species spanning 500 million years of evolution. Using a variety of bioinformatic approaches and correlating the results with many aspects of chromosome structure and function in this region, we were able to identify and evaluate the importance of 24 individual MCSs. This approach sensitively and accurately identified previously characterized regulatory elements but also discovered unidentified promoters, exons, splicing, and transcriptional regulatory elements. Together, these studies demonstrate an integrated approach by which to identify, subclassify, and predict the potential importance of MCSs. PMID:15998734

  19. Disruption of a long-range cis-acting regulator for Shh causes preaxial polydactyly.

    PubMed

    Lettice, Laura A; Horikoshi, Taizo; Heaney, Simon J H; van Baren, Marijke J; van der Linde, Herma C; Breedveld, Guido J; Joosse, Marijke; Akarsu, Nurten; Oostra, Ben A; Endo, Naoto; Shibata, Minoru; Suzuki, Mikio; Takahashi, Eiichi; Shinka, Toshikatsu; Nakahori, Yutaka; Ayusawa, Dai; Nakabayashi, Kazuhiko; Scherer, Stephen W; Heutink, Peter; Hill, Robert E; Noji, Sumihare

    2002-05-28

    Preaxial polydactyly (PPD) is a common limb malformation in human. A number of polydactylous mouse mutants indicate that misexpression of Shh is a common requirement for generating extra digits. Here we identify a translocation breakpoint in a PPD patient and a transgenic insertion site in the polydactylous mouse mutant sasquatch (Ssq). The genetic lesions in both lie within the same respective intron of the LMBR1/Lmbr1 gene, which resides approximately 1 Mb away from Shh. Genetic analysis of Ssq reveals that the Lmbr1 gene is incidental to the phenotype and that the mutation directly interrupts a cis-acting regulator of Shh. This regulator is most likely the target for generating PPD mutations in human.

  20. Disruption of a long-range cis-acting regulator for Shh causes preaxial polydactyly

    PubMed Central

    Lettice, Laura A.; Horikoshi, Taizo; Heaney, Simon J. H.; van Baren, Marijke J.; van der Linde, Herma C.; Breedveld, Guido J.; Joosse, Marijke; Akarsu, Nurten; Oostra, Ben A.; Endo, Naoto; Shibata, Minoru; Suzuki, Mikio; Takahashi, Eiichi; Shinka, Toshikatsu; Nakahori, Yutaka; Ayusawa, Dai; Nakabayashi, Kazuhiko; Scherer, Stephen W.; Heutink, Peter; Hill, Robert E.; Noji, Sumihare

    2002-01-01

    Preaxial polydactyly (PPD) is a common limb malformation in human. A number of polydactylous mouse mutants indicate that misexpression of Shh is a common requirement for generating extra digits. Here we identify a translocation breakpoint in a PPD patient and a transgenic insertion site in the polydactylous mouse mutant sasquatch (Ssq). The genetic lesions in both lie within the same respective intron of the LMBR1/Lmbr1 gene, which resides ≈1 Mb away from Shh. Genetic analysis of Ssq reveals that the Lmbr1 gene is incidental to the phenotype and that the mutation directly interrupts a cis-acting regulator of Shh. This regulator is most likely the target for generating PPD mutations in human. PMID:12032320

  1. Heparin-Mimicking Polymers: Synthesis and Biological Applications

    PubMed Central

    2016-01-01

    Heparin is a naturally occurring, highly sulfated polysaccharide that plays a critical role in a range of different biological processes. Therapeutically, it is mostly commonly used as an injectable solution as an anticoagulant for a variety of indications, although it has also been employed in other forms such as coatings on various biomedical devices. Due to the diverse functions of this polysaccharide in the body, including anticoagulation, tissue regeneration, anti-inflammation, and protein stabilization, and drawbacks of its use, analogous heparin-mimicking materials are also widely studied for therapeutic applications. This review focuses on one type of these materials, namely, synthetic heparin-mimicking polymers. Utilization of these polymers provides significant benefits compared to heparin, including enhancing therapeutic efficacy and reducing side effects as a result of fine-tuning heparin-binding motifs and other molecular characteristics. The major types of the various polymers are summarized, as well as their applications. Because development of a broader range of heparin-mimicking materials would further expand the impact of these polymers in the treatment of various diseases, future directions are also discussed. PMID:27739666

  2. Cluster Ion Spectrometry (CIS) Data Archiving in the CAA

    NASA Astrophysics Data System (ADS)

    Dandouras, I. S.; Barthe, A.; Penou, E.; Brunato, S.; Reme, H.; Kistler, L. M.; Blagau, A.; Facsko, G.; Kronberg, E.; Laakso, H. E.

    2009-12-01

    The Cluster Active Archive (CAA) aims at preserving the four Cluster spacecraft data, so that they are usable in the long-term by the scientific community as well as by the instrument team PIs and Co-Is. This implies that the data are filed together with the descriptive and documentary elements making it possible to select and interpret them. The CIS (Cluster Ion Spectrometry) experiment is a comprehensive ionic plasma spectrometry package onboard the four Cluster spacecraft, capable of obtaining full three-dimensional ion distributions (about 0 to 40 keV/e) with a time resolution of one spacecraft spin (4 sec) and with mass-per-charge composition determination. The CIS package consists of two different instruments, a Hot Ion Analyser (HIA) and a time-of-flight ion Composition Distribution Function (CODIF) analyser. For the archival of the CIS data a multi-level approach has been adopted. The CAA archival includes processed raw data (Level 1 data), moments of the ion distribution functions (Level 2 data), and calibrated high-resolution data in a variety of physical units (Level 3 data). The latter are 3-D ion distribution functions and 2-D pitch-angle distributions. In addition, a software package has been developed to allow the CAA user to interactively calculate partial or total moments of the ion distributions. Instrument cross-calibration has been an important activity in preparing the data for archival. The CIS data archive includes also experiment documentation, graphical products for browsing through the data, and data caveats. In addition, data quality indexes are under preparation, to help the user. Given the complexity of an ion spectrometer, and the variety of its operational modes, each one being optimised for a different magnetospheric region or measurement objective, consultation of the data caveats by the end user will always be a necessary step in the data analysis.

  3. Thermodynamic state ensemble models of cis-regulation.

    PubMed

    Sherman, Marc S; Cohen, Barak A

    2012-01-01

    A major goal in computational biology is to develop models that accurately predict a gene's expression from its surrounding regulatory DNA. Here we present one class of such models, thermodynamic state ensemble models. We describe the biochemical derivation of the thermodynamic framework in simple terms, and lay out the mathematical components that comprise each model. These components include (1) the possible states of a promoter, where a state is defined as a particular arrangement of transcription factors bound to a DNA promoter, (2) the binding constants that describe the affinity of the protein-protein and protein-DNA interactions that occur in each state, and (3) whether each state is capable of transcribing. Using these components, we demonstrate how to compute a cis-regulatory function that encodes the probability of a promoter being active. Our intention is to provide enough detail so that readers with little background in thermodynamics can compose their own cis-regulatory functions. To facilitate this goal, we also describe a matrix form of the model that can be easily coded in any programming language. This formalism has great flexibility, which we show by illustrating how phenomena such as competition between transcription factors and cooperativity are readily incorporated into these models. Using this framework, we also demonstrate that Michaelis-like functions, another class of cis-regulatory models, are a subset of the thermodynamic framework with specific assumptions. By recasting Michaelis-like functions as thermodynamic functions, we emphasize the relationship between these models and delineate the specific circumstances representable by each approach. Application of thermodynamic state ensemble models is likely to be an important tool in unraveling the physical basis of combinatorial cis-regulation and in generating formalisms that accurately predict gene expression from DNA sequence.

  4. Proton irradiation of the CIS115 for the JUICE mission

    NASA Astrophysics Data System (ADS)

    Soman, M. R.; Allanwood, E. A. H.; Holland, A. D.; Winstone, G. P.; Gow, J. P. D.; Stefanov, K.; Leese, M.

    2015-09-01

    The CIS115 is one of the latest CMOS Imaging Sensors designed by e2v technologies, with 1504x2000 pixels on a 7 μm pitch. Each pixel in the array is a pinned photodiode with a 4T architecture, achieving an average dark current of 22 electrons pixel-1 s-1 at 21°C measured in a front-faced device. The sensor aims for high optical sensitivity by utilising e2v's back-thinning and processing capabilities, providing a sensitive silicon thickness approximately 9 μm to 12 μm thick with a tuned anti-reflective coating. The sensor operates in a rolling shutter mode incorporating reset level subtraction resulting in a mean pixel readout noise of 4.25 electrons rms. The full well has been measured to be 34000 electrons in a previous study, resulting in a dynamic range of up to 8000. These performance characteristics have led to the CIS115 being chosen for JANUS, the high-resolution and wide-angle optical camera on the JUpiter ICy moon Explorer (JUICE). The three year science phase of JUICE is in the harsh radiation environment of the Jovian magnetosphere, primarily studying Jupiter and its icy moons. Analysis of the expected radiation environment and shielding levels from the spacecraft and instrument design predict the End Of Life (EOL) displacement and ionising damage for the CIS115 to be equivalent to 1010 10 MeV protons cm-2 and 100 krad(Si) respectively. Dark current and image lag characterisation results following initial proton irradiations are presented, detailing the initial phase of space qualification of the CIS115. Results are compared to the pre-irradiation performance and the instrument specifications and further qualification plans are outlined.

  5. History and Status of the CIS Customs Union

    SciTech Connect

    Lawson, T.M.; Erickson, S.A.

    1999-08-31

    This report explores the history of the CIS Customs Union and the major obstacles the Union faces in its implementation. Investigation of the Customs Union is necessary as its implementation could effect the Second Line of Defense (SLD) Program. Russian Customs contends that radiation detectors should not be installed along the Customs Union members borders of as the borders will be dissolved when the Union is implemented.

  6. City of Troitsk and Sooty Snow, Chelyabinsk, CIS

    NASA Technical Reports Server (NTRS)

    1992-01-01

    This view shows the industrial pollution around the Siberian city of Troitsk (54.0N, 61.0E). Troitsk is the smallest of a group of three heavy industrial cities east of the Urals, the others being Magnitogorsk and Chelyabinsk. All have been cited as being some of the worst industrial polluted cities in the CIS. Despite being the smallest of the three, Troitsk has the largest area of soot blackened snow. Respiratory diseases among the citizens are chronic.

  7. Cis and trans interactions between atlastin molecules during membrane fusion

    PubMed Central

    Liu, Tina Y.; Bian, Xin; Romano, Fabian B.; Shemesh, Tom; Rapoport, Tom A.; Hu, Junjie

    2015-01-01

    Atlastin (ATL), a membrane-anchored GTPase that mediates homotypic fusion of endoplasmic reticulum (ER) membranes, is required for formation of the tubular network of the peripheral ER. How exactly ATL mediates membrane fusion is only poorly understood. Here we show that fusion is preceded by the transient tethering of ATL-containing vesicles caused by the dimerization of ATL molecules in opposing membranes. Tethering requires GTP hydrolysis, not just GTP binding, because the two ATL molecules are pulled together most strongly in the transition state of GTP hydrolysis. Most tethering events are futile, so that multiple rounds of GTP hydrolysis are required for successful fusion. Supported lipid bilayer experiments show that ATL molecules sitting on the same (cis) membrane can also undergo nucleotide-dependent dimerization. These results suggest that GTP hydrolysis is required to dissociate cis dimers, generating a pool of ATL monomers that can dimerize with molecules on a different (trans) membrane. In addition, tethering and fusion require the cooperation of multiple ATL molecules in each membrane. We propose a comprehensive model for ATL-mediated fusion that takes into account futile tethering and competition between cis and trans interactions. PMID:25825753

  8. Cis-Active RNA Elements (CREs) and Picornavirus RNA Replication

    PubMed Central

    Steil, Benjamin P.; Barton, David J.

    2009-01-01

    Our understanding of picornavirus RNA replication has improved over the past 10 years, due in large part to the discovery of cis-active RNA elements (CREs) within picornavirus RNA genomes. CREs function as templates for the conversion of VPg, the Viral Protein of the genome, into VPgpUpUOH. These so called CREs are different from the previously recognized cis-active RNA sequences and structures within the 5′ and 3′ NTRs of picornavirus genomes. Two adenosine residues in the loop of the CRE RNA structures allow the viral RNA-dependent RNA polymerase 3DPol to add two uridine residues to the tyrosine residue of VPg. Because VPg and/or VPgpUpUOH prime the initiation of viral RNA replication, the asymmetric replication of viral RNA could not be explained without an understanding of the viral RNA template involved in the conversion of VPg into VPgpUpUOH primers. We review the growing body of knowledge regarding picornavirus CREs and discuss how CRE RNAs work coordinately with viral replication proteins and other cis-active RNAs in the 5′ and 3′ NTRs during RNA replication. PMID:18773930

  9. Polyphenols bearing cinnamaldehyde scaffold showing cell growth inhibitory effects on the cisplatin-resistant A2780/Cis ovarian cancer cells.

    PubMed

    Shin, Soon Young; Jung, Hyeryoung; Ahn, Seunghyun; Hwang, Doseok; Yoon, Hyuk; Hyun, Jiye; Yong, Yeonjoong; Cho, Hi Jae; Koh, Dongsoo; Lee, Young Han; Lim, Yoongho

    2014-03-15

    Ovarian carcinoma remains the most lethal among gynecological cancers. Chemoresistance is a clinical problem that severely limits treatment success. To identify potent anticancer agents against the cisplatin-resistant human ovarian cancer cell line A2780/Cis, 26 polyphenols bearing a cinnamaldehyde scaffold were synthesized. Structural differences in their inhibitory effect on clonogenicity of A2780/Cis cells were elucidated using comparative molecular field analysis and comparative molecular similarity indices analysis. Structural conditions required for increased inhibitory activity can be derived based on the analysis of their contour maps. The two most active compounds (16 and 19) were selected and further characterized their biological activities. We found that compounds 16 and 19 trigger cell cycle arrest at the G2/M phase and apoptotic cell death in cisplatin-resistant A2780/Cis human ovarian cancer cells. The molecular mechanism of compound 16 was elucidated using in vitro aurora A kinase assay, and the binding mode between the compound 16 and aurora A kinase was interpreted using in silico docking experiments. The findings obtained here may help us develop novel plant-derived polyphenols used for potent chemotherapeutic agents. In conclusion, compounds 16 and 19 could be used as promising lead compounds for the development of novel anticancer therapies in the treatment of cisplatin-resistant ovarian cancers.

  10. Separate cis-trans Pathways Post-transcriptionally Regulate Murine CD154 (CD40 Ligand) Expression

    PubMed Central

    Hamilton, B. JoNell; Wang, Xiao-Wei; Collins, Jane; Bloch, Donald; Bergeron, Alan; Henry, Brian; Terry, Benjamin M.; Zan, Moe; Mouland, Andrew J.; Rigby, William F. C.

    2008-01-01

    We report a role for CA repeats in the 3′-untranslated region (3′-UTR) in regulating CD154 expression. Human CD154 is encoded by an unstable mRNA; this instability is conferred in cis by a portion of its 3′-UTR that includes a polypyrimidine-rich region and CA dinucleotide repeat. We demonstrate similar instability activity with the murine CD154 3′-UTR. This instability element mapped solely to a conserved 100-base CU-rich region alone, which we call a CU-rich response element. Surprisingly, the CA dinucleotide-rich region also regulated reporter expression but at the level of translation. This activity was associated with poly(A) tail shortening and regulated by heterogeneous nuclear ribonucleoprotein L levels. We conclude that the CD154 3′-UTR contains dual cis-acting elements, one of which defines a novel function for exonic CA dinucleotide repeats. These findings suggest a mechanism for the association of 3′-UTR CA-rich response element polymorphisms with CD154 overexpression and the subsequent risk of autoimmune disease. PMID:18640985

  11. Cis-encoded non-coding antisense RNAs in streptococci and other low GC Gram (+) bacterial pathogens

    PubMed Central

    Cho, Kyu Hong; Kim, Jeong-Ho

    2015-01-01

    Due to recent advances of bioinformatics and high throughput sequencing technology, discovery of regulatory non-coding RNAs in bacteria has been increased to a great extent. Based on this bandwagon, many studies searching for trans-acting small non-coding RNAs in streptococci have been performed intensively, especially in the important human pathogen, group A and B streptococci. However, studies for cis-encoded non-coding antisense RNAs in streptococci have been scarce. A recent study shows antisense RNAs are involved in virulence gene regulation in group B streptococcus, S. agalactiae. This suggests antisense RNAs could have important roles in the pathogenesis of streptococcal pathogens. In this review, we describe recent discoveries of chromosomal cis-encoded antisense RNAs in streptococcal pathogens and other low GC Gram (+) bacteria to provide a guide for future studies. PMID:25859258

  12. PreCisIon: PREdiction of CIS-regulatory elements improved by gene’s positION

    PubMed Central

    Elati, Mohamed; Nicolle, Rémy; Junier, Ivan; Fernández, David; Fekih, Rim; Font, Julio; Képès, François

    2013-01-01

    Conventional approaches to predict transcriptional regulatory interactions usually rely on the definition of a shared motif sequence on the target genes of a transcription factor (TF). These efforts have been frustrated by the limited availability and accuracy of TF binding site motifs, usually represented as position-specific scoring matrices, which may match large numbers of sites and produce an unreliable list of target genes. To improve the prediction of binding sites, we propose to additionally use the unrelated knowledge of the genome layout. Indeed, it has been shown that co-regulated genes tend to be either neighbors or periodically spaced along the whole chromosome. This study demonstrates that respective gene positioning carries significant information. This novel type of information is combined with traditional sequence information by a machine learning algorithm called PreCisIon. To optimize this combination, PreCisIon builds a strong gene target classifier by adaptively combining weak classifiers based on either local binding sequence or global gene position. This strategy generically paves the way to the optimized incorporation of any future advances in gene target prediction based on local sequence, genome layout or on novel criteria. With the current state of the art, PreCisIon consistently improves methods based on sequence information only. This is shown by implementing a cross-validation analysis of the 20 major TFs from two phylogenetically remote model organisms. For Bacillus subtilis and Escherichia coli, respectively, PreCisIon achieves on average an area under the receiver operating characteristic curve of 70 and 60%, a sensitivity of 80 and 70% and a specificity of 60 and 56%. The newly predicted gene targets are demonstrated to be functionally consistent with previously known targets, as assessed by analysis of Gene Ontology enrichment or of the relevant literature and databases. PMID:23241390

  13. Proposed Pharmacological Countermeasures Against Apoptotic Cell Death in Experimental Models Mimicking Space Environment Damage

    NASA Astrophysics Data System (ADS)

    Lulli, Matteo; Papucci, Laura; Witort, Ewa; Donnini, Martino; Lapucci, Andrea; Lazzarano, Stefano; Mazzoni, Tiziano; Simoncini, Madine; Falciani, Piergiuseppe; Capaccioli, Sergio

    2008-06-01

    Several damaging agents have been suggested to affect human vision during long term space travels. Recently, apoptosis induced by DNA-damaging agents has emerged as frequent pathogenetic mechanism of ophthalmologic pathologies. Here, we propose two countermeasures: coenzyme Q10 and bcl-2 downregulation preventing antisense oligoribonucleotides (ORNs), aimed to inhibit cellular apoptotic death. Our studies have been carried out on retina and neuronal cultured cells treated with the following apoptotic stimuli mimicking space environment: a several-day exposure to either 3H-labeled tymidine or to the genotoxic drug doxorubicin, UV irradiation, hypoxia and glucose/growth factor starvation (Locke medium). The preliminary results clearly indicate that CoQ10, as well as bcl-2 down-regulation preventing ORNs, significantly counteract apoptosis in response to different DNA damaging agents in cultured eye and in neuronal cells. This supports the possibility that both could be optimal countermeasures against ophthalmologic lesions during space explorations.

  14. Estimation of thermal distribution in tissue-mimicking phantom made of carrageenan gel

    NASA Astrophysics Data System (ADS)

    Kim, Jungsoon; Jung, Jihee; Kim, Moojoon; Ha, Kanglyeol

    2015-07-01

    To probe the temperature elevation effect caused by ultrasound, the use of a tissue-mimicking phantom was newly suggested. Carrageenan gel was adopted to realize not only the required transparency for visualization but also the acoustic characteristics similar to those of human tissue. To visualize the temperature elevation effect inside the phantom, thermochromic film with a critical temperature of discoloration was introduced. From the visualized image, the temperature elevation due to planar and focused ultrasound in the phantom was obtained quantitatively. To verify the suggested method, the bioheat equation was solved numerically by the Fourier transform method. The theoretical results show good agreement with experimental ones regarding the temperature distribution while plane and focused ultrasound was irradiated into the phantom.

  15. Auditory-motor entrainment in vocal mimicking species: Additional ontogenetic and phylogenetic factors.

    PubMed

    Schachner, Adena

    2010-05-01

    We have recently found robust evidence of motor entrainment to auditory stimuli in multiple species of non-human animal, all of which were capable of vocal mimicry. In contrast, the ability remained markedly absent in many closely related species incapable of vocal mimicry. This suggests that vocal mimicry may be a necessary precondition for entrainment. However, within the vocal mimicking species, entrainment appeared non-randomly, suggesting that other components besides vocal mimicry play a role in the capacity and tendency to entrain. Here we discuss potential additional factors involved in entrainment. New survey data show that both male and female parrots are able to entrain, and that the entrainment capacity appears throughout the lifespan. We suggest routes for future study of entrainment, including both developmental studies in species known to entrain and further work to detect entrainment in species not well represented in our dataset. These studies may shed light on additional factors necessary for entrainment in addition to vocal mimicry.

  16. Effect of Body Structure on Skill Formation in a Force Precision Task Mimicking Cello Bowing Movement

    NASA Astrophysics Data System (ADS)

    Ogihara, Naomichi; Yamazaki, Nobutoshi

    To elucidate the skill formation mechanism in a complex force precision task mimicking cello bowing movements, three-dimensional joint orientations and changes in bowing force are measured for 2 novice and 2 expert subjects. A rigid link model of the human upper limb is constructed in order to calculate changes in joint moment, potential energy and structural inductivity of motion during bowing, and the motions are compared kinetically. Results show that the novices generate low-in-potential energy bowing motion, but not suitable for skillful control of the bow. In contrast, the experts can fulfill a task requirement by skillfully coordinating the musculo-skeletal system, but the motion is not easy as that of the novices. It is suggested that the transition from a novice to an expert may be difficult due to the ease in the initially generated motion, which obstructs the search for the optimal skillful motion.

  17. Self-assembling choline mimicks with enhanced binding affinities to C-LytA protein.

    PubMed

    Shi, Yang; Zhou, Hao; Zhang, Xiaoli; Wang, Jingyu; Long, Jiafu; Yang, Zhimou; Ding, Dan

    2014-10-15

    Streptococcus pneumoniae (pneumococcus) causes multiple illnesses in humans. Exploration of effective inhibitors with multivalent attachment sites for choline-binding modules is of great importance to reduce the pneumococcal virulence. In this work, we successfully developed two self-assembling choline mimicks, Ada-GFFYKKK' and Nap-GFFYKKK', which have the abilities to self-assemble into nanoparticles and nanofibers, respectively, yielding multivalent architectures. Additionally, the best characterized choline-binding module, C-terminal moiety of the pneumococcal cell-wall amidase LytA (C-LytA) was also produced with high purity. The self-assembling Ada-GFFYKKK' and Nap-GFFYKKK' show strong interactions with C-LytA, which possess much higher association constant values to the choline-binding modules as compared to the individual peptide Fmoc-K'. This study thus provides a self-assembly approach to yield inhibitors that are very promising for reducing the pneumococcal virulence.

  18. Detection of antibodies against synthetic peptides mimicking ureases fragments in sera of rheumatoid arthritis patients.

    PubMed

    Konieczna, Iwona; Kwinkowski, Marek; Kolesińska, Beata; Kamiński, Zbigniew; Zarnowiec, Paulina; Kaca, Wiesław

    2012-11-01

    Rheumatoid arthritis (RA) is a chronic disease with an autoimmunological background. RA is mostly characterized by systemic inflammation and injuries of synovial joints. There is a hypothesis that bacterial infections may be connected with development of the disease. It has been suggested that molecular mimicry between bacterial and human antigens may be one of possible mechanisms of RA development. One of potential antigens involved in this mechanism is urease - enzyme with high structural conservatism, occurring in pathogenic and commensal bacteria. We found that the level of antibodies against peptide mimicking urease "flap" region is significantly higher in sera from patients with rheumatoid arthritis in comparison with volunteer blood donor sera. We also observed that antibodies present in RA sera may bind not only specific peptide antigens but also peptides with a slightly different structure.

  19. High albumin levels restrict the kinetics of 13-cis retinoic acid uptake and intracellular isomerization to all-trans retinoic acid and inhibit its anti-proliferative effect on SZ95 sebocytes.

    PubMed

    Tsukada, Miki; Schröder, Mandy; Seltmann, Holger; Orfanos, Constantin E; Zouboulis, Christos C

    2002-07-01

    13-cis Retinoic acid is rapidly absorbed into cells and exerts its anti-proliferative effect on human sebocytes by specific isomerization to high levels of all-trans retinoic acid and binding the retinoic acid receptors. In this study, we have shown that bovine serum albumin, an extracellular binding protein for 13-cis retinoic acid, plays an important part in the uptake of 13-cis retinoic acid in human sebocytes, its intracellular isomerization to all-trans retinoic acid, and the induction of its anti-proliferative effect. The addition of highly concentrated bovine serum albumin (20 mg per ml) to the serum-free maintenance medium resulted in a rather controlled uptake of constant levels of 13-cis and all-trans retinoic acid into the cells over the 72 h of treatment. As a consequence, significantly reduced and delayed isomerization of 13-cis retinoic acid to all-trans retinoic acid was detected. In parallel experiments, the anti-proliferative activity of 13-cis retinoic acid on SZ95 sebocytes was abrogated by adding 20 mg bovine serum albumin per ml into the serum-free medium. These results indicate a critical function of serum albumin as retinoid-binding protein in reducing the concentration of active retinoids and restricting their biologic effects on human sebocytes.

  20. Enantioselective disruption of the endocrine system by Cis-Bifenthrin in the male mice.

    PubMed

    Jin, Yuanxiang; Wang, Jiangcong; Pan, Xiuhong; Miao, Wenyu; Lin, Xiaojian; Wang, Linggang; Fu, Zhengwei

    2015-07-01

    Bifenthrin (BF), as a chiral pyrethroid, is widely used to control field and household pests in China. At present, the commercial BF is a mixed compound containing cis isomers (cis-BF) including two enantiomers of 1R-cis-BF and 1S-cis-BF. In the present study, the two individual cis-BF enantiomers were separated by a preparative supercritical fluid chromatography. Then, four week-old adolescent male ICR mice were orally administered 1R-cis-BF and 1S-cis-BF separately daily for 3 weeks at doses of 0, 7.5 and 15 mg/kg/day, respectively. Results showed that the transcription status of some genes involved in cholesterol synthesis and transport as well as testosterone (T) synthesis in the testes were influenced by cis-BF enantiomers. Especially, we observed that the transcription status of key genes on the pathway of T synthesis including cytochrome P450 cholesterol side-chain cleavage enzyme (P450scc) and cytochrome P450 17α-hydroxysteroid dehydrogenase (P45017α)) were selectively altered in the testis of mice when treated with 1S-cis-BF, suggesting that it is the possible reason to explain why the lower serum T concentration in 1S-cis-BF treated group. Taken together, it concluded that both of the cis-BF enantiomers have the endocrine disruption activities, while 1S-cis-BF was higher than 1R-cis-BF in mice when exposed during the puberty. The data was helpful to understand the toxicity of cis-BF in mammals under enantiomeric level.

  1. Multimodal, 3D pathology-mimicking bladder phantom for evaluation of cystoscopic technologies (Conference Presentation)

    NASA Astrophysics Data System (ADS)

    Smith, Gennifer T.; Lurie, Kristen L.; Zlatev, Dimitar V.; Liao, Joseph C.; Ellerbee, Audrey K.

    2016-02-01

    Optical coherence tomography (OCT) and blue light cystoscopy (BLC) have shown significant potential as complementary technologies to traditional white light cystoscopy (WLC) for early bladder cancer detection. Three-dimensional (3D) organ-mimicking phantoms provide realistic imaging environments for testing new technology designs, the diagnostic potential of systems, and novel image processing algorithms prior to validation in real tissue. Importantly, the phantom should mimic features of healthy and diseased tissue as they appear under WLC, BLC, and OCT, which are sensitive to tissue color and structure, fluorescent contrast, and optical scattering of subsurface layers, respectively. We present a phantom posing the hollow shape of the bladder and fabricated using a combination of 3D-printing and spray-coating with Dragon Skin (DS) (Smooth-On Inc.), a highly elastic polymer to mimic the layered structure of the bladder. Optical scattering of DS was tuned by addition of titanium dioxide, resulting in scattering coefficients sufficient to cover the human bladder range (0.49 to 2.0 mm^-1). Mucosal vasculature and tissue coloration were mimicked with elastic cord and red dye, respectively. Urethral access was provided through a small hole excised from the base of the phantom. Inserted features of bladder pathology included altered tissue color (WLC), fluorescence emission (BLC), and variations in layered structure (OCT). The phantom surface and underlying material were assessed on the basis of elasticity, optical scattering, layer thicknesses, and qualitative image appearance. WLC, BLC, and OCT images of normal and cancerous features in the phantom qualitatively matched corresponding images from human bladders.

  2. Metal-organic frameworks from copper dimers with cis- and trans-1,4-cyclohexanedicarboxylate and cis,cis-1,3,5-cyclohexanetricarboxylate.

    PubMed

    Kumagai, Hitoshi; Akita-Tanaka, Motoko; Inoue, Katsuya; Takahashi, Kazuyuki; Kobayashi, Hayao; Vilminot, Serge; Kurmoo, Mohamedally

    2007-07-23

    Single crystals of three coordination networks containing the Cu(2)(COO)(4) core bridged by cyclohexane have been hydrothermally prepared by the reaction of 1,4-cyclohexanedicarboxylic (1,4-H(2)chdc) or 1,3,5-cyclohexanetricarboxylic (1,3,5-H(3)chtc) acid and Cu(NO(3))(2) x 6H(2)O. We report their characterizations by single-crystal X-ray structure determinations, IR spectroscopy, thermal analyses, and their magnetic properties. [Cu(2)(trans-1,4-chdc)(2)] (1) consists of 4 x 4 grids with the dimeric nodes connected by the trans-1,4-chdc, and these grids are then connected to each other by Cu-O bonds, resulting in a porous network (void volume of 130 Angstrom(3) per cell or 25%) with no solvent in its cavities. [Cu(2)(cis-1,4-chdc)(2)(H(2)O)(2)] (2) consists of two-legged ladders where the dimer nodes are bridged by pairs of cis-1,4-chdc and the water molecules cap the ends of the Cu dimers. [Cu(2)(1,3,5-Hchtc)(2)] (3) displays 4 x 4 grids, but each dimeric node is connected to its neighbors within the same grid by Cu-O bonds to form a layered network which further makes hydrogen-bond interactions with its neighbors. 2 and 3 have compact structures without any space for solvents. IR and DT-TGA confirm the absence of water in the empty channels of 1, while IR shows the presence of both protonated and deprotonated carboxyl groups for 3. The magnetic properties of all three compounds are dominated by the strong Cu-Cu antiferromagnetic interaction resulting in singlet-triplet gaps of 450-500 K.

  3. Various Tumor-Mimicking Lesions in the Musculoskeletal System: Causes and Diagnostic Approach

    PubMed Central

    Kim, Sue Yon; Ryu, Kyung Nam; Jin, Wook; Park, So Young

    2011-01-01

    Tumor-mimicking lesions in the musculoskeletal system can be defined as lesions mistaken as tumors due to the presence of palpation upon physical examination or a tumor-like appearance upon radiological examination. Moreover, tumor-mimicking lesions show diverse etiologies and anatomic locations. We illustrated the various tumor-mimicking lesions involving bone and soft tissue. In this review, the tumor-mimicking lesions were classified into those based on clinical examination and those based on radiological examination in musculoskeletal radiology. Awareness of the various causes of tumor-mimicking lesions, correctly obtaining clinical information, and the proper selection of imaging modality are important for the differentiation of tumor-mimicking lesions from true neoplasms. PMID:21430940

  4. Alchornea cordifolia seed oil: A rich source of a new C20 epoxide, (+)cis-14,15-epoxy-cis-11-eicosenoic acid.

    PubMed

    Kleiman, R; Plattner, R D; Spencer, G F

    1977-07-01

    A C20 homolog of vernolic acid has been found at the 50% level inAlchornea cordifolia, Euphorbiaceae, seed oil. This new acid, (+)cis-14,15-epoxy-cis-11-eicosenoic (alchornoic) acid, was isolated by high-pressure liquid chromotography and characterized by mass spectrometry, nuclear magnetic resonance and infrared spectroscopy, optical rotary dispersion, and ozonolysis-gas-chromotography.

  5. 21 CFR 573.637 - Methyl esters of conjugated linoleic acid (cis-9, trans-11 and trans-10, cis-12-octadecadienoic...

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... contain not less than 35 percent of other fatty acid esters composed of oleic acid, palmitic acid, stearic... 21 Food and Drugs 6 2013-04-01 2013-04-01 false Methyl esters of conjugated linoleic acid (cis-9, trans-11 and trans-10, cis-12-octadecadienoic acids). 573.637 Section 573.637 Food and Drugs FOOD...

  6. Genomic approaches to finding cis-regulatory modules in animals

    PubMed Central

    Hardison, Ross C.; Taylor, James

    2012-01-01

    Differential gene expression is the fundamental mechanism underlying animal development and cell differentiation. However, it is a challenge to identify comprehensively and accurately the DNA sequences required to regulate gene expression, called cis-regulatory modules (CRMs). Three major features (singly or in combination) are used to predict CRMs: clusters of transcription-factor binding-site motifs, noncoding DNA under evolutionary constraint, and biochemical marks associated with CRMs, such as histone modifications and protein occupancy. The validation rates for predictions indicate that identifying diagnostic biochemical marks is the most reliable method, and understanding is enhanced by analysis of motifs and conservation patterns within those predicted CRMs. PMID:22705667

  7. cis-clerodane diterpenes from the liverwort Scapania ciliata.

    PubMed

    Liu, Na; Zhu, Rong-Xiu; Wang, Song; Zhang, Jiao-Zhen; Lin, Zhao-Min; Li, Rui-Juan; Lou, Hong-Xiang

    2013-09-01

    Chemical investigation of the Chinese liverwort Scapania ciliata led to the isolation of four new cis-clerodane lactones, named ciliatolides A-D (1-4, resp.), among which compound 1 was found to be a tetranorclerodanoid. Their structures were determined by extensive analysis of spectroscopic data, and, in the case of compound 1, together with a single-crystal X-ray diffraction analysis. The absolute configurations were established by analysis of the CD spectra and by quantum-chemical CD calculations. The cytotoxicities of compounds 1-4 were preliminarily tested against the PC3 and MCF-7 cell lines.

  8. Subcutaneous Phaeohyphomycosis Due to Pyrenochaeta romeroi Mimicking a Synovial Cyst

    PubMed Central

    Dinh, Aurélien; Levy, Bruno; Bouchand, Frédérique; Davido, Benjamin; Duran, Clara; Cristi, Marin; Felter, Adrien; Salomon, Jérôme; Ait Ammar, Nawel

    2016-01-01

    Opportunistic subcutaneous fungal infections are increasing nowadays due to the growing number of medical conditions causing immunosuppression, especially organ transplant. The incidence rate of subcutaneous phaeohyphomycosis is very low. Most studies found are case reports. They showed a wide variation of clinical presentations. Pyrenochaeta romeroi, a fungus from the Dematiaceae group is a saprophyte found in soil and plants and a possible causative agent of phaeohyphomycosis. We present a rare case of subcutaneous phaeohyphomycosis caused by P. romeroi mimicking a synovial cyst in a diabetic patient. PMID:27630637

  9. Hepatitis A infection mimicking adult onset Still's disease.

    PubMed

    Sridharan, S; Mossad, S; Hoffman, G

    2000-07-01

    Fever, rash, and arthritis may be components of the prodrome of viral hepatitis. In the absence of jaundice and abnormal liver function tests, this form of polyarthritis is easily confused with primary autoimmune diseases. Whereas the association of systemic illness with musculoskeletal symptoms and numerous viral infections is well known, such an association with hepatitis A has only been rarely reported. We describe a case of hepatitis A infection mimicking adult onset Still's disease, and review the pathogenesis and differential diagnosis of Still's disease and the extraarticular manifestations of hepatitis.

  10. A case of generalized ostraceous psoriasis mimicking dermatitis neglecta.

    PubMed

    Nascimento, Bianca Angelina Macêdo do; Carvalho, Alessandra Haber; Dias, Carolina Moraes; Lage, Thaiane Lima; Carneiro, Clívia Maria Oliveira; Bittencourt, Maraya de Jesus Semblano

    2015-01-01

    Lithium has been implicated in the exacerbation of pre-existing psoriasis, in the induction of psoriasis on previously uninvolved skin of psoriasis patients, and in the triggering of psoriasis for the first time in patients without a personal or family history. Lithium-induced psoriasis (and its resistance to treatment) is one of the major reasons for noncompliance in patients treated with lithium. We describe a male patient who developed generalized ostraceous psoriasis whose clinical appearance mimicked dermatitis neglecta, 10 months after starting therapy with lithium.

  11. Superficial Fibromatosis Mimicking Glomus Tumor of the Second Toe

    PubMed Central

    Jo, Hyang Jeong; Kim, Gang Deuk; Kim, Yeung Jin; Choi, Deok Hwa; Park, Jae In

    2015-01-01

    Various types of tumor can occur in the subungual space, including glomus tumors, subungual exostosis, hemangioma, epidermal cysts, and malignant tumors. While fibromatosis can occur at various sites throughout the body, it is very rarely seen in the toe. Here, we are the first to report a case of superficial fibromatosis mimicking a glomus tumor in the subungual space of the second toe. The presentation of this condition shows the possibility of encountering uncommon superficial fibromatosis in the distal phalanx of the toe, and suggests that superficial fibromatosis should be included in the differential diagnosis of a glomus tumor in the toe. PMID:26330970

  12. Simple bone cyst of mandible mimicking periapical cyst.

    PubMed

    Hs, Charan Babu; Rai, Bhagawan Das; Nair, Manju A; Astekar, Madhusudan S

    2012-05-29

    Simple bone cysts (SBC) are pseudocysts occurring less commonly in the maxillofacial region. The uncertain and unclear etiopathogenesis led to numerous synonyms to refer this particular cyst. These cysts are devoid of an epithelial lining and are usually empty or contain blood or straw-colored fluid. In jaws initially it mimics a periapical cyst and later can lead to cortical bone expansion warranting for radical approach, which is seldom required. SBC is predominantly diagnosed in first two decades of life. Here we report a case of solitary bone cyst mimicking a periapical cyst of a mandibular molar in a 37-year-old patient.

  13. Brucellosis mimicking Henoch-Schönlein purpura.

    PubMed

    Massasso, David; Gibson, Kathryn

    2007-06-04

    A young male immigrant from Syria with a vasculitic-appearing leg rash, asymmetrical polyarthritis, microscopic haematuria, and raised inflammatory markers was provisionally diagnosed with Henoch-Schönlein purpura. Skin biopsy showed leukocytoclastic vasculitis. Low-grade fevers persisted despite non-steroidal anti-inflammatory therapy, and Brucella sp. was subsequently grown from both blood and synovial fluid aspirates. Further tests gave positive results for B. abortus, and triple antibiotic therapy produced a rapid clinical response. Cutaneous vasculitis has rarely been described in brucellosis, and this is the first report in the English medical literature of brucellosis mimicking Henoch-Schönlein purpura.

  14. Iliacus pyomyositis mimicking septic arthritis of the hip joint.

    PubMed

    Chen W-S; Wan Y-L

    1996-01-01

    The iliacus muscle is closely associated with the psoas muscle, femoral nerve, hip joint, pelvic and intraabdominal structures; thus, its disorders may present as lower abdominal pain, hip pain, or femoral neuropathy. Iliacus pyomyositis, a primary bacterial infection of the skeletal muscle not secondary to a contiguous skin, bone, or soft-tissue infection, presenting as hip pain, femoral neuropathy, and sympathetic effusion of the hip joint in an 8-year-old boy mimicked septic arthritis of the hip joint. Computed tomography was helpful in delineating the accurate location of the lesion. Surgical drainage and appropriate antibiotic therapy led to complete resolution and full functional recovery.

  15. Klebsiella pneumoniae pharyngitis mimicking malignancy: a diagnostic dilemma.

    PubMed

    Yeh, C-F; Li, W-Y; Hsu, Y-B

    2014-12-01

    Acute pharyngitis is a common disease. However, acute pharyngitis caused by Klebsiella pneumoniae with a gross appearance mimicking hypopharyngeal malignancy has never previously been reported. We report the case of a 57-year-old man with a right hypopharyngeal tumor which was disclosed by fiberoptic laryngoscopy and computed tomography scan. However, both the frozen and final pathologies showed no evidence of malignant cells, and a bacterial culture revealed the growth of K. pneumoniae. The hypopharyngeal lesion completely regressed after 2 weeks of antibiotic treatment. Clinicians should perform biopsy along with tissue culture for tumor-like lesions because infectious agents can lead to lesions with malignancy-like appearance.

  16. Intimal Sarcoma of the Descending Aorta Mimicking Aortitis

    PubMed Central

    Pucci, Angela; De Martino, Andrea; Levantino, Maurizio; Berchiolli, Raffaella; Basolo, Fulvio; Bortolotti, Uberto

    2016-01-01

    We describe a 74-year-old male patient with an intimal sarcoma of the descending aorta mimicking aortitis. The patient presented with lower back pain, fever, and increased C-reactive protein, erythrocyte sedimentation rate, and immunoglobulin G4 (IgG4) serum levels, together with Staphylococcus epidermidis-positive blood cultures. These findings, together with evidence of a 49-mm pseudoaneurysm of the descending thoracic aorta, caused us to suspect aortitis. However, postoperative histology and immunohistochemistry demonstrated the presence of an intimal aortic sarcoma. At the 8-month follow-up, local recurrence of the neoplasm and lung metastases were noted. PMID:28097198

  17. Subarachnoid haemorrhage mimicking transient ST-segment elevation myocardial infarction.

    PubMed

    Lai, C-H; Juan, Y-H; Chang, S-L; Lee, W-L; How, C-K; Hsu, T-F

    2015-08-01

    Patients often present to the emergency department with loss of consciousness. The differential diagnosis of such condition may be difficult because of limited clinical information. The authors present a case of subarachnoid haemorrhage (SAH) with initial electrocardiographic (ECG) finding mimicking ST-segment elevation myocardial infarction (STEMI), which was confirmed to resolve in a follow-up study. Accurate and timely diagnosis of SAH-related ST-segment elevation was important, as the therapeutic strategy for SAH is completely different from that for STEMI. If the clinicians do not have other tools for diagnosis, the follow-up ECG may help us make a most possible diagnosis.

  18. Endometriosis after surgical menopause mimicking pelvic malignancy: surgeons' predicament.

    PubMed

    Bhat, Rani A; Teo, Melissa; Bhat, Akhil Krishnanand

    2014-05-01

    Prevalence of persistent endometriosis in women after menopause without any hormonal replacement therapy is very rare. This is a case of a woman with previous history of total hysterectomy and bilateral salpingo-oophorectomy for endometriosis who presented with hemoperitoneum, vaginal bleeding, pelvic mass, and pulmonary thromboembolism mimicking as rectovaginal septum carcinoma. This is the first case report with a unique mode of presentation wherein the patient presented with hemoperitoneum requiring emergency embolization of the vessel to stabilize the patient. She underwent en bloc resection of the tumor with high anterior resection of the rectum. Histopathology confirmed endometriosis.

  19. Endometriosis After Surgical Menopause Mimicking Pelvic Malignancy: Surgeons’ Predicament

    PubMed Central

    Bhat, Rani A.; Teo, Melissa; Bhat, Akhil Krishnanand

    2014-01-01

    Prevalence of persistent endometriosis in women after menopause without any hormonal replacement therapy is very rare. This is a case of a woman with previous history of total hysterectomy and bilateral salpingo-oophorectomy for endometriosis who presented with hemoperitoneum, vaginal bleeding, pelvic mass, and pulmonary thromboembolism mimicking as rectovaginal septum carcinoma. This is the first case report with a unique mode of presentation wherein the patient presented with hemoperitoneum requiring emergency embolization of the vessel to stabilize the patient. She underwent en bloc resection of the tumor with high anterior resection of the rectum. Histopathology confirmed endometriosis. PMID:24936277

  20. A case of generalized ostraceous psoriasis mimicking dermatitis neglecta*

    PubMed Central

    do Nascimento, Bianca Angelina Macêdo; Carvalho, Alessandra Haber; Dias, Carolina Moraes; Lage, Thaiane Lima; Carneiro, Clívia Maria Oliveira; Bittencourt, Maraya de Jesus Semblano

    2015-01-01

    Lithium has been implicated in the exacerbation of pre-existing psoriasis, in the induction of psoriasis on previously uninvolved skin of psoriasis patients, and in the triggering of psoriasis for the first time in patients without a personal or family history. Lithium-induced psoriasis (and its resistance to treatment) is one of the major reasons for noncompliance in patients treated with lithium. We describe a male patient who developed generalized ostraceous psoriasis whose clinical appearance mimicked dermatitis neglecta, 10 months after starting therapy with lithium. PMID:26312715

  1. Fundamental Study of Bone-Mimicking Phantom Using Apatite

    NASA Astrophysics Data System (ADS)

    Hirai, Takuya; Ohdaira, Etsuzo; Masuzawa, Nobuyoshi; Itoh, Katsuhiko; Matozaki, Takeshi

    2001-05-01

    Because of the success of the ultrasonic method for diagnosing osteoporosis, the challenge to obtain ultrasonic images of the inner part of bone has begun. Since ultrasonic imaging of the inner part of bone is very difficult, further research is necessary. The goal of this study is to develop a bone-mimicking phantom for use in the visualization of bone by ultrasound. The developed phantom using apatite and polyvinyl alcohol (PVA) as materials with consideration of the periosteum showed fairly good agreement with real bone.

  2. Subacute combined degeneration mimicking traumatic spinal cord injury.

    PubMed

    Paul, Ian; Reichard, R Ross

    2009-03-01

    Subacute combined degeneration (SCD) of the spinal cord is the most common neurologic manifestation of vitamin B12 (cobalamin) deficiency and is usually secondary to autoimmune gastritis, but may also be seen in malnutrition syndromes such as chronic alcoholism, strict vegetarianism, gastrectomy, and also in nitrous oxide abuse. Although traumatic spinal cord injury is routinely encountered in the medical examiner's office, medical causes of spinal cord abnormalities such as SCD should be considered in the appropriate clinical setting. We report a case of alcohol-associated SCD mimicking traumatic spinal cord injury.

  3. Giant submandibular gland duct sialolith mimicking an impacted canine tooth

    PubMed Central

    Bhullar, Ramandeep Singh; Dhawan, Amit; Bhullar, Kanwalpreet; Malhotra, Sonia

    2015-01-01

    Sialolithiasis is the most common disease affecting the salivary glands and accounts for 80% of salivary gland disorders. Chronic sialolithiasis promotes stone formation. Size of the salivary stones may range from 0.1 mm to 30 mm or be even bigger. Those salivary stones, the size of which exceeds 15 mm in any one dimension or 1 g in weight are classified as giant sialoliths. Giant sialoliths of the submandibular gland duct are rarely reported. Here, we report a case of a giant sialolith of the submandibular gland duct mimicking an impacted mandibular canine tooth on routine radiographic examination and its surgical management through an intraoral approach. PMID:26668461

  4. Tissue-Mimicking Materials Using Segmented Polyurethane Gel and Their Acoustic Properties

    NASA Astrophysics Data System (ADS)

    Yoshida, Tomoji; Tanaka, Kouhei; Kondo, Toshio; Yasukawa, Kazuhiro; Miyamoto, Nobuaki; Taniguchi, Masahiko; Shikinami, Yasuo

    2012-07-01

    Accurate testing of an instrument by phantoms requires a tissue-mimicking material that has the acoustic velocity and density defined in the International Electrotechnical Commission (IEC) standard, and furthermore the tissue-mimicking material must be stable over time. To achieve the tissue-mimicking materials with the desired acoustic velocity and density defined in the IEC standard, new materials have been developed. The form of tissue-mimicking materials reported comprised polystyrene and poly(methyl methacrylate) (PMMA) particles dispersed in segmented polyurethane gel. They were stable over a period of 40 days and the changes in weight and acoustic velocity did not exceed 0.5%.

  5. Neutrophil recruitment limited by high-affinity bent β2 integrin binding ligand in cis

    PubMed Central

    Fan, Zhichao; McArdle, Sara; Marki, Alex; Mikulski, Zbigniew; Gutierrez, Edgar; Engelhardt, Britta; Deutsch, Urban; Ginsberg, Mark; Groisman, Alex; Ley, Klaus

    2016-01-01

    Neutrophils are essential for innate immunity and inflammation and many neutrophil functions are β2 integrin-dependent. Integrins can extend (E+) and acquire a high-affinity conformation with an ‘open' headpiece (H+). The canonical switchblade model of integrin activation proposes that the E+ conformation precedes H+, and the two are believed to be structurally linked. Here we show, using high-resolution quantitative dynamic footprinting (qDF) microscopy combined with a homogenous conformation-reporter binding assay in a microfluidic device, that a substantial fraction of β2 integrins on human neutrophils acquire an unexpected E−H+ conformation. E−H+ β2 integrins bind intercellular adhesion molecules (ICAMs) in cis, which inhibits leukocyte adhesion in vitro and in vivo. This endogenous anti-inflammatory mechanism inhibits neutrophil aggregation, accumulation and inflammation. PMID:27578049

  6. Profiling of cis-Diol-containing Nucleosides and Ribosylated Metabolites by Boronate-affinity Organic-silica Hybrid Monolithic Capillary Liquid Chromatography/Mass Spectrometry

    PubMed Central

    Jiang, Han-Peng; Qi, Chu-Bo; Chu, Jie-Mei; Yuan, Bi-Feng; Feng, Yu-Qi

    2015-01-01

    RNA contains a large number of modified nucleosides. In the metabolic re-exchange of RNA, modified nucleosides cannot be recycled and are thus excreted from cells into biological fluids. Determination of endogenous modified nucleosides in biological fluids may serve as non-invasive cancers diagnostic methods. Here we prepared boronate-affinity organic-silica hybrid capillary monolithic column (BOHCMC) that exhibited excellent selectivity toward the cis-diol-containing compounds. We then used the prepared BOHCMC as the on-line solid-phase microextraction (SPME) column and developed an on-line SPME-LC-MS/MS method to comprehensively profile cis-diol-containing nucleosides and ribosylated metabolites in human urine. Forty-five cis-diol-containing nucleosides and ribosylated metabolites were successfully identified in human urine. And five ribose conjugates, for the first time, were identified existence in human urine in the current study. Furthermore, the relative quantification suggested 4 cis-diol-containing compounds (5′-deoxy-5′-methylthioadensine, N4-acetylcytidine, 1-ribosyl-N-propionylhistamine and N2,N2,7-trimethylguanosine) increased more than 1.5 folds in all the 3 types of examined cancers (lung cancer, colorectal cancer, and nasopharyngeal cancer) compared to healthy controls. The on-line SPME-LC-MS/MS method demonstrates a promising method for the comprehensive profiling of cis-diol-containing ribose conjugates in human urines, which provides an efficient strategy for the identification and discovery of biomarkers and may be used for the screening of cancers. PMID:25585609

  7. cis-Regulatory Circuits Regulating NEK6 Kinase Overexpression in Transformed B Cells Are Super-Enhancer Independent.

    PubMed

    Huang, Yue; Koues, Olivia I; Zhao, Jiang-Yang; Liu, Regina; Pyfrom, Sarah C; Payton, Jacqueline E; Oltz, Eugene M

    2017-03-21

    Alterations in distal regulatory elements that control gene expression underlie many diseases, including cancer. Epigenomic analyses of normal and diseased cells have produced correlative predictions for connections between dysregulated enhancers and target genes involved in pathogenesis. However, with few exceptions, these predicted cis-regulatory circuits remain untested. Here, we dissect cis-regulatory circuits that lead to overexpression of NEK6, a mitosis-associated kinase, in human B cell lymphoma. We find that only a minor subset of predicted enhancers is required for NEK6 expression. Indeed, an annotated super-enhancer is dispensable for NEK6 overexpression and for maintaining the architecture of a B cell-specific regulatory hub. A CTCF cluster serves as a chromatin and architectural boundary to block communication of the NEK6 regulatory hub with neighboring genes. Our findings emphasize that validation of predicted cis-regulatory circuits and super-enhancers is needed to prioritize transcriptional control elements as therapeutic targets.

  8. The Cis-regulatory Logic of the Mammalian Photoreceptor Transcriptional Network

    PubMed Central

    Hsiau, Timothy H.-C.; Diaconu, Claudiu; Myers, Connie A.; Lee, Jongwoo; Cepko, Constance L.; Corbo, Joseph C.

    2007-01-01

    The photoreceptor cells of the retina are subject to a greater number of genetic diseases than any other cell type in the human body. The majority of more than 120 cloned human blindness genes are highly expressed in photoreceptors. In order to establish an integrative framework in which to understand these diseases, we have undertaken an experimental and computational analysis of the network controlled by the mammalian photoreceptor transcription factors, Crx, Nrl, and Nr2e3. Using microarray and in situ hybridization datasets we have produced a model of this network which contains over 600 genes, including numerous retinal disease loci as well as previously uncharacterized photoreceptor transcription factors. To elucidate the connectivity of this network, we devised a computational algorithm to identify the photoreceptor-specific cis-regulatory elements (CREs) mediating the interactions between these transcription factors and their target genes. In vivo validation of our computational predictions resulted in the discovery of 19 novel photoreceptor-specific CREs near retinal disease genes. Examination of these CREs permitted the definition of a simple cis-regulatory grammar rule associated with high-level expression. To test the generality of this rule, we used an expanded form of it as a selection filter to evolve photoreceptor CREs from random DNA sequences in silico. When fused to fluorescent reporters, these evolved CREs drove strong, photoreceptor-specific expression in vivo. This study represents the first systematic identification and in vivo validation of CREs in a mammalian neuronal cell type and lays the groundwork for a systems biology of photoreceptor transcriptional regulation. PMID:17653270

  9. Novel cis-selective and non-epimerisable C3 hydroxy azapodophyllotoxins targeting microtubules in cancer cells

    PubMed Central

    Kandil, Sahar; Wymant, Jennifer M.; Kariuki, Benson M.; Jones, Arwyn T.; McGuigan, Christopher; Westwell, Andrew D.

    2016-01-01

    Podophyllotoxin (PT) and its clinically used analogues are known to be powerful antitumour agents. These compounds contain a trans fused strained γ-lactone system, a feature that correlates to the process of epimerisation, whereby the trans γ-lactone system of ring D opens and converts to the more thermodynamically stable cis epimer. Since these cis epimers are known to be either less active or lacking antitumour activity, epimerisation is an undesirable feature from a chemotherapeutic point of view. To circumvent this problem, considerable efforts have been reported, amongst which is the synthesis of azapodophyllotoxins where the stereocentres at C2 and C3 are removed in order to preclude epimerisation. Herein we report the identification of a novel C3 hydroxy, cis-selective γ-lactone configuration of ring C in the azapodophyllotoxin scaffold, through an efficient stereoselective multicomponent reaction (MCR) involving fluorinated and non-fluorinated aldehydes. This configuration releases the highly strained trans γ-lactone system in podophyllotoxin analogues into the more thermodynamically stable cis γ-lactone motif and yet retains significantly potent activity. These compounds were evaluated against the human cancer lines MCF-7 and 22Rv1 in vitro. Fourteen out of the seventeen tested compounds exhibited sub-micromolar activity with IC50 values in the range of 0.11–0.91 μM, which is comparable and in some cases better than the activity profile of etoposide in this assay. Interestingly, we obtained strong evidence from spectroscopic and X-ray data analyses that the previously reported structure of similar analogues is not accurate. Molecular modelling performed using the podophyllotoxin binding site on β tubulin revealed a novel binding mode of these analogues. Furthermore, sub-cellular study of our compounds using immunolabelling and confocal microscopy analyses showed strong microtubule disruptive activity, particularly in dividing cells. PMID

  10. Cis-Diammine(Pyridine)Chloroplatinum(II), a Monofunctional Platinum(II) Antitumor Agent: Uptake, Structure, Function, And Prospects

    SciTech Connect

    Lovejoy, K.S.; Todd, R.C.; Zhang, S.; McCormick, M.S.; D'Aquino, J.A.; Reardon, J.T.; Sancar, A.; Giacomini, K.M.; Lippard, S.J.

    2009-05-19

    We have identified unique chemical and biological properties of a cationic monofunctional platinum(II) complex, cis-diammine(pyridine)chloroplatinum(II), cis-[Pt(NH{sub 3}){sub 2}(py)Cl]{sup +} or cDPCP, a coordination compound previously identified to have significant anticancer activity in a mouse tumor model. This compound is an excellent substrate for organic cation transporters 1 and 2, also designated SLC22A1 and SLC22A2, respectively. These transporters are abundantly expressed in human colorectal cancers, where they mediate uptake of oxaliplatin, cis-[Pt(DACH)(oxalate)] (DACH = trans-R,R-1,2-diaminocyclohexane), an FDA-approved first-line therapy for colorectal cancer. Unlike oxaliplatin, however, cDPCP binds DNA monofunctionally, as revealed by an x-ray crystal structure of cis-{l_brace}Pt(NH{sub 3}){sub 2}(py){r_brace}{sup 2+} bound to the N7 atom of a single guanosine residue in a DNA dodecamer duplex. Although the quaternary structure resembles that of B-form DNA, there is a base-pair step to the 5{prime} side of the Pt adduct with abnormally large shift and slide values, features characteristic of cisplatin intrastrand cross-links. cDPCP effectively blocks transcription from DNA templates carrying adducts of the complex, unlike DNA lesions of other monofunctional platinum(II) compounds like {l_brace}Pt(dien){r_brace}{sup 2+}. cDPCP-DNA adducts are removed by the nucleotide excision repair apparatus, albeit much less efficiently than bifunctional platinum-DNA intrastrand cross-links. These exceptional characteristics indicate that cDPCP and related complexes merit consideration as therapeutic options for treating colorectal and other cancers bearing appropriate cation transporters.

  11. Latex Clearing Protein—an Oxygenase Cleaving Poly(cis-1,4-Isoprene) Rubber at the cis Double Bonds

    PubMed Central

    Hiessl, Sebastian; Böse, Dietrich; Oetermann, Sylvia; Eggers, Jessica; Pietruszka, Jörg

    2014-01-01

    Gordonia polyisoprenivorans strain VH2, a potent rubber-degrading actinomycete, harbors two latex clearing proteins (Lcps), which are known to be essential for the microbial degradation of rubber. However, biochemical information on the exact role of this protein in the degradation of polyisoprene was lacking. In this study, the gene encoding Lcp1VH2 was heterologously expressed in strains of Escherichia coli, the corresponding protein was purified, and its role in rubber degradation was examined by measurement of oxygen consumption as well as by chromatographic and spectroscopic methods. It turned out that active Lcp1VH2 is a monomer and is responsible for the oxidative cleavage of poly(cis-1,4-isoprene) in synthetic as well as in natural rubber by the addition of oxygen (O2) to the cis double bonds. The resulting oligomers possess repetitive isoprene units with aldehyde (CHO-CH2—) and ketone (—CH2-CO-CH3) functional groups at the termini. Two fractions with average isoprene contents of 18 and 10, respectively, were isolated, thus indicating an endocleavage mechanism. The activity of Lcp1VH2 was determined by applying a polarographic assay. Alkenes, acyclic terpenes, or other rubber-like polymers, such as poly(cis-1,4-butadiene) or poly(trans-1,4-isoprene), are not oxidatively cleaved by Lcp1VH2. The pH and temperature optima of the enzyme are at pH 7 and 30°C, respectively. Furthermore, it was demonstrated that active Lcp1VH2 is a Cu(II)-containing oxygenase that exhibits a conserved domain of unknown function which cannot be detected in any other hitherto-characterized enzyme. The results presented here indicate that this domain might represent a new protein family of oxygenases. PMID:24928880

  12. Latex clearing protein-an oxygenase cleaving poly(cis-1,4-isoprene) rubber at the cis double bonds.

    PubMed

    Hiessl, Sebastian; Böse, Dietrich; Oetermann, Sylvia; Eggers, Jessica; Pietruszka, Jörg; Steinbüchel, Alexander

    2014-09-01

    Gordonia polyisoprenivorans strain VH2, a potent rubber-degrading actinomycete, harbors two latex clearing proteins (Lcps), which are known to be essential for the microbial degradation of rubber. However, biochemical information on the exact role of this protein in the degradation of polyisoprene was lacking. In this study, the gene encoding Lcp1VH2 was heterologously expressed in strains of Escherichia coli, the corresponding protein was purified, and its role in rubber degradation was examined by measurement of oxygen consumption as well as by chromatographic and spectroscopic methods. It turned out that active Lcp1VH2 is a monomer and is responsible for the oxidative cleavage of poly(cis-1,4-isoprene) in synthetic as well as in natural rubber by the addition of oxygen (O2) to the cis double bonds. The resulting oligomers possess repetitive isoprene units with aldehyde (CHO-CH2-) and ketone (-CH2-CO-CH3) functional groups at the termini. Two fractions with average isoprene contents of 18 and 10, respectively, were isolated, thus indicating an endocleavage mechanism. The activity of Lcp1VH2 was determined by applying a polarographic assay. Alkenes, acyclic terpenes, or other rubber-like polymers, such as poly(cis-1,4-butadiene) or poly(trans-1,4-isoprene), are not oxidatively cleaved by Lcp1VH2. The pH and temperature optima of the enzyme are at pH 7 and 30°C, respectively. Furthermore, it was demonstrated that active Lcp1VH2 is a Cu(II)-containing oxygenase that exhibits a conserved domain of unknown function which cannot be detected in any other hitherto-characterized enzyme. The results presented here indicate that this domain might represent a new protein family of oxygenases.

  13. Crystal structure of 1,6-di-thia-cyclo-deca-cis-3,cis-8-diene (DTCDD).

    PubMed

    Baughman, Russell G; Delanty, Molly C; Ortwerth, Michael F

    2014-11-01

    The title compound, C8H12S2 (trivial name DTCDD), was obtained as a side product of the reaction between cis-1,4-di-chloro-but-2-ene and sodium sulfide. The asymmetric unit consists of one-quarter of the mol-ecule (S site symmetry 2) and the complete mol-ecule has 2/m (C 2h ) point symmetry with the C=C bond in an E conformation. The geometry of the title compound is compared to those of a chloro derivative and a mercury complex.

  14. Phase transitions in chlorobenzene-cis-decalin mixtures

    NASA Astrophysics Data System (ADS)

    Mansingh, Abhai; Agarwal, C. B.; Singh, Ramadhar

    1980-01-01

    The dielectric constant ɛ' and loss tangent tan δ of chlorobenzene-cis-decalin mixtures have been measured in the temperature range 77 K to 330 K and frequency range 0.1 to 100 kHz. On cooling, ɛ' increases with decreasing temperature upto about 135 K, after which it drops rapidly with decreasing T followed by a slow decrease. This indicates that the liquid mixture goes to an amorphous phase which transforms to a glass phase of restricted dipole rotation below T g; however, the peak in ɛ' is due to relaxation in the amorphous phase (α relaxation) and does not give an exact T g. On heating, the behaviour of the cooling curve is retraced upto 160 K, after which ɛ' drops suddenly to a value lower than that at 77 K in the glass phase. This indicates the transition to a crystalline phase in which dipole rotational freedom is completely lost. The crystalline phase changes to a eutectic liquid phase of high ɛ' at a temperature (200 K) lower than the melting point of chlorobenzene and cis-decalin. Dielectric dispersion is observed only in the glass and amorphous phases. The dielectric relaxation time is independent of the concentration of chlorobenzene.

  15. Theoretical study of trans-cis photoisomerism in polymethine cyanines

    NASA Astrophysics Data System (ADS)

    Momicchioli, Fabio; Baraldi, Ivan; Berthier, Gaston

    1988-06-01

    The trans-cis photoisomerism of polymethine dyes has been interpreted so far using different and rather inconsistent models of the potential energy surfaces. In order to search for a unified electronic model, we tackled the problem again from an intramolecular point of view. Our study consisted in qualitative MO considerations followed by explicit (CS INDO) calculations of the S 0, T 1 and S 1 potential energy curves for a proper model system: pentamethine cyanine isomerizing around the 2-3 and 3-4 bonds. Torsional energy levels for the calculated potential curves were also obtained. The main conclusions are: (i) the photoreaction proceeds through a "non-spectroscopic" (perp) S 1 minimum which exists also in the isolated molecule, (ii) this twisted excited species has charge transfer character (TICT), as opposed to the biradicaloid character of the "non-spectroscopic" S 1 minimum involved in the trans→cis photoisomerization of olefines (e.g., stilbene). The possible consequences on the dynamics of the excited state relaxation in non-polar solvents are envisaged.

  16. [Synthesis and crystalline structure of cis-monochloro(dimenthylsulfoxide)].

    PubMed

    Bentefrit, F; Viossat, B; Tomas, A; Nguyen Huy, D; Morgant, G

    2002-03-01

    The synthesis of cis-monochloro(dimethylsulfoxide)(metforminuro) platine(II) was investigated. It crystallizes in the monoclinic system, space group P 2(1)/c with Z=4. The cell parameters are: a=9.173(2); b=11.286( 2); c=12.556( 3) (A); b=99.69(2) degrees. The structure of this compound was refined to R=0.031 and wR=0.038 using 1461 independent reflexions with I>3 s(I). The platinum coordination is square planar, built up from one Cl, one O from the dimethylsulfoxide, and one bidentate chelating ligand (metforminure anion) via the two imine nitrogen atoms in cis position. The negative charge of the metforminure ligand ensures the electric neutrality in the complex. The crystal packing is characterized by four hydrogen bonds, one of which is bifurcated (involving Cl atom (intramolecular bonding) and O(i) (intermolecular bonding; symmetry code i: x, 3/2-y; 1/2+z).

  17. Identification and comparative analysis of sixteen fungal peptidyl-prolyl cis/trans isomerase repertoires

    PubMed Central

    Pemberton, Trevor J

    2006-01-01

    Background The peptidyl-prolyl cis/trans isomerase (PPIase) class of proteins is present in all known eukaryotes, prokaryotes, and archaea, and it is comprised of three member families that share the ability to catalyze the cis/trans isomerisation of a prolyl bond. Some fungi have been used as model systems to investigate the role of PPIases within the cell, however how representative these repertoires are of other fungi or humans has not been fully investigated. Results PPIase numbers within these fungal repertoires appears associated with genome size and orthology between repertoires was found to be low. Phylogenetic analysis showed the single-domain FKBPs to evolve prior to the multi-domain FKBPs, whereas the multi-domain cyclophilins appear to evolve throughout cyclophilin evolution. A comparison of their known functions has identified, besides a common role within protein folding, multiple roles for the cyclophilins within pre-mRNA splicing and cellular signalling, and within transcription and cell cycle regulation for the parvulins. However, no such commonality was found with the FKBPs. Twelve of the 17 human cyclophilins and both human parvulins, but only one of the 13 human FKBPs, identified orthologues within these fungi. hPar14 orthologues were restricted to the Pezizomycotina fungi, and R. oryzae is unique in the known fungi in possessing an hCyp33 orthologue and a TPR-containing FKBP. The repertoires of Cryptococcus neoformans, Aspergillus fumigatus, and Aspergillus nidulans were found to exhibit the highest orthology to the human repertoire, and Saccharomyces cerevisiae one of the lowest. Conclusion Given this data, we would hypothesize that: (i) the evolution of the fungal PPIases is driven, at least in part, by the size of the proteome, (ii) evolutionary pressures differ both between the different PPIase families and the different fungi, and (iii) whilst the cyclophilins and parvulins have evolved to perform conserved functions, the FKBPs have

  18. Characterization of various tissue mimicking materials for medical ultrasound imaging

    NASA Astrophysics Data System (ADS)

    Thouvenot, Audrey; Poepping, Tamie; Peters, Terry M.; Chen, Elvis C. S.

    2016-04-01

    Tissue mimicking materials are physical constructs exhibiting certain desired properties, which are used in machine calibration, medical imaging research, surgical planning, training, and simulation. For medical ultrasound, those specific properties include acoustic propagation speed and attenuation coefficient over the diagnostic frequency range. We investigated the acoustic characteristics of polyvinyl chloride (PVC) plastisol, polydimethylsiloxane (PDMS), and isopropanol using a time-of-light technique, where a pulse was passed through a sample of known thickness contained in a water bath. The propagation speed in PVC is approximately 1400ms-1 depending on the exact chemical composition, with the attenuation coefficient ranging from 0:35 dB cm-1 at 1MHz to 10:57 dB cm-1 at 9 MHz. The propagation speed in PDMS is in the range of 1100ms-1, with an attenuation coefficient of 1:28 dB cm-1 at 1MHz to 21:22 dB cm-1 at 9 MHz. At room temperature (22 °C), a mixture of water-isopropanol (7:25% isopropanol by volume) exhibits a propagation speed of 1540ms-1, making it an excellent and inexpensive tissue-mimicking liquid for medical ultrasound imaging.

  19. Circumscribed choroidal haemangioma mimicking chronic central serous chorioretinopathy.

    PubMed

    Rahman, W; Horgan, N; Hungerford, J

    2013-03-01

    We describe a rare case of bilateral circumscribed choroidal haemangioma in an otherwise healthy male, which mimicked chronic central serous chorioretinopathy (CSCR). A 52-year-old Asian man presented with a one-year history of visual decline in his left eye. The vision in the right eye had been reduced for 15 years. Visual acuity was 6/60 in the right eye and 6/18 in the left eye. Fundus examination of the right eye revealed an area of discoloration with overlying retinal pigment epithelial changes in the macula and evidence of prior surrounding argon laser photocoagulation. The left macula showed a raised choroidal lesion with overlying retinal pigment epithelial changes and associated subretinal fluid. This appearance illustrates how chronic retinal pigment epithelial alterations associated with longstanding subretinal fluid exudation from circumscribed choroidal haemangiomas may mimick the appearance of chronic central serous chorioretinopathy. B-scan ultrasonography, fluorescein angiography, indocyanine green angiography and optical coherence tomography helped to establish the diagnosis. The active lesion in the left eye was treated with verteporfin photodynamic therapy with improvement in vision.

  20. Genetic variation in the odorant receptor OR2J3 is associated with the ability to detect the "grassy" smelling odor, cis-3-hexen-1-ol.

    PubMed

    McRae, Jeremy F; Mainland, Joel D; Jaeger, Sara R; Adipietro, Kaylin A; Matsunami, Hiroaki; Newcomb, Richard D

    2012-09-01

    The ability to detect many odors varies among individuals; however, the contribution of genotype to this variation has been assessed for relatively few compounds. We have identified a genetic basis for the ability to detect the flavor compound cis-3-hexen-1-ol. This compound is typically described as "green grassy" or the smell of "cut grass," with variation in the ability to detect it linked to single nucleotide polymorphisms (SNPs) in a region on human chromosome 6 containing 25 odorant receptor genes. We have sequenced the coding regions of all 25 receptors across an ethnically mixed population of 52 individuals and identified 147 sequence variants. We tested these for association with cis-3-hexen-1-ol detection thresholds and found 3 strongly associated SNPs, including one found in a functional odorant receptor (rs28757581 in OR2J3). In vitro assays of 13 odorant receptors from the region identified 3 receptors that could respond to cis-3-hexen-1-ol, including OR2J3. This gene contained 5 predicted haplotypes across the 52 individuals. We tested all 5 haplotypes in vitro and several amino acid substitutions on their own, such as rs28757581 (T113A). Two amino acid substitutions, T113A and R226Q, impaired the ability of OR2J3 to respond to cis-3-hexen-1-ol, and together these two substitutions effectively abolished the response to the compound. The haplotype of OR2J3 containing both T113A and R226Q explains 26.4% of the variation in cis-3-hexen-1-ol detection in our study cohort. Further research is required to examine whether OR2J3 haplotypes explain variation in perceived flavor experience and the consumption of foods containing cis-3-hexen-1-ol.

  1. Genomic analysis reveals major determinants of cis-regulatory variation in Capsella grandiflora

    PubMed Central

    Steige, Kim A.; Laenen, Benjamin; Reimegård, Johan; Slotte, Tanja

    2017-01-01

    Understanding the causes of cis-regulatory variation is a long-standing aim in evolutionary biology. Although cis-regulatory variation has long been considered important for adaptation, we still have a limited understanding of the selective importance and genomic determinants of standing cis-regulatory variation. To address these questions, we studied the prevalence, genomic determinants, and selective forces shaping cis-regulatory variation in the outcrossing plant Capsella grandiflora. We first identified a set of 1,010 genes with common cis-regulatory variation using analyses of allele-specific expression (ASE). Population genomic analyses of whole-genome sequences from 32 individuals showed that genes with common cis-regulatory variation (i) are under weaker purifying selection and (ii) undergo less frequent positive selection than other genes. We further identified genomic determinants of cis-regulatory variation. Gene body methylation (gbM) was a major factor constraining cis-regulatory variation, whereas presence of nearby transposable elements (TEs) and tissue specificity of expression increased the odds of ASE. Our results suggest that most common cis-regulatory variation in C. grandiflora is under weak purifying selection, and that gene-specific functional constraints are more important for the maintenance of cis-regulatory variation than genome-scale variation in the intensity of selection. Our results agree with previous findings that suggest TE silencing affects nearby gene expression, and provide evidence for a link between gbM and cis-regulatory constraint, possibly reflecting greater dosage sensitivity of body-methylated genes. Given the extensive conservation of gbM in flowering plants, this suggests that gbM could be an important predictor of cis-regulatory variation in a wide range of plant species. PMID:28096395

  2. Genomic analysis reveals major determinants of cis-regulatory variation in Capsella grandiflora.

    PubMed

    Steige, Kim A; Laenen, Benjamin; Reimegård, Johan; Scofield, Douglas G; Slotte, Tanja

    2017-01-31

    Understanding the causes of cis-regulatory variation is a long-standing aim in evolutionary biology. Although cis-regulatory variation has long been considered important for adaptation, we still have a limited understanding of the selective importance and genomic determinants of standing cis-regulatory variation. To address these questions, we studied the prevalence, genomic determinants, and selective forces shaping cis-regulatory variation in the outcrossing plant Capsella grandiflora We first identified a set of 1,010 genes with common cis-regulatory variation using analyses of allele-specific expression (ASE). Population genomic analyses of whole-genome sequences from 32 individuals showed that genes with common cis-regulatory variation (i) are under weaker purifying selection and (ii) undergo less frequent positive selection than other genes. We further identified genomic determinants of cis-regulatory variation. Gene body methylation (gbM) was a major factor constraining cis-regulatory variation, whereas presence of nearby transposable elements (TEs) and tissue specificity of expression increased the odds of ASE. Our results suggest that most common cis-regulatory variation in C. grandiflora is under weak purifying selection, and that gene-specific functional constraints are more important for the maintenance of cis-regulatory variation than genome-scale variation in the intensity of selection. Our results agree with previous findings that suggest TE silencing affects nearby gene expression, and provide evidence for a link between gbM and cis-regulatory constraint, possibly reflecting greater dosage sensitivity of body-methylated genes. Given the extensive conservation of gbM in flowering plants, this suggests that gbM could be an important predictor of cis-regulatory variation in a wide range of plant species.

  3. Evaluation of 9-cis retinoic acid and mitotane as antitumoral agents in an adrenocortical xenograft model.

    PubMed

    Nagy, Zoltán; Baghy, Kornélia; Hunyadi-Gulyás, Éva; Micsik, Tamás; Nyírő, Gábor; Rácz, Gergely; Butz, Henriett; Perge, Pál; Kovalszky, Ilona; Medzihradszky, Katalin F; Rácz, Károly; Patócs, Attila; Igaz, Peter

    2015-01-01

    The available drug treatment options for adrenocortical carcinoma (ACC) are limited. In our previous studies, the in vitro activity of 9-cis retinoic acid (9-cisRA) on adrenocortical NCI-H295R cells was shown along with its antitumoral effects in a small pilot xenograft study. Our aim was to dissect the antitumoral effects of 9-cisRA on ACC in a large-scale xenograft study involving mitotane, 9-cisRA and their combination. 43 male SCID mice inoculated with NCI-H295R cells were treated in four groups (i. control, ii. 9-cisRA, iii. mitotane, iv. 9-cisRA + mitotane) for 28 days. Tumor size follow-up, histological and immunohistochemical (Ki-67) analysis, tissue gene expression microarray, quantitative real-time-PCR for the validation of microarray results and to detect circulating microRNAs were performed. Protein expression was studied by proteomics and Western-blot validation. Only mitotane alone and the combination of 9-cisRA and mitotane resulted in significant tumor size reduction. The Ki-67 index was significantly reduced in both 9-cisRA and 9-cisRA+mitotane groups. Only modest changes at the mRNA level were found: the 9-cisRA-induced overexpression of apolipoprotein A4 and down-regulation of phosphodiesterase 4A was validated. The expression of circulating hsa-miR-483-5p was significantly reduced in the combined treatment group. The SET protein was validated as being significantly down-regulated in the combined mitotane+9-cisRA group. 9-cisRA might be a helpful additive agent in the treatment of ACC in combination with mitotane. Circulating hsa-miR-483-5p could be utilized for monitoring the treatment efficacy in ACC patients, and the treatment-induced reduction in protein SET expression might raise its relevance in ACC biology.

  4. Evaluation of 9-cis retinoic acid and mitotane as antitumoral agents in an adrenocortical xenograft model

    PubMed Central

    Nagy, Zoltán; Baghy, Kornélia; Hunyadi-Gulyás, Éva; Micsik, Tamás; Nyírő, Gábor; Rácz, Gergely; Butz, Henriett; Perge, Pál; Kovalszky, Ilona; Medzihradszky, Katalin F; Rácz, Károly; Patócs, Attila; Igaz, Peter

    2015-01-01

    The available drug treatment options for adrenocortical carcinoma (ACC) are limited. In our previous studies, the in vitro activity of 9-cis retinoic acid (9-cisRA) on adrenocortical NCI-H295R cells was shown along with its antitumoral effects in a small pilot xenograft study. Our aim was to dissect the antitumoral effects of 9-cisRA on ACC in a large-scale xenograft study involving mitotane, 9-cisRA and their combination. 43 male SCID mice inoculated with NCI-H295R cells were treated in four groups (i. control, ii. 9-cisRA, iii. mitotane, iv. 9-cisRA + mitotane) for 28 days. Tumor size follow-up, histological and immunohistochemical (Ki-67) analysis, tissue gene expression microarray, quantitative real-time-PCR for the validation of microarray results and to detect circulating microRNAs were performed. Protein expression was studied by proteomics and Western-blot validation. Only mitotane alone and the combination of 9-cisRA and mitotane resulted in significant tumor size reduction. The Ki-67 index was significantly reduced in both 9-cisRA and 9-cisRA+mitotane groups. Only modest changes at the mRNA level were found: the 9-cisRA-induced overexpression of apolipoprotein A4 and down-regulation of phosphodiesterase 4A was validated. The expression of circulating hsa-miR-483-5p was significantly reduced in the combined treatment group. The SET protein was validated as being significantly down-regulated in the combined mitotane+9-cisRA group. 9-cisRA might be a helpful additive agent in the treatment of ACC in combination with mitotane. Circulating hsa-miR-483-5p could be utilized for monitoring the treatment efficacy in ACC patients, and the treatment-induced reduction in protein SET expression might raise its relevance in ACC biology. PMID:26885453

  5. Skin color correction for tissue spectroscopy: demonstration of a novel approach with tissue-mimicking phantoms.

    PubMed

    Soyemi, Olusola O; Landry, Michelle R; Yang, Ye; Idwasi, Patrick O; Soller, Babs R

    2005-02-01

    The application of partial least squares (PLS) regression to visible-near-infrared (VIS-NIR) spectroscopy for modeling important blood and tissue parameters is generally complicated by the variation in skin pigmentation (melanin) across the human population. An orthogonal correction method for removing the influence of skin pigmentation has been demonstrated in diffuse reflectance spectra from two-layer tissue-mimicking phantoms. The absorption properties of the phantoms were defined by lyophilized human hemoglobin (bottom layer) and synthetic melanin (top layer). Tissue-like scattering was simulated in both layers with intralipid. The approach uses principal components analysis (PCA) loading vectors from a separate set of phantom spectra that encode the unwanted melanin variation to remove the effect of melanin from the test phantoms. The preprocessing of phantom spectra using this orthogonal correction method resulted in PLS models with reduced complexity and enhanced prediction performance. Preliminary results from a separate study that evaluates the feasibility of defining skin color variation in an experiment with a single human subject are also presented.

  6. Anti-tumor Properties of cis-Resveratrol Methylated Analogues in Metastatic Mouse Melanoma Cells

    PubMed Central

    Morris, Valery L.; Toseef, Tayyaba; Nazumudeen, Fathima B.; Rivoira, Christian; Spatafora, Carmela; Tringali, Corrado; Rotenberg, Susan A.

    2015-01-01

    Resveratrol (E-3,5,4’-trihydroxystilbene) is a polyphenol found in red wine that has been shown to have multiple anti-cancer properties. Although cis (Z) and trans (E) isomers of resveratrol occur in nature, the cis form is not biologically active. However, methylation at key positions of the cis form results in more potent anti-cancer properties. This study determined that synthetic cis-polymethoxystilbenes (methylated analogues of cis-resveratrol) inhibited cancer-related phenotypes of metastatic B16 F10 and non-metastatic B16 F1 mouse melanoma cells. In contrast with cis or trans-resveratrol and trans-polymethoxystilbene which were ineffective at 10 μM, cis-polymethoxystilbenes inhibited motility and proliferation of melanoma cells with low micromolar specificity (IC50 <10 μM). Inhibitory effects by cis-polymethoxystilbenes were significantly stronger with B16 F10 cells and were accompanied by decreased expression of β-tubulin and pleckstrin homology domain-interacting protein, a marker of metastatic B16 cells. Thus, cis-polymethoxystilbenes have potential as chemotherapeutic agents for metastatic melanoma. PMID:25567208

  7. Formation of cis-coniferin in cell-free extracts of Fagus grandifolia Ehrh bark

    NASA Technical Reports Server (NTRS)

    Yamamoto, E.; Inciong, E. J.; Davin, L. B.; Lewis, N. G.

    1990-01-01

    American beech (Fagus grandifolia Ehrh) bark exclusively accumulates cis-monolignols and their glucosidic conjugates; no evidence for the accumulation of trans-monolignols has been found. The glucosyltransferase from this source exhibits a very unusual substrate specificity for cis, and not trans, monolignols. This is further evidence that cis monolignols are involved in lignin formation in these plant tissues. Preliminary evidence for the existence of a novel trans-cis monolignol isomerase was obtained, in agreement with our contention that this isomerization is not photochemically mediated.

  8. Enantioselective synthesis of cis-decalins using organocatalysis and sulfonyl Nazarov reagents.

    PubMed

    Peña, Javier; Silveira-Dorta, Gastón; Moro, Rosalina F; Garrido, Narciso M; Marcos, Isidro S; Sanz, Francisca; Díez, David

    2015-04-10

    The first organocatalytic synthesis of cis-decalins using sulfonyl Nazarov reagents is reported. The Jørgensen's catalyst directs this highly enantioselective synthesis using different cyclohexenal derivatives.

  9. Enthalpy of ligand substitution in cis organopalladium complexes with monodentate ligands.

    PubMed

    Salas, Gorka; Casares, Juan A; Espinet, Pablo

    2009-10-21

    The enthalpy for the substitution reaction cis-[PdRf(2)(THF)(2)] + 2 L -->cis-[PdRf(2)L(2)] + 2THF (THF = tetrahydrofuran) has been measured in THF by calorimetric methods for Rf = 3,5-dichloro-2,4,6-trifluorophenyl, L = PPh(3), AsPh(3), SbPh(3), PMePh(2), PCyPh(2), PMe(3), AsMePh(2), or L(2) = dppe (1,2-bis(diphenylphosphino)ethane), dppf (1,1'-bis(diphenylphosphino)ferrocene). The values determined show that the substitution enthalpy has a strong dependence on the electronic and steric properties of the ligand. The study of the consecutive substitution reactions cis-[PdRf(2)(THF)(2)] + L -->cis-[PdRf(2)L(THF)] + THF, and cis-[PdRf(2)L(THF)] + L -->cis-[PdRf(2)L(2)] + THF has been carried our for L = PPh(3) and L = PCyPh(2). The first substitution is clearly more favorable for the bulkier leaving ligand, but the second gives practically the same DeltaH value for both cases, indicating that the differences in steric hindrance happen to compensate the electronic differences for both ligands. The X-ray structures of cis-[PdRf(2)(PMePh(2))(2)], cis-[PdRf(2)(dppe)] and cis-[PdRf(2)(dppf)] are reported.

  10. Cis-Expression Quantitative Trait Loci Mapping Reveals Replicable Associations with Heroin Addiction in OPRM1

    PubMed Central

    Hancock, Dana B.; Levy, Joshua L.; Gaddis, Nathan C.; Glasheen, Cristie; Saccone, Nancy L.; Page, Grier P.; Hulse, Gary; Wildenauer, Dieter; Kelty, Erin; Schwab, Sibylle; Degenhardt, Louisa; Martin, Nicholas G.; Montgomery, Grant W.; Attia, John; Holliday, Elizabeth G.; McEvoy, Mark; Scott, Rodney J.; Bierut, Laura J.; Nelson, Elliot C.; Kral, Alex; Johnson, Eric O.

    2015-01-01

    Background No opioid receptor, mu 1 (OPRM1) gene polymorphisms, including the functional single nucleotide polymorphism (SNP) rs1799971, have been conclusively associated with heroin/other opioid addiction, despite their biological plausibility. We used evidence of polymorphisms altering OPRM1 expression in normal human brain tissue to nominate and then test associations with heroin addiction. Methods We tested 103 OPRM1 SNPs for association with OPRM1 mRNA expression in prefrontal cortex from 224 European Americans and African Americans of the BrainCloud cohort. We then tested the 16 putative cis-quantitative trait loci (cis-eQTL) SNPs for association with heroin addiction in the Urban Health Study and two replication cohorts, totaling 16,729 European Americans, African Americans, and Australians of European ancestry. Results Four putative cis-eQTL SNPs were significantly associated with heroin addiction in the Urban Health Study (smallest P=8.9×10−5): rs9478495, rs3778150, rs9384169, and rs562859. Rs3778150, located in OPRM1 intron 1, was significantly replicated (P=6.3×10−5). Meta-analysis across all case-control cohorts resulted in P=4.3×10−8: the rs3778150-C allele (frequency=16%-19%) being associated with increased heroin addiction risk. Importantly, the functional SNP allele rs1799971-A was associated with heroin addiction only in the presence of rs3778150-C (P=1.48×10−6 for rs1799971-A/rs3778150-C and P=0.79 for rs1799971-A/rs3778150-T haplotypes). Lastly, replication was observed for six other intron 1 SNPs which had prior suggestive associations with heroin addiction (smallest P=2.7×10−8 for rs3823010). Conclusions Our findings show that common OPRM1 intron 1 SNPs have replicable associations with heroin addiction. The haplotype structure of rs3778150 and nearby SNPs may underlie the inconsistent associations between rs1799971 and heroin addiction. PMID:25744370

  11. Cell and Gene Therapy for Genetic Diseases: Inherited Disorders Affecting the Lung and Those Mimicking Sudden Infant Death Syndrome

    PubMed Central

    Keeler, Allison M.

    2012-01-01

    Abstract Some of the first human gene therapy trials targeted diseases of the lung and provided important information that will continue to help shape future trials. Here we describe both cell and gene therapies for lung diseases such as cystic fibrosis and alpha-1 antitrypsin disorder as well as fatty acid oxidation disorders that mimic sudden infant death syndrome (SIDS). Human clinical gene therapy trials for cystic fibrosis and alpha-1 antitrypsin have been performed using a variety of vectors including adenovirus, adeno-associated virus, and nonviral vectors. No human clinical gene therapy trials have been performed for disorders of fatty acid oxidation; however, important proof-of-principle studies have been completed for multiple fatty acid oxidation disorders. Important achievements have been made and have yet to come for cell and gene therapies for disorders of the lung and those mimicking SIDS. PMID:22642257

  12. Cell and gene therapy for genetic diseases: inherited disorders affecting the lung and those mimicking sudden infant death syndrome.

    PubMed

    Keeler, Allison M; Flotte, Terence R

    2012-06-01

    Some of the first human gene therapy trials targeted diseases of the lung and provided important information that will continue to help shape future trials. Here we describe both cell and gene therapies for lung diseases such as cystic fibrosis and alpha-1 antitrypsin disorder as well as fatty acid oxidation disorders that mimic sudden infant death syndrome (SIDS). Human clinical gene therapy trials for cystic fibrosis and alpha-1 antitrypsin have been performed using a variety of vectors including adenovirus, adeno-associated virus, and nonviral vectors. No human clinical gene therapy trials have been performed for disorders of fatty acid oxidation; however, important proof-of-principle studies have been completed for multiple fatty acid oxidation disorders. Important achievements have been made and have yet to come for cell and gene therapies for disorders of the lung and those mimicking SIDS.

  13. Massively parallel cis-regulatory analysis in the mammalian central nervous system.

    PubMed

    Shen, Susan Q; Myers, Connie A; Hughes, Andrew E O; Byrne, Leah C; Flannery, John G; Corbo, Joseph C

    2016-02-01

    Cis-regulatory elements (CREs, e.g., promoters and enhancers) regulate gene expression, and variants within CREs can modulate disease risk. Next-generation sequencing has enabled the rapid generation of genomic data that predict the locations of CREs, but a bottleneck lies in functionally interpreting these data. To address this issue, massively parallel reporter assays (MPRAs) have emerged, in which barcoded reporter libraries are introduced into cells, and the resulting barcoded transcripts are quantified by next-generation sequencing. Thus far, MPRAs have been largely restricted to assaying short CREs in a limited repertoire of cultured cell types. Here, we present two advances that extend the biological relevance and applicability of MPRAs. First, we adapt exome capture technology to instead capture candidate CREs, thereby tiling across the targeted regions and markedly increasing the length of CREs that can be readily assayed. Second, we package the library into adeno-associated virus (AAV), thereby allowing delivery to target organs in vivo. As a proof of concept, we introduce a capture library of about 46,000 constructs, corresponding to roughly 3500 DNase I hypersensitive (DHS) sites, into the mouse retina by ex vivo plasmid electroporation and into the mouse cerebral cortex by in vivo AAV injection. We demonstrate tissue-specific cis-regulatory activity of DHSs and provide examples of high-resolution truncation mutation analysis for multiplex parsing of CREs. Our approach should enable massively parallel functional analysis of a wide range of CREs in any organ or species that can be infected by AAV, such as nonhuman primates and human stem cell-derived organoids.

  14. Dissection of the cis-2-decenoic acid signaling network in Pseudomonas aeruginosa using microarray technique

    PubMed Central

    Rahmani-Badi, Azadeh; Sepehr, Shayesteh; Fallahi, Hossein; Heidari-Keshel, Saeed

    2015-01-01

    Many bacterial pathogens use quorum-sensing (QS) signaling to regulate the expression of factors contributing to virulence and persistence. Bacteria produce signals of different chemical classes. The signal molecule, known as diffusible signal factor (DSF), is a cis-unsaturated fatty acid that was first described in the plant pathogen Xanthomonas campestris. Previous works have shown that human pathogen, Pseudomonas aeruginosa, also synthesizes a structurally related molecule, characterized as cis-2-decenoic acid (C10: Δ2, CDA) that induces biofilm dispersal by multiple types of bacteria. Furthermore, CDA has been shown to be involved in inter-kingdom signaling that modulates fungal behavior. Therefore, an understanding of its signaling mechanism could suggest strategies for interference, with consequences for disease control. To identify the components of CDA signaling pathway in this pathogen, a comparative transcritpome analysis was conducted, in the presence and absence of CDA. A protein-protein interaction (PPI) network for differentially expressed (DE) genes with known function was then constructed by STRING and Cytoscape. In addition, the effects of CDA in combination with antimicrobial agents on the biofilm surface area and bacteria viability were evaluated using fluorescence microscopy and digital image analysis. Microarray analysis identified 666 differentially expressed genes in the presence of CDA and gene ontology (GO) analysis revealed that in P. aeruginosa, CDA mediates dispersion of biofilms through signaling pathways, including enhanced motility, metabolic activity, virulence as well as persistence at different temperatures. PPI data suggested that a cluster of five genes (PA4978, PA4979, PA4980, PA4982, PA4983) is involved in the CDA synthesis and perception. Combined treatments using both CDA and antimicrobial agents showed that following exposure of the biofilms to CDA, remaining cells on the surface were easily removed and killed by

  15. Fungal regulatory evolution: cis and trans in the balance

    PubMed Central

    Thompson, Dawn Anne; Regev, Aviv

    2009-01-01

    Regulatory divergence is likely a major driving force in evolution. Comparative genomics is being increasingly used to infer the evolution of gene regulation. Ascomycota fungi are uniquely suited among eukaryotes for regulatory evolution studies, due to broad phylogenetic scope, many sequenced genomes, and tractability of genomic analysis. Here we review recent advances in the identification of the contribution of cis and trans factors to expression divergence. Whereas current strategies have led to the discovery of surprising signatures and mechanisms, we still understand very little about the adaptive role of regulatory evolution. Empirical studies including experimental evolution, comparative functional genomics and hybrid and engineered strains are showing early promise toward deciphering the contribution of regulatory divergence to adaptation. PMID:19914250

  16. Mechanism of cis-prenyltransferase reaction probed by substrate analogues.

    PubMed

    Lu, Yen-Pin; Liu, Hon-Ge; Teng, Kuo-Hsun; Liang, Po-Huang

    2010-10-01

    Undecaprenyl pyrophosphate synthase (UPPS) is a cis-type prenyltransferases which catalyzes condensation reactions of farnesyl diphosphate (FPP) with eight isopentenyl pyrophosphate (IPP) units to generate C(55) product. In this study, we used two analogues of FPP, 2-fluoro-FPP and [1,1-(2)H(2)]FPP, to probe the reaction mechanism of Escherichia coli UPPS. The reaction rate of 2-fluoro-FPP with IPP under single-turnover condition is similar to that of FPP, consistent with the mechanism without forming a farnesyl carbocation intermediate. Moreover, the deuterium secondary KIE of 0.985±0.022 measured for UPPS reaction using [1,1-(2)H(2)]FPP supports the associative transition state. Unlike the sequential mechanism used by trans-prenyltransferases, our data demonstrate E. coli UPPS utilizes the concerted mechanism.

  17. Twine: display and analysis of cis-regulatory modules

    PubMed Central

    Pearson, Joseph C.; Crews, Stephen T.

    2013-01-01

    Summary: Many algorithms analyze enhancers for overrepresentation of known and novel motifs, with the goal of identifying binding sites for direct regulators of gene expression. Twine is a Java GUI with multiple graphical representations (‘Views’) of enhancer alignments that displays motifs, as IUPAC consensus sequences or position frequency matrices, in the context of phylogenetic conservation to facilitate cis-regulatory element discovery. Thresholds of phylogenetic conservation and motif stringency can be altered dynamically to facilitate detailed analysis of enhancer architecture. Views can be exported to vector graphics programs to generate high-quality figures for publication. Twine can be extended via Java plugins to manipulate alignments and analyze sequences. Availability: Twine is freely available as a compiled Java .jar package or Java source code at http://labs.bio.unc.edu/crews/twine/. Contact: steve_crews@unc.edu Supplementary information: Supplementary data are available at Bioinformatics online. PMID:23658420

  18. Uncovering cis Regulatory Codes Using Synthetic Promoter Shuffling

    PubMed Central

    Kinkhabwala, Ali; Guet, Călin C.

    2008-01-01

    Revealing the spectrum of combinatorial regulation of transcription at individual promoters is essential for understanding the complex structure of biological networks. However, the computations represented by the integration of various molecular signals at complex promoters are difficult to decipher in the absence of simple cis regulatory codes. Here we synthetically shuffle the regulatory architecture — operator sequences binding activators and repressors — of a canonical bacterial promoter. The resulting library of complex promoters allows for rapid exploration of promoter encoded logic regulation. Among all possible logic functions, NOR and ANDN promoter encoded logics predominate. A simple transcriptional cis regulatory code determines both logics, establishing a straightforward map between promoter structure and logic phenotype. The regulatory code is determined solely by the type of transcriptional regulation combinations: two repressors generate a NOR: NOT (a OR b) whereas a repressor and an activator generate an ANDN: a AND NOT b. Three-input versions of both logics, having an additional repressor as an input, are also present in the library. The resulting complex promoters cover a wide dynamic range of transcriptional strengths. Synthetic promoter shuffling represents a fast and efficient method for exploring the spectrum of complex regulatory functions that can be encoded by complex promoters. From an engineering point of view, synthetic promoter shuffling enables the experimental testing of the functional properties of complex promoters that cannot necessarily be inferred ab initio from the known properties of the individual genetic components. Synthetic promoter shuffling may provide a useful experimental tool for studying naturally occurring promoter shuffling. PMID:18446205

  19. Eosinophilic Cystitis Mimicking Bladder Tumour – A Rare Case Report

    PubMed Central

    D, Manimaran; T M, Karthikeyan; M, Sreenivasulu; V R, Mrinalini; V, Gopinath

    2013-01-01

    A 16–year–old male presented with urinary urgency, a frequency of 4 months duration and intermittent gross haematuria which were there since one month. Eosinophilia was noted in complete blood count and CT KUB with contrast showed a filling defect in the right lateral wall, over the vesicoureteric junction. Cystoscopy revealed a sessile mass lesion over right vesico–ureteric junction, with bullous oedema . Rest of the mucosa was normal. Transurethral resection of lesion was performed and histological examination showed features of eosinophilic cystitis. Patient was treated with corticosteroids, antimicrobial agents and antihistaminics and he is recovering well. We are presenting this case for its rare presentation and its possibility of mimicking a bladder tumour. Biopsy of the lesion was diagnostic and an early treatment showed good results. PMID:24298501

  20. Surgicel® granuloma mimicking ovarian cancer: A case report

    PubMed Central

    Cormio, Luigi; Cormio, Gennaro; Di Fino, Giuseppe; Scavone, Carmen; Sanguedolce, Francesca; Loizzi, Vera; Carrieri, Giuseppe

    2016-01-01

    Surgicel® is an absorbable sterile mesh composed of oxidized cellulose that is used to control intraoperative capillary or venous bleeding, due to its capacity to bind hemoglobin, thus allowing the formation of an artificial clot. In the present study, a large granuloma mimicking ovarian cancer, which developed following placement of a Surgicel® sponge during a combined pubovaginal sling procedure and cystocele repair, is reported. The aim of the present case report is to emphasize the fact that hemostatic measures should be removed following their use, and to alert surgeons to the risk of using and leaving in situ oxidized cellulose. Furthermore, accurate evaluation of the surgical history of the patient should always be performed prior to attempting surgery. PMID:27446398

  1. Mimicking diffuse supernova antineutrinos with the sun as a source

    SciTech Connect

    Raffelt, G. G.; Rashba, T. I.

    2010-04-15

    Measuring the {nu}-bar{sub e} component of the cosmic diffuse supernova neutrino background (DSNB) is the next ambitious goal for low-energy neutrino astronomy. The largest flux is expected in the lowest accessible energy bin. However, for E {<=} 15 MeV a possible signal can be mimicked by a solar {nu}-bar{sub e} flux that originates from the usual {sup 8}B neutrinos by spin-flavor oscillations. We show that such an interpretation is possible within the allowed range of neutrino electromagnetic transition moments and solar turbulent field strengths and distributions. Therefore, an unambiguous detection of the DSNB requires a significant number of events at E {>=} 15 MeV.

  2. Enterobiasis in ectopic locations mimicking tumor-like lesions.

    PubMed

    Pampiglione, Silvio; Rivasi, Francesco

    2009-01-01

    Both the clinical and the histopathological diagnostic difficulties of oxyuriasis in unusual sites and their importance from a clinical point of view are pointed out. The authors report two ectoptic cases of enterobiasis observed in Northern Italy, one located in a fallopian tube of a 57-year-old woman and the other in a perianal subcutaneous tissue of a 59-year-old man, mimicking tumor-like lesions. The authors take advantage of the occasion to focus the attention of the medical world on this subject, lamenting the scarce importance given to this parasitosis in university courses of medical schools and in medical textbooks as it is incorrectly considered "out-of-fashion."

  3. Enzyme-Mimicking properties of silicates and other minerals

    NASA Astrophysics Data System (ADS)

    Siegel, B. Z.; Siegel, S. M.

    The adsorptive and/or catalytic properties of clays, silicates in general, and other minerals are well known. More recently, their probable role in prebiotic syntheses of bio-organic compounds has become a matter of record. We demonstrate that, in addition to their role in de novo formation of important biomolecules, clays, micas, fibrous silicates and other minerals mimick the activities of contemporary enzymes including oxidases, esterases, phosphatases and glucosidases. The existence of such capabilities in substances likely to be represented on the surfaces of Earth-like planets may offer a challenge to the technology and design of remote life detection systems which must then distinguish between bona fide biological chemistry and mineral-base pseudometabolism. It also raises questions about the importance of mineral surfaces in post-mortem transformations of organic metabolites in our own biosphere.

  4. A Rare Presentation of Peritoneal Tuberculosis Mimicking Malignancy

    PubMed Central

    Swe, Thein; Naing, Akari Thein; Phyo, Zaw Win; Thwin, Malar

    2016-01-01

    Our search of literature revealed combined elevations of serum cancer antigen 125 levels and rheumatoid factor levels in a patient with peritoneal tuberculosis has rarely been reported. Thus, we describe the case of a 63-year-old female with large abdominal ascites and malignancy was ruled out with biopsy. High levels of serum cancer antigen and rheumatoid factor were noted. Physicians should be aware that tuberculosis infection could induce elevation of rheumatoid factor levels in the absence of rheumatologic symptoms or disease. A high index of suspicion is required because peritoneal tuberculosis is a great mimicker of other abdominal pathology, especially intraabdominal malignancies and can mislead physicians to undergo unnecessary interventions. PMID:27900335

  5. Blood-Mimicking Fluid for Testing Ultrasonic Diagnostic Instrument

    NASA Astrophysics Data System (ADS)

    Tanaka, Kouhei; Yoshida, Tomoji; Sato, Kazuishi; Kondo, Toshio; Yasukawa, Kazuhiro; Miyamoto, Nobuaki; Taniguchi, Masahiko

    2012-07-01

    We present a blood-mimicking fluid (BMF) for the Doppler test object of medical diagnostic instruments. Accurate measurement in a flow Doppler test requires a BMF that has the acoustic velocity and density defined in the International Electrotechnical Commission (IEC) standard, and furthermore, they must be stable over time. To formulate a fluid with the desired density and acoustic velocity, we have developed a new fluid made of glycerine and water-soluble silicone oil. The new BMF includes dispersed polystyrene particles as scatterers. The density of the liquid can be adjusted to maintain it at the same value as that of the polystyrene particles, thus ensuring neutral buoyancy of the particles. The MBF was stable over a period of 2 weeks, during which the density and acoustic velocity did not change.

  6. Dense Deposit Disease Mimicking a Renal Small Vessel Vasculitis.

    PubMed

    Singh, Lavleen; Singh, Geetika; Bhardwaj, Swati; Sinha, Aditi; Bagga, Arvind; Dinda, Amit

    2016-01-01

    Dense deposit disease is caused by fluid-phase dysregulation of the alternative complement pathway and frequently deviates from the classic membranoproliferative pattern of injury on light microscopy. Other patterns of injury described for dense deposit disease include mesangioproliferative, acute proliferative/exudative, and crescentic GN. Regardless of the histologic pattern, C3 glomerulopathy, which includes dense deposit disease and C3 GN, is defined by immunofluorescence intensity of C3c two or more orders of magnitude greater than any other immune reactant (on a 0-3 scale). Ultrastructural appearances distinguish dense deposit disease and C3 GN. Focal and segmental necrotizing glomerular lesions with crescents, mimicking a small vessel vasculitis such as ANCA-associated GN, are a very rare manifestation of dense deposit disease. We describe our experience with this unusual histologic presentation and distinct clinical course of dense deposit disease, discuss the pitfalls in diagnosis, examine differential diagnoses, and review the relevant literature.

  7. Isolated angiitis in the hypothalamus mimicking brain tumor.

    PubMed

    Tsutsumi, Satoshi; Ito, Masanori; Yasumoto, Yukimasa; Kaneda, Kazuhiko

    2008-01-01

    A 64-year-old female presented with exaggerating somnolence without contributory medical and lifestyle histories. She was not aware of any preceding infection or headache. Cerebral magnetic resonance imaging demonstrated an isolated enhanced mass in the hypothalamus without meningeal enhancement. Blood and cerebrospinal fluid examinations showed no significant findings except for hypernatremia and hyperprolactinemia. She underwent an open biopsy via the interhemispheric route. Histological examination revealed marked perivascular lymphocytic aggregation with polyclonal immunostaining both for B and T lymphocytes. No findings suggestive of underlying malignancy were recognized. Extensive work-up aiming at systemic vasculitis and lymphoma revealed no signs of extracranial lesion, so the most probable diagnosis was isolated angiitis in the hypothalamus. Angiitis may originate from the hypothalamus and should be considered in the differential diagnosis of hypothalamic lesion mimicking brain tumor on neuroimaging.

  8. Granulomatous prostatitis after intravesical immunotherapy mimicking prostate cancer.

    PubMed

    Białek, Waldemar; Rudzki, Sławomir; Iberszer, Paweł; Wronecki, Lech

    2016-12-01

    Intravesical immunotherapy with attenuated strains of Mycobacterium bovis is a widely used therapeutic option in patients with non-muscle-invasive transitional cell carcinoma of the bladder. A rare complication of intravesical therapy with the Bacillus Calmette-Guérin vaccine is granulomatous prostatitis, which due to increasing levels of prostate-specific antigen and abnormalities found in transrectal examination of the prostate may suggest concomitant prostate cancer. A case of extensive granulomatous prostatitis in a 61-year-old patient which occurred after the first course of a well-tolerated Bacillus Calmette-Guérin therapy is presented. Due to abnormalities found in rectal examination and an abnormal transrectal ultrasound image of the prostate with extensive infiltration mimicking neoplastic hyperplasia a core biopsy of the prostate was performed. Histopathological examination revealed inflammatory infiltration sites of tuberculosis origin.

  9. Granulomatous prostatitis after intravesical immunotherapy mimicking prostate cancer

    PubMed Central

    Rudzki, Sławomir; Iberszer, Paweł; Wronecki, Lech

    2016-01-01

    Intravesical immunotherapy with attenuated strains of Mycobacterium bovis is a widely used therapeutic option in patients with non-muscle-invasive transitional cell carcinoma of the bladder. A rare complication of intravesical therapy with the Bacillus Calmette-Guérin vaccine is granulomatous prostatitis, which due to increasing levels of prostate-specific antigen and abnormalities found in transrectal examination of the prostate may suggest concomitant prostate cancer. A case of extensive granulomatous prostatitis in a 61-year-old patient which occurred after the first course of a well-tolerated Bacillus Calmette-Guérin therapy is presented. Due to abnormalities found in rectal examination and an abnormal transrectal ultrasound image of the prostate with extensive infiltration mimicking neoplastic hyperplasia a core biopsy of the prostate was performed. Histopathological examination revealed inflammatory infiltration sites of tuberculosis origin. PMID:28138411

  10. Adenoid Cystic Carcinoma Mimicking an Oroantral Fistula: A Case Report

    PubMed Central

    Monteiro, Bárbara Vanessa de Brito; Grempel, Rafael Grotta; Gomes, Daliana Queiroga de Castro; Godoy, Gustavo Pina; Miguel, Márcia Cristina da Costa

    2013-01-01

    Introduction Adenoid cystic carcinoma (ACC) is one of the most frequent malignant salivary gland tumors, which commonly affects the minor salivary glands of the mouth and is rare in the nose and paranasal sinuses. In the maxillary sinus, ACC can mimic inflammatory diseases and has a poor prognosis. Objective To report a case of a 50-year-old man with ACC of the maxillary sinus whose clinical findings in the alveolar ridge mimicked an oroantral fistula. Case Report An excisional biopsy was performed and histopathologic analysis revealed ACC. Lung metastases and residual tumor in the maxillary sinus were detected by imaging methods. In view of the poor general health of the patient, no new surgical intervention was performed and he was only treated by radiotherapy and follow-up. Conclusion Although rare in the maxillary sinus, ACC should be included in the differential diagnosis of lesions affecting this site. PMID:25992095

  11. Mesenteric lymphangioma mimicking a cystic ovarian mass on imaging.

    PubMed

    Hitzerd, Emilie; van Hamont, Dennis; Pijnenborg, Johanna M A

    2016-02-01

    Pelvic cystic masses are frequently observed in women. Most lesions are benign and of ovarian origin. However, non-ovarian lesions can be easily confused with cystic ovarian masses on imaging, which hampers diagnostic and therapeutic management. In this report, a rare case of mesenteric lymphangioma mimicking an ovarian cystic mass, discovered as an incidental finding on orthopaedic MRI in an adult female, is presented. The report highlights the sometimes difficult diagnostic process of pelvic cystic masses, due to an extensive differential diagnosis and the fact that imaging is often inconclusive. Even though most cystic masses are of ovarian origin, non-ovarian causes can mimic ovarian masses and should be considered as differential diagnoses. Surgical exploration may be necessary to exclude malignant causes.

  12. Somatostatin-secreting Pheochromocytoma Mimicking Insulin-dependent Diabetes Mellitus

    PubMed Central

    Hirai, Hiroyuki; Midorikawa, Sanae; Suzuki, Shinichi; Sasano, Hironobu; Watanabe, Tsuyoshi; Satoh, Hiroaki

    2016-01-01

    We herein present the findings of a 42-year-old woman with either adrenal pheochromocytoma or intraadrenal paraganglioma that simultaneously secreted somatostatin, thus mimicking insulin-dependent diabetes mellitus. Pheochromocytoma was clinically diagnosed based on scintigraphy, elevated catecholamine levels, and finally a histopathological analysis of resected specimens. The patient had diabetic ketosis, requiring 40 U insulin for treatment. Following laparoscopic adrenalectomy, insulin therapy was discontinued and the urinary c-peptide levels changed from 5.5-9.0 to 81.3-87.0 μg/day. Histologically, somatostatin immunoreactivity was detected and the somatostatin levels were elevated in the serum-like fluid obtained from the tumor. Clinicians should be aware of the possible occurrence of simultaneous ectopic hormone secretion in patients with pheochromocytoma. PMID:27746437

  13. Recurrent histoplasmosis in AIDS mimicking a colonic carcinoma.

    PubMed

    Aisenberg, G; Marcos, L A; Ogbaa, I

    2009-06-01

    The prevalence rate of lower gastrointestinal bleeding in patients with AIDS is around 2.6%. A 42-year-old woman with AIDS (CD(4) count 9/microL) and recently treated for disseminated histoplasmosis presented to the emergency room with melena, severe anaemia and fever. A colonoscopy showed an umbilicated colonic nodule mimicking a carcinoma of the colon. The biopsy showed intracytoplasmic microorganisms compatible with Histoplasma capsulatum. She had poor compliance to the itraconazole when discharge on previous admission. Despite the fact that colonic histoplasmosis is uncommon, the mortality rate is around 8% and clinicians should be aware of the clinical presentation of histoplasmosis when recur, especially in patients not taking the itraconazole for long-term treatment.

  14. Atypical Ormond's disease associated with bile duct stricture mimicking cholangiocarcinoma.

    PubMed

    Quante, Michael; Appenrodt, Beate; Randerath, Simone; Wolff, Martin; Fischer, Hans-Peter; Sauerbruch, Tilman

    2009-01-01

    A 55-year-old woman with suspected hilar cholangiocarcinoma presented with jaundice and dilated intrahepatic bile ducts owing to high-grade hepatic duct confluence stenosis. The suspected tumour and the entire extrahepatic bile duct system were resected and Roux-en-Y hepaticojejunostomy was performed. Histological investigations showed perihepatic fibrosis but no signs of malignancy. One year later the patient developed bilateral hydronephrosis caused by ureteral obstruction. Since the patient had a gynaecological history of widespread inflammation, she was referred for transabdominal operative ureterolysis combined with hysterectomy and adnexectomy. Histological investigations as well as fluorodeoxyglucose-positron emission tomography (FDG-PET) and computed tomography (CT) findings were compatible with retroperitoneal fibrosis (Ormond's disease). Treatment with tamoxifen was initiated. To the best of our knowledge, only a few cases of intraperitoneal fibroses mimicking cholangiocarcinoma followed by the typical symptoms of retroperitoneal Ormond's disease have been reported.

  15. Liquid optical phantoms mimicking spectral characteristics of laboratory mouse biotissues

    NASA Astrophysics Data System (ADS)

    Loginova, D. A.; Sergeeva, E. A.; Krainov, A. D.; Agrba, P. D.; Kirillin, M. Yu

    2016-06-01

    Optical phantoms mimicking optical properties of real biotissues in the visible and IR spectral regions are developed based on measurements of the spectral characteristics of ex vivo samples of laboratory mouse biotissues. The phantoms are composed of aqueous solutions of Lipofundin, Indian ink and red ink with different spectral characteristics. The deviations of the measured absorption and scattering coefficients of phantoms in the wavelength range 480 - 580 nm from the corresponding values for real biotissues do not exceed 25% and 2%, respectively. For phantoms in the wavelength region 580 - 880 nm, the deviations of the absorption coefficient do not exceed 40% and the deviations of the scattering coefficient do not exceed 25%. These values, in general, fall within the range of variations for different individual mice of one strain.

  16. An Adolescent Patient with Scabies Mimicking Gottron Papules.

    PubMed

    Yoshinaga, Eiji; Oiso, Naoki; Kawara, Shigeru; Kawada, Akira

    2009-01-13

    Atypical features of scabies occur in infants and children and patients with prolonged use of corticosteroids or immunosuppression. We report a non-immunosuppressed 15-year-old female case of scabies showing scaly reddish papules over the proximal interphalangeal joints mimicking Gottron papules in classic dermatomyositis. Periungal erythema was also seen. Four months' topical corticosteroids from previous clinics had been used. Dermoscopic findings were consistent with typical pictures of scabies. Scraping of hand crusts demonstrated scabies mites and ova. Skin lesions of the patient were cured with oral ivermectin and topical 10% crotamiton. This case suggests that a lesion resembling Gottron papules may be added to the panel of unusual presentations of scabies.

  17. An Adolescent Patient with Scabies Mimicking Gottron Papules

    PubMed Central

    Yoshinaga, Eiji; Oiso, Naoki; Kawara, Shigeru; Kawada, Akira

    2010-01-01

    Atypical features of scabies occur in infants and children and patients with prolonged use of corticosteroids or immunosuppression. We report a non-immunosuppressed 15-year-old female case of scabies showing scaly reddish papules over the proximal interphalangeal joints mimicking Gottron papules in classic dermatomyositis. Periungal erythema was also seen. Four months’ topical corticosteroids from previous clinics had been used. Dermoscopic findings were consistent with typical pictures of scabies. Scraping of hand crusts demonstrated scabies mites and ova. Skin lesions of the patient were cured with oral ivermectin and topical 10% crotamiton. This case suggests that a lesion resembling Gottron papules may be added to the panel of unusual presentations of scabies. PMID:21173918

  18. Intussusception of Rectosigmoid Colon Cancer Mimicking a Pedunculated Tumor

    PubMed Central

    Saigusa, Susumu; Ohi, Masaki; Imaoka, Hiroki; Shimura, Tadanobu; Inoue, Yasuhiro; Kusunoki, Masato

    2014-01-01

    Intussusception in adults is a rare phenomenon involving the colon in approximately 20% of cases. A 65-year-old man was hospitalized with anorexia, anemia, dehydration, and melena. Digital rectal examination revealed a palpable mass approximately 5 cm from the anal verge. The mass moved between the rectosigmoid colon and the rectum below the peritoneal reflection during radiographic examinations and during sigmoidoscopy. We strongly suspected a rectosigmoid pedunculated tumor and performed a low anterior resection. Intraoperatively we observed intussusception of the rectosigmoid colon with easy manual reduction. The tumor was palpable in the rectosigmoid colon. The postoperative course was uneventful. This case illustrates intussusception of a rectosigmoid type 1 colon adenocarcinoma mimicking a pedunculated tumor. PMID:24963434

  19. Tissue-mimicking gel phantoms for thermal therapy studies.

    PubMed

    Dabbagh, Ali; Abdullah, Basri Johan Jeet; Ramasindarum, Chanthiriga; Abu Kasim, Noor Hayaty

    2014-10-01

    Tissue-mimicking phantoms that are currently available for routine biomedical applications may not be suitable for high-temperature experiments or calibration of thermal modalities. Therefore, design and fabrication of customized thermal phantoms with tailored properties are necessary for thermal therapy studies. A multitude of thermal phantoms have been developed in liquid, solid, and gel forms to simulate biological tissues in thermal therapy experiments. This article is an attempt to outline the various materials and techniques used to prepare thermal phantoms in the gel state. The relevant thermal, electrical, acoustic, and optical properties of these phantoms are presented in detail and the benefits and shortcomings of each type are discussed. This review could assist the researchers in the selection of appropriate phantom recipes for their in vitro study of thermal modalities and highlight the limitations of current phantom recipes that remain to be addressed in further studies.

  20. Dense Deposit Disease Mimicking a Renal Small Vessel Vasculitis

    PubMed Central

    Singh, Lavleen; Bhardwaj, Swati; Sinha, Aditi; Bagga, Arvind; Dinda, Amit

    2016-01-01

    Dense deposit disease is caused by fluid-phase dysregulation of the alternative complement pathway and frequently deviates from the classic membranoproliferative pattern of injury on light microscopy. Other patterns of injury described for dense deposit disease include mesangioproliferative, acute proliferative/exudative, and crescentic GN. Regardless of the histologic pattern, C3 glomerulopathy, which includes dense deposit disease and C3 GN, is defined by immunofluorescence intensity of C3c two or more orders of magnitude greater than any other immune reactant (on a 0–3 scale). Ultrastructural appearances distinguish dense deposit disease and C3 GN. Focal and segmental necrotizing glomerular lesions with crescents, mimicking a small vessel vasculitis such as ANCA-associated GN, are a very rare manifestation of dense deposit disease. We describe our experience with this unusual histologic presentation and distinct clinical course of dense deposit disease, discuss the pitfalls in diagnosis, examine differential diagnoses, and review the relevant literature. PMID:26361799

  1. Sarcoidosis mimicking a venous ulcer: a case report.

    PubMed

    Joshi, Smita S; Romanelli, Paolo; Kirsner, Robert S

    2009-11-01

    Sarcoidosis--a chronic, multisystem disease of unknown etiology characterized by noncaseating granulomas--may cause ulcerative lesions, particularly in African American women. A case of ulcerative sarcoidosis mimicking a venous ulcer is presented. The patient is a 44-year-old African American hypertensive, obese woman with a nonhealing medially based lower leg ulcer of 3 years' duration clinically consistent with a venous ulcer. The ulcer did not heal with compression therapy and pentoxifylline. Subsequent biopsies showed granulomatous inflammation consistent with sarcoidosis. When intralesional triamcinolone was added to compression therapy, the ulcer resolved after 3 months. Given its propensity toward formation on the lower extremities and ulcerative and atrophic appearance, ulcerative sarcoidosis should be considered in the differential diagnosis of a venous ulcer refractory to standard therapy, especially in African American women.

  2. Huge uterine-cervical diverticulum mimicking as a cyst.

    PubMed

    Chufal, S; Thapliyal, Naveen; Gupta, Manoj; Pangtey, Nirmal

    2012-01-01

    Here we report an incidental huge uterine-cervical diverticulum from a total abdominal hysterectomy specimen in a perimenopausal woman who presented with acute abdominal pain. The diverticulum was mimicking with various cysts present in the lateral side of the female genital tract. Histopathological examination confirmed this to be a cervical diverticulum with communication to uterine cavity through two different openings. They can attain huge size if left ignored for long duration and present a diagnostic challenge to clinicians, radiologists, as well as pathologists because of its extreme rarity. Therefore, diverticula should also be included as a differential diagnosis. Its histopathological confirmation also highlights that diverticula can present as an acute abdomen, requiring early diagnosis with appropriate timely intervention. Immunohistochemistry CD 10 has also been used to differentiate it from a mesonephric cyst.

  3. Subungual onycholemmal cyst of the toenail mimicking subungual melanoma.

    PubMed

    Busquets, Joanna; Banala, Mounica; Campanelli, Carmen; Sahu, Joya; Lee, Jason B

    2016-08-01

    This report highlights a rare case of a woman with horizontal ridging and tenderness of the right great toenail associated with dyspigmentation of 5 years' duration. Histopathology revealed a cystic structure with an epithelial lining mostly reminiscent of an isthmus-catagen cyst admixed with the presence of both an intermittent, focal granular layer and an eosinophilic cuticle surrounding pink, laminated keratin, most consistent with a diagnosis of subungual onycholemmal cyst (SOC). It is a rare and distinctive nail abnormality occurring in the dermis of the nail bed. We present a case of an SOC in the toenail mimicking subungual malignant melanoma, which may be an underrecognized and common entity that must be considered when discussing tumors of the nail unit, especially subungual melanoma.

  4. A salivary gland adenocarcinoma mimicking a microcystic adnexal carcinoma.

    PubMed

    Basile, John R; Lin, Yi-Ling

    2010-04-01

    The microcystic adnexal carcinoma (MAC) is a rare, slow-growing but locally aggressive neoplasm arising in the midface and lips of middle-aged adults. The MAC is histologically characterized by deeply infiltrating nests and islands of basaloid or squamous cells forming cysts and ductal structures, proliferating in a dense sclerotic stroma and occasionally exhibiting perineural invasion. We describe a salivary gland adenocarcinoma arising in the lower lip, characterized by ductal structures and cords, 3-5 cell layers in thickness, set in a dense fibrous stroma and also invading nerves, thus mimicking a MAC in both its clinical and its histopathologic appearance. The diagnostic dilemma presented by this lesion is discussed, along with a differential diagnosis and brief review of the literature.

  5. Optofluidic phantom mimicking optical properties of porcine livers

    SciTech Connect

    Long, Ruiqi; King, Travis; Akl, Tony; Ericson, Milton Nance; Wilson, Mark A.; Cote, Gerard L.; McShane, Michael J.

    2011-01-01

    One strategy for assessing efficacy of a liver transplant is to monitor perfusion and oxygenation after transplantation. An implantable optical sensor is being developed to overcome inadequacies of current monitoring approaches. To facilitate sensor design while minimizing animal use, a polydimethylsiloxane (PDMS)-based liver phantom was developed to mimic the optical properties of porcine liver in the 630-1000 nm wavelength range and the anatomical geometry of liver parenchyma. Using soft lithography to construct microfluidic channels in pigmented elastomer enabled the 2D approximation of hexagonal liver lobules with 15mm sinusoidal channels, which will allow perfusion with blood-mimicking fluids to facilitate the development of the liver perfusion and oxygenation monitoring system.

  6. Acoustical characterization of polysaccharide polymers tissue-mimicking materials.

    PubMed

    Cuccaro, Rugiada; Musacchio, Chiara; Giuliano Albo, P Alberto; Troia, Adriano; Lago, Simona

    2015-02-01

    Tissue-mimicking phantoms play a crucial role in medical ultrasound research because they can simulate biological soft tissues. In last years, many types of polymeric tissues have been proposed and characterized from an acoustical and a thermal point of view, but, rarely, a deep discussion about the quality of the measurements, in terms of the uncertainty evaluation, has been reported. In this work, considering the necessity to develop laboratory standards for the measurement of ultrasonic exposure and dose quantities, a detailed description of the experimental apparatuses for the sound speed and the attenuation coefficient measurements is given, focusing the attention on the uncertainty evaluation both of the results and analysis algorithms. In particular, this algorithm reveals a novel empirical relation, fixing a limit to the energy content (therefore limits the number of cycles) of the three parts in which the authors have proposed to divide the acoustical signal. Furthermore, the realisation of multi-components phantoms, Agar and Phytagel based tissue-mimicking gels along with others long chain molecules (dextrane or polyvinyl alcohol) and scattering materials (silicon carbide and kieselguhr) are investigated. This paper reports accurate speed of sound and attenuation coefficient measurements. Speed of sound is measured by a pulse-echo technique in far-field condition, using an optical glass buffer rod; while attenuation coefficient is determined by an insertion technique, using demineralized water as reference material. The experimental sound speed results are subjected to an overall estimated relative uncertainty of about 1.5% and the attenuation coefficient uncertainty is less than 2.5%. For the development of laboratory standards, a detailed analysis of the measurement uncertainty is fundamental to make sample properties comparable. The authors believe this study could represent the right direction to make phantoms characterizations referable and traceable.

  7. Organocatalytic, Diastereo- and Enantioselective Synthesis of Nonsymmetric cis-Stilbene Diamines: A Platform for the Preparation of Single-Enantiomer cis-Imidazolines for Protein–Protein Inhibition

    PubMed Central

    2015-01-01

    The finding by scientists at Hoffmann-La Roche that cis-imidazolines could disrupt the protein–protein interaction between p53 and MDM2, thereby inducing apoptosis in cancer cells, raised considerable interest in this scaffold over the past decade. Initial routes to these small molecules (i.e., Nutlin-3) provided only the racemic form, with enantiomers being enriched by chromatographic separation using high-pressure liquid chromatography (HPLC) and a chiral stationary phase. Reported here is the first application of an enantioselective aza-Henry approach to nonsymmetric cis-stilbene diamines and cis-imidazolines. Two novel mono(amidine) organocatalysts (MAM) were discovered to provide high levels of enantioselection (>95% ee) across a broad range of substrate combinations. Furthermore, the versatility of the aza-Henry strategy for preparing nonsymmetric cis-imidazolines is illustrated by a comparison of the roles of aryl nitromethane and aryl aldimine in the key step, which revealed unique substrate electronic effects providing direction for aza-Henry substrate–catalyst matching. This method was used to prepare highly substituted cis-4,5-diaryl imidazolines that project unique aromatic rings, and these were evaluated for MDM2-p53 inhibition in a fluorescence polarization assay. The diversification of access to cis-stilbene diamine-derived imidazolines provided by this platform should streamline their further development as chemical tools for disrupting protein–protein interactions. PMID:25017623

  8. A blood-mimicking fluid for particle image velocimetry with silicone vascular models

    NASA Astrophysics Data System (ADS)

    Yousif, Majid Y.; Holdsworth, David W.; Poepping, Tamie L.

    2011-03-01

    For accurate particle image velocimetry measurements in hemodynamics studies, it is important to use a fluid with a refractive index ( n) matching that of the vascular models (phantoms) and ideally a dynamic viscosity matching human blood. In this work, a blood-mimicking fluid (BMF) composed of water, glycerol, and sodium iodide was formulated for a range of refractive indices to match most common silicone elastomers ( n = 1.40-1.43) and with corresponding dynamic viscosity within the average cited range of healthy human blood (4.4 ± 0.5 cP). Both refractive index and viscosity were attained at room temperature (22.2 ± 0.2°C), which eliminates the need for a temperature-control system. An optimally matched BMF, suitable for use in a vascular phantom ( n = 1.4140 ± 0.0008, Sylgard 184), was demonstrated with composition (by weight) of 47.38% water, 36.94% glycerol (44:56 glycerol-water ratio), and 15.68% sodium iodide salt, resulting in a dynamic viscosity of 4 .31 ± 0 .03 cP.

  9. Temperature-dependent Physical Properties of a HIFU Blood Mimicking Fluid

    NASA Astrophysics Data System (ADS)

    Liu, Yunbo; Maruvada, Subha; King, Randy L.; Herman, Bruce A.; Wear, Keith A.

    2009-04-01

    A blood mimicking fluid (BMF) has been developed and characterized in a temperature dependent manner for high intensity focused ultrasound (HIFU) ablation devices. The BMF is based on a degassed and de-ionized water solution dispersed with low density polyethylene micro-spheres, nylon particles, gellan gum and glycerol. A broad range of physical parameters, including frequency dependent ultrasound attenuation, speed of sound, viscosity, thermal conductivity and diffusivity were characterized as a function of temperature (20° C to 70° C). The nonlinear parameter B/A and backscatter coefficient were also measured at room temperature. The attenuation coefficient is linearly proportional to the frequency (2 MHz-8 MHz) with a slope of about 0.2 dB cm-1 MHz-1 in the 20° C to 70° C range as has been reported for human blood. All the other temperature dependent physical parameters are also close to the reported values in human blood. These properties make the BMF a useful HIFU research tool for developing standardized exposimetry techniques, validating numerical models, and determining the safety and efficacy of HIFU ablation devices.

  10. Development and characterization of a blood mimicking fluid for high intensity focused ultrasound.

    PubMed

    Liu, Yunbo; Maruvada, Subha; King, Randy L; Herman, Bruce A; Wear, Keith A

    2008-09-01

    A blood mimicking fluid (BMF) has been developed for the acoustic and thermal characterizations of high intensity focused ultrasound (HIFU) ablation devices. The BMF is based on a degassed and de-ionized water solution dispersed with low density polyethylene microspheres, nylon particles, gellan gum, and glycerol. A broad range of physical parameters, including attenuation coefficient, speed of sound, viscosity, thermal conductivity, and diffusivity, were characterized as a function of temperature (20-70 degrees C). The nonlinear parameter B/A and backscatter coefficient were also measured at room temperature. Importantly, the attenuation coefficient is linearly proportional to the frequency (2-8 MHz) with a slope of about 0.2 dB cm(-1) MHz(-1) in the 20-70 degrees C range as in the case of human blood. Furthermore, sound speed and bloodlike backscattering indicate the usefulness of the BMF for ultrasound flow imaging and ultrasound-guided HIFU applications. Most of the other temperature-dependent physical parameters are also close to the reported values in human blood. These properties make it a unique HIFU research tool for developing standardized exposimetry techniques, validating numerical models, and determining the safety and efficacy of HIFU ablation devices.

  11. Paragonimiasis mimicking chest cancer and abdominal wall metastaisis: A case report

    PubMed Central

    ZHOU, RONGXING; ZHANG, MINJIA; CHENG, NANSHENG; ZHOU, YONG

    2016-01-01

    Typical human paragonimiasis demonstrates an elevated eosinophil count, positive immunoblot, nodular shadows of the lung and pleural thickening with pleural effusion, and these symptoms may be confused with chest cancer. In the present case, a rare case of human paragonimiasis mimicking chest cancer and abdominal wall metastasis is described, the 39-year-old male patient was admitted in our hospital for cough, weight loss 5 kg and a firm mass in right upper abdominal wall. The laboratory test showed unremarkable hematology and biochemistry results. Chest X-ray, Plain computed tomography of the chest and abdomen showed right pleural effusion, several nodules in right lower lung and a mass in the right upper abdominal wall. The initial diagnosis was lung or chest cancer with abdominal wall metastasis, and the abdominal wall mass was resected for the final diagnosis. The biopsy revealed eosinophilic granuloma with Charcot-Leyden crystal formation infiltrated in the muscular fibers. Subsequent to assessment of the antibodies against parasites, the final diagnosis of paragonimiasis was made. PMID:27313691

  12. Short-term plasticity and long-term potentiation mimicked in single inorganic synapses.

    PubMed

    Ohno, Takeo; Hasegawa, Tsuyoshi; Tsuruoka, Tohru; Terabe, Kazuya; Gimzewski, James K; Aono, Masakazu

    2011-06-26

    Memory is believed to occur in the human brain as a result of two types of synaptic plasticity: short-term plasticity (STP) and long-term potentiation (LTP; refs 1-4). In neuromorphic engineering, emulation of known neural behaviour has proven to be difficult to implement in software because of the highly complex interconnected nature of thought processes. Here we report the discovery of a Ag(2)S inorganic synapse, which emulates the synaptic functions of both STP and LTP characteristics through the use of input pulse repetition time. The structure known as an atomic switch, operating at critical voltages, stores information as STP with a spontaneous decay of conductance level in response to intermittent input stimuli, whereas frequent stimulation results in a transition to LTP. The Ag(2)S inorganic synapse has interesting characteristics with analogies to an individual biological synapse, and achieves dynamic memorization in a single device without the need of external preprogramming. A psychological model related to the process of memorizing and forgetting is also demonstrated using the inorganic synapses. Our Ag(2)S element indicates a breakthrough in mimicking synaptic behaviour essential for the further creation of artificial neural systems that emulate characteristics of human memory.

  13. Short-term plasticity and long-term potentiation mimicked in single inorganic synapses

    NASA Astrophysics Data System (ADS)

    Ohno, Takeo; Hasegawa, Tsuyoshi; Tsuruoka, Tohru; Terabe, Kazuya; Gimzewski, James K.; Aono, Masakazu

    2011-08-01

    Memory is believed to occur in the human brain as a result of two types of synaptic plasticity: short-term plasticity (STP) and long-term potentiation (LTP; refs , , , ). In neuromorphic engineering, emulation of known neural behaviour has proven to be difficult to implement in software because of the highly complex interconnected nature of thought processes. Here we report the discovery of a Ag2S inorganic synapse, which emulates the synaptic functions of both STP and LTP characteristics through the use of input pulse repetition time. The structure known as an atomic switch, operating at critical voltages, stores information as STP with a spontaneous decay of conductance level in response to intermittent input stimuli, whereas frequent stimulation results in a transition to LTP. The Ag2S inorganic synapse has interesting characteristics with analogies to an individual biological synapse, and achieves dynamic memorization in a single device without the need of external preprogramming. A psychological model related to the process of memorizing and forgetting is also demonstrated using the inorganic synapses. Our Ag2S element indicates a breakthrough in mimicking synaptic behaviour essential for the further creation of artificial neural systems that emulate characteristics of human memory.

  14. Planning "and" Sprinting: Use of a Hybrid Project Management Methodology within a CIS Capstone Course

    ERIC Educational Resources Information Center

    Baird, Aaron; Riggins, Frederick J.

    2012-01-01

    An increasing number of information systems projects in industry are managed using hybrid project management methodologies, but this shift in project management methods is not fully represented in our CIS curriculums. CIS capstone courses often include an applied project that is managed with traditional project management methods (plan first,…

  15. A CIS (Clinical Information System) Quality Evaluation Tool for Nursing Care Services

    ERIC Educational Resources Information Center

    Lee, Seon Ah

    2010-01-01

    The purpose of this study was to develop a tool to evaluate the quality of a clinical information system (CIS) conceived by nurses and conduct a pilot test with the developed tool as an initial assessment. CIS quality is required for successful implementation in information technology (IT) environments. The study started with the realization that…

  16. Cloning, Expression, and Characterization of cis-Polyprenyl Diphosphate Synthase from the Thermoacidophilic Archaeon Sulfolobus acidocaldarius

    PubMed Central

    Hemmi, Hisashi; Yamashita, Satoshi; Shimoyama, Takefumi; Nakayama, Toru; Nishino, Tokuzo

    2001-01-01

    cis-polyprenyl diphosphate synthases are involved in the biosynthesis of the glycosyl carrier lipid in most organisms. However, only little is known about this enzyme of archaea. In this report, we isolated the gene of cis-polyprenyl diphosphate synthase from a thermoacidophilic archaeon, Sulfolobus acidocaldarius, and characterized the recombinant enzyme. PMID:11114943

  17. Columbia River Coordinated Information System (CIS), 1992-1993 Annual Report.

    SciTech Connect

    Rowe, Mike; Roger, Phillip B.; O'Connor, Dick

    1993-11-01

    The purposes of this report are to: (1) describe the project to date; (2) to document the work and accomplishments of the (CIS) project for Fiscal Year 1993; and (3) to provide a glimpse of future project direction. The concept of a Coordinated Information System (CIS) as an approach to meeting the growing needs for regionally standardized anadromous fish information.

  18. Reactivity of stabilized Criegee intermediates (sCIs) from isoprene and monoterpene ozonolysis toward SO2 and organic acids

    NASA Astrophysics Data System (ADS)

    Sipilä, M.; Jokinen, T.; Berndt, T.; Richters, S.; Makkonen, R.; Donahue, N. M.; Mauldin, R. L., III; Kurtén, T.; Paasonen, P.; Sarnela, N.; Ehn, M.; Junninen, H.; Rissanen, M. P.; Thornton, J.; Stratmann, F.; Herrmann, H.; Worsnop, D. R.; Kulmala, M.; Kerminen, V.-M.; Petäjä, T.

    2014-11-01

    Oxidation processes in Earth's atmosphere are tightly connected to many environmental and human health issues and are essential drivers for biogeochemistry. Until the recent discovery of the atmospheric relevance of the reaction of stabilized Criegee intermediates (sCIs) with SO2, atmospheric oxidation processes were thought to be dominated by a few main oxidants: ozone, hydroxyl radicals (OH), nitrate radicals and, e.g. over oceans, halogen atoms such as chlorine. Here, we report results from laboratory experiments at 293 K and atmospheric pressure focusing on sCI formation from the ozonolysis of isoprene and the most abundant monoterpenes (α-pinene and limonene), and subsequent reactions of the resulting sCIs with SO2 producing sulfuric acid (H2SO4). The measured total sCI yields were (0.15 ± 0.07), (0.27 ± 0.12) and (0.58 ± 0.26) for α-pinene, limonene and isoprene, respectively. The ratio between the rate coefficient for the sCI loss (including thermal decomposition and the reaction with water vapour) and the rate coefficient for the reaction of sCI with SO2, k(loss) /k(sCI + SO2), was determined at relative humidities of 10 and 50%. Observed values represent the average reactivity of all sCIs produced from the individual alkene used in the ozonolysis. For the monoterpene-derived sCIs, the relative rate coefficients k(loss) / k(sCI + SO2) were in the range (2.0-2.4) × 1012 molecules cm-3 and nearly independent of the relative humidity. This fact points to a minor importance of the sCI + H2O reaction in the case of the sCI arising from α-pinene and limonene. For the isoprene sCIs, however, the ratio k(loss) / k(sCI + SO2) was strongly dependent on the relative humidity. To explore whether sCIs could have a more general role in atmospheric oxidation, we investigated as an example the reactivity of acetone oxide (sCI from the ozonolysis of 2,3-dimethyl-2-butene) toward small organic acids, i.e. formic and acetic acid. Acetone oxide was found to react faster

  19. Nanofibrous heparin and heparin-mimicking multilayers as highly effective endothelialization and antithrombogenic coatings.

    PubMed

    Nie, Chuanxiong; Ma, Lang; Cheng, Chong; Deng, Jie; Zhao, Changsheng

    2015-03-09

    Combining the advantages of the fibrous nanostructure of carbon nanotubes (CNTs) and the bioactivities of heparin/heparin-mimicking polyanions, functional nanofibrous heparin or heparin-mimicking multilayers were constructed on PVDF membrane with highly promoted endothelialization and antithrombogenic activities. Oxidized CNT (oCNT) was first functionalized with water-soluble chitosan (polycation), then enwrapped with heparin or a typical sulfonated heparin-mimicking polymers (poly(sodium 4-styrenesulfonate-co-sodium methacrylate)) to construct the multilayers. Then, the surface-deposited multilayers were constructed via electrostatic layer-by-layer assembly of the functionalized oCNTs. The scanning electron microscope and atom force microscope images confirmed that the coated multilayers exhibited nanofibrous and porous structure. The live/dead cell staining and cell viability assay results indicated that the coated nanofibrous multilayers had excellent compatibility with endothelial cells. The cell morphology observation further confirmed the promotion ability of surface endothelialization due to the coated heparin/heparin-mimicking multilayers. Further systematical evaluation on blood compatibility revealed that the surface heparin/heparin-mimicking multilayer-coated membranes also had significantly improved blood compatibility including restrained platelet adhesion and activation, prolonged blood clotting times, and inhibited activation of coagulation and complement factors. In summary, the proposed nanofibrous multilayers integrated endothelialization and antithrombogenic properties; meanwhile, the heparin-mimicking coating validated comparable performances as heparin coating. Herein, it is expected that the surface coating of nanofibrous multilayers, especially the facilely constructed heparin-mimicking coating, may have great application potential in biomedical fields.

  20. Cis-9, trans-11 and trans-10, cis-12 CLA mixture does not change body composition, induces insulin resistance and increases serum HDL cholesterol level in rats.

    PubMed

    de Almeida, Mariana Macedo; de Souza, Yamara Oliveira; Dutra Luquetti, Sheila Cristina Potente; Sabarense, Céphora Maria; do Amaral Corrêa, José Otávio; da Conceição, Ellen Paula Santos; Lisboa, Patrícia Cristina; de Moura, Egberto Gaspar; Andrade Soares, Sara Malaguti; Moura Gualberto, Ana Cristina; Gameiro, Jacy; da Gama, Marco Antônio Sundfeld; Ferraz Lopes, Fernando César; González Garcia, Raúl Marcel

    2015-01-01

    Synthetic supplements of conjugated linoleic acid (CLA) containing 50:50 mixture of cis-9, trans-11 and trans-10, cis-12 CLA isomers have been commercialized in some places for reducing body fat. However the safety of this CLA mixture is controversial and in some countries the CLA usage as food supplement is not authorized. Changes in insulinemic control and serum lipids profile are potential negative effects related to consumption of CLA mixture. The present study aimed to evaluate the effects of a diet containing mixture of cis-9, trans-11 and trans-10, cis-12 CLA on prevention of obesity risk as well as on potential side effects such as insulin resistance and dyslipidemia in Wistar rats. Thirty male Wistar rats were randomly assigned to the following dietary treatments (n=10/group), for 60 days: Normolipidic Control (NC), diet containing 4.0% soybean oil (SO); High Fat-Control (HF-C), diet containing 24.0% SO; High Fat-synthetic CLA (HF-CLA), diet containing 1.5% of an isomeric CLA mixture (Luta-CLA 60) and 22.5% SO. Luta-CLA 60 (BASF) contained nearly 60% of CLA (cis-9, trans-11 and trans-10, cis-12 CLA at 50:50 ratio). The HF-CLA diet contained 0.3% of each CLA isomer. HF-CLA diet had no effect on dietary intake and body composition. HF-CLA-fed rats had lower levels of PPARγ protein in retroperitoneal adipose tissue, hyperinsulinemia compared to HF-C-fed rats, hyperglycemia compared to NC-fed rats while no differences in glycemia were observed between NC and HF-C groups, increased HOMA index and higher levels of serum HDL cholesterol. Thus, feeding rats with a high fat diet containing equal parts of cis-9, trans-11 and trans-10, cis-12 CLA isomers had no effect on body composition and induced insulin resistance. Despite HF-CLA-fed rats had increased serum HDL cholesterol levels, caution should be taken before synthetic supplements containing cis-9, trans-11 and trans-10, cis-12 CLA are recommended as a nutritional strategy for weight management.

  1. Cis-Golgi cisternal assembly and biosynthetic activation occur sequentially in plants and algae.

    PubMed

    Donohoe, Bryon S; Kang, Byung-Ho; Gerl, Mathias J; Gergely, Zachary R; McMichael, Colleen M; Bednarek, Sebastian Y; Staehelin, L Andrew

    2013-05-01

    The cisternal progression/maturation model of Golgi trafficking predicts that cis-Golgi cisternae are formed de novo on the cis-side of the Golgi. Here we describe structural and functional intermediates of the cis cisterna assembly process in high-pressure frozen algae (Scherffelia dubia, Chlamydomonas reinhardtii) and plants (Arabidopsis thaliana, Dionaea muscipula; Venus flytrap) as determined by electron microscopy, electron tomography and immuno-electron microscopy techniques. Our findings are as follows: (i) The cis-most (C1) Golgi cisternae are generated de novo from cisterna initiators produced by the fusion of 3-5 COPII vesicles in contact with a C2 cis cisterna. (ii) COPII vesicles fuel the growth of the initiators, which then merge into a coherent C1 cisterna. (iii) When a C1 cisterna nucleates its first cisterna initiator it becomes a C2 cisterna. (iv) C2-Cn cis cisternae grow through COPII vesicle fusion. (v) ER-resident proteins are recycled from cis cisternae to the ER via COPIa-type vesicles. (vi) In S. dubia the C2 cisternae are capable of mediating the self-assembly of scale protein complexes. (vii) In plants, ∼90% of native α-mannosidase I localizes to medial Golgi cisternae. (viii) Biochemical activation of cis cisternae appears to coincide with their conversion to medial cisternae via recycling of medial cisterna enzymes. We propose how the different cis cisterna assembly intermediates of plants and algae may actually be related to those present in the ERGIC and in the pre-cis Golgi cisterna layer in mammalian cells.

  2. Cis-Golgi cisternal assembly and biosynthetic activation occur sequentially in plants and algae

    PubMed Central

    Donohoe, Bryon S.; Kang, Byung-Ho; Gerl, Mathias J.; Gergely, Zachary R.; McMichael, Colleen M.; Bednarek, Sebastian Y.; Staehelin, L. Andrew

    2013-01-01

    The cisternal progression/maturation model of Golgi trafficking predicts that cis-Golgi cisternae are formed de novo on the cis-side of the Golgi. Here we describe structural and functional intermediates of the cis cisterna assembly process in high-pressure frozen algae (Scherffelia dubia, Chlamydomonas reinhardtii) and plants (Arabidopsis thaliana, Dionaea muscipula; Venus Flytrap) as determined by electron microscopy, electron tomography and immuno-electron microscopy techniques. Our findings are as follows: (1) The cis-most (C1) Golgi cisternae are generated de novo from cisterna initiators produced by the fusion of 3–5 COPII vesicles in contact with a C2 cis cisterna. (2) COPII vesicles fuel the growth of the initiators, which then merge into a coherent C1 cisterna. (3) When a C1 cisterna nucleates its first cisterna initiator it becomes a C2 cisterna. (4) C2-Cn cis cisternae grow through COPII vesicle fusion. (5) ER-resident proteins are recycled from cis cisternae to the ER via COPIa-type vesicles. (6) In S. dubia the C2 cisternae are capable of mediating the self-assembly of scale protein complexes. (7) In plants, ~90% of native α-mannosidase I localizes to medial Golgi cisternae. (8) Biochemical activation of cis cisternae appears to coincide with their conversion to medial cisternae via recycling of medial cisterna enzymes. We propose how the different cis cisterna assembly intermediates of plants and algae may actually be related to those present in the ERGIC and in the pre-cis Golgi cisterna layer in mammalian cells. PMID:23369235

  3. 9-cis β-Carotene Increased Cholesterol Efflux to HDL in Macrophages

    PubMed Central

    Bechor, Sapir; Zolberg Relevy, Noa; Harari, Ayelet; Almog, Tal; Kamari, Yehuda; Ben-Amotz, Ami; Harats, Dror; Shaish, Aviv

    2016-01-01

    Cholesterol efflux from macrophages is a key process in reverse cholesterol transport and, therefore, might inhibit atherogenesis. 9-cis-β-carotene (9-cis-βc) is a precursor for 9-cis-retinoic-acid (9-cis-RA), which regulates macrophage cholesterol efflux. Our objective was to assess whether 9-cis-βc increases macrophage cholesterol efflux and induces the expression of cholesterol transporters. Enrichment of a mouse diet with βc from the alga Dunaliella led to βc accumulation in peritoneal macrophages. 9-cis-βc increased the mRNA levels of CYP26B1, an enzyme that regulates RA cellular levels, indicating the formation of RA from βc in RAW264.7 macrophages. Furthermore, 9-cis-βc, as well as all-trans-βc, significantly increased cholesterol efflux to high-density lipoprotein (HDL) by 50% in RAW264.7 macrophages. Likewise, food fortification with 9-cis-βc augmented cholesterol efflux from macrophages ex vivo. 9-cis-βc increased both the mRNA and protein levels of ABCA1 and apolipoprotein E (APOE) and the mRNA level of ABCG1. Our study shows, for the first time, that 9-cis-βc from the diet accumulates in peritoneal macrophages and increases cholesterol efflux to HDL. These effects might be ascribed to transcriptional induction of ABCA1, ABCG1, and APOE. These results highlight the beneficial effect of βc in inhibition of atherosclerosis by improving cholesterol efflux from macrophages. PMID:27447665

  4. Application of CIS to high-efficiency PV module fabrication. Phase 3 final technical report

    SciTech Connect

    Basol, B M; Kapur, V K; Leidholm, C R; Halani, A; Roe, R; Norsworthy, G

    1998-08-01

    During this research period, researchers at International Solar Electric Technology (ISET) concentrated their efforts on three different areas of research. Within the National CIS R and D Team, ISET participated in the substrate/Mo interactions working group and investigated issues such as Na diffusion from the soda-lime glass substrate into the Mo layers and CIS films. Researchers determined that the Na content within the Mo layers was not a strong function of the nature of the Mo film. However, they found that diffusion through the Mo layers was a function of the Mo film characteristics as well as a very strong function of the CIS growth process itself. Researchers showed conclusively that the Na resided on the grain boundaries of CIS layers. Another team activity involved evaluation of CdS-free CIS solar cells. ZnO/CIS junctions prepared by the two-stage process showed light-soaking effects. Cells left under illumination improved in efficiency and were similar to the CdS/CIS junctions. After storage in the dark, however, efficiency deteriorated greatly for the ZnO/CIS device, most of the decline coming from the open-circuit voltage values. Much of the effort during this period was spent on developing a low-cost, non-vacuum CIS deposition technique. The method developed involves particulate deposition and formation of precursor layers followed by the conversion of these layers into CIS. Test modules of 40--60 cm{sup 2} were adapted to understand the issues involved in this novel technology. At the present time, the submodule efficiencies are 6--7%. Single-cell efficiencies are in the 10--13% range.

  5. 9-cis β-Carotene Increased Cholesterol Efflux to HDL in Macrophages.

    PubMed

    Bechor, Sapir; Zolberg Relevy, Noa; Harari, Ayelet; Almog, Tal; Kamari, Yehuda; Ben-Amotz, Ami; Harats, Dror; Shaish, Aviv

    2016-07-19

    Cholesterol efflux from macrophages is a key process in reverse cholesterol transport and, therefore, might inhibit atherogenesis. 9-cis-β-carotene (9-cis-βc) is a precursor for 9-cis-retinoic-acid (9-cis-RA), which regulates macrophage cholesterol efflux. Our objective was to assess whether 9-cis-βc increases macrophage cholesterol efflux and induces the expression of cholesterol transporters. Enrichment of a mouse diet with βc from the alga Dunaliella led to βc accumulation in peritoneal macrophages. 9-cis-βc increased the mRNA levels of CYP26B1, an enzyme that regulates RA cellular levels, indicating the formation of RA from βc in RAW264.7 macrophages. Furthermore, 9-cis-βc, as well as all-trans-βc, significantly increased cholesterol efflux to high-density lipoprotein (HDL) by 50% in RAW264.7 macrophages. Likewise, food fortification with 9-cis-βc augmented cholesterol efflux from macrophages ex vivo. 9-cis-βc increased both the mRNA and protein levels of ABCA1 and apolipoprotein E (APOE) and the mRNA level of ABCG1. Our study shows, for the first time, that 9-cis-βc from the diet accumulates in peritoneal macrophages and increases cholesterol efflux to HDL. These effects might be ascribed to transcriptional induction of ABCA1, ABCG1, and APOE. These results highlight the beneficial effect of βc in inhibition of atherosclerosis by improving cholesterol efflux from macrophages.

  6. Assembly and disassembly of the Golgi complex: two processes arranged in a cis-trans direction

    PubMed Central

    1992-01-01

    We have studied the disassembly and assembly of two morphologically and functionally distinct parts of the Golgi complex, the cis/middle and trans cisterna/trans network compartments. For this purpose we have followed the redistribution of three cis/middle- (GMPc-1, GMPc-2, MG 160) and two trans- (GMPt-1 and GMPt-2) Golgi membrane proteins during and after treatment of normal rat kidney (NRK) cells with brefeldin A (BFA). BFA induced complete disassembly of the cis/middle- and trans- Golgi complex and translocation of GMPc and GMPt to the ER. Cells treated for short times (3 min) with BFA showed extensive disorganization of both cis/middle- and trans-Golgi complexes. However, complete disorganization of the trans part required much longer incubations with the drug. Upon removal of BFA the Golgi complex was reassembled by a process consisting of three steps: (a) exist of cis/middle proteins from the ER and their accumulation into vesicular structures scattered throughout the cytoplasm; (b) gradual relocation and accumulation of the trans proteins in the vesicles containing the cis/middle proteins; and (c) assembly of the cisternae, and reconstruction of the Golgi complex within an area located in the vicinity of the centrosome from which the ER was excluded. Reconstruction of the cis/middle-Golgi complex occurred under temperature conditions inhibitory of the reorganization of the trans- Golgi complex, and was dependent on microtubules. Reconstruction of the trans-Golgi complex, disrupted with nocodazole after selective fusion of the cis/middle-Golgi complex with the ER, occurred after the release of cis/middle-Golgi proteins from the ER and the assembly of the cis/middle cisternae. PMID:1730750

  7. Novel Insights into Interleukin 6 (IL-6) Cis- and Trans-signaling Pathways by Differentially Manipulating the Assembly of the IL-6 Signaling Complex*

    PubMed Central

    Lacroix, Marine; Rousseau, François; Guilhot, Florence; Malinge, Pauline; Magistrelli, Giovanni; Herren, Suzanne; Jones, Simon A.; Jones, Gareth W.; Scheller, Jürgen; Lissilaa, Rami; Kosco-Vilbois, Marie; Johnson, Zoë; Buatois, Vanessa; Ferlin, Walter

    2015-01-01

    The IL-6 signaling complex is described as a hexamer, formed by the association of two IL-6·IL-6 receptor (IL-6R)·gp130 trimers, with gp130 being the signal transducer inducing cis- and trans-mediated signaling via a membrane-bound or soluble form of the IL-6R, respectively. 25F10 is an anti-mouse IL-6R mAb that binds to both membrane-bound IL-6R and soluble IL-6R with the unique property of specifically inhibiting trans-mediated signaling events. In this study, epitope mapping revealed that 25F10 interacts at site IIb of IL-6R but allows the binding of IL-6 to the IL-6R and the recruitment of gp130, forming a trimer complex. Binding of 25F10 to IL-6R prevented the formation of the hexameric complex obligate for trans-mediated signaling, suggesting that the cis- and trans-modes of IL-6 signaling adopt different mechanisms for receptor complex assembly. To study this phenomenon also in the human system, we developed NI-1201, a mAb that targets, in the human IL-6R sequence, the epitope recognized by 25F10 for mice. Interestingly, NI-1201, however, did not selectively inhibit human IL-6 trans-signaling, although both mAbs produced beneficial outcomes in conditions of exacerbated IL-6 as compared with a site I-directed mAb. These findings shed light on the complexity of IL-6 signaling. First, triggering cis- versus trans-mediated IL-6 signaling occurs via distinctive mechanisms for receptor complex assembly in mice. Second, the formation of the receptor complex leading to cis- and trans-signaling biology in mice and humans is different, and this should be taken into account when developing strategies to inhibit IL-6 clinically. PMID:26363066

  8. Mimicking Exercise in Three-Dimensional Bioengineered Skeletal Muscle to Investigate Cellular and Molecular Mechanisms of Physiological Adaptation.

    PubMed

    Kasper, Andreas M; Turner, Daniel C; Martin, Neil R W; Sharples, Adam P

    2017-02-03

    Bioengineering of skeletal muscle in-vitro in order to produce highly aligned myofibres in relevant three dimensional (3D) matrices have allowed scientists to model the in-vivo skeletal muscle niche. This review discusses essential experimental considerations for developing bioengineered muscle in order to investigate exercise mimicking stimuli. We identify current knowledge in the use of electrical stimulation and co-culture with motor neurons to enhance skeletal muscle maturation and contractile function in bioengineered systems in-vitro. Importantly, we provide a current opinion on the use of acute and chronic exercise mimicking stimuli (electrical stimulation and mechanical overload) and the subsequent mechanisms underlying physiological adaptation in 3D bioengineered muscle. We also identify that future studies using the latest bioreactor technology, providing simultaneous electrical and mechanical loading and flow perfusion in-vitro, may provide the basis for advancing knowledge in the future. We also envisage, that more studies using genetic, pharmacological and hormonal modifications applied in human 3D bioengineered skeletal muscle may allow for an enhanced discovery of the in-depth mechanisms underlying the response to exercise in relevant human testing systems. Finally, 3D bioengineered skeletal muscle may provide an opportunity to be used as a pre-clinical in-vitro test-bed to investigate the mechanisms underlying catabolic disease, whilst modelling disease itself via the use of cells derived from human patients without exposing animals or humans (in phase I trials) to the side effects of potential therapies. This article is protected by copyright. All rights reserved.

  9. Determination of 9-cis beta-carotene and zeta-carotene in biological samples.

    PubMed

    Qin, Jian; Yeum, Kyung-Jin; Johnson, Elizabeth J; Krinsky, Norman I; Russell, Robert M; Tang, Guangwen

    2008-09-01

    Concentrations of 9-cis beta-carotene (9-cis betaC) and zeta-carotene (zetaC) in biological samples may provide crucial information on the biological activities of these carotenoids. However, in high-performance liquid chromatography (HPLC) these carotenoids are often co-eluted. Therefore, there is an urgent need to develop a method for 9-cis betaC and zetaC quantitation. Both 9-cis betaC and zetaC have peak absorbance at 400 and 450 nm, respectively, whereas only 9-cis betaC has peak absorbance at 475 nm. We developed a HPLC method to quantitate 9-cis betaC and zetaC by using peak absorbance ratios. The 9-cis betaC/zetaC peak area was monitored at 475, 450 and 400 nm. The 9-cis betaC was quantified by using absorbance value at 475 nm; zetaC was then calculated from the 9-cis betaC/zetaC peak at 400 nm by subtracting 9-cis betaC contribution at 400 nm using the 400-nm/475-nm peak absorbance ratio of 9-cis betaC (0.39). This method was applied to determine 9-cis betaC and zetaC concentrations in serum and breast milk samples (n=12) from American lactating women and serum and breast adipose tissue samples (n=16) from Korean women with either benign or malignant breast tumors. 9-cis betaC concentrations in serum and breast milk of American women, and serum and adipose tissue of Korean women were 7.1+/-0.8 and 1.1+/-0.2 nM, and 15.6+/-1.1 nM and 0.2+/-0.1 nmol/g, respectively. zetaC concentrations in the above samples were 54.2+/-7.2 and 8.3+/-1.8 nM, and 49.0+/-3.9 nM and 0.3+/-0.1 nmol/g, respectively.

  10. The autoimmunity-associated BLK haplotype exhibits cis-regulatory effects on mRNA and protein expression that are prominently observed in B cells early in development

    PubMed Central

    Simpfendorfer, Kim R.; Olsson, Lina M.; Manjarrez Orduño, Nataly; Khalili, Houman; Simeone, Alyssa M.; Katz, Matthew S.; Lee, Annette T.; Diamond, Betty; Gregersen, Peter K.

    2012-01-01

    The gene B lymphocyte kinase (BLK) is associated with rheumatoid arthritis, systemic lupus erythematosus and several other autoimmune disorders. The disease risk haplotype is known to be associated with reduced expression of BLK mRNA transcript in human B cell lines; however, little is known about cis-regulation of BLK message or protein levels in native cell types. Here, we show that in primary human B lymphocytes, cis-regulatory effects of disease-associated single nucleotide polymorphisms in BLK are restricted to naïve and transitional B cells. Cis-regulatory effects are not observed in adult B cells in later stages of differentiation. Allelic expression bias was also identified in primary human T cells from adult peripheral and umbilical cord blood (UCB), thymus and tonsil, although mRNA levels were reduced compared with B cells. Allelic regulation of Blk expression at the protein level was confirmed in UCB B cell subsets by intracellular staining and flow cytometry. Blk protein expression in CD4+ and CD8+ T cells was documented by western blot analysis; however, differences in protein expression levels by BLK genotype were not observed in any T cell subset. Blk allele expression differences at the protein level are thus restricted to early B cells, indicating that the involvement of Blk in the risk for autoimmune disease likely acts during the very early stages of B cell development. PMID:22678060

  11. Trapping and dynamic manipulation with magnetomotive photoacoustic imaging of targeted microspheres mimicking metastatic cancer cells trafficking in the vasculature

    NASA Astrophysics Data System (ADS)

    Wei, Chenwei; Xia, Jinjun; Pelivanov, Ivan; Hu, Xiaoge; Gao, Xiaohu; O'Donnell, Matthew

    2012-02-01

    Trapping and manipulation of micro-scale objects mimicking metastatic cancer cells in a flow field have been demonstrated with magnetomotive photoacoustic (mmPA) imaging. Coupled contrast agents combining gold nanorods (15 nm × 50 nm; absorption peak around 730 nm) with 15 nm diameter magnetic nanospheres were targeted to 10 μm polystyrene beads recirculating in a 1.6 mm diameter tube mimicking a human peripheral vessel. Targeted objects were then trapped by an external magnetic field produced by a dual magnet system consisting of two disc magnets separated by 6 cm to form a polarizing field (0.04 Tesla in the tube region) to magnetize the magnetic contrast agents, and a custom designed cone magnet array with a high magnetic field gradient (about 0.044 Tesla/mm in the tube region) producing a strong trapping force to magnetized contrast agents. Results show that polystyrene beads linked to nanocomposites can be trapped at flow rates up to 12 ml/min. It is shown that unwanted background in a photoacoustic image can be significantly suppressed by changing the position of the cone magnet array with respect to the tube, thus creating coherent movement of the trapped objects. This study makes mmPA imaging very promising for differential visualization of metastatic cells trafficking in the vasculature.

  12. Design of novel ligands of CDP-methylerythritol kinase by mimicking direct protein-protein and solvent-mediated interactions.

    PubMed

    Giménez-Oya, Victor; Villacañas, Oscar; Obiol-Pardo, Cristian; Antolin-Llovera, Meritxell; Rubio-Martinez, Jaime; Imperial, Santiago

    2011-01-01

    The methylerythritol 4-phosphate (MEP) pathway for the biosynthesis of the isoprenoid universal building blocks (isopentenyl diphosphate (IPP) and dimethylallyl diphosphate (DMAPP)) is present in most of human pathogens and is absent in animals, turning it into a promising therapeutic druggable pathway. Two different strategies, a pharmacophore-directed virtual screening and a protein-protein interaction (PPI)-mimicking cyclic peptide were used to search for compounds that bind to the PPI surface of the 4-(cytidine 5-diphospho)-2C-methyl-D-erythritol kinase (CMK), which catalyzes the fourth step of the MEP pathway. A significant part of the pharmacophore hypothesis used in this study was designed by mimicking water-mediated PPI relevant in the CMK homodimer complex stabilization. After database search and with the aid of docking and molecular dynamics (MD) simulations, a 7H-furo[3,2-g]chromen-7-one derivative and a cyclic peptide were chosen as candidates to be ligands of CMK. Their binding affinities were measured using surface plasmon resonance (SPR) technology.

  13. Low Thrust, Deep Throttling, US/CIS Integrated NTRE

    NASA Astrophysics Data System (ADS)

    Culver, Donald W.; Kolganov, Vyacheslav; Rochow, Richard F.

    1994-07-01

    In 1993 our international team performed a follow-on ``Nuclear Thermal Rocket Engine (NTRE) Extended Life Feasibility Assessment'' study for the Nuclear Propulsion Office (NPO) at NASAs Lewis Research Center. The main purpose of this study was to complete the 1992 study matrix to assess NTRE designs at thrust levels of 22.5, 11.3, and 6.8 tonnes, using Commonwealth of Independent States (CIS) reactor technology. An additional Aerojet goal was to continue improving the NTRE concept we had generated. Deep throttling, mission performance optimized engine design parametrics, and reliability/cost enhancing engine system simplifications were studied, because they seem to be the last three basic design improvements sorely needed by post-NERVA NTRE. Deep throttling improves engine life by eliminating damaging thermal and mechanical shocks caused by after-cooling with pulsed coolant flow. Alternately, it improves mission performance with steady flow after-cooling by minimizing reactor over-cooling. Deep throttling also provides a practical transition from high pressures and powers of the high thrust power cycle to the low pressures and powers of our electric power generating mode. Two deep throttling designs are discussed; a workable system that was studied and a simplified system that is recommended for future study. Mission-optimized engine thrust/weight (T/W) and Isp predictions are included along with system flow schemes and concept sketches.

  14. Detailed map of a cis-regulatory input function

    NASA Astrophysics Data System (ADS)

    Setty, Y.; Mayo, A. E.; Surette, M. G.; Alon, U.

    2003-06-01

    Most genes are regulated by multiple transcription factors that bind specific sites in DNA regulatory regions. These cis-regulatory regions perform a computation: the rate of transcription is a function of the active concentrations of each of the input transcription factors. Here, we used accurate gene expression measurements from living cell cultures, bearing GFP reporters, to map in detail the input function of the classic lacZYA operon of Escherichia coli, as a function of about a hundred combinations of its two inducers, cAMP and isopropyl -D-thiogalactoside (IPTG). We found an unexpectedly intricate function with four plateau levels and four thresholds. This result compares well with a mathematical model of the binding of the regulatory proteins cAMP receptor protein (CRP) and LacI to the lac regulatory region. The model is also used to demonstrate that with few mutations, the same region could encode much purer AND-like or even OR-like functions. This possibility means that the wild-type region is selected to perform an elaborate computation in setting the transcription rate. The present approach can be generally used to map the input functions of other genes.

  15. Using hexamers to predict cis-regulatory motifs in Drosophila

    PubMed Central

    Chan, Bob Y; Kibler, Dennis

    2005-01-01

    Background Cis-regulatory modules (CRMs) are short stretches of DNA that help regulate gene expression in higher eukaryotes. They have been found up to 1 megabase away from the genes they regulate and can be located upstream, downstream, and even within their target genes. Due to the difficulty of finding CRMs using biological and computational techniques, even well-studied regulatory systems may contain CRMs that have not yet been discovered. Results We present a simple, efficient method (HexDiff) based only on hexamer frequencies of known CRMs and non-CRM sequence to predict novel CRMs in regulatory systems. On a data set of 16 gap and pair-rule genes containing 52 known CRMs, predictions made by HexDiff had a higher correlation with the known CRMs than several existing CRM prediction algorithms: Ahab, Cluster Buster, MSCAN, MCAST, and LWF. After combining the results of the different algorithms, 10 putative CRMs were identified and are strong candidates for future study. The hexamers used by HexDiff to distinguish between CRMs and non-CRM sequence were also analyzed and were shown to be enriched in regulatory elements. Conclusion HexDiff provides an efficient and effective means for finding new CRMs based on known CRMs, rather than known binding sites. PMID:16253142

  16. Multigenome DNA sequence conservation identifies Hox cis-regulatory elements

    PubMed Central

    Kuntz, Steven G.; Schwarz, Erich M.; DeModena, John A.; De Buysscher, Tristan; Trout, Diane; Shizuya, Hiroaki; Sternberg, Paul W.; Wold, Barbara J.

    2008-01-01

    To learn how well ungapped sequence comparisons of multiple species can predict cis-regulatory elements in Caenorhabditis elegans, we made such predictions across the large, complex ceh-13/lin-39 locus and tested them transgenically. We also examined how prediction quality varied with different genomes and parameters in our comparisons. Specifically, we sequenced ∼0.5% of the C. brenneri and C. sp. 3 PS1010 genomes, and compared five Caenorhabditis genomes (C. elegans, C. briggsae, C. brenneri, C. remanei, and C. sp. 3 PS1010) to find regulatory elements in 22.8 kb of noncoding sequence from the ceh-13/lin-39 Hox subcluster. We developed the MUSSA program to find ungapped DNA sequences with N-way transitive conservation, applied it to the ceh-13/lin-39 locus, and transgenically assayed 21 regions with both high and low degrees of conservation. This identified 10 functional regulatory elements whose activities matched known ceh-13/lin-39 expression, with 100% specificity and a 77% recovery rate. One element was so well conserved that a similar mouse Hox cluster sequence recapitulated the native nematode expression pattern when tested in worms. Our findings suggest that ungapped sequence comparisons can predict regulatory elements genome-wide. PMID:18981268

  17. A Cis-Regulatory Map of the Drosophila Genome

    PubMed Central

    Nègre, Nicolas; Brown, Christopher D.; Ma, Lijia; Bristow, Christopher Aaron; Miller, Steven W.; Wagner, Ulrich; Kheradpour, Pouya; Eaton, Matthew L.; Loriaux, Paul; Sealfon, Rachel; Li, Zirong; Ishii, Haruhiko; Spokony, Rebecca F.; Chen, Jia; Hwang, Lindsay; Cheng, Chao; Auburn, Richard P.; Davis, Melissa B.; Domanus, Marc; Shah, Parantu K.; Morrison, Carolyn A.; Zieba, Jennifer; Suchy, Sarah; Senderowicz, Lionel; Victorsen, Alec; Bild, Nicholas A.; Grundstad, A. Jason; Hanley, David; MacAlpine, David M.; Mannervik, Mattias; Venken, Koen; Bellen, Hugo; White, Robert; Russell, Steven; Grossman, Robert L.; Ren, Bing; Gerstein, Mark; Posakony, James W.; Kellis, Manolis; White, Kevin P.

    2011-01-01

    Systematic annotation of gene regulatory elements is a major challenge in genome science. Direct mapping of chromatin modification marks and transcriptional factor binding sites genome-wide 1,2 has successfully identified specific subtypes of regulatory elements 3. In Drosophila several pioneering studies have provided genome-wide identification of Polycomb-Response Elements 4, chromatin states 5, transcription factor binding sites (TFBS) 6–9, PolII regulation 8, and insulator elements 10; however, comprehensive annotation of the regulatory genome remains a significant challenge. Here we describe results from the modENCODE cis-regulatory annotation project. We produced a map of the Drosophila melanogaster regulatory genome based on more than 300 chromatin immuno-precipitation (ChIP) datasets for eight chromatin features, five histone deacetylases (HDACs) and thirty-eight site-specific transcription factors (TFs) at different stages of development. Using these data we inferred more than 20,000 candidate regulatory elements and we validated a subset of predictions for promoters, enhancers, and insulators in vivo. We also identified nearly 2,000 genomic regions of dense TF binding associated with chromatin activity and accessibility. We discovered hundreds of new TF co-binding relationships and defined a TF network with over 800 potential regulatory relationships. PMID:21430782

  18. Cis-regulatory control of corticospinal system development and evolution

    PubMed Central

    Shim, Sungbo; Kwan, Kenneth Y.; Li, Mingfeng; Lefebvre, Veronique; Šestan, Nenad

    2012-01-01

    Summary The co-emergence of a six-layered cerebral neocortex and its corticospinal output system is one of the evolutionary hallmarks of mammals. However, the genetic programs that underlie their development and evolution remain poorly understood. Here we identify a conserved non-exonic element (E4) that acts as a cortex-specific enhancer for the nearby Fezf2, which is required for the specification of corticospinal neuron identity and connectivity. We find that SOX4 and SOX11 functionally compete with the repressor SOX5 in the trans-activation of E4. Cortex-specific double deletion of Sox4 and Sox11 leads to the loss of Fezf2 expression and failed specification of corticospinal neurons and, independent of Fezf2, a reeler-like inversion of layers. We show evidence supporting the emergence of functional SOX binding sites in E4 during tetrapod evolution and their subsequent stabilization in mammals and possibly amniotes. These findings reveal that SOX transcription factors converge onto a cis-acting element of Fezf2 and form critical components of a regulatory network controlling the identity and connectivity of corticospinal neurons. PMID:22678282

  19. Mechanism of cis-prenyltransferase reaction probed by substrate analogues

    SciTech Connect

    Lu, Yen-Pin; Liu, Hon-Ge; Teng, Kuo-Hsun; Liang, Po-Huang

    2010-10-01

    Research highlights: {yields} The extremely slow trans-OPPS reaction using 2-Fluoro-FPP supports the sequential mechanism with the carbocation intermediate. {yields} The similar UPPS reaction rate under single turnover supports the concerted mechanism, without the carbocation intermediate. {yields} The secondary kinetic isotope effect also supports associate transition state for UPPS reaction, without the carbocation intermediate. -- Abstract: Undecaprenyl pyrophosphate synthase (UPPS) is a cis-type prenyltransferases which catalyzes condensation reactions of farnesyl diphosphate (FPP) with eight isopentenyl pyrophosphate (IPP) units to generate C{sub 55} product. In this study, we used two analogues of FPP, 2-fluoro-FPP and [1,1-{sup 2}H{sub 2}]FPP, to probe the reaction mechanism of Escherichia coli UPPS. The reaction rate of 2-fluoro-FPP with IPP under single-turnover condition is similar to that of FPP, consistent with the mechanism without forming a farnesyl carbocation intermediate. Moreover, the deuterium secondary KIE of 0.985 {+-} 0.022 measured for UPPS reaction using [1,1-{sup 2}H{sub 2}]FPP supports the associative transition state. Unlike the sequential mechanism used by trans-prenyltransferases, our data demonstrate E. coli UPPS utilizes the concerted mechanism.

  20. cis,cis-Muconic acid: separation and catalysis to bio-adipic acid for nylon-6,6 polymerization

    SciTech Connect

    Vardon, Derek R.; Rorrer, Nicholas A.; Salvachúa, Davinia; Settle, Amy E.; Johnson, Christopher W.; Menart, Martin J.; Cleveland, Nicholas S.; Ciesielski, Peter N.; Steirer, K. Xerxes; Dorgan, John R.; Beckham, Gregg T.

    2016-01-01

    cis,cis-Muconic acid is a polyunsaturated dicarboxylic acid that can be produced renewably via the biological conversion of sugars and lignin-derived aromatic compounds. Subsequently, muconic acid can be catalytically converted to adipic acid -- the most commercially significant dicarboxylic acid manufactured from petroleum. Nylon-6,6 is the major industrial application for adipic acid, consuming 85% of market demand; however, high purity adipic acid (99.8%) is required for polymer synthesis. As such, process technologies are needed to effectively separate and catalytically transform biologically derived muconic acid to adipic acid in high purity over stable catalytic materials. To that end, this study: (1) demonstrates bioreactor production of muconate at 34.5 g L-1 in an engineered strain of Pseudomonas putida KT2440, (2) examines the staged recovery of muconic acid from culture media, (3) screens platinum group metals (e.g., Pd, Pt, Rh, Ru) for activity and leaching stability on activated carbon (AC) and silica supports, (4) evaluates the time-on-stream performance of Rh/AC in a trickle bed reactor, and (5) demonstrates the polymerization of bio-adipic acid to nylon-6,6. Separation experiments confirmed AC effectively removed broth color compounds, but subsequent pH/temperature shift crystallization resulted in significant levels of Na, P, K, S and N in the crystallized product. Ethanol dissolution of muconic acid precipitated bulk salts, achieving a purity of 99.8%. Batch catalysis screening reactions determined that Rh and Pd were both highly active compared to Pt and Ru, but Pd leached significantly (1-9%) from both AC and silica supports. Testing of Rh/AC in a continuous trickle bed reactor for 100 h confirmed stable performance after 24 h, although organic adsorption resulted in reduced steady-state activity. Lastly, polymerization of bio-adipic acid with hexamethyldiamine produced nylon-6,6 with comparable properties to its petrochemical counterpart

  1. Organic Compounds in the C3H6O3 Family: Microwave Spectrum of cis-cis Dimethyl Carbonate

    NASA Astrophysics Data System (ADS)

    McGuire, B. A.; Widicus Weaver, S. L.; Lovas, F. J.; Plusquellic, D. F.; Blake, G. A.

    2011-05-01

    A number of recent spectroscopic and observational efforts have focused on simple sugars and sugar alcohols because of their importance in prebiotic astro- chemistry. The simplest sugar-related species, glycolaldehyde, has been detected in Sgr B2(N), as have its C2H4O2 structural isomers acetic acid and methyl formate. Additional studies of the C3-sugars with empirical formula C3H6O3, glyceraldehyde and dihydroxyacetone, resulted in no clear interstellar detection. Structural isomerism is extensive in interstellar clouds, and there is a high level of correlation between the relative energies of isomers and their relative abundances, with the lowest energy isomers detected in greatest abundance. The detected members of the C2H4O2 family, however, defy this trend, having relative abundances of (acetic acid):(glycolaldehyde):(methyl formate) of about 2:1:52, despite acetic acid being the lowest energy isomer. These puzzling abundance ratios and the lack of detection of the C3H6O3 sugars gives rise to the question: "Which is the most likely isomer in the C3H6O3 family to be detectable in inter- stellar clouds?" In an attempt to answer this question, we carried out geometry optimization calculations to determine the relative binding energies of the 13 members of the C3H6O3 family. Of the four lowest- energy isomers, only lactic acid [CH3CH(OH)COOH] and dimethyl carbonate [(CH3)2CO3] are commercially available, and lactic acid has been previously investigated spectroscopically. We have therefore conducted a laboratory study of dimethyl carbonate, measuring its rotational spectrum from 8.4 - 25.3 GHz using a Fourier-Transform microwave spectrometer, and from 227 - 350 GHz using a direct absorption spectrometer. We report on the theoretical calculations performed on the C3H6O3 family of isomers, the experimental studies of cis-cis dimethyl carbonate, and the implica- tions of these results for interstellar chemistry. The details of this work are also reported in Lovas et

  2. Low aqueous solubility of 11-cis-retinal limits the rate of pigment formation and dark adaptation in salamander rods.

    PubMed

    Frederiksen, Rikard; Boyer, Nicholas P; Nickle, Benjamin; Chakrabarti, Kalyan S; Koutalos, Yiannis; Crouch, Rosalie K; Oprian, Daniel; Cornwall, M Carter

    2012-06-01

    We report experiments designed to test the hypothesis that the aqueous solubility of 11-cis-retinoids plays a significant role in the rate of visual pigment regeneration. Therefore, we have compared the aqueous solubility and the partition coefficients in photoreceptor membranes of native 11-cis-retinal and an analogue retinoid, 11-cis 4-OH retinal, which has a significantly higher solubility in aqueous medium. We have then correlated these parameters with the rates of pigment regeneration and sensitivity recovery that are observed when bleached intact salamander rod photoreceptors are treated with physiological solutions containing these retinoids. We report the following results: (a) 11-cis 4-OH retinal is more soluble in aqueous buffer than 11-cis-retinal. (b) Both 11-cis-retinal and 11-cis 4-OH retinal have extremely high partition coefficients in photoreceptor membranes, though the partition coefficient of 11-cis-retinal is roughly 50-fold greater than that of 11-cis 4-OH retinal. (c) Intact bleached isolated rods treated with solutions containing equimolar amounts of 11-cis-retinal or 11-cis 4-OH retinal form functional visual pigments that promote full recovery of dark current, sensitivity, and response kinetics. However, rods treated with 11-cis 4-OH retinal regenerated on average fivefold faster than rods treated with 11-cis-retinal. (d) Pigment regeneration from recombinant and wild-type opsin in solution is slower when treated with 11-cis 4-OH retinal than with 11-cis-retinal. Based on these observations, we propose a model in which aqueous solubility of cis-retinoids within the photoreceptor cytosol can place a limit on the rate of visual pigment regeneration in vertebrate photoreceptors. We conclude that the cytosolic gap between the plasma membrane and the disk membranes presents a bottleneck for retinoid flux that results in slowed pigment regeneration and dark adaptation in rod photoreceptors.

  3. Cis-trans isomerizations of beta-carotene and lycopene: a theoretical study.

    PubMed

    Guo, Wen-Hsin; Tu, Cheng-Yi; Hu, Ching-Han

    2008-09-25

    The all-trans to mono-cis isomerizations of polyenes and two C40H56 carotenes, beta-carotene and lycopene, at the ground singlet (S0) and triplet (T1) states are studied by means of quantum chemistry computations. At the S0 state of polyenes containing n acetylene units (Pn), we find that the energy barrier of the central C=C rotation decreases with n. In contrast, however, at the T 1 state, the rotational barrier increases with n. For the C40H56 carotenes, the rotational barriers of lycopene are lower than those of their beta-carotene counterparts. This difference renders the rotational rates of lycopene to be 1-2 orders of magnitude higher than those of beta-carotene at room temperature. For both these carotenes, the barrier is lowest for the rotation toward the 13-cis isomer. The relative abundances are in the following order: all-trans > 9-cis > 13-cis > 15-cis. Although the 5-cis isomer of lycopene has the lowest energy among the cis isomers, its formation from the all-trans form is restricted, owing to a very large rotational barrier. The possible physiological implications of this study are discussed.

  4. Thermal processing differentially affects lycopene and other carotenoids in cis-lycopene containing, tangerine tomatoes.

    PubMed

    Cooperstone, Jessica L; Francis, David M; Schwartz, Steven J

    2016-11-01

    Tangerine tomatoes, unlike red tomatoes, accumulate cis-lycopenes instead of the all-trans isomer. cis-Lycopene is the predominating isomeric form of lycopene found in blood and tissues. Our objective was to understand how thermal processing and lipid concentration affect carotenoid isomerisation and degradation in tangerine tomatoes. We conducted duplicated factorial designed experiments producing tangerine tomato juice and sauce, varying both processing time and lipid concentration. Carotenoids were extracted and analysed using high-performance liquid chromatography with photodiode array detection. Phytoene, phytofluene, ζ-carotene, neurosporene, tetra-cis-lycopene, all-trans-lycopene and other-cis-lycopenes were quantified. Tetra-cis-lycopene decreased with increasing heating time and reached 80% of the original level in sauce after processing times of 180min. All-trans-lycopene and other-cis-lycopenes increased with longer processing times. Total carotenoids and total lycopene decreased with increased heating times while phytoene and phytofluene were unchanged. These data suggest limiting thermal processing of tangerine tomato products if delivery of tetra-cis-lycopene is desirable.

  5. Synchrony and motor mimicking in chimpanzee observational learning

    PubMed Central

    Fuhrmann, Delia; Ravignani, Andrea; Marshall-Pescini, Sarah; Whiten, Andrew

    2014-01-01

    Cumulative tool-based culture underwrote our species' evolutionary success, and tool-based nut-cracking is one of the strongest candidates for cultural transmission in our closest relatives, chimpanzees. However the social learning processes that may explain both the similarities and differences between the species remain unclear. A previous study of nut-cracking by initially naïve chimpanzees suggested that a learning chimpanzee holding no hammer nevertheless replicated hammering actions it witnessed. This observation has potentially important implications for the nature of the social learning processes and underlying motor coding involved. In the present study, model and observer actions were quantified frame-by-frame and analysed with stringent statistical methods, demonstrating synchrony between the observer's and model's movements, cross-correlation of these movements above chance level and a unidirectional transmission process from model to observer. These results provide the first quantitative evidence for motor mimicking underlain by motor coding in apes, with implications for mirror neuron function. PMID:24923651

  6. Mimicking Neural Stem Cell Niche by Biocompatible Substrates

    PubMed Central

    Regalado-Santiago, Citlalli; Juárez-Aguilar, Enrique; Olivares-Hernández, Juan David; Tamariz, Elisa

    2016-01-01

    Neural stem cells (NSCs) participate in the maintenance, repair, and regeneration of the central nervous system. During development, the primary NSCs are distributed along the ventricular zone of the neural tube, while, in adults, NSCs are mainly restricted to the subependymal layer of the subventricular zone of the lateral ventricles and the subgranular zone of the dentate gyrus in the hippocampus. The circumscribed areas where the NSCs are located contain the secreted proteins and extracellular matrix components that conform their niche. The interplay among the niche elements and NSCs determines the balance between stemness and differentiation, quiescence, and proliferation. The understanding of niche characteristics and how they regulate NSCs activity is critical to building in vitro models that include the relevant components of the in vivo niche and to developing neuroregenerative approaches that consider the extracellular environment of NSCs. This review aims to examine both the current knowledge on neurogenic niche and how it is being used to develop biocompatible substrates for the in vitro and in vivo mimicking of extracellular NSCs conditions. PMID:26880934

  7. Trastuzumab-Induced Myocardiotoxicity Mimicking Acute Coronary Syndrome

    PubMed Central

    Ribeiro, K.B.; Miranda, C.H.; Andrade, J.M.; Galli, L.G.; Tiezzi, D.G.; Oliveira, H.F.; Zola, F.E.; Volpe, G.; Pazin-Filho, A.; Peria, F.M.

    2012-01-01

    Trastuzumab is an important biological agent in the treatment of HER2-positive breast cancer, with effects on response rates, progression-free survival, overall survival and quality of life. Although this drug is well tolerated in terms of adverse effects, trastuzumab-associated myocardiotoxicity has been described to have an incidence of 0.6–4.5% and in rare cases, the drug can trigger severe congestive heart failure with progression to death or even mimic acute coronary syndrome with complete left bundle branch blockade. In this paper is reported a case of trastuzumab-associated myocardiotoxicity manifesting as acute coronary syndrome in a 69-year-old female. The patient is currently undergoing a conservative clinical treatment that restricts overexertion. The majority of clinical studies report trastuzumab-induced cardiotoxicity as a rare event, and, when present, characterized by mild to moderate clinical signs, the ease of reversibility with pharmacological measures and the temporary discontinuation of the medication. Conversely, it is vital for the oncologist/cardiologist to consider the possibility that trastuzumab-induced cardiotoxicity may manifest itself as a severe clinical case, mimicking acute coronary syndrome, justifying careful risk stratification and adequate cardiac monitoring, especially in high-risk patients. PMID:22666200

  8. Idiopathic Transverse Myelitis Mimicking an Intramedullary Spinal Cord Tumor

    PubMed Central

    Fanous, Andrew A.; Olszewski, Nathan P.; Lipinski, Lindsay J.; Qiu, Jingxin

    2016-01-01

    The differential diagnoses for spinal cord lesions include spinal tumors and inflammatory processes. The distinction between these pathologies can be difficult if solely based on imaging. We report for the first time to our knowledge a case of idiopathic transverse myelitis (ITM) mimicking a discrete cervical spinal lesion in a 66-year-old man who presented with gait instability and neck pain. The patient's symptoms failed to resolve after an initial course of steroid therapy. Surgical biopsy confirmed the diagnosis of ITM. Subsequent treatment with dexamethasone resulted in complete resolution of the symptoms as well as the intramedullary enhancement. ITM is most common in the cervical and thoracic spine, spanning 3-4 spinal segments. It usually occupies more than 50% of the cross-sectional area of the spinal cord and tends to be central, uniform, and symmetric. It exhibits patchy and peripheral contrast enhancement. These criteria are useful guidelines that help distinguish ITM from neoplastic spinal lesions. A decision to perform biopsy must take into consideration the patient's clinical symptoms, the rate of progression of neurological deficits, and the imaging characteristics of the lesion. Surgical biopsy for questionable lesions should be reserved for patients with progressive neurological deficits refractory to empirical medical therapy. PMID:27672469

  9. Acoustic resolution photoacoustic Doppler velocimetry in blood-mimicking fluids

    NASA Astrophysics Data System (ADS)

    Brunker, Joanna; Beard, Paul

    2016-02-01

    Photoacoustic Doppler velocimetry provides a major opportunity to overcome limitations of existing blood flow measuring methods. By enabling measurements with high spatial resolution several millimetres deep in tissue, it could probe microvascular blood flow abnormalities characteristic of many different diseases. Although previous work has demonstrated feasibility in solid phantoms, measurements in blood have proved significantly more challenging. This difficulty is commonly attributed to the requirement that the absorber spatial distribution is heterogeneous relative to the minimum detectable acoustic wavelength. By undertaking a rigorous study using blood-mimicking fluid suspensions of 3 μm absorbing microspheres, it was discovered that the perceived heterogeneity is not only limited by the intrinsic detector bandwidth; in addition, bandlimiting due to spatial averaging within the detector field-of-view also reduces perceived heterogeneity and compromises velocity measurement accuracy. These detrimental effects were found to be mitigated by high-pass filtering to select photoacoustic signal components associated with high heterogeneity. Measurement under-reading due to limited light penetration into the flow vessel was also observed. Accurate average velocity measurements were recovered using “range-gating”, which furthermore maps the cross-sectional velocity profile. These insights may help pave the way to deep-tissue non-invasive mapping of microvascular blood flow using photoacoustic methods.

  10. Acoustic resolution photoacoustic Doppler velocimetry in blood-mimicking fluids.

    PubMed

    Brunker, Joanna; Beard, Paul

    2016-02-19

    Photoacoustic Doppler velocimetry provides a major opportunity to overcome limitations of existing blood flow measuring methods. By enabling measurements with high spatial resolution several millimetres deep in tissue, it could probe microvascular blood flow abnormalities characteristic of many different diseases. Although previous work has demonstrated feasibility in solid phantoms, measurements in blood have proved significantly more challenging. This difficulty is commonly attributed to the requirement that the absorber spatial distribution is heterogeneous relative to the minimum detectable acoustic wavelength. By undertaking a rigorous study using blood-mimicking fluid suspensions of 3 μm absorbing microspheres, it was discovered that the perceived heterogeneity is not only limited by the intrinsic detector bandwidth; in addition, bandlimiting due to spatial averaging within the detector field-of-view also reduces perceived heterogeneity and compromises velocity measurement accuracy. These detrimental effects were found to be mitigated by high-pass filtering to select photoacoustic signal components associated with high heterogeneity. Measurement under-reading due to limited light penetration into the flow vessel was also observed. Accurate average velocity measurements were recovered using "range-gating", which furthermore maps the cross-sectional velocity profile. These insights may help pave the way to deep-tissue non-invasive mapping of microvascular blood flow using photoacoustic methods.

  11. Moderately nonlinear ultrasound propagation in blood-mimicking fluid.

    PubMed

    Kharin, Nikolay A; Vince, D Geoffrey

    2004-04-01

    In medical diagnostic ultrasound (US), higher than-in-water nonlinearity of body fluids and tissue usually does not produce strong nonlinearly distorted waves because of the high absorption. The relative influence of absorption and nonlinearity can be characterized by the Gol'dberg number Gamma. There are two limiting cases in nonlinear acoustics: weak waves (Gamma < 1) or strong waves (Gamma > 1). However, at diagnostic frequencies in tissue and body fluids, the nonlinear effects and effects of absorption more likely are comparable (Gol'dberg number Gamma approximately 1). The aim of this work was to study the nonlinear propagation of a moderately nonlinear US second harmonic signal in a blood-mimicking fluid. Quasilinear solutions to the KZK equation are presented, assuming radiation from a flat and geometrically focused circular Gaussian source. The solutions are expressed in a new simplified closed form and are in very good agreement with those of previous studies measuring and modeling Gaussian beams. The solutions also show good agreement with the measurements of the beams produced by commercially available transducers, even without special Gaussian shading.

  12. Idiopathic hypertrophic pachymeningitis mimicking prolactinoma with recurrent vision loss.

    PubMed

    Lok, Julie Y C; Yip, Nelson K F; Chong, Kelvin K L; Li, C L; Young, Alvin L

    2015-08-01

    Idiopathic hypertrophic pachymeningitis is a rare inflammatory condition with diffuse thickening of the dura mater, which may cause a compressive effect or vascular compromise. We report on a 28-year-old Chinese woman with a history of granulomatous mastitis 7 years previously and oligomenorrhoea, headache, blurred vision, and raised prolactin level 2 years previously, that was diagnosed as prolactinoma and treated conservatively with bromocriptine. However, she had recurrent bilateral vision loss when the bromocriptine was stopped. Her symptoms were resolved by high-dose steroid injection but remained steroid-dependent. Serial magnetic resonance imaging scan showed progressive diffuse thickening of the pachymeningitis with disappearance of pituitary apoplexy. Lumbar puncture showed lymphocytosis with no organisms. Open biopsy of the meninges was performed and histology showed features of inflammatory infiltrates and vasculitis. This is an unusual presentation of a rare condition in this age-group, with co-existing granulomatous mastitis and chronic otitis media, and is a diagnostic challenge mimicking pituitary macroadenoma and meningioma in initial magnetic resonance imaging scans.

  13. Extramedullary Plasmacytoma Mimicking Pancreatic Cancer: An Unusual Presentation

    PubMed Central

    Sciancalepore, Daniela; Musci, Sergio; Fracella, Maria Rosaria; D'Alesio, Grazia; Sportelli, Azzurra; Ingravallo, Giuseppe; Vacca, Angelo

    2016-01-01

    Multiple myeloma is a plasma cell tumor that homes to and expands in the bone marrow and that, despite the new available drugs, remains incurable. Extramedullary plasmacytoma is a not frequent manifestation during the natural history of multiple myeloma and is frequently associated with plasma cell bone marrow infiltration. The most common locations for an EMP include the gastrointestinal tract, pleura, testis, skin, peritoneum, liver, endocrine glands, and lymph nodes. Primary involvement of the gallbladder fossa is exceedingly rare. In this report, we describe a patient with multiple myeloma who achieved a clinical and serological remission after autologous transplant but progressed rapidly at extramedullary site mimicking a second cancer (i.e., pancreatic or biliary cancer). In this case, the extramedullary localization was refractory to standard therapy, differently from bone marrow localization, but responded to lymphoma-like therapy. In this patient (i) the particular site of developing plasmacytoma is the gallbladder fossa, (ii) the timing of onset of this neoplasm is immediately after autologous transplant, and (iii) its disjunction from primary myeloma is that it appears in clinical and serological remission phase which may be confounding during the diagnostic approach simulating a different tumor (solid tumor). PMID:27847663

  14. Mimicking static anisotropic fluid spheres in general relativity

    NASA Astrophysics Data System (ADS)

    Boonserm, Petarpa; Ngampitipan, Tritos; Visser, Matt

    2016-11-01

    We argue that an arbitrary general relativistic static anisotropic fluid sphere, (static and spherically symmetric but with transverse pressure not equal to radial pressure), can nevertheless be successfully mimicked by suitable linear combinations of theoretically attractive and quite simple classical matter: a classical (charged) isotropic perfect fluid, a classical electromagnetic field and a classical (minimally coupled) scalar field. While the most general decomposition is not unique, a preferred minimal decomposition can be constructed that is unique. We show how the classical energy conditions for the anisotropic fluid sphere can be related to energy conditions for the isotropic perfect fluid, electromagnetic field, and scalar field components of the model. Furthermore, we show how this decomposition relates to the distribution of both electric charge density and scalar charge density throughout the model. The generalized TOV equation implies that the perfect fluid component in this model is automatically in internal equilibrium, with pressure forces, electric forces, and scalar forces balancing the gravitational pseudo-force. Consequently, we can build theoretically attractive matter models that can be used to mimic almost any static spherically symmetric spacetime.

  15. Wernicke's Encephalopathy Mimicking Acute Onset Stroke Diagnosed by CT Perfusion

    PubMed Central

    Advani, Rajiv; Kurz, Kathinka D.; Kurz, Martin W.

    2014-01-01

    Background. Metabolic syndromes such as Wernicke's encephalopathy may present with a sudden neurological deficit, thus mimicking acute onset stroke. Due to current emphasis on rapid admission and treatment of acute stroke patients, there is a significant risk that these stroke mimics may end up being treated with thrombolysis. Rigorous clinical and radiological skills are necessary to correctly identify such metabolic stroke mimics, in order to avoid doing any harm to these patients due to the unnecessary use of thrombolysis. Patient. A 51-year-old Caucasian male was admitted to our hospital with suspicion of an acute stroke due to sudden onset dysarthria and unilateral facial nerve paresis. Clinical examination revealed confusion and dysconjugate gaze. Computed tomography (CT) including a CT perfusion (CTP) scan revealed bilateral thalamic hyperperfusion. The use of both clinical and radiological findings led to correctly diagnosing Wernicke's encephalopathy. Conclusion. The application of CTP as a standard diagnostic tool in acute stroke patients can improve the detection of stroke mimics caused by metabolic syndromes as shown in our case report. PMID:24716022

  16. Mimicking Oxygen delivery and waste removal functions of blood.

    PubMed

    Zhang, Huaifa; Barralet, Jake E

    2017-02-15

    In addition to immunological and wound healing cell and platelet delivery, ion stasis and nutrient supply, blood delivers oxygen to cells and tissues and removes metabolic wastes. For decades researchers have been trying to develop approaches that mimic these two immediately vital functions of blood. Oxygen is crucial for the long-term survival of tissues and cells in vertebrates. Hypoxia (oxygen deficiency) and even at times anoxia (absence of oxygen) can occur during organ preservation, organ and cell transplantation, wound healing, in tumors and engineering of tissues. Different approaches have been developed to deliver oxygen to tissues and cells, including hyperbaric oxygen therapy (HBOT), normobaric hyperoxia therapy (NBOT), using biochemical reactions and electrolysis, employing liquids with high oxygen solubility, administering hemoglobin, myoglobin and red blood cells (RBCs), introducing oxygen-generating agents, using oxygen-carrying microparticles, persufflation, and peritoneal oxygenation. Metabolic waste accumulation is another issue in biological systems when blood flow is insufficient. Metabolic wastes change the microenvironment of cells and tissues, influence the metabolic activities of cells, and ultimately cause cell death. This review examines advances in blood mimicking systems in the field of biomedical engineering in terms of oxygen delivery and metabolic waste removal.

  17. Riboswitch Structure: an Internal Residue Mimicking the Purine Ligand

    SciTech Connect

    Delfosse, V.; Bouchard, P; Bonneau, E; Dagenais, P; Lemay, J; Lafontaine, D; Legault, P

    2009-01-01

    The adenine and guanine riboswitches regulate gene expression in response to their purine ligand. X-ray structures of the aptamer moiety of these riboswitches are characterized by a compact fold in which the ligand forms a Watson-Crick base pair with residue 65. Phylogenetic analyses revealed a strict restriction at position 39 of the aptamer that prevents the G39-C65 and A39-U65 combinations, and mutational studies indicate that aptamers with these sequence combinations are impaired for ligand binding. In order to investigate the rationale for sequence conservation at residue 39, structural characterization of the U65C mutant from Bacillus subtilis pbuE adenine riboswitch aptamer was undertaken. NMR spectroscopy and X-ray crystallography studies demonstrate that the U65C mutant adopts a compact ligand-free structure, in which G39 occupies the ligand-binding site of purine riboswitch aptamers. These studies present a remarkable example of a mutant RNA aptamer that adopts a native-like fold by means of ligand mimicking and explain why this mutant is impaired for ligand binding. Furthermore, this work provides a specific insight into how the natural sequence has evolved through selection of nucleotide identities that contribute to formation of the ligand-bound state, but ensures that the ligand-free state remains in an active conformation.

  18. Multimodal 3D cancer-mimicking optical phantom

    PubMed Central

    Smith, Gennifer T.; Lurie, Kristen L.; Zlatev, Dimitar V.; Liao, Joseph C.; Ellerbee Bowden, Audrey K.

    2016-01-01

    Three-dimensional (3D) organ-mimicking phantoms provide realistic imaging environments for testing various aspects of optical systems, including for evaluating new probe designs, characterizing the diagnostic potential of new technologies, and assessing novel image processing algorithms prior to validation in real tissue. We introduce and characterize the use of a new material, Dragon Skin (Smooth-On Inc.), and fabrication technique, air-brushing, for fabrication of a 3D phantom that mimics the appearance of a real organ under multiple imaging modalities. We demonstrate the utility of the material and technique by fabricating the first 3D, hollow bladder phantom with realistic normal and multi-stage pathology features suitable for endoscopic detection using the gold standard imaging technique, white light cystoscopy (WLC), as well as the complementary imaging modalities of optical coherence tomography and blue light cystoscopy, which are aimed at improving the sensitivity and specificity of WLC to bladder cancer detection. The flexibility of the material and technique used for phantom construction allowed for the representation of a wide range of diseased tissue states, ranging from inflammation (benign) to high-grade cancerous lesions. Such phantoms can serve as important tools for trainee education and evaluation of new endoscopic instrumentation. PMID:26977369

  19. Quadrivalvular marantic endocarditis (ME) mimicking acute bacterial endocarditis (ABE).

    PubMed

    Durie, Nicole M; Eisenstein, Lawrence E; Cunha, Burke A; Plummer, Maria Maratta

    2007-01-01

    Marantic endocarditis (ME) is defined by noninfectious valvular vegetations. The most common disorders associated with ME are malignancy with or without hypercoagulable state, intercardiac instrumentation, residual vegetations from previously treated infective endocarditis (IE), renal insufficiency, and burns. Another important cause of ME is systemic lupus erythematosus when accompanied by vegetations, that is, Libman-Sacks endocarditis. ME should be differentiated from IE because they may present with similar clinical features. Both ME and IE may present with fever and a heart murmur with or without embolic phenomenon. Leukocytosis and elevated erythrocyte sedimentation rate suggest the diagnosis of IE. The hallmark of IE is a cardiac vegetation and continuous high-grade bacteremia. After exclusion of the causes of culture negative endocarditis, the absence of bacteremia clearly differentiates ME from IE. We present a case of ME mimicking acute bacterial endocarditis (ABE). The differential diagnostic features of ME versus IE are discussed. To the best of our knowledge, this is the first reported case of quadrivalvular ME with massive vegetations on all cardiac valves, as well as the aorta, atria, and pulmonary artery.

  20. Acoustic resolution photoacoustic Doppler velocimetry in blood-mimicking fluids

    PubMed Central

    Brunker, Joanna; Beard, Paul

    2016-01-01

    Photoacoustic Doppler velocimetry provides a major opportunity to overcome limitations of existing blood flow measuring methods. By enabling measurements with high spatial resolution several millimetres deep in tissue, it could probe microvascular blood flow abnormalities characteristic of many different diseases. Although previous work has demonstrated feasibility in solid phantoms, measurements in blood have proved significantly more challenging. This difficulty is commonly attributed to the requirement that the absorber spatial distribution is heterogeneous relative to the minimum detectable acoustic wavelength. By undertaking a rigorous study using blood-mimicking fluid suspensions of 3 μm absorbing microspheres, it was discovered that the perceived heterogeneity is not only limited by the intrinsic detector bandwidth; in addition, bandlimiting due to spatial averaging within the detector field-of-view also reduces perceived heterogeneity and compromises velocity measurement accuracy. These detrimental effects were found to be mitigated by high-pass filtering to select photoacoustic signal components associated with high heterogeneity. Measurement under-reading due to limited light penetration into the flow vessel was also observed. Accurate average velocity measurements were recovered using “range-gating”, which furthermore maps the cross-sectional velocity profile. These insights may help pave the way to deep-tissue non-invasive mapping of microvascular blood flow using photoacoustic methods. PMID:26892989

  1. Mimicking the magnetic properties of rare earth elements using superatoms.

    PubMed

    Cheng, Shi-Bo; Berkdemir, Cuneyt; Castleman, A W

    2015-04-21

    Rare earth elements (REs) consist of a very important group in the periodic table that is vital to many modern technologies. The mining process, however, is extremely damaging to the environment, making them low yield and very expensive. Therefore, mimicking the properties of REs in a superatom framework is especially valuable but at the same time, technically challenging and requiring advanced concepts about manipulating properties of atom/molecular complexes. Herein, by using photoelectron imaging spectroscopy, we provide original idea and direct experimental evidence that chosen boron-doped clusters could mimic the magnetic characteristics of REs. Specifically, the neutral LaB and NdB clusters are found to have similar unpaired electrons and magnetic moments as their isovalent REs (namely Nd and Eu, respectively), opening up the great possibility in accomplishing rare earth mimicry. Extension of the superatom concept into the rare earth group not only further shows the power and advance of this concept but also, will stimulate more efforts to explore new superatomic clusters to mimic the chemistry of these heavy atoms, which will be of great importance in designing novel building blocks in the application of cluster-assembled nanomaterials. Additionally, based on these experimental findings, a novel "magic boron" counting rule is proposed to estimate the numbers of unpaired electrons in diatomic LnB clusters.

  2. Pulmonary Actinomycosis Mimicking Pulmonary Aspergilloma and a Brief Review of the Literature

    PubMed Central

    Higashi, Yoshitsugu; Nakamura, Shigeki; Ashizawa, Nobuyuki; Oshima, Kazuhiro; Tanaka, Akitaka; Miyazaki, Taiga; Izumikawa, Koichi; Yanagihara, Katsunori; Yamamoto, Yoshihiro; Miyazaki, Yoshitsugu; Mukae, Hiroshi; Kohno, Shigeru

    2017-01-01

    Pulmonary actinomycosis is a rare pulmonary infection that often exhibits unspecific symptoms and radiological findings. We herein report a case of pulmonary actinomycosis that mimicked pulmonary aspergilloma in an immunocompetent patient. PMID:28202870

  3. Noninvasive elasticity imaging in small vessels: validation on tissue-mimicking phantoms

    NASA Astrophysics Data System (ADS)

    Maurice, Roch L.; Daronat, Michel; Pivert, Nicolas; Foster, F. S.; Cloutier, Guy

    2004-04-01

    Non-invasive ultrasound elastography (NIVE) was recently introduced to characterize mechanical properties of superficial arteries. In this paper, the feasibility of NIVE for the purpose of studying small vessels in humans and small animals is investigated. The experiments were performed in vitro on vessel-mimicking phantoms of 1.5-mm lumen diameter and 1.5-mm wall thickness. Polyvinyl alcohol cryogel (PVA-C) was used to create double layer vessel walls. The stiffness of the interior portion of the vessels was made softer. The vessels were insonified at 32 MHz with an ultrasound biomicroscope. Radial stress was applied within the lumen of the phantom by applying incremental static pressure steps with a column of a flowing mixture of water-glycerol. The Lagrangian speckle tissue model estimator was used to assess the 2D-strain tensor, and the composite Von Mises elastograms were then computed. The two-layer vessel walls were clearly identifiable. Strain values close to 3% were measured for the interior portion, whereas strains around 1% were noted for the stiffer outside layer. In conclusion, the feasibility of NIVE for small vessel elasticity imaging was demonstrated in vitro.

  4. Fasting-Mimicking Diet Promotes Ngn3-Driven β-Cell Regeneration to Reverse Diabetes.

    PubMed

    Cheng, Chia-Wei; Villani, Valentina; Buono, Roberta; Wei, Min; Kumar, Sanjeev; Yilmaz, Omer H; Cohen, Pinchas; Sneddon, Julie B; Perin, Laura; Longo, Valter D

    2017-02-23

    Stem-cell-based therapies can potentially reverse organ dysfunction and diseases, but the removal of impaired tissue and activation of a program leading to organ regeneration pose major challenges. In mice, a 4-day fasting mimicking diet (FMD) induces a stepwise expression of Sox17 and Pdx-1, followed by Ngn3-driven generation of insulin-producing β cells, resembling that observed during pancreatic development. FMD cycles restore insulin secretion and glucose homeostasis in both type 2 and type 1 diabetes mouse models. In human type 1 diabetes pancreatic islets, fasting conditions reduce PKA and mTOR activity and induce Sox2 and Ngn3 expression and insulin production. The effects of the FMD are reversed by IGF-1 treatment and recapitulated by PKA and mTOR inhibition. These results indicate that a FMD promotes the reprogramming of pancreatic cells to restore insulin generation in islets from T1D patients and reverse both T1D and T2D phenotypes in mouse models. PAPERCLIP.

  5. i-cisTarget: an integrative genomics method for the prediction of regulatory features and cis-regulatory modules.

    PubMed

    Herrmann, Carl; Van de Sande, Bram; Potier, Delphine; Aerts, Stein

    2012-08-01

    The field of regulatory genomics today is characterized by the generation of high-throughput data sets that capture genome-wide transcription factor (TF) binding, histone modifications, or DNAseI hypersensitive regions across many cell types and conditions. In this context, a critical question is how to make optimal use of these publicly available datasets when studying transcriptional regulation. Here, we address this question in Drosophila melanogaster for which a large number of high-throughput regulatory datasets are available. We developed i-cisTarget (where the 'i' stands for integrative), for the first time enabling the discovery of different types of enriched 'regulatory features' in a set of co-regulated sequences in one analysis, being either TF motifs or 'in vivo' chromatin features, or combinations thereof. We have validated our approach on 15 co-expressed gene sets, 21 ChIP data sets, 628 curated gene sets and multiple individual case studies, and show that meaningful regulatory features can be confidently discovered; that bona fide enhancers can be identified, both by in vivo events and by TF motifs; and that combinations of in vivo events and TF motifs further increase the performance of enhancer prediction.

  6. cis-trans-Isomerization of unsaturated fatty acids during /γ-irradiation of barley grains

    NASA Astrophysics Data System (ADS)

    Geißler, Christian; Brede, Ortwin; Reinhardt, Jürgen

    2003-06-01

    Gamma-irradiating barley grains with doses of 10-100 kGy, a dose dependent isomerization of the naturally occurring cis-unsaturated fatty acids such as oleic, cis-vaccenic, linoleic and also of linolenic acid was found. Whereas the effect was negligible up to 10 kGy, at 50 kGy the trans-fatty acid level became comparable to that of other natural products like butter fat which means that there is no essential nutrition danger. The cis-trans-isomerization found in barley grains is explained mainly by a thiyl radical driven process rather than direct isomerization.

  7. Diastereoselective syntheses of substituted cis-hydrindanones featuring sequential inter- and intramolecular Michael reactions.

    PubMed

    Liu, Junjia; Marsini, Maurice A; Bedell, T Aaron; Reider, Paul J; Sorensen, Erik J

    2016-06-30

    The hydrindane (bicyclo[4.3.0]nonane) structural motif (1) and related cis-1-hydrindanone skeleton (2) are common substructures in many natural products. Herein, we describe efficient access to substituted cis-1-hydrindanones enabled by a sequence of Michael reactions. A copper-catalyzed intermolecular Michael addition of a cyclic silyl ketene acetal to a β-substituted-α-alkoxycarbonyl-cyclopentenone enables construction of a quaternary center and is followed, after incorporation of an additional Michael acceptor, by a second, intramolecular addition of a nucleophilic β-ketoester. This strategy affords stereoselective access to substituted bicyclic cis-hydrindanone ring systems containing up to three contiguous stereocenters.

  8. Designing CIS to improve decisions in depression disease management: a discourse analysis of front line practice.

    PubMed

    Mirel, Barbara; Ackerman, Mark S; Kerber, Kevin; Klinkman, Michael

    2006-01-01

    Clinical care management promises to help diminish the major health problem of depression. To realize this promise, front line clinicians must know which care management interventions are best for which patients and act accordingly. Unfortunately, the detailed intervention data required for such differentiated assessments are missing in most clinical information systems (CIS). To determine frontline clinicians' needs for these data and to identify the data that CIS should keep, we conducted an 18 month ethnographic study and discourse analysis of telehealth depression care management. Results show care managers need data-based evidence to choose best options, and discourse analysis suggests some personalized interventions that CIS should and can feasibly capture for evidence.

  9. A Mutational Analysis of the Active Site Loop Residues in cis-3-Chloroacrylic Acid Dehalogenase

    PubMed Central

    Schroeder, Gottfried K.; Huddleston, Jamison P.; Johnson, William H.; Whitman, Christian P.

    2013-01-01

    cis -3-Chloroacrylic acid dehalogenase (cis-CaaD) from Pseudomonas pavonaceae 170 and a homologue from Corynebacterium glutamicum designated Cg10062 share 34% sequence identity (54% similarity). The former catalyzes a key step in a bacterial catabolic pathway for the nematocide 1,3-dichloropropene, whereas the latter has no known biological activity. Although Cg10062 has the six active site residues (Pro-1, His-28, Arg-70, Arg-73, Tyr-103, Glu-114) that are critical for cis-CaaD activity, it shows only a low level cis-CaaD activity and lacks the specificity of cis-CaaD: Cg10062 processes both isomers of 3-chloroacrylate with a preference for the cis-isomer. Although the basis for these differences is unknown, a comparison of the crystal structures of the enzymes covalently modified by an adduct resulting from their incubation with the same inhibitor offers a possible explanation. A 6-residue active site loop in cis-CaaD shows a strikingly different conformation from that observed in Cg10062: the loop closes down on the active site of cis-CaaD, but not on that of Cg10062. In order to examine what this loop might contribute to cis-CaaD catalysis and specificity, the residues were changed individually to those found in Cg10062. Subsequent kinetic and mechanistic analysis suggests that the T34A mutant of cis-CaaD is more Cg10062-like. The mutant enzyme shows a 4-fold increase in Km (using cis-3-bromoacrylate), but not to the degree observed for Cg10062 (687-fold). The mutation also causes a 4-fold decrease in the burst rate (compared to the wild type cis-CaaD), whereas Cg10062 shows no burst rate. More telling is the reaction of the T34A mutant of cis-CaaD with the alternate substrate, 2,3-butadienoate. In the presence of NaBH4 and the allene, cis-CaaD is completely inactivated after one turnover due to the covalent modification of Pro-1. The same experiment with Cg10062 does not result in the covalent modification of Pro-1. The different outcomes are attributed to

  10. CIS-lunar space infrastructure lunar technologies: Executive summary

    NASA Technical Reports Server (NTRS)

    Faller, W.; Hoehn, A.; Johnson, S.; Moos, P.; Wiltberger, N.

    1989-01-01

    Technologies necessary for the creation of a cis-Lunar infrastructure, namely: (1) automation and robotics; (2) life support systems; (3) fluid management; (4) propulsion; and (5) rotating technologies, are explored. The technological focal point is on the development of automated and robotic systems for the implementation of a Lunar Oasis produced by Automation and Robotics (LOAR). Under direction from the NASA Office of Exploration, automation and robotics were extensively utilized as an initiating stage in the return to the Moon. A pair of autonomous rovers, modular in design and built from interchangeable and specialized components, is proposed. Utilizing a buddy system, these rovers will be able to support each other and to enhance their individual capabilities. One rover primarily explores and maps while the second rover tests the feasibility of various materials-processing techniques. The automated missions emphasize availability and potential uses of Lunar resources, and the deployment and operations of the LOAR program. An experimental bio-volume is put into place as the precursor to a Lunar environmentally controlled life support system. The bio-volume will determine the reproduction, growth and production characteristics of various life forms housed on the Lunar surface. Physicochemical regenerative technologies and stored resources will be used to buffer biological disturbances of the bio-volume environment. The in situ Lunar resources will be both tested and used within this bio-volume. Second phase development on the Lunar surface calls for manned operations. Repairs and re-configuration of the initial framework will ensue. An autonomously-initiated manned Lunar oasis can become an essential component of the United States space program.

  11. Small RNAs Originated from Pseudogenes: cis- or trans-Acting?

    PubMed Central

    Guo, Xingyi; Zhang, Zhaolei; Gerstein, Mark B.; Zheng, Deyou

    2009-01-01

    Pseudogenes are significant components of eukaryotic genomes, and some have acquired novel regulatory roles. To date, no study has characterized rice pseudogenes systematically or addressed their impact on the structure and function of the rice genome. In this genome-wide study, we have identified 11,956 non-transposon-related rice pseudogenes, most of which are from gene duplications. About 12% of the rice protein-coding genes, half of which are in singleton families, have a pseudogene paralog. Interestingly, we found that 145 of these pseudogenes potentially gave rise to antisense small RNAs after examining ∼1.5 million small RNAs from developing rice grains. The majority (>50%) of these antisense RNAs are 24-nucleotides long, a feature often seen in plant repeat-associated small interfering RNAs (siRNAs) produced by RNA-dependent RNA polymerase (RDR2) and Dicer-like protein 3 (DCL3), suggesting that some pseudogene-derived siRNAs may be implicated in repressing pseudogene transcription (i.e., cis-acting). Multiple lines of evidence, however, indicate that small RNAs from rice pseudogenes might also function as natural antisense siRNAs either by interacting with the complementary sense RNAs from functional parental genes (38 cases) or by forming double-strand RNAs with transcripts of adjacent paralogous pseudogenes (2 cases) (i.e., trans-acting). Further examinations of five additional small RNA libraries revealed that pseudogene-derived antisense siRNAs could be produced in specific rice developmental stages or physiological growth conditions, suggesting their potentially important roles in normal rice development. In summary, our results show that pseudogenes derived from protein-coding genes are prevalent in the rice genome, and a subset of them are strong candidates for producing small RNAs with novel regulatory roles. Our findings suggest that pseudogenes of exapted functions may be a phenomenon ubiquitous in eukaryotic organisms. PMID:19649160

  12. The intriguing Cyclophilin A-HIV-1 Vpr interaction: prolyl cis/trans isomerisation catalysis and specific binding

    PubMed Central

    2010-01-01

    Background Cyclophilin A (CypA) represents a potential target for antiretroviral therapy since inhibition of CypA suppresses human immunodeficiency virus type 1 (HIV-1) replication, although the mechanism through which CypA modulates HIV-1 infectivity still remains unclear. The interaction of HIV-1 viral protein R (Vpr) with the human peptidyl prolyl isomerase CypA is known to occur in vitro and in vivo. However, the nature of the interaction of CypA with Pro-35 of N-terminal Vpr has remained undefined. Results Characterization of the interactions of human CypA with N-terminal peptides of HIV-1 Vpr has been achieved using a combination of nuclear magnetic resonace (NMR) exchange spectroscopy and surface plasmon resonance spectroscopy (SPR). NMR data at atomic resolution indicate prolyl cis/trans isomerisation of the highly conserved proline residues Pro-5, -10, -14 and -35 of Vpr are catalyzed by human CypA and require only very low concentrations of the isomerase relative to that of the peptide substrates. Of the N-terminal peptides of Vpr only those containing Pro-35 bind to CypA in a biosensor assay. SPR studies of specific N-terminal peptides with decreasing numbers of residues revealed that a seven-residue motif centred at Pro-35 consisting of RHFPRIW, which under membrane-like solution conditions comprises the loop region connecting helix 1 and 2 of Vpr and the two terminal residues of helix 1, is sufficient to maintain strong specific binding. Conclusions Only N-terminal peptides of Vpr containing Pro-35, which appears to be vital for manifold functions of Vpr, bind to CypA in a biosensor assay. This indicates that Pro-35 is essential for a specific CypA-Vpr binding interaction, in contrast to the general prolyl cis/trans isomerisation observed for all proline residues of Vpr, which only involve transient enzyme-substrate interactions. Previously suggested models depicting CypA as a chaperone that plays a role in HIV-1 virulence are now supported by our data

  13. Asynchronous Replication, Mono-Allelic Expression, and Long Range Cis-Effects of ASAR6

    PubMed Central

    Smith, Leslie; Montagna, Christina; Thayer, Mathew J.

    2013-01-01

    Mammalian chromosomes initiate DNA replication at multiple sites along their length during each S phase following a temporal replication program. The majority of genes on homologous chromosomes replicate synchronously. However, mono-allelically expressed genes such as imprinted genes, allelically excluded genes, and genes on female X chromosomes replicate asynchronously. We have identified a cis-acting locus on human chromosome 6 that controls this replication-timing program. This locus encodes a large intergenic non-coding RNA gene named Asynchronous replication and Autosomal RNA on chromosome 6, or ASAR6. Disruption of ASAR6 results in delayed replication, delayed mitotic chromosome condensation, and activation of the previously silent alleles of mono-allelic genes on chromosome 6. The ASAR6 gene resides within an ∼1.2 megabase domain of asynchronously replicating DNA that is coordinated with other random asynchronously replicating loci along chromosome 6. In contrast to other nearby mono-allelic genes, ASAR6 RNA is expressed from the later-replicating allele. ASAR6 RNA is synthesized by RNA Polymerase II, is not polyadenlyated, is restricted to the nucleus, and is subject to random mono-allelic expression. Disruption of ASAR6 leads to the formation of bridged chromosomes, micronuclei, and structural instability of chromosome 6. Finally, ectopic integration of cloned genomic DNA containing ASAR6 causes delayed replication of entire mouse chromosomes. PMID:23593023

  14. The minimal effective dose of cis-9-cetylmyristoleate (CMO) in persons presenting with knee joint pain

    PubMed Central

    Lee, Sang Chul; Jin, Hyun Seung; Joo, Young; Kim, Yong Chul; Moon, Jee Youn

    2017-01-01

    Abstract Background: Nutraceuticals containing cis-9-cetylmyristoleate (CMO) are used to improve knee pain despite the lack of placebo-controlled studies in humans. The aim of the study was to explore the minimal effective dose of CMO for relieving knee joint pain. Methods: Twenty-eight subjects with mild degree arthritic knee joint pain were randomized into 4 groups; groups A, B, and C that contained 100%, 80%, and 62.4% of fatty acid component with 12.5% of CMO, and control group D (starch 100%). The pain intensity, functional disability, and the Patient Global Impression of Change (PGIC) were assessed for a 12-week ingestion period. Results: Compared to group D (n = 6), there were significant differences in pain score in group A (n = 7, P = 0.005) and group C (n = 7, P = 0.012), but not significant in group B (n = 6, P = 0.180). Western Ontario and McMaster Universities Arthritis (WOMAC) score decreased significantly in groups A and C. The PGIC was positive in the majority (>50%) in groups A, B, and C, whereas negative in 83.3% in group D (control). Conclusion: CMO is effective in alleviating knee pain in persons with mild degree arthritis of the knee joint, at an effective dose of 62.4%. PMID:28248869

  15. PReMod: a database of genome-wide mammalian cis-regulatory module predictions.

    PubMed

    Ferretti, Vincent; Poitras, Christian; Bergeron, Dominique; Coulombe, Benoit; Robert, François; Blanchette, Mathieu

    2007-01-01

    We describe PReMod, a new database of genome-wide cis-regulatory module (CRM) predictions for both the human and the mouse genomes. The prediction algorithm, described previously in Blanchette et al. (2006) Genome Res., 16, 656-668, exploits the fact that many known CRMs are made of clusters of phylogenetically conserved and repeated transcription factors (TF) binding sites. Contrary to other existing databases, PReMod is not restricted to modules located proximal to genes, but in fact mostly contains distal predicted CRMs (pCRMs). Through its web interface, PReMod allows users to (i) identify pCRMs around a gene of interest; (ii) identify pCRMs that have binding sites for a given TF (or a set of TFs) or (iii) download the entire dataset for local analyses. Queries can also be refined by filtering for specific chromosomal regions, for specific regions relative to genes or for the presence of CpG islands. The output includes information about the binding sites predicted within the selected pCRMs, and a graphical display of their distribution within the pCRMs. It also provides a visual depiction of the chromosomal context of the selected pCRMs in terms of neighboring pCRMs and genes, all of which are linked to the UCSC Genome Browser and the NCBI. PReMod: http://genomequebec.mcgill.ca/PReMod.

  16. Geometry matters: inverse cytotoxic relationship for cis/trans-Ru(ii) polypyridyl complexes from cis/trans-[PtCl2(NH3)2].

    PubMed

    Wachter, Erin; Zamora, Ana; Heidary, David K; Ruiz, José; Glazer, Edith C

    2016-08-09

    Two thermally activated ruthenium(ii) polypyridyl complexes, cis-Ru(bpy)2Cl2 and trans-Ru(qpy)Cl2 were investigated to determine the impact of the geometric arrangement of the exchangable ligands on the potential of the compounds to act as chemotherapeutics. In contrast to the geometry requirements for cisplatin, trans-Ru(qpy)Cl2 was 7.1-9.5× more cytotoxic than cis-Ru(bpy)2Cl2. This discovery could open up a new area of metal-based chemotherapeutic research.

  17. Identification of Cis-regulatory elements in the mouse Pax9/Nkx2-9 genomic region: implication for evolutionary conserved synteny.

    PubMed Central

    Santagati, Fabio; Abe, Kuniya; Schmidt, Volker; Schmitt-John, Thomas; Suzuki, Misao; Yamamura, Ken-Ichi; Imai, Kenji

    2003-01-01

    We previously reported close physical linkage between Pax9 and Nkx2-9 in the human, mouse, and pufferfish (Fugu rubripes) genomes. In this study, we analyzed cis-regulatory elements of the two genes by comparative sequencing in the three species and by transgenesis in the mouse. We identified two regions including conserved noncoding sequences that possessed specific enhancer activities for expression of Pax9 in the medial nasal process and of Nkx2-9 in the ventral neural tube. Remarkably, the latter contained the consensus Gli-binding motif. Interestingly, the identified Pax9 cis-regulatory sequences were located in an intron of the neighboring gene Slc25a21. Close examination of an extended genomic interval around Pax9 revealed the presence of strong synteny conservation in the human, mouse, and Fugu genomes. We propose such an intersecting organization of cis-regulatory sequences in multigenic regions as a possible mechanism that maintains evolutionary conserved synteny. PMID:14504231

  18. Mammalian chromosomes contain cis-acting elements that control replication timing, mitotic condensation, and stability of entire chromosomes.

    PubMed

    Thayer, Mathew J

    2012-09-01

    Recent studies indicate that mammalian chromosomes contain discrete cis-acting loci that control replication timing, mitotic condensation, and stability of entire chromosomes. Disruption of the large non-coding RNA gene ASAR6 results in late replication, an under-condensed appearance during mitosis, and structural instability of human chromosome 6. Similarly, disruption of the mouse Xist gene in adult somatic cells results in a late replication and instability phenotype on the X chromosome. ASAR6 shares many characteristics with Xist, including random mono-allelic expression and asynchronous replication timing. Additional "chromosome engineering" studies indicate that certain chromosome rearrangements affecting many different chromosomes display this abnormal replication and instability phenotype. These observations suggest that all mammalian chromosomes contain "inactivation/stability centers" that control proper replication, condensation, and stability of individual chromosomes. Therefore, mammalian chromosomes contain four types of cis-acting elements, origins, telomeres, centromeres, and "inactivation/stability centers", all functioning to ensure proper replication, condensation, segregation, and stability of individual chromosomes.

  19. Does the cis/trans configuration of peptide bonds in bioactive tripeptides play a role in ACE-1 enzyme inhibition?

    PubMed Central

    Siltari, Aino; Viitanen, Riikka; Kukkurainen, Sampo; Vapaatalo, Heikki; Valjakka, Jarkko

    2014-01-01

    Background The milk casein-derived bioactive tripeptides isoleucine-proline-proline (IPP) and valine-proline-proline (VPP) have been shown to prevent development of hypertension in animal models and to lower blood pressure in moderately hypertensive subjects in most but not all clinical trials. Inhibition of angiotensin-converting enzyme 1 (ACE-1) has been suggested as the explanation for these antihypertensive and beneficial vascular effects. Previously, human umbilical vein endothelial cells (HUVEC) have not been used to test ACE-1 inhibiting properties of casein derived tripeptides in vasculature. Purpose We focused on the cis/trans configurations of the peptide bonds in proline-containing tripeptides in order to discover whether the different structural properties of these peptides influence their activity in ACE-1 inhibition. We hypothesized that the configuration of proline-containing peptides plays a significant role in enzyme inhibition. Methods AutoDock 4.2 docking software was used to predict suitable peptide bond configurations of the tripeptides. Besides modeling studies, we completed ACE-1 activity measurements in vitro using HUVEC cultures. Results In HUVEC cells, both IPP and VPP inhibited ACE-1. Based on molecular docking studies, we propose that in ACE-1 inhibition IPP and VPP share a similar cis configuration between the first aliphatic (isoleucine or valine) and the second (proline) amino acid residues and more different configurations between two proline residues. In vivo experiments are needed to validate the significance of the present findings. PMID:24596454

  20. Preparation of a boronate affinity silica stationary phase with enhanced binding properties towards cis-diol compounds.

    PubMed

    Li, Hengye; Zhang, Xuemeng; Zhang, Lin; Wang, Xiaojin; Kong, Fenying; Fan, Dahe; Li, Lei; Wang, Wei

    2016-11-18

    In this study, a boronate affinity silica stationary phase with enhanced binding properties towards cis-diol compounds was prepared through the combination of surface-initiated atom transfer radical polymerization (SI-ATRP) with a Wulff-type boronate as affinity ligand. The stationary phase showed good hydrophilicity and improved binding strength toward adenosine, with binding constant to be as low as 2.38×10(-4)M. The column exhibited excellent binding specificity, low binding pH (≥5.5) and high binding capacities (80.1μmol adenosine g(-1) at pH 7.0 and 45.2μmol adenosine g(-1) at pH 5.5, respectively). The stationary phase was applied as adsorbent for the selective extraction of nucleosides in human urine with excellent specificity and high enrichment efficiency. These results demonstrated that this stationary phase could be favorably applied for selective capture and enrichment of cis-diol compounds in complex samples.

  1. Mimicking Photosynthesis with Electrode-Supported Lipid Nanoassemblies.

    PubMed

    Wang, Mingming; Zhan, Wei

    2016-11-15

    as well as their sequential formation on electrodes. Supported on electrodes, these bilayers uniformly afford reliable photocurrent generation and modular system design. (2) Gold-supported hybrid bilayers as a powerful model platform for probing biomembrane-associated photoelectrochemical processes. These hybrid nanostructures consist of one alkanethiol (or substituted alkanethiol) and one lipid monolayer, whose chemical identity and makeup can be separately controlled and modified. Such precise molecular organization and flexible formation, in turn, enable a series of physicochemical parameters key to photosynthetic processes to be explicitly examined and cross-compared. A few such examples, based on donor/acceptor distance and loading, interfacial dipole, and redox level, are included here to illustrate the usefulness and versatility of this system. (3) Mimicking photosynthesis with supercomplexed lipid nanoassemblies. This research effort was motivated to address the low light absorption suffered by single-bilayer based photosynthetic mimics and has yielded a new lipid-based approach to mimicking Nature's way of organizing multiple photosynthetic subunits. Rhodamine and fullerene assembled within these lipid supercomplexes display robust electronic communication. The remarkable possibility of using lipid matrix to further improve photoconversion efficiency is revealed by cholesterol, whose addition triggers exciton formation that promotes faster energy and electron transfer in these lipid nanoassemblies.

  2. The ecological situation and C.I.S. scientists' work on the SPS problem

    NASA Astrophysics Data System (ADS)

    Prisniakov, V.

    A brief historical perspective of the former USSR and current Confederation of Independent States (CIS) research and development activities relating to the Solar Power Satellite (SPS) concept is presented. Particular emphasis is on the ecological aspects of the SPS concept.

  3. Microwave Spectrum and Molecular Structure of the ARGON-CIS-1,2-DICHLOROETHYLENE Complex

    NASA Astrophysics Data System (ADS)

    Marshall, Mark D.; Leung, Helen O.; Nelson, Craig J.; Yoon, Leonard H.

    2016-06-01

    The non-planar molecular structure of the complex formed between the argon atom and cis-1,2-dichloroethylene is determined via analysis of its microwave spectrum. Spectra of the 35Cl and 37Cl isotopologues are observed in natural abundance and the nuclear quadrupole splitting due to the two chlorine nuclei is fully resolved. In addition, the complete quadrupole coupling tensor for the cis-1,2-dichloroethylene molecule, including the single non-zero off-diagonal element, has been determined. Unlike the argon-cis-1,2-difluoroethylene and the argon-vinyl chloride complexes, tunneling between the two equivalent non-planar configurations of argon-cis-1,2-dichloroethylene is not observed.

  4. cis-3-Chloroacrylic Acid: A New Cotton Defoliant and Crop Desiccant.

    PubMed

    Herrett, R A; Kurtz, A N

    1963-09-20

    cis-3-Chloroacrylic acid is a potent cotton defoliant and a crop desiccant. Relationships between structure and activity indicate a relatively high degree of specificity, since minor modifications in structure result in loss of activity.

  5. Isolation of cis-3-Amino-l-Proline from Cultured Mycelia of Morchella esculenta Fr.

    PubMed

    Moriguchi, M; Sada, S; Hatanaka, S

    1979-11-01

    cis-3-Amino-l-proline, identified once as a nonprotein amino acid from the fruiting bodies of Morchella esculenta Fr., was isolated also from the growth medium and cultured mycelia of the same fungus.

  6. Mimicking Nonequilibrium Steady States with Time-Periodic Driving

    NASA Astrophysics Data System (ADS)

    Raz, O.; Subaşı, Y.; Jarzynski, C.

    2016-04-01

    Under static conditions, a system satisfying detailed balance generically relaxes to an equilibrium state in which there are no currents. To generate persistent currents, either detailed balance must be broken or the system must be driven in a time-dependent manner. A stationary system that violates detailed balance evolves to a nonequilibrium steady state (NESS) characterized by fixed currents. Conversely, a system that satisfies instantaneous detailed balance but is driven by the time-periodic variation of external parameters—also known as a stochastic pump (SP)—reaches a periodic state with nonvanishing currents. In both cases, these currents are maintained at the cost of entropy production. Are these two paradigmatic scenarios effectively equivalent? For discrete-state systems, we establish a mapping between nonequilibrium stationary states and stochastic pumps. Given a NESS characterized by a particular set of stationary probabilities, currents, and entropy production rates, we show how to construct a SP with exactly the same (time-averaged) values. The mapping works in the opposite direction as well. These results establish a proof of principle: They show that stochastic pumps are able to mimic the behavior of nonequilibrium steady states, and vice versa, within the theoretical framework of discrete-state stochastic thermodynamics. Nonequilibrium steady states and stochastic pumps are often used to model, respectively, biomolecular motors driven by chemical reactions and artificial molecular machines steered by the variation of external, macroscopic parameters. Our results loosely suggest that anything a biomolecular machine can do, an artificial molecular machine can do equally well. We illustrate this principle by showing that kinetic proofreading, a NESS mechanism that explains the low error rates in biochemical reactions, can be effectively mimicked by a constrained periodic driving.

  7. Kawasaki disease mimicking a parapharyngeal abscess: a case report.

    PubMed

    Cai, Qianyun; Luo, Rong; Gan, Jing; Zhang, Li; Qu, Yi; Mu, Dezhi

    2015-05-01

    Parapharyngeal abscess (PPA)-like lesion is a very rare manifestation of Kawasaki disease (KD). Here we report a Chinese case of KD initially mimicking PPA, which is the first one reported in Asia.A 3-year-old male patient presented with fever, drooling, and bilateral painful cervical lymphadenopathy for 3 days. Chest X-ray and echocardiogram were normal. With substantial elevation of white blood count and C-reactive protein, purulent cervical lymphadenitis was considered. Symptoms did not improve after treatment with vancomycin, and the patient further developed trismus and restricted neck movement. Neck CT revealed a 2 × 1.5 cm hypodense lesion in the right parapharyngeal space with peripheral enhancement. PPA was suspected and on the 3rd day following admission, the patient received surgical incision and drainage. One milliliter of serous fluid was drained without bacterial growth on cultures. Fever persisted after surgery. As the clinical course proceeded, additional major signs of KD gradually evolved, and on the 6th day following admission the patient completely fulfilled the diagnostic criteria for KD. Rapid clinical improvement was observed following treatment with high-dose immunoglobulin and aspirin. Due to the parapharyngeal operation, the patient was fed milk through a nasogastric tube for 15 days. His neck incision became infected but healed gradually following dressing change and antibiotic treatment. Currently he remains asymptomatic during regular follow-up and repeated echocardiograms are normal.Both pediatricians and otolaryngologists can learn from this case that KD may initially manifest as PPA. Careful observation for major signs of KD during the clinical course can help to achieve a prompt and correct diagnosis. Thus, unnecessary surgery and cardiac complications of KD may be avoided.

  8. Computational discovery of cis-regulatory modules in Drosophila without prior knowledge of motifs

    PubMed Central

    Ivan, Andra; Halfon, Marc S; Sinha, Saurabh

    2008-01-01

    We consider the problem of predicting cis-regulatory modules without knowledge of motifs. We formulate this problem in a pragmatic setting, and create over 30 new data sets, using Drosophila modules, to use as a 'benchmark'. We propose two new methods for the problem, and evaluate these, as well as two existing methods, on our benchmark. We find that the challenge of predicting cis-regulatory modules ab initio, without any input of relevant motifs, is a realizable goal. PMID:18226245

  9. CisSERS: Customizable In Silico Sequence Evaluation for Restriction Sites.

    PubMed

    Sharpe, Richard M; Koepke, Tyson; Harper, Artemus; Grimes, John; Galli, Marco; Satoh-Cruz, Mio; Kalyanaraman, Ananth; Evans, Katherine; Kramer, David; Dhingra, Amit

    2016-01-01

    High-throughput sequencing continues to produce an immense volume of information that is processed and assembled into mature sequence data. Data analysis tools are urgently needed that leverage the embedded DNA sequence polymorphisms and consequent changes to restriction sites or sequence motifs in a high-throughput manner to enable biological experimentation. CisSERS was developed as a standalone open source tool to analyze sequence datasets and provide biologists with individual or comparative genome organization information in terms of presence and frequency of patterns or motifs such as restriction enzymes. Predicted agarose gel visualization of the custom analyses results was also integrated to enhance the usefulness of the software. CisSERS offers several novel functionalities, such as handling of large and multiple datasets in parallel, multiple restriction enzyme site detection and custom motif detection features, which are seamlessly integrated with real time agarose gel visualization. Using a simple fasta-formatted file as input, CisSERS utilizes the REBASE enzyme database. Results from CisSERS enable the user to make decisions for designing genotyping by sequencing experiments, reduced representation sequencing, 3'UTR sequencing, and cleaved amplified polymorphic sequence (CAPS) molecular markers for large sample sets. CisSERS is a java based graphical user interface built around a perl backbone. Several of the applications of CisSERS including CAPS molecular marker development were successfully validated using wet-lab experimentation. Here, we present the tool CisSERS and results from in-silico and corresponding wet-lab analyses demonstrating that CisSERS is a technology platform solution that facilitates efficient data utilization in genomics and genetics studies.

  10. CisSERS: Customizable in silico sequence evaluation for restriction sites

    DOE PAGES

    Sharpe, Richard M.; Koepke, Tyson; Harper, Artemus; ...

    2016-04-12

    High-throughput sequencing continues to produce an immense volume of information that is processed and assembled into mature sequence data. Here, data analysis tools are urgently needed that leverage the embedded DNA sequence polymorphisms and consequent changes to restriction sites or sequence motifs in a high-throughput manner to enable biological experimentation. CisSERS was developed as a standalone open source tool to analyze sequence datasets and provide biologists with individual or comparative genome organization information in terms of presence and frequency of patterns or motifs such as restriction enzymes. Predicted agarose gel visualization of the custom analyses results was also integrated tomore » enhance the usefulness of the software. CisSERS offers several novel functionalities, such as handling of large and multiple datasets in parallel, multiple restriction enzyme site detection and custom motif detection features, which are seamlessly integrated with real time agarose gel visualization. Using a simple fasta-formatted file as input, CisSERS utilizes the REBASE enzyme database. Results from CisSERSenable the user to make decisions for designing genotyping by sequencing experiments, reduced representation sequencing, 3’UTR sequencing, and cleaved amplified polymorphic sequence (CAPS) molecular markers for large sample sets. CisSERS is a java based graphical user interface built around a perl backbone. Several of the applications of CisSERS including CAPS molecular marker development were successfully validated using wet-lab experimentation. Here, we present the tool CisSERSand results from in-silico and corresponding wet-lab analyses demonstrating that CisSERS is a technology platform solution that facilitates efficient data utilization in genomics and genetics studies.« less

  11. Burn-induced subepicardial injury in frog heart: a simple model mimicking ST segment changes in ischemic heart disease.

    PubMed

    Kazama, Itsuro

    2016-02-01

    To mimic ischemic heart disease in humans, several animal models have been created, mainly in rodents by surgically ligating their coronary arteries. In the present study, by simply inducing burn injuries on the bullfrog heart, we reproduced abnormal ST segment changes in the electrocardiogram (ECG), mimicking those observed in ischemic heart disease, such as acute myocardial infarction and angina pectoris. The "currents of injury" created by a voltage gradient between the intact and damaged areas of the myocardium, negatively deflected the ECG vector during the diastolic phase, making the ST segment appear elevated during the systolic phase. This frog model of heart injury would be suitable to explain the mechanisms of ST segment changes observed in ischemic heart disease.

  12. Conjugated Linoleic Acid Induces Human Adipocyte Delipidation

    PubMed Central

    Brown, J. Mark; Boysen, Maria Sandberg; Chung, Soonkyu; Fabiyi, Olowatoyin; Morrison, Ron F.; Mandrup, Susanne; McIntosh, Michael K.

    2005-01-01

    Dietary conjugated linoleic acid (CLA) reduces body fat in animals and some humans. Here we show that trans-10, cis-12 CLA, but not cis-9, trans-11 CLA, when added to cultures of stromal vascular cells containing newly differentiated human adipocytes, caused a time-dependent decrease in triglyceride content, insulin-stimulated glucose and fatty acid uptake, incorporation into lipid, and oxidation compared with controls. In parallel, gene expression of peroxisome proliferator-activated receptor-γ and many of its downstream targets were diminished by trans-10, cis-12 CLA, whereas leptin gene expression was increased. Prior to changes in gene expression and metabolism, trans-10, cis-12 CLA caused a robust and sustained activation of mitogen-activated protein kinase kinase/extracellular signal-related kinase (MEK/ERK) signaling. Furthermore, the trans-10, cis-12 CLA-mediated activation of MEK/ERK could be attenuated by pretreatment with U0126 and pertussis toxin. In parallel, pretreatment with U0126 blocked the ability of trans-10, cis-12 CLA to alter gene expression and attenuate glucose and fatty acid uptake of the cultures. Intriguingly, the induction by CLA of MEK/ERK signaling was linked to hypersecretion of adipocytokines interleukin-6 and interleukin-8. Collectively, these data demonstrate for the first time that trans-10, cis-12 CLA decreases the triglyceride content of newly differentiated human adipocytes by inducing MEK/ERK signaling through the autocrine/paracrine actions of interleukins-6 and 8. PMID:15067015

  13. Thermochromic tissue-mimicking phantom for optimisation of thermal tumour ablation.

    PubMed

    Negussie, Ayele H; Partanen, Ari; Mikhail, Andrew S; Xu, Sheng; Abi-Jaoudeh, Nadine; Maruvada, Subha; Wood, Bradford J

    2016-05-01

    Purpose The purpose of this study was to (1) develop a novel tissue-mimicking thermochromic (TMTC) phantom that permanently changes colour from white to magenta upon heating above ablative temperatures, and (2) assess its utility for specific applications in evaluating thermal therapy devices. Materials and methods Polyacrylamide gel mixed with thermochromic ink was custom made to produce a TMTC phantom that changes its colour upon heating above biological ablative temperatures (> 60 °C). The thermal properties of the phantom were characterised, and compared to those of human tissue. In addition, utility of this phantom as a tool for the assessment of laser and microwave thermal ablation was examined. Results The mass density, thermal conductivity, and thermal diffusivity of the TMTC phantom were measured as 1033 ± 1.0 kg/m(3), 0.590 ± 0.015 W/m.K, and 0.145 ± 0.002 mm(2)/s, respectively, and found to be in agreement with reported values for human soft tissues. Heating the phantom with laser and microwave ablation devices produced clearly demarcated regions of permanent colour change geographically corresponding to regions with temperature elevations above 60 °C. Conclusion The TMTC phantom provides direct visualisation of ablation dynamics, including ablation volume and geometry as well as peak absolute temperatures within the treated region post-ablation. This phantom can be specifically tailored for different thermal therapy modalities, such as radiofrequency, laser, microwave, or therapeutic ultrasound ablation. Such modality-specific phantoms may enable better quality assurance, device characterisation, and ablation parameter optimisation, or optimise the study of dynamic heating parameters integral to drug device combination therapies relying upon heat.

  14. Auditory Stimuli Mimicking Ambient Sounds Drive Temporal “Delta-Brushes” in Premature Infants

    PubMed Central

    Chipaux, Mathilde; Colonnese, Matthew T.; Mauguen, Audrey; Fellous, Laure; Mokhtari, Mostafa; Lezcano, Oscar; Milh, Mathieu; Dulac, Olivier; Chiron, Catherine; Khazipov, Rustem; Kaminska, Anna

    2013-01-01

    In the premature infant, somatosensory and visual stimuli trigger an immature electroencephalographic (EEG) pattern, “delta-brushes,” in the corresponding sensory cortical areas. Whether auditory stimuli evoke delta-brushes in the premature auditory cortex has not been reported. Here, responses to auditory stimuli were studied in 46 premature infants without neurologic risk aged 31 to 38 postmenstrual weeks (PMW) during routine EEG recording. Stimuli consisted of either low-volume technogenic “clicks” near the background noise level of the neonatal care unit, or a human voice at conversational sound level. Stimuli were administrated pseudo-randomly during quiet and active sleep. In another protocol, the cortical response to a composite stimulus (“click” and voice) was manually triggered during EEG hypoactive periods of quiet sleep. Cortical responses were analyzed by event detection, power frequency analysis and stimulus locked averaging. Before 34 PMW, both voice and “click” stimuli evoked cortical responses with similar frequency-power topographic characteristics, namely a temporal negative slow-wave and rapid oscillations similar to spontaneous delta-brushes. Responses to composite stimuli also showed a maximal frequency-power increase in temporal areas before 35 PMW. From 34 PMW the topography of responses in quiet sleep was different for “click” and voice stimuli: responses to “clicks” became diffuse but responses to voice remained limited to temporal areas. After the age of 35 PMW auditory evoked delta-brushes progressively disappeared and were replaced by a low amplitude response in the same location. Our data show that auditory stimuli mimicking ambient sounds efficiently evoke delta-brushes in temporal areas in the premature infant before 35 PMW. Along with findings in other sensory modalities (visual and somatosensory), these findings suggest that sensory driven delta-brushes represent a ubiquitous feature of the human sensory

  15. Photochemical trans-/cis-isomerization and quantitation of zearalenone in edible oils.

    PubMed

    Köppen, Robert; Riedel, Juliane; Proske, Matthias; Drzymala, Sarah; Rasenko, Tatjana; Durmaz, Vedat; Weber, Marcus; Koch, Matthias

    2012-11-28

    The emphasis of the present work was to investigate the photochemical conversion of trans- to cis-zearalenone in edible oils under real-life conditions. For quantitation purposes a cis-zearalenone standard was synthesized and characterized for its identity and purity (≥95%) by (1)H NMR, X-ray crystallography, HPLC fluorescence and mass spectrometric detection. In a sample survey of 12 edible oils (9 corn oils, 3 hempseed oils) from local supermarkets all corn oils contained trans-zearalenone (median 194 μg/kg), but no cis-zearalenone was detected. For alteration studies trans-zearalenone contaminated corn oils were exposed to sunlight over 4 and 30 weeks, revealing an obvious shift toward cis-zearalenone up to a cis/trans ratio of 9:1 by storage in colorless glass bottles. Irradiation experiments of trans-zearalenone in different organic solvents confirmed the preferred formation of cis-zearalenone possibly caused by entropic effects rather than by enthalpic entities as investigated by quantum chemical and classical force field simulations.

  16. Structural Elucidation of cis/trans Dicaffeoylquinic Acid Photoisomerization Using Ion Mobility Spectrometry-Mass Spectrometry.

    PubMed

    Zheng, Xueyun; Renslow, Ryan S; Makola, Mpho M; Webb, Ian K; Deng, Liulin; Thomas, Dennis G; Govind, Niranjan; Ibrahim, Yehia M; Kabanda, Mwadham M; Dubery, Ian A; Heyman, Heino M; Smith, Richard D; Madala, Ntakadzeni E; Baker, Erin S

    2017-04-06

    Due to the recently uncovered health benefits and anti-HIV activities of dicaffeoylquinic acids (diCQAs), understanding their structures and functions is of great interest for drug discovery efforts. DiCQAs are analytically challenging to identify and quantify since they commonly exist as a diverse mixture of positional and geometric (cis/trans) isomers. In this work, we utilized ion mobility spectrometry coupled with mass spectrometry to separate the various isomers before and after UV irradiation. The experimental collision cross sections were then compared with theoretical structures to differentiate and identify the diCQA isomers. Our analyses found that naturally the diCQAs existed predominantly as trans/trans isomers, but after 3 h of UV irradiation, cis/cis, cis/trans, trans/cis, and trans/trans isomers were all present in the mixture. This is the first report of successful differentiation of cis/trans diCQA isomers individually, which shows the great promise of IMS coupled with theoretical calculations for determining the structure and activity relationships of different isomers in drug discovery studies.

  17. The Clinical Interview Schedule-Revised (CIS-R)-Malay Version, Clinical Validation.

    PubMed

    Subramaniam, Kavitha; Krishnaswamy, Saroja; Jemain, Abdul Aziz; Hamid, Abdul; Patel, Vikram

    2006-01-01

    Use of instruments or questionnaires in different cultural settings without proper validation can result in inaccurate results. Issues like reliability, validity, feasibility and acceptability should be considered in the use of an instrument. The study aims to determine the usefulness of the CIS-R Malay version in detecting common mental health problems specifically to establish the validity. The CIS-R instrument (PROQSY* format) was translated through the back translation process into Malay. Inter rater reliability was established for raters who were medical students. Cases and controls for the study were psychiatric in patients, out patient and relatives or friends accompanying the patients to the clinic or visiting the inpatients. The Malay version of CIS-R was administered to all cases and controls. All cases and controls involved in the study were rated by psychiatrists for psychiatric morbidity using the SCID as a guideline. Specificity and sensitivity of the CIS-R to the assessment by the psychiatrist were determined. The Malay version of CIS-R showed 100% sensitivity and 96.15% specificity at a cut off score of 9. The CIS-R can be a useful instrument for clinical and research use in the Malaysian population for diagnosing common mental disorders like depression and anxiety.

  18. Cis-interactions between Notch and its ligands block ligand-independent Notch activity

    PubMed Central

    Palmer, William Hunt; Jia, Dongyu; Deng, Wu-Min

    2014-01-01

    The Notch pathway is integrated into numerous developmental processes and therefore is fine-tuned on many levels, including receptor production, endocytosis, and degradation. Notch is further characterized by a twofold relationship with its Delta-Serrate (DSL) ligands, as ligands from opposing cells (trans-ligands) activate Notch, whereas ligands expressed in the same cell (cis-ligands) inhibit signaling. We show that cells without both cis- and trans-ligands can mediate Notch-dependent developmental events during Drosophila oogenesis, indicating ligand-independent Notch activity occurs when the receptor is free of cis- and trans-ligands. Furthermore, cis-ligands can reduce Notch activity in endogenous and genetically induced situations of elevated trans-ligand-independent Notch signaling. We conclude that cis-expressed ligands exert their repressive effect on Notch signaling in cases of trans-ligand-independent activation, and propose a new function of cis-inhibition which buffers cells against accidental Notch activity. DOI: http://dx.doi.org/10.7554/eLife.04415.001 PMID:25486593

  19. Mammalian nonsense codons can be cis effectors of nuclear mRNA half-life.

    PubMed Central

    Belgrader, P; Cheng, J; Zhou, X; Stephenson, L S; Maquat, L E

    1994-01-01

    Frameshift and nonsense mutations within the gene for human triosephosphate isomerase (TPI) that generate a nonsense codon within the first three-fourths of the protein coding region have been found to reduce the abundance of the product mRNA that copurifies with nuclei. The cellular process and location of the nonsense codon-mediated reduction have proven difficult to elucidate for technical reasons. We show here, using electron microscopy to judge the purity of isolated nuclei, that the previously established reduction to 25% of the normal mRNA level is evident for nuclei that are free of detectable cytoplasmic contamination. Therefore, the reduction is likely to be characteristic of bona fide nuclear RNA. Fully spliced nuclear mRNA is identified by Northern (RNA) blot hybridization and a reverse transcription-PCR assay as the species that undergoes decay in experiments that used the human c-fos promoter to elicit a burst and subsequent shutoff of TPI gene transcription upon the addition of serum to serum-deprived cells. Finally, the finding that deletion of a 5' splice site of the TPI gene results predominantly but not exclusively in the removal by splicing (i.e., skipping) of the upstream exon as a part of the flanking introns has been used to demonstrate that decay is specific to those mRNA products that maintain the nonsense codon. This result, together with our previous results that implicate translation by ribosomes and charged tRNAs in the decay mechanism, indicate that nonsense codon recognition takes place after splicing and triggers decay solely in cis. The possibility that decay takes place during the process of mRNA export from the nucleus to the cytoplasm is discussed. Images PMID:7969159

  20. Cis-regulatory elements are harbored in Intron5 of the RUNX1 gene

    PubMed Central

    2014-01-01

    Background Human RUNX1 gene is one of the most frequent target for chromosomal translocations associated with acute myeloid leukemia (AML) and acute lymphoid leukemia (ALL). The highest prevalence in AML is noted with (8; 21) translocation; which represents 12 to 15% of all AML cases. Interestingly, all the breakpoints mapped to date in t(8;21) are clustered in intron 5 of the RUNX1 gene and intron 1 of the ETO gene. No homologous sequences have been found at the recombination regions; but DNase I hypersensitive sites (DHS) have been mapped to the areas of the genes involved in t(8;21). Presence of DHS sites is commonly associated with regulatory elements such as promoters, enhancers and silencers, among others. Results In this study we used a combination of comparative genomics, cloning and transfection assays to evaluate potential regulatory elements located in intron 5 of the RUNX1 gene. Our genomic analysis identified nine conserved non-coding sequences that are evolutionarily conserved among rat, mouse and human. We cloned two of these regions in pGL-3 Promoter plasmid in order to analyze their transcriptional regulatory activity. Our results demonstrate that the identified regions can indeed regulate transcription of a reporter gene in a distance and position independent manner; moreover, their transcriptional effect is cell type specific. Conclusions We have identified nine conserved non coding sequence that are harbored in intron 5 of the RUNX1 gene. We have also demonstrated that two of these regions can regulate transcriptional activity in vitro. Taken together our results suggest that intron 5 of the RUNX1 gene contains multiple potential cis-regulatory elements. PMID:24655352