Science.gov

Sample records for mimicking human cis

  1. Humanlike Robots - Synthetically Mimicking Humans

    NASA Technical Reports Server (NTRS)

    Bar-Cohen, Yoseph

    2012-01-01

    Nature inspired many inventions and the field of technology that is based on the mimicking or inspiration of nature is widely known as Biomimetics and it is increasingly leading to many new capabilities. There are numerous examples of biomimetic successes including the copying of fins for swimming, and the inspiration of the insects and birds flight. More and more commercial implementations of biomimetics are appearing and behaving lifelike and applications are emerging that are important to our daily life. Making humanlike robots is the ultimate challenge to biomimetics and, for many years, it was considered science fiction, but such robots are becoming an engineering reality. Advances in producing such robot are allowing them to perform impressive functions and tasks. The development of such robots involves addressing many challenges and is raising concerns that are related to fear of their application implications and potential ethical issues. In this paper, the state-of-the-art of humanlike robots, potential applications and challenges will be reviewed.

  2. Humanlike Robots - Synthetically Mimicking Humans

    NASA Technical Reports Server (NTRS)

    Bar-Cohen, Yoseph

    2012-01-01

    Nature inspired many inventions and the field of technology that is based on the mimicking or inspiration of nature is widely known as Biomimetics and it is increasingly leading to many new capabilities. There are numerous examples of biomimetic successes including the copying of fins for swimming, and the inspiration of the insects and birds flight. More and more commercial implementations of biomimetics are appearing and behaving lifelike and applications are emerging that are important to our daily life. Making humanlike robots is the ultimate challenge to biomimetics and, for many years, it was considered science fiction, but such robots are becoming an engineering reality. Advances in producing such robot are allowing them to perform impressive functions and tasks. The development of such robots involves addressing many challenges and is raising concerns that are related to fear of their application implications and potential ethical issues. In this paper, the state-of-the-art of humanlike robots, potential applications and challenges will be reviewed.

  3. Cis-regulatory mutations in human disease

    PubMed Central

    2009-01-01

    Cis-acting regulatory sequences are required for the proper temporal and spatial control of gene expression. Variation in gene expression is highly heritable and a significant determinant of human disease susceptibility. The diversity of human genetic diseases attributed, in whole or in part, to mutations in non-coding regulatory sequences is on the rise. Improvements in genome-wide methods of associating genetic variation with human disease and predicting DNA with cis-regulatory potential are two of the major reasons for these recent advances. This review will highlight select examples from the literature that have successfully integrated genetic and genomic approaches to uncover the molecular basis by which cis-regulatory mutations alter gene expression and contribute to human disease. The fine mapping of disease-causing variants has led to the discovery of novel cis-acting regulatory elements that, in some instances, are located as far away as 1.5 Mb from the target gene. In other cases, the prior knowledge of the regulatory landscape surrounding the gene of interest aided in the selection of enhancers for mutation screening. The success of these studies should provide a framework for following up on the large number of genome-wide association studies that have identified common variants in non-coding regions of the genome that associate with increased risk of human diseases including, diabetes, autism, Crohn's, colorectal cancer, and asthma, to name a few. PMID:19641089

  4. Cis-regulatory mutations in human disease.

    PubMed

    Epstein, Douglas J

    2009-07-01

    Cis-acting regulatory sequences are required for the proper temporal and spatial control of gene expression. Variation in gene expression is highly heritable and a significant determinant of human disease susceptibility. The diversity of human genetic diseases attributed, in whole or in part, to mutations in non-coding regulatory sequences is on the rise. Improvements in genome-wide methods of associating genetic variation with human disease and predicting DNA with cis-regulatory potential are two of the major reasons for these recent advances. This review will highlight select examples from the literature that have successfully integrated genetic and genomic approaches to uncover the molecular basis by which cis-regulatory mutations alter gene expression and contribute to human disease. The fine mapping of disease-causing variants has led to the discovery of novel cis-acting regulatory elements that, in some instances, are located as far away as 1.5 Mb from the target gene. In other cases, the prior knowledge of the regulatory landscape surrounding the gene of interest aided in the selection of enhancers for mutation screening. The success of these studies should provide a framework for following up on the large number of genome-wide association studies that have identified common variants in non-coding regions of the genome that associate with increased risk of human diseases including, diabetes, autism, Crohn's, colorectal cancer, and asthma, to name a few.

  5. Cis-regulatory Elements and Human Evolution

    PubMed Central

    Siepel, Adam

    2014-01-01

    Modification of gene regulation has long been considered an important force in human evolution, particularly through changes to cis-regulatory elements (CREs) that function in transcriptional regulation. For decades, however, the study of cis-regulatory evolution was severely limited by the available data. New data sets describing the locations of CREs and genetic variation within and between species have now made it possible to study CRE evolution much more directly on a genome-wide scale. Here, we review recent research on the evolution of CREs in humans based on large-scale genomic data sets. We consider inferences based on primate divergence, human polymorphism, and combinations of divergence and polymorphism. We then consider “new frontiers” in this field stemming from recent research on transcriptional regulation. PMID:25218861

  6. Abundant raw material for cis-regulatory evolution in humans

    NASA Technical Reports Server (NTRS)

    Rockman, Matthew V.; Wray, Gregory A.

    2002-01-01

    Changes in gene expression and regulation--due in particular to the evolution of cis-regulatory DNA sequences--may underlie many evolutionary changes in phenotypes, yet little is known about the distribution of such variation in populations. We present in this study the first survey of experimentally validated functional cis-regulatory polymorphism. These data are derived from more than 140 polymorphisms involved in the regulation of 107 genes in Homo sapiens, the eukaryote species with the most available data. We find that functional cis-regulatory variation is widespread in the human genome and that the consequent variation in gene expression is twofold or greater for 63% of the genes surveyed. Transcription factor-DNA interactions are highly polymorphic, and regulatory interactions have been gained and lost within human populations. On average, humans are heterozygous at more functional cis-regulatory sites (>16,000) than at amino acid positions (<13,000), in part because of an overrepresentation among the former in multiallelic tandem repeat variation, especially (AC)(n) dinucleotide microsatellites. The role of microsatellites in gene expression variation may provide a larger store of heritable phenotypic variation, and a more rapid mutational input of such variation, than has been realized. Finally, we outline the distinctive consequences of cis-regulatory variation for the genotype-phenotype relationship, including ubiquitous epistasis and genotype-by-environment interactions, as well as underappreciated modes of pleiotropy and overdominance. Ordinary small-scale mutations contribute to pervasive variation in transcription rates and consequently to patterns of human phenotypic variation.

  7. Abundant raw material for cis-regulatory evolution in humans.

    PubMed

    Rockman, Matthew V; Wray, Gregory A

    2002-11-01

    Changes in gene expression and regulation--due in particular to the evolution of cis-regulatory DNA sequences--may underlie many evolutionary changes in phenotypes, yet little is known about the distribution of such variation in populations. We present in this study the first survey of experimentally validated functional cis-regulatory polymorphism. These data are derived from more than 140 polymorphisms involved in the regulation of 107 genes in Homo sapiens, the eukaryote species with the most available data. We find that functional cis-regulatory variation is widespread in the human genome and that the consequent variation in gene expression is twofold or greater for 63% of the genes surveyed. Transcription factor-DNA interactions are highly polymorphic, and regulatory interactions have been gained and lost within human populations. On average, humans are heterozygous at more functional cis-regulatory sites (>16,000) than at amino acid positions (<13,000), in part because of an overrepresentation among the former in multiallelic tandem repeat variation, especially (AC)(n) dinucleotide microsatellites. The role of microsatellites in gene expression variation may provide a larger store of heritable phenotypic variation, and a more rapid mutational input of such variation, than has been realized. Finally, we outline the distinctive consequences of cis-regulatory variation for the genotype-phenotype relationship, including ubiquitous epistasis and genotype-by-environment interactions, as well as underappreciated modes of pleiotropy and overdominance. Ordinary small-scale mutations contribute to pervasive variation in transcription rates and consequently to patterns of human phenotypic variation.

  8. Abundant raw material for cis-regulatory evolution in humans

    NASA Technical Reports Server (NTRS)

    Rockman, Matthew V.; Wray, Gregory A.

    2002-01-01

    Changes in gene expression and regulation--due in particular to the evolution of cis-regulatory DNA sequences--may underlie many evolutionary changes in phenotypes, yet little is known about the distribution of such variation in populations. We present in this study the first survey of experimentally validated functional cis-regulatory polymorphism. These data are derived from more than 140 polymorphisms involved in the regulation of 107 genes in Homo sapiens, the eukaryote species with the most available data. We find that functional cis-regulatory variation is widespread in the human genome and that the consequent variation in gene expression is twofold or greater for 63% of the genes surveyed. Transcription factor-DNA interactions are highly polymorphic, and regulatory interactions have been gained and lost within human populations. On average, humans are heterozygous at more functional cis-regulatory sites (>16,000) than at amino acid positions (<13,000), in part because of an overrepresentation among the former in multiallelic tandem repeat variation, especially (AC)(n) dinucleotide microsatellites. The role of microsatellites in gene expression variation may provide a larger store of heritable phenotypic variation, and a more rapid mutational input of such variation, than has been realized. Finally, we outline the distinctive consequences of cis-regulatory variation for the genotype-phenotype relationship, including ubiquitous epistasis and genotype-by-environment interactions, as well as underappreciated modes of pleiotropy and overdominance. Ordinary small-scale mutations contribute to pervasive variation in transcription rates and consequently to patterns of human phenotypic variation.

  9. i-cisTarget 2015 update: generalized cis-regulatory enrichment analysis in human, mouse and fly.

    PubMed

    Imrichová, Hana; Hulselmans, Gert; Atak, Zeynep Kalender; Potier, Delphine; Aerts, Stein

    2015-07-01

    i-cisTarget is a web tool to predict regulators of a set of genomic regions, such as ChIP-seq peaks or co-regulated/similar enhancers. i-cisTarget can also be used to identify upstream regulators and their target enhancers starting from a set of co-expressed genes. Whereas the original version of i-cisTarget was focused on Drosophila data, the 2015 update also provides support for human and mouse data. i-cisTarget detects transcription factor motifs (position weight matrices) and experimental data tracks (e.g. from ENCODE, Roadmap Epigenomics) that are enriched in the input set of regions. As experimental data tracks we include transcription factor ChIP-seq data, histone modification ChIP-seq data and open chromatin data. The underlying processing method is based on a ranking-and-recovery procedure, allowing accurate determination of enrichment across heterogeneous datasets, while also discriminating direct from indirect target regions through a 'leading edge' analysis. We illustrate i-cisTarget on various Ewing sarcoma datasets to identify EWS-FLI1 targets starting from ChIP-seq, differential ATAC-seq, differential H3K27ac and differential gene expression data. Use of i-cisTarget is free and open to all, and there is no login requirement. Address: http://gbiomed.kuleuven.be/apps/lcb/i-cisTarget. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  10. CREME: Cis-Regulatory Module Explorer for the Human Genome

    SciTech Connect

    Loots, G G; Sharan, R; Ovcharenko, I; Ben-Hur, A

    2004-02-11

    The binding of transcription factors to specific regulatory sequence elements is a primary mechanism for controlling gene transcription. Eukaryotic genes are often regulated by several transcription factors, whose binding sites are tightly clustered and form cis-regulatory modules. In this paper we present a web-server, CREME, for identifying and visualizing cis-regulatory modules in the promoter regions of a given set of potentially co-regulated genes. CREME relies on a database of putative transcription factor binding sites that have been annotated across the human genome using a library of position weight matrices and evolutionary conservation with the mouse and rat genomes. A search algorithm is applied to this dataset to identify combinations of transcription factors whose binding sites tend to co-occur in close proximity in the promoter regions of the input gene set. The identified cis-regulatory modules are statistically scored and significant combinations are reported and graphically visualized. Our web-server is available at http://creme.dcode.org/.

  11. Fate of pathogenic bacteria in microcosms mimicking human body sites.

    PubMed

    Castellani, Francesco; Ghidini, Valentina; Tafi, Maria Carla; Boaretti, Marzia; Lleo, Maria M

    2013-07-01

    During the infectious process, pathogens may reach anatomical sites where they are exposed to substances interfering with their growth. These substances can include molecules produced by the host, and his resident microbial population, as well as exogenous antibacterial drugs. Suboptimal concentrations of inhibitory molecules and stress conditions found in vivo (high or low temperatures, lack of oxygen, extreme pH) might induce in bacteria the activation of survival mechanisms blocking their division capability but allowing them to stay alive. These "dormant" bacteria can be reactivated in particular circumstances and would be able to express their virulence traits. In this study, it was evaluated the effect of some environmental conditions, such as optimal and suboptimal temperatures, direct light and antibiotic sub-inhibitory concentrations doses of antibiotic, on the human pathogens Escherichia coli and Enterococcus faecalis when incubated in fluids accumulated in the body of patients with different pathologies. It is shown that inoculation in a number of accumulated body fluids and the presence of gentamicin, reliable conditions encountered during pathological states, induce stress-responding strategies enabling bacteria to persist in microcosms mimicking the human body. Significant differences were detected in Gram-negative and Gram-positive species with E. faecalis surviving, as starved or viable but non-culturable forms, in any microcosm and condition tested and E. coli activating a viable but non-culturable state only in some clinical samples. The persistence of bacteria under these conditions, being non-culturable, might explain some recurrent infections without isolation of the causative agent after application of the standard microbiological methods.

  12. The Influence of 13-cis Retinoic Acid on Human Meibomian Gland Epithelial Cells

    PubMed Central

    Ding, Juan; Kam, Wendy R.; Dieckow, Julia; Sullivan, David A.

    2013-01-01

    Purpose. Meibomian gland dysfunction (MGD) is a primary cause of dry eye disease. One of the risk factors for MGD is exposure to 13-cis retinoic acid (13-cis RA), a metabolite of vitamin A. However, the mechanism is not well understood. We hypothesize that 13-cis RA inhibits cell proliferation, promotes cell death, alters gene and protein expressions, and attenuates cell survival pathways in human meibomian gland epithelial cells. Methods. To test our hypotheses, immortalized human meibomian gland epithelial cells were cultured with or without 13-cis RA for varying doses and time. Cell proliferation, cell death, gene expression, and proteins involved in proliferation/survival and inflammation were evaluated. Results. We found that 13-cis RA inhibited cell proliferation, induced cell death, and significantly altered the expression of 6726 genes, including those involved in cell proliferation, cell death, differentiation, keratinization, and inflammation, in human meibomian gland epithelial cells. Further, 13-cis RA also reduced the phosphorylation of Akt and increased the generation of interleukin-1β and matrix metallopeptidase 9. Conclusions. Exposure to 13-cis RA inhibits cell proliferation, increases cell death, alters gene expression, changes signaling pathways, and promotes inflammatory mediator and protease expression in meibomian gland epithelial cells. These effects may be responsible, at least in part, for the 13-cis RA–related induction of MGD. PMID:23722388

  13. Molecular targets for the protodynamic action of cis-urocanic acid in human bladder carcinoma cells

    PubMed Central

    2010-01-01

    Background cis-urocanic acid (cis-UCA) is an endogenous amino acid metabolite capable of transporting protons from the mildly acidic extracellular medium into the cell cytosol. The resulting intracellular acidification suppresses many cellular activities. The current study was aimed at characterizing the molecular mechanisms underlying cis-UCA-mediated cytotoxicity in cultured cancer cells. Methods 5367 bladder carcinoma cells were left untreated or treated with cis-UCA. Cell death was assessed by measuring caspase-3 activity, mitochondrial membrane polarization, formation and release of cytoplasmic histone-associated DNA fragments, and cellular permeabilization. Cell viability and metabolic activity were monitored by colorimetric assays. Nuclear labelling was used to quantify the effects of cis-UCA on cell cycle. The activity of the ERK and JNK signalling pathways was studied by immunoblotting with specific antibodies. Phosphatase activity in cis-UCA-treated cells was determined by assay kits measuring absorbance resulting from the dephosphorylation of an artificial substrate. All statistical analyses were performed using the two-way Student's t-test (p < 0.05). Results Here we report that treatment of the 5637 human bladder carcinoma cells with 2% cis-UCA induces both apoptotic and necrotic cell death. In addition, metabolic activity of the 5637 cells is rapidly impaired, and the cells arrest in cell cycle in response to cis-UCA. Importantly, we show that cis-UCA promotes the ERK and JNK signalling pathways by efficiently inhibiting the activity of serine/threonine and tyrosine phosphatases. Conclusions Our studies elucidate how cis-UCA modulates several cellular processes, thereby inhibiting the proliferation and survival of bladder carcinoma cells. These anti-cancer effects make cis-UCA a potential candidate for the treatment of non-muscle invasive bladder carcinoma. PMID:20920317

  14. Cis and trans effects of human genomic variants on gene expression.

    PubMed

    Bryois, Julien; Buil, Alfonso; Evans, David M; Kemp, John P; Montgomery, Stephen B; Conrad, Donald F; Ho, Karen M; Ring, Susan; Hurles, Matthew; Deloukas, Panos; Davey Smith, George; Dermitzakis, Emmanouil T

    2014-07-01

    Gene expression is a heritable cellular phenotype that defines the function of a cell and can lead to diseases in case of misregulation. In order to detect genetic variations affecting gene expression, we performed association analysis of single nucleotide polymorphisms (SNPs) and copy number variants (CNVs) with gene expression measured in 869 lymphoblastoid cell lines of the Avon Longitudinal Study of Parents and Children (ALSPAC) cohort in cis and in trans. We discovered that 3,534 genes (false discovery rate (FDR) = 5%) are affected by an expression quantitative trait locus (eQTL) in cis and 48 genes are affected in trans. We observed that CNVs are more likely to be eQTLs than SNPs. In addition, we found that variants associated to complex traits and diseases are enriched for trans-eQTLs and that trans-eQTLs are enriched for cis-eQTLs. As a variant affecting both a gene in cis and in trans suggests that the cis gene is functionally linked to the trans gene expression, we looked specifically for trans effects of cis-eQTLs. We discovered that 26 cis-eQTLs are associated to 92 genes in trans with the cis-eQTLs of the transcriptions factors BATF3 and HMX2 affecting the most genes. We then explored if the variation of the level of expression of the cis genes were causally affecting the level of expression of the trans genes and discovered several causal relationships between variation in the level of expression of the cis gene and variation of the level of expression of the trans gene. This analysis shows that a large sample size allows the discovery of secondary effects of human variations on gene expression that can be used to construct short directed gene regulatory networks.

  15. Cis and Trans Effects of Human Genomic Variants on Gene Expression

    PubMed Central

    Bryois, Julien; Buil, Alfonso; Evans, David M.; Kemp, John P.; Montgomery, Stephen B.; Conrad, Donald F.; Ho, Karen M.; Ring, Susan; Hurles, Matthew; Deloukas, Panos; Davey Smith, George; Dermitzakis, Emmanouil T.

    2014-01-01

    Gene expression is a heritable cellular phenotype that defines the function of a cell and can lead to diseases in case of misregulation. In order to detect genetic variations affecting gene expression, we performed association analysis of single nucleotide polymorphisms (SNPs) and copy number variants (CNVs) with gene expression measured in 869 lymphoblastoid cell lines of the Avon Longitudinal Study of Parents and Children (ALSPAC) cohort in cis and in trans. We discovered that 3,534 genes (false discovery rate (FDR) = 5%) are affected by an expression quantitative trait locus (eQTL) in cis and 48 genes are affected in trans. We observed that CNVs are more likely to be eQTLs than SNPs. In addition, we found that variants associated to complex traits and diseases are enriched for trans-eQTLs and that trans-eQTLs are enriched for cis-eQTLs. As a variant affecting both a gene in cis and in trans suggests that the cis gene is functionally linked to the trans gene expression, we looked specifically for trans effects of cis-eQTLs. We discovered that 26 cis-eQTLs are associated to 92 genes in trans with the cis-eQTLs of the transcriptions factors BATF3 and HMX2 affecting the most genes. We then explored if the variation of the level of expression of the cis genes were causally affecting the level of expression of the trans genes and discovered several causal relationships between variation in the level of expression of the cis gene and variation of the level of expression of the trans gene. This analysis shows that a large sample size allows the discovery of secondary effects of human variations on gene expression that can be used to construct short directed gene regulatory networks. PMID:25010687

  16. Global reorganisation of cis-regulatory units upon lineage commitment of human embryonic stem cells.

    PubMed

    Freire-Pritchett, Paula; Schoenfelder, Stefan; Várnai, Csilla; Wingett, Steven W; Cairns, Jonathan; Collier, Amanda J; García-Vílchez, Raquel; Furlan-Magaril, Mayra; Osborne, Cameron S; Fraser, Peter; Rugg-Gunn, Peter J; Spivakov, Mikhail

    2017-03-23

    Long-range cis-regulatory elements such as enhancers coordinate cell-specific transcriptional programmes by engaging in DNA looping interactions with target promoters. Deciphering the interplay between the promoter connectivity and activity of cis-regulatory elements during lineage commitment is crucial for understanding developmental transcriptional control. Here, we use Promoter Capture Hi-C to generate a high-resolution atlas of chromosomal interactions involving ~22,000 gene promoters in human pluripotent and lineage-committed cells, identifying putative target genes for known and predicted enhancer elements. We reveal extensive dynamics of cis-regulatory contacts upon lineage commitment, including the acquisition and loss of promoter interactions. This spatial rewiring occurs preferentially with predicted changes in the activity of cis-regulatory elements and is associated with changes in target gene expression. Our results provide a global and integrated view of promoter interactome dynamics during lineage commitment of human pluripotent cells.

  17. cis-Regulatory Mutations Are a Genetic Cause of Human Limb Malformations

    PubMed Central

    VanderMeer, Julia E.; Ahituv, Nadav

    2011-01-01

    The underlying mutations that cause human limb malformations are often difficult to determine, particularly for limb malformations that occur as isolated traits. Evidence from a variety of studies shows that cis-regulatory mutations, specifically in enhancers, can lead to some of these isolated limb malformations. Here, we provide a review of human limb malformations that have been shown to be caused by enhancer mutations and propose that cis-regulatory mutations will continue to be identified as the cause of additional human malformations as our understanding of regulatory sequences improves. PMID:21509892

  18. Humans mimicking animals: A cortical hierarchy for human vocal communication sounds

    PubMed Central

    Talkington, William J.; Rapuano, Kristina M.; Hitt, Laura; Frum, Chris A.; Lewis, James W.

    2012-01-01

    Numerous species possess cortical regions that are most sensitive to vocalizations produced by their own kind (conspecifics). In humans, the superior temporal sulci (STS) putatively represent homologous voice-sensitive areas of cortex. However, STS regions have recently been reported to represent auditory experience or “expertise” in general rather than showing exclusive sensitivity to human vocalizations per se. Using functional magnetic resonance imaging and a unique non-stereotypical category of complex human non-verbal vocalizations – human-mimicked versions of animal vocalizations – we found a cortical hierarchy in humans optimized for processing meaningful conspecific utterances. This left-lateralized hierarchy originated near primary auditory cortices and progressed into traditional speech-sensitive areas. These results suggest that the cortical regions supporting vocalization perception are initially organized by sensitivity to the human vocal tract in stages prior to the STS. Additionally, these findings have implications for the developmental time course of conspecific vocalization processing in humans as well as its evolutionary origins. PMID:22674283

  19. Enhancer divergence and cis-regulatory evolution in the human and chimp neural crest.

    PubMed

    Prescott, Sara L; Srinivasan, Rajini; Marchetto, Maria Carolina; Grishina, Irina; Narvaiza, Iñigo; Selleri, Licia; Gage, Fred H; Swigut, Tomek; Wysocka, Joanna

    2015-09-24

    cis-regulatory changes play a central role in morphological divergence, yet the regulatory principles underlying emergence of human traits remain poorly understood. Here, we use epigenomic profiling from human and chimpanzee cranial neural crest cells to systematically and quantitatively annotate divergence of craniofacial cis-regulatory landscapes. Epigenomic divergence is often attributable to genetic variation within TF motifs at orthologous enhancers, with a novel motif being most predictive of activity biases. We explore properties of this cis-regulatory change, revealing the role of particular retroelements, uncovering broad clusters of species-biased enhancers near genes associated with human facial variation, and demonstrating that cis-regulatory divergence is linked to quantitative expression differences of crucial neural crest regulators. Our work provides a wealth of candidates for future evolutionary studies and demonstrates the value of "cellular anthropology," a strategy of using in-vitro-derived embryonic cell types to elucidate both fundamental and evolving mechanisms underlying morphological variation in higher primates.

  20. Role of Human DNA Polymerase kappa in Extension Opposite from a cis-syn Thymine Dimer

    SciTech Connect

    R Vasquez-Del Carpio; T Silverstein; S Lone; R Johnson; L Prakash; S Prakash; A Aggarwal

    2011-12-31

    Exposure of DNA to UV radiation causes covalent linkages between adjacent pyrimidines. The most common lesion found in DNA from these UV-induced linkages is the cis-syn cyclobutane pyrimidine dimer. Human DNA polymerase {Kappa} (Pol{Kappa}), a member of the Y-family of DNA polymerases, is unable to insert nucleotides opposite the 3'T of a cis-syn T-T dimer, but it can efficiently extend from a nucleotide inserted opposite the 3'T of the dimer by another DNA polymerase. We present here the structure of human Pol{Kappa} in the act of inserting a nucleotide opposite the 5'T of the cis-syn T-T dimer. The structure reveals a constrained active-site cleft that is unable to accommodate the 3'T of a cis-syn T-T dimer but is remarkably well adapted to accommodate the 5'T via Watson-Crick base pairing, in accord with a proposed role for Pol{Kappa} in the extension reaction opposite from cyclobutane pyrimidine dimers in vivo.

  1. Role of human DNA polymerase κ in extension opposite from a cis-syn thymine dimer.

    PubMed

    Vasquez-Del Carpio, Rodrigo; Silverstein, Timothy D; Lone, Samer; Johnson, Robert E; Prakash, Louise; Prakash, Satya; Aggarwal, Aneel K

    2011-04-29

    Exposure of DNA to UV radiation causes covalent linkages between adjacent pyrimidines. The most common lesion found in DNA from these UV-induced linkages is the cis-syn cyclobutane pyrimidine dimer. Human DNA polymerase κ (Polκ), a member of the Y-family of DNA polymerases, is unable to insert nucleotides opposite the 3'T of a cis-syn T-T dimer, but it can efficiently extend from a nucleotide inserted opposite the 3'T of the dimer by another DNA polymerase. We present here the structure of human Polκ in the act of inserting a nucleotide opposite the 5'T of the cis-syn T-T dimer. The structure reveals a constrained active-site cleft that is unable to accommodate the 3'T of a cis-syn T-T dimer but is remarkably well adapted to accommodate the 5'T via Watson-Crick base pairing, in accord with a proposed role for Polκ in the extension reaction opposite from cyclobutane pyrimidine dimers in vivo. Copyright © 2011 Elsevier Ltd. All rights reserved.

  2. Identification of cis-suppression of human disease mutations by comparative genomics.

    PubMed

    Jordan, Daniel M; Frangakis, Stephan G; Golzio, Christelle; Cassa, Christopher A; Kurtzberg, Joanne; Davis, Erica E; Sunyaev, Shamil R; Katsanis, Nicholas

    2015-08-13

    Patterns of amino acid conservation have served as a tool for understanding protein evolution. The same principles have also found broad application in human genomics, driven by the need to interpret the pathogenic potential of variants in patients. Here we performed a systematic comparative genomics analysis of human disease-causing missense variants. We found that an appreciable fraction of disease-causing alleles are fixed in the genomes of other species, suggesting a role for genomic context. We developed a model of genetic interactions that predicts most of these to be simple pairwise compensations. Functional testing of this model on two known human disease genes revealed discrete cis amino acid residues that, although benign on their own, could rescue the human mutations in vivo. This approach was also applied to ab initio gene discovery to support the identification of a de novo disease driver in BTG2 that is subject to protective cis-modification in more than 50 species. Finally, on the basis of our data and models, we developed a computational tool to predict candidate residues subject to compensation. Taken together, our data highlight the importance of cis-genomic context as a contributor to protein evolution; they provide an insight into the complexity of allele effect on phenotype; and they are likely to assist methods for predicting allele pathogenicity.

  3. Computational identification of new structured cis-regulatory elements in the 3'-untranslated region of human protein coding genes.

    PubMed

    Chen, Xiaowei Sylvia; Brown, Chris M

    2012-10-01

    Messenger ribonucleic acids (RNAs) contain a large number of cis-regulatory RNA elements that function in many types of post-transcriptional regulation. These cis-regulatory elements are often characterized by conserved structures and/or sequences. Although some classes are well known, given the wide range of RNA-interacting proteins in eukaryotes, it is likely that many new classes of cis-regulatory elements are yet to be discovered. An approach to this is to use computational methods that have the advantage of analysing genomic data, particularly comparative data on a large scale. In this study, a set of structural discovery algorithms was applied followed by support vector machine (SVM) classification. We trained a new classification model (CisRNA-SVM) on a set of known structured cis-regulatory elements from 3'-untranslated regions (UTRs) and successfully distinguished these and groups of cis-regulatory elements not been strained on from control genomic and shuffled sequences. The new method outperformed previous methods in classification of cis-regulatory RNA elements. This model was then used to predict new elements from cross-species conserved regions of human 3'-UTRs. Clustering of these elements identified new classes of potential cis-regulatory elements. The model, training and testing sets and novel human predictions are available at: http://mRNA.otago.ac.nz/CisRNA-SVM.

  4. Automatic ECG quality scoring methodology: mimicking human annotators.

    PubMed

    Johannesen, Lars; Galeotti, Loriano

    2012-09-01

    An algorithm to determine the quality of electrocardiograms (ECGs) can enable inexperienced nurses and paramedics to record ECGs of sufficient diagnostic quality. Previously, we proposed an algorithm for determining if ECG recordings are of acceptable quality, which was entered in the PhysioNet Challenge 2011. In the present work, we propose an improved two-step algorithm, which first rejects ECGs with macroscopic errors (signal absent, large voltage shifts or saturation) and subsequently quantifies the noise (baseline, powerline or muscular noise) on a continuous scale. The performance of the improved algorithm was evaluated using the PhysioNet Challenge database (1500 ECGs rated by humans for signal quality). We achieved a classification accuracy of 92.3% on the training set and 90.0% on the test set. The improved algorithm is capable of detecting ECGs with macroscopic errors and giving the user a score of the overall quality. This allows the user to assess the degree of noise and decide if it is acceptable depending on the purpose of the recording.

  5. Interaction of Cis- and Trans-RuCl 2(DMSO)4 With Human Serum Albumin

    PubMed Central

    Kozlowski, Henryk; Katsaros, Nikolas

    2000-01-01

    The interaction between cis- and trans- RuCl2(DMSO)4 and human serum albumin have been investigated through UV-Vis, circular dichroism, fluorescence spectroscopy and inductively couplet plasma atomic emission spectroscopy (ICP(AES)) method Albumin can specifically bind 1 mole of cis-isomer and 2 moles of the trans-isomer RuCl2(DMSO)4 complex. The interaction of RuCl2(DMSO)4 with HSA causes: a conformational change with the loss of helical stability of protein; the strong quenching of the Trp 214 fluorescence indicating that the conformational change of the hydrophobic binding pocked in subdomain IIA takes place; a local perturbation of the warfarin binding site and induce some conformational changes at neighbour domains, a changing of the binding abilities towards heme. PMID:18475961

  6. Mimicking the human smell sensing mechanism with an artificial nose platform.

    PubMed

    Lee, Sang Hun; Kwon, Oh Seok; Song, Hyun Seok; Park, Seon Joo; Sung, Jong Hwan; Jang, Jyongsik; Park, Tai Hyun

    2012-02-01

    Sensing smell is a highly complex biological process, and characterizing and mimicking the interaction between the olfactory receptor (OR) protein and its ligands is extremely challenging. Herein, we report a highly sensitive and selective human nose-like nanobioelectronic nose (nbe-nose), which responds to gaseous odorants sensitively and selectively, has a signal specificity pattern similar to that in the cellular signal transduction pathway, and maintains an antagonistic behavior similar to the human nose. The human olfaction mechanism was mimicked by using carboxylated polypyrrole nanotubes (CPNTs) functionalized with human OR protein. The nbe-nose was able to detect gaseous odorants at a concentration as low as 0.02 parts-per-trillion (ppt), which was comparable to a highly trained, human expert's nose. The nbe-nose can be used scientifically for smell mechanism studies. It can be also applied to various fields that rely on smell monitoring for industrial and public purposes. Copyright © 2011 Elsevier Ltd. All rights reserved.

  7. Health reform: the human resource challenges for Central Asian Commonwealth of Independent States (CIS) countries.

    PubMed

    Parfitt, Barbara

    2009-01-01

    This paper examines the key human resource issues for health amongst mid-level workers in Central Asia CIS countries. It focuses on Azerbaijan, Tajikistan and Uzbekistan highlighting the human resource issues that are evident within these countries and illustrating how they differ from those described in the sub-Saharan developing countries. The key human resource issue highlighted by the World Health Organization Report [WHO. (2006). World Health Report: Working together for health. Geneva: WHO] was the scarcity of health workers. Four million health care workers were identified as essential if the health services of the world are able to meet current health needs. The primary area of need highlighted was in Africa. Africa bears the greatest burden of disease but has the lowest number of health care workers. In the CIS countries in Central Asia different human resource issues have emerged. The Soviet health care system was comprehensive but labour intensive it had a primarily acute and a specialist disease focused approach with little investment in primary and community health care. It was unsustainable and the legacy that it left the new Central Asian emerging nations was of a large workforce with poor levels of competence and outdated approaches to providing care along with a crumbling infrastructure. In response to this situation health reform has been introduced which focuses on a family model of primary health care with family doctors supported by Family Health Nurses. This approach is beginning to make a difference to the morbidity and mortality of the populations but still has a long way to go before its full benefits are realised.

  8. A heterogeneous human tissue mimicking phantom for RF heating and MRI thermal monitoring verification

    NASA Astrophysics Data System (ADS)

    Yuan, Yu; Wyatt, Cory; Maccarini, Paolo; Stauffer, Paul; Craciunescu, Oana; MacFall, James; Dewhirst, Mark; Das, Shiva K.

    2012-04-01

    This paper describes a heterogeneous phantom that mimics a human thigh with a deep-seated tumor, for the purpose of studying the performance of radiofrequency (RF) heating equipment and non-invasive temperature monitoring with magnetic resonance imaging (MRI). The heterogeneous cylindrical phantom was constructed with an outer fat layer surrounding an inner core of phantom material mimicking muscle, tumor and marrow-filled bone. The component materials were formulated to have dielectric and thermal properties similar to human tissues. The dielectric properties of the tissue mimicking phantom materials were measured with a microwave vector network analyzer and impedance probe over the frequency range of 80-500 MHz and at temperatures of 24, 37 and 45 °C. The specific heat values of the component materials were measured using a differential scanning calorimeter over the temperature range of 15-55 °C. The thermal conductivity value was obtained from fitting the curves obtained from one-dimensional heat transfer measurement. The phantom was used to verify the operation of a cylindrical four-antenna annular phased array extremity applicator (140 MHz) by examining the proton resonance frequency shift (PRFS) thermal imaging patterns for various magnitude/phase settings (including settings to focus heating in tumors). For muscle and tumor materials, MRI was also used to measure T1/T2* values (1.5 T) and to obtain the slope of the PRFS phase change versus temperature change curve. The dielectric and thermal properties of the phantom materials were in close agreement to well-accepted published results for human tissues. The phantom was able to successfully demonstrate satisfactory operation of the tested heating equipment. The MRI-measured thermal distributions matched the expected patterns for various magnitude/phase settings of the applicator, allowing the phantom to be used as a quality assurance tool. Importantly, the material formulations for the various tissue types

  9. A heterogeneous human tissue mimicking phantom for RF heating and MRI thermal monitoring verification.

    PubMed

    Yuan, Yu; Wyatt, Cory; Maccarini, Paolo; Stauffer, Paul; Craciunescu, Oana; Macfall, James; Dewhirst, Mark; Das, Shiva K

    2012-04-07

    This paper describes a heterogeneous phantom that mimics a human thigh with a deep-seated tumor, for the purpose of studying the performance of radiofrequency (RF) heating equipment and non-invasive temperature monitoring with magnetic resonance imaging (MRI). The heterogeneous cylindrical phantom was constructed with an outer fat layer surrounding an inner core of phantom material mimicking muscle, tumor and marrow-filled bone. The component materials were formulated to have dielectric and thermal properties similar to human tissues. The dielectric properties of the tissue mimicking phantom materials were measured with a microwave vector network analyzer and impedance probe over the frequency range of 80-500 MHz and at temperatures of 24, 37 and 45 °C. The specific heat values of the component materials were measured using a differential scanning calorimeter over the temperature range of 15-55 °C. The thermal conductivity value was obtained from fitting the curves obtained from one-dimensional heat transfer measurement. The phantom was used to verify the operation of a cylindrical four-antenna annular phased array extremity applicator (140 MHz) by examining the proton resonance frequency shift (PRFS) thermal imaging patterns for various magnitude/phase settings (including settings to focus heating in tumors). For muscle and tumor materials, MRI was also used to measure T1/T2* values (1.5 T) and to obtain the slope of the PRFS phase change versus temperature change curve. The dielectric and thermal properties of the phantom materials were in close agreement to well-accepted published results for human tissues. The phantom was able to successfully demonstrate satisfactory operation of the tested heating equipment. The MRI-measured thermal distributions matched the expected patterns for various magnitude/phase settings of the applicator, allowing the phantom to be used as a quality assurance tool. Importantly, the material formulations for the various tissue types

  10. An Integrated Approach to Identifying Cis-Regulatory Modules in the Human Genome

    PubMed Central

    Won, Kyoung-Jae; Agarwal, Saurabh; Shen, Li; Shoemaker, Robert; Ren, Bing; Wang, Wei

    2009-01-01

    In eukaryotic genomes, it is challenging to accurately determine target sites of transcription factors (TFs) by only using sequence information. Previous efforts were made to tackle this task by considering the fact that TF binding sites tend to be more conserved than other functional sites and the binding sites of several TFs are often clustered. Recently, ChIP-chip and ChIP-sequencing experiments have been accumulated to identify TF binding sites as well as survey the chromatin modification patterns at the regulatory elements such as promoters and enhancers. We propose here a hidden Markov model (HMM) to incorporate sequence motif information, TF-DNA interaction data and chromatin modification patterns to precisely identify cis-regulatory modules (CRMs). We conducted ChIP-chip experiments on four TFs, CREB, E2F1, MAX, and YY1 in 1% of the human genome. We then trained a hidden Markov model (HMM) to identify the labels of the CRMs by incorporating the sequence motifs recognized by these TFs and the ChIP-chip ratio. Chromatin modification data was used to predict the functional sites and to further remove false positives. Cross-validation showed that our integrated HMM had a performance superior to other existing methods on predicting CRMs. Incorporating histone signature information successfully penalized false prediction and improved the whole performance. The dataset we used and the software are available at http://nash.ucsd.edu/CIS/. PMID:19434238

  11. Repair synthesis by human cell extracts in DNA damaged by cis- and trans-diamminedichloroplatinum(II).

    PubMed Central

    Hansson, J; Wood, R D

    1989-01-01

    DNA damage was induced in closed circular plasmid DNA by treatment with cis- or trans-diamminedichloroplatinum(II). These plasmids were used as substrates in reactions to give quantitative measurements of DNA repair synthesis mediated by cell free extracts from human lymphoid cell lines. Adducts induced by both drugs stimulated repair synthesis in a dose dependent manner by an ATP-requiring process. Measurements by an isopycnic gradient sedimentation method gave an upper limit for the average patch sizes in this in vitro system of around 140 nucleotides. It was estimated that up to 3% of the drug adducts induce the synthesis of a repair patch. The repair synthesis is due to repair of a small fraction of frequent drug adducts, rather than extensive repair of a rare subclass of lesions. Nonspecific DNA synthesis in undamaged plasmids, caused by exonucleolytic degradation and resynthesis, was reduced by repeated purification of intact circular forms. An extract made from cells belonging to xeroderma pigmentosum complementation group A was deficient in repair synthesis in response to the presence of cis- or trans-diamminedichloroplatinum(II) adducts in DNA. Images PMID:2554251

  12. Metabolism of (-)-cis- and (-)-trans-rose oxide by cytochrome P450 enzymes in human liver microsomes.

    PubMed

    Nakahashi, Hiroshi; Yamamura, Yuuki; Usami, Atsushi; Rangsunvigit, Pramoch; Malakul, Pomthong; Miyazawa, Mitsuo

    2015-12-01

    The in vitro metabolism of (-)-cis- and (-)-trans-rose oxide was investigated using human liver microsomes and recombinant cytochrome P450 (P450 or CYP) enzymes for the first time. Both isomers of rose oxide were incubated with human liver microsomes, and the formation of the respective 9-oxidized metabolite were determined using gas chromatography-mass spectrometry (GC-MS). Of 11 different recombinant human P450 enzymes used, CYP2B6 and CYP2C19 were the primary enzymes catalysing the metabolism of (-)-cis- and (-)-trans-rose oxide. CYP1A2 also efficiently oxidized (-)-cis-rose oxide at the 9-position but not (-)-trans-rose oxide. α-Naphthoflavone (a selective CYP1A2 inhibitor), thioTEPA (a CYP2B6 inhibitor) and anti-CYP2B6 antibody inhibited (-)-cis-rose oxide 9-hydroxylation catalysed by human liver microsomes. On the other hand, the metabolism of (-)-trans-rose oxide was suppressed by thioTEPA and anti-CYP2B6 at a significant level in human liver microsomes. However, omeprazole (a CYP2C19 inhibitor) had no significant effects on the metabolism of both isomers of rose oxide. Using microsomal preparations from nine different human liver samples, (-)-9-hydroxy-cis- and (-)-9-hydroxy-trans-rose oxide formations correlated with (S)-mephenytoin N-demethylase activity (CYP2B6 marker activity). These results suggest that CYP2B6 plays important roles in the metabolism of (-)-cis- and (-)-trans-rose oxide in human liver microsomes.

  13. Molecular mechanism depressing PMA-induced invasive behaviors in human lung adenocarcinoma cells by cis- and trans-cinnamic acid.

    PubMed

    Tsai, Chiung-Man; Sun, Fang-Ming; Chen, Yen-Ling; Hsu, Chin-Lin; Yen, Gow-Chin; Weng, Chia-Jui

    2013-02-14

    Dietary polyphenols have been reported as an effective phytochemical for health protection and cinnamic acid (CA) is one of the polyphenols that has been demonstrated having chemopreventive potential. It was known that the early and distal metastasis might lead to the high mortality of patients with lung adenocarcinoma. We previously compared and verified the inhibitory effect of cis-CA and trans-CA on phorbol-12-myristate-13-acetate (PMA)-induced invasion of human lung adenocarcinoma A549 cells. The aim of this study was to explore the underlying molecular mechanism. By gelatin zymography and semi-quantitative RT-PCR, the activities and mRNA of MMP-9/MMP-2 exerted a significantly (p<.05) dose-dependent reduction by treating with cis-CA and trans-CA. Western blots further showed that the cis-CA- and trans-CA-inhibited MMPs might partly through modulating TIMP-1 and the PAI-2-regulated uPA activity. In molecular level, the AP-1 and NF-κB as well as the downstream of the MAPK pathway might be involved in cis-CA- and trans-CA-inhibited MMPs expression. This study disclosed the molecular mechanism underlying the anti-invasive activity of cis-CA and trans-CA and concluded the cis- and trans-form of CA should be a safe and potential agent to prevent lung tumor cells from metastasizing. Copyright © 2012 Elsevier B.V. All rights reserved.

  14. Exercise-mimicking treatment fails to increase Fndc5 mRNA & irisin secretion in primary human myotubes.

    PubMed

    Kurdiova, Timea; Balaz, Miroslav; Mayer, Alexander; Maderova, Denisa; Belan, Vitazoslav; Wolfrum, Christian; Ukropec, Jozef; Ukropcova, Barbara

    2014-06-01

    Irisin, myokine secreted by skeletal muscle, was suggested to mediate some of exercise health benefits via "browning" of white adipose tissue. However, mounting evidence contradicts the regulatory role of exercise for muscle irisin production/secretion in humans. Thus, we explored the direct effect of exercise-mimicking treatment on irisin in human primary muscle cells in vitro. Human primary muscle cell cultures were established from lean, obese prediabetic and type-2-diabetic individuals. Complex metabolic phenotyping included assessment of insulin sensitivity (euglycemic hyperinsulinemic clamp) and adiposity content&distribution (MRI&MRS). In vitro exercise-mimicking treatment (forskolin+ionomycin) was delivered in 1-h pulse/day during differentiation. Fndc5 mRNA (qRT-PCR) and secreted irisin (ELISA) were determined in cells and media. Exercise-mimicking treatment more than doubled Pgc1α mRNA in differentiated muscle cells. Nevertheless, Fndc5 mRNA was reduced by 18% and irisin in media by 20%. Moreover, Fncd5 mRNA was increased in myotubes derived from individuals with type-2-diabetes, independent on exercise-mimicking treatment. Fndc5 mRNA in cells was positively related to fasting glycemia (p=0.0001) and negatively to whole-body insulin sensitivity (p<0.05). Collectively, our data do not support the role of exercise-related signaling pathways in irisin regulation in human skeletal muscle and confirm our previous observations on increased Fndc5 expression in muscle cells from individuals with type-2-diabetes.

  15. Cis-regulatory underpinnings of human GLI3 expression in embryonic craniofacial structures and internal organs.

    PubMed

    Abbasi, Amir A; Minhas, Rashid; Schmidt, Ansgar; Koch, Sabine; Grzeschik, Karl-Heinz

    2013-10-01

    The zinc finger transcription factor Gli3 is an important mediator of Sonic hedgehog (Shh) signaling. During early embryonic development Gli3 participates in patterning and growth of the central nervous system, face, skeleton, limb, tooth and gut. Precise regulation of the temporal and spatial expression of Gli3 is crucial for the proper specification of these structures in mammals and other vertebrates. Previously we reported a set of human intronic cis-regulators controlling almost the entire known repertoire of endogenous Gli3 expression in mouse neural tube and limbs. However, the genetic underpinning of GLI3 expression in other embryonic domains such as craniofacial structures and internal organs remain elusive. Here we demonstrate in a transgenic mice assay the potential of a subset of human/fish conserved non-coding sequences (CNEs) residing within GLI3 intronic intervals to induce reporter gene expression at known regions of endogenous Gli3 transcription in embryonic domains other than central nervous system (CNS) and limbs. Highly specific reporter expression was observed in craniofacial structures, eye, gut, and genitourinary system. Moreover, the comparison of expression patterns directed by these intronic cis-acting regulatory elements in mouse and zebrafish embryos suggests that in accordance with sequence conservation, the target site specificity of a subset of these elements remains preserved among these two lineages. Taken together with our recent investigations, it is proposed here that during vertebrate evolution the Gli3 expression control acquired multiple, independently acting, intronic enhancers for spatiotemporal patterning of CNS, limbs, craniofacial structures and internal organs.

  16. Human chorionic gonadotropin induces human macrophages to form intracytoplasmic vacuoles mimicking Hofbauer cells in human chorionic villi.

    PubMed

    Yamaguchi, Munekage; Ohba, Takashi; Tashiro, Hironori; Yamada, Gen; Katabuchi, Hidetaka

    2013-01-01

    The most characteristic morphological feature of macrophages in the stroma of placental villi, known as Hofbauer cells, is their highly vacuolated appearance. They also show positive immunostaining for human chorionic gonadotropin (hCG) and express messenger ribonucleic acid of the luteinizing hormone/chorionic gonadotropin receptor with a deletion of exon 9 (LH/CG-R Δ9). Maternal hCG enters fetal plasma through the mesenchyme of the placental villi and promotes male sexual differentiation in early pregnancy; therefore, excess hCG may induce aberrant genital differentiation and hCG must be adjusted at the fetomaternal interface. We hypothesized that hCG is regulated by Hofbauer cells and that their peculiar vacuoles are involved in a cell-specific function. To assess the morphological modification and expression of LH/CG-R Δ9 in human macrophages after hCG exposure, the present study examined phorbol 12-myristate 13-acetate (PMA)-treated THP-1 cells, a human monocyte-macrophage cell line. hCG induced transient vacuole formation in PMA-treated THP-1 cells, morphologically mimicking Hofbauer cells. Immunocytochemistry showed that PMA-treated THP-1 cells incorporated hCG but not luteinizing hormone or follicle-stimulating hormone. Western blotting analyses demonstrated that PMA-treated THP-1 cells expressed an immunoreactive 60-kDa protein, designated as endogenous LH/CG-R Δ9. hCG induced a transient reduction in the LH/CG-R Δ9, which was synchronous with the appearance of cytoplasmic vacuoles. In conclusion, human macrophages regulating hCG via cytoplasmic LH/CG-R Δ9 mimic the morphological characteristics of Hofbauer cells. Their vacuoles may be associated with their cell-specific function to protect the fetus from exposure to excess maternal hCG during pregnancy.

  17. Hybrid vitronectin-mimicking polycaprolactone scaffolds for human retinal progenitor cell differentiation and transplantation.

    PubMed

    Lawley, Elodie; Baranov, Petr; Young, Michael

    2015-01-01

    Many advances have been made in an attempt to treat retinal degenerative diseases, such as age-related macular degeneration and retinitis pigmentosa. The irreversible loss of photoreceptors is common to both, and currently no restorative clinical treatment exists. It has been shown that retinal progenitor and photoreceptor precursor cell transplantation can rescue the retinal structure and function. Importantly, retinal progenitor cells can be collected from the developing neural retina with further expansion and additional modification in vitro, and the delivery into the degenerative host can be performed as a single-cell suspension injection or as a complex graft transplantation. Previously, we have described several polymer scaffolds for culture and transplantation of retinal progenitor cells of both mouse and human origin. This tissue engineering strategy increases donor cell survival and integration. We have also shown that biodegradable poly(ɛ-caprolactone) induces mature photoreceptor differentiation from human retinal progenitor cells. However, poor adhesive properties limit its use, and therefore it requires additional surface modification. The aim of this work was to study vitronectin-mimicking oligopeptides (Synthemax II-SC) poly(ɛ-caprolactone) films and their effects on human retinal progenitor cell adhesion, proliferation, and differentiation. Here, we show that the incorporation of vitronectin-mimicking oligopeptide into poly(ɛ-caprolactone) leads to dose-dependent increases in cell adhesion; the optimum dose identified as 30 µg/ml. Inhibition of human retinal progenitor cells proliferation was seen on poly(ɛ-caprolactone) and was maintained with the hybrid scaffold. This has been shown to be beneficial for driving cell differentiation. Additionally, we observed equal expression of Nrl, rhodopsin, recoverin, and rod outer membrane 1 after differentiation on the hybrid scaffold as compared to the standard fibronectin coating of poly

  18. Full Mimicking of Coronary Hemodynamics for Ex-Vivo Stimulation of Human Saphenous Veins.

    PubMed

    Piola, Marco; Ruiter, Matthijs; Vismara, Riccardo; Mastrullo, Valeria; Agrifoglio, Marco; Zanobini, Marco; Pesce, Maurizio; Soncini, Monica; Fiore, Gianfranco Beniamino

    2017-04-01

    After coronary artery bypass grafting, structural modifications of the saphenous vein wall lead to lumen narrowing in response to the altered hemodynamic conditions. Here we present the design of a novel ex vivo culture system conceived for mimicking central coronary artery hemodynamics, and we report the results of biomechanical stimulation experiments using human saphenous vein samples. The novel pulsatile system used an aortic-like pressure for forcing a time-dependent coronary-like resistance to obtain the corresponding coronary-like flow rate. The obtained pulsatile pressures and flow rates (diastolic/systolic: 80/120 mmHg and 200/100 mL/min, respectively) showed a reliable mimicking of the complex coronary hemodynamic environment. Saphenous vein segments from patients undergoing coronary artery bypass grafting (n = 12) were subjected to stimulation in our bioreactor with coronary pulsatile pressure/flow patterns or with venous-like perfusion. After 7-day stimulation, SVs were fixed and stained for morphometric evaluation and immunofluorescence. Results were compared with untreated segments of the same veins. Morphometric and immunofluorescence analysis revealed that 7 days of pulsatile stimulation: (i) did not affect integrity of the vessel wall and lumen perimeter, (ii) significantly decreased both intima and media thickness, (iii) led to partial endothelial denudation, and (iv) induced apoptosis in the vessel wall. These data are consistent with the early vessel remodeling events involved in venous bypass adaptation to arterial flow/pressure patterns. The pulsatile system proved to be a suitable device to identify ex vivo mechanical cues leading to graft adaptation.

  19. Pharmacokinetic correlation between experimental and clinical effects on human non-small cell lung cancers of cis-diammineglycolatoplatinum (254-S) and cis-diamminedichloroplatinum.

    PubMed

    Koenuma, M; Kasai, H; Uchida, N; Wada, T; Hattori, M; Oguma, T; Totani, T; Inaba, M

    1995-01-01

    We attempted to correlate the in vitro and in vivo antitumor activities of cis-diammineglycolatoplatinum (254-S), a novel platinum complex, and cis-diamminedichloro-platinum (CDDP) against the established culture cell lines and xenografts of human non-small cell lung cancer (NSCLC) with their clinical effects, based on the previous finding that the cytotoxicity of CDDP depends on the area under the curve (AUC). The concentration of 254-S and CDDP inhibiting the in vitro growth of 4 cultured NSCLC lines by 50% (IC50) was 0.82-7.8 and 0.53-4.2 micrograms/ml, respectively, showing a similar level. Of the 4 cell lines, only the most sensitive line, RERF-LC-AI, showed an IC50 close to a specific concentration (0.50 for 254-S and 0.32 micrograms/ml for CDDP) that reproduces in vitro the clinical AUCfree (24.8 and 5.34 micrograms-hr/ml) of the respective drugs. We treated 6 lines of human NSCLC xenografts implanted in nude mice with 254-S and CDDP at a particular dose (13.2 and 3.7 mg/kg) that is equivalent to the clinical doses with respect to the plasma AUCfree. 254-S and CDDP exhibited significant antitumor effects on 2 and 1 of the 6 lines, respectively. These in vitro and in vivo findings were considered to be relatively well correlated with the reported clinical response rates of 15-19% for 254-S and 14-15% for CDDP.

  20. Trans-10, cis-12 conjugated linoleic acid decreases de novo lipid synthesis in human adipocytes.

    PubMed

    Obsen, Thomas; Faergeman, Nils J; Chung, Soonkyu; Martinez, Kristina; Gobern, Semone; Loreau, Olivier; Wabitsch, Martin; Mandrup, Susanne; McIntosh, Michael

    2012-06-01

    Conjugated linoleic acid (CLA) reduces adiposity in vivo. However, mechanisms mediating these changes are unclear. Therefore, we treated cultures of human adipocytes with trans-10, cis-12 (10,12) CLA, cis-9, trans-11 (9,11) CLA or other trans fatty acids (FA), and measured indices of lipid metabolism. The lipid-lowering effects of 10,12 CLA were unique, as other trans FA did not reduce TG content to the same extent. Using low levels of [(14)C]-CLA isomers, it was shown that both isomers were readily incorporated into acylglycerols and phospholipids, albeit at lower levels than [(14)C]-oleic or [(14)C]-linoleic acids. When using [(14)C]-acetic acid and [(14)C]-pyruvic acid as substrates, 30 μM 10,12 CLA, but not 9,11 CLA, decreased de novo synthesis of triglyceride, free FA, diacylglycerol, cholesterol esters, cardiolipin, phospholipids and ceramides within 3-24 h. Treatment with 30 μM 10,12 CLA, but not 9,11 CLA, decreased total cellular lipids within 3 days and the ratio of monounsaturated FA (MUFA) to saturated FA, and increased C18:0 acyl-CoA levels within 24 h. Consistent with these data, stearoyl-CoA desaturase (SCD)-1 mRNA and protein levels were down-regulated by 10,12 CLA within 7-12 h, respectively. The mRNA levels of liver X receptor (LXR)α and sterol regulatory element binding protein (SREBP)-1c, transcription factors that regulate SCD-1, were decreased by 10,12 CLA within 5 h. These data suggest that the isomer-specific decrease in de novo lipid synthesis by 10,12 CLA is due, in part, to the rapid repression of lipogenic transcription factors that regulate MUFA synthesis, suggesting an anti-obesity mechanism unique to this trans FA. Copyright © 2012 Elsevier Inc. All rights reserved.

  1. Bactericidal activity of the human skin fatty acid cis-6-hexadecanoic acid on Staphylococcus aureus.

    PubMed

    Cartron, Michaël L; England, Simon R; Chiriac, Alina Iulia; Josten, Michaele; Turner, Robert; Rauter, Yvonne; Hurd, Alexander; Sahl, Hans-Georg; Jones, Simon; Foster, Simon J

    2014-07-01

    Human skin fatty acids are a potent aspect of our innate defenses, giving surface protection against potentially invasive organisms. They provide an important parameter in determining the ecology of the skin microflora, and alterations can lead to increased colonization by pathogens such as Staphylococcus aureus. Harnessing skin fatty acids may also give a new avenue of exploration in the generation of control measures against drug-resistant organisms. Despite their importance, the mechanism(s) whereby skin fatty acids kill bacteria has remained largely elusive. Here, we describe an analysis of the bactericidal effects of the major human skin fatty acid cis-6-hexadecenoic acid (C6H) on the human commensal and pathogen S. aureus. Several C6H concentration-dependent mechanisms were found. At high concentrations, C6H swiftly kills cells associated with a general loss of membrane integrity. However, C6H still kills at lower concentrations, acting through disruption of the proton motive force, an increase in membrane fluidity, and its effects on electron transfer. The design of analogues with altered bactericidal effects has begun to determine the structural constraints on activity and paves the way for the rational design of new antistaphylococcal agents.

  2. A heterogeneous human tissue mimicking phantom for RF heating and MRI thermal monitoring verification

    PubMed Central

    Yuan, Yu; Wyatt, Cory; Maccarini, Paolo; Stauffer, Paul; Craciunescu, Oana; MacFall, James; Dewhirst, Mark; Das, Shiva K.

    2013-01-01

    This paper describes a heterogeneous phantom that mimics a human thigh with a deep seated tumor, for the purpose of studying the performance of radiofrequency (RF) heating equipment and non-invasive temperature monitoring with magnetic resonance imaging (MRI). The heterogeneous cylindrical phantom was constructed with an outer fat layer surrounding an inner core of phantom material mimicking muscle, tumor and marrow-filled bone. The component materials were formulated to have dielectric and thermal properties similar to human tissues. The dielectric properties of the tissue-mimicking phantom materials were measured with a microwave vector network analyzer and impedance probe over the frequency range of 80 – 500 MHz and at temperatures of 24°C, 37°C, and 45°C. The specific heat values of the component materials were measured using a differential scanning calorimeter over the temperature range of 15 – 55°C. The thermal conductivity value was obtained from fitting the curves obtained from one-dimensional heat transfer measurement. The phantom was used to verify the operation of a cylindrical 4-antenna annular phased array extremity applicator (140 MHz), by examining the proton resonance frequency shift (PRFS) thermal imaging patterns for various magnitude/phase settings (including settings to focus heating in tumor). For muscle and tumor materials, MR imaging was also used to measure T1/T2* values (1.5 Tesla) and to obtain the slope of the PRFS phase change vs. temperature change curve. The dielectric and thermal properties of the phantom materials were in close agreement to well-accepted published results for human tissues. The phantom was able to successfully demonstrate satisfactory operation of the tested heating equipment. The MRI-measured thermal distributions matched the expected patterns for various magnitude/phase settings of the applicator, allowing the phantom to be used as a quality assurance tool. Importantly, the material formulations for the

  3. cis-Prenyltransferase: New Insights into Protein Glycosylation, Rubber Synthesis, and Human Diseases*

    PubMed Central

    Grabińska, Kariona A.; Park, Eon Joo; Sessa, William C.

    2016-01-01

    cis-Prenyltransferases (cis-PTs) constitute a large family of enzymes conserved during evolution and present in all domains of life. cis-PTs catalyze consecutive condensation reactions of allylic diphosphate acceptor with isopentenyl diphosphate (IPP) in the cis (Z) configuration to generate linear polyprenyl diphosphate. The chain lengths of isoprenoid carbon skeletons vary widely from neryl pyrophosphate (C10) to natural rubber (C>10,000). The homo-dimeric bacterial enzyme, undecaprenyl diphosphate synthase (UPPS), has been structurally and mechanistically characterized in great detail and serves as a model for understanding the mode of action of eukaryotic cis-PTs. However, recent experiments have revealed that mammals, fungal, and long-chain plant cis-PTs are heteromeric enzymes composed of two distantly related subunits. In this review, the classification, function, and evolution of cis-PTs will be discussed with a special emphasis on the role of the newly described NgBR/Nus1 subunit and its plants' orthologs as essential, structural components of the cis-PTs activity. PMID:27402831

  4. Cationic chlorophyl derivatives with SOD mimicking activity suppress the proliferation of human ovarian cancer cells.

    PubMed

    Kobayashi, Y; Maniki, M; Nakamura, K

    1996-06-01

    Derivatives of chlorophyl, e.g. Fe-chlorin e6-Na, alpha, beta, gamma, delta-Tetraphenylporphine-tetrasulfonic acid disulfonic acid salt tetrahydrate (Fe-TPPTS) and alpha, beta, gamma, delta-Tetrakis (4-N-trimethylaminophenyl) porphine, tetra (p-toluensulfonate (Fe-TTMAPP), express SOD mimicking activity. Examination was made of suppressive effects of human cancer cell lines by derivatives of chlorophyl. Fe-TPPTS and Fe-TTMAPP suppressed proliferation of the human ovarian cancer cell lines but Fe-chlorin e6-Na failed to suppress the proliferation. Lipid peroxide was increased by application of Fe-TPPTS and Fe-TTMAPP, but decreased by application of Fe-chlorin e6-Na. SOD activity of the cancer cells did not change by application of these drugs. TPPTS and TTMAPP have a cationic charge but Fe-chlorin e6-Na has an anionic charge. It is suggested that charge of these drugs relates to the suppressive effects of the cancer cell proliferation.

  5. Insight into GATA1 transcriptional activity through interrogation of cis elements disrupted in human erythroid disorders

    PubMed Central

    Wakabayashi, Aoi; Ulirsch, Jacob C.; Ludwig, Leif S.; Fiorini, Claudia; Yasuda, Makiko; Choudhuri, Avik; McDonel, Patrick; Zon, Leonard I.; Sankaran, Vijay G.

    2016-01-01

    Whole-exome sequencing has been incredibly successful in identifying causal genetic variants and has revealed a number of novel genes associated with blood and other diseases. One limitation of this approach is that it overlooks mutations in noncoding regulatory elements. Furthermore, the mechanisms by which mutations in transcriptional cis-regulatory elements result in disease remain poorly understood. Here we used CRISPR/Cas9 genome editing to interrogate three such elements harboring mutations in human erythroid disorders, which in all cases are predicted to disrupt a canonical binding motif for the hematopoietic transcription factor GATA1. Deletions of as few as two to four nucleotides resulted in a substantial decrease (>80%) in target gene expression. Isolated deletions of the canonical GATA1 binding motif completely abrogated binding of the cofactor TAL1, which binds to a separate motif. Having verified the functionality of these three GATA1 motifs, we demonstrate strong evolutionary conservation of GATA1 motifs in regulatory elements proximal to other genes implicated in erythroid disorders, and show that targeted disruption of such elements results in altered gene expression. By modeling transcription factor binding patterns, we show that multiple transcription factors are associated with erythroid gene expression, and have created predictive maps modeling putative disruptions of their binding sites at key regulatory elements. Our study provides insight into GATA1 transcriptional activity and may prove a useful resource for investigating the pathogenicity of noncoding variants in human erythroid disorders. PMID:27044088

  6. Synthetic peptides mimicking the binding site of human acetylcholinesterase for its inhibitor fasciculin 2.

    PubMed

    Kafurke, Uwe; Erijman, Ariel; Aizner, Yonatan; Shifman, Julia M; Eichler, Jutta

    2015-09-01

    Molecules capable of mimicking protein binding and/or functional sites present useful tools for a range of biomedical applications, including the inhibition of protein-ligand interactions. Such mimics of protein binding sites can currently be generated through structure-based design and chemical synthesis. Computational protein design could be further used to optimize protein binding site mimetics through rationally designed mutations that improve intermolecular interactions or peptide stability. Here, as a model for the study, we chose an interaction between human acetylcholinesterase (hAChE) and its inhibitor fasciculin-2 (Fas) because the structure and function of this complex is well understood. Structure-based design of mimics of the hAChE binding site for Fas yielded a peptide that binds to Fas at micromolar concentrations. Replacement of hAChE residues known to be essential for its interaction with Fas with alanine, in this peptide, resulted in almost complete loss of binding to Fas. Computational optimization of the hAChE mimetic peptide yielded a variant with slightly improved affinity to Fas, indicating that more rounds of computational optimization will be required to obtain peptide variants with greatly improved affinity for Fas. CD spectra in the absence and presence of Fas point to conformational changes in the peptide upon binding to Fas. Furthermore, binding of the optimized hAChE mimetic peptide to Fas could be inhibited by hAChE, providing evidence for a hAChE-specific peptide-Fas interaction.

  7. [Establishment of sprouting embryoid body model mimicking early embryonic vasculogenesis in human embryo].

    PubMed

    Jiang, Hua; Feng, You-Ji; Xie, Yi; Han, Jin-Lan; Wang, Zack; Chen, Tong

    2008-10-14

    To establish a sprouting embryoid body model mimicking early embryonic vasculogenesis in human embryo. Human embryonic stem were (hESCs) were cultured on the mouse embryo fibroblasts and then were induced to differentiate to form three-dimensional EB. The hEBs were cultured in media containing various angiogenesis-related factors: vascular endothelial growth factor (VEGF), fibroblast growth factor (FGF), endostatin, angiostatin, and platelet factor (PF)-4 of different concentrations for 3 days to observe the sprouting of the hEBs. 3, 3, 3', 3'-tetramethylindo-carbocyanine perchlorate labeled acetylated low density lipoprotein (Dil-AcLDL) was added onto the hEBs foe 4 h Immunofluorescence assay was used to observe if Dil-AcLDL was absorbed and if CD31 was expressed so as to determine the existence of embryonic endothelial cells in the sprouting structures. The ideal culturing condition was analyzed. The differentiated EBs formed sprouting structures in the collagen I matrix containing VEGF and FGF. The sprouts among individual EBs were able to link to each other and form vascular network-like structures. In the presence of VEGF and FGF, the sprouts branching from the EBs assimilated Dil-AcLDL, expressed CD31 and formed a 3-dimensional cylindrical organization. The concentrations of growth factors ideally stimulating sprouting growth were 100 ng/ml of VEGF and 50 ng/ml of FGF. The networks among the EBs were abolished by the angiostatin, endostatin, and PF4. The sprouting from hEBs accumulates embryonic endothelial cells and the sprouting network-like structures are indeed endothelial in nature. Inducing of sprouting EBs is an ideal model that mimics early embryonic vasculogenesis in humans.

  8. Analysis of cis-elements that facilitate extrachromosomal persistence of human papillomavirus genomes

    SciTech Connect

    Pittayakhajonwut, Daraporn; Angeletti, Peter C.

    2008-05-10

    Human papillomaviruses (HPVs) are maintained latently in dividing epithelial cells as nuclear plasmids. Two virally encoded proteins, E1, a helicase, and E2, a transcription factor, are important players in replication and stable plasmid maintenance in host cells. Recent experiments in yeast have demonstrated that viral genomes retain replication and maintenance function independently of E1 and E2 [Angeletti, P.C., Kim, K., Fernandes, F.J., and Lambert, P.F. (2002). Stable replication of papillomavirus genomes in Saccharomyces cerevisiae. J. Virol. 76(7), 3350-8; Kim, K., Angeletti, P.C., Hassebroek, E.C., and Lambert, P.F. (2005). Identification of cis-acting elements that mediate the replication and maintenance of human papillomavirus type 16 genomes in Saccharomyces cerevisiae. J. Virol. 79(10), 5933-42]. Flow cytometry studies of EGFP-reporter vectors containing subgenomic HPV fragments with or without a human ARS (hARS), revealed that six fragments located in E6-E7, E1-E2, L1, and L2 regions showed a capacity for plasmid stabilization in the absence of E1 and E2 proteins. Interestingly, four fragments within E7, the 3' end of L2, and the 5' end of L1 exhibited stability in plasmids that lacked an hARS, indicating that they possess both replication and maintenance functions. Two fragments lying in E1-E2 and the 3' region of L1 were stable only in the presence of hARS, that they contained only maintenance function. Mutational analyses of HPV16-GFP reporter constructs provided evidence that genomes lacking E1 and E2 could replicate to an extent similar to wild type HPV16. Together these results support the concept that cellular factors influence HPV replication and maintenance, independently, and perhaps in conjunction with E1 and E2, suggesting a role in the persistent phase of the viral lifecycle.

  9. Identification of an intronic cis-acting element in the human dopamine transporter gene

    PubMed Central

    Zhao, Ying; Zhou, Yanhong; Lin, Zhicheng

    2017-01-01

    The human dopamine transporter gene (hDAT) encodes the dopamine transporter in dopamine (DA) neurons to regulate DA transmission. hDAT expression varies significantly from neuron to neuron, and from individual to individual so that dysregulation of hDAT is related to many neuropsychiatric disorders. It is critical to identify hDAT-specific cis-acting elements that regulate the hDAT expression. Previous studies showed that hDAT Intron 1 displayed inhibitory activity for reporter gene expression. Here we report that the hDAT Intron 1 contains a 121-bp fragment that down-regulated both SV40 and hDAT promoter activities by 80% in vitro. Subfragments of 121-bp still down-regulated the SV40 promoter but not the hDAT promoter, as supported by nuclear protein-binding activities. Collectively, 121-bp is a silencer in vitro that might coordinate with transcriptional activities both inside and outside 121-bp in regulation of hDAT. PMID:22160470

  10. Human cellular retinaldehyde-binding protein has secondary thermal 9-cis-retinal isomerase activity.

    PubMed

    Bolze, Christin S; Helbling, Rachel E; Owen, Robin L; Pearson, Arwen R; Pompidor, Guillaume; Dworkowski, Florian; Fuchs, Martin R; Furrer, Julien; Golczak, Marcin; Palczewski, Krzysztof; Cascella, Michele; Stocker, Achim

    2014-01-08

    Cellular retinaldehyde-binding protein (CRALBP) chaperones 11-cis-retinal to convert opsin receptor molecules into photosensitive retinoid pigments of the eye. We report a thermal secondary isomerase activity of CRALBP when bound to 9-cis-retinal. UV/vis and (1)H NMR spectroscopy were used to characterize the product as 9,13-dicis-retinal. The X-ray structure of the CRALBP mutant R234W:9-cis-retinal complex at 1.9 Å resolution revealed a niche in the binding pocket for 9-cis-aldehyde different from that reported for 11-cis-retinal. Combined computational, kinetic, and structural data lead us to propose an isomerization mechanism catalyzed by a network of buried waters. Our findings highlight a specific role of water molecules in both CRALBP-assisted specificity toward 9-cis-retinal and its thermal isomerase activity yielding 9,13-dicis-retinal. Kinetic data from two point mutants of CRALBP support an essential role of Glu202 as the initial proton donor in this isomerization reaction.

  11. Human Cellular Retinaldehyde-Binding Protein Has Secondary Thermal 9-cis-Retinal Isomerase Activity

    PubMed Central

    Bolze, Christin S.; Helbling, Rachel E.; Owen, Robin L.; Pearson, Arwen R.; Pompidor, Guillaume; Dworkowski, Florian; Fuchs, Martin R.; Furrer, Julien; Golczak, Marcin; Palczewski, Krzysztof

    2014-01-01

    Cellular retinaldehyde-binding protein (CRALBP) chaperones 11-cis-retinal to convert opsin receptor molecules into photosensitive retinoid pigments of the eye. We report a thermal secondary isomerase activity of CRALBP when bound to 9-cis-retinal. UV/VIS and 1H-NMR spectroscopy were used to characterize the product as 9,13-dicis-retinal. The X-ray structure of the CRALBP mutant R234W:9-cis-retinal complex at 1.9 Å resolution revealed a niche in the binding-pocket for 9-cis-aldehyde different from that reported for 11-cis-retinal. Combined computational, kinetic, and structural data lead us to propose an isomerization mechanism catalyzed by a network of buried waters. Our findings highlight a specific role of water molecules in both CRALBP-assisted specificity towards 9-cis-retinal and its thermal isomerase activity yielding 9,13-dicis-retinal. Kinetic data from two point mutants of CRALBP support an essential role of Glu202 as the initial proton donor in this isomerization reaction. PMID:24328211

  12. Serum response of all-trans and 9-cis isomers of beta-carotene in humans.

    PubMed

    Johnson, E J; Krinsky, N I; Russell, R M

    1996-12-01

    Little work has been performed on the serum response of various carotene isomers. The present study was carried out to examine the serum response of all-trans and 9-cis isomers of beta-carotene (BC) using frequent blood sample collections at early time points. Serum responses of all-trans BC and a mixture of BC isomers containing 80% 9-cis BC were studied in 15 men by measuring the serum concentrations of BC at 1, 3, 5, 7, 9, 12, and 24 hours after a single large oral dose of all-trans BC or 9-cis BC. The serum response to an oral dose of all-trans BC (120 mg) significantly increased from baseline at 24 hr (p < 0.004). After an oral dose of a mixture of BC isomers (120 mg, 80% 9-cis BC), the peak concentration of 9-cis BC was significantly greater that baseline values (p < 0.016). Increases in serum all-trans BC levels, in part, may be due to greater intestinal absorption, whereas the inability to measure a significant increase in the concentration of 9-cis BC may indicate poor absorption, isomerization to all-trans BC, or a very rapid tissue uptake.

  13. Biorelevant media resistant co-culture model mimicking permeability of human intestine.

    PubMed

    Antoine, Delphine; Pellequer, Yann; Tempesta, Camille; Lorscheidt, Stefan; Kettel, Bernadette; Tamaddon, Lana; Jannin, Vincent; Demarne, Frédéric; Lamprecht, Alf; Béduneau, Arnaud

    2015-03-15

    Cell culture models are currently used to predict absorption pattern of new compounds and formulations in the human gastro-intestinal tract (GIT). One major drawback is the lack of relevant apical incubation fluids allowing mimicking luminal conditions in the GIT. Here, we suggest a culture model compatible with biorelevant media, namely Fasted State Simulated Intestinal Fluid (FaSSIF) and Fed State Simulated Intestinal Fluid (FeSSIF). Co-culture was set up from Caco-2 and mucus-secreting HT29-MTX cells using an original seeding procedure. Viability and cytotoxicity assays were performed following incubation of FeSSIF and FaSSIF with co-culture. Influence of biorelevant fluids on paracellular permeability or transporter proteins were also evaluated. Results were compared with Caco-2 and HT29-MTX monocultures. While Caco-2 viability was strongly affected with FeSSIF, no toxic effect was detected for the co-cultures in terms of viability and lactate dehydrogenase release. The addition of FeSSIF to the basolateral compartment of the co-culture induced cytotoxic effects which suggested the apical mucus barrier being cell protective. In contrast to FeSSIF, FaSSIF induced a slight increase of the paracellular transport and both tested media inhibited partially the P-gp-mediated efflux in the co-culture. Additionally, the absorptive transport of propranolol hydrochloride, a lipophilic β-blocker, was strongly affected by biorelevant fluids. This study demonstrated the compatibility of the Caco-2/HT29-MTX model with some of the current biorelevant media. Combining biorelevant intestinal fluids with features such as mucus secretion, adjustable paracellular and P-gp mediated transports, is a step forward to more realistic in-vitro models of the human intestine. Copyright © 2015. Published by Elsevier B.V.

  14. A novel infant milk formula concept: Mimicking the human milk fat globule structure.

    PubMed

    Gallier, Sophie; Vocking, Karin; Post, Jan Andries; Van De Heijning, Bert; Acton, Dennis; Van Der Beek, Eline M; Van Baalen, Ton

    2015-12-01

    Human milk (HM) provides all nutrients to support an optimal growth and development of the neonate. The composition and structure of HM lipids, the most important energy provider, have an impact on the digestion, uptake and metabolism of lipids. In HM, the lipids are present in the form of dispersed fat globules: large fat droplets enveloped by a phospholipid membrane. Currently, infant milk formula (Control IMF) contains small fat droplets primarily coated by proteins. Recently, a novel IMF concept (Concept IMF) was developed with a different lipid architecture, Nuturis(®), comprising large fat droplets with a phospholipid coating. Confocal laser scanning microscopy (CLSM), with appropriate fluorescent probes, and transmission electron microscopy were used to determine and compare the interfacial composition and structure of HM fat globules, Concept IMF fat droplets and Control IMF fat droplets. The presence of a trilayer-structured HM fat globule membrane, composed of phospholipids, proteins, glycoproteins and cholesterol, was confirmed; in addition exosome-like vesicles are observed within cytoplasmic crescents. The Control IMF fat droplets had a thick protein-only interface. The Concept IMF fat droplets showed a very thin interface composed of a mixture of phospholipids, proteins and cholesterol. Furthermore, the Concept IMF contained fragments of milk fat globule membrane, which has been suggested to have potential biological functions in infants. By mimicking more closely the structure and composition of HM fat globules, this novel IMF concept with Nuturis(®) may have metabolic and digestive properties that are more similar to HM compared to Control IMF. Copyright © 2015 The Authors. Published by Elsevier B.V. All rights reserved.

  15. Human immunodeficiency virus-positive secondary syphilis mimicking cutaneous T-cell lymphoma.

    PubMed

    Yamashita, Michiko; Fujii, Yoshiyuki; Ozaki, Keiji; Urano, Yoshio; Iwasa, Masami; Nakamura, Shingen; Fujii, Shiro; Abe, Masahiro; Sato, Yasuharu; Yoshino, Tadashi

    2015-10-08

    Malignant syphilis or lues maligna is a severe form of secondary syphilis that was commonly reported in the pre-antibiotic era, and has now reemerged with the advent of the human immunodeficiency virus (HIV) epidemic. However, the characteristic histopathological findings of malignant syphilis remain controversial. The aim of this case report was to clarify the clinical and histopathological findings of HIV-positive malignant secondary syphilis. A Japanese man in his forties complained of fever, skin lesions, headache, and myalgia without lymphadenopathy during the previous 4 weeks. The skin lesions manifested as erythematous, nonhealing, ulcerated papules scattered on his trunk, extremities, palm, and face. Although the skin lesions were suspected to be cutaneous T-cell lymphomas on histological analyses, they lacked T-cell receptor Jγ rearrangement; moreover, immunohistochemical analyses confirmed the presence of spirochetes. The patient was administered antibiotics and anti-retroviral therapy, which dramatically improved the symptoms. On the basis of these observations of the skin lesions, we finally diagnosed the patient with HIV-associated secondary syphilis that mimicked cutaneous T-cell lymphoma. The patient's systemic CD4+ lymphocyte count was very low, and the infiltrate was almost exclusively composed of CD8+ atypical lymphocytes; therefore, the condition was easily misdiagnosed as cutaneous lymphoma. Although the abundance of plasma cells is a good indicator of malignant syphilis on skin histological analyses, in some cases, the plasma cell count may be very low. Therefore, a diagnosis of malignant secondary syphilis should be considered before making a diagnosis of primary cutaneous peripheral T-cell lymphoma or lymphoma associated with HIV infection.

  16. A new murine model of sustainable and durable chronic critical limb ischemia fairly mimicking human pathology.

    PubMed

    Lejay, A; Choquet, P; Thaveau, F; Singh, F; Schlagowski, A; Charles, A-L; Laverny, G; Metzger, D; Zoll, J; Chakfe, N; Geny, B

    2015-02-01

    To establish a chronic mouse model of critical limb ischemia (CLI) with in vivo and ex vivo validation, closely mimicking human pathology. Swiss mice (n = 28) were submitted to sequential unilateral femoral (day 0) and iliac (day 4) ligatures. Ischemia was confirmed by clinical scores (tissue and functional damages) and methoxyisobutylisonitrile (MIBI) scintigraphies at days 0, 4, 6, 10, 20, and 30. At days 10, 20, and 30, muscle mitochondrial respiration, calcium retention capacity (CRC), and production of reactive oxygen species (ROS) were investigated, together with transcripts of mitochondrial biogenesis and antioxidant enzymes. Histological analysis was also performed. Clinical and functional damage confirmed CLI. MIBI scintigraphies showed hypoperfusion of the ischemic limb, which remained stable until day 30. Mitochondrial respiration was impaired in ischemic muscles compared with controls (Vmax = 7.93 ± 0.99 vs. 10.09 ± 2.87 mmol/L O2/minute/mg dry weight [dw]; p = .01), together with impaired CRC (7.4 ± 1.6 mmol/L minute/mg dw vs. 11.9 ± 0.9 mmol/L minute/mg dw; p < .001) and biogenesis (41% decrease in peroxisome proliferator-activated receptor gamma coactivator [PGC]-1α, 49% decrease in PGC-1β, and 41% decrease in nuclear respiratory factor-1). Ischemic muscles also demonstrated increased production of ROS under electron paramagnetic resonance (0.084 ± 0.029 vs. 0.051 ± 0.031 mmol/L minute/mg dw; p = .03) and with dihydroethidium staining (3622 ± 604 arbitrary units of fluorescence vs. 1224 ± 324; p < .01), decreased antioxidant enzymes (32% decrease in superoxide dismutase [SOD]1, 41% decrease in SOD2, and 49% decrease in catalase), and myopathic features (wider range in fiber size, rounded shape, centrally located nuclei, and smaller cross-sectional areas). All defects were stable over time. Sequential femoral and iliac ligatures closely mimic human functional, clinical, scintigraphic, and skeletal muscle

  17. Research Objectives for Human Missions in the Proving Ground of Cis-Lunar Space

    NASA Astrophysics Data System (ADS)

    Spann, James; Niles, Paul B.; Eppler, Dean B.; Kennedy, Kriss J.; Lewis, Ruthan.; Sullivan, Thomas A.

    2016-04-01

    Introduction: This talk will introduce the preliminary findings in support of NASA's Future Capabilities Team. In support of the ongoing studies conducted by NASA's Future Capabilities Team, we are tasked with collecting research objectives for the Proving Ground activities. The objectives could include but are certainly not limited to: demonstrating crew well being and performance over long duration missions, characterizing lunar volatiles, Earth monitoring, near Earth object search and identification, support of a far-side radio telescope, and measuring impact of deep space environment on biological systems. Beginning in as early as 2023, crewed missions beyond low Earth orbit will begin enabled by the new capabilities of the SLS and Orion vehicles. This will initiate the "Proving Ground" phase of human exploration with Mars as an ultimate destination. The primary goal of the Proving Ground is to demonstrate the capability of suitably long duration spaceflight without need of continuous support from Earth, i.e. become Earth Independent. A major component of the Proving Ground phase is to conduct research activities aimed at accomplishing major objectives selected from a wide variety of disciplines including but not limited to: Astronomy, Heliophysics, Fundamental Physics, Planetary Science, Earth Science, Human Systems, Fundamental Space Biology, Microgravity, and In Situ Resource Utilization. Mapping and prioritizing the most important objectives from these disciplines will provide a strong foundation for establishing the architecture to be utilized in the Proving Ground. Possible Architectures: Activities and objectives will be accomplished during the Proving Ground phase using a deep space habitat. This habitat will potentially be accompanied by a power/propulsion bus capable of moving the habitat to accomplish different objectives within cis-lunar space. This architecture can also potentially support staging of robotic and tele-robotic assets as well as

  18. Research Objectives for Human Missions in the Proving Ground of Cis-Lunar Space

    NASA Astrophysics Data System (ADS)

    Spann, James; Niles, Paul; Eppler, Dean; Kennedy, Kriss; Lewis, Ruthan; Sullivan, Thomas

    2016-07-01

    Introduction: This talk will introduce the preliminary findings in support of NASA's Future Capabilities Team. In support of the ongoing studies conducted by NASA's Future Capabilities Team, we are tasked with collecting re-search objectives for the Proving Ground activities. The objectives could include but are certainly not limited to: demonstrating crew well being and performance over long duration missions, characterizing lunar volatiles, Earth monitoring, near Earth object search and identification, support of a far-side radio telescope, and measuring impact of deep space environment on biological systems. Beginning in as early as 2023, crewed missions beyond low Earth orbit will be enabled by the new capabilities of the SLS and Orion vehicles. This will initiate the "Proving Ground" phase of human exploration with Mars as an ultimate destination. The primary goal of the Proving Ground is to demonstrate the capability of suitably long dura-tion spaceflight without need of continuous support from Earth, i.e. become Earth Independent. A major component of the Proving Ground phase is to conduct research activities aimed at accomplishing major objectives selected from a wide variety of disciplines including but not limited to: Astronomy, Heliophysics, Fun-damental Physics, Planetary Science, Earth Science, Human Systems, Fundamental Space Biology, Microgravity, and In Situ Resource Utilization. Mapping and prioritizing the most important objectives from these disciplines will provide a strong foundation for establishing the architecture to be utilized in the Proving Ground. Possible Architectures: Activities and objectives will be accomplished during the Proving Ground phase using a deep space habitat. This habitat will potentially be accompanied by a power/propulsion bus capable of moving the habitat to accomplish different objectives within cis-lunar space. This architecture can also potentially support stag-ing of robotic and tele-robotic assets as well as

  19. The resveratrol oligomers, cis- and trans-gnetin H, from Paeonia suffruticosa seeds inhibit the growth of several human cancer cell lines.

    PubMed

    Gao, Ying; He, Chunnian; Ran, Ran; Zhang, Dabing; Li, Dawei; Xiao, Pei-Gen; Altman, Elliot

    2015-07-01

    Paeonia suffruticosa Andrews (PSE) is a well-known Chinese medicine that has been widely used as an anti-tumor, anti-oxidative and anti-inflammatory agent. cis- and trans-gnetin H are two resveratrol oligomers isolated from the seeds of PSE. Although resveratrol is widely considered to be one of the most valuable natural chemopreventive agents and there are numerous studies on the antitumor activities of resveratrol, little is known about the antitumor properties of cis- and trans-gnetin H. The inhibitory effects of cis- and trans-gnetin H in different human cancer cell lines were assessed using fluorescent viability tests. Cytotoxicity in human lung and breast cancer cells was detected via nuclear condensation, cell permeability, and changes in the mitochondrial membrane potential (∆ψm). Apoptosis in human lung and breast cancer cells was assessed by flow cytometry, a luminescence assay and high-content screening analysis. Finally, a xenograft mice model was used to examine the efficacy of cis-gnetin H on lung tumors. cis- and trans-gnetin H have superior activity in inhibiting the proliferation of four human cancer cell lines, A549 (lung), BT20 (breast), MCF-7 (breast) and U2OS (osteosarcoma), and promote cell apoptosis, while having a minimal effect on two normal human epithelial cell lines, HPL1A (lung) and HMEC (breast) used as controls. cis- and trans-gnetin H promote apoptosis by releasing mitochondria cytochrome c, activating caspase 3/7 and inhibiting NF-κB activation. Flow cytometry analysis shows that cis- or trans-gnetin H arrested the cell cycle of cancer cells at the G0-G1 phase. Moreover, cis-gnetin H suppressed the growth of xenograft lung tumors in mice. Collectively, our findings demonstrate the promise of the natural compounds cis- and trans-gnetin H as candidates for cancer chemotherapy agents. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  20. Catalysis of cis/trans isomerization in native HIV-1 capsid by human cyclophilin A

    PubMed Central

    Bosco, Daryl A.; Eisenmesser, Elan Z.; Pochapsky, Susan; Sundquist, Wesley I.; Kern, Dorothee

    2002-01-01

    Packaging of cyclophilin A (CypA) into HIV-1 virions is essential for efficient replication; however, the reason for this is unknown. Incorporation is mediated through binding to the Gly-89–Pro-90 peptide bond of the N-terminal domain of HIV-1 capsid (CAN). Despite the fact that CypA is a peptidyl-prolyl cis/trans isomerase, catalytic activity on CAN has not been observed previously. We show here, using NMR exchange spectroscopy, that CypA does not only bind to CAN but also catalyzes efficiently the cis/trans isomerization of the Gly-89–Pro-90 peptide bond. In addition, conformational changes in CAN distal to the CypA binding loop are observed on CypA binding and catalysis. The results provide experimental evidence for efficient CypA catalysis on a natively folded and biologically relevant protein substrate. PMID:11929983

  1. Acute post-infectious cerebellar ataxia due to co-infection of human herpesvirus-6 and adenovirus mimicking myositis.

    PubMed

    Naselli, Aldo; Pala, Giovanna; Cresta, Federico; Finetti, Martina; Biancheri, Roberta; Renna, Salvatore

    2014-11-26

    Acute cerebellar ataxia (ACA) is a relatively common neurological disease in children. Most common types of ACA are acute post-infectious (APCA) and acute disseminated encephalomyelitis (ADEM). Less common but important causes include opsoclonus-myoclonus syndrome (OMS) and acute cerebellitis. Cerebellar neoplasms and acute hydrocephalus are additional causes of paediatric ataxia. APCA is the most common cause of ACA in children, comprising about 30-50% of total cases. This is a report about an immunocompetent 4-yrs-old male affected by APCA, due to co-infection by human herpesvirus-6 (HHV-6) and adenovirus, with symptoms mimicking myositis.

  2. Semiautomated microtiter plate assay for monitoring peptidylprolyl cis/trans isomerase activity in normal and pathological human sera.

    PubMed

    Küllertz, G; Lüthe, S; Fischer, G

    1998-03-01

    An UV/VIS spectrophotometric assay technique was developed that was able to routinely monitor peptidylprolyl cis/trans isomerase (PPIase) activity of biological fluids in 96-well microtiter plates. The assay, based on monitoring the cis-to-trans isomerization of succinyl-Phe-cisPro-Phe-4-nitroanilide as substrate in a chymotrypsin-coupled reaction, yields a throughput of 96 samples per 30 min. The assay's capacity was exemplified by dealing with the PPIase activity in several normal and pathological human sera. Reference values of 151 healthy subjects (83 females, 69 males, 17 to 60 years old) were found to possess significant sex-specific differences. PPIase activity factor K of the sera was significantly greater in males (5th, 50th, 95th percentiles: 17, 36, 55 K) than females (14, 30, 48 K). PPIase activities of sera from healthy donors (n = 151) were significantly higher (Mann-Whitney rank-sum test P < 0.0001) than those of patients (n = 47). PPIase activity in serum samples stored at 4 degrees C was stable for at least 20 h.

  3. ASAR15, A cis-Acting Locus that Controls Chromosome-Wide Replication Timing and Stability of Human Chromosome 15

    PubMed Central

    Donley, Nathan; Smith, Leslie; Thayer, Mathew J.

    2015-01-01

    DNA replication initiates at multiple sites along each mammalian chromosome at different times during each S phase, following a temporal replication program. We have used a Cre/loxP-based strategy to identify cis-acting elements that control this replication-timing program on individual human chromosomes. In this report, we show that rearrangements at a complex locus at chromosome 15q24.3 result in delayed replication and structural instability of human chromosome 15. Characterization of this locus identified long, RNA transcripts that are retained in the nucleus and form a “cloud” on one homolog of chromosome 15. We also found that this locus displays asynchronous replication that is coordinated with other random monoallelic genes on chromosome 15. We have named this locus ASynchronous replication and Autosomal RNA on chromosome 15, or ASAR15. Previously, we found that disruption of the ASAR6 lincRNA gene results in delayed replication, delayed mitotic condensation and structural instability of human chromosome 6. Previous studies in the mouse found that deletion of the Xist gene, from the X chromosome in adult somatic cells, results in a delayed replication and instability phenotype that is indistinguishable from the phenotype caused by disruption of either ASAR6 or ASAR15. In addition, delayed replication and chromosome instability were detected following structural rearrangement of many different human or mouse chromosomes. These observations suggest that all mammalian chromosomes contain similar cis-acting loci. Thus, under this scenario, all mammalian chromosomes contain four distinct types of essential cis-acting elements: origins, telomeres, centromeres and “inactivation/stability centers”, all functioning to promote proper replication, segregation and structural stability of each chromosome. PMID:25569254

  4. Allelic imbalance identifies novel tissue specific cis-regulatory variation for human UGT2B15

    PubMed Central

    Sun, Chang; Southard, Catherine; Witonsky, David B.; Olopade, Olufunmilayo I.; Di Rienzo, Anna

    2010-01-01

    Allelic imbalance (AI) is a powerful tool to identify cis-regulatory variation for gene expression. UGT2B15 is an important enzyme involved in the metabolism of multiple endobiotics and xenobiotics. In this study, we measured the relative expression of two alleles at this gene by using SNP rs1902023:G>T. An excess of the G over the T allele was consistently observed in liver (P<0.001), but not in breast (P=0.06) samples, suggesting that SNPs in strong linkage disequilibrium with G253T regulate UGT2B15 expression in liver. Seven such SNPs were identified by resequencing the promoter and exon 1, which define two distinct haplotypes. Reporter gene assays confirmed that one haplotype displayed ~20% higher promoter activity compared to the other major haplotype in liver HepG2 (P<0.001), but not in breast MCF-7 (P=0.540) cells. Reporter gene assays with additional constructs pointed to rs34010522:G>T and rs35513228:C>T as the cis-regulatory variants; both SNPs were also evaluated in LNCaP and Caco-2 cells. By ChIP, we showed that the transcription factor Nrf2 binds to the region spanning rs34010522:G>T in all four cell lines. Our results provide a good example for how AI can be used to identify cis-regulatory variation and gain insights into the tissue specific regulation of gene expression. PMID:19847790

  5. Metabolism in humans of cis-12,trans-15-octadecadienoic acid relative to palmitic, stearic, oleic and linoleic acids

    SciTech Connect

    Emken, E.A.; Rohwedder, W.K.; Adlof, R.O.; Rakoff, H.; Gulley, R.M.

    1987-07-01

    Mixtures of triglycerides containing deuterium-labeled hexadecanoic acid (16:0), octadecanoic acid (18:0), cis-9-octadecenoic acid (9c-18:1), cis-9,cis-12-octadecadienoic acid (9c, 12c-18:2) and cis-12,trans-15-octadecadienoic acid (12c,15t-18:2) were fed to two young-adult males. Plasma lipid classes were isolated from samples collected periodically over 48 hr. Incorporation and turnover of the deuterium-labeled fats in plasma lipids were followed by gas chromatography-mass spectrometry (GC-MS) analysis of the methyl ester derivatives. Absorption of the deuterated fats was followed by GC-MS analysis of chylomicron triglycerides isolated by ultracentrifugation. Results were the following: (i) endogenous fat contributed about 40% of the total fat incorporated into chylomicron triglycerides; (ii) elongation, desaturation and chain-shortened products from the deuterated fats were not detected; (iii) the polyunsaturated isomer 12c,15t-18:2 was metabolically more similar to saturated and 9c-18:1 fatty acids than to 9c,12c-18:2; (iv) relative incorporation of 9c,12c-18:2 into phospholipids did not increase proportionally with an increase of 9c,12c-18:2 in the mixture of deuterated fats fed; (v) absorption of 16:0, 18:0, 9c-18:1, 9c,12c-18:2 and 12c,15t-18:2 were similar; and (vi) data for the 1- and 2-acyl positions of phosphatidylcholine and for cholesteryl ester fractions reflected the known high specificity of phosphatidylcholine acyltransferase and lecithin:cholesteryl acyltransferase for 9c,12c-18:2. These results illustrate that incorporation of dietary fatty acids into human plasma lipid classes is selectively controlled and that incorporation of dietary 9c,12c-18:2 is limited.

  6. Powerful Identification of Cis-regulatory SNPs in Human Primary Monocytes Using Allele-Specific Gene Expression

    PubMed Central

    Almlöf, Jonas Carlsson; Lundmark, Per; Lundmark, Anders; Ge, Bing; Maouche, Seraya; Göring, Harald H. H.; Liljedahl, Ulrika; Enström, Camilla; Brocheton, Jessy; Proust, Carole; Godefroy, Tiphaine; Sambrook, Jennifer G.; Jolley, Jennifer; Crisp-Hihn, Abigail; Foad, Nicola; Lloyd-Jones, Heather; Stephens, Jonathan; Gwilliam, Rhian; Rice, Catherine M.; Hengstenberg, Christian; Samani, Nilesh J.; Erdmann, Jeanette; Schunkert, Heribert; Pastinen, Tomi; Deloukas, Panos; Goodall, Alison H.; Ouwehand, Willem H.; Cambien, François; Syvänen, Ann-Christine

    2012-01-01

    A large number of genome-wide association studies have been performed during the past five years to identify associations between SNPs and human complex diseases and traits. The assignment of a functional role for the identified disease-associated SNP is not straight-forward. Genome-wide expression quantitative trait locus (eQTL) analysis is frequently used as the initial step to define a function while allele-specific gene expression (ASE) analysis has not yet gained a wide-spread use in disease mapping studies. We compared the power to identify cis-acting regulatory SNPs (cis-rSNPs) by genome-wide allele-specific gene expression (ASE) analysis with that of traditional expression quantitative trait locus (eQTL) mapping. Our study included 395 healthy blood donors for whom global gene expression profiles in circulating monocytes were determined by Illumina BeadArrays. ASE was assessed in a subset of these monocytes from 188 donors by quantitative genotyping of mRNA using a genome-wide panel of SNP markers. The performance of the two methods for detecting cis-rSNPs was evaluated by comparing associations between SNP genotypes and gene expression levels in sample sets of varying size. We found that up to 8-fold more samples are required for eQTL mapping to reach the same statistical power as that obtained by ASE analysis for the same rSNPs. The performance of ASE is insensitive to SNPs with low minor allele frequencies and detects a larger number of significantly associated rSNPs using the same sample size as eQTL mapping. An unequivocal conclusion from our comparison is that ASE analysis is more sensitive for detecting cis-rSNPs than standard eQTL mapping. Our study shows the potential of ASE mapping in tissue samples and primary cells which are difficult to obtain in large numbers. PMID:23300628

  7. Different DNA damage response of cis and trans isomers of commonly used UV filter after the exposure on adult human liver stem cells and human lymphoblastoid cells.

    PubMed

    Sharma, Anežka; Bányiová, Katarína; Babica, Pavel; El Yamani, Naouale; Collins, Andrew Richard; Čupr, Pavel

    2017-09-01

    2-ethylhexyl 4-methoxycinnamate (EHMC), used in many categories of personal care products (PCPs), is one of the most discussed ultraviolet filters because of its endocrine-disrupting effects. EHMC is unstable in sunlight and can be transformed from trans-EHMC to emergent cis-EHMC. Toxicological studies are focusing only on trans-EHMC; thus the toxicological data for cis-EHMC are missing. In this study, the in vitro genotoxic effects of trans- and cis-EHMC on adult human liver stem cells HL1-hT1 and human-derived lymphoblastoid cells TK-6 using a high-throughput comet assay were studied. TK-6 cells treated with cis-EHMC showed a high level of DNA damage when compared to untreated cells in concentrations 1.56 to 25μgmL(-1). trans-EHMC showed genotoxicity after exposure to the two highest concentrations 12.5 and 25μgmL(-1). The increase in DNA damage on HL1-hT1 cells induced by cis-EHMC and trans-EHMC was detected at the concentration 25μgmL(-1). The No observed adverse effect level (NOAEL, mg kg(-1)bwday(-1)) was determined using a Quantitative in vitro to in vivo extrapolation (QIVIVE) approach: NOAELtrans-EHMC=3.07, NOAELcis-EHMC=0.30 for TK-6 and NOAELtrans-EHMC=26.46, NOAELcis-EHMC=20.36 for HL1-hT1. The hazard index (HI) was evaluated by comparing the reference dose (RfD, mgkg(-1)bwday(-1)) obtained from our experimental data with the chronic daily intake (CDI) of the female population. Using comet assay experimental data with the more sensitive TK-6 cells, HIcis-EHMC was 7 times higher than HItrans-EHMC. In terms of CDI, relative contributions were; dermal exposure route>oral>inhalation. According to our results we recommend the RfDtrans-EHMC=0.20 and RfDcis-EHMC=0.02 for trans-EHMC and cis-EHMC, respectively, to use for human health risk assessment. The significant difference in trans-EHMC and cis-EHMC response points to the need for toxicological reevaluation and application reassessment of both isomers in PCPs. Copyright © 2017 Elsevier B.V. All rights

  8. Selected heterozygosity at cis-regulatory sequences increases the expression homogeneity of a cell population in humans.

    PubMed

    Sung, Min Kyung; Jang, Juneil; Lee, Kang Seon; Ghim, Cheol-Min; Choi, Jung Kyoon

    2016-07-28

    Examples of heterozygote advantage in humans are scarce and limited to protein-coding sequences. Here, we attempt a genome-wide functional inference of advantageous heterozygosity at cis-regulatory regions. The single-nucleotide polymorphisms bearing the signatures of balancing selection are enriched in active cis-regulatory regions of immune cells and epithelial cells, the latter of which provide barrier function and innate immunity. Examples associated with ancient trans-specific balancing selection are also discovered. Allelic imbalance in chromatin accessibility and divergence in transcription factor motif sequences indicate that these balanced polymorphisms cause distinct regulatory variation. However, a majority of these variants show no association with the expression level of the target gene. Instead, single-cell experimental data for gene expression and chromatin accessibility demonstrate that heterozygous sequences can lower cell-to-cell variability in proportion to selection strengths. This negative correlation is more pronounced for highly expressed genes and consistently observed when using different data and methods. Based on mathematical modeling, we hypothesize that extrinsic noise from fluctuations in transcription factor activity may be amplified in homozygotes, whereas it is buffered in heterozygotes. While high expression levels are coupled with intrinsic noise reduction, regulatory heterozygosity can contribute to the suppression of extrinsic noise. This mechanism may confer a selective advantage by increasing cell population homogeneity and thereby enhancing the collective action of the cells, especially of those involved in the defense systems in humans.

  9. Effect of mutations mimicking phosphorylation on the structure and properties of human 14-3-3zeta.

    PubMed

    Sluchanko, Nikolai N; Chernik, Ivan S; Seit-Nebi, Alim S; Pivovarova, Anastasia V; Levitsky, Dmitrii I; Gusev, Nikolai B

    2008-09-15

    Effect of mutations mimicking phosphorylation on the structure of human 14-3-3zeta protein was analyzed by different methods. Mutation S58E increased intrinsic Trp fluorescence and binding of bis-ANS to 14-3-3. At low protein concentration mutation S58E increased the probability of dissociation of dimeric 14-3-3 and its susceptibility to proteolysis. Mutation S184E slightly increased Stokes radius and thermal stability of 14-3-3. Mutation T232E induced only small increase of Stokes radius and sedimentation coefficient that probably reflect the changes in the size or shape of 14-3-3. At low protein concentration the triple mutant S58E/S184E/T232E tended to dissociate, whereas at high concentration its properties were comparable with those of the wild type protein. The triple mutant was highly susceptible to proteolysis. Thus, mutation mimicking phosphorylation of Ser58 destabilized, whereas mutation of Ser184 induced stabilization of 14-3-3zeta structure.

  10. Trans- and cis-2-phenylindole platinum(II) complexes as cytotoxic agents against human breast adenocarcinoma cell lines

    NASA Astrophysics Data System (ADS)

    Tomé, Maria; López, Concepción; González, Asensio; Ozay, Bahadir; Quirante, Josefina; Font-Bardía, Mercè; Calvet, Teresa; Calvis, Carme; Messeguer, Ramon; Baldomá, Laura; Badía, Josefa

    2013-09-01

    The synthesis and characterization of the new 2-phenylindole derivative: C8H3N-2-C6H5-3NOMe-5OMe (3c) and the trans- and cis-isomers of [Pt(3c)Cl2(DMSO)] complexes (4c and 5c, respectively) are described. The crystal structures of 4c·CH2Cl2 and 5c confirm: (a) the existence of a Pt-Nindole bond, (b) the relative arrangement of the Cl- ligands [trans- (in 4c) or cis- (in 5c)] and (c) the anti-(E) configuration of the oxime. The cytotoxic assessment of C8H3N-2-(C6H4-4‧R1)-3NOMe-5R2 [with R1 = R2 = H (3a); R1 = Cl, R2 = H (3b) and R1 = H, R2 = OMe (3c)] and the geometrical isomers of [Pt(L)Cl2(DMSO)] with L = 3a-3c [trans- (4a-4c) and cis- (5a-5c), respectively] against human breast adenocarcinoma cell lines (MDA-MB231 and MCF-7) is also reported and reveals that all the platinum(II) complexes (except 4a) are more cytotoxic than cisplatin in front of the MCF7 cell line. Electrophoretic DNA migration studies of the synthesized compounds in the absence and in the presence of topoisomerase-I have been performed, in order to get further insights into their mechanism of action.

  11. A Cis-acting locus determines the polymorphic parental imprinting of the human IGF2R gene

    SciTech Connect

    Xu, Y.; Polychronakos, C.

    1994-09-01

    The murine gene encoding the insulin-like growth factor receptor (IGF2R) is parentally imprinted in the mouse with exclusive maternal expression, but most humans express both gene copies. We have reported preferential expression of the maternal copy in approximately 17% of normal human pre-term placenta samples and in 50% of the kidneys of Wilms` tumor patients. Thus, IGF2R imprinting appears to be a polymorphic trait that may predispose to cancer. We explored the possibility that imprinting is associated with sequence variations of the imprinted domain itself (cis-acting locus). We studied 9 subjects with imprinted IGF2R expression that were informative for parental origin. These subjects were heterozygous for a transcribed CA repeat at the 3{prime}UTR of the gene, used for the study of the parental origin of mRNA transcripts. The two most common alleles, A162 and A164 (names refer to size in bp), were analyzed. In all cases the preferentially transcribed allele was maternal (p=0.002). In all 8 cases in which A164 was present, it was of paternal origin and was repressed (p=0.008), while A162 was maternal and preferentially expressed in 8/9 cases. Parental origin of A162 and A164 was random in individuals with biallelic expression. PCR amplification of genomic DNA after digestion with the methylation-sensitive enzyme HpaII revealed biallelic methylation at the 3{prime}UTR in both imprinting and non-imprinting individuals, making it unlikely that the imprint-controlling element (ICE) is located there. Polymorphic IGF2R imprinting depends on a cis-acting locus, at linkage disequilibrium with, but probably distinct from, our 3{prime}UTR marker. Biallelic expression in many subjects with a paternal A164 suggests that the frequency of the imprintable ICE is much lower than that of A164. Alternatively, the cis-locus is necessary but not sufficient and input in trans is additionally required for paternal-germline specific IGF2R repression.

  12. A validated, sensitive HPLC-MS/MS method for quantification of cis-para-methyl-4-methylaminorex (cis-4,4'-DMAR) in rat and human plasma: application to pharmacokinetic studies in rats.

    PubMed

    Lucchetti, Jacopo; Marzo, Claudio M; Di Clemente, Angelo; Cervo, Luigi; Gobbi, Marco

    2017-06-01

    4,4'-DMAR is an analogue of the known psychostimulants 4-methylaminorex and aminorex. In the light of reports of deaths associated with its abuse, and the easy access from Internet vendors, the EU Council recently decided on control measures across member states. Here we describe a validated method for measuring plasma levels of cis-4,4'-DMAR, crucial for preclinical studies and analysis in human plasma. Chromatographic separation was done by gradient elution on a Kinetex C18 column with 0.1% formic acid in water and 0.1% formic acid in acetonitrile at 0.2 mL/min. Detection was by positive electrospray ionization (ESI+) in multiple reaction monitoring mode monitoring the quantifier transitions m/z 191.4 → m/z 148.3 for cis-4,4'-DMAR and m/z 259.3 → m/z 194.2 for carbamazepine (internal standard). Protein precipitation with 1% of formic acid in acetonitrile was used in cis-4,4'-DMAR extraction from plasma; recovery was high (>93%) with a negligible matrix effect. This method provides an accurate, precise, and sensitive method for cis-4,4'-DMAR quantification in human and rat plasma, following European Medicine Agency guidelines for bioanalytical method validation. Pharmacokinetic studies were conducted in rats. After an intravenous dose of 1 mg/kg, plasma levels declined rapidly (≥80% in 4 h), followed by a slow elimination phase (t1/2 of 5.14 ± 0.65 h). Absorption was rapid after intraperitoneal injection (tmax  = 15 min) with a rapid decline thereafter; Cmax and AUC0-240min showed dose-proportionality over the dose range 1-10 mg/kg. This method was successfully applied to investigate pharmacokinetic properties in rats and could be used to quantify cis-4,4'-DMAR levels in human plasma. Copyright © 2016 John Wiley & Sons, Ltd. Copyright © 2016 John Wiley & Sons, Ltd.

  13. Human Papillomavirus Type 18 cis-Elements Crucial for Segregation and Latency.

    PubMed

    Ustav, Mart; Castaneda, Fernando Rodriguez; Reinson, Tormi; Männik, Andres; Ustav, Mart

    2015-01-01

    Stable maintenance replication is characteristic of the latency phase of HPV infection, during which the viral genomes are actively maintained as extrachromosomal genetic elements in infected proliferating basal keratinocytes. Active replication in the S-phase and segregation of the genome into daughter cells in mitosis are required for stable maintenance replication. Most of our knowledge about papillomavirus genome segregation has come from studies of bovine papillomavirus type 1 (BPV-1), which have demonstrated that the E2 protein cooperates with cellular trans-factors and that E2 binding sites act as cis-regulatory elements in the viral genome that are essential for the segregation process. However, the genomic organization of the regulatory region in HPVs, and the properties of the viral proteins are different from those of their BPV-1 counterparts. We have designed a segregation assay for HPV-18 and used it to demonstrate that the E2 protein performs segregation in combination with at least two E2 binding sites. The cooperative binding of the E2 protein to two E2 binding sites is a major determinant of HPV-18 genome segregation, as demonstrated by the change in spacing between adjacent binding sites #1 and #2 in the HPV-18 Upstream Regulatory Region (URR). Duplication or triplication of the natural 4 bp 5'-CGGG-3' spacer between the E2 binding sites increased the cooperative binding of the E2 molecules as well as E2-dependent segregation. Removal of any spacing between these sites eliminated cooperative binding of the E2 protein and disabled segregation of the URR and HPV-18 genome. Transfer of these configurations of the E2 binding sites into viral genomes confirmed the role of the E2 protein and binding sites #1 and #2 in the segregation process. Additional analysis demonstrated that these sites also play an important role in the transcriptional regulation of viral gene expression from different HPV-18 promoters.

  14. Oleic Acid Attenuates trans-10, cis-12 Conjugated Linoleic Acid-Mediated Inflammatory Gene Expression in Human Adipocytes

    PubMed Central

    Reardon, Meaghan; Gobern, Semone; Martinez, Kristina; Shen, Wan; Reid, Tanya; McIntosh, Michael

    2012-01-01

    The weight loss supplement conjugated linoleic acid (CLA) consists of an equal mixture of trans-10, cis-12 (10,12) and cis-9, trans-11 (9,11) isomers. However, high levels of mixed CLA isomers, or the 10,12 isomer, causes chronic inflammation, lipodystrophy, or insulin resistance. We previously demonstrated that 10,12 CLA decreases de novo lipid synthesis along with the abundance and activity of stearoyl-CoA desaturase (SCD)-1, a delta-9 desaturase essential for the synthesis of monounsaturated fatty acids (MUFA). Thus, we hypothesized that the 10,12 CLA-mediated decrease in SCD-1, with the subsequent decrease in MUFA, was responsible for the observed effects. To test this hypothesis, 10,12 CLA-treated human adipocytes were supplemented with oleic acid for 12 h to 7 d, and inflammatory gene expression, insulin-stimulated glucose uptake, and lipid content were measured. Oleic acid reduced inflammatory gene expression in a dose-dependent manner, and restored the lipid content of 10,12 CLA-treated adipocytes without improving insulin-stimulated glucose uptake. In contrast, supplementation with stearic acid, a substrate for SCD-1, or 9,11 CLA did not prevent inflammatory gene expression by 10,12 CLA. Notably, 10,12 CLA impacted the expression of several G-protein coupled receptors that was attenuated by oleic acid. Collectively, these data show that oleic acid attenuates 10,12 CLA-induced inflammatory gene expression and lipid content, possibly by alleviating cell stress caused by the inhibition of MUFA needed for phospholipid and neutral lipid synthesis. PMID:22941440

  15. Oleic acid attenuates trans-10,cis-12 conjugated linoleic acid-mediated inflammatory gene expression in human adipocytes.

    PubMed

    Reardon, Meaghan; Gobern, Semone; Martinez, Kristina; Shen, Wan; Reid, Tanya; McIntosh, Michael

    2012-11-01

    The weight loss supplement conjugated linoleic acid (CLA) consists of an equal mixture of trans-10,cis-12 (10,12) and cis-9,trans-11 (9,11) isomers. However, high levels of mixed CLA isomers, or the 10,12 isomer, causes chronic inflammation, lipodystrophy, or insulin resistance. We previously demonstrated that 10,12 CLA decreases de novo lipid synthesis along with the abundance and activity of stearoyl-CoA desaturase (SCD)-1, a δ-9 desaturase essential for the synthesis of monounsaturated fatty acids (MUFA). Thus, we hypothesized that the 10,12 CLA-mediated decrease in SCD-1, with the subsequent decrease in MUFA, was responsible for the observed effects. To test this hypothesis, 10,12 CLA-treated human adipocytes were supplemented with oleic acid for 12 h to 7 days, and inflammatory gene expression, insulin-stimulated glucose uptake, and lipid content were measured. Oleic acid reduced inflammatory gene expression in a dose-dependent manner, and restored the lipid content of 10,12 CLA-treated adipocytes without improving insulin-stimulated glucose uptake. In contrast, supplementation with stearic acid, a substrate for SCD-1, or 9,11 CLA did not prevent inflammatory gene expression by 10,12 CLA. Notably, 10,12 CLA impacted the expression of several G-protein coupled receptors that was attenuated by oleic acid. Collectively, these data show that oleic acid attenuates 10,12 CLA-induced inflammatory gene expression and lipid content, possibly by alleviating cell stress caused by the inhibition of MUFA needed for phospholipid and neutral lipid synthesis.

  16. Determinants of Human Adipose Tissue Gene Expression: Impact of Diet, Sex, Metabolic Status, and Cis Genetic Regulation

    PubMed Central

    Viguerie, Nathalie; Montastier, Emilie; Maoret, Jean-José; Roussel, Balbine; Combes, Marion; Valle, Carine; Villa-Vialaneix, Nathalie; Iacovoni, Jason S.; Martinez, J. Alfredo; Holst, Claus; Astrup, Arne; Vidal, Hubert; Clément, Karine; Hager, Jorg; Saris, Wim H. M.; Langin, Dominique

    2012-01-01

    Weight control diets favorably affect parameters of the metabolic syndrome and delay the onset of diabetic complications. The adaptations occurring in adipose tissue (AT) are likely to have a profound impact on the whole body response as AT is a key target of dietary intervention. Identification of environmental and individual factors controlling AT adaptation is therefore essential. Here, expression of 271 transcripts, selected for regulation according to obesity and weight changes, was determined in 515 individuals before, after 8-week low-calorie diet-induced weight loss, and after 26-week ad libitum weight maintenance diets. For 175 genes, opposite regulation was observed during calorie restriction and weight maintenance phases, independently of variations in body weight. Metabolism and immunity genes showed inverse profiles. During the dietary intervention, network-based analyses revealed strong interconnection between expression of genes involved in de novo lipogenesis and components of the metabolic syndrome. Sex had a marked influence on AT expression of 88 transcripts, which persisted during the entire dietary intervention and after control for fat mass. In women, the influence of body mass index on expression of a subset of genes persisted during the dietary intervention. Twenty-two genes revealed a metabolic syndrome signature common to men and women. Genetic control of AT gene expression by cis signals was observed for 46 genes. Dietary intervention, sex, and cis genetic variants independently controlled AT gene expression. These analyses help understanding the relative importance of environmental and individual factors that control the expression of human AT genes and therefore may foster strategies aimed at improving AT function in metabolic diseases. PMID:23028366

  17. Précis of bayesian rationality: The probabilistic approach to human reasoning.

    PubMed

    Oaksford, Mike; Chater, Nick

    2009-02-01

    According to Aristotle, humans are the rational animal. The borderline between rationality and irrationality is fundamental to many aspects of human life including the law, mental health, and language interpretation. But what is it to be rational? One answer, deeply embedded in the Western intellectual tradition since ancient Greece, is that rationality concerns reasoning according to the rules of logic--the formal theory that specifies the inferential connections that hold with certainty between propositions. Piaget viewed logical reasoning as defining the end-point of cognitive development; and contemporary psychology of reasoning has focussed on comparing human reasoning against logical standards. Bayesian Rationality argues that rationality is defined instead by the ability to reason about uncertainty. Although people are typically poor at numerical reasoning about probability, human thought is sensitive to subtle patterns of qualitative Bayesian, probabilistic reasoning. In Chapters 1-4 of Bayesian Rationality (Oaksford & Chater 2007), the case is made that cognition in general, and human everyday reasoning in particular, is best viewed as solving probabilistic, rather than logical, inference problems. In Chapters 5-7 the psychology of "deductive" reasoning is tackled head-on: It is argued that purportedly "logical" reasoning problems, revealing apparently irrational behaviour, are better understood from a probabilistic point of view. Data from conditional reasoning, Wason's selection task, and syllogistic inference are captured by recasting these problems probabilistically. The probabilistic approach makes a variety of novel predictions which have been experimentally confirmed. The book considers the implications of this work, and the wider "probabilistic turn" in cognitive science and artificial intelligence, for understanding human rationality.

  18. Periodontal tissue regeneration using the cytokine cocktail mimicking secretomes in the conditioned media from human mesenchymal stem cells.

    PubMed

    Sakaguchi, Kohei; Katagiri, Wataru; Osugi, Masashi; Kawai, Takamasa; Sugimura-Wakayama, Yukiko; Hibi, Hideharu

    2017-02-26

    Secretomes in the conditioned media from human mesenchymal stem cells (MSC-CM) were previously demonstrated to promote periodontal tissue regeneration. By mixing insulin-like growth factor-1, vascular endothelial growth factor-A, and transforming growth factor-β1 which were included in MSC-CM, we made the cytokine cocktail (CC) mimicking MSC-CM, and then evaluated its efficacy on periodontal tissue regeneration. In vitro, CC promoted the migration of dog bone marrow-derived stem cells and periodontal ligament cells, and the tube formation of human umbilical vein endothelial cells. In vivo, class II furcation defects were surgically created at premolars in dogs. After 4 weeks of vinylpolysiloxane-induced inflammation, defects were filled with or without CC mixed in hydroxypropyl cellulose, or enamel matrix derivative (EMD). After 8 weeks, periodontal tissues were evaluated histologically and immunohistochemically. CC showed promotional effects on angiogenesis and formation of new bone and cementum. Osteogenesis by CC was greater than that by EMD and cementogenesis by CC was as well as that by EMD. CC may be promising for periodontal tissue regeneration. Copyright © 2017 Elsevier Inc. All rights reserved.

  19. Mapping cis-Regulatory Domains in the Human Genome UsingMulti-Species Conservation of Synteny

    SciTech Connect

    Ahituv, Nadav; Prabhakar, Shyam; Poulin, Francis; Rubin, EdwardM.; Couronne, Olivier

    2005-06-13

    Our inability to associate distant regulatory elements with the genes that they regulate has largely precluded their examination for sequence alterations contributing to human disease. One major obstacle is the large genomic space surrounding targeted genes in which such elements could potentially reside. In order to delineate gene regulatory boundaries we used whole-genome human-mouse-chicken (HMC) and human-mouse-frog (HMF) multiple alignments to compile conserved blocks of synteny (CBS), under the hypothesis that these blocks have been kept intact throughout evolution at least in part by the requirement of regulatory elements to stay linked to the genes that they regulate. A total of 2,116 and 1,942 CBS>200 kb were assembled for HMC and HMF respectively, encompassing 1.53 and 0.86 Gb of human sequence. To support the existence of complex long-range regulatory domains within these CBS we analyzed the prevalence and distribution of chromosomal aberrations leading to position effects (disruption of a genes regulatory environment), observing a clear bias not only for mapping onto CBS but also for longer CBS size. Our results provide a genome wide data set characterizing the regulatory domains of genes and the conserved regulatory elements within them.

  20. Research Objectives for Human Missions in the Proving Ground of Cis-Lunar Space

    NASA Technical Reports Server (NTRS)

    Niles, P. B.; Eppler, D. B.; Kennedy, K. J.; Lewis, R.; Spann, J. F.; Sullivan, T. A.

    2016-01-01

    Beginning in as early as 2023, crewed missions beyond low Earth orbit will begin enabled by the new capabilities of the SLS and Orion vehicles. This will initiate the "Proving Ground" phase of human exploration with Mars as an ultimate destination. The primary goal of the Proving Ground is to demonstrate the capability of suitably long duration spaceflight without need of continuous support from Earth, i.e. become Earth Independent. A major component of the Proving Ground phase is to conduct research activities aimed at accomplishing major objectives selected from a wide variety of disciplines including but not limited to: Astronomy, Heliophysics, Fundamental Physics, Planetary Science, Earth Science, Human Systems, Fundamental Space Biology, Microgravity, and In A major component of the Proving Ground phase is to conduct research activities aimed at accomplishing major objectives selected from a wide variety of disciplines including but not limited to: Astronomy, Heliophysics, Fundamental Physics, Planetary Science, Earth Science, Human Systems, Fundamental Space Biology, Microgravity, and In Situ Resource Utilization. Mapping and prioritizing the most important objectives from these disciplines will provide a strong foundation for establishing the architecture to be utilized in the Proving Ground.

  1. Enhancing fuzzy robot navigation systems by mimicking human visual perception of natural terrain traversibility

    NASA Technical Reports Server (NTRS)

    Tunstel, E.; Howard, A.; Edwards, D.; Carlson, A.

    2001-01-01

    This paper presents a technique for learning to assess terrain traversability for outdoor mobile robot navigation using human-embedded logic and real-time perception of terrain features extracted from image data.

  2. Enhancing fuzzy robot navigation systems by mimicking human visual perception of natural terrain traversibility

    NASA Technical Reports Server (NTRS)

    Tunstel, E.; Howard, A.; Edwards, D.; Carlson, A.

    2001-01-01

    This paper presents a technique for learning to assess terrain traversability for outdoor mobile robot navigation using human-embedded logic and real-time perception of terrain features extracted from image data.

  3. Rotational spectrum of cis-cis HOONO

    NASA Astrophysics Data System (ADS)

    Drouin, Brian J.; Fry, Juliane L.; Miller, Charles E.

    2004-03-01

    The pure rotational spectrum of cis-cis peroxynitrous acid, HOONO, has been observed. Over 220 transitions, sampling states up to J'=67 and Ka'=31, have been fitted with an rms uncertainty of 48.4 kHz. The experimentally determined rotational constants agree well with ab initio values for the cis-cis conformer, a five-membered ring formed by intramolecular hydrogen bonding. The small, positive inertial defect Δ=0.075667(60) amu Å2 and lack of any observable torsional splittings in the spectrum indicate that cis-cis HOONO exists in a well-defined planar structure at room temperature.

  4. Insight into GATA1 transcriptional activity through interrogation of cis elements disrupted in human erythroid disorders.

    PubMed

    Wakabayashi, Aoi; Ulirsch, Jacob C; Ludwig, Leif S; Fiorini, Claudia; Yasuda, Makiko; Choudhuri, Avik; McDonel, Patrick; Zon, Leonard I; Sankaran, Vijay G

    2016-04-19

    Whole-exome sequencing has been incredibly successful in identifying causal genetic variants and has revealed a number of novel genes associated with blood and other diseases. One limitation of this approach is that it overlooks mutations in noncoding regulatory elements. Furthermore, the mechanisms by which mutations in transcriptionalcis-regulatory elements result in disease remain poorly understood. Here we used CRISPR/Cas9 genome editing to interrogate three such elements harboring mutations in human erythroid disorders, which in all cases are predicted to disrupt a canonical binding motif for the hematopoietic transcription factor GATA1. Deletions of as few as two to four nucleotides resulted in a substantial decrease (>80%) in target gene expression. Isolated deletions of the canonical GATA1 binding motif completely abrogated binding of the cofactor TAL1, which binds to a separate motif. Having verified the functionality of these three GATA1 motifs, we demonstrate strong evolutionary conservation of GATA1 motifs in regulatory elements proximal to other genes implicated in erythroid disorders, and show that targeted disruption of such elements results in altered gene expression. By modeling transcription factor binding patterns, we show that multiple transcription factors are associated with erythroid gene expression, and have created predictive maps modeling putative disruptions of their binding sites at key regulatory elements. Our study provides insight into GATA1 transcriptional activity and may prove a useful resource for investigating the pathogenicity of noncoding variants in human erythroid disorders.

  5. Lessons learned from mice and man: mimicking human allergy through mouse models.

    PubMed

    Graham, Michelle T; Nadeau, Kari C

    2014-11-01

    The relevance of using mouse models to represent human allergic pathologies is still unclear. Recent studies suggest the limitations of using models as a standard for assessing immune response and tolerance mechanisms, as mouse models often do not sufficiently depict human atopic conditions. Allergy is a combination of aberrant responses to innocuous environmental agents and the subsequent TH2-mediated inflammatory responses. In this review, we will discuss current paradigms of allergy - specifically, TH2-mediated and IgE-associated immune responses - and current mouse models used to recreate these TH2-mediated pathologies. Our overall goal is to highlight discrepancies that exist between mice and men by examining the advantages and disadvantages of allergic mouse models with respect to the human allergic condition.

  6. Long-range evolutionary constraints reveal cis-regulatory interactions on the human X chromosome

    PubMed Central

    Naville, Magali; Ishibashi, Minaka; Ferg, Marco; Bengani, Hemant; Rinkwitz, Silke; Krecsmarik, Monika; Hawkins, Thomas A.; Wilson, Stephen W.; Manning, Elizabeth; Chilamakuri, Chandra S. R.; Wilson, David I.; Louis, Alexandra; Lucy Raymond, F.; Rastegar, Sepand; Strähle, Uwe; Lenhard, Boris; Bally-Cuif, Laure; van Heyningen, Veronica; FitzPatrick, David R.; Becker, Thomas S.; Roest Crollius, Hugues

    2015-01-01

    Enhancers can regulate the transcription of genes over long genomic distances. This is thought to lead to selection against genomic rearrangements within such regions that may disrupt this functional linkage. Here we test this concept experimentally using the human X chromosome. We describe a scoring method to identify evolutionary maintenance of linkage between conserved noncoding elements and neighbouring genes. Chromatin marks associated with enhancer function are strongly correlated with this linkage score. We test >1,000 putative enhancers by transgenesis assays in zebrafish to ascertain the identity of the target gene. The majority of active enhancers drive a transgenic expression in a pattern consistent with the known expression of a linked gene. These results show that evolutionary maintenance of linkage is a reliable predictor of an enhancer's function, and provide new information to discover the genetic basis of diseases caused by the mis-regulation of gene expression. PMID:25908307

  7. Redox control of resistance to cis-diamminedichloroplatinum (II) (CDDP): protective effect of human thioredoxin against CDDP-induced cytotoxicity.

    PubMed Central

    Sasada, T; Iwata, S; Sato, N; Kitaoka, Y; Hirota, K; Nakamura, K; Nishiyama, A; Taniguchi, Y; Takabayashi, A; Yodoi, J

    1996-01-01

    Thioredoxin is a small ubiquitous protein with multiple biological functions, including cellular defense mechanisms against oxidative stress. In the present study, we investigated the role of human thioredoxin (hTRX) in the acquisition of cellular resistance to cis-diamminedichloroplatinum (II) (CDDP). The expression and activity of hTRX in Jurkat T cells was dose-dependently enhanced by exposure to CDDP, as determined by immunoblot analysis and insulin reducing assay. Furthermore, chloramphenicol acetyltransferase analysis using the hTRX promoter-reporter gene construct revealed that treatment of Jurkat cells with CDDP caused transcriptional activation of the hTRX gene, which might be mediated through increased generation of intracellular reactive oxygen intermediates. To examine the biological significance of hTRX induction, we established hTRX-overexpressing derivatives of L929 fibrosarcoma cells by stable transfection with the hTRX cDNA. The clones, which constitutively expressed the exogenous hTRX, displayed increased resistance to CDDP-induced cytotoxicity, compared with the control clones. After exposure to CDDP, the control cells showed a significant increase in the intracellular accumulation of peroxides, whereas the hTRX-transfected cells did not. Taken together, these results suggest that overexpressed hTRX is responsible for the development of cellular resistance to CDDP, possibly by scavenging intracellular toxic oxidants generated by this anticancer agent. PMID:8636406

  8. Liquid chromatographic analysis of the cis(Z)- and trans(E)-isomers of clopenthixol in human plasma using a novel solid phase extraction procedure.

    PubMed

    Pucci, Vincenzo; Bugamelli, Francesca; Mandrioli, Roberto; Bartoletti, Claudio; Rossi, Nicola; Raggi, Maria Augusta

    2003-07-25

    A simple and highly sensitive high-performance liquid chromatographic (HPLC) method for the simultaneous determination of cis(Z)-clopenthixol and trans(E)-clopenthixol in human plasma has been developed. The chromatographic analysis was carried out isocratically on a reversed-phase column (C(8) 150 x 4.6 mm I.D., 5 microm) using a mixture of 25 mM phosphate buffer and acetonitrile (65:35 v/v, pH* 3.0) as the mobile phase, and ultraviolet detection at 230 nm. Plasma sample pretreatment was accomplished by means of an original solid-phase extraction (SPE) procedure carried out on cyanopropyl cartridges, with a high extraction yield and good selectivity. Under the optimum conditions, calibration graphs of spiked human plasma samples were obtained over the concentration ranges 1-300 ng ml(-1) for cis(Z)-clopenthixol and 1-200 ng ml(-1) for trans(E)-clopenthixol. The limit of detection (LOD) was 0.3 ng ml(-1) for both cis(Z)- and trans(E)-isomers of clopenthixol. The method was successfully applied to the determination of cis(Z)-clopenthixol and trans(E)-clopenthixol in plasma samples of schizophrenic patients undergoing therapy with zuclopenthixol.

  9. Dual effects of ketoconazole cis-enantiomers on CYP3A4 in human hepatocytes and HepG2 Cells.

    PubMed

    Novotná, Aneta; Krasulová, Kristýna; Bartoňková, Iveta; Korhoňová, Martina; Bachleda, Petr; Anzenbacher, Pavel; Dvořák, Zdeněk

    2014-01-01

    Antifungal drug ketoconazole causes severe drug-drug interactions by influencing gene expression and catalytic activity of major drug-metabolizing enzyme cytochrome P450 CYP3A4. Ketoconazole is administered in the form of racemic mixture of two cis-enantiomers, i.e. (+)-ketoconazole and (-)-ketoconazole. Many enantiopure drugs were introduced to human pharmacotherapy in last two decades. In the current paper, we have examined the effects of ketoconazole cis-enantiomers on the expression of CYP3A4 in human hepatocytes and HepG2 cells and on catalytic activity of CYP3A4 in human liver microsomes. We show that both ketoconazole enantiomers induce CYP3A4 mRNA and protein in human hepatocytes and HepG2 cells. Gene reporter assays revealed partial agonist activity of ketoconazole enantiomers towards pregnane X receptor PXR. Catalytic activity of CYP3A4/5 towards two prototypic substrates of CYP3A enzymes, testosterone and midazolam, was determined in presence of both (+)-ketoconazole and (-)-ketoconazole in human liver microsomes. Overall, both ketoconazole cis-enantiomers induced CYP3A4 in human cells and inhibited CYP3A4 in human liver microsomes. While interaction of ketoconazole with PXR and induction of CYP3A4 did not display enantiospecific pattern, inhibition of CYP3A4 catalytic activity by ketoconazole differed for ketoconazole cis-enantiomers ((+)-ketoconazole IC₅₀ 1.69 µM, Ki 0.92 µM for testosterone, IC₅₀ 1.46 µM, Ki 2.52 µM for midazolam; (-)-ketoconazole IC₅₀ 0.90 µM, Ki 0.17 µM for testosterone, IC₅₀ 1.04 µM, Ki 1.51 µM for midazolam).

  10. A dataset of stereoscopic images and ground-truth disparity mimicking human fixations in peripersonal space.

    PubMed

    Canessa, Andrea; Gibaldi, Agostino; Chessa, Manuela; Fato, Marco; Solari, Fabio; Sabatini, Silvio P

    2017-03-28

    Binocular stereopsis is the ability of a visual system, belonging to a live being or a machine, to interpret the different visual information deriving from two eyes/cameras for depth perception. From this perspective, the ground-truth information about three-dimensional visual space, which is hardly available, is an ideal tool both for evaluating human performance and for benchmarking machine vision algorithms. In the present work, we implemented a rendering methodology in which the camera pose mimics realistic eye pose for a fixating observer, thus including convergent eye geometry and cyclotorsion. The virtual environment we developed relies on highly accurate 3D virtual models, and its full controllability allows us to obtain the stereoscopic pairs together with the ground-truth depth and camera pose information. We thus created a stereoscopic dataset: GENUA PESTO-GENoa hUman Active fixation database: PEripersonal space STereoscopic images and grOund truth disparity. The dataset aims to provide a unified framework useful for a number of problems relevant to human and computer vision, from scene exploration and eye movement studies to 3D scene reconstruction.

  11. A dataset of stereoscopic images and ground-truth disparity mimicking human fixations in peripersonal space

    PubMed Central

    Canessa, Andrea; Gibaldi, Agostino; Chessa, Manuela; Fato, Marco; Solari, Fabio; Sabatini, Silvio P.

    2017-01-01

    Binocular stereopsis is the ability of a visual system, belonging to a live being or a machine, to interpret the different visual information deriving from two eyes/cameras for depth perception. From this perspective, the ground-truth information about three-dimensional visual space, which is hardly available, is an ideal tool both for evaluating human performance and for benchmarking machine vision algorithms. In the present work, we implemented a rendering methodology in which the camera pose mimics realistic eye pose for a fixating observer, thus including convergent eye geometry and cyclotorsion. The virtual environment we developed relies on highly accurate 3D virtual models, and its full controllability allows us to obtain the stereoscopic pairs together with the ground-truth depth and camera pose information. We thus created a stereoscopic dataset: GENUA PESTO—GENoa hUman Active fixation database: PEripersonal space STereoscopic images and grOund truth disparity. The dataset aims to provide a unified framework useful for a number of problems relevant to human and computer vision, from scene exploration and eye movement studies to 3D scene reconstruction. PMID:28350382

  12. A dataset of stereoscopic images and ground-truth disparity mimicking human fixations in peripersonal space

    NASA Astrophysics Data System (ADS)

    Canessa, Andrea; Gibaldi, Agostino; Chessa, Manuela; Fato, Marco; Solari, Fabio; Sabatini, Silvio P.

    2017-03-01

    Binocular stereopsis is the ability of a visual system, belonging to a live being or a machine, to interpret the different visual information deriving from two eyes/cameras for depth perception. From this perspective, the ground-truth information about three-dimensional visual space, which is hardly available, is an ideal tool both for evaluating human performance and for benchmarking machine vision algorithms. In the present work, we implemented a rendering methodology in which the camera pose mimics realistic eye pose for a fixating observer, thus including convergent eye geometry and cyclotorsion. The virtual environment we developed relies on highly accurate 3D virtual models, and its full controllability allows us to obtain the stereoscopic pairs together with the ground-truth depth and camera pose information. We thus created a stereoscopic dataset: GENUA PESTO—GENoa hUman Active fixation database: PEripersonal space STereoscopic images and grOund truth disparity. The dataset aims to provide a unified framework useful for a number of problems relevant to human and computer vision, from scene exploration and eye movement studies to 3D scene reconstruction.

  13. Epithelial membrane protein 2 (EMP2) deficiency alters placental angiogenesis, mimicking features of human placental insufficiency.

    PubMed

    Williams, Carmen J; Chu, Alison; Jefferson, Wendy N; Casero, David; Sudhakar, Deepthi; Khurana, Nevil; Hogue, Claire P; Aryasomayajula, Chinmayi; Patel, Priya; Sullivan, Peggy; Padilla-Banks, Elizabeth; Mohandessi, Shabnam; Janzen, Carla; Wadehra, Madhuri

    2017-03-14

    Epithelial membrane protein-2 (EMP2) is a tetraspan protein predicted to regulate placental development. Highly expressed in secretory endometrium and trophectoderm cells, previous studies suggest that it may regulate implantation by orchestrating the surface expression of integrins and other membrane proteins. In order to test the role of EMP2 in pregnancy, mice lacking EMP2 (Emp2(-/-) ) were generated. Emp2(-/-) females are fertile but have reduced litter sizes when carrying Emp2(-/-) but not Emp2(+/-) fetuses. Placentas of Emp2(-/-) fetuses exhibit dysregulation in pathways related to neoangiogenesis, coagulation, and oxidative stress, and have increased fibrin deposition and altered vasculature. Given that these findings often occur due to placental insufficiency resulting in an oxygen-poor environment, the expression of hypoxia-inducible factor-1 alpha (HIF-1α) was examined. Placentas from Emp2(-/-) fetuses had increased total HIF-1α expression in large part through an increase in uterine NK (uNK) cells, demonstrating a unique interplay between uNK cells and trophoblasts modulated through EMP2. To determine if these results translated to human pregnancy, placentas from normal, term deliveries or those complicated by placental insufficiency resulting in intrauterine growth restriction (IUGR) were stained for EMP2. EMP2 was significantly reduced in both villous and extravillous trophoblast populations in IUGR placentas. Experiments in vitro using human trophoblast cells lines indicate that EMP2 modulates angiogenesis by altering HIF-1α expression. Our results reveal a novel role for EMP2 in regulating trophoblast function and vascular development in mice and humans and suggest it may be a new biomarker for placental insufficiency.

  14. miRNA expression in human intestinal Caco-2 cells is comparably regulated by cis- and trans-fatty acids.

    PubMed

    Köpke, Solveigh; Buhrke, Thorsten; Lampen, Alfonso

    2015-03-01

    Trans-fatty acids are unsaturated fatty acids with at least one double bond in trans configuration. While their role in the development of coronary heart disease is broadly accepted, a potential impact of these fatty acids on colon carcinogenesis is still under discussion. MiRNAs are small non-coding RNAs that regulate the gene expression at a post-transcriptional level by inhibiting the translation of target mRNAs. We investigated the effect of 16 different C 18 fatty acid isomers on the expression of 84 cancer-related miRNAs in the human colorectal adenocarcinoma cell line Caco-2 by using a qRT-PCR array. 66 of these 84 miRNAs were deregulated by at least one fatty acid, however, there was no trans-specific impact on miRNA expression as the corresponding cis isomer of a given fatty acid generally had comparable effects on the miRNA expression profile. The most pronounced effects were observed for hsa-miR-146a-5p, which was upregulated by four of the 16 investigated fatty acids, and hsa-miR-32-5p, which was strongly downregulated by five fatty acids. As hsa-miR-32-5p was described to target genes being involved in the regulation of apoptosis, the effect of α-eleostearic acid on the expression of the apoptosis-associated genes BCL2L11, BCL-2, and BCL-XL was examined. The qPCR results indicate that fatty acid-mediated downregulation of hsa-miR-32-5p is accompanied by a downregulation of BCL-2 and BCL2L11 mRNA whereas BCL-XL was shown to be simultaneously upregulated. In conclusion, our data indicate that several fatty acids are able to regulate miRNA expression of human colon cancer cells. However, no trans-specific regulation was observed.

  15. Human brucellosis mimicking axial spondyloarthritis: a challenge for rheumatologists when applying the 2009 ASAS criteria.

    PubMed

    Ye, Cong; Shen, Gui-Fen; Li, Shou-Xin; Dong, Ling-Li; Yu, Yi-Kai; Tu, Wei; Zhu, Ying-Zi; Hu, Shao-Xian

    2016-06-01

    Although the development of the 2009 SpA classification criteria by Assessment of SpondyloArthritis international Society (ASAS) represents an important step towards a better definition of the early disease stage particularly in axial spondyloarthritis (axSpA), the specificity of the criteria has been criticized these days. As the commonest zoonotic infection worldwide, human brucellosis can mimic a large number of diseases, including SpA. This study was performed to determine the frequency of rheumatologic manifestations in patients with brucellosis and the chance of misdiagnosing them as having axSpA in central China. The results showed that clinical manifestations of axSpA could be observed in brucellosis. Over half of patients had back pain, and one fifth of the patients with back pain were less than 45 years old at onset and had the symptom for more than 3 months. Two young males were falsely classified as suffering from axSpA according to the ASAS criteria, and one with MRI proved sacroiliitis was once given Etanercept for treatment. Therefore, differential diagnosis including human brucellosis should always be kept in mind when applying the ASAS criteria, even in traditionally non-endemic areas.

  16. Development and Characterization of Piezoelectric Artificial Cochlear with micro Actuator mimicking Human Cochlear

    NASA Astrophysics Data System (ADS)

    Jung, Y.; Kim, S.; Kwak, J.; Kang, H.; Lee, Y. H.; Park, S.; Kim, W.; Hur, S.

    2013-12-01

    This paper presents the development of piezoelectric artificial cochlear (P-AC) capable of analyzing incoming acoustic or mechanical signals without external power source. The P-AC consists of membrane part and package part. The package part provides liquid environment through which the incoming signal is transmitted to membrane part. The membrane part responds to the transmitted signal and local area of the membrane part vibrates differently depending on its local resonant frequency. Previously in our group, we have demonstrated the feasibility of the P-AC with trapezoidal membrane part as sound analyzer by using mouth simulator as a sound input. In this research, we modified the P-AC to have the membrane part of logarithmically varying width. Also by incorporating mico-actuator into the package part that mimic the function of stapes bone in middle ear, we created similar environment to cochlear where human basilar membrane vibrates. The fabricated P-AC successfully demonstrates frequency separation of incoming mechanical signal from micro-actuator into several frequency bands within human hearing range.

  17. Novel Rat Model of Repetitive Portal Venous Embolization Mimicking Human Non-Cirrhotic Idiopathic Portal Hypertension

    PubMed Central

    Klein, Sabine; Hinüber, Christian; Hittatiya, Kanishka; Schierwagen, Robert; Uschner, Frank Erhard; Strassburg, Christian P.; Fischer, Hans-Peter; Spengler, Ulrich; Trebicka, Jonel

    2016-01-01

    Background Non-cirrhotic idiopathic portal hypertension (NCIPH) is characterized by splenomegaly, anemia and portal hypertension, while liver function is preserved. However, no animal models have been established yet. This study assessed a rat model of NCIPH and characterized the hemodynamics, and compared it to human NCIPH. Methods Portal pressure (PP) was measured invasively and coloured microspheres were injected in the ileocecal vein in rats. This procedure was performed weekly for 3 weeks (weekly embolization). Rats without and with single embolization served as controls. After four weeks (one week after last embolization), hemodynamics were investigated, hepatic fibrosis and accumulation of myofibroblasts were analysed. General characteristics, laboratory analyses and liver histology were collected in patients with NCIPH. Results Weekly embolization induced a hyperdynamic circulation, with increased PP. The mesenteric flow and hepatic hydroxyproline content was significantly higher in weekly embolized compared to single embolized rats (mesenteric flow +54.1%, hydroxyproline +41.7%). Mesenteric blood flow and shunt volumes increased, whereas splanchnic vascular resistance was decreased in the weekly embolization group. Fibrotic markers αSMA and Desmin were upregulated in weekly embolized rats. Discussion This study establishes a model using repetitive embolization via portal veins, comparable with human NCIPH and may serve to test new therapies. PMID:27589391

  18. Lycopene from heat-induced cis-isomer-rich tomato sauce is more bioavailable than from all-trans-rich tomato sauce in human subjects.

    PubMed

    Unlu, Nuray Z; Bohn, Torsten; Francis, David M; Nagaraja, Haikady N; Clinton, Steven K; Schwartz, Steven J

    2007-07-01

    Lycopene is present mainly as cis-isomers in human serum and tissues whereas all-trans-lycopene predominates in tomato products, suggesting that all-trans-lycopene is isomerised in the body or is less bioavailable. The objectives of the present study were to develop processing conditions for tomatoes to obtain products with different cis-trans-lycopene isomer distribution and to assess their bioavailability. Healthy adult subjects (n 12) were recruited for this randomised cross-over trial. Each intervention was preceded by a 2-week washout period. Two tomato sauces, one rich in all-trans-lycopene (32.5 mg total lycopene/100 g sauce; 5 % cis-isomers), the other high in cis-lycopene (26.4 mg total lycopene/100 g sauce; 45 % cis-isomers), were produced by different heat-processing techniques. Each sauce (150 g) was served in a standardised meal at 08.00 hours after overnight fasting. Plasma TAG-rich lipoprotein fractions over 9.5 h following test-meal consumption as a measure of lycopene absorption were obtained and expressed as baseline-corrected area under the concentration v. time curves (AUC), using HPLC-electrochemical detection. AUC values adjusted for the amount lycopene consumed showed that total, total cis-, and all-trans-lycopene responses were significantly higher from the cis-isomer-rich sauce, compared with the all-trans-rich sauce, being 7.30 (sem 1.45) v. 4.74 (sem 1.08) nmol x h/l (P = 0.002), 3.80 (sem 0.76) v. 1.98 (sem 0.37) nmol x h/l (P = 0.0005) and 3.50 (sem 0.76) v. 2.76 (sem 0.76) nmol x h/l (P = 0.01), respectively. The present study demonstrates significant lycopene bioavailability from cis-lycopene-rich tomato sauce and highlights the importance of considering isomer-distribution for lycopene bioavailability. Furthermore, processing parameters can be controlled to alter isomer patterns of tomato products and influence lycopene bioavailability.

  19. Transient Expression of Transgenic IL-12 in Mouse Liver Triggers Unremitting Inflammation Mimicking Human Autoimmune Hepatitis.

    PubMed

    Gil-Farina, Irene; Di Scala, Marianna; Salido, Eduardo; López-Franco, Esperanza; Rodríguez-García, Estefania; Blasi, Mercedes; Merino, Juana; Aldabe, Rafael; Prieto, Jesús; Gonzalez-Aseguinolaza, Gloria

    2016-09-15

    The etiopathogenesis of autoimmune hepatitis (AIH) remains poorly understood. In this study, we sought to develop an animal model of human AIH to gain insight into the immunological mechanisms driving this condition. C57BL/6 mice were i.v. injected with adeno-associated viral vectors encoding murine IL-12 or luciferase under the control of a liver-specific promoter. Organ histology, response to immunosuppressive therapy, and biochemical and immunological parameters, including Ag-specific humoral and cellular response, were analyzed. Mechanistic studies were carried out using genetically modified mice and depletion of lymphocyte subpopulations. Adeno-associated virus IL-12-treated mice developed histological, biochemical, and immunological changes resembling type 1 AIH, including marked and persistent liver mononuclear cell infiltration, hepatic fibrosis, hypergammaglobulinemia, anti-nuclear and anti-smooth muscle actin Abs, and disease remission with immunosuppressive drugs. Interestingly, transgenic IL-12 was short-lived, but endogenous IL-12 expression was induced, and both IL-12 and IFN-γ remained elevated during the entire study period. IFN-γ was identified as an essential mediator of liver damage, and CD4 and CD8 T cells but not NK, NKT, or B cells were essential executors of hepatic injury. Furthermore, both MHC class I and MHC class II expression was upregulated at the hepatocellular membrane, and induction of autoreactive liver-specific T cells was detected. Remarkably, although immunoregulatory mechanisms were activated, they only partially mitigated liver damage. Thus, low and transient expression of transgenic IL-12 in hepatocytes causes loss of tolerance to hepatocellular Ags, leading to chronic hepatitis resembling human AIH type 1. This model provides a practical tool to explore AIH pathogenesis and novel therapies.

  20. Cis- and Trans-gnetin H from Paeonia suffruticosa suppress inhibitor kappa B kinase phosphorylation in LPS-stimulated human THP-1 cells.

    PubMed

    Park, Hyo S; Vick, Eric J; Gao, Ying; He, Chunnian; Almosnid, Nadin Marwan; Farone, Mary; Farone, Anthony L

    2016-08-02

    The inflammatory response is an important mechanism in host defense; however, overstimulation and chronic inflammation are involved in many important human diseases. Currently, tumor necrosis factor-alpha blockers such as infliximab and adalimumab along with methotrexate are used in cases of severe and chronic disease. However, there are severe side effects and limitations associated with these treatments. Cis- and trans-gnetin H are compounds isolated from the seeds of Paeonia suffruticosa, a medicinal plant used in traditional Chinese medicine for the treatment of many conditions, including inflammatory diseases. In this study, we investigated possible anti-inflammatory mechanisms of cis- and trans-gnetin H against LPS-stimulated human THP-1 cells. PMA-differentiated THP-1 cells were pretreated with increasing concentrations of cis- and trans-gnetin H with or without LPS. Following treatment, cytotoxicity and the TNF-α, IL-1β, and IL-8 response were measured. We also characterized the nuclear translocation of NF-κB subunit p65 (RelA) by immunofluorescence and then investigated NF-κB activation by measuring the phosphorylation of NF-κB mediators, IKK-β, IκB α, and p65 by western blotting. We found that cis- and trans-gnetin H significantly inhibited the cytokine response in a concentration-dependent manner without affecting cell viability. Cis- and trans-gnetin H effectively inhibited nuclear translocation of p65 and phosphorylation of IKK-β, IκB α, and p65. While both compounds showed promising anti-inflammatory effects, trans-gnetin H was determined to be more effective in suppressing cytokine responses. We demonstrated that cis- and trans-gnetin H suppress cytokine response in LPS-stimulated THP-1 cells by preventing activation of key signaling molecules, IKK-β, IκB α, and p65, involved in the NF-κB pathway and suggest the use of cis- and trans-gnetin H in potential therapies for conditions and diseases associated with chronic inflammation

  1. Synergistic anti-proliferative effects of vitamin D derivatives and 9-cis retinoic acid in SH-SY5Y human neuroblastoma cells.

    PubMed

    Stio, M; Celli, A; Treves, C

    2001-06-01

    This study examines the effect of 1,25-dihydroxyvitamin D(3) [1,25(OH)(2)D(3)], 24,25-dihydroxyvitamin D(3) [24,25(OH)(2)D(3)], two vitamin D analogues (KH 1060 and EB 1089, which are 20-epi-22-oxa and 22,24-diene-analogues, respectively), 9-cis retinoic acid and all-trans retinoic acid on proliferation of SH-SY5Y human neuroblastoma cells, after treatment for 7 days. Cell number did not change when the cells were incubated with 1, 10 or 100 nM 1,25(OH)(2)D(3) or its derivatives, but significantly decreased in the presence of the two retinoids (0.001--10 microM final concentration). A synergistic inhibition was observed, when SH-SY5Y cells were treated combining 0.1 microM 9-cis retinoic acid and 10 nM 1,25(OH)(2)D(3) or 10 nM KH 1060, and 1 microM 9-cis retinoic acid and 10 nM 1,25(OH)(2)D(3) or 10 nM EB 1089. Acetylcholinesterase activity showed a significant increase, in comparison with controls, after treatment of the cells for 7 days with 0.1 or 1 microM 9-cis retinoic acid, alone or combined with 10 nM 1,25(OH)(2)D(3) or 10 nM KH 1060 or 10 nM EB 1089. This increase was synergistic, combining 1 microM 9-cis retinoic acid and 10 nM 1,25(OH)(2)D(3) or EB 1089. The levels of the c-myc encoded protein remarkably decreased after treatment of SH-SY5Y cells for 1, 3, 7 days with 0.1 and 1 microM 9-cis retinoic acid, alone or combined with 10 nM 1,25(OH)(2)D(3) or 10 nM KH 1060 or 10 nM EB 1089. In particular, the association of 1 microM 9-cis retinoic acid and 10 nM 1,25(OH)(2)D(3) or 10 nM EB 1089 resulted in a synergistic c-myc inhibition, in comparison with that obtained in the presence of the retinoid alone. These findings may have therapeutic implications in human neuroblastoma.

  2. Candidacidal Activity of Selected Ceragenins and Human Cathelicidin LL-37 in Experimental Settings Mimicking Infection Sites

    PubMed Central

    Durnaś, Bonita; Wnorowska, Urszula; Pogoda, Katarzyna; Deptuła, Piotr; Wątek, Marzena; Piktel, Ewelina; Głuszek, Stanisław; Gu, Xiaobo; Savage, Paul B.; Niemirowicz, Katarzyna; Bucki, Robert

    2016-01-01

    Fungal infections, especially those caused by antibiotic resistant pathogens, have become a serious public health problem due to the growing number of immunocompromised patients, including those subjected to anticancer treatment or suffering from HIV infection. In this study we assessed fungicidal activity of the ceragenins CSA-13, CSA-131 and CSA-192 against four fluconazole–resistant Candida strains. We found that ceragenins activity against planktonic Candida cells was higher than activity of human LL-37 peptide and synthetic cationic peptide omiganan. Compared to LL-37 peptide, ceragenins in the presence of DNase I demonstrated an increased ability to kill DNA-induced Candida biofilm. Microscopy studies show that treatment with LL-37 or ceragenins causes Candida cells to undergo extensive surface changes indicating surface membrane damage. This conclusion was substantiated by observation of rapid incorporation of FITC-labeled CSA-13, CSA-131 or LL-37 peptide into the more lipophilic environment of the Candida membrane. In addition to activity against Candida spp., ceragenins CSA-131 and CSA-192 display strong fungicidal activity against sixteen clinical isolates including Cryptococcus neoformans and Aspergillus fumigatus. These results indicate the potential of ceragenins for future development as new fungicidal agents. PMID:27315208

  3. A Tactile Recognition System Mimicking Human Mechanism for Recognizing Surface Roughness

    NASA Astrophysics Data System (ADS)

    Ohka, Masahiro; Kawamura, Takuya; Itahashi, Tastuya; Takayanagi, Jyun-Ichi; Miyaoka, Tetsu; Mitsuya, Yasunaga

    A mathematical model was formulated on the basis of results from psychophysical experiments in which human subjects discriminated fine steps on aluminum plates. The mathematical model emulated the real neuron discharge caused when a membrane potential exceeds a threshold. This membrane potential was determined by spatial and temporal summations of postsynaptic potential. To evaluate the mathematical model for surface texture recognition by robots, we performed a series of surface-detection experiments using a robotic manipulator equipped with an optical three-axis tactile sensor. The single sensor cell of this sensor consisted of a columnar feeler and a 2-by-2 array of conical feelers. The three-axis force was calculated from the area-sum and area-difference of the conical feelers’ contact areas. The robotic manipulator rubbed the tactile sensor on four brass plates with step heights of 0, 0.05, 0.1 and 0.2mm. Results showed that the mathematical model could distinguish these step heights in real time.

  4. A lettuce (Lactuca sativa) homolog of human Nogo-B receptor interacts with cis-prenyltransferase and is necessary for natural rubber biosynthesis.

    PubMed

    Qu, Yang; Chakrabarty, Romit; Tran, Hue T; Kwon, Eun-Joo G; Kwon, Moonhyuk; Nguyen, Trinh-Don; Ro, Dae-Kyun

    2015-01-23

    Natural rubber (cis-1,4-polyisoprene) is an indispensable biopolymer used to manufacture diverse consumer products. Although a major source of natural rubber is the rubber tree (Hevea brasiliensis), lettuce (Lactuca sativa) is also known to synthesize natural rubber. Here, we report that an unusual cis-prenyltransferase-like 2 (CPTL2) that lacks the conserved motifs of conventional cis-prenyltransferase is required for natural rubber biosynthesis in lettuce. CPTL2, identified from the lettuce rubber particle proteome, displays homology to a human NogoB receptor and is predominantly expressed in latex. Multiple transgenic lettuces expressing CPTL2-RNAi constructs showed that a decrease of CPTL2 transcripts (3-15% CPTL2 expression relative to controls) coincided with the reduction of natural rubber as low as 5%. We also identified a conventional cis-prenyltransferase 3 (CPT3), exclusively expressed in latex. In subcellular localization studies using fluorescent proteins, cytosolic CPT3 was relocalized to endoplasmic reticulum by co-occurrence of CPTL2 in tobacco and yeast at the log phase. Furthermore, yeast two-hybrid data showed that CPTL2 and CPT3 interact. Yeast microsomes containing CPTL2/CPT3 showed enhanced synthesis of short cis-polyisoprenes, but natural rubber could not be synthesized in vitro. Intriguingly, a homologous pair CPTL1/CPT1, which displays ubiquitous expressions in lettuce, showed a potent dolichol biosynthetic activity in vitro. Taken together, our data suggest that CPTL2 is a scaffolding protein that tethers CPT3 on endoplasmic reticulum and is necessary for natural rubber biosynthesis in planta, but yeast-expressed CPTL2 and CPT3 alone could not synthesize high molecular weight natural rubber in vitro.

  5. A Lettuce (Lactuca sativa) Homolog of Human Nogo-B Receptor Interacts with cis-Prenyltransferase and Is Necessary for Natural Rubber Biosynthesis*

    PubMed Central

    Qu, Yang; Chakrabarty, Romit; Tran, Hue T.; Kwon, Eun-Joo G.; Kwon, Moonhyuk; Nguyen, Trinh-Don; Ro, Dae-Kyun

    2015-01-01

    Natural rubber (cis-1,4-polyisoprene) is an indispensable biopolymer used to manufacture diverse consumer products. Although a major source of natural rubber is the rubber tree (Hevea brasiliensis), lettuce (Lactuca sativa) is also known to synthesize natural rubber. Here, we report that an unusual cis-prenyltransferase-like 2 (CPTL2) that lacks the conserved motifs of conventional cis-prenyltransferase is required for natural rubber biosynthesis in lettuce. CPTL2, identified from the lettuce rubber particle proteome, displays homology to a human NogoB receptor and is predominantly expressed in latex. Multiple transgenic lettuces expressing CPTL2-RNAi constructs showed that a decrease of CPTL2 transcripts (3–15% CPTL2 expression relative to controls) coincided with the reduction of natural rubber as low as 5%. We also identified a conventional cis-prenyltransferase 3 (CPT3), exclusively expressed in latex. In subcellular localization studies using fluorescent proteins, cytosolic CPT3 was relocalized to endoplasmic reticulum by co-occurrence of CPTL2 in tobacco and yeast at the log phase. Furthermore, yeast two-hybrid data showed that CPTL2 and CPT3 interact. Yeast microsomes containing CPTL2/CPT3 showed enhanced synthesis of short cis-polyisoprenes, but natural rubber could not be synthesized in vitro. Intriguingly, a homologous pair CPTL1/CPT1, which displays ubiquitous expressions in lettuce, showed a potent dolichol biosynthetic activity in vitro. Taken together, our data suggest that CPTL2 is a scaffolding protein that tethers CPT3 on endoplasmic reticulum and is necessary for natural rubber biosynthesis in planta, but yeast-expressed CPTL2 and CPT3 alone could not synthesize high molecular weight natural rubber in vitro. PMID:25477521

  6. Dirofilariasis Mimicking an Acute Scrotum.

    PubMed

    Bertozzi, Mirko; Rinaldi, Victoria Elisa; Prestipino, Marco; Giovenali, Paolo; Appignani, Antonino

    2015-10-01

    Human infections caused by Dirofilaria repens have been reported in many areas of the world. We describe a case of a 3-year-old child with an intrascrotal mass caused by D repens mimicking an acute scrotum. This represents the first case of scrotal dirofilariasis described in pediatric age with such an unusual presentation.

  7. Increase in cis-dichlorodiammineplatinum (II) cytotoxicity upon reversible electropermeabilization of the plasma membrane in cultured human NHIK 3025 cells.

    PubMed

    Melvik, J E; Pettersen, E O; Gordon, P B; Seglen, P O

    1986-12-01

    A series of brief electrical high-voltage discharges were given to cultured NHIK 3025 cells to render the plasma membrane transiently permeable to drugs. Using [14C]sucrose as an inert marker which normally does not cross plasma membranes, increased permeability could be demonstrated for no longer than 10 min following electrical treatment, indicating that the permeabilization was entirely reversible. The reversibility of the treatment was further demonstrated by a lack of effect on cell growth and colony-forming ability. When cells were given electrical discharges immediately before or during exposure to cis-dichlorodiammineplatinum(II)(cis-DDP) the cytotoxic drug effect increased. By using electrical discharges during a 2 hr drug treatment period the cytotoxicity was enhanced to an extent corresponding to at least a 3-fold increase in drug uptake relative to unpermeabilized cells. This increase in drug uptake was confirmed by direct measurements of the amount of cell-associated Pt by atomic absorbtion spectroscopy. The results suggest that uptake across the plasma membrane may be the rate-limiting factor in the cytotoxic effect of cis-DDP. Furthermore, the methodology applied in the present study may prove useful in assessing the influence of membrane permeability on the effect of other cytotoxic drugs.

  8. A pacemaker powered by an implantable biofuel cell operating under conditions mimicking the human blood circulatory system--battery not included.

    PubMed

    Southcott, Mark; MacVittie, Kevin; Halámek, Jan; Halámková, Lenka; Jemison, William D; Lobel, Robert; Katz, Evgeny

    2013-05-07

    Biocatalytic electrodes made of buckypaper were modified with PQQ-dependent glucose dehydrogenase on the anode and with laccase on the cathode and were assembled in a flow biofuel cell filled with serum solution mimicking the human blood circulatory system. The biofuel cell generated an open circuitry voltage, Voc, of ca. 470 mV and a short circuitry current, Isc, of ca. 5 mA (a current density of 0.83 mA cm(-2)). The power generated by the implantable biofuel cell was used to activate a pacemaker connected to the cell via a charge pump and a DC-DC converter interface circuit to adjust the voltage produced by the biofuel cell to the value required by the pacemaker. The voltage-current dependencies were analyzed for the biofuel cell connected to an Ohmic load and to the electronic loads composed of the interface circuit, or the power converter, and the pacemaker to study their operation. The correct pacemaker operation was confirmed using a medical device - an implantable loop recorder. Sustainable operation of the pacemaker was achieved with the system closely mimicking human physiological conditions using a single biofuel cell. This first demonstration of the pacemaker activated by the physiologically produced electrical energy shows promise for future electronic implantable medical devices powered by electricity harvested from the human body.

  9. A method for automatic fall detection of elderly people using floor vibrations and sound--proof of concept on human mimicking doll falls.

    PubMed

    Zigel, Yaniv; Litvak, Dima; Gannot, Israel

    2009-12-01

    Falls are a major risk for the elderly people living independently. Rapid detection of fall events can reduce the rate of mortality and raise the chances to survive the event and return to independent living. In the last two decades, several technological solutions for detection of falls were published, but most of them suffer from critical limitations. In this paper, we present a proof of concept to an automatic fall detection system for elderly people. The system is based on floor vibration and sound sensing, and uses signal processing and pattern recognition algorithm to discriminate between fall events and other events. The classification is based on special features like shock response spectrum and mel frequency ceptral coefficients. For the simulation of human falls, we have used a human mimicking doll: "Rescue Randy." The proposed solution is unique, reliable, and does not require the person to wear anything. It is designed to detect fall events in critical cases in which the person is unconscious or in a stress condition. From the preliminary research, the proposed system can detect human mimicking dolls falls with a sensitivity of 97.5% and specificity of 98.6%.

  10. Modification of the effect of tamoxifen, cis-platin, DTIC, and interferon-alpha 2b on human melanoma cells in culture by a mixture of vitamins.

    PubMed

    Prasad, K N; Hernandez, C; Edwards-Prasad, J; Nelson, J; Borus, T; Robinson, W A

    1994-01-01

    The effect of a mixture of vitamins in modifying the efficacy of commonly used drugs in the treatment of human melanoma has not been studied. Vitamin C and d-alpha-tocopheryl succinate (alpha-TS) alone reduced the growth of human melanoma (SK-30) cells in culture, whereas beta-carotene (BC), 13-cis-retinoic acid (RA), or sodium selenite alone was ineffective. RA caused morphological changes, as evidenced by flattening of cells and formation of short cytoplasmic processes. A mixture of four vitamins (vitamin C, BC, alpha-TS, and RA) was more effective in reducing growth of human melanoma cells than a mixture of three vitamins. The growth-inhibitory effect of cis-platin, decarbazine, tamoxifen, and recombinant interferon-alpha 2b was enhanced by vitamin C alone, a mixture of three vitamins (BC, alpha-TS, and RA), and a mixture of four vitamins (vitamin C, BC, alpha-TS, and RA) that contained 50 micrograms/ml of vitamin C. These data show that a mixture of three or four vitamins can enhance the growth-inhibitory effect of currently used chemotherapeutic agents on human melanoma cells.

  11. Folding of barstar C40A/C82A/P27A and catalysis of the peptidyl-prolyl cis/trans isomerization by human cytosolic cyclophilin (Cyp18).

    PubMed Central

    Golbik, R.; Fischer, G.; Fersht, A. R.

    1999-01-01

    Refolding of b*C40A/C82A/P27A is comprised of several kinetically detectable folding phases. The slowest phase in refolding originates from trans-->cis isomerization of the Tyr47-Pro48 peptide bond being in cis conformation in the native state. This refolding phase can be accelerated by the peptidyl-prolyl cis/trans isomerase human cytosolic cyclophilin (Cyp18) with a kcat/K(M) of 254,000 M(-1) s(-1). The fast refolding phase is not influenced by the enzyme. PMID:10422840

  12. Replication of chromosomal and episomal DNA in X-ray-damaged human cells: A cis- or trans-acting mechanism

    SciTech Connect

    Cleaver, J.E.; Rose, R.; Mitchell, D.L. )

    1990-12-01

    Episomal plasmids and viruses in mammalian cells present small targets for X-ray-induced DNA damage. At doses up to 100 Gy, DNA strand breaks or endonuclease III-sensitive sites were not discernible in 10.3-kb Epstein-Barr virus-based plasmid DNA or in 4.9-kb defective simian virus 40 DNA. DNA replication in these small molecules, however, was inhibited strongly by X-ray doses of greater than or equal to 20 Gy, decreasing to only 20 to 40% of control values. Inhibition was relieved slightly by growth in caffeine but was increased by growth in 3-aminobenzamide. Inhibition of DNA replication in episomal DNA molecules that are too small to sustain significant damage directly to their DNA may be due to either (a) a trans-acting diffusible factor that transfers the consequences of DNA breakage to episomes and to other replicating molecules, (b) a cis-acting mechanism in which episomes are structurally linked to genomic chromatin, and replication of both episomal and chromosomal replicons is under common control, or (c) radiation damage on other cellular structures unrelated to DNA. The resolution of these cellular mechanisms may shed light on the X-ray-resistant replication in ataxia-telangiectasia and may suggest strategies for molecular characterization of potential trans- or cis-acting factors.

  13. Distinct regulation of stearoyl-CoA desaturase 1 gene expression by cis and trans C18:1 fatty acids in human aortic smooth muscle cells.

    PubMed

    Minville-Walz, M; Gresti, J; Pichon, L; Bellenger, S; Bellenger, J; Narce, M; Rialland, M

    2012-04-01

    Consumption of trans fatty acids is positively correlated with cardiovascular diseases and with atherogenic risk factors. Trans fatty acids might play their atherogenic effects through lipid metabolism alteration of vascular cells. Accumulation of lipids in vascular smooth muscle cells is a feature of atherosclerosis and a consequence of lipid metabolism alteration. Stearoyl-CoA desaturase 1 (scd1) catalyses the production of monounsaturated fatty acids (e.g. oleic acid) and its expression is associated with lipogenesis induction and with atherosclerosis development. We were interested in analysing the regulation of delta-9 desaturation rate and scd1 expression in human aortic smooth muscle cells (HASMC) exposed to cis and trans C18:1 fatty acid isomers (cis-9 oleic acid, trans-11 vaccenic acid or trans-9 elaidic acid) for 48 h at 100 μM. Treatment of HASMC with these C18:1 fatty acid isomers led to differential effects on delta-9 desaturation; oleic acid repressed the desaturation rate more potently than trans-11 vaccenic acid, whereas trans-9 elaidic acid increased the delta-9 desaturation rate. We then correlated the delta-9 desaturation rate with the expression of scd1 protein and mRNA. We showed that C18:1 fatty acids controlled the expression of scd1 at the transcriptional level in HASMC, leading to an increase in scd1 mRNA content by trans-9 elaidic acid treatment, whereas a decrease in scd1 mRNA content was observed with cis-9 oleic acid and trans-11 vaccenic acid treatments. Altogether, this work highlights a differential capability of C18:1 fatty acid isomers to control scd1 gene expression, which presumes of different consequent effects on cell functions.

  14. Structural Insights into Substrate Binding by PvFKBP35, a Peptidylprolyl cis-trans Isomerase from the Human Malarial Parasite Plasmodium vivax

    PubMed Central

    Alag, Reema; Balakrishna, Asha Manikkoth; Rajan, Sreekanth; Qureshi, Insaf A.; Shin, Joon; Lescar, Julien; Grüber, Gerhard

    2013-01-01

    The immunosuppressive drug FK506 binding proteins (FKBPs), an immunophilin family with the immunosuppressive drug FK506 binding property, exhibit peptidylprolyl cis-trans isomerase (PPIase) activity. While the cyclophilin-catalyzed peptidylprolyl isomerization of X-Pro peptide bonds has been extensively studied, the mechanism of the FKBP-mediated peptidylprolyl isomerization remains uncharacterized. Thus, to investigate the binding of FKBP with its substrate and the underlying catalytic mechanism of the FKBP-mediated proline isomerization, here we employed the FK506 binding domain (FKBD) of the human malarial parasite Plasmodium vivax FK506 binding protein 35 (PvFKBP35) and examined the details of the molecular interaction between the isomerase and a peptide substrate. The crystallographic structures of apo PvFKBD35 and its complex with the tetrapeptide substrate succinyl-Ala-Leu-Pro-Phe-p-nitroanilide (sALPFp) determined at 1.4 Å and 1.65 Å resolutions, respectively, showed that the substrate binds to PvFKBD35 in a cis conformation. Nuclear magnetic resonance (NMR) studies demonstrated the chemical shift perturbations of D55, H67, V73, and I74 residues upon the substrate binding. In addition, the X-ray crystal structure, along with the mutational studies, shows that Y100 is a key residue for the catalytic activity. Taken together, our results provide insights into the catalytic mechanism of PvFKBP35-mediated cis-trans isomerization of substrate and ultimately might aid designing substrate mimetic inhibitors targeting the malarial parasite FKBPs. PMID:23435727

  15. Two cis-acting signals control ribosomal frameshift between human T-cell leukemia virus type II gag and pro genes.

    PubMed Central

    Falk, H; Mador, N; Udi, R; Panet, A; Honigman, A

    1993-01-01

    The open reading frame of the human T-cell leukemia virus type II pro gene is arranged at a -1 position relative to the gag gene. Synthesis of the Gag-Pro fusion polyprotein is facilitated by ribosomal frameshift into the reading frame of the pro gene. Cloning of a synthetic 41-bp oligonucleotide corresponding to the gag-pro junction within a heterologous gene (nef of human immunodeficiency virus type I) and mutation analysis revealed that two cis-acting signals, an adenosine residue stretch and a dyad symmetry sequence, flanking the UAA termination codon, are required for efficient ribosomal frameshifting between gag and pro. The stability of the stem-loop structure is crucial for frameshifting. Images PMID:8371359

  16. Transcriptional induction of the human prolactin gene by cAMP requires two cis-acting elements and at least the pituitary-specific factor Pit-1.

    PubMed

    Peers, B; Monget, P; Nalda, M A; Voz, M L; Berwaer, M; Belayew, A; Martial, J A

    1991-09-25

    To identify the cis-acting elements responsible for cAMP stimulation of human prolactin (hPRL) promoter activity, pituitary GC cells were transfected with 5'-deleted hPRL promoters fused to the chloramphenicol acetyltransferase reporter gene. The proximal regulatory region (coordinates -250 to -42) was sufficient to confer strong cAMP stimulation (+/- 25 fold). Further 5' and 3' deletions performed within this proximal region demonstrated that two types of cis-acting elements are involved in the cAMP regulation: (i) the binding sites of the pituitary-specific factor Pit-1, and (ii) the sequence between coordinates -115 and -85 (named fragment A), which contains a TGACG motif. We show by gel-shift and Southwestern experiments that fragment A binds Pit-1 monomer and also a ubiquitous factor that is neither cAMP-responsive element-binding protein nor activator protein-1. Strong cAMP induction was observed when fragment A was juxtaposed to a Pit-1 binding site. That Pit-1 plays an important role was supported further by the finding that the hPRL proximal region conferred cAMP regulation when linked to the herpes simplex virus thymidine kinase promoter only in pituitary GC cells and not in other heterologous cells, which do not express Pit-1. Furthermore, we observed that concatenated Pit-1 binding sites were able to confer cAMP responsiveness to the thymidine kinase promoter in GC cells.

  17. Tale of two isomers: complexities of human odor perception for cis- and trans-4-methylcyclohexane methanol from the chemical spill in West Virginia.

    PubMed

    Gallagher, Daniel L; Phetxumphou, Katherine; Smiley, Elizabeth; Dietrich, Andrea M

    2015-02-03

    Application of gas chromatography with mass spectrometric and human olfactory "sniffer" detectors reveals the nature of odorous chemicals from an industrial chemical spill. Crude 4-methylcyclohexane methanol (4-MCHM) spilled in a river and then contaminated drinking water and air for over 300000 consumers living in West Virginia. Olfactory gas chromatography allows investigators to independently measure the odor of chemical components in a mixture. Crude 4-MCHM is comprised of several major cyclohexane components, four of which have distinct isomer pairs. The cis- and trans-4-MCHM isomers are the only components to have distinct odors at the concentrations used in this study. The trans-4-MCHM is the dominant odorant with descriptors of "licorice" and "sweet". Trans-4-MCHM has an air odor threshold concentration of 0.060 ppb-v (95% CI: 0.040-0.091). The odor threshold concentrations are not influenced by gender or age but are lower by a factor of 5 for individuals with prior exposure compared to naïve subjects. Individual trans-4-MCHM odor threshold concentrations vary by more than a factor of 100. The cis-4-MCHM isomer has approximately a 2000-fold higher odor threshold concentration, different descriptors, and an even wider individual response range.

  18. The cis-acting elements involved in endonucleolytic cleavage of the 3' UTR of human IGF-II mRNAs bind a 50 kDa protein.

    PubMed Central

    Scheper, W; Holthuizen, P E; Sussenbach, J S

    1996-01-01

    Site-specific cleavage of human insulin-like growth factor II mRNAs requires two cis-acting elements, I and II, that are both located in the 3' untranslated region and separated by almost 2 kb. These elements can interact and form a stable RNA-RNA stem structure. In this study we have initiated the investigation of transacting factors involved in the cleavage of IGF-II mRNAs. The products of the cleavage reaction accumulate in the cytoplasm, suggesting that cleavage occurs in this cellular compartment. By electrophoretic mobility shift assays, we have identified a cytoplasmic protein with an apparent molecular weight of 48-50 kDa, IGF-II cleavage unit binding protein (ICU-BP), that binds to the stem structure formed by interaction of parts of the cis-acting elements I and II. The binding is resistant to high K+ concentrations and is dependent on Mg2+. In addition, ICU-BP binding is dependent on the cell density and correlates inversely with the IGM-II mRNA levels. In vivo cross-linking data show that this protein is associated with IGF-II mRNAs in vivo. PMID:8604329

  19. Glucocorticoid regulation of mouse and human dual specificity phosphatase 1 (DUSP1) genes: unusual cis-acting elements and unexpected evolutionary divergence.

    PubMed

    Tchen, Carmen R; Martins, Joana R S; Paktiawal, Nasren; Perelli, Roberta; Saklatvala, Jeremy; Clark, Andrew R

    2010-01-22

    Anti-inflammatory effects of glucocorticoids (GCs) are partly mediated by up-regulation of DUSP1 (dual specificity phosphatase 1), which dephosphorylates and inactivates mitogen-activated protein kinases. We identified putative GC-responsive regions containing GC receptor (GR) binding site consensus sequences that are well conserved between human and mouse DUSP1 loci in position, orientation, and sequence (at least 11 of 15 positions identical) and lie within regions of extended sequence conservation (minimum 65% identity over at least 100 bp). These were located approximately 29, 28, 24, 4.6, and 1.3 kb upstream of the DUSP1 transcription start site. The homology-based approach successfully identified four cis-acting regions that mediated transcriptional responses to dexamethasone. However, there was surprising interspecies divergence in site usage. This could not be explained by variations of the GR binding sites themselves. Instead, variations in flanking sequences appear to have driven the evolutionary divergence in mechanisms of regulation of mouse and human DUSP1 genes. There was a good correlation between the ability of cis-acting elements to respond to GC in transiently transfected reporter constructs and their ability to recruit GR in the context of intact chromatin. We propose that divergence of gene regulation has involved the loss or gain of binding sites for accessory transcription factors that assist in GR recruitment. Finally, a novel GC-responsive region of the human DUSP1 gene contains a highly unusual element, in which three closely spaced GR half-sites are required for potent transcriptional activation by GC.

  20. Cis-Lunar Base Camp

    NASA Technical Reports Server (NTRS)

    Merrill, Raymond G.; Goodliff, Kandyce E.; Mazanek, Daniel D.; Reeves, John D., Jr.

    2012-01-01

    Historically, when mounting expeditions into uncharted territories, explorers have established strategically positioned base camps to pre-position required equipment and consumables. These base camps are secure, safe positions from which expeditions can depart when conditions are favorable, at which technology and operations can be tested and validated, and facilitate timely access to more robust facilities in the event of an emergency. For human exploration missions into deep space, cis-lunar space is well suited to serve as such a base camp. The outer regions of cis-lunar space, such as the Earth-Moon Lagrange points, lie near the edge of Earth s gravity well, allowing equipment and consumables to be aggregated with easy access to deep space and to the lunar surface, as well as more distant destinations, such as near-Earth Asteroids (NEAs) and Mars and its moons. Several approaches to utilizing a cis-lunar base camp for sustainable human exploration, as well as some possible future applications are identified. The primary objective of the analysis presented in this paper is to identify options, show the macro trends, and provide information that can be used as a basis for more detailed mission development. Compared within are the high-level performance and cost of 15 preliminary cis-lunar exploration campaigns that establish the capability to conduct crewed missions of up to one year in duration, and then aggregate mass in cis-lunar space to facilitate an expedition from Cis-Lunar Base Camp. Launch vehicles, chemical propulsion stages, and electric propulsion stages are discussed and parametric sizing values are used to create architectures of in-space transportation elements that extend the existing in-space supply chain to cis-lunar space. The transportation options to cis-lunar space assessed vary in efficiency by almost 50%; from 0.16 to 0.68 kg of cargo in cis-lunar space for every kilogram of mass in Low Earth Orbit (LEO). For the 15 cases, 5-year campaign

  1. Generation and Characterization of a Human/Mouse Chimeric GD2-Mimicking Anti-Idiotype Antibody Ganglidiximab for Active Immunotherapy against Neuroblastoma

    PubMed Central

    Eger, Christin; Siebert, Nikolai; Seidel, Diana; Zumpe, Maxi; Jüttner, Madlen; Brandt, Sven; Müller, Hans-Peter; Lode, Holger N.

    2016-01-01

    Vaccination with proteins mimicking GD2 that is highly expressed on neuroblastoma (NB) cells is a promising strategy in treatment of NB, a pediatric malignancy with poor prognosis. We previously showed efficacy of ganglidiomab in vivo, a murine anti-idiotype (anti-Id) IgG1. In order to tailor immune responses to variable regions, we generated a new human/mouse chimeric anti-Id antibody (Ab) ganglidiximab by replacing murine constant fragments with corresponding human IgG1 regions. DNA sequences encoding for variable regions of heavy (VH) and light chains (VL) were synthesized by RT-PCR from total RNA of ganglidiomab-producing hybridoma cells and further ligated into mammalian expression plasmids with coding sequences for constant regions of human IgG1 heavy and light chains, respectively. We established a stable production cell line using Chinese hamster ovarian (CHO) cells co-transfected with two expression plasmids driving the expression of either ganglidiximab heavy or light chain. After purification from supernatants, anti-idiotypic characteristics of ganglidiximab were demonstrated. Binding of ganglidiximab to anti-GD2 Abs of the 14.18 family as well as to NK-92tr cells expressing a GD2-specific chimeric antigen receptor (scFv(ch14.18)-zeta) was shown using standard ELISA and flow cytometry analysis, respectively. Ganglidiximab binding affinities to anti-GD2 Abs were further determined by surface plasmon resonance technique. Moreover, binding of anti-GD2 Abs to the nominal antigen GD2 as well as GD2-specific Ab-mediated cytotoxicity (ADCC, CDC) was competitively inhibited by ganglidiximab. Finally, ganglidiximab was successfully used as a protein vaccine in vivo to induce a GD2-specific humoral immune response. In summary, we report generation and characterization of a new human/mouse chimeric anti-Id Ab ganglidiximab for active immunotherapy against NB. This Ab may be useful to tailor immune responses to the paratope regions mimicking GD2 overexpressed in NB

  2. Survival, growth and toxicity of Microcystis aeruginosa PCC 7806 in experimental conditions mimicking some features of the human gastro-intestinal environment.

    PubMed

    Stefanelli, Mara; Vichi, Susanna; Stipa, Giuseppe; Funari, Enzo; Testai, Emanuela; Scardala, Simona; Manganelli, Maura

    2014-05-25

    Cyanotoxins (CTX) are widely produced by several cyanobacteria (CB), increasingly spreading in most water bodies and terrestrial habitats, and represent a risk for human health. CB are prokaryotes, and although mostly autotrophic, several examples of heterotrophy in symbiotic relationship with different organisms have been described. In addition to the known routes of exposure, it has been hypothesized that CB might 'colonize' human intestine with relevant implications for human health. Colonization is a complex process and requires specific features of the possible invaders. Still, a short-term persistence as living and toxin-producing organisms within the intestinal lumen of the host could represent an 'internal' source of exposure to CTX. In this work we ran microcosm experiments (4-18days), looking at Microcystis aeruginosa PCC7806 resistance and cyanotoxin-producing capabilities in darkness, 37°C, pH 2, and subsequent recovery in a rich medium, in darkness, 37°C, in the presence of enteric bacteria, mimicking few important features of the gastrointestinal environment. We measured cyanobacterial populations and growth, microcystin (MC) production and the presence of mcyB gene. M. aeruginosa could grow in the dark at 37°C up to 17days, and survive at pH 2 at a rate between 30% and 70%, depending on the age and toxicity of the starting culture. Cell lysis resulted in a substantial amounts of MC released, not degraded at gastric pH. Following the acidic passage, still in the dark at 37°C, M. aeruginosa restarted to grow within 24h for the next 3-4days, independently on the presence of intestinal bacteria, maintaining the MC cell quota and mcyB gene. Our results show new features of CB: a significant resistance of M. aeruginosa in conditions far from its optimal one, that is an environment mimicking some of the important characteristics of human gastrointestinal tract, suggesting the possibility of an internal source of exposure to CTX, with implications for

  3. NCYM, a Cis-Antisense Gene of MYCN, Encodes a De Novo Evolved Protein That Inhibits GSK3β Resulting in the Stabilization of MYCN in Human Neuroblastomas

    PubMed Central

    Suenaga, Yusuke; Islam, S. M. Rafiqul; Alagu, Jennifer; Kaneko, Yoshiki; Kato, Mamoru; Tanaka, Yukichi; Kawana, Hidetada; Hossain, Shamim; Matsumoto, Daisuke; Yamamoto, Mami; Shoji, Wataru; Itami, Makiko; Shibata, Tatsuhiro; Nakamura, Yohko; Ohira, Miki; Haraguchi, Seiki; Takatori, Atsushi; Nakagawara, Akira

    2014-01-01

    The rearrangement of pre-existing genes has long been thought of as the major mode of new gene generation. Recently, de novo gene birth from non-genic DNA was found to be an alternative mechanism to generate novel protein-coding genes. However, its functional role in human disease remains largely unknown. Here we show that NCYM, a cis-antisense gene of the MYCN oncogene, initially thought to be a large non-coding RNA, encodes a de novo evolved protein regulating the pathogenesis of human cancers, particularly neuroblastoma. The NCYM gene is evolutionally conserved only in the taxonomic group containing humans and chimpanzees. In primary human neuroblastomas, NCYM is 100% co-amplified and co-expressed with MYCN, and NCYM mRNA expression is associated with poor clinical outcome. MYCN directly transactivates both NCYM and MYCN mRNA, whereas NCYM stabilizes MYCN protein by inhibiting the activity of GSK3β, a kinase that promotes MYCN degradation. In contrast to MYCN transgenic mice, neuroblastomas in MYCN/NCYM double transgenic mice were frequently accompanied by distant metastases, behavior reminiscent of human neuroblastomas with MYCN amplification. The NCYM protein also interacts with GSK3β, thereby stabilizing the MYCN protein in the tumors of the MYCN/NCYM double transgenic mice. Thus, these results suggest that GSK3β inhibition by NCYM stabilizes the MYCN protein both in vitro and in vivo. Furthermore, the survival of MYCN transgenic mice bearing neuroblastoma was improved by treatment with NVP-BEZ235, a dual PI3K/mTOR inhibitor shown to destabilize MYCN via GSK3β activation. In contrast, tumors caused in MYCN/NCYM double transgenic mice showed chemo-resistance to the drug. Collectively, our results show that NCYM is the first de novo evolved protein known to act as an oncopromoting factor in human cancer, and suggest that de novo evolved proteins may functionally characterize human disease. PMID:24391509

  4. cis-Regulatory changes in Kit ligand expression and parallel evolution of pigmentation in sticklebacks and humans.

    PubMed

    Miller, Craig T; Beleza, Sandra; Pollen, Alex A; Schluter, Dolph; Kittles, Rick A; Shriver, Mark D; Kingsley, David M

    2007-12-14

    Dramatic pigmentation changes have evolved within most vertebrate groups, including fish and humans. Here we use genetic crosses in sticklebacks to investigate the parallel origin of pigmentation changes in natural populations. High-resolution mapping and expression experiments show that light gills and light ventrums map to a divergent regulatory allele of the Kit ligand (Kitlg) gene. The divergent allele reduces expression in gill and skin tissue and is shared by multiple derived freshwater populations with reduced pigmentation. In humans, Europeans and East Asians also share derived alleles at the KITLG locus. Strong signatures of selection map to regulatory regions surrounding the gene, and admixture mapping shows that the KITLG genomic region has a significant effect on human skin color. These experiments suggest that regulatory changes in Kitlg contribute to natural variation in vertebrate pigmentation, and that similar genetic mechanisms may underlie rapid evolutionary change in fish and humans.

  5. Burying Dogs in Ancient Cis-Baikal, Siberia: Temporal Trends and Relationships with Human Diet and Subsistence Practices

    PubMed Central

    Losey, Robert J.; Garvie-Lok, Sandra; Leonard, Jennifer A.; Katzenberg, M. Anne; Germonpré, Mietje; Nomokonova, Tatiana; Sablin, Mikhail V.; Goriunova, Olga I.; Berdnikova, Natalia E.; Savel’ev, Nikolai A.

    2013-01-01

    The first objective of this study is to examine temporal patterns in ancient dog burials in the Lake Baikal region of Eastern Siberia. The second objective is to determine if the practice of dog burial here can be correlated with patterns in human subsistence practices, in particular a reliance on terrestrial mammals. Direct radiocarbon dating of a suite of the region’s dog remains indicates that these animals were given burial only during periods in which human burials were common. Dog burials of any kind were most common during the Early Neolithic (∼7–8000 B.P.), and rare during all other time periods. Further, only foraging groups seem to have buried canids in this region, as pastoralist habitation sites and cemeteries generally lack dog interments, with the exception of sacrificed animals. Stable carbon and nitrogen isotope data indicate that dogs were only buried where and when human diets were relatively rich in aquatic foods, which here most likely included river and lake fish and Baikal seal (Phoca sibirica). Generally, human and dog diets appear to have been similar across the study subregions, and this is important for interpreting their radiocarbon dates, and comparing them to those obtained on the region’s human remains, both of which likely carry a freshwater old carbon bias. Slight offsets were observed in the isotope values of dogs and humans in our samples, particularly where both have diets rich in aquatic fauna. This may result from dietary differences between people and their dogs, perhaps due to consuming fish of different sizes, or even different tissues from the same aquatic fauna. This paper also provides a first glimpse of the DNA of ancient canids in Northeast Asia. PMID:23696851

  6. Burying dogs in ancient Cis-Baikal, Siberia: temporal trends and relationships with human diet and subsistence practices.

    PubMed

    Losey, Robert J; Garvie-Lok, Sandra; Leonard, Jennifer A; Katzenberg, M Anne; Germonpré, Mietje; Nomokonova, Tatiana; Sablin, Mikhail V; Goriunova, Olga I; Berdnikova, Natalia E; Savel'ev, Nikolai A

    2013-01-01

    The first objective of this study is to examine temporal patterns in ancient dog burials in the Lake Baikal region of Eastern Siberia. The second objective is to determine if the practice of dog burial here can be correlated with patterns in human subsistence practices, in particular a reliance on terrestrial mammals. Direct radiocarbon dating of a suite of the region's dog remains indicates that these animals were given burial only during periods in which human burials were common. Dog burials of any kind were most common during the Early Neolithic (∼7-8000 B.P.), and rare during all other time periods. Further, only foraging groups seem to have buried canids in this region, as pastoralist habitation sites and cemeteries generally lack dog interments, with the exception of sacrificed animals. Stable carbon and nitrogen isotope data indicate that dogs were only buried where and when human diets were relatively rich in aquatic foods, which here most likely included river and lake fish and Baikal seal (Phoca sibirica). Generally, human and dog diets appear to have been similar across the study subregions, and this is important for interpreting their radiocarbon dates, and comparing them to those obtained on the region's human remains, both of which likely carry a freshwater old carbon bias. Slight offsets were observed in the isotope values of dogs and humans in our samples, particularly where both have diets rich in aquatic fauna. This may result from dietary differences between people and their dogs, perhaps due to consuming fish of different sizes, or even different tissues from the same aquatic fauna. This paper also provides a first glimpse of the DNA of ancient canids in Northeast Asia.

  7. Tissue mimicking materials for dental ultrasound

    PubMed Central

    Singh, Rahul S.; Culjat, Martin O.; Grundfest, Warren S.; Brown, Elliott R.; White, Shane N.

    2008-01-01

    While acoustic tissue mimicking materials have been explored for a variety of soft and hard biological tissues, no dental hard tissue mimicking materials have been characterized. Tooth phantoms are necessary to better understand acoustic phenomenology within the tooth environment and to accelerate the advancement of dental ultrasound imaging systems. In this study, soda lime glass and dental composite were explored as surrogates for human enamel and dentin, respectively, in terms of compressional velocity, attenuation, and acoustic impedance. The results suggest that a tooth phantom consisting of glass and composite can effectively mimic the acoustic behavior of a natural human tooth. PMID:18396919

  8. Tissue mimicking materials for dental ultrasound.

    PubMed

    Singh, Rahul S; Culjat, Martin O; Grundfest, Warren S; Brown, Elliott R; White, Shane N

    2008-04-01

    While acoustic tissue mimicking materials have been explored for a variety of soft and hard biological tissues, no dental hard tissue mimicking materials have been characterized. Tooth phantoms are necessary to better understand acoustic phenomenology within the tooth environment and to accelerate the advancement of dental ultrasound imaging systems. In this study, soda lime glass and dental composite were explored as surrogates for human enamel and dentin, respectively, in terms of compressional velocity, attenuation, and acoustic impedance. The results suggest that a tooth phantom consisting of glass and composite can effectively mimic the acoustic behavior of a natural human tooth.

  9. Cadherin 13: Human cis-Regulation and Selectively Altered Addiction Phenotypes and Cerebral Cortical Dopamine in Knockout Mice

    PubMed Central

    Drgonova, Jana; Walther, Donna; Hartstein, G Luke; Bukhari, Mohammad O; Baumann, Michael H; Katz, Jonathan; Hall, F Scott; Arnold, Elizabeth R; Flax, Shaun; Riley, Anthony; Rivero, Olga; Lesch, Klaus-Peter; Troncoso, Juan; Ranscht, Barbara; Uhl, George R

    2016-01-01

    The cadherin 13 (CDH13) gene encodes a cell adhesion molecule likely to influence development and connections of brain circuits that modulate addiction, locomotion and cognition, including those that involve midbrain dopamine neurons. Human CDH13 mRNA expression differs by more than 80% in postmortem cerebral cortical samples from individuals with different CDH13 genotypes, supporting examination of mice with altered CDH13 expression as models for common human variation at this locus. Constitutive CDH13 knockout mice display evidence for changed cocaine reward: shifted dose response relationship in tests of cocaine-conditioned place preference using doses that do not alter cocaine-conditioned taste aversion. Reduced adult CDH13 expression in conditional knockouts also alters cocaine reward in ways that correlate with individual differences in cortical CDH13 mRNA levels. In control and comparison behavioral assessments, knockout mice display modestly quicker acquisition of rotarod and water maze tasks, with a trend toward faster acquisition of 5-choice serial reaction time tasks that otherwise displayed no genotype-related differences. They display significant differences in locomotion in some settings, with larger effects in males. In assessments of brain changes that might contribute to these behavioral differences, there are selective alterations of dopamine levels, dopamine/metabolite ratios, dopaminergic fiber densities and mRNA encoding the activity dependent transcription factor npas4 in cerebral cortex of knockout mice. These novel data and previously reported human associations of CDH13 variants with addiction, individual differences in responses to stimulant administration and attention deficit hyperactivity disorder (ADHD) phenotypes suggest that levels of CDH13 expression, through mechanisms likely to include effects on mesocortical dopamine, influence stimulant reward and may contribute modestly to cognitive and locomotor phenotypes relevant to ADHD

  10. Wild-type Human γD-crystallin Promotes Aggregation of Its Oxidation-mimicking, Misfolding-prone W42Q Mutant*

    PubMed Central

    Serebryany, Eugene; King, Jonathan A.

    2015-01-01

    Non-native protein conformers generated by mutation or chemical damage template aggregation of wild-type, undamaged polypeptides in diseases ranging from amyotrophic lateral sclerosis to cancer. We tested for such interactions in the natively monomeric human eye lens protein γd-crystallin, whose aggregation leads to cataract disease. The oxidation-mimicking W42Q mutant of γd-crystallin formed non-native polymers starting from a native-like state under physiological conditions. Aggregation occurred in the temperature range 35–45 °C, in which the mutant protein began to lose the native conformation of its N-terminal domain. Surprisingly, wild-type γd-crystallin promoted W42Q polymerization in a catalytic manner, even at mutant concentrations too low for homogeneous nucleation to occur. The presence of wild-type protein also downshifted the temperature range of W42Q aggregation. W42Q aggregation required formation of a non-native intramolecular disulfide bond but not intermolecular cross-linking. Transient WT/W42Q binding may catalyze this oxidative misfolding event in the mutant. That a more stable variant in a mixture can specifically promote aggregation of a less stable one rationalizes how extensive aggregation of rare damaged polypeptides can occur during the course of aging. PMID:25787081

  11. Dynamic morphological changes in the skulls of mice mimicking human Apert syndrome resulting from gain-of-function mutation of FGFR2 (P253R).

    PubMed

    Du, Xiaolan; Weng, Tujun; Sun, Qidi; Su, Nan; Chen, Zhi; Qi, Huabing; Jin, Ming; Yin, Liangjun; He, Qifen; Chen, Lin

    2010-08-01

    Apert syndrome is caused mainly by gain-of-function mutations of fibroblast growth factor receptor 2. We have generated a mouse model (Fgfr2(+/P253R)) mimicking human Apert syndrome resulting from fibroblast growth factor receptor 2 Pro253Arg mutation using the knock-in approach. This mouse model in general has the characteristic skull morphology similar to that in humans with Apert syndrome. To characterize the detailed changes of form in the overall skull and its major anatomic structures, euclidean distance matrix analysis was used to quantitatively compare the form and growth difference between the skulls of mutants and their wild-type controls. There were substantial morphological differences between the skulls of mutants and their controls at 4 and 8 weeks of age (P < 0.01). The mutants showed shortened skull dimensions along the rostrocaudal axis, especially in their face. The width of the frontal bone and the distance between the two orbits were broadened mediolaterally. The neurocrania were significantly increased along the dorsoventral axis and slightly increased along the mediolateral axis, and also had anteriorly displayed opisthion along the rostrocaudal axis. Compared with wild-type, the mutant mandible had an anteriorly displaced coronoid process and mandibular condyle along the rostrocaudal axis. We further found that there was catch-up growth in the nasal bone, maxilla, zygomatic bone and some regions of the mandible of the mutant skulls during the 4-8-week interval. The above-mentioned findings further validate the Fgfr2(+/P253R) mouse strain as a good model for human Apert syndrome. The changes in form characterized in this study will help to elucidate the mechanisms through which the Pro253Arg mutation in fibroblast growth factor receptor 2 affects craniofacial development and causes Apert syndrome.

  12. The meta-epigenomic structure of purified human stem cell populations is defined at cis-regulatory sequences

    PubMed Central

    Zhao, Yong Mei; Golden, Aaron; Mar, Jessica C.; Einstein, Francine H.; Greally, John M.

    2014-01-01

    The mechanism and significance of epigenetic variability in the same cell type between healthy individuals are not clear. Here, we purify human CD34+ hematopoietic stem and progenitor cells (HSPCs) from different individuals and find that there is increased variability of DNA methylation at loci with properties of promoters and enhancers. The variability is especially enriched at candidate enhancers near genes transitioning between silent and expressed states, and encoding proteins with leukocyte differentiation properties. Our findings of increased variability at loci with intermediate DNA methylation values, at candidate “poised” enhancers, and at genes involved in HSPC lineage commitment suggest that CD34+ cell subtype heterogeneity between individuals is a major mechanism for the variability observed. Epigenomic studies performed on cell populations, even when purified, are testing collections of epigenomes, or meta-epigenomes. Our findings show that meta-epigenomic approaches to data analysis can provide insights into cell subpopulation structure. PMID:25327398

  13. Cis-acting sequences from a human surfactant protein gene confer pulmonary-specific gene expression in transgenic mice

    SciTech Connect

    Korfhagen, T.R.; Glasser, S.W.; Wert, S.E.; Bruno, M.D.; Daugherty, C.C.; McNeish, J.D.; Stock, J.L.; Potter, S.S.; Whitsett, J.A. )

    1990-08-01

    Pulmonary surfactant is produced in late gestation by developing type II epithelial cells lining the alveolar epithelium of the lung. Lack of surfactant at birth is associated with respiratory distress syndrome in premature infants. Surfactant protein C (SP-C) is a highly hydrophobic peptide isolated from pulmonary tissue that enhances the biophysical activity of surfactant phospholipids. Like surfactant phospholipid, SP-C is produced by epithelial cells in the distal respiratory epithelium, and its expression increases during the latter part of gestation. A chimeric gene containing 3.6 kilobases of the promoter and 5{prime}-flanking sequences of the human SP-C gene was used to express diphtheria toxin A. The SP-C-diphtheria toxin A fusion gene was injected into fertilized mouse eggs to produce transgenic mice. Affected mice developed respiratory failure in the immediate postnatal period. Morphologic analysis of lungs from affected pups showed variable but severe cellular injury confined to pulmonary tissues. Ultrastructural changes consistent with cell death and injury were prominent in the distal respiratory epithelium. Proximal components of the tracheobronchial tree were not severely affected. Transgenic animals were of normal size at birth, and structural abnormalities were not detected in nonpulmonary tissues. Lung-specific diphtheria toxin A expression controlled by the human SP-C gene injured type II epithelial cells and caused extensive necrosis of the distal respiratory epithelium. The absence of type I epithelial cells in the most severely affected transgenic animals supports the concept that developing type II cells serve as precursors to type I epithelial cells.

  14. Melorheostosis mimicking synovial osteochondromatosis.

    PubMed

    Wadhwa, Vibhor; Chhabra, Avneesh; Samet, Jonathan D

    2014-01-01

    Melorheostosis is an uncommon, sporadic, sclerosing bone lesion that may affect the adjacent soft tissues. It has been associated with many entities such as osteopoikilosis, soft tissue vascular malformations, bone and soft tissue tumors, nephrotic syndrome, segmental limb contractures, osteosarcoma, desmoid tumor, and mesenteric fibromatosis. Synovial osteochondromatosis is a benign neoplasia of the hyaline cartilage presenting as nodules in the subsynovial tissue of a joint or tendon sheath. The intra-articular extension of melorheostosis mimicking synovial osteochondromatosis has not been reported before. In this article, the authors describe an unusual case mimicking synovial chondromatosis arising as a result of melorheostosis and their characteristic imaging findings.

  15. The dominant Anopheles vectors of human malaria in the Americas: occurrence data, distribution maps and bionomic précis

    PubMed Central

    2010-01-01

    Background An increasing knowledge of the global risk of malaria shows that the nations of the Americas have the lowest levels of Plasmodium falciparum and P. vivax endemicity worldwide, sustained, in part, by substantive integrated vector control. To help maintain and better target these efforts, knowledge of the contemporary distribution of each of the dominant vector species (DVS) of human malaria is needed, alongside a comprehensive understanding of the ecology and behaviour of each species. Results A database of contemporary occurrence data for 41 of the DVS of human malaria was compiled from intensive searches of the formal and informal literature. The results for the nine DVS of the Americas are described in detail here. Nearly 6000 occurrence records were gathered from 25 countries in the region and were complemented by a synthesis of published expert opinion range maps, refined further by a technical advisory group of medical entomologists. A suite of environmental and climate variables of suspected relevance to anopheline ecology were also compiled from open access sources. These three sets of data were then combined to produce predictive species range maps using the Boosted Regression Tree method. The predicted geographic extent for each of the following species (or species complex*) are provided: Anopheles (Nyssorhynchus) albimanus Wiedemann, 1820, An. (Nys.) albitarsis*, An. (Nys.) aquasalis Curry, 1932, An. (Nys.) darlingi Root, 1926, An. (Anopheles) freeborni Aitken, 1939, An. (Nys.) marajoara Galvão & Damasceno, 1942, An. (Nys.) nuneztovari*, An. (Ano.) pseudopunctipennis* and An. (Ano.) quadrimaculatus Say, 1824. A bionomics review summarising ecology and behaviour relevant to the control of each of these species was also compiled. Conclusions The distribution maps and bionomics review should both be considered as a starting point in an ongoing process of (i) describing the distributions of these DVS (since the opportunistic sample of occurrence

  16. Analysis of cis and trans Requirements for DNA Replication at the Right-End Hairpin of the Human Bocavirus 1 Genome

    PubMed Central

    Shen, Weiran; Deng, Xuefeng; Zou, Wei; Engelhardt, John F.; Yan, Ziying

    2016-01-01

    with an HBoV1 capsid has been developed to efficiently deliver the cystic fibrosis transmembrane conductance regulator gene to human airway epithelia. Here, we identified both cis-acting elements and trans-acting proteins that are required for HBoV1 DNA replication at the right-end hairpin in HEK293 cells. We localized the minimal replication origin, which contains both NS1 nicking and binding sites, to a 46-nucleotide sequence in the right-end hairpin. The identification of these essential elements of HBoV1 DNA replication acting both in cis and in trans will provide guidance to develop antiviral strategies targeting viral DNA replication at the right-end hairpin and to design next-generation recombinant HBoV1 vectors, a promising tool for gene therapy of lung diseases. PMID:27334591

  17. Analysis of cis and trans Requirements for DNA Replication at the Right-End Hairpin of the Human Bocavirus 1 Genome.

    PubMed

    Shen, Weiran; Deng, Xuefeng; Zou, Wei; Engelhardt, John F; Yan, Ziying; Qiu, Jianming

    2016-09-01

    capsid has been developed to efficiently deliver the cystic fibrosis transmembrane conductance regulator gene to human airway epithelia. Here, we identified both cis-acting elements and trans-acting proteins that are required for HBoV1 DNA replication at the right-end hairpin in HEK293 cells. We localized the minimal replication origin, which contains both NS1 nicking and binding sites, to a 46-nucleotide sequence in the right-end hairpin. The identification of these essential elements of HBoV1 DNA replication acting both in cis and in trans will provide guidance to develop antiviral strategies targeting viral DNA replication at the right-end hairpin and to design next-generation recombinant HBoV1 vectors, a promising tool for gene therapy of lung diseases. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  18. Fine-scale chromatin interaction maps reveal the cis-regulatory landscape of human lincRNA genes

    PubMed Central

    Ma, Wenxiu; Ay, Ferhat; Lee, Choli; Gulsoy, Gunhan; Deng, Xinxian; Cook, Savannah; Hesson, Jennifer; Cavanaugh, Christopher; Ware, Carol B.; Krumm, Anton; Shendure, Jay; Blau, C. Anthony; Disteche, Christine M.; Noble, William S.; Duan, ZhiJun

    2014-01-01

    High-throughput methods based on chromosome conformation capture (3C) have greatly advanced our understanding of the three-dimensional (3D) organization of genomes but are limited in resolution by their reliance on restriction enzymes (REs). Here we describe a method called DNase Hi-C for comprehensively mapping global chromatin contacts that uses DNase I for chromatin fragmentation, leading to greatly improved efficiency and resolution compared to Hi-C. Coupling this method with DNA capture technology provides a high-throughput approach for targeted mapping of fine-scale chromatin architecture. We applied targeted DNase Hi-C to characterize the 3D organization of 998 lincRNA (long intergenic noncoding RNA) promoters in two human cell lines, thereby revealing that expression of lincRNAs is tightly controlled by complex mechanisms involving both super-enhancers and the polycomb repressive complex. Our results provide the first glimpse of a cell type-specific 3D organization of lincRNA genes. PMID:25437436

  19. Naturally occurring rhodopsin mutation in the dog causes retinal dysfunction and degeneration mimicking human dominant retinitis pigmentosa.

    PubMed

    Kijas, James W; Cideciyan, Artur V; Aleman, Tomas S; Pianta, Michael J; Pearce-Kelling, Susan E; Miller, Brian J; Jacobson, Samuel G; Aguirre, Gustavo D; Acland, Gregory M

    2002-04-30

    Rhodopsin is the G protein-coupled receptor that is activated by light and initiates the transduction cascade leading to night (rod) vision. Naturally occurring pathogenic rhodopsin (RHO) mutations have been previously identified only in humans and are a common cause of dominantly inherited blindness from retinal degeneration. We identified English Mastiff dogs with a naturally occurring dominant retinal degeneration and determined the cause to be a point mutation in the RHO gene (Thr4Arg). Dogs with this mutant allele manifest a retinal phenotype that closely mimics that in humans with RHO mutations. The phenotypic features shared by dog and man include a dramatically slowed time course of recovery of rod photoreceptor function after light exposure and a distinctive topographic pattern to the retinal degeneration. The canine disease offers opportunities to explore the basis of prolonged photoreceptor recovery after light in RHO mutations and determine whether there are links between the dysfunction and apoptotic retinal cell death. The RHO mutant dog also becomes the large animal needed for preclinical trials of therapies for a major subset of human retinopathies.

  20. The sensing of poorly deformable red blood cells by the human spleen can be mimicked in vitro

    PubMed Central

    Deplaine, Guillaume; Safeukui, Innocent; Jeddi, Fakhri; Lacoste, François; Brousse, Valentine; Perrot, Sylvie; Biligui, Sylvestre; Guillotte, Micheline; Guitton, Corinne; Dokmak, Safi; Aussilhou, Béatrice; Sauvanet, Alain; Cazals Hatem, Dominique; Paye, François; Thellier, Marc; Mazier, Dominique; Milon, Geneviève; Mohandas, Narla; Mercereau-Puijalon, Odile; David, Peter H.

    2011-01-01

    Retention of poorly deformable red blood cells (RBCs) by the human spleen has been recognized as a critical determinant of pathogenesis in hereditary spherocytosis, malaria, and other RBC disorders. Using an ex vivo perfusion system, we had previously shown that retention of Plasmodium falciparum–infected RBCs (Pf-RBCs) occur in the splenic red pulp, upstream from the sinus wall. To experimentally replicate the mechanical sensing of RBCs by the splenic microcirculation, we designed a sorting device where a mixture of 5- to 25-μm-diameter microbeads mimics the geometry of narrow and short interendothelial splenic slits. Heated RBCs, Pf-RBCs, and RBCs from patients with hereditary spherocytosis were retained in the microbead layer, without hemolysis. The retention rates of Pf-RBCs were similar in microbeads and in isolated perfused human spleens. These in vitro results directly confirm the importance of the mechanical sensing of RBCs by the human spleen. In addition, rigid and deformable RBC subpopulations could be separated and characterized at the molecular level, and the device was used to deplete a stored RBC population from its subpopulation of rigid RBCs. This experimental approach may contribute to a better understanding of the role of the spleen in the pathogenesis of inherited and acquired RBC disorders. PMID:21163923

  1. Naturally occurring rhodopsin mutation in the dog causes retinal dysfunction and degeneration mimicking human dominant retinitis pigmentosa

    PubMed Central

    Kijas, James W.; Cideciyan, Artur V.; Aleman, Tomas S.; Pianta, Michael J.; Pearce-Kelling, Susan E.; Miller, Brian J.; Jacobson, Samuel G.; Aguirre, Gustavo D.; Acland, Gregory M.

    2002-01-01

    Rhodopsin is the G protein-coupled receptor that is activated by light and initiates the transduction cascade leading to night (rod) vision. Naturally occurring pathogenic rhodopsin (RHO) mutations have been previously identified only in humans and are a common cause of dominantly inherited blindness from retinal degeneration. We identified English Mastiff dogs with a naturally occurring dominant retinal degeneration and determined the cause to be a point mutation in the RHO gene (Thr4Arg). Dogs with this mutant allele manifest a retinal phenotype that closely mimics that in humans with RHO mutations. The phenotypic features shared by dog and man include a dramatically slowed time course of recovery of rod photoreceptor function after light exposure and a distinctive topographic pattern to the retinal degeneration. The canine disease offers opportunities to explore the basis of prolonged photoreceptor recovery after light in RHO mutations and determine whether there are links between the dysfunction and apoptotic retinal cell death. The RHO mutant dog also becomes the large animal needed for preclinical trials of therapies for a major subset of human retinopathies. PMID:11972042

  2. Genetic and biochemical analysis of cis regulatory elements within the keratinocyte enhancer region of the human papillomavirus type 31 upstream regulatory region during different stages of the viral life cycle.

    PubMed

    Sen, Ellora; Alam, Samina; Meyers, Craig

    2004-01-01

    Using linker scanning mutational analysis, we recently identified potential cis regulatory elements contained within the 5' upstream regulatory region (URR) domain and auxiliary enhancer (AE) region of the human papillomavirus type 31 (HPV31) URR involved in the regulation of E6/E7 promoter activity at different stages of the viral life cycle. For the present study, we extended the linker scanning mutational analysis to identify potential cis elements located in the keratinocyte enhancer (KE) region (nucleotides 7511 to 7762) of the HPV31 URR and to characterize cellular factors that bind to these elements under conditions representing different stages of the viral life cycle. The linker scanning mutational analysis identified viral cis elements located in the KE region that regulate transcription in the presence and absence of any viral gene products or viral DNA replication and determine the role of host tissue differentiation on viral transcriptional regulation. Using electrophoretic mobility shift assays, we illustrated defined reorganization in the composition of cellular transcription factors binding to the same cis regulatory elements at different stages of the HPV differentiation-dependent life cycle. Our studies provide an extensive map of functional elements in the KE region of the HPV31 URR, identify cis regulatory elements that exhibit significant transcription regulatory potential, and illustrate changes in specific protein-DNA interactions at different stages of the viral life cycle. The variable recruitment of transcription factors to the same cis element under different cellular conditions may represent a mechanism underlying the tight link between keratinocyte differentiation and E6/E7 expression.

  3. Mimicking human expert interpretation of remotely sensed raster imagery by using a novel segmentation analysis within ArcGIS

    NASA Astrophysics Data System (ADS)

    Le Bas, Tim; Scarth, Anthony; Bunting, Peter

    2015-04-01

    Traditional computer based methods for the interpretation of remotely sensed imagery use each pixel individually or the average of a small window of pixels to calculate a class or thematic value, which provides an interpretation. However when a human expert interprets imagery, the human eye is excellent at finding coherent and homogenous areas and edge features. It may therefore be advantageous for computer analysis to mimic human interpretation. A new toolbox for ArcGIS 10.x will be presented that segments the data layers into a set of polygons. Each polygon is defined by a K-means clustering and region growing algorithm, thus finding areas, their edges and any lineations in the imagery. Attached to each polygon are the characteristics of the imagery such as mean and standard deviation of the pixel values, within the polygon. The segmentation of imagery into a jigsaw of polygons also has the advantage that the human interpreter does not need to spend hours digitising the boundaries. The segmentation process has been taken from the RSGIS library of analysis and classification routines (Bunting et al., 2014). These routines are freeware and have been modified to be available in the ArcToolbox under the Windows (v7) operating system. Input to the segmentation process is a multi-layered raster image, for example; a Landsat image, or a set of raster datasets made up from derivatives of topography. The size and number of polygons are set by the user and are dependent on the imagery used. Examples will be presented of data from the marine environment utilising bathymetric depth, slope, rugosity and backscatter from a multibeam system. Meaningful classification of the polygons using their numerical characteristics is the next goal. Object based image analysis (OBIA) should help this workflow. Fully calibrated imagery systems will allow numerical classification to be translated into more readily understandable terms. Peter Bunting, Daniel Clewley, Richard M. Lucas and Sam

  4. The application of silicon sol-gel technology to forensic blood substitute development: Mimicking aspects of whole human blood rheology.

    PubMed

    Stotesbury, Theresa; Illes, Mike; Wilson, Paul; Vreugdenhil, Andrew J

    2017-01-01

    Solution-gelation chemistry has promising applications in forensic synthetic blood substitute development. This research offers a silicon-based sol-gel approach to creating stable materials that share similar rheological properties to that of whole human blood samples. Room temperature, high water content, silicon sol-gels were created using the organosilane precursors 3-glycidoxypropyltrimethoxysilane and tetraethylorthosilicate along with various concentrations of filler and pigment. Shear-thinning non-Newtonian properties were observed within most formulations of the presented materials. The effects of colloidal concentration, temperature, age and filler addition on the viscosity of the sol-gels were investigated. SEM-EDS analysis was used to identify the behavior of the fillers within the film and support their inclusion for basic bloodstain pattern simulation. A final proposed candidate sol-gel was assessed using a previously reported passive drip simulation test on a hard, dry surface and passed. This works represents encouraging development in providing safe material alternatives to using whole human blood for forensic training and research. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  5. Human cysticercosis of the breast mimicking breast cancer: a report of a case from Ile-Ife, Nigeria. .

    PubMed

    Omonisi, A E; Odujoko, O O; Aluko, J A; Akinyemi, H A; Alatishe, O I; Omoniyi-Esan, G O

    2014-01-01

    Human cystericosis is the infection caused by the larvae of pork tapeworm Taeniasolium. The infection commonly affects the muscle, the central nervous system and subcutaneous tissues. The involvement of the breast is unusual. To present a 54 years old postmenopausal woman, a petty trader and a Jehovah witness who presented with a painless lump in the right breast which was increasing in size. The mass was clinically diagnosed by the Surgeon who examined her as a case of right breast cancer and an excisional biopsy was done. A review of the case note, autopsy findings including gross and microscopic examinations and literature was done. A histopathological appraisal of biopsy revealed the presence of the typical cysticercus larva and a definitive diagnosis of right breast Cystericosis was made. The diagnosis of cysticercosis in unusual sites such as breast may be clinically difficult and this supports why all biopsies must be sent to the pathologists for definitive diagnosis. Human cystericosis of the breast is rare, nevertheless, this should be considered as a differential diagnosis for amass in the breast particularly in the tropics and developing countries. To the best of our knowledge, this is the first case from our centre.

  6. K-Ras and cyclooxygenase-2 coactivation augments intraductal papillary mucinous neoplasm and Notch1 mimicking human pancreas lesions

    PubMed Central

    Chiblak, Sara; Steinbauer, Brigitte; Pohl-Arnold, Andrea; Kucher, Dagmar; Abdollahi, Amir; Schwager, Christian; Höft, Birgit; Esposito, Irene; Müller-Decker, Karin

    2016-01-01

    Mutational activation of K-Ras is an initiating event of pancreatic ductal adenocarcinomas (PDAC) that may develop either from pancreatic intraepithelial neoplasia (PanIN) or intraductal papillary mucinous neoplasms (IPMN). Cyclooxygenase-2 (COX-2)-derived prostaglandin E2 (PGE2) is causally related to pancreatic carcinogenesis. Here, we deciphered the impact of COX-2, a key modulator of inflammation, in concert with active mutant K-RasG12D on tumor burden and gene expression signature using compound mutant mouse lines. Concomitant activation of COX-2 and K-RasG12D accelerated the progression of pancreatic intraepithelial lesions predominantly with a cystic papillary phenotype resembling human IPMN. Transcriptomes derived from laser capture microdissected preneoplastic lesions of single and compound mutants revealed a signature that was significantly enriched in Notch1 signaling components. In vitro, Notch1 signaling was COX-2-dependent. In line with these findings, human IPMN stratified into intestinal, gastric and pancreatobillary types displayed Notch1 immunosignals with high prevalence, especially in the gastric lesions. In conclusion, a yet unknown link between activated Ras, protumorigenic COX-2 and Notch1 in IPMN onset was unraveled. PMID:27381829

  7. Hypothermic Preconditioning Reverses Tau Ontogenesis in Human Cortical Neurons and is Mimicked by Protein Phosphatase 2A Inhibition

    PubMed Central

    Rzechorzek, Nina M.; Connick, Peter; Livesey, Matthew R.; Borooah, Shyamanga; Patani, Rickie; Burr, Karen; Story, David; Wyllie, David J.A.; Hardingham, Giles E.; Chandran, Siddharthan

    2015-01-01

    Hypothermia is potently neuroprotective, but the molecular basis of this effect remains obscure. Changes in neuronal tau protein are of interest, since tau becomes hyperphosphorylated in injury-resistant, hypothermic brains. Noting inter-species differences in tau isoforms, we have used functional cortical neurons differentiated from human pluripotent stem cells (hCNs) to interrogate tau modulation during hypothermic preconditioning at clinically-relevant temperatures. Key tau developmental transitions (phosphorylation status and splicing shift) are recapitulated during hCN differentiation and subsequently reversed by mild (32 °C) to moderate (28 °C) cooling — conditions which reduce oxidative and excitotoxic stress-mediated injury in hCNs. Blocking a major tau kinase decreases hCN tau phosphorylation and abrogates hypothermic neuroprotection, whilst inhibition of protein phosphatase 2A mimics cooling-induced tau hyperphosphorylation and protects normothermic hCNs from oxidative stress. These findings indicate a possible role for phospho-tau in hypothermic preconditioning, and suggest that cooling drives human tau towards an earlier ontogenic phenotype whilst increasing neuronal resilience to common neurotoxic insults. This work provides a critical step forward in understanding how we might exploit the neuroprotective benefits of cooling without cooling patients. PMID:26870825

  8. Complementary DNA encoding the human T-cell FK506-binding protein, a peptidylprolyl cis-trans isomerase distinct from cyclophilin

    SciTech Connect

    Maki, Noboru; Sekiguchi, Fumiko; Nishimaki, Junichi; Miwa, Keiko; Hayano, Toshiya; Takahashi, Nobuhiro; Suzuki, Masanori )

    1990-07-01

    The recently discovered macrolide FK506 has been demonstrated to have potent immunosuppressive activity at concentrations 100-fold lower than cyclosporin A, a cyclic undecapeptide that is used to prevent rejection after transplantation of bone marrow and organs, such as kidney, heart, and liver. After the recent discovery that the cylcosporin A-binding protein cyclophilin is identical to peptidylprolyl cis-trans isomerase, a cellular binding protein for FK506 was found to be distinct from cyclophilin but to have the same enzymatic activity. In this study, the authors isolated a cDNA coding for FK506-binding protein (FKBP) from human peripheral blood T cells by using mixed 20-mer oligonucleotide probes synthesized on the basis of the sequence, Glu-Asp-Gly-Lys-Lys-Phe-Asp, reported for bovine FKBP. The DNA isolated contained an open reading frame encoding 108 amino acid residues. The first 40 residues of the deduced amino acid sequence were identical to those of the reported amino-terminal sequence of bovine FKBP, indicating that the DNA sequence isolated represents the gene coding for FKBP. This result suggests that two catalytically similar proteins, cyclophilin and FKBP, evolved independently. In Northern blot analysis, mRNA species of {approx}1.8 kilobases that hybridized with human FKBP cDNA were detected in poly(A){sup +} RNAs from brain, lung, liver, and placental cells and leukocytes. Induction of Jurkat leukemic T cells with phorbol 12-myristate 13-acetate and ionomycin did not affect the level of FKBP mRNA.

  9. New invMED1 element cis-activates human multidrug-related MDR1 and MVP genes, involving the LRP130 protein

    PubMed Central

    Labialle, Stéphane; Dayan, Guila; Gayet, Landry; Rigal, Dominique; Gambrelle, Joël; Baggetto, Loris G.

    2004-01-01

    The MDR1 gene is a key component of the cytotoxic defense network and its overexpression results in the multidrug resistance (MDR) phenotype. However, the molecular mechanisms that regulate the MDR1 gene and coordinate multiple MDR-related genes expression are poorly understood. In a previous study, we identified a new 12 bp cis-activating region in the 5′-flanking region of the human MDR1 gene, which we called inverted MED1. In the present study, we characterized the precise binding element, which we named invMED1, and revealed the presence of the LRP130 protein as the nuclear factor. Its binding intensity increases with the endogenous MDR1 geneexpression and with the MDR level of CEM leukemia cells. Interestingly, the LRP130 level did not vary with the chemoresistance level. We observed the involvement of LRP130 in the transcriptional activity of the MDR1 gene promoter, and moreover, in that of the MDR-related, invMED1-containing, MVP gene promoter. We used siRNAs and transcriptional decoys in two unrelated human cancer cell lines to show the role of the invMED1/LRP130 couple in both MDR1 and MVP endogenous genes activities. We showed that invMED1 was localized in the −105/−100 and −148/−143 regions of the MDR1 and MVP gene promoters, respectively. In addition, since the invMED1 sequence is primarily located in the −160/−100 bp region of mammalian MDR-related genes, our results present the invMED1/LRP130 couple as a potential central regulator of the transcription of these genes. PMID:15272088

  10. Murine Ccl2/Cx3cr1 Deficiency Results in Retinal Lesions Mimicking Human Age-Related Macular Degeneration

    PubMed Central

    Tuo, Jingsheng; Bojanowski, Christine M.; Zhou, Min; Shen, Defen; Ross, Robert J.; Rosenberg, Kevin I.; Cameron, D. Joshua; Yin, Chunyue; Kowalak, Jeffrey A.; Zhuang, Zhengping; Zhang, Kang; Chan, Chi-Chao

    2007-01-01

    Purpose Senescent Ccl2-/- mice are reported to develop cardinal features of human age-related macular degeneration (AMD). Loss-of-function single-nucleotide polymorphisms within CX3CR1 are also found to be associated with AMD. The authors generated Ccl2-/-/Cx3cr1-/- mice to establish a more characteristic and reproducible AMD model. Methods Single Ccl2- and Cx3cr1-deficient mice were crossbred to obtain Ccl2-/-/Cx3cr1-/- mice. Funduscopy, histopathology, retinal A2E quantification, proteomics, RT-PCR gene expression assay, immunochemistry, and Western blotting were used to examine the retina and to evaluate gene expression within the retinal tissue. Results By 6 weeks of age, all Ccl2-/-/Cx3cr1-/- mice developed AMD-like retinal lesions, including drusen, retinal pigment epithelium alteration, and photoreceptor degeneration. Furthermore, choroidal neovascularization occurred in 15% of the mice. These degenerative lesions progressed with age. A2E, a major lipofuscin fluorophore that accumulated during AMD progression, was significantly higher in the Ccl2-/-/Cx3cr1-/- retina than in the wild-type retina. Complement cofactor was higher in the Ccl2-/-/Cx3cr1-/- RPE. Proteomics data indicated that four proteins were differentially expressed in Ccl2-/-/Cx3cr1-/- retina compared with control. One of these proteins, ERp29, an endoplasmic reticulum protein, functions as an escort chaperone and in protein folding. Conclusions The authors concluded that Ccl2-/-/Cx3cr1-/- mice develop a broad spectrum of AMD abnormalities with early onset and high penetrance. These observations implicate certain chemokines and endoplasmic reticulum proteins in AMD pathogenesis. Similar to the mechanism of neurodegeneration caused by dysfunction of endoplasmic reticulum proteins, decreased chaperoning may cause misfolded protein accumulation, leading to drusen formation and retinal degeneration. PMID:17652758

  11. Human pericyte-endothelial cell interactions in co-culture models mimicking the diabetic retinal microvascular environment.

    PubMed

    Tarallo, Sonia; Beltramo, Elena; Berrone, Elena; Porta, Massimo

    2012-12-01

    Pericytes regulate vascular tone, perfusion pressure and endothelial cell (EC) proliferation in capillaries. Thiamine and benfotiamine counteract high glucose-induced damage in vascular cells. We standardized two human retinal pericyte (HRP)/EC co-culture models to mimic the diabetic retinal microvascular environment. We aimed at evaluating the interactions between co-cultured HRP and EC in terms of proliferation/apoptosis and the possible protective role of thiamine and benfotiamine against high glucose-induced damage. EC and HRP were co-cultured in physiological glucose and stable or intermittent high glucose, with or without thiamine/benfotiamine. No-contact model: EC were plated on a porous membrane suspended into the medium and HRP on the bottom of the same well. Cell-to-cell contact model: EC and HRP were plated on the opposite sides of the same membrane. Proliferation (cell counts and DNA synthesis), apoptosis and tubule formation in Matrigel were assessed. In the no-contact model, stable high glucose reduced proliferation of co-cultured EC/HRP and EC alone and increased co-cultured EC/HRP apoptosis. In the contact model, both stable and intermittent high glucose reduced co-cultured EC/HRP proliferation and increased apoptosis. Stable high glucose had no effects on HRP in separate cultures. Both EC and HRP proliferated better when co-cultured. Thiamine and benfotiamine reversed high glucose-induced damage in all cases. HRP are sensitive to soluble factors released by EC when cultured in high glucose conditions, as suggested by conditioned media assays. In the Matrigel models, addition of thiamine and benfotiamine re-established the high glucose-damaged interactions between EC/HRP and stabilized microtubules.

  12. Adventitial Vessel Growth and Progenitor Cells Activation in an Ex Vivo Culture System Mimicking Human Saphenous Vein Wall Strain after Coronary Artery Bypass Grafting

    PubMed Central

    Prandi, Francesca; Piola, Marco; Soncini, Monica; Colussi, Claudia; D’Alessandra, Yuri; Penza, Eleonora; Agrifoglio, Marco; Vinci, Maria Cristina; Polvani, Gianluca; Gaetano, Carlo; Fiore, Gianfranco Beniamino; Pesce, Maurizio

    2015-01-01

    Saphenous vein graft disease is a timely problem in coronary artery bypass grafting. Indeed, after exposure of the vein to arterial blood flow, a progressive modification in the wall begins, due to proliferation of smooth muscle cells in the intima. As a consequence, the graft progressively occludes and this leads to recurrent ischemia. In the present study we employed a novel ex vivo culture system to assess the biological effects of arterial-like pressure on the human saphenous vein structure and physiology, and to compare the results to those achieved in the presence of a constant low pressure and flow mimicking the physiologic vein perfusion. While under both conditions we found an activation of Matrix Metallo-Proteases 2/9 and of microRNAs-21/146a/221, a specific effect of the arterial-like pressure was observed. This consisted in a marked geometrical remodeling, in the suppression of Tissue Inhibitor of Metallo-Protease-1, in the enhanced expression of TGF-β1 and BMP-2 mRNAs and, finally, in the upregulation of microRNAs-138/200b/200c. In addition, the veins exposed to arterial-like pressure showed an increase in the density of the adventitial vasa vasorum and of cells co-expressing NG2, CD44 and SM22α markers in the adventitia. Cells with nuclear expression of Sox-10, a transcription factor characterizing multipotent vascular stem cells, were finally found in adventitial vessels. Our findings suggest, for the first time, a role of arterial-like wall strain in the activation of pro-pathologic pathways resulting in adventitial vessels growth, activation of vasa vasorum cells, and upregulation of specific gene products associated to vascular remodeling and inflammation. PMID:25689822

  13. Adventitial vessel growth and progenitor cells activation in an ex vivo culture system mimicking human saphenous vein wall strain after coronary artery bypass grafting.

    PubMed

    Prandi, Francesca; Piola, Marco; Soncini, Monica; Colussi, Claudia; D'Alessandra, Yuri; Penza, Eleonora; Agrifoglio, Marco; Vinci, Maria Cristina; Polvani, Gianluca; Gaetano, Carlo; Fiore, Gianfranco Beniamino; Pesce, Maurizio

    2015-01-01

    Saphenous vein graft disease is a timely problem in coronary artery bypass grafting. Indeed, after exposure of the vein to arterial blood flow, a progressive modification in the wall begins, due to proliferation of smooth muscle cells in the intima. As a consequence, the graft progressively occludes and this leads to recurrent ischemia. In the present study we employed a novel ex vivo culture system to assess the biological effects of arterial-like pressure on the human saphenous vein structure and physiology, and to compare the results to those achieved in the presence of a constant low pressure and flow mimicking the physiologic vein perfusion. While under both conditions we found an activation of Matrix Metallo-Proteases 2/9 and of microRNAs-21/146a/221, a specific effect of the arterial-like pressure was observed. This consisted in a marked geometrical remodeling, in the suppression of Tissue Inhibitor of Metallo-Protease-1, in the enhanced expression of TGF-β1 and BMP-2 mRNAs and, finally, in the upregulation of microRNAs-138/200b/200c. In addition, the veins exposed to arterial-like pressure showed an increase in the density of the adventitial vasa vasorum and of cells co-expressing NG2, CD44 and SM22α markers in the adventitia. Cells with nuclear expression of Sox-10, a transcription factor characterizing multipotent vascular stem cells, were finally found in adventitial vessels. Our findings suggest, for the first time, a role of arterial-like wall strain in the activation of pro-pathologic pathways resulting in adventitial vessels growth, activation of vasa vasorum cells, and upregulation of specific gene products associated to vascular remodeling and inflammation.

  14. Cap-independent translation of human SP-A 5'-UTR variants: a double-loop structure and cis-element contribution.

    PubMed

    Wang, Guirong; Guo, Xiaoxuan; Silveyra, Patricia; Kimball, Scot R; Floros, Joanna

    2009-04-01

    Human surfactant protein A (hSP-A), a molecule of innate immunity and surfactant-related functions, consists of two functional genes, SP-A1 and SP-A2. SP-A expression is regulated by several factors including environmental stressors. SP-A1 and SP-A2 5'-untranslated region (5'-UTR) splice variants have a differential impact on translation efficiency and mRNA stability. To study whether these variants mediate internal ribosome entry site (IRES) activity (i.e., cap-independent translation), we performed transient transfection experiments in H441 cells with constructs containing one SP-A1 (A'D', AB'D', or A'CD') or SP-A2 (ABD) 5'-UTR splice variant between the Renilla and firefly luciferase genes of a bicistronic reporter vector. We found that 1) variants A'D', ABD, and AB'D' exhibit significantly higher IRES activities than negative control (no SP-A 5'-UTR) and A'CD' has no activity; the order of highest IRES activity was ABD > A'D' > AB'D; 2) IRES activity of ABD significantly increased in response to diesel particulate matter (20 microg/ml) but not in response to ozone (1 ppm for 1 h); 3) deletion mutants of ABD revealed regulatory elements associated with IRES activity; one at the end of exon A attenuated activity, whereas a region containing a short adenosine-rich motif in the second half of exon B and the start of exon D enhanced activity; 4) elimination of a predicted double-loop structure or increase in free energy significantly reduced IRES activity; 5) elimination of one or both double-loop structures in A'D' did not affect cap-dependent translation activity. Thus several factors, including cis-elements and secondary structure type and stability, are required for hSP-A 5'-UTR variant-mediated cap-independent translation.

  15. Identification of the oleic acid ethanolamide (OEA) isomer cis-vaccenic acid ethanolamide (VEA) as a highly abundant 18:1 fatty acid ethanolamide in blood plasma from rats and humans.

    PubMed

    Röhrig, Waldemar; Waibel, Reiner; Perlwitz, Christopher; Pischetsrieder, Monika; Hoch, Tobias

    2016-09-01

    The endocannabinoid system is important in various physiological pathways, especially the regulation of food intake. It consists of endocannabinoids like 2-arachidonoyl-glycerol (2-AG) or the fatty acid ethanolamide archachidonoyl-ethanolamide (AEA) with binding affinity to cannabinoid receptors. Further, fatty acid ethanolamides (FAEAs) influence the endocannabinoid system without affecting cannabinoid receptors by using independent physiological pathways. Among FAEAs, oleic acid ethanolamide (OEA) gained importance because of its promising ability to reduce food intake. By ultrahigh-performance liquid chromatography-electrospray ionization-tandem mass spectrometry (UHPLC-ESI-MS/MS), we detected a chromatographically separated molecule in plasma samples from rats and humans with identical mass and fragmentation patterns as those of OEA. Via synthesis and extensive analysis of ethanolamides of different cis/trans- and position isomers of oleic acid (cis9-18:1), we could identify the unknown molecule as vaccenic acid (cis11-18:1) ethanolamide (VEA). In this study we identified VEA as the most abundant 18:1 FAEA in rat plasma and the second most abundant 18:1 FAEA in human plasma.

  16. Expression of Alternatively Spliced Human T-Cell Leukemia Virus Type 1 mRNAs Is Influenced by Mitosis and by a Novel cis-Acting Regulatory Sequence

    PubMed Central

    Cavallari, Ilaria; Rende, Francesca; Bona, Marion K.; Sztuba-Solinska, Joanna; Silic-Benussi, Micol; Tognon, Martina; Franchini, Genoveffa; D'Agostino, Donna M.

    2015-01-01

    ABSTRACT Human T-cell leukemia virus type 1 (HTLV-1) expression depends on the concerted action of Tax, which drives transcription of the viral genome, and Rex, which favors expression of incompletely spliced mRNAs and determines a 2-phase temporal pattern of viral expression. In the present study, we investigated the Rex dependence of the complete set of alternatively spliced HTLV-1 mRNAs. Analyses of cells transfected with Rex–wild-type and Rex-knockout HTLV-1 molecular clones using splice site-specific quantitative reverse transcription (qRT)-PCR revealed that mRNAs encoding the p30Tof, p13, and p12/8 proteins were Rex dependent, while the p21rex mRNA was Rex independent. These findings provide a rational explanation for the intermediate-late temporal pattern of expression of the p30tof, p13, and p12/8 mRNAs described in previous studies. All the Rex-dependent mRNAs contained a 75-nucleotide intronic region that increased the nuclear retention and degradation of a reporter mRNA in the absence of other viral sequences. Selective 2′-hydroxyl acylation analyzed by primer extension (SHAPE) analysis revealed that this sequence formed a stable hairpin structure. Cell cycle synchronization experiments indicated that mitosis partially bypasses the requirement for Rex to export Rex-dependent HTLV-1 transcripts. These findings indicate a link between the cycling properties of the host cell and the temporal pattern of viral expression/latency that might influence the ability of the virus to spread and evade the immune system. IMPORTANCE HTLV-1 is a complex retrovirus that causes two distinct pathologies termed adult T-cell leukemia/lymphoma and tropical spastic paraparesis/HTLV-1-associated myelopathy in about 5% of infected individuals. Expression of the virus depends on the concerted action of Tax, which drives transcription of the viral genome, and Rex, which favors expression of incompletely spliced mRNAs and determines a 2-phase temporal pattern of virus

  17. Expression of Alternatively Spliced Human T-Cell Leukemia Virus Type 1 mRNAs Is Influenced by Mitosis and by a Novel cis-Acting Regulatory Sequence.

    PubMed

    Cavallari, Ilaria; Rende, Francesca; Bona, Marion K; Sztuba-Solinska, Joanna; Silic-Benussi, Micol; Tognon, Martina; LeGrice, Stuart F J; Franchini, Genoveffa; D'Agostino, Donna M; Ciminale, Vincenzo

    2015-11-18

    Human T-cell leukemia virus type 1 (HTLV-1) expression depends on the concerted action of Tax, which drives transcription of the viral genome, and Rex, which favors expression of incompletely spliced mRNAs and determines a 2-phase temporal pattern of viral expression. In the present study, we investigated the Rex dependence of the complete set of alternatively spliced HTLV-1 mRNAs. Analyses of cells transfected with Rex-wild-type and Rex-knockout HTLV-1 molecular clones using splice site-specific quantitative reverse transcription (qRT)-PCR revealed that mRNAs encoding the p30Tof, p13, and p12/8 proteins were Rex dependent, while the p21rex mRNA was Rex independent. These findings provide a rational explanation for the intermediate-late temporal pattern of expression of the p30tof, p13, and p12/8 mRNAs described in previous studies. All the Rex-dependent mRNAs contained a 75-nucleotide intronic region that increased the nuclear retention and degradation of a reporter mRNA in the absence of other viral sequences. Selective 2'-hydroxyl acylation analyzed by primer extension (SHAPE) analysis revealed that this sequence formed a stable hairpin structure. Cell cycle synchronization experiments indicated that mitosis partially bypasses the requirement for Rex to export Rex-dependent HTLV-1 transcripts. These findings indicate a link between the cycling properties of the host cell and the temporal pattern of viral expression/latency that might influence the ability of the virus to spread and evade the immune system. HTLV-1 is a complex retrovirus that causes two distinct pathologies termed adult T-cell leukemia/lymphoma and tropical spastic paraparesis/HTLV-1-associated myelopathy in about 5% of infected individuals. Expression of the virus depends on the concerted action of Tax, which drives transcription of the viral genome, and Rex, which favors expression of incompletely spliced mRNAs and determines a 2-phase temporal pattern of virus expression. The findings reported

  18. Cis-Nerolidol Induces Endoplasmic Reticulum Stress and Cell Death in Human Hepatocellular Carcinoma Cells through Extensive CYP2C19 and CYP1A2 Oxidation.

    PubMed

    Biazi, Bruna Isabela; Zanetti, Thalita Alves; Baranoski, Adrivanio; Corveloni, Amanda Cristina; Mantovani, Mário Sérgio

    2017-03-02

    Of late, many studies are attempting to find new molecules with anti-cancer properties, especially those with the capability to inhibit cell growth. The aim of this work was to evaluate nerolidol, a plant-based compound, as its cytotoxicity, genotoxicity, antiproliferative and apoptotic induction, cell cycle, mitochondrial membrane potential, and RT-qPCR of transcripts related to those pathways in the human hepatocellular carcinoma cell line (HepG2/C3A). Only cis-nerolidol (C-NER) demonstrated cytotoxicity (100 to 250 μM) activity and was selected to conduct the following experiments. C-NER did not show genotoxic activity, but altered the mitochondrial membrane potential, reduced cell proliferation by arresting cell cycle in G1 phase and induced cell death. RT-qPCR showed that C-NER down-regulated genes related to apoptosis (BAK1, BAX, CAPN1, CASP8, CASP9, PARP1 and TP53), cell cycle (CCND1, CCNE1, CDK1 and CDK2), xenobiotic metabolism (CYP2D6 and CYP3A4) and paraptosis (IGF1R receptor). Up-regulation was seen in case of genes related to cell survival (BBC3 and MYC) and reticulum stress protein response (EIF2AK3 and ERN1) and xenobiotic metabolism (CYP1A2 and CYP2C19). We deduced that the antiproliferative activity of C-NER is attributable to its modulation of the cyclins and cyclin-dependent kinases as these proteins are necessary for G1/S phase transition. EIF2AK3, ERN1, CYP2C19 and CYP1A2 up-regulation suggests that endoplasmic reticulum stress was induced owing to the increased activity of cytochrome P450 enzymes. Caspase-independent cell death was also observed, indicating that another type of cell death, paraptosis, was triggered. Our results indicate that C-NER has considerable potential in anti-cancer therapy because it modulates important molecular targets of cell survival and proliferation. This article is protected by copyright. All rights reserved.

  19. Urticaria mimickers in children.

    PubMed

    Mathur, Anubhav N; Mathes, Erin F

    2013-01-01

    Acute urticaria is a self-limited cutaneous condition marked by transient, erythematous, and pruritic wheals. It is a hypersensitivity response that is often secondary to infection, medications, or food allergies in children. In contrast, the urticarial "mimickers" described in this review article are often seen in the context of fever and extracutaneous manifestations in pediatric patients. The differential diagnosis ranges from benign and self-limited hypersensitivity responses to multisystem inflammatory diseases. Establishing the correct diagnosis of an urticarial rash in a pediatric patient is necessary to both prevent an unnecessary work up for self-limited conditions and to appropriately recognize and evaluate multisystem inflammatory disorders. Herein, we describe two cases to illustrate the clinical manifestations, laboratory findings, histopathology and differential diagnoses for several mimickers of acute urticaria including: urticaria multiforme, serum sickness like reaction, Henoch-Schönlein purpura, acute hemorrhagic edema of infancy, systemic onset juvenile idiopathic arthritis, cryopyrin associated periodic syndromes, and urticarial vasculitis. © 2013 Wiley Periodicals, Inc.

  20. A cis-acting element in the promoter of human ether à go-go 1 potassium channel gene mediates repression by calcitriol in human cervical cancer cells.

    PubMed

    Cázares-Ordoñez, V; González-Duarte, R J; Díaz, L; Ishizawa, M; Uno, S; Ortíz, V; Ordoñez-Sánchez, M L; Makishima, M; Larrea, F; Avila, E

    2015-02-01

    The human ether à go-go 1 potassium channel (hEAG1) is required for cell cycle progression and proliferation of cancer cells. Inhibitors of hEAG1 activity and expression represent potential therapeutic drugs in cancer. Previously, we have shown that hEAG1 expression is downregulated by calcitriol in a variety of cancer cells. Herein, we provided evidence on the regulatory mechanism involved in such repressive effect in cells derived from human cervical cancer. Our results indicate that repression by calcitriol occurs at the transcriptional level and involves a functional negative vitamin D response element (nVDRE) E-box type in the hEAG1 promoter. The described mechanism in this work implies that a protein complex formed by the vitamin D receptor-interacting repressor, the vitamin D receptor, the retinoid X receptor, and the Williams syndrome transcription factor interact with the nVDRE in the hEAG1 promoter in the absence of ligand. Interestingly, all of these transcription factors except the vitamin D receptor-interacting repressor are displaced from hEAG1 promoter in the presence of calcitriol. Our results provide novel mechanistic insights into calcitriol mode of action in repressing hEAG1 gene expression.

  1. Mutagenesis in monkey cells of a vector containing a single d(GPG) cis-diamminedichloroplatinum(II) adduct placed on codon 13 of the human H-ras proto-oncogene.

    PubMed Central

    Pillaire, M J; Margot, A; Villani, G; Sarasin, A; Defais, M; Gentil, A

    1994-01-01

    Cisplatin (cis-[Pt(NH3)2Cl2]) is a widely used antitumor agent whose mutagenic activity raises the possibility of the induction of secondary cancer as a result of treatment. Mutation of the proto-oncogene H-ras is found in more than 30% of all human tumors, where it has been postulated to contribute to the initiation and progression of human cancers. Activating mutations in the H-ras gene are predominantly single-base substitutions, most frequently at codons 12, 13 and 61. In the present work we have studied the mutational spectra induced by a single cis-[Pt(NH3)2d(GpG)] adduct, the most frequent DNA crosslink formed by cisplatin. We have constructed a 25-mer-Pt oligonucleotide singly modified at codon 13 (GGT) within the human H-ras DNA sequence and we have inserted it into a single-stranded SV40-based shuttle vector able to replicate in simian COS7 cells. After replication in the mammalian host, vectors were extracted, amplified in bacteria and DNA from 124 randomly chosen colonies was sequenced. The observed mutation frequency was 21%. Base substitutions were the most frequent modification. 92% of the mutagenic events occurred at one or both of the platinated guanines of codon 13. The single G-->T transversion accounted for 65% of the total mutations scored. All single base substitutions were located at the G in the 3' position showing, for the first time, that the guanine at the 3' side of a cis-[Pt(NH3)2d(GpG)] adduct may be a preferential site for cisplatin induced mutations. The substitution G-->T at this position of the codon 13 of the H-ras proto-oncogene is known to induce the oncogenic properties of the p21ras protein. Images PMID:8041613

  2. Proteomic analysis of changes in the protein composition of MCF-7 human breast cancer cells induced by all-trans retinoic acid, 9-cis retinoic acid, and their combination.

    PubMed

    Flodrova, D; Benkovska, D; Macejova, D; Bialesova, L; Hunakova, L; Brtko, J; Bobalova, J

    2015-01-05

    Retinoic acid (all-trans and 9-cis) isomers represent important therapeutic agents for many types of cancers, including human breast cancer. Changes in protein composition of the MCF-7 human breast cancer cells were induced by all-trans retinoic acid, 9-cis retinoic acid, and their combination and subsequently proteomic strategies based on bottom-up method were applied. Proposed approach was used for the analysis of proteins extracted from MCF-7 human breast cancer cell line utilizing a commercially manufactured kit RIPA and separated on two dimensional (2D) sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) after treatment with both retinoic acid isomers. We found significant differences in occurrence of proteins probably affecting the cell migration process in tumour cells. Heat shock protein 27, ribonucleoprotein SmD3, and cofilin-1 were significantly upregulated after treatment with combination of individual retinoic acid isomers. On the other hand, AP-5 complex subunit beta-1 shows the different response. Thus, the results might help to find the answer to important medical questions on (i) the identification of signaling pathways affected by retinoic acid isomers or (ii) how the observed proteomic pattern might reflect the effectiveness of retinoic acids treatment. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  3. cis-1,2-Dichloroethylene

    Integrated Risk Information System (IRIS)

    EPA / 635 / R - 09 / 006 F www.epa.gov / iris TOXICOLOGICAL REVIEW OF cis - 1,2 - DICHLOROETHYLENE and trans - 1,2 - DICHLOROETHYLENE ( CAS Nos . cis : 156 - 59 - 2 ; trans : 156 - 60 - 5 ; mixture : 540 - 59 - 0 ) In Support of Summary Information on the Integrated Risk Information System ( IRIS )

  4. Characterization of the human lipoprotein lipase (LPL) promoter: Evidence of two cis-regulatory regions, LP-[alpha] and LP-[beta] of importance for the differentation-linked induction of the LPL gene during adipogenesis

    SciTech Connect

    Enerbaeck, S.; Ohlsson, B.G.; Samuelsson, L.; Bjursell, G. )

    1992-10-01

    When preadipocytes differentiate into adipocytes, several differentiation-linked genes are activated. Lipo-protein lipase (LPL) is one of the first genes induced during this process. To investigate early events in adipocyte development, we have focused on the transcriptional activation of the LPL gene. For this purpose, we have cloned and fused different parts of intragenic and flanking sequences with a chloramphenicol acetyltransferase reporter gene. Transient transfection experiments and DNase I hypersensitivity assays indicate that several positive as well as negative elements contribute to transcriptional regulation of the LPL gene. When reporter gene constructs were stably introduced into preadipocytes, we were able to monitor and compare the activation patterns of different promoter deletion mutants at selected time points representing the process of adipocyte development. We could delimit two cis-regulatory elements important for gradual activation of the LPL gene during adipocyte development in vitro. These elements, LP-[alpha] (-702 to -666) and LP-[beta] (-468 to -430), contain a striking similarity to a consensus sequence known to bind the transcription factors HNF-3 and fork head. Results of gel mobility shift assays and DNase I and exonuclease III in vitro protection assays indicate that factors with DNA-binding properties similar to those of the HNF-3/fork head family of transcription factors are present in adipocytes and interact with LP-[alpha] and LP-[beta]. We also demonstrate that LP-[alpha] and LP-[beta] were both capable of conferring a differentiation-linked expression pattern to a heterolog promoter, thus mimicking the expression of the endogenous LPL gene during adipocyte differentiation. These findings indicate that interactions with LP-[alpha] and LP-[beta] could be a part of a differentiation switch governing induction of the LPL gene during adipocyte differentiation. 48 refs., 11 figs.

  5. Characterization of the human lipoprotein lipase (LPL) promoter: evidence of two cis-regulatory regions, LP-alpha and LP-beta, of importance for the differentiation-linked induction of the LPL gene during adipogenesis.

    PubMed Central

    Enerbäck, S; Ohlsson, B G; Samuelsson, L; Bjursell, G

    1992-01-01

    When preadipocytes differentiate into adipocytes, several differentiation-linked genes are activated. Lipoprotein lipase (LPL) is one of the first genes induced during this process. To investigate early events in adipocyte development, we have focused on the transcriptional activation of the LPL gene. For this purpose, we have cloned and fused different parts of intragenic and flanking sequences with a chloramphenicol acetyltransferase reporter gene. Transient transfection experiments and DNase I hypersensitivity assays indicate that several positive as well as negative elements contribute to transcriptional regulation of the LPL gene. When reporter gene constructs were stably introduced into preadipocytes, we were able to monitor and compare the activation patterns of different promoter deletion mutants at selected time points representing the process of adipocyte development. We could delimit two cis-regulatory elements important for gradual activation of the LPL gene during adipocyte development in vitro. These elements, LP-alpha (-702 to -666) and LP-beta (-468 to -430), contain a striking similarity to a consensus sequence known to bind the transcription factors HNF-3 and fork head. Results of gel mobility shift assays and DNase I and exonuclease III in vitro protection assays indicate that factors with DNA-binding properties similar to those of the HNF-3/fork head family of transcription factors are present in adipocytes and interact with LP-alpha and LP-beta. We also demonstrate that LP-alpha and LP-beta were both capable of conferring a differentiation-linked expression pattern to a heterolog promoter, thus mimicking the expression of the endogenous LPL gene during adipocyte differentiation. These findings indicate that interactions with LP-alpha and LP-beta could be a part of a differentiation switch governing induction of the LPL gene during adipocyte differentiation. Images PMID:1406652

  6. Mimicking the Moon

    NASA Image and Video Library

    2014-11-03

    When Galileo first observed Venus displaying a crescent phase, he excitedly wrote to Kepler (in anagram) of Venus mimicking the moon-goddess. He would have been delirious with joy to see Saturn and Titan, seen in this image, doing the same thing. More than just pretty pictures, high-phase observations -- taken looking generally toward the Sun, as in this image -- are very powerful scientifically since the way atmospheres and rings transmit sunlight is often diagnostic of compositions and physical states. In this example, Titan's crescent nearly encircles its disk due to the small haze particles high in its atmosphere refracting the incoming light of the distant Sun. This view looks toward the sunlit side of the rings from about 3 degrees above the ringplane. The image was taken in violet light with the Cassini spacecraft wide-angle camera on Aug. 11, 2013. The view was obtained at a distance of approximately 1.1 million miles (1.7 million kilometers) from Saturn and at a Sun-Saturn-spacecraft, or phase, angle of 154 degrees. Image scale is 64 miles (103 kilometers) per pixel. http://photojournal.jpl.nasa.gov/catalog/PIA18291

  7. Human in vitro 3D co-culture model to engineer vascularized bone-mimicking tissues combining computational tools and statistical experimental approach.

    PubMed

    Bersini, Simone; Gilardi, Mara; Arrigoni, Chiara; Talò, Giuseppe; Zamai, Moreno; Zagra, Luigi; Caiolfa, Valeria; Moretti, Matteo

    2016-01-01

    The generation of functional, vascularized tissues is a key challenge for both tissue engineering applications and the development of advanced in vitro models analyzing interactions among circulating cells, endothelium and organ-specific microenvironments. Since vascularization is a complex process guided by multiple synergic factors, it is critical to analyze the specific role that different experimental parameters play in the generation of physiological tissues. Our goals were to design a novel meso-scale model bridging the gap between microfluidic and macro-scale studies, and high-throughput screen the effects of multiple variables on the vascularization of bone-mimicking tissues. We investigated the influence of endothelial cell (EC) density (3-5 Mcells/ml), cell ratio among ECs, mesenchymal stem cells (MSCs) and osteo-differentiated MSCs (1:1:0, 10:1:0, 10:1:1), culture medium (endothelial, endothelial + angiopoietin-1, 1:1 endothelial/osteo), hydrogel type (100%fibrin, 60%fibrin+40%collagen), tissue geometry (2 × 2 × 2, 2 × 2 × 5 mm(3)). We optimized the geometry and oxygen gradient inside hydrogels through computational simulations and we analyzed microvascular network features including total network length/area and vascular branch number/length. Particularly, we employed the "Design of Experiment" statistical approach to identify key differences among experimental conditions. We combined the generation of 3D functional tissue units with the fine control over the local microenvironment (e.g. oxygen gradients), and developed an effective strategy to enable the high-throughput screening of multiple experimental parameters. Our approach allowed to identify synergic correlations among critical parameters driving microvascular network development within a bone-mimicking environment and could be translated to any vascularized tissue.

  8. Caesium cis-tetrachloridodioxidorhenate(VII).

    PubMed

    Hołyńska, Małgorzata; Lis, Tadeusz

    2008-02-01

    The title crystal structure, Cs[ReCl(4)O(2)], consists of cis-tetrachloridodioxidorhenate(VII) anions and caesium cations. The distorted octahedral anion has nearly C(2v) symmetry, with a cis arrangement of the oxide ligands. The Re-Cl bond lengths for the Cl atoms trans to the oxide ligands are affected by the trans influence of the Re-O bonds and are longer than for the Cl atoms cis to the oxide ligands [average of 2.472 (2) A versus average of 2.322 (2) A, respectively]. There are ten Cl atoms from six cis-tetrachloridodioxidorhenate(VII) anions in the neighbourhood of the caesium cation.

  9. CisLunar Habitat Internal Architecture Design Criteria

    NASA Technical Reports Server (NTRS)

    Jones, R.; Kennedy, K.; Howard, R.; Whitmore, M.; Martin, C.; Garate, J.

    2017-01-01

    BACKGROUND: In preparation for human exploration to Mars, there is a need to define the development and test program that will validate deep space operations and systems. In that context, a Proving Grounds CisLunar habitat spacecraft is being defined as the next step towards this goal. This spacecraft will operate differently from the ISS or other spacecraft in human history. The performance envelope of this spacecraft (mass, volume, power, specifications, etc.) is being defined by the Future Capabilities Study Team. This team has recognized the need for a human-centered approach for the internal architecture of this spacecraft and has commissioned a CisLunar Phase-1 Habitat Internal Architecture Study Team to develop a NASA reference configuration, providing the Agency with a "smart buyer" approach for future acquisition. THE CISLUNAR HABITAT INTERNAL ARCHITECTURE STUDY: Overall, the CisLunar Habitat Internal Architecture study will address the most significant questions and risks in the current CisLunar architecture, habitation, and operations concept development. This effort is achieved through definition of design criteria, evaluation criteria and process, design of the CisLunar Habitat Phase-1 internal architecture, and the development and fabrication of internal architecture concepts combined with rigorous and methodical Human-in-the-Loop (HITL) evaluations and testing of the conceptual innovations in a controlled test environment. The vision of the CisLunar Habitat Internal Architecture Study is to design, build, and test a CisLunar Phase-1 Habitat Internal Architecture that will be used for habitation (e.g. habitability and human factors) evaluations. The evaluations will mature CisLunar habitat evaluation tools, guidelines, and standards, and will interface with other projects such as the Advanced Exploration Systems (AES) Program integrated Power, Avionics, Software (iPAS), and Logistics for integrated human-in-the-loop testing. The mission of the Cis

  10. trans-10,cis-12 Conjugated linoleic acid induces depolarization of mitochondrial membranes in HT-29 human colon cancer cells: a possible mechanism for induction of apoptosis.

    PubMed

    Cho, Han Jin; Kwon, Gyoo Taik; Park, Jung Han Yoon

    2009-10-01

    Conjugated linoleic acid (CLA), which is naturally present in a variety of foods such as milk fat and the meat of ruminant animals, has been demonstrated to exert chemoprotective effects in several tissues in experimental animals. CLA is a collective term, which denotes one or more positional and geometric isomers of octadecadienoic acid, with cis-9,trans-11 (c9t11) and trans-10,cis-12 CLA (t10c12) being the principal isomers in commercial preparations. We observed previously that physiological levels of CLA inhibited HT-29 cell growth, and the growth inhibitory effects of CLA were attributed to the effect of t10c12, but not c9t11. In the present study, we assessed the mechanisms by which physiological levels of CLA and t10c12 induce apoptosis in HT-29 cells. HT-29 cells were cultured for 3 days in serum-free medium in the presence of various concentrations of CLA (0-20 micromol/L) or t10c12 (0-4 micromol/L). Addition of CLA or t10c12 to culture medium resulted in a dose-dependent increase in the numbers of apoptotic cells. The results of western blot analysis of total cell lysates showed that CLA and t10c12 increased the levels of cleaved caspase-9, caspase-3, and poly(ADP-ribose) polymerase but did not alter the levels of Bcl-2 family member proteins. However, these fatty acids were shown to increase the translocation of Bad and Bax to the mitochondria, increase mitochondrial membrane permeability, and induce the release of cytochrome c and Smac/Diablo from the mitochondria. In addition, CLA and t10c12 diminished Akt content and Akt phosphorylation. These findings indicate that physiological levels of t10c12 induce apoptosis in HT-29 colon cancer cells, which is mediated via mitochondrion-mediated events associated with a decline in Akt activity, an increase in the translocation of the pro-apototic Bad and Bax to the mitochondria, and the subsequent disruption of normal mitochondrial membrane potential.

  11. Liquid chromatography-mass spectrometry of cis- and all-trans-lycopene in human serum and prostate tissue after dietary supplementation with tomato sauce.

    PubMed

    van Breemen, Richard B; Xu, Xiaoying; Viana, Marlos A; Chen, Longwen; Stacewicz-Sapuntzakis, Maria; Duncan, Claudine; Bowen, Phyllis E; Sharifi, Roohollah

    2002-04-10

    Several epidemiological studies suggest a lower incidence of prostate cancer in men who routinely consume tomato products. Tomatoes are the primary dietary source of lycopene, which is among the most potent antioxidants of the carotenoids. Men with clinical stage T1 or T2 prostate adenocarcinoma were recruited (n = 32) and consumed tomato sauce based pasta dishes for 3 weeks (equivalent to 30 mg of lycopene per day) before radical prostectomy. Prostate tissue from needle biopsy just before intervention and prostectomy after supplementation from a subset of 11 subjects was evaluated for both total lycopene and lycopene geometrical isomer ratios. A gradient HPLC system using a C(18) column with UV-vis absorbance detection was used to measure total lycopene. Because the absorbance detector was insufficiently sensitive, HPLC with a C(30) column and positive ion atmospheric pressure chemical ionization mass spectrometric (LC-MS) detection was developed as a new assay to measure the ratio of lycopene cis/trans isomers in these samples. The limit of detection of the LC-MS method was determined to be 0.93 pmol of lycopene on-column, and a linear response was obtained over 3 orders of magnitude. Total lycopene in serum increased 2.0-fold from 35.6 to 69.9 microg/dL (from 0.664 to 1.30 microM) as a result of dietary supplementation with tomato sauce, whereas total lycopene in prostate tissue increased 3.0-fold from 0.196 to 0.582 ng/mg of tissue (from 0.365 to 1.09 pmol/mg). all-trans-Lycopene and at least 14 cis-isomer peaks were detected in prostate tissue and serum. The mean proportion of all-trans-lycopene in prostate tissue was approximately 12.4% of total lycopene before supplementation but increased to 22.7% after dietary intervention with tomato sauce. In serum there was only a 2.8% but statistically significant increase in the proportion of all-trans-lycopene after intervention. These results indicate that short-term supplementation with tomato sauce containing

  12. Accuracy of phase contrast, black-blood, and bright-blood pulse sequences for measuring compliance and distensibility coefficients in a human-tissue mimicking phantom.

    PubMed

    Taviani, Valentina; Patterson, Andrew J; Worters, Pauline; Sutcliffe, Michael P F; Graves, Martin J; Gillard, Jonathan H

    2010-01-01

    To assess the accuracy of MR-derived luminal diameter variations and its implications for compliance (CC) and distensibility coefficients (DC) by comparison with high-resolution digital photography (HRDP) in a tissue-mimicking phantom with pulsatile flow. Diameters, CC, and DC extracted using cine phase-contrast (CPC), cine bright-blood (CBrB), and a cine black-blood (CBB) sequence were compared. The diameter in the left-right direction was compared against HRDP, as the gold-standard. The experiments were performed using 256(2) and 512(2) matrix sizes. Bland-Altman analysis was performed to compare each sequence with the gold-standard in terms of diameter changes over the simulated cardiac cycle. The bias and 95% limits of agreement (LOA) for CBB and CBrB were comparable. The bias for CPC was larger, however, the LOA were comparable. Increasing spatial resolution improved agreement with HRDP for all sequences. CBrB-derived CC and DC were within 3% of the high resolution CBB values while CPC CC and DC were underestimated but still within 11%. CPC images were found to underestimate the luminal area over the cardiac cycle. CBrB-derived diameters were more accurate in diastole while CBB-derived diameters gave the best results in systole. CC and DC varied depending on the pulse sequence. (c) 2009 Wiley-Liss, Inc.

  13. Selective inhibition of human immunodeficiency viruses by racemates and enantiomers of cis-5-fluoro-1-[2-(hydroxymethyl)-1,3-oxathiolan-5-yl]cytosine.

    PubMed Central

    Schinazi, R F; McMillan, A; Cannon, D; Mathis, R; Lloyd, R M; Peck, A; Sommadossi, J P; St Clair, M; Wilson, J; Furman, P A

    1992-01-01

    2',3'-Dideoxy-5-fluoro-3'-thiacytidine (FTC) has been shown to be a potent and selective compound against human immunodeficiency virus type 1 in acutely infected primary human lymphocytes. FTC is also active against human immunodeficiency virus type 2, simian immunodeficiency virus, and feline immunodeficiency virus in various cell culture systems, including human monocytes. The antiviral activity can be prevented by 2'-deoxycytidine, but not by other natural nucleosides, suggesting that FTC must be phosphorylated to be active and 2'-deoxycytidine kinase is responsible for the phosphorylation. By using chiral columns or enzymatic techniques, the two enantiomers of FTC were separated. The (-)-beta-enantiomer of FTC was about 20-fold more potent than the (+)-beta-enantiomer against human immunodeficiency virus type 1 in peripheral blood mononuclear cells and was also effective in thymidine kinase-deficient CEM cells. Racemic FTC and its enantiomers were nontoxic to human lymphocytes and other cell lines at concentrations of up to 100 microM. Studies with human bone marrow cells indicated that racemic FTC and its (-)-enantiomer had a median inhibitory concentration of > 30 microM. The (+)-enantiomer was significantly more toxic than the (-)-enantiomer to myeloid progenitor cells. The susceptibilities to FTC of pretherapy isolates in comparison with those of posttherapy 3'-azido-3'-deoxythymidine-resistant viruses in human lymphocytes were not substantially different. Similar results were obtained with well-defined 2',3'-dideoxyinosine- and nevirapine-resistant viruses. (-)-FTC-5'-triphosphate competitively inhibited human immunodeficiency virus type 1 reverse transcriptase, with an inhibition constant of 2.9 microM, when a poly(I)n.oligo(dC)19-24 template primer was used. These results suggest that further development of the (-)-Beta-enantiomer of FTC is warranted as an antiviral agent for infections caused by human immunodeficiency viruses. Images PMID:1283296

  14. Beta-carotene isomers in human serum, breast milk and buccal mucosa cells after continuous oral doses of all-trans and 9-cis beta-carotene.

    PubMed

    Johnson, E J; Qin, J; Krinsky, N I; Russell, R M

    1997-10-01

    The concentrations of all-trans beta-carotene (tBC) and 9-cis beta-carotene (9cBC) isomers in serum, breast milk and buccal mucosa cells were determined after continuous oral doses as a simple, non-invasive method to determine whether differences in tissue uptake are important determinants of serum responses. Twelve healthy lactating women were recruited for a nonresidential study. On d 1, blood samples were obtained from fasting subjects for baseline concentrations of beta-carotene isomers. Over a 1-wk period, subjects were given either seven doses of a placebo (n = 4) or seven doses of naturally occurring BC (n = 8) derived from Dunaliella bardawil (64 mg tBC, 69 mg 9cBC). Subjects were instructed to consume a single beta-carotene dose along with a meal containing adequate fat each day for 1 wk. On d 2, 3, 5 and 8, blood samples and breast milk were collected from fasting subjects. On d 1 and 8, buccal mucosa cells were collected. Samples were analyzed for carotenoids by HPLC. In the experimental group, the mean serum concentration of tBC significantly increased to seven times the baseline level by the end of the supplementation period (P < 0.0001). The serum concentration of 9cBC significantly increased to three times the baseline level by the end of the supplementation period (P < 0.0001). The changes in milk and buccal mucosa cells levels of tBC and 9cBC followed a pattern similar to that for serum, showing significant increases at the end of the supplementation period. In the control group, the serum, milk and buccal mucosa cell concentrations of BC isomers did not change. This study confirms the previously reported differences in the serum response curves of tBC and 9cBC and provides evidence that there is no difference in tissue uptake of tBC and 9cBC.

  15. Xanthogranulomatous cholecystitis mimicking gallbladder cancer.

    PubMed

    Ewelukwa, Ofor; Ali, Omair; Akram, Salma

    2014-05-08

    Xanthogranulomatous cholecystitis (XGC) is a benign, uncommon variant of chronic cholecystitis characterised by focal or diffuse destructive inflammatory process of the gallbladder (GB). Macroscopically, it appears like yellowish tumour-like masses in the wall of the GB. This article reports on a 74-year-old woman with XGC mimicking GB cancer.

  16. Kaposi's sarcoma-associated herpesvirus (human herpesvirus 8) replication and transcription factor activates the K9 (vIRF) gene through two distinct cis elements by a non-DNA-binding mechanism.

    PubMed

    Ueda, Keiji; Ishikawa, Kayo; Nishimura, Ken; Sakakibara, Shuhei; Do, Eunju; Yamanishi, Koichi

    2002-12-01

    The replication and transcription activator (RTA) of Kaposi's sarcoma-associated herpesvirus (KSHV), or human herpesvirus 8, a homologue of Epstein-Barr virus BRLF1 or Rta, is a strong transactivator and inducer of lytic replication. RTA acting alone can induce lytic replication of KSHV in infected cell lines that originated from primary effusion lymphomas, leading to virus production. During the lytic replication process, RTA activates many kinds of genes, including polyadenylated nuclear RNA, K8, K9 (vIRF), ORF57, and so on. We focused here on the mechanism of how RTA upregulates the K9 (vIRF) promoter and identified two independent cis-acting elements in the K9 (vIRF) promoter that responded to RTA. These elements were finally confined to the sequence 5'-TCTGGGACAGTC-3' in responsive element (RE) I-2B and the sequence 5'-GTACTTAAAATA-3' in RE IIC-2, both of which did not share sequence homology. Multiple factors bound specifically with these elements, and their binding was correlated with the RTA-responsive activity. Electrophoretic mobility shift assay with nuclear extract from infected cells and the N-terminal part of RTA expressed in Escherichia coli, however, did not show that RTA interacted directly with these elements, in contrast to the RTA responsive elements in the PAN/K12 promoter region, the ORF57/K8 promoter region. Thus, it was likely that RTA could transactivate several kinds of unique cis elements without directly binding to the responsive elements, probably through cooperation with other DNA-binding factors.

  17. Genome-wide significant schizophrenia risk variation on chromosome 10q24 is associated with altered cis-regulation of BORCS7, AS3MT, and NT5C2 in the human brain.

    PubMed

    Duarte, Rodrigo R R; Troakes, Claire; Nolan, Matthew; Srivastava, Deepak P; Murray, Robin M; Bray, Nicholas J

    2016-09-01

    Chromosome 10q24.32-q24.33 is one of the most robustly supported risk loci to emerge from genome-wide association studies (GWAS) of schizophrenia. However, extensive linkage disequilibrium makes it difficult to distinguish the actual susceptibility gene(s) at the locus, limiting its value for improving biological understanding of the condition. In the absence of coding changes that can account for the association, risk is likely conferred by altered regulation of one or more genes in the region. We, therefore, used highly sensitive measures of allele-specific expression to assess cis-regulatory effects associated with the two best-supported schizophrenia risk variants (SNP rs11191419 and indel ch10_104957618_I/rs202213518) on the primary positional candidates BORCS7, AS3MT, CNNM2, and NT5C2 in the human brain. Heterozygosity at rs11191419 was associated with increased allelic expression of BORCS7 and AS3MT in the fetal and adult brain, and with reduced allelic expression of NT5C2 in the adult brain. Heterozygosity at ch10_104957618_I was associated with reduced allelic expression of NT5C2 in both the fetal and adult brain. Comparisons between cDNA ratios in heterozygotes and homozygotes for the risk alleles indicated that cis-effects on NT5C2 expression in the adult dorsolateral prefrontal cortex could be largely accounted for by genotype at these two risk variants. While not excluding effects on other genes in the region, this study implicates altered neural expression of BORCS7, AS3MT, and NT5C2 in susceptibility to schizophrenia arising from genetic variation at the chromosome 10q24 locus. © 2016 The Authors. American Journal of Medical Genetics Part B: Neuropsychiatric Genetics Published by Wiley Periodicals, Inc.

  18. Biodegradation of cis-1,2-Dichloroethene in Simulated Underground Thermal Energy Storage Systems.

    PubMed

    Ni, Zhuobiao; van Gaans, Pauline; Smit, Martijn; Rijnaarts, Huub; Grotenhuis, Tim

    2015-11-17

    Underground thermal energy storage (UTES) use has showed a sharp rise in numbers in the last decades, with aquifer thermal energy storage (ATES) and borehole thermal energy storage (BTES) most widely used. In many urban areas with contaminated aquifers, there exists a desire for sustainable heating and cooling with UTES and a need for remediation. We investigated the potential synergy between UTES and bioremediation with batch experiments to simulate the effects of changing temperature and liquid exchange that occur in ATES systems, and of only temperature change occurring in BTES systems on cis-DCE reductive dechlorination. Compared to the natural situation (NS) at a constant temperature of 10 °C, both UTES systems with 25/5 °C for warm and cold well performed significantly better in cis-DCE (cis-1,2-dichloroethene) removal. The overall removal efficiency under mimicked ATES and BTES conditions were respectively 13 and 8.6 times higher than in NS. Inoculation with Dehalococcoides revealed that their initial presence is a determining factor for the dechlorination process. Temperature was the dominating factor when Dehalococcoides abundance was sufficient. Stimulated biodegradation was shown to be most effective in the mimicked ATES warm well because of the combined effect of suitable temperature, sustaining biomass growth, and regular cis-DCE supply.

  19. Prolyl cis-trans isomerization as a molecular timer.

    PubMed

    Lu, Kun Ping; Finn, Greg; Lee, Tae Ho; Nicholson, Linda K

    2007-10-01

    Proline is unique in the realm of amino acids in its ability to adopt completely distinct cis and trans conformations, which allows it to act as a backbone switch that is controlled by prolyl cis-trans isomerization. This intrinsically slow interconversion can be catalyzed by the evolutionarily conserved group of peptidyl prolyl cis-trans isomerase enzymes. These enzymes include cyclophilins and FK506-binding proteins, which are well known for their isomerization-independent role as cellular targets for immunosuppressive drugs. The significance of enzyme-catalyzed prolyl cis-trans isomerization as an important regulatory mechanism in human physiology and pathology was not recognized until the discovery of the phosphorylation-specific prolyl isomerase Pin1. Recent studies indicate that both phosphorylation-dependent and phosphorylation-independent prolyl cis-trans isomerization can act as a novel molecular timer to help control the amplitude and duration of a cellular process, and prolyl cis-trans isomerization might be a new target for therapeutic interventions.

  20. Polymorphism of linoleic acid (cis-9, cis-12-octadecadienoic acid) and alpha-linolenic acid (cis-9, cis-12, cis-15-octadecatrienoic acid).

    PubMed

    Ueno, S; Miyazaki, A; Yano, J; Furukawa, Y; Suzuki, M; Sato, K

    2000-10-01

    Crystallization and polymorphic properties of linoleic acid (cis-9, cis-12-Octadecadienoic acid) (LA) and alpha-linolenic acid (cis-9, cis-12, cis-15-Octadecatrienoic acid) (alpha-LNA) have been studied by optical microscopy, differential scanning calorimetry (DSC) and X-ray diffraction (XRD). The DSC analyses presented three polymorphs in LA, and two polymorphs in alpha-LNA. The XRD patterns of the higher- and lower-temperature forms in LA and alpha-LNA showed orthorhombic O'(//)+O-like and O'(//) subcell, which were similar to those of alpha- and gamma-forms of mono-unsaturated fatty acids, respectively. From the solvent crystallization of LA and alpha-LNA in acetonitrile, single crystals of the higher temperature polymorphs have been obtained. The crystal habits of truncated rhombic shape were also similar to those of alpha-forms of the mono-unsaturated fatty acids. The enthalpy and entropy values of fusion and dissolution of the alpha-forms of LA, alpha-LNA and oleic acid showed that the two values decreased with increasing number of the cis-double bond.

  1. Serine/Arginine-Rich Splicing Factor 3 and Heterogeneous Nuclear Ribonucleoprotein A1 Regulate Alternative RNA Splicing and Gene Expression of Human Papillomavirus 18 through Two Functionally Distinguishable cis Elements

    PubMed Central

    Ajiro, Masahiko; Tang, Shuang; Doorbar, John

    2016-01-01

    ABSTRACT Human papillomavirus 18 (HPV18) is the second most common oncogenic HPV type associated with cervical, anogenital, and oropharyngeal cancers. Like other oncogenic HPVs, HPV18 encodes two major (one early and one late) polycistronic pre-mRNAs that are regulated by alternative RNA splicing to produce a repertoire of viral transcripts for the expression of individual viral genes. However, RNA cis-regulatory elements and trans-acting factors contributing to HPV18 alternative RNA splicing remain unknown. In this study, an exonic splicing enhancer (ESE) in the nucleotide (nt) 3520 to 3550 region in the HPV18 genome was identified and characterized for promotion of HPV18 929^3434 splicing and E1^E4 production through interaction with SRSF3, a host oncogenic splicing factor differentially expressed in epithelial cells and keratinocytes. Introduction of point mutations in the SRSF3-binding site or knockdown of SRSF3 expression in cells reduces 929^3434 splicing and E1^E4 production but activates other, minor 929^3465 and 929^3506 splicing. Knockdown of SRSF3 expression also enhances the expression of E2 and L1 mRNAs. An exonic splicing silencer (ESS) in the HPV18 nt 612 to 639 region was identified as being inhibitory to the 233^416 splicing of HPV18 E6E7 pre-mRNAs via binding to hnRNP A1, a well-characterized, abundantly and ubiquitously expressed RNA-binding protein. Introduction of point mutations into the hnRNP A1-binding site or knockdown of hnRNP A1 expression promoted 233^416 splicing and reduced E6 expression. These data provide the first evidence that the alternative RNA splicing of HPV18 pre-mRNAs is subject to regulation by viral RNA cis elements and host trans-acting splicing factors. IMPORTANCE Expression of HPV18 genes is regulated by alternative RNA splicing of viral polycistronic pre-mRNAs to produce a repertoire of viral early and late transcripts. RNA cis elements and trans-acting factors contributing to HPV18 alternative RNA splicing have been

  2. Serine/Arginine-Rich Splicing Factor 3 and Heterogeneous Nuclear Ribonucleoprotein A1 Regulate Alternative RNA Splicing and Gene Expression of Human Papillomavirus 18 through Two Functionally Distinguishable cis Elements.

    PubMed

    Ajiro, Masahiko; Tang, Shuang; Doorbar, John; Zheng, Zhi-Ming

    2016-10-15

    Human papillomavirus 18 (HPV18) is the second most common oncogenic HPV type associated with cervical, anogenital, and oropharyngeal cancers. Like other oncogenic HPVs, HPV18 encodes two major (one early and one late) polycistronic pre-mRNAs that are regulated by alternative RNA splicing to produce a repertoire of viral transcripts for the expression of individual viral genes. However, RNA cis-regulatory elements and trans-acting factors contributing to HPV18 alternative RNA splicing remain unknown. In this study, an exonic splicing enhancer (ESE) in the nucleotide (nt) 3520 to 3550 region in the HPV18 genome was identified and characterized for promotion of HPV18 929^3434 splicing and E1^E4 production through interaction with SRSF3, a host oncogenic splicing factor differentially expressed in epithelial cells and keratinocytes. Introduction of point mutations in the SRSF3-binding site or knockdown of SRSF3 expression in cells reduces 929^3434 splicing and E1^E4 production but activates other, minor 929^3465 and 929^3506 splicing. Knockdown of SRSF3 expression also enhances the expression of E2 and L1 mRNAs. An exonic splicing silencer (ESS) in the HPV18 nt 612 to 639 region was identified as being inhibitory to the 233^416 splicing of HPV18 E6E7 pre-mRNAs via binding to hnRNP A1, a well-characterized, abundantly and ubiquitously expressed RNA-binding protein. Introduction of point mutations into the hnRNP A1-binding site or knockdown of hnRNP A1 expression promoted 233^416 splicing and reduced E6 expression. These data provide the first evidence that the alternative RNA splicing of HPV18 pre-mRNAs is subject to regulation by viral RNA cis elements and host trans-acting splicing factors. Expression of HPV18 genes is regulated by alternative RNA splicing of viral polycistronic pre-mRNAs to produce a repertoire of viral early and late transcripts. RNA cis elements and trans-acting factors contributing to HPV18 alternative RNA splicing have been discovered in this

  3. Missed Appendicitis: Mimicking Urologic Symptoms

    PubMed Central

    Akhavizadegan, Hamed

    2012-01-01

    Appendicitis, a common disease, has different presentations. This has made its diagnosis difficult. This paper aims to present two cases of missed appendicitis with completely urologic presentation and the way that helped us to reach the correct diagnosis. The first case with symptoms fully related to kidney and the second mimicking epididymorchitis hindered prompt diagnosis. Right site of the pain, relapsing fever, frequent physical examination, and resistance to medical treatment were main clues which help us to make correct diagnosis. PMID:23326748

  4. Multiple Functional Variants in cis Modulate PDYN Expression.

    PubMed

    Babbitt, Courtney C; Silverman, Jesse S; Haygood, Ralph; Reininga, Jennifer M; Rockman, Matthew V; Wray, Gregory A

    2010-02-01

    Understanding genetic variation and its functional consequences within cis-regulatory regions remains an important challenge in human genetics and evolution. Here, we present a fine-scale functional analysis of segregating variation within the cis-regulatory region of prodynorphin, a gene that encodes an endogenous opioid precursor with roles in cognition and disease. In order to characterize the functional consequences of segregating variation in cis in a region under balancing selection in different human populations, we examined associations between specific polymorphisms and gene expression in vivo and in vitro. We identified five polymorphisms within the 5' flanking region that affect transcript abundance: a 68-bp repeat recognized in prior studies, as well as two microsatellites and two single nucleotide polymorphisms not previously implicated as functional variants. The impact of these variants on transcription differs by brain region, sex, and cell type, implying interactions between cis genotype and the differentiated state of cells. The effects of individual variants on expression level are not additive in some combinations, implying epistatic interactions between nearby variants. These data reveal an unexpectedly complex relationship between segregating genetic variation and its expression-trait consequences and highlights the importance of close functional scrutiny of natural genetic variation within even relatively well-studied cis-regulatory regions.

  5. Human cytomegalovirus contains a tegument protein that enhances transcription from promoters with upstream ATF and AP-1 cis-acting elements.

    PubMed Central

    Liu, B; Stinski, M F

    1992-01-01

    The tegument proteins of human cytomegalovirus are introduced into cells as components of infectious virus. The tegument proteins may affect viral and cellular transcription prior to the synthesis of the immediate-early viral regulatory proteins. The phosphorylated tegument protein of 71 kDa (pp71) is reported to be encoded by the UL82 gene. The UL82 gene products transactivated promoters containing upstream ATF or AP-1 binding sites. In contrast, the phosphorylated tegument protein of 65 kDa (pp65), encoded by the UL83 gene, had no detectable effect on these promoters. Enhancement by UL82 of downstream transcription was directly proportional to the number of upstream ATF sites. Response to UL82 transactivation was abolished by mutation of the ATF site. Mutation in the carboxy-terminal region of UL82 also eliminated transactivation. Even though the major immediate-early promoter of human cytomegalovirus is a strong enhancer-containing promoter, UL82 further enhanced its transcription as much as 20-fold. The mechanism of UL82 enhancement of transcription from viral or cellular promoters is not known, but the enhancement may be mediated by triggering one of the protein kinase signaling pathways, increasing the affinity of ATF or AP-1 for the target sequence, or stabilizing the complex between the eucaryotic transcription factor and the target sequence. Images PMID:1318413

  6. Identification of cis-acting sequences responsible for phorbol ester induction of human serum amyloid A gene expression via a nuclear factor kB-like transcription factor

    SciTech Connect

    Edbrooke, M.R.; Cheshire, J.K.; Woo, P.; Burt, B.W.

    1989-05-01

    The authors have analyzed the 5'-flanking region of one of the genes coding for the human acute-phase protein, serum amyloid A (SAA). They found that SAA mRNA could be increased fivefold in transfected cells by treatment with phorbol 12-myristate 13-acetate (PMA). To analyze this observation further, they placed a 265-base-pair 5' SAA fragment upstream of the reporter chloramphenicol acetyltransferase (CAT) gene and transfected this construct into HeLa cells. PMA treatment of these transient transfectants resulted in increased CAT expression. Nuclear proteins from PMA-treated HeLa cells bound to this DNA fragment, and methylation interference analysis showed that the binding was specific to the sequence GGGACTTTCC (between -82 and -91), a sequence previously described by others as the binding site for the nuclear factor NF/kappa/B. In a cotransfection competition experiment, they could abolish PMA-induced CAT activity by using cloned human immunodeficiency virus long-terminal-repeat DNA containing the NF/kappa/B-binding sequence. The same long-terminal-repeat DNA containing mutant NF/kappa/B-binding sequences did not affect CAT expression, which suggested that binding by an NF/kappa/B-like factor is required for increased SAA transcription.

  7. The Community Intercomparison Suite (CIS)

    NASA Astrophysics Data System (ADS)

    Watson-Parris, Duncan; Schutgens, Nick; Cook, Nick; Kipling, Zak; Kershaw, Phil; Gryspeerdt, Ed; Lawrence, Bryan; Stier, Philip

    2017-04-01

    Earth observations (both remote and in-situ) create vast amounts of data providing invaluable constraints for the climate science community. Efficient exploitation of these complex and highly heterogeneous datasets has been limited however by the lack of suitable software tools, particularly for comparison of gridded and ungridded data, thus reducing scientific productivity. CIS (http://cistools.net) is an open-source, command line tool and Python library which allows the straight-forward quantitative analysis, intercomparison and visualisation of remote sensing, in-situ and model data. The CIS can read gridded and ungridded remote sensing, in-situ and model data - and many other data sources 'out-of-the-box', such as ESA Aerosol and Cloud CCI product, MODIS, Cloud CCI, Cloudsat, AERONET. Perhaps most importantly however CIS also employs a modular plugin architecture to allow for the reading of limitless different data types. Users are able to write their own plugins for reading the data sources which they are familiar with, and share them within the community, allowing all to benefit from their expertise. To enable the intercomparison of this data the CIS provides a number of operations including: the aggregation of ungridded and gridded datasets to coarser representations using a number of different built in averaging kernels; the subsetting of data to reduce its extent or dimensionality; the co-location of two distinct datasets onto a single set of co-ordinates; the visualisation of the input or output data through a number of different plots and graphs; the evaluation of arbitrary mathematical expressions against any number of datasets; and a number of other supporting functions such as a statistical comparison of two co-located datasets. These operations can be performed efficiently on local machines or large computing clusters - and is already available on the JASMIN computing facility. A case-study using the GASSP collection of in-situ aerosol observations

  8. Activation of the major immediate early gene of human cytomegalovirus by cis-acting elements in the promoter-regulatory sequence and by virus-specific trans-acting components.

    PubMed Central

    Stinski, M F; Roehr, T J

    1985-01-01

    Upstream of the major immediate early gene of human cytomegalovirus (Towne) is a strong promoter-regulatory region that promotes the synthesis of 1.95-kilobase mRNA (D. R. Thomsen, R. M. Stenberg, W. F. Goins, and M. F. Stinski, Proc. Natl. Acad. Sci. U.S.A. 81:659-663, 1984; M. F. Stinski, D. R. Thomsen, R. M. Stenberg, and L. C. Goldstein, J. Virol. 46:1-14, 1983). The wild-type promoter-regulatory region as well as deletions within this region were ligated upstream of the thymidine kinase, chloramphenicol acetyltransferase, or ovalbumin genes. These gene chimeras were constructed to investigate the role of the regulatory sequences in enhancing downstream expression. The regulatory region extends to approximately 465 nucleotides upstream of the cap site for the initiation of transcription. The extent and type of regulatory sequences upstream of the promoter influences the level of in vitro transcription as well as the amount of in vivo expression of the downstream gene. The regulatory elements for cis-activation appear to be repeated several times within the regulatory region. A direct correlation was established between the distribution of the 19 (5' CCCCAGTTGACGTCAATGGG 3')- and 18 (5' CACTAACGGGACTTTCCAA 3')-nucleotide repeats and the level of downstream expression. In contrast, the 16 (5' CTTGGCAGTACATCAA 3')-nucleotide repeat is not necessary for the enhancement of downstream expression. In a domain associated with the 19- or 18-nucleotide repeats are elements that can be activated in trans by a human cytomegalovirus-specified component but not a herpes simplex virus-specified component. Therefore, the regulatory sequences of the major immediate early gene of human cytomegalovirus have an important role in interacting with cellular and virus-specific factors of the transcription complex to enhance downstream expression of this critical viral gene. Images PMID:2991567

  9. Efficacy of a combination of human recombinant erythropoietin + 13-cis-retinoic acid and dihydroxylated vitamin D3 to improve moderate to severe anaemia in low/intermediate risk myelodysplastic syndromes.

    PubMed

    Ferrero, Dario; Darbesio, Antonella; Giai, Valentina; Genuardi, Mariella; Dellacasa, Chiara Maria; Sorasio, Roberto; Bertini, Marilena; Boccadoro, Mario

    2009-02-01

    The efficacy of human recombinant erythropoietin (rEPO) in myelodysplastic syndromes (MDS) has generally been best in untransfused patients with 'refractory anaemia' according to the World Health Organization (WHO). We treated 63 MDS patients [excluding refractory anaemia with excess blasts, type 2 (RAEB2)] with a previously tested combination of 13-cis-retinoic acid and dihydroxylated vitamin D3 +/- 6-thioguanine in addition to rEPO. Most patients were categorized as refractory cytopenia with multilineage dysplasia and RAEB1, with intermediate 1 International Prognostic Scoring System (IPSS) score; all had Hb <95 g/l, and 70% required regular erythrocyte transfusions. Treatment was well tolerated, and erythroid response rate according to new International Working Group criteria was 60%: 50% in RAEB1 and 64% in non-RAEB patients (P = 0.383). Response rate was not affected by transfusion requirement (63%; 58% in untransfused), IPSS and WHO Prognostic Scoring System scores, and weekly rEPO dosage (30-50 000 U vs. 80 000 U). Median response duration was 16 months. Median survival reached 14 months for RAEB1 and 55 months for non-RAEB patients, with a significant difference in the latter between responders and non-responders (median 82 months vs. 44 months; P = 0.036). Our combined therapy, independent of rEPO dosage, achieved in patients with unfavourable response predictors, a rate of anaemia improvement comparable to the best obtained in lower risk patients by high-dose rEPO.

  10. Concurrent liquid chromatographic separation and photodiode array detection of retinol, tocopherols, all-trans-alpha-carotene, all-trans-beta-carotene and the mono-cis isomers of beta-carotene in extracts of human plasma.

    PubMed

    Lane, J R; Webb, L W; Acuff, R V

    1997-11-07

    In this report we describe the development of a method for the concurrent reversed-phase high-performance liquid chromatographic separation and photodiode array detection of human plasma retinol, tocopherols and carotenes. For a single sample injection, retinol, retinyl acetate, alpha-tocopherol, gamma-tocopherol, alpha-tocopheryl acetate, all-trans-alpha-carotene and all-trans-beta-carotene, as well as the mono-cis geometrical isomers of beta-carotene were separated and detected. Analytical separations were performed at a subambient temperature (0 degree C) over a Suplex pKb-100 reversed-phase analytical column with an isocratic mobile phase of methanol-methyl tert.-butyl ether-water (80:20:5, v/v/v) at a flow-rate of 0.8 ml/min for 60 min. Standards and samples were reconstituted in ethanol, and typically, 50 microliters was injected for analysis. By HPLC, compounds of interest were clearly resolved and detectable at the picomole level.

  11. The use of cis-parinaric acid to determine lipid peroxidation in human erythrocyte membranes. Comparison of normal and sickle erythrocyte membranes.

    PubMed

    Van den Berg, J J; Kuypers, F A; Qju, J H; Chiu, D; Lubin, B; Roelofsen, B; Op den Kamp, J A

    1988-09-15

    The recently developed parinaric acid assay is shown to offer possibilities for studying peroxidation processes in biological membrane systems. Taking the human erythrocyte membrane as a model, several initiating systems were investigated, as well as the effect of residual hemoglobin in ghost membrane preparations. The effectivity of a radical generating system appeared to be strongly dependent upon whether radicals are generated at the membrane level or in the water phase. Thus, cumene hydroperoxide at concentrations of 1.0-1.5 mM was found to be a very efficient initiator of peroxidation in combination with submicromolar levels of hemin-Fe3+ as membrane-bound cofactor. In combination with cumene hydroperoxide, membrane-bound hemoglobin appeared to be about 6-times more effective in promoting peroxidation than hemoglobin in the water phase. Results comparing the behaviour of normal and sickle erythrocyte ghost suspensions in the peroxidation assay suggest that the increased oxidative stress on sickle erythrocyte membranes could be due to enhanced membrane binding of sickle hemoglobin, but also partly to a characteristically higher capability of sickle hemoglobin to promote peroxidation. The order of peroxidation-promoting capabilities that could be derived from the experiments was hemin greater than sickle hemoglobin greater than normal hemoglobin.

  12. Cis and Trans Acting Factors Involved in Human Cytomegalovirus Experimental and Natural Latent Infection of CD14 (+) Monocytes and CD34 (+) Cells

    PubMed Central

    Pari, Gregory S.

    2013-01-01

    The parameters involved in human cytomegalovirus (HCMV) latent infection in CD14 (+) and CD34 (+) cells remain poorly identified. Using next generation sequencing we deduced the transcriptome of HCMV latently infected CD14 (+) and CD34 (+) cells in experimental as well as natural latency settings. The gene expression profile from natural infection in HCMV seropositive donors closely matched experimental latency models, and included two long non-coding RNAs (lncRNAs), RNA4.9 and RNA2.7 as well as the mRNAs encoding replication factors UL84 and UL44. Chromatin immunoprecipitation assays on experimentally infected CD14 (+) monocytes followed by next generation sequencing (ChIP-Seq) were employed to demonstrate both UL84 and UL44 proteins interacted with the latent viral genome and overlapped at 5 of the 8 loci identified. RNA4.9 interacts with components of the polycomb repression complex (PRC) as well as with the MIE promoter region where the enrichment of the repressive H3K27me3 mark suggests that this lncRNA represses transcription. Formaldehyde Assisted Isolation of Regulatory Elements (FAIRE), which identifies nucleosome-depleted viral DNA, was used to confirm that latent mRNAs were associated with actively transcribed, FAIRE analysis also showed that the terminal repeat (TR) region of the latent viral genome is depleted of nucleosomes suggesting that this region may contain an element mediating viral genome maintenance. ChIP assays show that the viral TR region interacts with factors associated with the pre replication complex and a plasmid subclone containing the HCMV TR element persisted in latently infected CD14 (+) monocytes, strongly suggesting that the TR region mediates viral chromosome maintenance. PMID:23717203

  13. Mimicking herpes simplex virus 1 and herpes simplex virus 2 mucosal behavior in a well-characterized human genital organ culture.

    PubMed

    Steukers, Lennert; Weyers, Steven; Yang, Xiaoyun; Vandekerckhove, Annelies P; Glorieux, Sarah; Cornelissen, Maria; Van den Broeck, Wim; Temmerman, Marleen; Nauwynck, Hans J

    2014-07-15

    We developed and morphologically characterized a human genital mucosa explant model (endocervix and ectocervix/vagina) to mimic genital herpes infections caused by herpes simplex virus types 1 (HSV-1) and 2 (HSV-2). Subsequent analysis of HSV entry receptor expression throughout the menstrual cycle in genital tissues was performed, and the evolution of HSV-1/-2 mucosal spread over time was assessed. Nectin-1 and -2 were expressed in all tissues during the entire menstrual cycle. Herpesvirus entry mediator expression was limited mainly to some connective tissue cells. Both HSV-1 and HSV-2 exhibited a plaque-wise mucosal spread across the basement membrane and induced prominent epithelial syncytia.

  14. Sequence polymorphisms cause many false cis eQTLs.

    PubMed

    Alberts, Rudi; Terpstra, Peter; Li, Yang; Breitling, Rainer; Nap, Jan-Peter; Jansen, Ritsert C

    2007-07-18

    Many investigations have reported the successful mapping of quantitative trait loci (QTLs) for gene expression phenotypes (eQTLs). Local eQTLs, where expression phenotypes map to the genes themselves, are of especially great interest, because they are direct candidates for previously mapped physiological QTLs. Here we show that many mapped local eQTLs in genetical genomics experiments do not reflect actual expression differences caused by sequence polymorphisms in cis-acting factors changing mRNA levels. Instead they indicate hybridization differences caused by sequence polymorphisms in the mRNA region that is targeted by the microarray probes. Many such polymorphisms can be detected by a sensitive and novel statistical approach that takes the individual probe signals into account. Applying this approach to recent mouse and human eQTL data, we demonstrate that indeed many local eQTLs are falsely reported as "cis-acting" or "cis" and can be successfully detected and eliminated with this approach.

  15. The dominant Anopheles vectors of human malaria in Africa, Europe and the Middle East: occurrence data, distribution maps and bionomic précis

    PubMed Central

    2010-01-01

    Background This is the second in a series of three articles documenting the geographical distribution of 41 dominant vector species (DVS) of human malaria. The first paper addressed the DVS of the Americas and the third will consider those of the Asian Pacific Region. Here, the DVS of Africa, Europe and the Middle East are discussed. The continent of Africa experiences the bulk of the global malaria burden due in part to the presence of the An. gambiae complex. Anopheles gambiae is one of four DVS within the An. gambiae complex, the others being An. arabiensis and the coastal An. merus and An. melas. There are a further three, highly anthropophilic DVS in Africa, An. funestus, An. moucheti and An. nili. Conversely, across Europe and the Middle East, malaria transmission is low and frequently absent, despite the presence of six DVS. To help control malaria in Africa and the Middle East, or to identify the risk of its re-emergence in Europe, the contemporary distribution and bionomics of the relevant DVS are needed. Results A contemporary database of occurrence data, compiled from the formal literature and other relevant resources, resulted in the collation of information for seven DVS from 44 countries in Africa containing 4234 geo-referenced, independent sites. In Europe and the Middle East, six DVS were identified from 2784 geo-referenced sites across 49 countries. These occurrence data were combined with expert opinion ranges and a suite of environmental and climatic variables of relevance to anopheline ecology to produce predictive distribution maps using the Boosted Regression Tree (BRT) method. Conclusions The predicted geographic extent for the following DVS (or species/suspected species complex*) is provided for Africa: Anopheles (Cellia) arabiensis, An. (Cel.) funestus*, An. (Cel.) gambiae, An. (Cel.) melas, An. (Cel.) merus, An. (Cel.) moucheti and An. (Cel.) nili*, and in the European and Middle Eastern Region: An. (Anopheles) atroparvus, An. (Ano

  16. Recycling Of Cis Photovoltaic Waste

    DOEpatents

    Drinkard, Jr., William F.; Long, Mark O.; Goozner; Robert E.

    1998-07-14

    A method for extracting and reclaiming metals from scrap CIS photovoltaic cells and associated photovoltaic manufacturing waste by leaching the waste with dilute nitric acid, skimming any plastic material from the top of the leaching solution, separating glass substrate from the leachate, electrolyzing the leachate to plate a copper and selenium metal mixture onto a first cathode, replacing the cathode with a second cathode, re-electrolyzing the leachate to plate cadmium onto the second cathode, separating the copper from selenium, and evaporating the depleted leachate to yield a zinc and indium containing solid.

  17. Low cost CIS device processing

    NASA Astrophysics Data System (ADS)

    Başol, B. M.; Kapur, V. K.; Leidholm, C. R.; Roe, R.; Halani, A.; Norsworthy, G.

    1997-02-01

    CIS films were grown on soda-lime glass/Mo substrates using a low cost, non-vacuum technique. Morphology of the resulting layers was improved and solar cells with 12.4% total area efficiency were demonstrated on these films. A submodule of about 25 cm2 area was also fabricated with a conversion efficiency of 8.17%. Work is now in progress to grow films containing Ga and/or S and to take this technology to larger scale production.

  18. Gene expression profiling of cultured human NF1 heterozygous (NF1+/-) melanocytes reveals downregulation of a transcriptional cis-regulatory network mediating activation of the melanocyte-specific dopachrome tautomerase (DCT) gene.

    PubMed

    Boucneau, Joachim; De Schepper, Sofie; Vuylsteke, Marnik; Van Hummelen, Paul; Naeyaert, Jean-Marie; Lambert, Jo

    2005-08-01

    One of the major primary features of the neurocutaneous genetic disorder Neurofibromatosis type 1 are the hyperpigmentary café-au-lait macules where disregulation of melanocyte biology is supposed to play a key etiopathogenic role. To gain better insight into the possible role of the tumor suppressor gene NF1, a transcriptomic microarray analysis was performed on human NF1 heterozygous (NF1+/-) melanocytes of a Neurofibromatosis type 1 patient and NF1 wild type (NF1+/+) melanocytes of a healthy control patient, both cultured from normally pigmented skin and hyperpigmented lesional café-au-lait skin. From the magnitude of gene effects, we found that gene expression was affected most strongly by genotype and less so by lesional type. A total of 137 genes had a significant twofold or more up- (72) or downregulated (65) expression in NF1+/- melanocytes compared with NF1+/+ melanocytes. Melanocytes cultured from hyperpigmented café-au-lait skin showed 37 upregulated genes whereas only 14 were downregulated compared with normal skin melanocytes. In addition, significant genotype xlesional type interactions were observed for 465 genes. Differentially expressed genes were mainly involved in regulating cell proliferation and cell adhesion. A high number of transcription factor genes, among which a specific subset important in melanocyte lineage development, were downregulated in the cis-regulatory network governing the activation of the melanocyte-specific dopachrome tautomerase (DCT) gene. Although the results presented have been obtained with a restricted number of patients (one NF1 patient and one control) and using cDNA microarrays that may limit their interpretation, the data nevertheless addresses for the first time the effect of a heterozygous NF1 gene on the expression of the human melanocyte transcriptome and has generated several interesting candidate genes helpful in elucidating the etiopathology of café-au-lait macules in NF1 patients.

  19. Megakaryocytes mimicking metastatic breast carcinoma.

    PubMed

    Hoda, Syed A; Resetkova, Erika; Yusuf, Yasmin; Cahan, Anthony; Rosen, Paul P

    2002-05-01

    False-positive diagnosis of lymph nodes occurs when a benign element in a lymph node, or in its capsule, is interpreted as metastatic carcinoma. This report describes a patient with breast carcinoma who had megakaryocytes in axillary sentinel lymph nodes mimicking metastatic carcinoma. The patient had no history of a hematologic disease, and we found no evidence of a concurrent hematopoietic disorder. The megakaryocytes were reactive for CD31, CD61, and von Willebrand factor, but not for cytokeratin (AE1/AE3). Megakaryocytes should be added to the list of benign histologic abnormalities that may simulate metastatic carcinoma in a sentinel lymph node.

  20. Norwegian scabies mimicking rupioid psoriasis*

    PubMed Central

    Costa, Juliana Bastos; de Sousa, Virna Lygia Lobo Rocha; da Trindade Neto, Pedro Bezerra; Paulo Filho, Thomás de Aquino; Cabral, Virgínia Célia Dias Florêncio; Pinheiro, Patrícia Moura Rossiter

    2012-01-01

    Norwegian scabies is a highly contagious skin infestation caused by an ectoparasite, Scarcoptes scabiei var. Hominis, which mainly affects immunosuppressed individuals. Clinically, it may simulate various dermatoses such as psoriasis, Darier's disease, seborrheic dermatitis, among others. This is a case report of a 33-year-old woman, immunocompetent, diagnosed with generalized anxiety disorder (cancer phobia), who had erythematous, well-defined plaques, covered with rupioid crusts, on her neck, axillary folds, breast, periumbilical region, groin area, besides upper back and elbows, mimicking an extremely rare variant of psoriasis, denominated rupioid psoriasis. PMID:23197214

  1. Tinea capitis mimicking folliculitis decalvans.

    PubMed

    Tangjaturonrusamee, C; Piraccini, B M; Vincenzi, C; Starace, M; Tosti, A

    2011-01-01

    We report on an adult patient with tinea capitis caused by Microsporum canis, who presented with diffuse alopecia and follicular pustules, mimicking folliculitis decalvans. Examination of the scalp showed severe alopecia with prominent involvement of the frontal and vertex scalp: the skin was markedly erythematous with pustules and brownish crusts. Videodermoscopy revealed visible follicular ostia, numerous pustular lesions and several comma hairs. Fluconazole 150 mg a week for 8 weeks associated with ketoconazole shampoo cleared the inflammatory lesions and produced complete hair regrowth. © 2009 Blackwell Verlag GmbH.

  2. The great mimickers of rosacea.

    PubMed

    Olazagasti, Jeannette; Lynch, Peter; Fazel, Nasim

    2014-07-01

    Although rosacea is one of the most common conditions treated by dermatologists, it also is one of the most misunderstood. It is a chronic disorder affecting the central parts of the face and is characterized by frequent flushing; persistent erythema (ie, lasting for at least 3 months); telangiectasia; and interspersed episodes of inflammation with swelling, papules, and pustules. Understanding the clinical variants and disease course of rosacea is important to differentiate this entity from other conditions that can mimic rosacea. Herein we present several mimickers of rosacea that physicians should consider when diagnosing this condition.

  3. Splenic inflammatory pseudotumor mimicking angiosarcoma.

    PubMed

    Hsu, Chao-Wen; Lin, Chieh-Hsin; Yang, Tsung-Lung; Chang, Hong-Tai

    2008-11-07

    Splenic tumors are rare. Differentiation of the tumors before operation is of great value regarding the outcome. A case of a 32-year-old man with a splenic inflammatory pseudotumor (IPT) mimicking splenic angiosarcoma is described. The tumor was highly suspected of being splenic angiosarcoma based on radiological findings preoperatively. However, after splenectomy, histopathological examinations revealed splenic IPT. Splenic IPT and angiosarcoma are rare and often pose diagnostic difficulties because the clinical and radiological findings are obscure. Due to large differences in prognosis, we briefly reviewed the clinical, radiological, and pathological features of both of the tumors.

  4. Splenic inflammatory pseudotumor mimicking angiosarcoma

    PubMed Central

    Hsu, Chao-Wen; Lin, Chieh-Hsin; Yang, Tsung-Lung; Chang, Hong-Tai

    2008-01-01

    Splenic tumors are rare. Differentiation of the tumors before operation is of great value regarding the outcome. A case of a 32-year-old man with a splenic inflammatory pseudotumor (IPT) mimicking splenic angiosarcoma is described. The tumor was highly suspected of being splenic angiosarcoma based on radiological findings preoperatively. However, after splenectomy, histopathological examinations revealed splenic IPT. Splenic IPT and angiosarcoma are rare and often pose diagnostic difficulties because the clinical and radiological findings are obscure. Due to large differences in prognosis, we briefly reviewed the clinical, radiological, and pathological features of both of the tumors. PMID:19009664

  5. Mimicking Melanosomes: Polydopamine Nanoparticles as Artificial Microparasols

    PubMed Central

    2017-01-01

    A primary role of melanin in skin is the prevention of UV-induced nuclear DNA damage to human skin cells, where it serves to screen out harmful UV radiation. Melanin is delivered to keratinocytes in the skin after being excreted as melanosomes from melanocytes. Defects in melanin production in humans can cause diseases, many of which currently lack effective treatments due to their genetic origins (e.g., skin cancer, vitiligo, and albinism). The widespread prevalence of melanin-related diseases and an increasing interest in the performance of various polymeric materials related to melanin necessitates novel synthetic routes for preparing melanin-like materials. In this work, we prepared melanin-like nanoparticles (MelNPs) via spontaneous oxidation of dopamine, as biocompatible, synthetic analogues of naturally occurring melanosomes, and investigated their uptake, transport, distribution, and UV-protective capabilities in human keratinocytes. Critically, we demonstrate that MelNPs are endocytosed, undergo perinuclear aggregation, and form a supranuclear cap, or so-called microparasol in human epidermal keratinocytes (HEKa), mimicking the behavior of natural melananosomes in terms of cellular distribution and the fact that they serve to protect the cells from UV damage. PMID:28691067

  6. Tissue-Mimicking Geometrical Constraints Stimulate Tissue-Like Constitution and Activity of Mouse Neonatal and Human-Induced Pluripotent Stem Cell-Derived Cardiac Myocytes.

    PubMed

    Pilarczyk, Götz; Raulf, Alexandra; Gunkel, Manuel; Fleischmann, Bernd K; Lemor, Robert; Hausmann, Michael

    2016-01-07

    The present work addresses the question of to what extent a geometrical support acts as a physiological determining template in the setup of artificial cardiac tissue. Surface patterns with alternating concave to convex transitions of cell size dimensions were used to organize and orientate human-induced pluripotent stem cell (hIPSC)-derived cardiac myocytes and mouse neonatal cardiac myocytes. The shape of the cells, as well as the organization of the contractile apparatus recapitulates the anisotropic line pattern geometry being derived from tissue geometry motives. The intracellular organization of the contractile apparatus and the cell coupling via gap junctions of cell assemblies growing in a random or organized pattern were examined. Cell spatial and temporal coordinated excitation and contraction has been compared on plain and patterned substrates. While the α-actinin cytoskeletal organization is comparable to terminally-developed native ventricular tissue, connexin-43 expression does not recapitulate gap junction distribution of heart muscle tissue. However, coordinated contractions could be observed. The results of tissue-like cell ensemble organization open new insights into geometry-dependent cell organization, the cultivation of artificial heart tissue from stem cells and the anisotropy-dependent activity of therapeutic compounds.

  7. Beta-human chorionic gonadotropin expression in recurrent and metastatic giant cell tumors of bone: a potential mimicker of germ cell tumor.

    PubMed

    Lawless, Margaret E; Jour, George; Hoch, Benjamin L; Rendi, Mara H

    2014-10-01

    Giant cell tumors of bone (GCTs) are generally benign, locally aggressive neoplasms that rarely metastasize. The beta subunit of human chorionic gonadotropin (beta-hCG) is expressed in syncytiotrophoblasts and several nongynecologic neoplasms but has not been described in GCT. At our institution, we observed cases of elevated beta-hCG in patients with GCT leading to diagnostic difficulty and in one case, concern for metastatic choriocarcinoma. This study aims to determine the frequency of beta-hCG expression in GCT and any relationship to clinical aggressiveness. We evaluated tissue expression of beta-hCG by immunohistochemistry with 58% of cases staining for beta-hCG. Additionally, 2 of 11 patients with available serum and/or urine beta-hCG measurements demonstrated elevated beta-hCG due to tumor. It is important to be aware of beta-hCG expression by GCT and the potential for elevated urine and serum beta-hCG levels in patients with GCT so as to avoid misdiagnosis of pregnancy or gestational trophoblastic disease.

  8. A New Mouse Model of Limb-Girdle Muscular Dystrophy Type 2I Homozygous for the Common L276I Mutation Mimicking the Mild Phenotype in Humans.

    PubMed

    Krag, Thomas O; Vissing, John

    2015-12-01

    Limb-girdle muscular dystrophy type 2I (LGMD2I) is caused by mutations in the Fukutin-related protein (FKRP) gene, leading to inadequate glycosylation of α-dystroglycan, an important protein linking the extracellular matrix to the cytoskeleton. We created a mouse model of the common FKRP L276I mutation and a hemizygous FKRP L276I knockout model. We studied histopathology and protein expression in the models at different ages and found that homozygous FKRP L276I mice developed a mild progressive myopathy with increased muscle regeneration and fibrosis starting from 1 year of age. This was likely caused by progressive loss of α-dystroglycan-specific glycosylation, which was decreased by 78% at 20 months. The homozygous FKRP knockout was embryonic lethal, but the hemizygous L276I model resembled the homozygous FKRP L276I model at comparable ages. These models emphasize the importance of FKRP in maintaining proper glycosylation of α-dystroglycan. The mild progression in the homozygous FKRP L276I model resembles that in patients with LGMD2I who are homozygous for the L276I mutation. This animal model could, therefore, be relevant for understanding the pathophysiology of and developing a treatment strategy for the human disorder.

  9. Tissue-Mimicking Geometrical Constraints Stimulate Tissue-Like Constitution and Activity of Mouse Neonatal and Human-Induced Pluripotent Stem Cell-Derived Cardiac Myocytes

    PubMed Central

    Pilarczyk, Götz; Raulf, Alexandra; Gunkel, Manuel; Fleischmann, Bernd K.; Lemor, Robert; Hausmann, Michael

    2016-01-01

    The present work addresses the question of to what extent a geometrical support acts as a physiological determining template in the setup of artificial cardiac tissue. Surface patterns with alternating concave to convex transitions of cell size dimensions were used to organize and orientate human-induced pluripotent stem cell (hIPSC)-derived cardiac myocytes and mouse neonatal cardiac myocytes. The shape of the cells, as well as the organization of the contractile apparatus recapitulates the anisotropic line pattern geometry being derived from tissue geometry motives. The intracellular organization of the contractile apparatus and the cell coupling via gap junctions of cell assemblies growing in a random or organized pattern were examined. Cell spatial and temporal coordinated excitation and contraction has been compared on plain and patterned substrates. While the α-actinin cytoskeletal organization is comparable to terminally-developed native ventricular tissue, connexin-43 expression does not recapitulate gap junction distribution of heart muscle tissue. However, coordinated contractions could be observed. The results of tissue-like cell ensemble organization open new insights into geometry-dependent cell organization, the cultivation of artificial heart tissue from stem cells and the anisotropy-dependent activity of therapeutic compounds. PMID:26751484

  10. Interaction of a peptide derived from C-terminus of human TRPA1 channel with model membranes mimicking the inner leaflet of the plasma membrane.

    PubMed

    Witschas, Katja; Jobin, Marie-Lise; Korkut, Dursun Nizam; Vladan, Maria Magdalena; Salgado, Gilmar; Lecomte, Sophie; Vlachova, Viktorie; Alves, Isabel D

    2015-05-01

    The transient receptor potential ankyrin 1 channel (TRPA1) belongs to the TRP cation channel superfamily that responds to a panoply of stimuli such as changes in temperature, calcium levels, reactive oxygen and nitrogen species and lipid mediators among others. The TRP superfamily has been implicated in diverse pathological states including neurodegenerative disorders, kidney diseases, inflammation, pain and cancer. The intracellular C-terminus is an important regulator of TRP channel activity. Studies with this and other TRP superfamily members have shown that the C-terminus association with lipid bilayer alters channel sensitivity and activation, especially interactions occurring through basic residues. Nevertheless, it is not yet clear how this process takes place and which regions in the C-terminus would be responsible for such membrane recognition. With that in mind, herein the first putative membrane interacting region of the C-terminus of human TRPA1, (corresponding to a 29 residue peptide, IAEVQKHASLKRIAMQVELHTSLEKKLPL) named H1 due to its potential helical character was chosen for studies of membrane interaction. The affinity of H1 to lipid membranes, H1 structural changes occurring upon this interaction as well as effects of this interaction in lipid organization and integrity were investigated using a biophysical approach. Lipid models systems composed of zwitterionic and anionic lipids, namely those present in the lipid membrane inner leaflet, where H1 is prone to interact, where used. The study reveals a strong interaction and affinity of H1 as well as peptide structuration especially with membranes containing anionic lipids. Moreover, the interactions and peptide structure adoption are headgroup specific. Copyright © 2015 Elsevier B.V. All rights reserved.

  11. Delivery of human mesenchymal adipose-derived stem cells restores multiple urological dysfunctions in a rat model mimicking radical prostatectomy damages through tissue-specific paracrine mechanisms.

    PubMed

    Yiou, René; Mahrouf-Yorgov, Meriem; Trébeau, Céline; Zanaty, Marc; Lecointe, Cécile; Souktani, Richard; Zadigue, Patricia; Figeac, Florence; Rodriguez, Anne-Marie

    2016-02-01

    Urinary incontinence (UI) and erectile dysfunction (ED) are the most common functional urological disorders and the main sequels of radical prostatectomy (RP) for prostate cancer. Mesenchymal stem cell (MSC) therapy holds promise for repairing tissue damage due to RP. Because animal studies accurately replicating post-RP clinical UI and ED are lacking, little is known about the mechanisms underlying the urological benefits of MSC in this setting. To determine whether and by which mechanisms MSC can repair damages to both striated urethral sphincter (SUS) and penis in the same animal, we delivered human multipotent adipose stem cells, used as MSC model, in an immunocompetent rat model replicating post-RP UI and ED. In this model, we demonstrated by using noninvasive methods in the same animal from day 7 to day 90 post-RP injury that MSC administration into both the SUS and the penis significantly improved urinary continence and erectile function. The regenerative effects of MSC therapy were not due to transdifferentiation and robust engraftment at injection sites. Rather, our results suggest that MSC benefits in both target organs may involve a paracrine process with not only soluble factor release by the MSC but also activation of the recipient's secretome. These two effects of MSC varied across target tissues and damaged-cell types. In conclusion, our work provides new insights into the regenerative properties of MSC and supports the ability of MSC from a single source to repair multiple types of damage, such as those seen after RP, in the same individual. © 2015 AlphaMed Press.

  12. Evidence of Sulfur Mustard Exposure in Human Plasma by LC-ESI-MS-MS Detection of the Albumin-Derived Alkylated HETE-CP Dipeptide and Chromatographic Investigation of Its Cis/Trans Isomerism.

    PubMed

    Gandor, Felix; Gawlik, Michael; Thiermann, Horst; John, Harald

    2015-05-01

    Sulfur mustard (SM) is a chemical warfare agent that causes painful blisters and chemically modifies endogenous biomacromolecules by alkylation to hydroxyethylthioethyl (HETE) adducts representing valuable long-term markers for post-exposure analysis. The albumin adduct formed in human plasma in vitro (HETE bound to the side chain of cysteine 34) was isolated and cleaved by current lots of pronase primarily generating the internal modified dipeptide (HETE-cysteine-proline, HETE-CP) instead of the formerly reported HETE-CPF tripeptide. The analyte was detected by liquid chromatography-electrospray ionization tandem-mass spectrometry (LC-ESI-MS-MS). In principle, HETE-CP undergoes a dynamic on-column equilibrium of cis-trans isomerism thus requiring separation at 50°C to obtain one narrow peak. Accordingly, we developed both a novel longer lasting but more sensitive microbore (1 mm i.d., flow 30 µL/min, cycle time 60 min, LOD 50 nM) and a faster, less sensitive narrowbore (2.1 mm i.d., 200 µL/min, cycle time 16 min, LOD 100 nM, both on Atlantis T3 material at 50°C) LC-ESI-MS-MS method suitable for verification analysis. The corresponding tri- and tetrapeptide, Q(HETE)-CPF were monitored simultaneously. HETE-CP peak areas were directly proportional to SM concentrations added to plasma in vitro (0.05-100 µM). Albumin adducts formed by deuterated SM (d8-SM) served as internal standard.

  13. Reactive arthritis mimicking inflammatory bowel disease arthritis: a challenging diagnosis.

    PubMed

    Trabulo, D; Mangualde, J; Cremers, I; Oliveira, A P

    2014-01-01

    Reactive arthritis comprises a subgroup of infection-associated arthritis which occurs after genitourinary or gastrointestinal tract infection in genetically susceptible hosts. Studies have proposed Salmonella, Shigella or Yersinia infection as the microorganisms responsible for the post-dysenteric form. The human leukocyte antigen (HLA)-B27 is a well recognised best-known predisposing factor. We report a case of HLA-B27-associated reactive arthritis after Salmonella goldcoast enteritis, mimicking inflammatory bowel disease arthritis.

  14. Advanced research on cis-Neonicotinoids.

    PubMed

    Shao, Xusheng; Ye, Zhejun; Bao, Haibo; Liu, Zewen; Xu, Xiaoyong; Li, Zhong; Qian, Xuhong

    2011-01-01

    cis-Neonicotinoids are a type of neonicotinoid, in which the nitro or the cyano group are in cis-configuration relative to heteroaromatic moiety, which show excellent activities against a range of insect species. This review covers cis-neonicotinoids with commercialization perspectives, structural optimization (phenylazoneonicotinoids and chlorothiazolyl analogues of Paichongding), modes of action studies, radiao-synthesis of Paichongding and Cycloxaprid, and photostability of neonicotinoids.

  15. Inverse heat mimicking of given objects

    NASA Astrophysics Data System (ADS)

    Alwakil, Ahmed; Zerrad, Myriam; Bellieud, Michel; Amra, Claude

    2017-03-01

    We address a general inverse mimicking problem in heat conduction. The objects to cloak and mimic are chosen beforehand; these objects identify a specific set of space transformations. The shapes that can be mimicked are derived from the conductivity matrices. Numerical calculation confirms all of the analytical predictions. The technique provides key advantages for applications and can be extended to the field of waves.

  16. Challenging mimickers of primary systemic vasculitis.

    PubMed

    Miloslavsky, Eli M; Stone, John H; Unizony, Sebastian H

    2015-01-01

    The need to distinguish true primary systemic vasculitis from its multiple potential mimickers is one of the most challenging diagnostic conundrums in clinical medicine. This article reviews 9 challenging vasculitis mimickers: fibromuscular dysplasia, calciphylaxis, segmental arterial mediolysis, antiphospholipid syndrome, hypereosinophilic syndrome, lymphomatoid granulomatosis, malignant atrophic papulosis, livedoid vasculopathy, and immunoglobulin G4-related disease.

  17. Decoding cis-regulatory systems in ascidians.

    PubMed

    Kusakabe, Takehiro

    2005-02-01

    Ascidians, or sea squirts, are lower chordates, and share basic gene repertoires and many characteristics, both developmental and physiological, with vertebrates. Therefore, decoding cis-regulatory systems in ascidians will contribute toward elucidating the genetic regulatory systems underlying the developmental and physiological processes of vertebrates. cis-Regulatory DNAs can also be used for tissue-specific genetic manipulation, a powerful tool for studying ascidian development and physiology. Because the ascidian genome is compact compared with vertebrate genomes, both intergenic regions and introns are relatively small in ascidians. Short upstream intergenic regions contain a complete set of cis-regulatory elements for spatially regulated expression of a majority of ascidian genes. These features of the ascidian genome are a great advantage in identifying cis-regulatory sequences and in analyzing their functions. Function of cis-regulatory DNAs has been analyzed for a number of tissue-specific and developmentally regulated genes of ascidians by introducing promoter-reporter fusion constructs into ascidian embryos. The availability of the whole genome sequences of the two Ciona species, Ciona intestinalis and Ciona savignyi, facilitates comparative genomics approaches to identify cis-regulatory DNAs. Recent studies demonstrate that computational methods can help identify cis-regulatory elements in the ascidian genome. This review presents a comprehensive list of ascidian genes whose cis-regulatory regions have been subjected to functional analysis, and highlights the recent advances in bioinformatics and comparative genomics approaches to cis-regulatory systems in ascidians.

  18. Black hole mimickers: Regular versus singular behavior

    SciTech Connect

    Lemos, Jose P. S.; Zaslavskii, Oleg B.

    2008-07-15

    Black hole mimickers are possible alternatives to black holes; they would look observationally almost like black holes but would have no horizon. The properties in the near-horizon region where gravity is strong can be quite different for both types of objects, but at infinity it could be difficult to discern black holes from their mimickers. To disentangle this possible confusion, we examine the near-horizon properties, and their connection with far away asymptotic properties, of some candidates to black mimickers. We study spherically symmetric uncharged or charged but nonextremal objects, as well as spherically symmetric charged extremal objects. Within the uncharged or charged but nonextremal black hole mimickers, we study nonextremal {epsilon}-wormholes on the threshold of the formation of an event horizon, of which a subclass are called black foils, and gravastars. Within the charged extremal black hole mimickers we study extremal {epsilon}-wormholes on the threshold of the formation of an event horizon, quasi-black holes, and wormholes on the basis of quasi-black holes from Bonnor stars. We elucidate whether or not the objects belonging to these two classes remain regular in the near-horizon limit. The requirement of full regularity, i.e., finite curvature and absence of naked behavior, up to an arbitrary neighborhood of the gravitational radius of the object enables one to rule out potential mimickers in most of the cases. A list ranking the best black hole mimickers up to the worst, both nonextremal and extremal, is as follows: wormholes on the basis of extremal black holes or on the basis of quasi-black holes, quasi-black holes, wormholes on the basis of nonextremal black holes (black foils), and gravastars. Since in observational astrophysics it is difficult to find extremal configurations (the best mimickers in the ranking), whereas nonextremal configurations are really bad mimickers, the task of distinguishing black holes from their mimickers seems to

  19. Pediatric myositis ossificans mimicking osteosarcoma.

    PubMed

    Yamaga, Kensaku; Kobayashi, Eisuke; Kubota, Daisuke; Setsu, Nokitaka; Tanaka, Yuya; Minami, Yusuke; Tanzawa, Yoshikazu; Nakatani, Fumihiko; Kawai, Akira; Chuman, Hirokazu

    2015-10-01

    Myositis ossificans (MO) is a rare benign cause of heterotopic bone formation in soft tissue that most commonly affects young adults, typically following trauma. We report the case of an 11-year-old girl who developed MO mimicking osteosarcoma in her right shoulder. Plain radiography and computed tomography showed poorly defined flocculated densities in the soft tissue and a periosteal reaction along the proximal humerus. On magnetic resonance imaging, the mass displayed an ill-defined margin and inhomogeneous signal change. Histologically, the mass had a pseudosarcomatous appearance. Based on these findings, the patient was initially misdiagnosed with osteosarcoma at another hospital. The diagnosis was difficult because the patient was 11 years old and had no trauma history, with atypical radiographic changes and a predilection for the site of origin for osteosarcomas. We finally made the correct diagnosis of MO by carefully reviewing and reflecting on the pathological differences between stages. © 2015 Japan Pediatric Society.

  20. Diseases mimicking intussusception: diagnostic dilemma.

    PubMed

    Karakus, Suleyman Cuneyt; Ozokutan, Bulent Hayri; Ceylan, Haluk

    2014-10-01

    Intussusception is a common abdominal emergency in early childhood. The aim of this study was to describe the diseases mimicking intussusception and to discuss the causes and management of these conditions. Seven patients who were initially diagnosed as having intussusception on abdominal ultrasonography but who had a final diagnosis of diseases other than intussusception were reviewed retrospectively. Two patients with ileocolic intussusception underwent ultrasonography-guided reduction with a hydrostatic method but the ultrasonographic findings persisted. At surgery, only edematous ileocecal valve and mesenteric lymphadenopathy were observed. In three patients with Henoch-Schönlein purpura, initial abdominal ultrasonography showed intussusception. The patients with no sign of obstructive symptoms were managed conservatively with a diagnosis of intramural hemorrhage and on follow up the ultrasonographic findings of intussusception was resolved. One patient with the target sign on computed tomography and ultrasonography of the abdomen underwent ileocolic resection and end-to-end anastomosis due to a tumor in the cecum. There was no evidence of intussusception. One patient with a cyst in the right lower quadrant accompanying intussusception on ultrasonography of the abdomen underwent ultrasonography-guided reduction but the ultrasonographic findings persisted. On exploration, only cecal duplication cyst without intussusception was detected. Cecal resection including the cyst and end-to-end ileocolic anastomosis were performed. Ultrasonography, color Doppler ultrasonography, barium or hydrostatic enema and computed tomography are helpful in diagnosing intussusception, but patients with radiologic findings of intussusception should be evaluated on symptoms and clinical findings before surgical intervention. Also, other diseases mimicking intussusception should be kept in mind in the differential diagnosis. © 2014 Japan Pediatric Society.

  1. IRIS Toxicological Review of Cis-& Trans-1,2-Dichloroethylene (External Review Draft)

    EPA Science Inventory

    EPA is conducting a peer review of the scientific basis supporting the human health hazard and dose-response assessment of cis- and trans-1,2-dichloroethylene that will appear in the Integrated Risk Information System (IRIS) database.

  2. IRIS Toxicological Review of Cis-& Trans-1,2-Dichloroethylene (External Review Draft)

    EPA Science Inventory

    EPA is conducting a peer review of the scientific basis supporting the human health hazard and dose-response assessment of cis- and trans-1,2-dichloroethylene that will appear in the Integrated Risk Information System (IRIS) database.

  3. Suppression of blastogenesis and proliferation of activated CD4+ T cells: intravenous immunoglobulin (IVIg) versus novel anti-human leucocyte antigen (HLA)-E monoclonal antibodies mimicking HLA-I reactivity of IVIg

    PubMed Central

    Ravindranath, M H; Terasaki, P I; Pham, T; Jucaud, V; Kawakita, S

    2014-01-01

    Activated CD4+ T cells undergo blastogenesis and proliferation and they express several surface receptors, including β2-microglobulin-free human leucocyte antigen (HLA) heavy chains (open conformers). Intravenous immunoglobulin (IVIg) suppresses activated T cells, but the mechanism is unclear. IVIg reacts with HLA-Ia/Ib antigens but its reactivity is lost when the anti-HLA-E Ab is adsorbed out. Anti-HLA-E antibodies may bind to the peptides shared by HLA-E and the HLA-I alleles. These shared peptides are cryptic in intact HLA, but exposed in open conformers. The hypothesis that anti-HLA-E monoclonal antibodies (mAbs) that mimic HLA-I reactivity of IVIg may suppress activated T cells by binding to the shared peptides of the open conformers on the T cell surface was tested by examining the relative binding affinity of those mAbs for open conformers coated on regular beads and for intact HLA coated on iBeads, and by comparing the effects on the suppression of phytohaemagglutinin (PHA)-activated T cells of three entities: IVIg, anti-HLA-E mAbs that mimic IVIg [Terasaki Foundation Laboratory (TFL)-006 and (TFL)-007]; and anti-HLA-E antibodies that do not mimic IVIg (TFL-033 and TFL-037). Suppression of blastogenesis and proliferation of those T cells by both IVIg and the anti-HLA-E mAbs was dose-dependent, the dose required with mAbs 50–150-fold lower than with IVIg. TFL-006 and TFL-007 significantly suppressed blastogenesis and proliferation of activated CD4+ T cells, but neither the non-IVIg-mimicking mAbs nor control antibodies did so. The suppression may be mediated by Fab-binding of TFL-006/TFL-007 to the exposed shared peptides. The mAb binding to the open conformer may signal T cell deactivation because the open conformers have an elongated cytoplasmic tail with phosphorylation sites (tryosine320/serine335). PMID:24889882

  4. Bone tumor mimickers: A pictorial essay

    PubMed Central

    Mhuircheartaigh, Jennifer Ni; Lin, Yu-Ching; Wu, Jim S

    2014-01-01

    Focal lesions in bone are very common and many of these lesions are not bone tumors. These bone tumor mimickers can include numerous normal anatomic variants and non-neoplastic processes. Many of these tumor mimickers can be left alone, while others can be due to a significant disease process. It is important for the radiologist and clinician to be aware of these bone tumor mimickers and understand the characteristic features which allow discrimination between them and true neoplasms in order to avoid unnecessary additional workup. Knowing which lesions to leave alone or which ones require workup can prevent misdiagnosis and reduce patient anxiety. PMID:25114385

  5. cis Expression of the F12 Human Immunodeficiency Virus (HIV) Nef Allele Transforms the Highly Productive NL4-3 HIV Type 1 to a Replication-Defective Strain: Involvement of both Env gp41 and CD4 Intracytoplasmic Tails

    PubMed Central

    Olivetta, Eleonora; Pugliese, Katherina; Bona, Roberta; D'Aloja, Paola; Ferrantelli, Flavia; Santarcangelo, Anna Claudia; Mattia, Gianfranco; Verani, Paola; Federico, Maurizio

    2000-01-01

    F12 human immunodeficiency virus type 1 (HIV-1) nef is a naturally occurring nef mutant cloned from the provirus of a nonproductive, nondefective, and interfering HIV-1 variant (F12-HIV). We have already shown that cells stably transfected with a vector expressing the F12-HIV nef allele do not downregulate CD4 receptors and, more peculiarly, become resistant to the replication of wild type (wt) HIV. In order to investigate the mechanism of action of such an HIV inhibition, the F12-HIV nef gene was expressed in the context of the NL4-3 HIV-1 infectious molecular clone by replacing the wt nef gene (NL4-3/chi). Through this experimental approach we established the following. First, NL4-3/chi and nef-defective (Δnef) NL4-3 viral particles behave very similarly in terms of viral entry and HIV protein production during the first replicative cycle. Second, no viral particles were produced from cells infected with NL4-3/chi virions, whatever the multiplicity of infection used. The viral inhibition apparently occurs at level of viral assembling and/or release. Third, this block could not be relieved by in-trans expression of wt nef. Finally, NL4-3/chi reverts to a producer HIV strain when F12-HIV Nef is deprived of its myristoyl residue. Through a CD4 downregulation competition assay, we demonstrated that F12-HIV Nef protein potently inhibits the CD4 downregulation induced by wt Nef. Moreover, we observed a redistribution of CD4 receptors at the cell margin induced by F12-HIV Nef. These observations strongly suggest that F12-HIV Nef maintains the ability to interact with the intracytoplasmic tail of the CD4 receptor molecule. Remarkably, we distinguished the intracytoplasmic tails of Env gp41 and CD4 as, respectively, viral and cellular targets of the F12-HIV Nef-induced viral retention. For the first time, the inhibition of the viral life cycle by means of in-cis expression of a Nef mutant is here reported. Delineation of the F12-HIV Nef mechanism of action may offer

  6. Measurement of guided mode wavenumbers in soft tissue-bone mimicking phantoms using ultrasonic axial transmission

    NASA Astrophysics Data System (ADS)

    Chen, Jiangang; Foiret, Josquin; Minonzio, Jean-Gabriel; Talmant, Maryline; Su, Zhongqing; Cheng, Li; Laugier, Pascal

    2012-05-01

    Human soft tissue is an important factor that influences the assessment of human long bones using quantitative ultrasound techniques. To investigate such influence, a series of soft tissue-bone phantoms (a bone-mimicking plate coated with a layer of water, glycerol or silicon rubber) were ultrasonically investigated using a probe with multi-emitter and multi-receiver arrays in an axial transmission configuration. A singular value decomposition signal processing technique was applied to extract the frequency-dependent wavenumbers of several guided modes. The results indicate that the presence of a soft tissue-mimicking layer introduces additional guided modes predicted by a fluid waveguide model. The modes propagating in the bone-mimicking plate covered by the soft-tissue phantom are only slightly modified compared to their counterparts in the free bone-mimicking plate, and they are still predicted by an elastic transverse isotropic two-dimensional waveguide. Altogether these observations suggest that the soft tissue-bone phantoms can be modeled as two independent waveguides. Even in the presence of the overlying soft tissue-mimicking layer, the modes propagating in the bone-mimicking plate can still be extracted and identified. These results suggest that our approach can be applied for the purpose of the characterization of the material and structural properties of cortical bone.

  7. Measurement of guided mode wavenumbers in soft tissue-bone mimicking phantoms using ultrasonic axial transmission.

    PubMed

    Chen, Jiangang; Foiret, Josquin; Minonzio, Jean-Gabriel; Talmant, Maryline; Su, Zhongqing; Cheng, Li; Laugier, Pascal

    2012-05-21

    Human soft tissue is an important factor that influences the assessment of human long bones using quantitative ultrasound techniques. To investigate such influence, a series of soft tissue-bone phantoms (a bone-mimicking plate coated with a layer of water, glycerol or silicon rubber) were ultrasonically investigated using a probe with multi-emitter and multi-receiver arrays in an axial transmission configuration. A singular value decomposition signal processing technique was applied to extract the frequency-dependent wavenumbers of several guided modes. The results indicate that the presence of a soft tissue-mimicking layer introduces additional guided modes predicted by a fluid waveguide model. The modes propagating in the bone-mimicking plate covered by the soft-tissue phantom are only slightly modified compared to their counterparts in the free bone-mimicking plate, and they are still predicted by an elastic transverse isotropic two-dimensional waveguide. Altogether these observations suggest that the soft tissue-bone phantoms can be modeled as two independent waveguides. Even in the presence of the overlying soft tissue-mimicking layer, the modes propagating in the bone-mimicking plate can still be extracted and identified. These results suggest that our approach can be applied for the purpose of the characterization of the material and structural properties of cortical bone.

  8. Tracheobronchial Amyloidosis Mimicking Tracheal Tumor.

    PubMed

    Tanrıverdi, Elif; Özgül, Mehmet Akif; Uzun, Oğuz; Gül, Şule; Çörtük, Mustafa; Yaşar, Zehra; Acat, Murat; Arda, Naciye; Çetinkaya, Erdoğan

    2016-01-01

    Tracheobronchial amyloidosis is a rare presentation and accounts for about 1% of benign tumors in this area. The diagnosis of disease is delayed due to nonspecific pulmonary symptoms. Therapeutic approaches are required to control progressive pulmonary symptoms for most of the patients. Herein, we report a case of a 68-year-old man admitted with progressive dyspnea to our institution for further evaluation and management. He was initially diagnosed with and underwent management for bronchial asthma for two years but had persistent symptoms despite optimal medical therapy. Pulmonary computed tomography scan revealed severe endotracheal stenosis. Bronchoscopy was performed and showed endotracheal mass obstructing 70% of the distal trachea and mimicking a neoplastic lesion. The mass was successfully resected by mechanical resection, argon plasma coagulation (APC), and Nd-YAG laser during rigid bronchoscopy. Biopsy materials showed deposits of amorphous material by hematoxylin and eosin staining and these deposits were selectively stained with Congo Red. Although this is a rare clinical condition, this case indicated that carrying out a bronchoscopy in any patient complaining of atypical bronchial symptoms or with uncontrolled asthma is very important.

  9. Tracheobronchial Amyloidosis Mimicking Tracheal Tumor

    PubMed Central

    Özgül, Mehmet Akif; Uzun, Oğuz; Yaşar, Zehra; Acat, Murat; Arda, Naciye; Çetinkaya, Erdoğan

    2016-01-01

    Tracheobronchial amyloidosis is a rare presentation and accounts for about 1% of benign tumors in this area. The diagnosis of disease is delayed due to nonspecific pulmonary symptoms. Therapeutic approaches are required to control progressive pulmonary symptoms for most of the patients. Herein, we report a case of a 68-year-old man admitted with progressive dyspnea to our institution for further evaluation and management. He was initially diagnosed with and underwent management for bronchial asthma for two years but had persistent symptoms despite optimal medical therapy. Pulmonary computed tomography scan revealed severe endotracheal stenosis. Bronchoscopy was performed and showed endotracheal mass obstructing 70% of the distal trachea and mimicking a neoplastic lesion. The mass was successfully resected by mechanical resection, argon plasma coagulation (APC), and Nd-YAG laser during rigid bronchoscopy. Biopsy materials showed deposits of amorphous material by hematoxylin and eosin staining and these deposits were selectively stained with Congo Red. Although this is a rare clinical condition, this case indicated that carrying out a bronchoscopy in any patient complaining of atypical bronchial symptoms or with uncontrolled asthma is very important. PMID:27594885

  10. Fibrosing mediastinitis mimicking bronchogenic carcinoma

    PubMed Central

    Bayiz, Hulya; Mutluay, Neslihan; Koyuncu, Adem; Demirag, Funda; Dagli, Gulfidan; Berktas, Bahadir; Berkoglu, Mine

    2013-01-01

    Fibrosing mediastinitis is a rare but benign disorder characterized by an excessive fibrotic reaction in the mediastinum which can result in compromise of airways, great vessels, and other mediastinal structures. In this paper we presented a patient with fibrosing mediastinitis mimicking bronchogenic carcinoma. The patient was a 32-year-old diabetic male admitting with cough and hemoptysis. There was a right hilar mass and multiple mediastinal conglomerated lymph nodes on chest computed tomography. Positron emission tomography with computed tomography (PET/CT) scan demonstrated increased fluorodeoxyglucose (FDG) uptake at the right hilar mass lesion and mediastinal lymph nodes. Fiberoptic bronchoscopy showed mucosal distortion of right upper lobe. Pathologic examination of the mucosal biopsy revealed inflammation. Endobronchial ultrasound guided transbronchial needle and cervical mediastinoscopic lymph node biopsies were undiagnostic. Diagnostic thoracotomy confirmed the diagnosis fibrosing mediastinitis. Administration of six months of systemic corticosteroid and antituberculous therapy was not beneficial. In conclusion, despite being a rare clinical entity, fibrosing mediastinitis should be kept in mind in the differential diagnosis of mediastinal mass lesions of unknown etiology. The diagnosis is exceptionally difficult in the presence of atypical radiological findings. The treatment is particularly challenging without any proven effective therapy. PMID:23372962

  11. [Infestation with Enterobius vermicularis mimicking appendicitis].

    PubMed

    Levens, Afra M A; Schurink, Maarten; Koetse, Harma A; van Baren, Robertine

    2014-01-01

    Gastrointestinal infestation with the parasite Enterobius vermicularis is common in humans and is usually harmless. Anal pruritus is the most characteristic symptom, but the parasites can cause severe abdominal pain mimicking appendicitis. Early recognition can prevent an unnecessary appendectomy. A six-year-old girl reported to the accident and emergency department with pain in the lower right abdominal region. She was admitted and treated for suspected perforated appendix, following physical examination supplemented with an abdominal CT scan. After antibiotic treatment the symptoms disappeared as did the abscess, apart from a minor amount of residual infiltrate. She was then readmitted twice with recurrent abdominal pain without radiological evidence of an abdominal focus. We decided to conduct a diagnostic laparoscopy and an elective appendectomy à froid. During this procedure living worms were found in the appendix. Treatment with the anthelminthicum mebendazol was effective. Gastro-intestinal infestation with E. vermicularis is very common, especially in young children. This infestation is usually harmless, but can mimic appendicitis. This infestation is easily treatable with mebendazol.

  12. Inverse heat mimicking of given objects

    PubMed Central

    Alwakil, Ahmed; Zerrad, Myriam; Bellieud, Michel; Amra, Claude

    2017-01-01

    We address a general inverse mimicking problem in heat conduction. The objects to cloak and mimic are chosen beforehand; these objects identify a specific set of space transformations. The shapes that can be mimicked are derived from the conductivity matrices. Numerical calculation confirms all of the analytical predictions. The technique provides key advantages for applications and can be extended to the field of waves. PMID:28252031

  13. Membrane interactions and conformational preferences of human and avian prion N-terminal tandem repeats: the role of copper(II) ions, pH, and membrane mimicking environments.

    PubMed

    Di Natale, Giuseppe; Pappalardo, Giuseppe; Milardi, Danilo; Sciacca, Michele F M; Attanasio, Francesco; La Mendola, Diego; Rizzarelli, Enrico

    2010-11-04

    The flexible N-terminal domain of the prion protein (PrP(c)) is believed to play a pivotal role in both trafficking of the protein through the cell membrane and its pathogenic conversion into the β sheet-rich scrapie isoform (PrP(sc)). Unlike mammalian PrP(c), avian prion proteins are not known to undergo any pathogenic conformational conversions. Consequently, some critical advances in our understanding of the molecular mechanisms underlying prion pathogenesis are expected from comparative studies of the biophysical properties of the N-terminal domains of the two proteins. The present study addresses the role played by different environmental factors, i.e., copper(II), pH, and membrane-mimicking environments, in assisting the conformational preferences of huPrP60-91 and chPrP53-76, two soluble peptides encompassing the N-terminal copper(II) binding domains of the human and chicken prion proteins, respectively. Moreover, the membrane interactions of huPrP60-91, chPrP53-76, and their copper(II) complexes were evaluated by Trp fluorescence in conjunction with measurements of the variation in thermotropic properties of 1,2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC) unilamellar vesicles. Circular dichroism experiments revealed that huPrP60-91 adopts a predominant polyproline II conformation in aqueous solution that is destabilized at basic pH or in the presence of trifluoroethanol (TFE). Unlike anionic sodium dodecyl sulfate (SDS), which seems to stabilize the polyproline II conformation further, zwitterionic dodecylphosphocholine (DPC) micelles do not affect the peptide structure. On the contrary, copper(II) promptly promotes an increase in β-turn-rich structures. Differential scanning calorimetry (DSC) and Trp fluorescence assays carried out on DPPC model membranes after incubation with huPrP60-91 showed a marked tendency of the peptide to slowly penetrate the lipid bilayer with a concomitant conformational transition toward an extended β-sheet-like structure

  14. Plant growth inhibition by cis-cinnamoyl glucosides and cis-cinnamic acid.

    PubMed

    Hiradate, Syuntaro; Morita, Sayaka; Furubayashi, Akihiro; Fujii, Yoshiharu; Harada, Jiro

    2005-03-01

    Spiraea thunbergii Sieb. contains 1-O-cis-cinnamoyl-beta-D-glucopyranose (CG) and 6-O-(4'-hydroxy-2'-methylene-butyroyl)-1-O-cis-cinnamoyl-beta-D-glucopyranose (BCG) as major plant growth inhibiting constituents. In the present study, we determined the inhibitory activity of CG and BCG on root elongation of germinated seedlings of lettuce (Lactuca sativa), pigweed (Amaranthus retroflexus), red clover (Trifolium pratense), timothy (Phleum pratense), and bok choy (Brassica rapa var chinensis) in comparison with that of two well-known growth inhibitors, 2,4-dichlorophenoxyacetic acid (2,4-D) and (+)-2-cis-4-trans-abscisic acid (cis-ABA), as well as two related chemicals of CG and BCG, cis-cinnamic acid (cis-CA) and trans-cinnamic acid (trans-CA). The EC50 values for CG and BCG on lettuce were roughly one-half to one-quarter of the value for cis-ABA. cis-Cinnamic acid, which is a component of CG and BCG, possessed almost the same inhibitory activity of CG and BCG, suggesting that the essential chemical structure responsible for the inhibitory activity of CG and BCG is cis-CA. The cis-stereochemistry of the methylene moiety is apparently needed for high inhibitory activity, as trans-CA had an EC50 value roughly 100 times that of CG, BCG, and cis-CA. Growth inhibition by CG, BCG, and cis-CA was influenced by the nature of the soil in the growing medium: alluvial soil preserved the bioactivity, whereas volcanic ash and calcareous soils inhibited bioactivity. These findings indicate a potential role of cis-CA and its glucosides as allelochemicals for use as plant growth regulators in agricultural fields.

  15. Spontaneous motor entrainment to music in multiple vocal mimicking species.

    PubMed

    Schachner, Adena; Brady, Timothy F; Pepperberg, Irene M; Hauser, Marc D

    2009-05-26

    The human capacity for music consists of certain core phenomena, including the tendency to entrain, or align movement, to an external auditory pulse [1-3]. This ability, fundamental both for music production and for coordinated dance, has been repeatedly highlighted as uniquely human [4-11]. However, it has recently been hypothesized that entrainment evolved as a by-product of vocal mimicry, generating the strong prediction that only vocal mimicking animals may be able to entrain [12, 13]. Here we provide comparative data demonstrating the existence of two proficient vocal mimicking nonhuman animals (parrots) that entrain to music, spontaneously producing synchronized movements resembling human dance. We also provide an extensive comparative data set from a global video database systematically analyzed for evidence of entrainment in hundreds of species both capable and incapable of vocal mimicry. Despite the higher representation of vocal nonmimics in the database and comparable exposure of mimics and nonmimics to humans and music, only vocal mimics showed evidence of entrainment. We conclude that entrainment is not unique to humans and that the distribution of entrainment across species supports the hypothesis that entrainment evolved as a by-product of selection for vocal mimicry.

  16. Combining anti-cancer drugs with artificial sweeteners: synthesis and anti-cancer activity of saccharinate (sac) and thiosaccharinate (tsac) complexes cis-[Pt(sac)2(NH3)2] and cis-[Pt(tsac)2(NH3)2].

    PubMed

    Al-Jibori, Subhi A; Al-Jibori, Ghassan H; Al-Hayaly, Lamaan J; Wagner, Christoph; Schmidt, Harry; Timur, Suna; Baris Barlas, F; Subasi, Elif; Ghosh, Shishir; Hogarth, Graeme

    2014-12-01

    The new platinum(II) complexes cis-[Pt(sac)2(NH3)2] (sac=saccharinate) and cis-[Pt(tsac)2(NH3)2] (tsac=thiosaccharinate) have been prepared, the X-ray crystal structure of cis-[Pt(sac)2(NH3)2] x H2O reveals that both saccharinate anions are N-bound in a cis-arrangement being inequivalent in both the solid-state and in solution at room temperature. Preliminary anti-cancer activity has been assessed against A549 human alveolar type-II like cell lines with the thiosaccharinate complex showing good activity.

  17. Substrate influences on CIS device performance

    SciTech Connect

    Dawson-Elli, D.F.; Moore, C.B.; Gay, R.R.; Jensen, C.L.

    1994-12-31

    It has been reported that the substrate plays an active role in copper indium diselenide (CIS) devices. The physical properties of the substrate, i.e., thermal expansion coefficient, chemical composition, strain point, surface quality and cleanliness may all play a role in device efficiency and process reproducibility. For example, sodium is known to influence the conductivity of CIS, and that soda lime glass (SLG) introduces sodium into the CIS. In the experiments reported here, the sodium level in the CIS was varied by (a) changing the substrate composition and (b) the use of SiO{sub x}N{sub y} and SiN{sub x} barrier layers. Cells were fabricated on the candidate substrate and barrier layer combinations. V{sub oc} was observed to drop with the addition of barrier layers to sodium containing glasses. The films were also analyzed for sodium by SIMS. The cell performance and SIMS analysis are presented and their significance is discussed.

  18. Anisotropic microstructured poly(vinyl alcohol) tissue-mimicking phantoms.

    PubMed

    Dawson, Andrew; Harris, Paul; Gouws, Gideon

    2010-07-01

    Novel microstructured PVA phantoms mimicking fibrous tissues have been developed using a simple freeze-casting process. Scanning electron micrographs reveal highly anisotropic microstructure with dimensions of the order of 5 to 100 microm. Characterization of an example phantom revealed acoustic properties consistent with those found in fibrous tissues. At 20 MHz, the velocity measured parallel to the microstructure orientation of 1555 ms(-1) was significantly greater than that perpendicular to the microstructure of 1537 ms(-1). The attenuation coefficient was measured to be 5 dBxmm(-1) and proportional to the 1.6 power of frequency, which is in good agreement with that for normal human myocardium.

  19. Surface hopping dynamics of direct trans --> cis photoswitching of an azobenzene derivative in constrained adsorbate geometries

    NASA Astrophysics Data System (ADS)

    Floß, Gereon; Granucci, Giovanni; Saalfrank, Peter

    2012-12-01

    With ongoing miniaturization of electronic devices, the need for individually addressable, switchable molecules arises. An example are azobenzenes on surfaces which have been shown to be switchable between trans and cis forms. Here, we examine the "direct" (rather than substrate-mediated) channel of the trans → cis photoisomerization after ππ* excitation of tetra-tert-butyl-azobenzene physisorbed on surfaces mimicking Au(111) and Bi(111), respectively. In spirit of the direct channel, the electronic structure of the surface is neglected, the latter merely acting as a rigid platform which weakly interacts with the molecule via Van-der-Waals forces. Starting from thermal ensembles which represent the trans-form, sudden excitations promote the molecules to ππ*-excited states which are non-adiabatically coupled among themselves and to a nπ*-excited and the ground state, respectively. After excitation, relaxation to the ground state by internal conversion takes place, possibly accompanied by isomerization. The process is described here by "on the fly" semiclassical surface hopping dynamics in conjunction with a semiempirical Hamiltonian (AM1) and configuration-interaction type methods. It is found that steric constraints imposed by the substrate lead to reduced but non-vanishing, trans → cis reaction yields and longer internal conversion times than for the isolated molecule. Implications for recent experiments for azobenzenes on surfaces are discussed.

  20. Coronavirus cis-Acting RNA Elements.

    PubMed

    Madhugiri, R; Fricke, M; Marz, M; Ziebuhr, J

    2016-01-01

    Coronaviruses have exceptionally large RNA genomes of approximately 30 kilobases. Genome replication and transcription is mediated by a multisubunit protein complex comprised of more than a dozen virus-encoded proteins. The protein complex is thought to bind specific cis-acting RNA elements primarily located in the 5'- and 3'-terminal genome regions and upstream of the open reading frames located in the 3'-proximal one-third of the genome. Here, we review our current understanding of coronavirus cis-acting RNA elements, focusing on elements required for genome replication and packaging. Recent bioinformatic, biochemical, and genetic studies suggest a previously unknown level of conservation of cis-acting RNA structures among different coronavirus genera and, in some cases, even beyond genus boundaries. Also, there is increasing evidence to suggest that individual cis-acting elements may be part of higher-order RNA structures involving long-range and dynamic RNA-RNA interactions between RNA structural elements separated by thousands of nucleotides in the viral genome. We discuss the structural and functional features of these cis-acting RNA elements and their specific functions in coronavirus RNA synthesis. © 2016 Elsevier Inc. All rights reserved.

  1. Recurrent epiploic appendagitis mimicking appendicitis and cholecystitis

    PubMed Central

    Hearne, Christopher B.; Taboada, Jorge

    2017-01-01

    Epiploic appendagitis (EA) is a rare cause of acute abdominal pain caused by inflammation of an epiploic appendage. It has a nonspecific clinical presentation that may mimic other acute abdominal pathologies on physical exam, such as appendicitis, diverticulitis, or cholecystitis. However, EA is usually benign and self-limiting and can be treated conservatively. We present the case of a patient with two episodes of EA, the first mimicking acute appendicitis and the second mimicking acute cholecystitis. Although recurrence of EA is rare, it should be part of the differential diagnosis of acute, localized abdominal pain. A correct diagnosis of EA will prevent unnecessary hospitalization, antibiotic use, and surgical procedures. PMID:28127129

  2. Advances in the CIS research at NREL

    SciTech Connect

    Ramanathan, K.; Bhattacharya, R.N.; Granata, J.; Webb, J.; Niles, D.; Contreras, M.A.; Wiesner, H.; Hasoon, F.S.; Noufi, R.

    1997-12-31

    This paper summarizes the research of the CIS Team at NREL in three major areas: absorber deposition; understanding the role of chemical bath deposited (CBD) CdS in CIS junctions; and in the development of devices without CdS. Low cost, scaleable processes chosen for absorber fabrication include sputtering, electrodeposition (ED), and close spaced sublimation (CSS). The interaction between the CBD and the CIS has been investigated and the results show that Cd might be instrumental in shaping the interface. The authors have also developed a process to fabricate a 13.5% efficiency ZnO/CuInGaSe{sub 2} device without CdS or other buffer layers.

  3. Cis and Trans Isomers of Cycloalkenes

    NASA Astrophysics Data System (ADS)

    Barrows, Susan E.; Eberlein, Thomas H.

    2005-09-01

    As a rule, a trans disubstituted alkene is more stable than the corresponding cis isomer. For cycloalkenes of fewer than eleven members, cis isomers are more stable than their trans counterparts. Although this exception to the normal rule is occasionally noted in beginning organic chemistry textbooks, it is often done without a careful analysis of the reasons behind it. The purpose of this article is to provide that analysis. In order for a cycloalkene to accommodate a trans double bond one or more of the following nonideal geometries must occur: a twisted π bond; pyramidal sp 2 -carbon atoms; nonideal sp 3 bond angles; or longer than normal C C single and double bonds. This article provides a list of experimentally determined relative energies of the cis and trans isomers within the series cycloheptene cycloundecene, along with computationally derived energies at several levels of theory. It also examines the geometric distortions through which cycloalkenes relieve the strain introduced by a trans double bond.

  4. Systemic sarcoidosis mimicking malignant metastatic disease

    PubMed Central

    Hammen, Irena; Sherson, David Lee; Davidsen, Jesper Roemhild

    2015-01-01

    We present a case of systemic sarcoidosis involving the liver, pancreas, lungs, mediastinal and intraabdominal lymph nodes and bones. Multiple organ system manifestations mimicked malignant metastatic disease. The diagnosis was established with clinical, radiological, and pathological findings after neoplasm was ruled out by pathological tests. The patient showed rapid symptom remission with systemic steroid treatment. PMID:26672956

  5. Lymphomatoid granulomatosis mimicking interstitial lung disease.

    PubMed

    Braham, Emna; Ayadi-Kaddour, Aïda; Smati, Belhassen; Ben Mrad, Sonia; Besbes, Mohammed; El Mezni, Faouzi

    2008-11-01

    Lymphoid granulomatosis is a rare form of pulmonary angiitis. This case report presents a patient with lymphoid granulomatosis in whom the clinical presentation, radiological features and the partial response to corticosteroid therapy mimicked interstitial lung disease. Lymphoid granulomatosis was only diagnosed at post-mortem examination. The range of reported clinical presentations, diagnostic approaches and outcomes are described.

  6. Binding of the human nucleotide excision repair proteins XPA and XPC/HR23B to the 5R-thymine glycol lesion and structure of the cis-(5R,6S) thymine glycol epimer in the 5'-GTgG-3' sequence: destabilization of two base pairs at the lesion site.

    PubMed

    Brown, Kyle L; Roginskaya, Marina; Zou, Yue; Altamirano, Alvin; Basu, Ashis K; Stone, Michael P

    2010-01-01

    The 5R thymine glycol (5R-Tg) DNA lesion exists as a mixture of cis-(5R,6S) and trans-(5R,6R) epimers; these modulate base excision repair. We examine the 7:3 cis-(5R,6S):trans-(5R,6R) mixture of epimers paired opposite adenine in the 5'-GTgG-3' sequence with regard to nucleotide excision repair. Human XPA recognizes the lesion comparably to the C8-dG acetylaminoflourene (AAF) adduct, whereas XPC/HR23B recognition of Tg is superior. 5R-Tg is processed by the Escherichia coli UvrA and UvrABC proteins less efficiently than the C8-dG AAF adduct. For the cis-(5R, 6S) epimer Tg and A are inserted into the helix, remaining in the Watson-Crick alignment. The Tg N3H imine and A N(6) amine protons undergo increased solvent exchange. Stacking between Tg and the 3'-neighbor G*C base pair is disrupted. The solvent accessible surface and T(2) relaxation of Tg increases. Molecular dynamics calculations predict that the axial conformation of the Tg CH(3) group is favored; propeller twisting of the Tg*A pair and hydrogen bonding between Tg OH6 and the N7 atom of the 3'-neighbor guanine alleviate steric clash with the 5'-neighbor base pair. Tg also destabilizes the 5'-neighbor G*C base pair. This may facilitate flipping both base pairs from the helix, enabling XPC/HR23B recognition prior to recruitment of XPA.

  7. [Investigation of Predisposition Biomarkers to Identify Risk Factors for Drug-induced Liver Injury in Humans: Analyses of Endogenous Metabolites in an Animal Model Mimicking Human Responders to APAP-induced Hepatotoxicity].

    PubMed

    Kobayashi, Akio; Kondo, Kazuma; Sugai, Shoichiro

    2015-01-01

    Drug-induced liver injury is a main reason of regulatory action pertaining to drugs, including restrictions to clinical indications and withdrawal from the marketplace. Acetaminophen (APAP) is a commonly used and effective analgesic/antipyretic agent and relatively safe drug even in long-term treatment. However, it is known that APAP at therapeutic doses may cause hepatotoxicity in some individuals. Hence great efforts have been made to identify risk factors for APAP-induced chronic hepatotoxicity. We investigated the contribution of undernourishment to susceptibility to APAP-induced chronic hepatotoxicity using an animal model. We employed daytime restricted fed (RF) rats as a modified-nutritional state model for human APAP-induced hepatotoxicity. RF and ad libitum fed (ALF) rats were given APAP at 0, 300, and 500 mg/kg for 3 months. Plasma and urinary glutathione-related metabolomes and liver function parameters were measured during the dosing period. Endogenous metabolites forming at different levels between the RF and ALF rats could be potential predisposition biomarkers for APAP-induced hepatotoxicity. In addition, RF rats were considered a useful model to estimate the contribution of nutritional state of patients to APAP-induced chronic hepatotoxicity. In this article we report our current research focusing on nutritional state as risk factor for APAP-induced chronic hepatotoxicity and our findings of hepatotoxicity biomarkers.

  8. Stereoselective synthesis of cis-p-menth-8-ene-1,7-diol, cis-p-menthane-1,7-diol, and cis-p-menthane-1,7,8-triol.

    PubMed

    Kobler, Christoph; Effenberger, Franz

    2005-04-22

    The natural products cis-p-menthane-1,7-diol (cis-IV), cis-p-menth-8-ene-1,7-diol (cis-I) and cis-p-menthane-1,7,8-triol (cis-II) are obtained starting from the corresponding cis-cyanohydrins, cis-2 and cis-7, respectively, by chemical transformation of the cyano into the hydroxymethyl group. The key step of the synthesis is the very high cis-selectivity (> or = 96 %) of the MeHNL-catalyzed HCN addition to 4-alkylcyclohexanones. From 4-isopropylcyclohexanone (1) the cyanohydrin cis-2 and from 4-(1-methylvinyl)cyclohexanone (6) the cyanohydrin cis-7 result almost quantitatively. Regioselective hydroxylation of cis-I affords the triol cis-II. X-ray crystal structure determinations of the final products confirm their cis-configuration.

  9. An ideal blood mimicking fluid for doppler ultrasound phantoms.

    PubMed

    Samavat, H; Evans, J A

    2006-10-01

    In order to investigate the problems of detecting tumours by ultrasound it is very important to have a portable Doppler flow test object to use as a standardising tool. The flow Doppler test objects are intended to mimic the flow in human arteries. To make the test meaningful, the acoustic properties of the main test object components (tissue and blood mimic) should match closely the properties of the corresponding human tissues, while the tube should ideally have little influence. The blood mimic should also represent the haemodynamic properties of blood. An acceptable flow test object has been designed to closely mimic blood flow in arteries. We have evaluated the properties of three blood mimicking fluid: two have been described recently in the literature, the third is a local design. One of these has emerged as being particularly well matched to the necessary characteristics for in-vitro work.

  10. Intramedullary cervical neurenteric cyst mimicking an abscess.

    PubMed

    Muzumdar, D; Bhatt, Y; Sheth, J

    2008-01-01

    We describe a cervical intramedullary neurenteric cyst in a 12-year-old male patient who presented with gradual onset and progressively worsening neck pain, spastic quadriparesis and impaired sensation in the C(2) dermatome. MR imaging revealed a well-defined peripherally enhancing cystic intramedullary lesion with a posteroinferior enhancing nodule at the C(2)-C(3) level mimicking an abscess. There was no evidence of spinal dysraphism. The lesion was completely resected through a posterior approach and the patient showed radical improvement in his symptomatology. At follow-up after 3 years, he was asymptomatic and the MR imaging showed no evidence of any residual or recurrent cyst. The case presented here is unique, since a spinal neurenteric cyst showing intense peripheral contrast enhancement mimicking an abscess is unusual. The radiological features, pathogenesis and surgical considerations in cervical intramedullary neurenteric cysts are discussed and the relevant literature is briefly reviewed.

  11. Spherical boson stars as black hole mimickers

    SciTech Connect

    Guzman, F. S.; Rueda-Becerril, J. M.

    2009-10-15

    We present spherically symmetric boson stars as black hole mimickers based on the power spectrum of a simple accretion disk model. The free parameters of the boson star are the mass of the boson and the fourth-order self-interaction coefficient in the scalar field potential. We show that even if the mass of the boson is the only free parameter, it is possible to find a configuration that mimics the power spectrum of the disk due to a black hole of the same mass. We also show that for each value of the self-interaction a single boson star configuration can mimic a black hole at very different astrophysical scales in terms of the mass of the object and the accretion rate. In order to show that it is possible to distinguish one of our mimickers from a black hole, we also study the deflection of light.

  12. Long-term follow-up of myelodysplastic syndrome patients with moderate/severe anaemia receiving human recombinant erythropoietin + 13-cis-retinoic acid and dihydroxylated vitamin D3: independent positive impact of erythroid response on survival.

    PubMed

    Crisà, Elena; Foli, Cristina; Passera, Roberto; Darbesio, Antonella; Garvey, Kimberly B; Boccadoro, Mario; Ferrero, Dario

    2012-07-01

    We previously reported a 60% erythroid response rate with recombinant erythropoietin + 13-cis retinoic acid + dihydroxylated vitamin D3 in 63 elderly myelodysplastic patients (median age 75 years) with unfavourable features for response to erythropoietin alone [70% transfusion-dependent, 35% refractory anaemia with ring sideroblasts/refractory anaemia with excess of blasts type 1 (RAEB1), 70% with International Prognostic Scoring System (IPSS) Intermediate-1 or -2]. This report updates that case study at a 7-year follow-up, and compared the impact on overall survival of erythroid response to known prognostic factors. The erythroid response duration (median 17 months; 22 in non-RAEB patients, with 20% patients in response after 6 years of therapy) was longer than in most studies with erythropoietin alone. Overall survival (median 55 months in non-RAEB, 15 in RAEB1 patients) was negatively affected by RAEB1 diagnosis, IPSS and WPSS intermediate scores and transfusion-dependence. In the multivariate analysis, erythroid response maintained an independent positive impact on survival, particularly in non-RAEB patients in the first 3 years from diagnosis (90% survival compared to 50% of non-responders). In conclusion, the long-term follow-up confirmed the achievement, by our combined treatment, of fairly long-lasting erythroid response in the majority of MDS patients with unfavourable prognostic features for response to erythropoietin: this translated in a survival benefit that was independent from other prognostic features.

  13. Pulmonary diseases with imaging findings mimicking aspergilloma.

    PubMed

    Gazzoni, Fernando Ferreira; Severo, Luiz Carlos; Marchiori, Edson; Guimarães, Marcos Duarte; Garcia, Tiago Severo; Irion, Klaus L; Camargo, José Jesus; Felicetti, José Carlos; de Mattos Oliveira, Flavio; Hochhegger, Bruno

    2014-06-01

    Patients with preexisting lung cavities are at risk of developing intracavitary fungal colonization. Because Aspergillus spp. are the most commonly implicated fungi, these fungal masses are called aspergillomas. Their characteristic "ball-in-hole" appearance, however, may be found in a variety of other conditions that can produce radiologic findings mimicking aspergilloma. In this paper, we review the main diseases that may mimic the radiographic findings of aspergilloma, with brief descriptions of clinical, radiologic, and histopathologic findings.

  14. Isolated giant molluscum contagiosum mimicking epidermoid cyst

    PubMed Central

    Uzuncakmak, Tugba K.; Kuru, Burce C.; Zemheri, Ebru I.; Zindanci, Ilkin; Turkoglu, Zafer; Kavala, Mukaddes

    2016-01-01

    Molluscum contagiosum is a benign cutaneous viral infection which is caused by double- stranded DNA poxvirus. It affects mainly children and young adults and usually presents with single or multiple umblicated papules or nodules on face, arms, legs and anogenital regions. It may present in atypical size and clinical appearance in patients with altered or impaired immunity and rarely in immuncompetent patients. Herein we present an immuncompetent young adult patient with isolated giant molluscum contagiosum, which was mimicking epidermoid cyst clinically. PMID:27648389

  15. Mad honey intoxication mimicking acute coronary syndrome.

    PubMed

    Dur, Ali; Sonmez, Ertan; Civelek, Cemil; AhmetTurkdogan, Kenan; AkifVatankulu, Mehmet; Sogut, Ozgur

    2014-09-01

    Mad honey intoxication or grayanotoxin poisoning is caused by consumption of grayanotoxin-containing toxic honey produced from leaves and flowers of the Rhododendron family. Despite the rarity of intoxication cases, the correct diagnosis and treatment are required because of the significance of haemodynamic disturbance and confounding of symptoms for disease identification. We report herein a case of a patient with mad honey intoxication mimicking acute non-ST segment elevation myocardial infarction and review the pathophysiology and diagnostic considerations.

  16. A Pilocytic Astrocytoma Mimicking a Clinoidal Meningioma

    PubMed Central

    Hong, Christopher S.; Lehman, Norman L.; Sauvageau, Eric

    2014-01-01

    Pilocytic astrocytomas and meningiomas are benign, primary brain tumors that may involve the optic tract. Classically, the presence of a dural “tail” sign may differentiate a meningioma from other intracranial lesions. In this report, we describe a mass with the typical appearance of a clinoidal meningioma on magnetic resonance imaging (MRI) but postoperatively diagnosed as a pilocytic astrocytoma. This case illustrates the rare occurrence of a pilocytic astrocytoma mimicking a meningioma on MRI. PMID:24744944

  17. Rare Mimickers of Exostosis: A Case Series

    PubMed Central

    Perubhotla, Lakshmi Manasa

    2016-01-01

    Exophytic growths from bones are a common entity. Osteochondroma is the most common benign exophytic lesion and we tend to diagnose every benign looking exophytic lesion as osteochondroma. Here we reported two entities of cases, one was Nora’s lesion and another one was supracondylar process of humerus, both of which were mimickers of osteochondroma and their salient and differentiating features from osteochondromas. PMID:27630926

  18. Study of cis-cinnamic acid in Arabidopsis thaliana.

    PubMed

    Wong, Wai Shing; Guo, Di; Wang, Xiao Li; Yin, Zhi Qi; Xia, Bing; Li, Ning

    2005-01-01

    Trans-cinnamic acid (CA) can be isomerized to cis-CA in Arabidopsis thaliana extract under sunlight. Piperonylic acid treatment of Arabidopsis under ultraviolet (UV) light increased the level of cis-CA in these treated tissues. Similarly, cis-CA was also detected from Oryza sativa seedlings grown under sunlight. These results suggest that cis-CA may occur in planta. Application of cis-CA to seedlings of both wild type Arabidopsis and auxin-insensitive mutants, aux1 and axr2, resulted in nearly identical dose response curves in root growth, indicating that the mode of action by which cis-CA affects plant growth is different from that of auxins. According to root growth inhibition assay, cis-CA is nearly 10 times more active than trans-CA. These results suggest that cis-CA is a unique plant growth regulator but its in vivo function remains to be elucidated.

  19. cis-Regulatory control circuits in development.

    PubMed

    Howard, Meredith L; Davidson, Eric H

    2004-07-01

    During development, an organism undergoes many rounds of pattern formation, generating ever-greater complexity with each ensuing round of cell division and specification. The instructions for executing this process are encoded in the cis-regulatory modules that direct the expression of developmental transcription factors and signaling molecules. Each transcription factor binding site within a cis-regulatory module contributes information about when, where, or how much a gene is turned on, and by dissecting the modules driving a given gene, all the inputs governing expression of the gene can be accurately identified. Furthermore, by mapping the output of each gene to the inputs of other genes, it is possible to reverse engineer developmental circuits and even whole networks. At this higher level of organization, common bilaterian strategies for specifying progenitor fields, locking down regulatory states, and driving development forward emerge.

  20. Status of flexible CIS research at ISET

    NASA Technical Reports Server (NTRS)

    Basol, B. M.; Kapur, V. K.; Minnick, A.; Halani, A.; Leidholm, C. R.

    1994-01-01

    Polycrystalline thin film solar cells fabricated on light-weight, flexible substrates are very attractive for space applications. In this work CulnSe2 (CIS) based thin film devices were processed on metallic foil substrates using the selenization technique. CIS deposition method involved reaction of electron-bean evaporated Cu-In precursor layers with a selenizing atmosphere at around 400 C. Several metallic foils such as Mo, Ti, Al, Ni, and Cu were evaluated as possible substrates for these devices. Solar cells with AM1.5 efficiencies of 9.0-9.34 percent and good mechanical integrity were demonstrated on Mo and Ti foils. Monolithic integration of these devices was also demonstrated up to 4 in x 4 in size.

  1. PDSS/IMC CIS user's guide

    NASA Technical Reports Server (NTRS)

    1984-01-01

    The Spacelab Payload Development Support System PDSS Image Motion Compensator (IMC) computer interface simulation (CIS) user's manual is given. The software provides a real time interface simulation for the following IMC subsystems: the Dry Rotor Reference Unit, the Advanced Star/Target Reference Optical sensor, the Ultra Violet imaging telescope, the Wisconson Ultraviolet Photopolarimetry Experiment, the Cruciform Power distributor, and the Spacelab Experiment Computer Operating System.

  2. Combinatorial Cis-regulation in Saccharomyces Species.

    PubMed

    Spivak, Aaron T; Stormo, Gary D

    2016-01-15

    Transcriptional control of gene expression requires interactions between the cis-regulatory elements (CREs) controlling gene promoters. We developed a sensitive computational method to identify CRE combinations with conserved spacing that does not require genome alignments. When applied to seven sensu stricto and sensu lato Saccharomyces species, 80% of the predicted interactions displayed some evidence of combinatorial transcriptional behavior in several existing datasets including: (1) chromatin immunoprecipitation data for colocalization of transcription factors, (2) gene expression data for coexpression of predicted regulatory targets, and (3) gene ontology databases for common pathway membership of predicted regulatory targets. We tested several predicted CRE interactions with chromatin immunoprecipitation experiments in a wild-type strain and strains in which a predicted cofactor was deleted. Our experiments confirmed that transcription factor (TF) occupancy at the promoters of the CRE combination target genes depends on the predicted cofactor while occupancy of other promoters is independent of the predicted cofactor. Our method has the additional advantage of identifying regulatory differences between species. By analyzing the S. cerevisiae and S. bayanus genomes, we identified differences in combinatorial cis-regulation between the species and showed that the predicted changes in gene regulation explain several of the species-specific differences seen in gene expression datasets. In some instances, the same CRE combinations appear to regulate genes involved in distinct biological processes in the two different species. The results of this research demonstrate that (1) combinatorial cis-regulation can be inferred by multi-genome analysis and (2) combinatorial cis-regulation can explain differences in gene expression between species. Copyright © 2016 Spivak and Stormo.

  3. Combinatorial Cis-regulation in Saccharomyces Species

    PubMed Central

    Spivak, Aaron T.; Stormo, Gary D.

    2016-01-01

    Transcriptional control of gene expression requires interactions between the cis-regulatory elements (CREs) controlling gene promoters. We developed a sensitive computational method to identify CRE combinations with conserved spacing that does not require genome alignments. When applied to seven sensu stricto and sensu lato Saccharomyces species, 80% of the predicted interactions displayed some evidence of combinatorial transcriptional behavior in several existing datasets including: (1) chromatin immunoprecipitation data for colocalization of transcription factors, (2) gene expression data for coexpression of predicted regulatory targets, and (3) gene ontology databases for common pathway membership of predicted regulatory targets. We tested several predicted CRE interactions with chromatin immunoprecipitation experiments in a wild-type strain and strains in which a predicted cofactor was deleted. Our experiments confirmed that transcription factor (TF) occupancy at the promoters of the CRE combination target genes depends on the predicted cofactor while occupancy of other promoters is independent of the predicted cofactor. Our method has the additional advantage of identifying regulatory differences between species. By analyzing the S. cerevisiae and S. bayanus genomes, we identified differences in combinatorial cis-regulation between the species and showed that the predicted changes in gene regulation explain several of the species-specific differences seen in gene expression datasets. In some instances, the same CRE combinations appear to regulate genes involved in distinct biological processes in the two different species. The results of this research demonstrate that (1) combinatorial cis-regulation can be inferred by multi-genome analysis and (2) combinatorial cis-regulation can explain differences in gene expression between species. PMID:26772747

  4. Fragrance material review on cis-jasmone.

    PubMed

    Scognamiglio, J; Jones, L; Letizia, C S; Api, A M

    2012-10-01

    A toxicologic and dermatologic review of cis-jasmone when used as a fragrance ingredient is presented. cis-Jasmone is a member of the fragrance structural group ketones cyclopentanones and cyclopentenones. The common characteristic structural element of the group members is a cyclopentanone or cyclopentenone ring with a straight or branched chain alkane or alkene substituent. This review contains a detailed summary of all available toxicology and dermatology papers that are related to this individual fragrance ingredient and is not intended as a stand-alone document. Available data for cis-jasmone were evaluated then summarized and includes physical properties, acute toxicity, skin irritation, mucous membrane (eye) irritation, skin sensitization, phototoxicity, photoallergy, and genotoxicity data. A safety assessment of the entire ketones cyclopentanones and cyclopentenones will be published simultaneously with this document; please refer to Belsito et al. (2012) for an overall assessment of the safe use of this material and all ketones cyclopentanones and cyclopentenones in fragrances. Copyright © 2012 Elsevier Ltd. All rights reserved.

  5. Options for Staging Orbits in Cis-Lunar Space

    NASA Technical Reports Server (NTRS)

    Whitley, Ryan; Martinez, Roland

    2015-01-01

    NASA has been studying options to conduct missions beyond Low Earth Orbit, but within the Earth-Moon system, in preparation for deep space exploration including human missions to Mars. Referred to as the Proving Ground, this arena of exploration activities will enable the development of human spaceflight systems and operations to satisfy future exploration objectives beyond the cis-lunar environment. One option being considered includes the deployment of a habitable element or elements, which could be used as a central location for aggregation of supplies and resources for human missions in cis-lunar space and beyond. Characterizing candidate orbit locations for this asset and the impacts on system design and mission operations is important in the overall assessment of the options being considered. The orbits described in this paper were initially selected by taking advantage of previous studies conducted by NASA and the work of other authors. In this paper orbits are assessed for their relative attractiveness based on various factors. First, a set of constraints related to the capability of the combined Orion and SLS system to deliver humans and cargo to and from the orbit are evaluated. Second, the ability to support potential lunar surface activities is considered. Finally, deployed assets intended to spend multiple years in the Proving Ground would ideally require minimal station keeping costs to reduce the mass budget allocated to this function. Additional mission design drivers include potential for uninterrupted communication with deployed assets, thermal, communications, and other operational implications. The results of the characterization and evaluation of the selected orbits indicate a Near Rectilinear Orbit (NRO) is an attractive candidate as an aggregation point or staging location for operations. In this paper, the NRO is further described in terms which balance a number of key attributes that favor a variety of mission classes to meet multiple

  6. Options for Staging Orbits in Cis-Lunar Space

    NASA Technical Reports Server (NTRS)

    Martinez, Roland; Whitley, Ryan

    2016-01-01

    NASA has been studying options to conduct missions beyond Low Earth Orbit, but within the Earth-Moon system, in preparation for deep space exploration including human missions to Mars. Referred to as the Proving Ground, this arena of exploration activities will enable the development of human spaceflight systems and operations to satisfy future exploration objectives beyond the cis-lunar environment. One option being considered includes the deployment of a habitable element or elements, which could be used as a central location for aggregation of supplies and resources for human missions in cis-lunar space and beyond. Characterizing candidate orbit locations for this asset and the impacts on system design and mission operations is important in the overall assessment of the options being considered. The orbits described in this paper were initially selected by taking advantage of previous studies conducted by NASA and the work of other authors. In this paper orbits are assessed for their relative attractiveness based on various factors. A set of constraints related to the capability of the combined Orion and SLS system to deliver humans and cargo to and from the orbit are evaluated. Deployed assets intended to spend multiple years in the Proving Ground would ideally require minimal station keeping costs to reduce the mass budget allocated to this function. Additional mission design drivers include eclipse frequency, potential for uninterrupted communication with deployed assets, thermal, attitude control, communications, and other operational implications. Also the ability to support potential lunar surface activities and excursion missions beyond Earth-Moon space is considered. The results of the characterization and evaluation of the selected orbits indicate a Near Rectilinear Orbit (NRO) is an attractive candidate as an aggregation point or staging location for operations. In this paper, the NRO is further described in terms which balance a number of key

  7. Enzymatic and free radical formation of cis- and trans- epoxyeicosatrienoic acids in vitro and in vivo.

    PubMed

    Aliwarga, Theresa; Raccor, Brianne S; Lemaitre, Rozenn N; Sotoodehnia, Nona; Gharib, Sina A; Xu, Libin; Totah, Rheem A

    2017-07-19

    Epoxyeicosatrienoic acids (EETs) are metabolites of arachidonic acid (AA) oxidation that have important cardioprotective and signaling properties. AA is an ω-6 polyunsaturated fatty acid (PUFA) that is prone to autoxidation. Although hydroperoxides and isoprostanes are major autoxidation products of AA, EETs are also formed from the largely overlooked peroxyl radical addition mechanism. While autoxidation yields both cis- and trans-EETs, cytochrome P450 (CYP) epoxygenases have been shown to exclusively catalyze the formation of all regioisomer cis-EETs, on each of the double bonds. In plasma and red blood cell (RBC) membranes, cis- and trans-EETs have been observed, and both have multiple physiological functions. We developed a sensitive ultra-performance liquid chromatography tandem mass spectrometry (UPLC-MS/MS) assay that separates cis- and trans- isomers of EETs and applied it to determine the relative distribution of cis- vs. trans-EETs in reaction mixtures of AA subjected to free radical oxidation in benzene and liposomes in vitro. We also determined the in vivo distribution of EETs in several tissues, including human and mouse heart, and RBC membranes. We then measured EET levels in heart and RBC of young mice compared to old. Formation of EETs in free radical reactions of AA in benzene and in liposomes exhibited time- and AA concentration-dependent increase and trans-EET levels were higher than cis-EETs under both conditions. In contrast, cis-EET levels were overall higher in biological samples. In general, trans-EETs increased with mouse age more than cis-EETs. We propose a mechanism for the non-enzymatic formation of cis- and trans-EETs involving addition of the peroxyl radical to one of AA's double bonds followed by bond rotation and intramolecular homolytic substitution (SHi). Enzymatic formation of cis-EETs by cytochrome P450 most likely occurs via a one-step concerted mechanism that does not allow bond rotation. The ability to accurately measure

  8. DNA unwinding produced by site-specific intrastrand cross-links of the antitumor drug cis-diamminedichloroplatinum(II)

    SciTech Connect

    Bellon, S.F.; Coleman, J.H.; Lippard, S.J. )

    1991-08-13

    The DNA unwinding produced by specific adducts of the antitumor drug cis-diamminedi-chloroplatinum(II) has been quantitatively determined. Synthetic DNA duplex oligonucleotides of varying lengths with two base pair cohesive ends were synthesized and characterized that contained site-specific intrastrand N7-purine/N7-purine cross-links. Included are cis-(Pt(NH{sub 3}){sub 2}(d(GpG))), cis-(Pt(NH){sub 3}{sub 2}(d(ApG))), and cis-(Pt(NH{sub 3}){sub 2}(d(GpTpG))) adducts, respectively referred to as cis-GG, cis-AG, and cis-GTG. Local DNA distortions at the site of platination were amplified by polymerization of these monomers and quantitatively evaluated by using polyacrylamide gel electrophoresis. The extent of DNA unwinding was determined by systematically varying the interplatinum distance, or phasing, in polymers containing the adducts. The multimer that migrates most slowly gives the optimal phasing for cooperative bending, from which the degree of unwinding can be obtained. The authors find that the cis-GG and cis-AG adducts both unwind DNA by 13{degrees}, while the cis-GTG adduct unwinds DNA by 23{degrees}. In addition, experiments are presented that support previous studies revealing that a hinge joint forms at the sites of platination in DNA molecules containing trans-GTG adducts. On the basis of an analysis of the present and other published studies of site-specifically modified DNA. The authors propose that local duplex unwinding is a major determinant in the recognition of DNA damage by the Escherichia coli (A)BC excinuclease. In addition, local duplex unwinding of 13{degrees} and bending by 35{degrees} are shown to correlate well with the recognition of platinated DNA by a previously identified damage recognition protein (DRP) in human cells.

  9. Characterization of cis-regulatory elements of the c-myc promoter responding to human GM-CSF or mouse interleukin 3 in mouse proB cell line BA/F3 cells expressing the human GM-CSF receptor.

    PubMed

    Watanabe, S; Ishida, S; Koike, K; Arai, K

    1995-06-01

    Interleukin 3 (IL-3) or granulocyte macrophage colony-stimulating factor (GM-CSF) activates c-fos, c-jun, and c-myc genes and proliferation in both hematopoietic and nonhematopoietic cells. Using a series of deletion mutants of the beta subunit of human GM-CSF receptor (hGMR) and inhibitors of tyrosine kinase, two distinct signaling pathways, one for activation of c-fos and c-jun genes, and the other for cell proliferation and activation of c-myc gene have been elucidated. In contrast to wealth of information on the pathway leading to activation of c-fos/c-jun genes, knowledge of the latter is scanty. To clarify the mechanisms of activation of c-myc gene by cytokines, we established a transient transfection assay in mouse proB cell line BA/F3 cells expressing hGMR. Analyses of hGMR beta subunit mutants revealed two cytoplasmic regions involved in activation of the c-myc promoter, one is essential and the other is dispensable but enhances the activity. These regions are located at the membrane proximal and the distal regions covering amino acid positions 455-544 and 544-589, respectively. Characterization of cis-acting regulatory elements of the c-myc gene showed that the region containing the P2 promoter initiation site is sufficient to mediate the response to mIL-3 or hGM-CSF. Electrophoretic mobility shift assay using an oligonucleotide corresponding to the distal putative E2F binding site revealed that p107/E2F complex, the negative regulator of E2F, decreased, and free E2F increased after mIL-3 stimulation. These results support the thesis that mIL-3 or hGM-CSF regulates the c-myc promoter by altering composition of the E2F complexes at E2F binding site.

  10. Sequence Polymorphisms Cause Many False cis eQTLs

    PubMed Central

    Alberts, Rudi; Terpstra, Peter; Li, Yang; Breitling, Rainer; Nap, Jan-Peter; Jansen, Ritsert C.

    2007-01-01

    Many investigations have reported the successful mapping of quantitative trait loci (QTLs) for gene expression phenotypes (eQTLs). Local eQTLs, where expression phenotypes map to the genes themselves, are of especially great interest, because they are direct candidates for previously mapped physiological QTLs. Here we show that many mapped local eQTLs in genetical genomics experiments do not reflect actual expression differences caused by sequence polymorphisms in cis-acting factors changing mRNA levels. Instead they indicate hybridization differences caused by sequence polymorphisms in the mRNA region that is targeted by the microarray probes. Many such polymorphisms can be detected by a sensitive and novel statistical approach that takes the individual probe signals into account. Applying this approach to recent mouse and human eQTL data, we demonstrate that indeed many local eQTLs are falsely reported as “cis-acting” or “cis” and can be successfully detected and eliminated with this approach. PMID:17637838

  11. Randomized Subspace Learning for Proline Cis-Trans Isomerization Prediction.

    PubMed

    Al-Jarrah, Omar Y; Yoo, Paul D; Taha, Kamal; Muhaidat, Sami; Shami, Abdallah; Zaki, Nazar

    2015-01-01

    Proline residues are common source of kinetic complications during folding. The X-Pro peptide bond is the only peptide bond for which the stability of the cis and trans conformations is comparable. The cis-trans isomerization (CTI) of X-Pro peptide bonds is a widely recognized rate-limiting factor, which can not only induces additional slow phases in protein folding but also modifies the millisecond and sub-millisecond dynamics of the protein. An accurate computational prediction of proline CTI is of great importance for the understanding of protein folding, splicing, cell signaling, and transmembrane active transport in both the human body and animals. In our earlier work, we successfully developed a biophysically motivated proline CTI predictor utilizing a novel tree-based consensus model with a powerful metalearning technique and achieved 86.58 percent Q2 accuracy and 0.74 Mcc, which is a better result than the results (70-73 percent Q2 accuracies) reported in the literature on the well-referenced benchmark dataset. In this paper, we describe experiments with novel randomized subspace learning and bootstrap seeding techniques as an extension to our earlier work, the consensus models as well as entropy-based learning methods, to obtain better accuracy through a precise and robust learning scheme for proline CTI prediction.

  12. Stimulation of Phospholipid Scrambling of the Erythrocyte Membrane by 9-Cis-Retinoic Acid.

    PubMed

    Abed, Majed; Alzoubi, Kousi; Lang, Florian; Al Mamun Bhuayn, Abdulla

    2017-01-01

    The endogenous retinoid 9-cis-retinoic acid has previously been shown to trigger apoptosis in a wide variety of cells including several tumor cells and has thus been suggested for the treatment of malignancy. Similar to apoptosis of nucleated cells, erythrocytes may enter suicidal erythrocyte death or eryptosis, which is characterized by cell shrinkage and cell membrane scrambling with phosphatidylserine translocation to the erythrocyte surface. Cellular mechanisms participating in the accomplishment of eryptosis include increase of cytosolic Ca2+ activity ([Ca2+]i) and formation of ceramide. The present study explored, whether 9-cis-retinoic acid induces eryptosis and whether the effect involves Ca2+ and/or ceramide. Flow cytometry was employed to estimate erythrocyte volume from forward scatter, phosphatidylserine exposure at the cell surface from annexin-V-binding, [Ca2+]i from Fluo3-fluorescence, and ceramide abundance utilizing specific antibodies. Hemolysis was quantified from hemoglobin concentration in the supernatant. A 48 hours exposure of human erythrocytes to 9-cis-retinoic acid (≥ 0.5 µg/ml) significantly increased the percentage of annexin-V-binding cells and significantly decreased forward scatter. Exposure to 9-cis-retinoic acid (≥ 0.5 µg/ml) significantly increased Fluo3-fluorescence, and the effect of 9-cis-retinoic acid on annexin-V-binding was significantly blunted by removal of extracellular Ca2+. Exposure to 9-cis-retinoic acid (1 µg/ml) further significantly increased the ceramide abundance at the erythrocyte surface and significantly increased hemolysis. 9-cis-retinoic acid triggers phospholipid scrambling of the erythrocyte cell membrane, an effect at least in part downstream of Ca2+ and ceramide. © 2017 The Author(s)Published by S. Karger AG, Basel.

  13. IRIS Toxicological Review of Cis-& Trans-1,2-Dichloroethylene (Final Report)

    EPA Science Inventory

    EPA has finalized the Toxicological Review of cis- & trans-1,2-Dichloroethylene: in support of the Integrated Risk Information System (IRIS). Now final, this assessment may be used by EPA’s program and regional offices to inform decisions to protect human health.

  14. IRIS Toxicological Review of Cis-& Trans-1,2-Dichloroethylene (Final Report)

    EPA Science Inventory

    EPA has finalized the Toxicological Review of cis- & trans-1,2-Dichloroethylene: in support of the Integrated Risk Information System (IRIS). Now final, this assessment may be used by EPA’s program and regional offices to inform decisions to protect human health.

  15. Synergistic activation by cis-fatty acid and diacylglycerol of protein kinase C and protein phosphorylation in hippocampal slices.

    PubMed

    Chen, S G; Murakami, K

    1995-10-01

    cis-Unsaturated fatty acid, which activates protein kinase C in vitro, stimulates protein phosphorylation in intact hippocampal slices. Two protein bands (44,000 and 47,000 mol. wt) are particularly sensitive to cis-fatty acid and are phosphorylated in a dose- and time-dependent manner. The cis-fatty acid-stimulated protein phosphorylation can be further potentiated with diacylglycerol or 12-O-tetradecanoylphorbol 13-acetate. Several lines of evidence indicate that the cis-fatty acid-stimulated phosphorylation of these proteins is mediated by protein kinase C. First, the cis-fatty acid effect is mimicked by other protein kinase C activators such as diacylglycerol. Second, the stimulation of the phosphorylation by these activators can be blocked by staurosporine, which potently inhibits protein kinase C. Third, a concomitant application of cis-fatty acid and diacylglycerol or 12-O-tetradecanoylphorbol 13-acetate enhances the 44,000 and 47,000 mol. wt phosphorylation in a synergistic manner, which is a novel activation mode for protein kinase C. Fourth, they can be phosphorylated by purified protein kinase C (type III: alpha). Moreover, the synergistic activation of purified protein kinase C by cis-fatty acid and diacylglycerol leads to a drastic increase in the phosphorylation of these two protein bands. Two-dimensional gel electrophoresis and immunoblot analysis revealed that they are both acidic proteins. The 47,000 mol. wt band consists of two protein components; one is found to be F1/growth-associated protein-43 (pI = 4.5), and the other 47,000 mol, wt protein has broad pI ranging from 4.6 to 4.9. The 44,000 mol. wt component is a major phosphoprotein with pI of 4.8-5.1. Our results strongly indicate that cis-fatty acid can act as a regulator of endogenous protein kinase C in concert with diacylglycerol, and stimulate protein phosphorylation of its substrates such as F1/growth-associated protein-43 in the hippocampus.

  16. Samarium(II) promoted stereoselective synthesis of antiproliferative cis-beta-alkoxy-gamma-alkyl-gamma-lactones.

    PubMed

    Donadel, Osvaldo J; Martín, Tomás; Martín, Víctor S; Padrón, José M

    2007-01-01

    Samarium(II) iodide promotes the stereoselective synthesis of cis-beta-alkoxy-gamma-alkyl-gamma-lactones under mild conditions starting from linear precursors. The in vitro antiproliferative activities were examined in the human solid tumor cell lines from diverse origin A2780, SW1573, and WiDr. From the growth inhibition data a structure-activity relationship was obtained. Overall the results point to the relevant role of cis-beta-alkoxy-gamma-alkyl-gamma-lactones as novel scaffolds for the development of new anticancer drugs.

  17. The Role of Cis-Lunar Space in Future Global Space Exploration

    NASA Technical Reports Server (NTRS)

    Bobskill, Marianne R.; Lupisella, Mark L.

    2012-01-01

    Cis-lunar space offers affordable near-term opportunities to help pave the way for future global human exploration of deep space, acting as a bridge between present missions and future deep space missions. While missions in cis-lunar space have value unto themselves, they can also play an important role in enabling and reducing risk for future human missions to the Moon, Near-Earth Asteroids (NEAs), Mars, and other deep space destinations. The Cis-Lunar Destination Team of NASA's Human Spaceflight Architecture Team (HAT) has been analyzing cis-lunar destination activities and developing notional missions (or "destination Design Reference Missions" [DRMs]) for cis-lunar locations to inform roadmap and architecture development, transportation and destination elements definition, operations, and strategic knowledge gaps. The cis-lunar domain is defined as that area of deep space under the gravitational influence of the earth-moon system. This includes a set of earth-centered orbital locations in low earth orbit (LEO), geosynchronous earth orbit (GEO), highly elliptical and high earth orbits (HEO), earth-moon libration or "Lagrange" points (E-ML1 through E-ML5, and in particular, E-ML1 and E-ML2), and low lunar orbit (LLO). To help explore this large possibility space, we developed a set of high level cis-lunar mission concepts in the form of a large mission tree, defined primarily by mission duration, pre-deployment, type of mission, and location. The mission tree has provided an overall analytical context and has helped in developing more detailed design reference missions that are then intended to inform capabilities, operations, and architectures. With the mission tree as context, we will describe two destination DRMs to LEO and GEO, based on present human space exploration architectural considerations, as well as our recent work on defining mission activities that could be conducted with an EML1 or EML2 facility, the latter of which will be an emphasis of this

  18. Interleukin-5 receptor alpha subunit gene regulation in human eosinophil development: identification of a unique cis-element that acts lie an enhancer in regulating activity of the IL-5R alpha promoter.

    PubMed

    Sun, Z; Yergeau, D A; Wong, I C; Tuypens, T; Tavernier, J; Paul, C C; Baumann, M A; Auron, P E; Tenen, D G; Ackerman, S J

    1996-01-01

    Further functional and biochemical characterization of the nuclear factor(s) which interacts with the EOS1 enhancer-like element in the IL-5R alpha promoter is currently in progress. Since different transcription factors recognize and interact with DNA in distinct fashions and with distinct structural motifs, we have modeled potential binding of the EOS1 factor to its cis-element based upon its methylation interference pattern (Fig. 2), using a cylindrical DNA helical projection (Fig. 6). Over a length of two helical turns, all nuclear protein contacts indicated by methylation interference map to one side of the DNA helix, suggesting that EOS1 binds in the major groove, across the minor groove, and on only one side of the helix. Further review of the model also reveals a potential diad symmetry for the binding site, suggestive of binding by a homodimer and consistent with the formation of the two DNA-protein complexes in our electrophoretic mobility shift experiments that could represent interactions with monomer versus dimer. Comparison of the EOS1 binding motif to similar models for the binding of other transcription factor families for which structural crystallographic and/or binding data is available suggests a similarity of the EOS1 complex to that of the bacterial helix-turn-helix phage lambda and 434 repressor-operator complexes, and the Cys4 zinc finger glucocorticoid response element (GRE) DNA-binding motifs, all of which show similar diad symmetry and binding in the major groove on one side of the DNA. The possibility that EOS1 functions as a GRE is being investigated, especially since there is a consensus AP-1 site at bp -440 to -432 of the IL-5R alpha promoter, immediately adjacent to the EOS1 binding site (see Fig. 5 in reference [36]) and AP-1/GRE interactions have been identified for composite response elements in the regulation of a number of different genes. The identification or cloning of EOS1, a potentially novel and eosinophil lineage

  19. Rotational spectroscopy and dipole moment of cis-cis HOONO and DOONO.

    PubMed

    Fry, Juliane L; Drouin, Brian J; Miller, Charles E

    2006-02-28

    The rotational spectrum of cis-cis HOONO has been studied over a broad range of frequencies, 13-840 GHz, using pulsed beam Fourier-transform microwave spectroscopy and room-temperature flow cell submillimeter spectroscopy. The rotational spectrum of the deuterated isotopomer, cis-cis DOONO, has been studied over a subset of this range, 84-640 GHz. Improved spectroscopic constants have been determined for HOONO, and the DOONO spectrum is analyzed for the first time. Weak-field Stark effect measurements in the region of 84-110 GHz have been employed to determine the molecular dipole moments of cis-cis HOONO [mu(a) = 0.542(8) D, mu(b) = 0.918(15) D, mu = 1.07(2) D] and DOONO [mu(a) = 0.517(9) D, mu(b) = 0.930(15) D, mu = 1.06(2) D]. The quadrupole coupling tensor in the principal inertial axis system for the 14N nucleus has been determined to be chi(aa) = 1.4907(25) MHz, chi(bb) = -4.5990(59) MHz, chi(ab) = 3.17(147) MHz, and chi(cc) = 3.1082(59) MHz. Coordinates of the H atom in the center-of-mass frame have been determined with use of the Kraitchman equations, /aH/ = 0.516 A and /bH/ = 1.171 A. The inertial defects of HOONO and DOONO are consistent with a planar equilibrium structure with significant out-of-plane H atom torsional motion. Comparisons of the present results are made to ab initio calculations.

  20. Nontuberculous mycobacterial pulmonary disease mimicking lung cancer

    PubMed Central

    Hong, Su Jin; Kim, Tae Jung; Lee, Jae-Ho; Park, Jeong-Soo

    2016-01-01

    Abstract To describe the features and clinical implications of computed tomography (CT), positron emission tomography (PET), and percutaneous needle aspiration biopsy (PCNB) in pulmonary nontuberculous mycobacterial (NTM) disease manifesting as a solitary nodule, mass, or mass-like consolidation mimicking malignancy. Among a cohort of 388 patients with NTM pulmonary disease, 14 patients with clinically and radiologically suspected lung cancer were included in our study. Two chest radiologists evaluated CT features, including lesion type (nodule, mass, or mass-like consolidation), morphologic features (margin, degree of enhancement, calcification), and presence of accompanying findings suggestive of NTM pulmonary disease (bronchiectasis with clustered centrilobular nodules or upper-lobe cavitary lesions) by consensus. Diagnostic procedures for microbiologic diagnosis of NTM disease and clinical outcome were reviewed. Incidence of NTM pulmonary disease presenting as solitary nodule/mass (n = 8) or mass-like consolidation (n = 6) was 3.6% (14 of 388). Most lesions were detected incidentally during routine health check-up or evaluation of other disease (11 of 14, 79%). Lesions typically showed poor contrast-enhancement (9 of 12) and internal calcification (6 of 14). No lesions had CT features suggestive of NTM pulmonary disease. All 4 lesions for which PET/CT imaging was performed showed strong fluorodeoxyglucose uptake simulating malignant lesions (mean, 4.9; range, 3.6–7.8). PCNB revealed mycobacterial histology in 6 of 11 specimens and positive culture results were obtained for 7 of 7 specimens. NTM pulmonary disease may present as a solitary nodule, mass, or mass-like consolidation mimicking malignancy. CT features and PCNB are important to diagnose NTM disease mimicking lung cancer to avoid unnecessary surgery. PMID:27367996

  1. Antibody against early driver of neurodegeneration cis P-tau blocks brain injury and tauopathy.

    PubMed

    Kondo, Asami; Shahpasand, Koorosh; Mannix, Rebekah; Qiu, Jianhua; Moncaster, Juliet; Chen, Chun-Hau; Yao, Yandan; Lin, Yu-Min; Driver, Jane A; Sun, Yan; Wei, Shuo; Luo, Man-Li; Albayram, Onder; Huang, Pengyu; Rotenberg, Alexander; Ryo, Akihide; Goldstein, Lee E; Pascual-Leone, Alvaro; McKee, Ann C; Meehan, William; Zhou, Xiao Zhen; Lu, Kun Ping

    2015-07-23

    Traumatic brain injury (TBI), characterized by acute neurological dysfunction, is one of the best known environmental risk factors for chronic traumatic encephalopathy and Alzheimer's disease, the defining pathologic features of which include tauopathy made of phosphorylated tau protein (P-tau). However, tauopathy has not been detected in the early stages after TBI, and how TBI leads to tauopathy is unknown. Here we find robust cis P-tau pathology after TBI in humans and mice. After TBI in mice and stress in vitro, neurons acutely produce cis P-tau, which disrupts axonal microtubule networks and mitochondrial transport, spreads to other neurons, and leads to apoptosis. This process, which we term 'cistauosis', appears long before other tauopathy. Treating TBI mice with cis antibody blocks cistauosis, prevents tauopathy development and spread, and restores many TBI-related structural and functional sequelae. Thus, cis P-tau is a major early driver of disease after TBI and leads to tauopathy in chronic traumatic encephalopathy and Alzheimer's disease. The cis antibody may be further developed to detect and treat TBI, and prevent progressive neurodegeneration after injury.

  2. cis p-tau: early driver of brain injury and tauopathy blocked by antibody

    PubMed Central

    Mannix, Rebekah; Qiu, Jianhua; Moncaster, Juliet; Chen, Chun-Hau; Yao, Yandan; Lin, Yu-Min; Driver, Jane A; Sun, Yan; Wei, Shuo; Luo, Man-Li; Albayram, Onder; Huang, Pengyu; Rotenberg, Alexander; Ryo, Akihide; Goldstein, Lee E; Pascual-Leone, Alvaro; McKee, Ann C.; Meehan, William; Zhou, Xiao Zhen; Lu, Kun Ping

    2015-01-01

    Traumatic brain injury (TBI), characterized by acute neurological dysfunction, is one of the best known environmental risk factors for chronic traumatic encephalopathy (CTE) and Alzheimer's disease (AD), whose defining pathologic features include tauopathy made of phosphorylated tau (p-tau). However, tauopathy has not been detected in early stages after TBI and how TBI leads to tauopathy is unknown. Here we find robust cis p-tau pathology after sport- and military-related TBI in humans and mice. Acutely after TBI in mice and stress in vitro, neurons prominently produce cis p-tau, which disrupts axonal microtubule network and mitochondrial transport, spreads to other neurons, and leads to apoptosis. This process, termed “cistauosis”, appears long before other tauopathy. Treating TBI mice with cis antibody blocks cistauosis, prevents tauopathy development and spread, and restores many TBI-related structural and functional sequelae. Thus, cis p-tau is a major early driver after TBI and leads to tauopathy in CTE and AD, and cis antibody may be further developed to detect and treat TBI, and prevent progressive neurodegeneration after injury. PMID:26176913

  3. Brucellosis in spondyloarthritis mimicking an exacerbation.

    PubMed

    Garip, Y; Eser, F; Erten, S; Yilmaz, O; Yildirim, P

    2014-01-01

    Spondyloarthritis are a group of chronic inflammatory diseases that affect the axial skeleton, entheses and peripheral joints and may have extraarticular manifestations such as uveitis, psoriasis and inflammatory bowel disease. Brucellosis is a systemic infectious disease, endemic in Middle East, Latin America, and Mediterranean countries, which may present manifestations that resemble other diseases posing serious problems of differential diagnosis. Some hallmarks of Brucellosis may mimic a spondyloarthritis flare. In this paper, authors present a clinical case of brucellosis occurring in a patient with spondyloarthritis. Clinical symptoms initially mimicked exacerbation of spondyloarthritis.

  4. Thymic Langerhans cell histiocytosis mimicking lymphoma.

    PubMed

    Yağci, Begül; Varan, Ali; Uner, Aysegül; Akyüz, Canan; Büyükpamukçu, Münevver

    2008-12-01

    Langerhans cell histiocytosis (LCH) is a rare disorder characterized by clonal expansion of antigen presenting Langerhans cells. Different clinical features can be seen according to the involved organs and systems. Multisystem disease with organ dysfunction is more common in infants, whereas single system disease is usually observed in older children. The disease can affect any system or organ throughout the body. Thymus is a rarely involvement site reported in LCH and usually is accompanied by skin, bone or lung disease. Here we report a 12-year-old male with thymic involvement by LCH clinically mimicking lymphoma.

  5. Post-pancreatitis Fat Necrosis Mimicking Carcinomatosis.

    PubMed

    Smith, Joshua P; Arnoletti, J Pablo; Varadarajulu, Shyam; Morgan, Desiree E

    2008-01-01

    Acute pancreatitis can result in retroperitoneal fat necrosis, typically occurring in the peripancreatic region, with extension into the transverse mesocolon, omentum and mesenteric root. When evaluated with contrast enhanced computed tomography (CECT), acute peripancreatic post necrotic collections typically become lower in attenuation over time, and often appear as homogeneous fluid collections. Saponification as a complication of fat necrosis in patients with acute pancreatitis is a well recognized clinical entity. While retroperitonal fat necrosis is commonly seen on CECT, saponification is not a prominent imaging feature. We present a case of acute pancreatitis complicated by extensive saponification of fat throughout the retroperitoneum and peritoneal lining, mimicking carcinomatosis.

  6. Severe emphysematous pyelonephritis mimicking intestinal obstruction.

    PubMed

    Sun, Ji Ning; Zhang, Bao Long; Yu, Hai Yan; Wang, Bin

    2015-12-01

    Emphysematous pyelonephritis is a severe necrotizing infection characterized by the presence of gas and/or fluid in the renal parenchyma, collecting system, or perirenal tissues. Emphysematous pyelonephritis with approximately 15 cm air-fluid level, diffused ureteral involvement, and the accumulation of gas in liver and peritoneal cavity is very rare. Here, we reported a severe emphysematous pyelonephritis with multiple huge air-fluid level mimicking intestinal obstruction and with the accumulation of gas in liver and ureter in computed tomography imaging. The patient was successfully managed by percutaneous nephrostomy combined with medical treatment.

  7. Chondroblastoma of the acromion mimicking fibrous dysplasia.

    PubMed

    Gebert, Carsten; Hardes, Jendrik; Streitbürger, Arne; Vieth, Volker; Bürger, Horst; Winkelmann, Winfried; Gosheger, Georg

    2004-12-01

    The authors report the case of a 65-year-old man who presented with an expansive osteolytic lesion in the right acromion, mimicking cystic fibrous dysplasia. Magnetic resonance imaging showed a lesion with intermediate-signal intensity on T1-weighted images and a high-signal intensity on fat suppressed T2-weighted images. The biopsy led to the diagnosis of chondroblastoma. This tumour is rare in flat bones, and may mimic other benign or malignant lesions. It is therefore essential to perform a biopsy in order to obtain a definite diagnosis. The acromion was excised, and replaced with an iliac crest graft.

  8. Intradural Extramedullary Tuberculoma Mimicking En Plaque Meningioma

    PubMed Central

    Shim, Dae Moo; Kim, Tae Kyun; Chae, Soo Uk

    2010-01-01

    A 24-year-old man with tuberculosis meningitis developed acute paraplegia and sensory disturbances 5 weeks after receiving conventional antituberculous therapy. Magnetic resonance imaging revealed an intradural extramedullary long segmental mass mimicking en plaque meningioma at the T2-T6 vertebrae levels. Prompt surgical decompression was performed. A histology examination of the mass revealed a tuberculoma. After surgery, the patient showed improved motor power and a normal bladder function. Intradural extramedullary tuberculoma of the spinal cord is rare complication of tuberculosis meningitis, which can occur as a response to conventional antituberculous therapy. PMID:21119945

  9. Pulmonary tumour microembolism clinically mimicking alveolitis

    PubMed Central

    Lo, A W I; Tse, G M K; Chu, W C W; Chan, A B W

    2003-01-01

    A 56 year old man with previously unsuspected recurrence of squamous cell carcinoma of the oesophagus presented with dyspnoea. Bronchoscopy and computed tomography suggested bronchopneumonic changes with an infectious cause. He suffered a rapidly deteriorating course and died despite active treatment, including antibiotics and mechanical ventilation. Necropsy revealed a florid pulmonary tumour microembolism mimicking alveolitis. No bronchopneumonia was seen. The emboli arose from loosely attached tumour vegetations in the tricuspid valve. In a patient with known malignancy, tumour microembolism should be considered as an uncommon cause of rapid respiratory failure, refractory to antibiotic treatment. PMID:14600135

  10. Environmental testing of CIS based modules

    SciTech Connect

    Willett, D.

    1995-11-01

    This report describes environmental testing of Siemen`s CIS modules. Charts and diagrams are presented on data concerning: temporary power loss of laminated mini-modules; the 50 thermal cycle test; the 10 humidity freeze cycle test; results after 1000 hours of exposure to damp heat; and interconnect test structures in damp heat testing. It is concluded that moisture ingress causes permanent increases in the series resistance of modules, and that improved packaging is needed for better high humidity reliability. Also, dry dark heat caused temporary power losses which were recovered in sunlight.

  11. TFM-Explorer: mining cis-regulatory regions in genomes

    PubMed Central

    Tonon, Laurie; Varré, Jean-Stéphane

    2010-01-01

    DNA-binding transcription factors (TFs) play a central role in transcription regulation, and computational approaches that help in elucidating complex mechanisms governing this basic biological process are of great use. In this perspective, we present the TFM-Explorer web server that is a toolbox to identify putative TF binding sites within a set of upstream regulatory sequences of genes sharing some regulatory mechanisms. TFM-Explorer finds local regions showing overrepresentation of binding sites. Accepted organisms are human, mouse, rat, chicken and drosophila. The server employs a number of features to help users to analyze their data: visualization of selected binding sites on genomic sequences, and selection of cis-regulatory modules. TFM-Explorer is available at http://bioinfo.lifl.fr/TFM. PMID:20522509

  12. Clinical and Histologic Mimickers of Celiac Disease.

    PubMed

    Kamboj, Amrit K; Oxentenko, Amy S

    2017-08-17

    Celiac disease is an autoimmune disorder of the small bowel, classically associated with diarrhea, abdominal pain, and malabsorption. The diagnosis of celiac disease is made when there are compatible clinical features, supportive serologic markers, representative histology from the small bowel, and response to a gluten-free diet. Histologic findings associated with celiac disease include intraepithelial lymphocytosis, crypt hyperplasia, villous atrophy, and a chronic inflammatory cell infiltrate in the lamina propria. It is important to recognize and diagnose celiac disease, as strict adherence to a gluten-free diet can lead to resolution of clinical and histologic manifestations of the disease. However, many other entities can present with clinical and/or histologic features of celiac disease. In this review article, we highlight key clinical and histologic mimickers of celiac disease. The evaluation of a patient with serologically negative enteropathy necessitates a carefully elicited history and detailed review by a pathologist. Medications can mimic celiac disease and should be considered in all patients with a serologically negative enteropathy. Many mimickers of celiac disease have clues to the underlying diagnosis, and many have a targeted therapy. It is necessary to provide patients with a correct diagnosis rather than subject them to a lifetime of an unnecessary gluten-free diet.

  13. Doxycycline-induced ulceration mimicking esophageal cancer

    PubMed Central

    Tahan, Veysel; Sayrak, Hakan; Bayar, Nevzat; Erer, Burak; Tahan, Gulgun; Dane, Faysal

    2008-01-01

    Introduction Doxycycline-induced esophageal ulcer patients are mostly young persons with no history of esophageal dysfunction. Heartburn, midsternal pain and dysphagia are the most common symptoms. It has generally a benign course. The present case is the first report of doxycycline-induced extensive ulcerations, mimicking esophageal cancer in two esophageal segments alongside, in the literature. Case presentation This report describes a 16-year-old Caucasian girl who, while taking doxycycline capsules100 mg twice a day for acne vulgaris for 3 months, developed these symptoms. An upper endoscopy revealed multiple circumferential deep ulcerations surrounding fragile, irregular, hyperemic and hypertrophic mucosa at the level of the mid-esophagus and concomitantly in the lower esophageal sphincter. The lesions were biopsied to exclude esophageal carcinoma because of the suspicious appearance in the endoscopic examination. The histopathological examination, haematoxylin and eosin stained sections showed ulceration with a mixed inflammatory infiltrate. Doxycycline was discontinued and she was given sucralfate 1 g qid and omeprazole 20 mg bid orally. All symptoms of the patient were resolved on the third day of the treatment. After 4 weeks of the therapy, an upper endoscopic control examination demonstrated normal findings. Conclusion The present case has been an uncommon presentation of doxycycline-induced extensive ulcerations, mimicking esophageal cancer in two esophageal segments, concomitantly. Even the lesions were biopsied to exclude esophageal carcinoma. A modification on the behavior of taking drugs can prevent these unpleasant complications. PMID:18778470

  14. Inflammatory Myofibroblastic Tumor Mimicking Apical Periodontitis.

    PubMed

    Adachi, Makoto; Kiho, Kazuki; Sekine, Genta; Ohta, Takahisa; Matsubara, Makoto; Yoshida, Takakazu; Katsumata, Akitoshi; Tanuma, Jun-ichi; Sumitomo, Shinichiro

    2015-12-01

    Inflammatory myofibroblastic tumors (IMTs) are rare. IMTs of the head and neck occur in all age groups, from neonates to old age, with the highest incidence occurring in childhood and early adulthood. An IMT has been defined as a histologically distinctive lesion of uncertain behavior. This article describes an unusual case of IMT mimicking apical periodontitis in the mandible of a 42-year-old man. At first presentation, the patient showed spontaneous pain and percussion pain at teeth #28 to 30, which continued after initial endodontic treatment. Panoramic radiography revealed a radiolucent lesion at the site. Cone-beam computed tomographic imaging showed osteolytic lesions, suggesting an aggressive neoplasm requiring incisional biopsy. Histopathological examination indicated an IMT. The lesion was removed en bloc under general anesthesia, and the patient manifested no clinical evidence of recurrence for 24 months. Lesions of nonendodontic origin should be included in the differential diagnosis of apical periodontitis. Every available diagnostic tool should be used to confirm the diagnosis. Cone-beam computed tomographic imaging is very helpful for differential diagnosis in IMTs mimicking apical periodontitis.

  15. Nonlinearity parameter for tissue-mimicking materials.

    PubMed

    Dong, F; Madsen, E L; MacDonald, M C; Zagzebski, J A

    1999-06-01

    A finite amplitude insert-substitution method has been used to determine the ultrasonic nonlinearity parameter B/A of nine versions of water-based, macroscopically uniform ultrasonically tissue-mimicking (TM) nonfat and fat materials. In this method, the amplitude of the second harmonic following transmission through degassed distilled water with known B/A (B/A = 5.2) and the amplitude of the second harmonic following transmission through the unknown sample are measured. The ratio of these amplitudes allows calculation of the B/A of the sample. Measured B/A values of the nonfat materials range from 5.6 to 6.6. These values compare favorably with published values for nonfat soft tissues. In contrast, the measured B/A values for two tissue-mimicking fat materials are 9.8 and 11.1; these two values represent the low and high end of B/A for most fresh fatty tissues. For comparison, B/A was measured for two commonly available uniform materials, corn oil and ethylene glycol, and the results are in good agreement with published values.

  16. Regioselective trans-cis photoisomerization of m-styrylstilbenes

    SciTech Connect

    Ito, Y.; Uozy, Y.; Dote, T.; Ueda, M.; Matsuura, T.

    1988-01-06

    Trans-cis photoisomerization of m-styrylstilbenes, i.e., 2,4,6-triisopropyl-3'-styrylstilbene (TISS), 2,4,6-trimethyl-3'-styrylstilbene (TMSS), and 3-styrylstilbene (SS), and of stilbenes, i.e., 2,4,6-triisopropylstilbene (TIS), 2,4,6-trimethylstilbene (TMS), and stilbene (S), are studied under direct of benzophenone-sensitized irradiation in hexane. Measurements of quantum yields of isomerization have revealed that although the styrylstilbene molecule bears two styryl groups, the reaction is highly regioselective, depending upon the excitation conditions and reactant structures. For example, isomerization of trans, trans-TISS and trans,cis-TISS occurred either at the 2,4,6-trisubstituted styryl side upon direct excitation or at the unstubstituted styryl side upon sensitized excitation. When the starting material carries an unsubstituted cis-styryl group, the major isomerization always occurred at this moiety by either direct or sensitized excitation, e.g., cis,trans-TISS ..-->.. trans,trans-TISS, cis,cis-TISS ..-->.. trans,cis-TISS, and cis,trans-SS ..-->.. trans,trans-SS. Furthermore, the photoisomerization of cis,cis-SS was found to be one-way. These results are interpreted in terms of the usual energy sink concept: the excited-state energies (E/sub S/ and E/sub T/) of the stilbene chromophores depend on molecular distortion in a subtle manner.

  17. Surface hopping dynamics of direct trans → cis photoswitching of an azobenzene derivative in constrained adsorbate geometries.

    PubMed

    Floß, Gereon; Granucci, Giovanni; Saalfrank, Peter

    2012-12-21

    With ongoing miniaturization of electronic devices, the need for individually addressable, switchable molecules arises. An example are azobenzenes on surfaces which have been shown to be switchable between trans and cis forms. Here, we examine the "direct" (rather than substrate-mediated) channel of the trans → cis photoisomerization after ππ∗ excitation of tetra-tert-butyl-azobenzene physisorbed on surfaces mimicking Au(111) and Bi(111), respectively. In spirit of the direct channel, the electronic structure of the surface is neglected, the latter merely acting as a rigid platform which weakly interacts with the molecule via Van-der-Waals forces. Starting from thermal ensembles which represent the trans-form, sudden excitations promote the molecules to ππ∗-excited states which are non-adiabatically coupled among themselves and to a nπ∗-excited and the ground state, respectively. After excitation, relaxation to the ground state by internal conversion takes place, possibly accompanied by isomerization. The process is described here by "on the fly" semiclassical surface hopping dynamics in conjunction with a semiempirical Hamiltonian (AM1) and configuration-interaction type methods. It is found that steric constraints imposed by the substrate lead to reduced but non-vanishing, trans → cis reaction yields and longer internal conversion times than for the isolated molecule. Implications for recent experiments for azobenzenes on surfaces are discussed.

  18. A cis-regulatory module activating transcription in the suspensor contains five cis-regulatory elements

    DOE PAGES

    Henry, Kelli F.; Kawashima, Tomokazu; Goldberg, Robert B.

    2015-03-22

    Little is known about the molecular mechanisms by which the embryo proper and suspensor of plant embryos activate specific gene sets shortly after fertilization. We analyzed the upstream region of the Scarlet Runner Bean (Phaseolus coccineus) G564 gene in order to understand how genes are activated specifically in the suspensor during early embryo development. Previously, we showed that a 54-bp fragment of the G564 upstream region is sufficient for suspensor transcription and contains at least three required cis-regulatory sequences, including the 10-bp motif (5'-GAAAAGCGAA-3'), the 10 bp-like motif (5'-GAAAAACGAA-3'), and Region 2 motif (partial sequence 5'-TTGGT-3'). Here, we use site-directedmore » mutagenesis experiments in transgenic tobacco globularstage embryos to identify two additional cis-regulatory elements within the 54-bp cis-regulatory module that are required for G564 suspensor transcription: the Fifth motif (5'-GAGTTA-3') and a third 10-bp-related sequence (5'-GAAAACCACA-3'). Further deletion of the 54-bp fragment revealed that a 47-bp fragment containing the five motifs (the 10-bp, 10-bp-like, 10-bp-related, Region 2 and Fifth motifs) is sufficient for suspensor transcription, and represents a cis-regulatory module. A consensus sequence for each type of motif was determined by comparing motif sequences shown to activate suspensor transcription. Phylogenetic analyses suggest that the regulation of G564 is evolutionarily conserved. Lastly, a homologous cis-regulatory module was found upstream of the G564 ortholog in the Common Bean (Phaseolus vulgaris), indicating that the regulation of G564 is evolutionarily conserved in closely related bean species.« less

  19. A cis-regulatory module activating transcription in the suspensor contains five cis-regulatory elements.

    PubMed

    Henry, Kelli F; Kawashima, Tomokazu; Goldberg, Robert B

    2015-06-01

    Little is known about the molecular mechanisms by which the embryo proper and suspensor of plant embryos activate specific gene sets shortly after fertilization. We analyzed the upstream region of the Scarlet Runner Bean (Phaseolus coccineus) G564 gene in order to understand how genes are activated specifically in the suspensor during early embryo development. Previously, we showed that a 54-bp fragment of the G564 upstream region is sufficient for suspensor transcription and contains at least three required cis-regulatory sequences, including the 10-bp motif (5'-GAAAAGCGAA-3'), the 10 bp-like motif (5'-GAAAAACGAA-3'), and Region 2 motif (partial sequence 5'-TTGGT-3'). Here, we use site-directed mutagenesis experiments in transgenic tobacco globular-stage embryos to identify two additional cis-regulatory elements within the 54-bp cis-regulatory module that are required for G564 suspensor transcription: the Fifth motif (5'-GAGTTA-3') and a third 10-bp-related sequence (5'-GAAAACCACA-3'). Further deletion of the 54-bp fragment revealed that a 47-bp fragment containing the five motifs (the 10-bp, 10-bp-like, 10-bp-related, Region 2 and Fifth motifs) is sufficient for suspensor transcription, and represents a cis-regulatory module. A consensus sequence for each type of motif was determined by comparing motif sequences shown to activate suspensor transcription. Phylogenetic analyses suggest that the regulation of G564 is evolutionarily conserved. A homologous cis-regulatory module was found upstream of the G564 ortholog in the Common Bean (Phaseolus vulgaris), indicating that the regulation of G564 is evolutionarily conserved in closely related bean species.

  20. 9-cis-retinoic acid promotes cell adhesion through integrin dependent and independent mechanisms across immune lineages.

    PubMed

    Whelan, Jarrett T; Chen, Jianming; Miller, Jabin; Morrow, Rebekah L; Lingo, Joshuah D; Merrell, Kaitlin; Shaikh, Saame Raza; Bridges, Lance C

    2013-05-01

    Retinoids are essential in the proper establishment and maintenance of immunity. Although retinoids are implicated in immune related processes, their role in immune cell adhesion has not been well established. In this study, the effect of 9-cis-retinoic acid (9-cis-RA) on human hematopoietic cell adhesion was investigated. 9-cis-RA treatment specifically induced cell adhesion of the human immune cell lines HuT-78, NB4, RPMI 8866 and U937. Due to the prominent role of integrin receptors in mediating immune cell adhesion, we sought to evaluate if cell adhesion was integrin-dependent. By employing a variety of integrin antagonist including function-blocking antibodies and EDTA, we establish that 9-cis-RA prompts immune cell adhesion through established integrin receptors in addition to a novel integrin-independent process. The novel integrin-independent adhesion required the presence of retinoid and was attenuated by treatment with synthetic corticosteroids. Finally, we demonstrate that 9-cis-RA treatment of primary murine B-cells induces ex vivo adhesion that persists in the absence of integrin function. Our study is the first to demonstrate that 9-cis-RA influences immune cell adhesion through at least two functionally distinct mechanisms.

  1. The Role of cis Regulatory Evolution in Maize Domestication

    PubMed Central

    Lemmon, Zachary H.; Bukowski, Robert; Sun, Qi; Doebley, John F.

    2014-01-01

    Gene expression differences between divergent lineages caused by modification of cis regulatory elements are thought to be important in evolution. We assayed genome-wide cis and trans regulatory differences between maize and its wild progenitor, teosinte, using deep RNA sequencing in F1 hybrid and parent inbred lines for three tissue types (ear, leaf and stem). Pervasive regulatory variation was observed with approximately 70% of ∼17,000 genes showing evidence of regulatory divergence between maize and teosinte. However, many fewer genes (1,079 genes) show consistent cis differences with all sampled maize and teosinte lines. For ∼70% of these 1,079 genes, the cis differences are specific to a single tissue. The number of genes with cis regulatory differences is greatest for ear tissue, which underwent a drastic transformation in form during domestication. As expected from the domestication bottleneck, maize possesses less cis regulatory variation than teosinte with this deficit greatest for genes showing maize-teosinte cis regulatory divergence, suggesting selection on cis regulatory differences during domestication. Consistent with selection on cis regulatory elements, genes with cis effects correlated strongly with genes under positive selection during maize domestication and improvement, while genes with trans regulatory effects did not. We observed a directional bias such that genes with cis differences showed higher expression of the maize allele more often than the teosinte allele, suggesting domestication favored up-regulation of gene expression. Finally, this work documents the cis and trans regulatory changes between maize and teosinte in over 17,000 genes for three tissues. PMID:25375861

  2. Evidence for a 13,14-cis cycle in bacteriorhodopsin

    SciTech Connect

    Tavan, P.; Schulten, K.

    1986-07-01

    The authors discuss to what extent the vibrational spectra of bacteriorhodopsin are in agreement with a photo-cycle of bacteriorhodopsin that involves the sequence BR, IO(all-trans) ..-->.. K(13,14-cis) ..-->.. L(13,14-cis) ..-->.. M(13-cis) ..-->.. N(13-cis) ..-->.. O(all-trans). The discussion is based on a quantumchemical modified neglect of diatomic overlap (MNDO) calculation of the vibrational spectra of the relevant isomers of the protonated retinal Schiff base. In particular, they investigated in these calculations the effects of different charge environments on the frequencies of the relevant C-C single bond stretching vibrations of these isomers.

  3. High-altitude cerebral oedema mimicking stroke

    PubMed Central

    Yanamandra, Uday; Gupta, Amul; Patyal, Sagarika; Varma, Prem Prakash

    2014-01-01

    High-altitude cerebral oedema (HACO) is the most fatal high-altitude illness seen by rural physicians practising in high-altitude areas. HACO presents clinically with cerebellar ataxia, features of raised intracranial pressure (ICP) and coma. Early identification is important as delay in diagnosis can be fatal. We present two cases of HACO presenting with focal deficits mimicking stroke. The first patient presented with left-sided hemiplegia associated with the rapid deterioration in the sensorium. Neuroimaging revealed features suggestive of vasogenic oedema. The second patient presented with monoplegia of the lower limb. Neuroimaging revealed perfusion deficit in anterior cerebral artery territory. Both patients were managed with dexamethasone and they improved dramatically. Clinical picture and neuroimaging closely resembled acute ischaemic stroke in both cases. Thrombolysis in these patients would have been disastrous. Recent travel to high altitude, young age, absence of atherosclerotic risk factors and features of raised ICP concomitantly directed the diagnosis to HACO. PMID:24671373

  4. Orthokeratinised odontogenic cyst mimicking periapical cyst

    PubMed Central

    Rajalakshmi, R; Sreeja, C; Vijayalakshmi, D; Leelarani, V

    2013-01-01

    Orthokeratinised odontogenic cyst (OOC) denotes the odontogenic cyst that microscopically has an orthokeratinised epithelial lining. OOC is characterised by a less-aggressive behaviour and a low rate of recurrence. This report describes a case of OOC involving posterior part of the mandible that mimicked periapical cyst in a 14-year-old boy. The initial clinical diagnosis was given as periapical cyst based on the clinical and radiographical features. Enucleation of the cyst was performed and the specimen was sent for histopathological examination. A definite diagnosis of OOC was made by histopathological examination of the biopsy specimen. This case emphases on including OOC in the differential diagnosis of radiolucencies occurring in the periapical region of non-vital tooth. PMID:24099763

  5. Orthokeratinised odontogenic cyst mimicking periapical cyst.

    PubMed

    Rajalakshmi, R; Sreeja, C; Vijayalakshmi, D; Leelarani, V

    2013-10-07

    Orthokeratinised odontogenic cyst (OOC) denotes the odontogenic cyst that microscopically has an orthokeratinised epithelial lining. OOC is characterised by a less-aggressive behaviour and a low rate of recurrence. This report describes a case of OOC involving posterior part of the mandible that mimicked periapical cyst in a 14-year-old boy. The initial clinical diagnosis was given as periapical cyst based on the clinical and radiographical features. Enucleation of the cyst was performed and the specimen was sent for histopathological examination. A definite diagnosis of OOC was made by histopathological examination of the biopsy specimen. This case emphases on including OOC in the differential diagnosis of radiolucencies occurring in the periapical region of non-vital tooth.

  6. Mature posterior fossa teratoma mimicking dermoid cyst.

    PubMed

    Bohara, Manoj; Yonezawa, Hajime; Karki, Prasanna; Bakhtiar, Yuriz; Hirano, Hirofumi; Kitazono, Ikumi; Matsuyama, Nozomu; Arita, Kazunori

    2013-10-01

    We describe a very rare case of mature posterior fossa teratoma in an adult who presented with clinico-radiological findings consistent with a dermoid cyst. A computed tomography scan showed a hypodense mass in the cistern magna with calcification and a sinus tract in the occipital bone. Magnetic resonance imaging revealed a hypo- to hyperintense mass without contrast enhancement. The intraoperative picture showed a dermal sinus and a cyst containing lipid, keratin and hair. Histopathological examination showed a tumor with components of all the three germ layers; thereby, a diagnosis of mature teratoma was made. The histopathological differentiation between teratoma and dermoid cyst is very valuable for ruling out the presence of immature/malignant or germinomatous components that would require further adjuvant therapies. Thus, we here present a rare case of posterior fossa teratoma mimicking dermoid cyst and emphasize the importance of histopathological differentiation between these entities.

  7. Infant botulism mimicking an acute abdomen.

    PubMed

    Pisanti, R; Vitiello, R; Formicola, S; Pisanti, A

    2009-12-01

    Botulism is the acute, flaccid paralysis caused by a neurotoxin produced by Clostridium botulinum. In the infant, clinical symptoms are usually unspecific such as poor feeding, weak suck, feeble cry, drooling, followed by a symmetric, descending, flaccid paralysis beginning with the cranial nerve musculature. The initial symptoms of the disease are often similar to several diseases and therefore differential diagnosis is very difficult and rarely suspected by the physician. Since 2004 only 22 cases of infant botulism have been reported in Italy. Since most paediatricians are unfamiliar with the clinical manifestations of infant botulism, the diagnosis can be easily missed. Hence the disease may well be underestimated and underreported. We report a clinical case of botulism presenting initially with abdominal distention, thereby mimicking acute abdomen.

  8. Inherited cardiomyopathies mimicking arrhythmogenic right ventricular cardiomyopathy.

    PubMed

    Roberts, Jason D; Veinot, John P; Rutberg, Julie; Gollob, Michael H

    2010-01-01

    Arrhythmogenic right ventricular cardiomyopathy (ARVC) represents an inherited cardiomyopathy that manifests clinically with malignant ventricular arrhythmias, sudden cardiac death, and less commonly heart failure. The condition is characterized by replacement of the myocardium, primarily of the right ventricle, with fibrofatty tissue. Extensive fibrofatty replacement of the myocardium has been previously thought to be pathognomonic of ARVC; however, this report details two other forms of inherited cardiomyopathy, namely hypertrophic cardiomyopathy (HCM) and the PRKAG2 cardiac syndrome, that were found to have significant fibrofatty myocardial replacement at pathologic examination. This report represents the first documentation of inherited cardiomyopathies mimicking ARVC and highlights the concept that other cardiac conditions can be associated with fibrofatty replacement of the myocardium. Copyright 2010 Elsevier Inc. All rights reserved.

  9. Pulmonary artery sarcoma mimicking pulmonary thromboembolism.

    PubMed

    Celik, Gökhan; Ciledağ, Aydin; Yüksel, Cabir; Yenigün, Bülent Mustafa; Kutlay, Hakan; Yazicıoğlu, Levent; Perçinel, Sibel; Kaya, Akin

    2011-01-01

    A 30 years old male patient was referred to our hospital with a diagnosis of pulmonary thromboembolism due to thorax-computerized tomography (CT) angiography, revealing a thrombus totally occluding left main pulmonary artery. The lesion was evaluated as tumoural mass. Positron emission tomography (PET)-CT revealed pathologic uptake at pulmonary artery mass. Due to localization of tumour, left pneumonectomy was performed. The pathological diagnosis revealed to be pulmonary artery sarcoma. The patient was presented because pulmonary artery sarcomas are very rare tumors and can mimick pulmonary thromboembolism. The true prevalence is underestimated as many pulmonary artery sarcomas are misdiagnosed as pulmonary thromboembolism. PET-CT may help to make a differential diagnosis.

  10. Mimicking semi-convection by convective overshooting

    NASA Astrophysics Data System (ADS)

    Caloi, V.; Mazzitelli, I.

    1990-12-01

    This paper investigates the behavior of so called 'semiconvection' (described by Schwarzschild, 1970; Castellani et al., 1971), of stars burning He in a convective core but exibiting an apparent spontaneous capability to partially mix into the core the matter from outside the formal boundaries of the convective region. A simple numerical algorithm based on a small and ad hoc amount of convective overshooting is presented which, if properly tuned, can mimick the effect of semiconvection in the computation of those stellar evolutionary phases in which a convective helium burning core is present. Using this algorithm, the time-consuming numerical procedures involved in the evaluation of the correct chemical profiles at the boundaries of the formally convective He core can be avoided.

  11. A subtle mimicker in emergency department

    PubMed Central

    Angelis, Maria Vittoria De; Giacomo, Roberta Di; Muzio, Antonio Di; Onofrj, Marco; Bonanni, Laura

    2016-01-01

    Abstract Background: Movement disorder emergencies include any movement disorder which develops over hours to days, in which failure to appropriately diagnose and manage can result in patient morbidity or mortality. Movement disorder emergencies include acute dystonia: sustained or intermittent muscle contractions causing abnormal, often repetitive, movements. Acute dystonia is a serious challenge for emergency room doctors and neurologists, because of the high probability of misdiagnosis, due to the presence of several mimickers including partial seizures, meningitis, localized tetanus, serum electrolyte level abnormalities, strychnine poisoning, angioedema, malingering, catatonia, and conversion. Methods: We describe 2 examples, accompanied by videos, of acute drug-induced oro-mandibular dystonia, both subsequent to occasional haloperidol intake. Results: Management and treatment of this movement disorder are often difficult: neuroleptics withdrawal, treatment with benzodiazepines, and anticholinergics are recommended. Conclusion: Alternative treatment options are also discussed. PMID:27741141

  12. Polypoid uterine lesions mimicking endometrial stromal sarcoma.

    PubMed Central

    McCluggage, W G; Alderdice, J M; Walsh, M Y

    1999-01-01

    Two polypoid submucosal uterine lesions were examined histologically and immunohistochemically with monoclonal antibodies to desmin and alpha smooth muscle actin. One case comprised a leiomyoma and the other a polypoid form of adenomyosis. Both polyps had prolapsed through the external cervical os. The lesions had an ulcerated surface with focal areas of marked increased cellularity and pronounced vascularity throughout, such that they mimicked a low grade endometrial stromal sarcoma infiltrating the myometrium. The cellular areas showed diffuse positivity for desmin and alpha smooth muscle actin, confirming them to be of smooth muscle origin. The changes of marked hypercellularity and pronounced vascularity within polypoid submucosal uterine lesions have not been emphasised in published reports up to now. Pathologists should be aware of these morphological features in order to avoid misdiagnosis of such cases as endometrial stromal sarcomas. The changes described here are likely to be secondary to trauma associated with a polypoid lesion prolapsing through the external cervical os. Images PMID:10605413

  13. Phthriasis Palpebrarum Mimicking Lid Eczema and Blepharitis

    PubMed Central

    Turgut, Burak; Kurt, Julide; Çatak, Onur; Demir, Tamer

    2009-01-01

    Phthiriasis palpebrarum (PP) is a rare eyelid infestation caused by phthirus pubis. We report a case of PP mimicking lid eczema and blepharitis. A 68-year-old woman had moderate itching in both eyes. Her initial diagnosis was considered to be lid eczema or blepharitis because of findings similar to exfoliative lesions and color changes in eyelids and to excretions over eyelashes. Careful observation revealed many lice and translucent nits, protuberances and hyperpigmentary changes, and the buried lice in both eyelids. No hyperemia or secretion was observed on the lids and in the conjunctiva in both eyes. The patient was treated with pilocarpine hydrochloride 4% drops. At the end of the first week, no louse or nit was present. Although it was known that PP is a rare cause of blepharoconjunctivitis, it might observe as an isolated infestation of the eyelids and this condition can easily be misdiagnosed as lid eczema and blepharitis. PMID:20339456

  14. Polarons and bipolarons in cis-polyacetylene

    NASA Astrophysics Data System (ADS)

    Utz, Wolfram; Förner, Wolfgang

    1998-05-01

    We present a parametrization for the Pariser-Parr-Pople Hamiltonian for the description of cis-polyacetylene (cPA). In contrast to trans-polyacetylene, we have to include symmetry breaking between neighboring sites into the Su-Schrieffer-Heeger-type one-electron part of the Hamiltonian. Our parametrization is based on correlated ab initio calculations on cis-hexatriene and on the results of independent calculations found in the literature. For open-shell systems (singly charged polarons) we use the annihilated unrestricted Hartree-Fock method to avoid the artificial spin contaminations inherent in UHF (unrestricted HF) calculations, which lead to the inclusion of fractions of the correlation energy in UHF total energies which cannot be controlled and are different for different systems and even for different geometries of the same system. Thus UHF is useless for the calculation of potential hypersurfaces and thus in turn for dynamical simulations. We find that in cPA singly-charged polarons are formed, while in doubly-charged chains stable bipolarons are found, although of a quite large width. This is in contrast to recent results reported by Shimoi and Abe [Y. Shimoi and S. Abe, Synth. Met. 69, 687 (1995) and Phys. Rev. B 50, 14 781 (1994)] who found that two singly-charged polarons are more stable for realistic parameter values than a doubly-charged bipolaron. We further find that the charged polarons are mobile in the chain and thus we conclude that polarons and bipolarons can serve as charge carriers (the latter ones spinless) in doped cPA.

  15. 2,3-cis-2R,3R-(−)-epiafzelechin-3-O-p-coumarate, a novel flavan-3-ol isolated from Fallopia convolvulus seed, is an estrogen receptor agonist in human cell lines

    PubMed Central

    2013-01-01

    Background The plant genus Fallopia is well-known in Chinese traditional medicine and includes many species that contain bioactive compounds, namely phytoestrogens. Consumption of phytoestrogens may be linked to decreased incidence of breast and prostate cancers therefore discovery of novel phytoestrogens and novel sources of phytoestrogens is of interest. Although phytoestrogen content has been analyzed in the rhizomes of various Fallopia sp., seeds of a Fallopia sp. have never been examined for phytoestrogen presence. Methods Analytical chemistry techniques were used with guidance from an in vitro estrogen receptor bioassay (a stably transfected human ovarian carcinoma cell line) to isolate and identify estrogenic components from seeds of Fallopia convolvulus. A transiently transfected human breast carcinoma cell line was used to characterize the biological activity of the isolated compounds on estrogen receptors (ER) α and β. Results Two compounds, emodin and the novel flavan-3-ol, (−)-epiafzelechin-3-O-p-coumarate (rhodoeosein), were identified to be responsible for estrogenic activity of F. convolvulus seed extract. Absolute stereochemistry of rhodoeosein was determined by 1 and 2D NMR, optical rotation and circular dichroism. Emodin was identified by HPLC/DAD, LC/MS/MS, and FT/ICR-MS. When characterizing the ER specificity in biological activity of rhodoeosein and emodin, rhodoeosein was able to exhibit a four-fold greater relative estrogenic potency (REP) in breast cells transiently-transfected with ERβ as compared to those transfected with ERα, and emodin exhibited a six-fold greater REP in ERβ-transfected breast cells. Cell type-specific differences were observed with rhodoeosein but not emodin; rhodoeosein produced superinduction of reporter gene activity in the human ovarian cell line (> 400% of maximum estradiol [E2] induction) but not in the breast cell line. Conclusion This study is the first to characterize the novel flavan-3-ol compound

  16. Profiling of conserved non-coding elements upstream of SHOX and functional characterisation of the SHOX cis-regulatory landscape

    PubMed Central

    Verdin, Hannah; Fernández-Miñán, Ana; Benito-Sanz, Sara; Janssens, Sandra; Callewaert, Bert; Waele, Kathleen De; Schepper, Jean De; François, Inge; Menten, Björn; Heath, Karen E.; Gómez-Skarmeta, José Luis; Baere, Elfride De

    2015-01-01

    Genetic defects such as copy number variations (CNVs) in non-coding regions containing conserved non-coding elements (CNEs) outside the transcription unit of their target gene, can underlie genetic disease. An example of this is the short stature homeobox (SHOX) gene, regulated by seven CNEs located downstream and upstream of SHOX, with proven enhancer capacity in chicken limbs. CNVs of the downstream CNEs have been reported in many idiopathic short stature (ISS) cases, however, only recently have a few CNVs of the upstream enhancers been identified. Here, we set out to provide insight into: (i) the cis-regulatory role of these upstream CNEs in human cells, (ii) the prevalence of upstream CNVs in ISS, and (iii) the chromatin architecture of the SHOX cis-regulatory landscape in chicken and human cells. Firstly, luciferase assays in human U2OS cells, and 4C-seq both in chicken limb buds and human U2OS cells, demonstrated cis-regulatory enhancer capacities of the upstream CNEs. Secondly, CNVs of these upstream CNEs were found in three of 501 ISS patients. Finally, our 4C-seq interaction map of the SHOX region reveals a cis-regulatory domain spanning more than 1 Mb and harbouring putative new cis-regulatory elements. PMID:26631348

  17. Prepare dispersed CIS nano-scale particles and spray coating CIS absorber layers using nano-scale precursors

    NASA Astrophysics Data System (ADS)

    Liou, Jian-Chiun; Diao, Chien-Chen; Lin, Jing-Jenn; Chen, Yen-Lin; Yang, Cheng-Fu

    2014-01-01

    In this study, the Mo-electrode thin films were deposited by a two-stepped process, and the high-purity copper indium selenide-based powder (CuInSe2, CIS) was fabricated by hydrothermal process by Nanowin Technology Co. Ltd. From the X-ray pattern of the CIS precursor, the mainly crystalline phase was CIS, and the almost undetectable CuSe phase was observed. Because the CIS powder was aggregated into micro-scale particles and the average particle sizes were approximately 3 to 8 μm, the CIS power was ground into nano-scale particles, then the 6 wt.% CIS particles were dispersed into isopropyl alcohol to get the solution for spray coating method. Then, 0.1 ml CIS solution was sprayed on the 20 mm × 10 mm Mo/glass substrates, and the heat treatment for the nano-scale CIS solution under various parameters was carried out in a selenization furnace. The annealing temperature was set at 550°C, and the annealing time was changed from 5 to 30 min, without extra Se content was added in the furnace. The influences of annealing time on the densification, crystallization, resistivity ( ρ), hall mobility ( μ), and carrier concentration of the CIS absorber layers were well investigated in this study.

  18. Prepare dispersed CIS nano-scale particles and spray coating CIS absorber layers using nano-scale precursors.

    PubMed

    Liou, Jian-Chiun; Diao, Chien-Chen; Lin, Jing-Jenn; Chen, Yen-Lin; Yang, Cheng-Fu

    2014-01-01

    In this study, the Mo-electrode thin films were deposited by a two-stepped process, and the high-purity copper indium selenide-based powder (CuInSe2, CIS) was fabricated by hydrothermal process by Nanowin Technology Co. Ltd. From the X-ray pattern of the CIS precursor, the mainly crystalline phase was CIS, and the almost undetectable CuSe phase was observed. Because the CIS powder was aggregated into micro-scale particles and the average particle sizes were approximately 3 to 8 μm, the CIS power was ground into nano-scale particles, then the 6 wt.% CIS particles were dispersed into isopropyl alcohol to get the solution for spray coating method. Then, 0.1 ml CIS solution was sprayed on the 20 mm × 10 mm Mo/glass substrates, and the heat treatment for the nano-scale CIS solution under various parameters was carried out in a selenization furnace. The annealing temperature was set at 550°C, and the annealing time was changed from 5 to 30 min, without extra Se content was added in the furnace. The influences of annealing time on the densification, crystallization, resistivity (ρ), hall mobility (μ), and carrier concentration of the CIS absorber layers were well investigated in this study.

  19. cis-Diamminedichloroplatinum(II)-induced DNA adducts in peripheral leukocytes from seven cancer patients: quantitative immunochemical detection of the adduct induction and removal after a single dose of cis-diamminedichloroplatinum(II).

    PubMed

    Fichtinger-Schepman, A M; van Oosterom, A T; Lohman, P H; Berends, F

    1987-06-01

    The same four platinum-containing products identified in nucleolytic digests of DNA treated with cisplatin (cisDDP) in vitro now have been shown to be present in digested DNA originating from human cells after in vivo exposure. The immunochemical detection of these products at the fmol level became possible by the application of an existing and two newly raised rabbit antisera with specificities towards the various cisDDP-DNA derived products. In DNA isolated from white blood cells of a number of cancer patients treated with the drug for the first time, intrastrand cross-links on pGpG base sequences appeared to be the main adduct, followed by the intrastrand cross-links on pApG sequences, interstrand cross-links, and/or intrastrand cross-links on two guanines separated by one or more bases and a very low amount of monofunctionally bound cisDDP to guanine; typical proportions were 65, 22, 13, and less than 1%, respectively. The induction and removal of the main adduct, the intrastrand cross-link on pGpG sequences, have been studied in DNA from blood samples of six male patients after their first cisDDP treatment. The results indicate that the susceptibility of blood cells to cisDDP-DNA adduct formation can show strong individually determined differences. From the data it is also clear that a substantial part of the adducts is removed within the first 24 h after the cisDDP-infusion.

  20. Evaluating the economic viability of CdTe/CIS and CIGS/CIS tandem photovoltaic modules

    DOE PAGES

    Nanayakkara, Sanjini U.; Horowitz, Kelsey; Kanevce, Ana; ...

    2017-01-20

    In this paper, we analyze the potential cost competitiveness of two frameless, glass–glass thin-film tandem photovoltaic module structures, cadmium telluride (CdTe)/CuInSe2 (CIS) and CuIn0.3Ga0.7Se2 (CIGS)/CIS, based on the demonstrated cost of manufacturing the respective component cell technologies in high volume. To consider multiple economic scenarios, we base the CdTe/CIS module efficiency on the current industrial production of CdTe modules, while for CIGS/CIS, we use an aspirational estimate for CIGS efficiency. We focus on four-terminal mechanically stacked structures, thus avoiding the need to achieve current matching between the two cells. The top cell in such a tandem must have a transparentmore » back contact, which has not been successfully implemented to date. However, for the purpose of understanding the economic viability of both tandems, we assume that this can be implemented at a cost similar to that of sputtered indium tin oxide. The cost of both tandem module structures was found to be nearly identical on an equal-area basis and approximately $30/m2 higher than the single-junction alternatives. Both tandem modules are about 4% (absolute) more efficient than a module by using the top-cell material alone. We find that these tandem modules might reduce total system cost by as much as 11% in applications having a high area-related balance-of-system cost, such as area-constrained residential systems; however, the relative advantage of tandems decreases in the cases where balance-of-system costs are lower, such as in commercial and utility scale systems.« less

  1. Hypoxia-Mimicking Nanofibrous Scaffolds Promote Endogenous Bone Regeneration.

    PubMed

    Yao, Qingqing; Liu, Yangxi; Tao, Jianning; Baumgarten, Keith M; Sun, Hongli

    2016-11-30

    Utilizing biomimetic materials to potentiate endogenous cell growth or signaling is superior to relying on exogenous cells or signals for bone formation. Desferoxamine (DFO), which is a hypoxia-mimetic agent that chelates iron (Fe(3+)), mimics hypoxia to encourage bone healing. However, high cytotoxicity, off-target effects, and the short half-life of DFO have significantly impeded its further applications. We mitigated these side effects by locally immobilizing DFO onto a gelatin nanofibrous (GF) scaffold that retained DFO's ability to chelate Fe(3+). Moreover, DFO-functionalized GF (GF-DFO) scaffolds, which have similar micro/macrostructures to GF scaffolds, not only demonstrated decreased cytotoxicity on both human umbilical vein endothelial cells and human mesenchymal stem cells but also significantly increased vascular endothelial growth factor (VEGF) expression in vitro. Most importantly, in our in vivo experiments on a critical-sized cranial bone defect mouse model, a significant amount of bone was formed in most of the GF-DFO scaffolds after six weeks, while very little new bone was observed in the GF scaffolds. These data suggest that use of a hypoxia-mimicking nanofibrous scaffold is a promising strategy for promoting endogenous bone formation.

  2. Mimicking cellular transport mechanism in stem cells through endosomal escape of new peptide-coated quantum dots

    NASA Astrophysics Data System (ADS)

    Narayanan, Karthikeyan; Yen, Swee Kuan; Dou, Qingqing; Padmanabhan, Parasuraman; Sudhaharan, Thankiah; Ahmed, Sohail; Ying, Jackie Y.; Selvan, Subramanian Tamil

    2013-07-01

    Protein transport is an important phenomenon in biological systems. Proteins are transported via several mechanisms to reach their destined compartment of cell for its complete function. One such mechanism is the microtubule mediated protein transport. Up to now, there are no reports on synthetic systems mimicking the biological protein transport mechanism. Here we report a highly efficient method of mimicking the microtubule mediated protein transport using newly designed biotinylated peptides encompassing a microtubule-associated sequence (MTAS) and a nuclear localization signaling (NLS) sequence, and their final conjugation with streptavidin-coated CdSe/ZnS quantum dots (QDs). Our results demonstrate that these novel bio-conjugated QDs enhance the endosomal escape and promote targeted delivery into the nucleus of human mesenchymal stem cells via microtubules. Mimicking the cellular transport mechanism in stem cells is highly desirable for diagnostics, targeting and therapeutic applications, opening up new avenues in the area of drug delivery.

  3. Probing the cis-arrangement of prototype tight junction proteins claudin-1 and claudin-3.

    PubMed

    Milatz, Susanne; Piontek, Jörg; Schulzke, Jörg-Dieter; Blasig, Ingolf E; Fromm, Michael; Günzel, Dorothee

    2015-06-15

    Claudins form a large family of TJ (tight junction) proteins featuring four transmembrane segments (TM1-TM4), two extracellular loops, one intracellular loop and intracellular N- and C-termini. They form continuous and branched TJ strands by homo- or heterophilic interaction within the same membrane (cis-interaction) and with claudins of the opposing lateral cell membrane (trans-interaction). In order to clarify the molecular organization of TJ strand formation, we investigated the cis-interaction of two abundant prototypic claudins. Human claudin-1 and claudin-3, fused to ECFP or EYFP at the N- or C-terminus, were expressed in the TJ-free cell line HEK (human embryonic kidney)-293. Using FRET analysis, the proximity of claudin N- and C-termini integrated in homopolymeric strands composed of claudin-3 or of heteropolymeric strands composed of claudin-1 and claudin-3 were determined. The main results are that (i) within homo- and heteropolymers, the average distance between the cytoplasmic ends of the TM1s of cis-interacting claudin molecules is shorter than the average distance between their TM4s, and (ii) TM1 segments of neighbouring claudins are oriented towards each other as the cytoplasmic end of TM1 is in close proximity to more other TM1 segments than TM4 is to other TM4 segments. The results indicate at least two different cis-interaction interfaces within claudin-3 homopolymers as well as within claudin-1/claudin-3 heteropolymers. The data provide novel insight into the molecular TJ architecture consistent with a model with an antiparallel double-row cis-arrangement of classic claudin protomers within strands.

  4. U.S./CIS eye joint nuclear rocket venture

    NASA Technical Reports Server (NTRS)

    Clark, John S.; Mcilwain, Melvin C.; Smetanikov, Vladimir; D'Yakov, Evgenij K.; Pavshuk, Vladimir A.

    1993-01-01

    An account is given of the significance for U.S. spacecraft development of a nuclear thermal rocket (NTR) reactor concept that has been developed in the (formerly Soviet) Commonwealth of Independent States (CIS). The CIS NTR reactor employs a hydrogen-cooled zirconium hydride moderator and ternary carbide fuels; the comparatively cool operating temperatures associated with this design promise overall robustness.

  5. U.S./CIS eye joint nuclear rocket venture

    NASA Technical Reports Server (NTRS)

    Clark, John S.; Mcilwain, Melvin C.; Smetanikov, Vladimir; D'Yakov, Evgenij K.; Pavshuk, Vladimir A.

    1993-01-01

    An account is given of the significance for U.S. spacecraft development of a nuclear thermal rocket (NTR) reactor concept that has been developed in the (formerly Soviet) Commonwealth of Independent States (CIS). The CIS NTR reactor employs a hydrogen-cooled zirconium hydride moderator and ternary carbide fuels; the comparatively cool operating temperatures associated with this design promise overall robustness.

  6. Short asymmetric synthesis of (-)- and (+)-cis-lauthisan.

    PubMed

    Carreño, M Carmen; Des Mazery, Renaud; Urbano, Antonio; Colobert, Françoise; Solladié, Guy

    2005-05-12

    The asymmetric synthesis of both enantiomers of cis-lauthisan (3) is achieved in only six steps from diethyl pimelate (4), the key steps being the diastereodivergent reduction of beta-ketosulfoxide 7 and the highly cis-stereoselective Et(3)SiH/TMSOTf-promoted reductive cyclization of enantiopure hydroxy sulfinyl ketones (S)-14 and (R)-14.

  7. Peptidyl-prolyl cis-trans isomerases: structure and functions.

    PubMed

    Pliyev, B K; Gurvits, B Y

    1999-07-01

    Peptidyl-prolyl cis-trans isomerases (PPI) catalyze cis-trans isomerization of imide bonds in peptides and proteins. This review summarizes the literature on the structure and functions of PPIs, their involvement in protein folding, and organization of PPI-containing receptors and membrane channels. A possible role of several PPIs in distant interactions between cells is discussed.

  8. Occupational Neurobrucellosis Mimicking a Brain Tumor: A Case Report and Review of the Literature

    PubMed Central

    Abdulghani, Dina; Farhan, Roiya; Algahtani, Raghad

    2017-01-01

    Brucellosis is a zoonotic bacterial infection which is transmitted to humans from infected animals and is endemic in many parts of the world including Saudi Arabia. In this article, we report a case of occupational neurobrucellosis that presented with a space-occupying lesion mimicking a brain tumor. We stress on the importance of obtaining detailed social history including occupation to reach the diagnosis in several conditions including brucellosis. We also stress on taking universal precautions when handling any specimens. It may be advisable that manipulation of all unknown specimens arriving at the laboratory should occur in biological safety cabinet until a highly infectious organism is ruled out. Neurobrucellosis should be included in the differential diagnosis in patients presenting with solitary mass lesion mimicking brain tumor especially in endemic areas or high occupational risk group. PMID:28299214

  9. Possible neuro-Sweet disease mimicking brain tumor in the medulla oblongata--case report.

    PubMed

    Akiba, Chihiro; Esaki, Takanori; Ando, Maya; Furuya, Tsuyoshi; Noda, Kazuyuki; Nakao, Yasuaki; Yamamoto, Takuji; Okuma, Yasuyuki; Mori, Kentaro

    2011-01-01

    A 62-year-old male presented with a rare case of possible neuro-Sweet Disease (NSD) mimicking brain tumor in the medulla oblongata, manifesting as numbness in the bilateral upper and lower extremities, gait disturbance, dysarthria, and swallowing disturbance which gradually deteriorated over 3 months. Magnetic resonance imaging showed a mass lesion in the medulla oblongata, extending to the upper cervical cord with rim enhancement by gadolinium. The preoperative diagnosis was brain tumor, such as glioma, or inflammatory disease. His neurological symptoms gradually deteriorated, so biopsy was performed through the midline suboccipital approach. Histological examination showed infiltration of inflammatory cells, mainly lymphocytes and macrophages. Human leukocyte antigen typing showed Cw1 and B54 which strongly suggested possible NSD. Steroid pulse therapy was started after surgery and the clinical symptoms improved. Neurosurgeons should be aware of inflammatory disorders such as NSD mimicking brain tumor.

  10. The dependencies of phase velocity and dispersion on volume fraction in cancellous-bone-mimicking phantoms.

    PubMed

    Wear, Keith A

    2009-02-01

    Frequency-dependent phase velocity was measured in eight cancellous-bone-mimicking phantoms consisting of suspensions of randomly oriented nylon filaments (simulating trabeculae) in a soft-tissue-mimicking medium (simulating marrow). Trabecular thicknesses ranged from 152 to 356 mum. Volume fractions of nylon filament material ranged from 0% to 10%. Phase velocity varied approximately linearly with frequency over the range from 300 to 700 kHz. The increase in phase velocity (compared with phase velocity in a phantom containing no filaments) at 500 kHz was approximately proportional to volume fraction occupied by nylon filaments. The derivative of phase velocity with respect to frequency was negative and exhibited nonlinear, monotonically decreasing dependence on volume fraction. The dependencies of phase velocity and its derivative on volume fraction in these phantoms were similar to those reported in previous studies on (1) human cancellous bone and (2) phantoms consisting of parallel nylon wires immersed in water.

  11. In vitro effects of combinations of cis-amminedichloro (2-methylpyridine) platinum (II) (ZD0473) with other novel anticancer drugs on the growth of SBC-3, a human small cell lung cancer cell line.

    PubMed

    Kanzawa, F; Akiyama, Y; Saijo, N; Nishio, K

    2003-06-01

    Among numerous clinical regimens of combination chemotherapy, synergy has been observed to be particularly marked with combinations containing cisplatin (CDDP). However, the clinical use of CDDP has sometimes been limited by acquired resistance. The new-generation platinum drug, ZD0473, was synthesized with the aim of hindering the reaction of the drug with thiols, by the introduction of a 2-methylpyridine ligand. This enables the drug to exert antitumor activity against cisplatin-resistant cancer cells with elevated glutathione and/or metallothionein levels. The drug was also shown experimentally to overcome cisplatin resistance due to impaired drug accumulation, and enhanced DNA repair/tolerance to platinum-DNA adducts. We investigated the effects of combinations of ZD0473 with other anticancer drugs on the growth of a human small-cell lung cancer cell line (SBC-3). Six novel anticancer drugs were tested: docetaxel (TXT), paclitaxel (TXL), vinorelbine (VNB), irinotecan (CPT-11), gemcitabine (GEM) and pemetrexed (MTA). The growth inhibitory effect of the drugs was measured by MTT assay and the effects of the combination regimens were evaluated by the combination index analysis method developed by Chou and Talalay. Synergy was demonstrated for the combination regimens of ZD0473-GEM and ZD0473-TXL, while an additive effect was observed with combinations containing TXT, VNB, CPT-11 or MTA. In the case of the ZD0473-GEM combination, synergy was observed over a wide range of inhibition levels at dose ratios of 50:1, 100:1 and 250:1. The level of synergy was equivalent to that observed for combinations of CDDP-etoposide, CDDP-GEM and nedaplatin-CPT-11. The results suggest that the combination of ZD0473 with GEM merits further investigation in small cell lung cancer.

  12. New probabilistic risk assessment of ethylhexyl methoxycinnamate: Comparing the genotoxic effects of trans- and cis-EHMC.

    PubMed

    Nečasová, Anežka; Bányiová, Katarína; Literák, Jaromír; Čupr, Pavel

    2017-02-01

    Ethylhexyl methoxycinnamate (EHMC) is a widely used UV filter present in a large number of personal care products (PCPs). Under normal conditions, EHMC occurs in a mixture of two isomers: trans-EHMC and cis-EHMC in a ratio of 99:1. When exposed to sunlight, the trans isomer is transformed to the less stable cis isomer and the efficiency of the UV filter is reduced. To date, the toxicological effects of the cis-EHMC isomer remain largely unknown. We developed a completely new method for preparing cis-EHMC. An EHMC technical mixture was irradiated using a UV lamp and 98% pure cis-EHMC was isolated from the irradiated solution using column chromatography. The genotoxic effects of the isolated cis-EHMC isomer and the nonirradiated trans-EHMC were subsequently measured using two bioassays (SOS chromotest and UmuC test). In the case of trans-EHMC, significant genotoxicity was observed using both bioassays at the highest concentrations (0.5 - 4 mg mL(-1) ). In the case of cis-EHMC, significant genotoxicity was only detected using the UmuC test at concentrations of 0.25 - 1 mg mL(-1) . Based on these results, the NOEC was calculated for both cis- and trans-EHMC, 0.038 and 0.064 mg mL(-1) , respectively. Risk assessment of dermal, oral and inhalation exposure to PCPs containing EHMC was carried out for a female population using probabilistic simulation and by using Quantitative in vitro to in vivo extrapolation (QIVIVE). The risk of cis-EHMC was found to be ∼1.7 times greater than trans-EHMC. In the case of cis-EHMC, a hazard index of 1 was exceeded in the 92nd percentile. Based on the observed differences between the isomers, EHMC application in PCPs requires detailed reassessment. Further exploration of the toxicological effects and properties of cis-EHMC is needed in order to correctly predict risks posed to humans and the environment. © 2016 Wiley Periodicals, Inc. Environ Toxicol 32: 569-580, 2017.

  13. [Enzymatic formation of a cis,cis-muconic acid derivative using pyrazon-degrading bacteria (author's transl)].

    PubMed

    Blobel, F; Eberspächer, J; Haug, S; Lingens, F

    1976-01-01

    The cis,cis-muconic acid derivative of pyrazon, which was formerly isolated from the medium of pyrazon-degrading bacteria, was formed enzymatically by incubation of the catechol derivative of pyrazon with partially purified ortho pyrocatechase from pyrazon-degrading bacteria.

  14. Oxylipin Signaling: A Distinct Role for the Jasmonic Acid Precursor cis-(+)-12-Oxo-Phytodienoic Acid (cis-OPDA)

    PubMed Central

    Dave, Anuja; Graham, Ian A.

    2012-01-01

    Oxylipins are lipid-derived compounds, many of which act as signals in the plant response to biotic and abiotic stress. They include the phytohormone jasmonic acid (JA) and related jasmonate metabolites cis-(+)-12-oxo-phytodienoic acid (cis-OPDA), methyl jasmonate, and jasmonoyl-L-isoleucine (JA-Ile). Besides the defense response, jasmonates are involved in plant growth and development and regulate a range of processes including glandular trichome development, reproduction, root growth, and senescence. cis-OPDA is known to possess a signaling role distinct from JA-Ile. The non-enzymatically derived phytoprostanes are structurally similar to cis-OPDA and induce a common set of genes that are not responsive to JA in Arabidopsis thaliana. A novel role for cis-OPDA in seed germination regulation has recently been uncovered based on evidence from double mutants and feeding experiments showing that cis-OPDA interacts with abscisic acid (ABA), inhibits seed germination, and increases ABA INSENSITIVE5 (ABI5) protein abundance. Large amounts of cis-OPDA are esterified to galactolipids in A. thaliana and the resulting compounds, known as Arabidopsides, are thought to act as a rapidly available source of cis-OPDA. PMID:22645585

  15. Germinating the 2050 Cis-Lunar Econosphere

    NASA Technical Reports Server (NTRS)

    Scott, David W.; Tinker, Michael L.; Nall, Mark E.; Wright, Gregory M.

    2015-01-01

    In early 2013, the Marshall Space Flight Center (MSFC) Director and MSFC's Office of Strategic Analysis and Communications (OSAC) chartered a diverse team for a six-week "sprint" to speculate (in a disciplined manner) and paint (with broad brush strokes) a picture of how earth, space, and public/private entities might be operating and relating to each other...in the year 2100. Two 12-person groups of civil servants, one with members having 15 years or less of NASA experience and the other with more senior members, worked independently and then compared and integrated their conclusions. In 2014, the "Space 2100" team, with some new team members and different group boundaries, ran a longer sprint to a) develop more detailed estimates of the operations and economics of space activities in the vicinity of the Earth and Moon in the 2050 time frame, b) identify evolutionary steps and viable paths needed to make that a reality, and c) recommend actions to enable and invigorate those steps. This paper explores Space 2100's first two sprints and their projections of NASA's role in what will likely be a highly networked international space industry and cis-lunar infrastructure.

  16. Germinating the 2050 Cis-Lunar Econosphere

    NASA Technical Reports Server (NTRS)

    Scott, David W.; Curreri, Peter A.; Ferguson, Cynthia K.; Nall, Mark E.; Tinker, Michael L.; Wright, Gregory M.

    2015-01-01

    In early 2013, Marshall Space Flight Center's upper management chartered a diverse team for a six-week 'sprint' to speculate (in a disciplined manner) and paint (with broad brush strokes) a picture of how earth, space, and public/private entities might be operating and relating to each other... in the year 2100. Two 12-person groups of civil servants, one with members having 15 years or less of NASA experience and the other with more senior members, worked independently and then compared and integrated their conclusions. In 2014, the 'Space 2100' team, with some new team members and different group boundaries, ran a longer sprint to a) develop more detailed estimates of the operations and economics of space activities in the vicinity of the Earth and Moon in the 2050 time frame, b) identify evolutionary paths, barriers, and opportunities, and c) suggest actions and philosophies to enable and invigorate progress towards the vision. This paper explores Space 2100's first two sprints and their projections of NASA's role in what will likely be a highly networked, international space industry and cis-lunar infrastructure.

  17. Hydroxychloroquine-associated hyperpigmentation mimicking elder abuse.

    PubMed

    Cohen, Philip R

    2013-12-01

    Hydroxychloroquine may result in cutaneous dyschromia. Older individuals who are the victims of elder abuse can present with bruising and resolving ecchymoses. The features of hydroxychloroquine-associated hyperpigmentation are described, the mucosal and skin manifestations of elder abuse are reviewed, and the mucocutaneous mimickers of elder abuse are summarized. An elderly woman being treated with hydroxychloroquine for systemic lupus erythematosus developed drug-associated black and blue pigmentation of her skin. The dyschromia was misinterpreted by her clinician as elder abuse and Adult Protective Services was notified. The family was eventually cleared of suspected elder abuse. A skin biopsy of the patient's dyschromia confirmed the diagnosis of hydroxychloroquine-associated hyperpigmentation. Hyperpigmentation of skin, mucosa, and nails can be observed in patients treated with antimalarials, including hydroxychloroquine. Elder abuse is a significant and underreported problem in seniors. Cutaneous findings can aid in the discovery of physical abuse, sexual abuse, and self-neglect in elderly individuals. However, medication-associated effects, systemic conditions, and accidental external injuries can mimic elder abuse. Therefore, a complete medical history and appropriate laboratory evaluation, including skin biopsy, should be conducted when the diagnosis of elder abuse is suspected.

  18. Cervical spinal meningioma mimicking intramedullary spinal tumor.

    PubMed

    Senturk, Senem; Guzel, Aslan; Guzel, Ebru; Bayrak, Aylin Hasanefendioğlu; Sav, Aydin

    2009-01-01

    Case report. To report a very unusual spinal meningioma, mimicking an intramedullary spinal tumor. Spinal meningiomas, usually associated with signs and symptoms of cord or nerve root compression, are generally encountered in women aged over 40. Radiologic diagnosis is often established by their intradural extramedullary location on magnetic resonance images. A 60-year-old woman had a 6-month history of progressive weakness in her upper extremities, difficulty in walking, and cervical pain radiating through both arms. Neurologic examination revealed motor strength deficiency in all her extremities, with extensor reflexes, clonus, and bilateral hyper-reflexiveness. A sensory deficit was present all over her body. Magnetic resonance images revealed that the spinal cord appeared expanded with an ill-defined, homogeneously contrast-enhanced, lobulated, eccentric mass at the C1-C3 level. The patient was operated with a preliminary diagnosis of an intramedullary tumor. At surgery, the mass was found to be extramedullary, and gross total resection was performed. Histopathological examination revealed a meningioma characterized by the presence of fibrous and meningothelial components. The patient was able to ambulate with a cane, and extremity strength and sensation improved 2 months after surgery. Spinal meningiomas can mimic intramedullary tumors, and should be considered in differential diagnosis of intradural tumors with atypical appearance.

  19. Mammary analogue secretory carcinoma mimicking salivary adenoma.

    PubMed

    Williams, Lindsay; Chiosea, Simion I

    2013-12-01

    Mammary analogue secretory carcinoma (MASC) is a recently described salivary gland tumor characterized by ETV6 translocation. It appears that prior studies have identified MASC by reviewing salivary gland carcinomas, such as acinic cell carcinoma and adenocarcinoma, not otherwise specified. To address the possibility of MASC mimicking benign salivary neoplasms we reviewed 12 salivary gland (cyst)adenomas diagnosed prior to the discovery of MASC. One encapsulated (cyst)adenoma of the parotid gland demonstrated features of MASC. The diagnosis was confirmed by fluorescence in situ hybridization with an ETV6 break-apart probe. An unusual complex pattern of ETV6 rearrangement with duplication of the telomeric/distal ETV6 probe was identified. This case illustrates that MASC may mimic salivary (cyst)adenomas. To more accurately assess true clinical and morphologic spectrum of MASC, future studies may have to include review of salivary (cyst)adenomas. The differential diagnosis of MASC may have to be expanded to include cases resembling salivary (cyst)adenomas.

  20. Microfabricated adhesive mimicking gecko foot-hair

    NASA Astrophysics Data System (ADS)

    Geim, A. K.; Dubonos, S. V.; Grigorieva, I. V.; Novoselov, K. S.; Zhukov, A. A.; Shapoval, S. Yu.

    2003-07-01

    The amazing climbing ability of geckos has attracted the interest of philosophers and scientists alike for centuries. However, only in the past few years has progress been made in understanding the mechanism behind this ability, which relies on submicrometre keratin hairs covering the soles of geckos. Each hair produces a miniscule force ~10-7 N (due to van der Waals and/or capillary interactions) but millions of hairs acting together create a formidable adhesion of ~10 N cm-2: sufficient to keep geckos firmly on their feet, even when upside down on a glass ceiling. It is very tempting to create a new type of adhesive by mimicking the gecko mechanism. Here we report on a prototype of such 'gecko tape' made by microfabrication of dense arrays of flexible plastic pillars, the geometry of which is optimized to ensure their collective adhesion. Our approach shows a way to manufacture self-cleaning, re-attachable dry adhesives, although problems related to their durability and mass production are yet to be resolved.

  1. Pontine lesions mimicking acute peripheral vestibulopathy

    PubMed Central

    Thomke, F.; Hopf, H. C.

    1999-01-01

    OBJECTIVES—Clinical signs of acute peripheral vestibulopathy (APV) were repeatedly reported with pontine lesions. The clinical relevance of such a mechanism is not known, as most studies were biased by patients with additional clinical signs of brainstem dysfunction.
METHODS—Masseter reflex (MassR), blink reflex (BlinkR), brainstem auditory evoked potentials (BAEPs), and DC electro-oculography (EOG) were tested in 232 consecutive patients with clinical signs of unilateral APV.
RESULTS—Forty five of the 232 patients (19.4%) had at least one electrophysiological abnormality suggesting pontine dysfunction mainly due to possible vertebrobasilar ischaemia (22 patients) and multiple sclerosis (eight patients). MassR abnormalities were seen in 24patients, and EOG abnormalities of saccades and following eye movements occurred in 22 patients. Three patients had BlinkR-R1 abnormalities, and one had delayed BAEP waves IV and V. Clinical improvement was almost always (32 of 34 re-examined patients) associated with improvement or normalisation of at least one electrophysiological abnormality. Brain MRI was done in 25 of the 44 patients and confirmed pontine lesions in six (two infarcts, three inflammations, one tumour).
CONCLUSIONS—Pontine dysfunction was suggested in 45 of 232 consecutive patients with clinical signs of APV on the basis of abnormal electrophysiological findings, and was mainly attributed to brainstem ischaemia and multiple sclerosis. The frequency of pontine lesions mimicking APV is underestimated if based on MRI established lesions only.

 PMID:10084533

  2. Vitamin D Deficiency Rickets Mimicking Pseudohypoparathyroidism

    PubMed Central

    Kurtoğlu, Selim; Yıldız, Aysel; Akın, Mustafa Ali; Kendirici, Mustafa

    2010-01-01

    Vitamin D deficiency rickets (VDDR) is a disorder biochemically characterized by elevated serum alkaline phosphatase (ALP) activity, normal or decreased serum calcium (Ca) and inorganic phosphate concentrations, secondary hyperparathyroidism and decreased serum 25−hydroxyvitamin D (25(OH)D) levels. In stage 1 VDDR, urinary amino acid and phosphate excretion are normal with minimal or no findings of rickets on radiographs. Pseudohypoparathyroidism (PHP) is an inherited disorder characterized by end−organ resistance to parathormone (PTH). VDDR occasionally resembles PHP type 2 in clinical presentation and biochemical features, creating difficulties in the differential diagnosis of these two entities. Here we report an infant diagnosed with VDDR. In addition to inadequate vitamin D intake, usage of antiepileptic drugs (AED) may have led to the worsening of the vitamin D deficiency. The patient presented with a history of febrile convulsions, for which he received phenobarbital treatment. The initial findings of hypocalcemia, hyperphosphatemia and normal tubular reabsorption of phosphate, mimicking PHP 2, responded well to vitamin D and oral Ca treatment with normalization of serum Ca, phosphorus (P), ALP and PTH levels Conflict of interest:None declared. PMID:21274319

  3. Ruptured hepatic abscess mimicking perforated viscus.

    PubMed

    Lai, Yen-Chun; Su, Yu-Jang; Chang, Wen-Han

    2008-11-01

    In the majority of pneumoperitoneum cases we diagnose perforated viscus. We present herein a case of ruptured hepatic abscess mimicking perforated viscus. A 40-year-old man presented to the emergency room with fever and right upper quadrant abdominal pain. The fever had been on/off for a period of 1 month. On physical examination, diffuse abdominal pain with rebounding tenderness was noted. Blood tests showed leukocytosis with left shift, hyperglycemia, and elevated liver function tests. A chest X-ray showed a subdiaphragmatic region air-fluid level, indicating a hepatic abscess. Pneumoperitoneum was also seen. Owing to the status of peritonitis, computed tomography (CT) of the abdomen was performed and revealed an air-containing liver abscess in the right lobe of the liver. Perforation of a hollow organ was also suspected because of the pneumoperitoneum. An emergent laparotomy was immediately performed for the suspicion of a hollow organ perforation. No perforation of the hollow viscus was found. The ruptured hepatic abscess was attributed to the pneumoperitoneum. A blood culture grew Klebsiella pneumoniae four days later, and the same organism was also found in a surgical specimen culture of the abscess. For a ruptured hepatic abscess, surgical intervention with draining of the abscess and cleaning of the abdominal cavity are essential to save patient lives.

  4. Egg white ovalbumin digestion mimicking physiological conditions.

    PubMed

    Martos, Gustavo; Contreras, Patricia; Molina, Elena; López-Fandiño, Rosina

    2010-05-12

    Gastrointestinal digestion of ovalbumin (OVA) was simulated using an in vitro system in two steps, which mimicked digestion in the stomach and duodenum, to assess the effect of different gastric pHs, different concentrations of proteases, and the presence of surfactants, such as phosphatidylcholine (PC) and bile salts (BS). OVA was very resistant to pepsin action at an enzyme/substrate ratio that would resemble a physiological situation (1:20 w/w, 172 units/mg) at pH values equal or above 2. The presence of PC did not change the susceptibility of OVA to proteolysis with pepsin. Fluorescence experiments showed that OVA interacted with PC vesicles, particularly at acidic pH, but it is likely that the protein maintained a high degree of conformational stability, resisting pepsin action. The presence of BS at physiological concentrations considerably increased the proteolysis of OVA by a mixture of pancreatic enzymes. The addition of PC made OVA even more sensitive to proteolytic degradation, suggesting that OVA could associate with the surfactants under duodenal conditions, increasing its exposure to pancreatic proteinases. Immunoreactivity against IgE from sera of allergic patients was retained after in vitro gastric digestion, depending on the reactivity of the sera, but it decreased considerably after in vitro duodenal digestion.

  5. CisMiner: genome-wide in-silico cis-regulatory module prediction by fuzzy itemset mining.

    PubMed

    Navarro, Carmen; Lopez, Francisco J; Cano, Carlos; Garcia-Alcalde, Fernando; Blanco, Armando

    2014-01-01

    Eukaryotic gene control regions are known to be spread throughout non-coding DNA sequences which may appear distant from the gene promoter. Transcription factors are proteins that coordinately bind to these regions at transcription factor binding sites to regulate gene expression. Several tools allow to detect significant co-occurrences of closely located binding sites (cis-regulatory modules, CRMs). However, these tools present at least one of the following limitations: 1) scope limited to promoter or conserved regions of the genome; 2) do not allow to identify combinations involving more than two motifs; 3) require prior information about target motifs. In this work we present CisMiner, a novel methodology to detect putative CRMs by means of a fuzzy itemset mining approach able to operate at genome-wide scale. CisMiner allows to perform a blind search of CRMs without any prior information about target CRMs nor limitation in the number of motifs. CisMiner tackles the combinatorial complexity of genome-wide cis-regulatory module extraction using a natural representation of motif combinations as itemsets and applying the Top-Down Fuzzy Frequent- Pattern Tree algorithm to identify significant itemsets. Fuzzy technology allows CisMiner to better handle the imprecision and noise inherent to regulatory processes. Results obtained for a set of well-known binding sites in the S. cerevisiae genome show that our method yields highly reliable predictions. Furthermore, CisMiner was also applied to putative in-silico predicted transcription factor binding sites to identify significant combinations in S. cerevisiae and D. melanogaster, proving that our approach can be further applied genome-wide to more complex genomes. CisMiner is freely accesible at: http://genome2.ugr.es/cisminer. CisMiner can be queried for the results presented in this work and can also perform a customized cis-regulatory module prediction on a query set of transcription factor binding sites provided by

  6. Development of Vibrational Culture Model Mimicking Vocal Fold Tissues.

    PubMed

    Kim, Dongjoo; Lim, Jae-Yol; Kwon, Soonjo

    2016-10-01

    The vocal folds (VFs) are connective tissues with complex matrix structures that provide the required mechanical properties for voice generation. VF injury leads to changes in tissue structure and properties, resulting in reduced voice quality. However, injury-induced biochemical changes and repair in scarred VF tissues have not been well characterized to date. To treat scarred VFs, it is essential to understand how physiological characteristics of VFs tissue change in response to external perturbation. In this study, we designed a simple vibrational culture model to mimic vibratory microenvironments observed in vivo. This model consists of a flexible culture plate, three linear actuators, a stereo splitter, and a function generator. Human vocal fold fibroblast (hVFF) monolayers were established on the flexible membrane, to which normal phonatory vibrations were delivered from linear actuators and a function generator. The hVFF monolayers were exposed to the vibrational stresses at a frequency of 205 Hz for 2, 6, and 10 h with maximum displacement of 47.1 μm, followed by a 6 h rest. We then observed the changes in cell morphology, cell viability, and gene expression related to extracellular matrix components. In our dynamic culture device mimicking normal phonatory frequencies, cell proliferation increased and expression of hyaluronic acid synthase 2 was downregulated in response to vibrational stresses. The results presented herein will be useful for evaluating cellular responses following VF injuries in the presence or absence of vibrational stresses.

  7. Auditory-motor entrainment in vocal mimicking species

    PubMed Central

    2010-01-01

    We have recently found robust evidence of motor entrainment to auditory stimuli in multiple species of non-human animal, all of which were capable of vocal mimicry. In contrast, the ability remained markedly absent in many closely related species incapable of vocal mimicry. This suggests that vocal mimicry may be a necessary precondition for entrainment. However, within the vocal mimicking species, entrainment appeared non-randomly, suggesting that other components besides vocal mimicry play a role in the capacity and tendency to entrain. Here we discuss potential additional factors involved in entrainment. New survey data show that both male and female parrots are able to entrain, and that the entrainment capacity appears throughout the lifespan. We suggest routes for future study of entrainment, including both developmental studies in species known to entrain and further work to detect entrainment in species not well represented in our dataset. These studies may shed light on additional factors necessary for entrainment in addition to vocal mimicry. PMID:20714417

  8. Red blood cell-mimicking synthetic biomaterial particles.

    PubMed

    Doshi, Nishit; Zahr, Alisar S; Bhaskar, Srijanani; Lahann, Joerg; Mitragotri, Samir

    2009-12-22

    Biomaterials form the basis of current and future biomedical technologies. They are routinely used to design therapeutic carriers, such as nanoparticles, for applications in drug delivery. Current strategies for synthesizing drug delivery carriers are based either on discovery of materials or development of fabrication methods. While synthetic carriers have brought upon numerous advances in drug delivery, they fail to match the sophistication exhibited by innate biological entities. In particular, red blood cells (RBCs), the most ubiquitous cell type in the human blood, constitute highly specialized entities with unique shape, size, mechanical flexibility, and material composition, all of which are optimized for extraordinary biological performance. Inspired by this natural example, we synthesized particles that mimic the key structural and functional features of RBCs. Similar to their natural counterparts, RBC-mimicking particles described here possess the ability to carry oxygen and flow through capillaries smaller than their own diameter. Further, they can also encapsulate drugs and imaging agents. These particles provide a paradigm for the design of drug delivery and imaging carriers, because they combine the functionality of natural RBCs with the broad applicability and versatility of synthetic drug delivery particles.

  9. Angle-resolved spectroscopy: a tissue-mimicking phantom study

    NASA Astrophysics Data System (ADS)

    Zhang, Yan; Vasefi, Fartash; Chamson-Reig, Astrid; Najiminainia, Mohamadreza; Kaminska, Bozena; Carson, Jeffrey J. L.

    2012-03-01

    The Radial Angular Filter Array (RAFA) is a novel optical filter consisting of a radially-distributed series of micromachined channels with a focal length of a few millimeters. The RAFA filters photons passing through the focal point according to the propagation direction and has proven to be capable of collecting the angular distribution and the spectral information of photons simultaneously and non-invasively, which allows angle-resolved spectroscopic measurement of a turbid medium. To explore the feasibility of using this device to characterize the optical abnormalities in human tissues, we tested the performance of an angle-resolved RAFA-based spectroscopy system to detect absorption targets embedded within a tissue-mimicking phantom. The body of the phantom was made of 0.1% IntralipidTM/agarose gel (7 mm in thickness) and the targets were spherical (1.5 mm in radius) and contained 10 μM Indocyanine Green (ICG). The illumination source was a broadband near infrared (NIR) collimated beam. Photons were angularly filtered by the RAFA and spectrally resolved by a pushbroom spectrometer. The experimental results confirmed that the RAFA preferentially filtered photons that carried absorption and scattering information of the embedded targets.

  10. Non-harmful insertion of data mimicking computer network attacks

    DOEpatents

    Neil, Joshua Charles; Kent, Alexander; Hash, Jr, Curtis Lee

    2016-06-21

    Non-harmful data mimicking computer network attacks may be inserted in a computer network. Anomalous real network connections may be generated between a plurality of computing systems in the network. Data mimicking an attack may also be generated. The generated data may be transmitted between the plurality of computing systems using the real network connections and measured to determine whether an attack is detected.

  11. Deformed Skull Morphology Is Caused by the Combined Effects of the Maldevelopment of Calvarias, Cranial Base and Brain in FGFR2-P253R Mice Mimicking Human Apert Syndrome

    PubMed Central

    Luo, Fengtao; Xie, Yangli; Xu, Wei; Huang, Junlan; Zhou, Siru; Wang, Zuqiang; Luo, Xiaoqing; Liu, Mi; Chen, Lin; Du, Xiaolan

    2017-01-01

    Apert syndrome (AS) is a common genetic syndrome in humans characterized with craniosynostosis. Apert patients and mouse models showed abnormalities in sutures, cranial base and brain, that may all be involved in the pathogenesis of skull malformation of Apert syndrome. To distinguish the differential roles of these components of head in the pathogenesis of the abnormal skull morphology of AS, we generated mouse strains specifically expressing mutant FGFR2 in chondrocytes, osteoblasts, and progenitor cells of central nervous system (CNS) by crossing Fgfr2+/P253R-Neo mice with Col2a1-Cre, Osteocalcin-Cre (OC-Cre), and Nestin-Cre mice, respectively. We then quantitatively analyzed the skull and brain morphology of these mutant mice by micro-CT and micro-MRI using Euclidean distance matrix analysis (EDMA). Skulls of Col2a1-Fgfr2+/P253R mice showed Apert syndrome-like dysmorphology, such as shortened skull dimensions along the rostrocaudal axis, shortened nasal bone, and evidently advanced ossification of cranial base synchondroses. The OC-Fgfr2+/P253R mice showed malformation in face at 8-week stage. Nestin-Fgfr2+/P253R mice exhibited increased dorsoventral height and rostrocaudal length on the caudal skull and brain at 8 weeks. Our study indicates that the abnormal skull morphology of AS is caused by the combined effects of the maldevelopment in calvarias, cranial base, and brain tissue. These findings further deepen our knowledge about the pathogenesis of the abnormal skull morphology of AS, and provide new clues for the further analyses of skull phenotypes and clinical management of AS. PMID:28123344

  12. Award Winner in the Young Investigator Category, 2017 Society for Biomaterials Annual Meeting and Exposition, Minneapolis, MN, April 05-08, 2017: Lymph node stiffness-mimicking hydrogels regulate human B-cell lymphoma growth and cell surface receptor expression in a molecular subtype-specific manner.

    PubMed

    Apoorva, F N U; Tian, Ye F; Pierpont, Timothy M; Bassen, David M; Cerchietti, Leandro; Butcher, Jonathan T; Weiss, Robert S; Singh, Ankur

    2017-07-01

    Diffuse large B-cell lymphoma (DLBCL) is the most common type of non-Hodgkin's lymphoma, with multiple molecular subtypes. The activated B-cell-like DLBCL subtype accounts for roughly one-third of all the cases and has an inferior prognosis. There is a need to develop better class of therapeutics that could target molecular pathways in resistant DLBCLs; however, this requires DLBCLs to be studied in representative tumor microenvironments. The pathogenesis and progression of lymphoma has been mostly studied from the point of view of genetic alterations and intracellular pathway dysregulation. By comparison, the importance of lymphoma microenvironment in which these malignant cells arise and reside has not been studied in as much detail. We have recently elucidated the role of integrin signaling in lymphomas and demonstrated that inhibition of integrin-ligand interactions abrogated the proliferation of malignant cells in vitro and in patient-derived xenograft. Here we demonstrate the role of lymph node tissue stiffness on DLBCL in a B-cell molecular subtype specific manner. We engineered tunable bioartificial hydrogels that mimicked the stiffness of healthy and neoplastic lymph nodes of a transgenic mouse model and primary human lymphoma tumors. Our results demonstrate that molecularly diverse DLBCLs grow differentially in soft and high stiffness microenvironments, which further modulates the integrin and B-cell receptor expression level as well as response to therapeutics. We anticipate that our findings will be broadly useful to study lymphoma biology and discover new class of therapeutics that target B-cell tumors in physical environments. © 2016 Wiley Periodicals, Inc. J Biomed Mater Res Part A: 105A: 1833-1844, 2017. © 2017 Wiley Periodicals, Inc.

  13. Prediction of Cis-Regulatory Elements Controlling Genes Differentially Expressed by Retinal and Choroidal Vascular Endothelial Cells.

    PubMed

    Choi, Dongseok; Appukuttan, Binoy; Binek, Sierra J; Planck, Stephen R; Stout, J Timothy; Rosenbaum, James T; Smith, Justine R

    2008-01-01

    Cultured endothelial cells of the human retina and choroid demonstrate distinct patterns of gene expression. We hypothesized that differential gene expression reflected differences in the interactions of transcription factors and respective cis-regulatory motifs(s) in these two emdothelial cell subpopulations, recognizing that motifs often exist as modules. We tested this hypothesis in silico by using TRANSFAC Professional and CisModule to identify cis-regulatory motifs and modules in genes that were differentially expressed by human retinal versus choroidal endothelial cells, as identified by analysis of a microarray data set. Motifs corresponding to eight transcription factors were significantly (p < 0.05) differentially abundant in genes that were relatively highly expressed in retinal (i.e., GCCR, HMGIY, HSF1, p53, VDR) or choroidal (i.e., E2F, YY1, ZF5) endothelial cells. Predicted cis-regulatory modules were quite different for these two groups of genes. Our findings raise the possibility of exploiting specific cis-regulatory motifs to target therapy at the ocular endothelial cells subtypes responsible for neovascular age-related macular degeneration or proliferative diabetic retinopathy.

  14. Multi-phase back contacts for CIS solar cells

    DOEpatents

    Rockett, A.A.; Yang, L.C.

    1995-12-19

    Multi-phase, single layer, non-interdiffusing M-Mo back contact metallized films, where M is selected from Cu, Ga, or mixtures thereof, for CIS cells are deposited by a sputtering process on suitable substrates, preferably glass or alumina, to prevent delamination of the CIS from the back contact layer. Typical CIS compositions include CuXSe{sub 2} where X is In or/and Ga. The multi-phase mixture is deposited on the substrate in a manner to provide a columnar microstructure, with micro-vein Cu or/and Ga regions which partially or fully vertically penetrate the entire back contact layer. The CIS semiconductor layer is then deposited by hybrid sputtering and evaporation process. The Cu/Ga-Mo deposition is controlled to produce the single layer two-phase columnar morphology with controllable Cu or Ga vein size less than about 0.01 microns in width. During the subsequent deposition of the CIS layer, the columnar Cu/Ga regions within the molybdenum of the Cu/Ga-Mo back layer tend to partially leach out, and are replaced by columns of CIS. Narrower Cu and/or Ga regions, and those with fewer inner connections between regions, leach out more slowly during the subsequent CIS deposition. This gives a good mechanical and electrical interlock of the CIS layer into the Cu/Ga-Mo back layer. Solar cells employing In-rich CIS semiconductors bonded to the multi-phase columnar microstructure back layer of this invention exhibit vastly improved photo-electrical conversion on the order of 17% greater than Mo alone, improved uniformity of output across the face of the cell, and greater Fill Factor. 15 figs.

  15. Multi-phase back contacts for CIS solar cells

    DOEpatents

    Rockett, Angus A.; Yang, Li-Chung

    1995-01-01

    Multi-phase, single layer, non-interdiffusing M-Mo back contact metallized films, where M is selected from Cu, Ga, or mixtures thereof, for CIS cells are deposited by a sputtering process on suitable substrates, preferably glass or alumina, to prevent delamination of the CIS from the back contact layer. Typical CIS compositions include CuXSe.sub.2 where X is In or/and Ga. The multi-phase mixture is deposited on the substrate in a manner to provide a columnar microstructure, with micro-vein Cu or/and Ga regions which partially or fully vertically penetrate the entire back contact layer. The CIS semiconductor layer is then deposited by hybrid sputtering and evaporation process. The Cu/Ga-Mo deposition is controlled to produce the single layer two-phase columnar morphology with controllable Cu or Ga vein size less than about 0.01 microns in width. During the subsequent deposition of the CIS layer, the columnar Cu/Ga regions within the molybdenum of the Cu/Ga-Mo back layer tend to partially leach out, and are replaced by columns of CIS. Narrower Cu and/or Ga regions, and those with fewer inner connections between regions, leach out more slowly during the subsequent CIS deposition. This gives a good mechanical and electrical interlock of the CIS layer into the Cu/Ga-Mo back layer. Solar cells employing In-rich CIS semiconductors bonded to the multi-phase columnar microstructure back layer of this invention exhibit vastly improved photo-electrical conversion on the order of 17% greater than Mo alone, improved uniformity of output across the face of the cell, and greater Fill Factor.

  16. Integrated photocatalytic micropillar nanoreactor electrospray ionization chip for mimicking phase I metabolic reactions.

    PubMed

    Nissilä, Teemu; Sainiemi, Lauri; Karikko, Mika-Matti; Kemell, Marianna; Ritala, Mikko; Franssila, Sami; Kostiainen, Risto; Ketola, Raimo A

    2011-04-21

    We developed a nanoreactor chip based system to mimic phase I metabolic reactions of small organic compounds. The microchip, made of silicon, has an anatase-phase titanium dioxide (TiO(2)) nanolayer coating for photocatalysis and an integrated electrospray ionization (ESI) tip for direct mass spectrometric (MS) analysis. This novel method for mimicking phase I metabolic reactions uses an on-chip TiO(2)-nanolayer and an external UV-lamp to induce photocatalyzed chemical reactions of drug compounds in aqueous solutions. The reactions of selected test compounds (verapamil, metoprolol, propranolol, lidocaine, 2-acetamidofluorene, and S-methylthiopurine) produced mostly the same main products as phase I metabolic reactions induced by human liver microsomes, rat hepatocytes, or cytochrome P enzymes, showing hydroxylation, dehydrogenation, and dealkylations as the main photocatalytic reactions. With this method it is possible to detect reactive and toxic products (mimicking reactive metabolites) due to the absence of biological matrices and an immediate analysis. The method used is sensitive: only 20-40 pmol (1-10 ng) of a substrate was needed for the experiment, thus it provides an inexpensive method for screening possible metabolites of new drug candidates. Due to small dimensions of the microchip, diffusion lengths are suitable for the high reaction rates, thus providing a rapid analysis as the reaction products can be detected and identified directly after the photoinduced reactions have occurred. The method shows a similar performance to that of electrochemistry, a commonly used technique for mimicking phase I metabolism.

  17. Histone replacement marks the boundaries of cis-regulatory domains.

    PubMed

    Mito, Yoshiko; Henikoff, Jorja G; Henikoff, Steven

    2007-03-09

    Cellular memory is maintained at homeotic genes by cis-regulatory elements whose mechanism of action is unknown. We have examined chromatin at Drosophila homeotic gene clusters by measuring, at high resolution, levels of histone replacement and nucleosome occupancy. Homeotic gene clusters display conspicuous peaks of histone replacement at boundaries of cis-regulatory domains superimposed over broad regions of low replacement. Peaks of histone replacement closely correspond to nuclease-hypersensitive sites, binding sites for Polycomb and trithorax group proteins, and sites of nucleosome depletion. Our results suggest the existence of a continuous process that disrupts nucleosomes and maintains accessibility of cis-regulatory elements.

  18. The Golgi apparatus: roles for distinct 'cis' and 'trans' compartments.

    PubMed

    Rothman, J E

    1982-01-01

    The Golgi apparatus seems to consist of distinct cis and trans compartments that are proposed to act sequentially to refine the protein export of the endoplasmic reticulum by removing escaped endoplasmic reticulum proteins. Refinement may be a multi-stage process that employs a principle akin to fractional distillation; the stack of cisternae comprising the cis Golgi may be the plates in this distillation tower. The trans Golgi, consisting of the last one or two cisternae, may be the receiver that collects from the cis Golgi only its most refined fraction for later distribution to specific locations throughout the cell.

  19. Noncavernous arteriovenous shunts mimicking carotid cavernous fistulae

    PubMed Central

    Kobkitsuksakul, Chai; Jiarakongmun, Pakorn; Chanthanaphak, Ekachat; Singhara Na Ayudya, Sirintara (Pongpech)

    2016-01-01

    PURPOSE The classic symptoms and signs of carotid cavernous sinus fistula or cavernous sinus dural arteriovenous fistula (AVF) consist of eye redness, exophthalmos, and gaze abnormality. The angiography findings typically consist of arteriovenous shunt at cavernous sinus with ophthalmic venous drainage with or without cortical venous reflux. In rare circumstances, the shunts are localized outside the cavernous sinus, but mimic symptoms and radiography of the cavernous shunt. We would like to present the other locations of the arteriovenous shunt, which mimic the clinical presentation of carotid cavernous fistulae, and analyze venous drainages. METHODS We retrospectively examined the records of 350 patients who were given provisional diagnoses of carotid cavernous sinus fistulae or cavernous sinus dural AVF in the division of Interventional Neuroradiology, Ramathibodi Hospital, Bangkok between 2008 and 2014. Any patient with cavernous arteriovenous shunt was excluded. RESULTS Of those 350 patients, 10 patients (2.85%) were identified as having noncavernous sinus AVF. The angiographic diagnoses consisted of three anterior condylar (hypoglossal) dural AVF, two traumatic middle meningeal AVF, one lesser sphenoid wing dural AVF, one vertebro-vertebral fistula (VVF), one intraorbital AVF, one direct dural artery to cortical vein dural AVF, and one transverse-sigmoid dural AVF. Six cases (60%) were found to have venous efferent obstruction. CONCLUSION Arteriovenous shunts mimicking the cavernous AVF are rare, with a prevalence of only 2.85% in this series. The clinical presentation mainly depends on venous outflow. The venous outlet of the arteriovenous shunts is influenced by venous afferent-efferent patterns according to the venous anatomy of the central nervous system and the skull base, as well as by architectural disturbance, specifically, obstruction of the venous outflow. PMID:27767958

  20. Assessing Computational Methods of Cis-Regulatory Module Prediction

    PubMed Central

    Su, Jing; Teichmann, Sarah A.; Down, Thomas A.

    2010-01-01

    Computational methods attempting to identify instances of cis-regulatory modules (CRMs) in the genome face a challenging problem of searching for potentially interacting transcription factor binding sites while knowledge of the specific interactions involved remains limited. Without a comprehensive comparison of their performance, the reliability and accuracy of these tools remains unclear. Faced with a large number of different tools that address this problem, we summarized and categorized them based on search strategy and input data requirements. Twelve representative methods were chosen and applied to predict CRMs from the Drosophila CRM database REDfly, and across the human ENCODE regions. Our results show that the optimal choice of method varies depending on species and composition of the sequences in question. When discriminating CRMs from non-coding regions, those methods considering evolutionary conservation have a stronger predictive power than methods designed to be run on a single genome. Different CRM representations and search strategies rely on different CRM properties, and different methods can complement one another. For example, some favour homotypical clusters of binding sites, while others perform best on short CRMs. Furthermore, most methods appear to be sensitive to the composition and structure of the genome to which they are applied. We analyze the principal features that distinguish the methods that performed well, identify weaknesses leading to poor performance, and provide a guide for users. We also propose key considerations for the development and evaluation of future CRM-prediction methods. PMID:21152003

  1. Trans-cis molecular photoswitching in interstellar Space.

    PubMed

    Cuadrado, S; Goicoechea, J R; Roncero, O; Aguado, A; Tercero, B; Cernicharo, J

    2016-12-01

    As many organic molecules, formic acid (HCOOH) has two conformers (trans and cis). The energy barrier to internal conversion from trans to cis is much higher than the thermal energy available in molecular clouds. Thus, only the most stable conformer (trans) is expected to exist in detectable amounts. We report the first interstellar detection of cis-HCOOH. Its presence in ultraviolet (UV) irradiated gas exclusively (the Orion Bar photodissociation region), with a low trans-to-cis abundance ratio of 2.8 ± 1.0, supports a photoswitching mechanism: a given conformer absorbs a stellar photon that radiatively excites the molecule to electronic states above the interconversion barrier. Subsequent fluorescent decay leaves the molecule in a different conformer form. This mechanism, which we specifically study with ab initio quantum calculations, was not considered in Space before but likely induces structural changes of a variety of interstellar molecules submitted to UV radiation.

  2. Trans-cis molecular photoswitching in interstellar Space*

    PubMed Central

    Cuadrado, S.; Goicoechea, J. R.; Roncero, O.; Aguado, A.; Tercero, B.; Cernicharo, J.

    2016-01-01

    As many organic molecules, formic acid (HCOOH) has two conformers (trans and cis). The energy barrier to internal conversion from trans to cis is much higher than the thermal energy available in molecular clouds. Thus, only the most stable conformer (trans) is expected to exist in detectable amounts. We report the first interstellar detection of cis-HCOOH. Its presence in ultraviolet (UV) irradiated gas exclusively (the Orion Bar photodissociation region), with a low trans-to-cis abundance ratio of 2.8 ± 1.0, supports a photoswitching mechanism: a given conformer absorbs a stellar photon that radiatively excites the molecule to electronic states above the interconversion barrier. Subsequent fluorescent decay leaves the molecule in a different conformer form. This mechanism, which we specifically study with ab initio quantum calculations, was not considered in Space before but likely induces structural changes of a variety of interstellar molecules submitted to UV radiation. PMID:28003686

  3. New cis-clerodane diterpenoids from Croton schiedeanus.

    PubMed

    Puebla, Pilar; Correa, Sofía Ximena; Guerrero, Mario; Carron, Rosalía; San Feliciano, Arturo

    2005-03-01

    The acid fraction of extracts from the aerial part of Croton schiedeanus afforded six cis-clerodane type diterpenoids. Two of them (1 and 4) are new natural compounds. Structural elucidation was achieved on the basis of their spectral data.

  4. The metabolism of cis- and trans-decalin

    PubMed Central

    Elliott, T. H.; Robertson, J. S.; Williams, R. T.

    1966-01-01

    1. The metabolism of cis- and trans-decalin in the rabbit has been investigated. 2. Both hydrocarbons were oxidized to racemic secondary alcohols and excreted as ether glucuronides in amounts equal to about 60% of the dose administered. The principal glucuronides were isolated as triacetyl methyl esters and as sodium salts. 3. cis-Decalin gave rise mainly to (±)-cis–cis-2-decalol, together with a little cis–trans-2-decalol, and trans-decalin mainly to (±)-trans–cis-2-decalol and a small amount of trans–trans-2-decalol. 4. These results suggest that biological oxidation of the decalins does not occur via a free-radical mechanism. An attempt is made to explain why racemic alcohols are obtained, rather than the more typical optically active products of enzymic reaction, and a mechanism is proposed. It is suggested that enzymes similar to steroid hydroxylases are involved. PMID:5968538

  5. The tomato cis-prenyltransferase gene family.

    PubMed

    Akhtar, Tariq A; Matsuba, Yuki; Schauvinhold, Ines; Yu, Geng; Lees, Hazel A; Klein, Samuel E; Pichersky, Eran

    2013-02-01

    cis-prenyltransferases (CPTs) are predicted to be involved in the synthesis of long-chain polyisoprenoids, all with five or more isoprene (C5) units. Recently, we identified a short-chain CPT, neryl diphosphate synthase (NDPS1), in tomato (Solanum lycopersicum). Here, we searched the tomato genome and identified and characterized its entire CPT gene family, which comprises seven members (SlCPT1-7, with NDPS1 designated as SlCPT1). Six of the SlCPT genes encode proteins with N-terminal targeting sequences, which, when fused to GFP, mediated GFP transport to the plastids of Arabidopsis protoplasts. The SlCPT3-GFP fusion protein was localized to the cytosol. Enzymatic characterization of recombinant SlCPT proteins demonstrated that SlCPT6 produces Z,Z-FPP, and SlCPT2 catalyzes the formation of nerylneryl diphosphate while SlCPT4, SlCPT5 and SlCPT7 synthesize longer-chain products (C25-C55). Although no in vitro activity was demonstrated for SlCPT3, its expression in the Saccharomyces cerevisiae dolichol biosynthesis mutant (rer2) complemented the temperature-sensitive growth defect. Transcripts of SlCPT2, SlCPT4, SlCPT5 and SlCPT7 are present at low levels in multiple tissues, SlCPT6 is exclusively expressed in red fruit and roots, and SlCPT1, SlCPT3 and SlCPT7 are highly expressed in trichomes. RNAi-mediated suppression of NDPS1 led to a large decrease in β-phellandrene (which is produced from neryl diphosphate), with greater reductions achieved with the general 35S promoter compared to the trichome-specific MKS1 promoter. Phylogenetic analysis revealed CPT gene families in both eudicots and monocots, and showed that all the short-chain CPT genes from tomato (SlCPT1, SlCPT2 and SlCPT6) are closely linked to terpene synthase gene clusters.

  6. A distant, cis-acting enhancer drives induction of Arf by Tgfβ in the developing eye

    PubMed Central

    Zheng, Yanbin; Devitt, Caitlin; Liu, Jing; Mei, Jie; Skapek, Stephen X

    2015-01-01

    The Arf tumor suppressor represents one of several genes encoded at the Cdkn2a and Cdkn2b loci in the mouse. Beyond its role blunting the growth of incipient cancer cells, the Arf gene also plays an essential role in development: Its gene product, p19Arf, is induced by Tgfβ2 in the developing eye to dampen proliferative signals from Pdgfrβ, which effect ultimately fosters the vascular remodeling required for normal vision in the mouse. Mechanisms underlying Arf induction by Tgfβ2 are not fully understood. Using the chr4Δ70kb/Δ70kb mouse, we now show that deletion of the coronary artery disease (CAD) risk interval lying upstream of the Cdkn2a/b locus represses developmentally-timed induction of Arf resulting in eye disease mimicking the persistent hyperplastic primary vitreous (PHPV) found in Arf-null mice and in children. Using mouse embryo fibroblasts, we demonstrate that Arf induction by Tgfβ is blocked in cis to the 70 kb deletion, but Arf induction by activated RAS and cell culture “shock” is not. Finally, we show that Arf induction by Tgfβ is derailed by preventing RNA polymerase II recruitment following Smad 2/3 binding to the promoter. These findings provide the first evidence that the CAD risk interval, located at a distance from Arf, acts as a cis enhancer of Tgfβ2-driven induction of Arf during development. PMID:23665474

  7. In Vitro Micellarization and Intestinal Cell Uptake of cis Isomers of Lycopene Exceed Those of All-trans Lycopene

    USDA-ARS?s Scientific Manuscript database

    The ratio of cis and all-trans lycopene (LYC) in human and animal tissues exeeds that in foods. The basis for this difference remains unknown, although differences in their stability, transport, and metabolism have been suggested. Here we systematically compared the digestive stability, efficiency...

  8. High-resolution analysis of cis-acting regulatory networks at the α-globin locus.

    PubMed

    Hughes, Jim R; Lower, Karen M; Dunham, Ian; Taylor, Stephen; De Gobbi, Marco; Sloane-Stanley, Jacqueline A; McGowan, Simon; Ragoussis, Jiannis; Vernimmen, Douglas; Gibbons, Richard J; Higgs, Douglas R

    2013-01-01

    We have combined the circular chromosome conformation capture protocol with high-throughput, genome-wide sequence analysis to characterize the cis-acting regulatory network at a single locus. In contrast to methods which identify large interacting regions (10-1000 kb), the 4C approach provides a comprehensive, high-resolution analysis of a specific locus with the aim of defining, in detail, the cis-regulatory elements controlling a single gene or gene cluster. Using the human α-globin locus as a model, we detected all known local and long-range interactions with this gene cluster. In addition, we identified two interactions with genes located 300 kb (NME4) and 625 kb (FAM173a) from the α-globin cluster.

  9. Workstation Designs for a Cis-Lunar Deep Space Habitat

    NASA Technical Reports Server (NTRS)

    Howe, A. Scott

    2014-01-01

    Using the International Standard Payload Rack (ISPR) system, a suite of workstations required for deep space missions have been proposed to fill out habitation functions in an International Space Station (ISS) derived Cis-lunar Deep Space Habitat. This paper introduces the functional layout of the Cis-lunar habitat design, and describes conceptual designs for modular deployable work surfaces, General Maintenance Workstation (GMWS), In-Space Manufacturing Workstation (ISMW), Intra-Vehicular Activity Telerobotics Work Station (IVA-TRWS), and Galley / Wardroom.

  10. Workstation Designs for a Cis-Lunar Deep Space Habitat

    NASA Technical Reports Server (NTRS)

    Howe, A. Scott

    2014-01-01

    Using the International Standard Payload Rack (ISPR) system, a suite of workstations required for deep space missions have been proposed to fill out habitation functions in an International Space Station (ISS) derived Cis-lunar Deep Space Habitat. This paper introduces the functional layout of the Cis-lunar habitat design, and describes conceptual designs for modular deployable work surfaces, General Maintenance Workstation (GMWS), In-Space Manufacturing Workstation (ISMW), Intra-Vehicular Activity Telerobotics Work Station (IVA-TRWS), and Galley / Wardroom.

  11. Advances in research on cis-9, trans-11 conjugated linoleic acid: a major functional conjugated linoleic acid isomer.

    PubMed

    Wang, Tao; Lee, Hong Gu

    2015-01-01

    Conjugated linoleic acid (CLA) consists of a group of positional and geometric conjugated isomers of linoleic acid. Since the identification of CLA as a factor that can inhibit mutagenesis and carcinogenesis, thousands of studies have been conducted in the last several decades. Among the many isomers discovered, cis-9, trans-11 CLA is the most intensively studied because of its multiple, isomer-specific effects in humans and animals. This paper provides an overview of the available data on cis-9, trans-11 CLA, including its isomer-specific effects, biosynthesis, in vivo/in vitro research models, quantification, and the factors influencing its content in ruminant products.

  12. Nozomi Cis-Lunar Phase Orbit Determination

    NASA Technical Reports Server (NTRS)

    Ryne, Mark; Criddle, Kevin

    2000-01-01

    Japan's Institute of Space and Astronautical Science (ISAS) launched Nozomi, its first mission to the planet Mars using the newly developed M-V launch vehicle on July 3, 1998. Scientific objectives of the mission are to study the structure and dynamics of the Martian upper atmosphere and its interaction with the solar wind. Nozomi is a cooperative mission between ISAS and the National Aeronautics and Space Administration (NASA). The NASA contribution includes navigation and tracking services provided by the Jet Propulsion Laboratory (JPL). The spacecraft also serves as an engineering demonstration of basic technology for planetary exploration. One of the new technologies was a unique trajectory, developed by ISAS, which used solar gravitational perturbations at the weak stability boundary as an aid to achieve an Earth-Mars transfer orbit. This trajectory saves approximately 120 m/s of Delta V compared to direct hyperbolic insertion and is considered an enabling technology for the mission. Nozomi was the first spacecraft to employ this trajectory and provided on-orbit validation of the technique. The trajectory was achieved by initially placing the spacecraft in a highly elliptical cis-lunar phasing orbit. Six maneuvers were performed during this period to correct injection errors and target an outbound lunar swingby in September 1998. The gravity assist from the lunar swingby raised apogee to the vicinity of the weak stability boundary. After three more targeting maneuvers, Nozomi performed an inbound lunar swingby followed immediately by a powered Earth swingby in late December 1998. A 420 m/s Trans Mars Insertion (TMI) burn at the final Earth periapsis was intended to place the spacecraft on a heliocentric trajectory leading to Mars orbit insertion in October 1999. Orbit determination for Nozomi is performed in parallel by both ISAS and the Multi-Mission Navigation (MMNAV) group at JPL. This was an advantage for the mission because each group would generate

  13. Nozomi Cis-Lunar Phase Orbit Determination

    NASA Technical Reports Server (NTRS)

    Ryne, Mark; Criddle, Kevin

    2000-01-01

    Japan's Institute of Space and Astronautical Science (ISAS) launched Nozomi, its first mission to the planet Mars using the newly developed M-V launch vehicle on July 3, 1998. Scientific objectives of the mission are to study the structure and dynamics of the Martian upper atmosphere and its interaction with the solar wind. Nozomi is a cooperative mission between ISAS and the National Aeronautics and Space Administration (NASA). The NASA contribution includes navigation and tracking services provided by the Jet Propulsion Laboratory (JPL). The spacecraft also serves as an engineering demonstration of basic technology for planetary exploration. One of the new technologies was a unique trajectory, developed by ISAS, which used solar gravitational perturbations at the weak stability boundary as an aid to achieve an Earth-Mars transfer orbit. This trajectory saves approximately 120 m/s of Delta V compared to direct hyperbolic insertion and is considered an enabling technology for the mission. Nozomi was the first spacecraft to employ this trajectory and provided on-orbit validation of the technique. The trajectory was achieved by initially placing the spacecraft in a highly elliptical cis-lunar phasing orbit. Six maneuvers were performed during this period to correct injection errors and target an outbound lunar swingby in September 1998. The gravity assist from the lunar swingby raised apogee to the vicinity of the weak stability boundary. After three more targeting maneuvers, Nozomi performed an inbound lunar swingby followed immediately by a powered Earth swingby in late December 1998. A 420 m/s Trans Mars Insertion (TMI) burn at the final Earth periapsis was intended to place the spacecraft on a heliocentric trajectory leading to Mars orbit insertion in October 1999. Orbit determination for Nozomi is performed in parallel by both ISAS and the Multi-Mission Navigation (MMNAV) group at JPL. This was an advantage for the mission because each group would generate

  14. Resistance patterns between cis-diamminedichloroplatinum(II) and ionizing radiation

    SciTech Connect

    De Pooter, C.M.; Scalliet, P.G.; Elst, H.J.; Huybrechts, J.J.; Gheuens, E.E.; Van Oosterom, A.T.; Fichtinger-Schepman, A.M.; De Bruijn, E.A. )

    1991-09-01

    Cross-resistance between cis-diamminedichloroplatinum(II) (CDDP) and radiation resistance has been suggested from clinical and experimental data. To determine whether cross-resistance patterns between both cytotoxic approaches exist, resistance against CDDP and ionizing radiation was induced separately in human ovarian cancer cells in a cross-over design. Subsequently sensitivity changes were determined for both treatment modalities. CDDP resistance was induced previously, and resistant cells were grown at three different levels of CDDP:0 ng/ml; 250 ng/ml; and 500 ng/ml. Resistance with resistance factor (RF) 3.4 to 5.1 proved to be stable, since withdrawal of CDDP pressure for at least 6 mo did not alter resistance patterns. CDDP-resistant cells also demonstrated stable resistance against ionizing radiation, with RF ranging from 1.7 to 2.0. The resistance patterns could not be explained by differences in growth kinetics and DNA content. Resistance to ionizing radiation was induced in the same human ovarian cancer cells as used for CDDP resistance studies. Exposure with 1.5 Gy of intermittent irradiation during 6 mo, at time intervals of 48 h, resulted in cells which were able to grow under chronic ionizing radiation pressure. RF was 2.0; the resistance was lost after 6 mo of culturing without ionizing radiation pressure. With intermittent radiation doses of 0.5 and 1.0 Gy, no significant resistance could be induced. Cells intermittently exposed to 0.5, 1.0, and 1.5 Gy during 6 mo demonstrated increased sensitivity to CDDP, with 0.22 less than RF less than 0.43. Increased sensitivity was associated with proportionally increased formation of the platinum-DNA adducts.

  15. Restless legs syndrome mimicking S1 radiculopathy.

    PubMed

    Zambelis, Th; Wolgamuth, B R; Papoutsi, S N; Economou, N T

    2016-01-01

    mimicking several pathological conditions, Restless Legs Syndrome prevalence on general population according to various large epidemiological studies and pathogenic hypotheses on the issue of Restless Legs Syndrome are discussed. Finally, by presenting another possible "RLS-mimic" our aim is to highlight the common misdiagnosis of Restless Legs Syndrome, which can mimic a variety of disorders, some of which are very common, such as an S1 radiculopathy, thus raising concern among doctors of various specialties addressed to by Restless Legs Syndrome sufferers, on the importance of proper diagnosis of the syndrome.

  16. Tissue-mimicking phantom materials for narrowband and ultrawideband microwave applications.

    PubMed

    Lazebnik, Mariya; Madsen, Ernest L; Frank, Gary R; Hagness, Susan C

    2005-09-21

    We propose and characterize oil-in-gelatin dispersions that approximate the dispersive dielectric properties of a variety of human soft tissues over the microwave frequency range from 500 MHz to 20 GHz. Different tissues are mimicked by selection of an appropriate concentration of oil. The materials possess long-term stability and can be employed in heterogeneous configurations without change in geometry or dielectric properties due to osmotic effects. Thus, these materials can be used to construct heterogeneous phantoms, including anthropomorphic types, for narrowband and ultrawideband microwave technologies, such as breast cancer detection and imaging systems.

  17. Tissue-mimicking phantom materials for narrowband and ultrawideband microwave applications

    NASA Astrophysics Data System (ADS)

    Lazebnik, Mariya; Madsen, Ernest L.; Frank, Gary R.; Hagness, Susan C.

    2005-09-01

    We propose and characterize oil-in-gelatin dispersions that approximate the dispersive dielectric properties of a variety of human soft tissues over the microwave frequency range from 500 MHz to 20 GHz. Different tissues are mimicked by selection of an appropriate concentration of oil. The materials possess long-term stability and can be employed in heterogeneous configurations without change in geometry or dielectric properties due to osmotic effects. Thus, these materials can be used to construct heterogeneous phantoms, including anthropomorphic types, for narrowband and ultrawideband microwave technologies, such as breast cancer detection and imaging systems.

  18. Vpr Protein of Human Immunodeficiency Virus Type 1 Forms Cation-Selective Channels in Planar Lipid Bilayers

    NASA Astrophysics Data System (ADS)

    Piller, S. C.; Ewart, G. D.; Premkumar, A.; Cox, G. B.; Gage, P. W.

    1996-01-01

    A small (96-aa) protein, virus protein R (Vpr), of human immunodeficiency virus type 1 contains one hydrophobic segment that could form a membrane-spanning helix. Recombinant Vpr, expressed in Escherichia coli and purified by affinity chromatography, formed ion channels in planar lipid bilayers when it was added to the cis chamber and when the trans chamber was held at a negative potential. The channels were more permeable to Na+ than to Cl- ions and were inhibited when the trans potential was made positive. Similar channel activity was caused by Vpr that had a truncated C terminus, but the potential dependence of channel activity was no longer seen. Antibody raised to a peptide mimicking part of the C terminus of Vpr (AbC) inhibited channel activity when added to the trans chamber but had no effect when added to the cis chamber. Antibody to the N terminus of Vpr (AbN) increased channel activity when added to the cis chamber but had no effect when added to the trans chamber. The effects of potential and antibodies on channel activity are consistent with a model in which the positive C-terminal end of dipolar Vpr is induced to traverse the bilayer membrane when the opposite (trans) side of the membrane is at a negative potential. The C terminus of Vpr would then be available for interaction with AbC in the trans chamber, and the N terminus would be available for interaction with AbN in the cis chamber. The ability of Vpr to form ion channels in vitro suggests that channel formation by Vpr in vivo is possible and may be important in the life cycle of human immunodeficiency virus type 1 and/or may cause changes in cells that contribute to AIDS-related pathologies.

  19. Glucose intolerance following cis-platinum treatment in rats.

    PubMed

    Goldstein, R S; Mayor, G H; Rosenbaum, R W; Hook, J B; Santiago, J V; Bond, J T

    1982-01-01

    cis-Dichlorodiammineplatinum (cis-Pt) is a heavy metal complex used in cancer chemotherapy. Since this drug has been shown to induce hyperglycemia in rats, these studies were initiated to elucidate the effects of cis-Pt on carbohydrate tolerance and insulin and glucagon secretion. Two days following i.v. cis-Pt (2.5 or 7.5 mg/kg, 5 ml/kg) or vehicle administration to male F-344 rats, plasma glucose, immunoreactive insulin (IRI) and glucagon (IRG) concentrations were determined in the basal state and serially following a glucose load (2 g/kg, i.p.). Since cis-Pt induces a dose-related anorexia, a pair-fed control group was also studied. Administration of 7.5 mg/kg cis-Pt was associated with plasma glucose concentrations 2.5-5 times greater than ad-libitum and pair-fed controls at every time point during the 2-h glucose tolerance test. Although basal plasma IRI concentrations of the 7.5-mg/kg group were comparable to ad-libitum fed controls, they were significantly greater than those of pair-fed partners. Furthermore, the appropriate IRI response to a glucose stimulus observed in both controls and the 2.5-mg/kg group was absent in the 7.5-mg/kg group. Basal plasma IRG concentrations of the 7.5-mg/kg group were approximately 3-4 times greater than ad-libitum and pair-fed controls and were not suppressed following a glucose load. These results suggest that cis-Pt induces marked glucose intolerance in association with an impaired IRI response and abnormal glucagon response to a glucose stimulus.

  20. Isolated neurosarcoidosis mimicking multifocal meningiomas: a diagnosis pitfall

    PubMed Central

    Wang, Kun; He, Xiaoying; Wang, Wei; Niu, Huanjiang; Wang, Yirong; Cai, Xiujun; Yang, Shuxu

    2016-01-01

    Abstract Introduction: Neurosarcoidosis accounts for approximately 5% of the sarcoidosis, which develops exclusively in the nervous system and is always difficult to diagnose. We describe a rare case of isolated neurosarcoidosis mimicking as multifocal meningiomas. A 27-year-old male was admitted to our hospital with a history of unconsciousness and convulsion 1 month ago, which was suspected as a seizure. The results showed no abnormalities in complete blood count; serum electrolytes; erythrocyte sedimentation rate and ultrasonography of the liver, pancreas, spleen, kidney and parotid gland, and so on. Chest radiograph and electroencephalogram were also normal. Serum-angiotensin-converting enzyme slightly increased. Normal opening pressure was shown in cerebrospinal fluid sampling, which includes 8/μL white blood cells, 0.93 g/L protein, and 3.03 mmol/L glucose. Enhanced magnetic resonance imaging revealed multifocal enhancement lesions, including left sphenoid wing region, left temporal and bilateral occipitoparietal region, which were suspected as multiple “meningioma”. A left frontotemporal craniotomy was further performed. Both necrotizing and non-necrotizing granulomas were revealed in the pathological specimen, most of which were associated with multinucleated giant cells and macrophages. We could also see the fibrosis and inflammatory reaction in the sample composed of lymphocytes, histiocytes, and plasma cells. Histopathological examination showed that the cells were positive for human CD68 (KP1), CD68 (PGM1), and CD163; however, they were negative for the AF, epithelial membrane antigen, and glial fibrillary acidic protein. Tuberculosis-deoxyribonucleic acid test and special stains for acid-fast bacilli and fungi were negative. The diagnosis was finally made as isolated neurosarcoidosis. Then the patient was treated with additional corticosteroid therapy. Serial imaging examination 4 months later revealed that the lesions extremely decreased

  1. Evaluating cis-2,6-Dimethylpiperidide (cis-DMP) as a Base Component in Lithium-Mediated Zincation Chemistry

    PubMed Central

    Armstrong, David R; Garden, Jennifer A; Kennedy, Alan R; Leenhouts, Sarah M; Mulvey, Robert E; O'Keefe, Philip; O'Hara, Charles T; Steven, Alan

    2013-01-01

    Most recent advances in metallation chemistry have centred on the bulky secondary amide 2,2,6,6-tetramethylpiperidide (TMP) within mixed metal, often ate, compositions. However, the precursor amine TMP(H) is rather expensive so a cheaper substitute would be welcome. Thus this study was aimed towards developing cheaper non-TMP based mixed-metal bases and, as cis-2,6-dimethylpiperidide (cis-DMP) was chosen as the alternative amide, developing cis-DMP zincate chemistry which has received meagre attention compared to that of its methyl-rich counterpart TMP. A new lithium diethylzincate, [(TMEDA)LiZn(cis-DMP)Et2] (TMEDA=N,N,N′,N′-tetramethylethylenediamine) has been synthesised by co-complexation of Li(cis-DMP), Et2Zn and TMEDA, and characterised by NMR (including DOSY) spectroscopy and X-ray crystallography, which revealed a dinuclear contact ion pair arrangement. By using N,N-diisopropylbenzamide as a test aromatic substrate, the deprotonative reactivity of [(TMEDA)LiZn(cis-DMP)Et2] has been probed and contrasted with that of the known but previously uninvestigated di-tert-butylzincate, [(TMEDA)LiZn(cis-DMP)tBu2]. The former was found to be the superior base (for example, producing the ortho-deuteriated product in respective yields of 78 % and 48 % following D2O quenching of zincated benzamide intermediates). An 88 % yield of 2-iodo-N,N-diisopropylbenzamide was obtained on reaction of two equivalents of the diethylzincate with the benzamide followed by iodination. Comparisons are also drawn using 1,1,1,3,3,3-hexamethyldisilazide (HMDS), diisopropylamide and TMP as the amide component in the lithium amide, Et2Zn and TMEDA system. Under certain conditions, the cis-DMP base system was found to give improved results in comparison to HMDS and diisopropylamide (DA), and comparable results to a TMP system. Two novel complexes isolated from reactions of the di-tert-butylzincate and crystallographically characterised, namely the pre-metallation complex [{(iPr)2N(Ph)C=O}LiZn(cis

  2. Evaluating cis-2,6-dimethylpiperidide (cis-DMP) as a base component in lithium-mediated zincation chemistry.

    PubMed

    Armstrong, David R; Garden, Jennifer A; Kennedy, Alan R; Leenhouts, Sarah M; Mulvey, Robert E; O'Keefe, Philip; O'Hara, Charles T; Steven, Alan

    2013-09-27

    Most recent advances in metallation chemistry have centred on the bulky secondary amide 2,2,6,6-tetramethylpiperidide (TMP) within mixed metal, often ate, compositions. However, the precursor amine TMP(H) is rather expensive so a cheaper substitute would be welcome. Thus this study was aimed towards developing cheaper non-TMP based mixed-metal bases and, as cis-2,6-dimethylpiperidide (cis-DMP) was chosen as the alternative amide, developing cis-DMP zincate chemistry which has received meagre attention compared to that of its methyl-rich counterpart TMP. A new lithium diethylzincate, [(TMEDA)LiZn(cis-DMP)Et2] (TMEDA=N,N,N',N'-tetramethylethylenediamine) has been synthesised by co-complexation of Li(cis-DMP), Et2Zn and TMEDA, and characterised by NMR (including DOSY) spectroscopy and X-ray crystallography, which revealed a dinuclear contact ion pair arrangement. By using N,N-diisopropylbenzamide as a test aromatic substrate, the deprotonative reactivity of [(TMEDA)LiZn(cis-DMP)Et2] has been probed and contrasted with that of the known but previously uninvestigated di-tert-butylzincate, [(TMEDA)LiZn(cis-DMP)tBu2]. The former was found to be the superior base (for example, producing the ortho-deuteriated product in respective yields of 78% and 48% following D2O quenching of zincated benzamide intermediates). An 88% yield of 2-iodo-N,N-diisopropylbenzamide was obtained on reaction of two equivalents of the diethylzincate with the benzamide followed by iodination. Comparisons are also drawn using 1,1,1,3,3,3-hexamethyldisilazide (HMDS), diisopropylamide and TMP as the amide component in the lithium amide, Et2Zn and TMEDA system. Under certain conditions, the cis-DMP base system was found to give improved results in comparison to HMDS and diisopropylamide (DA), and comparable results to a TMP system. Two novel complexes isolated from reactions of the di-tert-butylzincate and crystallographically characterised, namely the pre-metallation complex [{(iPr)2N(Ph)C=O}LiZn(cis

  3. A Cis-Lunar Propellant Infrastructure for Flexible Path Exploration and Space Commerce

    NASA Technical Reports Server (NTRS)

    Oeftering, Richard C.

    2012-01-01

    This paper describes a space infrastructure concept that exploits lunar water for propellant production and delivers it to users in cis-lunar space. The goal is to provide responsive economical space transportation to destinations beyond low Earth orbit (LEO) and enable in-space commerce. This is a game changing concept that could fundamentally affect future space operations, provide greater access to space beyond LEO, and broaden participation in space exploration. The challenge is to minimize infrastructure development cost while achieving a low operational cost. This study discusses the evolutionary development of the infrastructure from a very modest robotic operation to one that is capable of supporting human operations. The cis-lunar infrastructure involves a mix of technologies including cryogenic propellant production, reusable lunar landers, propellant tankers, orbital transfer vehicles, aerobraking technologies, and electric propulsion. This cislunar propellant infrastructure replaces Earth-launched propellants for missions beyond LEO. It enables users to reach destinations with smaller launchers or effectively multiplies the user s existing payload capacity. Users can exploit the expanded capacity to launch logistics material that can then be traded with the infrastructure for propellants. This mutually beneficial trade between the cis-lunar infrastructure and propellant users forms the basis of in-space commerce.

  4. Control of Biofilms with the Fatty Acid Signaling Molecule cis-2-Decenoic Acid

    PubMed Central

    Marques, Cláudia N. H.; Davies, David G.; Sauer, Karin

    2015-01-01

    Biofilms are complex communities of microorganisms in organized structures attached to surfaces. Importantly, biofilms are a major cause of bacterial infections in humans, and remain one of the most significant challenges to modern medical practice. Unfortunately, conventional therapies have shown to be inadequate in the treatment of most chronic biofilm infections based on the extraordinary innate tolerance of biofilms to antibiotics. Antagonists of quorum sensing signaling molecules have been used as means to control biofilms. QS and other cell-cell communication molecules are able to revert biofilm tolerance, prevent biofilm formation and disrupt fully developed biofilms, albeit with restricted effectiveness. Recently however, it has been demonstrated that Pseudomonas aeruginosa produces a small messenger molecule cis-2-decenoic acid (cis-DA) that shows significant promise as an effective adjunctive to antimicrobial treatment of biofilms. This molecule is responsible for induction of the native biofilm dispersion response in a range of Gram-negative and Gram-positive bacteria and in yeast, and has been shown to reverse persistence, increase microbial metabolic activity and significantly enhance the cidal effects of conventional antimicrobial agents. In this manuscript, the use of cis-2-decenoic acid as a novel agent for biofilm control is discussed. Stimulating the biofilm dispersion response as a novel antimicrobial strategy holds significant promise for enhanced treatment of infections and in the prevention of biofilm formation. PMID:26610524

  5. Control of carotenoid biosynthesis through a heme-based cis-trans isomerase

    PubMed Central

    Beltrán, Jesús; Kloss, Brian; Hosler, Jonathan P.; Geng, Jiafeng; Liu, Aimin; Modi, Anuja; Dawson, John H.; Sono, Masanori; Shumskaya, Maria; Ampomah-Dwamena, Charles; Love, James D.; Wurtzel, Eleanore T.

    2015-01-01

    Plants synthesize carotenoids essential for plant development and survival. These metabolites also serve as essential nutrients for human health. The biosynthetic pathway leading to all plant carotenoids occurs in chloroplasts and other plastids and requires 15-cis-ζ-carotene isomerase (Z-ISO). It was not certain whether isomerization was achieved by Z-ISO alone or in combination with other enzymes. Here we show that Z-ISO is a bona fide enzyme and integral membrane protein. Z-ISO independently catalyzes the cis-to-trans isomerization of the 15–15′ C=C bond in 9,15,9′-cis-ζ-carotene to produce the substrate required by the following biosynthetic pathway enzyme. We discovered that isomerization depends upon a ferrous heme b cofactor that undergoes redox-regulated ligand-switching between the heme iron and alternate Z-ISO amino acid residues. Heme b-dependent isomerization of a large, hydrophobic compound in a membrane is unprecedented. As an isomerase, Z-ISO represents a new prototype for heme b proteins and potentially utilizes a novel chemical mechanism. PMID:26075523

  6. The identification of cis-regulatory elements: A review from a machine learning perspective.

    PubMed

    Li, Yifeng; Chen, Chih-Yu; Kaye, Alice M; Wasserman, Wyeth W

    2015-12-01

    The majority of the human genome consists of non-coding regions that have been called junk DNA. However, recent studies have unveiled that these regions contain cis-regulatory elements, such as promoters, enhancers, silencers, insulators, etc. These regulatory elements can play crucial roles in controlling gene expressions in specific cell types, conditions, and developmental stages. Disruption to these regions could contribute to phenotype changes. Precisely identifying regulatory elements is key to deciphering the mechanisms underlying transcriptional regulation. Cis-regulatory events are complex processes that involve chromatin accessibility, transcription factor binding, DNA methylation, histone modifications, and the interactions between them. The development of next-generation sequencing techniques has allowed us to capture these genomic features in depth. Applied analysis of genome sequences for clinical genetics has increased the urgency for detecting these regions. However, the complexity of cis-regulatory events and the deluge of sequencing data require accurate and efficient computational approaches, in particular, machine learning techniques. In this review, we describe machine learning approaches for predicting transcription factor binding sites, enhancers, and promoters, primarily driven by next-generation sequencing data. Data sources are provided in order to facilitate testing of novel methods. The purpose of this review is to attract computational experts and data scientists to advance this field.

  7. Time-dependent inhibition of peptidylprolyl cis-trans-isomerases by FK506 is probably due to cis-trans isomerization of the inhibitor's imide bond.

    PubMed Central

    Zarnt, T; Lang, K; Burtscher, H; Fischer, G

    1995-01-01

    Free in solution, the immunosuppressive compounds cyclosporin A (CsA), FK506, ascomycin and rapamycin are present in many solvents in various slowly interconverting conformations. Together with their cellular receptor proteins, cyclophilin (CyP) and FK506-binding protein (FKBP), however, these inhibitors have been shown to have a homogeneous conformation. The existence of a slow cis-trans interconversion of an imidic bond in the inhibitor molecule during the course of the formation of the CsA-CyP18cy complex (where CyP18cy is human 18 kDa cytosolic CyP) prompted us to investigate the reaction of the peptidomacrolides FK506, ascomycin and rapamycin with two specific binding-proteins in more detail. Since formation of the FK506-FKBP complex results in the inhibition of the peptidylprolyl cis-trans-isomerase activity of the binding protein, we used the enzyme's decrease in enzymic activity to monitor binding of the inhibitors to their enzyme targets. For FK506, the kinetics of inhibition of human 12 kDa cytosolic FKBP (FKBP12cy) were clearly dependent on time. Subsequent to a rapid inactivation reaction, not resolved in its kinetics due to manual mixing, a slow dominant first-order inactivation process with a relaxation time of 1163 s at 10 degrees C was observed. Concomitantly the Ki value of the slow phase dropped 2.6-fold within the first 60 min of incubation. Using the FKBP12cy homologue 25 kDa membrane FKBP (FKBP25mem), a bacterial peptidylprolyl cis-trans-isomerase, the rate and amplitudes of the inhibition reactions were very similar to FKBP12cy. On the other hand, the kinetics and amplitudes of the inhibition of FKBP12cy varied significantly if rapamycin was used as an inhibitor instead of FK 506. Owing to reduced conformation transition in rapamycin upon binding to FKBP12cy, the slow phase during inhibition was significantly decreased in amplitude. A likely reason for this became apparent when the activation-enthalpy and the pH-dependence of the rate

  8. Time-dependent inhibition of peptidylprolyl cis-trans-isomerases by FK506 is probably due to cis-trans isomerization of the inhibitor's imide bond.

    PubMed

    Zarnt, T; Lang, K; Burtscher, H; Fischer, G

    1995-01-01

    Free in solution, the immunosuppressive compounds cyclosporin A (CsA), FK506, ascomycin and rapamycin are present in many solvents in various slowly interconverting conformations. Together with their cellular receptor proteins, cyclophilin (CyP) and FK506-binding protein (FKBP), however, these inhibitors have been shown to have a homogeneous conformation. The existence of a slow cis-trans interconversion of an imidic bond in the inhibitor molecule during the course of the formation of the CsA-CyP18cy complex (where CyP18cy is human 18 kDa cytosolic CyP) prompted us to investigate the reaction of the peptidomacrolides FK506, ascomycin and rapamycin with two specific binding-proteins in more detail. Since formation of the FK506-FKBP complex results in the inhibition of the peptidylprolyl cis-trans-isomerase activity of the binding protein, we used the enzyme's decrease in enzymic activity to monitor binding of the inhibitors to their enzyme targets. For FK506, the kinetics of inhibition of human 12 kDa cytosolic FKBP (FKBP12cy) were clearly dependent on time. Subsequent to a rapid inactivation reaction, not resolved in its kinetics due to manual mixing, a slow dominant first-order inactivation process with a relaxation time of 1163 s at 10 degrees C was observed. Concomitantly the Ki value of the slow phase dropped 2.6-fold within the first 60 min of incubation. Using the FKBP12cy homologue 25 kDa membrane FKBP (FKBP25mem), a bacterial peptidylprolyl cis-trans-isomerase, the rate and amplitudes of the inhibition reactions were very similar to FKBP12cy. On the other hand, the kinetics and amplitudes of the inhibition of FKBP12cy varied significantly if rapamycin was used as an inhibitor instead of FK 506. Owing to reduced conformation transition in rapamycin upon binding to FKBP12cy, the slow phase during inhibition was significantly decreased in amplitude. A likely reason for this became apparent when the activation-enthalpy and the pH-dependence of the rate

  9. Munchausen syndrome mimicking psychiatric disease with concomitant genuine physical illness

    PubMed Central

    Almeida, Jaime; da Silva, Joaquim Alves; Xavier, Miguel; Gusmão, Ricardo

    2010-01-01

    Munchausen syndrome is a disorder in which patients intentionally produce symptoms mimicking physical or psychiatric illnesses with the aim to assume the sick role and to gain medical attention. Once a patient receives a Munchausen syndrome diagnosis every complaint made thence tends to be regarded with scepticism by clinical staff. However, it is possible that a bona fide illness, which might be disregarded, may coexist in these patients. We report a case of MS mimicking psychiatric disease with concomitant genuine acute physical illness. Despite the initial doubts about the veracity of the latter, due to its prompt recognition, treatment was successful. PMID:22798096

  10. Unusual reactivity of cytotoxic cis-dihydrazide Pt(II) complexes in aqueous solution.

    PubMed

    Kushev, Daniel; Grünert, Renate; Spassovska, Nadejda; Golovinsky, Evgeny; Bednarski, Patrick J

    2003-09-01

    Complexes of the general structure cis-[PtX(2)(hydrazide)(2)] and cis-[PtX(2)NH(3)(hydrazide)], where X=Cl(-), Br(-) and I(-), and hydrazide=cyclohexylcarboxylic acid hydrazide (chcah), cyclopentylcarboxylic acid hydrazide (cpcah), 3-aminocyclohexanspiro-5-hydantoin (achsh) and 3-aminocyclopentanspiro-5-hydantoin (acpsh), were investigated with respect to aqueous stability, DNA platination rates and cytotoxic activity on a panel of seven human cancer cell lines as well as a cisplatin-resistant cell line. Stabilities in aqueous solution, determined by RP-HPLC and UV-Vis methods, were highly dependent on the type of halide ligand, with stability decreasing in the order I(-)>Cl(-)>Br(-). Added chloride (100 mM) only stabilized the dichloro-Pt(II) complexes containing the hydrazide as part of a hydantoin ring (i.e., achsh). Platination of calf thymus DNA determined by AAS was most rapid with dichloro-Pt(II) complexes containing achsh ligand. The mixed-amine dichloro-Pt(II) complexes with either chcah or cpcah ligands also platinated DNA >80%, but at a slower rate, while dihydrazide dichloro-Pt(II) complexes with either chcah or cpcah ligands resulted in <25% DNA platination at 24 h. cis-[PtX(2)(hydrazide)(2)], where hydrazide=chcah or cpcah, were the most potent compounds (chcah>cpcah), but activity was independent of the halide ligand (I(-)=Cl(-)=Br(-)). These complexes showed no cross-resistance with cisplatin, but they also showed little differentiation in potency over the seven cell lines. Complexes with the hydantoin ligands achsh and acpsh were inactive in all cell lines. Thus, neither stability in aqueous media nor covalent binding to DNA are correlated with biological activity, suggesting that cis-dihydrazide Pt(II) complexes act by a unique mechanism of action.

  11. Cis-Lunar Reusable In-Space Transportation Architecture for the Evolvable Mars Campaign

    NASA Technical Reports Server (NTRS)

    McVay, Eric S.; Jones, Christopher A.; Merrill, Raymond G.

    2016-01-01

    Human exploration missions to Mars or other destinations in the solar system require large quantities of propellant to enable the transportation of required elements from Earth's sphere of influence to Mars. Current and proposed launch vehicles are incapable of launching all of the requisite mass on a single vehicle; hence, multiple launches and in-space aggregation are required to perform a Mars mission. This study examines the potential of reusable chemical propulsion stages based in cis-lunar space to meet the transportation objectives of the Evolvable Mars Campaign and identifies cis-lunar propellant supply requirements. These stages could be supplied with fuel and oxidizer delivered to cis-lunar space, either launched from Earth or other inner solar system sources such as the Moon or near Earth asteroids. The effects of uncertainty in the model parameters are evaluated through sensitivity analysis of key parameters including the liquid propellant combination, inert mass fraction of the vehicle, change in velocity margin, and change in payload masses. The outcomes of this research include a description of the transportation elements, the architecture that they enable, and an option for a campaign that meets the objectives of the Evolvable Mars Campaign. This provides a more complete understanding of the propellant requirements, as a function of time, that must be delivered to cis-lunar space. Over the selected sensitivity ranges for the current payload and schedule requirements of the 2016 point of departure of the Evolvable Mars Campaign destination systems, the resulting propellant delivery quantities are between 34 and 61 tonnes per year of hydrogen and oxygen propellant, or between 53 and 76 tonnes per year of methane and oxygen propellant, or between 74 and 92 tonnes per year of hypergolic propellant. These estimates can guide future propellant manufacture and/or delivery architectural analysis.

  12. Solid Phase Biosensors for Arsenic or Cadmium Composed of A trans Factor and cis Element Complex

    PubMed Central

    Siddiki, Mohammad Shohel Rana; Kawakami, Yasunari; Ueda, Shunsaku; Maeda, Isamu

    2011-01-01

    The presence of toxic metals in drinking water has hazardous effects on human health. This study was conducted to develop GFP-based-metal-binding biosensors for on-site assay of toxic metal ions. GFP-tagged ArsR and CadC proteins bound to a cis element, and lost the capability of binding to it in their As- and Cd-binding conformational states, respectively. Water samples containing toxic metals were incubated on a complex of GFP-tagged ArsR or CadC and cis element which was immobilized on a solid surface. Metal concentrations were quantified with fluorescence intensity of the metal-binding states released from the cis element. Fluorescence intensity obtained with the assay significantly increased with increasing concentrations of toxic metals. Detection limits of 1 μg/L for Cd(II) and 5 μg/L for As(III) in purified water and 10 µg/L for Cd(II) and As(III) in tap water and bottled mineral water were achieved by measurement with a battery-powered portable fluorometer after 15-min and 30-min incubation, respectively. A complex of freeze dried GFP-tagged ArsR or CadC binding to cis element was stable at 4 °C and responded to 5 μg/L As(III) or Cd(II). The solid phase biosensors are sensitive, less time-consuming, portable, and could offer a protocol for on-site evaluation of the toxic metals in drinking water. PMID:22346629

  13. Cis-regulatory mechanisms governing stem and progenitor cell transitions

    PubMed Central

    Johnson, Kirby D.; Kong, Guangyao; Gao, Xin; Chang, Yuan-I; Hewitt, Kyle J.; Sanalkumar, Rajendran; Prathibha, Rajalekshmi; Ranheim, Erik A.; Dewey, Colin N.; Zhang, Jing; Bresnick, Emery H.

    2015-01-01

    Cis-element encyclopedias provide information on phenotypic diversity and disease mechanisms. Although cis-element polymorphisms and mutations are instructive, deciphering function remains challenging. Mutation of an intronic GATA motif (+9.5) in GATA2, encoding a master regulator of hematopoiesis, underlies an immunodeficiency associated with myelodysplastic syndrome (MDS) and acute myeloid leukemia (AML). Whereas an inversion relocalizes another GATA2 cis-element (−77) to the proto-oncogene EVI1, inducing EVI1 expression and AML, whether this reflects ectopic or physiological activity is unknown. We describe a mouse strain that decouples −77 function from proto-oncogene deregulation. The −77−/− mice exhibited a novel phenotypic constellation including late embryonic lethality and anemia. The −77 established a vital sector of the myeloid progenitor transcriptome, conferring multipotentiality. Unlike the +9.5−/− embryos, hematopoietic stem cell genesis was unaffected in −77−/− embryos. These results illustrate a paradigm in which cis-elements in a locus differentially control stem and progenitor cell transitions, and therefore the individual cis-element alterations cause unique and overlapping disease phenotypes. PMID:26601269

  14. Innovative front end processing for next generation CIS module production

    NASA Astrophysics Data System (ADS)

    Probst, Volker; Jasenek, Axel; Sandfort, Christian; Letsch, Andreas; Koetschau, Immo; Hahn, Thomas; Feichtinger, Jochen; Eschrich, Heinz

    2015-08-01

    The successful implementation of two new process steps into an existing Cu(In,Ga)(Se,S)2 (CIS) production line was achieved. One, a newly developed back contact, aims for a better process control, as far as the transition of the metallic back contact to a selenide/metal bi-layer during CIS-formation is concerned. This was done by the introduction of a corrosion resistant barrier layer, which reliably stops chalcogenide diffusion from the top. By doing so, a back contact layer is obtained, with well defined properties in which the functionalities of the back electrode now is divided between two separated layers. The other development presented in this paper, tackles the complexity of CIS-module production and the interferences between the different processes required. By shifting the P1-scribing process after i-ZnO deposition, the process sequence for CIS is simplified and it will be shown that this new P1i exhibits superior properties as far as CIS morphology and groove quality is concerned.

  15. DBMS UTILIZATION: A Corporate Information System (CIS) development approach

    NASA Technical Reports Server (NTRS)

    Rozett, P.

    1983-01-01

    The Corporate Information System (CIS), an integrated information system intended to tie the corporation together as a functioning entity, is described. In addition to being a major upgraded automated data processing system, the CIS is a management philosophy which recognizes data as a valuable corporate resource and which distinguishes between data and selected data, or information. It further recognizes that different users need different kinds of information. Plans for CIS development are discussed. It will offer its users not just after-the-fact data, but timely information in a format that is meaningful and useful to the particular user, so that the information can be applied in planning, controlling, and decision making by all levels of management. In effect, CIS will help the corporation itself to function as a total, integrated system by typing together administrative activities through information exchange. The CIS supports the operational, tactical control, and strategic planning functions of the corporation. Operational functions are the day-to-day processing necessary to support the corporation's work, such as purchasing and payroll.

  16. DBMS UTILIZATION: A Corporate Information System (CIS) development approach

    NASA Technical Reports Server (NTRS)

    Rozett, P.

    1983-01-01

    The Corporate Information System (CIS), an integrated information system intended to tie the corporation together as a functioning entity, is described. In addition to being a major upgraded automated data processing system, the CIS is a management philosophy which recognizes data as a valuable corporate resource and which distinguishes between data and selected data, or information. It further recognizes that different users need different kinds of information. Plans for CIS development are discussed. It will offer its users not just after-the-fact data, but timely information in a format that is meaningful and useful to the particular user, so that the information can be applied in planning, controlling, and decision making by all levels of management. In effect, CIS will help the corporation itself to function as a total, integrated system by typing together administrative activities through information exchange. The CIS supports the operational, tactical control, and strategic planning functions of the corporation. Operational functions are the day-to-day processing necessary to support the corporation's work, such as purchasing and payroll.

  17. Heparin-mimicking multilayer coating on polymeric membrane via LbL assembly of cyclodextrin-based supramolecules.

    PubMed

    Deng, Jie; Liu, Xinyue; Ma, Lang; Cheng, Chong; Shi, Wenbin; Nie, Chuanxiong; Zhao, Changsheng

    2014-12-10

    In this study, multifunctional and heparin-mimicking star-shaped supramolecules-deposited 3D porous multilayer films with improved biocompatibility were fabricated via a layer-by-layer (LbL) self-assembly method on polymeric membrane substrates. Star-shaped heparin-mimicking polyanions (including poly(styrenesulfonate-co-sodium acrylate; Star-PSS-AANa) and poly(styrenesulfonate-co-poly(ethylene glycol)methyl ether methacrylate; Star-PSS-EGMA)) and polycations (poly(methyl chloride-quaternized 2-(dimethylamino)ethyl methacrylate; Star-PMeDMA) were first synthesized by atom transfer radical polymerization (ATRP) from β-cyclodextrin (β-CD) based cores. Then assembly of 3D porous multilayers onto polymeric membrane surfaces was carried out by alternating deposition of the polyanions and polycations via electrostatic interaction. The surface morphology and composition, water contact angle, blood activation, and thrombotic potential as well as cell viability for the coated heparin-mimicking films were systematically investigated. The results of surface ATR-FTIR spectra and XPS spectra verified successful deposition of the star-shaped supramolecules onto the biomedical membrane surfaces; scanning electron microscopy (SEM) and atomic force microscopy (AFM) observations revealed that the modified substrate had 3D porous surface morphology, which might have a great biological influence on the biointerface. Furthermore, systematic in vitro investigation of protein adsorption, platelet adhesion, human platelet factor 4 (PF4, indicates platelet activation), activate partial thromboplastin time (APTT), thrombin time (TT), coagulation activation (thrombin-antithrombin III complex (TAT, indicates blood coagulant)), and blood-related complement activation (C3a and C5a, indicates inflammation potential) confirmed that the heparin-mimicking multilayer coated membranes exhibited ultralow blood component activations and excellent hemocompatibility. Meanwhile, after surface coating

  18. Redescription of Cis taurus (Reitter, 1878) (Coleoptera: Ciidae).

    PubMed

    Oliveira, Ester H; Lopes-Andrade, Cristiano

    2013-01-09

    Cis taurus (Reitter) is the type-species of Macrocis Reitter, a genus subsequently synonymized with Cis Latreille. It names a diversified but barely studied species-group of Cis, the taurus group. The objective of the present work is to redescribe C. taurus, designate a lectotype and provide the first description of male abdominal terminalia of the species. We also provide new data on its geographic distribution, restricted to three major Mexico mountain ranges: the Sierra Madre Oriental, the Sierra Madre de Chiapas and the Transmexican Volcanic Belt (Sierra Nevada). This is a first and important step in the ongoing revision of the taurus species-group.

  19. cisExpress: motif detection in DNA sequences.

    PubMed

    Triska, Martin; Grocutt, David; Southern, James; Murphy, Denis J; Tatarinova, Tatiana

    2013-09-01

    One of the major challenges for contemporary bioinformatics is the analysis and accurate annotation of genomic datasets to enable extraction of useful information about the functional role of DNA sequences. This article describes a novel genome-wide statistical approach to the detection of specific DNA sequence motifs based on similarities between the promoters of similarly expressed genes. This new tool, cisExpress, is especially designed for use with large datasets, such as those generated by publicly accessible whole genome and transcriptome projects. cisExpress uses a task farming algorithm to exploit all available computational cores within a shared memory node. We demonstrate the robust nature and validity of the proposed method. It is applicable for use with a wide range of genomic databases for any species of interest. cisExpress is available at www.cisexpress.org.

  20. cisExpress: motif detection in DNA sequences

    PubMed Central

    Triska, Martin; Grocutt, David; Southern, James; Murphy, Denis J.; Tatarinova, Tatiana

    2013-01-01

    Motivation: One of the major challenges for contemporary bioinformatics is the analysis and accurate annotation of genomic datasets to enable extraction of useful information about the functional role of DNA sequences. This article describes a novel genome-wide statistical approach to the detection of specific DNA sequence motifs based on similarities between the promoters of similarly expressed genes. This new tool, cisExpress, is especially designed for use with large datasets, such as those generated by publicly accessible whole genome and transcriptome projects. cisExpress uses a task farming algorithm to exploit all available computational cores within a shared memory node. We demonstrate the robust nature and validity of the proposed method. It is applicable for use with a wide range of genomic databases for any species of interest. Availability: cisExpress is available at www.cisexpress.org. Contact: tatiana.tatarinova@usc.edu Supplementary information: Supplementary data are available at Bioinformatics online. PMID:23793750

  1. Mimicking Neurotransmitter Release in Chemical Synapses via Hysteresis Engineering in MoS2 Transistors.

    PubMed

    Arnold, Andrew J; Razavieh, Ali; Nasr, Joseph R; Schulman, Daniel S; Eichfeld, Chad M; Das, Saptarshi

    2017-03-28

    Neurotransmitter release in chemical synapses is fundamental to diverse brain functions such as motor action, learning, cognition, emotion, perception, and consciousness. Moreover, improper functioning or abnormal release of neurotransmitter is associated with numerous neurological disorders such as epilepsy, sclerosis, schizophrenia, Alzheimer's disease, and Parkinson's disease. We have utilized hysteresis engineering in a back-gated MoS2 field effect transistor (FET) in order to mimic such neurotransmitter release dynamics in chemical synapses. All three essential features, i.e., quantal, stochastic, and excitatory or inhibitory nature of neurotransmitter release, were accurately captured in our experimental demonstration. We also mimicked an important phenomenon called long-term potentiation (LTP), which forms the basis of human memory. Finally, we demonstrated how to engineer the LTP time by operating the MoS2 FET in different regimes. Our findings could provide a critical component toward the design of next-generation smart and intelligent human-like machines and human-machine interfaces.

  2. The role of cis-carotenoids in abscisic acid biosynthesis.

    PubMed

    Parry, A D; Babiano, M J; Horgan, R

    1990-08-01

    Evidence has been obtained which is consistent with 9'-cis-neoxanthin being a major precursor of abscisic acid (ABA) in higher plants. A mild, rapid procedure was developed for the extraction and analysis of carotenoids from a range of tissues. Once purified the carotenoids were identified from their light-absorbance properties, reactions with dilute acid, high-performance liquid chromatography Rts, mass spectra and the quasiequilibria resulting from iodine-catalysed or chlorophyllsensitised photoisomerisation. Two possible ABA precursors, 9'-cis-neoxanthin and 9-cis-violaxanthin, were identified in extracts of light-grown and etiolated leaves (of Lycopersicon esculentum, Phaseolus vulgaris, Vicia faba, Pisum sativum, Cicer arietinum, Zea mays, Nicotiana plumbaginifolia, Plantago lanceolata and Digitalis purpurea), and roots of light-grown and etiolated plants (Lycopersicon, Phaseolus and Zea). The 9,9'-di-cisisomer of violaxanthin was synthesised but its presence was not detected in any extracts. Levels of 9'-cis-neoxanthin and all-trans-violaxanthin were between 20- to 100-fold greater than those of ABA in light-grown leaves. The levels of 9-cis-violaxanthin were similar to those of ABA but unaffected by water stress. Etiolated Phaseolus leaves contained reduced amounts of carotenoids (15-20% compared with light-grown leaves) but retained the ability to synthesise large amounts of ABA. The amounts of ABA synthesised, measured as increases in ABA and its metabolites phaseic acid and dihydrophaseic acid, were closely matched by decreases in the levels of 9'-cis-neoxanthin and all-trans-violaxanthin. In etiolated seedlings grown on 50% D2O, deuterium incorporation into ABA was similar to that into the xanthophylls. Relative levels of carotenoids in roots and light-grown and etiolated leaves of the ABA-deficient mutants, notabilis, flacca and sitiens were the same as those found in wild-type tomato tissues.

  3. Isolation of cis-Zeatin from Corynebacterium fascians Cultures

    PubMed Central

    Scarbrough, Emanuel; Armstrong, Donald J.; Skoog, Folke; Frihart, Charles R.; Leonard, Nelson J.

    1973-01-01

    Three cytokinin-active constituents have been isolated from the culture medium of Corynebacterium fascians, a plant pathogen causing fasciation. One constituent is now identified as cis-zeatin [6-(4-hydroxy-3-methyl-cis-2-butenylamino)purine]. It represents the first unequivocal demonstration of the production of a zeatin isomer by a bacterial species. Another constituent was identified earlier as 6-(3-methyl-2-butenyl-amino)purine. The third constituent, distinct, on Sephadex LH-20 column chromatography, from the above two and their ribosides, has not yet been identified. Images PMID:16592126

  4. Bronchial Aneurysms Mimicking Aortic Aneurysms: Endovascular Treatment in Two Patients

    SciTech Connect

    Vernhet, Helene; Bousquet, Claudine; Jean, Betty; Lesnik, Alvian; Durand, Gerard; Giron, Jacques; Senac, Jean Paul

    1999-05-15

    Bronchial artery dilatation and aneurysm formation is a potential complication of local inflammation, especially in bronchiectasis. When the bronchial artery has an ectopic origin from the inferior segment of the aortic arch, aneurysms may mimick aortic aneurysms. Despite this particular location, endovascular treatment is possible. We report two such aneurysms that were successfully embolized with steel coils.

  5. Cutaneous lymphoid hyperplasia mimicking cutaneous lymphoma in a hyperthyroid cat

    PubMed Central

    Snead, Elisabeth; Kerr, Moira; MacDonald, Valerie

    2013-01-01

    A 12-year-old neutered male domestic shorthair cat presented for chronic, localized, swelling and crusting of the left upper lip, weight loss, sporadic vomiting, and focal alopecia between the scapulae was diagnosed with hyperthyroidism and regional eosinophilic lymphadenitis. Treatment with methimazole exacerbated an underlying hypersensitivity disorder leading to marked generalized lymphadenopathy that histologically mimicked lymphoma. PMID:24155419

  6. Retroperitoneal bronchogenic cyst mimicking hydatid liver: a case report.

    PubMed

    Parray, Fazl Q; Sherwani, Afak Yusuf; Dangroo, Sajad Ahmad; Bisati, Rafia Aziz; Malik, Nighat Shaffi

    2012-01-01

    Bronchogenic cysts frequently occur in the mediastinum. They may be rarely encountered in the abdomen and retroperitoneum. Bronchogenic cysts can in fact mimic hydatid cysts. We report a case of retroperitoneal bronchogenic cyst below the right hemidiaphragm mimicking a hydatid cyst of the liver in a 30-year-old female.

  7. Retroperitoneal Bronchogenic Cyst Mimicking Hydatid Liver: A Case Report

    PubMed Central

    Parray, Fazl Q.; Sherwani, Afak Yusuf; Dangroo, Sajad Ahmad; Bisati, Rafia Aziz; Malik, Nighat Shaffi

    2012-01-01

    Bronchogenic cysts frequently occur in the mediastinum. They may be rarely encountered in the abdomen and retroperitoneum. Bronchogenic cysts can in fact mimic hydatid cysts. We report a case of retroperitoneal bronchogenic cyst below the right hemidiaphragm mimicking a hydatid cyst of the liver in a 30-year-old female. PMID:22606600

  8. Organic diseases mimicking acral lick dermatitis in six dogs.

    PubMed

    Denerolle, Philippe; White, Stephen D; Taylor, Tara S; Vandenabeele, Sophie I J

    2007-01-01

    Acral lick dermatitis ("lick granuloma") in dogs is often thought to have a behavioral etiology. However, other diseases may cause lesions on the distal legs, mimicking acral lick dermatitis. In this report, six dogs were presented with acral lick dermatitis-like lesions from different underlying causes-namely lymphoma, an orthopedic pin, deep pyoderma, mast cell tumor, leishmaniasis, and (presumptive) sporotrichosis.

  9. [Ectopic pancreas mimicking advanced gastric malignancy--case report].

    PubMed

    Zawada, Iwona; Lewosiuk, Agnieszka; Hnatyszyn, Krzysztof; Patalan, Michał; Woyke, Stanisław; Kostyrka, Roman; Marlicz, Krzysztof; Starzyńska, Teresa

    2012-04-01

    Ectopic pancreas is the most common type of ectopic tissue in gastrointestinal tract. It is typically asymptomatic, presenting as a small submucosal lesion in prepyloric region of stomach. The diagnosis is usually incidental, during gastroscopy. The patient with symptomatic heterotropic pancreas, mimicking gastric malignancy was described.

  10. Headache attributed to unruptured saccular aneurysm, mimicking hemicrania continua.

    PubMed

    Vikelis, Michail; Xifaras, Michail; Magoufis, Georgios; Gekas, Georgios; Mitsikostas, Dimos Dimitrios

    2005-06-01

    Unruptured cerebral arterial aneurysms most often remain asymptomatic, but they may cause headache or other symptoms or signs. We describe herewith a case of headache attributed to an unruptured internal carotid artery aneurysm, clearly mimicking the phenotype of hemicrania continua. Potential pathophysiological explanations and recommendations for recognition of similar cases are discussed.

  11. Cutaneous lymphoid hyperplasia mimicking cutaneous lymphoma in a hyperthyroid cat.

    PubMed

    Snead, Elisabeth; Kerr, Moira; Macdonald, Valerie

    2013-10-01

    A 12-year-old neutered male domestic shorthair cat presented for chronic, localized, swelling and crusting of the left upper lip, weight loss, sporadic vomiting, and focal alopecia between the scapulae was diagnosed with hyperthyroidism and regional eosinophilic lymphadenitis. Treatment with methimazole exacerbated an underlying hypersensitivity disorder leading to marked generalized lymphadenopathy that histologically mimicked lymphoma.

  12. Trichophyton Schoenleinii-induced widespread tinea corporis mimicking parapsoriasis.

    PubMed

    Mansouri, P; Farshi, S; Khosravi, A R; Naraghi, Z S; Chalangari, R

    2012-06-01

    We report a case of extensive tinea corporis in an 80-year-old woman on her forearms, thighs, legs, buttocks and trunk, mimicking parapsoriasis due to Trichophyton schoenleinii, without scalp involvement. Diagnosis of Trichophyton schoenleinii was confirmed by microscopy and mycological culture specimens.

  13. Histoplasmosis mimicking primary lung cancer or pulmonary metastases *,**

    PubMed Central

    Bello, Aline Gehlen Dall; Severo, Cecilia Bittencourt; Guazzelli, Luciana Silva; Oliveira, Flavio Mattos; Hochhegger, Bruno; Severo, Luiz Carlos

    2013-01-01

    OBJECTIVE: To describe the main clinical and radiological characteristics of patients with histoplasmosis mimicking lung cancer. METHODS: This was a retrospective descriptive study based on the analysis of the medical records of the 294 patients diagnosed with histoplasmosis between 1977 and 2011 at the Mycology Laboratory of the Santa Casa Sisters of Mercy Hospital of Porto Alegre in the city of Porto Alegre, Brazil. The diagnosis of histoplasmosis was established by culture, histopathological examination, or immunodiffusion testing (identification of M or H precipitation bands). After identifying the patients with macroscopic lesions, as well as radiological and CT findings consistent with malignancy, we divided the patients into two groups: those with a history of cancer and presenting with lesions mimicking metastases (HC group); and those with no such history but also presenting with lesions mimicking metastases (NHC group). RESULTS: Of the 294 patients diagnosed with histoplasmosis, 15 had presented with lesions mimicking primary neoplasia or metastases (9 and 6 in the HC and NHC groups, respectively). The age of the patients ranged from 13 to 67 years (median, 44 years). Of the 15 patients, 14 (93%) presented with pulmonary lesions at the time of hospitalization. CONCLUSIONS: The clinical and radiological syndrome of neoplastic disease is not confined to malignancy, and granulomatous infectious diseases must therefore be considered in the differential diagnosis. PMID:23503487

  14. Rectal diverticulitis mimicking rectal carcinoma with intestinal obstruction: case report.

    PubMed

    Özçelik, Ümit; Bircan, Hüseyin Yüce; Eren, Eryiğit; Demiralay, Ebru; Işıklar, İclal; Demirağ, Alp; Moray, Gökhan

    2015-01-01

    Although diverticular disease of the colon is common, the occurrence of rectal diverticula is extremely rare with only sporadic reports in the literature since 1911. Symptomatic rectal diverticula are seen even less frequently, and surgical intervention is needed for only complicated cases. Here we report the case of a 63-year-old woman presenting with rectal diverticulitis mimicking rectal carcinoma with intestinal obstruction.

  15. Diffuse Large B Cell Lymphoma Mimicking Granulomatosis with Polyangiitis

    PubMed Central

    Horowitz, Netanel; Ben-Itzhak, Ofer; Braun-Moscovici, Yolanda

    2016-01-01

    In a patient with systemic multiorgan disease with overlapping features, the differential diagnosis included infectious diseases, malignancies, and systemic autoimmune or inflammatory diseases. We present an unusual case of a young male with B cell lymphoma who presented with symptoms mimicking systemic vasculitis and review the existing literature. PMID:27293945

  16. The cutaneous manifestations and common mimickers of physical child abuse.

    PubMed

    Mudd, Shawna S; Findlay, Jeanne S

    2004-01-01

    The cutaneous manifestations of physical child abuse are some of the most common and easily recognized forms of injury. To make an accurate assessment and diagnosis, it is important to differentiate between inflicted cutaneous injuries and mimickers of physical abuse. Likewise, an understanding of reporting guidelines helps guide practitioners in their decision making.

  17. Giant cell myocarditis mimicking idiopathic fascicular ventricular tachycardia.

    PubMed

    Weidenbach, Michael; Springer, Tina; Daehnert, Ingo; Klingel, Karin; Doll, Susanne; Janousek, Jan

    2008-02-01

    We report an adolescent with giant cell myocarditis (GCM) mimicking tachycardia-induced cardiomyopathy. His electrocardiogram (ECG) was typical for an incessant form of fascicular ventricular tachycardia. The patient rapidly deteriorated and required support using extracorporeal membrane oxygenation (ECMO). Biopsy revealed GCM with massive myocyte necrosis. He was successfully heart transplanted 6 days after admission.

  18. Mechanisms for attenuation in cancellous-bone-mimicking phantoms.

    PubMed

    Wear, Keith A

    2008-11-01

    Broadband ultrasound attenuation (BUA) in cancellous bone is useful for prediction of osteoporotic fracture risk, but its causes are not well understood. To investigate attenuation mechanisms, 9 cancellous-bone-mimicking phantoms containing nylon filaments (simulating bone trabeculae) embedded within soft-tissue-mimicking fluid (simulating marrow) were interrogated. The measurements of frequency-dependent attenuation coefficient had 3 separable components: 1) a linear (with frequency) component attributable to absorption in the soft-tissue-mimicking fluid, 2) a quasilinear (with frequency) component, which may include absorption in and longitudinal-shear mode conversion by the nylon filaments, and 3) a nonlinear (with frequency) component, which may be attributable to longitudinal-longitudinal scattering by the nylon filaments. The slope of total linear (with frequency) attenuation coefficient (sum of components #1 and #2) versus frequency was found to increase linearly with volume fraction, consistent with reported measurements on cancellous bone. Backscatter coefficient measurements in the 9 phantoms supported the claim that the nonlinear (with frequency) component of attenuation coefficient (component #3) was closely associated with longitudinal-longitudinal scattering. This work represents the first experimental separation of these 3 components of attenuation in cancellous bone-mimicking phantoms.

  19. Mimicking shear zones: An example from Wadi Filk, Jordan

    NASA Astrophysics Data System (ADS)

    Meyer, Sven Erik; Passchier, Cees; Jarrar, Ghaleb H.; Ghanem, Hind; Yaseen, Najel

    2017-05-01

    Ductile shear zones can develop in at least two ways: (1) a nucleus can grow laterally by free propagation into undeformed host rock, like most faults or joints; (2) the zone may nucleate and grow on or in a planar discontinuity and mimick its orientation. Most small-scale ductile shear zones are mimicking zones, but large-scale ductile shear zones could be free-propagating. The Wadi Filk mylonite zone in Jordan is a two km long, ten meter wide mylonite zone flanked by ultramylonite zones, developed in undeformed Neoproterozoic porphyritic monzogranite. Since mineral and major element composition of mylonite and monzogranite are identical, the structure seems to have formed by free propagation. Only detailed observations of the microstructure and trace element chemistry of the mylonite indicate that it is mimicking a precursor rhyolitic dyke. The Wadi Filk mylonite zone shows that even km-scale ductile shear zones can be mimicking dykes. Fine-grained chilled margins of dykes can act as a nucleus of ultramylonite formation.

  20. Osteoid osteoma of the radial styloid mimicking de quervain tenosynovitis.

    PubMed

    Chloros, George D; Themistocleous, George S; Papagelopoulos, Panayiotis J; Khaldi, Lubna; Efstathopoulos, Dimitrios G; Soucacos, Panayotis N

    2007-10-01

    A very unusual location of osteoid osteoma arising in the radial styloid is presented, which strongly mimicked de Quervain tenosynovitis, thereby resulting in the patient undergoing an additional unnecessary operation and a substantial delay of more than 2 years in diagnosis.

  1. Pre-university Chemistry Students in a Mimicked Scholarly Peer Review

    NASA Astrophysics Data System (ADS)

    van Rens, Lisette; Hermarij, Philip; Pilot, Albert; Beishuizen, Jos; Hofman, Herman; Wal, Marjolein

    2014-10-01

    Peer review is a significant component in scientific research. Introducing peer review into inquiry processes may be regarded as an aim to develop student understanding regarding quality in inquiries. This study examines student understanding in inquiry peer reviews among pre-university chemistry students, aged 16-17, when they enact a design of a mimicked scholarly peer review. This design is based on a model of a human activity system. Twenty-five different schools in Brazil, Germany, Poland and The Netherlands participated. The students (n = 880) conducted in small groups (n = 428) open inquiries on fermentation. All groups prepared an inquiry report for peer review. These reports were published on a website. Groups were randomly paired in an internet symposium, where they posted review comments to their peers. These responses were qualitatively analyzed on small groups' level of understanding regarding seven categories: inquiry question, hypothesis, management of control variables, accurate measurement, presenting results, reliability of results, discussion and conclusion. The mimicked scholarly review prompted a collective practice. Student understanding was significantly well on presenting results, discussion and conclusion, and significantly less on inquiry question and reliability of results. An enacted design, based on a model of a human activity system, created student understanding of quality in inquiries as well as an insight in a peer-reviewing practice. To what extent this model can be applied in a broader context of design research in science education needs further study.

  2. Deriving a blood-mimicking fluid for particle image velocimetry in Sylgard-184 vascular models.

    PubMed

    Yousif, Majid Y; Holdsworth, David W; Poepping, Tamie L

    2009-01-01

    A new blood-mimicking fluid (BMF) has been developed for particle image velocimetry (PIV), which enables flow studies in vascular models (phantoms). A major difficulty in PIV that affects measurement accuracy is the refraction and distortion of light passing through the interface between the model and the fluid, due to the difference in refractive index (n) between the two materials. The problem can be eliminated by using a fluid with a refractive index matching that of the model. Such fluids are not commonly available, especially for vascular research where the fluid should also have a viscosity similar to human blood. In this work, a blood-mimicking fluid, composed of water (47.38% by weight), glycerol (36.94% by weight) and sodium iodide salt (15.68% by weight), was developed for compatibility with our silicone (Sylgard 184; n = 1.414) phantoms. The fluid exhibits a dynamic viscosity of 4.31+/-0.03 cP which lies within the range of human blood viscosity (4.4+/-0.6 cP). Both refractive index and viscosity were attained at 22.2+/-0.2 degrees C, which is a feasible room temperature, thus eliminating the need for a temperature-control system. The fluid will be used to study hemodynamics in vascular flow models fabricated from Sylgard 184.

  3. Précis of implicit nationalism.

    PubMed

    Hassin, Ran R; Ferguson, Melissa J; Kardosh, Rasha; Porter, Shanette C; Carter, Travis J; Dudareva, Veronika

    2009-06-01

    While the study of nationalism has received much attention throughout the social sciences and humanities, the experimental investigation of it lags behind. In this paper we review recent advances in the examination of implicit nationalism. In the first set of experiments we survey, the Palestinian, Israeli, Italian, and Russian flags were primed (or not, in the control conditions) and their effects on political thought and behavior were tested. In the second set the American or the Israeli flag was primed (or not) and prejudice toward African-Americans or Palestinians (respectively) was examined. The results of all experiments suggest that the implicit activation of national cues has far-reaching implications on political thought and behavior as well as on attitudes toward minorities. Under the assumption that the image of national flags is associated in memory with national ideologies, these results suggest that national ideologies can be implicitly pursued in a way that significantly affects our thoughts and behaviors.

  4. Profiling of cis-diol-containing nucleosides and ribosylated metabolites by boronate-affinity organic-silica hybrid monolithic capillary liquid chromatography/mass spectrometry.

    PubMed

    Jiang, Han-Peng; Qi, Chu-Bo; Chu, Jie-Mei; Yuan, Bi-Feng; Feng, Yu-Qi

    2015-01-14

    RNA contains a large number of modified nucleosides. In the metabolic re-exchange of RNA, modified nucleosides cannot be recycled and are thus excreted from cells into biological fluids. Determination of endogenous modified nucleosides in biological fluids may serve as non-invasive cancers diagnostic methods. Here we prepared boronate-affinity organic-silica hybrid capillary monolithic column (BOHCMC) that exhibited excellent selectivity toward the cis-diol-containing compounds. We then used the prepared BOHCMC as the on-line solid-phase microextraction (SPME) column and developed an on-line SPME-LC-MS/MS method to comprehensively profile cis-diol-containing nucleosides and ribosylated metabolites in human urine. Forty-five cis-diol-containing nucleosides and ribosylated metabolites were successfully identified in human urine. And five ribose conjugates, for the first time, were identified existence in human urine in the current study. Furthermore, the relative quantification suggested 4 cis-diol-containing compounds (5'-deoxy-5'-methylthioadensine, N(4)-acetylcytidine, 1-ribosyl-N-propionylhistamine and N(2),N(2),7-trimethylguanosine) increased more than 1.5 folds in all the 3 types of examined cancers (lung cancer, colorectal cancer, and nasopharyngeal cancer) compared to healthy controls. The on-line SPME-LC-MS/MS method demonstrates a promising method for the comprehensive profiling of cis-diol-containing ribose conjugates in human urines, which provides an efficient strategy for the identification and discovery of biomarkers and may be used for the screening of cancers.

  5. The (+)-cis- and (+)-trans-Olibanic Acids: Key Odorants of Frankincense.

    PubMed

    Cerutti-Delasalle, Céline; Mehiri, Mohamed; Cagliero, Cecilia; Rubiolo, Patrizia; Bicchi, Carlo; Meierhenrich, Uwe J; Baldovini, Nicolas

    2016-10-24

    Frankincense (olibanum) is one of the oldest aromatic materials used by humans, but the key molecular constituents contributing to its characteristic odor remained unknown. Reported herein is the discovery that (1S,2S)-(+)-trans- and (1S,2R)-(+)-cis-2-octylcyclopropyl-1-carboxylic acids are highly potent and substantive odorants occurring in ppm amounts in all of the frankincense samples analyzed, even those showing radically different volatile compositions. These cyclopropyl-derived acids provide the very characteristic old churchlike endnote of the frankincense odor. © 2016 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  6. Mediation Analysis Demonstrates That Trans-eQTLs Are Often Explained by Cis-Mediation: A Genome-Wide Analysis among 1,800 South Asians

    PubMed Central

    Pierce, Brandon L.; Tong, Lin; Chen, Lin S.; Rahaman, Ronald; Argos, Maria; Jasmine, Farzana; Roy, Shantanu; Paul-Brutus, Rachelle; Westra, Harm-Jan; Franke, Lude; Esko, Tonu; Zaman, Rakibuz; Islam, Tariqul; Rahman, Mahfuzar; Baron, John A.; Kibriya, Muhammad G.; Ahsan, Habibul

    2014-01-01

    A large fraction of human genes are regulated by genetic variation near the transcribed sequence (cis-eQTL, expression quantitative trait locus), and many cis-eQTLs have implications for human disease. Less is known regarding the effects of genetic variation on expression of distant genes (trans-eQTLs) and their biological mechanisms. In this work, we use genome-wide data on SNPs and array-based expression measures from mononuclear cells obtained from a population-based cohort of 1,799 Bangladeshi individuals to characterize cis- and trans-eQTLs and determine if observed trans-eQTL associations are mediated by expression of transcripts in cis with the SNPs showing trans-association, using Sobel tests of mediation. We observed 434 independent trans-eQTL associations at a false-discovery rate of 0.05, and 189 of these trans-eQTLs were also cis-eQTLs (enrichment P<0.0001). Among these 189 trans-eQTL associations, 39 were significantly attenuated after adjusting for a cis-mediator based on Sobel P<10-5. We attempted to replicate 21 of these mediation signals in two European cohorts, and while only 7 trans-eQTL associations were present in one or both cohorts, 6 showed evidence of cis-mediation. Analyses of simulated data show that complete mediation will be observed as partial mediation in the presence of mediator measurement error or imperfect LD between measured and causal variants. Our data demonstrates that trans-associations can become significantly stronger or switch directions after adjusting for a potential mediator. Using simulated data, we demonstrate that this phenomenon is expected in the presence of strong cis-trans confounding and when the measured cis-transcript is correlated with the true (unmeasured) mediator. In conclusion, by applying mediation analysis to eQTL data, we show that a substantial fraction of observed trans-eQTL associations can be explained by cis-mediation. Future studies should focus on understanding the mechanisms underlying

  7. Mediation analysis demonstrates that trans-eQTLs are often explained by cis-mediation: a genome-wide analysis among 1,800 South Asians.

    PubMed

    Pierce, Brandon L; Tong, Lin; Chen, Lin S; Rahaman, Ronald; Argos, Maria; Jasmine, Farzana; Roy, Shantanu; Paul-Brutus, Rachelle; Westra, Harm-Jan; Franke, Lude; Esko, Tonu; Zaman, Rakibuz; Islam, Tariqul; Rahman, Mahfuzar; Baron, John A; Kibriya, Muhammad G; Ahsan, Habibul

    2014-12-01

    A large fraction of human genes are regulated by genetic variation near the transcribed sequence (cis-eQTL, expression quantitative trait locus), and many cis-eQTLs have implications for human disease. Less is known regarding the effects of genetic variation on expression of distant genes (trans-eQTLs) and their biological mechanisms. In this work, we use genome-wide data on SNPs and array-based expression measures from mononuclear cells obtained from a population-based cohort of 1,799 Bangladeshi individuals to characterize cis- and trans-eQTLs and determine if observed trans-eQTL associations are mediated by expression of transcripts in cis with the SNPs showing trans-association, using Sobel tests of mediation. We observed 434 independent trans-eQTL associations at a false-discovery rate of 0.05, and 189 of these trans-eQTLs were also cis-eQTLs (enrichment P<0.0001). Among these 189 trans-eQTL associations, 39 were significantly attenuated after adjusting for a cis-mediator based on Sobel P<10-5. We attempted to replicate 21 of these mediation signals in two European cohorts, and while only 7 trans-eQTL associations were present in one or both cohorts, 6 showed evidence of cis-mediation. Analyses of simulated data show that complete mediation will be observed as partial mediation in the presence of mediator measurement error or imperfect LD between measured and causal variants. Our data demonstrates that trans-associations can become significantly stronger or switch directions after adjusting for a potential mediator. Using simulated data, we demonstrate that this phenomenon is expected in the presence of strong cis-trans confounding and when the measured cis-transcript is correlated with the true (unmeasured) mediator. In conclusion, by applying mediation analysis to eQTL data, we show that a substantial fraction of observed trans-eQTL associations can be explained by cis-mediation. Future studies should focus on understanding the mechanisms underlying

  8. trans,cis,cis-bis(benzoato)dichlorido(cyclohexane-1R,2R-diamine)platinum(IV): a prodrug candidate for the treatment of oxaliplatin-refractory colorectal cancer.

    PubMed

    Gandin, Valentina; Marzano, Cristina; Pelosi, Giorgio; Ravera, Mauro; Gabano, Elisabetta; Osella, Domenico

    2014-06-01

    The gold standard for the treatment of metastatic colorectal cancer consists of combination chemotherapy. Over time, however, the development of chemoresistant tumor clones leads to relapse. It may be possible to overcome oxaliplatin chemoresistance in colorectal cancer cells by exploiting a complex obtained from the insertion of the cyclohexane-1R,2R-diamine carrier ligand (the same diamine present in oxaliplatin) into an octahedral Pt(IV) scaffold with high lipophilicity conferred by two benzoate axial ligands. Herein we report the synthesis, characterization (including X-ray structure), biological activity, and cellular accumulation of trans,cis,cis-bis(benzoato)dichlorido(cyclohexane-1R,2R-diamine)platinum(IV) complex in a panel of several human cancer cell lines, including a colon carcinoma cell line resistant to oxaliplatin. The compound under investigation shows the best performance in terms of in vitro anti-proliferative activity and ability to overcome chemoresistance, with respect to oxaliplatin and some other Pt(II) reference complexes. This result is likely related to the high lipophilicity shown by the title compound that favors its cellular accumulation by passive diffusion.

  9. In vitro antiprotozoal activity of (S)-cis-Verbenol against Leishmania spp. and Trypanosoma cruzi.

    PubMed

    Yaluff, Gloria; Vega, Celeste; Alvarenga, Nelson

    2017-04-01

    (S)-cis-Verbenol, a monoterpene frequently found as a component of essential oils, was assayed against Leishmania amazonensis, Leishmania infantum, Leishmania brasiliensis and against two strains of Trypanosoma cruzi. The cytotoxicity of the compound was also assayed against human fibroblast cells using a colorimetric method. Benznidazole was used as reference drug against T. cruzi and amphotericin B was used against Leishmania spp. The compound showed good activity against the trypanosomes, being more active against the CL Brenner strain, with an IC50 value of 8.3μg/mL. Against Leishmania, the IC50 values were between 2.1 and 3.8μg/mL. The compound showed no cytotoxicity against human fibroblasts at the concentrations assayed and was 100-500 times more toxic for the parasites than for the human cells, as indicated by the selectivity indexes. The results open interesting perspectives about the potential of (S)-cis-Verbenol and other individual components of essential oils for the treatment of these diseases. Copyright © 2016 Elsevier B.V. All rights reserved.

  10. Redundancy and the evolution of cis-regulatory element multiplicity.

    PubMed

    Paixão, Tiago; Azevedo, Ricardo B R

    2010-07-08

    The promoter regions of many genes contain multiple binding sites for the same transcription factor (TF). One possibility is that this multiplicity evolved through transitional forms showing redundant cis-regulation. To evaluate this hypothesis, we must disentangle the relative contributions of different evolutionary mechanisms to the evolution of binding site multiplicity. Here, we attempt to do this using a model of binding site evolution. Our model considers binding sequences and their interactions with TFs explicitly, and allows us to cast the evolution of gene networks into a neutral network framework. We then test some of the model's predictions using data from yeast. Analysis of the model suggested three candidate nonadaptive processes favoring the evolution of cis-regulatory element redundancy and multiplicity: neutral evolution in long promoters, recombination and TF promiscuity. We find that recombination rate is positively associated with binding site multiplicity in yeast. Our model also indicated that weak direct selection for multiplicity (partial redundancy) can play a major role in organisms with large populations. Our data suggest that selection for changes in gene expression level may have contributed to the evolution of multiple binding sites in yeast. We conclude that the evolution of cis-regulatory element redundancy and multiplicity is impacted by many aspects of the biology of an organism: both adaptive and nonadaptive processes, both changes in cis to binding sites and in trans to the TFs that interact with them, both the functional setting of the promoter and the population genetic context of the individuals carrying them.

  11. A cis-Regulatory Signature for Chordate Anterior Neuroectodermal Genes

    PubMed Central

    Christiaen, Lionel; Joly, Jean-Stéphane

    2010-01-01

    One of the striking findings of comparative developmental genetics was that expression patterns of core transcription factors are extraordinarily conserved in bilaterians. However, it remains unclear whether cis-regulatory elements of their target genes also exhibit common signatures associated with conserved embryonic fields. To address this question, we focused on genes that are active in the anterior neuroectoderm and non-neural ectoderm of the ascidian Ciona intestinalis. Following the dissection of a prototypic anterior placodal enhancer, we searched all genomic conserved non-coding elements for duplicated motifs around genes showing anterior neuroectodermal expression. Strikingly, we identified an over-represented pentamer motif corresponding to the binding site of the homeodomain protein OTX, which plays a pivotal role in the anterior development of all bilaterian species. Using an in vivo reporter gene assay, we observed that 10 of 23 candidate cis-regulatory elements containing duplicated OTX motifs are active in the anterior neuroectoderm, thus showing that this cis-regulatory signature is predictive of neuroectodermal enhancers. These results show that a common cis-regulatory signature corresponding to K50-Paired homeodomain transcription factors is found in non-coding sequences flanking anterior neuroectodermal genes in chordate embryos. Thus, field-specific selector genes impose architectural constraints in the form of combinations of short tags on their target enhancers. This could account for the strong evolutionary conservation of the regulatory elements controlling field-specific selector genes responsible for body plan formation. PMID:20419150

  12. Team-based thin-film CIS research activities

    NASA Astrophysics Data System (ADS)

    Ullal, Harin S.

    1997-02-01

    This paper describes the team-based thin-film copper indium diselenide (CIS) research activities. The CIS team was formed in December 1994 in Kona, Hawaii. Originally, the team had two working groups: the "Junction" and the "Absorber" groups. Currently, there are four working groups the Present Junction, New Junction, Substrate/Mo Impact, and the Transient Effect groups. We have completed extensive data compilation of CIS-based films and solar cells using various techniques such as Auger, photoluminescence, scanning electron microscopy, secondary-ion mass spectrometry, X-ray photoelectron spectroscopy, X-ray diffraction, capacitance-voltage, light and dark current-voltage, and quantum efficiency. Studies are under way to understand the fundamental mechanisms that demonstrate a total-area, high efficiency of 17.7% in CuInGaSe2 devices using chemical-bath deposition (CBD) CdS. Alternate buffer layers are also being investigated to replace the CBD CdS. The impact of various Mo substrates from the various industrial partners has been investigated, and the results are reported. A study is under way to investigate the transient effects in encapsulated/laminated thin-film CIS-based devices.

  13. cis- and trans-Stilbenes: Chromatographic Separation and Photochemical Isomerization.

    ERIC Educational Resources Information Center

    Levine, Samuel G.; And Others

    1988-01-01

    Describes an experiment that is to be performed midway in the first semester of an undergraduate organic chemistry laboratory coinciding with the students' introduction to cis-trans isomerism in the study of alkenes. Discusses the apparatus, materials, experimental procedure, historical significance, and results. (CW)

  14. Creating a Collaborative Learning Community in the CIS Sandbox

    ERIC Educational Resources Information Center

    Frydenberg, Mark

    2013-01-01

    Purpose: The purpose of this paper is to investigate the impact of transforming a traditional university computer lab to create a collaborative learning community known as the CIS Sandbox, by remodeling a physical space and supporting it with a virtual presence through the use of social media tools. The discussion applies Selander's "designs for…

  15. cis- and trans-Stilbenes: Chromatographic Separation and Photochemical Isomerization.

    ERIC Educational Resources Information Center

    Levine, Samuel G.; And Others

    1988-01-01

    Describes an experiment that is to be performed midway in the first semester of an undergraduate organic chemistry laboratory coinciding with the students' introduction to cis-trans isomerism in the study of alkenes. Discusses the apparatus, materials, experimental procedure, historical significance, and results. (CW)

  16. Efficient direct ZnO/CIS solar cells

    SciTech Connect

    Olsen, L.C.; William Addis, F.; Lei, W.; Li, J.

    1996-01-01

    This paper describes investigations of CIS solar cells with ZnO window layers deposited by MOCVD. These studies have been conducted with graded absorber CIS substrates obtained from Siemens Solar. Cell fabrication involves surface preparation of the Siemens substrate, growth of 200 to 400 A of undoped ZnO by MOCVD, deposition of a highly conducting ZnO top contact layer and deposition of a Ni/Ag collector grid. MOCVD growth of ZnO is accomplished in a SPIRE 500XT reactor by reacting a zinc adduct and tetrahydrofuran. Processing development has been conducted by forming test cells on ZnO/CIS structures by depositing thin, transparent Al contacts 2.8 mm in diameter on top of the ZnO window layer to serve as contacts. Several cells have been completed with a total area efficiency {ge}11.0{percent}, with the best result being 11.3{percent}. The best active area efficiency is approximately 12{percent}. Other topics discussed include current-voltage characteristics of direct ZnO/CIS cells. {copyright} {ital 1996 American Institute of Physics.}

  17. Creating a Collaborative Learning Community in the CIS Sandbox

    ERIC Educational Resources Information Center

    Frydenberg, Mark

    2013-01-01

    Purpose: The purpose of this paper is to investigate the impact of transforming a traditional university computer lab to create a collaborative learning community known as the CIS Sandbox, by remodeling a physical space and supporting it with a virtual presence through the use of social media tools. The discussion applies Selander's "designs for…

  18. cis-parthenolid-9-one from Anvillea garcinii.

    PubMed

    Abdel-Sattar, E; McPhail, A T

    2000-11-01

    The cis-isomer (2) of the previously isolated parthenolid-9-one (1) was isolated from Anvillea garcinii and the structures and relative stereochemistries of both were determined from NMR data in combination with single-crystal X-ray analysis. In vitro cytotoxicity and in vivo antitumor activity for both compounds are reported.

  19. Peer Tutoring in the CIS Sandbox: Does It Work?

    ERIC Educational Resources Information Center

    Frydenberg, Mark

    2013-01-01

    This paper reports on a student-created and facilitated peer-tutoring activity to assist first-year students in preparing for their final exam in an introductory information technology course. Tutors at the CIS Sandbox, a collaborative learning lab at an American university, offered a series of "Crunch Sessions" to their peers. This…

  20. Trans-cis molecular photoswitching in interstellar space

    NASA Astrophysics Data System (ADS)

    Cuadrado, S.; Goicoechea, J. R.; Roncero, O.; Aguado, A.; Tercero, B.; Cernicharo, J.

    2016-11-01

    As many organic molecules, formic acid (HCOOH) has two conformers (trans and cis). The energy barrier to internal conversion from trans to cis is much higher than the thermal energy available in molecular clouds. Thus, only the most stable conformer (trans) is expected to exist in detectable amounts. We report the first interstellar detection of cis-HCOOH. Its presence in ultraviolet (UV) irradiated gas exclusively (the Orion Bar photodissociation region), with a low trans-to-cis abundance ratio of 2.8 ± 1.0, supports a photoswitching mechanism: a given conformer absorbs a stellar photon that radiatively excites the molecule to electronic states above the interconversion barrier. Subsequent fluorescent decay leaves the molecule in a different conformer form. This mechanism, which we specifically study with ab initio quantum calculations, was not considered in Space before but likely induces structural changes of a variety of interstellar molecules submitted to UV radiation. This paper makes use of observations obtained with the IRAM-30 m telescope. IRAM is supported by INSU/CNRS (France), MPG (Germany), and IGN (Spain).

  1. Structural Brain Network Characteristics Can Differentiate CIS from Early RRMS

    PubMed Central

    Muthuraman, Muthuraman; Fleischer, Vinzenz; Kolber, Pierre; Luessi, Felix; Zipp, Frauke; Groppa, Sergiu

    2016-01-01

    Focal demyelinated lesions, diffuse white matter (WM) damage, and gray matter (GM) atrophy influence directly the disease progression in patients with multiple sclerosis. The aim of this study was to identify specific characteristics of GM and WM structural networks in subjects with clinically isolated syndrome (CIS) in comparison to patients with early relapsing-remitting multiple sclerosis (RRMS). Twenty patients with CIS, 33 with RRMS, and 40 healthy subjects were investigated using 3 T-MRI. Diffusion tensor imaging was applied, together with probabilistic tractography and fractional anisotropy (FA) maps for WM and cortical thickness correlation analysis for GM, to determine the structural connectivity patterns. A network topology analysis with the aid of graph theoretical approaches was used to characterize the network at different community levels (modularity, clustering coefficient, global, and local efficiencies). Finally, we applied support vector machines (SVM) to automatically discriminate the two groups. In comparison to CIS subjects, patients with RRMS were found to have increased modular connectivity and higher local clustering, highlighting increased local processing in both GM and WM. Both groups presented increased modularity and clustering coefficients in comparison to healthy controls. SVM algorithms achieved 97% accuracy using the clustering coefficient as classifier derived from GM and 65% using WM from probabilistic tractography and 67% from modularity of FA maps to differentiate between CIS and RRMS patients. We demonstrate a clear increase of modular and local connectivity in patients with early RRMS in comparison to CIS and healthy subjects. Based only on a single anatomic scan and without a priori information, we developed an automated and investigator-independent paradigm that can accurately discriminate between patients with these clinically similar disease entities, and could thus complement the current dissemination-in-time criteria for

  2. The 11-cis Retinal Origins of Lipofuscin in the Retina.

    PubMed

    Adler, Leopold; Boyer, Nicholas P; Chen, Chunhe; Ablonczy, Zsolt; Crouch, Rosalie K; Koutalos, Yiannis

    2015-01-01

    Lipofuscin is a fluorescent mixture of partially digested proteins and lipids that accumulates with age in the lysosomal compartment of the retinal pigment epithelium (RPE) of the eye. Because it has been found to have significant cytotoxic potential, lipofuscin is thought to play a role in retinal degeneration diseases including age-related macular degeneration and Stargardt disease, a form of juvenile macular degeneration. The only known components of lipofuscin are bis-retinoids, the condensation products of two molecules of retinal. The bulk of lipofuscin is thought to originate in the rod photoreceptor outer segments as a by-product of reactions involving the retinal chromophore of rhodopsin. 11-cis retinal flows from the RPE into the rod outer segments, where it combines with opsin to form rhodopsin; all-trans retinal is released into the rod outer segments by photoactivated rhodopsin following its excitation by light. Both 11-cis and all-trans retinal can generate lipofuscin-like fluorophores and bis-retinoids when added to rod outer segment membranes. The levels of lipofuscin precursor fluorophores present in the outer segments of dark-adapted rods are similar in cyclic-light- and dark-reared mice, as are the levels of accumulated lipofuscin in the RPE. Because the retinol dehydrogenase enzyme present in rod outer segments can reduce all-trans but not 11-cis retinal, lipofuscin precursors are more likely to form from 11-cis than all-trans retinal, even under cyclic light conditions. Thus, 11-cis retinal may be the primary source of lipofuscin in the retina. © 2015 Elsevier Inc. All rights reserved.

  3. Fabrication of double layer optical tissue phantom by spin coating method: mimicking epidermal and dermal layer

    NASA Astrophysics Data System (ADS)

    Park, Jihoon; Bae, Yunjin; Bae, Youngwoo; Kang, Heesung; Lee, Kyoung-Joung; Jung, Byungjo

    2013-02-01

    Methodologies to fabricate a solid optical tissue phantom (OTP) mimicking epidermal thin-layer have been developed for in vitro human skin experiment. However, there are cumbersome and time-consuming efforts in fabrication process such as a custom-made casting and calculation of solvent volume before curing process. In a previous study, we introduced a new methodology based on spin coating method (SCM) which is utilized to fabricate a thin-layer OTP analogous to epidermal thickness. In this study, a double layer solid OTP which has epidermal and dermal layers was fabricated to mimic the morphological and optical similarity of human tissue. The structural characteristic and optical properties of fabricated double layer OTP were measured using optical coherence tomography and inverse adding doubling algorithms, respectively. It is expected that the new methodology based on the SCM may be usefully used in the fabrication of double layer OTP.

  4. Molecular mechanisms governing Pcdh-γ gene expression: Evidence for a multiple promoter and cis-alternative splicing model

    PubMed Central

    Wang, Xiaozhong; Su, Hong; Bradley, Allan

    2002-01-01

    The genomic architecture of protocadherin (Pcdh) gene clusters is remarkably similar to that of the immunoglobulin and T cell receptor gene clusters, and can potentially provide significant molecular diversity. Pcdh genes are abundantly expressed in the central nervous system. These molecules are primary candidates for establishing specific neuronal connectivity. Despite the extensive analyses of the genomic structure of both human and mouse Pcdh gene clusters, the definitive molecular mechanisms that control Pcdh gene expression are still unknown. Four theories have been proposed, including (1) DNA recombination followed by cis-splicing, (2) single promoter and cis-alternative splicing, (3) multiple promoters and cis-alternative splicing, and (4) multiple promoters and trans-splicing. Using a combination of molecular and genetic analyses, we evaluated the four models at the Pcdh-γ locus. Our analysis provides evidence that the transcription of individual Pcdh-γ genes is under the control of a distinct but related promoter upstream of each Pcdh-γ variable exon, and posttranscriptional processing of each Pcdh-γ transcript is predominantly mediated through cis-alternative splicing. PMID:12154121

  5. Amitraz: a mimicker of organophosphate poisoning.

    PubMed

    Dhooria, Sahajal; Behera, Digambar; Agarwal, Ritesh

    2015-10-01

    Amitraz is used as an ectoparasiticide for dogs and cattle. Human poisoning due to amitraz may be misdiagnosed as organophosphate/carbamate (OPC) toxicity, since amitraz poisoning shares several clinical features (miosis, bradycardia and hypotension) encountered with OPC poisoning. A 19-year-old man with an alleged history of suicidal ingestion of a pesticide presented with drowsiness and was found to have constricted pupils, hypotension and bradycardia. He was diagnosed as a case of OPC poisoning and was treated with atropine and pralidoxime prior to presentation to our centre. Absence of a hypersecretory state, and the presence of hyperglycaemia and hypothermia along with a normal serum cholinesterase level suggested an alternate possibility. Retrieval of the poison container confirmed the diagnosis of amitraz poisoning. The patient made a rapid recovery with supportive management. Clinician awareness is key to successful management of this poisoning, which carries a good prognosis.

  6. Cis-trans isomerization in the S1 state of acetylene: identification of cis-well vibrational levels.

    PubMed

    Merer, Anthony J; Steeves, Adam H; Baraban, Joshua H; Bechtel, Hans A; Field, Robert W

    2011-06-28

    A systematic analysis of the S(1)-trans (Ã(1)A(u)) state of acetylene, using IR-UV double resonance along with one-photon fluorescence excitation spectra, has allowed assignment of at least part of every single vibrational state or polyad up to a vibrational energy of 4200 cm(-1). Four observed vibrational levels remain unassigned, for which no place can be found in the level structure of the trans-well. The most prominent of these lies at 46 175 cm(-1). Its (13)C isotope shift, exceptionally long radiative lifetime, unexpected rotational selection rules, and lack of significant Zeeman effect, combined with the fact that no other singlet electronic states are expected at this energy, indicate that it is a vibrational level of the S(1)-cis isomer (Ã(1)A(2)). Guided by ab initio calculations [J. H. Baraban, A. R. Beck, A. H. Steeves, J. F. Stanton, and R. W. Field, J. Chem. Phys. 134, 244311 (2011)] of the cis-well vibrational frequencies, the vibrational assignments of these four levels can be established from their vibrational symmetries together with the (13)C isotope shift of the 46 175 cm(-1) level (assigned here as cis-3(1)6(1)). The S(1)-cis zero-point level is deduced to lie near 44 900 cm(-1), and the ν(6) vibrational frequency of the S(1)-cis well is found to be roughly 565 cm(-1); these values are in remarkably good agreement with the results of recent ab initio calculations. The 46 175 cm(-1) vibrational level is found to have a 3.9 cm(-1) staggering of its K-rotational structure as a result of quantum mechanical tunneling through the isomerization barrier. Such tunneling does not give rise to ammonia-type inversion doubling, because the cis and trans isomers are not equivalent; instead the odd-K rotational levels of a given vibrational level are systematically shifted relative to the even-K rotational levels, leading to a staggering of the K-structure. These various observations represent the first definite assignment of an isomer of

  7. Development of a tissue-mimicking neck model for medical education.

    PubMed

    Xu, Jason J; Fung, Kevin; Glicksman, Jordan T; Brandt, Michael G; Campbell, Gordon

    2012-04-01

    The ability to palpate neck masses and lymph nodes and appreciate qualities such as size, location, and consistency is critical for patient care and an important clinical skill for all physicians. Medical students currently learn neck palpation by practicing on healthy, standardized patients; however, studies of similar procedures have shown that educational models with simulated pathology help improve technique and confidence. Our goal was to create a tissue-mimicking neck model with palpable masses. Iterative design and development of a high-fidelity neck model using polyvinyl alcohol-cryogel (PVA-C), a nontoxic and biocompatible polymer that exhibits favourable tissue-mimicking elastic properties. Model geometries were digitally reconstructed from high-resolution cadaveric magnetic resonance imaging sections to create physical moulds through stereolithography. PVA-C was formulated to mimic the characteristics of human tissue. A life-like neck model was built and consists of these components: muscle, larynx, spine, soft tissue, pathologic nodes, and skin. A final neck model prototype has been completed and will be evaluated by otolaryngology consultants and residents for face and construct validity and assessed in a randomized, controlled trial to evaluate how it impacts students' ability to detect neck masses.

  8. Raloxifene protects against seizures and neurodegeneration in a mouse model mimicking epilepsy in postmenopausal woman.

    PubMed

    Pottoo, F H; Bhowmik, M; Vohora, D

    2014-12-18

    Epilepsy in menopausal women presents several challenges in the treatment including an increased risk of seizures due to hormone replacement therapy. We investigated the hypothesis if raloxifene, a selective oestrogen receptor modulator, could be employed to prevent behavioural seizures and morphological alterations in a mouse model mimicking epilepsy in postmenopausal women. Female mice were made ovotoxic by treatment with 4-vinylcyclohexene diepoxide (VCD) to mimic a postmenopausal state. They were then subjected to kainic acid (KA)-induced seizures and neurotoxicity, as assessed by microscopic examination of hippocampus, relevant to human temporal lobe epilepsy. VCD administration (for 15days followed by a drug-free period of 30days) induced ovotoxicity in mice as evidenced by reduced number of primary ovarian follicles. This was accompanied by a 62.4% reduction in serum oestradiol levels. The bone mineral density of ovotoxic mice, however, remained unaffected. Raloxifene (8mg/kg) reduced the seizure severity score in both normal and ovotoxic mice and protected against degeneration induced by KA in the CA3, CA1 sub-fields and hilus of the DG. Hippocampal TGF-β3 levels were not affected by any of the treatments. We show the potential protective role of raloxifene in preventing seizures and neuronal damage in a mouse model mimicking epilepsy in postmenopausal women which was found unrelated to hippocampal TGF-β3. Raloxifene might represent a novel therapeutic option for postmenopausal temporal lobe epileptic woman.

  9. A cis-regulatory module activating transcription in the suspensor contains five cis-regulatory elements

    SciTech Connect

    Henry, Kelli F.; Kawashima, Tomokazu; Goldberg, Robert B.

    2015-03-22

    Little is known about the molecular mechanisms by which the embryo proper and suspensor of plant embryos activate specific gene sets shortly after fertilization. We analyzed the upstream region of the Scarlet Runner Bean (Phaseolus coccineus) G564 gene in order to understand how genes are activated specifically in the suspensor during early embryo development. Previously, we showed that a 54-bp fragment of the G564 upstream region is sufficient for suspensor transcription and contains at least three required cis-regulatory sequences, including the 10-bp motif (5'-GAAAAGCGAA-3'), the 10 bp-like motif (5'-GAAAAACGAA-3'), and Region 2 motif (partial sequence 5'-TTGGT-3'). Here, we use site-directed mutagenesis experiments in transgenic tobacco globularstage embryos to identify two additional cis-regulatory elements within the 54-bp cis-regulatory module that are required for G564 suspensor transcription: the Fifth motif (5'-GAGTTA-3') and a third 10-bp-related sequence (5'-GAAAACCACA-3'). Further deletion of the 54-bp fragment revealed that a 47-bp fragment containing the five motifs (the 10-bp, 10-bp-like, 10-bp-related, Region 2 and Fifth motifs) is sufficient for suspensor transcription, and represents a cis-regulatory module. A consensus sequence for each type of motif was determined by comparing motif sequences shown to activate suspensor transcription. Phylogenetic analyses suggest that the regulation of G564 is evolutionarily conserved. Lastly, a homologous cis-regulatory module was found upstream of the G564 ortholog in the Common Bean (Phaseolus vulgaris), indicating that the regulation of G564 is evolutionarily conserved in closely related bean species.

  10. Functionally conserved cis-regulatory elements of COL18A1 identified through zebrafish transgenesis.

    PubMed

    Kague, Erika; Bessling, Seneca L; Lee, Josephine; Hu, Gui; Passos-Bueno, Maria Rita; Fisher, Shannon

    2010-01-15

    Type XVIII collagen is a component of basement membranes, and expressed prominently in the eye, blood vessels, liver, and the central nervous system. Homozygous mutations in COL18A1 lead to Knobloch Syndrome, characterized by ocular defects and occipital encephalocele. However, relatively little has been described on the role of type XVIII collagen in development, and nothing is known about the regulation of its tissue-specific expression pattern. We have used zebrafish transgenesis to identify and characterize cis-regulatory sequences controlling expression of the human gene. Candidate enhancers were selected from non-coding sequence associated with COL18A1 based on sequence conservation among mammals. Although these displayed no overt conservation with orthologous zebrafish sequences, four regions nonetheless acted as tissue-specific transcriptional enhancers in the zebrafish embryo, and together recapitulated the major aspects of col18a1 expression. Additional post-hoc computational analysis on positive enhancer sequences revealed alignments between mammalian and teleost sequences, which we hypothesize predict the corresponding zebrafish enhancers; for one of these, we demonstrate functional overlap with the orthologous human enhancer sequence. Our results provide important insight into the biological function and regulation of COL18A1, and point to additional sequences that may contribute to complex diseases involving COL18A1. More generally, we show that combining functional data with targeted analyses for phylogenetic conservation can reveal conserved cis-regulatory elements in the large number of cases where computational alignment alone falls short.

  11. Rational Design of Pathogen-Mimicking Amphiphilic Materials as Nanoadjuvants

    NASA Astrophysics Data System (ADS)

    Ulery, Bret D.; Petersen, Latrisha K.; Phanse, Yashdeep; Kong, Chang Sun; Broderick, Scott R.; Kumar, Devender; Ramer-Tait, Amanda E.; Carrillo-Conde, Brenda; Rajan, Krishna; Wannemuehler, Michael J.; Bellaire, Bryan H.; Metzger, Dennis W.; Narasimhan, Balaji

    2011-12-01

    An opportunity exists today for cross-cutting research utilizing advances in materials science, immunology, microbial pathogenesis, and computational analysis to effectively design the next generation of adjuvants and vaccines. This study integrates these advances into a bottom-up approach for the molecular design of nanoadjuvants capable of mimicking the immune response induced by a natural infection but without the toxic side effects. Biodegradable amphiphilic polyanhydrides possess the unique ability to mimic pathogens and pathogen associated molecular patterns with respect to persisting within and activating immune cells, respectively. The molecular properties responsible for the pathogen-mimicking abilities of these materials have been identified. The value of using polyanhydride nanovaccines was demonstrated by the induction of long-lived protection against a lethal challenge of Yersinia pestis following a single administration ten months earlier. This approach has the tantalizing potential to catalyze the development of next generation vaccines against diseases caused by emerging and re-emerging pathogens.

  12. A patient with plaque type morphea mimicking systemic lupus erythematosus.

    PubMed

    Wardhana; Datau, E A

    2015-04-01

    Morphea is an uncommon connective tissue disease with the most prominent feature being thickening or fibrosis of the dermal without internal organ involvement. It is also known as a part of localized scleroderma. Based on clinical presentation and depth of tissue involvement, morphea is classified into several forms, and about two thirds of adults with morphea have plaque type. Overproduction of collagen production by fibroblast is the cause of abnormality in morphea, and the hyperactivity mechanism of fibroblast is still unknown, although there are several mechanisms already proposed. Plaque type morphea is actually a benign and self limited. Plaque type morphea that mimicking systemic lupus erythematosus in clinical appearance, such as alopecia and oral mucosal ulcers, is uncommon. A case of plaque type morphea mimicking systemic lupus erythematosus in a 20 year old woman was discussed. The patient was treated with local and systemic immunosuppressant and antioxydant. The patient's condition is improved without any significant side effects.

  13. Granuloma inguinale mimicking as squamous cell carcinoma of penis

    PubMed Central

    Pilani, Abhishek; Vora, Rita; Anjaneyan, Gopikrishnan

    2014-01-01

    Granuloma inguinale (GI) is an acquired chronic, slowly progressive, mildly contagious disease of venereal origin, characterized by granulomatous ulceration of the genitalia and neighboring sites, with little or no tendency to spontaneous healing caused by Klebsiella (Calymmatobacterium) granulomatis. A 55-year-old male presented with fissured, foul smelling, fungating growth over prepuce with phimosis mimicking squamous cell carcinoma (SCC) without lymphadenopathy. It started with painless papulonodular showed pseudoepitheliomatous hyperplasia, infiltration in dermis, acanthosis and vacuolated macrophages suggestive of GI and not showing any histopathological features of SCC. Patient was successfully treated by giving cotrimoxazole twice a day for 21 days. Here, we presented a case of GI mimicking SCC of penis, which was diagnosed on basis of histopathology and treated with excision followed by medical therapy with cotrimoxazole. PMID:24958990

  14. The stiffening of arteries by the tissue-mimicking gelatin.

    PubMed

    Zhang, Xiaoming; Greenleaf, James F

    2006-08-01

    Pulse wave velocity (PWV) is widely used for estimating the stiffness of an artery. PWV is measured by the time of travel of the "foot" of the pressure wave over a known distance. This technique has a low time resolution and is an average measurement of artery stiffness between the two measuring sites. The elastic modulus of the artery can be estimated with PWV, but the surrounding tissue effects are not considered. In this paper an external short pulse wave is generated noninvasively in the arterial wall by the radiation force of ultrasound. The pulse wave velocity in the artery is measured by a scanning technique with high-time resolution. The effect of tissue-mimicking gelatin on the artery is analyzed by measuring the wave velocity of the artery without and embedded in gelatin. It is found that the tissue-mimicking gelatin significantly stiffens the rubber tube and the artery if they are embedded in gelatin.

  15. An exposimetry system using tissue-mimicking liquid.

    PubMed

    Stiles, Timothy A; Madsen, Ernest L; Frank, Gary R

    2008-01-01

    Acoustic output measurements of diagnostic ultrasound scanners are currently performed in water and derated to approximate in situ values. The derating scheme ignores nonlinear propagation of sound waves and has been shown in previous numerical and experimental studies to tend to underestimate relevant pressure and intensity values in tissue mimicking media. This work describes an alternative method, which uses a tissue-mimicking liquid with attenuation coefficient slope of 0.3 dB/cm/MHz, speed of sound of 1,540 m/s and nonlinearity parameter B/A of 7.5. The acoustic properties of this liquid are stable for at least 2 y after production. Initial results using a single M-mode configuration are presented. These results confirm that derating can significantly underestimate the pulse intensity integral and peak rarefactional pressure.

  16. Testicular Schistosomiasis Mimicking Malignancy in a Child: A Case Report.

    PubMed

    Ekenze, Sebastian O; Modekwe, Victor O; Nzegwu, Martin A; Ekpemo, Samuel C; Ezomike, Uchechukwu O

    2015-08-01

    Schistosomiasis is an important communicable disease in the developing world. However, testicular schistosomiasis is an extremely rare condition. We report a case of testicular schistosomiasis mimicking testicular tumour in a 13 year old who presented with huge unilateral testicular mass. The dilemma encountered in the diagnosis and treatment of this child is presented to highlight the need for high index of suspicion of this pathology in children with testicular mass presenting from schistosomiasis-endemic areas.

  17. Mimicking biological functionality with polymers for biomedical applications

    NASA Astrophysics Data System (ADS)

    Green, Jordan J.; Elisseeff, Jennifer H.

    2016-12-01

    The vast opportunities for biomaterials design and functionality enabled by mimicking nature continue to stretch the limits of imagination. As both biological understanding and engineering capabilities develop, more sophisticated biomedical materials can be synthesized that have multifaceted chemical, biological and physical characteristics designed to achieve specific therapeutic goals. Mimicry is being used in the design of polymers for biomedical applications that are required locally in tissues, systemically throughout the body, and at the interface with tissues.

  18. Intracranial subdural empyema mimicking a recurrent chronic subdural hematoma

    PubMed Central

    Doan, Ninh; Patel, Mohit; Nguyen, Ha Son; Mountoure, Andrew; Shabani, Saman; Gelsomino, Michael; Janich, Karl; Kurpad, Shekar

    2016-01-01

    Intracranial subdural empyema (ISDE) is a life-threatening condition. The risk for ISDE increases in patients that have undergone prior intracranial procedures. The non-specificity in its clinical presentation often makes ISDE difficult to diagnose. Here, we present a rare case of ISDE mimicking a recurrent chronic subdural hematoma, emphasizing the significance of obtaining early magnetic resonance images of the brain for early diagnosis and treatment to achieve the optimal outcome. PMID:27651110

  19. Cartilage Delamination Flap Mimicking a Torn Medial Meniscus

    PubMed Central

    Bin Abd Razak, Hamid Rahmatullah; Amit Kanta, Mitra

    2016-01-01

    We report a case of a chondral delamination lesion due to medial parapatellar plica friction syndrome involving the medial femoral condyle. This mimicked a torn medial meniscus in clinical and radiological presentation. Arthroscopy revealed a chondral delamination flap, which was debrided. Diagnosis of chondral lesions in the knee can be challenging. Clinical examination and MRI have good accuracy for diagnosis and should be used in tandem. Early diagnosis and treatment of chondral lesions are important to prevent progression to early osteoarthritis. PMID:28070434

  20. Localized IgG4-related Cholecystitis Mimicking Gallbladder Cancer.

    PubMed

    Inoue, Tadahisa; Okumura, Fumihiro; Mizushima, Takashi; Nishie, Hirotada; Iwasaki, Hiroyasu; Anbe, Kaiki; Ozeki, Takanori; Kachi, Kenta; Fukusada, Shigeki; Suzuki, Yuta; Watanabe, Kazuko; Sano, Hitoshi

    2015-01-01

    We encountered a case of localized IgG4-cholecystitis mimicking gallbladder cancer with focal/segmental type1 autoimmune pancreatitis (AIP). In this case, we were unable to exclude a diagnosis of gallbladder cancer and thus performed radical cholecystectomy. Type1 AIP is often associated with gallbladder lesions, accompanied by generally diffuse, circumferential thickening of the gallbladder wall. Although localized IgG4-related cholecystitis is extremely rare, differentiating this condition from gallbladder cancer is often very difficult.

  1. Mimicking Classical Conditioning Based on a Single Flexible Memristor.

    PubMed

    Wu, Chaoxing; Kim, Tae Whan; Guo, Tailiang; Li, Fushan; Lee, Dea Uk; Yang, J Joshua

    2017-03-01

    The mimicking of classical conditioning, including acquisition, extinction, recovery, and generalization, can be efficiently achieved by using a single flexible memristor. In particular, the experiment of Pavlov's dog is successfully demonstrated. This demonstration paves the way for reproducing advanced neural processes and provides a frontier approach to the design of artificial-intelligence systems with dramatically reduced complexity. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  2. A giant ancient schwannoma mimicking an adnexal mass

    PubMed Central

    Karaköse, Oktay; Pülat, Hüseyin; Oğuz, Serhat; Zihni, İsmail; Özçelik, Kazım Çağlar; Yalta, Tülin Deniz; Eken, Hüseyin

    2016-01-01

    Abstract Introduction: Ancient schwannoma is a rare tumor of the peripheral nerve sheath. As degenerative properties are defined histologically, it can be wrongly interpreted as malignant. Case presentation: The case presented here is of a giant ancient schwannoma with a pelvic retroperitoneal location, which was mimicking an adnexal mass. Conclusion: In the rarely seen cases in the retroperitoneum, it may reach very large dimensions. PMID:27472696

  3. Osteofibrous dysplasia of clavicle clinically mimicking chronic osteomyelitis

    PubMed Central

    Gopinathan, Nirmal Raj; Prakash, Mahesh; Saibaba, Balaji; Das, Ashim

    2016-01-01

    Osteofibrous dysplasia or ossifying fibroma is an uncommon benign fibro-osseous lesion of childhood, commonly described in the maxilla and the mandible. Among long bones, it usually presents in the tibia as a painless swelling or anterior bowing. Ossifying fibroma of clavicle has never been reported in English literature, to the best of our knowledge. Here, we would like to present an unusual case of osteofibrous dysplasia of clavicle clinically mimicking chronic osteomyelitis. PMID:27413281

  4. Regional bone change in intramuscular haemangioma mimicking primary bone tumour.

    PubMed

    Shikhare, Sumer; Chacko, Julio K; Chuah, Khoon L

    2015-04-01

    Intramuscular haemangiomas are benign soft-tissue tumours, commonly located in the extremities. We present a right-leg intramuscular haemangioma with florid periosteal reaction in adjacent tibia, mimicking a primary bone tumour. Plain radiograph and magnetic resonance imaging features are illustrated with the surgical and histopathological findings. Radiologists need to be familiar with reactive bone changes secondary to deep-seated intramuscular haemangiomas to avoid potential misdiagnosis.

  5. Addison's Disease Mimicking as Acute Pancreatitis: A Case Report.

    PubMed

    Chaudhuri, Sayani; Rao, Karthik N; Patil, Navin; Ommurugan, Balaji; Varghese, George

    2017-04-01

    Over past two decades there has been significant improvement in medical field in elucidating the underlying pathophysiology and genetics of Addison's disease. Adrenal insufficiency (Addison's disease) is a rare disease with an incidence of 0.8/100,000 cases. The diagnosis may be delayed if the clinical presentation mimics a gastrointestinal disorder or psychiatric illness. We report a case of Addison's disease presenting as acute pain in abdomen mimicking clinical presentation of acute pancreatitis.

  6. Heparin-Mimicking Polymers: Synthesis and Biological Applications.

    PubMed

    Paluck, Samantha J; Nguyen, Thi H; Maynard, Heather D

    2016-11-14

    Heparin is a naturally occurring, highly sulfated polysaccharide that plays a critical role in a range of different biological processes. Therapeutically, it is mostly commonly used as an injectable solution as an anticoagulant for a variety of indications, although it has also been employed in other forms such as coatings on various biomedical devices. Due to the diverse functions of this polysaccharide in the body, including anticoagulation, tissue regeneration, anti-inflammation, and protein stabilization, and drawbacks of its use, analogous heparin-mimicking materials are also widely studied for therapeutic applications. This review focuses on one type of these materials, namely, synthetic heparin-mimicking polymers. Utilization of these polymers provides significant benefits compared to heparin, including enhancing therapeutic efficacy and reducing side effects as a result of fine-tuning heparin-binding motifs and other molecular characteristics. The major types of the various polymers are summarized, as well as their applications. Because development of a broader range of heparin-mimicking materials would further expand the impact of these polymers in the treatment of various diseases, future directions are also discussed.

  7. Dengue fever mimicking acute appendicitis: A case report.

    PubMed

    McFarlane, M E C; Plummer, J M; Leake, P A; Powell, L; Chand, V; Chung, S; Tulloch, K

    2013-01-01

    Dengue fever is an acute viral disease, which usually presents as a mild febrile illness. Patients with severe disease present with dengue haemorrhagic fever or dengue toxic shock syndrome. Rarely, it presents with abdominal symptoms mimicking acute appendicitis. We present a case of a male patient presenting with right iliac fossa pain and suspected acute appendicitis that was later diagnosed with dengue fever following a negative appendicectomy. A 13-year old male patient presented with fever, localized right-sided abdominal pain and vomiting. Abdominal ultrasound was not helpful and appendicectomy was performed due to worsening abdominal signs and an elevated temperature. A normal appendix with enlarged mesenteric nodes was found at surgery. Complete blood count showed thrombocytopenia with leucopenia. Dengue fever was now suspected and confirmed by IgM enzyme-linked immunosorbent assay against dengue virus. This unusual presentation of dengue fever mimicking acute appendicitis should be suspected during viral outbreaks and in patients with atypical symptoms and cytopenias on blood evaluation in order to prevent unnecessary surgery. This case highlights the occurrence of abdominal symptoms and complications that may accompany dengue fever. Early recognition of dengue fever mimicking acute appendicitis will avoid non-therapeutic operation and the diagnosis may be aided by blood investigations indicating a leucopenia, which is uncommon in patients with suppurative acute appendicitis. Copyright © 2013 The Authors. Published by Elsevier Ltd.. All rights reserved.

  8. Heparin-Mimicking Polymers: Synthesis and Biological Applications

    PubMed Central

    2016-01-01

    Heparin is a naturally occurring, highly sulfated polysaccharide that plays a critical role in a range of different biological processes. Therapeutically, it is mostly commonly used as an injectable solution as an anticoagulant for a variety of indications, although it has also been employed in other forms such as coatings on various biomedical devices. Due to the diverse functions of this polysaccharide in the body, including anticoagulation, tissue regeneration, anti-inflammation, and protein stabilization, and drawbacks of its use, analogous heparin-mimicking materials are also widely studied for therapeutic applications. This review focuses on one type of these materials, namely, synthetic heparin-mimicking polymers. Utilization of these polymers provides significant benefits compared to heparin, including enhancing therapeutic efficacy and reducing side effects as a result of fine-tuning heparin-binding motifs and other molecular characteristics. The major types of the various polymers are summarized, as well as their applications. Because development of a broader range of heparin-mimicking materials would further expand the impact of these polymers in the treatment of various diseases, future directions are also discussed. PMID:27739666

  9. Novel tissue mimicking materials for high frequency breast ultrasound phantoms.

    PubMed

    Cannon, Louise M; Fagan, Andrew J; Browne, Jacinta E

    2011-01-01

    The development and acoustical characterisation of a range of novel agar-based tissue mimicking material (TMMs) for use in clinically relevant, quality assurance (QA) and anthropomorphic breast phantoms are presented. The novel agar-based TMMs described in this study are based on a comprehensive, systematic variation of the ingredients in the International Electrotechnical Commission (IEC) TMM. A novel, solid fat-mimicking material was also developed and acoustically characterised. Acoustical characterisation was carried out using an in-house scanning acoustic macroscope at low (7.5 MHz) and high frequencies (20 MHz), using the pulse-echo insertion technique. The speeds of sound range from 1490 to 1570 m. s(-1), attenuation coefficients range from 0.1 to 0.9 dB. cm(‑1). MHz(-1) and relative backscatter ranges from 0 to -20 dB. It was determined that tissues can be mimicked in terms of independently controllable speeds of sound and attenuation coefficients. These properties make these novel TMMs suitable for use in clinically relevant QA and anthropomorphic phantoms and would potentially be useful for other high frequency applications such as intravascular and small animal imaging. Copyright © 2011 World Federation for Ultrasound in Medicine & Biology. Published by Elsevier Inc. All rights reserved.

  10. Radiation stability of cis-isomers of dicyclohexano-18-crown-6

    NASA Astrophysics Data System (ADS)

    Abashkin, V. M.; Wester, D. W.; Campbell, J. A.; Grant, K. E.

    1996-10-01

    The γ-ray initiated decomposition of the pure cis-syn-cis and cis-anti-cis stereoisomers of dicyclohexano-18-crown-6 (DCH-6) and its strontium nitrate complex was studied by Fourier-transform infrared spectrophotometry and gas-chromatography-mass-spectrometry with integrated doses up to 1.5 MGy and dose rate varying from 3 to 8 Gy/s. The proposed shceme of radilysis of DCH-6 that is derived from the experimental data is consistent with symmetric initial cleavage of the CO bonds between the terminal C of the bridging diethylether groups and the O of the cyclohexane-1,2-diol groups. The cis-syn-cis isomer of DCH-6 is more stable to γ-radiation than the cis-anti-cis isomer.

  11. Multilayered tissue mimicking skin and vessel phantoms with tunable mechanical, optical, and acoustic properties

    PubMed Central

    Chen, Alvin I.; Balter, Max L.; Chen, Melanie I.; Gross, Daniel; Alam, Sheikh K.; Maguire, Timothy J.; Yarmush, Martin L.

    2016-01-01

    Purpose: This paper describes the design, fabrication, and characterization of multilayered tissue mimicking skin and vessel phantoms with tunable mechanical, optical, and acoustic properties. The phantoms comprise epidermis, dermis, and hypodermis skin layers, blood vessels, and blood mimicking fluid. Each tissue component may be individually tailored to a range of physiological and demographic conditions. Methods: The skin layers were constructed from varying concentrations of gelatin and agar. Synthetic melanin, India ink, absorbing dyes, and Intralipid were added to provide optical absorption and scattering in the skin layers. Bovine serum albumin was used to increase acoustic attenuation, and 40 μm diameter silica microspheres were used to induce acoustic backscatter. Phantom vessels consisting of thin-walled polydimethylsiloxane tubing were embedded at depths of 2–6 mm beneath the skin, and blood mimicking fluid was passed through the vessels. The phantoms were characterized through uniaxial compression and tension experiments, rheological frequency sweep studies, diffuse reflectance spectroscopy, and ultrasonic pulse-echo measurements. Results were then compared to in vivo and ex vivo literature data. Results: The elastic and dynamic shear behavior of the phantom skin layers and vessel wall closely approximated the behavior of porcine skin tissues and human vessels. Similarly, the optical properties of the phantom tissue components in the wavelength range of 400–1100 nm, as well as the acoustic properties in the frequency range of 2–9 MHz, were comparable to human tissue data. Normalized root mean square percent errors between the phantom results and the literature reference values ranged from 1.06% to 9.82%, which for many measurements were less than the sample variability. Finally, the mechanical and imaging characteristics of the phantoms were found to remain stable after 30 days of storage at 21 °C. Conclusions: The phantoms described in this

  12. Multilayered tissue mimicking skin and vessel phantoms with tunable mechanical, optical, and acoustic properties.

    PubMed

    Chen, Alvin I; Balter, Max L; Chen, Melanie I; Gross, Daniel; Alam, Sheikh K; Maguire, Timothy J; Yarmush, Martin L

    2016-06-01

    This paper describes the design, fabrication, and characterization of multilayered tissue mimicking skin and vessel phantoms with tunable mechanical, optical, and acoustic properties. The phantoms comprise epidermis, dermis, and hypodermis skin layers, blood vessels, and blood mimicking fluid. Each tissue component may be individually tailored to a range of physiological and demographic conditions. The skin layers were constructed from varying concentrations of gelatin and agar. Synthetic melanin, India ink, absorbing dyes, and Intralipid were added to provide optical absorption and scattering in the skin layers. Bovine serum albumin was used to increase acoustic attenuation, and 40 μm diameter silica microspheres were used to induce acoustic backscatter. Phantom vessels consisting of thin-walled polydimethylsiloxane tubing were embedded at depths of 2-6 mm beneath the skin, and blood mimicking fluid was passed through the vessels. The phantoms were characterized through uniaxial compression and tension experiments, rheological frequency sweep studies, diffuse reflectance spectroscopy, and ultrasonic pulse-echo measurements. Results were then compared to in vivo and ex vivo literature data. The elastic and dynamic shear behavior of the phantom skin layers and vessel wall closely approximated the behavior of porcine skin tissues and human vessels. Similarly, the optical properties of the phantom tissue components in the wavelength range of 400-1100 nm, as well as the acoustic properties in the frequency range of 2-9 MHz, were comparable to human tissue data. Normalized root mean square percent errors between the phantom results and the literature reference values ranged from 1.06% to 9.82%, which for many measurements were less than the sample variability. Finally, the mechanical and imaging characteristics of the phantoms were found to remain stable after 30 days of storage at 21 °C. The phantoms described in this work simulate the mechanical, optical, and

  13. Different reaction mechanisms for cis- and trans-prenyltransferases

    SciTech Connect

    Lu Yenpin; Liu Hunge; Liang, P-H.

    2009-02-06

    Octaprenyl diphosphate synthase (OPPs) and undecaprenyl diphosphate synthases (UPPs) catalyze consecutive condensation reactions of farnesyl diphosphate (FPP) with 5 and 8 isopentenyl diphosphate (IPP) to generate C{sub 40} and C{sub 55} products with trans- and cis-double bonds, respectively. In this study, we used IPP analogue, 3-bromo-3-butenyl diphosphate (Br-IPP), in conjunction with radiolabeled FPP, to probe the reaction mechanisms of the two prenyltransferases. Using this alternative substrate with electron-withdrawing bromo group at the C3 position to slow down the condensation step, trapping of farnesol in the OPPs reaction from radiolabeled FPP under basic condition was observed, consistent with a sequential mechanism. In contrast, UPPs reaction yielded no farnesyl carbocation intermediate under the same condition with radiolabeled FPP and Br-IPP, indicating a concerted mechanism. Our data demonstrate the different reaction mechanisms for cis- and tran-prenyltransferases although they share the same substrates.

  14. DNA interaction with cis- and trans- isomers of photosensitive surfactant

    NASA Astrophysics Data System (ADS)

    Unksov, I. N.; Kasyanenko, N. A.

    2014-12-01

    Interaction between DNA and photosensitive cationic surfactant in a solution is studied. Studies were conducted to examine the impact of the surfactant in its cis- conformation on the size of DNA molecule and also to investigate the phase behavior of the system depending on DNA and surfactant concentration. We conclude that trans- isomer of surfactant requires its smaller concentration to reach the DNA compaction compared with cis- isomer received by UV radiation of solutions. Studies of DNA-surfactant systems were performed by means of spectrophotometry and viscometry. Variation of surfactant concentration enables us to determine the precipitation zone on phase diagram. From the viscosity study it can be indicated that precipitation zone is narrower for UV-radiated surfactant and it shifts to higher surfactant concentration. Also we examine the reversibility of DNA compaction in systems with the surfactant in its trans- form.

  15. Functional Evolution of a cis-Regulatory Module

    PubMed Central

    Palsson, Arnar; Alekseeva, Elena; Bergman, Casey M; Nathan, Janaki; Kreitman, Martin

    2005-01-01

    Lack of knowledge about how regulatory regions evolve in relation to their structure–function may limit the utility of comparative sequence analysis in deciphering cis-regulatory sequences. To address this we applied reverse genetics to carry out a functional genetic complementation analysis of a eukaryotic cis-regulatory module—the even-skipped stripe 2 enhancer—from four Drosophila species. The evolution of this enhancer is non-clock-like, with important functional differences between closely related species and functional convergence between distantly related species. Functional divergence is attributable to differences in activation levels rather than spatiotemporal control of gene expression. Our findings have implications for understanding enhancer structure–function, mechanisms of speciation and computational identification of regulatory modules. PMID:15757364

  16. High-throughput discovery of post-transcriptional cis-regulatory elements.

    PubMed

    Wissink, Erin M; Fogarty, Elizabeth A; Grimson, Andrew

    2016-03-03

    Post-transcriptional gene regulation controls the amount of protein produced from an individual mRNA by altering rates of decay and translation. Many sequence elements that direct post-transcriptional regulation have been found; in mammals, most such elements are located within the 3' untranslated regions (3'UTRs). Comparative genomic studies demonstrate that mammalian 3'UTRs contain extensive conserved sequence tracts, yet only a small fraction corresponds to recognized elements, implying that many additional novel elements exist. Despite a variety of computational, molecular, and biochemical approaches, identifying functional 3'UTRs elements remains difficult. We created a high-throughput cell-based screen that enables identification of functional post-transcriptional 3'UTR regulatory elements. Our system exploits integrated single-copy reporters, which are expressed and processed as endogenous genes. We screened many thousands of short random sequences for their regulatory potential. Control sequences with known effects were captured effectively using our approach, establishing that our methodology was robust. We found hundreds of functional sequences, which we validated in traditional reporter assays, including verifying their regulatory impact in native sequence contexts. Although 3'UTRs are typically considered repressive, most of the functional elements were activating, including ones that were preferentially conserved. Additionally, we adapted our screening approach to examine the effect of elements on RNA abundance, revealing that most elements act by altering mRNA stability. We developed and used a high-throughput approach to discover hundreds of post-transcriptional cis-regulatory elements. These results imply that most human 3'UTRs contain many previously unrecognized cis-regulatory elements, many of which are activating, and that the post-transcriptional fate of an mRNA is largely due to the actions of many individual cis-regulatory elements within its

  17. Quantitation of cis- and trans-monounsaturated fatty acids in dairy products and cod liver oil by mass spectrometry in the selected ion monitoring mode.

    PubMed

    Hauff, Simone; Vetter, Walter

    2009-05-13

    Monounsaturated fatty acids (MUFAs) are important constituents of dietary fats. While cis-configurated isomers belong to the classic fatty acids of food, trans-fatty acids are suspected to pose a risk to human health. In either case, a thorough assessment of both positional and geometrical isomers of MUFAs is an important task in food and life sciences. For this purpose, a method suitable for routine analysis was developed. After lipid extraction and conversion of fatty acids into corresponding fatty acid methyl esters, cis and trans isomers of MUFAs were separated on silver-ion-impregnated cartridges. Fractions containing either cis- or trans-MUFAs were determined by gas chromatography-electron ionization mass spectrometry in the selected ion monitoring (GC/EI-MS-SIM) mode using [M-32](+) as quantification ions and [M-74](+) as well as M(+) as qualifier ions. A total of 14 MUFAs were available as reference standards, but a total of 40 MUFAs (22 cis and 18 trans isomers) were identified with high selectivity in samples of cheese, goat fat, human milk, and cod liver oil. The 18:1 and 16:1 isomers contributed most to both the cis- and trans-MUFAs. Application of internal standards allowed for the quantification of MUFAs only in the food samples. The amount of trans-fatty acids was determined to be 0.9- 4.3 g/100 g, with the lowest levels in human milk fat and the highest levels in Roquefort cheese. After exclusion of oleic acid, the concentrations of trans- and cis-MUFAs were at the same level in samples from ruminants and human milk fat.

  18. History and Status of the CIS Customs Union

    SciTech Connect

    Lawson, T.M.; Erickson, S.A.

    1999-08-31

    This report explores the history of the CIS Customs Union and the major obstacles the Union faces in its implementation. Investigation of the Customs Union is necessary as its implementation could effect the Second Line of Defense (SLD) Program. Russian Customs contends that radiation detectors should not be installed along the Customs Union members borders of as the borders will be dissolved when the Union is implemented.

  19. City of Troitsk and Sooty Snow, Chelyabinsk, CIS

    NASA Technical Reports Server (NTRS)

    1992-01-01

    This view shows the industrial pollution around the Siberian city of Troitsk (54.0N, 61.0E). Troitsk is the smallest of a group of three heavy industrial cities east of the Urals, the others being Magnitogorsk and Chelyabinsk. All have been cited as being some of the worst industrial polluted cities in the CIS. Despite being the smallest of the three, Troitsk has the largest area of soot blackened snow. Respiratory diseases among the citizens are chronic.

  20. Thermodynamic state ensemble models of cis-regulation.

    PubMed

    Sherman, Marc S; Cohen, Barak A

    2012-01-01

    A major goal in computational biology is to develop models that accurately predict a gene's expression from its surrounding regulatory DNA. Here we present one class of such models, thermodynamic state ensemble models. We describe the biochemical derivation of the thermodynamic framework in simple terms, and lay out the mathematical components that comprise each model. These components include (1) the possible states of a promoter, where a state is defined as a particular arrangement of transcription factors bound to a DNA promoter, (2) the binding constants that describe the affinity of the protein-protein and protein-DNA interactions that occur in each state, and (3) whether each state is capable of transcribing. Using these components, we demonstrate how to compute a cis-regulatory function that encodes the probability of a promoter being active. Our intention is to provide enough detail so that readers with little background in thermodynamics can compose their own cis-regulatory functions. To facilitate this goal, we also describe a matrix form of the model that can be easily coded in any programming language. This formalism has great flexibility, which we show by illustrating how phenomena such as competition between transcription factors and cooperativity are readily incorporated into these models. Using this framework, we also demonstrate that Michaelis-like functions, another class of cis-regulatory models, are a subset of the thermodynamic framework with specific assumptions. By recasting Michaelis-like functions as thermodynamic functions, we emphasize the relationship between these models and delineate the specific circumstances representable by each approach. Application of thermodynamic state ensemble models is likely to be an important tool in unraveling the physical basis of combinatorial cis-regulation and in generating formalisms that accurately predict gene expression from DNA sequence.

  1. Cluster Ion Spectrometry (CIS) Data Archiving in the CAA

    NASA Astrophysics Data System (ADS)

    Dandouras, I. S.; Barthe, A.; Penou, E.; Brunato, S.; Reme, H.; Kistler, L. M.; Blagau, A.; Facsko, G.; Kronberg, E.; Laakso, H. E.

    2009-12-01

    The Cluster Active Archive (CAA) aims at preserving the four Cluster spacecraft data, so that they are usable in the long-term by the scientific community as well as by the instrument team PIs and Co-Is. This implies that the data are filed together with the descriptive and documentary elements making it possible to select and interpret them. The CIS (Cluster Ion Spectrometry) experiment is a comprehensive ionic plasma spectrometry package onboard the four Cluster spacecraft, capable of obtaining full three-dimensional ion distributions (about 0 to 40 keV/e) with a time resolution of one spacecraft spin (4 sec) and with mass-per-charge composition determination. The CIS package consists of two different instruments, a Hot Ion Analyser (HIA) and a time-of-flight ion Composition Distribution Function (CODIF) analyser. For the archival of the CIS data a multi-level approach has been adopted. The CAA archival includes processed raw data (Level 1 data), moments of the ion distribution functions (Level 2 data), and calibrated high-resolution data in a variety of physical units (Level 3 data). The latter are 3-D ion distribution functions and 2-D pitch-angle distributions. In addition, a software package has been developed to allow the CAA user to interactively calculate partial or total moments of the ion distributions. Instrument cross-calibration has been an important activity in preparing the data for archival. The CIS data archive includes also experiment documentation, graphical products for browsing through the data, and data caveats. In addition, data quality indexes are under preparation, to help the user. Given the complexity of an ion spectrometer, and the variety of its operational modes, each one being optimised for a different magnetospheric region or measurement objective, consultation of the data caveats by the end user will always be a necessary step in the data analysis.

  2. Proton irradiation of the CIS115 for the JUICE mission

    NASA Astrophysics Data System (ADS)

    Soman, M. R.; Allanwood, E. A. H.; Holland, A. D.; Winstone, G. P.; Gow, J. P. D.; Stefanov, K.; Leese, M.

    2015-09-01

    The CIS115 is one of the latest CMOS Imaging Sensors designed by e2v technologies, with 1504x2000 pixels on a 7 μm pitch. Each pixel in the array is a pinned photodiode with a 4T architecture, achieving an average dark current of 22 electrons pixel-1 s-1 at 21°C measured in a front-faced device. The sensor aims for high optical sensitivity by utilising e2v's back-thinning and processing capabilities, providing a sensitive silicon thickness approximately 9 μm to 12 μm thick with a tuned anti-reflective coating. The sensor operates in a rolling shutter mode incorporating reset level subtraction resulting in a mean pixel readout noise of 4.25 electrons rms. The full well has been measured to be 34000 electrons in a previous study, resulting in a dynamic range of up to 8000. These performance characteristics have led to the CIS115 being chosen for JANUS, the high-resolution and wide-angle optical camera on the JUpiter ICy moon Explorer (JUICE). The three year science phase of JUICE is in the harsh radiation environment of the Jovian magnetosphere, primarily studying Jupiter and its icy moons. Analysis of the expected radiation environment and shielding levels from the spacecraft and instrument design predict the End Of Life (EOL) displacement and ionising damage for the CIS115 to be equivalent to 1010 10 MeV protons cm-2 and 100 krad(Si) respectively. Dark current and image lag characterisation results following initial proton irradiations are presented, detailing the initial phase of space qualification of the CIS115. Results are compared to the pre-irradiation performance and the instrument specifications and further qualification plans are outlined.

  3. City of Troitsk and Sooty Snow, Chelyabinsk, CIS

    NASA Technical Reports Server (NTRS)

    1992-01-01

    This view shows the industrial pollution around the Siberian city of Troitsk (54.0N, 61.0E). Troitsk is the smallest of a group of three heavy industrial cities east of the Urals, the others being Magnitogorsk and Chelyabinsk. All have been cited as being some of the worst industrial polluted cities in the CIS. Despite being the smallest of the three, Troitsk has the largest area of soot blackened snow. Respiratory diseases among the citizens are chronic.

  4. cisMEP: an integrated repository of genomic epigenetic profiles and cis-regulatory modules in Drosophila

    PubMed Central

    2014-01-01

    Background Cis-regulatory modules (CRMs), or the DNA sequences required for regulating gene expression, play the central role in biological researches on transcriptional regulation in metazoan species. Nowadays, the systematic understanding of CRMs still mainly resorts to computational methods due to the time-consuming and small-scale nature of experimental methods. But the accuracy and reliability of different CRM prediction tools are still unclear. Without comparative cross-analysis of the results and combinatorial consideration with extra experimental information, there is no easy way to assess the confidence of the predicted CRMs. This limits the genome-