Science.gov

Sample records for mismatch-repair mmr proteins

  1. Mismatch repair proteins: key regulators of genetic recombination.

    PubMed

    Surtees, J A; Argueso, J L; Alani, E

    2004-01-01

    Mismatch repair (MMR) systems are central to maintaining genome stability in prokaryotes and eukaryotes. MMR proteins play a fundamental role in avoiding mutations, primarily by removing misincorporation errors that occur during DNA replication. MMR proteins also act during genetic recombination in steps that include repairing mismatches in heteroduplex DNA, modulating meiotic crossover control, removing 3' non-homologous tails during double-strand break repair, and preventing recombination between divergent sequences. In this review we will, first, discuss roles for MMR proteins in repairing mismatches that occur during recombination, particularly during meiosis. We will also explore how studying this process has helped to refine models of double-strand break repair, and particularly to our understanding of gene conversion gradients. Second, we will examine the role of MMR proteins in repressing homeologous recombination, i.e. recombination between divergent sequences. We will also compare the requirements for MMR proteins in preventing homeologous recombination to the requirements for these proteins in mismatch repair.

  2. Mismatch repair system proteins in oral benign and malignant lesions.

    PubMed

    Amaral-Silva, Gleyson Kleber do; Martins, Manoela Domingues; Pontes, Hélder Antônio Rebelo; Fregnani, Eduardo Rodrigues; Lopes, Márcio Ajudarte; Fonseca, Felipe Paiva; Vargas, Pablo Agustin

    2017-04-01

    Different environmental agents may cause DNA mutations by disrupting its double-strand structure; however, even normal DNA polymerase function may synthesize mismatch nucleotide bases, occasionally demonstrating failure in its proofreading activity. To overcome this issue, mismatch repair (MMR) system, a group of proteins specialized in finding mispairing bases and small loops of insertion or deletion, works to avoid the occurrence of mutations that could ultimately lead to innumerous human diseases. In the last decades, the role of MMR proteins in oral carcinogenesis and in the development of other oral cavity neoplasms has grown, but their importance in the pathogenesis and their prognostic potential for patients affected by oral malignancies, especially oral squamous cell carcinoma (OSCC), remain unclear. Therefore, in this manuscript we aimed to review and critically discuss the currently available data on MMR proteins expression in oral potentially malignant lesions, in OSCC, and in other oral neoplasms to better understand their relevance in these lesions.

  3. Mismatch repair.

    PubMed

    Fishel, Richard

    2015-10-30

    Highly conserved MutS homologs (MSH) and MutL homologs (MLH/PMS) are the fundamental components of mismatch repair (MMR). After decades of debate, it appears clear that the MSH proteins initiate MMR by recognizing a mismatch and forming multiple extremely stable ATP-bound sliding clamps that diffuse without hydrolysis along the adjacent DNA. The function(s) of MLH/PMS proteins is less clear, although they too bind ATP and are targeted to MMR by MSH sliding clamps. Structural analysis combined with recent real-time single molecule and cellular imaging technologies are providing new and detailed insight into the thermal-driven motions that animate the complete MMR mechanism.

  4. Mismatch Repair Proteins Are Activators of Toxic Responses to Chromium-DNA Damage

    PubMed Central

    Peterson-Roth, Elizabeth; Reynolds, Mindy; Quievryn, George; Zhitkovich, Anatoly

    2005-01-01

    Chromium(VI) is a toxic and carcinogenic metal that causes the formation of DNA phosphate-based adducts. Cr-DNA adducts are genotoxic in human cells, although they do not block replication in vitro. Here, we report that induction of cytotoxicity in Cr(VI)-treated human colon cells and mouse embryonic fibroblasts requires the presence of all major mismatch repair (MMR) proteins. Cr-DNA adducts lost their ability to block replication of Cr-modified plasmids in human colon cells lacking MLH1 protein. The presence of functional mismatch repair caused induction of p53-independent apoptosis associated with activation of caspases 2 and 7. Processing of Cr-DNA damage by mismatch repair resulted in the extensive formation of γ-H2AX foci in G2 phase, indicating generation of double-stranded breaks as secondary toxic lesions. Induction of γ-H2AX foci was observed at 6 to 12 h postexposure, which was followed by activation of apoptosis in the absence of significant G2 arrest. Our results demonstrate that mismatch repair system triggers toxic responses to Cr-DNA backbone modifications through stress mechanisms that are significantly different from those for other forms of DNA damage. Selection for Cr(VI) resistant, MMR-deficient cells may explain the very high frequency of lung cancers with microsatellite instability among chromate workers. PMID:15831465

  5. Screening for Muir-Torre syndrome using mismatch repair protein immunohistochemistry of sebaceous neoplasms.

    PubMed

    Roberts, Maegan E; Riegert-Johnson, Douglas L; Thomas, Brittany C; Thomas, Colleen S; Heckman, Michael G; Krishna, Murli; DiCaudo, David J; Bridges, Alina G; Hunt, Katherine S; Rumilla, Kandelaria M; Cappel, Mark A

    2013-06-01

    Screening for the Muir-Torre variant of Lynch Syndrome (LS) using Mismatch Repair (MMR) gene immunohistochemistry (IHC) on sebaceous neoplasms (SNs) is technically feasible. To date, research into the clinical utility of MMR IHC for this indication is limited. We conducted a retrospective chart review of 90 patients with MMR IHC completed on at least one SN from January 2005 to May 2010. SNs included were adenomas, epitheliomas, carcinomas and basal and squamous cell carcinomas with sebaceous differentiation. Of the 90 patients, 13 (14 %) had genetically confirmed or fulfilled clinical criteria for a diagnosis of MTS and 51 patients (57 %) presented with an abnormal MMR IHC result (loss of one or more MMR proteins) on at least one SN. Abnormal IHC had a sensitivity of 85 %, specificity of 48 %, positive predictive value (PPV) of 22 % and negative predictive value (NPV) of 95 % when evaluating for MTS. When personal or family history of colorectal cancer (≥2 family members with a history of colorectal cancer) was taken into consideration, ignoring IHC results, sensitivity was 92 %, specificity was 99 %, PPV was 92 % and NPV was 99 %. MMR IHC on SNs when used to screen for MTS has poor diagnostic utility. We recommend that MMR IHC not be performed routinely on SNs when the patient does not have either personal or family history of colorectal cancer.

  6. DNA mismatch repair proteins are required for efficient herpes simplex virus 1 replication.

    PubMed

    Mohni, Kareem N; Mastrocola, Adam S; Bai, Ping; Weller, Sandra K; Heinen, Christopher D

    2011-12-01

    Herpes simplex virus 1 (HSV-1) is a double-stranded DNA virus that replicates in the nucleus of its human host cell and is known to interact with many cellular DNA repair proteins. In this study, we examined the role of cellular mismatch repair (MMR) proteins in the virus life cycle. Both MSH2 and MLH1 are required for efficient replication of HSV-1 in normal human cells and are localized to viral replication compartments. In addition, a previously reported interaction between MSH6 and ICP8 was confirmed by coimmunoprecipitation and extended to show that UL12 is also present in this complex. We also report for the first time that MLH1 associates with ND10 nuclear bodies and that like other ND10 proteins, MLH1 is recruited to the incoming genome. Knockdown of MLH1 inhibits immediate-early viral gene expression. MSH2, on the other hand, which is generally thought to play a role in mismatch repair at a step prior to that of MLH1, is not recruited to incoming genomes and appears to act at a later step in the viral life cycle. Silencing of MSH2 appears to inhibit early gene expression. Thus, both MLH1 and MSH2 are required but appear to participate in distinct events in the virus life cycle. The observation that MLH1 plays an earlier role in HSV-1 infection than does MSH2 is surprising and may indicate a novel function for MLH1 distinct from its known MSH2-dependent role in mismatch repair.

  7. Expression of Mismatch Repair Proteins in Early and Advanced Gastric Cancer in Poland

    PubMed Central

    Karpińska-Kaczmarczyk, Katarzyna; Lewandowska, Magdalena; Ławniczak, Małgorzata; Białek, Andrzej; Urasińska, Elżbieta

    2016-01-01

    Background Mutations in DNA of mismatch repair (MMR) genes result in failure to repair errors that occur during DNA replication in microsatellites, resulting in accumulation of frameshift mutations in these genes and leading to DNA mismatch replication errors and microsatellite instability. Gastric cancers (GCs) with high MSI (MSI-H) are a well-defined subset of carcinomas showing distinctive clinicopathological features. In this study we investigated the rate of MSI and the correlation between MSI status and clinicopathological features of GC. Material/Methods The study included 107 patients with GCs: 61 with advanced gastric cancers (AGC) and 46 with early gastric cancer (EGC). MSI deficiency in GCs was assessed by the immunohistochemical analysis of expression of MMR proteins – MLH1, MSH2, MSH6, and PMS2 – using formalin-fixed and paraffin-embedded tissue. Results A total of 6 (5.6%) MSI-H were observed. The loss of MMR proteins expression was associated with the intestinal type of GC in Lauren classification, and tubular and papillary architecture in WHO classification. There was no statistically significant association between negative MMR expression and other selected clinical parameters: age, sex, tumor location, depth of invasion (EGC and AGC), lymph nodes status, presence of the ulceration, and lymphocytic infiltrate. Conclusions In the present era of personalized medicine, the histological type of GC and MMR proteins status in cancer cells are very important for the proper surveillance of patients with familial GC and sporadic GCs, as well as for selecting the proper follow-up and treatment. Larger collaborative studies are needed to verify the features of MSI-H GCs in Poland. PMID:27527654

  8. Interdependence of DNA mismatch repair proteins MLH1 and MSH2 in apoptosis in human colorectal carcinoma cell lines.

    PubMed

    Hassen, Samar; Ali, Akhtar A; Kilaparty, Surya P; Al-Anbaky, Qudes A; Majeed, Waqar; Boman, Bruce M; Fields, Jeremy Z; Ali, Nawab

    2016-01-01

    The mammalian DNA mismatch repair (MMR) system consists of a number of proteins that play important roles in repair of base pair mismatch mutations and in maintenance of genomic integrity. A defect in this system can cause genetic instability, which can lead to carcinogenesis. For instance, a germline mutation in one of the mismatch repair proteins, especially MLH1 or MSH2, is responsible for hereditary non-polyposis colorectal cancer. These MMR proteins also play an important role in the induction of apoptosis. Accordingly, altered expression of or a defect in MLH1 or MSH2 may confer resistance to anti-cancer drugs used in chemotherapy. We hypothesized that the ability of these two MMR proteins to regulate apoptosis are interdependent. Moreover, a defect in either one may confer resistance to chemotherapy by an inability to trigger apoptosis. To this end, we studied three cell lines-SW480, LoVo, and HTC116. These cell lines were selected based on their differential expression of MLH1 and MSH2 proteins. SW480 expresses both MLH1 and MSH2; LoVo expresses only MLH1 but not MSH2; HCT116 expresses only MSH2 but not MLH1 protein. MTT assays, a measure of cytotoxicity, showed that there were different cytotoxic effects of an anti-cancer drug, etoposide, on these cell lines, effects that were correlated with the MMR status of the cells. Cells that are deficient in MLH1 protein (HCT116 cells) were resistant to the drug. Cells that express both MLH1 and MSH2 proteins (SW480 cells) showed caspase-3 cleavage, an indicator of apoptosis. Cells that lack MLH1 (HCT116 cells) did not show any caspase-3 cleavage. Expression of full-length MLH1 protein was decreased in MMR proficient (SW480) cells during apoptosis; it remained unchanged in cells that lack MSH2 (LoVo cells). The expression of MSH2 protein remained unchanged during apoptosis both in MMR proficient (SW480) and deficient (HCT116) cells. Studies on translocation of MLH1 protein from nucleus to cytosolic fraction, an

  9. Role of Cell Cycle Regulation and MLH1, A Key DNA Mismatch Repair Protein, In Adaptive Survival Responses. Final Report

    SciTech Connect

    David A. Boothman

    1999-08-11

    Due to several interesting findings on both adaptive survival responses (ASRs) and DNA mismatch repair (MMR), this grant was separated into two discrete Specific Aim sets (each with their own discrete hypotheses). The described experiments were simultaneously performed.

  10. Roles for mismatch repair family proteins in promoting meiotic crossing over

    PubMed Central

    Manhart, Carol M.; Alani, Eric

    2015-01-01

    The mismatch repair (MMR) family complexes Msh4-Msh5 and Mlh1-Mlh3 act with Exo1 and Sgs1-Top3-Rmi1 in a meiotic double strand break repair pathway that results in the asymmetric cleavage of double Holliday junctions (dHJ) to form crossovers. This review discusses how meiotic roles for Msh4-Msh5 and Mlh1-Mlh3 do not fit paradigms established for post-replicative MMR. We also outline models used to explain how these factors promote the formation of meiotic crossovers required for the accurate segregation of chromosome homologs during the Meiosis I division. PMID:26686657

  11. Helicobacter pylori infection and expression of DNA mismatch repair proteins

    PubMed Central

    Mirzaee, Vahid; Molaei, Mahsa; Shalmani, Hamid Mohaghegh; Zali, Mohammad Reza

    2008-01-01

    AIM: To determine the expression of DNA (MMR) proteins, including hMLH1 and hMSH2, in gastric epithelial cells in the patients with or without Helicobacter pylori (H pylori)-infected gastritis. METHODS: Fifty H pylori-positive patients and 50 H pylori-negative patients were enrolled in the study. During endoscopy of patients with non-ulcer dyspepsia, two antral and two corpus biopsies were taken for histological examination (Giemsa stain) and for immunohistochemical staining of hMLH1 and hMSH2. RESULTS: The percentage of epithelial cell nuclei that demonstrated positivity for hMLH1 staining was 84.14 ± 7.32% in H pylori-negative patients, while it was 73.34 ± 10.10% in H pylori-positive patients (P < 0.0001). No significant difference was seen between the two groups regarding the percentage of epithelial cell nuclei that demonstrated positivity for hMSH2 staining (81.16 ± 8.32% in H pylori-negative versus 78.24 ± 8.71% in H pylori-positive patients; P = 0.09). CONCLUSION: This study indicates that H pylori might promote development of gastric carcinoma at least in part through its ability to affect the DNA MMR system. PMID:19034977

  12. Minor Changes in Expression of the Mismatch Repair Protein MSH2 Exert a Major Impact on Glioblastoma Response to Temozolomide.

    PubMed

    McFaline-Figueroa, José L; Braun, Christian J; Stanciu, Monica; Nagel, Zachary D; Mazzucato, Patrizia; Sangaraju, Dewakar; Cerniauskas, Edvinas; Barford, Kelly; Vargas, Amanda; Chen, Yimin; Tretyakova, Natalia; Lees, Jacqueline A; Hemann, Michael T; White, Forest M; Samson, Leona D

    2015-08-01

    Glioblastoma (GBM) is often treated with the cytotoxic drug temozolomide, but the disease inevitably recurs in a drug-resistant form after initial treatment. Here, we report that in GBM cells, even a modest decrease in the mismatch repair (MMR) components MSH2 and MSH6 have profound effects on temozolomide sensitivity. RNAi-mediated attenuation of MSH2 and MSH6 showed that such modest decreases provided an unexpectedly strong mechanism of temozolomide resistance. In a mouse xenograft model of human GBM, small changes in MSH2 were sufficient to suppress temozolomide-induced tumor regression. Using The Cancer Genome Atlas to analyze mRNA expression patterns in tumors from temozolomide-treated GBM patients, we found that MSH2 transcripts in primary GBM could predict patient responses to initial temozolomide therapy. In recurrent disease, the absence of microsatellite instability (the standard marker for MMR deficiency) suggests a lack of involvement of MMR in the resistant phenotype of recurrent disease. However, more recent studies reveal that decreased MMR protein levels occur often in recurrent GBM. In accordance with our findings, these reported decreases may constitute a mechanism by which GBM evades temozolomide sensitivity while maintaining microsatellite stability. Overall, our results highlight the powerful effects of MSH2 attenuation as a potent mediator of temozolomide resistance and argue that MMR activity offers a predictive marker for initial therapeutic response to temozolomide treatment.

  13. Proteasome inhibition rescues clinically significant unstable variants of the mismatch repair protein Msh2

    PubMed Central

    Arlow, Tim; Scott, Kristan; Wagenseller, Aubrey; Gammie, Alison

    2013-01-01

    MSH2 is required for DNA mismatch repair recognition in eukaryotes. Deleterious mutations in human MSH2 account for approximately half of the alleles associated with a common hereditary cancer syndrome. Previously, we characterized clinically identified MSH2 missense mutations, using yeast as a model system, and found that the most common cause of defective DNA mismatch repair was low levels of the variant Msh2 proteins. Here, we show that increased protein turnover is responsible for the reduced cellular levels. Increasing gene dosage of more than half of the missense alleles fully restored function. A titration experiment revealed that raising the expression level of one variant to less than wild-type levels restored mismatch repair, suggesting that overexpression is not always required to regain function. We found that the ubiquitin-mediated proteasome degradation pathway is the major mechanism for increased turnover of the Msh2 variants and identified the primary ubiquitin ligase as San1. Deletion of San1 restored protein levels for all but one variant, but did not elevate wild-type Msh2 levels. The unstable variants interacted with San1, whereas wild-type Msh2 did not. Additionally, san1Δ suppressed the mismatch repair defect of unstable variants. Of medical significance, the clinically approved drug Bortezomib partially restored protein levels and mismatch repair function for low-level variants and reversed the resistance to cisplatin, a common chemotherapeutic. Our results provide the foundation for an innovative therapeutic regime for certain mismatch-repair-defective cancers that are refractory to conventional chemotherapies. PMID:23248292

  14. Non-canonical actions of mismatch repair

    PubMed Central

    Crouse, Gray F.

    2015-01-01

    At the heart of the mismatch repair (MMR) system are proteins that recognize mismatches in DNA. Such mismatches can be mispairs involving normal or damaged bases or insertion/deletion loops due to strand misalignment. When such mispairs are generated during replication or recombination, MMR will direct removal of an incorrectly paired base or block recombination between nonidentical sequences. However, when mispairs are recognized outside the context of replication, proper strand discrimination between old and new DNA is lost, and MMR can act randomly and mutagenically on mispaired DNA. Such non-canonical actions of MMR are important in somatic hypermutation and class switch recombination, expansion of triplet repeats, and potentially in mutations arising in nondividing cells. MMR involvement in damage recognition and signaling is complex, with the end result likely dependent on the amount of DNA damage in a cell. PMID:26698648

  15. Mismatch repair proteins MSH2, MLH1, and EXO1 are important for class-switch recombination events occurring in B cells that lack nonhomologous end joining.

    PubMed

    Eccleston, Jennifer; Yan, Catherine; Yuan, Karen; Alt, Frederick W; Selsing, Erik

    2011-02-15

    In the absence of core nonhomologous end-joining (NHEJ) factors, Ab gene class-switch recombination (CSR) uses an alternative end-joining (A-EJ) pathway to recombine switch (S) region DNA breaks. Previous reports showing decreased S-junction microhomologies in MSH2-deficient mice and an exonuclease 1 (EXO1) role in yeast microhomology-mediated end joining suggest that mismatch repair (MMR) proteins might influence A-EJ-mediated CSR. We have directly investigated whether MMR proteins collectively or differentially influence the A-EJ mechanism of CSR by analyzing CSR in mice deficient in both XRCC4 and individual MMR proteins. We find CSR is reduced and that Igh locus chromosome breaks are reduced in the MMR/XRCC4 double-deficient B cells compared with B cells deficient in XRCC4 alone, suggesting MMR proteins function upstream of double-strand break formation to influence CSR efficiency in these cells. Our results show that MLH1, EXO1, and MSH2 are all important for efficient A-EJ-mediated CSR, and we propose that MMR proteins convert DNA nicks and point mutations into dsDNA breaks for both C-NHEJ and A-EJ pathways of CSR. We also find Mlh1-XRCC4(-) B cells have an increased frequency of direct S junctions, suggesting that MLH1 proteins may have additional functions that influence A-EJ-mediated CSR.

  16. Evolutionary Covariance Combined with Molecular Dynamics Predicts a Framework for Allostery in the MutS DNA Mismatch Repair Protein

    PubMed Central

    2017-01-01

    Mismatch repair (MMR) is an essential, evolutionarily conserved pathway that maintains genome stability by correcting base-pairing errors in DNA. Here we examine the sequence and structure of MutS MMR protein to decipher the amino acid framework underlying its two key activities—recognizing mismatches in DNA and using ATP to initiate repair. Statistical coupling analysis (SCA) identified a network (sector) of coevolved amino acids in the MutS protein family. The potential functional significance of this SCA sector was assessed by performing molecular dynamics (MD) simulations for alanine mutants of the top 5% of 160 residues in the distribution, and control nonsector residues. The effects on three independent metrics were monitored: (i) MutS domain conformational dynamics, (ii) hydrogen bonding between MutS and DNA/ATP, and (iii) relative ATP binding free energy. Each measure revealed that sector residues contribute more substantively to MutS structure–function than nonsector residues. Notably, sector mutations disrupted MutS contacts with DNA and/or ATP from a distance via contiguous pathways and correlated motions, supporting the idea that SCA can identify amino acid networks underlying allosteric communication. The combined SCA/MD approach yielded novel, experimentally testable hypotheses for unknown roles of many residues distributed across MutS, including some implicated in Lynch cancer syndrome. PMID:28135092

  17. Café-au-lait macules and pediatric malignancy caused by biallelic mutations in the DNA mismatch repair (MMR) gene PMS2.

    PubMed

    Jackson, Carl-Christian; Holter, Spring; Pollett, Aaron; Clendenning, Mark; Chou, Shirley; Senter, Leigha; Ramphal, Raveena; Gallinger, Steven; Boycott, Kym

    2008-06-01

    A 14-year-old male presented with a T4 sigmoid adenocarcinoma, <10 colonic adenomas and multiple café-au-lait macules. Family history was not suggestive of a dominant hereditary form of colorectal cancer. Evaluation of the tumor revealed abnormal immunohistochemical staining of the PMS2 protein and high frequency microsatellite instability. Germline analysis identified biallelic PMS2 missense mutations. A new cancer syndrome caused by biallelic mutations in the mismatch repair genes, including PMS2, is now emerging and is characterized by café-au-lait macules, colonic polyps and a distinctive tumor spectrum.

  18. Correlation of tumour BRAF mutations and MLH1 methylation with germline mismatch repair (MMR) gene mutation status: a literature review assessing utility of tumour features for MMR variant classification.

    PubMed

    Parsons, Michael T; Buchanan, Daniel D; Thompson, Bryony; Young, Joanne P; Spurdle, Amanda B

    2012-03-01

    Colorectal cancer (CRC) that demonstrates microsatellite instability (MSI) is caused by either germline mismatch repair (MMR) gene mutations, or 'sporadic' somatic tumour MLH1 promoter methylation. MLH1 promoter methylation is reportedly correlated with tumour BRAF V600E mutation status. No systematic review has been undertaken to assess the value of BRAF V600E mutation and MLH1 promoter methylation tumour markers as negative predictors of germline MMR mutation status. A literature review of CRC cohorts tested for MMR mutations, and tumour BRAF V600E mutation and/or MLH1 promoter methylation was conducted using PubMed. Studies were assessed for tumour features, stratified by tumour MMR status based on immunohistochemistry or MSI where possible. Pooled frequencies and 95% CIs were calculated using a random effects model. BRAF V600E results for 4562 tumours from 35 studies, and MLH1 promoter methylation results for 2975 tumours from 43 studies, were assessed. In 550 MMR mutation carriers, the BRAF V600E mutation frequency was 1.40% (95% CI 0.06% to 3%). In MMR mutation-negative cases, the BRAF V600E mutation frequency was 5.00% (95% CI 4% to 7%) in 1623 microsatellite stable (MSS) cases and 63.50% (95% CI 47% to 79%) in 332 cases demonstrating MLH1 methylation or MLH1 expression loss. MLH1 promoter methylation of the 'A region' was reported more frequently than the 'C region' in MSS CRCs (17% vs 0.06%, p<0.0001) and in MLH1 mutation carriers (42% vs 6%, p<0.0001), but not in MMR mutation-negative MSI-H CRCs (40% vs 47%, p=0.12). Methylation of the 'C region' was a predictor of MMR mutation-negative status in MSI-H CRC cases (47% vs 6% in MLH1 mutation carriers, p<0.0001). This review demonstrates that tumour BRAF V600E mutation, and MLH1 promoter 'C region' methylation specifically, are strong predictors of negative MMR mutation status. It is important to incorporate these features in multifactorial models aimed at predicting MMR mutation status.

  19. Screening for Lynch syndrome and referral to clinical genetics by selective mismatch repair protein immunohistochemistry testing: an audit and cost analysis.

    PubMed

    Colling, Richard; Church, David N; Carmichael, Juliet; Murphy, Lucinda; East, James; Risby, Peter; Kerr, Rachel; Chetty, Runjan; Wang, Lai Mun

    2015-12-01

    Lynch syndrome (LS) accounts for around 3% of colorectal cancers (CRCs) and is caused by germline mutations in mismatch repair (MMR) genes. Recently, screening strategies to identify patients with LS have become popular. We audited CRCs screened with MMR immunohistochemistry (IHC) in 2013. 209 tumours had MMR IHC performed at a cost of £12 540. 47/209 (21%) cases showed IHC loss of expression in at least one MMR protein. 28/44 cases with loss of MLH1 had additional BRAF V600E testing, at a cost of £5040. MMR IHC reduced the number of potential clinical genetics referrals from 209 to 47. BRAF mutation testing, performed in a subset of cases with MLH1 loss, further reduced this to 21. At a cost of £1340 per referral, this model of LS screening for clinical genetics referral had significant potential savings (£234 340) and can be easily implemented in parallel with MMR IHC done for prognostication in CRCs.

  20. Reduction of DNA mismatch repair protein expression in airway epithelial cells of premenopausal women chronically exposed to biomass smoke.

    PubMed

    Mukherjee, Bidisha; Dutta, Anindita; Chowdhury, Saswati; Roychoudhury, Sanghita; Ray, Manas Ranjan

    2014-02-01

    Biomass burning is a major source of indoor air pollution in rural India. This study examined whether chronic inhalation of biomass smoke causes change in the DNA mismatch repair (MMR) pathway in the airway cells. For this, airway cells exfoliated in sputum were collected from 72 premenopausal nonsmoking rural women (median age 34 years) who cooked with biomass (wood, dung, crop residues) and 68 control women who cooked with cleaner fuel liquefied petroleum gas (LPG) for the past 5 years or more. The levels of particulate matters with diameters less than 10 and 2.5 μm (PM10 and PM2.5) in indoor air were measured by real-time aerosol monitor. Benzene exposure was monitored by measuring trans,trans-muconic acid (t,t-MA) in urine by high-performance liquid chromatography with ultraviolet detector. Generation of reactive oxygen species (ROS) and level of superoxide dismutase (SOD) in airway cells were measured by flow cytometry and spectrophotometry, respectively. Immunocytochemical assay revealed lower percentage of airway epithelial cells expressing MMR proteins mutL homolog 1 (MLH1) and mutS homolog 2 (MSH2) in biomass-using women compared to LPG-using controls. Women who cooked with biomass had 6.7 times higher level of urinary t,t-MA, twofold increase in ROS generation, and 31 % depletion of SOD. Indoor air of biomass-using households had three times more particulate matters than that of controls. ROS, urinary t,t-MA, and particulate pollution in biomass-using kitchen had negative correlation, while SOD showed positive correlation with MSH2 and MLH1 expression. It appears that chronic exposure to biomass smoke reduces MMR response in airway epithelial cells, and oxidative stress plays an important role in the process.

  1. Selenium compounds activate ATM-dependent DNA damage responses via the mismatch repair protein hMLH1 in colorectal cancer cells

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Epidemiological and animal studies indicate that selenium supplementation suppresses risk of colorectal and other cancers. The majority of colorectal cancers are characterized by a defective DNA mismatch repair (MMR) process. Here, we have employed the MMR-deficient HCT 116 colorectal cancer cells ...

  2. New insights into the mechanism of DNA mismatch repair

    PubMed Central

    Reyes, Gloria X.; Schmidt, Tobias T.; Kolodner, Richard D.; Hombauer, Hans

    2015-01-01

    The genome of all organisms is constantly being challenged by endogenous and exogenous sources of DNA damage. Errors like base:base mismatches or small insertions and deletions, primarily introduced by DNA polymerases during DNA replication are repaired by an evolutionary conserved DNA mismatch repair (MMR) system. The MMR system, together with the DNA replication machinery, promote repair by an excision and resynthesis mechanism during or after DNA replication, increasing replication fidelity by upto-three orders of magnitude. Consequently, inactivation of MMR genes results in elevated mutation rates that can lead to increased cancer susceptibility in humans. In this review, we summarize our current understanding of MMR with a focus on the different MMR protein complexes, their function and structure. We also discuss how recent findings have provided new insights in the spatio-temporal regulation and mechanism of MMR. PMID:25862369

  3. Expression of hMSH2 protein of the human DNA mismatch repair system in oral lichen planus

    PubMed Central

    2004-01-01

    Lichen planus is a mucocutaneous disease of inflammatory nature and unknown etiology. It is characterized by a cell-mediated immunological response to induced antigenic change in skin and/or mucosa. The possible malignant transformation of lichen planus remains a subject of controversial discussions in the literature. hMSH2 is one of the human DNA mismatch repair (hMMR) genes and it plays an important role in reducing mutation and maintaining genomic stability. hMSH2 alterations have been reported in oral squamous cell carcinoma and there are evidences suggesting the association between oral lichen planus and squamous cell carcinoma. In this study, we aim to investigate the immunolocalization of hMSH2 protein in oral lichen planus compared to oral normal mucosa epithelium. We examined the expression of hMSH2 protein by immunohistochemistry in twenty-six cases of oral lichen planus. Clinically, 12 of them were categorized into reticular subtype and 14 were atrophic/erosive. Ten cases of normal mucosa were added to the control group. Results showed that the percentage of positive cells to hMSH2 was smaller in reticular (46.54%; p=0,006) and atrophic/erosive (48.79%; p=0,028) subtypes of oral lichen planus compared to normal mucosa (61.29%). The reduced expression of hMSH2 protein in oral lichen planus suggests that this lesion is more susceptible to mutation and therefore facilitate the development of oral squamous cell carcinoma. PMID:15912193

  4. Diffusion and Binding of Mismatch Repair Protein, MSH2, in Breast Cancer Cells at Different Stages of Neoplastic Transformation

    PubMed Central

    Sigley, Justin; Jarzen, John; Scarpinato, Karin; Guthold, Martin; Pu, Tracey; Nelli, Daniel; Low, Josiah

    2017-01-01

    The interior of cells is a highly complex medium, containing numerous organelles, a matrix of different fibers and a viscous, aqueous fluid of proteins and small molecules. The interior of cells is also a highly dynamic medium, in which many components move, either by active transport or passive diffusion. The mobility and localization of proteins inside cells can provide important insights into protein function and also general cellular properties, such as viscosity. Neoplastic transformation affects numerous cellular properties, and our goal was to investigate the diffusional and binding behavior of the important mismatch repair (MMR) protein MSH2 in live human cells at various stages of neoplastic transformation. Toward this end, noncancerous, immortal, tumorigenic, and metastatic mammary epithelial cells were transfected with EGFP and EGFP-tagged MSH2. MSH2 forms two MMR proteins (MutSα and MutSβ) and we assume MSH2 is in the complex MutSα, though our results are similar in either case. Unlike the MutS complexes that bind to nuclear DNA, EGFP diffuses freely. EGFP and MutSα-EGFP diffusion coefficients were determined in the cytoplasm and nucleus of each cell type using fluorescence recovery after photobleaching. Diffusion coefficients were 14–24 μm2/s for EGFP and 3–7 μm2/s for MutSα-EGFP. EGFP diffusion increased in going from noncancerous to immortal cells, indicating a decrease in viscosity, with smaller changes in subsequent stages. MutSα produces an effective diffusion coefficient that, coupled with the free EGFP diffusion measurements, can be used to extract a pure diffusion coefficient and a pseudo-equilibrium constant K*. The MutSα nuclear K* increased sixfold in the first stage of cancer and then decreased in the more advanced stages. The ratio of nuclear to cytoplasmic K*for MutSα increased almost two orders of magnitude in going from noncancerous to immortal cells, suggesting that this quantity may be a sensitive metric for recognizing

  5. Novel DNA mismatch-repair activity involving YB-1 in human mitochondria.

    PubMed

    de Souza-Pinto, Nadja C; Mason, Penelope A; Hashiguchi, Kazunari; Weissman, Lior; Tian, Jingyan; Guay, David; Lebel, Michel; Stevnsner, Tinna V; Rasmussen, Lene Juel; Bohr, Vilhelm A

    2009-06-04

    Maintenance of the mitochondrial genome (mtDNA) is essential for proper cellular function. The accumulation of damage and mutations in the mtDNA leads to diseases, cancer, and aging. Mammalian mitochondria have proficient base excision repair, but the existence of other DNA repair pathways is still unclear. Deficiencies in DNA mismatch repair (MMR), which corrects base mismatches and small loops, are associated with DNA microsatellite instability, accumulation of mutations, and cancer. MMR proteins have been identified in yeast and coral mitochondria; however, MMR proteins and function have not yet been detected in human mitochondria. Here we show that human mitochondria have a robust mismatch-repair activity, which is distinct from nuclear MMR. Key nuclear MMR factors were not detected in mitochondria, and similar mismatch-binding activity was observed in mitochondrial extracts from cells lacking MSH2, suggesting distinctive pathways for nuclear and mitochondrial MMR. We identified the repair factor YB-1 as a key candidate for a mitochondrial mismatch-binding protein. This protein localizes to mitochondria in human cells, and contributes significantly to the mismatch-binding and mismatch-repair activity detected in HeLa mitochondrial extracts, which are significantly decreased when the intracellular levels of YB-1 are diminished. Moreover, YB-1 depletion in cells increases mitochondrial DNA mutagenesis. Our results show that human mitochondria contain a functional MMR repair pathway in which YB-1 participates, likely in the mismatch-binding and recognition steps.

  6. Mismatch repair protein immunohistochemistry: a useful population screening strategy for Lynch syndrome.

    PubMed

    Musulén, Eva; Sanz, Carolina; Muñoz-Mármol, Ana María; Ariza, Aurelio

    2014-07-01

    Lynch syndrome (LS), the most frequent form of hereditary colorectal cancer, shows a highly penetrant, autosomal dominant pattern of inheritance. Distinction of LS colorectal carcinoma instances from the much more common sporadic colorectal carcinoma cases is of paramount importance. Revised Bethesda Guidelines were developed to diagnose LS by evaluating a combination of clinical and pathologic data. The aim of the present study was to evaluate the usefulness of the pathology items included in the Revised Bethesda Guidelines. We have prospectively studied a series of 1624 consecutive colorectal carcinomas with an algorithm including immunohistochemical analysis of mismatch repair proteins and molecular study of microsatellite instability and BRAF c.1799 T > A (p.V600E) gene mutations. Patients with tumors showing LS features were referred for germline mutation analysis. By applying our algorithmic approach, we were able to identify LS features in 89 colorectal cancer patients, of whom only 27 met Revised Bethesda Guidelines pathology criteria. Of the 89 patients, 47 were then studied at the Genetic Counseling Unit, and LS was confirmed in 18, of whom 7 had not been identified by the Revised Bethesda Guidelines. Our study shows that the Revised Bethesda Guidelines failed to detect 70% of patients at risk of LS. Our algorithmic approach is a realistic and effective tool for LS identification. We strongly recommend the implementation of universal population screening for LS among all patients with newly diagnosed colorectal carcinoma.

  7. Immunohistochemistry staining for mismatch repair proteins: the endoscopic biopsy material provides useful and coherent results.

    PubMed

    Vilkin, Alex; Leibovici-Weissman, Ya'ara; Halpern, Marisa; Morgenstern, Sara; Brazovski, Eli; Gingold-Belfer, Rachel; Wasserberg, Nir; Brenner, Baruch; Niv, Yaron; Sneh-Arbib, Orly; Levi, Zohar

    2015-11-01

    Immunohistochemistry (IHC) testing for mismatch repair proteins (MMRP) in patients with colorectal cancer can be performed on endoscopic biopsy material or the surgical resection material. Data are continuing to accumulate regarding the deleterious effect of neoadjuvant chemoradiation on MMRP expression. However, despite continuing rise in the use of endoscopic biopsies for IHC, most pathology departments still use mainly the surgical materials for IHC testing. In this study we compared the quality of stains among 96 colon cancer subjects with paired endoscopic and surgical material available for MLH1, MSH2, MSH6, and PMS2 stains (96 × 4, yielding 384 paired stains). Each slide received both a quantitative score (immunoreactivity [0-3] × percent positivity [0-4]) and a qualitative score (absent; weak and focal; strong). The quantitative scores of all MMRP were significantly higher among the endoscopic material (P<.001 for all). In 358 pairs (93.2%), both the endoscopic and operative material stained either strong (322, 83.9%) or absent (36, 9.4%). In 26 pairs (6.8%), the endoscopic material stained strong, whereas the operative material stained focal and weak. No endoscopic biopsy materials stained focal and weak. Our findings indicate that the biopsy material may provide more coherent results. Although these results may indicate that biopsy material provides coherent and useful results, it is yet to be determined if the demonstrated differences pose a real clinical problem in interpreting final results of IHC staining of such kind. Hence, we suggest that when available, the endoscopic material rather than the operative one should serve as the primary substrate for IHC staining.

  8. How reliable is immunohistochemical staining for DNA mismatch repair proteins performed after neoadjuvant chemoradiation?

    PubMed

    Vilkin, Alex; Halpern, Marisa; Morgenstern, Sara; Brazovski, Eli; Gingold-Belfer, Rachel; Boltin, Doron; Purim, Ofer; Kundel, Yulia; Welinsky, Sara; Brenner, Baruch; Niv, Yaron; Levi, Zohar

    2014-10-01

    Immunohistochemistry (IHC) testing for mismatch repair proteins (MMRP) is currently being used primarily in colorectal cancer resection specimens. We aimed to compare the results of IHC staining performed on biopsy specimens obtained at endoscopy with that performed on surgical specimens after neoadjuvant therapy. Thirty-two rectal cancer subjects had paired preneoadjuvant and postneoadjuvant tissue available for IHC staining (MLH1, MSH2, MSH6, and PMS2), whereas 39 rectosigmoid cancer patients who did not receive neoadjuvant treatment served as controls. Each slide received a qualitative (absent, focal, and strong) and quantitative score (immunoreactivity [0-3] × percent positivity [0-4]). The quantitative scores of MMRP from the operative material were significantly lower in the neoadjuvant group than in the control (P < .05 for all).The scores of all MMRP from endoscopic biopsies were not significantly different between the neoadjuvant and the control groups. Disagreement between the endoscopic biopsy and the operative material was evident in 23 of 128 stains (18.5%) in the neoadjuvant group and in 12 of 156 stains (7.7%) in the control group (P = .009). In the neoadjuvant group, a disagreement pattern of "endoscopic strong operative focal" was observed in 28.1% for PMS2, 12.5% for MSH6, 12.5% for MLH1, and 6.3% for MSH2, and in the control group, this same disagreement pattern was found in 12.8% for PMS2, 7.7% for MSH6, 7.7% for MLH1, and 0% for MSH2. Based on our findings, we suggest that for rectal cancer, the endoscopic material rather than the operative material should serve as the primary material for IHC staining.

  9. DNA Triplet Repeat Expansion and Mismatch Repair

    PubMed Central

    Iyer, Ravi R.; Pluciennik, Anna; Napierala, Marek; Wells, Robert D.

    2016-01-01

    DNA mismatch repair is a conserved antimutagenic pathway that maintains genomic stability through rectification of DNA replication errors and attenuation of chromosomal rearrangements. Paradoxically, mutagenic action of mismatch repair has been implicated as a cause of triplet repeat expansions that cause neurological diseases such as Huntington disease and myotonic dystrophy. This mutagenic process requires the mismatch recognition factor MutSβ and the MutLα (and/or possibly MutLγ) endonuclease, and is thought to be triggered by the transient formation of unusual DNA structures within the expanded triplet repeat element. This review summarizes the current knowledge of DNA mismatch repair involvement in triplet repeat expansion, which encompasses in vitro biochemical findings, cellular studies, and various in vivo transgenic animal model experiments. We present current mechanistic hypotheses regarding mismatch repair protein function in mediating triplet repeat expansions and discuss potential therapeutic approaches targeting the mismatch repair pathway. PMID:25580529

  10. A non-canonical mismatch repair pathway in prokaryotes.

    PubMed

    Castañeda-García, A; Prieto, A I; Rodríguez-Beltrán, J; Alonso, N; Cantillon, D; Costas, C; Pérez-Lago, L; Zegeye, E D; Herranz, M; Plociński, P; Tonjum, T; García de Viedma, D; Paget, M; Waddell, S J; Rojas, A M; Doherty, A J; Blázquez, J

    2017-01-27

    Mismatch repair (MMR) is a near ubiquitous pathway, essential for the maintenance of genome stability. Members of the MutS and MutL protein families perform key steps in mismatch correction. Despite the major importance of this repair pathway, MutS-MutL are absent in almost all Actinobacteria and many Archaea. However, these organisms exhibit rates and spectra of spontaneous mutations similar to MMR-bearing species, suggesting the existence of an alternative to the canonical MutS-MutL-based MMR. Here we report that Mycobacterium smegmatis NucS/EndoMS, a putative endonuclease with no structural homology to known MMR factors, is required for mutation avoidance and anti-recombination, hallmarks of the canonical MMR. Furthermore, phenotypic analysis of naturally occurring polymorphic NucS in a M. smegmatis surrogate model, suggests the existence of M. tuberculosis mutator strains. The phylogenetic analysis of NucS indicates a complex evolutionary process leading to a disperse distribution pattern in prokaryotes. Together, these findings indicate that distinct pathways for MMR have evolved at least twice in nature.

  11. Deficient mismatch repair: Read all about it (Review)

    PubMed Central

    RICHMAN, SUSAN

    2015-01-01

    Defects in the DNA mismatch repair (MMR) proteins, result in a phenotype called microsatellite instability (MSI), occurring in up to 15% of sporadic colorectal cancers. Approximately one quarter of colon cancers with deficient MMR (dMMR) develop as a result of an inherited predisposition syndrome, Lynch syndrome (formerly known as HNPCC). It is essential to identify patients who potentially have Lynch syndrome, as not only they, but also family members, may require screening and monitoring. Diagnostic criteria have been developed, based primarily on Western populations, and several methodologies are available to identify dMMR tumours, including immunohistochemistry and microsatellite testing. These criteria have provided evidence supporting the introduction of reflex testing. Yet, it is becoming increasingly clear that tests have a limited sensitivity and specificity and may yet be superseded by next generation sequencing. In this review, the limitations of diagnostic criteria are discussed, and current and emerging screening technologies explained. There is now useful evidence supporting the prognostic and predictive value of dMMR status in colorectal tumours, but much less is known about their value in extracolonic tumours, that may also feature in Lynch syndrome. This review assesses current literature relating to dMMR in endometrial, ovarian, gastric and melanoma cancers, which it would seem, may benefit from large-scale clinical trials in order to further close the gap in knowledge between colorectal and extracolonic tumours. PMID:26315971

  12. A non-canonical mismatch repair pathway in prokaryotes

    PubMed Central

    Castañeda-García, A.; Prieto, A. I.; Rodríguez-Beltrán, J.; Alonso, N.; Cantillon, D.; Costas, C.; Pérez-Lago, L.; Zegeye, E. D.; Herranz, M.; Plociński, P.; Tonjum, T.; García de Viedma, D.; Paget, M.; Waddell, S. J.; Rojas, A. M.; Doherty, A. J.; Blázquez, J.

    2017-01-01

    Mismatch repair (MMR) is a near ubiquitous pathway, essential for the maintenance of genome stability. Members of the MutS and MutL protein families perform key steps in mismatch correction. Despite the major importance of this repair pathway, MutS–MutL are absent in almost all Actinobacteria and many Archaea. However, these organisms exhibit rates and spectra of spontaneous mutations similar to MMR-bearing species, suggesting the existence of an alternative to the canonical MutS–MutL-based MMR. Here we report that Mycobacterium smegmatis NucS/EndoMS, a putative endonuclease with no structural homology to known MMR factors, is required for mutation avoidance and anti-recombination, hallmarks of the canonical MMR. Furthermore, phenotypic analysis of naturally occurring polymorphic NucS in a M. smegmatis surrogate model, suggests the existence of M. tuberculosis mutator strains. The phylogenetic analysis of NucS indicates a complex evolutionary process leading to a disperse distribution pattern in prokaryotes. Together, these findings indicate that distinct pathways for MMR have evolved at least twice in nature. PMID:28128207

  13. HEREDITARY, SPORADIC AND METASTATIC COLORECTAL CANCER ARE COMMONLY DRIVEN BY SPECIFIC SPECTRUMS OF DEFECTIVE DNA MISMATCH REPAIR COMPONENTS

    PubMed Central

    CARETHERS, JOHN M.

    2016-01-01

    DNA mismatch repair (MMR) is one of several human cell mechanisms utilized to repair mutable mistakes within DNA, particularly after DNA is replicated. MMR function is dependent upon heterodimerization of specific MMR proteins that can recognize base-base mispairs as well as frameshifts at microsatellite sequences, followed by the triggering of other complementary proteins that execute excision and repair or initiate cell demise if repair is futile. MMR function is compromised in specific disease states, all of which can be biochemically recognized by faulty repair of microsatellite sequences, causing microsatellite instability. Germline mutation of an MMR gene causes Lynch syndrome, the most common inherited form of colorectal cancer (CRC), and biallelic germline mutations cause the rare constitutional mismatch repair deficiency syndrome. Somatic inactivation of MMR through epigenetic mechanisms is observed in 15% of sporadic CRC, and a smaller portion of CRCs possess biallelic somatic mutations. A novel inflammation-driven nuclear-to-cytoplasmic shift of the specific MMR protein hMSH3 is seen in up to 60% of sporadic CRCs that associates with metastasis and poor patient prognosis, unlike improved outcome when MMR is genetically inactivated. The mechanism for MMR inactication as well as the component affected dictates the clinical spectrum and clinical response for patients. PMID:28066040

  14. Mismatch binding, ADP-ATP exchange and intramolecular signaling during mismatch repair

    PubMed Central

    Hingorani, Manju M.

    2015-01-01

    The focus of this article is on the DNA binding and ATPase activities of the mismatch repair (MMR) protein, MutS—our current understanding of how this protein uses ATP to fuel its actions on DNA and initiate repair via interactions with MutL, the next protein in the pathway. Structure-function and kinetic studies have yielded detailed views of the MutS mechanism of action in MMR. How MutS and MutL work together after mismatch recognition to enable strand-specific nicking, which leads to strand excision and synthesis, is less clear and remains an active area of investigation. PMID:26704427

  15. MUTYH and the mismatch repair system: partners in crime?

    PubMed

    Niessen, Renée C; Sijmons, Rolf H; Ou, J; Olthof, Sandra G M; Osinga, Jan; Ligtenberg, Marjolijn J; Hogervorst, Frans B L; Weiss, Marjan M; Tops, Carli M J; Hes, Frederik J; de Bock, Geertruida H; Buys, Charles H C M; Kleibeuker, Jan H; Hofstra, Robert M W

    2006-03-01

    Biallelic germline mutations of MUTYH-a gene encoding a base excision repair protein-are associated with an increased susceptibility of colorectal cancer. Whether monoallelic MUTYH mutations also increase cancer risk is not yet clear, although there is some evidence suggesting a slight increase of risk. As the MUTYH protein interacts with the mismatch repair (MMR) system, we hypothesised that the combination of a monoallelic MUTYH mutation with an MMR gene mutation increases cancer risk. We therefore investigated the prevalence of monoallelic MUTYH mutations in carriers of a germline MMR mutation: 40 carriers of a truncating mutation (group I) and 36 of a missense mutation (group II). These patients had been diagnosed with either colorectal or endometrial cancer. We compared their MUTYH mutation frequencies with those observed in a group of 134 Dutch colorectal and endometrial cancer patients without an MMR gene mutation (0.7%) and those reported for Caucasian controls (1.5%). In group I one monoallelic MUTYH mutation was found (2.5%). In group II five monoallelic germline MUTYH mutations were found (14%), four of them in MSH6 missense mutation carriers (20%). Of all patients with an MMR gene mutation, only those with a missense mutation showed a significantly higher frequency of (monoallelic) MUTYH mutations than the Dutch cancer patients without MMR gene mutations (P = 0.002) and the published controls (P = 0.001). These results warrant further study to test the hypothesis of mutations in MMR genes (in particular MSH6) and MUTYH acting together to increase cancer risk.

  16. Purification, crystallization and preliminary X-ray diffraction analysis of the human mismatch repair protein MutS[beta

    SciTech Connect

    Tseng, Quincy; Orans, Jillian; Hast, Michael A.; Iyer, Ravi R.; Changela, Anita; Modrich, Paul L.; Beese, Lorena S.

    2012-03-16

    MutS{beta} is a eukaryotic mismatch repair protein that preferentially targets extrahelical unpaired nucleotides and shares partial functional redundancy with MutS{alpha} (MSH2-MSH6). Although mismatch recognition by MutS{alpha} has been shown to involve a conserved Phe-X-Glu motif, little is known about the lesion-binding mechanism of MutS{beta}. Combined MSH3/MSH6 deficiency triggers a strong predisposition to cancer in mice and defects in msh2 and msh6 account for roughly half of hereditary nonpolyposis colorectal cancer mutations. These three MutS homologs are also believed to play a role in trinucleotide repeat instability, which is a hallmark of many neurodegenerative disorders. The baculovirus overexpression and purification of recombinant human MutS{beta} and three truncation mutants are presented here. Binding assays with heteroduplex DNA were carried out for biochemical characterization. Crystallization and preliminary X-ray diffraction analysis of the protein bound to a heteroduplex DNA substrate are also reported.

  17. The DNA mismatch repair protein MutS forms a one-dimensional Tonks gas on DNA

    NASA Astrophysics Data System (ADS)

    Bundschuh, Ralf; Klajner, Piotr; Hanne, Jeungphill; Britton, Brooke M.; Liu, Jianquan; Park, Jonghyun; Lee, Jong-Bong; Fishel, Richard

    2014-03-01

    MutS is a protein involved in DNA mismatch repair. It recognizes the mismatch, forms a sliding clamp around the DNA, and displaces other proteins bound to the DNA prior to the actual repair process. Here, we present a quantitative model of an ensemble of MutS molecules on a short strand of DNA with one mismatch. We model the ensemble as a Tonks gas of passively diffusing one-dimensional particles of finite extension and include clamp formation at the mismatch and random detachment. The distributions of MutS number bound to the DNA for different mismatch positions and different MutS concentrations in solution fit very well with distributions determined by single molecule experiments, thereby establishing the Tonks gas as an excellent model of MutS action on DNA. This material is based upon work supported by the National Science Foundation under Grant No. 01105458 (RB), the National Institutes of Health under Grant No. CA67007 (RF), and the National Research Foundation of Korea under Grant No. 2011-0013901 (JBL).

  18. Molecular patterns in deficient mismatch repair colorectal tumours: results from a French prospective multicentric biological and genetic study

    PubMed Central

    Etienne-Grimaldi, M-C; Mahamat, A; Chazal, M; Laurent-Puig, P; Olschwang, S; Gaub, M-P; Formento, J-L; Formento, P; Sudaka, A; Boige, V; Abderrahim-Ferkoune, A; Benchimol, D; André, T; Houry, S; Faucheron, J-L; Letoublon, C; Gilly, F-N; Delpero, J-R; Lasser, P; Pradere, B; Pezet, D; Penault-Llorca, F; Milano, G

    2014-01-01

    Background: To test the prognostic value of tumour protein and genetic markers in colorectal cancer (CRC) and examine whether deficient mismatch repair (dMMR) tumours had a distinct profile relative to proficient mismatch repair (pMMR) tumours. Methods: This prospective multicentric study involved 251 stage I–III CRC patients. Analysed biomarkers were EGFR (binding assay), VEGFA, thymidylate synthase (TS), thymidine phosphorylase (TP) and dihydropyrimidine dehydrogenase (DPD) expressions, MMR status, mutations of KRAS (codons 12–13), BRAF (V600E), PIK3CA (exons 9 and 20), APC (exon 15) and P53 (exons 4–9), CpG island methylation phenotype status, ploidy, S-phase, LOH. Results: The only significant predictor of relapse-free survival (RFS) was tumour staging. Analyses restricted to stage III showed a trend towards a shorter RFS in KRAS-mutated (P=0.005), BRAF wt (P=0.009) and pMMR tumours (P=0.036). Deficient mismatch repair tumours significantly demonstrated higher TS (median 3.1 vs 1.4) and TP (median 5.8 vs 3.5) expression relative to pMMR (P<0.001) and show higher DPD expression (median 14.9 vs 7.9, P=0.027) and EGFR content (median 69 vs 38, P=0.037) relative to pMMR. Conclusions: Present data suggesting that both TS and DPD are overexpressed in dMMR tumours as compared with pMMR tumours provide a strong rationale that may explain the resistance of dMMR tumours to 5FU-based therapy. PMID:24800948

  19. Disease-associated repeat instability and mismatch repair.

    PubMed

    Schmidt, Monika H M; Pearson, Christopher E

    2016-02-01

    Expanded tandem repeat sequences in DNA are associated with at least 40 human genetic neurological, neurodegenerative, and neuromuscular diseases. Repeat expansion can occur during parent-to-offspring transmission, and arise at variable rates in specific tissues throughout the life of an affected individual. Since the ongoing somatic repeat expansions can affect disease age-of-onset, severity, and progression, targeting somatic expansion holds potential as a therapeutic target. Thus, understanding the factors that regulate this mutation is crucial. DNA repair, in particular mismatch repair (MMR), is the major driving force of disease-associated repeat expansions. In contrast to its anti-mutagenic roles, mammalian MMR curiously drives the expansion mutations of disease-associated (CAG)·(CTG) repeats. Recent advances have broadened our knowledge of both the MMR proteins involved in disease repeat expansions, including: MSH2, MSH3, MSH6, MLH1, PMS2, and MLH3, as well as the types of repeats affected by MMR, now including: (CAG)·(CTG), (CGG)·(CCG), and (GAA)·(TTC) repeats. Mutagenic slipped-DNA structures have been detected in patient tissues, and the size of the slip-out and their junction conformation can determine the involvement of MMR. Furthermore, the formation of other unusual DNA and R-loop structures is proposed to play a key role in MMR-mediated instability. A complex correlation is emerging between tissues showing varying amounts of repeat instability and MMR expression levels. Notably, naturally occurring polymorphic variants of DNA repair genes can have dramatic effects upon the levels of repeat instability, which may explain the variation in disease age-of-onset, progression and severity. An increasing grasp of these factors holds prognostic and therapeutic potential.

  20. Dynamics of DNA Mismatch Repair

    NASA Astrophysics Data System (ADS)

    Coats, Julie; Lin, Yuyen; Rasnik, Ivan

    2009-11-01

    DNA mismatch repair protects the genome from spontaneous mutations by recognizing errors, excising damage, and re-synthesizing DNA in a pathway that is highly conserved. Mismatch recognition is accomplished by the MutS family of proteins which are weak ATPases that bind specifically to damaged DNA, but the specific molecular mechanisms by which these proteins recognize damage and initiate excision are not known. Previous structural investigations have implied that protein-induced conformational changes are central to mismatch recognition. Because damage detection is a highly dynamic process in which conformational changes of the protein-DNA complexes occur on a time scale of a few seconds, it is difficult to obtain meaningful kinetic information with traditional ensemble techniques. In this work, we use single molecule fluorescence resonance energy transfer (smFRET) to study the conformational dynamics of fluorescently labeled DNA substrates in the presence of the mismatch repair protein MutS from E. coli and its human homolog MSH2/MSH6. Our studies allow us to obtain quantitative kinetic information about the rates of binding and dissociation and to determine the conformational states for each protein-DNA complex.

  1. New Therapeutic Opportunities Based on DNA Mismatch Repair and BRAF Status in Metastatic Colorectal Cancer.

    PubMed

    Cohen, Romain; Svrcek, Magali; Dreyer, Chantal; Cervera, Pascale; Duval, Alex; Pocard, Marc; Fléjou, Jean-François; de Gramont, Aimery; André, Thierry

    2016-03-01

    Recently, colorectal cancer (CRC) subtyping consortium identified four consensus molecular subtypes (CMS1-4). CMS1 is enriched for deficient mismatch repair (dMMR) and BRAF (V600E) tumors. Intriguingly, this subtype has better relapse-free survival but worse overall survival after relapse compared with the other subtypes. Growing evidence is accumulating on the benefit of specific therapeutic strategies such as immune checkpoint inhibition therapy in dMMR tumors and mitogen-activated protein kinase (MAPK) pathway targeted therapy in tumors harboring BRAF (V600E) mutation. After reviewing dMMR prognostic value, immune checkpoints as major targets for dMMR carcinomas will be highlighted. Following, BRAF (V600E) prognostic impact will be reviewed and therapeutic strategies with the combination of cytotoxic agents and especially the combinations of BRAF and MAPK inhibitors will be discussed.

  2. Evidence that the DNA mismatch repair system removes 1-nucleotide Okazaki fragment flaps.

    PubMed

    Kadyrova, Lyudmila Y; Dahal, Basanta K; Kadyrov, Farid A

    2015-10-02

    The DNA mismatch repair (MMR) system plays a major role in promoting genome stability and suppressing carcinogenesis. In this work, we investigated whether the MMR system is involved in Okazaki fragment maturation. We found that in the yeast Saccharomyces cerevisiae, the MMR system and the flap endonuclease Rad27 act in overlapping pathways that protect the nuclear genome from 1-bp insertions. In addition, we determined that purified yeast and human MutSα proteins recognize 1-nucleotide DNA and RNA flaps. In reconstituted human systems, MutSα, proliferating cell nuclear antigen, and replication factor C activate MutLα endonuclease to remove the flaps. ATPase and endonuclease mutants of MutLα are defective in the flap removal. These results suggest that the MMR system contributes to the removal of 1-nucleotide Okazaki fragment flaps.

  3. Mismatch repair during homologous and homeologous recombination.

    PubMed

    Spies, Maria; Fishel, Richard

    2015-03-02

    Homologous recombination (HR) and mismatch repair (MMR) are inextricably linked. HR pairs homologous chromosomes before meiosis I and is ultimately responsible for generating genetic diversity during sexual reproduction. HR is initiated in meiosis by numerous programmed DNA double-strand breaks (DSBs; several hundred in mammals). A characteristic feature of HR is the exchange of DNA strands, which results in the formation of heteroduplex DNA. Mismatched nucleotides arise in heteroduplex DNA because the participating parental chromosomes contain nonidentical sequences. These mismatched nucleotides may be processed by MMR, resulting in nonreciprocal exchange of genetic information (gene conversion). MMR and HR also play prominent roles in mitotic cells during genome duplication; MMR rectifies polymerase misincorporation errors, whereas HR contributes to replication fork maintenance, as well as the repair of spontaneous DSBs and genotoxic lesions that affect both DNA strands. MMR suppresses HR when the heteroduplex DNA contains excessive mismatched nucleotides, termed homeologous recombination. The regulation of homeologous recombination by MMR ensures the accuracy of DSB repair and significantly contributes to species barriers during sexual reproduction. This review discusses the history, genetics, biochemistry, biophysics, and the current state of studies on the role of MMR in homologous and homeologous recombination from bacteria to humans.

  4. Mismatch Repair during Homologous and Homeologous Recombination

    PubMed Central

    Spies, Maria; Fishel, Richard

    2015-01-01

    Homologous recombination (HR) and mismatch repair (MMR) are inextricably linked. HR pairs homologous chromosomes before meiosis I and is ultimately responsible for generating genetic diversity during sexual reproduction. HR is initiated in meiosis by numerous programmed DNA double-strand breaks (DSBs; several hundred in mammals). A characteristic feature of HR is the exchange of DNA strands, which results in the formation of heteroduplex DNA. Mismatched nucleotides arise in heteroduplex DNA because the participating parental chromosomes contain nonidentical sequences. These mismatched nucleotides may be processed by MMR, resulting in nonreciprocal exchange of genetic information (gene conversion). MMR and HR also play prominent roles in mitotic cells during genome duplication; MMR rectifies polymerase misincorporation errors, whereas HR contributes to replication fork maintenance, as well as the repair of spontaneous DSBs and genotoxic lesions that affect both DNA strands. MMR suppresses HR when the heteroduplex DNA contains excessive mismatched nucleotides, termed homeologous recombination. The regulation of homeologous recombination by MMR ensures the accuracy of DSB repair and significantly contributes to species barriers during sexual reproduction. This review discusses the history, genetics, biochemistry, biophysics, and the current state of studies on the role of MMR in homologous and homeologous recombination from bacteria to humans. PMID:25731766

  5. Native mass spectrometry provides direct evidence for DNA mismatch-induced regulation of asymmetric nucleotide binding in mismatch repair protein MutS.

    PubMed

    Monti, Maria Chiara; Cohen, Serge X; Fish, Alexander; Winterwerp, Herrie H K; Barendregt, Arjan; Friedhoff, Peter; Perrakis, Anastassis; Heck, Albert J R; Sixma, Titia K; van den Heuvel, Robert H H; Lebbink, Joyce H G

    2011-10-01

    The DNA mismatch repair protein MutS recognizes mispaired bases in DNA and initiates repair in an ATP-dependent manner. Understanding of the allosteric coupling between DNA mismatch recognition and two asymmetric nucleotide binding sites at opposing sides of the MutS dimer requires identification of the relevant MutS.mmDNA.nucleotide species. Here, we use native mass spectrometry to detect simultaneous DNA mismatch binding and asymmetric nucleotide binding to Escherichia coli MutS. To resolve the small differences between macromolecular species bound to different nucleotides, we developed a likelihood based algorithm capable to deconvolute the observed spectra into individual peaks. The obtained mass resolution resolves simultaneous binding of ADP and AMP.PNP to this ABC ATPase in the absence of DNA. Mismatched DNA regulates the asymmetry in the ATPase sites; we observe a stable DNA-bound state containing a single AMP.PNP cofactor. This is the first direct evidence for such a postulated mismatch repair intermediate, and showcases the potential of native MS analysis in detecting mechanistically relevant reaction intermediates.

  6. Synergism of Dam, MutH, and MutS in methylation-directed mismatch repair in Escherichia coli.

    PubMed

    Hu, Changkun; Zhao, Yunqi; Sun, Huiyun; Yang, Yixin

    2017-01-01

    DNA mismatch repair (MMR) is a critical mutation surveillance system for recognizing and repairing erroneous insertion, deletion, and disincorporation of base. Major components of mismatch repair system consist of MutH, MutL, and MutS. Dam methylates adenine to distinguish newly synthesized daughter strands from the parent strands. Employing a tyrosine-auxotrophic E. coli FX-11 strain, the mutation frequency can be determined by the number of tyrosine revertants and the cell viability of FX-11 with deficiencies in dam and mismatch repair proteins. This study showed that mutS defect produced a higher mutation frequency than mutH did. Interestingly, double defects in dam and mutS synergistically produced a dramatically higher spontaneous mutation frequency than the summation of mutation frequencies of FX-11 strains with individual deficiency of dam or mutS, suggesting that Dam may work with MutHL to partially accomplish the task of recognizing the mismatch sites to retain partial mismatch repair capacity.

  7. Eukaryotic Mismatch Repair in Relation to DNA Replication.

    PubMed

    Kunkel, Thomas A; Erie, Dorothy A

    2015-01-01

    Three processes act in series to accurately replicate the eukaryotic nuclear genome. The major replicative DNA polymerases strongly prevent mismatch formation, occasional mismatches that do form are proofread during replication, and rare mismatches that escape proofreading are corrected by mismatch repair (MMR). This review focuses on MMR in light of increasing knowledge about nuclear DNA replication enzymology and the rate and specificity with which mismatches are generated during leading- and lagging-strand replication. We consider differences in MMR efficiency in relation to mismatch recognition, signaling to direct MMR to the nascent strand, mismatch removal, and the timing of MMR. These studies are refining our understanding of relationships between generating and repairing replication errors to achieve accurate replication of both DNA strands of the nuclear genome.

  8. Crosstalk between BRCA-Fanconi anemia and mismatch repair pathways prevents MSH2-dependent aberrant DNA damage responses.

    PubMed

    Peng, Min; Xie, Jenny; Ucher, Anna; Stavnezer, Janet; Cantor, Sharon B

    2014-08-01

    Several proteins in the BRCA-Fanconi anemia (FA) pathway, such as FANCJ, BRCA1, and FANCD2, interact with mismatch repair (MMR) pathway factors, but the significance of this link remains unknown. Unlike the BRCA-FA pathway, the MMR pathway is not essential for cells to survive toxic DNA interstrand crosslinks (ICLs), although MMR proteins bind ICLs and other DNA structures that form at stalled replication forks. We hypothesized that MMR proteins corrupt ICL repair in cells that lack crosstalk between BRCA-FA and MMR pathways. Here, we show that ICL sensitivity of cells lacking the interaction between FANCJ and the MMR protein MLH1 is suppressed by depletion of the upstream mismatch recognition factor MSH2. MSH2 depletion suppresses an aberrant DNA damage response, restores cell cycle progression, and promotes ICL resistance through a Rad18-dependent mechanism. MSH2 depletion also suppresses ICL sensitivity in cells deficient for BRCA1 or FANCD2, but not FANCA. Rescue by Msh2 loss was confirmed in Fancd2-null primary mouse cells. Thus, we propose that regulation of MSH2-dependent DNA damage response underlies the importance of interactions between BRCA-FA and MMR pathways.

  9. Exonic deletions of mismatch repair genes MLH1 and MSH2 correlate with prognosis and protein expression levels in malignant melanomas.

    PubMed

    Korabiowska, Monika; Brinck, Ulrich; Stachura, Jerzy; Jawien, Jacek; Hasse, Frank Michael; Cordon-Cardos, Carlos; Fischer, Gösta

    2006-01-01

    The mutations of MLH1 and MSH2 have been reported to be responsible for malignant transformation and tumour progression in several sporadic tumours. Eighty-six primary malignant melanomas with known follow-up were investigated. Point mutations of DNA mismatch repair MLH1 and MSH2 in malignant melanomas were not found. Exon 12 (MSH2) was not present in 26 out of the 86 melanomas and exon 13 (MSH2) was lost in 25 of the tumours. The loss of exon 15 (MLH1) was observed in 22 out of the 86 tumours and the loss of exon 16 (MLH1) in 24 melanomas. The loss of exons correlated strongly with the loss of MLH1 and MSH2 protein expression. In multivariate analysis, including all 4 exons and expressions of MLH1 and MSH2, prognostic significance was found only for loss of exon 12 (MSH2) and loss of exon 15 (MLH1).

  10. Lynch Syndrome from a surgeon perspective: retrospective study of clinical impact of mismatch repair protein expression analysis in colorectal cancer patients less than 50 years old

    PubMed Central

    2014-01-01

    Background In clinical practice, unexpected diagnosis of colorectal cancer in young patients requires prompt surgery, thus genetic testing for Lynch Syndrome is frequently missed, and clinical management may result incorrect. Methods Patients younger than 50 years old undergoing colorectal resection for cancer in the period 1994-2007 were identified (Group A, 49 cases), and compared to a group of randomly selected patients more than 50 (Group B, 85 cases). In 31 group A patients, immunohistochemical expression analysis of MLH1, MSH2 and MSH6 was performed; personal and familial history of patients with defective MMR proteins expression was further investigated, searching for synchronous and metachronous tumors in probands and their families. Results Fifty-one percent of patients did not express one or more MMR proteins (MMR-) and should be considered Lynch Syndrome carriers (16 patients, group A1); while only 31.2% of them were positive for Amsterdam criteria, 50% had almost another tumor, 37.5% had another colorectal tumor and 68% had relatives with colorectal tumor. This group of patients, compared with A2 group (< 50 years old, MMR+) and B group, showed typical characteristics of HNPCC, such as proximal location, mucinous histotype, poor differentiation, high stage and shorter survival. Conclusions The present study confirms that preoperative knowledge of MMR proteins expression in colorectal cancer patients would allow correct staging, more extended colonic resection, specific follow-up and familial screening. PMID:24533633

  11. LNA modification of single-stranded DNA oligonucleotides allows subtle gene modification in mismatch-repair-proficient cells.

    PubMed

    van Ravesteyn, Thomas W; Dekker, Marleen; Fish, Alexander; Sixma, Titia K; Wolters, Astrid; Dekker, Rob J; Te Riele, Hein P J

    2016-04-12

    Synthetic single-stranded DNA oligonucleotides (ssODNs) can be used to generate subtle genetic modifications in eukaryotic and prokaryotic cells without the requirement for prior generation of DNA double-stranded breaks. However, DNA mismatch repair (MMR) suppresses the efficiency of gene modification by >100-fold. Here we present a commercially available ssODN design that evades MMR and enables subtle gene modification in MMR-proficient cells. The presence of locked nucleic acids (LNAs) in the ssODNs at mismatching bases, or also at directly adjacent bases, allowed 1-, 2-, or 3-bp substitutions in MMR-proficient mouse embryonic stem cells as effectively as in MMR-deficient cells. Additionally, in MMR-proficient Escherichia coli, LNA modification of the ssODNs enabled effective single-base-pair substitution. In vitro, LNA modification of mismatches precluded binding of purified E. coli MMR protein MutS. These findings make ssODN-directed gene modification particularly well suited for applications that require the evaluation of a large number of sequence variants with an easy selectable phenotype.

  12. LNA modification of single-stranded DNA oligonucleotides allows subtle gene modification in mismatch-repair-proficient cells

    PubMed Central

    van Ravesteyn, Thomas W.; Dekker, Marleen; Fish, Alexander; Sixma, Titia K.; Wolters, Astrid; Dekker, Rob J.; te Riele, Hein P. J.

    2016-01-01

    Synthetic single-stranded DNA oligonucleotides (ssODNs) can be used to generate subtle genetic modifications in eukaryotic and prokaryotic cells without the requirement for prior generation of DNA double-stranded breaks. However, DNA mismatch repair (MMR) suppresses the efficiency of gene modification by >100-fold. Here we present a commercially available ssODN design that evades MMR and enables subtle gene modification in MMR-proficient cells. The presence of locked nucleic acids (LNAs) in the ssODNs at mismatching bases, or also at directly adjacent bases, allowed 1-, 2-, or 3-bp substitutions in MMR-proficient mouse embryonic stem cells as effectively as in MMR-deficient cells. Additionally, in MMR-proficient Escherichia coli, LNA modification of the ssODNs enabled effective single-base-pair substitution. In vitro, LNA modification of mismatches precluded binding of purified E. coli MMR protein MutS. These findings make ssODN-directed gene modification particularly well suited for applications that require the evaluation of a large number of sequence variants with an easy selectable phenotype. PMID:26951689

  13. Involvement of p53 mutation and mismatch repair proteins dysregulation in NNK-induced malignant transformation of human bronchial epithelial cells.

    PubMed

    Shen, Ying; Zhang, Shuilian; Huang, Xiaobin; Chen, Kailin; Shen, Jing; Wang, Zhengyang

    2014-01-01

    Genome integrity is essential for normal cellular functions and cell survival. Its instability can cause genetic aberrations and is considered as a hallmark of most cancers. To investigate the carcinogenesis process induced by tobacco-specific carcinogen NNK, we studied the dynamic changes of two important protectors of genome integrity, p53 and MMR system, in malignant transformation of human bronchial epithelial cells after NNK exposure. Our results showed that the expression of MLH1, one of the important MMR proteins, was decreased early and maintained the downregulation during the transformation in a histone modification involved and DNA methylation-independent manner. Another MMR protein PMS2 also displayed a declined expression while being in a later stage of transformation. Moreover, we conducted p53 mutation analysis and revealed a mutation at codon 273 which led to the replacement of arginine by histidine. With the mutation, DNA damage-induced activation of p53 was significantly impaired. We further reintroduced the wild-type p53 into the transformed cells, and the malignant proliferation can be abrogated by inducing cell cycle arrest and apoptosis. These findings indicate that p53 and MMR system play an important role in the initiation and progression of NNK-induced transformation, and p53 could be a potential therapeutic target for tobacco-related cancers.

  14. Mismatch Repair Proficiency and In Vitro Response to 5-Fluorouracil

    PubMed Central

    CARETHERS, JOHN M.; CHAUHAN, DHARAM P.; FINK, DANIEL; NEBEL, SIBYLLE; BRESALIER, ROBERT S.; HOWELL, STEPHEN B.; BOLAND, C. RICHARD

    2015-01-01

    Background & Aims The DNA mismatch repair (MMR) system recognizes certain DNA adducts caused by alkylation damage in addition to its role in recognizing and directing repair of interstrand nucleotide mismatches and slippage mistakes at microsatellite sequences. Because defects in the MMR system can confer tolerance to acquired DNA damage and, by inference, the toxic effects of certain chemotherapeutic agents, we investigated the effect of 5-fluorouracil (5-FU) on colon cancer cell lines. Methods We determined growth selection by cell enrichment assay and cloning efficiency after treatment with 5 μmol/L 5-FU, assayed nucleic 3H–5-FU incorporation, and analyzed the cell cycle by flow cytometry. Results 5-FU treatment provided a growth advantage for MMR-deficient cell lines, indicating a relative degree of tolerance to 5-FU by the MMR-deficient cell lines. Enhanced survival was statistically significant after 5 days of growth, and a 28-fold reduction in survival was noted in the MMR-proficient cells by clonagenic assays after 10 days of growth. Differences in nucleotide uptake of 5-FU did not account for the observed growth differences, and specific cell cycle checkpoint arrest was not detected. Conclusions Intact DNA MMR seems to recognize 5-FU incorporated into DNA but may do so in a different manner than other types of alkylation damage. Defective DNA MMR might be one mechanism for tumor resistance to 5-FU. PMID:10381918

  15. Mouse models of DNA mismatch repair in cancer research

    PubMed Central

    Lee, Kyeryoung; Tosti, Elena; Edelmann, Winfried

    2016-01-01

    Germline mutations in DNA mismatch repair (MMR) genes are the cause of hereditary non-polyposis colorectal cancer/Lynch syndrome (HNPCC/LS) one of the most common cancer predisposition syndromes, and defects in MMR are also prevalent in sporadic colorectal cancers. In the past, the generation and analysis of mouse lines with knockout mutations in all of the known MMR genes has provided insight into how loss of individual MMR genes affects genome stability and contributes to cancer susceptibility. These studies also revealed essential functions for some of the MMR genes in B cell maturation and fertility. In this review, we will provide a brief overview of the cancer predisposition phenotypes of recently developed mouse models with targeted mutations in MutS and MutL homologs (Msh and Mlh, respectively) and their utility as preclinical models. The focus will be on mouse lines with conditional MMR mutations that have allowed more accurate modeling of human cancer syndromes in mice and that together with new technologies in gene targeting, hold great promise for the analysis of MMR-deficient intestinal tumors and other cancers which will drive the development of preventive and therapeutic treatment strategies. PMID:26708047

  16. Mouse models of DNA mismatch repair in cancer research.

    PubMed

    Lee, Kyeryoung; Tosti, Elena; Edelmann, Winfried

    2016-02-01

    Germline mutations in DNA mismatch repair (MMR) genes are the cause of hereditary non-polyposis colorectal cancer/Lynch syndrome (HNPCC/LS) one of the most common cancer predisposition syndromes, and defects in MMR are also prevalent in sporadic colorectal cancers. In the past, the generation and analysis of mouse lines with knockout mutations in all of the known MMR genes has provided insight into how loss of individual MMR genes affects genome stability and contributes to cancer susceptibility. These studies also revealed essential functions for some of the MMR genes in B cell maturation and fertility. In this review, we will provide a brief overview of the cancer predisposition phenotypes of recently developed mouse models with targeted mutations in MutS and MutL homologs (Msh and Mlh, respectively) and their utility as preclinical models. The focus will be on mouse lines with conditional MMR mutations that have allowed more accurate modeling of human cancer syndromes in mice and that together with new technologies in gene targeting, hold great promise for the analysis of MMR-deficient intestinal tumors and other cancers which will drive the development of preventive and therapeutic treatment strategies.

  17. Mismatch Repair Proteins and Microsatellite Instability in Colorectal Carcinoma (MLH1, MSH2, MSH6 and PMS2): Histopathological and Immunohistochemical Study

    PubMed Central

    Ismael, Nour El Hoda S.; El Sheikh, Samar A.; Talaat, Suzan M.; Salem, Eman M.

    2017-01-01

    BACKGROUND: Colorectal cancer (CRC) is one of the most common cancers worldwide. Microsatellite instability (MSI) is detected in about 15% of all colorectal cancers. CRC with MSI has particular characteristics such as improved survival rates and better prognosis. They also have a distinct sensitivity to the action of chemotherapy. AIM: The aim of the study was to detect microsatellite instability in a cohort of colorectal cancer Egyptian patients using the immunohistochemical expression of mismatch repair proteins (MLH1, MSH2, MSH6 and PMS2). MATERIAL AND METHODS: Cases were divided into Microsatellite stable (MSS), Microsatellite unstable low (MSI-L) and Microsatellite unstable high (MSI-H). This Microsatellite stability status was correlated with different clinicopathological parameters. RESULTS: There was a statistically significant correlation between the age of cases, tumor site & grade and the microsatellite stability status. There was no statistically significant correlation between the gender of patients, tumor subtype, stage, mucoid change, necrosis, tumor borders, lymphocytic response, lymphovascular emboli and the microsatellite stability status. CONCLUSION: Testing for MSI should be done for all colorectal cancer patients, especially those younger than 50 years old, right sided and high-grade CRCs. PMID:28293308

  18. Mismatch repair status may predict response to adjuvant chemotherapy in resectable pancreatic ductal adenocarcinoma.

    PubMed

    Riazy, Maziar; Kalloger, Steve E; Sheffield, Brandon S; Peixoto, Renata D; Li-Chang, Hector H; Scudamore, Charles H; Renouf, Daniel J; Schaeffer, David F

    2015-10-01

    Deficiencies in DNA mismatch repair have been associated with inferior response to 5-FU in colorectal cancer. Pancreatic ductal adenocarcinoma is similarly treated with pyrimidine analogs, yet the predictive value of mismatch repair status for response to these agents has not been examined in this malignancy. A tissue microarray with associated clinical outcome, comprising 254 resected pancreatic ductal adenocarcinoma patients was stained for four mismatch repair proteins (MLH1, MSH2, MSH6 and PMS2). Mismatch repair deficiency and proficiency was determined by the absence or presence of uniform nuclear staining in tumor cells, respectively. Cases identified as mismatch repair deficient on the tissue microarray were confirmed by immunohistochemistry on whole slide sections. Of the 265 cases, 78 (29%) received adjuvant treatment with a pyrimidine analog and 41 (15%) showed a mismatch repair-deficient immunoprofile. Multivariable disease-specific survival in the mismatch repair-proficient cohort demonstrated that adjuvant chemotherapy, regional lymph-node status, gender, and the presence of tumor budding were significant independent prognostic variables (P≤0.04); however, none of the eight clinico-pathologic covariates examined in the mismatch repair-deficient cohort were of independent prognostic significance. Univariable assessment of disease-specific survival revealed an almost identical survival profile for both treated and untreated patients with a mismatch repair-deficient profile, while treatment in the mismatch repair-proficient cohort conferred a greater than 10-month median disease-specific survival advantage over their untreated counterparts (P=0.0018). In this cohort, adjuvant chemotherapy with a pyrimidine analog conferred no survival advantage to mismatch repair-deficient pancreatic ductal adenocarcinoma patients. Mismatch repair immunoprofiling is a feasible predictive marker in pancreatic ductal adenocarcinoma patients, and further prospective

  19. Genome Wide In silico Analysis of the Mismatch Repair Components of Plasmodium falciparum and Their Comparison with Human Host

    PubMed Central

    Tarique, Mohammed; Ahmad, Moaz; Chauhan, Manish; Tuteja, Renu

    2017-01-01

    Malaria a major parasitic infection globally particularly in tropical and sub-tropical regions of the world is responsible for about 198 million cases and estimated deaths due to this disease are about 0.6 million. The emergence of drug resistance in the malaria parasite is alarming and it is necessary to understand its underlying cause and molecular mechanisms. It has been established that drug resistant malaria parasites have defective mismatch repair (MMR) therefore it is essential to study this pathway and its components in detail. Recently a number of non-synonymous Single Nucleotide Polymorphisms have been reported in genes involved in MMR pathways. PfMLH is an endonuclease essential to restore the MMR in drug resistant strains of Plasmodium falciparum. Considering all these facts about the role of MMR in emergence of drug resistant parasite, in this manuscript we report a genome wide analysis of the components of the MMR pathway such as MLH, Pms1, MSH2-1, MSH2-2, MSH6, and UvrD using in silico bioinformatics based approaches. The phylogenetic analysis revealed evolutionary closeness with the MMR components of various organisms. It is noteworthy that P. falciparum contains two homologs of MSH2, which are located on different chromosomes. The structural modeling of these components showed their similarity with the human/yeast MMR components. The docking studies reveal that PfUvrD and PfMLH interact with each other. The in silico identification of interacting partners of the major MMR components identified numerous P. falciparum specific proteins. In line with our previous studies the present study will also contribute significantly to understand the MMR pathway of malaria parasite. PMID:28232818

  20. Screening for germline mismatch repair mutations following diagnosis of sebaceous neoplasm.

    PubMed

    Everett, Jessica N; Raymond, Victoria M; Dandapani, Monica; Marvin, Monica; Kohlmann, Wendy; Chittenden, Anu; Koeppe, Erika; Gustafson, Shanna L; Else, Tobias; Fullen, Douglas R; Johnson, Timothy M; Syngal, Sapna; Gruber, Stephen B; Stoffel, Elena M

    2014-12-01

    IMPORTANCE Sebaceous neoplasms (SNs) define the Muir-Torre syndrome variant of Lynch syndrome (LS), which is associated with increased risk for colon and other cancers necessitating earlier and more frequent screening to reduce morbidity and mortality.Immunohistochemical (IHC) staining for mismatch repair (MMR) proteins in SNs can be used to screen for LS, but data on subsequent germline genetic testing to confirm LS diagnosis are limited.OBJECTIVE To characterize the utility of IHC screening of SNs in identification of germline MMR mutations confirming LS.DESIGN, SETTING, AND PARTICIPANTS Retrospective study at 2 academic cancer centers of 86 adult patients referred for clinical genetics evaluation after diagnosis of SN.MAIN OUTCOMES AND MEASURES Results of tumor IHC testing and germline genetic testing were reviewed to determine positive predictive value and sensitivity of IHC testing in diagnosis of LS. Clinical variables, including age at diagnosis of SN, clinical diagnostic criteria for LS and Muir-Torre syndrome, and family history characteristics were compared between mutation carriers and noncarriers.RESULTS Of 86 patients with SNs, 25 (29%) had germline MMR mutations confirming LS.Among 77 patients with IHC testing on SNs, 38 (49%) had loss of staining of 1 or more MMR proteins and 14 had germline MMR mutations. Immunohistochemical analysis correctly identified 13 of 16 MMR mutation carriers, corresponding to 81% sensitivity. Ten of 12 patients(83%) with more than 1 SN had MMR mutations. Fifty-two percent of MMR mutation carriers did not meet clinical diagnostic criteria for LS, and 11 of 25 (44%) did not meet the clinical definition of Muir-Torre syndrome. CONCLUSIONS AND RELEVANCE Immunohistochemical screening of SNs is effective in identifying patients with germline MMR mutations and can be used as a first-line test when LSis suspected. Abnormal IHC results, including absence of MSH2, are not diagnostic of LS and should be interpreted cautiously in

  1. Biomarkers for immune therapy in colorectal cancer: mismatch-repair deficiency and others

    PubMed Central

    Bupathi, Manojkumar

    2016-01-01

    Colorectal cancer (CRC) is a heterogeneous disease for which the treatment backbone has primarily been cytotoxic chemotherapy. With better understanding of the involved molecular mechanisms, it is now known that there are a number of epigenetic and genetic events, which are involved in CRC pathogenesis. Specific biomarkers have been identified which can be used to determine the clinical outcome of patients beyond tumor staging and predict for treatment efficacy. Molecular testing is now routinely performed to select for patients that will benefit the most from targeted agents and immunotherapy. In addition to KRAS, NRAS, and BRAF mutation (MT), analysis of DNA mismatch repair (MMR) status, tumor infiltrating lymphocytes, and checkpoint protein expression may be helpful to determine whether patients are eligible for certain therapies. The focus of this article is to discuss present and upcoming biomarkers for immunotherapy in CRC. PMID:27747085

  2. Mismatch repair genes identified using genetic screens in Blm-deficient embryonic stem cells.

    PubMed

    Guo, Ge; Wang, Wei; Bradley, Allan

    2004-06-24

    Phenotype-driven recessive genetic screens in diploid organisms require a strategy to render the mutation homozygous. Although homozygous mutant mice can be generated by breeding, a reliable method to make homozygous mutations in cultured cells has not been available, limiting recessive screens in culture. Cultured embryonic stem (ES) cells provide access to all of the genes required to elaborate the fundamental components and physiological systems of a mammalian cell. Here we have exploited the high rate of mitotic recombination in Bloom's syndrome protein (Blm)-deficient ES cells to generate a genome-wide library of homozygous mutant cells from heterozygous mutations induced with a revertible gene trap retrovirus. We have screened this library for cells with defects in DNA mismatch repair (MMR), a system that detects and repairs base-base mismatches. We demonstrate the recovery of cells with homozygous mutations in known and novel MMR genes. We identified Dnmt1(ref. 5) as a novel MMR gene and confirmed that Dnmt1-deficient ES cells exhibit micro-satellite instability, providing a mechanistic explanation for the role of Dnmt1 in cancer. The combination of insertional mutagenesis in Blm-deficient ES cells establishes a new approach for phenotype-based recessive genetic screens in ES cells.

  3. DNA Mismatch Repair System: Repercussions in Cellular Homeostasis and Relationship with Aging

    PubMed Central

    Conde-Pérezprina, Juan Cristóbal; León-Galván, Miguel Ángel; Konigsberg, Mina

    2012-01-01

    The mechanisms that concern DNA repair have been studied in the last years due to their consequences in cellular homeostasis. The diverse and damaging stimuli that affect DNA integrity, such as changes in the genetic sequence and modifications in gene expression, can disrupt the steady state of the cell and have serious repercussions to pathways that regulate apoptosis, senescence, and cancer. These altered pathways not only modify cellular and organism longevity, but quality of life (“health-span”). The DNA mismatch repair system (MMR) is highly conserved between species; its role is paramount in the preservation of DNA integrity, placing it as a necessary focal point in the study of pathways that prolong lifespan, aging, and disease. Here, we review different insights concerning the malfunction or absence of the DNA-MMR and its impact on cellular homeostasis. In particular, we will focus on DNA-MMR mechanisms regulated by known repair proteins MSH2, MSH6, PMS2, and MHL1, among others. PMID:23213348

  4. DNA mismatch repair and the DNA damage response

    PubMed Central

    Li, Zhongdao; Pearlman, Alexander H.; Hsieh, Peggy

    2015-01-01

    This review discusses the role of DNA mismatch repair (MMR) in the DNA damage response (DDR) that triggers cell cycle arrest and, in some cases, apoptosis. Although the focus is on findings from mammalian cells, much has been learned from studies in other organisms including bacteria and yeast [1,2]. MMR promotes a DDR mediated by a key signaling kinase, ATM and Rad3-related (ATR), in response to various types of DNA damage including some encountered in widely used chemotherapy regimes. An introduction to the DDR mediated by ATR reveals its immense complexity and highlights the many biological and mechanistic questions that remain. Recent findings and future directions are highlighted. PMID:26704428

  5. Dynamic control of strand excision during human DNA mismatch repair.

    PubMed

    Jeon, Yongmoon; Kim, Daehyung; Martín-López, Juana V; Lee, Ryanggeun; Oh, Jungsic; Hanne, Jeungphill; Fishel, Richard; Lee, Jong-Bong

    2016-03-22

    Mismatch repair (MMR) is activated by evolutionarily conserved MutS homologs (MSH) and MutL homologs (MLH/PMS). MSH recognizes mismatched nucleotides and form extremely stable sliding clamps that may be bound by MLH/PMS to ultimately authorize strand-specific excision starting at a distant 3'- or 5'-DNA scission. The mechanical processes associated with a complete MMR reaction remain enigmatic. The purified human (Homo sapien or Hs) 5'-MMR excision reaction requires the HsMSH2-HsMSH6 heterodimer, the 5' → 3' exonuclease HsEXOI, and the single-stranded binding heterotrimer HsRPA. The HsMLH1-HsPMS2 heterodimer substantially influences 5'-MMR excision in cell extracts but is not required in the purified system. Using real-time single-molecule imaging, we show that HsRPA or Escherichia coli EcSSB restricts HsEXOI excision activity on nicked or gapped DNA. HsMSH2-HsMSH6 activates HsEXOI by overcoming HsRPA/EcSSB inhibition and exploits multiple dynamic sliding clamps to increase tract length. Conversely, HsMLH1-HsPMS2 regulates tract length by controlling the number of excision complexes, providing a link to 5' MMR.

  6. Truncation of the MSH2 C-terminal 60 amino acids disrupts effective DNA mismatch repair and is causative for Lynch syndrome.

    PubMed

    Wielders, Eva; Delzenne-Goette, Elly; Dekker, Rob; van der Valk, Martin; Te Riele, Hein

    2017-04-01

    Missense variants of DNA mismatch repair (MMR) genes pose a problem in clinical genetics as long as they cannot unambiguously be assigned as the cause of Lynch syndrome (LS). To study such variants of uncertain clinical significance, we have developed a functional assay based on direct measurement of MMR activity in mouse embryonic stem cells expressing mutant protein from the endogenous alleles. We have applied this protocol to a specific truncation mutant of MSH2 that removes 60 C-terminal amino acids and has been found in suspected LS families. We show that the stability of the MSH2/MSH6 heterodimer is severely perturbed, causing attenuated MMR in in vitro assays and cancer predisposition in mice. This mutation can therefore unambiguously be considered as deleterious and causative for LS.

  7. Mismatch repair balances leading and lagging strand DNA replication fidelity.

    PubMed

    Lujan, Scott A; Williams, Jessica S; Pursell, Zachary F; Abdulovic-Cui, Amy A; Clark, Alan B; Nick McElhinny, Stephanie A; Kunkel, Thomas A

    2012-01-01

    The two DNA strands of the nuclear genome are replicated asymmetrically using three DNA polymerases, α, δ, and ε. Current evidence suggests that DNA polymerase ε (Pol ε) is the primary leading strand replicase, whereas Pols α and δ primarily perform lagging strand replication. The fact that these polymerases differ in fidelity and error specificity is interesting in light of the fact that the stability of the nuclear genome depends in part on the ability of mismatch repair (MMR) to correct different mismatches generated in different contexts during replication. Here we provide the first comparison, to our knowledge, of the efficiency of MMR of leading and lagging strand replication errors. We first use the strand-biased ribonucleotide incorporation propensity of a Pol ε mutator variant to confirm that Pol ε is the primary leading strand replicase in Saccharomyces cerevisiae. We then use polymerase-specific error signatures to show that MMR efficiency in vivo strongly depends on the polymerase, the mismatch composition, and the location of the mismatch. An extreme case of variation by location is a T-T mismatch that is refractory to MMR. This mismatch is flanked by an AT-rich triplet repeat sequence that, when interrupted, restores MMR to > 95% efficiency. Thus this natural DNA sequence suppresses MMR, placing a nearby base pair at high risk of mutation due to leading strand replication infidelity. We find that, overall, MMR most efficiently corrects the most potentially deleterious errors (indels) and then the most common substitution mismatches. In combination with earlier studies, the results suggest that significant differences exist in the generation and repair of Pol α, δ, and ε replication errors, but in a generally complementary manner that results in high-fidelity replication of both DNA strands of the yeast nuclear genome.

  8. Risk of colorectal cancer for people with a mutation in both a MUTYH and a DNA mismatch repair gene.

    PubMed

    Win, Aung Ko; Reece, Jeanette C; Buchanan, Daniel D; Clendenning, Mark; Young, Joanne P; Cleary, Sean P; Kim, Hyeja; Cotterchio, Michelle; Dowty, James G; MacInnis, Robert J; Tucker, Katherine M; Winship, Ingrid M; Macrae, Finlay A; Burnett, Terrilea; Le Marchand, Loïc; Casey, Graham; Haile, Robert W; Newcomb, Polly A; Thibodeau, Stephen N; Lindor, Noralane M; Hopper, John L; Gallinger, Steven; Jenkins, Mark A

    2015-12-01

    The base excision repair protein, MUTYH, functionally interacts with the DNA mismatch repair (MMR) system. As genetic testing moves from testing one gene at a time, to gene panel and whole exome next generation sequencing approaches, understandin g the risk associated with co-existence of germline mutations in these genes will be important for clinical interpretation and management. From the Colon Cancer Family Registry, we identified 10 carriers who had both a MUTYH mutation (6 with c.1187G>A p.(Gly396Asp), 3 with c.821G>A p.(Arg274Gln), and 1 with c.536A>G p.(Tyr179Cys)) and a MMR gene mutation (3 in MLH1, 6 in MSH2, and 1 in PMS2), 375 carriers of a single (monoallelic) MUTYH mutation alone, and 469 carriers of a MMR gene mutation alone. Of the 10 carriers of both gene mutations, 8 were diagnosed with colorectal cancer. Using a weighted cohort analysis, we estimated that risk of colorectal cancer for carriers of both a MUTYH and a MMR gene mutation was substantially higher than that for carriers of a MUTYH mutation alone [hazard ratio (HR) 21.5, 95% confidence interval (CI) 9.19-50.1; p < 0.001], but not different from that for carriers of a MMR gene mutation alone (HR 1.94, 95% CI 0.63-5.99; p = 0.25). Within the limited power of this study, there was no evidence that a monoallelic MUTYH gene mutation confers additional risk of colorectal cancer for carriers of a MMR gene mutation alone. Our finding suggests MUTYH mutation testing in MMR gene mutation carriers is not clinically informative.

  9. Risk of colorectal cancer for people with a mutation in both a MUTYH and a DNA mismatch repair gene

    PubMed Central

    Win, Aung Ko; Reece, Jeanette C.; Buchanan, Daniel D.; Clendenning, Mark; Young, Joanne P.; Cleary, Sean P.; Kim, Hyeja; Cotterchio, Michelle; Dowty, James G.; MacInnis, Robert J.; Tucker, Katherine M.; Winship, Ingrid M.; Macrae, Finlay A.; Burnett, Terrilea; Le Marchand, Loïc; Casey, Graham; Haile, Robert W.; Newcomb, Polly A.; Thibodeau, Stephen N.; Lindor, Noralane M.; Hopper, John L.; Gallinger, Steven; Jenkins, Mark A.

    2015-01-01

    The base excision repair protein, MUTYH, functionally interacts with the DNA mismatch repair (MMR) system. As genetic testing moves from testing one gene at a time, to gene panel and whole exome next generation sequencing approaches, understanding the risk associated with co-existence of germline mutations in these genes will be important for clinical interpretation and management. From the Colon Cancer Family Registry, we identified 10 carriers who had both a MUTYH mutation (6 with c.1187G>A p.(Gly396Asp), 3 with c.821G>A p.(Arg274Gln), and 1 with c.536A>G p.(Tyr179Cys)) and a MMR gene mutation (3 in MLH1, 6 in MSH2, and 1 in PMS2), 375 carriers of a single (monoallelic) MUTYH mutation alone, and 469 carriers of a MMR gene mutation alone. Of the 10 carriers of both gene mutations, 8 were diagnosed with colorectal cancer. Using a weighted cohort analysis, we estimated that risk of colorectal cancer for carriers of both a MUTYH and a MMR gene mutation was substantially higher than that for carriers of a MUTYH mutation alone [hazard ratio (HR) 21.5, 95 % confidence interval (CI) 9.19–50.1; p < 0.001], but not different from that for carriers of a MMR gene mutation alone (HR 1.94, 95 % CI 0.63–5.99; p = 0.25). Within the limited power of this study, there was no evidence that a monoallelic MUTYH gene mutation confers additional risk of colorectal cancer for carriers of a MMR gene mutation alone. Our finding suggests MUTYH mutation testing in MMR gene mutation carriers is not clinically informative. PMID:26202870

  10. Comparison of the Mismatch Repair System between Primary and Metastatic Colorectal Cancers Using Immunohistochemistry

    PubMed Central

    Jung, Jiyoon; Kang, Youngjin; Lee, Yoo Jin; Kim, Eojin; Ahn, Bokyung; Lee, Eunjung; Kim, Joo Young; Lee, Jeong Hyeon; Lee, Youngseok; Kim, Chul Hwan; Chae, Yang-Seok

    2017-01-01

    Background Colorectal cancer (CRC) is one of the most common malignancies worldwide. Approximately 10%–15% of the CRC cases have defective DNA mismatch repair (MMR) genes. Although the high level of microsatellite instability status is a predictor of favorable outcome in primary CRC, little is known about its frequency and importance in secondary CRC. Immunohistochemical staining (IHC) for MMR proteins (e.g., MLH1, MSH2, MSH6, and PMS2) has emerged as a useful technique to complement polymerase chain reaction (PCR) analyses. Methods In this study, comparison between the MMR system of primary CRCs and paired liver and lung metastatic lesions was done using IHC and the correlation with clinical outcomes was also examined. Results Based on IHC, 7/61 primary tumors (11.4%) showed deficient MMR systems, while 13/61 secondary tumors (21.3%) showed deficiencies. In total, 44 cases showed proficient expression in both the primary and metastatic lesions. Three cases showed deficiencies in both the primary and paired metastatic lesions. In 10 cases, proficient expression was found only in the primary lesions, and not in the corresponding metastatic lesions. In four cases, proficient expression was detected in the secondary tumor, but not in the primary tumor. Conclusions Although each IHC result and the likely defective genes were not exactly matched between the primary and the metastatic tumors, identical results for primary and metastatic lesions were obtained in 77% of the cases (47/61). These data are in agreement with the previous microsatellite detection studies that used PCR and IHC. PMID:28192899

  11. Cyclin E and histone H3 levels are regulated by 5-fluorouracil in a DNA mismatch repair-dependent manner

    PubMed Central

    Chung, Heekyung; Chaudhry, Joy; Lopez, Claudia G

    2010-01-01

    Several studies indicate that the DNA mismatch repair (MMR) system may trigger cytotoxicity upon 5-fluorouracil (5-FU) recognition, but signaling pathways regulated by MMR in response to 5-FU are unknown. We hypothesize that recognition of 5-FU in DNA by MMR proteins trigger specific signaling cascades that results in slowing of the cell cycle and cell death. Whole human genome cDNA microarrays were used to examine relative signaling responses induced in MMR-proficient cells after 5-FU (5 µM) treatment for 24 hours. Analysis revealed 43 pathways differentially affected by 5-FU compared to control (p < 0.05), including cyclin and cell cycle regulation involving G1-S cell cycle transition, activation of Src, MAP K, p53 and base excision repair. In particular, 5-FU upregulated cyclins E1 and E2 (≥1.4-fold) and downregulated cdc25C, cyclins B1 and B2, histone H2A, H2B and H3 (≤-1.4-fold) over control. Cell cycle analysis revealed a G1/S arrest by 5-FU that was congruent with increased cyclin E and decreased cdc25C protein expression. Importantly, with knockdown of hMLH1 and hMSH2, we observed that decreased histone H3 expression by 5-FU was dependent on hMLH1. Additionally, 5-FU treatment dramatically decreased levels of several histone H3 modifications. Our data suggest that 5-FU induces a G1/S arrest by regulating cyclin E and cdc25C expression and MMR recognition of 5-FU in DNA may modulate cyclin E to affect the cell cycle. Furthermore, MMR recognition of 5-FU reduces histone H3 levels that could be related to DNA access by proteins and/or cell death during the G1/S phase of the cell cycle. PMID:20930505

  12. Is thymidine glycol containing DNA a substrate of E. coli DNA mismatch repair system?

    PubMed

    Perevozchikova, Svetlana A; Trikin, Roman M; Heinze, Roger J; Romanova, Elena A; Oretskaya, Tatiana S; Friedhoff, Peter; Kubareva, Elena A

    2014-01-01

    The DNA mismatch repair (MMR) system plays a crucial role in the prevention of replication errors and in the correction of some oxidative damages of DNA bases. In the present work the most abundant oxidized pyrimidine lesion, 5,6-dihydro-5,6-dihydroxythymidine (thymidine glycol, Tg) was tested for being recognized and processed by the E. coli MMR system, namely complex of MutS, MutL and MutH proteins. In a partially reconstituted MMR system with MutS-MutL-MutH proteins, G/Tg and A/Tg containing plasmids failed to provoke the incision of DNA. Tg residue in the 30-mer DNA duplex destabilized double helix due to stacking disruption with neighboring bases. However, such local structural changes are not important for E. coli MMR system to recognize this lesion. A lack of repair of Tg containing DNA could be due to a failure of MutS (a first acting protein of MMR system) to interact with modified DNA in a proper way. It was shown that Tg in DNA does not affect on ATPase activity of MutS. On the other hand, MutS binding affinities to DNA containing Tg in G/Tg and A/Tg pairs are lower than to DNA with a G/T mismatch and similar to canonical DNA. Peculiarities of MutS interaction with DNA was monitored by Förster resonance energy transfer (FRET) and fluorescence anisotropy. Binding of MutS to Tg containing DNAs did not result in the formation of characteristic DNA kink. Nevertheless, MutS homodimer orientation on Tg-DNA is similar to that in the case of G/T-DNA. In contrast to G/T-DNA, neither G/Tg- nor A/Tg-DNA was able to stimulate ADP release from MutS better than canonical DNA. Thus, Tg residue in DNA is unlikely to be recognized or processed by the E. coli MMR system. Probably, the MutS transformation to active "sliding clamp" conformation on Tg-DNA is problematic.

  13. The unstructured linker arms of Mlh1-Pms1 are important for interactions with DNA during mismatch repair.

    PubMed

    Plys, Aaron J; Rogacheva, Maria V; Greene, Eric C; Alani, Eric

    2012-09-14

    DNA mismatch repair (MMR) models have proposed that MSH (MutS homolog) proteins identify DNA polymerase errors while interacting with the DNA replication fork. MLH (MutL homolog) proteins (primarily Mlh1-Pms1 in baker's yeast) then survey the genome for lesion-bound MSH proteins. The resulting MSH-MLH complex formed at a DNA lesion initiates downstream steps in repair. MLH proteins act as dimers and contain long (20-30 nm) unstructured arms that connect two terminal globular domains. These arms can vary between 100 and 300 amino acids in length, are highly divergent between organisms, and are resistant to amino acid substitutions. To test the roles of the linker arms in MMR, we engineered a protease cleavage site into the Mlh1 linker arm domain of baker's yeast Mlh1-Pms1. Cleavage of the Mlh1 linker arm in vitro resulted in a defect in Mlh1-Pms1 DNA binding activity, and in vivo proteolytic cleavage resulted in a complete defect in MMR. We then generated a series of truncation mutants bearing Mlh1 and Pms1 linker arms of varying lengths. This work revealed that MMR is greatly compromised when portions of the Mlh1 linker are removed, whereas repair is less sensitive to truncation of the Pms1 linker arm. Purified complexes containing truncations in Mlh1 and Pms1 linker arms were analyzed and found to have differential defects in DNA binding that also correlated with the ability to form a ternary complex with Msh2-Msh6 and mismatch DNA. These observations are consistent with the unstructured linker domains of MLH proteins providing distinct interactions with DNA during MMR.

  14. Mismatch Repair Gene Expression as a Predictor of Tumor Responses in Patients With Rectal Cancer Treated With Preoperative Chemoradiation

    PubMed Central

    Huh, Jung Wook; Kim, Hee Cheol; Kim, Seok Hyung; Park, Yoon Ah; Cho, Yong Beom; Yun, Seong Hyeon; Lee, Woo Yong; Park, Hee Chul; Choi, Doo Ho; Park, Joon Oh; Park, Young Suk; Chun, Ho-Kyung

    2016-01-01

    Abstract This study evaluated the predictive and prognostic value of expression of mismatch repair (MMR) protein, including MLH1, MSH2, and MSH6 in rectal cancer patients with preoperative chemoradiotherapy. MMR protein expression was measured by immunohistochemistry in both pretreatment biopsies (pre-) and pathologic specimens (post-) from 209 patients with locally advanced rectal cancer who underwent preoperative chemoradiotherapy and radical surgery. The patients were followed for a median period of 44 months. A pathologic complete response (pCR) was observed in 30 patients (14.4%). The expression levels of MLH1, MSH2, and MSH6 were not significantly different between the pCR and non-pCR groups. A multivariate analysis revealed that tumor differentiation, postoperative chemotherapy, and pre-MSH6 expression were independent predictors of overall survival; ypN category and perineural invasion were independent predictors of disease-free survival. The pre-MSH6 expression was significantly associated with tumor budding and expression of all MMR proteins. On multivariate analysis, ypN category and post-MSH6 expression were independent predictors for local recurrence. In our study, we observed the independent prognostic value of MSH6 expression in pretreatment tissue on overall survival and MSH6 expression after chemoradiation on local recurrence. Constitutive MSH6 expression before and after preoperative therapy may be a useful tool for prediction of oncologic outcome in locally advanced rectal cancer. PMID:26817916

  15. Interaction between Mismatch Repair and Genetic Recombination in Saccharomyces Cerevisiae

    PubMed Central

    Alani, E.; Reenan, RAG.; Kolodner, R. D.

    1994-01-01

    The yeast Saccharomyces cerevisiae encodes a set of genes that show strong amino acid sequence similarity to MutS and MutL, proteins required for mismatch repair in Escherichia coli. We examined the role of MSH2 and PMS1, yeast homologs of mutS and mutL, respectively, in the repair of base pair mismatches formed during meiotic recombination. By using specifically marked HIS4 and ARG4 alleles, we showed that msh2 mutants displayed a severe defect in the repair of all base pair mismatches as well as 1-, 2- and 4-bp insertion/deletion mispairs. The msh2 and pms1 phenotypes were indistinguishable, suggesting that the wild-type gene products act in the same repair pathway. A comparison of gene conversion events in wild-type and msh2 mutants indicated that mismatch repair plays an important role in genetic recombination. (1) Tetrad analysis at five different loci revealed that, in msh2 mutants, the majority of aberrant segregants displayed a sectored phenotype, consistent with a failure to repair mismatches created during heteroduplex formation. In wild type, base pair mismatches were almost exclusively repaired toward conversion rather than restoration. (2) In msh2 strains 10-19% of the aberrant tetrads were Ab4:4. (3) Polarity gradients at HIS4 and ARG4 were nearly abolished in msh2 mutants. The frequency of gene conversion at the 3' end of these genes was increased and was nearly the frequency observed at the 5' end. (4) Co-conversion studies were consistent with mismatch repair acting to regulate heteroduplex DNA tract length. We favor a model proposing that recombination events occur through the formation and resolution of heteroduplex intermediates and that mismatch repair proteins specifically interact with recombination enzymes to regulate the length of symmetric heteroduplex DNA. PMID:8056309

  16. Loss of DNA mismatch repair facilitates reactivation of a reporter plasmid damaged by cisplatin

    PubMed Central

    Cenni, B; Kim, H-K; Bubley, G J; Aebi, S; Fink, D; Teicher, B A; Howell, S B; Christen, R D

    1999-01-01

    In addition to recognizing and repairing mismatched bases in DNA, the mismatch repair (MMR) system also detects cisplatin DNA adducts and loss of MMR results in resistance to cisplatin. A comparison was made of the ability of MMR-proficient and -deficient cells to remove cisplatin adducts from their genome and to reactivate a transiently transfected plasmid that had previously been inactivated by cisplatin to express the firefly luciferase enzyme. MMR deficiency due to loss of hMLH1 function did not change the extent of platinum (Pt) accumulation or kinetics of removal from total cellular DNA. However, MMR-deficient cells, lacking either hMLH1 or hMSH2, generated twofold more luciferase activity from a cisplatin-damaged reporter plasmid than their MMR-proficient counterparts. Thus, detection of the cisplatin adducts by the MMR system reduced the efficiency of reactivation of the damaged luciferase gene compared to cells lacking this detector. The twofold reduction in reactivation efficiency was of the same order of magnitude as the difference in cisplatin sensitivity between the MMR-proficient and -deficient cells. We conclude that although MMR-proficient and -deficient cells remove Pt from their genome at equal rates, the loss of a functional MMR system facilitates the reactivation of a cisplatin-damaged reporter gene. © 1999 Cancer Research Campaign PMID:10360646

  17. Effects of suppressing the DNA mismatch repair system on homeologous recombination in tomato.

    PubMed

    Tam, Sheh May; Hays, John B; Chetelat, Roger T

    2011-12-01

    In plant breeding, the ability to manipulate genetic (meiotic) recombination would be beneficial for facilitating gene transfer from wild relatives of crop plants. The DNA mismatch repair (MMR) system helps maintain genetic integrity by correcting base mismatches that arise via DNA synthesis or damage, and antagonizes recombination between homeologous (divergent) DNA sequences. Previous studies have established that the genomes of cultivated tomato (Solanum lycopersicum) and the wild relative S. lycopersicoides are substantially diverged (homeologous) such that recombination between their chromosomes is strongly reduced. Here, we report the effects on homeologous recombination of suppressing endogenous MMR genes in S. lycopersicum via RNAi-induced silencing of SlMSH2 and SlMSH7 or overexpressing dominant negatives of Arabidopsis MSH2 (AtMSH2-DN) in an alien substitution line (SL-8) of S. lycopersicoides in tomato. We show that certain inhibitions of MMR (RNAi of SlMSH7, AtMSH2-DN) are associated with modest increases in homeologous recombination, ranging from 3.8 to 29.2% (average rate of 17.8%) compared to controls. Unexpectedly, only the AtMSH2-DN proteins but not RNAi-induced silencing of MSH2 was found to increase homeologous recombination. The ratio of single to double crossovers (SCO:DCO ratio) decreased by approximately 50% in progeny of the AtMSH2-DN parents. An increase in the frequency of heterozygous SL-8 plants was also observed in the progeny of the SlMSH7-RNAi parents. Our findings may contribute to acceleration of introgression in cultivated tomato.

  18. Role of Deficient Mismatch Repair in the Personalized Management of Colorectal Cancer

    PubMed Central

    Zhang, Cong-Min; Lv, Jin-Feng; Gong, Liang; Yu, Lin-Yu; Chen, Xiao-Ping; Zhou, Hong-Hao; Fan, Lan

    2016-01-01

    Colorectal cancer (CRC) represents the third most common type of cancer in developed countries and one of the leading causes of cancer deaths worldwide. Personalized management of CRC has gained increasing attention since there are large inter-individual variations in the prognosis and response to drugs used to treat CRC owing to molecular heterogeneity. Approximately 15% of CRCs are caused by deficient mismatch repair (dMMR) characterized by microsatellite instability (MSI) phenotype. The present review is aimed at highlighting the role of MMR status in informing prognosis and personalized treatment of CRC including adjuvant chemotherapy, targeted therapy, and immune checkpoint inhibitor therapy to guide the individualized therapy of CRC. PMID:27618077

  19. Microsatellites in the Eukaryotic DNA Mismatch Repair Genes as Modulators of Evolutionary Mutation Rate

    NASA Technical Reports Server (NTRS)

    Chang, Dong Kyung; Metzgar, David; Wills, Christopher; Boland, C. Richard

    2003-01-01

    All "minor" components of the human DNA mismatch repair (MMR) system-MSH3, MSH6, PMS2, and the recently discovered MLH3-contain mononucleotide microsatellites in their coding sequences. This intriguing finding contrasts with the situation found in the major components of the DNA MMR system-MSH2 and MLH1-and, in fact, most human genes. Although eukaryotic genomes are rich in microsatellites, non-triplet microsatellites are rare in coding regions. The recurring presence of exonal mononucleotide repeat sequences within a single family of human genes would therefore be considered exceptional.

  20. Alleles of the yeast Pms1 mismatch-repair gene that differentially affect recombination- and replication-related processes.

    PubMed Central

    Welz-Voegele, Caroline; Stone, Jana E; Tran, Phuoc T; Kearney, Hutton M; Liskay, R Michael; Petes, Thomas D; Jinks-Robertson, Sue

    2002-01-01

    Mismatch-repair (MMR) systems promote eukaryotic genome stability by removing errors introduced during DNA replication and by inhibiting recombination between nonidentical sequences (spellchecker and antirecombination activities, respectively). Following a common mismatch-recognition step effected by MutS-homologous Msh proteins, homologs of the bacterial MutL ATPase (predominantly the Mlh1p-Pms1p heterodimer in yeast) couple mismatch recognition to the appropriate downstream processing steps. To examine whether the processing steps in the spellchecker and antirecombination pathways might differ, we mutagenized the yeast PMS1 gene and screened for mitotic separation-of-function alleles. Two alleles affecting only the antirecombination function of Pms1p were identified, one of which changed an amino acid within the highly conserved ATPase domain. To more specifically address the role of ATP binding/hydrolysis in MMR-related processes, we examined mutations known to compromise the ATPase activity of Pms1p or Mlh1p with respect to the mitotic spellchecker and antirecombination activities and with respect to the repair of mismatches present in meiotic recombination intermediates. The results of these analyses confirm a differential requirement for the Pms1p ATPase activity in replication vs. recombination processes, while demonstrating that the Mlh1p ATPase activity is important for all examined MMR-related functions. PMID:12454061

  1. MutSα maintains the mismatch repair capability by inhibiting PCNA unloading

    PubMed Central

    Kawasoe, Yoshitaka; Tsurimoto, Toshiki; Nakagawa, Takuro; Masukata, Hisao; Takahashi, Tatsuro S

    2016-01-01

    Eukaryotic mismatch repair (MMR) utilizes single-strand breaks as signals to target the strand to be repaired. DNA-bound PCNA is also presumed to direct MMR. The MMR capability must be limited to a post-replicative temporal window during which the signals are available. However, both identity of the signal(s) involved in the retention of this temporal window and the mechanism that maintains the MMR capability after DNA synthesis remain unclear. Using Xenopus egg extracts, we discovered a mechanism that ensures long-term retention of the MMR capability. We show that DNA-bound PCNA induces strand-specific MMR in the absence of strand discontinuities. Strikingly, MutSα inhibited PCNA unloading through its PCNA-interacting motif, thereby extending significantly the temporal window permissive to strand-specific MMR. Our data identify DNA-bound PCNA as the signal that enables strand discrimination after the disappearance of strand discontinuities, and uncover a novel role of MutSα in the retention of the post-replicative MMR capability. DOI: http://dx.doi.org/10.7554/eLife.15155.001 PMID:27402201

  2. Impact of DNA mismatch repair system alterations on human fertility and related treatments*

    PubMed Central

    Hu, Min-hao; Liu, Shu-yuan; Wang, Ning; Wu, Yan; Jin, Fan

    2016-01-01

    DNA mismatch repair (MMR) is one of the biological pathways, which plays a critical role in DNA homeostasis, primarily by repairing base-pair mismatches and insertion/deletion loops that occur during DNA replication. MMR also takes part in other metabolic pathways and regulates cell cycle arrest. Defects in MMR are associated with genomic instability, predisposition to certain types of cancers and resistance to certain therapeutic drugs. Moreover, genetic and epigenetic alterations in the MMR system demonstrate a significant relationship with human fertility and related treatments, which helps us to understand the etiology and susceptibility of human infertility. Alterations in the MMR system may also influence the health of offspring conceived by assisted reproductive technology in humans. However, further studies are needed to explore the specific mechanisms by which the MMR system may affect human infertility. This review addresses the physiological mechanisms of the MMR system and associations between alterations of the MMR system and human fertility and related treatments, and potential effects on the next generation. PMID:26739522

  3. Loss of DNA mismatch repair imparts a selective advantage in planarian adult stem cells.

    PubMed

    Hollenbach, Jessica P; Resch, Alissa M; Palakodeti, Dasaradhi; Graveley, Brenton R; Heinen, Christopher D

    2011-01-01

    Lynch syndrome (LS) leads to an increased risk of early-onset colorectal and other types of cancer and is caused by germline mutations in DNA mismatch repair (MMR) genes. Loss of MMR function results in a mutator phenotype that likely underlies its role in tumorigenesis. However, loss of MMR also results in the elimination of a DNA damage-induced checkpoint/apoptosis activation barrier that may allow damaged cells to grow unchecked. A fundamental question is whether loss of MMR provides pre-cancerous stem cells an immediate selective advantage in addition to establishing a mutator phenotype. To test this hypothesis in an in vivo system, we utilized the planarian Schmidtea mediterranea which contains a significant population of identifiable adult stem cells. We identified a planarian homolog of human MSH2, a MMR gene which is mutated in 38% of LS cases. The planarian Smed-msh2 is expressed in stem cells and some progeny. We depleted Smed-msh2 mRNA levels by RNA-interference and found a striking survival advantage in these animals treated with a cytotoxic DNA alkylating agent compared to control animals. We demonstrated that this tolerance to DNA damage is due to the survival of mitotically active, MMR-deficient stem cells. Our results suggest that loss of MMR provides an in vivo survival advantage to the stem cell population in the presence of DNA damage that may have implications for tumorigenesis.

  4. Helicobacter pylori infection modulates the expression of miRNAs associated with DNA mismatch repair pathway.

    PubMed

    Santos, Juliana C; Brianti, Mitsue T; Almeida, Victor R; Ortega, Manoela M; Fischer, Wolfgang; Haas, Rainer; Matheu, Ander; Ribeiro, Marcelo L

    2017-04-01

    Genetic and epigenetic inactivation of DNA mismatch repair (MMR) genes might lead to modifications in cancer-related gene expression and cancer development. Recently, it has been shown that the infection by Helicobacter pylori, the major causative agent of gastric cancer, induces DNA damage and inhibits MMR DNA repair. Also, it has been reported that microRNAs (miRs) have an important role in regulating genomic stability and MMR DNA repair. Thus, the aim of this study was to identify miRs regulating MMR pathway in H. pylori-associated gastric carcinogenesis. To address this question, a gastric epithelial cell line and AGS cancer gastric cells were infected with several H. pylori strains. MMR gene expression and miRs correlating with H. pylori strain infection were evaluated. The results showed that H. pylori infection significantly down-regulated the expression of all selected MMR genes. Also, H. pylori infection modulated the expression of several miRs (including miR-150-5p, miR-155-5p, and miR-3163), after 4, 8, and 12 h of infection. Computational prediction of candidate miRs and their predicted MMR targeting sites were obtained from TargetScan, mirDB, and MetaCore. The generated data indicated that the selected miRs (miR-150-5p, miR-155-5p, and miR-3163) could possibly target and modulate MMR genes (POLD3, MSH2, and MSH3, respectively). The target validation was performed using mimics and luciferase gene reporter assays. Briefly, this study shows that H. pylori impairs MMR DNA repair pathway and identifies miRs that regulate MMR gene expression in gastric cancer. © 2016 Wiley Periodicals, Inc.

  5. Competency in mismatch repair prohibits clonal expansion of cancer cells treated with N-methyl-N'-nitro-N-nitrosoguanidine.

    PubMed Central

    Carethers, J M; Hawn, M T; Chauhan, D P; Luce, M C; Marra, G; Koi, M; Boland, C R

    1996-01-01

    The phenomenon of alkylation tolerance has been observed in cells that are deficient in some component of the DNA mismatch repair (MMR) system. An alkylation-induced cell cycle arrest had been reported previously in one MMR-proficient cell line, whereas a MMR-defective clone derived from this line escapes from this arrest. We examined human cancer cell lines to determine if the cell cycle arrest were dependent upon the MMR system. Growth characteristics and cell cycle analysis after MNNG treatment were ascertained in seven MMR-deficient and proficient cell lines, with and without confirmed mutations in hMLH1 or hMSH2 by an in vitro transcription/translation assay. MMR-proficient cells underwent growth arrest in the G2 phase of the cell cycle after the first S phase, whereas MMR-deficient cells escaped an initial G2 delay and resumed a normal growth pattern. In the HCT116 line corrected for defective MMR by chromosome 3 transfer, the G2 phase arrest lasted more than five days. In another MMR-proficient colon cancer cell line, SW480, cell death occurred five days after MNNG treatment. A competent MMR system appears to be necessary for G2 arrest or cell death after alkylation damage, and this cell cycle checkpoint may allow the cell to repair damaged DNA, or prevent the replication of mutated DNA by prohibiting clonal expansion. PMID:8690794

  6. An interplay of the base excision repair and mismatch repair pathways in active DNA demethylation

    PubMed Central

    Grin, Inga; Ishchenko, Alexander A.

    2016-01-01

    Active DNA demethylation (ADDM) in mammals occurs via hydroxylation of 5-methylcytosine (5mC) by TET and/or deamination by AID/APOBEC family enzymes. The resulting 5mC derivatives are removed through the base excision repair (BER) pathway. At present, it is unclear how the cell manages to eliminate closely spaced 5mC residues whilst avoiding generation of toxic BER intermediates and whether alternative DNA repair pathways participate in ADDM. It has been shown that non-canonical DNA mismatch repair (ncMMR) can remove both alkylated and oxidized nucleotides from DNA. Here, a phagemid DNA containing oxidative base lesions and methylated sites are used to examine the involvement of various DNA repair pathways in ADDM in murine and human cell-free extracts. We demonstrate that, in addition to short-patch BER, 5-hydroxymethyluracil and uracil mispaired with guanine can be processed by ncMMR and long-patch BER with concomitant removal of distant 5mC residues. Furthermore, the presence of multiple mispairs in the same MMR nick/mismatch recognition region together with BER-mediated nick formation promotes proficient ncMMR resulting in the reactivation of an epigenetically silenced reporter gene in murine cells. These findings suggest cooperation between BER and ncMMR in the removal of multiple mismatches that might occur in mammalian cells during ADDM. PMID:26843430

  7. Evolving approach and clinical significance of detecting DNA mismatch repair deficiency in colorectal carcinoma

    PubMed Central

    Shia, Jinru

    2016-01-01

    The last two decades have seen significant advancement in our understanding of colorectal tumors with DNA mismatch repair (MMR) deficiency. The ever-emerging revelations of new molecular and genetic alterations in various clinical conditions have necessitated constant refinement of disease terminology and classification. Thus, a case with the clinical condition of hereditary non-polyposis colorectal cancer as defined by the Amsterdam criteria may be one of Lynch syndrome characterized by a germline defect in one of the several MMR genes, one of the yet-to-be-defined “Lynch-like syndrome” if there is evidence of MMR deficiency in the tumor but no detectable germline MMR defect or tumor MLH1 promoter methylation, or “familial colorectal cancer type X” if there is no evidence of MMR deficiency. The detection of these conditions carries significant clinical implications. The detection tools and strategies are constantly evolving. The Bethesda guidelines symbolize a selective approach that uses clinical information and tumor histology as the basis to select high-risk individuals. Such a selective approach has subsequently been found to have limited sensitivity, and is thus gradually giving way to the alternative universal approach that tests all newly diagnosed colorectal cancers. Notably, the universal approach also has its own limitations; its cost-effectiveness in real practice, in particular, remains to be determined. Meanwhile, technological advances such as the next-generation sequencing are offering the promise of direct genetic testing for MMR deficiency at an affordable cost probably in the near future. This article reviews the up-to-date molecular definitions of the various conditions related to MMR deficiency, and discusses the tools and strategies that have been used in detecting these conditions. Special emphasis will be placed on the evolving nature and the clinical importance of the disease definitions and the detection strategies. PMID:25716099

  8. MonoSeq Variant Caller Reveals Novel Mononucleotide Run Indel Mutations in Tumors with Defective DNA Mismatch Repair

    PubMed Central

    Walker, Christopher J.; Miranda, Mario A.; O’Hern, Matthew J.; Blachly, James S.; Moyer, Cassandra L.; Ivanovich, Jennifer; Kroll, Karl W.; Eisfeld, Ann-Kathrin; Sapp, Caroline E.; Mutch, David G.; Cohn, David E.; Bundschuh, Ralf; Goodfellow, Paul J

    2016-01-01

    Next-generation sequencing has revolutionized cancer genetics, but accurately detecting mutations in repetitive DNA sequences, especially mononucleotide runs, remains a challenge. This is a particular concern for tumors with defective mismatch repair (MMR) that accumulate strand-slippage mutations. We developed MonoSeq to improve indel mutation detection in mononucleotide runs, and used MonoSeq to investigate strand-slippage mutations in endometrial cancers, a tumor type that has frequent loss of MMR. We performed extensive Sanger sequencing to validate both clonal and sub-clonal MonoSeq mutation calls. Eighty-one regions containing mononucleotide runs were sequenced in 542 primary endometrial cancers (223 with defective MMR). Our analyses revealed that the overall mutation rate in MMR-deficient tumors was 20–30-fold higher than in MMR normal tumors. MonoSeq analysis identified several previously unreported mutations, including a novel hotspot in an A7 run in the terminal exon of ARID5B.The ARID5B indel mutations were seen in both MMR-deficient and MMR normal tumors, suggesting biologic selection. Analysis of tumor mRNAs revealed the presence of mutant transcripts that could result in translation of neopeptides. Improved detection of mononucleotide run strand-slippage mutations has clear implications for comprehensive mutation detection in tumors with defective MMR. Indel frameshift mutations and the resultant antigenic peptides could help guide immunotherapy strategies. PMID:27346418

  9. MonoSeq Variant Caller Reveals Novel Mononucleotide Run Indel Mutations in Tumors with Defective DNA Mismatch Repair.

    PubMed

    Walker, Christopher J; Miranda, Mario A; O'Hern, Matthew J; Blachly, James S; Moyer, Cassandra L; Ivanovich, Jennifer; Kroll, Karl W; Eisfeld, Ann-Kathrin; Sapp, Caroline E; Mutch, David G; Cohn, David E; Bundschuh, Ralf; Goodfellow, Paul J

    2016-10-01

    Next-generation sequencing has revolutionized cancer genetics, but accurately detecting mutations in repetitive DNA sequences, especially mononucleotide runs, remains a challenge. This is a particular concern for tumors with defective mismatch repair (MMR) that accumulate strand-slippage mutations. We developed MonoSeq to improve indel mutation detection in mononucleotide runs, and used MonoSeq to investigate strand-slippage mutations in endometrial cancers, a tumor type that has frequent loss of MMR. We performed extensive Sanger sequencing to validate both clonal and subclonal MonoSeq mutation calls. Eighty-one regions containing mononucleotide runs were sequenced in 540 primary endometrial cancers (223 with defective MMR). Our analyses revealed that the overall mutation rate in MMR-deficient tumors was 20-30-fold higher than in MMR-normal tumors. MonoSeq analysis identified several previously unreported mutations, including a novel hotspot in an A7 run in the terminal exon of ARID5B.The ARID5B indel mutations were seen in both MMR-deficient and MMR-normal tumors, suggesting biologic selection. The analysis of tumor mRNAs revealed the presence of mutant transcripts that could result in translation of neopeptides. Improved detection of mononucleotide run strand-slippage mutations has clear implications for comprehensive mutation detection in tumors with defective MMR. Indel frameshift mutations and the resultant antigenic peptides could help guide immunotherapy strategies.

  10. DNA Helicases in NER, BER, and MMR.

    PubMed

    Kuper, Jochen; Kisker, Caroline

    2013-01-01

    Different DNA repair mechanisms have evolved to protect our genome from modifications caused by endogenous and exogenous agents, thus maintaining the integrity of the DNA. Helicases often play a central role in these repair pathways and have shown to be essential for diverse tasks within these mechanisms. In prokaryotic nucleotide excision repair (NER) for example the two helicases UvrB and UvrD assume vastly different functions. While UvrB is intimately involved in damage verification and acts as an anchor for the other prokaryotic NER proteins UvrA and UvrC, UvrD is required to resolve the post-incision complex leading to the release of UvrC and the incised ssDNA fragment. For the XPD helicase in eukaryotic NER a similar function in analogy to UvrB has been proposed, whereas XPB the second helicase uses only its ATPase activity during eukaryotic NER. In prokaryotic mismatch repair (MMR) UvrD again plays a central role. The different tasks of this protein in the different repair pathways highlight the importance of regulative protein-protein interactions to fine-tune its helicase activity. In other DNA repair pathways the role of the helicases involved is sometimes not as well characterized, and no helicase has so far been described to assume the function of UvrD in eukaryotic MMR. RecQ helicases and FancJ interact with eukaryotic MMR proteins but their involvement in this repair pathway is unclear. Lastly, long-patch base excision repair is linked to the WRN helicase and many proteins within this pathway interact with the helicase leading to increased activity of the interacting proteins as observed for pol β and FEN-1 or the helicase itself is negatively regulated through the interaction with APE-1. However, compared to the precise functions described for the helicases in the other DNA repair mechanisms the role of WRN in BER remains speculative and requires further analysis.

  11. Functional role of DNA mismatch repair gene PMS2 in prostate cancer cells.

    PubMed

    Fukuhara, Shinichiro; Chang, Inik; Mitsui, Yozo; Chiyomaru, Takeshi; Yamamura, Soichiro; Majid, Shahana; Saini, Sharanjot; Deng, Guoren; Gill, Ankurpreet; Wong, Darryn K; Shiina, Hiroaki; Nonomura, Norio; Lau, Yun-Fai C; Dahiya, Rajvir; Tanaka, Yuichiro

    2015-06-30

    DNA mismatch repair (MMR) enzymes act as proofreading complexes that maintains genomic integrity and MMR-deficient cells show an increased mutation rate. MMR has also been shown to influence cell signaling and the regulation of tumor development. MMR consists of various genes and includes post-meiotic segregation (PMS) 2 which is a vital component of mutL-alpha. In prostate, the functional role of this gene has never been reported and in this study, our aim was to investigate the effect of PMS2 on growth properties of prostate cancer (PCa) cells. Previous studies have shown PMS2 to be deficient in DU145 cells and this lack of expression was confirmed by Western blotting whereas normal prostatic PWR-1E and RWPE-1 cells expressed this gene. PMS2 effects on various growth properties of DU145 were then determined by creating stable gene transfectants. Interestingly, PMS2 caused decreased cell proliferation, migration, invasion, and in vivo growth; and increased apoptosis as compared to vector control. We further analyzed genes affected by PMS2 expression and observe the apoptosis-related TMS1 gene to be significantly upregulated whereas anti-apoptotic BCL2A1 was downregulated. These results demonstrate a functional role for PMS2 to protect against PCa progression by enhancing apoptosis of PCa cells.

  12. Mutations affecting a putative MutLα endonuclease motif impact multiple mismatch repair functions

    PubMed Central

    Erdeniz, Naz; Nguyen, Megan; Deschênes, Suzanne M.; Liskay, R. Michael

    2008-01-01

    Mutations in DNA mismatch repair (MMR) lead to increased mutation rates and higher recombination between similar, but not identical sequences, as well as resistance to certain DNA methylating agents. Recently, a component of human MMR machinery, MutLα, has been shown to display a latent endonuclease activity. The endonuclease active site appears to include a conserved motif, DQHA(X)2E(X)4E, within the COOH-terminus of human PMS2. Substitution of the glutamic acid residue (E705) abolished the endonuclease activity and mismatch-dependent excision in vitro. Previously, we showed that the PMS2-E705K mutation and the corresponding mutation in Saccharomyces cerevisiae were both recessive loss of function alleles for mutation avoidance in vivo. Here, we show that mutations impacting this endonuclease motif also significantly affect MMR-dependent suppression of homeologous recombination in yeast and responses to Sn1-type methylating agents in both yeast and mammalian cells. Thus, our in vivo results suggest that the endonuclease activity of MutLα is important not only in MMR-dependent mutation avoidance but also for recombination and damage response functions. PMID:17567544

  13. The impact of sequence divergence and DNA mismatch repair on homeologous recombination in Arabidopsis.

    PubMed

    Li, Liangliang; Jean, Martine; Belzile, François

    2006-03-01

    We examined the effects of substrate divergence and DNA mismatch repair (MMR) on recombination in Arabidopsis thaliana. Relative to the frequency observed in plants with a homologous construct (0% divergence), recombination was decreased 4.1-, 9.6-, 11.7- or 20.3-fold, respectively, in lines with constructs containing 0.5%, 2%, 4% or 9% divergence between the recombination substrates. To evaluate the contribution of the MMR system in this decrease, 12 independent reporter lines (two or three lines per reporter construct) were crossed to an AtMSH2 T-DNA insertional mutant. We examined the recombination frequency in progeny homozygous for a reporter T-DNA and homozygous either for the wild type or the mutant allele of AtMSH2. The loss of MMR activity led to a two- to ninefold increase in homeologous recombination and the size of the increase did not seem to correlate with the amount of divergence. Inversely, complementation of the insertional mutant with a wild-type cDNA of AtMSH2 reduced recombination. Our results demonstrate clearly that sequence divergence can dramatically reduce the recombination frequency in plants and that the MMR system plays a part in this decrease.

  14. Mismatch repair genes in renal cortical neoplasms.

    PubMed

    Baiyee, Daniel; Banner, Barbara

    2006-02-01

    Mutation of human mutL homolog 1 (MLH-1) and human mutS homolog 2 (MSH-2) has been linked with the pathogenesis of colorectal carcinoma in hereditary nonpolyposis colorectal cancer syndrome and other carcinomas. Mutations of these genes in renal cell carcinomas were recently described. The aim of this study was to examine the expression of MLH-1 and MSH-2 in renal cortical neoplasms of various histological types by immunohistochemistry. Thirty-eight (n = 38) resected renal tumors were obtained from the surgical pathology files of the UMass Memorial Healthcare, including clear cell carcinomas (CLEARs, n = 20), papillary carcinomas (PAPs, n = 8), chromophobe carcinomas (CHRs, n = 4), and oncocytomas (ONCs, n = 6). Positive immunostaining for MLH-1 and MSH-2 was graded by the number of positive tumor cell nuclei, as follows: 0, negative; 1, up to one third of positive nuclei; 2, one to two thirds positive; and 3, greater than two thirds positive. Loss of MLH-1 or MSH-2 was defined as a tumor with grade 0 or 1, compared with the normal tubules. Normal tubules and intercalated ducts contained cells positive for MLH-1 and MSH-2 in all cases. For both antibodies, positive staining in tumors ranged from grade 1 to 3 in the CLEAR and PAP but was only grade 2 to 3 in the CHR and ONC. Loss of MLH-1 and/or MSH-2 occurred in malignant tumors but not in ONC. Loss of MLH-1 was present in 8 (40%) of 20 CLEARs and 4 (50%) of 8 PAPs, compared with loss of MSH-2 in 4 (20%) of 20 CLEARs and 1 (25%) of 4 CHRs. Our results suggest that loss of mismatch repair genes is involved in the malignant transformation in some renal carcinomas, particularly those derived from the proximal tubules.

  15. E. coli mismatch repair acts downstream of replication fork stalling to stabilize the expanded (GAA·TTC)n sequence

    PubMed Central

    Bourn, Rebecka L.; Rindler, Paul M.; Pollard, Laura M.; Bidichandani, Sanjay I.

    2008-01-01

    Expanded triplet repeat sequences are known to cause at least 16 inherited neuromuscular diseases. In addition to short length changes, expanded triplet repeat tracts frequently undergo large changes, often amounting to hundreds of base-pairs. Such changes might occur when template or primer slipping creates insertion/deletion loops (IDLs), which are normally repaired by the mismatch repair system (MMR). However, in prokaryotes and eukaryotes, MMR promotes large changes in the length of (CTG·CAG)n sequences, the motif most commonly associated with human disease. We tested the effect of MMR on instability of the expanded (GAA·TTC)n sequence, which causes Friedreich ataxia, by comparing repeat instability in wild-type and MMR-deficient strains of E. coli. As expected, the prevalence of small mutations increased in the MMR-deficient strains. However, the prevalence of large contractions increased in the MMR mutants specifically when GAA was the lagging strand template, the orientation in which replication fork stalling is known to occur. After hydroxyurea-induced stalling, both orientations of replication showed significantly more large contractions in MMR mutants than in the wild-type, suggesting that fork stalling may be responsible for the large contractions. Deficiency of MMR promoted large contractions independently of RecA status, a known determinant of (GAA·TTC)n instability. These data suggest that two independent mechanisms act in response to replication stalling to prevent instability of the (GAA·TTC)n sequence in E. coli, when GAA serves as the lagging strand template: one that is dependent on RecA-mediated restart of stalled forks, and another that is dependent on MMR-mediated repair of IDLs. While MMR destabilizes the (CTG·CAG)n sequence, it is involved in stabilization of the (GAA·TTC)n sequence. The role of MMR in triplet repeat instability therefore depends on the repeat sequence and the orientation of replication. PMID:19046977

  16. Quantifying the contributions of base selectivity, proofreading and mismatch repair to nuclear DNA replication in Saccharomyces cerevisiae.

    PubMed

    St Charles, Jordan A; Liberti, Sascha E; Williams, Jessica S; Lujan, Scott A; Kunkel, Thomas A

    2015-07-01

    Mismatches generated during eukaryotic nuclear DNA replication are removed by two evolutionarily conserved error correction mechanisms acting in series, proofreading and mismatch repair (MMR). Defects in both processes are associated with increased susceptibility to cancer. To better understand these processes, we have quantified base selectivity, proofreading and MMR during nuclear DNA replication in Saccharomyces cerevisiae. In the absence of proofreading and MMR, the primary leading and lagging strand replicases, polymerase ɛ and polymerase δ respectively, synthesize DNA in vivo with somewhat different error rates and specificity, and with apparent base selectivity that is more than 100 times higher than measured in vitro. Moreover, leading and lagging strand replication fidelity rely on a different balance between proofreading and MMR. On average, proofreading contributes more to replication fidelity than does MMR, but their relative contributions vary from nearly all proofreading of some mismatches to mostly MMR of other mismatches. Thus accurate replication of the two DNA strands results from a non-uniform and variable balance between error prevention, proofreading and MMR.

  17. Absence of chicken myelin basic protein residues in commercial formulations of MMR vaccine.

    PubMed

    Afzal, M A; Pipkin, P A; Minor, P D

    2000-10-15

    Several preparations of MMR vaccines and their progenitor monovalent vaccine bulks produced by two different manufacturers were examined serologically for the presence of chicken myelin basic protein (MBP) residues. The products were challenged against several commercial preparations of anti-hMBP antisera that reacted positively with the control MBP preparations of human and chicken origins. There was no evidence of the presence of MBP components in MMR vaccines or their progenitor vaccine bulks as shown by the reactivity profiles of the antibody preparations against control and test antigens.

  18. Mismatch repair at stop codons is directed independent of GATC methylation on the Escherichia coli chromosome.

    PubMed

    Sneppen, Kim; Semsey, Szabolcs

    2014-12-05

    The mismatch repair system (MMR) corrects replication errors that escape proofreading. Previous studies on extrachromosomal DNA in Escherichia coli suggested that MMR uses hemimethylated GATC sites to identify the newly synthesized strand. In this work we asked how the distance of GATC sites and their methylation status affect the occurrence of single base substitutions on the E. coli chromosome. As a reporter system we used a lacZ gene containing an early TAA stop codon. We found that occurrence of point mutations at this stop codon is unaffected by GATC sites located more than 115 base pairs away. However, a GATC site located about 50 base pairs away resulted in a decreased mutation rate. This effect was independent of Dam methylation. The reversion rate of the stop codon increased only slightly in dam mutants compared to mutL and mutS mutants. We suggest that unlike on extrachromosomal DNA, GATC methylation is not the only strand discrimination signal for MMR on the E. coli chromosome.

  19. Mismatch repair at stop codons is directed independent of GATC methylation on the Escherichia coli chromosome

    NASA Astrophysics Data System (ADS)

    Sneppen, Kim; Semsey, Szabolcs

    2014-12-01

    The mismatch repair system (MMR) corrects replication errors that escape proofreading. Previous studies on extrachromosomal DNA in Escherichia coli suggested that MMR uses hemimethylated GATC sites to identify the newly synthesized strand. In this work we asked how the distance of GATC sites and their methylation status affect the occurrence of single base substitutions on the E. coli chromosome. As a reporter system we used a lacZ gene containing an early TAA stop codon. We found that occurrence of point mutations at this stop codon is unaffected by GATC sites located more than 115 base pairs away. However, a GATC site located about 50 base pairs away resulted in a decreased mutation rate. This effect was independent of Dam methylation. The reversion rate of the stop codon increased only slightly in dam mutants compared to mutL and mutS mutants. We suggest that unlike on extrachromosomal DNA, GATC methylation is not the only strand discrimination signal for MMR on the E. coli chromosome.

  20. Mismatch repair at stop codons is directed independent of GATC methylation on the Escherichia coli chromosome

    PubMed Central

    Sneppen, Kim; Semsey, Szabolcs

    2014-01-01

    The mismatch repair system (MMR) corrects replication errors that escape proofreading. Previous studies on extrachromosomal DNA in Escherichia coli suggested that MMR uses hemimethylated GATC sites to identify the newly synthesized strand. In this work we asked how the distance of GATC sites and their methylation status affect the occurrence of single base substitutions on the E. coli chromosome. As a reporter system we used a lacZ gene containing an early TAA stop codon. We found that occurrence of point mutations at this stop codon is unaffected by GATC sites located more than 115 base pairs away. However, a GATC site located about 50 base pairs away resulted in a decreased mutation rate. This effect was independent of Dam methylation. The reversion rate of the stop codon increased only slightly in dam mutants compared to mutL and mutS mutants. We suggest that unlike on extrachromosomal DNA, GATC methylation is not the only strand discrimination signal for MMR on the E. coli chromosome. PMID:25475788

  1. Detection of coding microsatellite frameshift mutations in DNA mismatch repair-deficient mouse intestinal tumors.

    PubMed

    Woerner, Stefan M; Tosti, Elena; Yuan, Yan P; Kloor, Matthias; Bork, Peer; Edelmann, Winfried; Gebert, Johannes

    2015-11-01

    Different DNA mismatch repair (MMR)-deficient mouse strains have been developed as models for the inherited cancer predisposing Lynch syndrome. It is completely unresolved, whether coding mononucleotide repeat (cMNR) gene mutations in these mice can contribute to intestinal tumorigenesis and whether MMR-deficient mice are a suitable molecular model of human microsatellite instability (MSI)-associated intestinal tumorigenesis. A proof-of-principle study was performed to identify mouse cMNR-harboring genes affected by insertion/deletion mutations in MSI murine intestinal tumors. Bioinformatic algorithms were developed to establish a database of mouse cMNR-harboring genes. A panel of five mouse noncoding mononucleotide markers was used for MSI classification of intestinal matched normal/tumor tissues from MMR-deficient (Mlh1(-/-) , Msh2(-/-) , Msh2(LoxP/LoxP) ) mice. cMNR frameshift mutations of candidate genes were determined by DNA fragment analysis. Murine MSI intestinal tumors but not normal tissues from MMR-deficient mice showed cMNR frameshift mutations in six candidate genes (Elavl3, Tmem107, Glis2, Sdccag1, Senp6, Rfc3). cMNRs of mouse Rfc3 and Elavl3 are conserved in type and length in their human orthologs that are known to be mutated in human MSI colorectal, endometrial and gastric cancer. We provide evidence for the utility of a mononucleotide marker panel for detection of MSI in murine tumors, the existence of cMNR instability in MSI murine tumors, the utility of mouse subspecies DNA for identification of polymorphic repeats, and repeat conservation among some orthologous human/mouse genes, two of them showing instability in human and mouse MSI intestinal tumors. MMR-deficient mice hence are a useful molecular model system for analyzing MSI intestinal carcinogenesis.

  2. A mononucleotide repeat in PRRT2 is an important, frequent target of mismatch repair deficiency in cancer

    PubMed Central

    Alves, Inês Teles; Cano, David; Böttcher, René; van der Korput, Hetty; Dinjens, Winand; Jenster, Guido; Trapman, Jan

    2017-01-01

    The DNA mismatch repair (MMR) system corrects DNA replication mismatches thereby contributing to the maintenance of genomic stability. MMR deficiency has been observed in prostate cancer but its impact on the genomic landscape of these tumours is not known. In order to identify MMR associated mutations in prostate cancer we have performed whole genome sequencing of the MMR deficient PC346C prostate cancer cell line. We detected a total of 1196 mutations in PC346C which was 1.5-fold higher compared to a MMR proficient prostate cancer sample (G089). Of all different mutation classes, frameshifts in mononucleotide repeat (MNR) sequences were significantly enriched in the PC346C sample. As a result, a selection of genes with frameshift mutations in MNR was further assessed regarding its mutational status in a comprehensive panel of prostate, ovarian, endometrial and colorectal cancer cell lines. We identified PRRT2 and DAB2IP to be frequently mutated in MMR deficient cell lines, colorectal and endometrial cancer patient samples. Further characterization of PRRT2 revealed an important role of this gene in cancer biology. Both normal prostate cell lines and a colorectal cancer cell line showed increased proliferation, migration and invasion when expressing the mutated form of PRRT2 (ΔPRRT2). The wild-type PRRT2 (PRRT2wt) had an inhibitory effect in proliferation, consistent with the low expression level of PRRT2 in cancer versus normal prostate samples. PMID:27907910

  3. MLH1 promoter methylation, diet, and lifestyle factors in mismatch repair deficient colorectal cancer patients from EPIC-Norfolk.

    PubMed

    Gay, Laura J; Arends, Mark J; Mitrou, Panagiota N; Bowman, Richard; Ibrahim, Ashraf E; Happerfield, Lisa; Luben, Robert; McTaggart, Alison; Ball, Richard Y; Rodwell, Sheila A

    2011-01-01

    There is conflicting evidence for the role diet and lifestyle play in the development of mismatch repair (MMR)-deficient colorectal cancers (CRC). In this study, associations between MMR deficiency, clinicopathological characteristics, and dietary and lifestyle factors in sporadic CRC were investigated. Tumor samples from 185 individuals in the EPIC-Norfolk study were analyzed for MLH1 gene promoter methylation and microsatellite instability (MSI). Dietary and lifestyle data were collected prospectively using 7-day food diaries (7dd) and questionnaires. MMR-deficient tumor cases (MLH1 promoter methylation positive, MSI-H) were more likely to be female, older at diagnosis, early Dukes' stage (A/B), and proximal in location (MSI-H P = 0.03, 0.03, 0.02, and 0.001, respectively). Tumors with positive MLH1 promoter methylation (>20%) were associated with poor differentiation (P = 0.03). Low physical activity was associated with cases without MSI (P = 0.05). MMR deficiency was not significantly associated with cigarette smoking or alcohol, folate, fruit, vegetable, or meat consumption. We conclude that MMR-deficient tumors represent a distinct subset of sporadic CRC that are proximal in location, early Dukes' stage, and poorly differentiated, in cases that are female and older at diagnosis. There is no overall role for diet and lifestyle in MMR status in CRC, consistent with age-related susceptibility to MLH1 promoter methylation.

  4. GADD45α modulates curcumin sensitivity through c-Abl- and JNK-dependent signaling pathways in a mismatch repair-dependent manner.

    PubMed

    Naick, Hemanth; Jin, Shunqian; Baskaran, R

    2016-03-01

    Colorectal cancer is a critical health concern because of its incidence as the third most prevalent cancer in the world. Currently, 5-fluorouracil (5-FU), 6-thioguanine, and certain other genotoxic agents are mainstays of treatment; however, patients often die due to emergence of resistant population. Curcumin, a bioactive compound derived from the dietary turmeric (Curcuma longa) is an effective anticancer, anti-inflammatory, and antioxidant agent. Previously, we reported that human colorectal cancer cell lines compromised for mismatch repair (MMR) function exhibit heightened sensitivity to curcumin due to sustained curcumin-induced unrepaired DNA damage compared to proficient population counterparts. In this report, we show that the protein levels of gadd45α, whose transcript levels are increased during DNA damage and stress signals, are upregulated following curcumin treatment in a dose- and time-dependent manner. We further observed that cells compromised for Mlh1 function (HCT116 + Ch2) displayed ~twofold increased GADD45α upregulation compared to similarly treated proficient counterparts (HCT116 + Ch3). Similarly, suppression of Mlh1 using ShRNA increased GADD45α upregulation upon curcumin treatment. On the other hand, suppression of GADD45α using SiRNA-blocked curcumin-induced cell death induction in Mlh1-deficient cells. Moreover, inhibition of Abl through ST571 treatment and its downstream effector JNK through SP600125 treatment blocked GADD45α upregulation and cell death triggered by curcumin. Collective results lead us to conclude that GADD45α modulates curcumin sensitivity through activation of c-Abl > JNK signaling in a mismatch repair-dependent manner.

  5. A novel DNA damage response mediated by DNA mismatch repair in Caenorhabditis elegans: induction of programmed autophagic cell death in non-dividing cells

    PubMed Central

    Moriwaki, Takahito; Kato, Yuichi; Nakamura, Chihiro; Ishikawa, Satoru; Zhang-Akiyama, Qiu-Mei

    2015-01-01

    DNA mismatch repair (MMR) contributes to genome integrity by correcting errors of DNA polymerase and inducing cell death in response to DNA damage. Dysfunction of MMR results in increased mutation frequency and cancer risk. Clinical researches revealed that MMR abnormalities induce cancers of non-dividing tissues, such as kidney and liver. However, how MMR suppresses cancer in non-dividing tissues is not understood. To address that mechanism, we analyzed the roles of MMR in non-dividing cells using Caenorhabditis elegans (C. elegans), in which all somatic cells are non-dividing in the adult stage. In this study, we used stable MMR-mutant lines with a balancer chromosome. First, we confirmed that deficiency of MMR leads to resistance to various mutagens in C. elegans dividing cells. Next, we performed drug resistance assays, and found that MMR-deficient adult worms were resistant to SN1-type alkylating and oxidizing agents. In addition, dead cell staining and reporter assays of an autophagy-related gene demonstrated that the cell death was autophagic cell death. Interestingly, this autophagic cell death was not suppressed by caffeine, implying that MMR induces death of non-dividing cells in an atl-1-independent manner. Hence, we propose the hypothesis that MMR prevents cancers in non-dividing tissues by directly inducing cell death. PMID:26413217

  6. The mismatch repair system reduces meiotic homeologous recombination and stimulates recombination-dependent chromosome loss.

    PubMed Central

    Chambers, S R; Hunter, N; Louis, E J; Borts, R H

    1996-01-01

    Efficient genetic recombination requires near-perfect homology between participating molecules. Sequence divergence reduces the frequency of recombination, a process that is dependent on the activity of the mismatch repair system. The effects of chromosomal divergence in diploids of Saccharomyces cerevisiae in which one copy of chromosome III is derived from a closely related species, Saccharomyces paradoxus, have been examined. Meiotic recombination between the diverged chromosomes is decreased by 25-fold. Spore viability is reduced with an observable increase in the number of tetrads with only two or three viable spores. Asci with only two viable spores are disomic for chromosome III, consistent with meiosis I nondisjunction of the homeologs. Asci with three viable spores are highly enriched for recombinants relative to tetrads with four viable spores. In 96% of the class with three viable spores, only one spore possesses a recombinant chromosome III, suggesting that the recombination process itself contributes to meiotic death. This phenomenon is dependent on the activities of the mismatch repair genes PMS1 and MSH2. A model of mismatch-stimulated chromosome loss is proposed to account for this observation. As expected, crossing over is increased in pms1 and msh2 mutants. Furthermore, genetic exchange in pms1 msh2 double mutants is affected to a greater extent than in either mutant alone, suggesting that the two proteins act independently to inhibit homeologous recombination. All mismatch repair-deficient strains exhibited reductions in the rate of chromosome III nondisjunction. PMID:8887641

  7. Prediction of biological behavior and prognosis of colorectal cancer patients by tumor MSI/MMR in the Chinese population

    PubMed Central

    Yan, Wen-Yue; Hu, Jing; Xie, Li; Cheng, Lei; Yang, Mi; Li, Li; Shi, Jiong; Liu, Bao-Rui; Qian, Xiao-Ping

    2016-01-01

    Colorectal cancers (CRCs) exhibiting microsatellite instability (MSI) have special biological behavior. The clinical predictors for MSI and its survival relevance for the Chinese population were still unclear. Seven hundred ninety-five CRC patients were retrospectively assessed. Mismatch repair (MMR) proteins (MSH2, MSH6, PMS1, and MLH1) expression was detected by immunohistochemistry using tumor tissues of all patients. DNA MSI status was analyzed by polymerase chain reaction in 182 samples randomly selected from the 795 cases. Among all CRC tumor tissues, 97 cases (12.2%) were with an MMR protein-deficient (MMR-D) phenotype, whereas 698 cases (87.8%) were with an MMR proteins intact (MMR-I) phenotype. A total of 21 (11.5%) CRCs were identified as having high microsatellite instability, 156 (85.7%) tumors were having microsatellite stability (MSS), and five (2.7%) were having low microsatellite instability. Importantly, MMR status was demonstrated to be moderately consistent with MSI status (κ=0.845, 95% confidence interval [CI] 0.721, 0.969). Unconditional logistic regression analysis revealed age, number of lymph node, tumor diameter, and tumor site as predictors for MSI with a substantial ability to discriminate different MSI status by area under curve of 80.62% using receiver operation curve. Compared with MMR-I, MMR-D was an independent prognostic factor for longer overall survival (hazard ratio =0.340, 95% CI 0.126, 0.919; P=0.034). MMR-D is an independent prognostic factor for better outcome. Our results may provide evidence for individualized diagnosis and treatment of CRC, but this will require further validation in larger sample studies. PMID:27994472

  8. The Mre11/Rad50/Nbs1 complex interacts with the mismatch repair system and contributes to temozolomide-induced G2 arrest and cytotoxicity.

    PubMed

    Mirzoeva, Olga K; Kawaguchi, Tomohiro; Pieper, Russell O

    2006-11-01

    The chemotherapeutic agent temozolomide produces O(6)-methylguanine (O6MG) in DNA, which triggers futile DNA mismatch repair, DNA double-strand breaks (DSB), G(2) arrest, and ultimately cell death. Because the protein complex consisting of Mre11/Rad50/Nbs1 (MRN complex) plays a key role in DNA damage detection and signaling, we asked if this complex also played a role in the cellular response to temozolomide. Temozolomide exposure triggered the assembly of MRN complex into chromatin-associated nuclear foci. MRN foci formed significantly earlier than gamma-H2AX and 53BP1 foci that assembled in response to temozolomide-induced DNA DSBs. MRN foci formation was suppressed in cells that incurred lower levels of temozolomide-induced O6MG lesions and/or had decreased mismatch repair capabilities, suggesting that the MRN foci formed not in response to temozolomide-induced DSB but rather in response to mismatch repair processing of mispaired temozolomide-induced O6MG lesions. Consistent with this idea, the MRN foci colocalized with those of proliferating cell nuclear antigen (a component of the mismatch repair complex), and the MRN complex component Nbs1 coimmunoprecipitated with the mismatch repair protein Mlh1 specifically in response to temozolomide treatment. Furthermore, small inhibitory RNA-mediated suppression of Mre11 levels decreased temozolomide-induced G(2) arrest and cytotoxicity in a manner comparable to that achieved by suppression of mismatch repair. These data show that temozolomide-induced O6MG lesions, acted upon by the mismatch repair system, drive formation of the MRN complex foci and the interaction of this complex with the mismatch repair machinery. The MRN complex in turn contributes to the control of temozolomide-induced G(2) arrest and cytotoxicity, and as such is an additional determining factor in glioma sensitivity to DNA methylating chemotherapeutic drugs such as temozolomide.

  9. Avalanching mutations in biallelic mismatch repair deficiency syndrome.

    PubMed

    Waterfall, Joshua J; Meltzer, Paul S

    2015-03-01

    Tumors from pediatric patients generally contain relatively few somatic mutations. A new study reports a striking exception in individuals in whom biallelic germline deficiency for mismatch repair is compounded by somatic loss of function in DNA proofreading polymerases, resulting in 'ultra-hypermutated' malignant brain tumors.

  10. DREMECELS: A Curated Database for Base Excision and Mismatch Repair Mechanisms Associated Human Malignancies

    PubMed Central

    Shukla, Ankita; Singh, Tiratha Raj

    2016-01-01

    DNA repair mechanisms act as a warrior combating various damaging processes that ensue critical malignancies. DREMECELS was designed considering the malignancies with frequent alterations in DNA repair pathways, that is, colorectal and endometrial cancers, associated with Lynch syndrome (also known as HNPCC). Since lynch syndrome carries high risk (~40–60%) for both cancers, therefore we decided to cover all three diseases in this portal. Although a large population is presently affected by these malignancies, many resources are available for various cancer types but no database archives information on the genes specifically for only these cancers and disorders. The database contains 156 genes and two repair mechanisms, base excision repair (BER) and mismatch repair (MMR). Other parameters include some of the regulatory processes that have roles in these disease progressions due to incompetent repair mechanisms, specifically BER and MMR. However, our unique database mainly provides qualitative and quantitative information on these cancer types along with methylation, drug sensitivity, miRNAs, copy number variation (CNV) and somatic mutations data. This database would serve the scientific community by providing integrated information on these disease types, thus sustaining diagnostic and therapeutic processes. This repository would serve as an excellent accompaniment for researchers and biomedical professionals and facilitate in understanding such critical diseases. DREMECELS is publicly available at http://www.bioinfoindia.org/dremecels. PMID:27276067

  11. Evidence that hMLH3 functions primarily in meiosis and in hMSH2-hMSH3 mismatch repair.

    PubMed

    Charbonneau, Nicole; Amunugama, Ravindra; Schmutte, Christoph; Yoder, Kristine; Fishel, Richard

    2009-07-01

    The MutS (MSH) and MutL (MLH) homologs are conserved proteins that function in mismatch repair (MMR) and meiosis. We examined mRNA and protein expression of hMLH3 compared to other human MSH and MLH in a panel of human tissues and the HeLa cell line. Quantitative PCR suggests that MSH and MLH transcripts are expressed ubiquitously. hMLH3 mRNA is present at low levels in numerous tissues. Protein expression appears to correlate with a threshold of mRNA expression with hMLH3 present at high levels in testis. In addition, we have found and mapped interactions between hMLH1 and hMLH3 with hMSH3. These data are consistent with yeast studies and suggest a role for hMLH3 in meiosis as well as hMSH2-hMSH3 repair processes and little if any role in Hereditary Non-Polyposis Colorectal Cancer (HNPCC).

  12. Emerging importance of mismatch repair components including UvrD helicase and their cross-talk with the development of drug resistance in malaria parasite.

    PubMed

    Ahmad, Moaz; Tuteja, Renu

    2014-12-01

    Human malaria is an important parasitic infection responsible for a significant number of deaths worldwide, particularly in tropical and subtropical regions. The recent scenario has worsened mainly because of the emergence of drug-resistant malaria parasites having the potential to spread across the world. Drug-resistant parasites possess a defective mismatch repair (MMR); therefore, it is essential to explore its mechanism in detail to determine the underlying cause. Recently, artemisinin-resistant parasites have been reported to exhibit nonsynonymous single nucleotide polymorphisms in genes involved in MMR pathways such as MutL homolog (MLH) and UvrD. Plasmodium falciparum MLH is an endonuclease required to restore the defective MMR in drug-resistant W2 strain of P. falciparum. Although the role of helicases in eukaryotic MMR has been questioned, the identification and characterization of the UvrD helicase and their cross-talk with MLH in P. falciparum suggests the possible involvement of UvrD in MMR. A comparative genome-wide analysis revealed the presence of the UvrD helicase in Plasmodium species, while it is absent in human host. Therefore, PfUvrD may emerge as a suitable drug target to control malaria. This review study is focused on recent developments in MMR biochemistry, emerging importance of the UvrD helicase, possibility of its involvement in MMR and the emerging cross-talk between MMR components and drug resistance in malaria parasite.

  13. Role of mismatch repair in the Escherichia coli UVM response.

    PubMed

    Murphy, H S; Palejwala, V A; Rahman, M S; Dunman, P M; Wang, G; Humayun, M Z

    1996-12-01

    Mutagenesis at 3,N4-ethenocytosine (epsilonC), a nonpairing mutagenic lesion, is significantly enhanced in Escherichia coli cells pretreated with UV, alkylating agents, or H2O2. This effect, termed UVM (for UV modulation of mutagenesis), is distinct from known DNA damage-inducible responses, such as the SOS response, the adaptive response to alkylating agents, or the oxyR-mediated response to oxidative agents. Here, we have addressed the hypothesis that UVM results from transient depletion of a mismatch repair activity that normally acts to reduce mutagenesis. To test whether the loss of mismatch repair activities results in the predicted constitutive UVM phenotype, E. coli cells defective for methyl-directed mismatch repair, for very-short-patch repair, or for the N-glycosylase activities MutY and MutM were treated with the UVM-inducing agent 1-methyl-3-nitro-1-nitrosoguanidine, with subsequent transfection of M13 viral single-stranded DNA bearing a site-specific epsilonC lesion. Survival of the M13 DNA was measured as transfection efficiency, and mutation fixation at the lesion was characterized by multiplex sequencing technology. The results showed normal UVM induction patterns in all the repair-defective strains tested. In addition, normal UVM induction was observed in cells overexpressing MutH, MutL, or MutS. All strains displayed UVM reactivation, the term used to describe the increased survival of epsilonC-containing DNA in UVM-induced cells. Taken together, these results indicate that the UVM response is independent of known mismatch repair systems in E. coli and may thus represent a previously unrecognized misrepair or misreplication pathway.

  14. Frequent PIK3CA Mutations in Colorectal and Endometrial Cancer with Double Somatic Mismatch Repair Mutations

    PubMed Central

    Cohen, Stacey A.; Turner, Emily H.; Beightol, Mallory B.; Jacobson, Angela; Gooley, Ted A.; Salipante, Stephen J.; Haraldsdottir, Sigurdis; Smith, Christina; Scroggins, Sheena; Tait, Jonathan F.; Grady, William M.; Lin, Edward H.; Cohn, David E.; Goodfellow, Paul J.; Arnold, Mark W.; de la Chapelle, Albert; Pearlman, Rachel; Hampel, Heather; Pritchard, Colin C.

    2016-01-01

    Background & Aims Double somatic mutations in mismatch repair (MMR) genes have recently been described in colorectal and endometrial cancers with microsatellite instability (MSI) not attributable to MLH1 hypermethylation or germline mutation. We sought to define the molecular phenotype of this newly recognized tumor subtype. Methods From two prospective Lynch syndrome screening studies, we identified patients with colorectal and endometrial tumors harboring ≥2 somatic MMR mutations, but normal germline MMR testing (“double somatic”). We determined the frequencies of tumor PIK3CA, BRAF, KRAS, NRAS, and PTEN mutations by targeted next-generation sequencing and used logistic-regression models to compare them to: Lynch syndrome, MLH1 hypermethylated, and microsatellite stable (MSS) tumors. We validated our findings using independent datasets from The Cancer Genome Atlas (TCGA). Results Among colorectal cancer cases, we found that 14/21 (67%) of double somatic cases had PIK3CA mutations vs. 4/18 (22%) Lynch syndrome, 2/10 (20%) MLH1 hypermethylated, and 12/78 (15%) MSS tumors; p<0.0001. PIK3CA mutations were detected in 100% of 13 double somatic endometrial cancers (p=0.04). BRAF mutations were absent in double somatic and Lynch syndrome colorectal tumors. We found highly similar results in a validation cohort from TCGA (113 colorectal, 178 endometrial cancer), with 100% of double somatic cases harboring a PIK3CA mutation (p<0.0001). Conclusions PIK3CA mutations are present in double somatic mutated colorectal and endometrial cancers at substantially higher frequencies than other MSI subgroups. PIK3CA mutation status may better define an emerging molecular entity in colorectal and endometrial cancers, with the potential to inform screening and therapeutic decision making. PMID:27302833

  15. Cascading MutS and MutL sliding clamps control DNA diffusion to activate mismatch repair.

    PubMed

    Liu, Jiaquan; Hanne, Jeungphill; Britton, Brooke M; Bennett, Jared; Kim, Daehyung; Lee, Jong-Bong; Fishel, Richard

    2016-11-24

    Mismatched nucleotides arise from polymerase misincorporation errors, recombination between heteroallelic parents and chemical or physical DNA damage. Highly conserved MutS (MSH) and MutL (MLH/PMS) homologues initiate mismatch repair and, in higher eukaryotes, act as DNA damage sensors that can trigger apoptosis. Defects in human mismatch repair genes cause Lynch syndrome or hereditary non-polyposis colorectal cancer and 10-40% of related sporadic tumours. However, the collaborative mechanics of MSH and MLH/PMS proteins have not been resolved in any organism. We visualized Escherichia coli (Ec) ensemble mismatch repair and confirmed that EcMutS mismatch recognition results in the formation of stable ATP-bound sliding clamps that randomly diffuse along the DNA with intermittent backbone contact. The EcMutS sliding clamps act as a platform to recruit EcMutL onto the mismatched DNA, forming an EcMutS-EcMutL search complex that then closely follows the DNA backbone. ATP binding by EcMutL establishes a second long-lived DNA clamp that oscillates between the principal EcMutS-EcMutL search complex and unrestricted EcMutS and EcMutL sliding clamps. The EcMutH endonuclease that targets mismatch repair excision only binds clamped EcMutL, increasing its DNA association kinetics by more than 1,000-fold. The assembly of an EcMutS-EcMutL-EcMutH search complex illustrates how sequential stable sliding clamps can modulate one-dimensional diffusion mechanics along the DNA to direct mismatch repair.

  16. Antagonism of ultraviolet-light mutagenesis by the methyl-directed mismatch-repair system of Escherichia coli.

    PubMed Central

    Liu, H; Hewitt, S R; Hays, J B

    2000-01-01

    Previous studies have demonstrated that the Escherichia coli MutHLS mismatch-repair system can process UV-irradiated DNA in vivo and that the human MSH2.MSH6 mismatch-repair protein binds more strongly in vitro to photoproduct/base mismatches than to "matched" photoproducts in DNA. We tested the hypothesis that mismatch repair directed against incorrect bases opposite photoproducts might reduce UV mutagenesis, using two alleles at E. coli lacZ codon 461, which revert, respectively, via CCC --> CTC and CTT --> CTC transitions. F' lacZ targets were mated from mut(+) donors into mutH, mutL, or mutS recipients, once cells were at substantial densities, to minimize spontaneous mutation prior to irradiation. In umu(+) mut(+) recipients, a range of UV fluences induced lac(+) revertant frequencies of 4-25 x 10(-8); these frequencies were consistently 2-fold higher in mutH, mutL, or mutS recipients. Since this effect on mutation frequency was unaltered by an Mfd(-) defect, it appears not to involve transcription-coupled excision repair. In mut(+) umuC122::Tn5 bacteria, UV mutagenesis (at 60 J/m(2)) was very low, but mutH or mutL or mutS mutations increased reversion of both lacZ alleles roughly 25-fold, to 5-10 x 10(-8). Thus, at UV doses too low to induce SOS functions, such as Umu(2)'D, most incorrect bases opposite occasional photoproducts may be removed by mismatch repair, whereas in heavily irradiated (SOS-induced) cells, mismatch repair may only correct some photoproduct/base mismatches, so UV mutagenesis remains substantial. PMID:10655206

  17. Improved generation of rat gene knockouts by target-selected mutagenesis in mismatch repair-deficient animals

    PubMed Central

    van Boxtel, Ruben; Toonen, Pim W; Verheul, Mark; van Roekel, Henk S; Nijman, Isaac J; Guryev, Victor; Cuppen, Edwin

    2008-01-01

    Background The laboratory rat (Rattus norvegicus) is one of the preferred model organisms in physiological and pharmacological research, although the availability of specific genetic models, especially gene knockouts, is limited. N-ethyl-N-nitrosourea (ENU)-driven target-selected mutagenesis is currently the most successful method in rats, although it is still very laborious and expensive. Results As ENU-induced DNA damage is normally recognized by the mismatch repair (MMR) system, we hypothesized that the effectiveness of the target-selected mutagenesis approach could be improved by using a MMR-deficient genetic background. Indeed, Msh6 knockout rats were found to be more sensitive to ENU treatment and the germ line mutation rate was boosted more than two-fold to 1 mutation per 585 kb. In addition, the molecular mutation spectrum was found to be changed in favor of generating knockout-type alleles by ~20%, resulting in an overall increase in efficiency of ~2.5 fold. The improved effectiveness was demonstrated by high throughput mutation discovery in 70 Mb of sequence in a set of only 310 mutant F1 rats. This resulted in the identification of 89 mutations of which four introduced a premature stopcodon and 64 resulted in amino acid changes. Conclusion Taken together, we show that the use of a MMR-deficient background considerably improves ENU-driven target-selected mutagenesis in the rat, thereby reducing animal use as well as screening costs. The use of a mismatch repair-deficient genetic background for improving mutagenesis and target-selected knockout efficiency is in principle applicable to any organism of interest. PMID:18840264

  18. Potential of the Akt inhibitor LY294005 to antagonize the efficacy of Cisplatin against HCT116 tumor cells in a DNA mismatch repair-dependent manner.

    PubMed

    Fedier, Andre; Erdmann, Ruediger; Boulikas, Teni; Fink, Daniel

    2006-11-01

    Human colorectal adenocarcinoma sublines either deficient (HCT116+ch2) or proficient (HCT116+ch3) in the function of MLH1, one of five proteins crucial to DNA mismatch repair (MMR), were used to investigate whether the Akt-specific inhibitor LY294005 could not only increase the efficacy of platinum drugs in HCT116 cells in general but also increase the efficacy of the cisplatinum compounds Cisplatin and Lipoplatin specifically in MLH1-deficient, Cisplatin- and Lipoplatin-resistant HCT116 cells. We report that, under the conditions it increased the efficacy of Docetaxel and did not affect that of 6-thioguanine, LY294005 decreased the sensitivity of both sublines to Cisplatin, Lipoplatin, Oxaliplatin, and Lipoxal. Notably, the LY294005-imposed decrease was significantly higher in the MLH1-proficient than in the MLH1-deficient subline with Cisplatin and Lipoplatin, whereas it was nearly the same in both sublines with Oxaliplatin and Lipoxal. These LY294005-imposed changes in drug sensitivity, i.e. increase with Docetaxel and decreases with platinum compounds, were not associated with the concomitant abrogation in the levels of phospho-Aktser473. Analogous changes in drug sensitivity were also observed with the PI3-kinase inhibitor LY294002, but these changes were associated with complete abrogation of phospho-Aktser473. These observations suggest a possible relationship between MMR-mediated cisplatinum DNA damage signaling and the Akt signaling pathway, e.g. a common target for both pathways. A possibly novel property of Akt in aggravating drug sensitivity may also be proposed.

  19. The cumulative effects of polymorphisms in the DNA mismatch repair genes and tobacco smoking in oesophageal cancer risk.

    PubMed

    Vogelsang, Matjaz; Wang, Yabing; Veber, Nika; Mwapagha, Lamech M; Parker, M Iqbal

    2012-01-01

    The DNA mismatch repair (MMR) enzymes repair errors in DNA that occur during normal DNA metabolism or are induced by certain cancer-contributing exposures. We assessed the association between 10 single-nucleotide polymorphisms (SNPs) in 5 MMR genes and oesophageal cancer risk in South Africans. Prior to genotyping, SNPs were selected from the HapMap database, based on their significantly different genotypic distributions between European ancestry populations and four HapMap populations of African origin. In the Mixed Ancestry group, the MSH3 rs26279 G/G versus A/A or A/G genotype was positively associated with cancer (OR = 2.71; 95% CI: 1.34-5.50). Similar associations were observed for PMS1 rs5742938 (GG versus AA or AG: OR = 1.73; 95% CI: 1.07-2.79) and MLH3 rs28756991 (AA or GA versus GG: OR = 2.07; 95% IC: 1.04-4.12). In Black individuals, however, no association between MMR polymorhisms and cancer risk was observed in individual SNP analysis. The interactions between MMR genes were evaluated using the model-based multifactor-dimensionality reduction approach, which showed a significant genetic interaction between SNPs in MSH2, MSH3 and PMS1 genes in Black and Mixed Ancestry subjects, respectively. The data also implies that pathogenesis of common polymorphisms in MMR genes is influenced by exposure to tobacco smoke. In conclusion, our findings suggest that common polymorphisms in MMR genes and/or their combined effects might be involved in the aetiology of oesophageal cancer.

  20. Agenesis of the corpus callosum and gray matter heterotopia in three patients with constitutional mismatch repair deficiency syndrome.

    PubMed

    Baas, Annette F; Gabbett, Michael; Rimac, Milan; Kansikas, Minttu; Raphael, Martine; Nievelstein, Rutger Aj; Nicholls, Wayne; Offerhaus, Johan; Bodmer, Danielle; Wernstedt, Annekatrin; Krabichler, Birgit; Strasser, Ulrich; Nyström, Minna; Zschocke, Johannes; Robertson, Stephen P; van Haelst, Mieke M; Wimmer, Katharina

    2013-01-01

    Constitutional mismatch repair deficiency (CMMR-D) syndrome is a rare inherited childhood cancer predisposition caused by biallelic germline mutations in one of the four mismatch repair (MMR)-genes, MLH1, MSH2, MSH6 or PMS2. Owing to a wide tumor spectrum, the lack of specific clinical features and the overlap with other cancer predisposing syndromes, diagnosis of CMMR-D is often delayed in pediatric cancer patients. Here, we report of three new CMMR-D patients all of whom developed more than one malignancy. The common finding in these three patients is agenesis of the corpus callosum (ACC). Gray matter heterotopia is present in two patients. One of the 57 previously reported CMMR-D patients with brain tumors (therefore all likely had cerebral imaging) also had ACC. With the present report the prevalence of cerebral malformations is at least 4/60 (6.6%). This number is well above the population birth prevalence of 0.09-0.36 live births with these cerebral malformations, suggesting that ACC and heterotopia are features of CMMR-D. Therefore, the presence of cerebral malformations in pediatric cancer patients should alert to the possible diagnosis of CMMR-D. ACC and gray matter heterotopia are the first congenital malformations described to occur at higher frequency in CMMR-D patients than in the general population. Further systematic evaluations of CMMR-D patients are needed to identify possible other malformations associated with this syndrome.

  1. Production of Extrachromosomal MicroDNAs Is Linked to Mismatch Repair Pathways and Transcriptional Activity.

    PubMed

    Dillon, Laura W; Kumar, Pankaj; Shibata, Yoshiyuki; Wang, Yuh-Hwa; Willcox, Smaranda; Griffith, Jack D; Pommier, Yves; Takeda, Shunichi; Dutta, Anindya

    2015-06-23

    MicroDNAs are <400-base extrachromosomal circles found in mammalian cells. Tens of thousands of microDNAs have been found in all tissue types, including sperm. MicroDNAs arise preferentially from areas with high gene density, GC content, and exon density from promoters with activating chromatin modifications and in sperm from the 5'-UTR of full-length LINE-1 elements, but are depleted from lamin-associated heterochromatin. Analysis of microDNAs from a set of human cancer cell lines revealed lineage-specific patterns of microDNA origins. A survey of microDNAs from chicken cells defective in various DNA repair proteins reveals that homologous recombination and non-homologous end joining repair pathways are not required for microDNA production. Deletion of the MSH3 DNA mismatch repair protein results in a significant decrease in microDNA abundance, specifically from non-CpG genomic regions. Thus, microDNAs arise as part of normal cellular physiology—either from DNA breaks associated with RNA metabolism or from replication slippage followed by mismatch repair.

  2. The Arabidopsis DNA mismatch repair gene PMS1 restricts somatic recombination between homeologous sequences.

    PubMed

    Li, Liangliang; Dion, Eric; Richard, Gabriel; Domingue, Olivier; Jean, Martine; Belzile, François J

    2009-04-01

    The eukaryotic DNA mismatch repair (MMR) system contributes to maintaining the fidelity of genetic information by correcting replication errors and preventing illegitimate recombination events. This study aimed to examine the function(s) of the Arabidopsis thaliana PMS1 gene (AtPMS1), one of three homologs of the bacterial MutL gene in plants. Two independent mutant alleles (Atpms1-1 and Atpms1-2) were obtained and one of these (Atpms1-1) was studied in detail. The mutant exhibited a reduction in seed set and a bias against the transmission of the mutant allele. Somatic recombination, both homologous and homeologous, was examined using a set of reporter constructs. Homologous recombination remained unchanged in the mutant while homeologous recombination was between 1.7- and 4.8-fold higher than in the wild type. This increase in homeologous recombination frequency was not correlated with the degree of sequence divergence. In RNAi lines, a range of increases in homeologous recombination were observed with two lines showing a 3.3-fold and a 3.6-fold increase. These results indicate that the AtPMS1 gene contributes to an antirecombination activity aimed at restricting recombination between diverged sequences.

  3. Crosstalk between mismatch repair and base excision repair in human gastric cancer.

    PubMed

    Simonelli, Valeria; Leuzzi, Giuseppe; Basile, Giorgia; D'Errico, Mariarosaria; Fortini, Paola; Franchitto, Annapaola; Viti, Valentina; Brown, Ashley R; Parlanti, Eleonora; Pascucci, Barbara; Palli, Domenico; Giuliani, Alessandro; Palombo, Fabio; Sobol, Robert W; Dogliotti, Eugenia

    2016-06-20

    DNA repair gene expression in a set of gastric cancers suggested an inverse association between the expression of the mismatch repair (MMR) gene MLH1 and that of the base excision repair (BER) gene DNA polymerase β (Polβ). To gain insight into possible crosstalk of these two repair pathways in cancer, we analysed human gastric adenocarcinoma AGS cells over-expressing Polβ or Polβ active site mutants, alone or in combination with MLH1 silencing. Next, we investigated the cellular response to the alkylating agent methyl methanesulfonate (MMS) and the purine analogue 6-thioguanine (6-TG), agents that induce lesions that are substrates for BER and/or MMR. AGS cells over-expressing Polβ were resistant to 6-TG to a similar extent as when MLH1 was inactivated while inhibition of O6-methylguanine-DNA methyltransferase (MGMT) was required to detect resistance to MMS. Upon either treatment, the association with MLH1 down-regulation further amplified the resistant phenotype. Moreover, AGS cells mutated in Polβ were hypersensitive to both 6-TG and MMS killing and their sensitivity was partially rescued by MLH1 silencing. We provide evidence that the critical lethal lesions in this new pathway are double strand breaks that are exacerbated when Polβ is defective and relieved when MLH1 is silenced. In conclusion, we provide evidence of crosstalk between MLH1 and Polβ that modulates the response to alkylation damage. These studies suggest that the Polβ/MLH1 status should be taken into consideration when designing chemotherapeutic approaches for gastric cancer.

  4. The MutSα-Proliferating Cell Nuclear Antigen Interaction in Human DNA Mismatch Repair*S⃞♦

    PubMed Central

    Iyer, Ravi R.; Pohlhaus, Timothy J.; Chen, Sihong; Hura, Gregory L.; Dzantiev, Leonid; Beese, Lorena S.; Modrich, Paul

    2008-01-01

    We have examined the interaction parameters, conformation, and functional significance of the human MutSα· proliferating cell nuclear antigen (PCNA) complex in mismatch repair. The two proteins associate with a 1:1 stoichiometry and a KD of 0.7 μm in the absence or presence of heteroduplex DNA. PCNA does not influence the affinity of MutSα for a mismatch, and mismatch-bound MutSα binds PCNA. Small angle x-ray scattering studies have established the molecular parameters of the complex, which are consistent with an elongated conformation in which the two proteins associate in an end-to-end fashion in a manner that does not involve an extended unstructured tether, as has been proposed for yeast MutSα and PCNA (Shell, S. S., Putnam, C. D., and Kolodner, R. D. (2007) Mol. Cell26 ,565 -57817531814). MutSα variants lacking the PCNA interaction motif are functional in 3′- or 5′-directed mismatch-provoked excision, but display a partial defect in 5′-directed mismatch repair. This finding is consistent with the modest mutability conferred by inactivation of the MutSα PCNA interaction motif and suggests that interaction of the replication clamp with other repair protein(s) accounts for the essential role of PCNA in MutSα-dependent mismatch repair. PMID:18326858

  5. Cell cycle and mismatch repair genes as potential biomarkers in Arabidopsis thaliana seedlings exposed to silver nanoparticles.

    PubMed

    Gopalakrishnan Nair, Prakash M; Chung, Ill-Min

    2014-06-01

    The expression of cell cycle genes and DNA mismatch repair (MMR) genes were analyzed in Arabidopsis thaliana seedlings exposed to 0, 0.2, 0.5 and 1 mg/L of silver nanoparticles for 24, 48 and 72 h using real-time PCR. Significant up-regulation of AtPCNA1 was observed after 24 h exposure to 0.2 and 0.5 mg/L of silver nanoparticles. AtPCNA2 gene was up-regulated after 24, 48 and 72 h exposure to 0.5 and 1 mg/L of silver nanoparticles. AtMLH1 gene was up-regulated after 48 h exposure to 0.5 and 1 mg/L of silver nanoparticles and down-regulated after 72 h. Down-regulation of AtMSH2, AtMSH3, AtMSH6 and AtMSH7 mRNA was observed after exposure to all concentrations of silver nanoparticles for different time periods. Exposure to silver ions showed no significant change in the expression levels of AtPCNA and MMR genes. The results show that AtPCNA and MMR genes could be used as potential molecular biomarkers.

  6. Relevance of GC content to the conservation of DNA polymerase III/mismatch repair system in Gram-positive bacteria

    PubMed Central

    Akashi, Motohiro; Yoshikawa, Hirofumi

    2013-01-01

    The mechanism of DNA replication is one of the driving forces of genome evolution. Bacterial DNA polymerase III, the primary complex of DNA replication, consists of PolC and DnaE. PolC is conserved in Gram-positive bacteria, especially in the Firmicutes with low GC content, whereas DnaE is widely conserved in most Gram-negative and Gram-positive bacteria. PolC contains two domains, the 3′-5′exonuclease domain and the polymerase domain, while DnaE only possesses the polymerase domain. Accordingly, DnaE does not have the proofreading function; in Escherichia coli, another enzyme DnaQ performs this function. In most bacteria, the fidelity of DNA replication is maintained by 3′-5′ exonuclease and a mismatch repair (MMR) system. However, we found that most Actinobacteria (a group of Gram-positive bacteria with high GC content) appear to have lost the MMR system and chromosomes may be replicated by DnaE-type DNA polymerase III with DnaQ-like 3′-5′ exonuclease. We tested the mutation bias of Bacillus subtilis, which belongs to the Firmicutes and found that the wild type strain is AT-biased while the mutS-deletant strain is remarkably GC-biased. If we presume that DnaE tends to make mistakes that increase GC content, these results can be explained by the mutS deletion (i.e., deletion of the MMR system). Thus, we propose that GC content is regulated by DNA polymerase and MMR system, and the absence of polC genes, which participate in the MMR system, may be the reason for the increase of GC content in Gram-positive bacteria such as Actinobacteria. PMID:24062730

  7. PD-1 Blockade in Tumors with Mismatch-Repair Deficiency

    PubMed Central

    Le, D.T.; Uram, J.N.; Wang, H.; Bartlett, B.R.; Kemberling, H.; Eyring, A.D.; Skora, A.D.; Luber, B.S.; Azad, N.S.; Laheru, D.; Biedrzycki, B.; Donehower, R.C.; Zaheer, A.; Fisher, G.A.; Crocenzi, T.S.; Lee, J.J.; Duffy, S.M.; Goldberg, R.M.; de la Chapelle, A.; Koshiji, M.; Bhaijee, F.; Huebner, T.; Hruban, R.H.; Wood, L.D.; Cuka, N.; Pardoll, D.M.; Papadopoulos, N.; Kinzler, K.W.; Zhou, S.; Cornish, T.C.; Taube, J.M.; Anders, R.A.; Eshleman, J.R.; Vogelstein, B.; Diaz, L.A.

    2015-01-01

    BACKGROUND Somatic mutations have the potential to encode “non-self” immunogenic antigens. We hypothesized that tumors with a large number of somatic mutations due to mismatch-repair defects may be susceptible to immune checkpoint blockade. METHODS We conducted a phase 2 study to evaluate the clinical activity of pembrolizumab, an anti–programmed death 1 immune checkpoint inhibitor, in 41 patients with progressive metastatic carcinoma with or without mismatch-repair deficiency. Pembrolizumab was administered intravenously at a dose of 10 mg per kilogram of body weight every 14 days in patients with mismatch repair–deficient colorectal cancers, patients with mismatch repair–proficient colorectal cancers, and patients with mismatch repair–deficient cancers that were not colorectal. The coprimary end points were the immune-related objective response rate and the 20-week immune-related progression-free survival rate. RESULTS The immune-related objective response rate and immune-related progression-free survival rate were 40% (4 of 10 patients) and 78% (7 of 9 patients), respectively, for mismatch repair–deficient colorectal cancers and 0% (0 of 18 patients) and 11% (2 of 18 patients) for mismatch repair–proficient colorectal cancers. The median progression-free survival and overall survival were not reached in the cohort with mismatch repair–deficient colorectal cancer but were 2.2 and 5.0 months, respectively, in the cohort with mismatch repair–proficient colorectal cancer (hazard ratio for disease progression or death, 0.10 [P<0.001], and hazard ratio for death, 0.22 [P = 0.05]). Patients with mismatch repair–deficient noncolorectal cancer had responses similar to those of patients with mismatch repair–deficient colorectal cancer (immune-related objective response rate, 71% [5 of 7 patients]; immune-related progression-free survival rate, 67% [4 of 6 patients]). Whole-exome sequencing revealed a mean of 1782 somatic mutations per tumor in

  8. Endometrial tumour BRAF mutations and MLH1 promoter methylation as predictors of germline mismatch repair gene mutation status: a literature review.

    PubMed

    Metcalf, Alexander M; Spurdle, Amanda B

    2014-03-01

    Colorectal cancer (CRC) that displays high microsatellite instability (MSI-H) can be caused by either germline mutations in mismatch repair (MMR) genes, or non-inherited transcriptional silencing of the MLH1 promoter. A correlation between MLH1 promoter methylation, specifically the 'C' region, and BRAF V600E status has been reported in CRC studies. Germline MMR mutations also greatly increase risk of endometrial cancer (EC), but no systematic review has been undertaken to determine if these tumour markers may be useful predictors of MMR mutation status in EC patients. Endometrial cancer cohorts meeting review inclusion criteria encompassed 2675 tumours from 20 studies for BRAF V600E, and 447 tumours from 11 studies for MLH1 methylation testing. BRAF V600E mutations were reported in 4/2675 (0.1%) endometrial tumours of unknown MMR mutation status, and there were 7/823 (0.9%) total sequence variants in exon 11 and 27/1012 (2.7%) in exon 15. Promoter MLH1 methylation was not observed in tumours from 32 MLH1 mutation carriers, or for 13 MSH2 or MSH6 mutation carriers. MMR mutation-negative individuals with tumour MLH1 and PMS2 IHC loss displayed MLH1 methylation in 48/51 (94%) of tumours. We have also detailed specific examples that show the importance of MLH1 promoter region, assay design, and quantification of methylation. This review shows that BRAF mutations occurs so infrequently in endometrial tumours they can be discounted as a useful marker for predicting MMR-negative mutation status, and further studies of endometrial cohorts with known MMR mutation status are necessary to quantify the utility of tumour MLH1 promoter methylation as a marker of negative germline MMR mutation status in EC patients.

  9. Human MutL-complexes monitor homologous recombination independently of mismatch repair.

    PubMed

    Siehler, Simone Yasmin; Schrauder, Michael; Gerischer, Ulrike; Cantor, Sharon; Marra, Giancarlo; Wiesmüller, Lisa

    2009-02-01

    The role of mismatch repair proteins has been well studied in the context of DNA repair following DNA polymerase errors. Particularly in yeast, MSH2 and MSH6 have also been implicated in the regulation of genetic recombination, whereas MutL homologs appeared to be less important. So far, little is known about the role of the human MutL homolog hMLH1 in recombination, but recently described molecular interactions suggest an involvement. To identify activities of hMLH1 in this process, we applied an EGFP-based assay for the analysis of different mechanisms of DNA repair, initiated by a targeted double-stranded DNA break. We analysed 12 human cellular systems, differing in the hMLH1 and concomitantly in the hPMS1 and hPMS2 status via inducible protein expression, genetic reconstitution, or RNA interference. We demonstrate that hMLH1 and its complex partners hPMS1 and hPMS2 downregulate conservative homologous recombination (HR), particularly when involving DNA sequences with only short stretches of uninterrupted homology. Unexpectedly, hMSH2 is dispensable for this effect. Moreover, the damage-signaling kinase ATM and its substrates BLM and BACH1 are not strictly required, but the combined effect of ATM/ATR-signaling components may mediate the anti-recombinogenic effect. Our data indicate a protective role of hMutL-complexes in a process which may lead to detrimental genome rearrangements, in a manner which does not depend on mismatch repair.

  10. Mismatch repair genes Mlh1 and Mlh3 modify CAG instability in Huntington's disease mice: genome-wide and candidate approaches.

    PubMed

    Pinto, Ricardo Mouro; Dragileva, Ella; Kirby, Andrew; Lloret, Alejandro; Lopez, Edith; St Claire, Jason; Panigrahi, Gagan B; Hou, Caixia; Holloway, Kim; Gillis, Tammy; Guide, Jolene R; Cohen, Paula E; Li, Guo-Min; Pearson, Christopher E; Daly, Mark J; Wheeler, Vanessa C

    2013-10-01

    The Huntington's disease gene (HTT) CAG repeat mutation undergoes somatic expansion that correlates with pathogenesis. Modifiers of somatic expansion may therefore provide routes for therapies targeting the underlying mutation, an approach that is likely applicable to other trinucleotide repeat diseases. Huntington's disease Hdh(Q111) mice exhibit higher levels of somatic HTT CAG expansion on a C57BL/6 genetic background (B6.Hdh(Q111) ) than on a 129 background (129.Hdh(Q111) ). Linkage mapping in (B6x129).Hdh(Q111) F2 intercross animals identified a single quantitative trait locus underlying the strain-specific difference in expansion in the striatum, implicating mismatch repair (MMR) gene Mlh1 as the most likely candidate modifier. Crossing B6.Hdh(Q111) mice onto an Mlh1 null background demonstrated that Mlh1 is essential for somatic CAG expansions and that it is an enhancer of nuclear huntingtin accumulation in striatal neurons. Hdh(Q111) somatic expansion was also abolished in mice deficient in the Mlh3 gene, implicating MutLγ (MLH1-MLH3) complex as a key driver of somatic expansion. Strikingly, Mlh1 and Mlh3 genes encoding MMR effector proteins were as critical to somatic expansion as Msh2 and Msh3 genes encoding DNA mismatch recognition complex MutSβ (MSH2-MSH3). The Mlh1 locus is highly polymorphic between B6 and 129 strains. While we were unable to detect any difference in base-base mismatch or short slipped-repeat repair activity between B6 and 129 MLH1 variants, repair efficiency was MLH1 dose-dependent. MLH1 mRNA and protein levels were significantly decreased in 129 mice compared to B6 mice, consistent with a dose-sensitive MLH1-dependent DNA repair mechanism underlying the somatic expansion difference between these strains. Together, these data identify Mlh1 and Mlh3 as novel critical genetic modifiers of HTT CAG instability, point to Mlh1 genetic variation as the likely source of the instability difference in B6 and 129 strains and suggest that MLH1

  11. Mismatch Repair Genes Mlh1 and Mlh3 Modify CAG Instability in Huntington's Disease Mice: Genome-Wide and Candidate Approaches

    PubMed Central

    Pinto, Ricardo Mouro; Dragileva, Ella; Kirby, Andrew; Lloret, Alejandro; Lopez, Edith; St. Claire, Jason; Panigrahi, Gagan B.; Hou, Caixia; Holloway, Kim; Gillis, Tammy; Guide, Jolene R.; Cohen, Paula E.; Li, Guo-Min; Pearson, Christopher E.; Daly, Mark J.; Wheeler, Vanessa C.

    2013-01-01

    The Huntington's disease gene (HTT) CAG repeat mutation undergoes somatic expansion that correlates with pathogenesis. Modifiers of somatic expansion may therefore provide routes for therapies targeting the underlying mutation, an approach that is likely applicable to other trinucleotide repeat diseases. Huntington's disease HdhQ111 mice exhibit higher levels of somatic HTT CAG expansion on a C57BL/6 genetic background (B6.HdhQ111) than on a 129 background (129.HdhQ111). Linkage mapping in (B6x129).HdhQ111 F2 intercross animals identified a single quantitative trait locus underlying the strain-specific difference in expansion in the striatum, implicating mismatch repair (MMR) gene Mlh1 as the most likely candidate modifier. Crossing B6.HdhQ111 mice onto an Mlh1 null background demonstrated that Mlh1 is essential for somatic CAG expansions and that it is an enhancer of nuclear huntingtin accumulation in striatal neurons. HdhQ111 somatic expansion was also abolished in mice deficient in the Mlh3 gene, implicating MutLγ (MLH1–MLH3) complex as a key driver of somatic expansion. Strikingly, Mlh1 and Mlh3 genes encoding MMR effector proteins were as critical to somatic expansion as Msh2 and Msh3 genes encoding DNA mismatch recognition complex MutSβ (MSH2–MSH3). The Mlh1 locus is highly polymorphic between B6 and 129 strains. While we were unable to detect any difference in base-base mismatch or short slipped-repeat repair activity between B6 and 129 MLH1 variants, repair efficiency was MLH1 dose-dependent. MLH1 mRNA and protein levels were significantly decreased in 129 mice compared to B6 mice, consistent with a dose-sensitive MLH1-dependent DNA repair mechanism underlying the somatic expansion difference between these strains. Together, these data identify Mlh1 and Mlh3 as novel critical genetic modifiers of HTT CAG instability, point to Mlh1 genetic variation as the likely source of the instability difference in B6 and 129 strains and suggest that MLH1 protein

  12. Cloning of the hexA mismatch-repair gene of Streptococcus pneumoniae and identification of the product.

    PubMed

    Martin, B; Prats, H; Claverys, J P

    1985-01-01

    The hexA mismatch repair gene of Streptococcus pneumoniae has been cloned into multicopy plasmid vectors. The cloned hexA gene is expressed as judged from its ability to complement various chromosomal hexA- alleles. Its direction of transcription was defined and the functional limits were localized by original methods relying on homology-dependent integration of nonautonomous chimeric plasmids carrying chromosomal inserts into the chromosome. Comparison of the proteins encoded by recombinant plasmids and by restriction fragments allowed us to identify an Mr 94 000 protein as the probable product of the hexA gene.

  13. Epigenetic Enhancement of the Post-replicative DNA Mismatch Repair of Mammalian Genomes by a Hemi-mCpG-Np95-Dnmt1 Axis

    PubMed Central

    Wang, Keh-Yang; Chen, Chun-Chang; Tsai, Shih-Feng; Shen, Che-Kun James

    2016-01-01

    DNA methylation at C of CpG dyads (mCpG) in vertebrate genomes is essential for gene regulation, genome stability and development. We show in this study that proper functioning of post-replicative DNA mismatch repair (MMR) in mammalian cells relies on the presence of genomic mCpG, as well as on the maintenance DNA methyltransferase Dnmt1 independently of its catalytic activity. More importantly, high efficiency of mammalian MMR surveillance is achieved through a hemi-mCpG-Np95(Uhrf1)-Dnmt1 axis, in which the MMR surveillance complex(es) is recruited to post-replicative DNA by Dnmt1, requiring its interactions with MutSα, as well as with Np95 bound at the hemi-methylated CpG sites. Thus, efficiency of MMR surveillance over the mammalian genome in vivo is enhanced at the epigenetic level. This synergy endows vertebrate CpG methylation with a new biological significance and, consequently, an additional mechanism for the maintenance of vertebrate genome stability. PMID:27886214

  14. A study of molecular signals deregulating mismatch repair genes in prostate cancer compared to benign prostatic hyperplasia.

    PubMed

    Basu, Sanmitra; Majumder, Subhadipa; Bhowal, Ankur; Ghosh, Alip; Naskar, Sukla; Nandy, Sumit; Mukherjee, Subhabrata; Sinha, Rajan Kumar; Basu, Keya; Karmakar, Dilip; Banerjee, Soma; Sengupta, Sanghamitra

    2015-01-01

    Prostate cancer is one of the leading causes of mortality among aging males. There is an unmet requirement of clinically useful biomarkers for early detection of prostate cancer to reduce the liabilities of overtreatment and accompanying morbidity. The present population-based study investigates the factors disrupting expression of multiple functionally related genes of DNA mismatch repair pathway in prostate cancer patients to identify molecular attributes distinguishing adenocarcinoma from benign hyperplasia of prostate. Gene expression was compared between tissue samples from prostate cancer and benign prostatic hyperplasia using real-time-PCR, western blot and immunohistochemistry. Assessment of genotypes of seven single-nucleotide-polymorphisms of three MMR genes was conducted using PCR-coupled RFLP and sequencing. Promoter methylation was interrogated by methylation-specific-PCR and bisulfite-sequencing. Interaction between microRNAs and MMR genes was verified by 3'UTR-based dual luciferase assays. Concurrent reduction of three MMR genes namely hMLH1, hMSH6 and hMSH2 (34-85%, P<0.05) was observed in prostate cancer tissues. hMSH6 polymorphism rs1800932(Pro92Pro) conferred a borderline protection in cancer patients (OR = 0.33, 95% CI = 0.15-0.75). Relative transcript level of hMLH1 was inversely related (r = -0.59, P<0.05) with methylation quotient of its promoter which showed a significantly higher methylation density (P = 0.008, Z = -2.649) in cancer patients. hsa-miR-155, hsa-miR-141 and hsa-miR-21 gene expressions were significantly elevated (66-85%, P<0.05) in tumor specimens and negatively correlated (r = -0.602 to -0.527, P<0.05) with that of MMR genes. hsa-miR-155 & hsa-miR-141 and hsa-miR-155 & hsa-miR-21 were demonstrated to bind to their putative seed sequences in hMLH1 and hMSH6 3'UTRs respectively. Relatively higher expression of DNA methyl-transferases (DNMT1 and DNMT3b) and HIF-1α genes (34-50%, P<0.05) were also detected in tumor tissues. This

  15. A Study of Molecular Signals Deregulating Mismatch Repair Genes in Prostate Cancer Compared to Benign Prostatic Hyperplasia

    PubMed Central

    Basu, Sanmitra; Majumder, Subhadipa; Bhowal, Ankur; Ghosh, Alip; Naskar, Sukla; Nandy, Sumit; Mukherjee, Subhabrata; Sinha, Rajan Kumar; Basu, Keya; Karmakar, Dilip; Banerjee, Soma; Sengupta, Sanghamitra

    2015-01-01

    Prostate cancer is one of the leading causes of mortality among aging males. There is an unmet requirement of clinically useful biomarkers for early detection of prostate cancer to reduce the liabilities of overtreatment and accompanying morbidity. The present population-based study investigates the factors disrupting expression of multiple functionally related genes of DNA mismatch repair pathway in prostate cancer patients to identify molecular attributes distinguishing adenocarcinoma from benign hyperplasia of prostate. Gene expression was compared between tissue samples from prostate cancer and benign prostatic hyperplasia using real-time-PCR, western blot and immunohistochemistry. Assessment of genotypes of seven single-nucleotide-polymorphisms of three MMR genes was conducted using PCR-coupled RFLP and sequencing. Promoter methylation was interrogated by methylation-specific-PCR and bisulfite-sequencing. Interaction between microRNAs and MMR genes was verified by 3'UTR-based dual luciferase assays. Concurrent reduction of three MMR genes namely hMLH1, hMSH6 and hMSH2 (34-85%, P<0.05) was observed in prostate cancer tissues. hMSH6 polymorphism rs1800932(Pro92Pro) conferred a borderline protection in cancer patients (OR = 0.33, 95% CI = 0.15-0.75). Relative transcript level of hMLH1 was inversely related (r = -0.59, P<0.05) with methylation quotient of its promoter which showed a significantly higher methylation density (P = 0.008, Z = -2.649) in cancer patients. hsa-miR-155, hsa-miR-141 and hsa-miR-21 gene expressions were significantly elevated (66-85%, P<0.05) in tumor specimens and negatively correlated (r = -0.602 to -0.527, P<0.05) with that of MMR genes. hsa-miR-155 & hsa-miR-141 and hsa-miR-155 & hsa-miR-21 were demonstrated to bind to their putative seed sequences in hMLH1 and hMSH6 3’UTRs respectively. Relatively higher expression of DNA methyl-transferases (DNMT1 and DNMT3b) and HIF-1α genes (34-50%, P<0.05) were also detected in tumor tissues

  16. Evaluating the performance of clinical criteria for predicting mismatch repair gene mutations in Lynch syndrome: a comprehensive analysis of 3,671 families.

    PubMed

    Steinke, Verena; Holzapfel, Stefanie; Loeffler, Markus; Holinski-Feder, Elke; Morak, Monika; Schackert, Hans K; Görgens, Heike; Pox, Christian; Royer-Pokora, Brigitte; von Knebel-Doeberitz, Magnus; Büttner, Reinhard; Propping, Peter; Engel, Christoph

    2014-07-01

    Carriers of mismatch repair (MMR) gene mutations have a high lifetime risk for colorectal and endometrial cancers, as well as other malignancies. As mutation analysis to detect these patients is expensive and time-consuming, clinical criteria and tumor-tissue analysis are widely used as pre-screening methods. The aim of our study was to evaluate the performance of commonly applied clinical criteria (the Amsterdam I and II Criteria, and the original and revised Bethesda Guidelines) and the results of tumor-tissue analysis in predicting MMR gene mutations. We analyzed 3,671 families from the German HNPCC Registry and divided them into nine mutually exclusive groups with different clinical criteria. A total of 680 families (18.5%) were found to have a pathogenic MMR gene mutation. Among all 1,284 families with microsatellite instability-high (MSI-H) colorectal cancer, the overall mutation detection rate was 53.0%. Mutation frequencies and their distribution between the four MMR genes differed significantly between clinical groups (p < 0.001). The highest frequencies were found in families fulfilling the Amsterdam Criteria (46.4%). Families with loss of MSH2 expression had higher mutation detection rates (69.5%) than families with loss of MLH1 expression (43.1%). MMR mutations were found significantly more often in families with at least one MSI-H small-bowel cancer (p < 0.001). No MMR mutations were found among patients under 40-years-old with only colorectal adenoma. Familial clustering of Lynch syndrome-related tumors, early age of onset, and familial occurrence of small-bowel cancer were clinically relevant predictors for Lynch syndrome.

  17. Dynamic basis for one-dimensional DNA scanning by the mismatch repair complex Msh2-Msh6.

    PubMed

    Gorman, Jason; Chowdhury, Arindam; Surtees, Jennifer A; Shimada, Jun; Reichman, David R; Alani, Eric; Greene, Eric C

    2007-11-09

    The ability of proteins to locate specific sites or structures among a vast excess of nonspecific DNA is a fundamental theme in biology. Yet the basic principles that govern these mechanisms remain poorly understood. For example, mismatch repair proteins must scan millions of base pairs to find rare biosynthetic errors, and they then must probe the surrounding region to identify the strand discrimination signals necessary to distinguish the parental and daughter strands. To determine how these proteins might function we used single-molecule optical microscopy to answer the following question: how does the mismatch repair complex Msh2-Msh6 interrogate undamaged DNA? Here we show that Msh2-Msh6 slides along DNA via one-dimensional diffusion. These findings indicate that interactions between Msh2-Msh6 and DNA are dominated by lateral movement of the protein along the helical axis and have implications for how MutS family members travel along DNA at different stages of the repair reaction.

  18. Mismatch repair regulates homologous recombination, but has little influence on antigenic variation, in Trypanosoma brucei.

    PubMed

    Bell, Joanna S; McCulloch, Richard

    2003-11-14

    Antigenic variation is critical in the life of the African trypanosome, as it allows the parasite to survive in the face of host immunity and enhance its transmission to other hosts. Much of trypanosome antigenic variation uses homologous recombination of variant surface glycoprotein (VSG)-encoding genes into specialized transcription sites, but little is known about the processes that regulate it. Here we describe the effects on VSG switching when two central mismatch repair genes, MSH2 and MLH1, are mutated. We show that disruption of the parasite mismatch repair system causes an increased frequency of homologous recombination, both between perfectly matched DNA molecules and between DNA molecules with divergent sequences. Mismatch repair therefore provides an important regulatory role in homologous recombination in this ancient eukaryote. Despite this, the mismatch repair system has no detectable role in regulating antigenic variation, meaning that VSG switching is either immune to mismatch selection or that mismatch repair acts in a subtle manner, undetectable by current assays.

  19. Methylation Analysis of DNA Mismatch Repair Genes Using DNA Derived from the Peripheral Blood of Patients with Endometrial Cancer: Epimutation in Endometrial Carcinogenesis

    PubMed Central

    Takeda, Takashi; Banno, Kouji; Yanokura, Megumi; Adachi, Masataka; Iijima, Moito; Kunitomi, Haruko; Nakamura, Kanako; Iida, Miho; Nogami, Yuya; Umene, Kiyoko; Masuda, Kenta; Kobayashi, Yusuke; Yamagami, Wataru; Hirasawa, Akira; Tominaga, Eiichiro; Susumu, Nobuyuki; Aoki, Daisuke

    2016-01-01

    Germline mutation of DNA mismatch repair (MMR) genes is a cause of Lynch syndrome. Methylation of MutL homolog 1 (MLH1) and MutS homolog 2 (MSH2) has been detected in peripheral blood cells of patients with colorectal cancer. This methylation is referred to as epimutation. Methylation of these genes has not been studied in an unselected series of endometrial cancer cases. Therefore, we examined methylation of MLH1, MSH2, and MSH6 promoter regions of peripheral blood cells in 206 patients with endometrial cancer using a methylation-specific polymerase chain reaction (MSP). Germline mutation of MMR genes, microsatellite instability (MSI), and immunohistochemistry (IHC) were also analyzed in each case with epimutation. MLH1 epimutation was detected in a single patient out of a total of 206 (0.49%)—1 out of 58 (1.72%) with an onset age of less than 50 years. The patient with MLH1 epimutation showed high level MSI (MSI-H), loss of MLH1 expression and had developed endometrial cancer at 46 years old, complicated with colorectal cancer. No case had epimutation of MSH2 or MSH6. The MLH1 epimutation detected in a patient with endometrial cancer may be a cause of endometrial carcinogenesis. This result indicates that it is important to check epimutation in patients with endometrial cancer without a germline mutation of MMR genes. PMID:27754426

  20. Methylation Analysis of DNA Mismatch Repair Genes Using DNA Derived from the Peripheral Blood of Patients with Endometrial Cancer: Epimutation in Endometrial Carcinogenesis.

    PubMed

    Takeda, Takashi; Banno, Kouji; Yanokura, Megumi; Adachi, Masataka; Iijima, Moito; Kunitomi, Haruko; Nakamura, Kanako; Iida, Miho; Nogami, Yuya; Umene, Kiyoko; Masuda, Kenta; Kobayashi, Yusuke; Yamagami, Wataru; Hirasawa, Akira; Tominaga, Eiichiro; Susumu, Nobuyuki; Aoki, Daisuke

    2016-10-14

    Germline mutation of DNA mismatch repair (MMR) genes is a cause of Lynch syndrome. Methylation of MutL homolog 1 (MLH1) and MutS homolog 2 (MSH2) has been detected in peripheral blood cells of patients with colorectal cancer. This methylation is referred to as epimutation. Methylation of these genes has not been studied in an unselected series of endometrial cancer cases. Therefore, we examined methylation of MLH1, MSH2, and MSH6 promoter regions of peripheral blood cells in 206 patients with endometrial cancer using a methylation-specific polymerase chain reaction (MSP). Germline mutation of MMR genes, microsatellite instability (MSI), and immunohistochemistry (IHC) were also analyzed in each case with epimutation. MLH1 epimutation was detected in a single patient out of a total of 206 (0.49%)-1 out of 58 (1.72%) with an onset age of less than 50 years. The patient with MLH1 epimutation showed high level MSI (MSI-H), loss of MLH1 expression and had developed endometrial cancer at 46 years old, complicated with colorectal cancer. No case had epimutation of MSH2 or MSH6. The MLH1 epimutation detected in a patient with endometrial cancer may be a cause of endometrial carcinogenesis. This result indicates that it is important to check epimutation in patients with endometrial cancer without a germline mutation of MMR genes.

  1. DNA tandem repeat instability in the Escherichia coli chromosome is stimulated by mismatch repair at an adjacent CAG·CTG trinucleotide repeat

    PubMed Central

    Blackwood, John K.; Okely, Ewa A.; Zahra, Rabaab; Eykelenboom, John K.; Leach, David R. F.

    2010-01-01

    Approximately half the human genome is composed of repetitive DNA sequences classified into microsatellites, minisatellites, tandem repeats, and dispersed repeats. These repetitive sequences have coevolved within the genome but little is known about their potential interactions. Trinucleotide repeats (TNRs) are a subclass of microsatellites that are implicated in human disease. Expansion of CAG·CTG TNRs is responsible for Huntington disease, myotonic dystrophy, and a number of spinocerebellar ataxias. In yeast DNA double-strand break (DSB) formation has been proposed to be associated with instability and chromosome fragility at these sites and replication fork reversal (RFR) to be involved either in promoting or in preventing instability. However, the molecular basis for chromosome fragility of repetitive DNA remains poorly understood. Here we show that a CAG·CTG TNR array stimulates instability at a 275-bp tandem repeat located 6.3 kb away on the Escherichia coli chromosome. Remarkably, this stimulation is independent of both DNA double-strand break repair (DSBR) and RFR but is dependent on a functional mismatch repair (MMR) system. Our results provide a demonstration, in a simple model system, that MMR at one type of repetitive DNA has the potential to influence the stability of another. Furthermore, the mechanism of this stimulation places a limit on the universality of DSBR or RFR models of instability and chromosome fragility at CAG·CTG TNR sequences. Instead, our data suggest that explanations of chromosome fragility should encompass the possibility of chromosome gaps formed during MMR. PMID:21149728

  2. Measles, Mumps, Rubella (MMR)

    MedlinePlus

    ... Measles, Mumps, Rubella (MMR) Meningococcal Disease Pneumococcal Disease Polio Tetanus, Diphtheria, and Pertussis (Tdap) Professional Resources HPV ... Measles, Mumps, Rubella (MMR) Meningococcal Disease Pneumococcal Disease Polio Tetanus, Diphtheria, and Pertussis (Tdap) You May Also ...

  3. A quantitative model of bacterial mismatch repair as applied to studying induced mutagenesis

    NASA Astrophysics Data System (ADS)

    Belov, O. V.; Chuluunbaatar, O.; Kapralov, M. I.; Sweilam, N. H.

    2013-11-01

    The paper presents a mathematical model of the DNA mismatch repair system in Escherichia coli bacterial cells. The key pathways of this repair mechanism were simulated on the basis of modern experimental data. We have modelled in detail five main pathways of DNA misincorporation removal with different DNA exonucleases. Here we demonstrate an application of the model to problems of radiation-induced mutagenesis.

  4. Saturation of DNA mismatch repair and error catastrophe by a base analogue in Escherichia coli.

    PubMed Central

    Negishi, Kazuo; Loakes, David; Schaaper, Roel M

    2002-01-01

    Deoxyribosyl-dihydropyrimido[4,5-c][1,2]oxazin-7-one (dP) is a potent mutagenic deoxycytidine-derived base analogue capable of pairing with both A and G, thereby causing G. C --> A. T and A. T --> G. C transition mutations. We have found that the Escherichia coli DNA mismatch-repair system can protect cells against this mutagenic action. At a low dose, dP is much more mutagenic in mismatch-repair-defective mutH, mutL, and mutS strains than in a wild-type strain. At higher doses, the difference between the wild-type and the mutator strains becomes small, indicative of saturation of mismatch repair. Introduction of a plasmid containing the E. coli mutL(+) gene significantly reduces dP-induced mutagenesis. Together, the results indicate that the mismatch-repair system can remove dP-induced replication errors, but that its capacity to remove dP-containing mismatches can readily be saturated. When cells are cultured at high dP concentration, mutant frequencies reach exceptionally high levels and viable cell counts are reduced. The observations are consistent with a hypothesis in which dP-induced cell killing and growth impairment result from excess mutations (error catastrophe), as previously observed spontaneously in proofreading-deficient mutD (dnaQ) strains. PMID:12196386

  5. A relationship to survival is seen by combining the factors of mismatch repair status, tumor location and age of onset in colorectal cancer patients

    PubMed Central

    Li, Pan; Xiao, Zhitao; Braciak, Todd A.; Ou, Qingjian; Chen, Gong; Oduncu, Fuat S.

    2017-01-01

    Background The progression of colorectal cancer (CRC) may differ depending on the location of the tumor and the age of onset of the disease. Previous studies also suggested that the molecular basis of CRC varies with tumor location, which could affect the clinical management of patients. Therefore, we performed survival analysis looking at different age groups and mismatch repair status (MMR) of CRC patients according to primary tumor location in an attempt to identify subgroups of CRC that might help in the prognosis of disease. Methods A group of 2233 patients operated on to remove their CRC tumors were analyzed (521 with right colon cancer, 740 with left colon cancer and 972 with rectal cancer). The expression of four MMR genes was assessed by immunohistochemistry (IHC), independent of clinical criteria. From the data collected, a predictive model for overall survival (OS) could be constructed for some associations of tumor location and age of onset using Kaplan-Meier, logistic and Cox regression analysis. Results When tumor location was considered as the lone factor, we found no statistical difference in overall survival (OS) between right cancer (68%), left cancer (67%) or rectal cancer tumor locations (71%) (HR: 1.17, 95%CI (confidence interval): 0.97–1.43, P = 0.057). When age of onset was considered, middle age (40–59 years) and older (60–85 years) patients were found to have higher OS than younger onset cancer (20–39 years) patients (69% vs 71% vs 59%, HR: 1.07, 95% confidence interval (CI): 0.91–1.25, P = 0.008). When both age of onset and tumor location were considered in combination as disease factors, we found that the subgroup of patients with left colon cancer from middle age (69%) and older (67%) aged patients had higher OS than younger (54%) patients (HR: 0.89, 95%CI: 0.68–1.16, P = 0.048). However in patients with right colon cancers, we found no statistical difference is OS between younger, middle age or older grouped patients (60% vs

  6. The effects of mismatch repair and RAD1 genes on interchromosomal crossover recombination in Saccharomyces cerevisiae.

    PubMed

    Nicholson, Ainsley; Fabbri, Rebecca M; Reeves, Jason W; Crouse, Gray F

    2006-06-01

    We have previously shown that recombination between 400-bp substrates containing only 4-bp differences, when present in an inverted repeat orientation, is suppressed by >20-fold in wild-type strains of S. cerevisiae. Among the genes involved in this suppression were three genes involved in mismatch repair--MSH2, MSH3, and MSH6--and one in nucleotide excision repair, RAD1. We now report the involvement of these genes in interchromosomal recombination occurring via crossovers using these same short substrates. In these experiments, recombination was stimulated by a double-strand break generated by the HO endonuclease and can occur between completely identical (homologous) substrates or between nonidentical (homeologous) substrates. In addition, a unique feature of this system is that recombining DNA strands can be given a choice of either type of substrate. We find that interchromosomal crossover recombination with these short substrates is severely inhibited in the absence of MSH2, MSH3, or RAD1 and is relatively insensitive to the presence of mismatches. We propose that crossover recombination with these short substrates requires the products of MSH2, MSH3, and RAD1 and that these proteins have functions in recombination in addition to the removal of terminal nonhomology. We further propose that the observed insensitivity to homeology is a result of the difference in recombinational mechanism and/or the timing of the observed recombination events. These results are in contrast with those obtained using longer substrates and may be particularly relevant to recombination events between the abundant short repeated sequences that characterize the genomes of higher eukaryotes.

  7. Proximity to AGCT sequences dictates MMR-independent versus MMR-dependent mechanisms for AID-induced mutation via UNG2.

    PubMed

    Thientosapol, Eddy Sanchai; Sharbeen, George; Lau, K K Edwin; Bosnjak, Daniel; Durack, Timothy; Stevanovski, Igor; Weninger, Wolfgang; Jolly, Christopher J

    2016-12-29

    AID deaminates C to U in either strand of Ig genes, exclusively producing C:G/G:C to T:A/A:T transition mutations if U is left unrepaired. Error-prone processing by UNG2 or mismatch repair diversifies mutation, predominantly at C:G or A:T base pairs, respectively. Here, we show that transversions at C:G base pairs occur by two distinct processing pathways that are dictated by sequence context. Within and near AGCT mutation hotspots, transversion mutation at C:G was driven by UNG2 without requirement for mismatch repair. Deaminations in AGCT were refractive both to processing by UNG2 and to high-fidelity base excision repair (BER) downstream of UNG2, regardless of mismatch repair activity. We propose that AGCT sequences resist faithful BER because they bind BER-inhibitory protein(s) and/or because hemi-deaminated AGCT motifs innately form a BER-resistant DNA structure. Distal to AGCT sequences, transversions at G were largely co-dependent on UNG2 and mismatch repair. We propose that AGCT-distal transversions are produced when apyrimidinic sites are exposed in mismatch excision patches, because completion of mismatch repair would require bypass of these sites.

  8. Loss of DNA mismatch repair function and cancer predisposition in the mouse: animal models for human hereditary nonpolyposis colorectal cancer.

    PubMed

    Edelmann, Lisa; Edelmann, Winfried

    2004-08-15

    Germline mutations in DNA mismatch repair genes underlie one of the most common hereditary cancer predisposition syndromes known in humans, hereditary nonpolyposis colorectal cancer (HNPCC). Defects of the DNA mismatch repair system are also prevalent in sporadic colorectal cancers. The generation of mice with targeted inactivating mutations in the mismatch repair genes has facilitated the in vivo study of how these genes function and how their individual loss contributes to tumorigenesis. Although there are notable limitations when using murine models to study the molecular basis of human cancer, there is remarkable similarity between the two species with respect to the contribution of individual members of the mismatch repair system to cancer susceptibility, and mouse mutants have greatly enhanced our understanding of the normal role of these genes in mutation avoidance and suppression of tumorigenesis.

  9. Characterisation of the oxysterol metabolising enzyme pathway in mismatch repair proficient and deficient colorectal cancer

    PubMed Central

    Swan, Rebecca; Alnabulsi, Abdo; Cash, Beatriz; Alnabulsi, Ayham; Murray, Graeme I.

    2016-01-01

    Oxysterols are oxidised derivatives of cholesterol, formed by the enzymatic activity of several cytochrome P450 enzymes and tumour-derived oxysterols have been implicated in tumour growth and survival. The aim of this study was to profile the expression of oxysterol metabolising enzymes in primary colorectal cancer and assess the association between expression and prognosis. Immunohistochemistry was performed on a colorectal cancer tissue microarray containing 650 primary colorectal cancers using monoclonal antibodies to CYP2R1, CYP7B1, CYP8B1, CYP27A1, CYP39A1, CYP46A1 and CYP51A1, which we have developed. Unsupervised hierarchical cluster analysis was used to examine the overall relationship of oxysterol metabolising enzyme expression with outcome and based on this identify an oxysterol metabolising enzyme signature associated with prognosis. Cluster analysis of the whole patient cohort identified a good prognosis group (mean survival=146 months 95% CI 127-165 months) that had a significantly better survival (δ2=12.984, p<0.001, HR=1.983, 95% CI 1.341-2.799) than the poor prognosis group (mean survival=107 months, 95% CI 98-123 months). For the mismatch repair proficient cohort, the good prognosis group had a significantly better survival (δ2=8.985, p=0.003, HR=1.845, 95% CI 1.227-2.774) than the poor prognosis group. Multi-variate analysis showed that cluster group was independently prognostically significant in both the whole patient cohort (p=0.02, HR=1.554, 95% CI 1.072-2.252) and the mismatch repair proficient group (p=0.04, HR=1.530, 95% CI 1.014-2.310). Individual oxysterol metabolising enzymes are overexpressed in colorectal cancer and an oxysterol metabolising enzyme expression profile associated with prognosis has been identified in the whole patient cohort and in mismatch repair proficient colorectal cancers. PMID:27341022

  10. Differential requirement for proliferating cell nuclear antigen in 5' and 3' nick-directed excision in human mismatch repair.

    PubMed

    Guo, Shuangli; Presnell, Steven R; Yuan, Fenghua; Zhang, Yanbin; Gu, Liya; Li, Guo-Min

    2004-04-23

    Proliferating cell nuclear antigen (PCNA) is involved in mammalian mismatch repair at a step prior to or at mismatch excision, but the molecular mechanism of this process is not fully understood. To examine the role of PCNA in mismatch-provoked and nick-directed excision, orientation-specific mismatch removal of heteroduplexes with a pre-existing nick was monitored in human nuclear extracts supplemented with the PCNA inhibitor protein p21. We show here that, whereas 3' nick-directed mismatch excision was completely inhibited by low concentrations of p21 or a p21 C-terminal fusion protein, 5' nick-directed excision was only partially blocked under the same conditions. No further reduction of the 5' excision was detected when a much higher concentration of p21 C-terminal protein was used. These results suggest the following. (i) There is a differential requirement for PCNA in 3' and 5' nick-directed excision; and (ii) 5' nick-directed excision is conducted by a manner either dependent on or independent of PCNA. Our in vitro reconstitution experiments indeed identified a 5' nick-directed excision pathway that is dependent on PCNA, hMutSalpha, and a partially purified fraction from a HeLa nuclear extract.

  11. 'Escherichia Coli' MutS Tetramerization Domain Structure Reveals That Stable Dimers But Not Tetramers are Essential for DNA Mismatch Repair in Vivo

    SciTech Connect

    Mendillo, M.L.; Putnam, C.D.; Kolodner, R.D.; /UC, San Diego

    2007-07-10

    The E. coli mispair binding protein MutS forms dimers and tetramers in vitro, although the functional form in vivo is under debate. Here we demonstrate that the MutS tetramer is extended in solution using small angle x-ray scattering (SAXS) and the crystal structure of the C-terminal 34 amino acids of MutS containing the tetramer-forming domain fused to maltose binding protein (MBP). Wild-type C-terminal MBP fusions formed tetramers and could bind MutS and MutS-MutL-DNA complexes. In contrast, Asp835Arg and Arg840Glu mutations predicted to disrupt tetrameric interactions only allowed dimerization of MBP. A chromosomal MutS truncation mutation eliminating the dimerization/tetramerization domain eliminated mismatch repair, whereas the tetramer-disrupting MutS Asp835Arg and Arg840Glu mutations only modestly affected MutS function. These results demonstrate that dimerization but not tetramerization of the MutS C- terminus is essential for mismatch repair.

  12. Nucleotide sequence of the hexA gene for DNA mismatch repair in Streptococcus pneumoniae and homology of hexA to mutS of Escherichia coli and Salmonella typhimurium

    SciTech Connect

    Priebe, S.D.; Hadi, S.M.; Greenberg, B.; Lacks, S.A.

    1988-01-01

    The Hex system of heteroduplex DNA base mismatch repair operates in Streptococcus pneumoniae after transformation and replication to correct donor and nascent DNA strands, respectively. A functionally similar system, called Mut, operates in Escherichia coli and Salmonella typhimurium. The nucleotide sequence of a 3.8-kilobase segment from the S. pneumoniae chromosome that includes the 2.7-kilobase hexA gene was determined. Chromosomal DNA used as donor to measure Hex phenotype was irradiated with UV light. An open reading frame that could encode a 17-kilodalton polypeptide (OrfC) was located just upstream of the gene encoding a polypeptide of 95 kilodaltons corresponding to HexA. Shine-Dalgarno sequences and putative promoters were identified upstream of each protein start site. Insertion mutations showed that only HexA functioned in mismatch repair and that the promoter for hexA transcription was located within the OrfC-coding region. The HexA polypeptide contains a consensus sequence for ATP- or GTP-binding sites in proteins. Comparison of the entire HexA protein sequence to that of MutS of S. typhimurium, showed the proteins to be homologous, inasmuch as 36% of their amino acid residues were identical. This homology indicates that the Hex and Mut systems of mismatch repair evolved from an ancestor common to the gram-positive streptococci and the gram-negative enterobacteria. It is the first direct evidence linking the two systems.

  13. Homologous and homeologous intermolecular gene conversion are not differentially affected by mutations in the DNA damage or the mismatch repair genes RAD1, RAD50, RAD51, RAD52, RAD54, PMS1 and MSH2

    SciTech Connect

    Porter, G.; Westmoreland, J.; Priebe, S.

    1996-06-01

    Mismatch repair (MMR) genes or genes involved in both DNA damage repair and homologous recombination might affect homeologous vs. homologous recombination differentially. Spontaneous mitotic gene conversion between a chromosome and a homologous or homeologous donor sequence (14% diverged) on a single copy plasmid was examined in wild-type Saccharomyces cerevisiae strains and in MMR or DNA damage repair mutants. Homologous recombination in rad51, rad52 and rad54 mutants was considerably reduced, while there was little effect of rad1, rad50, pms1 and msh2 null mutations. DNA divergence resulted in no differential effect on recombination rates in the wild type or the mutants; there was only a five- to 10-fold reduction in homeologous relative to homologous recombination regardless of background. Since DNA divergence is known to affect recombination in some systems, we propose that differences in the role of MMR depends on the mode of recombination and/or the level of divergence. Based on analysis of the recombination breakpoints, there is a minimum of three homologous bases required at a recombination junction. A comparison of Rad{sup +} vs. rad52 strains revealed that while all conversion tracts are continuous, elimination of RAD52 leads to the appearance of a novel class of very short conversion tracts. 67 refs., 5 figs., 4 tabs.

  14. Homologous and Homeologous Intermolecular Gene Conversion Are Not Differentially Affected by Mutations in the DNA Damage or the Mismatch Repair Genes Rad1, Rad50, Rad51, Rad52, Rad54, Pms1 and Msh2

    PubMed Central

    Porter, G.; Westmoreland, J.; Priebe, S.; Resnick, M. A.

    1996-01-01

    Mismatch repair (MMR) genes or genes involved in both DNA damage repair and homologous recombination might affect homeologous vs. homologous recombination differentially. Spontaneous mitotic gene conversion between a chromosome and a homologous or homeologous donor sequence (14% diverged) on a single copy plasmid was examined in wild-type Saccharomyces cerevisiae strains and in MMR or DNA damage repair mutants. Homologous recombination in rad51, rad52 and rad54 mutants was considerably reduced, while there was little effect of rad1, rad50, pms1 and msh2 null mutations. DNA divergence resulted in no differential effect on recombination rates in the wild type or the mutants; there was only a five- to 10-fold reduction in homeologous relative to homologous recombination regardless of background. Since DNA divergence is known to affect recombination in some systems, we propose that differences in the role of MMR depends on the mode of recombination and/or the level of divergence. Based on analysis of the recombination breakpoints, there is a minimum of three homologous bases required at a recombination junction. A comparison of Rad(+) vs. rad52 strains revealed that while all conversion tracts are continuous, elimination of RAD52 leads to the appearance of a novel class of very short conversion tracts. PMID:8725224

  15. Sequence and stress-response analyses of the DNA mismatch repair gene hexA in Lactococcus lactis.

    PubMed

    Ren, J; Park, J H; Dunn, N W; Kim, W S

    2001-10-01

    The DNA mismatch repair gene hexA was identified in Lactococcus lactis by PCR amplification by using a pair of primers homologous to the DNA-binding Dps protein. The gene in its entirety, including the regulatory regions, was sequenced, by using a strategy of chromosomal walking based on two PCR protocols. The open reading frame of 2526 bp was preceded by a strong ribosome-binding site (AGGAAG) and was followed by a potential transcription terminator (hairpin loop structure). The 5' terminus of the hexA mRNA was located 135 bp upstream of the start codon, and putative -10 and -35 regions were identified. The deduced amino acid sequence revealed two motifs, the ATP/GTP-binding site (P-loop) and the "MutS family signature". The hexA promoter was cloned into pMU1327, which contained a promoter-less CAT reporter gene, and the promoter activity was examined under oxidative-stress conditions. It appears that the promoter activity is down-shifted by H2O2 at 4 mM.

  16. Mismatch Repair in Schizosaccharomyces Pombe Requires the Mutl Homologous Gene Pms1: Molecular Cloning and Functional Analysis

    PubMed Central

    Schar, P.; Baur, M.; Schneider, C.; Kohli, J.

    1997-01-01

    Homologues of the bacterial mutS and mutL genes involved in DNA mismatch repair have been found in organisms from bacteria to humans. Here, we describe the structure and function of a newly identified Schizosaccharomyces pombe gene that encodes a predicted amino acid sequence of 794 residues with a high degree of homology to MutL related proteins. On the basis of its closer relationship to the eukaryotic ``PMS'' genes than to the ``MLH'' genes, we have designated the S. pombe homologue pms1. Disruption of the pms1 gene causes a significant increase of spontaneous mutagenesis as documented by reversion rate measurements. Tetrad analyses of crosses homozygous for the pms1 mutation reveal a reduction of spore viability from >92% to 80% associated with a low proportion (~50%) of meioses producing four viable spores and a significant, allele-dependent increase of the level of post-meiotic segregation of genetic marker allele pairs. The mutant phenotypes are consistent with a general function of pms1 in correction of mismatched base pairs arising as a consequence of DNA polymerase errors during DNA synthesis, or of hybrid DNA formation between homologous but not perfectly complementary DNA strands during meiotic recombination. PMID:9258673

  17. Correlation between germline mutations in MMR genes and microsatellite instability in ovarian cancer specimens.

    PubMed

    Akbari, Mohammad R; Zhang, Shiyu; Cragun, Deborah; Lee, Ji-Hyun; Coppola, Domenico; McLaughlin, John; Risch, Harvey A; Rosen, Barry; Shaw, Patricia; Sellers, Thomas A; Schildkraut, Joellen; Narod, Steven A; Pal, Tuya

    2017-02-07

    A high proportion of ovarian cancers from women who carry germline mutations in mismatch repair (MMR) genes demonstrate microsatellite instability (MSI). The utility of pre-screening ovarian cancer specimens for MSI to identify potential patients for germline screening for MMR mutations is uncertain. 656 women with malignant ovarian cancer underwent both MSI testing and germline mutation testing for large rearrangements in three MMR genes, MLH1, MSH2 and MSH6. Germline DNA sequencing data for the same genes was available. Among the 656 women, only four (0.6%) carried a clearly pathogenic MMR mutation. All four cancers from patients with mutations had loss of two or more microsatellite markers (MSI-high). Eighty-four of 652 (13.0%) women without a mutation had MSI-high ovarian cancers. Using MSI-high as a prescreening criterion, the sensitivity of MSI testing to identify germline MMR gene mutations was 100% and the positive predictive value was 4.5%. Germline mutations in MLH1, MSH2 and MSH6 are rare among unselected cases of ovarian cancer. Patients with germline mutations often will have MSI-positive cancers and pre-screening of ovarian cancer specimens may be an efficient way of identifying patients with Lynch syndrome.

  18. Mismatch repair of heteroduplex DNA intermediates of extrachromosomal recombination in mammalian cells.

    PubMed Central

    Deng, W P; Nickoloff, J A

    1994-01-01

    Previous work indicated that extrachromosomal recombination in mammalian cells could be explained by the single-strand annealing (SSA) model. This model predicts that extrachromosomal recombination leads to nonconservative crossover products and that heteroduplex DNA (hDNA) is formed by annealing of complementary single strands. Mismatched bases in hDNA may subsequently be repaired to wild-type or mutant sequences, or they may remain unrepaired and segregate following DNA replication. We describe a system to examine the formation and mismatch repair of hDNA in recombination intermediates. Our results are consistent with extrachromosomal recombination occurring via SSA and producing crossover recombinant products. As predicted by the SSA model, hDNA was present in double-strand break-induced recombination intermediates. By placing either silent or frameshift mutations in the predicted hDNA region, we have shown that mismatches are efficiently repaired prior to DNA replication. Images PMID:8264607

  19. Phenotypic Heterogeneity by Germline Mismatch Repair Gene Defect in Lynch Syndrome Patients.

    PubMed

    Hernâni-Eusébio, Jorge; Barbosa, Elisabete

    2016-10-01

    Introdução: A síndrome de Lynch é a forma hereditária mais comum de cancro colo-rectal, sendo também responsável por cancro do endométrio e de outros tipos. Associa-se a mutações germinativas nos genes de mismatch repair do ADN e a instabilidade de microssatélites. As mutações MLH1 e MSH2 têm um fenótipo de síndrome de Lynch ‘clássico’, sendo o MSH2 mais associado a cancro extra-cólico. Mutações do MSH6 e PMS2 têm um fenótipo atípico. A expressão clínica é heterogénea, existindo uma correlação entre o gene mismatch repair mutado e o padrão fenotípico. Material e Métodos: Análise retrospetiva dos dados clínicos de doentes que cumpriam os critérios de Amesterdão ou que tinha mutações nos genes mismatch repair, entre setembro de 2012 e outubro de 2015. Resultados: Identificámos 28 doentes. Dezassete tinham cancro colo-rectal sendo a localização no cólon direito predominante. Cinco tiveram cancro do endométrio (mediana da idade de diagnóstico – 53), sem qualquer mutação no MSH6. Cinco desenvolveram outros cancros. Todos os casos com mutações mismatch repair estudados tinham instabilidade de microssatélites. Discussão: Na maioria dos casos foi encontrada mutação no MSH2 apesar de o MLH1 ser descrito na literatura como o gene mais frequentemente mutado. Interessa dizer que os doentes com cancro colo-rectal não evidenciam uma tendência para ter muito infiltrado inflamatório. Na maioria dos casos foi realizada colectomia parcial apesar da incidência elevada de lesões síncronas e metácronas associadas. Histerectomia e anexectomia profilática foi realizada em doentes em menopausa/perimenopausa. Conclusão: O registo standardizado dos dados dos doentes poderá levar a um melhor acompanhamento e conhecimento desta síndrome. O uso das Guidelines de Bethesda poderá identificar novos casos que escapam aos critérios de Amesterdão. A pesquisa de instabilidade de microssatélites deve ser feita em muito maior n

  20. Spontaneous frameshift mutations in Saccharomyces cerevisiae: accumulation during DNA replication and removal by proofreading and mismatch repair activities.

    PubMed Central

    Greene, C N; Jinks-Robertson, S

    2001-01-01

    The accumulation of frameshift mutations during DNA synthesis is determined by the rate at which frameshift intermediates are generated during DNA polymerization and the efficiency with which frameshift intermediates are removed by DNA polymerase-associated exonucleolytic proofreading activity and/or the postreplicative mismatch repair machinery. To examine the relative contributions of these factors to replication fidelity in Saccharomyces cerevisiae, we determined the reversion rates and spectra of the lys2 Delta Bgl +1 frameshift allele. Wild-type and homozygous mutant diploid strains with all possible combinations of defects in the exonuclease activities of DNA polymerases delta and epsilon (conferred by the pol3-01 and pol2-4 alleles, respectively) and in mismatch repair (deletion of MSH2) were analyzed. Although there was no direct correlation between homopolymer run length and frameshift accumulation in the wild-type strain, such a correlation was evident in the triple mutant strain lacking all repair capacity. Furthermore, examination of strains defective in one or two repair activities revealed distinct biases in the removal of the corresponding frameshift intermediates by exonucleolytic proofreading and/or mismatch repair. Finally, these analyses suggest that the mismatch repair machinery may be important for generating some classes of frameshift mutations in yeast. PMID:11560887

  1. A 30-Year-Old Man with Three Primary Malignancies: A Case of Constitutional Mismatch Repair Deficiency.

    PubMed

    Rengifo-Cam, William; Jasperson, Kory; Garrido-Laguna, Ignacio; Colman, Howard; Scaife, Courtney; Samowitz, Wade; Samadder, N Jewel

    2017-01-01

    Constitutional mismatch repair deficiency (CMMRD) is a devastating cancer predisposition syndrome for which clinical manifestations, genetic screening, and cancer prevention strategies are limited. We report a case of CMMRD presenting with metachronous colorectal cancer and brain cancer. Oncologists and gastroenterologists should be aware of the CMMRD syndrome as a rare cause of very early-onset colorectal cancer.

  2. A 30-Year-Old Man with Three Primary Malignancies: A Case of Constitutional Mismatch Repair Deficiency

    PubMed Central

    Rengifo-Cam, William; Jasperson, Kory; Garrido-Laguna, Ignacio; Colman, Howard; Scaife, Courtney; Samowitz, Wade

    2017-01-01

    Constitutional mismatch repair deficiency (CMMRD) is a devastating cancer predisposition syndrome for which clinical manifestations, genetic screening, and cancer prevention strategies are limited. We report a case of CMMRD presenting with metachronous colorectal cancer and brain cancer. Oncologists and gastroenterologists should be aware of the CMMRD syndrome as a rare cause of very early-onset colorectal cancer. PMID:28286799

  3. Insights into protein -- DNA interactions, stability and allosteric communications: A computational study of MutS-DNA recognition complexes

    NASA Astrophysics Data System (ADS)

    Negureanu, Lacramioara; Salsbury, Freddie

    2012-02-01

    DNA mismatch repair proteins (MMR) maintain genetic stability by recognizing and repairing mismatched bases and insertion/deletion loops mistakenly incorporated during DNA replication, and initiate cellular response to certain types of DNA damage. The most abundant MMR mismatch-binding factor in eukaryotes, MutS, recognizes and initiates the repair of base-base mismatches and small insertion/deletions. We performed molecular dynamics simulations on mismatched and damaged MutS-DNA complexes. A comprehensive DNA binding site analysis of relevant conformations shows that MutS proteins recognize the mismatched and platinum cross-linked DNA substrates in significantly different modes. Distinctive conformational changes associated with MutS binding to mismatched and damaged DNA have been identified and they provide insight into the involvement of MMR proteins in DNA-repair and DNA-damage pathways. Stability and allosteric interactions at the heterodimer interface associated with the mismatch and damage recognition step allow for prediction of key residues in MMR cancer-causing mutations. A rigorous hydrogen bonding analysis for ADP molecules at the ATPase binding sites is also presented. A large number of known MMR cancer causing mutations among the residues were found.

  4. Mismatch repair genes of Streptococcus pneumoniae: HexA confers a mutator phenotype in Escherichia coli by negative complementation.

    PubMed

    Prudhomme, M; Méjean, V; Martin, B; Claverys, J P

    1991-11-01

    DNA repair systems able to correct base pair mismatches within newly replicated DNA or within heteroduplex molecules produced during recombination are widespread among living organisms. Evidence that such generalized mismatch repair systems evolved from a common ancestor is particularly strong for two of them, the Hex system of the gram-positive Streptococcus pneumoniae and the Mut system of the gram-negative Escherichia coli and Salmonella typhimurium. The homology existing between HexA and MutS and between HexB and MutL prompted us to investigate the effect of expressing hex genes in E. coli. Complementation of mutS or mutL mutations, which confer a mutator phenotype, was assayed by introducing on a multicopy plasmid the hexA and hexB genes, under the control of an inducible promoter, either individually or together in E. coli strains. No decrease in mutation rate was conferred by either hexA or hexB gene expression. However, a negative complementation effect was observed in wild-type E. coli cells: expression of hexA resulted in a typical Mut- mutator phenotype. hexB gene expression did not increase the mutation rate either individually or in conjunction with hexA. Since expression of hexA did not affect the mutation rate in mutS mutant cells and the hexA-induced mutator effect was recA independent, it is concluded that this effect results from inhibition of the Mut system. We suggest that HexA, like its homolog MutS, binds to mismatches resulting from replication errors, but in doing so it protects them from repair by the Mut system. In agreement with this hypothesis, an increase in mutS gene copy number abolished the hexA-induced mutator phenotype. HexA protein could prevent repair either by being unable to interact with Mut proteins or by producing nonfunctional repair complexes.

  5. Mitotane sensitizes adrenocortical cancer cells to ionizing radiations by involvement of the cyclin B1/CDK complex in G2 arrest and mismatch repair enzymes modulation.

    PubMed

    Cerquetti, Lidia; Sampaoli, Camilla; Amendola, Donatella; Bucci, Barbara; Misiti, Silvia; Raza, Giorgio; De Paula, Ugo; Marchese, Rodolfo; Brunetti, Ercole; Toscano, Vincenzo; Stigliano, Antonio

    2010-08-01

    Mitotane inhibits steroid synthesis by an action on steroidogenic enzymes, as 11beta-hydroxylase and cholesterol side chain cleavage. It also has a cytotoxic effect on the adrenocortical cells and represents a primary drug used in the adrenocortical carcinoma (ACC). H295R and SW13 cell lines were treated with mitotane 10(-5) M and ionizing radiations (IR) in combination therapy, inducing an irreversible inhibition of cell growth in both adrenocortical cancer cells. As shown in a previous report, mitotane/IR combination treatment induced a cell accumulation in the G2 phase. Here, we report the radiosensitizing properties of mitotane in two different ACC cell lines. The drug reveals the effectiveness to enhance the cytotoxic effects of IR by attenuating DNA repair and interfering on the activation of mitosis promoting factor (MPF), mainly regulated by the degradation of cyclin B1 in the mitotic process. These events may explain the inappropriate activation of cdc2, implicated in G2/M phase arrest and probably induced by the mitotane and IR in the combined treatment. Indeed, treatment with purvalanol, a cdc2-inhibitor prevents cell cycle arrest, triggering the G2/M transition. The observation that mitotane and IR in combination treatment amplifies the activation level of cyclin B/cdc2 complexes contributing to cell cycle arrest, suggests that the MPF could function as a master signal for controlling the temporal order of different mitotic events. Moreover, we report that mitotane interferes in modulation of mismatch repair (MMR) enzymes, revealing radiosensitizing drug ability.

  6. Longer telomeres are associated with cancer risk in MMR-proficient hereditary non-polyposis colorectal cancer.

    PubMed

    Seguí, Nuria; Guinó, Elisabet; Pineda, Marta; Navarro, Matilde; Bellido, Fernando; Lázaro, Conxi; Blanco, Ignacio; Moreno, Victor; Capellá, Gabriel; Valle, Laura

    2014-01-01

    Aberrant telomere length measured in blood has been associated with increased risk of several cancer types. In the field of hereditary non-polyposis colorectal cancer (CRC), and more particularly in Lynch syndrome, caused by germline mutations in the mismatch repair (MMR) genes, we recently found that cancer-affected MMR gene mutation carriers had shorter telomeres and more pronounced shortening of telomere length with age than controls and unaffected MMR gene mutation carriers. Here we evaluate blood telomere length in MMR-proficient hereditary non-polyposis CRC, i.e. familial CRC type X (fCRC-X). A total of 57 cancer-affected and 57 cancer-free individuals from 34 Amsterdam-positive fCRC-X families were analyzed and compared to the data previously published on 144 cancer-affected and 100 cancer-free MMR gene mutation carriers, and 234 controls. Relative telomere length was measured using a monochrome multiplex quantitative PCR method, following strict measures to avoid sources of bias and adjusting by age. Despite the retrospective nature of our study, the results show that longer telomeres associate with cancer risk in fCRC-X, thus identifying different patterns of telomere length according to the status of the MMR system.

  7. The mismatch repair system modulates curcumin sensitivity through induction of DNA strand breaks and activation of G2-M checkpoint.

    PubMed

    Jiang, Zhihua; Jin, ShunQian; Yalowich, Jack C; Brown, Kevin D; Rajasekaran, Baskaran

    2010-03-01

    The highly conserved mismatch (MMR) repair system corrects postreplicative errors and modulates cellular responses to genotoxic agents. Here, we show that the MMR system strongly influences cellular sensitivity to curcumin. Compared with MMR-proficient cells, isogenically matched MMR-deficient cells displayed enhanced sensitivity to curcumin. Similarly, cells suppressed for MLH1 or MSH2 expression by RNA interference displayed increased curcumin sensitivity. Curcumin treatment generated comparable levels of reactive oxygen species and the mutagenic adduct 8-oxo-guanine in MMR-proficient and MMR-deficient cells; however, accumulation of gammaH2AX foci, a marker for DNA double-strand breaks (DSB), occurred only in MMR-positive cells in response to curcumin treatment. Additionally, MMR-positive cells showed activation of Chk1 and induction of G(2)-M cell cycle checkpoint following curcumin treatment and inhibition of Chk1 by UCN-01 abrogated Chk1 activation and heightened apoptosis in MMR-proficient cells. These results indicate that curcumin triggers the accumulation of DNA DSB and induction of a checkpoint response through a MMR-dependent mechanism. Conversely, in MMR-compromised cells, curcumin-induced DSB is significantly blunted, and as a result, cells fail to undergo cell cycle arrest, enter mitosis, and die through mitotic catastrophe. The results have potential therapeutic value, especially in the treatment of tumors with compromised MMR function.

  8. MSH-2 and MLH-1 Protein Expression in Muir Torre Syndrome-Related and Sporadic Sebaceous Neoplasms

    PubMed Central

    Morales-Burgos, Adisbeth; Sánchez, Jorge L.; Figueroa, Luz D.; De Jesús-Monge, Wilfredo E.; Cruz-Correa, Marcia R.; González-Keelan, Carmen; Nazario, Cruz María

    2009-01-01

    Background Muir-Torre Syndrome (MTS) is a rare autosomal-dominant disorder characterized by the predisposition to both sebaceous neoplasm and internal malignancies. MTS-associated sebaceous neoplasms reveal mutations in DNA mismatch repair (MMR) genes and microsatellite instability. A significant part of MTS patients represents a phenotypic variant, the hereditary nonpolyposis colorectal cancer (HNPCC). A strong correlation between microsatellite instability and immunostaining has been demonstrated. The early recognition of sebaceous neoplasm as part of MTS, and their differentiation from sporadic sebaceous neoplasm may have an important application in a clinical setting. The absence of MLH-1 or MSH-2 expression by immunostaining identifies tumors with mismatch repair deficiency. Objectives Our aim is to determine whether an immunohistochemical approach, targeting DNA repair proteins MSH-2 and MLH-1 in MTS-related sebaceous neoplasm and their sporadic counterparts, can be used for their identification. Methods We examined 15 sebaceous neoplasms (including 6 internal malignancy- associated sebaceous neoplasms and 8 sporadic sebaceous neoplasms) from 11 patients for the expression of MSH-2 and MLH-1 by immunohistochemistry. Results Four of 5 internal malignancy-associated sebaceous neoplasms showed loss of expression of MSH-2 or MLH-1. Correlation of the immunostaining pattern of the sebaceous neoplasms and the patients’ positive history of colon carcinoma was 80%. Seven of 8 sporadic sebaceous neoplasms showed a positive expression of MSH-2 and MLH-1. The prevalence for loss of expression of MMR proteins in sebaceous neoplasms was 38.5%. MMR immunostaining had 87.5% specificity and 80% sensitivity. Limitations This study is limited by a small sample size, and by bias selection due to the use of non nationwide data-base as the resource of cases. Conclusions Our findings demonstrate that immunohistochemical testing for internal malignancy-associated sebaceous

  9. Mitochondrial dysfunction and increased sensitivity to excitotoxicity in mice deficient in DNA mismatch repair.

    PubMed

    Francisconi, Simona; Codenotti, Mara; Ferrari Toninelli, Giulia; Uberti, Daniela; Memo, Maurizio

    2006-07-01

    The expression profile in the hippocampus of mice lacking one allele of the MutS homologue (Msh2), gene, which is one of the most representative components of the DNA mismatch repair system, was analysed to understand whether defects in the repair or in response to DNA damage could impact significantly on brain function. The overall results suggested a reduction in mitochondrial function as indicated by gene expression analysis, biochemical and behavioural studies. In the hippocampus of Msh2+/- mice, array data, validated by RT-PCR and western blot analysis, showed reduced expression levels of genes for cytochrome c oxidase subunit 2 (CoxII), ATP synthase subunit beta and superoxide dismutase 1. Biochemically, mitochondria from the hippocampus and cortex of these mice show reduced CoxII and increased aconitase activity. Behaviourally, these alterations resulted in mice with increased vulnerability to kainic acid-induced epileptic seizures and hippocampal neuronal loss. These data suggest that lack of an efficient system involved in recognizing and repairing DNA damage may generate a brain mitochondriopathy.

  10. DNA mismatch repair gene MSH6 implicated in determining age at natural menopause

    PubMed Central

    Perry, John R.B.; Hsu, Yi-Hsiang; Chasman, Daniel I.; Johnson, Andrew D.; Elks, Cathy; Albrecht, Eva; Andrulis, Irene L.; Beesley, Jonathan; Berenson, Gerald S.; Bergmann, Sven; Bojesen, Stig E.; Bolla, Manjeet K.; Brown, Judith; Buring, Julie E.; Campbell, Harry; Chang-Claude, Jenny; Chenevix-Trench, Georgia; Corre, Tanguy; Couch, Fergus J.; Cox, Angela; Czene, Kamila; D'adamo, Adamo Pio; Davies, Gail; Deary, Ian J.; Dennis, Joe; Easton, Douglas F.; Engelhardt, Ellen G.; Eriksson, Johan G.; Esko, Tõnu; Fasching, Peter A.; Figueroa, Jonine D.; Flyger, Henrik; Fraser, Abigail; Garcia-Closas, Montse; Gasparini, Paolo; Gieger, Christian; Giles, Graham; Guenel, Pascal; Hägg, Sara; Hall, Per; Hayward, Caroline; Hopper, John; Ingelsson, Erik; Kardia, Sharon L.R.; Kasiman, Katherine; Knight, Julia A.; Lahti, Jari; Lawlor, Debbie A.; Magnusson, Patrik K.E.; Margolin, Sara; Marsh, Julie A.; Metspalu, Andres; Olson, Janet E.; Pennell, Craig E.; Polasek, Ozren; Rahman, Iffat; Ridker, Paul M.; Robino, Antonietta; Rudan, Igor; Rudolph, Anja; Salumets, Andres; Schmidt, Marjanka K.; Schoemaker, Minouk J.; Smith, Erin N.; Smith, Jennifer A.; Southey, Melissa; Stöckl, Doris; Swerdlow, Anthony J.; Thompson, Deborah J.; Truong, Therese; Ulivi, Sheila; Waldenberger, Melanie; Wang, Qin; Wild, Sarah; Wilson, James F; Wright, Alan F.; Zgaga, Lina; Ong, Ken K.; Murabito, Joanne M.; Karasik, David; Murray, Anna

    2014-01-01

    The length of female reproductive lifespan is associated with multiple adverse outcomes, including breast cancer, cardiovascular disease and infertility. The biological processes that govern the timing of the beginning and end of reproductive life are not well understood. Genetic variants are known to contribute to ∼50% of the variation in both age at menarche and menopause, but to date the known genes explain <15% of the genetic component. We have used genome-wide association in a bivariate meta-analysis of both traits to identify genes involved in determining reproductive lifespan. We observed significant genetic correlation between the two traits using genome-wide complex trait analysis. However, we found no robust statistical evidence for individual variants with an effect on both traits. A novel association with age at menopause was detected for a variant rs1800932 in the mismatch repair gene MSH6 (P = 1.9 × 10−9), which was also associated with altered expression levels of MSH6 mRNA in multiple tissues. This study contributes to the growing evidence that DNA repair processes play a key role in ovarian ageing and could be an important therapeutic target for infertility. PMID:24357391

  11. Altered expression and new mutations in DNA mismatch repair genes MLH1 and MSH2 in melanoma brain metastases.

    PubMed

    Korabiowska, Monika; König, Fatima; Verheggen, Raphaela; Schlott, Thilo; Cordon-Cardo, Carlos; Romeike, Bernd; Brinck, Ulrich

    2004-01-01

    Brain metastases, including those of malignant melanoma (known for its high genomic instability), are the most common intracranial tumors. The main objective of this study was to investigate expression and mutation in the DNA mismatch repair system in melanoma brain metastases. Expression of MLH1, MSH2, PMS1 and PMS2 was investigated immunohistochemically in 31 melanoma metastatic tumors. Mutational analysis of MLH1 and MSH2 was performed in 17 melanoma brain metastases. Loss of MLH1 and MSH2 expression was found in 10/31 and 12/31 tumors. PMS1 (27/31) and PMS2 (28/31) expression was preserved in the majority of lesions. Potential missense mutation was found in MSH2 (exon 13) in 2/17 melanomas. Mutation in the intron sequence between exon 14 and 15 of MLH1 (exon 15) was observed in 4/17 cases. Our results indicate that the two major DNA mismatch repair genes, MLH1 and MSH2, are more frequently affected by alterations in the DNA mismatch repair system than the helper genes PMS1 and PMS2. The presence of mutations of MSH2 and MLH1 in melanoma brain metastases, which has not been found in primary melanomas, indicates the high genomic instability of melanoma brain metastases.

  12. MMR: risk, choice, chance.

    PubMed

    Fitzpatrick, Michael

    2004-01-01

    The unfolding of the measles, mumps and rubella (MMR) controversy reveals some of the key features of the cultural climate affecting matters of health and illness in contemporary society. A high level of anxiety around issues of health is reflected in a heightened sense of individual vulnerability to environmental dangers (such as atmospheric pollution, electromagnetic fields, bioterrorism) and in a general aversion to risk, particularly in relation to children. This mood has proved responsive to views sceptical, if not hostile, towards science and medicine and associated professionals, particularly in the sphere of immunization. The result is that uptake of MMR vaccination in the UK has fallen, from a peak of 92% in the mid-1990s to a national level of 82% in 2003 (at the age of two); in London uptake is now less than 75%-much less in some areas-causing a significant risk of outbreaks of measles. In the USA too, the proportion of parents opting out of regulations requiring immunization as a condition of school entry has increased significantly in some areas, though these controversies appear to have had little impact so far in continental Europe.

  13. Relationship between DNA mismatch repair genes expression, Ku-genes expression and ploidy-related parameters in the progression of pigmented lesions of the skin.

    PubMed

    Korabiowska, Monika; Tscherny, Michael; Stachura, Jerzy; Ruschenburg, Ilka; Cordon-Cardo, Carlos; Brinck, Ulrich

    2002-01-01

    Defects of DNA repair systems in cutaneous tumours are related to DNA mismatch repair genes (MLH1, MSH2, PMS1, PMS2) and Ku70/80 genes involved in double- strand repair. In this study we investigated the statistical relationship between these systems and DNA-ploidy-related parameters in 19 naevus cell naevi, 23 lentigos maligna, 76 primary melanomas and 31 melanoma metastases, applying the correlation coefficient according to Spearman. In naevi significant correlations were found between Ku70/80 gene expression and some ploidy-related parameters. In lentigos, additionally, some significant correlations between the expression of DNA mismatch repair genes were found. Similar results were demonstrated for primary melanomas. In metastases no one significant correlation between DNA mismatch repair genes and Ku-genes was present. We postulate that DNA mismatch repair genes and Ku70/80 genes are functionally independent and that some of them are able to influence ploidy-related parameters.

  14. Case report: impressive response to pembrolizumab in a patient with mismatch-repair deficient metastasized colorectal cancer and bulky disease

    PubMed Central

    Kieler, Markus; Scheithauer, Werner; Zielinski, Christoph C; Chott, Andreas; Al-Mukhtar, Ali; Prager, Gerald W

    2016-01-01

    Here, we report the history of a 42-year-old female patient with sporadic mismatch-repair-deficient metastatic colorectal cancer and abdominal bulky disease, who received pembrolizumab (200 mg every 3 weeks) after the failure of third-line treatment. Restaging 3 months after initiation of treatment revealed a striking response with shrinkage of the bulky peritoneal tumour mass (baseline size 11×11×14 cm) to nearly 25% of the original tumour volume (6.2×7.1×10.4 cm). Restaging 8 months after initiation showed further downsizing of the tumour mass (5.5×7.0×8.0 cm). Tumour markers CEA and CA 19-9 decreased to normal levels, haemoglobin level increased from 8 to 13 mg/dL and her overall clinical performance status increased from ECOG 3 to 1 within 3 months. Therapy with pembrolizumab was continued and is still ongoing. We emphasise the importance of testing for mismatch-repair status in metastatic disease. PMID:28255450

  15. Introduction of specific point mutations into RNA polymerase II by gene targeting in mouse embryonic stem cells: evidence for a DNA mismatch repair mechanism.

    PubMed Central

    Steeg, C M; Ellis, J; Bernstein, A

    1990-01-01

    We have introduced two specific point mutations, located 20 base pairs apart, into the endogenous murine gene that encodes the largest subunit of RNA polymerase II (RPII215). The first mutation conferred resistance to the mushroom toxin alpha-amanitin (amar), and the second mutation generated a restriction fragment length polymorphism without altering the protein sequence. Targeted amar clones were generated at a frequency of 1 in 30 totipotent embryonic stem cells that expressed stably integrated DNA vectors after electroporation. Thirty to 40% of these clones had acquired both mutations, whereas, surprisingly, the remaining clones had acquired the specific amar point mutation but lacked the restriction fragment length polymorphism. We suggest that the latter clones were generated by independent DNA mismatch repair rather than by double crossover or gene conversion. These results demonstrate that it is possible to introduce specific point mutations into an endogenous gene in embryonic stem cells. Thus it should be possible to introduce single base substitutions into other cellular genes, including nonselectable genes, by optimizing the efficiency of gene transfer and/or the sensitivity of screening for targeted clones. Images PMID:1972278

  16. mmr, a Mycobacterium tuberculosis Gene Conferring Resistance to Small Cationic Dyes and Inhibitors

    PubMed Central

    De Rossi, Edda; Branzoni, Manuela; Cantoni, Rita; Milano, Anna; Riccardi, Giovanna; Ciferri, Orio

    1998-01-01

    The mmr gene, cloned from Mycobacterium tuberculosis, was shown to confer to Mycobacterium smegmatis resistance to tetraphenylphosphonium (TPP), erythromycin, ethidium bromide, acriflavine, safranin O, and pyronin Y. The gene appears to code for a protein containing four transmembrane domains. Studies of [3H]TPP intracellular accumulation strongly suggest that the resistance mediated by the Mmr protein involves active extrusion of TPP. PMID:9811672

  17. Evolutionary Rate Covariation in Meiotic Proteins Results from Fluctuating Evolutionary Pressure in Yeasts and Mammals

    PubMed Central

    Clark, Nathan L.; Alani, Eric; Aquadro, Charles F.

    2013-01-01

    Evolutionary rates of functionally related proteins tend to change in parallel over evolutionary time. Such evolutionary rate covariation (ERC) is a sequence-based signature of coevolution and a potentially useful signature to infer functional relationships between proteins. One major hypothesis to explain ERC is that fluctuations in evolutionary pressure acting on entire pathways cause parallel rate changes for functionally related proteins. To explore this hypothesis we analyzed ERC within DNA mismatch repair (MMR) and meiosis proteins over phylogenies of 18 yeast species and 22 mammalian species. We identified a strong signature of ERC between eight yeast proteins involved in meiotic crossing over, which seems to have resulted from relaxation of constraint specifically in Candida glabrata. These and other meiotic proteins in C. glabrata showed marked rate acceleration, likely due to its apparently clonal reproductive strategy and the resulting infrequent use of meiotic proteins. This correlation between change of reproductive mode and change in constraint supports an evolutionary pressure origin for ERC. Moreover, we present evidence for similar relaxations of constraint in additional pathogenic yeast species. Mammalian MMR and meiosis proteins also showed statistically significant ERC; however, there was not strong ERC between crossover proteins, as observed in yeasts. Rather, mammals exhibited ERC in different pathways, such as piRNA-mediated defense against transposable elements. Overall, if fluctuation in evolutionary pressure is responsible for ERC, it could reveal functional relationships within entire protein pathways, regardless of whether they physically interact or not, so long as there was variation in constraint on that pathway. PMID:23183665

  18. Development of DNA mismatch repair gene, MutS, as a diagnostic marker for detection and phylogenetic analysis of algal Megaviruses.

    PubMed

    Wilson, William H; Gilg, Ilana C; Duarte, Amy; Ogata, Hiroyuki

    2014-10-01

    Megaviruses are generically defined as giant viruses with genomes up to 1.26Mb that infect eukaryotic unicellular protists; they are clearly delineated in DNA polymerase B phylogenetic trees; in addition, common features often include an associated virophage observed during infection; the presence of an amino acyl tRNA synthetase gene; and a nucleic acid mismatch repair protein, MutS gene. The archetypal representative of this evolving putative family is Mimivirus, an opportunistic pathogen of Acanthamoeba spp. originally thought to be a bacterium until its genome sequence was published in 2004. Subsequent analysis of marine metagenomic data revealed Megaviruses are likely ubiquitous on the surface ocean. Analysis of genome sequences of giant viruses isolated from naturally occurring marine protists such as microalgae and a microflagellate grazer, started the expansion of the Megaviridae. Here, we explored the possibility of developing Megavirus specific markers for mutS that could be used in virus molecular ecology studies. MutS is split into 15 different clades representing a wide range of cellular life, and two that contain Megaviruses, clade MutS7 and clade MutS8. We developed specific PCR primers that recognized Megavirus clade MutS8, a clade that we propose discriminates most of the algal Megaviruses. Analysis of seawater off the coast of Maine, US, revealed novel groups of algal Megaviruses that were present in all samples tested. The Megavirus clade MutS8 marker should be considered as a tool to reveal new diversity and distribution of this enigmatic group of viruses.

  19. Heteroduplex formation and mismatch repair of the "stuck" mutation during mating-type switching in Saccharomyces cerevisiae.

    PubMed Central

    Ray, B L; White, C I; Haber, J E

    1991-01-01

    We sequenced two alleles of the MATa locus of Saccharomyces cerevisiae that reduce homothallic switching and confer viability to HO rad52 strains. Both the MATa-stk (J. E. Haber, W. T. Savage, S. M. Raposa, B. Weiffenbach, and L. B. Rowe, Proc. Natl. Acad. Sci. USA 77:2824-2828, 1980) and MATa-survivor (R. E. Malone and D. Hyman, Curr. Genet. 7:439-447, 1983) alleles result from a T----A base change at position Z11 of the MAT locus. These strains also contain identical base substitutions at HMRa, so that the mutation is reintroduced when MAT alpha switches to MATa. Mating-type switching in a MATa-stk strain relative to a MATa Z11T strain is reduced at least 50-fold but can be increased by expression of HO from a galactose-inducible promoter. We confirmed by Southern analysis that the Z11A mutation reduced the efficiency of double-strand break formation compared with the Z11T variant; the reduction was more severe in MAT alpha than in MATa. In MAT alpha, the Z11A mutation also creates a mat alpha 1 (sterile) mutation that distinguishes switches of MATa-stk to either MAT alpha or mat alpha 1-stk. Pedigree analysis of cells induced to switch in G1 showed that MATa-stk switched frequently (23% of the time) to produce one mat alpha 1-stk and one MAT alpha progeny. This postswitching segregation suggests that Z11 was often present in heteroduplex DNA that was not mismatch repaired. When mismatch repair was prevented by deletion of the PMS1 gene, there was an increase in the proportion of mat alpha 1-stk/MAT alpha sectors (59%) and in pairs of switched cells that both retained the stk mutation (27%). We conclude that at least one strand of DNA only 4 bp from the HO cut site is not degraded in most of the gene conversion events that accompany MAT switching. Images PMID:1922052

  20. Heteroduplex formation and mismatch repair of the "stuck" mutation during mating-type switching in Saccharomyces cerevisiae.

    PubMed

    Ray, B L; White, C I; Haber, J E

    1991-10-01

    We sequenced two alleles of the MATa locus of Saccharomyces cerevisiae that reduce homothallic switching and confer viability to HO rad52 strains. Both the MATa-stk (J. E. Haber, W. T. Savage, S. M. Raposa, B. Weiffenbach, and L. B. Rowe, Proc. Natl. Acad. Sci. USA 77:2824-2828, 1980) and MATa-survivor (R. E. Malone and D. Hyman, Curr. Genet. 7:439-447, 1983) alleles result from a T----A base change at position Z11 of the MAT locus. These strains also contain identical base substitutions at HMRa, so that the mutation is reintroduced when MAT alpha switches to MATa. Mating-type switching in a MATa-stk strain relative to a MATa Z11T strain is reduced at least 50-fold but can be increased by expression of HO from a galactose-inducible promoter. We confirmed by Southern analysis that the Z11A mutation reduced the efficiency of double-strand break formation compared with the Z11T variant; the reduction was more severe in MAT alpha than in MATa. In MAT alpha, the Z11A mutation also creates a mat alpha 1 (sterile) mutation that distinguishes switches of MATa-stk to either MAT alpha or mat alpha 1-stk. Pedigree analysis of cells induced to switch in G1 showed that MATa-stk switched frequently (23% of the time) to produce one mat alpha 1-stk and one MAT alpha progeny. This postswitching segregation suggests that Z11 was often present in heteroduplex DNA that was not mismatch repaired. When mismatch repair was prevented by deletion of the PMS1 gene, there was an increase in the proportion of mat alpha 1-stk/MAT alpha sectors (59%) and in pairs of switched cells that both retained the stk mutation (27%). We conclude that at least one strand of DNA only 4 bp from the HO cut site is not degraded in most of the gene conversion events that accompany MAT switching.

  1. Mismatch repair defects and Lynch syndrome: The role of the basic scientist in the battle against cancer.

    PubMed

    Heinen, Christopher D

    2016-02-01

    We have currently entered a genomic era of cancer research which may soon lead to a genomic era of cancer treatment. Patient DNA sequencing information may lead to a personalized approach to managing an individual's cancer as well as future cancer risk. The success of this approach, however, begins not necessarily in the clinician's office, but rather at the laboratory bench of the basic scientist. The basic scientist plays a critical role since the DNA sequencing information is of limited use unless one knows the function of the gene that is altered and the manner by which a sequence alteration affects that function. The role of basic science research in aiding the clinical management of a disease is perhaps best exemplified by considering the case of Lynch syndrome, a hereditary disease that predisposes patients to colorectal and other cancers. This review will examine how the diagnosis, treatment and even prevention of Lynch syndrome-associated cancers has benefitted from extensive basic science research on the DNA mismatch repair genes whose alteration underlies this condition.

  2. [Cloning of mMR-1 gene and expression in Pichia pastoris systems].

    PubMed

    Li, Tian-Bo; Hu, Yang; Wang, Yi-Guang; Xia, Huan-Zhang

    2005-01-01

    hMR-1 (Homo Myofibrillogenesis Regulator 1, AF417001) is a novel homo gene, which was firstly cloned in our laboratory. The former studies revealed that hMR-1 is a transmembrane protein which shows protein interaction with sarcomeric proteins like myomesin I, myosin regulatory light chain, alpha-enolase and some cell regulator proteins such as eukaryotic translation initiation factor3 subunit 5 (eIF3S5) and etc. In this work, we focused on cloning the homologous gene of hMR-1 from mouse C57BL/6J and exploring its expression using Pichia pastoris yeast system. Two pairs of primers were synthesized according to the hMR-1 gene homologous sequence on mouse genome chromosome 1. The mouse MR-1 gene (mMR-1) was cloned by PCR following the first round RT-PCR from mouse C57BL/6J spleen total RNA. Sequence analysis verified that mMR-1 gene and amino acids sequence showed 90.4% and 90.1% identity with hMR-1, respectively. The prediction of hydrophobic transmembrane structure of mMR-1 suggested it is also a transmembrane protein. The mMR-1 Pichia pastoris expression vector pPIC9-mMR-1 was constructed by fusion of the flanking mMR-1 ORF in the pPIC9 plasmid. After linearization of pPIC9-mMR-1 with Sal I, the 8.5kb DNA fragment was transformed into Pichia pastoris GS115 strain by electroporation. GS115/Mut+ pPIC9-mMR-1 transformants were selected on minimal methanol medium. Integration of mMR-1 gene into the yeast genome in the recombinants was verified by PCR from the transformants total DNA. The mMR-1 protein was expressed by induction under the concentration of 0.5 % methanol. The specific induced protein of 25 kD molecular mass in SDS-PAGE was confirmed to be the mMR-1 protein by Western blot rsing hMR-1 polyclonal antibody. The expression level of this recombinant mMR-1 protein was about 50 mg/L. The successful expression of mMR-1 in the Pichia pastoris GS115 will facilitate the further functional analysis of the novel gene MR-1 in animal model.

  3. The E705K mutation in hPMS2 exerts recessive, not dominant, effects on mismatch repair

    PubMed Central

    Deschênes, Suzanne M.; Tomer, Guy; Nguyen, Megan; Erdeniz, Naz; Juba, Nicole C.; Sepúlveda, Natalia; Pisani, Jenna E.; Liskay, R. Michael

    2008-01-01

    The hPMS2 mutation E705K is associated with Turcot syndrome. To elucidate the pathogenesis of hPMS2-E705K, we modeled this mutation in yeast and characterized its expression and effects on mutation avoidance in mammalian cells. We found that while hPMS2-E705K (pms1-E738K in yeast) did not significantly affect hPMS2 (Pms1p in yeast) stability or interaction with MLH1, it could not complement the mutator phenotype in MMR-deficient mouse or yeast cells. Further-more, hPMS2-E705K/pms1-E738K inhibited MMR in wild-type (WT) mammalian cell extracts or yeast cells only when present in excess amounts relative to WT PMS2. Our results strongly suggest that hPMS2-E705K is a recessive loss-of-function allele. PMID:17029773

  4. Destabilization of the MutSα’s protein-protein interface due to binding to the DNA adduct induced by anticancer agent Carboplatin via molecular dynamics simulations

    PubMed Central

    Negureanu, Lacramioara; Salsbury, Freddie R

    2013-01-01

    DNA mismatch repair (MMR) proteins maintain genetic integrity in all organisms by recognizing and repairing DNA errors. Such alteration of hereditary information can lead to various diseases, including cancer. Besides their role in DNA repair, MMR proteins detect and initiate cellular responses to certain type of DNA damage. Its response to the damaged DNA has made the human MMR pathway a useful target for anticancer agents such as carboplatin. This study indicates that strong, specific interactions at the interface of MutSα in response to the mismatched DNA recognition are replaced by weak, non-specific interactions in response to the damaged DNA recognition. Data suggest a severe impairment of the dimerization of MutSα in response to the damaged DNA recognition. While the core of MutSα is preserved in response to the damaged DNA recognition, the loss of contact surface and the rearrangement of contacts at the protein interface suggest a different packing in response to the damaged DNA recognition. Coupled in response to the mismatched DNA recognition, interaction energies, hydrogen bonds, salt bridges, and solvent accessible surface areas at the interface of MutSα and within the subunits are uncoupled or asynchronously coupled in response to the damaged DNA recognition. These pieces of evidence suggest that the loss of a synchronous mode of response in the MutSα’s surveillance for DNA errors would possible be one of the mechanism(s) of signaling the MMR-dependent programed cell death much wanted in anticancer therapies. The analysis was drawn from dynamics simulations. PMID:24061854

  5. An Efficient Site-Specific Method for Irreversible Covalent Labeling of Proteins with a Fluorophore.

    PubMed

    Liu, Jiaquan; Hanne, Jeungphill; Britton, Brooke M; Shoffner, Matthew; Albers, Aaron E; Bennett, Jared; Zatezalo, Rachel; Barfield, Robyn; Rabuka, David; Lee, Jong-Bong; Fishel, Richard

    2015-11-19

    Fluorophore labeling of proteins while preserving native functions is essential for bulk Förster resonance energy transfer (FRET) interaction and single molecule imaging analysis. Here we describe a versatile, efficient, specific, irreversible, gentle and low-cost method for labeling proteins with fluorophores that appears substantially more robust than a similar but chemically distinct procedure. The method employs the controlled enzymatic conversion of a central Cys to a reactive formylglycine (fGly) aldehyde within a six amino acid Formylglycine Generating Enzyme (FGE) recognition sequence in vitro. The fluorophore is then irreversibly linked to the fGly residue using a Hydrazinyl-Iso-Pictet-Spengler (HIPS) ligation reaction. We demonstrate the robust large-scale fluorophore labeling and purification of E.coli (Ec) mismatch repair (MMR) components. Fluorophore labeling did not alter the native functions of these MMR proteins in vitro or in singulo. Because the FGE recognition sequence is easily portable, FGE-HIPS fluorophore-labeling may be easily extended to other proteins.

  6. Population Modelling with M&M's[R

    ERIC Educational Resources Information Center

    Winkel, Brian

    2009-01-01

    Several activities in which population dynamics can be modelled by tossing M&M's[R] candy are presented. Physical activities involving M&M's[R] can be modelled by difference equations and several population phenomena, including death and immigration, are studied. (Contains 1 note.)

  7. Case-case study of factors associated to hMLH1, hMSH2, and hMSH6 protein expression among endometrial cancer patients of the University District Hospital of San Juan, Puerto Rico

    PubMed Central

    González, Lorena; Ortiz, Ana P.; Suárez, Erick; Umpierre, Sharee; Marcos, Maria J.; Billoch, Jorge; Joy, Leilani; Charneco, Eileen; Lacourt, Mercedes Y.; Bernabe-Dones, Raúl D.; Cruz-Correa, Marcia

    2012-01-01

    Lynch syndrome (LS) is an autosomal dominant disorder caused by DNA mismatch repair (MMR) system deficiencies. Women affected by LS present a 40 to 60% lifetime risk of endometrial cancer (EC). Objective This case-case study aims to determine the frequency of the hMLH1, hMSH2, and hMSH6 MMR proteins and the factors (age, family history of cancer [FHC] related to LS, and body mass index [BMI]) associated to their absence in EC patients attending the University District Hospital of San Juan, Puerto Rico. Method/Materials Twenty cases were preliminary evaluated for the MMR protein expression by immunohistochemistry testing and classified as positive-cases (presence of protein) or negative-cases (absence of protein). The statistical analysis was based on the logistic regression model using the Maximum Likelihood estimation (MLE). The Bayesian approach was used to determine the posterior probability {posterior Pr[OR>1]}. Results Results showed absence for at least one MMR protein in 25% of the cases; 15% for hMLH1 and 10% for hMSH2. None of the cases showed an absence for hMSH6. The MLE demonstrated that women diagnosed with EC before the age of 50 (OR: 12.4; 95%CI = 0.5–322.7), having FHC related to LS (OR: 17.7; 95%CI = 0.6–534.6), and having lower BMI (OR: 2.38; 95%CI = 0.39–14.28) present higher odds than their counterparts of lacking an MMR protein, once adjusting for potential predictors (p > .05). The posterior probability that an excess risk of lacking an MMR protein occurs was ≥ 95% for each predictor. Conclusion Our study in this Hispanic population supports previous studies in that younger age, FHC, and lower BMI are associated with increased odds of having an absence of MMR protein expression. Further studies with larger sample sizes should be performed. PMID:22635031

  8. Red meat and poultry intake, polymorphisms in the nucleotide excision repair and mismatch repair pathways and colorectal cancer risk

    PubMed Central

    Joshi, Amit D.; Corral, Román; Siegmund, Kimberly D.; Haile, Robert W.; Le Marchand, Loïc; Martínez, Maria Elena; Ahnen, Dennis J.; Sandler, Robert S.; Lance, Peter; Stern, Mariana C.

    2009-01-01

    Diets high in red meat have been consistently associated with colorectal cancer (CRC) risk and may result in exposure to carcinogens that cause DNA damage [i.e polycyclic aromatic hydrocarbons, heterocyclic amines (HCAs) and N-nitroso compounds]. Using a family-based study, we investigated whether polymorphisms in the nucleotide excision repair (NER) (ERCC1 3′ untranslated region (UTR) G/T, XPD Asp312Asn and Lys751Gln, XPC intron 11 C/A, XPA 5′ UTR C/T, XPF Arg415Gln and XPG Asp1104His) and mismatch repair (MLH1 Ile219Val and MSH2 Gly322Asp) pathways modified the association with red meat and poultry intake. We tested for gene–environment interactions using case-only analyses (n = 577) and compared the results using case-unaffected sibling comparisons (n = 307 sibships). Increased risk of CRC was observed for intake of more than or equal to three servings per week of red meat [odds ratio (OR) = 1.8, 95% confidence interval (CI) = 1.3–2.5)] or high-temperature cooked red meat (OR = 1.6, 95% CI = 1.1–2.2). Intake of red meat heavily brown on the outside or inside increased CRC risk only among subjects who carried the XPD codon 751 Lys/Lys genotype (case-only interaction P = 0.006 and P = 0.001, respectively, for doneness outside or inside) or the XPD codon 312 Asp/Asp genotype (case-only interaction P = 0.090 and P < 0.001, respectively). These interactions were stronger for rectal cancer cases (heterogeneity test P = 0.002 for XPD Asp312Asn and P = 0.03 for XPD Lys751Gln) and remained statistically significant after accounting for multiple testing. Case-unaffected sibling analyses were generally supportive of the case-only results. These findings highlight the possible contribution of diets high in red meat to the formation of lesions that elicit the NER pathway, such as carcinogen-induced bulky adducts. PMID:19029193

  9. Mucoidy, Quorum Sensing, Mismatch Repair and Antibiotic Resistance in Pseudomonas aeruginosa from Cystic Fibrosis Chronic Airways Infections

    PubMed Central

    Feliziani, Sofía; Sola, Claudia; Bocco, José L.; Montanaro, Patricia; Canigia, Liliana Fernández; Argaraña, Carlos E.; Smania, Andrea M.

    2010-01-01

    Survival of Pseudomonas aeruginosa in cystic fibrosis (CF) chronic infections is based on a genetic adaptation process consisting of mutations in specific genes, which can produce advantageous phenotypic switches and ensure its persistence in the lung. Among these, mutations inactivating the regulators MucA (alginate biosynthesis), LasR (quorum sensing) and MexZ (multidrug-efflux pump MexXY) are the most frequently observed, with those inactivating the DNA mismatch repair system (MRS) being also highly prevalent in P. aeruginosa CF isolates, leading to hypermutator phenotypes that could contribute to this adaptive mutagenesis by virtue of an increased mutation rate. Here, we characterized the mutations found in the mucA, lasR, mexZ and MRS genes in P. aeruginosa isolates obtained from Argentinean CF patients, and analyzed the potential association of mucA, lasR and mexZ mutagenesis with MRS-deficiency and antibiotic resistance. Thus, 38 isolates from 26 chronically infected CF patients were characterized for their phenotypic traits, PFGE genotypic patterns, mutations in the mucA, lasR, mexZ, mutS and mutL gene coding sequences and antibiotic resistance profiles. The most frequently mutated gene was mexZ (79%), followed by mucA (63%) and lasR (39%) as well as a high prevalence (42%) of hypermutators being observed due to loss-of-function mutations in mutL (60%) followed by mutS (40%). Interestingly, mutational spectra were particular to each gene, suggesting that several mechanisms are responsible for mutations during chronic infection. However, no link could be established between hypermutability and mutagenesis in mucA, lasR and mexZ, indicating that MRS-deficiency was not involved in the acquisition of these mutations. Finally, although inactivation of mucA, lasR and mexZ has been previously shown to confer resistance/tolerance to antibiotics, only mutations in MRS genes could be related to an antibiotic resistance increase. These results help to unravel the

  10. Simple Sequence Repeats Together with Mismatch Repair Deficiency Can Bias Mutagenic Pathways in Pseudomonas aeruginosa during Chronic Lung Infection

    PubMed Central

    Moyano, Alejandro J.; Feliziani, Sofía; Di Rienzo, Julio A.; Smania, Andrea M.

    2013-01-01

    Pseudomonas aeruginosa is an opportunistic pathogen that chronically infects the airways of cystic fibrosis (CF) patients and undergoes a process of genetic adaptation based on mutagenesis. We evaluated the role of mononucleotide G:C and A:T simple sequence repeats (SSRs) in this adaptive process. An in silico survey of the genome sequences of 7 P. aeruginosa strains showed that mononucleotide G:C SSRs but not A:T SSRs were greatly under-represented in coding regions, suggesting a strong counterselection process for G:C SSRs with lengths >5 bp but not for A:T SSRs. A meta-analysis of published whole genome sequence data for a P. aeruginosa strain from a CF patient with chronic airway infection showed that G:C SSRs but not A:T SSRs were frequently mutated during the infection process through the insertion or deletion of one or more SSR subunits. The mutation tendency of G:C SSRs was length-dependent and increased exponentially as a function of SSR length. When this strain naturally became a stable Mismatch Repair System (MRS)-deficient mutator, the degree of increase of G:C SSRs mutations (5-fold) was much higher than that of other types of mutation (2.2-fold or less). Sequence analysis of several mutated genes reported for two different collections, both containing mutator and non-mutator strains of P. aeruginosa from CF chronic infections, showed that the proportion of G:C SSR mutations was significantly higher in mutators than in non-mutators, whereas no such difference was observed for A:T SSR mutations. Our findings, taken together, provide genome-scale evidences that under a MRS-deficient background, long G:C SSRs are able to stochastically bias mutagenic pathways by making the genes in which they are harbored more prone to mutation. The combination of MRS deficiency and virulence-related genes that contain long G:C SSRs is therefore a matter of concern in P. aeruginosa CF chronic infection. PMID:24278287

  11. hMYH and hMTH1 cooperate for survival in mismatch repair defective T-cell acute lymphoblastic leukemia

    PubMed Central

    Eshtad, S; Mavajian, Z; Rudd, S G; Visnes, T; Boström, J; Altun, M; Helleday, T

    2016-01-01

    hMTH1 is an 8-oxodGTPase that prevents mis-incorporation of free oxidized nucleotides into genomic DNA. Base excision and mismatch repair pathways also restrict the accumulation of oxidized lesions in DNA by removing the mis-inserted 8-oxo-7,8-dihydro-2'-deoxyguanosines (8-oxodGs). In this study, we aimed to investigate the interplay between hMYH DNA glycosylase and hMTH1 for cancer cell survival by using mismatch repair defective T-cell acute lymphoblastic leukemia (T-ALL) cells. To this end, MYH and MTH1 were silenced individually or simultaneously using small hairpin RNAs. Increased sub-G1 population and apoptotic cells were observed upon concurrent depletion of both enzymes. Elevated cell death was consistent with cleaved caspase 3 accumulation in double knockdown cells. Importantly, overexpression of the nuclear isoform of hMYH could remove the G1 arrest and partially rescue the toxicity observed in hMTH1-depleted cells. In addition, expression profiles of human DNA glycosylases were generated using quantitative reverse transcriptase–PCR in MTH1 and/or MYH knockdown cells. NEIL1 DNA glycosylase, involved in repair of oxidized nucleosides, was found to be significantly downregulated as a cellular response to MTH1–MYH co-suppression. Overall, the results suggest that hMYH and hMTH1 functionally cooperate for effective repair and survival in mismatch repair defective T-ALL Jurkat A3 cells. PMID:27918552

  12. Escherichia coli strains (ndk) lacking nucleoside diphosphate kinase are powerful mutators for base substitutions and frameshifts in mismatch-repair-deficient strains.

    PubMed

    Miller, Jeffrey H; Funchain, Pauline; Clendenin, Wendy; Huang, Tiffany; Nguyen, Anh; Wolff, Erika; Yeung, Annie; Chiang, Ju-Huei; Garibyan, Lilit; Slupska, Malgorzata M; Yang, Hanjing

    2002-09-01

    Nucleoside diphosphate (NDP) kinase is one of the enzymes that maintains triphosphate pools. Escherichia coli strains (ndk) lacking this enzyme have been shown to be modest base substitution mutators, and two members of the human family of NDP kinases act as tumor suppressors. We show here that in E. coli strains lacking NDP kinase high levels of mispairs are generated, but most of these are corrected by the mismatch-repair system. Double mutants that are ndk mutS, lacking both the NDP kinase and mismatch repair, have levels of base substitutions 15-fold higher and levels of certain frameshifts up to 10-fold higher than those of the respective mutations in mutS strains that are NDP kinase proficient. A sequence analysis of the specificity of base substitution mutations generated in ndk and ndk mutS backgrounds as well as other experiments suggests that NDP kinase deficiency stimulates polymerase errors that lead to A:T --> G:C transitions and that the editing capacity of cells may be affected, leading to additional uncorrected mispairs and to A:T --> T:A transversions.

  13. Development of an Immunosensor Based on Layered Double Hydroxides for MMR Cancer Biomarker Detection.

    PubMed

    Hammami, M; Soussou, A; Idoudi, F; Cohen-Bouhacina, T; Bouhaouala-Zahar, B; Baccar, Z M

    2015-10-01

    As a potential biomarker for the investigation of cancer inflammatory profiles, macrophage mannose receptor (MMR, CD206) is herein selected to develop an immunosensor based on layered double hydroxide (LDH). Like an endocyte C-type lectin receptor, MMR plays an important role in immune homeostasis by scavenging unwanted mannose glycoproteins. It attracts a progressive attention thanks to its particularly high expression within the tumor microenvironment. There is a great of interest to develop an immunosensor based on an antibody specific to MMR for detection of stroma versus tumor cells. In this work, we studied the feasibility of high sensitive MMR cancer Screen Printed Electrode (SPE) immunosensor. Working electrode of commercialized SPE was modified by immobilization of specific antibody (anti-MMR) into thin layer of LDH nanomaterials. Structural, morphological, and surface properties of LDHs were studied by X-Ray diffraction, atomic force microscopy and Infrared spectroscopy in ATR. Cyclic Voltammetry technique was used to study interaction between the human recombinant MMR protein (rHu-MMR, NSO derived) and an immobilized antibody into developed immunosensor. High specific response of -11.72 μA/ng.mL(-1) (with a correlation coefficient of R(2)=0.994 ) were obtained in linear range of 0.05 ng/mL to 10.0 ng/mL of specific recombinant antigen. The limit of detection (LOD) was less than 15.0 pg/mL. From these attractive results, the feasibility of an electrochemical immunosensor for cancer was proved. Additional experiments to study stability and reproducibility the immunosensor should be completed in perspective to use these anti-MMR based immunosensors for sensing human MMR in patient biopsies and sera.

  14. Overexpression of MutSα Complex Proteins Predicts Poor Prognosis in Oral Squamous Cell Carcinoma

    PubMed Central

    Wagner, Vivian Petersen; Webber, Liana Preto; Salvadori, Gabriela; Meurer, Luise; Fonseca, Felipe Paiva; Castilho, Rogério Moraes; Squarize, Cristiane Helena; Vargas, Pablo Agustin; Martins, Manoela Domingues

    2016-01-01

    Abstract The DNA mismatch repair (MMR) system is responsible for the detection and correction of errors created during DNA replication, thereby avoiding the incorporation of mutations in dividing cells. The prognostic value of alterations in MMR system has not previously been analyzed in oral squamous cell carcinoma (OSCC). The study comprised 115 cases of OSCC diagnosed between 1996 and 2010. The specimens collected were constructed into tissue microarray blocks. Immunohistochemical staining for MutSα complex proteins hMSH2 and hMSH6 was performed. The slides were subsequently scanned into high-resolution images, and nuclear staining of hMSH2 and hMSH6 was analyzed using the Nuclear V9 algorithm. Univariable and multivariable Cox proportional hazard regression models were performed to evaluate the prognostic value of hMSH2 and hMSH6 in OSCC. All cases in the present cohort were positive for hMSH2 and hMSH6 and a direct correlation was found between the expression of the proteins (P < 0.05). The mean number of positive cells for hMSH2 and hMSH6 was 64.44 ± 15.21 and 31.46 ± 22.38, respectively. These values were used as cutoff points to determine high protein expression. Cases with high expression of both proteins simultaneously were classified as having high MutSα complex expression. In the multivariable analysis, high expression of the MutSα complex was an independent prognostic factor for poor overall survival (hazard ratio: 2.75, P = 0.02). This study provides a first insight of the prognostic value of alterations in MMR system in OSCC. We found that MutSα complex may constitute a molecular marker for the poor prognosis of OSCC. PMID:27258499

  15. Influencing factors in MMR immunisation decision making.

    PubMed

    Hill, Marie C; Cox, Carol L

    Immunisation decision making is not a straightforward process for parents. Many factors influence parental decision making on whether they immunise their child with the measles, mumps and rubella (MMR) vaccine. The feasibility study described in this article provides insight into influencing factors associated with decisions regarding the immunisation of children by parents. The study findings suggest that the practice nurse is a credible source of information for parents seeking informed decision making. At a time when the incidence of measles and mumps is rising in the UK, the provision of appropriate information by the practice nurse has the potential to increase uptake of the MMR vaccine.

  16. Role of the Mmr Efflux Pump in Drug Resistance in Mycobacterium tuberculosis

    PubMed Central

    Rodrigues, Liliana; Villellas, Cristina; Bailo, Rebeca; Viveiros, Miguel

    2013-01-01

    Efflux pumps are membrane proteins capable of actively transporting a broad range of substrates from the cytoplasm to the exterior of the cell. Increased efflux activity in response to drug treatment may be the first step in the development of bacterial drug resistance. Previous studies showed that the efflux pump Mmr was significantly overexpressed in strains exposed to isoniazid. In the work to be described, we constructed mutants lacking or overexpressing Mmr in order to clarify the role of this efflux pump in the development of resistance to isoniazid and other drugs in M. tuberculosis. The mmr knockout mutant showed an increased susceptibility to ethidium bromide, tetraphenylphosphonium, and cetyltrimethylammonium bromide (CTAB). Overexpression of mmr caused a decreased susceptibility to ethidium bromide, acriflavine, and safranin O that was obliterated in the presence of the efflux inhibitors verapamil and carbonyl cyanide m-chlorophenylhydrazone. Isoniazid susceptibility was not affected by the absence or overexpression of mmr. The fluorometric method allowed the detection of a decreased efflux of ethidium bromide in the knockout mutant, whereas the overexpressed strain showed increased efflux of this dye. This increased efflux activity was inhibited in the presence of efflux inhibitors. Under our experimental conditions, we have found that efflux pump Mmr is mainly involved in the susceptibility to quaternary compounds such as ethidium bromide and disinfectants such as CTAB. The contribution of this efflux pump to isoniazid resistance in Mycobacterium tuberculosis still needs to be further elucidated. PMID:23165464

  17. Temozolomide Resistance in Glioblastoma Cell Lines: Implication of MGMT, MMR, P-Glycoprotein and CD133 Expression

    PubMed Central

    Prados, Jose; Caba, Octavio; Cabeza, Laura; Berdasco, Maria; Gónzalez, Beatriz; Melguizo, Consolación

    2015-01-01

    Background The use of temozolomide (TMZ) has improved the prognosis for glioblastoma multiforme patients. However, TMZ resistance may be one of the main reasons why treatment fails. Although this resistance has frequently been linked to the expression of O6-methylguanine-DNA methyltransferase (MGMT) it seems that this enzyme is not the only molecular mechanism that may account for the appearance of drug resistance in glioblastoma multiforme patients as the mismatch repair (MMR) complex, P-glycoprotein, and/or the presence of cancer stem cells may also be implicated. Methods Four nervous system tumor cell lines were used to analyze the modulation of MGMT expression and MGMT promoter methylation by TMZ treatment. Furthermore, 5-aza-2’-deoxycytidine was used to demethylate the MGMT promoter and O(6)-benzylguanine to block GMT activity. In addition, MMR complex and P-glycoprotein expression were studied before and after TMZ exposure and correlated with MGMT expression. Finally, the effect of TMZ exposure on CD133 expression was analyzed. Results Our results showed two clearly differentiated groups of tumor cells characterized by low (A172 and LN229) and high (SF268 and SK-N-SH) basal MGMT expression. Interestingly, cell lines with no MGMT expression and low TMZ IC50 showed a high MMR complex expression, whereas cell lines with high MGMT expression and high TMZ IC50 did not express the MMR complex. In addition, modulation of MGMT expression in A172 and LN229 cell lines was accompanied by a significant increase in the TMZ IC50, whereas no differences were observed in SF268 and SK-N-SH cell lines. In contrast, P-glycoprotein and CD133 was found to be unrelated to TMZ resistance in these cell lines. Conclusions These results may be relevant in understanding the phenomenon of TMZ resistance, especially in glioblastoma multiforme patients laking MGMT expression, and may also aid in the design of new therapeutic strategies to improve the efficacy of TMZ in glioblastoma

  18. Identification of the mismatch repair genes PMS2 and MLH1 as p53 target genes by using serial analysis of binding elements

    PubMed Central

    Chen, Jiguo; Sadowski, Ivan

    2005-01-01

    The ability to determine the global location of transcription factor binding sites in vivo is important for a comprehensive understanding of gene regulation in human cells. We have developed a technology, called serial analysis of binding elements (SABE), involving subtractive hybridization of chromatin immunoprecipitation-enriched DNA fragments followed by the generation and analysis of concatamerized sequence tags. We applied the SABE technology to search for p53 target genes in the human genome, and have identified several previously described p53 targets in addition to numerous potentially novel targets, including the DNA mismatch repair genes MLH1 and PMS2. Both of these genes were determined to be responsive to DNA damage and p53 activation in normal human fibroblasts, and have p53-response elements within their first intron. These two genes may serve as a sensor in DNA repair mechanisms and a critical determinant for the decision between cell-cycle arrest and apoptosis. These results also demonstrate the potential for use of SABE as a broadly applicable means to globally identify regulatory elements for human transcription factors in vivo. PMID:15781865

  19. Identification of a deletion in the mismatch repair gene, MSH2, using mouse-human cell hybrids monosomal for chromosome 2.

    PubMed

    Pyatt, R E; Nakagawa, H; Hampel, H; Sedra, M; Fuchik, M B; Comeras, I; de la Chapelle, A; Prior, T W

    2003-03-01

    Hereditary non-polyposis colorectal cancer is characterized by mutations in one of the DNA mismatch repair genes, primarily MLH1, MSH2, or MSH6. We report here the identification of a genomic deletion of approximately 11.4 kb encompassing the first two exons of the MSH2 gene in two generations of an Ohio family. By Southern blot analysis, using a cDNA probe spanning the first seven exons of MSH2, an alteration in each of three different enzyme digests (including a unique 13-kb band on HindIII digests) was observed, which suggested the presence of a large alteration in the 5' region of this gene. Mouse-human cell hybrids from a mutation carrier were then generated which contained a single copy each of human chromosome 2 on which the MSH2 gene resides. Southern blots on DNA from the cell hybrids demonstrated the same, unique 13-kb band from one MSH2 allele, as seen in the diploid DNA. DNA from this same monosomal cell hybrid failed to amplify in polymerase chain reactions (PCRs) using primers to exons 1 and 2, demonstrating the deletion of these sequences in one MSH2 allele, and the breakpoints involving Alu repeats were identified by PCR amplification and sequence analysis.

  20. Hypermutation in Burkholderia cepacia complex is mediated by DNA mismatch repair inactivation and is highly prevalent in cystic fibrosis chronic respiratory infection.

    PubMed

    Martina, Pablo; Feliziani, Sofía; Juan, Carlos; Bettiol, Marisa; Gatti, Blanca; Yantorno, Osvaldo; Smania, Andrea M; Oliver, Antonio; Bosch, Alejandra

    2014-11-01

    The Burkholderia cepacia complex (Bcc) represents an important group of pathogens involved in long-term lung infection in cystic fibrosis (CF) patients. A positive selection of hypermutators, linked to antimicrobial resistance development, has been previously reported for Pseudomonas aeruginosa in this chronic infection setting. Hypermutability, however, has not yet been systematically evaluated in Bcc species. A total of 125 well characterized Bcc isolates recovered from 48 CF patients, 10 non-CF patients and 15 environmental samples were analyzed. In order to determine the prevalence of mutators their spontaneous mutation rates to rifampicin resistance were determined. In addition, the genetic basis of the mutator phenotypes was investigated by sequencing the mutS and mutL genes, the main components of the mismatch repair system (MRS). The overall prevalence of hypermutators in the collection analyzed was 13.6%, with highest occurrence (40.7%) among the chronically infected CF patients, belonging mainly to B. cenocepacia, B. multivorans, B. cepacia, and B. contaminans -the most frequently recovered Bcc species from CF patients worldwide. Thirteen (76.5%) of the hypermutators were defective in mutS and/or mutL. Finally, searching for a possible association between antimicrobial resistance and hypermutability, the resistance-profiles to 17 antimicrobial agents was evaluated. High antimicrobial resistance rates were documented for all the Bcc species recovered from CF patients, but, except for ciprofloxacin, a significant association with hypermutation was not detected. In conclusion, in the present study we demonstrate for the first time that, MRS-deficient Bcc species mutators are highly prevalent and positively selected in CF chronic lung infections. Hypermutation therefore, might be playing a key role in increasing bacterial adaptability to the CF-airway environment, facilitating the persistence of chronic lung infections.

  1. Intralesional tuberculin (PPD) versus measles, mumps, rubella (MMR) vaccine in treatment of multiple warts: a comparative clinical and immunological study.

    PubMed

    Shaheen, Maha Adel; Salem, Samar Abdallah M; Fouad, Dina Adel; El-Fatah, Abeer Aly Abd

    2015-01-01

    Intralesional purified protein derivative (PPD) or mumps, measles, rubella (MMR) were not previously compared regarding their efficacy or mechanism of action in treatment of warts. We aimed to compare their efficacy in treatment of multiple warts and investigate their effect on serum interleukin (IL)-4 and IL-12. Thirty patients with multiple warts were included (10 treated with PPD, 10 with MMR, and 10 with normal saline (control)). Injection was done every 3 weeks until clearance or maximum of three treatments. Clinical response of target and distant warts was evaluated. Serum ILs-4 and -12 were assessed before and after treatment. A significantly higher rate of complete response was found in target and distant warts with PPD (60% each) and MMR (80%, 40%, respectively) compared with controls (0%), with no significant difference between both treatments. After treatment, the control group showed the lowest serum IL-12 and IL-4 levels compared with the MMR- and PPD-treated groups with statistically significant difference in between. MMR resulted in a significantly higher serum IL-12 than PPD. With PPD, IL-4 was increased with statistically significant change compared with pretreat-ment level. Intralesional PPD and MMR show comparable efficacy and safety in treatment of multiple warts. Serum ILs-4 and-12 increase following antigen injection.

  2. Measles, Mumps, Rubella and the MMR Vaccine during Pregnancy

    MedlinePlus

    Measles, Mumps, Rubella and the MMR Vaccine during Pregnancy In every pregnancy, a woman starts out with a 3-5% chance of having a baby with a birth defect. ... exposure to measles, mumps, rubella, and the MMR vaccine may increase the risk for birth defects above ...

  3. Unintended events following immunization with MMR: a systematic review.

    PubMed

    Jefferson, Tom; Price, Deirdre; Demicheli, Vittorio; Bianco, Elvira

    2003-09-08

    Public debate over the safety of the trivalent measles, mumps and rubella (MMR) vaccine and the drop in vaccination rates in several countries persists despite its almost universal use and accepted effectiveness. We carried out a systematic review to assess the evidence of unintended effects (beneficial or harmful) associated with MMR and the applicability of systematic reviewing methods to the field of safety evaluation. Eligible studies were comparative prospective or retrospective on healthy individuals up to 15 years of age, carried out or published by 2003. We identified 120 articles satisfying our inclusion criteria and included 22. MMR is associated with a lower incidence of upper respiratory tract infections, a higher incidence of irritability, similar incidence of other adverse effects compared to placebo and is likely to be associated with benign thrombocytopenic purpura (TP), parotitis, joint and limb complaints and aseptic meningitis (mumps Urabe strain-containing MMR). Exposure to MMR is unlikely to be associated with Crohn's disease, ulcerative colitis, autism or aseptic meningitis (mumps Jeryl-Lynn strain-containing MMR). The design and reporting of safety outcomes in MMR vaccine studies, both pre- and post-marketing, are largely inadequate. The evidence of adverse events following immunization with MMR cannot be separated from its role in preventing the target diseases.

  4. Active segregation of yeast mitochondria by Myo2 is essential and mediated by Mmr1 and Ypt11.

    PubMed

    Chernyakov, Irina; Santiago-Tirado, Felipe; Bretscher, Anthony

    2013-09-23

    Active segregation of essential organelles is required for successful cell division. The essential budding yeast myosin V Myo2 actively segregates most organelles along polarized actin cables. The mechanism of mitochondrial segregation remains controversial, with movement driven by actin polymerization, movement driven by association with transported cortical endoplasmic reticulum (ER), and direct transport by Myo2 proposed as models. Two nonessential proteins, Mmr1 and the Rab GTPase Ypt11, bind Myo2 and have been implicated in mitochondrial inheritance, although their specific roles are also contended. We generated myo2(sens) mutations that exhibit no overt phenotype but render MMR1 essential and have compromised Ypt11 binding. We then isolated myo2(sens)mmr1(ts) conditional mutants and determined that they have a specific and severe defect in active mitochondrial inheritance, revealing mitochondrial transport by Myo2 as an essential function. ypt11Δ mmr1(ts) cells also have conditional defects in growth and active transport of mitochondria into the bud, both of which are suppressed by artificially forcing mitochondrial inheritance. At the restrictive temperature, cells defective in mitochondrial inheritance give rise to dead buds that go through cytokinesis normally, showing no evidence of a proposed cell-cycle mitochondrial inheritance checkpoint. Thus, active mitochondrial inheritance is an essential process and a function of Myo2 that requires either Mmr1 or Ypt11.

  5. 'MMR talk' and vaccination choices: an ethnographic study in Brighton.

    PubMed

    Poltorak, Mike; Leach, Melissa; Fairhead, James; Cassell, Jackie

    2005-08-01

    In the context of the high-profile controversy that has unfolded in the UK around the measles, mumps and rubella (MMR) vaccine and its possible adverse effects, this paper explores how parents in Brighton, southern England, are thinking about MMR for their own children. Research focusing on parents' engagement with MMR has been dominated by analysis of the proximate influences on their choices, and in particular scientific and media information, which have led health policy to focus on information and education campaigns. This paper reports ethnographic work including narratives by mothers in Brighton. Our work questions such reasoning in showing how wider personal and social issues shape parents' immunisation actions. The narratives by mothers show how practices around MMR are shaped by personal histories, by birth experiences and related feelings of control, by family health histories, by their readings of their child's health and particular strengths and vulnerabilities, by particular engagements with health services, by processes building or undermining confidence, and by friendships and conversations with others, which are themselves shaped by wider social differences and transformations. Although many see vaccination as a personal decision which must respond to the particularities of a child's immune system, 'MMR talk', which affirms these conceptualisations, has become a social phenomenon in itself. These perspectives suggest ways in which people's engagements with MMR reflect wider changes in their relations with science and the state.

  6. Exploring the evidence surrounding the debate on MMR and autism.

    PubMed

    Purssell, Edward

    Autism is a poorly understood condition that would appear to be on the increase. There is currently much concern about a possible link between the measles, mumps and rubella (MMR) vaccination and autism which has resulted in a substantial reduction in the uptake of MMR, putting children at risk of three significant childhood diseases. This article looks at the evidence for a link between MMR and autism, finding that while a plausible hypothesis has been constructed, there is not substantive evidence for such a link and that the quality of this evidence is, in many cases, poor. This is due, in part, to the difficulties inherent in pre- and post-licensure vaccination research. These difficulties and the importance of vaccination and parental understanding of risk are discussed.

  7. MMR vaccination and autism: is there a link?

    PubMed

    DeStefano, Frank; Thompson, William W

    2002-07-01

    In 1998, a report was published describing 12 patients with inflammatory bowel conditions and regressive developmental disorders consisting primarily of autism. The authors hypothesised that MMR vaccine may have been responsible for the bowel dysfunction which subsequently resulted in the neurodevelopmental disorders. The suggestion that measles vaccine may cause autism through a persistent bowel infection generated much interest since it provided a possible biological mechanism for a causal association. Epidemiological studies, however, have not found an association between MMR vaccination and autism. Autism has a strong genetic component and its associated neurological defects probably occur during embryonic development. It seems unlikely that a vaccination that is given after birth could cause autism. In a minority of cases, autism may have onset after 1 year of age (regressive autism) but the one epidemiological study that included such cases did not find an association with MMR vaccination. Currently, the weight of the available epidemiological and related evidence does not support a causal link between MMR vaccine and autism.

  8. MMR-Vaccine and Regression in Autism Spectrum Disorders: Negative Results Presented from Japan

    ERIC Educational Resources Information Center

    Uchiyama, Tokio; Kurosawa, Michiko; Inaba, Yutaka

    2007-01-01

    It has been suggested that the measles, mumps, and rubella vaccine (MMR) is a cause of regressive autism. As MMR was used in Japan only between 1989 and 1993, this time period affords a natural experiment to examine this hypothesis. Data on 904 patients with autism spectrum disorders (ASD) were analyzed. During the period of MMR usage no…

  9. Preservation of DNA integrity and neuronal degeneration.

    PubMed

    Francisconi, Simona; Codenotti, Mara; Ferrari-Toninelli, Giulia; Uberti, Daniela; Memo, Maurizio

    2005-04-01

    The mismatch repair system (MMR) is an important member of the DNA checkpoint, that includes a number of protein deputed to control genomic stability through cell cycle arrest, DNA repair, and apoptosis. Here we summarize some recent data from our and other groups underlining the contribution to neurodegeneration of MSH2, perhaps the most relevant component of the MMR system. These data suggest that this protein participates not only in the cancer prevention machinery for the body but also in neurodegenerative processes.

  10. Risk, its perception and the media: the MMR controversy.

    PubMed

    Hackett, Alison Jane

    2008-07-01

    This article aims to explore how the media contributes to and generates 'risk' and 'risk perception.' The example of parents refusing to have their children immunised with the measles, mumps and rubella (MMR) vaccine following negative media reporting will be discussed. The media appears to have an important influence on the perception of risk. We are living in a society that is increasingly aware of risk, and in which risk is socially constructed. It is important that healthcare professionals provide clear, consistent, evidence-based information to clients, ensuring that any areas of uncertainty are acknowledged. Otherwise, the public's trust in the healthcare professional will be undermined.

  11. A polymorphism in the MSH3 mismatch repair gene is associated with the levels of somatic instability of the expanded CTG repeat in the blood DNA of myotonic dystrophy type 1 patients.

    PubMed

    Morales, Fernando; Vásquez, Melissa; Santamaría, Carolina; Cuenca, Patricia; Corrales, Eyleen; Monckton, Darren G

    2016-04-01

    Somatic mosaicism of the expanded CTG repeat in myotonic dystrophy type 1 is age-dependent, tissue-specific and expansion-biased, contributing toward the tissue-specificity and progressive nature of the symptoms. Previously, using regression modelling of repeat instability we showed that variation in the rate of somatic expansion in blood DNA contributes toward variation in age of onset, directly implicating somatic expansion in the disease pathway. Here, we confirm these results using a larger more genetically homogenous Costa Rican DM1 cohort (p<0.001). Interestingly, we also provide evidence that supports subtle sex-dependent differences in repeat length-dependent age at onset and somatic mutational dynamics. Previously, we demonstrated that variation in the rate of somatic expansion was a heritable quantitative trait. Given the important role that DNA mismatch repair genes play in mediating expansions in mouse models, we tested for modifier gene effects with 13 DNA mismatch gene polymorphisms (one each in MSH2, PMS2, MSH6 and MLH1; and nine in MSH3). After correcting for allele length and age effects, we identified three polymorphisms in MSH3 that were associated with variation in somatic instability: Rs26279 (p=0.003); Rs1677658 (p=0.009); and Rs10168 (p=0.031). However, only the association with Rs26279 remained significant after multiple testing correction. Although we revealed a statistically significant association between Rs26279 and somatic instability, we did not detect an association with the age at onset. Individuals with the A/A genotype for Rs26279 tended to show a greater propensity to expand the CTG repeat than other genotypes. Interestingly, this SNP results in an amino acid change in the critical ATPase domain of MSH3 and is potentially functionally dimorphic. These data suggest that MSH3 is a key player in generating somatic variation in DM1 patients and further highlight MSH3 as a potential therapeutic target.

  12. Application of a 5-tiered scheme for standardized classification of 2,360 unique mismatch repair gene variants in the InSiGHT locus-specific database.

    PubMed

    Thompson, Bryony A; Spurdle, Amanda B; Plazzer, John-Paul; Greenblatt, Marc S; Akagi, Kiwamu; Al-Mulla, Fahd; Bapat, Bharati; Bernstein, Inge; Capellá, Gabriel; den Dunnen, Johan T; du Sart, Desiree; Fabre, Aurelie; Farrell, Michael P; Farrington, Susan M; Frayling, Ian M; Frebourg, Thierry; Goldgar, David E; Heinen, Christopher D; Holinski-Feder, Elke; Kohonen-Corish, Maija; Robinson, Kristina Lagerstedt; Leung, Suet Yi; Martins, Alexandra; Moller, Pal; Morak, Monika; Nystrom, Minna; Peltomaki, Paivi; Pineda, Marta; Qi, Ming; Ramesar, Rajkumar; Rasmussen, Lene Juel; Royer-Pokora, Brigitte; Scott, Rodney J; Sijmons, Rolf; Tavtigian, Sean V; Tops, Carli M; Weber, Thomas; Wijnen, Juul; Woods, Michael O; Macrae, Finlay; Genuardi, Maurizio

    2014-02-01

    The clinical classification of hereditary sequence variants identified in disease-related genes directly affects clinical management of patients and their relatives. The International Society for Gastrointestinal Hereditary Tumours (InSiGHT) undertook a collaborative effort to develop, test and apply a standardized classification scheme to constitutional variants in the Lynch syndrome-associated genes MLH1, MSH2, MSH6 and PMS2. Unpublished data submission was encouraged to assist in variant classification and was recognized through microattribution. The scheme was refined by multidisciplinary expert committee review of the clinical and functional data available for variants, applied to 2,360 sequence alterations, and disseminated online. Assessment using validated criteria altered classifications for 66% of 12,006 database entries. Clinical recommendations based on transparent evaluation are now possible for 1,370 variants that were not obviously protein truncating from nomenclature. This large-scale endeavor will facilitate the consistent management of families suspected to have Lynch syndrome and demonstrates the value of multidisciplinary collaboration in the curation and classification of variants in public locus-specific databases.

  13. No Effect of MMR Withdrawal on the Incidence of Autism: A Total Population Study

    ERIC Educational Resources Information Center

    Honda, Hideo; Shimizu, Yasuo; Rutter, Michael

    2005-01-01

    Background: A causal relationship between the measles, mumps, and rubella (MMR) vaccine and occurrence of autism spectrum disorders (ASD) has been claimed, based on an increase in ASD in the USA and the UK after introduction of the MMR vaccine. However, the possibility that this increase is coincidental has not been eliminated. The unique…

  14. Media Reports of Links between MMR and Autism: A Discourse Analysis

    ERIC Educational Resources Information Center

    O'Dell, Lindsay; Brownlow, Charlotte

    2005-01-01

    This paper details an analysis of BBC reporting of the proposed links between MMR and autism. The study aimed to identify main issues arising from the media reports into the link between MMR and the development of autism, and how these contribute to common understandings about people with autism. The study employed a form of discourse analysis to…

  15. MMR vaccination status of children exempted from school-entry immunization mandates

    PubMed Central

    Sethuraman, Karthik; Omer, Saad B.; Hanlon, Alexandra L.; Levy, Michael Z.; Salmon, Daniel

    2015-01-01

    BACKGROUND Child immunizations are one of the most successful public health interventions of the past century. Still, parental vaccine hesitancy is widespread and increasing. One manifestation of this are rising rates of nonmedical or “personal beliefs” exemptions (PBEs) from school-entry immunization mandates. Exemptions have been shown to be associated with increased risk of disease outbreak, but the strength of this association depends critically on the true vaccination status of exempted children, which has not been assessed. OBJECTIVE To estimate the true measles-mumps-rubella (MMR) vaccination status of children with PBEs. METHODS We use administrative data collected by the California Department of Public Health in 2009 and imputation to estimate the MMR vaccination status of children with PBEs under varying scenarios. RESULTS Results from 2009 surveillance data indicate MMR1/MMR2 coverage of 18–47% among children with PBEs at typical schools and 11–34% among children with PBEs at schools with high PBE rates. Imputation scenarios point to much higher coverage (64–92% for MMR1 and 25–58% for MMR2 at typical schools; 49–90% for MMR1 and 16–63% for MMR2 at high PBE schools) but still below levels needed to maintain herd immunity against measles. CONCLUSIONS These coverage estimates suggest that prior analyses of the relative risk of measles associated with vaccine refusal underestimate that risk by an order of magnitude of 2–10 times. PMID:26431991

  16. Distinctive patterns of p53 protein expression and microsatellite instability in human colorectal cancer.

    PubMed

    Nyiraneza, Christine; Jouret-Mourin, Anne; Kartheuser, Alex; Camby, Philippe; Plomteux, Olivier; Detry, Roger; Dahan, Karin; Sempoux, Christine

    2011-12-01

    Although evidence suggests an inverse relationship between microsatellite instability and p53 alterations in colorectal cancer, no study has thoroughly examined the use of p53 immunohistochemistry in phenotyping colorectal cancers. We investigated the value of p53 immunohistochemistry in microsatellite instability-positive colorectal cancers prescreening and attempted to clarify the relationship between DNA mismatch repair system and p53 pathway. In a series of 104 consecutive colorectal cancers, we performed p53 immunohistochemistry, TP53 mutational analysis, DNA mismatch repair system efficiency evaluation (DNA mismatch repair system immunohistochemistry, microsatellite instability status, MLH1/MSH2 germ line, and BRAF, murine double minute 2, and p21 immunohistochemistry. Microsatellite instability high was observed in 25 of 104 colorectal cancers, with DNA mismatch repair system protein loss (24/25) and germ line (8/25) or BRAF mutations (8/25). p53 immunohistochemistry revealed 3 distinct patterns of expression: complete negative immunostaining associated with truncating TP53 mutations (P < .0001), diffuse overexpression associated with missense TP53 mutations (P < .0001), and restricted overexpression characterized by a limited number of homogenously scattered strongly positive tumor cells in 36.5% of colorectal cancers. This latest pattern was associated with wild-type TP53 and microsatellite instability high colorectal cancers (P < .0001) including all Lynch tumors (8/8), but its presence among 22% of DNA mismatch repair system-competent colorectal cancers decreased its positive predictive value (55.2% [95% confidence interval, 45%-65%]). It was also correlated with murine double minute 2 overexpression (P < .0001) and inversely with p21 loss (P = .0002), independently of microsatellite instability status. In conclusion, a restricted pattern of p53 overexpression is preferentially associated with microsatellite instability high phenotype and could

  17. BOREAS RSS-3 Reflectance Measured from a Helicopter-Mounted Barnes MMR

    NASA Technical Reports Server (NTRS)

    Hall, Forrest G. (Editor); Nickeson, Jaime (Editor); Walthall, Charles L.; Loechel, Sara; deColstoun, Eric Brown

    2000-01-01

    The BOREAS RSS-3 team acquired helicopter-based radiometric measurements of forested sites with a Barnes MMR. The data were collected in 1994 during the three BOREAS IFCs at numerous tower and auxiliary sites in both the NSA and SSA. The 15-degree FOV of the MMR yielded approximately 79-m ground resolution from an altitude of 300 m. The MMR has seven spectral bands that are similar to the Landsat TM bands, ranging from the blue region to the thermal. The data are stored in tabular ASCII files. The data are stored in tabular ASCII files.

  18. An MLH1 Mutation Links BACH1/FANCJ to Colon Cancer, Signaling, and Insight toward Directed Therapy

    PubMed Central

    Xie, Jenny; Guillemette, Shawna; Peng, Min; Gilbert, Candace; Buermeyer, Andrew; Cantor, Sharon B.

    2017-01-01

    Defects in MLH1, as with other mismatch repair (MMR) proteins, are the primary cause of hereditary nonpolyposis colon cancer (HNPCC). Mutations in MMR genes often disrupt mismatch repair and MMR signaling functions. However, some HNPCC-associated mutations have unknown pathogenicity. Here, we uncover an MLH1 clinical mutation with a leucine (L)-to-histidine (H) amino acid change at position 607 that ablates MLH1 binding to FANCJ. Given that a DNA helicase is not essential for mammalian MMR in vitro, we considered that loss of MLH1 binding to FANCJ could alter MMR signaling. Consistent with this hypothesis, FANCJ-deficient cells exhibit delayed MMR signaling and apoptotic responses that generate resistance to agents that induce O6-methylguanine lesions. Our data indicate that the delay in MMR signaling provides time for the methylguanine methyltransferase (MGMT) enzyme to reverse DNA methylation. In essence, FANCJ deficiency alters the competition between two pathways: MGMT-prosurvival versus MMR-prodeath. This outcome could explain the HNPCC familial cancers that present as microsatellite stable and with intact MMR, such as MLHL607H. Importantly, the link between FANCJ and HNPCC provides insight toward directed therapies because loss of the FANCJ/MLH1 interaction also uniquely sensitizes cells to DNA cross-linking agents. PMID:20978114

  19. MMR vaccination and autism : what is the evidence for a causal association?

    PubMed

    Madsen, Kreesten M; Vestergaard, Mogens

    2004-01-01

    It has been suggested that vaccination with the measles-mumps-rubella (MMR) vaccine causes autism. The wide-scale use of the MMR vaccine has been reported to coincide with the apparent increase in the incidence of autism. Case reports have described children who developed signs of both developmental regression and gastrointestinal symptoms shortly after MMR vaccination.A review of the literature revealed no convincing scientific evidence to support a causal relationship between the use of MMR vaccines and autism. No primate models exist to support the hypothesis. The biological plausibility remains questionable and there is a sound body of epidemiological evidence to refute the hypothesis. The hypothesis has been subjected to critical evaluation in many different ways, using techniques from molecular biology to population-based epidemiology, and with a vast number of independent researchers involved, none of which has been able to corroborate the hypothesis.

  20. [The relationship between MMR vaccination level and the number of new cases of autism in children].

    PubMed

    Mrozek-Budzyn, Dorota; Kiełtyka, Agnieszka

    2008-01-01

    The MMR vaccination coverage in Malopolskie voivodeship improved rapidly and finally reached a high level during last years. The number of new cases of autism spectrum disorders in children during that time revealed a slightly rising but not significant trend, while the number of childhood autism were stable. Ecological study showed no correlation between MMR vaccination and an increased risk of childhood autism and autism spectrum disorders in children.

  1. Safety and Immunogenicity of Human Serum Albumin-Free MMR Vaccine in US Children Aged 12–15 Months

    PubMed Central

    Mufson, Maurice A.; Diaz, Clemente; Leonardi, Michael; Harrison, Christopher J.; Grogg, Stanley; Carbayo, Antonio; Carlo-Torres, Simon; JeanFreau, Robert; Quintero-Del-Rio, Ana; Bautista, Gisele; Povey, Michael; Da Costa, Christopher; Nicholson, Ouzama; Innis, Bruce L.

    2015-01-01

    Background M-M-RTMII (MMRII; Merck & Co) is currently the only measles-mumps-rubella (MMR) vaccine licensed in the United States. Another licensed vaccine would reinforce MMR supply. This study assessed the immunogenicity of a candidate vaccine (PriorixTM, GlaxoSmithKline Vaccines [MMR-RIT]) when used as a first dose among eligible children in the United States. Methods In this exploratory Phase-2, multicenter, observer-blind study, 1220 healthy subjects aged 12–15 months were randomized (3:3:3:3) and received 1 dose of 1 of 3 MMR-RIT lots with differing mumps virus titers (MMR-RIT-1 [4.8 log10]; MMR-RIT-2 [4.1 log10]; MMR-RIT-3 [3.7 log10] CCID50) or MMRII co-administered with hepatitis A vaccine (HAV), varicella vaccine (VAR) and 7-valent pneumococcal conjugate vaccine (PCV7). Immune response to measles, mumps, and rubella viruses was evaluated at Day 42 post-vaccination. Incidence of solicited injection site, general, and serious adverse events was assessed. Results Seroresponse rates for MMR vaccine viral components in MMR-RIT lots were 98.3–99.2% (measles), 89.7–90.7% (mumps), and 97.5–98.8% (rubella), and for MMRII were 99.6%, 91.1%, and 100%, respectively. Immune responses to HAV, VAR, and PCV7 were similar when co-administered with any of the 3 MMR-RIT lots or MMRII. There were no apparent differences in solicited or serious adverse events among the 4 groups. Conclusions Immune responses were above threshold levels for projected protection against the 3 viruses from MMR-RIT lots with differing mumps virus titers. MMR-RIT had an acceptable safety profile when co-administered with HAV, VAR, and PCV7. Clinical Trials Registration NCT00861744; etrack; 111870 PMID:26582873

  2. Erybraedin C and bitucarpin A, two structurally related pterocarpans purified from Bituminaria bituminosa, induced apoptosis in human colon adenocarcinoma cell lines MMR- and p53-proficient and -deficient in a dose-, time-, and structure-dependent fashion.

    PubMed

    Maurich, Tiziana; Iorio, Mariacarla; Chimenti, Daniele; Turchi, Gino

    2006-02-01

    Pterocarpans, the second group of natural isoflavonoids, have received considerable interest on account of their medicinal properties. These drugs are employed as antitoxins, but display antifungal, antiviral and antibacterial properties as well. Erybraedin C and bitucarpin A are two new structurally related pterocarpans recently purified and characterized. Bitucarpin A differs from erybraedin C for the absence of a prenyl group in 5' position and the presence of a methoxylate hydroxyl group in 7, 4' positions. These compounds proved not to be clastogens in human lymphocytes per se but displayed anticlastogenic activity against mytomicin C and bleomycin C. Here we extended the study of their antiproliferative and apoptosis-inducing mechanism on human cell lines. Two human adenocarcinoma cell lines, LoVo and HT29, as examples of slow-growing solid tumors, proficient and deficient in mismatch repair system (MMR), p53 and Bcl-2, were used to evaluate the cytotoxicity of the drugs and their effects on the cell cycle, measured by flow cytometry. Erybraedin C similarly affects the survival of HT29 (MMR +/+, p53 -/- and Bcl-2 +/+) and LoVo (MMR -/-, p53 +/+ and Bcl-2 -/-) cells (LD(50): 1.94 and 1.73 microg/ml, respectively). By contrast, bitucarpin A exhibits a differential cytotoxicity in the cell lines (LD(50): 6.00 microg/ml, HT29, and 1.84 microg/ml, LoVo). The cell cycle distributions of the LoVo and HT29 cells treated with erybraedin C lacked a specific checkpoint arrest, whereas they underwent a characteristic sub-G(1) peak, time- and drug-concentration dependent. So that apoptotic process induced by erybraedin C in both adenocarcinoma cell lines is independent of cell cycle arrest and of phenotypic status of the cells as well. By contrast, bitucarpin A affects cell cycle progression on both cell lines, inducing a transient block in G(0)/G(1) along 24-96 h, and induces apoptosis with a cell density and treatment time dependency. Similar results were obtained with

  3. Age-stratified seroprevalence of measles, mumps and rubella (MMR) virus infections in Switzerland after the introduction of MMR mass vaccination.

    PubMed

    Matter, L; Germann, D; Bally, F; Schopfer, K

    1997-01-01

    We have performed age-stratified seroprevalence studies for MMR to evaluate these vaccinations. Serum samples submitted for diagnostic testing were randomly selected for unlinked anonymous panels. IgG antibodies were tested by ELISA and indirect immunofluorescence. In the vaccination cohort (age 1.5 to 6.5 years), seroprevalence attained 80%. For measles and mumps it continued to increase to 95%, while for rubella it declined transiently to 60% between 7 and 12 years of age. We observed no differences according to gender in any age group in 1991-1992. (Semi)quantitative values of the IgG antibodies against all three viruses increased during adolescence, suggesting wild virus circulation. In 1992, MMR vaccination has reached < 80% of the children during their second year of age. Due to previous monovalent measles and mumps vaccinations in pre-school children and due to endemic and epidemic activity, particularly of mumps virus, a trough of the seroprevalence in adolescents was evident only for rubella. MMR vaccination campaigns performed at school since 1987 have increase seroprevalence in this population segment and have probably over-compensated for the expected shift to the right of the seroprevalence curves. A more compulsive implementation of the recommended childhood vaccination schedule and continued efforts at catchup vaccinations during school age especially for rubella are necessary to avoid the accumulation of susceptible young adults during the forthcoming decades.

  4. Coexistence of MSI with KRAS mutation is associated with worse prognosis in colorectal cancer

    PubMed Central

    Hu, Jing; Yan, Wen-Yue; Xie, Li; Cheng, Lei; Yang, Mi; Li, Li; Shi, Jiong; Liu, Bao-Rui; Qian, Xiao-Ping

    2016-01-01

    Abstract Kristen rat sarcoma viral oncogene homolog (KRAS) and microsatellite instability (MSI) are prognostic markers of colorectal cancer (CRC). However, the clinical value is still not fully understood, when giving the consideration to both the molecular makers. Five hundred fifty-one patients with CRC were retrospectively assessed by determining their clinicopathological features. KRAS mutations were detected by polymerase chain reaction. MSI, a defect in the mismatch repair (MMR) system, was detected by immunohistochemistry. The prognostic value of KRAS in combination with MSI was studied. Among 551 CRC patients, mutations in KRAS codon 12 and KRAS codon 13 were detected in 34.5% and 10.5% of patients, respectively. Four hundred one tumors were randomly selected to detect for MMR proteins expression. In this analysis, 30 (7.5%) tumors that had at least 1 MMR protein loss were defined as MMR protein-deficient (MMR-D), and the remaining tumors were classed as MMR protein-intact (MMR-I). According to KRAS mutation and MSI status, CRC was classified into 4 groups: Group 1, KRAS-mutated and MMR-I; Group 2, KRAS-mutated and MMR-D; Group 3, KRAS wild and MMR-I; and Group 4, KRAS wild and MMR-D. We found that patients in Group4 had the best prognosis. In conclusion, combination status of KRAS and MSI status may be used as a prognostic biomarker for CRC patient, if validated by larger studies. PMID:27977612

  5. Mmr1p is a mitochondrial factor for Myo2p-dependent inheritance of mitochondria in the budding yeast.

    PubMed

    Itoh, Takashi; Toh-E, Akio; Matsui, Yasushi

    2004-07-07

    Class V myosins play a pivotal role in organelle distribution. In the budding yeast, Myo2p, a class V myosin, is essential for mitochondrial distribution. We identified MMR1 as a high-dose suppressor of the myo2 mitochondrial defect and that Mmr1p resides restrictively on the bud-localizing mitochondria and forms a complex with Myo2p tail. Mmr1p loss delayed mitochondrial transfer to buds and completely abolished mitochondrial distribution in the absence of Ypt11p, which promotes mitochondrial distribution by complex formation with Myo2p tail. The myo2-573 mutation, which causes a mitochondrial distribution defect and inactivates the Mmr1p function, reduced association between Myo2p and Mmr1p and depolarized Mmr1p localization on mitochondria. These strongly suggest that Mmr1p is a key mitochondrial component of the link between Myo2p and mitochondria for Myo2p-dependent mitochondrial distribution. Genetical analysis revealed that the Mmr1p-Myo2p pathway is independent of the Ypt11p-Myo2p pathway, suggesting that an essential system for mitochondrial distribution is composed of two independent Myo2p pathways.

  6. Similar immunogenicity of measles-mumps-rubella (MMR) vaccine administrated at 8 months versus 12 months age in children.

    PubMed

    He, Hanqing; Chen, Enfu; Chen, Haiping; Wang, Zhifang; Li, Qian; Yan, Rui; Guo, Jing; Zhou, Yang; Pan, Jinren; Xie, Shuyun

    2014-06-30

    Two doses of measles-mumps-rubella (MMR) strategy has been recommended by World Health Organization and is also widely adopted in many countries. In order to provide the evidence for perfecting the immunization strategy of MMR, this study evaluated the safety and immunogenicity of MMR with different two-dose schedule in infants. 280 participants were enrolled and randomly allocated to Group 1 (first dose at 8 months) or Group 2 (first dose at 12 months), and both groups administered the second dose at 10 months later. Solicited local and general symptoms after each vaccination with MMR were mild and infrequent in all participants of two groups. After administration of the first dose of MMR, seropositive rates were 100% in both groups for measles, 89.3% in Group 1 and 87.1% in Group 2 for mumps (P=0.578), 92.0% in Group 1 and 92.9% in Group 2 (P=0.393). The seropositive rates of mumps decreased significantly (from >86% to <65%) both in two groups (P<0.001) 10 months after the first dose of MMR, but no significant change was found in measles and rubella. All children get the positive titer for three vaccines in two groups after given the second dose MMR, higher seroconversion rate was found for mumps both in two groups (71.7% vs 77.2%, P=0.370). In conclusion, this study indicated that the MMR was well tolerated and immunogenic against measles, mumps and rubella with schedule of first dose both at 8 months and 12 months age. Our findings strongly supported that two doses of MMR can be introduced by replacing the first dose of MR in current EPI with MMR at 8 months age and the second dose at 18 months in China.

  7. Delayed adaptive immunity is related to higher MMR vaccine-induced antibody titers in children.

    PubMed

    Strömbeck, Anna; Lundell, Anna-Carin; Nordström, Inger; Andersson, Kerstin; Adlerberth, Ingegerd; Wold, Agnes E; Rudin, Anna

    2016-04-01

    There are notable inter-individual variations in vaccine-specific antibody responses in vaccinated children. The aim of our study was to investigate whether early-life environmental factors and adaptive immune maturation prior and close to measles-mumps-rubella (MMR) immunization relate to magnitudes of vaccine-specific antibody titers. In the FARMFLORA birth cohort, including both farming and non-farming families, children were immunized with the MMR vaccine at 18 months of age. MMR vaccine-induced antibody titers were measured in plasma samples obtained at 36 months of age. Infants' blood samples obtained at birth, 3-5 days and at 4 and 18 months of age were analyzed for T- and B-cell numbers, proportions of naive and memory T and B cells, and fractions of putative regulatory T cells. Multivariate factor analyses show that higher anti-MMR antibody titers were associated with a lower degree of adaptive immune maturation, that is, lower proportions of memory T cells and a lower capacity of mononuclear cells to produce cytokines, but with higher proportions of putative regulatory T cells. Further, children born by cesarean section (CS) had significantly higher anti-measles titers than vaginally-born children; and CS was found to be associated with delayed adaptive immunity. Also, girls presented with significantly higher anti-mumps and anti-rubella antibody levels than boys at 36 months of age. These results indicate that delayed adaptive immune maturation before and in close proximity to immunization seems to be advantageous for the ability of children to respond with higher anti-MMR antibody levels after vaccination.

  8. Delayed adaptive immunity is related to higher MMR vaccine-induced antibody titers in children

    PubMed Central

    Strömbeck, Anna; Lundell, Anna-Carin; Nordström, Inger; Andersson, Kerstin; Adlerberth, Ingegerd; Wold, Agnes E; Rudin, Anna

    2016-01-01

    There are notable inter-individual variations in vaccine-specific antibody responses in vaccinated children. The aim of our study was to investigate whether early-life environmental factors and adaptive immune maturation prior and close to measles–mumps–rubella (MMR) immunization relate to magnitudes of vaccine-specific antibody titers. In the FARMFLORA birth cohort, including both farming and non-farming families, children were immunized with the MMR vaccine at 18 months of age. MMR vaccine-induced antibody titers were measured in plasma samples obtained at 36 months of age. Infants' blood samples obtained at birth, 3–5 days and at 4 and 18 months of age were analyzed for T- and B-cell numbers, proportions of naive and memory T and B cells, and fractions of putative regulatory T cells. Multivariate factor analyses show that higher anti-MMR antibody titers were associated with a lower degree of adaptive immune maturation, that is, lower proportions of memory T cells and a lower capacity of mononuclear cells to produce cytokines, but with higher proportions of putative regulatory T cells. Further, children born by cesarean section (CS) had significantly higher anti-measles titers than vaginally-born children; and CS was found to be associated with delayed adaptive immunity. Also, girls presented with significantly higher anti-mumps and anti-rubella antibody levels than boys at 36 months of age. These results indicate that delayed adaptive immune maturation before and in close proximity to immunization seems to be advantageous for the ability of children to respond with higher anti-MMR antibody levels after vaccination. PMID:27195118

  9. Evaluating a Web-Based MMR Decision Aid to Support Informed Decision-Making by UK Parents: A Before-and-After Feasibility Study

    ERIC Educational Resources Information Center

    Jackson, Cath; Cheater, Francine M.; Peacock, Rose; Leask, Julie; Trevena, Lyndal

    2010-01-01

    Objective: The objective of this feasibility study was to evaluate the acceptability and potential effectiveness of a web-based MMR decision aid in supporting informed decision-making for the MMR vaccine. Design: This was a prospective before-and-after evaluation. Setting: Thirty parents of children eligible for MMR vaccination were recruited from…

  10. Association between perfluoroalkyl substance exposure and asthma and allergic disease in children as modified by MMR vaccination.

    PubMed

    Timmermann, Clara Amalie Gade; Budtz-Jørgensen, Esben; Jensen, Tina Kold; Osuna, Christa Elyse; Petersen, Maria Skaalum; Steuerwald, Ulrike; Nielsen, Flemming; Poulsen, Lars K; Weihe, Pál; Grandjean, Philippe

    2017-12-01

    Perfluoroalkyl substances (PFASs) are highly persistent chemicals that might be associated with asthma and allergy, but the associations remain unclear. Therefore, this study examined whether pre- and postnatal PFAS exposure was associated with childhood asthma and allergy. Measles, mumps, and rubella (MMR) vaccination in early life may have a protective effect against asthma and allergy, and MMR vaccination is therefore taken into account when evaluating these associations. In a cohort of Faroese children whose mothers were recruited during pregnancy, serum concentrations of five PFASs - Perfluorohexane sulfonic acid (PFHxS), perfluorooctane sulfonic acid (PFOS), perfluorooctanoic acid (PFOA), perfluorononanoic acid (PFNA), and perfluorodecanoic acid (PFDA) - were measured at three timepoints (maternal serum in pregnancy week 34-36 and child serum at ages 5 and 13 years) and their association with immunoglobulin E (IgE) (cord blood and at age 7 years) and asthma/allergic diseases (questionnaires at ages 5 and 13 years and skin prick test at age 13 years) was determined. A total of 559 children were included in the analyses. Interactions with MMR vaccination were evaluated. Among 22 MMR-unvaccinated children, higher levels of the five PFASs at age 5 years were associated with increased odds of asthma at ages 5 and 13. The associations were reversed among MMR-vaccinated children. Prenatal PFAS exposure was not associated with childhood asthma or allergic diseases regardless of MMR vaccination status. In conclusion, PFAS exposure at age 5 was associated with increased risk of asthma among a small subgroup of MMR-unvaccinated children but not among MMR-vaccinated children. While PFAS exposure may impact immune system functions, this study suggests that MMR vaccination might be a potential effect-modifier.

  11. Evidence and policymaking: The introduction of MMR vaccine in the Netherlands

    PubMed Central

    Blume, Stuart; Tump, Janneke

    2010-01-01

    Based on a case-study of the introduction of measles-mumps-rubella (MMR) vaccine in the Netherlands two decades ago, using documentary and archival sources, this paper examines the way evidence is used in policymaking. Starting from the question of ‘what counts as evidence’, two central claims are developed. First, the decision to introduce MMR was not one but a series of decisions going back at least seven years, over the course of which the significance attached to various forms of evidence changed. Second, results of international studies were coming gradually to be of greater significance than evidence gathered from within the Netherlands itself. These developments had, and continue to have, major consequences for national scientific competences. PMID:20667640

  12. The blame frame: media attribution of culpability about the MMR-autism vaccination scare.

    PubMed

    Holton, Avery; Weberling, Brooke; Clarke, Christopher E; Smith, Michael J

    2012-01-01

    Scholars have examined how news media frame events, including responsibility for causing and fixing problems, and how these frames inform public judgment. This study analyzed 281 newspaper articles about a controversial medical study linking the measles, mumps, and rubella (MMR) vaccination with autism. Given criticism of the study and its potential negative impact on vaccination rates across multiple countries, the current study examined actors to whom news media attributed blame for the MMR-vaccine association, sources used to support those attributions, and what solutions (e.g., mobilizing information), if any, were offered. This study provides unique insight by examining the evolution of these attributions over the lifetime of the controversy. Findings emphasize how news media may attribute blame in health risk communication and how that ascription plays a potentially vital role in shaping public behavior. Theoretical and practical implications are discussed.

  13. What Every Behavior Analyst Should Know About the “MMR Causes Autism” Hypothesis

    PubMed Central

    Ahearn, William H

    2010-01-01

    In 1998, the English physician Andrew Wakefield suggested that the MMR vaccine insults the guts of children who then regress developmentally and become autistic. Although his research did not provide firm evidence for this hypothesis, many believe that (a) the MMR vaccine can cause autism; (b) children with autism typically have gastrointestinal problems; and, (c) a necessary component of treating autism is “treating the gut” through dietary restrictions. Research has subsequently shown that Wakefield's hypothesis is unquestionably false, children with autism are not more likely to have gastrointestinal problems, and there is no sound evidence that diets are a valid treatment for autism. This paper will critically review these topics. PMID:22479671

  14. A New Approach to Nuclear Power The Multi-Module Reactor (MMR) Concept

    SciTech Connect

    Vernon, Milton E.

    2002-07-01

    While fuel cost for nuclear power is incredibly low relative to fossil fuel, the capital investment needed to build today's nuclear power plant is substantial. Utilities are reluctant to build new nuclear power plants because of the long construction time and the associated uncertainty of investment recovery. This paper introduces a new modular reactor concept, the Multi-Module Reactor (MMR), that reduces both the construction cost and time in an attempt to renew commercial interest in nuclear power. (authors)

  15. Factors associated with poor adherence to MMR vaccination in parents who follow vaccination schedule.

    PubMed

    Restivo, Vincenzo; Napoli, Giuseppe; Marsala, Maria Grazia Laura; Bonanno, Valentina; Sciuto, Valentina; Amodio, Emanuele; Calamusa, Giuseppe; Vitale, Francesco; Firenze, Alberto

    2015-01-01

    Due to median vaccination coverage far from elimination level, Italy is still an European country with high number of measles cases per million of people. In this study we explored potential socioeconomic, medical and demographic factors which could influence the propensity of family members for measles vaccination schedule. A cross-sectional study was performed through a questionnaire administered to the parents of children who received the first dose of MMR vaccine in two different vaccination centers in the Palermo area from November 2012 to May 2013. Overall, the role played by internet (OR 19.8 P = 0.001) and the large number of children in a family (OR 7.3 P ≤ 0.001) were the factors more associated to be unvaccinated, whereas the birth order of the child (OR 0.3 P = < 0.05 for the oldest children vs. the closer young one) and reporting a lack of MMR vaccination as a "personal decision" (OR 0.19 P ≤ 0.01) inversely correlated with the risk of quitting vaccination. These findings can be useful for a better knowledge of disaffection to vaccination practice in local settings and could contribute to improve and maintain timely uptake, suggesting approaches to optimize the uptake of MMR tailored to the needs of local populations.

  16. Healthcare workers and measles-mumps-rubella (MMR) status: how worried should we be about further outbreaks?

    PubMed

    Basu, S; Giri, P; Adisesh, A; McNAUGHT, R

    2014-08-01

    Recently, a number of outbreaks of measles and mumps have occurred within the UK and Europe. Healthcare workers (HCWs) are at risk of contracting and transmitting disease to patients and staff. To examine this risk at the point of entry to healthcare, we assessed the serological results of new HCWs presenting for pre-placement clearance without evidence of measles-mumps-rubella (MMR) immunity between 1 April 2010 and 31 March 2012. Overall rates of serological positivity to MMR across all age groups were 88·2%, 68·8% and 93·9%, respectively. With regard to measles and mumps, there were statistically significant decreases in the percentage of HCWs born after 1980 that had positive serology (P < 0·05). No such differences were seen between healthcare groups. Most seronegative HCWs accepted MMR vaccination. Despite our entry-level findings, the ongoing risk of a MMR outbreak within this cohort of HCWs appears low.

  17. [Lack of association between MMR vaccination and the incidence of autism in children: a case-control study].

    PubMed

    Mrozek-Budzyn, Dorota; Kiełtyka, Agnieszka; Majewska, Renata

    2009-01-01

    The matched case-control study has been undertook to investigate whether measles, mumps, and rubella (MMR) vaccine may be casually associated with autism in children. Cases were children to 14-year old with diagnosis of core autism or atypical autism. Controls were matched on age, sex and general practice. The 96 cases and 192 controls were included. The study provides strong evidence against association of autism with both MMR and a single measles individual vaccine. Additionally children vaccinated with MMR, regardless of age of vaccination (to 18th, 24th and 36th month of life), had risk equal half of that of single measles vaccinated (for vaccinated to 18th month OR=0.41 95%PU: 0.20-0.85). Our findings confirm that MMR vaccination is not associated with an increased risk of autism in children.

  18. What are parents' perspectives on psychological empowerment in the MMR vaccination decision? A focus group study

    PubMed Central

    Fadda, Marta; Galimberti, Elisa; Carraro, Valter; Schulz, Peter J

    2016-01-01

    Objectives Most developed countries do not have compulsory immunisation requirements, but instead issue recommendations. Although parents are expected to make an informed, autonomous (ie, empowered) decision regarding their children's vaccinations, there is no evidence about how parents' interpret this demand nor on the latitude of their decision-making. The goal of this study is to gain insights from parents residing in a low measles-mumps-rubella (MMR) uptake area on what constitutes feelings of empowerment in the decision they have to make on their child's MMR vaccination. Design A qualitative study employing focus group interviews. Setting 11 vaccination centres and hospitals in the Province of Trento, Italy. Participants 24 mothers and 4 fathers of children for whom the MMR vaccination decision was still pending participated in 6 focus groups. Results Autonomy and competence were salient themes in relation to empowerment, and were further connected with beliefs regarding legal responsibility and ethics of freedom concerning the decision, parents' relationship with the paediatrician (trust), feelings of relevance of the decision and related stress, and seeking, avoidance, or fear of vaccination-related information. Competence was interpreted as medical knowledge and information-seeking skills, but it was also related to the extent parents perceived the paediatrician to be competent. Conclusions Since parents' interpretation of empowerment goes beyond mere perceptions of being informed and autonomous and differs across individuals, it is important that this construct be correctly interpreted and implemented by best practice, for instance by explicitly adopting a relational conception of autonomy. Knowing whether parents want to make an empowered decision and what their information and autonomy needs are might help health professionals adapt their communication about immunisation, and promote parental perception of making an informed, autonomous decision. PMID

  19. Mismatch repair gene MLH3 Pro844Leu and Thr942Ile polymorphisms and the susceptibility to cervical carcinoma and HPV infection: a case-control study in a Chinese population.

    PubMed

    Ye, Feng; Cheng, Qi; Shen, Jiajie; Zhou, Caiyun; Chen, Huaizeng

    2014-01-01

    To investigate the association between MLH3 Pro844Leu, Thr942Ile polymorphisms and potential linkage with the risk of cervical carcinoma and potential effect on protein function, we carried out a case-control study with 400 cervical squamous cell carcinoma, 400 CIN3 and 1200 normal controls in a Chinese population. The results showed that there was an increased risk of cervical carcinoma and CIN3 associated with the genotype 844CT [OR 2.17 (1.61-2.94); P<0.001; OR 1.49 (1.08-2.07), P 0.017, respectively] and a decreased risk with the 942CT genotype [OR 0.56 (0.38-0.82); P<0.001; OR 0.37 (0.24-0.58), P<0.001, respectively]. Most 844CT genotypes were linkage CT(844)-CC(942), which increased the risk of cervical carcinoma and CIN3 [77/83, OR 2.04 (1.48-2.80), P<0.001; 55/61, OR 1.46 (1.03-2.06), P 0.035, respectively]. Most 942CT were linkage CC(844)-CT(942), which decreased the risk of cervical carcinoma [29/35, OR 0.60 (0.40-0.91); P 0.017; 18/24, OR 0.33 (0.20-0.55), P<0.001, respectively]. In some grouping, the 844CT and 942CT were further enriched; especially HR-HPV-positive subjects both in the CIN3 and the cervical carcinoma, the 844CT had greater enrichment. These results included that CT(844)-CC(942) was associated with a high risk of cervical carcinoma and CIN3, and the CC(844)-CT(942) decreased the risk. The 844CT had a higher level of enrichment in HR-HPV positive individuals, which is probably related to HR-HPV susceptibility. There was no significant difference of the MLH3 mRNA expression and these two amino acid substitutions did not impact on the protein function.

  20. Mismatch Repair Gene MLH3 Pro844Leu and Thr942Ile Polymorphisms and the Susceptibility to Cervical Carcinoma and HPV Infection: A Case-Control Study in a Chinese Population

    PubMed Central

    Ye, Feng; Cheng, Qi; Shen, Jiajie; Zhou, Caiyun; Chen, Huaizeng

    2014-01-01

    To investigate the association between MLH3 Pro844Leu, Thr942Ile polymorphisms and potential linkage with the risk of cervical carcinoma and potential effect on protein function, we carried out a case-control study with 400 cervical squamous cell carcinoma, 400 CIN3 and 1200 normal controls in a Chinese population. The results showed that there was an increased risk of cervical carcinoma and CIN3 associated with the genotype 844CT [OR 2.17 (1.61–2.94); P<0.001; OR 1.49 (1.08–2.07), P 0.017, respectively] and a decreased risk with the 942CT genotype [OR 0.56 (0.38–0.82); P<0.001; OR 0.37 (0.24–0.58), P<0.001, respectively]. Most 844CT genotypes were linkage CT(844)-CC(942), which increased the risk of cervical carcinoma and CIN3 [77/83, OR 2.04 (1.48–2.80), P<0.001; 55/61, OR 1.46 (1.03–2.06), P 0.035, respectively]. Most 942CT were linkage CC(844)-CT(942), which decreased the risk of cervical carcinoma [29/35, OR 0.60 (0.40–0.91); P 0.017; 18/24, OR 0.33 (0.20–0.55), P<0.001, respectively]. In some grouping, the 844CT and 942CT were further enriched; especially HR-HPV-positive subjects both in the CIN3 and the cervical carcinoma, the 844CT had greater enrichment. These results included that CT(844)-CC(942) was associated with a high risk of cervical carcinoma and CIN3, and the CC(844)-CT(942) decreased the risk. The 844CT had a higher level of enrichment in HR-HPV positive individuals, which is probably related to HR-HPV susceptibility. There was no significant difference of the MLH3 mRNA expression and these two amino acid substitutions did not impact on the protein function. PMID:24759751

  1. Attitudinal and Demographic Predictors of Measles-Mumps-Rubella Vaccine (MMR) Uptake during the UK Catch-Up Campaign 2008–09: Cross-Sectional Survey

    PubMed Central

    Brown, Katrina; Fraser, Graham; Ramsay, Mary; Shanley, Ruth; Cowley, Noel; van Wijgerden, Johan; Toff, Penelope; Falconer, Michelle; Hudson, Michael; Green, John; Kroll, J. Simon; Vincent, Charles; Sevdalis, Nick

    2011-01-01

    Background and Objective Continued suboptimal measles-mumps-rubella (MMR) vaccine uptake has re-established measles epidemic risk, prompting a UK catch-up campaign in 2008–09 for children who missed MMR doses at scheduled age. Predictors of vaccine uptake during catch-ups are poorly understood, however evidence from routine schedule uptake suggests demographics and attitudes may be central. This work explored this hypothesis using a robust evidence-based measure. Design Cross-sectional self-administered questionnaire with objective behavioural outcome. Setting and Participants 365 UK parents, whose children were aged 5–18 years and had received <2 MMR doses before the 2008–09 UK catch-up started. Main Outcome Measures Parents' attitudes and demographics, parent-reported receipt of invitation to receive catch-up MMR dose(s), and catch-up MMR uptake according to child's medical record (receipt of MMR doses during year 1 of the catch-up). Results Perceived social desirability/benefit of MMR uptake (OR = 1.76, 95% CI = 1.09–2.87) and younger child age (OR = 0.78, 95% CI = 0.68–0.89) were the only independent predictors of catch-up MMR uptake in the sample overall. Uptake predictors differed by whether the child had received 0 MMR doses or 1 MMR dose before the catch-up. Receipt of catch-up invitation predicted uptake only in the 0 dose group (OR = 3.45, 95% CI = 1.18–10.05), whilst perceived social desirability/benefit of MMR uptake predicted uptake only in the 1 dose group (OR = 9.61, 95% CI = 2.57–35.97). Attitudes and demographics explained only 28% of MMR uptake in the 0 dose group compared with 61% in the 1 dose group. Conclusions Catch-up MMR invitations may effectively move children from 0 to 1 MMR doses (unimmunised to partially immunised), whilst attitudinal interventions highlighting social benefits of MMR may effectively move children from 1 to 2 MMR doses (partially to fully immunised). Older children may be

  2. Risks and benefits of the single versus the triple MMR vaccine: how can health professionals reassure parents?

    PubMed

    McGreevy, Deborah

    2005-03-01

    Measles, mumps and rubella (MMR) are all preventable but infectious diseases caused by viruses. A particular study by Wakefield et al suggests that there are potentially adverse effects of having the triple MMR vaccine. This has been reported widely by the media and has caused alarm to parents of young children, probably contributing to the decline in its uptake. In order to provide the context for the debate regarding the single versus the triple vaccine, this paper briefly appraises firstly, the Wakefield et al research paper that has led to public health concerns and secondly, a more rigorous research study (Madsen et al) that contradicts the findings; the paper then explores the risks and benefits of the single and the triple MMR vaccine programmes, finally providing a short discussion on factors that might influence the decision-making process by parents when faced with the dilemma of not having their child vaccinated, or opting for either the single or triple vaccination programme.

  3. Mismatch Repair Balances Leading and Lagging Strand DNA Replication Fidelity

    DTIC Science & Technology

    2012-10-11

    the most deleterious mismatches (i.e., indel mismatches). Within classes of similar deleterious potential (base-base mismatches), evolution has...spontaneous mutation rates and the sequencing of URA3 mutants were as previously described [2,13,21], save that MSH2 was deleted from haploid pol2

  4. [The putative link between the MMR vaccine and autism and refusal to vaccinate].

    PubMed

    Segura Benedicto, Andreu

    2012-01-01

    The paper of Wakefield et al. in The Lancet, triggered a negative reaction to the MMR vaccine, even though it was just a series of cases and the association between vaccination and autism could well be anecdotal. However, it was found that this association was spurious, not only because of hidden biases but also to alterations of the data and other improper behavior of the two authors that they were expelled from medical council. Finally, the article was removed from the magazine. This episode invites to think about the credibility and trust in the authorities and professionals to the population, as well as the suspicions that may arise when there are potential conflicts of interest among professionals, industry magazines and the population. A special area of interest is on the distorted expectations of health interventions, including vaccination, particularly with regard to both individual and collective prevention.

  5. Reasons for measles cases not being vaccinated with MMR: investigation into parents' and carers' views following a large measles outbreak.

    PubMed

    McHale, P; Keenan, A; Ghebrehewet, S

    2016-03-01

    Uptake rates for the combined measles, mumps and rubella (MMR) vaccine have been below the required 95% in the UK since a retracted and discredited article linking the MMR vaccine with autism and inflammatory bowel disease was released in 1998. This study undertook semi-structured telephone interviews among parents or carers of 47 unvaccinated measles cases who were aged between 13 months and 9 years, during a large measles outbreak in Merseyside. Results showed that concerns over the specific links with autism remain an important cause of refusal to vaccinate, with over half of respondents stating this as a reason. A quarter stated child illness during scheduled vaccination time, while other reasons included general safety concerns and access issues. Over half of respondents felt that more information or a discussion with a health professional would help the decision-making process, while a third stated improved access. There was clear support for vaccination among respondents when asked about current opinions regarding MMR vaccine. The findings support the hypothesis that safety concerns remain a major barrier to MMR vaccination, and also support previous evidence that experience of measles is an important determinant in the decision to vaccinate.

  6. Persistence of measles antibodies, following changes in the recommended age for the second dose of MMR-vaccine in Portugal.

    PubMed

    Gonçalves, Guilherme; Frade, João; Nunes, Carla; Mesquita, João Rodrigo; Nascimento, Maria São José

    2015-09-22

    In populations vaccinated with two doses of combined measles-mumps-rubella vaccine (MMR), the serum levels of antibodies against measles depend on the vaccination schedule, time elapsed from the last dose and the area-specific epidemiological situation. Variables measuring "schedule" are age at first and second doses of MMR and intervals derived from that. Changes in vaccination schedules have been made in Portugal. The specific objectives of this study were to measure the association between those potential determinants and the concentration of measles-specific IgG antibodies, after the second dose of MMR. Convenience samples of three Portuguese birth cohorts were selected for this study (41, 66 and 60 born, respectively, in 2001-2003, 1990-1993 and 1994-1995). Geometric mean concentrations (GMC) for measles IgG were, respectively, 934, 251 and 144mIU/ml; p<0.001). Anti-measles-IgG serum concentration decreased with time since last vaccination (waning immunity) and was not influenced by any other component of vaccination schedule, namely age at vaccination with the second dose of MMR. Waning levels of measles antibodies have been observed elsewhere but not as fast as it was observed in Portuguese birth cohorts in this study. Changes in the vaccination schedules might have to be considered in the future.

  7. iPE-MMR: An integrated approach to accurately assign monoisotopic precursor masses to tandem mass spectrometric data

    PubMed Central

    Jung, Hee-Jung; Purvine, Samuel O.; Kim, Hokeun; Petyuk, Vladislav A.; Hyung, Seok-Won; Monroe, Matthew E.; Mun, Dong-Gi; Kim, Kyong-Chul; Park, Jong-Moon; Kim, Su-Jin; Tolic, Nikola; Slysz, Gordon W.; Moore, Ronald J.; Zhao, Rui; Adkins, Joshua N.; Anderson, Gordon A.; Lee, Hookeun; Camp, David G.; Yu, Myeong-Hee; Smith, Richard D.; Lee, Sang-Won

    2010-01-01

    Accurate assignment of monoisotopic precursor masses to tandem mass spectrometric (MS/MS) data is a fundamental and critically important step for successful peptide identifications in mass spectrometry based proteomics. Here we describe an integrated approach that combines three previously reported methods of treating MS/MS data for precursor mass refinement. This combined method, “integrated Post-Experiment Monoisotopic Mass Refinement” (iPE-MMR), integrates steps: 1) generation of refined MS/MS data by DeconMSn; 2) additional refinement of the resultant MS/MS data by a modified version of PE-MMR; 3) elimination of systematic errors of precursor masses using DtaRefinery. iPE-MMR is the first method that utilizes all MS information from multiple MS scans of a precursor ion including multiple charge states, in an MS scan, to determine precursor mass. By combining these methods, iPE-MMR increases sensitivity in peptide identification and provides increased accuracy when applied to complex high-throughput proteomics data. PMID:20863060

  8. Reproductive Decision-Making in MMR Mutation Carriers After Results Disclosure: Impact of Psychological Status in Childbearing Options.

    PubMed

    Duffour, Jacqueline; Combes, Audrey; Crapez, Evelyne; Boissière-Michot, Florence; Bibeau, Frédéric; Senesse, Pierre; Ychou, Marc; Courraud, Julie; de Forges, Hélène; Roca, Lise

    2016-06-01

    Reproductive techniques such as prenatal diagnosis (PND) or preimplantation genetic diagnosis (PGD), although debated, are legally forbidden in France in case of Lynch syndrome. The preference of mutation carriers about their reproductive options is not systematically considered in France. We aimed to prospectively assess the reproductive preferences of mismatch repair mutation carriers consulting in our institution (2003-2010, n = 100). We also considered the short- and long-term post-disclosure psychological impact using the Impact of Events Scale-Revised questionnaire to measure the prevalence of posttraumatic stress disorder (PTSD) in those patients. Complete data were obtained for 34 respondents (17 males, 17 females, median age of 33.5 years [22-59]). Seventeen respondents (57 %) preferred spontaneous natural conception versus 28 % and 35 % choosing PND and PGD, respectively. At results disclosure, respondents mainly explained their distress by fear of premature death (43 %) and transmitting mutated genes (42 %). One year later, this last fear remained predominant in 55 % of subjects. None of the main socio-demographical, psychological or medical variables (including fear of transmitting mutations) was significantly associated with the reproductive preferences. Results disclosure had a real and time-decreasing psychological impact on mutation carriers. Reproductive techniques, expected to decrease the hereditary risk, were not significantly preferred to natural conception.

  9. Guanine- 5-carboxylcytosine base pairs mimic mismatches during DNA replication.

    PubMed

    Shibutani, Toshihiro; Ito, Shinsuke; Toda, Mariko; Kanao, Rie; Collins, Leonard B; Shibata, Marika; Urabe, Miho; Koseki, Haruhiko; Masuda, Yuji; Swenberg, James A; Masutani, Chikahide; Hanaoka, Fumio; Iwai, Shigenori; Kuraoka, Isao

    2014-06-09

    The genetic information encoded in genomes must be faithfully replicated and transmitted to daughter cells. The recent discovery of consecutive DNA conversions by TET family proteins of 5-methylcytosine into 5-hydroxymethylcytosine, 5-formylcytosine, and 5-carboxylcytosine (5caC) suggests these modified cytosines act as DNA lesions, which could threaten genome integrity. Here, we have shown that although 5caC pairs with guanine during DNA replication in vitro, G·5caC pairs stimulated DNA polymerase exonuclease activity and were recognized by the mismatch repair (MMR) proteins. Knockdown of thymine DNA glycosylase increased 5caC in genome, affected cell proliferation via MMR, indicating MMR is a novel reader for 5caC. These results suggest the epigenetic modification products of 5caC behave as DNA lesions.

  10. Dilemmas of a vitalizing vaccine market: lessons from the MMR vaccine/autism debate.

    PubMed

    Bragesjö, Fredrik; Hallberg, Margareta

    2011-03-01

    A number of issues related to vaccines and vaccinations in society are discussed in this paper. Our purpose is to merge an analysis of some recent changes in the vaccine market with social science research on the relationship between citizens and authorities. The article has two empirical parts. The first shows how the vaccine market, which for many years has had immense financial problems, nowadays seems to becoming economically vitalized, mostly due to the production of new and profitable vaccines. However prosperous the future may appear, certain reactions from the public regarding vaccination initiatives offer insight into inherent problems of vaccine policies in many Western countries. In the second part of the article, these problems are exemplified with the recent controversy over the MMR (measles, mumps, and rubella) vaccine. We conclude that in spite of the improving profit-margins, the vaccine market remains vulnerable and insecure. Vaccines are permeated by society, even more so than pharmaceutics that are used to cure or alleviate illnesses. Radical changes in financial conditions with promises of a more profitable market will not, we argue, solve other even more fundamental problems.

  11. 'That's just what's expected of you … so you do it': mothers discussions around choice and the MMR vaccination.

    PubMed

    Johnson, Sally; Capdevila, Rose

    2014-01-01

    One of the major shifts in the form and experience of contemporary family life has been the increasing insertion of the 'expert' voice into the relationship between parents and children. This paper focuses on an exploration of mothers' engagement with advice around the combined measles, mumps and rubella (MMR) vaccine. Much of the previous literature utilises a 'decision-making' framework, based on 'risk assessment' whereby mothers' decisions are conceptualised as rooted in complex belief systems, and supposes that that by gaining an understanding of these systems, beliefs and behaviour can be modified and uptake improved. However, less attention has been paid to the ways in which mothers negotiate such advice or the ways in which advice is mediated by positionings, practices and relationships. Analysis of data from a focus group with five mothers identified three themes: (i) Sourcing advice and information, (ii) Constructing 'Mother knows best' and (iii) Negotiating agency. Despite the trustworthiness of advice and information being questioned, an awareness of concerns about the MMR, and health professionals being constructed as remote, ultimate conformity to, and compliance with, the 'system' and 'society' were described as determining MMR 'decisions'.

  12. Missed Opportunities for Measles, Mumps, and Rubella (MMR) Immunization in Mesoamerica: Potential Impact on Coverage and Days at Risk

    PubMed Central

    Mokdad, Ali H.; Gagnier, Marielle C.; Colson, K. Ellicott; Dansereau, Emily; Zúñiga-Brenes, Paola; Ríos-Zertuche, Diego; Haakenstad, Annie; Johanns, Casey K.; Palmisano, Erin B.; Hernandez, Bernardo; Iriarte, Emma

    2015-01-01

    Background Recent outbreaks of measles in the Americas have received news and popular attention, noting the importance of vaccination to population health. To estimate the potential increase in immunization coverage and reduction in days at risk if every opportunity to vaccinate a child was used, we analyzed vaccination histories of children 11–59 months of age from large household surveys in Mesoamerica. Methods Our study included 22,234 children aged less than 59 months in El Salvador, Guatemala, Honduras, Mexico, Nicaragua, and Panama. Child vaccination cards were used to calculate coverage of measles, mumps, and rubella (MMR) and to compute the number of days lived at risk. A child had a missed opportunity for vaccination if their card indicated a visit for vaccinations at which the child was not caught up to schedule for MMR. A Cox proportional hazards model was used to compute the hazard ratio associated with the reduction in days at risk, accounting for missed opportunities. Results El Salvador had the highest proportion of children with a vaccine card (91.2%) while Nicaragua had the lowest (76.5%). Card MMR coverage ranged from 44.6% in Mexico to 79.6% in Honduras while potential coverage accounting for missed opportunities ranged from 70.8% in Nicaragua to 96.4% in El Salvador. Younger children were less likely to have a missed opportunity. In Panama, children from households with higher expenditure were more likely to have a missed opportunity for MMR vaccination compared to the poorest (OR 1.62, 95% CI: 1.06–2.47). In Nicaragua, compared to children of mothers with no education, children of mothers with primary education and secondary education were less likely to have a missed opportunity (OR 0.46, 95% CI: 0.24–0.88 and OR 0.25, 95% CI: 0.096–0.65, respectively). Mean days at risk for MMR ranged from 158 in Panama to 483 in Mexico while potential days at risk ranged from 92 in Panama to 239 in El Salvador. Conclusions Our study found high levels

  13. MutS Homologues hMSH4 and hMSH5: Genetic Variations, Functions, and Implications in Human Diseases.

    PubMed

    Clark, Nicole; Wu, Xiling; Her, Chengtao

    2013-04-01

    The prominence of the human mismatch repair (MMR) pathway is clearly reflected by the causal link between MMR gene mutations and the occurrence of Lynch syndrome (or HNPCC). The MMR family of proteins also carries out a plethora of diverse cellular functions beyond its primary role in MMR and homologous recombination. In fact, members of the MMR family of proteins are being increasingly recognized as critical mediators between DNA damage repair and cell survival. Thus, a better functional understanding of MMR proteins will undoubtedly aid the development of strategies to effectively enhance apoptotic signaling in response to DNA damage induced by anti-cancer therapeutics. Among the five known human MutS homologs, hMSH4 and hMSH5 form a unique heterocomplex. However, the expression profiles of the two genes are not correlated in a number of cell types, suggesting that they may function independently as well. Consistent with this, these two proteins are promiscuous and thought to play distinct roles through interacting with different binding partners. Here, we describe the gene and protein structures of eukaryotic MSH4 and MSH5 with a particular emphasis on their human homologues, and we discuss recent findings of the roles of these two genes in DNA damage response and repair. Finally, we delineate the potential links of single nucleotide polymorphism (SNP) loci of these two genes with several human diseases.

  14. Characterization of Pathogenic Human MSH2 Missense Mutations Using Yeast as a Model System: A Laboratory Course in Molecular Biology

    PubMed Central

    Gammie, Alison E.; Erdeniz, Naz

    2004-01-01

    This work describes the project for an advanced undergraduate laboratory course in cell and molecular biology. One objective of the course is to teach students a variety of cellular and molecular techniques while conducting original research. A second objective is to provide instruction in science writing and data presentation by requiring comprehensive laboratory reports modeled on the primary literature. The project for the course focuses on a gene, MSH2, implicated in the most common form of inherited colorectal cancer. Msh2 is important for maintaining the fidelity of genetic material where it functions as an important component of the DNA mismatch repair machinery. The goal of the project has two parts. The first part is to create mapped missense mutation listed in the human databases in the cognate yeast MSH2 gene and to assay for defects in DNA mismatch repair. The second part of the course is directed towards understanding in what way are the variant proteins defective for mismatch repair. Protein levels are analyzed to determine if the missense alleles display decreased expression. Furthermore, the students establish whether the Msh2p variants are properly localized to the nucleus using indirect immunofluorescence and whether the altered proteins have lost their ability to interact with other subunits of the MMR complex by creating recombinant DNA molecules and employing the yeast 2-hybrid assay. PMID:22039344

  15. Characterization of pathogenic human MSH2 missense mutations using yeast as a model system: a laboratory course in molecular biology.

    PubMed

    Gammie, Alison E; Erdeniz, Naz

    2004-01-01

    This work describes the project for an advanced undergraduate laboratory course in cell and molecular biology. One objective of the course is to teach students a variety of cellular and molecular techniques while conducting original research. A second objective is to provide instruction in science writing and data presentation by requiring comprehensive laboratory reports modeled on the primary literature. The project for the course focuses on a gene, MSH2, implicated in the most common form of inherited colorectal cancer. Msh2 is important for maintaining the fidelity of genetic material where it functions as an important component of the DNA mismatch repair machinery. The goal of the project has two parts. The first part is to create mapped missense mutation listed in the human databases in the cognate yeast MSH2 gene and to assay for defects in DNA mismatch repair. The second part of the course is directed towards understanding in what way are the variant proteins defective for mismatch repair. Protein levels are analyzed to determine if the missense alleles display decreased expression. Furthermore, the students establish whether the Msh2p variants are properly localized to the nucleus using indirect immunofluorescence and whether the altered proteins have lost their ability to interact with other subunits of the MMR complex by creating recombinant DNA molecules and employing the yeast 2-hybrid assay.

  16. Transient suppression of MLH1 allows effective single-nucleotide substitution by single-stranded DNA oligonucleotides.

    PubMed

    Dekker, Marleen; de Vries, Sandra; Aarts, Marieke; Dekker, Robert; Brouwers, Conny; Wiebenga, Oliver; de Wind, Niels; Cantelli, Erika; Tonelli, Roberto; Te Riele, Hein

    2011-10-01

    Short synthetic single-stranded oligodeoxyribonucleotides (ssODNs) can be used to introduce subtle modifications into the genome of mouse embryonic stem cells (ESCs). We have previously shown that effective application of ssODN-mediated gene targeting in ESC requires (transient) suppression of DNA mismatch repair (MMR). However, whereas transient down-regulation of the mismatch recognition protein MSH2 allowed substitution of 3 or 4 nucleotides, 1 or 2 nucleotide substitutions were still suppressed. We now demonstrate that single- or dinucleotide substitution can effectively be achieved by transient down-regulation of the downstream MMR protein MLH1. By exploiting highly specific real-time PCR, we demonstrate the feasibility of substituting a single basepair in a non-selectable gene. However, disabling the MMR machinery may lead to inadvertent mutations. To obtain insight into the mutation rate associated with transient MMR suppression, we have compared the impact of transient and constitutive MMR deficiency on the repair of frameshift intermediates at mono- and dinucleotide repeats. Repair at these repeats relied on the substrate specificity and functional redundancy of the MSH2/MSH6 and MSH2/MSH3 MMR complexes. MLH1 knockdown increased the level of spontaneous mutagenesis, but modified ESCs remained germ line competent. Thus, transient MLH1 suppression provides a valuable extension of the MSH2 knockdown strategy, allowing rapid generation of mice carrying single basepair alterations in their genome.

  17. Children's health and the social theory of risk: insights from the British measles, mumps and rubella (MMR) controversy.

    PubMed

    Casiday, Rachel Elizabeth

    2007-09-01

    Recent debates in the United Kingdom about the measles, mumps and rubella (MMR) vaccine and its alleged link with autism have centred on contested notions of risk. This paper presents findings from 87 parents' focus group and interview discussions of their decision-making about the vaccine in light of three streams of theoretical literature on risk (cultural theory, risk society, psychometric models of risk perception) and models of vaccination acceptance and resistance. In addition to the risks of infectious disease and autism, parents balanced other risk concerns-both biological and social-in making their decisions. Such decisions, made on behalf of children unable to choose for themselves, and in the midst of contradictory information and uncertainty, symbolised what it means to be a 'good parent'. To cope with uncertainty, parents sought explanations for why some children seem to be more vulnerable to adverse outcomes than others. Debates about children's risks may need special theoretical consideration beyond that offered by the current risk literature. Specific aspects of the MMR debate, namely, selecting between potentially competing risks, making risk judgements on behalf of dependent others, and tensions between private and public good, provide a platform for exploring how social theories of risk might be adapted for children's health controversies.

  18. Widening inequalities in MMR vaccine uptake rates among ethnic groups in an urban area of the UK during a period of vaccine controversy (1994-2000).

    PubMed

    Hawker, Jeremy I; Olowokure, Babatunde; Wood, Annette L; Wilson, Richard C; Johnson, Richard

    2007-10-23

    We examined MMR vaccine uptake among ethnic groups in Birmingham, UK between 1994 and 2000, a period incorporating adverse MMR vaccine publicity. From 1994 to 2000 overall uptake: (1) fell significantly from 91.1% in 1994 to 89.8% (chi(2) for trend p<0.001) in 2000, (2) in Asian children significantly increased (chi(2) for trend p<0.001), and (3) in White children significantly decreased (chi(2) for trend p<0.001). Differences between ethnic groups with the highest (Asian) and the lowest (Black Caribbean) uptake rates increased from 2.1% in 1994 (p=ns) to 6.8% in 2000 (p<0.001). This study suggests underlying ethnic inequalities in MMR vaccine uptake and differential response to adverse vaccine publicity.

  19. Chromatographic isolation of the functionally active MutS protein covalently linked to deoxyribonucleic acid.

    PubMed

    Monakhova, Mayya; Ryazanova, Alexandra; Hentschel, Andreas; Viryasov, Mikhail; Oretskaya, Tatiana; Friedhoff, Peter; Kubareva, Elena

    2015-04-10

    DNA metabolism is based on formation of different DNA-protein complexes which can adopt various conformations. To characterize functioning of such complexes, one needs a solution-based technique which allows fixing a complex in a certain transient conformation. The crosslinking approach is a popular tool for such studies. However, it is under debate if the protein components retain their natural activities in the resulting crosslinked complexes. In the present work we demonstrate the possibility of obtaining pure DNA conjugate with functionally active protein using as example MutS protein from Escherichia coli mismatch repair system. A conjugate of a chemically modified mismatch-containing DNA duplex with MutS is fixed by thiol-disulfide exchange reaction. To perform a reliable test of the protein activity in the conjugate, such conjugate must be thoroughly separated from the uncrosslinked protein and DNA prior to the test. In the present work, we employ anion exchange chromatography for this purpose for the first time and demonstrate this technique to be optimal for the conjugate purification. The activity test is a FRET-based detection of DNA unbending. We show experimentally that MutS in the conjugate retains its ability to unbend DNA in response to ATP addition and find out for the first time that the DNA unbending rate increases with increasing ATP concentration. Since the crosslinked complexes contain active MutS protein, they can be used in further experiments to investigate MutS interactions with other proteins of the mismatch repair system.

  20. Making Sense of Missense in the Lynch Syndrome: The Clinical Perspective

    PubMed Central

    Lynch, Henry T.; Jascur, Thomas; Lanspa, Stephen; Boland, C. Richard

    2010-01-01

    The DNA mismatch repair system provides critical genetic housekeeping, and its failure is associated with tumorigenesis. Through distinct domains on the DNA mismatch repair proteins, the system recognizes and repairs errors occurring during DNA synthesis, but signals apoptosis when the DNA damage cannot be repaired. Certain missense mutations in the mismatch repair genes can selectively alter just one of these functions. This impacts the clinical features of tumors associated with defective DNA mismatch repair activity. New work reported by Xie et al. in this issue of the journal (beginning on page XXX) adds to the understanding of DNA mismatch repair. PMID:20978117

  1. Minimizing adsorption of histidine-tagged proteins for the study of protein-deoxyribonucleic acid interactions by kinetic capillary electrophoresis.

    PubMed

    Liyanage, Ruchi; Krylova, Svetlana M; Krylov, Sergey N

    2013-12-27

    Affinity interactions between DNA and proteins play a crucial role in many cellular processes. Kinetic Capillary Electrophoresis is a highly efficient tool for kinetic and equilibrium studies of protein-DNA interactions. Recombinant proteins, which are typically used for in vitro studies of protein-DNA interactions, are often expressed with a His tag to aid in their purification. In this work, we study how His tags affect Kinetic Capillary Electrophoresis analysis of protein-DNA interactions. We found that the addition of a His tag can increase or decrease protein adsorption to a bare-silica capillary wall, dependent on the protein. For Kinetic Capillary Electrophoresis measurements, it is essential to have as little protein adsorption as possible. We screened a number of capillary coatings to reduce adsorption of the His-tagged DNA mismatch repair protein MutS to the capillary wall and found that UltraTrol LN was the most effective coating. The effectiveness of the coating was confirmed with the prevention of adsorption of His-tagged fat mass and obesity-associated protein. Under typical conditions, the coating reduced protein adsorption to a level at which accurate Kinetic Capillary Electrophoresis analysis of protein-DNA interactions was possible. We further used Kinetic Capillary Electrophoresis to study how the His tag affected Kd of protein-DNA interactions for the MutS protein. Using UltraTrol LN, we found that the effect of the His tag was insignificant.

  2. Lynch syndrome in a 15-year-old boy.

    PubMed

    Bodas, A; Pérez-Segura, P; Maluenda, C; Caldés, T; Olivera, E; Díaz-Rubio, E

    2008-10-01

    Hereditary nonpolyposis colorectal cancer (HNPCC), or Lynch syndrome, dominantly inherited, is characterized by the development of a variety of cancers due to germline mutations in DNA mismatch repair genes (MMR). This syndrome was diagnosed in a 15-year-old boy because his father and grandmother were also found to have the same kind of cancer. Microsatellite instability prompted a search for germline mutations in the MLH1, MSH2, MSH6, and PMS2 genes. Use of immunohistochemical staining for MMR proteins, genomic sequencing, and deletion studies, evidenced MSH2 axonal deletion. Neoplastic lesions of colon are most often encountered in the adult population but can, on rare occasions, be found in younger patients. We would like to emphasize the importance of suspecting Lynch syndrome and performing genetic studies, even in young patients, when there is a family history of colorectal cancer.

  3. Excision of translesion synthesis errors orchestrates responses to helix-distorting DNA lesions

    PubMed Central

    Tsaalbi-Shtylik, Anastasia; Ferrás, Cristina; Pauw, Bea; Hendriks, Giel; Temviriyanukul, Piya; Carlée, Leone; Calléja, Fabienne; van Hees, Sandrine; Akagi, Jun-Ichi; Iwai, Shigenori; Hanaoka, Fumio; Jansen, Jacob G.

    2015-01-01

    In addition to correcting mispaired nucleotides, DNA mismatch repair (MMR) proteins have been implicated in mutagenic, cell cycle, and apoptotic responses to agents that induce structurally aberrant nucleotide lesions. Here, we investigated the mechanistic basis for these responses by exposing cell lines with single or combined genetic defects in nucleotide excision repair (NER), postreplicative translesion synthesis (TLS), and MMR to low-dose ultraviolet light during S phase. Our data reveal that the MMR heterodimer Msh2/Msh6 mediates the excision of incorrect nucleotides that are incorporated by TLS opposite helix-distorting, noninstructive DNA photolesions. The resulting single-stranded DNA patches induce canonical Rpa–Atr–Chk1-mediated checkpoints and, in the next cell cycle, collapse to double-stranded DNA breaks that trigger apoptosis. In conclusion, a novel MMR-related DNA excision repair pathway controls TLS a posteriori, while initiating cellular responses to environmentally relevant densities of genotoxic lesions. These results may provide a rationale for the colorectal cancer tropism in Lynch syndrome, which is caused by inherited MMR gene defects. PMID:25869665

  4. Non-canonical uracil processing in DNA gives rise to double-strand breaks and deletions: relevance to class switch recombination

    PubMed Central

    Bregenhorn, Stephanie; Kallenberger, Lia; Artola-Borán, Mariela; Peña-Diaz, Javier; Jiricny, Josef

    2016-01-01

    During class switch recombination (CSR), antigen-stimulated B-cells rearrange their immunoglobulin constant heavy chain (CH) loci to generate antibodies with different effector functions. CSR is initiated by activation-induced deaminase (AID), which converts cytosines in switch (S) regions, repetitive sequences flanking the CH loci, to uracils. Although U/G mispairs arising in this way are generally efficiently repaired to C/Gs by uracil DNA glycosylase (UNG)-initiated base excision repair (BER), uracil processing in S-regions of activated B-cells occasionally gives rise to double strand breaks (DSBs), which trigger CSR. Surprisingly, genetic experiments revealed that CSR is dependent not only on AID and UNG, but also on mismatch repair (MMR). To elucidate the role of MMR in CSR, we studied the processing of uracil-containing DNA substrates in extracts of MMR-proficient and –deficient human cells, as well as in a system reconstituted from recombinant BER and MMR proteins. Here, we show that the interplay of these repair systems gives rise to DSBs in vitro and to genomic deletions and mutations in vivo, particularly in an S-region sequence. Our findings further suggest that MMR affects pathway choice in DSB repair. Given its amenability to manipulation, our system represents a powerful tool for the molecular dissection of CSR. PMID:26743004

  5. Information is in the eye of the beholder: Seeking information on the MMR vaccine through an Internet search engine

    PubMed Central

    Yom-Tov, Elad; Fernandez-Luque, Luis

    2014-01-01

    Vaccination campaigns are one of the most important and successful public health programs ever undertaken. People who want to learn about vaccines in order to make an informed decision on whether to vaccinate are faced with a wealth of information on the Internet, both for and against vaccinations. In this paper we develop an automated way to score Internet search queries and web pages as to the likelihood that a person making these queries or reading those pages would decide to vaccinate. We apply this method to data from a major Internet search engine, while people seek information about the Measles, Mumps and Rubella (MMR) vaccine. We show that our method is accurate, and use it to learn about the information acquisition process of people. Our results show that people who are pro-vaccination as well as people who are anti-vaccination seek similar information, but browsing this information has differing effect on their future browsing. These findings demonstrate the need for health authorities to tailor their information according to the current stance of users. PMID:25954435

  6. Information is in the eye of the beholder: Seeking information on the MMR vaccine through an Internet search engine.

    PubMed

    Yom-Tov, Elad; Fernandez-Luque, Luis

    2014-01-01

    Vaccination campaigns are one of the most important and successful public health programs ever undertaken. People who want to learn about vaccines in order to make an informed decision on whether to vaccinate are faced with a wealth of information on the Internet, both for and against vaccinations. In this paper we develop an automated way to score Internet search queries and web pages as to the likelihood that a person making these queries or reading those pages would decide to vaccinate. We apply this method to data from a major Internet search engine, while people seek information about the Measles, Mumps and Rubella (MMR) vaccine. We show that our method is accurate, and use it to learn about the information acquisition process of people. Our results show that people who are pro-vaccination as well as people who are anti-vaccination seek similar information, but browsing this information has differing effect on their future browsing. These findings demonstrate the need for health authorities to tailor their information according to the current stance of users.

  7. 'Avoiding harm to others' considerations in relation to parental measles, mumps and rubella (MMR) vaccination discussions - an analysis of an online chat forum.

    PubMed

    Skea, Zoë C; Entwistle, Vikki A; Watt, Ian; Russell, Elizabeth

    2008-11-01

    Vaccination against contagious diseases is intended to benefit individuals and contribute to the eradication of such diseases from the population as a whole. The Measles, Mumps and Rubella (MMR) vaccine is widely recommended for all children with the aim of protecting against measles, mumps, and rubella. However, within the UK, there has been significant controversy surrounding its safety. This paper presents findings from a UK study of discussions about MMR in an online chat forum for parents. We observed archived discussions (without posting any messages) and conducted a thematic analysis to explore in more detail how participants discussed particular topics. Most participants were female, had young children, lived in the UK. They had reached a range of decisions regarding MMR vaccination. This analysis focuses on discussions about 'avoiding harm to others,' which were important considerations for many of the participating parents. In the context of concerns about MMR safety, participants expressed a desire to both (a) protect their own child and (b) help protect others by contributing to herd immunity. Parents made a distinction between healthy and vulnerable children which had important implications for their views about who should bear the burden of vaccination. Some parents were quite critical of those who did not vaccinate healthy children, and urged them to do so on grounds of social responsibility. Our findings suggest that social scientists with an interest in vaccination practice should attend carefully to lay understandings of herd immunity as a public good and views about obligations to others in society. Policy makers, too, might consider giving more emphasis to herd immunity in vaccination promotional material, although attention should be paid to the ways in which parents distinguish between healthy and vulnerable children.

  8. The impact of the media on the decision of parents in South Wales to accept measles-mumps-rubella (MMR) immunization.

    PubMed

    Walsh, S; Thomas, D Rh; Mason, B W; Evans, M R

    2015-02-01

    A large measles outbreak occurred in South Wales in 2012/2013. The outbreak has been attributed to low take-up of measles-mumps-rubella (MMR) immunization in the early 2000s. To understand better the factors that led to this outbreak we present the findings of a case-control study carried out in the outbreak area in 2001 to investigate parents' decision on whether to accept MMR. Parents who decided not to take-up MMR at the time were more likely to be older and better educated, more likely to report being influenced by newspapers [adjusted odds ratio (aOR) 3·07, 95% confidence interval (CI) 1·62-5·80], television (aOR 3·30, 95% CI 1·70-6·43), the internet (aOR 7·23, 3·26-16·06) and vaccine pressure groups (aOR 5·20, 95% CI 2·22-12·16), and less likely to be influenced by a health visitor (aOR 0·30, 95% CI 0·16-0·57). In this area of Wales, daily English-language regional newspapers, UK news programmes and the internet appeared to have a powerful negative influence. We consider the relevance of these findings to the epidemiology of the outbreak and the subsequent public health response.

  9. Immune response to the mumps component of the MMR vaccine in the routine of immunisation services in the Brazilian National Immunisation Program.

    PubMed

    Santos, Eliane Matos dos; Silva e Sá, Gloria Regina da; Siqueira, Marilda Mendonça; Martins, Reinaldo de Menezes; Camacho, Luiz Antonio Bastos; von Doellinger, Vanessa dos Reis; Maia, Maria de Lourdes de Sousa

    2014-06-01

    A non-controlled longitudinal study was conducted to evaluate the combined vaccine against measles, mumps and rubella (MMR) immunogenicity in 150 children vaccinated in the routine of three health units in the city of Rio de Janeiro, Brazil, 2008-2009, without other vaccines administered during the period from 30 days before to 30 days after vaccination. A previous study conducted in Brazil in 2007, in 1,769 children ranging from 12-15 months of age vaccinated against yellow fever and MMR simultaneously or at intervals of 30 days or more between doses, had shown low seroconversion for mumps regardless of the interval between administration of the two vaccines. The current study showed 89.5% (95% confidence interval: 83.3; 94.0) seroconversion rate for mumps. All children seroconverted for measles and rubella. After revaccination, high antibody titres and seroconversion rates were achieved against mumps. The results of this study and others suggest that two MMR doses confer optimal immunoresponses for all three antigens and the possible need for additional doses should be studied taking into account not only serological, but also epidemiological data, as there is no serological correlate of protection for mumps.

  10. Plasmodium falciparum MLH is schizont stage specific endonuclease.

    PubMed

    Tarique, Mohammed; Satsangi, Akash Tripathi; Ahmad, Moaz; Singh, Shailja; Tuteja, Renu

    2012-02-01

    Malaria is one of the most important infectious diseases in many regions around the world including India. Plasmodium falciparum is the cause of most lethal form of malaria while Plasmodium vivax is the major cause outside Africa. Regardless of considerable efforts over the last many years there is still no commercial vaccine against malaria and the disease is mainly treated using a range of established drugs. With time, the malaria parasite is developing drug resistance to most of the commonly used drugs. This drug resistance might be due to defective mismatch repair in the parasite. Previously we have reported that the P. falciparum genome contains homologues to most of the components of mismatch repair (MMR) complex. In the present study we report the detailed biochemical characterization of one of the main component of MMR complex, MLH, from P. falciparum. Our results show that MLH is an ATPase and it can incise covalently closed circular DNA in the presence of Mn(2+) or Mg(2+) ions. Using the truncated derivatives we show that full length protein MLH is required for all the enzymatic activities. Using immunodepletion assays we further show that the ATPase and endomuclease activities are attributable to PfMLH protein. Using immunofluorescence assay we report that the peak expression of MLH in both 3D7 and Dd2 strains of P. falciparum is mainly in the schizont stages of the intraerythrocytic development, where DNA replication is active. MMR also contributes to the overall fidelity of DNA replication and the peak expression of MLH in the schizont stages suggests that MLH is most likely involved in correcting the mismatches occurring during replication. This study should make a significant contribution in our better understanding of DNA metabolic processes in the parasite.

  11. Persistence of antibodies in 4-8 year old Austrian children after vaccination with hexavalent DTaP-HBV-IPV/Hib and MMR vaccines.

    PubMed

    Paulke-Korinek, Maria; Fischmeister, Gustav; Grac, Ana; Rendi-Wagner, Pamela; Kundi, Michael; Mohsenzadeh-Rabbani, Afsaneh; Moritz, Katharina; Fenninger, Beate; Jarisch, Reinhart; Jasinska, Joanna; Holzmann, Heidemarie; Wiedermann, Ursula; Kollaritsch, Herwig

    2011-07-18

    To determine the proficiency of the Austrian childhood vaccination schedule to induce long lasting seroprotection against vaccine preventable diseases a seroepidemiological study in 348 children between four and eight years of age was conducted. Antibodies against diphtheria, tetanus, pertussis, hepatitis B, measles, mumps and rubella antigens were assessed in children, who had been vaccinated with hexavalent DTaP-HBV-IPV/Hib vaccines at three, four, five months and in the second year of life and/or MMR vaccines in the second year of life at least once, but mostly twice. High seroprotection rates (SPRs) were detected for tetanus (96%) and measles (90%). SPRs regarding diphtheria and mumps were 81% and 72%, respectively. Rubella-SPRs were 68% in females and 58% in males. Hepatitis B-antibody levels ≥10 mIU/mL were present in 52%; antibodies against pertussis were detected in 27% of the children. SPRs for measles and rubella depended on the interval since last vaccination; mumps-antibodies were significantly lower after one MMR-vaccination only. Antibodies against diphtheria, tetanus and pertussis depended on the interval since last vaccination while HBs-antibodies did not. The low levels of antibodies 1-7 years after vaccination against pertussis, rubella and mumps after only one vaccination should be considered when recommending new vaccination schedules.

  12. Single nucleotide polymorphisms/haplotypes associated with multiple rubella-specific immune response outcomes post-MMR immunization in healthy children.

    PubMed

    Ovsyannikova, Inna G; Salk, Hannah M; Larrabee, Beth R; Pankratz, V Shane; Poland, Gregory A

    2015-10-01

    The observed heterogeneity in rubella-specific immune response phenotypes post-MMR vaccination is thought to be explained, in part, by inter-individual genetic variation. In this study, single nucleotide polymorphisms (SNPs) and multiple haplotypes in several candidate genes were analyzed for associations with more than one rubella-specific immune response outcome, including secreted IFN-γ, secreted IL-6, and neutralizing antibody titers. Overall, we identified 23 SNPs in 10 different genes that were significantly associated with at least two rubella-specific immune responses. Of these SNPs, we detected eight in the PVRL3 gene, five in the PVRL1 gene, one in the TRIM22 gene, two in the IL10RB gene, two in the TLR4 gene, and five in other genes (PVR, ADAR, ZFP57, MX1, and BTN2A1/BTN3A3). The PVRL3 gene haplotype GACGGGGGCAGCAAAAAGAAGAGGAAAGAACAA was significantly associated with both higher IFN-γ secretion (t-statistic 4.43, p < 0.0001) and higher neutralizing antibody titers (t-statistic 3.14, p = 0.002). Our results suggest that there is evidence of multigenic associations among identified gene SNPs and that polymorphisms in these candidate genes contribute to the overall observed differences between individuals in response to live rubella virus vaccine. These results will aid our understanding of mechanisms behind rubella-specific immune response to MMR vaccine and influence the development of vaccines in the future.

  13. The single-stranded DNA-binding protein of Escherichia coli.

    PubMed Central

    Meyer, R R; Laine, P S

    1990-01-01

    The single-stranded DNA-binding protein (SSB) of Escherichia coli is involved in all aspects of DNA metabolism: replication, repair, and recombination. In solution, the protein exists as a homotetramer of 18,843-kilodalton subunits. As it binds tightly and cooperatively to single-stranded DNA, it has become a prototypic model protein for studying protein-nucleic acid interactions. The sequences of the gene and protein are known, and the functional domains of subunit interaction, DNA binding, and protein-protein interactions have been probed by structure-function analyses of various mutations. The ssb gene has three promoters, one of which is inducible because it lies only two nucleotides from the LexA-binding site of the adjacent uvrA gene. Induction of the SOS response, however, does not lead to significant increases in SSB levels. The binding protein has several functions in DNA replication, including enhancement of helix destabilization by DNA helicases, prevention of reannealing of the single strands and protection from nuclease digestion, organization and stabilization of replication origins, primosome assembly, priming specificity, enhancement of replication fidelity, enhancement of polymerase processivity, and promotion of polymerase binding to the template. E. coli SSB is required for methyl-directed mismatch repair, induction of the SOS response, and recombinational repair. During recombination, SSB interacts with the RecBCD enzyme to find Chi sites, promotes binding of RecA protein, and promotes strand uptake. PMID:2087220

  14. Meta-analysis of mismatch repair polymorphisms within the cogent consortium for colorectal cancer susceptibility.

    PubMed

    Picelli, Simone; Lorenzo Bermejo, Justo; Chang-Claude, Jenny; Hoffmeister, Michael; Fernández-Rozadilla, Ceres; Carracedo, Angel; Castells, Antoni; Castellví-Bel, Sergi; Naccarati, Alessio; Pardini, Barbara; Vodickova, Ludmila; Müller, Heiko; Talseth-Palmer, Bente A; Stibbard, Geoffrey; Peterlongo, Paolo; Nici, Carmela; Veneroni, Silvia; Li, Li; Casey, Graham; Tenesa, Albert; Farrington, Susan M; Tomlinson, Ian; Moreno, Victor; van Wezel, Tom; Wijnen, Juul; Dunlop, Malcolm; Radice, Paolo; Scott, Rodney J; Vodicka, Pavel; Ruiz-Ponte, Clara; Brenner, Hermann; Buch, Stephan; Völzke, Henry; Hampe, Jochen; Schafmayer, Clemens; Lindblom, Annika

    2013-01-01

    In the last four years, Genome-Wide Association Studies (GWAS) have identified sixteen low-penetrance polymorphisms on fourteen different loci associated with colorectal cancer (CRC). Due to the low risks conferred by known common variants, most of the 35% broad-sense heritability estimated by twin studies remains unexplained. Recently our group performed a case-control study for eight Single Nucleotide Polymorphisms (SNPs) in 4 CRC genes. The present investigation is a follow-up of that study. We have genotyped six SNPs that showed a positive association and carried out a meta-analysis based on eight additional studies comprising in total more than 8000 cases and 6000 controls. The estimated recessive odds ratio for one of the SNPs, rs3219489 (MUTYH Q338H), decreased from 1.52 in the original Swedish study, to 1.18 in the Swedish replication, and to 1.08 in the initial meta-analysis. Since the corresponding summary probability value was 0.06, we decided to retrieve additional information for this polymorphism. The incorporation of six further studies resulted in around 13000 cases and 13000 controls. The newly updated OR was 1.03. The results from the present large, multicenter study illustrate the possibility of decreasing effect sizes with increasing samples sizes. Phenotypic heterogeneity, differential environmental exposures, and population specific linkage disequilibrium patterns may explain the observed difference of genetic effects between Sweden and the other investigated cohorts.

  15. Improvement of ENU Mutagenesis Efficiency Using Serial Injection and Mismatch Repair Deficiency Mice.

    PubMed

    Gallego-Llamas, Jabier; Timms, Andrew E; Pitstick, Rose; Peters, Janet; Carlson, George A; Beier, David R

    2016-01-01

    ENU mutagenesis is a powerful method for generating novel lines of mice that are informative with respect to both fundamental biological processes and human disease. Rapid developments in genomic technology have made the task of identifying causal mutations by positional cloning remarkably efficient. One limitation of this approach remains the mutation frequency achievable using standard treatment protocols, which currently generate approximately 1-2 sequence changes per megabase when optimized. In this study we used two strategies to attempt to increase the number of mutations induced by ENU treatment. One approach employed mice carrying a mutation in the DNA repair enzyme Msh6. The second strategy involved injection of ENU to successive generations of mice. To evaluate the number of ENU-induced mutations, single mice or pooled samples were analyzed using whole exome sequencing. The results showed that there is considerable variability in the induced mutation frequency using these approaches, but an overall increase in ENU-induced variants from one generation to another was observed. The analysis of the mice deficient for Msh6 also showed an increase in the ENU-induced variants compared to the wild-type ENU-treated mice. However, in both cases the increase in ENU-induced mutation frequency was modest.

  16. Spontaneous Mutation at a 5-Methylcytosine Hotspot Is Prevented by Very Short Patch (Vsp) Mismatch Repair

    PubMed Central

    Lieb, M.

    1991-01-01

    In many strains of Escherichia coli, the product of gene dcm methylates the internal cytosines in the sequence 5'CC(A or T)GG. Spontaneous deamination of 5-methylcytosine produces thymine which, if not corrected, can result in a transition mutation. 5-Methylcytosines in the lacI gene are hotspots for spontaneous C to T mutations. dcm is linked to vsr, a gene required for very short patch (VSP) repair. VSP repair corrects T.G mispairs in the following contexts: (GGTCC)(CTAGG), (GGACC)(CTTGG), (GTCC)(TAGG) and (GGTC)(CTAG). I have investigated the relationships between cytosine methylation, mutation, and VSP repair. Spontaneous mutations in the repressor (cI) gene of lambda prophage were isolated in wild-type and mutant lysogens. A hotspot for spontaneous mutation that corresponds with a 5-methylcytosine was observed in wild-type lysogens but was not present in bacteria lacking both methylase and VSP repair activity. Introduction of a plasmid containing dcm(+) and vsr(+) restored the mutation hotspot. If the added plasmid carried only dcm(+), the frequency of spontaneous mutations at the 5-methylcytosine was over 10-fold higher than in Dcm(+)Vsr(+) lysogens. The addition of vsr on a plasmid to a wild-type lysogen resulted in a 4-fold reduction in mutation at the hotspot. These findings support the previously untested hypothesis that VSP repair prevents mutations resulting from deamination of 5-methylcytosine. PMID:1829427

  17. Meta-Analysis of Mismatch Repair Polymorphisms within the Cogent Consortium for Colorectal Cancer Susceptibility

    PubMed Central

    Chang-Claude, Jenny; Hoffmeister, Michael; Fernández-Rozadilla, Ceres; Carracedo, Angel; Castells, Antoni; Castellví-Bel, Sergi; Juan, Diego Morillas; Raquel, Muñoz; Marisa, Manzano; Francisco, Colina; Jose, Díaz; Carolina, Ibarrola; Guadalupe, López; Alberto, Ibáñez; Antoni, Castells; Virgínia, Piñol; Sergi, Castellví-Bel; Francesc, Balaguer; Victoria, Gonzalo; Teresa, Ocaña; María Dolores, Giráldez; Maria, Pellisé; Anna, Serradesanferm; Leticia, Moreira; Miriam, Cuatrecasas; Josep, M. Piqué; Ángel, Lanas; Javier, Alcedo; Javier, Ortego; Joaquin, Cubiella; Ma, Soledad Díez; Mercedes, Salgado; Eloy, Sánchez; Mariano, Vega; Montserrat, Andreu; Anna, Abuli; Xavier, Bessa; Mar, Iglesias; Agustín, Seoane; Felipe, Bory; Gemma, Navarro; Beatriz, Bellosillo; Josep, Ma Dedeu; Cristina, Álvarez; Marc, Puigvehí; Luis, Bujanda; Ángel, Cosme; Inés, Gil; Mikel, Larzabal; Carlos, Placer; María, del Mar Ramírez; Elisabeth, Hijona; Jose, M. Enríquez-Navascués; Jose, L. Elosegui; Artemio, Payá; Rodrigo, Jover; Cristina, Alenda; Laura, Sempere; Nuria, Acame; Estefanía, Rojas; Lucía, Pérez-Carbonell; Joaquim, Rigau; Ángel, Serrano; Anna, Giménez; Joan, Saló; Eduard, Batiste-Alentorn; Josefina, Autonell; Ramon, Barniol; Ana, María García; Fernando, Carballo; Antonio, Bienvenido; Eduardo, Sanz; Fernando, González; Jaime, Sánchez; Akiko, Ono; Mercedes, Latorre; Enrique, Medina; Jaime, Cuquerella; Pilar, Canelles; Miguel, Martorell; José, Ángel García; Francisco, Quiles; Elisa, Orti; Juan, Clofent; Jaime, Seoane; Antoni, Tardío; Eugenia, Sanchez; Ma, Luisa de Castro; Antoni, Tardío; Juan, Clofent; Vicent, Hernández; Xavier, Llor; Rosa, M. Xicola; Marta, Piñol; Mercè, Rosinach; Anna, Roca; Elisenda, Pons; José, M. Hernández; Miquel, A. Gassull; Fernando, Fernández-Bañares; Josep, M. Viver; Antonio, Salas; Jorge, Espinós; Montserrat, Forné; Maria, Esteve; Josep, M. Reñé; Carmen, Piñol; Juan, Buenestado; Joan, Viñas; Enrique, Quintero; David, Nicolás; Adolfo, Parra; Antonio, Martín; Lidia, Argüello; Vicente, Pons; Virginia, Pertejo; Teresa, Sala; Dolors, Gonzalez; Eva, Roman; Teresa, Ramon; Maria, Poca; Ma, Mar Concepción; Marta, Martin; Lourdes, Pétriz; Daniel, Martinez; Ángel, Carracedo; Clara, Ruiz-Ponte; Ceres, Fernández-Rozadilla; Ma, Magdalena Castro; Sabino, Riestra; Luis, Rodrigo; Javier, Fernández; Jose, Luis Cabriada; Luis, Carreño; Susana, Oquiñena; Federico, Bolado; Elena, Peña; José, Manuel Blas; Gloria, Ceña; Juan, José Sebastián; Antonio, Naranjo; Naccarati, Alessio; Pardini, Barbara; Vodickova, Ludmila; Müller, Heiko; Talseth-Palmer, Bente A.; Stibbard, Geoffrey; Peterlongo, Paolo; Nici, Carmela; Veneroni, Silvia; Li, Li; Casey, Graham; Tenesa, Albert; Farrington, Susan M.; Tomlinson, Ian; Moreno, Victor; van Wezel, Tom; Wijnen, Juul; Dunlop, Malcolm; Radice, Paolo; Scott, Rodney J.; Vodicka, Pavel; Ruiz-Ponte, Clara; Brenner, Hermann; Buch, Stephan; Völzke, Henry; Hampe, Jochen; Schafmayer, Clemens; Lindblom, Annika

    2013-01-01

    In the last four years, Genome-Wide Association Studies (GWAS) have identified sixteen low-penetrance polymorphisms on fourteen different loci associated with colorectal cancer (CRC). Due to the low risks conferred by known common variants, most of the 35% broad-sense heritability estimated by twin studies remains unexplained. Recently our group performed a case-control study for eight Single Nucleotide Polymorphisms (SNPs) in 4 CRC genes. The present investigation is a follow-up of that study. We have genotyped six SNPs that showed a positive association and carried out a meta-analysis based on eight additional studies comprising in total more than 8000 cases and 6000 controls. The estimated recessive odds ratio for one of the SNPs, rs3219489 (MUTYH Q338H), decreased from 1.52 in the original Swedish study, to 1.18 in the Swedish replication, and to 1.08 in the initial meta-analysis. Since the corresponding summary probability value was 0.06, we decided to retrieve additional information for this polymorphism. The incorporation of six further studies resulted in around 13000 cases and 13000 controls. The newly updated OR was 1.03. The results from the present large, multicenter study illustrate the possibility of decreasing effect sizes with increasing samples sizes. Phenotypic heterogeneity, differential environmental exposures, and population specific linkage disequilibrium patterns may explain the observed difference of genetic effects between Sweden and the other investigated cohorts. PMID:24039736

  18. Improvement of ENU Mutagenesis Efficiency Using Serial Injection and Mismatch Repair Deficiency Mice

    PubMed Central

    Pitstick, Rose; Peters, Janet; Carlson, George A.

    2016-01-01

    ENU mutagenesis is a powerful method for generating novel lines of mice that are informative with respect to both fundamental biological processes and human disease. Rapid developments in genomic technology have made the task of identifying causal mutations by positional cloning remarkably efficient. One limitation of this approach remains the mutation frequency achievable using standard treatment protocols, which currently generate approximately 1–2 sequence changes per megabase when optimized. In this study we used two strategies to attempt to increase the number of mutations induced by ENU treatment. One approach employed mice carrying a mutation in the DNA repair enzyme Msh6. The second strategy involved injection of ENU to successive generations of mice. To evaluate the number of ENU-induced mutations, single mice or pooled samples were analyzed using whole exome sequencing. The results showed that there is considerable variability in the induced mutation frequency using these approaches, but an overall increase in ENU-induced variants from one generation to another was observed. The analysis of the mice deficient for Msh6 also showed an increase in the ENU-induced variants compared to the wild-type ENU-treated mice. However, in both cases the increase in ENU-induced mutation frequency was modest. PMID:27441645

  19. Clinical characterization and mutation spectrum in Caribbean Hispanic families with Lynch Syndrome

    PubMed Central

    Cruz-Correa, Marcia; Diaz-Algorri, Yaritza; Pérez-Mayoral, Julyann; Suleiman-Suleiman, Wasilah; Gonzalez-Pons, Maria del Mar; Bertrán, Carlos; Casellas, Nicolás; Rodríguez, Natalia; Pardo, Sherly; Rivera, Keyla; Mosquera, Rafael; Rodriguez-Quilichini, Segundo

    2015-01-01

    Lynch Syndrome (LS) is an inherited form of colorectal cancer caused by germline mutations in the Mismatch Repair (MMR) genes. It accounts for approximately 5% of all colorectal cancers. The prevalence of Lynch Syndrome among US Hispanics is unknown. The objective of this study was to describe the germline mutations of Lynch Syndrome in Caribbean Hispanics from Puerto Rico and Dominican Republic. A total of 89 subjects were recruited through the Puerto Rico Familial Colorectal Cancer Registry and were classified according to Amsterdam and Bethesda clinical guidelines. For those tumors with lack of expression of MMR protein, gene sequencing was ordered. A total of 35 individuals with deficient MMR system were identified: 22 had MMR mutations and 13 had tumors with absent MMR protein expression. Our results show that the mutation spectrum of Caribbean Hispanic LS patients was composed mostly of MSH2 (66.7 %) mutations, followed by MLH1 (25.0 %). One mutation was identified in MSH6 (8.3 %). A previously unidentified mutation in MLH1 gene c.2044_2045del was found in one Caribbean Hispanic family. MMR mutation-positive individuals were found to be more likely to have a prominent family history of CRC and tumors located at the proximal colon. Compared to MSH2 mutation carriers, MLH1 mutation-positive individuals were more likely to have a strong family history of CRC and LS associated cancers. Furthermore, insurance coverage for genetic testing was found to be limited in the study population with 65.1% of the individuals recruited were denied coverage. This report presents the first description of the mutation spectrum and clinicopathologic characteristics of LS Caribbean Hispanics patients. PMID:25782445

  20. Clinical characterization and mutation spectrum in Caribbean Hispanic families with Lynch syndrome.

    PubMed

    Cruz-Correa, Marcia; Diaz-Algorri, Yaritza; Pérez-Mayoral, Julyann; Suleiman-Suleiman, Wasilah; Gonzalez-Pons, Maria del Mar; Bertrán, Carlos; Casellas, Nicolás; Rodríguez, Natalia; Pardo, Sherly; Rivera, Keyla; Mosquera, Rafael; Rodriguez-Quilichini, Segundo

    2015-09-01

    Lynch syndrome (LS) is an inherited form of colorectal cancer (CRC) caused by germline mutations in the mismatch repair (MMR) genes. It accounts for approximately 5% of all CRCs. The prevalence of LS among US Hispanics is unknown. The objective of this study was to describe the germline mutations of LS in Caribbean Hispanics from Puerto Rico and Dominican Republic. A total of 89 subjects were recruited through the Puerto Rico Familial Colorectal Cancer Registry and were classified according to Amsterdam and Bethesda clinical guidelines. For those tumors with lack of expression of MMR protein, gene sequencing was ordered. A total of 35 individuals with deficient MMR system were identified: 22 had MMR mutations and 13 had tumors with absent MMR protein expression. Our results show that the mutation spectrum of Caribbean Hispanic LS patients was composed mostly of MSH2 (66.7%) mutations, followed by MLH1 (25.0%). One mutation was identified in MSH6 (8.3%). A previously unidentified mutation in MLH1 gene c.2044_2045del was found in one Caribbean Hispanic family. MMR mutation-positive individuals were found to be more likely to have a prominent family history of CRC and tumors located at the proximal colon. Compared to MSH2 mutation carriers, MLH1 mutation-positive individuals were more likely to have a strong family history of CRC and LS associated cancers. Furthermore, insurance coverage for genetic testing was found to be limited in the study population with 65.1% of the individuals recruited were denied coverage. This report presents the first description of the mutation spectrum and clinicopathologic characteristics of LS Caribbean Hispanics patients.

  1. The multifaceted influence of histone deacetylases on DNA damage signalling and DNA repair

    PubMed Central

    Roos, Wynand Paul; Krumm, Andrea

    2016-01-01

    Histone/protein deacetylases play multiple roles in regulating gene expression and protein activation and stability. Their deregulation during cancer initiation and progression cause resistance to therapy. Here, we review the role of histone deacetylases (HDACs) and the NAD+ dependent sirtuins (SIRTs) in the DNA damage response (DDR). These lysine deacetylases contribute to DNA repair by base excision repair (BER), nucleotide excision repair (NER), mismatch repair (MMR), non-homologous end joining (NHEJ), homologous recombination (HR) and interstrand crosslink (ICL) repair. Furthermore, we discuss possible mechanisms whereby these histone/protein deacetylases facilitate the switch between DNA double-strand break (DSB) repair pathways, how SIRTs play a central role in the crosstalk between DNA repair and cell death pathways due to their dependence on NAD+, and the influence of small molecule HDAC inhibitors (HDACi) on cancer cell resistance to genotoxin based therapies. Throughout the review, we endeavor to identify the specific HDAC targeted by HDACi leading to therapy sensitization. PMID:27738139

  2. Absence of detectable measles virus genome sequence in blood of autistic children who have had their MMR vaccination during the routine childhood immunization schedule of UK.

    PubMed

    Afzal, M A; Ozoemena, L C; O'Hare, A; Kidger, K A; Bentley, M L; Minor, P D

    2006-05-01

    Leukocyte preparations from children with documented evidence of MMR vaccination and confirmed diagnosis of autism were examined by several assays designed to target multiple regions of the measles virus genome sequence. No sample was found positive by any method. The assays applied were highly sensitive, specific and robust in nature, and were based on the amplification of measles virus RNA transcripts by real-time quantitative RT-PCR (QRT-PCR) as well as by conventional RT-PCR-nested PCR. The assays applied were potentially able to detect measles virus RNA down to single figure copy numbers per reaction. The amount of total nucleic acid extract of leukocytes subjected to various measles virus-specific investigations was several fold higher than minimally required of a sample where measles virus persistence is well documented. This study failed to substantiate reports of the persistence of measles virus in autistic children with development regression.

  3. Human MLH1 suppresses the insertion of telomeric sequences at intra-chromosomal sites in telomerase-expressing cells.

    PubMed

    Jia, Pingping; Chastain, Megan; Zou, Ying; Her, Chengtao; Chai, Weihang

    2016-11-29

    Aberrant formation of interstitial telomeric sequences (ITSs) promotes genome instabilities. However, it is unclear how aberrant ITS formation is suppressed in human cells. Here, we report that MLH1, a key protein involved in mismatch repair (MMR), suppresses telomeric sequence insertion (TSI) at intra-chromosomal regions. The frequency of TSI can be elevated by double-strand break (DSB) inducer and abolished by ATM/ATR inhibition. Suppression of TSI requires MLH1 recruitment to DSBs, indicating that MLH1's role in DSB response/repair is important for suppressing TSI. Moreover, TSI requires telomerase activity but is independent of the functional status of p53 and Rb. Lastly, we show that TSI is associated with chromosome instabilities including chromosome loss, micronuclei formation and chromosome breakage that are further elevated by replication stress. Our studies uncover a novel link between MLH1, telomerase, telomere and genome stability.

  4. GATE Monte Carlo simulations for variations of an integrated PET/MR hybrid imaging system based on the Biograph mMR model

    NASA Astrophysics Data System (ADS)

    Aklan, B.; Jakoby, B. W.; Watson, C. C.; Braun, H.; Ritt, P.; Quick, H. H.

    2015-06-01

    A simulation toolkit, GATE (Geant4 Application for Tomographic Emission), was used to develop an accurate Monte Carlo (MC) simulation of a fully integrated 3T PET/MR hybrid imaging system (Siemens Biograph mMR). The PET/MR components of the Biograph mMR were simulated in order to allow a detailed study of variations of the system design on the PET performance, which are not easy to access and measure on a real PET/MR system. The 3T static magnetic field of the MR system was taken into account in all Monte Carlo simulations. The validation of the MC model was carried out against actual measurements performed on the PET/MR system by following the NEMA (National Electrical Manufacturers Association) NU 2-2007 standard. The comparison of simulated and experimental performance measurements included spatial resolution, sensitivity, scatter fraction, and count rate capability. The validated system model was then used for two different applications. The first application focused on investigating the effect of an extension of the PET field-of-view on the PET performance of the PET/MR system. The second application deals with simulating a modified system timing resolution and coincidence time window of the PET detector electronics in order to simulate time-of-flight (TOF) PET detection. A dedicated phantom was modeled to investigate the impact of TOF on overall PET image quality. Simulation results showed that the overall divergence between simulated and measured data was found to be less than 10%. Varying the detector geometry showed that the system sensitivity and noise equivalent count rate of the PET/MR system increased progressively with an increasing number of axial detector block rings, as to be expected. TOF-based PET reconstructions of the modeled phantom showed an improvement in signal-to-noise ratio and image contrast to the conventional non-TOF PET reconstructions. In conclusion, the validated MC simulation model of an integrated PET/MR system with an overall

  5. MLH1 constitutional and somatic methylation in patients with MLH1 negative tumors fulfilling the revised Bethesda criteria

    PubMed Central

    Crucianelli, Francesca; Tricarico, Rossella; Turchetti, Daniela; Gorelli, Greta; Gensini, Francesca; Sestini, Roberta; Giunti, Laura; Pedroni, Monica; Ponz de Leon, Maurizio; Civitelli, Serenella; Genuardi, Maurizio

    2014-01-01

    Lynch syndrome (LS) is a tumor predisposing condition caused by constitutional defects in genes coding for components of the mismatch repair (MMR) apparatus. While hypermethylation of the promoter of the MMR gene MLH1 occurs in about 15% of colorectal cancer samples, it has also been observed as a constitutional alteration, in the absence of DNA sequence mutations, in a small number of LS patients. In order to obtain further insights on the phenotypic characteristics of MLH1 epimutation carriers, we investigated the somatic and constitutional MLH1 methylation status of 14 unrelated subjects with a suspicion of LS who were negative for MMR gene constitutional mutations and whose tumors did not express the MLH1 protein. A novel case of constitutional MLH1 epimutation was identified. This patient was affected with multiple primary tumors, including breast cancer, diagnosed starting from the age of 55 y. Investigation of her offspring by allele specific expression revealed that the epimutation was not stable across generations. We also found MLH1 hypermethylation in cancer samples from 4 additional patients who did not have evidence of constitutional defects. These patients had some characteristics of LS, namely early age at onset and/or positive family history, raising the possibility of genetic influences in the establishment of somatic MLH1 methylation. PMID:25437057

  6. Slow conformational changes in MutS and DNA direct ordered transitions between mismatch search, recognition and signaling of DNA repair.

    PubMed

    Sharma, Anushi; Doucette, Christopher; Biro, F Noah; Hingorani, Manju M

    2013-11-15

    MutS functions in mismatch repair (MMR) to scan DNA for errors, identify a target site and trigger subsequent events in the pathway leading to error removal and DNA re-synthesis. These actions, enabled by the ATPase activity of MutS, are now beginning to be analyzed from the perspective of the protein itself. This study provides the first ensemble transient kinetic data on MutS conformational dynamics as it works with DNA and ATP in MMR. Using a combination of fluorescence probes (on Thermus aquaticus MutS and DNA) and signals (intensity, anisotropy and resonance energy transfer), we have monitored the timing of key conformational changes in MutS that are coupled to mismatch binding and recognition, ATP binding and hydrolysis, as well as sliding clamp formation and signaling of repair. Significant findings include (a) a slow step that follows weak initial interaction between MutS and DNA, in which concerted conformational changes in both macromolecules control mismatch recognition, and (b) rapid, binary switching of MutS conformations that is concerted with ATP binding and hydrolysis and (c) is stalled after mismatch recognition to control formation of the ATP-bound MutS sliding clamp. These rate-limiting pre- and post-mismatch recognition events outline the mechanism of action of MutS on DNA during initiation of MMR.

  7. Novel Mutations in MLH1 and MSH2 Genes in Mexican Patients with Lynch Syndrome

    PubMed Central

    Moreno-Ortiz, Jose Miguel; Ayala-Madrigal, María de la Luz; Corona-Rivera, Jorge Román; Maciel-Gutiérrez, Víctor; Franco-Topete, Ramón Antonio; Armendáriz-Borunda, Juan; Pérez-Carbonell, Lucia; Rhees, Jennifer; Gutiérrez-Angulo, Melva

    2016-01-01

    Background. Lynch Syndrome (LS) is characterized by germline mutations in the DNA mismatch repair (MMR) genes MLH1, MSH2, MSH6, and PMS2. This syndrome is inherited in an autosomal dominant pattern and is characterized by early onset colorectal cancer (CRC) and extracolonic tumors. The aim of this study was to identify mutations in MMR genes in three Mexican patients with LS. Methods. Immunohistochemical analysis was performed as a prescreening method to identify absent protein expression. PCR, Denaturing High Performance Liquid Chromatography (dHPLC), and Sanger sequencing complemented the analysis. Results. Two samples showed the absence of nuclear staining for MLH1 and one sample showed loss of nuclear staining for MSH2. The mutations found in MLH1 gene were c.2103+1G>C in intron 18 and compound heterozygous mutants c.1852_1854delAAG (p.K618del) and c.1852_1853delinsGC (p.K618A) in exon 16. In the MSH2 gene, we identified mutation c.638dupT (p.L213fs) in exon 3. Conclusions. This is the first report of mutations in MMR genes in Mexican patients with LS and these appear to be novel. PMID:27247567

  8. When, and how, should we introduce a combination measles-mumps-rubella (MMR) vaccine into the national childhood expanded immunization programme in South Africa?

    PubMed

    Cameron, Neil A

    2012-09-07

    This article briefly reviews the history and epidemiology of measles, mumps and rubella disease and the case for introducing combination measles-mumps-rubella (MMR) vaccine into the national childhood immunization schedule in South Africa. Despite adopting the World Health Organization's Measles Elimination strategy in 1996 and achieving a significant decrease the incidence of measles, added effort is needed in South and southern Africa to reach the goal to eliminate endogenous spread measles. Mumps is still common disease of childhood and while there are few sequelae, even the rare complications are important in large populations. Congenital rubella syndrome is seldom reported, but it is estimated that of the million or so children born every year in South Africa over 600 infants are affected to some degree by rubella infection. The naturally acquired immunity to rubella in women of childbearing age in South Africa has been estimated at over 90%, so that introducing a rubella containing vaccine in childhood may paradoxically increase the proportion of girls reaching puberty still susceptible to rubella. The elimination of endogenous measles and rubella is being achieved in many countries in South America, and despite the recent measles epidemic, must still be seriously considered for South and southern Africa. Current constraints and potential steps needed to reach the goal in South Africa are discussed.

  9. Analysis of Molecular Markers by Anatomic Tumor Site in Stage III Colon Carcinomas from Adjuvant Chemotherapy Trial NCCTG N0147 (Alliance)

    PubMed Central

    Sinicrope, Frank A.; Mahoney, Michelle R.; Yoon, Harry H.; Smyrk, Thomas C.; Thibodeau, Stephen N.; Goldberg, Richard M.; Nelson, Garth D.; Sargent, Daniel J.; Alberts, Steven R.

    2015-01-01

    PURPOSE To determine the frequency and prognostic association of molecular markers by anatomic tumor site in patients with stage III colon carcinomas. Experimental Design In a randomized trial of adjuvant FOLFOX + cetuximab, BRAFV600E and KRAS (exon 2) mutations and DNA mismatch repair (MMR) proteins were analyzed in tumors (N=3,018) in relationship to tumor location including subsite. Cox models were used to assess clinical outcome including overall survival (OS). RESULTS KRAS codon 12 mutations were most frequent at the splenic flexure and cecum; codon 13 mutations were evenly distributed. BRAF mutation frequency sharply increased from transverse colon to cecum in parallel with deficient (d) MMR. Non-mutated BRAF or KRAS tumors progressively decreased from sigmoid to transverse (all p<0.0001). Significantly poorer OS was found for mutant KRAS in distal [HR, 1.98 (1.49–2.63); p<.0001] vs proximal [1.25 (0.97–1.60), p=.079] cancers. BRAF status and outcome were not significantly associated with tumor site. Proximal vs distal dMMR tumors had significantly better outcome. An interaction test was significant for tumor site by KRAS (padjusted=.043) and MMR (padjusted=.010) for OS. Significant prognostic differences for biomarkers by tumor site were maintained in the FOLFOX arm. Tumor site was independently prognostic with a stepwise improvement from cecum to sigmoid (OS: padjusted=0.001). CONCLUSIONS Mutations in BRAF or KRAS codon 12 were enriched in proximal cancers whereas non-mutated BRAF/KRAS were increased in distal tumors. Significant differences in outcome for KRAS mutations and dMMR were found by tumor site, indicating that their interpretation should occur in the context of tumor location. PMID:26187617

  10. HuCOP1 contributes to the regulation of DNA repair in keratinocytes.

    PubMed

    Fazekas, B; Carty, M P; Németh, I; Kemény, L; Széll, M; Ádám, É

    2017-03-01

    We have previously demonstrated that the E3 ligase Human Constitutive Photomorphogenic Protein (huCOP1) is expressed in human keratinocytes and negatively regulates p53. The MutS homolog 2 (MSH2) protein plays a central role in DNA MMR mechanism and is implicated in the cellular response to anticancer agents, such as cisplatin. Our aim was to clarify whether huCOP1 plays a role in DNA MMR by affecting MSH2 protein level in human keratinocytes. To define the role of huCOP1 in DNA mismatch repair, we determined whether huCOP1 affects MSH2 abundance. MSH2 protein level was detected by immunocytochemical staining using a keratinocyte cell line in which the expression level of huCOP1 was stably decreased (siCOP1). To investigate whether huCOP1 silencing influences cisplatin-induced cell death, control and siCOP1 keratinocyte cells were treated with increasing concentrations of cisplatin and cell viability was recorded after 48 and 96 h. Stable silencing of huCOP1 in human keratinocytes resulted in a reduced level of MSH2 protein. huCOP1 silencing also sensitized keratinocytes to the interstrand crosslinking inducer cisplatin. Our results indicate that decreased huCOP1 correlates with lower MSH2 levels. These protein level changes lead to increased sensitivity toward cisplatin treatment, implicating that huCOP1 plays a positive role in maintaining genome integrity in human keratinocytes.

  11. Small bowel adenocarcinoma phenotyping, a clinicobiological prognostic study

    PubMed Central

    Aparicio, T; Svrcek, M; Zaanan, A; Beohou, E; Laforest, A; Afchain, P; Mitry, Emmanuel; Taieb, J; Di Fiore, F; Gornet, J-M; Thirot-Bidault, A; Sobhani, I; Malka, D; Lecomte, T; Locher, C; Bonnetain, F; Laurent-Puig, P

    2013-01-01

    Background: Small bowel adenocarcinoma (SBA) is a rare tumour with a poor prognosis. Molecular biology data on SBA carcinogenesis are lacking. Methods: Expression of HER2, β-catenin, p53 and mismatch repair (MMR) protein was assessed by immunohistochemistry. KRAS, V600E BRAF mutations and microsatellite instability were investigated. Results: We obtained samples from 63 SBA patients (tumour stages: I–II: 30% III: 35% IV: 32% locally advanced: 3%). HER2 overexpression (3+) was observed in 2 out of 62 patients, overexpression of p53 in 26 out of 62, abnormal expression of β-catenin in 12 out of 61, KRAS mutation in 21 out of 49, BRAF V600E mutation in 1 out of 40 patients, MMR deficiency (dMMR) in 14 out of 61 and was consistent with Lynch syndrome in 9 out of 14 patients. All of the dMMR tumours were in the duodenum or jejunum and only one was stage IV. Median overall survival (OS) was 36.6 months (95% CI, 26.9–72.2). For all patients, in univariate analysis, stages I–II (P<0.001), WHO PS 0–1 (P=0.01) and dMMR phenotype (P=0.02) were significantly associated with longer OS. In multivariate analysis, disease stage (P=0.01) and WHO PS 0–1 (P=0.001) independently predicted longer OS. For stage IV patients, median OS was 20.5 months (95% CI: 14.6; 36.6 months). In multivariate analysis, WHO PS 0–1 (P=0.0001) and mutated KRAS status (P=0.02) independently predicted longer OS. Conclusion: This large study suggests that molecular alterations in SBA are closer to those in colorectal cancer (CRC) than those in gastric cancer, with low levels of HER 2 overexpression and high frequencies of KRAS mutations. The seemingly higher frequency of dMMR than in CRC may be explained by the higher frequency of Lynch syndrome in SBA patients. A dMMR phenotype was significantly associated with a non-metastatic tumour (P=0.02). A trend for a good prognosis and a duodenum or jejunum primary site was associated with dMMR. PMID:24196786

  12. Single-molecule views of MutS on mismatched DNA

    PubMed Central

    Lee, Jong-Bong; Cho, Won-Ki; Park, Jonghyun; Jeon, Yongmoon; Kim, Daehyung; Lee, Seung Hwan; Fishel, Richard

    2014-01-01

    Base-pair mismatches that occur during DNA replication or recombination can reduce genetic stability or conversely increase genetic diversity. The genetics and biophysical mechanism of mismatch repair (MMR) has been extensively studied since its discovery nearly 50 years ago. MMR is a strand-specific excision-resynthesis reaction that is initiated by MutS homolog (MSH) binding to the mismatched nucleotides. The MSH mismatch-binding signal is then transmitted to the immediate downstream MutL homolog (MLH/PMS) MMR components and ultimately to a distant strand scission site where excision begins. The mechanism of signal transmission has been controversial for decades. We have utilized single molecule Forster Resonance Energy Transfer (smFRET), Fluorescence Tracking (smFT) and Polarization Total Internal Reflection Fluorescence (smP-TIRF) to examine the interactions and dynamic behaviors of single Thermus aquaticus MutS (TaqMutS) particles on mismatched DNA. We determined that Taq-MutS forms an incipient clamp to search for a mismatch in ∼1 s intervals by 1-dimensional (1D) thermal fluctuation-driven rotational diffusion while in continuous contact with the helical duplex DNA. When MutS encounters a mismatch it lingers for ∼3 s to exchange bound ADP for ATP (ADP → ATP exchange). ATP binding by TaqMutS induces an extremely stable clamp conformation (∼10 min) that slides off the mismatch and moves along the adjacent duplex DNA driven simply by 1D thermal diffusion. The ATP-bound sliding clamps rotate freely while in discontinuous contact with the DNA. The visualization of a train of MSH proteins suggests that dissociation of ATP-bound sliding clamps from the mismatch permits multiple mismatch-dependent loading events. These direct observations have provided critical clues into understanding the molecular mechanism of MSH proteins during MMR. PMID:24629484

  13. Proteins.

    ERIC Educational Resources Information Center

    Doolittle, Russell F.

    1985-01-01

    Examines proteins which give rise to structure and, by virtue of selective binding to other molecules, make genes. Binding sites, amino acids, protein evolution, and molecular paleontology are discussed. Work with encoding segments of deoxyribonucleic acid (exons) and noncoding stretches (introns) provides new information for hypotheses. (DH)

  14. DNA polymerase delta, RFC and PCNA are required for repair synthesis of large looped heteroduplexes in Saccharomyces cerevisiae.

    PubMed

    Corrette-Bennett, Stephanie E; Borgeson, Claudia; Sommer, Debbie; Burgers, Peter M J; Lahue, Robert S

    2004-01-01

    Small looped mispairs are corrected by DNA mismatch repair (MMR). In addition, a distinct process called large loop repair (LLR) corrects loops up to several hundred nucleotides in extracts of bacteria, yeast or human cells. Although LLR activity can be readily demonstrated, there has been little progress in identifying its protein components. This study identified some of the yeast proteins responsible for DNA repair synthesis during LLR. Polyclonal antisera to either Pol31 or Pol32 subunits of polymerase delta efficiently inhibited LLR in extracts by blocking repair just prior to gap filling. Gap filling was inhibited regardless of whether the loop was retained or removed. These experiments suggest polymerase delta is uniquely required in yeast extracts for LLR-associated synthesis. Similar results were obtained with antisera to the clamp loader proteins Rfc3 and Rfc4, and to PCNA, i.e. LLR was inhibited just prior to gap filling for both loop removal and loop retention. Thus PCNA and RFC seem to act in LLR only during repair synthesis, in contrast to their roles at both pre- and post-excision steps of MMR. These biochemical experiments support the idea that yeast polymerase delta, RFC and PCNA are required for large loop DNA repair synthesis.

  15. Distribution of crossing over on mouse synaptonemal complexes using immunofluorescent localization of MLH1 protein.

    PubMed Central

    Anderson, L K; Reeves, A; Webb, L M; Ashley, T

    1999-01-01

    We have used immunofluorescent localization to examine the distribution of MLH1 (MutL homolog) foci on synaptonemal complexes (SCs) from juvenile male mice. MLH1 is a mismatch repair protein necessary for meiotic recombination in mice, and MLH1 foci have been proposed to mark crossover sites. We present evidence that the number and distribution of MLH1 foci on SCs closely correspond to the number and distribution of chiasmata on diplotene-metaphase I chromosomes. MLH1 foci were typically excluded from SC in centromeric heterochromatin. For SCs with one MLH1 focus, most foci were located near the middle of long SCs, but near the distal end of short SCs. For SCs with two MLH1 foci, the distribution of foci was bimodal regardless of SC length, with most foci located near the proximal and distal ends. The distribution of MLH1 foci indicated interference between foci. We observed a consistent relative distance (percent of SC length in euchromatin) between two foci on SCs of different lengths, suggesting that positive interference between MLH1 foci is a function of relative SC length. The extended length of pachytene SCs, as compared to more condensed diplotene-metaphase I bivalents, makes mapping crossover events and interference distances using MLH1 foci more accurate than using chiasmata. PMID:10101178

  16. Advances in the understanding of Fanconi Anemia Complementation Group D2 Protein (FANCD2) in human cancer.

    PubMed

    Shen, Yihang; Zhang, Jun; Yu, Herbert; Fei, Peiwen

    Fanconi anemia (FA) is a rare human genetic disease, resulting from dysfunction in any of 17 known complementation proteins: FANC-A, B, C, D1, D2, E, F, G, I, J, L, M, N, O, P, Q & S, and other unknowns. Besides the severe bone marrow failure, an extremely high incidence of cancer as well as many other clinic symptoms associated with FA patients, FA cells are known of insufficiency in homologous recombination, DNA mismatch repair, nucleotide excision repair, translesion DNA synthesis, and other molecular defects, leading to genome instability. Those similar molecular and cellular/tissue features show that all FA proteins function in one common signaling pathway, namely, the FA pathway. The monoubiquitination of FANCD2 is the central step of the FA pathway activation upon DNA damage or during DNA replication. The molecular functions of FANCD2 emerge as a very attractive filed of investigation in cancer research. Herein, we review the recent progresses in FANCD2 functions at these rapidly progressed aspects.

  17. Protein

    MedlinePlus

    ... Search for: Harvard T.H. Chan School of Public Health Email People Departments Calendar Careers Give my.harvard ... Nutrition Source Harvard T.H. Chan School of Public Health > The Nutrition Source > What Should I Eat? > Protein ...

  18. Protein

    MedlinePlus

    ... Go lean with protein. • Choose lean meats and poultry. Lean beef cuts include round steaks (top loin, ... main dishes. • Use nuts to replace meat or poultry, not in addition to meat or poultry (i. ...

  19. Human MSH2 protein

    DOEpatents

    de la Chapelle, Albert; Vogelstein, Bert; Kinzler, Kenneth W.

    1997-01-01

    The human MSH2 gene, responsible for hereditary non-polyposis colorectal cancer, was identified by virtue of its homology to the MutS class of genes, which are involved in DNA mismatch repair. The sequence of cDNA clones of the human gene are provided, and the sequence of the gene can be used to demonstrate the existence of germ line mutations in hereditary non-polyposis colorectal cancer (HNPCC) kindreds, as well as in replication error.sup.+ (RER.sup.+) tumor cells.

  20. Human MSH2 protein

    DOEpatents

    Chapelle, A. de la; Vogelstein, B.; Kinzler, K.W.

    1997-01-07

    The human MSH2 gene, responsible for hereditary non-polyposis colorectal cancer, was identified by virtue of its homology to the MutS class of genes, which are involved in DNA mismatch repair. The sequence of cDNA clones of the human gene are provided, and the sequence of the gene can be used to demonstrate the existence of germ line mutations in hereditary non-polyposis colorectal cancer (HNPCC) kindreds, as well as in replication error{sup +} (RER{sup +}) tumor cells. 19 figs.

  1. Advanced Colorectal Adenomas in Patients Under 45 Years of Age Are Mostly Sporadic

    PubMed Central

    Nalbantoglu, ILKe; Watson, Rao; Goodwin, Jonathan; Safar, Elyas; Chokshi, Reena V.; Azar, Riad R.; Davidson, Nicholas O.

    2014-01-01

    Background The presence of advanced adenomas in younger individuals is a criterion for Lynch syndrome (LS). However, the utility of screening advanced adenomas for loss of mismatch repair (MMR) protein expression to identify suspected LS remains unclear. Aims Determine the prevalence of MMR defects to understand whether these patients harbor a defined genetic risk for CRC. Methods The study cohort included adult patients ≤45 years of age with advanced adenomas (villous histology, ≥1 cm in diameter, ≥3 polyps of any size) endoscopically removed between 2001 and 2011. Clinical records were reviewed along with detailed pathological review and immunohistochemical MMR analysis. Results A total of 76 (40.1 % male, age 40.6 ± 5.4 years) patients met inclusion and exclusion criteria. Indications for colonoscopy were gastrointestinal (GI) bleeding 39 (51.3 %), CRC in a first-degree relative 17 (22.4 %) and somatic GI symptoms 20 (26.3 %). Index colonoscopy revealed a median of 1 adenoma (range 1–4), mean diameter of 12.9 ±7.1 mm, 40 (52.6 %) with villous histology. The mean follow-up duration was 3.3 ± 2 years. Recurrent adenomas developed in 24 (31.6 %), of which 8 (10.5 %) were advanced adenomas; none of these patients developed CRC. One of 66 (1.5 %) adenomas available for immunohistochemical (IHC) testing revealed loss of MLH1 and PMS2. Conclusions IHC screening of advanced adenomas from patients younger than 45 years of age identified potential LS in one of 64 patients. The low yield of IHC screening in this population suggests that universal IHC screening of advanced adenomas from patients younger than 45 years of age for MMR defects is not an efficient strategy for identifying LS subjects. PMID:24925148

  2. Lack of Association between Membrane-Type 1 Matrix Metalloproteinase Expression and Clinically Relevant Molecular or Morphologic Tumor Characteristics at the Leading Edge of Invasive Colorectal Carcinoma

    PubMed Central

    Arndt, Annette; Kraft, Klaus; Wardelmann, Eva; Steinestel, Konrad

    2015-01-01

    Colorectal cancer (CRC) is one of the leading causes of death from cancer in the western world, but tumor biology and clinical course show great interindividual variation. Molecular and morphologic tumor characteristics, such as KRAS/BRAF mutation status, mismatch repair (MMR) protein expression, tumor growth pattern, and tumor cell budding, have been shown to be of key therapeutic and/or prognostic relevance in CRC. Membrane-type 1 matrix metalloproteinase (MT1-MMP) is a membrane-anchored zinc-binding endopeptidase that is expressed at the leading edge of various invasive carcinomas and promotes tumor cell invasion through degradation of the extracellular matrix. The aim of this study was to investigate possible associations between MT1-MMP expression and molecular tumor characteristics as well as morphologic features of tumor aggressiveness in a consecutive series of 79 CRC tissue samples. However, although MT1-MMP was expressed in 41/79 samples (52%), there was no significant association between MT1-MMP expression and KRAS/BRAF mutation status, MMR protein expression, presence of lymphovascular invasion, tumor growth pattern, tumor-infiltrating lymphocytes, or tumor cell budding in our sample cohort (P > 0.05). Thus, we conclude that although MT1-MMP may play a role in CRC invasion, it is not of key relevance to the current models of CRC invasion and aggressiveness. PMID:26106602

  3. Association Between IHC and MSI Testing to Identify Mismatch Repair–Deficient Patients with Ovarian Cancer

    PubMed Central

    Lee, Ji-Hyun; Cragun, Deborah; Thompson, Zachary; Coppola, Domenico; Nicosia, Santo V.; Akbari, Mohammad; Zhang, Shiyu; McLaughlin, John; Narod, Steven; Schildkraut, Joellen; Sellers, Thomas A.

    2014-01-01

    Objective: In epithelial ovarian cancer, concordance between results of microsatellite instability (MSI) and immunohistochemical (IHC) testing has not been demonstrated. This study evaluated the association of MSI-high (MSI-H) status with loss of expression (LoE) of mismatch repair (MMR) proteins on IHC and assessed for potential factors affecting the strength of the association. Methods: Tumor specimens from three population-based studies of epithelial ovarian cancer were stained for MMR proteins through manual or automated methods, and results were interpreted by one of two pathologists. Tumor and germline DNA was extracted and MSI testing performed. Multivariable logistic regression models were fitted to predict loss of IHC expression based on MSI status after adjusting for staining method and reading pathologist. Results: Of 834 cases, 564 (67.6%) were concordant; 41 were classified as MSI-H with LoE and 523 as microsatellite stable (MSS) with no LoE. Of the 270 discordant cases, 83 were MSI-H with no LoE and 187 were MSS with LoE. Both IHC staining method and reading pathologist were strongly associated with discordant results. Conclusions: Lack of concordance in the current study may be related to inconsistencies in IHC testing methods and interpretation. Results support the need for validation studies before routine screening of ovarian tumors is implemented in clinical practice for the purpose of identifying Lynch syndrome. PMID:24592941

  4. Fanconi anemia pathway regulates convergent transcription-induced cell death at trinucleotide repeats in human cells

    PubMed Central

    Chatterjee, Nimrat; Lin, Yunfu; Wilson, John H.

    2016-01-01

    Almost 20 incurable neurodegenerative disorders are caused by trinucleotide repeat (TNR) expansion beyond a certain threshold, with disease time of onset and severity positively correlating with repeat length. Typically, long TNRs display a bias toward further expansion and repeats continue to expand not only during germline transmissions from parents to offspring, but also remain highly unstable in somatic tissues of patients. Hence, understanding TNR instability mechanisms sheds light on underlying disease pathology. Recently, we showed that activated ATR is the major signal for convergent-transcription-induced cell death at CAG repeats and is regulated by the mismatch repair (MMR) pathway. Additionally, components of other DNA repair pathways such as transcription-coupled nucleotide excision repair (TC-NER) and R-loop resolution by RNaseH reduce cell death. Because activated ATR signals the Fanconi anemia (FA) pathway of interstrand crosslink DNA repair, we asked whether the FA pathway also modulates convergent-transcription-induced cell death at expanded CAG repeats. We show here that siRNA knockdown of FA components—FANCI, FANCJ, FANCM, FANCA, and FANCD2—decreases cell death, suggesting that FA proteins, like MMR proteins, are activators of cell death during convergent transcription. PMID:27595121

  5. Meiotic recombination involving heterozygous large insertions in Saccharomyces cerevisiae: formation and repair of large, unpaired DNA loops.

    PubMed Central

    Kearney, H M; Kirkpatrick, D T; Gerton, J L; Petes, T D

    2001-01-01

    Meiotic recombination in Saccharomyces cerevisiae involves the formation of heteroduplexes, duplexes containing DNA strands derived from two different homologues. If the two strands of DNA differ by an insertion or deletion, the heteroduplex will contain an unpaired DNA loop. We found that unpaired loops as large as 5.6 kb can be accommodated within a heteroduplex. Repair of these loops involved the nucleotide excision repair (NER) enzymes Rad1p and Rad10p and the mismatch repair (MMR) proteins Msh2p and Msh3p, but not several other NER (Rad2p and Rad14p) and MMR (Msh4p, Msh6p, Mlh1p, Pms1p, Mlh2p, Mlh3p) proteins. Heteroduplexes were also formed with DNA strands derived from alleles containing two different large insertions, creating a large "bubble"; repair of this substrate was dependent on Rad1p. Although meiotic recombination events in yeast are initiated by double-strand DNA breaks (DSBs), we showed that DSBs occurring within heterozygous insertions do not stimulate interhomologue recombination. PMID:11514439

  6. Role of Red Meat and Resistant Starch in Promutagenic Adduct Formation, MGMT Repair, Thymic Lymphoma and Intestinal Tumourigenesis in Msh2 -Deficient Mice.

    PubMed

    Winter, Jean M; Hu, Ying; Young, Graeme P; Kohonen-Corish, Maija R J; Le Leu, Richard K

    2014-01-01

    Red meat may increase promutagenic lesions in the colon. Resistant starch (RS) can reduce these lesions and chemically induced colon tumours in rodents. Msh2 is a mismatch repair (MMR) protein, recognising unrepaired promutagenic adducts for removal. We determined if red meat and/or RS modulated DNA adducts or oncogenesis in Msh2-deficient mice. A total of 100 Msh2-/- and 60 wild-type mice consumed 1 of 4 diets for 6 months: control, RS, red meat and red meat+RS. Survival time, aberrant crypt foci (ACF), colon and small intestinal tumours, lymphoma, colonic O6-methyl-2-deoxyguanosine (O6MeG) adducts, methylguanine methyltransferase (MGMT) and cell proliferation were examined. In Msh2-/- mice, red meat enhanced survival compared to control (p<0.01) and lowered total tumour burden compared to RS (p<0.167). Msh2-/- mice had more ACF than wild-type mice (p<0.014), but no colon tumours developed. Msh2-/- increased cell proliferation (p<0.001), lowered DNA O6MeG adducts (p<0.143) and enhanced MGMT protein levels (p<0.001) compared to wild-type mice, with RS supplementation also protecting against DNA adducts (p<0.01). No link between red meat-induced promutagenic adducts and risk for colorectal cancer was observed after 6 months' feeding. Colonic epithelial changes after red meat and RS consumption with MMR deficiency will differ from normal epithelial cells.

  7. Effect of bis(beta-chloroethyl)sulfide (BCES) on base mismatch repair of DNA in monkey kidney cells.

    PubMed

    Fan, L J; Bernstein, I A

    1991-11-01

    Sulfur mustard, bis(beta-chloroethyl)sulfide (BCES), a bifunctional alkylating agent, is a vesicant whose mode of action involves interference with the integrity of cellular DNA. Alkylation of DNA is responsible for some of the biological effects of BCES in tissue. Another possible mechanism by which BCES could exert its toxic effect is interference with high fidelity repair of damaged DNA. This study evaluated the possible effects of BCES on the repair of specific errors, i.e., mismatched bases, in the DNA. Heteroduplex (ht) DNA, formed between two temperature-sensitive mutants of SV40 virus, tsA239 and tsA255, each having a different point mutation in the gene for large T antigen, was used to study the effect of BCES on mismatched base repair in African green monkey kidney (AGMK) cells. AGMK cells were exposed to dilute solutions of BCES in methylene chloride (MC) prior to cationic lipofection with ht DNA. In order for the cells to produce wild type (wt) SV40 DNA at a nonpermissive temperature (41 degrees C), repair of at least one of the two mismatches in the DNA had to occur. It was observed that (a) as the concentration of BCES was increased, a proportionally longer delay in the appearance of wt DNA at 41 degrees C was observed in treated cells transfected with ht DNA as compared with cultures exposed to MC alone and then transfected with ht DNA, (b) there was no such effect in exposed AGMK cells transfected with wt DNA, (c) wt and ht DNA were transfected at similar rates in unexposed cells, and (d) BCES did not affect the rate of transfection of wt cells. These observations are consistent with the hypothesis that BCES affects mismatched base repair.

  8. Unnatural substrates reveal the importance of 8-oxoguanine for in vivo mismatch repair by MutY

    PubMed Central

    Livingston, Alison L.; O’Shea, Valerie L.; Kim, Taewoo; Kool, Eric T.; David, Sheila S.

    2009-01-01

    Escherchia coli MutY plays an important role in preventing mutations associated with the oxidative lesion 7,8-dihydro-8-oxo-2′-deoxyguanosine (OG) in DNA by excising adenines from OG:A mismatches as the first step of base excision repair. To determine the importance of specific steps in the base pair recognition and base removal process of MutY, we have evaluated the effects of modifications of the OG:A substrate on the kinetics of base removal, mismatch affinity and repair to G:C in an Escherchia coli-based assay. Surprisingly, adenine modification was tolerated in the cellular assay, while modification of OG results in minimal cellular repair. High affinity for the mismatch and efficient base removal require the presence of OG. Taken together, these results suggest that the presence of OG is a critical feature for MutY to locate OG:A mismatches and select the appropriate adenines for excision to initiate repair in vivo prior to replication. PMID:18026095

  9. Assessment of the InSiGHT Interpretation Criteria for the Clinical Classification of 24 MLH1 and MSH2 Gene Variants.

    PubMed

    Tricarico, Rossella; Kasela, Mariann; Mareni, Cristina; Thompson, Bryony A; Drouet, Aurélie; Staderini, Lucia; Gorelli, Greta; Crucianelli, Francesca; Ingrosso, Valentina; Kantelinen, Jukka; Papi, Laura; De Angioletti, Maria; Berardi, Margherita; Gaildrat, Pascaline; Soukarieh, Omar; Turchetti, Daniela; Martins, Alexandra; Spurdle, Amanda B; Nyström, Minna; Genuardi, Maurizio

    2017-01-01

    Pathogenicity assessment of DNA variants in disease genes to explain their clinical consequences is an integral component of diagnostic molecular testing. The International Society for Gastrointestinal Hereditary Tumors (InSiGHT) has developed specific criteria for the interpretation of mismatch repair (MMR) gene variants. Here, we performed a systematic investigation of 24 MLH1 and MSH2 variants. The assessments were done by analyzing population frequency, segregation, tumor molecular characteristics, RNA effects, protein expression levels, and in vitro MMR activity. Classifications were confirmed for 15 variants and changed for three, and for the first time determined for six novel variants. Overall, based on our results, we propose the introduction of some refinements to the InSiGHT classification rules. The proposed changes have the advantage of homogenizing the InSIGHT interpretation criteria with those set out by the Evidence-based Network for the Interpretation of Germline Mutant Alleles (ENIGMA) consortium for the BRCA1/BRCA2 genes. We also observed that the addition of only few clinical data was sufficient to obtain a more stable classification for variants considered as "likely pathogenic" or "likely nonpathogenic." This shows the importance of obtaining as many as possible points of evidence for variant interpretation, especially from the clinical setting.

  10. The Medicinal Chemistry of Imidazotetrazine Prodrugs

    PubMed Central

    Moody, Catherine L.; Wheelhouse, Richard T

    2014-01-01

    Temozolomide (TMZ) is the standard first line treatment for malignant glioma, reaching “blockbuster” status in 2010, yet it remains the only drug in its class. The main constraints on the clinical effectiveness of TMZ therapy are its requirement for active DNA mismatch repair (MMR) proteins for activity, and inherent resistance through O6-methyl guanine-DNA methyl transferase (MGMT) activity. Moreover, acquired resistance, due to MMR mutation, results in aggressive TMZ-resistant tumour regrowth following good initial responses. Much of the attraction in TMZ as a drug lies in its PK/PD properties: it is acid stable and has 100% oral bioavailability; it also has excellent distribution properties, crosses the blood-brain barrier, and there is direct evidence of tumour localisation. This review seeks to unravel some of the mysteries of the imidazotetrazine class of compounds to which TMZ belongs. In addition to an overview of different synthetic strategies, we explore the somewhat unusual chemical reactivity of the imidazotetrazines, probing their mechanisms of reaction, examining which attributes are required for an active drug molecule and reviewing the use of this combined knowledge towards the development of new and improved anti-cancer agents. PMID:25014631

  11. Non-specificity and synergy at the binding site of the carboplatin-induced DNA adduct via molecular dynamics simulations of the MutSα-DNA recognition complex

    PubMed Central

    Negureanu, Lacramioara; Salsbury, Freddie R

    2013-01-01

    MutSα is the most abundant mismatch binding factor of human DNA mismatch repair (MMR) proteins. MMR maintain genetic stability by recognizing and repairing DNA defects. Failure to accomplish their function may lead to cancer. In addition, MutSα recognizes at least some types of DNA damage making it a target for anticancer agents. Here, complementing scarce experimental data, we report unique hydrogen bonding motifs associated with the recognition of the carboplatin induced DNA damage by MutSα. These data predict that carboplatin and cisplatin induced damaging DNA adducts are recognized by MutSα in a similar manner. Our simulations also indicate that loss of base pairing at the damage site results in (1) non-specific binding and (2) changes in the atomic flexibility at the lesion site and beyond. To further quantify alterations at MutSα-DNA interface in response to damage recognition non-bonding interactions and salt bridges were investigated. These data indicate (1) possible different packing and (2) disruption of the salt bridges at the MutSα-DNA interface in the damaged complex. These findings (1) underscore the general observation of disruptions at the MutSα-DNA interface and (2) highlight the nature of the anticancer effect of the carboplatin agent. The analysis was carried out from atomistic simulations. PMID:23799640

  12. A highly precise and portable genome engineering method allows comparison of mutational effects across bacterial species

    PubMed Central

    Nyerges, Ákos; Csörgő, Bálint; Nagy, István; Bálint, Balázs; Bihari, Péter; Lázár, Viktória; Apjok, Gábor; Umenhoffer, Kinga; Bogos, Balázs; Pósfai, György; Pál, Csaba

    2016-01-01

    Currently available tools for multiplex bacterial genome engineering are optimized for a few laboratory model strains, demand extensive prior modification of the host strain, and lead to the accumulation of numerous off-target modifications. Building on prior development of multiplex automated genome engineering (MAGE), our work addresses these problems in a single framework. Using a dominant-negative mutant protein of the methyl-directed mismatch repair (MMR) system, we achieved a transient suppression of DNA repair in Escherichia coli, which is necessary for efficient oligonucleotide integration. By integrating all necessary components into a broad-host vector, we developed a new workflow we term pORTMAGE. It allows efficient modification of multiple loci, without any observable off-target mutagenesis and prior modification of the host genome. Because of the conserved nature of the bacterial MMR system, pORTMAGE simultaneously allows genome editing and mutant library generation in other biotechnologically and clinically relevant bacterial species. Finally, we applied pORTMAGE to study a set of antibiotic resistance-conferring mutations in Salmonella enterica and E. coli. Despite over 100 million y of divergence between the two species, mutational effects remained generally conserved. In sum, a single transformation of a pORTMAGE plasmid allows bacterial species of interest to become an efficient host for genome engineering. These advances pave the way toward biotechnological and therapeutic applications. Finally, pORTMAGE allows systematic comparison of mutational effects and epistasis across a wide range of bacterial species. PMID:26884157

  13. A highly precise and portable genome engineering method allows comparison of mutational effects across bacterial species.

    PubMed

    Nyerges, Ákos; Csörgő, Bálint; Nagy, István; Bálint, Balázs; Bihari, Péter; Lázár, Viktória; Apjok, Gábor; Umenhoffer, Kinga; Bogos, Balázs; Pósfai, György; Pál, Csaba

    2016-03-01

    Currently available tools for multiplex bacterial genome engineering are optimized for a few laboratory model strains, demand extensive prior modification of the host strain, and lead to the accumulation of numerous off-target modifications. Building on prior development of multiplex automated genome engineering (MAGE), our work addresses these problems in a single framework. Using a dominant-negative mutant protein of the methyl-directed mismatch repair (MMR) system, we achieved a transient suppression of DNA repair in Escherichia coli, which is necessary for efficient oligonucleotide integration. By integrating all necessary components into a broad-host vector, we developed a new workflow we term pORTMAGE. It allows efficient modification of multiple loci, without any observable off-target mutagenesis and prior modification of the host genome. Because of the conserved nature of the bacterial MMR system, pORTMAGE simultaneously allows genome editing and mutant library generation in other biotechnologically and clinically relevant bacterial species. Finally, we applied pORTMAGE to study a set of antibiotic resistance-conferring mutations in Salmonella enterica and E. coli. Despite over 100 million y of divergence between the two species, mutational effects remained generally conserved. In sum, a single transformation of a pORTMAGE plasmid allows bacterial species of interest to become an efficient host for genome engineering. These advances pave the way toward biotechnological and therapeutic applications. Finally, pORTMAGE allows systematic comparison of mutational effects and epistasis across a wide range of bacterial species.

  14. Mutagenesis in PMS2- and MSH2-deficient mice indicates differential protection from transversions and frameshifts.

    PubMed

    Andrew, S E; Xu, X S; Baross-Francis, A; Narayanan, L; Milhausen, K; Liskay, R M; Jirik, F R; Glazer, P M

    2000-07-01

    DNA mismatch repair (MMR) deficiency leads to an increased mutation frequency and a predisposition to neoplasia. 'Knockout' mice deficient in the MMR proteins Msh2 and Pms2 crossed with mutation detection reporter (supF, lacI and cII) transgenic mice have been used to facilitate a comparison of the changes in mutation frequency and spectra. We find that the mutation frequency was consistently higher in Msh2-deficient mice than Pms2-deficient mice. The lacI target gene, which is highly sensitive to point mutations, demonstrated that both Msh2- and Pms2-deficient mice accumulate transition mutations as the predominant mutation. However, when compared with Msh2(-/-) mice, lacI and cII mutants from Pms2-deficient mice revealed an increased proportion of +/-1 bp frameshift mutations and a corresponding decrease in transversion mutations. The supF target gene, which is sensitive to frameshift mutations, and the cII target gene revealed a strong tendency for -1 bp deletions over +1 bp insertions in Msh2(-/-) compared with Pms2(-/-) mice. These data indicate that Msh2 and Pms2 deficiency have subtle but differing effects on mutation avoidance which may contribute to the differences in tumor spectra observed in the two 'knockout' mouse models. These variances in mutation accumulation may also play a role, in part, in the differences seen in prevalence of MSH2 and PMS2 germline mutations in hereditary non-polyposis colorectal cancer patients.

  15. Mismatch-induced lethality due to a defect in Escherichia coli RecQ helicase in exonuclease-deficient background: Dependence on MutS and UvrD functions.

    PubMed

    Yamana, Yoshimasa; Sonezaki, Shuji; Ogawa, Hiroaki I; Kusano, Kohji

    2010-05-01

    Escherichia coli DNA-unwinding protein RecQ has roles in the regulation of general recombination and the processing of stalled replication forks. In this study, we found that knockout of the recQ gene in combination with xonA xseA recJ mutations, which inhibit methyl-directed mismatch repair (MMR), caused about 100-fold increase in sensitivity to a purine analog 2-aminopurine (2AP). Intriguingly, inactivation of a MMR initiator due to the either mutation mutS or uvrD completely suppressed the 2AP sensitivity caused by recQ xonA xseA recJ mutations, suggesting that RecQ helicase might act on the DNA structures that are generated by the processing of DNA by the MutSLH complex and UvrD helicase. Moreover, the recQ gene knockout in combination with xonA xseA recJ mutations enhanced 2AP-induced filament formation, and increased by twofold the rate of spontaneous forward mutations in the thyA locus but did not increase the rate of rifampicin-resistant mutations. We discuss about the possible interplay between E. coli RecQ helicase and mismatch recognition factors.

  16. A novel protein, Rsf1/Pxd1, is critical for the single-strand annealing pathway of double-strand break repair in Schizosaccharomyces pombe.

    PubMed

    Wang, Hanqian; Zhang, Zhanlu; Zhang, Lan; Zhang, Qiuxue; Zhang, Liang; Zhao, Yangmin; Wang, Weibu; Fan, Yunliu; Wang, Lei

    2015-06-01

    The process of single-strand annealing (SSA) repairs DNA double-strand breaks that are flanked by direct repeat sequences through the coordinated actions of a series of proteins implicated in recombination, mismatch repair and nucleotide excision repair (NER). Many of the molecular and mechanistic insights gained in SSA repair have principally come from studies in the budding yeast Saccharomyces cerevisiae. However, there is little molecular understanding of the SSA pathway in the fission yeast Schizosaccharomyces pombe. To further our understanding of this important process, we established a new chromosome-based SSA assay in fission yeast. Our genetic analyses showed that, although many homologous components participate in SSA repair in these species indicating that some evolutionary conservation, Saw1 and Slx4 are not principal agents in the SSA repair pathway in fission yeast. This is in marked contrast to the function of Saw1 and Slx4 in budding yeast. Additionally, a novel genus-specific protein, Rsf1/Pxd1, physically interacts with Rad16, Swi10 and Saw1 in vitro and in vivo. We find that Rsf1/Pxd1 is not required for NER and demonstrate that, in fission yeast, Rsf1/Pxd1, but not Saw1, plays a critical role in SSA recombination.

  17. The Ssr protein (T1E_1405) from Pseudomonas putida DOT-T1E enables oligonucleotide-based recombineering in platform strain P. putida EM42.

    PubMed

    Aparicio, Tomás; Jensen, Sheila I; Nielsen, Alex T; de Lorenzo, Victor; Martínez-García, Esteban

    2016-10-01

    Some strains of the soil bacterium Pseudomonas putida have become in recent years platforms of choice for hosting biotransformations of industrial interest. Despite availability of many genetic tools for this microorganism, genomic editing of the cell factory P. putida EM42 (a derivative of reference strain KT2440) is still a time-consuming endeavor. In this work we have investigated the in vivo activity of the Ssr protein encoded by the open reading frame T1E_1405 from Pseudomonas putida DOT-T1E, a plausible functional homologue of the β protein of the Red recombination system of λ phage of Escherichia coli. A test based on the phenotypes of pyrF mutants of P. putida (the yeast's URA3 ortholog) was developed for quantifying the ability of Ssr to promote invasion of the genomic DNA replication fork by synthetic oligonucleotides. The efficiency of the process was measured by monitoring the inheritance of the changes entered into pyrF by oligonucleotides bearing mutated sequences. Ssr fostered short and long genomic deletions/insertions at considerable frequencies as well as single-base swaps not affected by mismatch repair. These results not only demonstrate the feasibility of recombineering in P. putida, but they also enable a suite of multiplexed genomic manipulations in this biotechnologically important bacterium.

  18. Site- and strand-specific nicking of DNA by fusion proteins derived from MutH and I-SceI or TALE repeats

    PubMed Central

    Gabsalilow, Lilia; Schierling, Benno; Friedhoff, Peter; Pingoud, Alfred; Wende, Wolfgang

    2013-01-01

    Targeted genome engineering requires nucleases that introduce a highly specific double-strand break in the genome that is either processed by homology-directed repair in the presence of a homologous repair template or by non-homologous end-joining (NHEJ) that usually results in insertions or deletions. The error-prone NHEJ can be efficiently suppressed by ‘nickases’ that produce a single-strand break rather than a double-strand break. Highly specific nickases have been produced by engineering of homing endonucleases and more recently by modifying zinc finger nucleases (ZFNs) composed of a zinc finger array and the catalytic domain of the restriction endonuclease FokI. These ZF-nickases work as heterodimers in which one subunit has a catalytically inactive FokI domain. We present two different approaches to engineer highly specific nickases; both rely on the sequence-specific nicking activity of the DNA mismatch repair endonuclease MutH which we fused to a DNA-binding module, either a catalytically inactive variant of the homing endonuclease I-SceI or the DNA-binding domain of the TALE protein AvrBs4. The fusion proteins nick strand specifically a bipartite recognition sequence consisting of the MutH and the I-SceI or TALE recognition sequences, respectively, with a more than 1000-fold preference over a stand-alone MutH site. TALE–MutH is a programmable nickase. PMID:23408850

  19. Gene expression and role in cadmium tolerance of two PLAC8-containing proteins identified in the ericoid mycorrhizal fungus Oidiodendron maius.

    PubMed

    Di Vietro, Luigi; Daghino, Stefania; Abbà, Simona; Perotto, Silvia

    2014-08-01

    Fungi living in heavy metal polluted soils have evolved different cellular and molecular systems to adapt and survive in these harsh environments. Oidiodendron maius Zn is an ericoid mycorrhizal fungus previously shown to be highly tolerant to zinc thanks to antioxidative enzymes and membrane transporters. A novel gene, OmFCR1, was recently identified from this fungus because it conferred strong cadmium tolerance when expressed in yeast. OmFCR1 codes for a protein belonging to the PLAC8 family and physically interacts in yeast with the mismatch repair system, involved in DNA damage repair. The O. maius Zn genome also contains another gene - named OmFCR2 - that codes for a protein sharing with OmFCR1, the PLAC8 domain and other sequence similarities. In this work, we analyzed gene expression of OmFCR1 and OmFCR2 in the fungus O. maius Zn when exposed to cadmium, the ability of OmFCR2 to confer cadmium tolerance when expressed in yeast, and the growth of OmFCR1-null mutants of O. maius Zn upon cadmium exposure. Although OmFCR2 was also able to confer some cadmium tolerance to yeast, the different expression pattern of these two genes would suggest different roles in O. maius Zn.

  20. Microsatellite instability and B-type Raf proto-oncogene mutation in colorectal cancer: Clinicopathological characteristics and effects on survival

    PubMed Central

    Batur, Sebnem; Bakkaloglu, Dogu Vuralli; Kepil, Nuray; Erdamar, Sibel

    2016-01-01

    Prognostic significance of microsatellite instability (MSI) status and B-type Raf proto-oncogene (BRAF) mutation in colorectal cancer is controversial. The aim of this study was to examine the clinical and pathological characteristics associated with microsatellite stability and the effect of MSI and BRAF mutation on the survival of patients with colorectal cancer. The study included 145 colorectal cancer cases. All the patients were examined for DNA mismatch repair (MMR) proteins with an immunohistochemical method. Molecular assessment of MSI was available in a subset of 41 patients. In addition, BRAF mutation analysis was performed in 30 cases. Immunohistochemically, MMR deficiency was present in 28 (19.3%) patients. Female gender (p = 0.001), lesion size ≥5 cm (p = 0.013), Crohn-like response (p = 0.035), and right-sided localization (p < 0.001) were significantly more frequent among MMR-deficient patients. The overall survival was 44.1 ± 5.1 months (95% confidence interval [CI], 33.7-54.4). Multivariate analyses identified only high tumor grade as an independent predictor of poor overall survival: odd ratio, 6.7 (95% CI 2.1-21.7), p = 0.002. In the subset of patients with available BRAF assessment (n = 30), a negative BRAF status was associated with better survival when compared to a positive BRAF status (36.7 ± 2.1 vs. 34.1 ± 7.2 months, p = 0.048). The sensitivity and specificity of the immunohistochemical method in predicting positive MSI status, with the molecular method as a reference, were 85.7% (95% CI: 56.2%-97.5%) and 88.9% (95% CI: 69.7%-97.1%), respectively. BRAF appears to be a significant predictor of a worse outcome in patients with colorectal cancer. Further studies with a large spectrum of clinical and biological variables are warranted. PMID:27131021

  1. ATPase activity of Plasmodium falciparum MLH is inhibited by DNA-interacting ligands and dsRNAs of MLH along with UvrD curtail malaria parasite growth.

    PubMed

    Tarique, Mohammed; Chauhan, Manish; Tuteja, Renu

    2016-09-14

    Malaria caused by Plasmodium falciparum is the major disease burden all over the world. Recently, the situation has deteriorated because the malarial parasites are becoming progressively more resistant to numerous commonly used antimalarial drugs. Thus, there is a critical requirement to find other means to restrict and eliminate malaria. The mismatch repair (MMR) machinery of parasite is quite unique in several ways, and it can be exploited for finding new drug targets. MutL homolog (MLH) is one of the major components of MMR machinery, and along with UvrD, it helps in unwinding the DNA. We have screened several DNA-interacting ligands for their effect on intrinsic ATPase activity of PfMLH protein. This screening suggested that several ligands such as daunorubicin, etoposide, ethidium bromide, netropsin, and nogalamycin are inhibitors of the ATPase activity of PfMLH, and their apparent IC50 values range from 2.1 to 9.35 μM. In the presence of nogalamycin and netropsin, the effect was significant because in their presence, the V max value dropped from 1.024 μM of hydrolyzed ATP/min to 0.596 and 0.643 μM of hydrolyzed ATP/min, respectively. The effect of double-stranded RNAs of PfMLH and PfUvrD on growth of P. falciparum 3D7 strain was studied. The parasite growth was significantly inhibited suggesting that these components belonging to MMR pathway are crucial for the survival of the parasite.

  2. Somatic molecular changes and histo-pathological features of colorectal cancer in Tunisia

    PubMed Central

    Aissi, Sana; Buisine, Marie Pierre; Zerimech, Farid; Kourda, Nadia; Moussa, Amel; Manai, Mohamed; Porchet, Nicole

    2013-01-01

    AIM: To determine correlations between family history, clinical features and mutational status of genes involved in the progression of colorectal cancer (CRC). METHODS: Histo-pathological features and molecular changes [KRAS, BRAF and CTNNB1 genes mutations, microsatellite instability (MSI) phenotype, expression of mismatch repair (MMR) and mucin (MUC) 5AC proteins, mutation and expression analysis of TP53, MLH1 promoter hypermethylation analysis] were examined in a series of 51 unselected Tunisian CRC patients, 10 of them had a proven or probable hereditary disease, on the track of new tumoral markers for CRC susceptibility in Tunisian patients. RESULTS: As expected, MSI and MMR expression loss were associated to the presence of familial CRC (75% vs 9%, P < 0.001). However, no significant associations have been detected between personal or familial cancer history and KRAS (codons 12 and 13) or TP53 (exons 4-9) alterations. A significant inverse relationship has been observed between the presence of MSI and TP53 accumulation (10.0% vs 48.8%, P = 0.0335) in CRC tumors, suggesting different molecular pathways to CRC that in turn may reflect different environmental exposures. Interestingly, MUC5AC expression was significantly associated to the presence of MSI (46.7% vs 8.3%, P = 0.0039), MMR expression loss (46.7% vs 8.3%, P = 0.0039) and the presence of familial CRC (63% vs 23%, P = 0.039). CONCLUSION: These findings suggest that MUC5AC expression analysis may be useful in the screening of Tunisian patients with high risk of CRC. PMID:23983431

  3. [Interpretation of the updates of NCCN 2017 version 1.0 guideline for colorectal cancer].

    PubMed

    Chen, Gong

    2017-01-25

    The NCCN has recently released its 2017 version 1.0 guideline for colorectal cancer. There are several updates from this new version guideline which are believed to change the current clinical practice. Update one, low-dose aspirin is recommended for patients with colorectal cancer after colectomy for secondary chemoprevention. Update two, biological agents are removed from the neoadjuvant treatment regimen for resectable metastatic colorectal cancer (mCRC). This update is based on lack of evidence to support benefits of biological agents including bevacizumab and cetuximab in the neoadjuvant setting. Both technical criteria and prognostic information should be considered for decision-making. Currently biological agents may not be excluded from the neoadjuvant setting for patients with resectable but poor prognostic disease. Update three, panitumumab and cetuximab combination therapy is only recommended for left-sided tumors in the first line therapy. The location of the primary tumor can be both prognostic and predictive in response to EGFR inhibitors in metastatic colorectal cancer. Cetuximab and panitumumab confer little benefit to patients with metastatic colorectal cancer in the primary tumor originated on the right side. On the other hand, EGFR inhibitors provide significant benefit compared with bevacizumab-containing therapy or chemotherapy alone for patients with left primary tumor. Update four, PD-1 immune checkpoint inhibitors including pembrolizumab or nivolumab are recommended as treatment options in patients with metastatic deficient mismatch repair (dMMR) colorectal cancer in second- or third-line therapy. dMMR tumors contain thousands of mutations, which can encode mutant proteins with the potential to be recognized and targeted by the immune system. It has therefore been hypothesized that dMMR tumors may be sensitive to PD-1 inhibitors.

  4. MLH1-deficient tumor cells are resistant to lipoplatin, but retain sensitivity to lipoxal.

    PubMed

    Fedier, André; Poyet, Cédric; Perucchini, Daniele; Boulikas, Teni; Fink, Daniel

    2006-03-01

    Lipoplatin, currently under phase III evaluation, is a novel liposomal cisplatin formulation highly effective against cancers. Lipoplatin has eliminated or reduced the systemic toxicity frequently seen for cisplatin. The objective of the present study was to determine whether the cytotoxic effect of lipoplatin is dependent on the functional integrity of DNA mismatch repair (MMR), a post-replicative DNA repair machinery implicated in cell cycle control and apoptosis. Clonogenic data revealed a significant (P<0.05) 2-fold resistance to lipoplatin of HCT116 human colorectal adenocarcinoma cells lacking MLH1, one of five proteins crucial to MMR function, as compared to MLH1-expressing HCT116 cells. In addition, MLH1-deficient cells were at least 3-fold less susceptible to apoptosis (DNA fragmentation) than MLH1-proficient cells. However, proteolytic processing of caspase-3, caspase-7 and poly(ADP-ribose)polymerase-1 following lipoplatin treatment was comparable in MLH1-deficient cells and -proficient cells. Furthermore, MLH1-deficient cells retained the ability to attenuate cell cycle progression past the G2/M checkpoint following lipoplatin treatment. In conclusion, our results indicate that the lipoplatin-sensitive phenotype of MLH1-proficient cells correlated with increased apoptosis which may occur via caspase-independent pathways. They also suggest that the integrity of MMR function is a relevant determinant accounting for the cytotoxicity of lipoplatin. However, this does not seem to apply to lipoxal, a novel liposomal formulation of oxaliplatin, because MLH1-deficient cells were as sensitive to lipoxal as MLH1-proficient cells.

  5. Diagnostic method employing MSH2 protein

    DOEpatents

    de la Chapelle, Albert; Vogelstein, Bert; Kinzler, Kenneth W.

    1998-01-01

    The human MSH2 gene, responsible for hereditary non-polyposis colorectal cancer, was identified by virtue of its homology to the MutS class of genes, which are involved in DNA mismatch repair. The sequence of cDNA clones of the human gene are provided, and the sequence of the gene can be used to demonstrate the existence of germ line mutations in hereditary non-polyposis colorectal cancer (HNPCC) kindreds, as well as in replication error.sup.+ (RER.sup.+) tumor cells.

  6. Diagnostic method employing MSH2 protein

    DOEpatents

    Chapelle, A. de la; Vogelstein, B.; Kinzler, K.W.

    1998-11-17

    The human MSH2 gene, responsible for hereditary non-polyposis colorectal cancer, was identified by virtue of its homology to the MutS class of genes, which are involved in DNA mismatch repair. The sequence of cDNA clones of the human gene are provided, and the sequence of the gene can be used to demonstrate the existence of germ line mutations in hereditary non-polyposis colorectal cancer (HNPCC) kindreds, as well as in replication error{sup +} (RER{sup +}) tumor cells. 19 figs.

  7. Alignment of Homologous Chromosomes and Effective Repair of Programmed DNA Double-Strand Breaks during Mouse Meiosis Require the Minichromosome Maintenance Domain Containing 2 (MCMDC2) Protein

    PubMed Central

    Ravindranathan, Ramya; Dereli, Ihsan; Stanzione, Marcello; Tóth, Attila

    2016-01-01

    Orderly chromosome segregation during the first meiotic division requires meiotic recombination to form crossovers between homologous chromosomes (homologues). Members of the minichromosome maintenance (MCM) helicase family have been implicated in meiotic recombination. In addition, they have roles in initiation of DNA replication, DNA mismatch repair and mitotic DNA double-strand break repair. Here, we addressed the function of MCMDC2, an atypical yet conserved MCM protein, whose function in vertebrates has not been reported. While we did not find an important role for MCMDC2 in mitotically dividing cells, our work revealed that MCMDC2 is essential for fertility in both sexes due to a crucial function in meiotic recombination. Meiotic recombination begins with the introduction of DNA double-strand breaks into the genome. DNA ends at break sites are resected. The resultant 3-prime single-stranded DNA overhangs recruit RAD51 and DMC1 recombinases that promote the invasion of homologous duplex DNAs by the resected DNA ends. Multiple strand invasions on each chromosome promote the alignment of homologous chromosomes, which is a prerequisite for inter-homologue crossover formation during meiosis. We found that although DNA ends at break sites were evidently resected, and they recruited RAD51 and DMC1 recombinases, these recombinases were ineffective in promoting alignment of homologous chromosomes in the absence of MCMDC2. Consequently, RAD51 and DMC1 foci, which are thought to mark early recombination intermediates, were abnormally persistent in Mcmdc2-/- meiocytes. Importantly, the strand invasion stabilizing MSH4 protein, which marks more advanced recombination intermediates, did not efficiently form foci in Mcmdc2-/- meiocytes. Thus, our work suggests that MCMDC2 plays an important role in either the formation, or the stabilization, of DNA strand invasion events that promote homologue alignment and provide the basis for inter-homologue crossover formation during

  8. MMR Vaccine (Measles, Mumps, and Rubella)

    MedlinePlus

    ... in women), and mild fever. If a woman gets rubella while she is pregnant, she could have a miscarriage or her baby could be born with serious birth defects. These diseases spread from person to person through the air. You can easily ...

  9. Functional testing strategy for coding genetic variants of unclear significance in MLH1 in Lynch syndrome diagnosis.

    PubMed

    Hinrichsen, Inga; Schäfer, Dieter; Langer, Deborah; Köger, Nicole; Wittmann, Margarethe; Aretz, Stefan; Steinke, Verena; Holzapfel, Stefanie; Trojan, Jörg; König, Rainer; Zeuzem, Stefan; Brieger, Angela; Plotz, Guido

    2015-02-01

    Lynch syndrome is caused by inactivating mutations in the MLH1 gene, but genetic variants of unclear significance frequently preclude diagnosis. Functional testing can reveal variant-conferred defects in gene or protein function. Based on functional defect frequencies and clinical applicability of test systems, we developed a functional testing strategy aimed at efficiently detecting pathogenic defects in coding MLH1 variants. In this strategy, tests of repair activity and expression are prioritized over analyses of subcellular protein localization and messenger RNA (mRNA) formation. This strategy was used for four unclear coding MLH1 variants (p.Asp41His, p.Leu507Phe, p.Gln689Arg, p.Glu605del + p.Val716Met). Expression was analyzed using a transfection system, mismatch repair (MMR) activity by complementation in vitro, mRNA formation by reverse transcriptase-PCR in carrier lymphocyte mRNA, and subcellular localization with dye-labeled fusion constructs. All tests included clinically meaningful controls. The strategy enabled efficient identification of defects in two unclear variants: the p.Asp41His variant showed loss of MMR activity, whereas the compound variant p.Glu605del + p.Val716Met had a defect of expression. This expression defect was significantly stronger than the pathogenic expression reference variant analyzed in parallel, therefore the defect of the compound variant is also pathogenic. Interestingly, the expression defect was caused additively by both of the compound variants, at least one of which is non-pathogenic when occurring by itself. Tests were neutral for p.Leu507Phe and p.Gln689Arg, and the results were consistent with available clinical data. We finally discuss the improved sensitivity and efficiency of the applied strategy and its limitations in analyzing unclear coding MLH1 variants.

  10. Brain metastases in gastro-oesophageal adenocarcinoma: insights into the role of the human epidermal growth factor receptor 2 (HER2)

    PubMed Central

    Feilchenfeldt, J; Varga, Z; Siano, M; Grabsch, H I; Held, U; Schuknecht, B; Trip, A; Hamaguchi, T; Gut, P; Balague, O; Khanfir, K; Diebold, J; Jochum, W; Shoji, H; Kushima, R; Wagner, D; Shimada, Y; Cats, A; Knuth, A; Moch, H; Aebi, S; Hofer, S

    2015-01-01

    Background: Gastro-oesophageal adenocarcinomas rarely metastasize to the central nervous system (CNS). The role of the human epidermal growth factor receptor 2 (HER2) in patients with these cancers and CNS involvement is presently unknown. Patients and Methods: A multicentre registry was established to collect data from patients with gastro-oesophageal adenocarcinomas and CNS involvement both retrospectively and prospectively. Inclusion in the study required a predefined clinical data set, a central neuro-radiological or histopathological confirmation of metastatic CNS involvement and central assessment of HER2 by immunohistochemistry (IHC) and in situ hybridisation (ISH). In addition, expression of E-cadherin and DNA mismatch repair (MMR) proteins were assessed by IHC. Results: One hundred patients fulfilled the inclusion criteria. The population's median age was 59 years (interquartile range: 54–68), of which 85 (85%) were male. Twenty-five patients were of Asian and 75 of Caucasian origin. HER2 status was positive in 36% (95% CI: 26.6–46.2) of cases. Median time from initial diagnosis to the development of brain metastases (BMets) or leptomeningeal carcinomatosis (LC) was 9.9 months (95% CI: 8.5–15.0). Median overall survival from diagnosis was 16.9 months (95% CI: 14.0–20.7) and was not related to the HER2 status. E-cadherin loss was observed in 9% of cases and loss of expression in at least one DNA MMR proteins in 6%. Conclusions: The proportion of a positive HER2 status in patients with gastro-oesophageal adenocarcinoma and CNS involvement was higher than expected. The impact of anti-HER2 therapies should be studied prospectively. PMID:26313663

  11. Prospective multicenter study of the impact of oncotype DX colon cancer assay results on treatment recommendations in stage II colon cancer patients.

    PubMed

    Srivastava, Geetika; Renfro, Lindsay A; Behrens, Robert J; Lopatin, Margarita; Chao, Calvin; Soori, Gamini S; Dakhil, Shaker R; Mowat, Rex B; Kuebler, J Philip; Kim, George; Mazurczak, Miroslaw; Lee, Mark; Alberts, Steven R

    2014-05-01

    The Oncotype DX colon cancer assay is a clinically validated predictor of recurrence risk in stage II colon cancer patients. This prospective study evaluated the impact of recurrence score (RS) results on physician recommendations regarding adjuvant chemotherapy in T3, mismatch repair-proficient (MMR-P) stage II colon cancer patients. Patients and Methods. Stage IIA colon cancer patients were enrolled in 17 centers. Patient tumor specimens were assessed by the RS test (quantitative reverse transcription-polymerase chain reaction) and mismatch repair (immunohistochemistry). For each patient, the physician's recommended postoperative treatment plan of observation, fluoropyrimidine monotherapy, or combination therapy with oxaliplatin was recorded before and after the RS and mismatch repair results were provided. Results. Of 221 enrolled patients, 141 patients had T3 MMR-P tumors and were eligible for the primary analysis. Treatment recommendations changed for 63 (45%; 95% confidence interval: 36%-53%) of these 141 T3 MMR-P patients, with intensity decreasing for 47 (33%) and increasing for 16 (11%). Recommendations for chemotherapy decreased from 73 patients (52%) to 42 (30%), following review of RS results by physician and patient. Increased treatment intensity was more often observed at higher RS values, and decreased intensity was observed at lower values (p = .011). Conclusion. Compared with traditional clinicopathological assessment, incorporation of the RS result into clinical decision making was associated with treatment recommendation changes for 45% of T3 MMR-P stage II colon cancer patients in this prospective multicenter study. Use of the RS assay may lead to overall reduction in adjuvant chemotherapy use in this subgroup of stage II colon cancer patients.

  12. Prospective Multicenter Study of the Impact of Oncotype DX Colon Cancer Assay Results on Treatment Recommendations in Stage II Colon Cancer Patients

    PubMed Central

    Srivastava, Geetika; Renfro, Lindsay A.; Behrens, Robert J.; Lopatin, Margarita; Chao, Calvin; Soori, Gamini S.; Dakhil, Shaker R.; Mowat, Rex B.; Kuebler, J. Philip; Kim, George; Mazurczak, Miroslaw; Lee, Mark

    2014-01-01

    Purpose. The Oncotype DX colon cancer assay is a clinically validated predictor of recurrence risk in stage II colon cancer patients. This prospective study evaluated the impact of recurrence score (RS) results on physician recommendations regarding adjuvant chemotherapy in T3, mismatch repair-proficient (MMR-P) stage II colon cancer patients. Patients and Methods. Stage IIA colon cancer patients were enrolled in 17 centers. Patient tumor specimens were assessed by the RS test (quantitative reverse transcription-polymerase chain reaction) and mismatch repair (immunohistochemistry). For each patient, the physician’s recommended postoperative treatment plan of observation, fluoropyrimidine monotherapy, or combination therapy with oxaliplatin was recorded before and after the RS and mismatch repair results were provided. Results. Of 221 enrolled patients, 141 patients had T3 MMR-P tumors and were eligible for the primary analysis. Treatment recommendations changed for 63 (45%; 95% confidence interval: 36%–53%) of these 141 T3 MMR-P patients, with intensity decreasing for 47 (33%) and increasing for 16 (11%). Recommendations for chemotherapy decreased from 73 patients (52%) to 42 (30%), following review of RS results by physician and patient. Increased treatment intensity was more often observed at higher RS values, and decreased intensity was observed at lower values (p = .011). Conclusion. Compared with traditional clinicopathological assessment, incorporation of the RS result into clinical decision making was associated with treatment recommendation changes for 45% of T3 MMR-P stage II colon cancer patients in this prospective multicenter study. Use of the RS assay may lead to overall reduction in adjuvant chemotherapy use in this subgroup of stage II colon cancer patients. PMID:24710310

  13. The key role of CYC2 during meiosis in Tetrahymena thermophila.

    PubMed

    Xu, Qianlan; Wang, Ruoyu; Ghanam, A R; Yan, Guanxiong; Miao, Wei; Song, Xiaoyuan

    2016-04-01

    Meiotic recombination is carried out through a specialized pathway for the formation and repair of DNA double-strand breaks (DSBs) made by the Spo11 protein. The present study shed light on the functional role of cyclin, CYC2, in Tetrahymena thermophila which has transcriptionally high expression level during meiosis process. Knocking out the CYC2 gene results in arrest of meiotic conjugation process at 2.5-3.5 h after conjugation initiation, before the meiosis division starts, and in company with the absence of DSBs. To investigate the underlying mechanism of this phenomenon, a complete transcriptome profile was performed between wild-type strain and CYC2 knock-out strain. Functional analysis of RNA-Seq results identifies related differentially expressed genes (DEGs) including SPO11 and these DEGs are enriched in DNA repair/mismatch repair (MMR) terms in homologous recombination (HR), which indicates that CYC2 could play a crucial role in meiosis by regulating SPO11 and participating in HR.

  14. Chromosomal islands of Streptococcus pyogenes and related streptococci: molecular switches for survival and virulence

    PubMed Central

    Nguyen, Scott V.; McShan, William M.

    2014-01-01

    Streptococcus pyogenes is a significant pathogen of humans, annually causing over 700,000,000 infections and 500,000 deaths. Virulence in S. pyogenes is closely linked to mobile genetic elements like phages and chromosomal islands (CI). S. pyogenes phage-like chromosomal islands (SpyCI) confer a complex mutator phenotype on their host. SpyCI integrate into the 5′ end of DNA mismatch repair (MMR) gene mutL, which also disrupts downstream operon genes lmrP, ruvA, and tag. During early logarithmic growth, SpyCI excise from the bacterial chromosome and replicate as episomes, relieving the mutator phenotype. As growth slows and the cells enter stationary phase, SpyCI reintegrate into the chromosome, again silencing the MMR operon. This system creates a unique growth-dependent and reversible mutator phenotype. Additional CI using the identical attachment site in mutL have been identified in related species, including Streptococcus dysgalactiae subsp. equisimilis, Streptococcus anginosus, Streptococcus intermedius, Streptococcus parauberis, and Streptococcus canis. These CI have small genomes, which range from 13 to 20 kB, conserved integrase and DNA replication genes, and no identifiable genes encoding capsid proteins. SpyCI may employ a helper phage for packaging and dissemination in a fashion similar to the Staphylococcus aureus pathogenicity islands (SaPI). Outside of the core replication and integration genes, SpyCI and related CI show considerable diversity with the presence of many indels that may contribute to the host cell phenotype or fitness. SpyCI are a subset of a larger family of streptococcal CI who potentially regulate the expression of other host genes. The biological and phylogenetic analysis of streptococcal chromosomal islands provides important clues as to how these chromosomal islands help S. pyogenes and other streptococcal species persist in human populations in spite of antibiotic therapy and immune challenges. PMID:25161960

  15. VE1 immunohistochemistry predicts BRAF V600E mutation status and clinical outcome in colorectal cancer

    PubMed Central

    Schafroth, Christian; Galván, José A.; Centeno, Irene; Koelzer, Viktor H.; Dawson, Heather E.; Sokol, Lena; Rieger, Gregor; Berger, Martin D.; Hädrich, Marion; Rosenberg, Robert; Nitsche, Ulrich; Schnüriger, Beat; Langer, Rupert; Inderbitzin, Daniel; Lugli, Alessandro; Zlobec, Inti

    2015-01-01

    Aim VE1 is a monoclonal antibody detecting mutant BRAFV600E protein by immunohistochemistry. Here we aim to determine the inter-observer agreement and concordance of VE1 with mutational status, investigate heterogeneity in colorectal cancers and metastases and determine the prognostic effect of VE1 in colorectal cancer patients. Methods Concordance of VE1 with mutational status and inter-observer agreement were tested on a pilot cohort of colorectal cancers (n = 34), melanomas (n = 23) and thyroid cancers (n = 8). Two prognostic cohorts were evaluated (n = 259, Cohort 1 and n = 226, Cohort 2) by multiple-punch tissue microarrays. VE1 staining on preoperative biopsies (n = 118 patients) was compared to expression in resections. Primary tumors and metastases from 13 patients were tested for VE1 heterogeneity using a tissue microarray generated from all available blocks (n = 100 blocks). Results Inter-observer agreement was 100% (kappa = 1.0). Concordance between VE1 and V600E mutation was 98.5%. Cohort 1: VE1 positivity (seen in 13.5%) was associated with older age (p = 0.0175) and MLH1 deficiency (p < 0.0001). Cohort 2: VE1 positivity (seen in 12.8%) was associated with female gender (p = 0.0016), right-sided tumor location (p < 0.0001), higher tumor grade (p < 0.0001) and mismatch repair (MMR)-deficiency (p < 0.0001). In survival analysis, MMR status and postoperative therapy were identified as possible confounding factors. Adjusting for these features, VE1 was an unfavorable prognostic factor. Preoperative biopsy staining matched resections in all cases except one. No heterogeneity was found across any primary/metastatic tumor blocks. Conclusion VE1 is highly concordant for V600E and homogeneously expressed suggesting staining can be analysed on resection specimens, preoperative biopsies, metastatic lesions and tissue microarrays. PMID:26496026

  16. Chromosomal islands of Streptococcus pyogenes and related streptococci: molecular switches for survival and virulence.

    PubMed

    Nguyen, Scott V; McShan, William M

    2014-01-01

    Streptococcus pyogenes is a significant pathogen of humans, annually causing over 700,000,000 infections and 500,000 deaths. Virulence in S. pyogenes is closely linked to mobile genetic elements like phages and chromosomal islands (CI). S. pyogenes phage-like chromosomal islands (SpyCI) confer a complex mutator phenotype on their host. SpyCI integrate into the 5' end of DNA mismatch repair (MMR) gene mutL, which also disrupts downstream operon genes lmrP, ruvA, and tag. During early logarithmic growth, SpyCI excise from the bacterial chromosome and replicate as episomes, relieving the mutator phenotype. As growth slows and the cells enter stationary phase, SpyCI reintegrate into the chromosome, again silencing the MMR operon. This system creates a unique growth-dependent and reversible mutator phenotype. Additional CI using the identical attachment site in mutL have been identified in related species, including Streptococcus dysgalactiae subsp. equisimilis, Streptococcus anginosus, Streptococcus intermedius, Streptococcus parauberis, and Streptococcus canis. These CI have small genomes, which range from 13 to 20 kB, conserved integrase and DNA replication genes, and no identifiable genes encoding capsid proteins. SpyCI may employ a helper phage for packaging and dissemination in a fashion similar to the Staphylococcus aureus pathogenicity islands (SaPI). Outside of the core replication and integration genes, SpyCI and related CI show considerable diversity with the presence of many indels that may contribute to the host cell phenotype or fitness. SpyCI are a subset of a larger family of streptococcal CI who potentially regulate the expression of other host genes. The biological and phylogenetic analysis of streptococcal chromosomal islands provides important clues as to how these chromosomal islands help S. pyogenes and other streptococcal species persist in human populations in spite of antibiotic therapy and immune challenges.

  17. The chromatin remodelling component SMARCB1/INI1 influences the metastatic behavior of colorectal cancer through a gene signature mapping to chromosome 22

    PubMed Central

    2013-01-01

    Background INI1 (Integrase interactor 1), also known as SMARCB1, is the most studied subunit of chromatin remodelling complexes. Its role in colorectal tumorigenesis is not known. Methods We examined SMARCB1/INI1 protein expression in 134 cases of colorectal cancer (CRC) and 60 matched normal mucosa by using tissue microarrays and western blot and categorized the results according to mismatch repair status (MMR), CpG island methylator phenotype, biomarkers of tumor differentiation CDX2, CK20, vimentin and p53. We validated results in two independent data sets and in cultured CRC cell lines. Results Herein, we show that negative SMARCB1/INI1 expression (11% of CRCs) associates with loss of CDX2, poor differentiation, liver metastasis and shorter patients’ survival regardless of the MMR status or tumor stage. Unexpectedly, even CRCs displaying diffuse nuclear INI1 staining (33%) show an adverse prognosis and vimentin over-expression, in comparison with the low expressing group (56%). The negative association of SMARCB1/INI1-lack of expression with a metastatic behavior is enhanced by the TP53 status. By interrogating global gene expression from two independent cohorts of 226 and 146 patients, we confirm the prognostic results and identify a gene signature characterized by SMARCB1/INI1 deregulation. Notably, the top genes of the signature (BCR, COMT, MIF) map on the long arm of chromosome 22 and are closely associated with SMARCB1/INI1. Conclusion Our findings suggest that SMARCB1/INI1-dysregulation and genetic hot-spots on the long arm of chromosome 22 might play an important role in the CRC metastatic behavior and be clinically relevant as novel biomarkers. PMID:24286138

  18. Pre-trial inter-laboratory analytical validation of the FOCUS4 personalised therapy trial

    PubMed Central

    Richman, Susan D; Adams, Richard; Quirke, Phil; Butler, Rachel; Hemmings, Gemma; Chambers, Phil; Roberts, Helen; James, Michelle D; Wozniak, Sue; Bathia, Riya; Pugh, Cheryl; Maughan, Timothy; Jasani, Bharat

    2016-01-01

    Introduction Molecular characterisation of tumours is increasing personalisation of cancer therapy, tailored to an individual and their cancer. FOCUS4 is a molecularly stratified clinical trial for patients with advanced colorectal cancer. During an initial 16-week period of standard first-line chemotherapy, tumour tissue will undergo several molecular assays, with the results used for cohort allocation, then randomisation. Laboratories in Leeds and Cardiff will perform the molecular testing. The results of a rigorous pre-trial inter-laboratory analytical validation are presented and discussed. Methods Wales Cancer Bank supplied FFPE tumour blocks from 97 mCRC patients with consent for use in further research. Both laboratories processed each sample according to an agreed definitive FOCUS4 laboratory protocol, reporting results directly to the MRC Trial Management Group for independent cross-referencing. Results Pyrosequencing analysis of mutation status at KRAS codons12/13/61/146, NRAS codons12/13/61, BRAF codon600 and PIK3CA codons542/545/546/1047, generated highly concordant results. Two samples gave discrepant results; in one a PIK3CA mutation was detected only in Leeds, and in the other, a PIK3CA mutation was only detected in Cardiff. pTEN and mismatch repair (MMR) protein expression was assessed by immunohistochemistry (IHC) resulting in 6/97 discordant results for pTEN and 5/388 for MMR, resolved upon joint review. Tumour heterogeneity was likely responsible for pyrosequencing discrepancies. The presence of signet-ring cells, necrosis, mucin, edge-effects and over-counterstaining influenced IHC discrepancies. Conclusions Pre-trial assay analytical validation is essential to ensure appropriate selection of patients for targeted therapies. This is feasible for both mutation testing and immunohistochemical assays and must be built into the workup of such trials. Trial registration number ISRCTN90061564. PMID:26350752

  19. Msh2 deficiency leads to chromosomal abnormalities, centrosome amplification, and telomere capping defect

    SciTech Connect

    Wang, Yisong; Liu, Yie

    2006-01-01

    Msh2 is a key mammalian DNA mismatch repair (MMR) gene and mutations or deficiencies in mammalian Msh2 gene result in microsatellite instability (MSI+) and the development of cancer. Here, we report that primary mouse embryonic fibroblasts (MEFs) deficient in the murine MMR gene Msh2 (Msh2-/-) showed a significant increase in chromosome aneuploidy, centrosome amplification, and defective mitotic spindle organization and unequal chromosome segregation. Although Msh2-/- mouse tissues or primary MEFs had no apparent change in telomerase activity, telomere length, or recombination at telomeres, Msh2-/- MEFs showed an increase in chromosome end-to-end fusions or chromosome ends without detectable telomeric DNA. These data suggest that MSH2 helps to maintain genomic stability through the regulation of the centrosome and normal telomere capping in vivo and that defects in MMR can contribute to oncogenesis through multiple pathways.

  20. Growth inhibition and antioxidative status induced by selenium-enriched broccoli extract and selenocompounds in DNA mismatch repair-deficient human colon cancer cells.

    PubMed

    Tsai, Cheng-Fang; Ou, Bor-Rung; Liang, Yu-Chuan; Yeh, Jan-Ying

    2013-08-15

    The effects of enzymatic-digested Se-enriched broccoli extracts (SeB) and selenocompounds on growth and antioxidative status in human colon cancer cells was investigated in this study. HCT116 and HCT116+Chr.3 cells were treated with selenocompounds (sodium selenite, sodium selenate, Se-Met, MeSeCys) or SeB [high-Se (H-SeB) or low-Se (L-SeB)]. The cytotoxicity induced by selenocompounds in HCT116 cells was not associated with cellular H2O2 level, while the differential cytotoxicity observed by sodium selenite between HCT116 and HCT116+Chr.3 cell lines was related to cellular H2O2 production with the change in antioxidative enzyme activity, and the restoration of chromosome 3. H-SeB was found to reduce the cellular H2O2 content in HCT116+Chr.3 cells. The results in this study indicate that regardless of Se content, the cytotoxicity in HCT116 cells of both SeB forms appeared to be H2O2-independent, whereas the cytotoxicity in HCT116+Chr.3 of either SeB form appeared to be H2O2-dependent with an increase in antioxidative ability for H-SeB.

  1. The role of germline mutations in the BRCA1/2 and mismatch repair genes in men ascertained for early-onset and/or familial prostate cancer.

    PubMed

    Maia, Sofia; Cardoso, Marta; Paulo, Paula; Pinheiro, Manuela; Pinto, Pedro; Santos, Catarina; Pinto, Carla; Peixoto, Ana; Henrique, Rui; Teixeira, Manuel R

    2016-01-01

    Prostate cancer (PrCa) is one of the most common cancers diagnosed worldwide and 5-10 % of all cases are estimated to be associated with inherited predisposition. Even though there is strong evidence that the genetic component is significant in PrCa, the genetic etiology of familial and early-onset disease is largely unknown. Although it has been suggested that men from families with hereditary breast/ovarian cancer (HBOC) and, more recently, with Lynch syndrome may have an increased risk for PrCa, the contribution of these syndromes to PrCa predisposition in families ascertained for early-onset and/or familial PrCa, independently of the presence of other cancers in the family, is uncertain. To quantify the contribution of genes associated with HBOC and Lynch syndromes to PrCa predisposition, we have tested for germline mutations 460 early-onset and/or familial PrCa patients. All patients were screened for the six mutations that are particularly common in Portugal and 38 of them were selected for complete sequencing of BRCA1/2 and/or MLH1, MSH2 and MSH6. Two patients were found to harbor the same MSH2 mutation and a third patient carried a Portuguese BRCA2 founder mutation. None of the alterations were identified in 288 control subjects. Furthermore, we reviewed the 62 PrCa diagnoses in all HBOC (n = 161) and Lynch syndrome (n = 124) families previously diagnosed at our department, and found five other BRCA2 mutation carriers and two additional MSH2 mutation carriers. The clinicopathological characteristics of mutation carriers are in concordance with earlier data suggesting an aggressive PrCa phenotype and support the hypothesis that mutation carriers might benefit from targeted screening according to the gene mutated in the germline.

  2. Prognostic value and clinicopathological features of PD-1/PD-L1 expression with mismatch repair status and desmoplastic stroma in Chinese patients with pancreatic cancer.

    PubMed

    Wang, Yu; Lin, Jiacheng; Cui, Jiujie; Han, Ting; Jiao, Feng; Meng, Zhuo; Wang, Liwei

    2017-02-07

    Pancreatic cancer (PC) is a highly lethal cancer. Thus, the immune molecular markers which help to select PC patients are especially important. In this study, we aimed at systematically analyzing the expression of MLH1, MSH2, PD-L1 and PD-1, investigate their clinical significance and prognostic value. We found that high expression of PD-L1 on cancer cell membranes correlated with lymph node metastasis (P = 0.033) and strongly correlated with poor-differentiation (P = 0.008); high expression of PD-1 on cell membranes of T-cells correlated with well-differentiation (P = 0.018) and strongly correlated with advanced T stage (P = 0.004); high PD-1 expression was associated with a significantly superior OS and was an independent prognostic factor (P = 0.031). Then we found an inverse correlation between MSH2 expression and PD-L1 expression (Spearman correlation coefficient r = -0.295, P = 0.004). In subgroup analyses, we observed that PD-1 expression level was associated with OS only at low PD-L1 expression subgroup (P = 0.021). Finally, when we stratified the cases into four subgroups based on PD-1 expression and stroma density, we found that patients with high PD-1 expression and dense stroma had a better OS, while patients with low PD-1 expression and moderate stroma showed a worst outcome. Our result may provide more effective molecular markers for immunotherapeutic strategies of PC patients in clinical practice.

  3. Risk of Breast Cancer Associated with Reproductive and Fertility Factors According to a Family History of Breast Cancer

    DTIC Science & Technology

    1999-10-01

    mutation (C677T) in the MTHFR gene is associated with reduced enzyme ac- tions in one of five DNA-mismatch repair (MMR) genes (hMSH2, hMLH1, hPMS1,VyA... mutations than in noncarriers. 2 1 Since a family history of breast cancer may not only reflect shared genes but also shared exposures, a family study...unchanged. To study families most likely to be carrying a mutation in BRCA1 or BRCA2, analyses were conducted in high-risk families defined by the number

  4. Communication of Genetic Test Results to Family and Health Care Providers Following Disclosure of Research Results

    PubMed Central

    Graves, Kristi D.; Sinicrope, Pamela S.; Esplen, Mary Jane; Peterson, Susan K.; Patten, Christi A.; Lowery, Jan; Sinicrope, Frank A.; Nigon, Sandra K.; Borgen, Joyce; Gorin, Sherri Sheinfeld; Keogh, Louise A.; Lindor, Noralane M.

    2014-01-01

    Purpose Few studies have examined methods to promote communication following the return of DNA mismatch repair (MMR) genetic test results obtained during research. The purpose of the present study was to evaluate a telephone protocol for returning research results of MMR gene testing to identify Lynch Syndrome. Methods We invited individuals with known MMR mutations in their family who were enrolled in the Colon Cancer Family Registry at the Mayo Clinic to participate. Participants completed surveys before and 6-months after MMR test result disclosure. Results Among 107 participants, 79% opted to learn their MMR test results; of these, 44 (41%) carried MMR mutations. Post-disclosure, 54% reported screening for any type of cancer. Among carriers, >74% reported communicating results to family; communication was predicted by baseline confidence in coping with the genetic test result (Z=1.97, P=.04). Result disclosure to a physician was predicted by greater perceived cancer risk (Z=2.08, P=.03) and greater intention to share results with family (Z=3.07, P=.002). Conclusions Research vs. clinically-based gene disclosure presents challenges. A telephone disclosure process for the return of research-based results among Lynch syndrome families led to high rates of result uptake and participant communication of results to providers and family members. PMID:24091800

  5. Role of AtMSH7 in UV-B-induced DNA damage recognition and recombination.

    PubMed

    Lario, Luciana Daniela; Botta, Pablo; Casati, Paula; Spampinato, Claudia Patricia

    2015-06-01

    The mismatch repair (MMR) system maintains genome integrity by correcting replication-associated errors and inhibiting recombination between divergent DNA sequences. The basic features of the pathway have been highly conserved throughout evolution, although the nature and number of the proteins involved in this DNA repair system vary among organisms. Plants have an extra mismatch recognition protein, MutSγ, which is a heterodimer: MSH2-MSH7. To further understand the role of MSH7 in vivo, we present data from this protein in Arabidopsis thaliana. First, we generated transgenic plants that express β-glucuronidase (GUS) under the control of the MSH7 promoter. Histochemical staining of the transgenic plants indicated that MSH7 is preferentially expressed in proliferating tissues. Then, we identified msh7 T-DNA insertion mutants. Plants deficient in MSH7 show increased levels of UV-B-induced cyclobutane pyrimidine dimers relative to wild-type (WT) plants. Consistent with the patterns of MSH7 expression, we next analysed the role of the protein during somatic and meiotic recombination. The frequency of somatic recombination between homologous or homeologous repeats (divergence level of 1.6%) was monitored using a previously described GUS recombination reporter assay. Disruption of MSH7 has no effect on the rates of somatic homologous or homeologous recombination under control conditions or after UV-B exposure. However, the rate of meiotic recombination between two genetically linked seed-specific fluorescent markers was 97% higher in msh7 than in WT plants. Taken together, these results suggest that MSH7 is involved in UV-B-induced DNA damage recognition and in controlling meiotic recombination.

  6. MSH-6: extending the reliability of immunohistochemistry as a screening tool in Muir-Torre syndrome.

    PubMed

    Chhibber, Vishes; Dresser, Karen; Mahalingam, Meera

    2008-02-01

    The subtype of Muir-Torre syndrome, allelic to hereditary nonpolyposis colorectal cancer is typically associated with germline mutations in the mismatch repair proteins MSH-2 and/or MLH-1. More recently, mutation in an additional mismatch repair protein MSH-6 has been documented in a patient with Muir-Torre syndrome. Given this, the aim of the present study was to ascertain the frequency of the same in unselected sebaceous gland neoplasms. Overall, we found that 59% of sebaceous neoplasms exhibited a mutation in at least one mismatch repair protein gene -- a prevalence rate similar to that reported previously by others. Of interest, we found MSH-6 to be the mismatch repair protein most commonly lost 17/41 (41%), followed by MSH-2 14/41 (34%) and MLH-18/41 (20%) and the positive predictive value of each were as follows: MLH-1 88%, MSH-6 67% and MSH-2 55%. The frequency of a MSH-6 germline mutation in our cohort indicates that it is not a rare finding. Evidence indicating microsatellite stability in three of 17 patients with a clinical history indicative of Muir-Torre syndrome and a mutation in only MSH-6 suggests that the phenotype of a germline MSH-6 mutation differs from that of MLH-1 and MSH-2 mutations and further supports the use of immunohistochemistry as a screening tool in patients with Muir-Torre syndrome with an extended panel that includes MSH-6.

  7. Spotting the mistakes, one molecule at a time.

    PubMed

    Quessada-Vial, Audrey; van Oijen, Antoine M

    2012-07-03

    In this issue of Structure, Cho and colleagues provide intriguing insight into the first steps of the DNA mismatch repair process. By using single-molecule techniques, they show that the protein MutS undergoes two different types of diffusion on error-containing DNA in an ATP-dependent way.

  8. Participation of DNA repair in the response to 5-fluorouracil

    PubMed Central

    Wyatt, Michael D.; Wilson, David M.

    2008-01-01

    The anti-metabolite 5-fluorouracil (5-FU) is employed clinically to manage solid tumors including colorectal and breast cancer. Intracellular metabolites of 5-FU can exert cytotoxic effects via inhibition of thymidylate synthetase, or through incorporation into RNA and DNA, events that ultimately activate apoptosis. In this review, we cover the current data implicating DNA repair processes in cellular responsiveness to 5-FU treatment. Evidence points to roles for base excision repair (BER) and mismatch repair (MMR). However, mechanistic details remain unexplained, and other pathways have not been exhaustively interrogated. Homologous recombination is of particular interest, because it resolves unrepaired DNA intermediates not properly dealt with by BER or MMR. Furthermore, crosstalk among DNA repair pathways and S-phase checkpoint signaling has not been examined. Ongoing efforts aim to design approaches and reagents that (i) approximate repair capacity and (ii) mediate strategic regulation of DNA repair in order to improve the efficacy of current anti-cancer treatments. PMID:18979208

  9. Clinical Significance and Prognostic Relevance of Microsatellite Instability in Sporadic Colorectal Cancer Patients

    PubMed Central

    Copija, Angelika; Waniczek, Dariusz; Witkoś, Andrzej; Walkiewicz, Katarzyna; Nowakowska-Zajdel, Ewa

    2017-01-01

    Microsatellite instability (MSI) is a marker of the replication error phenotype. It is caused by impaired DNA mismatch repair processes (MMR), resulting in ineffectiveness of the mechanisms responsible for the DNA replication precision and postreplicative DNA repair. MSI underlies the pathogenesis of 10%–20% of colorectal cancer (CRC) cases. The data about the potential value of MMR status as a predictive factor for 5-fluorouracil (FU)-based chemotherapy remain unclear. According to National Comprehensive Cancer Network updated guidelines, MSI testing is recommended for all patients with stage II CRC because patients with MSI-H (high-frequency MSI) tumour may have a good prognosis and obtain no benefit from 5-FU-based adjuvant chemotherapy. The significance of the MSI status as a predictive factor for patients with metastatic disease was not confirmed. The association between the MSI status and the efficacy of the therapy based on anti-programmed death-1 receptor inhibitors requires further studies. PMID:28067827

  10. Nimotuzumab enhances temozolomide-induced growth suppression of glioma cells expressing mutant EGFR in vivo.

    PubMed

    Nitta, Yusuke; Shimizu, Saki; Shishido-Hara, Yukiko; Suzuki, Kaori; Shiokawa, Yoshiaki; Nagane, Motoo

    2016-03-01

    A mutant form of epidermal growth factor receptor (EGFR), EGFRvIII, is common in glioblastoma (GBM) and confers enhanced tumorigenic activity and drug resistance. Nimotuzumab, an anti-EGFR antibody, has shown preclinical and clinical activity to GBM, but its specific activity against EGFRvIII has not been fully investigated. Human glioma U87MG or LNZ308 cells overexpressing either wild-type (wt) EGFR or EGFRvIII were treated with nimotuzumab, temozolomide, or both. Expression and phosphorylation status of molecules were determined by Western blot analysis. Methylation status of promoter region of O(6) -methylguanine-DNA methyltransferase (MGMT) was detected by methylation-specific PCR. Antitumor activity was tested using nude mice bearing either subcutaneous or intracerebral xenografts along with analyses of EGFR phosphorylation status, proliferation, apoptosis, and vessel density. Nimotuzumab treatment resulted in reduction of EGFRvIII tyrosine phosphorylation with a decrease in Akt phosphorylation that was greater than that of wtEGFR. Correspondingly, antitumor effects, growth suppression and survival elongation, were more significant in mice bearing either subcutaneous or intracerebral tumor expressing EGFRvIII than in those expressing wtEGFR. These effects were markedly increased when temozolomide was combined with nimotuzumab. The post-treatment recurrent brain tumors exhibited a decrease in expression of the mismatch repair (MMR) proteins, MSH6 and MLH1, but their methylated MGMT status did not changed. Nimotuzumab has in vivo antitumor activity against GBM, especially those expressing EGFRvIII, when combined with temozolomide. This could provide a basis for preselection of patients with GBM by EGFR status who might benefit from the nimotuzumab and temozolomide combination therapy.

  11. Immunohistochemical staining for p16 and BRAFV600E is useful to distinguish between sporadic and hereditary (Lynch syndrome-related) microsatellite instable colorectal carcinomas.

    PubMed

    Boissière-Michot, Florence; Frugier, Hélène; Ho-Pun-Cheung, Alexandre; Lopez-Crapez, Evelyne; Duffour, Jacqueline; Bibeau, Frédéric

    2016-08-01

    DNA mismatch repair (MMR) protein analysis by immunohistochemistry (IHC) can identify colorectal cancer (CRC) with microsatellite instability (MSI). As MLH1-deficient CRC can be hereditary or sporadic, markers to distinguish between them are needed. MLH1 promoter methylation assay is the reference method; however, sometimes, it is challenging on formalin-fixed paraffin-embedded tissue samples. We assessed by IHC the expression of BRAFV600E, p16, MGMT, and CDX2 in 55 MLH1-deficient MSI CRC samples (of which 8 had a germline MLH1 mutation) to determine whether this panel differentiates between sporadic and hereditary CRCs. We also analyzed MLH1 promoter methylation by methylation-specific PCR and pyrosequencing and BRAF status by genotyping. None of the hereditary CRCs showed MLH1 methylation, BRAF mutation, BRAFV600E-positive immunostaining, or loss of p16 expression. We detected MLH1 promoter methylation in 67 % and a BRAF mutation in 42 % of CRC, all showing MLH1 promoter methylation. BRAFV600E IHC and BRAF genotyping gave concordant results in all but two samples. Loss of expression of p16 was found in 30 % of CRC with methylation of the MLH1 promoter, but its expression was retained in all non-methylated and part of MLH1-methylated tumors (100 % specificity, 30 % sensitivity). CDX2 and MGMT expression was not associated with MLH1 status. Thus, BRAFV600E and p16 IHC may help in differentiating sporadic from hereditary MLH1-deficient CRC with MSI. Specifically, p16 IHC might be used as a surrogate marker for MLH1 promoter methylation, because all p16-negative CRCs displayed MLH1 methylation, whereas hereditary CRCs were all p16-positive.

  12. Molecular analysis of mixed endometrial carcinomas shows clonality in most cases

    PubMed Central

    Hoang, Lien N.; Almadani, Noorah; Li, Xiaodong; Soslow, Robert A; Gilks, C. Blake; Lee, Cheng-Han

    2016-01-01

    Mixed endometrial carcinoma refers to a tumor that is comprised of two or more distinct histotypes. We studied 18 mixed-type endometrial carcinomas - 11 mixed serous and low-grade endometrioid carcinomas (SC/EC), 5 mixed clear cell and low-grade endometrioid carcinomas (CCC/EC), and 2 mixed clear cell and serous carcinoma (CCC/SC), using targeted next generation sequencing and immunohistochemistry to compare the molecular profiles of the different histotypes present in each case. In 16 of 18 cases there was molecular evidence that both components shared a clonal origin. Eight cases (6 EC/SC, 1 EC/CCC and 1 SC/CCC) showed a serous carcinoma molecular profile that was the same in both components. Five cases (3 CCC/EC and 2 SC/EC) showed a shared endometrioid molecular profile and identical mismatch repair protein (MMR) deficiency in both components. A single SC/EC case harbored the same POLE exonuclease domain mutation in both components. One SC/CCC and one EC/CCC case showed both shared and unique molecular features in the two histotype components, suggesting early molecular divergence from a common clonal origin. In two cases, there were no shared molecular features and these appear to be biologically unrelated synchronous tumors. Overall, these results show that the different histologic components in mixed endometrial carcinomas typically share the same molecular aberrations. Mixed endometrial carcinomas most commonly occur through morphological mimicry, whereby tumors with serous-type molecular profile show morphological features of endometrioid or clear cell carcinoma, or through underlying deficiency in DNA nucleotide repair, with resulting rapid accrual of mutations and intratumoral phenotypic heterogeneity. Less commonly, mixed endometrial carcinomas are the result of early molecular divergence from a common progenitor clone or are synchronous biologically unrelated tumors (collision tumors). PMID:26492180

  13. MutS2 Promotes Homologous Recombination in Bacillus subtilis.

    PubMed

    Burby, Peter E; Simmons, Lyle A

    2017-01-15

    Bacterial MutS proteins are subdivided into two families, MutS1 and MutS2. MutS1 family members recognize DNA replication errors during their participation in the well-characterized mismatch repair (MMR) pathway. In contrast to the well-described function of MutS1, the function of MutS2 in bacteria has remained less clear. In Helicobacter pylori and Thermus thermophilus, MutS2 has been shown to suppress homologous recombination. The role of MutS2 is unknown in the Gram-positive bacterium Bacillus subtilis In this work, we investigated the contribution of MutS2 to maintaining genome integrity in B. subtilis We found that deletion of mutS2 renders B. subtilis sensitive to the natural antibiotic mitomycin C (MMC), which requires homologous recombination for repair. We demonstrate that the C-terminal small MutS-related (Smr) domain is necessary but not sufficient for tolerance to MMC. Further, we developed a CRISPR/Cas9 genome editing system to test if the inducible prophage PBSX was the underlying cause of the observed MMC sensitivity. Genetic analysis revealed that MMC sensitivity was dependent on recombination and not on nucleotide excision repair or a symptom of prophage PBSX replication and cell lysis. We found that deletion of mutS2 resulted in decreased transformation efficiency using both plasmid and chromosomal DNA. Further, deletion of mutS2 in a strain lacking the Holliday junction endonuclease gene recU resulted in increased MMC sensitivity and decreased transformation efficiency, suggesting that MutS2 could function redundantly with RecU. Together, our results support a model where B. subtilis MutS2 helps to promote homologous recombination, demonstrating a new function for bacterial MutS2.

  14. Mechanisms of glycosylase induced genomic instability

    PubMed Central

    2017-01-01

    Human alkyladenine DNA glycosylase (AAG) initiates base excision repair (BER) to guard against mutations by excising alkylated and deaminated purines. Counterintuitively, increased expression of AAG has been implicated in increased rates of spontaneous mutation in microsatellite repeats. This microsatellite mutator phenotype is consistent with a model in which AAG excises bulged (unpaired) bases, altering repeat length. To directly test the role of base excision in AAG-induced mutagenesis, we conducted mutation accumulation experiments in yeast overexpressing different variants of AAG and detected mutations via high-depth genome resequencing. We also developed a new software tool, hp_caller, to perform accurate genotyping at homopolymeric repeat loci. Overexpression of wild-type AAG elevated indel mutations in homopolymeric sequences distributed throughout the genome. However, catalytically inactive variants (E125Q/E125A) caused equal or greater increases in frameshift mutations. These results disprove the hypothesis that base excision is the key step in mutagenesis by overexpressed wild-type AAG. Instead, our results provide additional support for the previously published model wherein overexpressed AAG interferes with the mismatch repair (MMR) pathway. In addition to the above results, we observed a dramatic mutator phenotype for N169S AAG, which has increased rates of excision of undamaged purines. This mutant caused a 10-fold increase in point mutations at G:C base pairs and a 50-fold increase in frameshifts in A:T homopolymers. These results demonstrate that it is necessary to consider the relative activities and abundance of many DNA replication and repair proteins when considering mutator phenotypes, as they are relevant to the development of cancer and its resistance to treatment. PMID:28333944

  15. The endonuclease domain of MutL interacts with the β sliding clamp

    PubMed Central

    Pillon, Monica C.; Miller, Jeffrey H.; Guarné, Alba

    2010-01-01

    Mismatch repair corrects errors that have escaped polymerase proofreading enhancing replication fidelity by at least two orders of magnitude. The β and PCNA sliding clamps increase the polymerase processivity during DNA replication and are important at several stages of mismatch repair. Both MutS and MutL, the two proteins that initiate the mismatch repair response, interact with β. Binding of MutS to β is important to recruit MutS and MutL to foci. Moreover, the endonuclease activity of human and yeast MutLα is stimulated by PCNA. However, the concrete functions of the processivity clamp in the repair steps preceding DNA resynthesis remain obscure. Here, we demonstrate that the C-terminal domain of MutL encompasses a bona fide β-binding motif that mediates a weak, yet specific, interaction between the two proteins. Mutation of this conserved motif correlates with defects in mismatch repair, demonstrating that the direct interaction with β is important for MutL function. The interaction between the C-terminal domain of MutL and β is conserved in both B. subtilis and E. coli, but the repair defects associated with mutation of this β-binding motif are more severe in the former, suggesting that this interaction may have a more prominent role in methyl-independent than methyl-directed mismatch repair systems. Together with previously published data, our work strongly suggests that β may stimulate the endonuclease activity of MutL through its direct interaction with the C-terminal domain of MutL. PMID:21050827

  16. MSH-MLH complexes formed at a DNA mismatch are disrupted by the PCNA sliding clamp.

    PubMed

    Bowers, J; Tran, P T; Joshi, A; Liskay, R M; Alani, E

    2001-03-09

    In the yeast Saccharomyces cerevisiae, mismatch repair (MMR) is initiated by the binding of heterodimeric MutS homolog (MSH) complexes to mismatches that include single nucleotide and loop insertion/deletion mispairs. In in vitro experiments, the mismatch binding specificity of the MSH2-MSH6 heterodimer is eliminated if ATP is present. However, addition of the MutL homolog complex MLH1-PMS1 to binding reactions containing MSH2-MSH6, ATP, and mismatched substrate results in the formation of a stable ternary complex. The stability of this complex suggests that it represents an intermediate in MMR that is subsequently acted upon by other MMR factors. In support of this idea, we found that the replication processivity factor proliferating cell nuclear antigen (PCNA), which plays a critical role in MMR at step(s) prior to DNA resynthesis, disrupted preformed ternary complexes. These observations, in conjunction with experiments performed with streptavidin end-blocked mismatch substrates, suggested that PCNA interacts with an MSH-MLH complex formed on DNA mispairs.

  17. DnaN clamp zones provide a platform for spatiotemporal coupling of mismatch detection to DNA replication.

    PubMed

    Lenhart, Justin S; Sharma, Anushi; Hingorani, Manju M; Simmons, Lyle A

    2013-02-01

    Mismatch repair (MMR) increases the fidelity of DNA replication by identifying and correcting replication errors. Processivity clamps are vital components of DNA replication and MMR, yet the mechanism and extent to which they participate in MMR remains unclear. We investigated the role of the Bacillus subtilis processivity clamp DnaN, and found that it serves as a platform for mismatch detection and coupling of repair to DNA replication. By visualizing functional MutS fluorescent fusions in vivo, we find that MutS forms foci independent of mismatch detection at sites of replication (i.e. the replisome). These MutS foci are directed to the replisome by DnaN clamp zones that aid mismatch detection by targeting the search to nascent DNA. Following mismatch detection, MutS disengages from the replisome, facilitating repair. We tested the functional importance of DnaN-mediated mismatch detection for MMR, and found that it accounts for 90% of repair. This high dependence on DnaN can be bypassed by increasing MutS concentration within the cell, indicating a secondary mode of detection in vivo whereby MutS directly finds mismatches without associating with the replisome. Overall, our results provide new insight into the mechanism by which DnaN couples mismatch recognition to DNA replication in living cells.

  18. PolyA Deletions in Hereditary Nonpolyposis Colorectal Cancer

    PubMed Central

    Kim, Kyoung-Mee; Salovaara, Reijo; Mecklin, Jukka-Pekka; Järvinen, Heikki J.; Aaltonen, Lauri A.; Shibata, Darryl

    2002-01-01

    Microsatellite instability (MSI) secondary to loss of DNA mismatch repair (MMR) is present in adenomas and colorectal carcinomas from individuals with hereditary nonpolyposis colorectal cancer (HNPCC). To better characterize when MMR loss occurs during HNPCC progression, the extent of deletions in noncoding polyA sequences were compared between 6 adenomas (all ≤1.0 cm in size) and 10 cancers. Numbers of deleted bases reflect time since loss of MMR because polyA deletions are stepwise. Adenoma deletions were nearly the same (85%) as the cancers with sum total deletions at four different polyA loci of −32.7 bases in adenomas and −38.4 bases in cancers. Intervals between negative clinical examinations and tumor removal (average of 2.1 years) were known for six tumors. There were no significant differences in the extent of deletions in tumors removed under clinical surveillance (−34.8 bases) versus tumors removed without prior negative examinations (−36.5 bases). These findings illustrate that MSI is extensive in both small adenomas, and tumors which appear after negative clinical examinations, consistent with an early loss of MMR in HNPCC, even before a gatekeeper mutation. PMID:11943734

  19. Evolution in Fast Forward: a Potential Role for Mutators in Accelerating Staphylococcus aureus Pathoadaptation

    PubMed Central

    Canfield, Gregory S.; Schwingel, Johanna M.; Foley, Matthew H.; Vore, Kelly L.; Boonanantanasarn, Kanitsak; Gill, Ann L.; Sutton, Mark D.

    2013-01-01

    Pathogen evolution and subsequent phenotypic heterogeneity during chronic infection are proposed to enhance Staphylococcus aureus survival during human infection. We tested this theory by genetically and phenotypically characterizing strains with mutations constructed in the mismatch repair (MMR) and oxidized guanine (GO) system, termed mutators, which exhibit increased spontaneous-mutation frequencies. Analysis of these mutators revealed not only strain-dependent increases in the spontaneous-mutation frequency but also shifts in mutational type and hot spots consistent with loss of GO or MMR functions. Although the GO and MMR systems are relied upon in some bacterial species to prevent reactive oxygen species-induced DNA damage, no deficit in hydrogen peroxide sensitivity was found when either of these DNA repair pathways was lost in S. aureus. To gain insight into the contribution of increased mutation supply to S. aureus pathoadaptation, we measured the rate of α-hemolysin and staphyloxanthin inactivation during serial passage. Detection of increased rates of α-hemolysin and staphyloxanthin inactivation in GO and MMR mutants suggests that these strains are capable of modifying virulence phenotypes implicated in mediating infection. Accelerated derivation of altered virulence phenotypes, combined with the absence of increased ROS sensitivity, highlights the potential of mutators to drive pathoadaptation in the host and serve as catalysts for persistent infections. PMID:23204459

  20. Protein Condensation

    NASA Astrophysics Data System (ADS)

    Gunton, James D.; Shiryayev, Andrey; Pagan, Daniel L.

    2007-09-01

    Preface; 1. Introduction; 2. Globular protein structure; 3. Experimental methods; 4. Thermodynamics and statistical mechanics; 5. Protein-protein interactions; 6. Theoretical studies of equilibrium; 7. Nucleation theory; 8. Experimental studies of nucleation; 9. Lysozyme; 10. Some other globular proteins; 11. Membrane proteins; 12. Crystallins and cataracts; 13. Sickle hemoglobin and sickle cell anemia; 14, Alzheimer's disease; Index.

  1. Protein Condensation

    NASA Astrophysics Data System (ADS)

    Gunton, James D.; Shiryayev, Andrey; Pagan, Daniel L.

    2014-07-01

    Preface; 1. Introduction; 2. Globular protein structure; 3. Experimental methods; 4. Thermodynamics and statistical mechanics; 5. Protein-protein interactions; 6. Theoretical studies of equilibrium; 7. Nucleation theory; 8. Experimental studies of nucleation; 9. Lysozyme; 10. Some other globular proteins; 11. Membrane proteins; 12. Crystallins and cataracts; 13. Sickle hemoglobin and sickle cell anemia; 14, Alzheimer's disease; Index.

  2. Whole Gene Capture Analysis of 15 CRC Susceptibility Genes in Suspected Lynch Syndrome Patients

    PubMed Central

    van Wezel, Tom; Jagmohan-Changur, Shantie C.; Ruano, Dina; van der Klift, Heleen M.; van den Akker, Brendy E. W. M.; Laros, Jeroen F. J.; van Galen, Michiel; Wagner, Anja; Letteboer, Tom G. W.; Gómez-García, Encarna B.; Tops, Carli M. J.; Vasen, Hans F.; Devilee, Peter; Hes, Frederik J.; Morreau, Hans; Wijnen, Juul T.

    2016-01-01

    Background and Aims Lynch Syndrome (LS) is caused by pathogenic germline variants in one of the mismatch repair (MMR) genes. However, up to 60% of MMR-deficient colorectal cancer cases are categorized as suspected Lynch Syndrome (sLS) because no pathogenic MMR germline variant can be identified, which leads to difficulties in clinical management. We therefore analyzed the genomic regions of 15 CRC susceptibility genes in leukocyte DNA of 34 unrelated sLS patients and 11 patients with MLH1 hypermethylated tumors with a clear family history. Methods Using targeted next-generation sequencing, we analyzed the entire non-repetitive genomic sequence, including intronic and regulatory sequences, of 15 CRC susceptibility genes. In addition, tumor DNA from 28 sLS patients was analyzed for somatic MMR variants. Results Of 1979 germline variants found in the leukocyte DNA of 34 sLS patients, one was a pathogenic variant (MLH1 c.1667+1delG). Leukocyte DNA of 11 patients with MLH1 hypermethylated tumors was negative for pathogenic germline variants in the tested CRC susceptibility genes and for germline MLH1 hypermethylation. Somatic DNA analysis of 28 sLS tumors identified eight (29%) cases with two pathogenic somatic variants, one with a VUS predicted to pathogenic and LOH, and nine cases (32%) with one pathogenic somatic variant (n = 8) or one VUS predicted to be pathogenic (n = 1). Conclusions This is the first study in sLS patients to include the entire genomic sequence of CRC susceptibility genes. An underlying somatic or germline MMR gene defect was identified in ten of 34 sLS patients (29%). In the remaining sLS patients, the underlying genetic defect explaining the MMRdeficiency in their tumors might be found outside the genomic regions harboring the MMR and other known CRC susceptibility genes. PMID:27300758

  3. Association of MSH6 mutation with glioma susceptibility, drug resistance and progression

    PubMed Central

    Xie, Chaoran; Sheng, Hansong; Zhang, Nu; Li, Shiting; Wei, Xiangyu; Zheng, Xuesheng

    2016-01-01

    MutS homolog 6 (MSH6) is one of the mismatch repair proteins and is encoded by the MSH6 gene, which is located on chromosome 2 and is 23,806 bp in length, including 10 exons and 83 untranslated regions. The MSH6 protein consists of 1,358 amino acid residues and forms a heterodimer with another mismatch repair protein, MSH2. The MSH2-MSH6 heterodimeric complex is able to recognize base-base substitution and single-base insertion/deletion mismatches. Germline mutations of MSH6 lead to high susceptibility to glioma, as well as a number of benign or malignant tumors in other organs. However, somatic MSH6 mutations are not associated with susceptibility to glioma. Somatic MSH6 mutations usually follow temozolomide treatment and result in resistance to temozolomide. Subsequently, MSH6 mutations cause a hypermutation in the glioma cell genome, which may accelerate tumor progression. PMID:27446556

  4. NDR proteins

    PubMed Central

    Jones, Alan M

    2010-01-01

    N-myc downregulated (NDR) genes were discovered more than fifteen years ago. Indirect evidence support a role in tumor progression and cellular differentiation, but their biochemical function is still unknown. Our detailed analyses on Arabidopsis NDR proteins (deisgnated NDR-like, NDL) show their involvement in altering auxin transport, local auxin gradients and expression level of auxin transport proteins. Animal NDL proteins may be involved in membrane recycling of E-cadherin and effector for the small GTPase. In light of these findings, we hypothesize that NDL proteins regulate vesicular trafficking of auxin transport facilitator PIN proteins by biochemically alterating the local lipid environment of PIN proteins. PMID:20724844

  5. A proposal: Evolution of PCNA's role as a marker of newly replicated DNA

    PubMed Central

    Georgescu, Roxana; Langston, Lance; O'Donnell, Mike

    2015-01-01

    Processivity clamps that hold DNA polymerases to DNA for processivity were the first proteins known to encircle the DNA duplex. At the time, polymerase processivity was thought to be the only function of ring shaped processivity clamps. But studies from many laboratories have identified numerous proteins that bind and function with sliding clamps. Among these processes are mismatch repair and nucleosome assembly. Interestingly, there exist polymerases that are highly processive and do not require clamps. Hence, DNA polymerase processivity does not intrinsically require that sliding clamps evolved for this purpose. We propose that polymerases evolved to require clamps as a way of ensuring that clamps are deposited on newly replicated DNA. These clamps are then used on the newly replicated daughter strands, for processes important to genomic integrity, such as mismatch repair and the assembly of nucleosomes to maintain epigenetic states of replicating cells during development. PMID:25704660

  6. P53 Staining Correlates with Tumor Type and Location in Sebaceous Neoplasms

    PubMed Central

    Shalin, Sara C.; Sakharpe, Aniket; Lyle, Stephen; Lev, Dina; Calonje, Eduardo; Lazar, Alexander J.

    2010-01-01

    Sebaceous neoplasms are commonly considered in their relationship to the Muir-Torre Syndrome and the now well-documented loss of DNA mismatch repair proteins leading to microsatellite instability. However, sebaceous neoplasms showing microsatellite instability comprise only a subset of this group of tumors, and thus alternative tumorigenic mechanisms must exist. This paper explores the relationship of p53, a tumor suppressor implicated in other cutaneous malignancies, and sebaceous neoplasia. We examined 94 sebaceous tumors from 92 patients. Tumors with strong nuclear p53 staining were significantly associated with the diagnosis of sebaceous carcinoma compared to benign sebaceous lesions, most notably for periocular carcinomas. Importantly, nuclear mismatch repair protein expression was intact in all lesions showing p53 alterations, suggesting that p53 dysfunction may represent a divergent pathway in the molecular pathogenesis of these tumors. PMID:22441365

  7. Proteins (image)

    MedlinePlus

    ... is an important nutrient that builds muscles and bones and provides energy. Protein can help with weight control because it helps you feel full and satisfied from your meals. The healthiest proteins are the leanest. This means ...

  8. Protein Structure

    ERIC Educational Resources Information Center

    Asmus, Elaine Garbarino

    2007-01-01

    Individual students model specific amino acids and then, through dehydration synthesis, a class of students models a protein. The students clearly learn amino acid structure, primary, secondary, tertiary, and quaternary structure in proteins and the nature of the bonds maintaining a protein's shape. This activity is fun, concrete, inexpensive and…

  9. A Changing Landscape of Advanced Prostate Cancer: Understanding Mechanisms of Resistance to Potent Hormonal Therapies

    DTIC Science & Technology

    2015-10-01

    and CpG DNA methylation integrative analyses point to key drivers of NEPC including loss of RB1 and TP53 and primarily epigenetic changes...sequencing (WES) and other molecular analyses of tumor and germline DNA from patients with advanced disease and to follow patients prospectively to...protein expression alterations involving DNA mismatch repair genes consistent with prior studies. The significant overlap between CRPC-Adeno and CRPC

  10. Targeting of the MUC1-C Oncoprotein in Colitis-Associated Colorectal Cancer

    DTIC Science & Technology

    2014-11-01

    represents an attractive target for the treatment of colon cancer . REFERENCES 1. Kufe, D, Mucins in cancer : function, prognosis and therapy...Nature Reviews Cancer , 2009. 9:874-85. 2. Byrd, JC and Bresalier RS, Mucins and mucin binding proteins in colorectal cancer . Cancer Metastasis Rev...Gastroenterol, 2008. 14:2139-41. 5. Lugli, A, et al., Prognostic significance of mucins in colorectal cancer with different DNA mismatch-repair status. J

  11. Mature microsatellites: mechanisms underlying dinucleotide microsatellite mutational biases in human cells.

    PubMed

    Baptiste, Beverly A; Ananda, Guruprasad; Strubczewski, Noelle; Lutzkanin, Andrew; Khoo, Su Jen; Srikanth, Abhinaya; Kim, Nari; Makova, Kateryna D; Krasilnikova, Maria M; Eckert, Kristin A

    2013-03-01

    Dinucleotide microsatellites are dynamic DNA sequences that affect genome stability. Here, we focused on mature microsatellites, defined as pure repeats of lengths above the threshold and unlikely to mutate below it in a single mutational event. We investigated the prevalence and mutational behavior of these sequences by using human genome sequence data, human cells in culture, and purified DNA polymerases. Mature dinucleotides (≥10 units) are present within exonic sequences of >350 genes, resulting in vulnerability to cellular genetic integrity. Mature dinucleotide mutagenesis was examined experimentally using ex vivo and in vitro approaches. We observe an expansion bias for dinucleotide microsatellites up to 20 units in length in somatic human cells, in agreement with previous computational analyses of germ-line biases. Using purified DNA polymerases and human cell lines deficient for mismatch repair (MMR), we show that the expansion bias is caused by functional MMR and is not due to DNA polymerase error biases. Specifically, we observe that the MutSα and MutLα complexes protect against expansion mutations. Our data support a model wherein different MMR complexes shift the balance of mutations toward deletion or expansion. Finally, we show that replication fork progression is stalled within long dinucleotides, suggesting that mutational mechanisms within long repeats may be distinct from shorter lengths, depending on the biochemistry of fork resolution. Our work combines computational and experimental approaches to explain the complex mutational behavior of dinucleotide microsatellites in humans.

  12. Meat intake, cooking methods, dietary carcinogens, and colorectal cancer risk: findings from the Colorectal Cancer Family Registry.

    PubMed

    Joshi, Amit D; Kim, Andre; Lewinger, Juan Pablo; Ulrich, Cornelia M; Potter, John D; Cotterchio, Michelle; Le Marchand, Loic; Stern, Mariana C

    2015-06-01

    Diets high in red meat and processed meats are established colorectal cancer (CRC) risk factors. However, it is still not well understood what explains this association. We conducted comprehensive analyses of CRC risk and red meat and poultry intakes, taking into account cooking methods, level of doneness, estimated intakes of heterocyclic amines (HCAs) that accumulate during meat cooking, tumor location, and tumor mismatch repair proficiency (MMR) status. We analyzed food frequency and portion size data including a meat cooking module for 3364 CRC cases, 1806 unaffected siblings, 136 unaffected spouses, and 1620 unaffected population-based controls, recruited into the CRC Family Registry. Odds ratios (OR) and 95% confidence intervals (CI) for nutrient density variables were estimated using generalized estimating equations. We found no evidence of an association between total nonprocessed red meat or total processed meat and CRC risk. Our main finding was a positive association with CRC for pan-fried beefsteak (P(trend) < 0.001), which was stronger among MMR deficient cases (heterogeneity P = 0.059). Other worth noting associations, of borderline statistical significance after multiple testing correction, were a positive association between diets high in oven-broiled short ribs or spareribs and CRC risk (P(trend) = 0.002), which was also stronger among MMR-deficient cases, and an inverse association with grilled hamburgers (P(trend) = 0.002). Our results support the role of specific meat types and cooking practices as possible sources of human carcinogens relevant for CRC risk.

  13. Analysis of crossover breakpoints yields new insights into the nature of the gene conversion events associated with large NF1 deletions mediated by nonallelic homologous recombination.

    PubMed

    Bengesser, Kathrin; Vogt, Julia; Mussotter, Tanja; Mautner, Victor-Felix; Messiaen, Ludwine; Cooper, David N; Kehrer-Sawatzki, Hildegard

    2014-02-01

    Large NF1 deletions are mediated by nonallelic homologous recombination (NAHR). An in-depth analysis of gene conversion operating in the breakpoint-flanking regions of large NF1 deletions was performed to investigate whether the rate of discontinuous gene conversion during NAHR with crossover is increased, as has been previously noted in NAHR-mediated rearrangements. All 20 germline type-1 NF1 deletions analyzed were mediated by NAHR associated with continuous gene conversion within the breakpoint-flanking regions. Continuous gene conversion was also observed in 31/32 type-2 NF1 deletions investigated. In contrast to the meiotic type-1 NF1 deletions, type-2 NF1 deletions are predominantly of post-zygotic origin. Our findings therefore imply that the mitotic as well as the meiotic NAHR intermediates of large NF1 deletions are processed by long-patch mismatch repair (MMR), thereby ensuring gene conversion tract continuity instead of the discontinuous gene conversion that is characteristic of short-patch repair. However, the single type-2 NF1 deletion not exhibiting continuous gene conversion was processed without MMR, yielding two different deletion-bearing chromosomes, which were distinguishable in terms of their breakpoint positions. Our findings indicate that MMR failure during NAHR, followed by post-meiotic/mitotic segregation, has the potential to give rise to somatic mosaicism in human genomic rearrangements by generating breakpoint heterogeneity.

  14. Therapeutic proteins.

    PubMed

    Dimitrov, Dimiter S

    2012-01-01

    Protein-based therapeutics are highly successful in clinic and currently enjoy unprecedented recognition of their potential. More than 100 genuine and similar number of modified therapeutic proteins are approved for clinical use in the European Union and the USA with 2010 sales of US$108 bln; monoclonal antibodies (mAbs) accounted for almost half (48%) of the sales. Based on their pharmacological activity, they can be divided into five groups: (a) replacing a protein that is deficient or abnormal; (b) augmenting an existing pathway; (c) providing a novel function or activity; (d) interfering with a molecule or organism; and (e) delivering other compounds or proteins, such as a radionuclide, cytotoxic drug, or effector proteins. Therapeutic proteins can also be grouped based on their molecular types that include antibody-based drugs, Fc fusion proteins, anticoagulants, blood factors, bone morphogenetic proteins, engineered protein scaffolds, enzymes, growth factors, hormones, interferons, interleukins, and thrombolytics. They can also be classified based on their molecular mechanism of activity as (a) binding non-covalently to target, e.g., mAbs; (b) affecting covalent bonds, e.g., enzymes; and (c) exerting activity without specific interactions, e.g., serum albumin. Most protein therapeutics currently on the market are recombinant and hundreds of them are in clinical trials for therapy of cancers, immune disorders, infections, and other diseases. New engineered proteins, including bispecific mAbs and multispecific fusion proteins, mAbs conjugated with small molecule drugs, and proteins with optimized pharmacokinetics, are currently under development. However, in the last several decades, there are no conceptually new methodological developments comparable, e.g., to genetic engineering leading to the development of recombinant therapeutic proteins. It appears that a paradigm change in methodologies and understanding of mechanisms is needed to overcome major

  15. Polymorphisms in DNA Repair Genes, Recreational Physical Activity and Breast Cancer Risk

    PubMed Central

    McCullough, Lauren E.; Santella, Regina M.; Cleveland, Rebecca J.; Millikan, Robert C.; Olshan, Andrew F.; North, Kari E.; Bradshaw, Patrick T.; Eng, Sybil M.; Terry, Mary Beth; Shen, Jing; Crew, Katherine D.; Rossner, Pavel; Teitelbaum, Susan L.; Neugut, Alfred I.; Gammon, Marilie D.

    2013-01-01

    The mechanisms driving the inverse association between recreational physical activity (RPA) and breast cancer risk are complex. While exercise is associated with increased reactive oxygen species production it may also improve damage repair systems, particularly those that operate on single-strand breaks including base excision repair (BER), nucleotide excision repair (NER) and mismatch repair (MMR). Of these repair pathways, the role of MMR in breast carcinogenesis is least investigated. Polymorphisms in MMR or other DNA repair gene variants may modify the association between RPA and breast cancer incidence. We investigated the individual and joint effects of variants in three MMR pathway genes (MSH3, MLH1 and MSH2) on breast cancer occurrence using resources from the Long Island Breast Cancer Study Project. We additionally characterized interactions between RPA and genetic polymorphisms in MMR, BER and NER pathways. We found statistically significant multiplicative interactions (p<0.05) between MSH2 and MLH1, as well as between postmenopausal RPA and four variants in DNA repair (XPC-Ala499Val, XPF-Arg415Gln, XPG-Asp1104His and MLH1-lle219Val). Significant risk reductions were observed among highly active women with the common genotype for XPC (OR=0.54; 95% CI, 0.36–0.81) and XPF (OR=0.62; 95% CI, 0.44–0.87), as well as among active women who carried at least one variant allele in XPG (OR=0.46; 95% CI, 0.29–0.77) and MLH1 (OR=0.46; 95% CI, 0.30–0.71). Our data show that women with minor alleles in both MSH2 and MLH1 could be at increased breast cancer risk. RPA may be modified by genes in the DNA repair pathway, and merit further investigation. PMID:23852586

  16. Aspirin, Ibuprofen, and the Risk for Colorectal Cancer in Lynch Syndrome

    PubMed Central

    Ait Ouakrim, Driss; Dashti, Seyedeh Ghazaleh; Chau, Rowena; Buchanan, Daniel D.; Clendenning, Mark; Rosty, Christophe; Winship, Ingrid M.; Young, Joanne P.; Giles, Graham G.; Leggett, Barbara; Macrae, Finlay A.; Ahnen, Dennis J.; Casey, Graham; Gallinger, Steven; Haile, Robert W.; Le Marchand, Loïc; Thibodeau, Stephen N.; Lindor, Noralane M.; Newcomb, Polly A.; Potter, John D.; Baron, John A.; Hopper, John L.; Jenkins, Mark A.

    2015-01-01

    Background: Inheritance of a germline mutation in one of the DNA mismatch repair (MMR) genes MLH1, MSH2, MSH6, and PMS2 causes a high risk of colorectal and other cancers (Lynch Syndrome). Use of aspirin has been shown to be associated with a reduced risk of colorectal cancer for the general population as well as for MMR gene mutation carriers. The aim of this study was to determine whether use of aspirin and ibuprofen in a nontrial setting is associated with the risk of colorectal cancer risk for MMR gene mutation carriers. Methods: We included 1858 participants in the Colon Cancer Family Registry who had been found to have a pathogenic germline mutation in a MMR gene (carriers). We used weighted Cox proportional hazards regression to estimate hazard ratios (HRs) and 95% confidence intervals (CIs). All statistical tests were two-sided. Results: A total of 714 carriers (38%) were diagnosed with colorectal cancer at a mean age of 42.4 (standard deviation 10.6) years. A reduced risk of colorectal cancer was associated with aspirin use (for 1 month to 4.9 years: HR = 0.49, 95% CI = 0.27 to 0.90, P = .02; for ≥5 years: HR = 0.25, 95% CI = 0.10 to 0.62, P = .003) and ibuprofen use (for 1 month to 4.9 years: HR = 0.38, 95% CI = 0.18 to 0.79, P = .009; for ≥5 years: HR = 0.26, 95% CI = 0.10 to 0.69, P = .007), compared with less than one month of use. Conclusion: Our results provide additional evidence that, for MMR gene mutation carriers, use of aspirin and ibuprofen might be effective in reducing their high risk of colorectal cancer. PMID:26109217

  17. First report of a de novo germline mutation in the MLH1 gene.

    PubMed

    Stulp, Rein P; Vos, Yvonne J; Mol, Bart; Karrenbeld, Arend; de Raad, Monique; van der Mijle, Huub J C; Sijmons, Rolf H

    2006-02-07

    Hereditary non-polyposis colorectal carcinoma (HNPCC) is an autosomal dominant disorder associated with colorectal and endometrial cancer and a range of other tumor types. Germline mutations in the DNA mismatch repair (MMR) genes, particularly MLH1, MSH2, and MSH6, underlie this disorder. The vast majority of these HNPCC-associated mutations have been proven, or assumed, given the family history of cancer, to be transmitted through several generations. To the best of our knowledge, only a single case of a de novo germline MMR gene mutation (in MSH2) has been reported till now. Here, we report a patient with a de novo mutation in MLH1. We identified a MLH1 Q701X truncating mutation in the blood lymphocytes of a male who had been diagnosed with rectal cancer at the age of 35. His family history of cancer was negative for the first- and second-degree relatives. The mutation could not be detected in the patient' parents and sibling and paternity was confirmed with a set of highly polymorphic markers. Non-penetrance and small family size is the common explanation of verified negative family histories of cancer in patients with a germline MMR gene mutation. However, in addition to some cases explained by non-paternity, de novo germline mutations should be considered as a possible explanation as well. As guidelines that stress not to restrict MMR gene mutation testing to patients with a positive family history are more widely introduced, more cases of de novo MMR gene germline mutations may be revealed.

  18. Structure of the Endonuclease Domain of MutL: Unlicensed to Cut

    SciTech Connect

    Pillon, M.; Lorenowicz, J; Uckelmann, M; Klocko, A; Chung, Y; Modrich, P; Walker, G; Simmons, L; Friedhoff, P; Guarne, A

    2010-01-01

    DNA mismatch repair corrects errors that have escaped polymerase proofreading, increasing replication fidelity 100- to 1000-fold in organisms ranging from bacteria to humans. The MutL protein plays a central role in mismatch repair by coordinating multiple protein-protein interactions that signal strand removal upon mismatch recognition by MutS. Here we report the crystal structure of the endonuclease domain of Bacillus subtilis MutL. The structure is organized in dimerization and regulatory subdomains connected by a helical lever spanning the conserved endonuclease motif. Additional conserved motifs cluster around the lever and define a Zn{sup 2+}-binding site that is critical for MutL function in vivo. The structure unveils a powerful inhibitory mechanism to prevent undesired nicking of newly replicated DNA and allows us to propose a model describing how the interaction with MutS and the processivity clamp could license the endonuclease activity of MutL. The structure also provides a molecular framework to propose and test additional roles of MutL in mismatch repair.

  19. High frequency strand slippage mutations in CTCF in MSI-positive endometrial cancers.

    PubMed

    Zighelboim, Israel; Mutch, David G; Knapp, Amy; Ding, Li; Xie, Mingchao; Cohn, David E; Goodfellow, Paul J

    2014-01-01

    Tumors with defective mismatch repair acquire large numbers of strand slippage mutations including frameshifts in coding sequence repeats. We identified a mutational hotspot, p.T204fs, in the insulator-binding protein (CTCF) in MSI-positive endometrial cancers. Although CTCF was described as a significantly mutated gene by the endometrial cancer TCGA, the A₇ track variants leading to T204 frameshifts were not reported. Reanalysis of TCGA data using Pindel revealed frequent T204fs mutations, confirming CTCF is an MSI target gene and revealed the same frameshifts in tumors with intact mismatch repair. We show that T204fs transcripts are subject to nonsense-mediated decay and as such, T204fs mutations are unlikely to act as dominant negatives. The spectrum and pattern of mutations observed is consistent with CTCF acting as a haploinsufficient tumor suppressor.

  20. Hereditary nonpolyposis colorectal cancer: Review of clinical, molecular genetics, and counseling aspects

    SciTech Connect

    Bellacosa, A.; Genuardi, M.; Anti, M.; Viel, A.; Ponz de Leon, M.

    1996-04-24

    Lynch syndrome, or hereditary nonpolyposis colon cancer (HNPCC), is an autosomal dominant disease accounting for approximately 1-5% of all colorectal cancer cases. Due to the lack of pathognomonic morphological or biomolecular markers, HNPCC has traditionally posed unique problems to clinicians and geneticists alike, both in terms of diagnosis and clinical management. Recently, novel insight into the pathogenesis of this syndrome has been provided by the identification of its molecular basis. In HNPCC families, germline mutations in any of four genes encoding proteins of a specialized DNA repair system, the mismatch repair, predispose to cancer development. Mutations in mismatch repair genes lead to an overall increase of the mutation rate and are associated with a phenotype of length instability of microsatellite loci. The present report summarizes the clinicopathological aspects of HNPCC and reviews the most recent molecular and biochemical findings. 115 refs., 2 figs., 3 tabs.

  1. Msh2 deficiency leads to dysmyelination of the corpus callosum, impaired locomotion, and altered sensory function in mice

    PubMed Central

    Diouf, Barthelemy; Devaraju, Prakash; Janke, Laura J.; Fan, Yiping; Frase, Sharon; Eddins, Donnie; Peters, Jennifer L.; Kim, Jieun; Pei, Deqing; Cheng, Cheng; Zakharenko, Stanislav S.; Evans, William E.

    2016-01-01

    A feature in patients with constitutional DNA-mismatch repair deficiency is agenesis of the corpus callosum, the cause of which has not been established. Here we report a previously unrecognized consequence of deficiency in MSH2, a protein known primarily for its function in correcting nucleotide mismatches or insertions and deletions in duplex DNA caused by errors in DNA replication or recombination. We documented that Msh2 deficiency causes dysmyelination of the axonal projections in the corpus callosum. Evoked action potentials in the myelinated corpus callosum projections of Msh2-null mice were smaller than wild-type mice, whereas unmyelinated axons showed no difference. Msh2-null mice were also impaired in locomotive activity and had an abnormal response to heat. These findings reveal a novel pathogenic consequence of MSH2 deficiency, providing a new mechanistic hint to previously recognized neurological disorders in patients with inherited DNA-mismatch repair deficiency. PMID:27476972

  2. Whey Protein

    MedlinePlus

    ... inflammation (polymyalgia rheumatica). Taking whey protein in a dairy product twice daily for 8 weeks does not improve muscle function, walking speed, or other movement tests in people with polymyalgia rheumatica. Other conditions. More evidence is needed to rate whey protein for these uses.

  3. GNL3L Is a Nucleo-Cytoplasmic Shuttling Protein: Role in Cell Cycle Regulation.

    PubMed

    Thoompumkal, Indu Jose; Subba Rao, Malireddi Rama Krishna; Kumaraswamy, Anbarasu; Krishnan, Rehna; Mahalingam, Sundarasamy

    2015-01-01

    GNL3L is an evolutionarily conserved high molecular weight GTP binding nucleolar protein belonging to HSR1-MMR1 subfamily of GTPases. The present investigation reveals that GNL3L is a nucleo-cytoplasmic shuttling protein and its export from the nucleus is sensitive to Leptomycin B. Deletion mutagenesis reveals that the C-terminal domain (amino acids 501-582) is necessary and sufficient for the export of GNL3L from the nucleus and the exchange of hydrophobic residues (M567, L570 and 572) within the C-terminal domain impairs this process. Results from the protein-protein interaction analysis indicate that GNL3L interaction with CRM1 is critical for its export from the nucleus. Ectopic expression of GNL3L leads to lesser accumulation of cells in the 'G2/M' phase of cell cycle whereas depletion of endogenous GNL3L results in 'G2/M' arrest. Interestingly, cell cycle analysis followed by BrdU labeling assay indicates that significantly increased DNA synthesis occurs in cells expressing nuclear export defective mutant (GNL3L∆NES) compared to the wild type or nuclear import defective GNL3L. Furthermore, increased hyperphosphorylation of Rb at Serine 780 and the upregulation of E2F1, cyclins A2 and E1 upon ectopic expression of GNL3L∆NES results in faster 'S' phase progression. Collectively, the present study provides evidence that GNL3L is exported from the nucleus in CRM1 dependent manner and the nuclear localization of GNL3L is important to promote 'S' phase progression during cell proliferation.

  4. Total protein

    MedlinePlus

    ... 2016:chap 215. Read More Agammaglobulinemia Albumin - blood (serum) test Amino acids Antibody Burns Chronic Congenital nephrotic syndrome Fibrinogen blood test Glomerulonephritis Hemoglobin Liver disease Malabsorption Multiple myeloma Polycythemia vera Protein in diet ...

  5. Molecular Features and Methylation Status in Early Onset (≤40 Years) Colorectal Cancer: A Population Based, Case-Control Study

    PubMed Central

    Magnani, Giulia; Furlan, Daniela; Sahnane, Nora; Reggiani Bonetti, Luca; Domati, Federica; Pedroni, Monica

    2015-01-01

    Colorectal cancer is usually considered a disease of the elderly. However, a small fraction of patients develops colorectal cancer earlier. The aim of our study was to define the frequency of known hereditary colorectal syndromes and to characterise genetic and epigenetic features of early nonhereditary tumors. Thirty-three patients ≤40 years with diagnosis of colorectal cancer and 41 patients with disease at >60 years of age were investigated for MSI, Mismatch Repair proteins expression, KRAS and BRAF mutations, hypermethylation, and LINE-1 hypomethylation. Detection of germline mutations was performed in Mismatch Repair, APC and MUTYH genes. Early onset colorectal cancer showed a high incidence of hereditary forms (18%). KRAS mutations were detected in 36% of early nonhereditary tumors. Early onset colorectal cancer disclosed an average number of methylated genes significantly lower when compared to the controls (p = 0.02). Finally both of the two groups were highly methylated in ESR1, GATA5, and WT1 genes and were similar for LINE-1 hypomethylation. The genetic make-up of carcinomas differs from young to elderly patients. Early onset tumors showed more frequently a constitutional defective of Mismatch Repair System and a minor number of methylated genes. Hypermethylation of ESR1, GATA5, and WT1 genes suggests possible markers in the earlier diagnosis of colorectal tumorigenesis. PMID:26557847

  6. A Mutation in a Saccharomyces Cerevisiae Gene (Rad3) Required for Nucleotide Excision Repair and Transcription Increases the Efficiency of Mismatch Correction

    PubMed Central

    Yang, Y.; Johnson, A. L.; Johnston, L. H.; Siede, W.; Friedberg, E. C.; Ramachandran, K.; Kunz, B. A.

    1996-01-01

    RAD3 functions in DNA repair and transcription in Saccharomyces cerevisiae and particular rad3 alleles confer a mutator phenotype, possibly as a consequence of defective mismatch correction. We assessed the potential involvement of the Rad3 protein in mismatch correction by comparing heteroduplex repair in isogenic rad3-1 and wild-type strains. The rad3-1 allele increased the spontaneous mutation rate but did not prevent heteroduplex repair or bias its directionality. Instead, the efficiency of mismatch correction was enhanced in the rad3-1 strain. This surprising result prompted us to examine expression of yeast mismatch repair genes. We determined that MSH2, but not MLH1, is transcriptionally regulated during the cell-cycle like PMS1, and that rad3-1 does not increase the transcript levels for these genes in log phase cells. These observations suggest that the rad3-1 mutation gives rise to an enhanced efficiency of mismatch correction via a process that does not involve transcriptional regulation of mismatch repair. Interestingly, mismatch repair also was more efficient when error-editing by yeast DNA polymerase δ was eliminated. We discuss our results in relation to possible mechanisms that may link the rad3-1 mutation to mismatch correction efficiency. PMID:8889512

  7. Protein Crystallizability.

    PubMed

    Smialowski, Pawel; Wong, Philip

    2016-01-01

    Obtaining diffracting quality crystals remains a major challenge in protein structure research. We summarize and compare methods for selecting the best protein targets for crystallization, construct optimization and crystallization condition design. Target selection methods are divided into algorithms predicting the chance of successful progression through all stages of structural determination (from cloning to solving the structure) and those focusing only on the crystallization step. We tried to highlight pros and cons of different approaches examining the following aspects: data size, redundancy and representativeness, overfitting during model construction, and results evaluation. In summary, although in recent years progress was made and several sequence properties were reported to be relevant for crystallization, the successful prediction of protein crystallization behavior and selection of corresponding crystallization conditions continue to challenge structural researchers.

  8. Protein Crystallization

    NASA Technical Reports Server (NTRS)

    Chernov, Alexander A.

    2005-01-01

    Nucleation, growth and perfection of protein crystals will be overviewed along with crystal mechanical properties. The knowledge is based on experiments using optical and force crystals behave similar to inorganic crystals, though with a difference in orders of magnitude in growing parameters. For example, the low incorporation rate of large biomolecules requires up to 100 times larger supersaturation to grow protein, rather than inorganic crystals. Nucleation is often poorly reproducible, partly because of turbulence accompanying the mixing of precipitant with protein solution. Light scattering reveals fluctuations of molecular cluster size, its growth, surface energies and increased clustering as protein ages. Growth most often occurs layer-by-layer resulting in faceted crystals. New molecular layer on crystal face is terminated by a step where molecular incorporation occurs. Quantitative data on the incorporation rate will be discussed. Rounded crystals with molecularly disordered interfaces will be explained. Defects in crystals compromise the x-ray diffraction resolution crucially needed to find the 3D atomic structure of biomolecules. The defects are immobile so that birth defects stay forever. All lattice defects known for inorganics are revealed in protein crystals. Contribution of molecular conformations to lattice disorder is important, but not studied. This contribution may be enhanced by stress field from other defects. Homologous impurities (e.g., dimers, acetylated molecules) are trapped more willingly by a growing crystal than foreign protein impurities. The trapped impurities induce internal stress eliminated in crystals exceeding a critical size (part of mni for ferritin, lysozyme). Lesser impurities are trapped from stagnant, as compared to the flowing, solution. Freezing may induce much more defects unless quickly amorphysizing intracrystalline water.

  9. ATP binding and hydrolysis by Saccharomyces cerevisiae Msh2-Msh3 are differentially modulated by mismatch and double-strand break repair DNA substrates.

    PubMed

    Kumar, Charanya; Eichmiller, Robin; Wang, Bangchen; Williams, Gregory M; Bianco, Piero R; Surtees, Jennifer A

    2014-06-01

    In Saccharomyces cerevisiae, Msh2-Msh3-mediated mismatch repair (MMR) recognizes and targets insertion/deletion loops for repair. Msh2-Msh3 is also required for 3' non-homologous tail removal (3'NHTR) in double-strand break repair. In both pathways, Msh2-Msh3 binds double-strand/single-strand junctions and initiates repair in an ATP-dependent manner. However, we recently demonstrated that the two pathways have distinct requirements with respect to Msh2-Msh3 activities. We identified a set of aromatic residues in the nucleotide binding pocket (FLY motif) of Msh3 that, when mutated, disrupted MMR, but left 3'NHTR largely intact. One of these mutations, msh3Y942A, was predicted to disrupt the nucleotide sandwich and allow altered positioning of ATP within the pocket. To develop a mechanistic understanding of the differential requirements for ATP binding and/or hydrolysis in the two pathways, we characterized Msh2-Msh3 and Msh2-msh3Y942A ATP binding and hydrolysis activities in the presence of MMR and 3'NHTR DNA substrates. We observed distinct, substrate-dependent ATP hydrolysis and nucleotide turnover by Msh2-Msh3, indicating that the MMR and 3'NHTR DNA substrates differentially modify the ATP binding/hydrolysis activities of Msh2-Msh3. Msh2-msh3Y942A retained the ability to bind DNA and ATP but exhibited altered ATP hydrolysis and nucleotide turnover. We propose that both ATP and structure-specific repair substrates cooperate to direct Msh2-Msh3-mediated repair and suggest an explanation for the msh3Y942A separation-of-function phenotype.

  10. Female Hormonal Factors and the Risk of Endometrial Cancer in Lynch Syndrome

    PubMed Central

    Dashti, Seyedeh Ghazaleh; Chau, Rowena; Ouakrim, Driss Ait; Buchanan, Daniel D.; Clendenning, Mark; Young, Joanne P.; Winship, Ingrid M.; Arnold, Julie; Ahnen, Dennis J.; Haile, Robert W.; Casey, Graham; Gallinger, Steven; Thibodeau, Stephen N.; Lindor, Noralane M.; Le Marchand, Loïc; Newcomb, Polly A.; Potter, John D.; Baron, John A.; Hopper, John L.; Jenkins, Mark A.; Win, Aung Ko

    2015-01-01

    Importance Apart from hysterectomy, there is no consensus recommendation for reducing endometrial cancer risk for women with a mismatch repair (MMR) gene mutation (Lynch syndrome). Objective To investigate the association between hormonal factors and endometrial cancer risk in Lynch syndrome. Design, Setting, and Participants A retrospective cohort study including 1,128 women with a MMR gene mutation identified from the Colon Cancer Family Registry was conducted. Data were analyzed using a weighted cohort approach. Participants were recruited between 1997 and 2012, from centers across the United States, Australia, Canada, and New Zealand. Exposures Age at menarche, first and last live birth, and menopause, number of live births, hormonal contraceptive use, and postmenopausal hormone use. Main Outcome and Measures Self-reported diagnosis of endometrial cancer. Results Endometrial cancer was diagnosed in 133 women (incidence per 100 person-years, 0.29; 95% confidence interval [CI], 0.24 to 0.34). A lower risk of endometrial cancer was associated with later age at menarche (hazard ratio [HR] per year, 0.85 [95%CI, 0.73 to 0.99]; P=.04), parity (parous vs nulliparous: HR, 0.21 [95%CI, 0.10 to 0.42]; P<.001), and hormonal contraceptive use (≥1 year vs <1 year: HR, 0.39 [95%CI, 0.23 to 0.64]; P<.001). There was no statistically significant association between endometrial cancer and age at first and last live birth, age at menopause, and postmenopausal hormone use. Conclusions and Relevance For women with a MMR gene mutation, some endogenous and exogenous hormonal factors were associated with a lower risk of endometrial cancer. These directions and strengths of associations were similar to those for the general population. If replicated, these findings suggest that women with a MMR gene mutation may be counseled like the general population in regard to hormonal influences on endometrial cancer risk. PMID:26151267

  11. Background Mutational Features of the Radiation-Resistant Bacterium Deinococcus radiodurans.

    PubMed

    Long, Hongan; Kucukyildirim, Sibel; Sung, Way; Williams, Emily; Lee, Heewook; Ackerman, Matthew; Doak, Thomas G; Tang, Haixu; Lynch, Michael

    2015-09-01

    Deinococcus bacteria are extremely resistant to radiation, oxidation, and desiccation. Resilience to these factors has been suggested to be due to enhanced damage prevention and repair mechanisms, as well as highly efficient antioxidant protection systems. Here, using mutation-accumulation experiments, we find that the GC-rich Deinococcus radiodurans has an overall background genomic mutation rate similar to that of E. coli, but differs in mutation spectrum, with the A/T to G/C mutation rate (based on a total count of 88 A:T → G:C transitions and 82 A:T → C:G transversions) per site per generation higher than that in the other direction (based on a total count of 157 G:C → A:T transitions and 33 G:C → T:A transversions). We propose that this unique spectrum is shaped mainly by the abundant uracil DNA glycosylases reducing G:C → A:T transitions, adenine methylation elevating A:T → C:G transversions, and absence of cytosine methylation decreasing G:C → A:T transitions. As opposed to the greater than 100× elevation of the mutation rate in MMR(-) (DNA Mismatch Repair deficient) strains of most other organisms, MMR(-) D. radiodurans only exhibits a 4-fold elevation, raising the possibility that other DNA repair mechanisms compensate for a relatively low-efficiency DNA MMR pathway. As D. radiodurans has plentiful insertion sequence (IS) elements in the genome and the activities of IS elements are rarely directly explored, we also estimated the insertion (transposition) rate of the IS elements to be 2.50 × 10(-3) per genome per generation in the wild-type strain; knocking out MMR did not elevate the IS element insertion rate in this organism.

  12. Recombinant protein production technology

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Recombinant protein production is an important technology for antibody production, biochemical activity study, and structural determination during the post-genomic era. Limiting factors in recombinant protein production include low-level protein expression, protein precipitation, and loss of protein...

  13. Mycobacterium tuberculosis efpA encodes an efflux protein of the QacA transporter family.

    PubMed Central

    Doran, J L; Pang, Y; Mdluli, K E; Moran, A J; Victor, T C; Stokes, R W; Mahenthiralingam, E; Kreiswirth, B N; Butt, J L; Baron, G S; Treit, J D; Kerr, V J; Van Helden, P D; Roberts, M C; Nano, F E

    1997-01-01

    The Mycobacterium tuberculosis H37Rv efpA gene encodes a putative efflux protein, EfpA, of 55,670 Da. The deduced EfpA protein was similar in secondary structure to Pur8, MmrA, TcmA, LfrA, EmrB, and other members of the QacA transporter family (QacA TF) which mediate antibiotic and chemical resistance in bacteria and yeast. The predicted EfpA sequence possessed all transporter motifs characteristic of the QacA TF, including those associated with proton-antiport function and the motif considered to be specific to exporters. The 1,590-bp efpA open reading frame was G+C rich (65%), whereas the 40-bp region immediately upstream had an A+T bias (35% G+C). Reverse transcriptase-PCR assays indicated that efpA was expressed in vitro and in situ. Putative promoter sequences were partially overlapped by the A+T-rich region and by a region capable of forming alternative secondary structures indicative of transcriptional regulation in analogous systems. PCR single-stranded conformational polymorphism analysis demonstrated that these upstream flanking sequences and the 231-bp, 5' coding region are highly conserved among both drug-sensitive and multiply-drug-resistant isolates of M. tuberculosis. The efpA gene was present in the slow-growing human pathogens M. tuberculosis, Mycobacterium leprae, and Mycobacterium bovis and in the opportunistic human pathogens Mycobacterium avium and Mycobacterium intracellular. However, efpA was not present in 17 other opportunistically pathogenic or nonpathogenic mycobacterial species. PMID:9008277

  14. Protein inference: A protein quantification perspective.

    PubMed

    He, Zengyou; Huang, Ting; Liu, Xiaoqing; Zhu, Peijun; Teng, Ben; Deng, Shengchun

    2016-08-01

    In mass spectrometry-based shotgun proteomics, protein quantification and protein identification are two major computational problems. To quantify the protein abundance, a list of proteins must be firstly inferred from the raw data. Then the relative or absolute protein abundance is estimated with quantification methods, such as spectral counting. Until now, most researchers have been dealing with these two processes separately. In fact, the protein inference problem can be regarded as a special protein quantification problem in the sense that truly present proteins are those proteins whose abundance values are not zero. Some recent published papers have conceptually discussed this possibility. However, there is still a lack of rigorous experimental studies to test this hypothesis. In this paper, we investigate the feasibility of using protein quantification methods to solve the protein inference problem. Protein inference methods aim to determine whether each candidate protein is present in the sample or not. Protein quantification methods estimate the abundance value of each inferred protein. Naturally, the abundance value of an absent protein should be zero. Thus, we argue that the protein inference problem can be viewed as a special protein quantification problem in which one protein is considered to be present if its abundance is not zero. Based on this idea, our paper tries to use three simple protein quantification methods to solve the protein inference problem effectively. The experimental results on six data sets show that these three methods are competitive with previous protein inference algorithms. This demonstrates that it is plausible to model the protein inference problem as a special protein quantification task, which opens the door of devising more effective protein inference algorithms from a quantification perspective. The source codes of our methods are available at: http://code.google.com/p/protein-inference/.

  15. Leucine Zipper Down-regulated in Cancer-1 (LDOC1) interacts with Guanine nucleotide binding protein-like 3-like (GNL3L) to modulate Nuclear Factor-kappa B (NF-κB) signaling during cell proliferation.

    PubMed

    Thoompumkal, Indu Jose; Rehna, Krishnan; Anbarasu, Kumaraswamy; Mahalingam, Sundarasamy

    2016-12-01

    Guanine nucleotide binding protein-like 3-like (GNL3L) is an evolutionarily conserved putative nucleolar GTPase belonging to the HSR1-MMR1 family. In the present study, using protein-protein interaction assays, we show that Leucine Zipper Down-regulated in Cancer-1 (LDOC1) is a novel interacting partner of GNL3L. Furthermore, our results reveal that ectopic expression of LDOC1 destabilizes endogenous GNL3L levels and down modulates GNL3L-induced cell proliferation, in contrast, the knockdown of LDOC1 potentiates cell proliferation upon GNL3L expression. Interestingly, GNL3L upregulates NF-κB dependent transcriptional activity by modulating the expression of NF-κB subunit p65, which is reversed upon co-expression of LDOC1 with GNL3L. GNL3L also potentiates TNF-α mediated NF-κB activity. In addition, anti-apoptotic function of GNL3L is impaired upon p65 knockdown, suggesting its critical role in GNL3L mediated cell proliferation/survival. An inverse correlation of GNL3L and LDOC1 expression profiles in various tumor tissues from BioXpress database indicate their critical role in cancer. Collectively, our data provides evidence that GNL3L-LDOC1 interplay regulates cell proliferation through the modulation of NF-κB pathway during tumorigenesis.

  16. Epigenetic Loss of MLH1 Expression in Normal Human Hematopoietic Stem Cell Clones is Defined by the Promoter CpG Methylation Pattern Observed by High-Throughput Methylation Specific Sequencing

    PubMed Central

    Kenyon, Jonathan; Nickel-Meester, Gabrielle; Qing, Yulan; Santos-Guasch, Gabriela; Drake, Ellen; PingfuFu; Sun, Shuying; Bai, Xiaodong; Wald, David; Arts, Eric; Gerson, Stanton L.

    2016-01-01

    Normal human hematopoietic stem and progenitor cells (HPC) lose expression of MLH1, an important mismatch repair (MMR) pathway gene, with age. Loss of MMR leads to replication dependent mutational events and microsatellite instability observed in secondary acute myelogenous leukemia and other hematologic malignancies. Epigenetic CpG methylation upstream of the MLH1 promoter is a contributing factor to acquired loss of MLH1 expression in tumors of the epithelia and proximal mucosa. Using single molecule high-throughput bisulfite sequencing we have characterized the CpG methylation landscape from −938 to −337 bp upstream of the MLH1 transcriptional start site (position +0), from 30 hematopoietic colony forming cell clones (CFC) either expressing or not expressing MLH1. We identify a correlation between MLH1 promoter methylation and loss of MLH1 expression. Additionally, using the CpG site methylation frequencies obtained in this study we were able to generate a classification algorithm capable of sorting the expressing and non-expressing CFC. Thus, as has been previously described for many tumor cell types, we report for the first time a correlation between the loss of MLH1 expression and increased MLH1 promoter methylation in CFC derived from CD34+ selected hematopoietic stem and progenitor cells. PMID:27570841

  17. A simple and reproducible scoring system for EGFR in colorectal cancer: application to prognosis and prediction of response to preoperative brachytherapy.

    PubMed

    Zlobec, I; Vuong, T; Hayashi, S; Haegert, D; Tornillo, L; Terracciano, L; Lugli, A; Jass, J

    2007-03-12

    The aim of this study was to determine the predictive and prognostic value of epidermal growth factor receptor (EGFR) expression in rectal cancers treated with preoperative high-dose rate brachytherapy and in mismatch-repair (MMR)-proficient colorectal cancers (CRCs), respectively. We validate the use of receiver operating characteristic (ROC) curve analysis to select cutoff scores for EGFR overexpression for the end points studied. Immunohistochemistry (IHC) for EGFR was performed on 82 rectal tumour biopsies and 1197 MMR-proficient CRCs using a tissue microarray. Immunoreactivity was scored as the percentage of positive tumour cells by three pathologists and the inter-observer reliability was assessed. ROC curve-derived cutoffs were used to analyse the association of EGFR overexpression, tumour response and several clinicopathological features including survival. The scoring method was found to be reproducible in rectal cancer biopsies and CRCs. The selected cutoff scores from ROC curve analysis for each clinicopathological feature were highly consistent among pathologists. EGFR overexpression was associated with response to radiotherapy (P-value <0.001) and with worse survival time (P-value <0.001). In multivariate analysis, EGFR overexpression was independently associated with adverse prognosis (P-value <0.001). Epidermal growth factor receptor is a predictive marker of response to preoperative radiotherapy and an independent adverse prognostic factor CRC.

  18. PMS2 monoallelic mutation carriers: the known unknown

    PubMed Central

    Goodenberger, McKinsey L.; Thomas, Brittany C.; Riegert-Johnson, Douglas; Boland, C. Richard; Plon, Sharon E.; Clendenning, Mark; Ko Win, Aung; Senter, Leigha; Lipkin, Steven M.; Stadler, Zsofia K.; Macrae, Finlay A.; Lynch, Henry T.; Weitzel, Jeffrey N.; de la Chapelle, Albert; Syngal, Sapna; Lynch, Patrick; Parry, Susan; Jenkins, Mark A.; Gallinger, Steven; Holter, Spring; Aronson, Melyssa; Newcomb, Polly A.; Burnett, Terrilea; Le Marchand, Loïc; Pichurin, Pavel; Hampel, Heather; Terdiman, Jonathan P.; Lu, Karen H.; Thibodeau, Stephen; Lindor, Noralane M.

    2016-01-01

    Germline mutations in MLH1, MSH2, MSH6 and PMS2 have been shown to cause Lynch syndrome. The penetrance for cancer and tumor spectrum has been repeatedly studied and multiple professional societies have proposed clinical management guidelines for affected individuals. Several studies have demonstrated a reduced penetrance for monoallelic carriers of PMS2 mutations compared to the other mismatch repair (MMR) genes, but clinical management guidelines have largely proposed the same screening recommendations for all MMR gene carriers. The authors considered whether enough evidence existed to propose new screening guidelines specific to PMS2 mutation carriers with regard to age of onset and frequency of colonic screening. Published reports of PMS2 germline mutations were combined with unpublished cases from the authors’ research registries and clinical practices, and a discussion of potential modification of cancer screening guidelines was pursued. A total of 234 monoallelic PMS2 mutation carriers from 170 families were included. Approximately 8% of those with CRC were diagnosed under age 30 and each of these tumors presented on the left-side of the colon. As it is currently unknown what causes the early-onset of CRC in some families with monoallelic PMS2 germline mutations, the authors recommend against reducing cancer surveillance guidelines in families found having monoallelic PMS2 mutations in spite of the documented reduced penetrance. PMID:25856668

  19. Marked increase in biofilm-derived rough pneumococcal variants and rifampin-resistant strains not due to hex gene mutations.

    PubMed

    McEllistrem, M Catherine; Scott, Jennifer R; Zuniga-Castillo, Jacobo; Khan, Saleem A

    2009-06-01

    Otitis, pneumonia, and meningitis are tissue-based pneumococcal infections that can be associated with biofilms. The emergence of phenotypic rough variants, also known as acapsular small-colony variants, is essential for pneumococcal biofilm formation. These rough variants can increase nearly 100-fold in biofilms over time and can arise through single nucleotide polymorphisms (SNPs), deletions, or tandem duplications in the first gene of the capsular operon, cps3D. We detected a 100-fold increase in rifampin-resistant (Rif(r)) mutants in biofilms compared to planktonic cultures using a nonvaccine serotype 3 strain, which is causing an increasing number of cases of otitis in the 7-valent pneumococcal conjugate vaccine era. Since both rough variants and Rif(r) strains can arise through SNPs, they could emerge due to alteration of the mismatch repair (MMR) system. The Hex system, a pneumococcal MMR system, repairs mismatches during replication and transformation. In this study, no mutations were detected in the hexAB gene sequences among several rough variants with unique mutations in the cps3D gene. Within a hexA null mutant grown in broth, we detected only a 17.5-fold increase in rough variants compared to the wild-type parental strain. Taken together, these data suggest that mutations in the hex genes and modulation of hexA activity are unlikely to account for the generation of biofilm-derived rough variants.

  20. High-throughput SNP-based authentication of human cell lines

    PubMed Central

    Castro, Felipe; Dirks, Wilhelm G.; Fähnrich, Silke; Hotz-Wagenblatt, Agnes; Pawlita, Michael; Schmitt, Markus

    2012-01-01

    Use of false cell lines remains a major problem in biological research. Short tandem repeat (STR) profiling represents the gold standard technique for cell line authentication. However, mismatch repair (MMR) deficient cell lines are characterized by microsatellite instability, which could force allelic drifts in combination with a selective outgrowth of otherwise persisting side lines, and thus, are likely to be misclassified by STR-profiling. Based on the high-throughput Luminex platform, we developed a 24-plex SNP-profiling assay, called Multiplex Cell Authentication (MCA), for determining authentication of human cell lines. MCA was evaluated by analysing a collection of 436 human cell lines from the DSMZ, previously characterised by eight loci STR profiling. Both assays showed a very high degree of concordance and similar average matching probabilities (~1 × 10−8 for STR-profiling and ~1 × 10−9 for MCA). MCA enabled the detection of less than 3% contaminating human cells. Analysing MMR deficient cell lines, evidence was obtained for a higher robustness of the MCA compared to STR profiling. In conclusion, MCA could complement routine cell line authentication and replace the standard authentication STR technique in case of MSI cell lines. PMID:22700458

  1. Novel Implications in Molecular Diagnosis of Lynch Syndrome

    PubMed Central

    Liccardo, Raffaella; Izzo, Paola

    2017-01-01

    About 10% of total colorectal cancers are associated with known Mendelian inheritance, as Familial Adenomatous Polyposis (FAP) and Lynch syndrome (LS). In these cancer types the clinical manifestations of disease are due to mutations in high-risk alleles, with a penetrance at least of 70%. The LS is associated with germline mutations in the DNA mismatch repair (MMR) genes. However, the mutation detection analysis of these genes does not always provide informative results for genetic counseling of LS patients. Very often, the molecular analysis reveals the presence of variants of unknown significance (VUSs) whose interpretation is not easy and requires the combination of different analytical strategies to get a proper assessment of their pathogenicity. In some cases, these VUSs may make a more substantial overall contribution to cancer risk than the well-assessed severe Mendelian variants. Moreover, it could also be possible that the simultaneous presence of these genetic variants in several MMR genes that behave as low risk alleles might contribute in a cooperative manner to increase the risk of hereditary cancer. In this paper, through a review of the recent literature, we have speculated a novel inheritance model in the Lynch syndrome; this could pave the way toward new diagnostic perspectives. PMID:28250766

  2. Learning about Proteins

    MedlinePlus

    ... What Happens in the Operating Room? Learning About Proteins KidsHealth > For Kids > Learning About Proteins A A ... the foods you eat. continue Different Kinds of Protein Protein from animal sources, such as meat and ...

  3. Protein Microarray Technology

    PubMed Central

    Hall, David A.; Ptacek, Jason

    2007-01-01

    Protein chips have emerged as a promising approach for a wide variety of applications including the identification of protein-protein interactions, protein-phospholipid interactions, small molecule targets, and substrates of proteins kinases. They can also be used for clinical diagnostics and monitoring disease states. This article reviews current methods in the generation and applications of protein microarrays. PMID:17126887

  4. Length, protein protein interactions, and complexity

    NASA Astrophysics Data System (ADS)

    Tan, Taison; Frenkel, Daan; Gupta, Vishal; Deem, Michael W.

    2005-05-01

    The evolutionary reason for the increase in gene length from archaea to prokaryotes to eukaryotes observed in large-scale genome sequencing efforts has been unclear. We propose here that the increasing complexity of protein-protein interactions has driven the selection of longer proteins, as they are more able to distinguish among a larger number of distinct interactions due to their greater average surface area. Annotated protein sequences available from the SWISS-PROT database were analyzed for 13 eukaryotes, eight bacteria, and two archaea species. The number of subcellular locations to which each protein is associated is used as a measure of the number of interactions to which a protein participates. Two databases of yeast protein-protein interactions were used as another measure of the number of interactions to which each S. cerevisiae protein participates. Protein length is shown to correlate with both number of subcellular locations to which a protein is associated and number of interactions as measured by yeast two-hybrid experiments. Protein length is also shown to correlate with the probability that the protein is encoded by an essential gene. Interestingly, average protein length and number of subcellular locations are not significantly different between all human proteins and protein targets of known, marketed drugs. Increased protein length appears to be a significant mechanism by which the increasing complexity of protein-protein interaction networks is accommodated within the natural evolution of species. Consideration of protein length may be a valuable tool in drug design, one that predicts different strategies for inhibiting interactions in aberrant and normal pathways.

  5. Identification of Lynch Syndrome Among Patients With Colorectal Cancer

    PubMed Central

    Moreira, Leticia; Balaguer, Francesc; Lindor, Noralane; de la Chapelle, Albert; Hampel, Heather; Aaltonen, Lauri A.; Hopper, John L.; Le Marchand, Loic; Gallinger, Steven; Newcomb, Polly A.; Haile, Robert; Thibodeau, Stephen N.; Gunawardena, Shanaka; Jenkins, Mark A.; Buchanan, Daniel D.; Potter, John D.; Baron, John A.; Ahnen, Dennis J.; Moreno, Victor; Andreu, Montserrat; Ponz de Leon, Maurizio; Rustgi, Anil K.; Castells, Antoni

    2013-01-01

    Context Lynch syndrome is the most common form of hereditary colorectal cancer (CRC) and is caused by germline mutations in DNA mismatch repair (MMR) genes. Identification of gene carriers currently relies on germline analysis in patients with MMR-deficient tumors, but criteria to select individuals in whom tumor MMR testing should be performed are unclear. Objective To establish a highly sensitive and efficient strategy for the identification of MMR gene mutation carriers among CRC probands. Design, Setting, and Patients Pooled-data analysis of 4 large cohorts of newly diagnosed CRC probands recruited between 1994 and 2010 (n = 10 206) from the Colon Cancer Family Registry, the EPICOLON project, the Ohio State University, and the University of Helsinki examining personal, tumor-related, and family characteristics, as well as microsatellite instability, tumor MMR immunostaining, and germline MMR mutational status data. Main Outcome Measures Performance characteristics of selected strategies (Bethesda guidelines, Jerusalem recommendations, and those derived from a bivariate/multivariate analysis of variables associated with Lynch syndrome) were compared with tumor MMR testing of all CRC patients (universal screening). Results Of 10 206 informative, unrelated CRC probands, 312 (3.1%) were MMR gene mutation carriers. In the population-based cohorts (n=3671 probands), the universal screening approach (sensitivity, 100%;95% CI, 99.3%–100%; specificity, 93.0%; 95% CI, 92.0%–93.7%; diagnostic yield, 2.2%; 95% CI, 1.7%–2.7%) was superior to the use of Bethesda guidelines (sensitivity, 87.8%; 95% CI, 78.9%–93.2%; specificity, 97.5%; 95% CI, 96.9%–98.0%; diagnostic yield, 2.0%; 95% CI, 1.5%–2.4%; P <.001), Jerusalem recommendations (sensitivity, 85.4%; 95% CI, 77.1%–93.6%; specificity, 96.7%; 95% CI, 96.0%–97.2%; diagnostic yield, 1.9%; 95% CI, 1.4%–2.3%; P < .001), and a selective strategy based on tumor MMR testing of cases with CRC diagnosed at age 70

  6. Maintenance energy requirements of beef cows and relationship with cow and calf performance, metabolic hormones, and functional proteins.

    PubMed

    Cooper-Prado, M J; Long, N M; Davis, M P; Wright, E C; Madden, R D; Dilwith, J W; Bailey, C L; Spicer, L J; Wettemann, R P

    2014-08-01

    Gestating Angus, nonlactating, spring-calving cows were used to determine variation in maintenance energy requirements (MR); to evaluate the relationship among MR and cow and calf performance, plasma concentrations of IGF-I, T4, glucose, insulin, and ruminal temperature; and to describe the LM proteome and evaluate protein abundance in cows with different MR. Cows (4 to 7 yr of age) with a BCS of 5.0 ± 0.2 and BW of 582 ± 37 kg in the second to third trimester of gestation were studied in 3 trials (trial 1, n = 23; trial 2, n = 32; trial 3, n = 38). Cows were individually fed a complete diet in amounts to meet predicted MR (Level 1 Model of NRC), and feed intake was adjusted weekly until constant BW was achieved for at least 21 d (maintenance). Cows were classified on the basis of MR as low (>0.5 SD less than mean, LMR), moderate (±0.5 SD of mean, MMR), or high (>0.5 SD more than mean, HMR) MR. Blood samples were taken at maintenance and at 2 mo postpartum in trial 2. Muscle biopsies were taken from LMR and HMR after cows consumed actual MR for 28 d (trial 2) or 21 d (trial 3). Proteins from LM were separated by 2-dimensional difference gel electrophoresis and were identified, and abundance was quantified and compared. The greatest differences in MR between cows were 29%, 24%, and 25% in trials 1, 2, and 3, respectively. Daily MR (NEm, kcal·BW(-0.75)·d(-1)) averaged 89.2 ± 6.3, 93.0 ± 4.9, and 90.4 ± 4.6 in trials 1, 2, and 3, respectively. Postpartum BW and BCS, calf birth and weaning weights, postpartum luteal activity, and ruminal temperature were not influenced by MR of the cows. Concentrations of IGF-I were greater (P = 0.001) in plasma of MMR compared with LMR cows consuming predicted MR diets, and MR was negatively correlated with concentrations of IGF-I in plasma (r = -0.38; P = 0.05) at 2 mo postpartum. A total of 103 proteins were isolated from LM; 52 gene products were identified. Abundance of specific proteins in the LM was not influenced (P > 0

  7. EDITORIAL: Precision proteins Precision proteins

    NASA Astrophysics Data System (ADS)

    Demming, Anna

    2010-06-01

    Since the birth of modern day medicine, during the times of Hippocrates in ancient Greece, the profession has developed from the rudimentary classification of disease into a rigorous science with an inspiring capability to treat and cure. Scientific methodology has distilled clinical diagnostic tools from the early arts of prognosis, which used to rely as much on revelation and prophecy, as intuition and judgement [1]. Over the past decade, research into the interactions between proteins and nanosystems has provided some ingenious and apt techniques for delving into the intricacies of anatomical systems. In vivo biosensing has emerged as a vibrant field of research, as much of medical diagnosis relies on the detection of substances or an imbalance in the chemicals in the body. The inherent properties of nanoscale structures, such as cantilevers, make them well suited to biosensing applications that demand the detection of molecules at very low concentrations. Measurable deflections in cantilevers functionalised with antibodies provide quantitative indicators of the presence of specific antigens when the two react. Such developments have roused mounting interest in the interactions of proteins with nanostructures, such as carbon nanotubes [3], which have demonstrated great potential as generic biomarkers. Plasmonic properties are also being exploited in sensing applications, such as the molecular sentinel recently devised by researchers in the US. The device uses the plasmonic properties of a silver nanoparticle linked to a Raman labelled hairpin DNA probe to signal changes in the probe geometry resulting from interactions with substances in the environment. Success stories so far include the detection of two specific genes associated with breast cancer [4]. A greater understanding of how RNA interference regulates gene expression has highlighted the potential of using this natural process as another agent for combating disease in personalized medicine. However, the

  8. Immunogenicity and safety of measles-mumps-rubella and varicella vaccines coadministered with a fourth dose of Haemophilus influenzae type b and Neisseria meningitidis serogroups C and Y-tetanus toxoid conjugate vaccine in toddlers: a pooled analysis of randomized trials.

    PubMed

    Bryant, Kristina; McVernon, Jodie; Marchant, Colin; Nolan, Terry; Marshall, Gary; Richmond, Peter; Marshall, Helen; Nissen, Michael; Lambert, Stephen; Aris, Emmanuel; Mesaros, Narcisa; Miller, Jacqueline

    2012-08-01

    A pooled analysis was conducted of 1257 toddlers who received a fourth dose of Haemophilus influenzae type b-Neisseria meningitidis serogroups C and Y-tetanus toxoid conjugate vaccine (HibMenCY-TT) or Hib conjugate vaccine (Hib polysaccharide conjugated to N. meningitidis outer membrane protein) coadministered with measles-mumps-rubella (MMR) and varicella (VAR) vaccines (NCT00134719/NCT00289783). Noninferiority of immunological responses to MMR and VAR was demonstrated between groups and incidences of MMR- and VAR-specific solicited symptoms were similar, indicating that HibMenCY-TT can be coadministered with MMR and VAR.

  9. Abnormal measles-mumps-rubella antibodies and CNS autoimmunity in children with autism.

    PubMed

    Singh, Vijendra K; Lin, Sheren X; Newell, Elizabeth; Nelson, Courtney

    2002-01-01

    Autoimmunity to the central nervous system (CNS), especially to myelin basic protein (MBP), may play a causal role in autism, a neurodevelopmental disorder. Because many autistic children harbor elevated levels of measles antibodies, we conducted a serological study of measles-mumps-rubella (MMR) and MBP autoantibodies. Using serum samples of 125 autistic children and 92 control children, antibodies were assayed by ELISA or immunoblotting methods. ELISA analysis showed a significant increase in the level of MMR antibodies in autistic children. Immunoblotting analysis revealed the presence of an unusual MMR antibody in 75 of 125 (60%) autistic sera but not in control sera. This antibody specifically detected a protein of 73-75 kD of MMR. This protein band, as analyzed with monoclonal antibodies, was immunopositive for measles hemagglutinin (HA) protein but not for measles nucleoprotein and rubella or mumps viral proteins. Thus the MMR antibody in autistic sera detected measles HA protein, which is unique to the measles subunit of the vaccine. Furthermore, over 90% of MMR antibody-positive autistic sera were also positive for MBP autoantibodies, suggesting a strong association between MMR and CNS autoimmunity in autism. Stemming from this evidence, we suggest that an inappropriate antibody response to MMR, specifically the measles component thereof, might be related to pathogenesis of autism.

  10. Shotgun protein sequencing.

    SciTech Connect

    Faulon, Jean-Loup Michel; Heffelfinger, Grant S.

    2009-06-01

    A novel experimental and computational technique based on multiple enzymatic digestion of a protein or protein mixture that reconstructs protein sequences from sequences of overlapping peptides is described in this SAND report. This approach, analogous to shotgun sequencing of DNA, is to be used to sequence alternative spliced proteins, to identify post-translational modifications, and to sequence genetically engineered proteins.

  11. Protein Crystal Based Nanomaterials

    NASA Technical Reports Server (NTRS)

    Bell, Jeffrey A.; VanRoey, Patrick

    2001-01-01

    This is the final report on a NASA Grant. It concerns a description of work done, which includes: (1) Protein crystals cross-linked to form fibers; (2) Engineering of protein to favor crystallization; (3) Better knowledge-based potentials for protein-protein contacts; (4) Simulation of protein crystallization.

  12. Genetic variant in the telomerase gene modifies cancer risk in Lynch syndrome.

    PubMed

    Bellido, Fernando; Guinó, Elisabet; Jagmohan-Changur, Shantie; Seguí, Nuria; Pineda, Marta; Navarro, Matilde; Lázaro, Conxi; Blanco, Ignacio; Vasen, Hans F A; Moreno, Victor; Capellá, Gabriel; Wijnen, Juul T; Valle, Laura

    2013-05-01

    Lynch syndrome (LS) is an inherited cancer-predisposing disorder caused by germline mutations in the mismatch repair (MMR) genes. The high variability in individual cancer risk observed among LS patients suggests the existence of modifying factors. Identifying genetic modifiers of risk could help implement personalized surveillance programs based on predicted cancer risks. Here we evaluate the role of the telomerase (hTERT) rs2075786 SNP as a cancer-risk modifier in LS, studying 255 and 675 MMR gene mutation carriers from Spain and the Netherlands, respectively. The study of the Spanish sample revealed that the minor allele (A) confers increased cancer risk at an early age. The analysis of the Dutch sample confirmed the association of the A allele, especially in homozygosity, with increased cancer risk in mutation carriers under the age of 45 (relative riskLSca<45_AA=2.90; 95% confidence interval=1.02-8.26). Rs2075786 is associated with colorectal cancer (CRC) risk neither in the general population nor in non-Lynch CRC families. In silico studies predicted that the SNP causes the disruption of a transcription binding site for a retinoid receptor, retinoid X receptor alpha, probably causing early telomerase activation and therefore accelerated carcinogenesis. Notably, cancer-affected LS patients with the AA genotype have shorter telomeres than those with GG. In conclusion, MMR gene mutation carriers with hTERT rs2075786 are at high risk to develop a LS-related tumor at an early age. Cancer-preventive measures and stricter cancer surveillance at early ages might help prevent or early detect cancer in these mutation carriers.

  13. DNA Methylation Identifies Loci Distinguishing Hereditary Nonpolyposis Colorectal Cancer Without Germ-Line MLH1/MSH2 Mutation from Sporadic Colorectal Cancer

    PubMed Central

    Chen, Chung-Hsing; Sheng Jiang, Shih; Hsieh, Ling-Ling; Tang, Reiping; Hsiung, Chao A; Tsai, Hui-Ju; Chang, I-Shou

    2016-01-01

    Objectives: Roughly half of hereditary nonpolyposis colorectal cancer (HNPCC) cases are Lynch syndrome and exhibit germ-line mutations in DNA mismatch repair (MMR) genes; the other half are familial colorectal cancer (CRC) type X (FCCTX) and are MMR proficient. About 70% of Lynch syndrome tumors have germ-line MLH1 or MSH2 mutations. The clinical presentation, histopathological features, and carcinogenesis of FCCTX resemble those of sporadic MMR-proficient colorectal tumors. It is of interest to obtain biomarkers that distinguish FCCTX from sporadic microsatellite stable (MSS) CRC, to develop preventive strategies. Methods: The tumors and adjacent normal tissues of 40 patients with HNPCC were assayed using the Illumina Infinium HumanMethylation27 (HM27) BeadChip to assess the DNA methylation level at about 27,000 loci. The germ-line mutation status of MLH1 and MSH2 and the microsatellite instability status in these patients were obtained. Genome-wide DNA methylation measurements of three groups of patients with general CRC were downloaded from public domain databases. Probes with DNA methylation levels that differed significantly between patients with sporadic MSS CRC and FCCTX were examined, to explore their potential as biomarkers. Results: We found that MSS HNPCC tumors were overwhelmingly hypomethylated compared with those from patient groups with other types of CRC, including germ-line MLH1/MSH2-mutated HNPCC and sporadic MSS CRC. Five gene-marker panels that exhibited a sensitivity of 100% and a specificity higher than 90% in both discovery and validation cohorts were proposed to distinguish MSS HNPCC tumors from sporadic MSS CRC. Conclusions: Our results warrant further investigation and validation. The loci identified here may become useful biomarkers for distinguishing between FCCTX and sporadic MSS CRC tumors. PMID:27977020

  14. Fertility after young onset colorectal cancer: a study of subjects with Lynch syndrome

    PubMed Central

    Stupart, Douglas; Win, Aung Ko; Jenkins, Mark; Winship, Ingrid M.

    2016-01-01

    Aim Infertility is a concern for young colorectal cancer (CRC) survivors, but this risk is not well quantified. Mismatch repair (MMR) mutation carriers are a useful cohort for studying fertility after CRC as they commonly develop CRC when young, and unaffected family members provide demographically similar controls. The aim of this study was to determine the effect of CRC on fertility in a large cohort of MMR mutation carriers. Method MMR mutation carriers identified from the Australasian Colorectal Cancer Family Registry were included. For each year of life within the fertile age range (15 to 49), the number of living individuals and the number of children born to them were determined. Individuals were grouped by whether or not they had had a diagnosis of CRC by that age. Age-specific and total fertility rates were calculated. Results 1068 subjects (611 women and 457 men) were identified, of whom 467 were diagnosed with CRC. There were 1,192 births during 18674 person- years of follow up of the women and 814 births during 14013 person- years of follow up to the men. The total fertility rate was decreased in women after a diagnosis of CRC compared who did not have CRC (1.3 vs. 2.2 P=0.0011), but age- specific fertility was only reduced in the 20–24 year age group. In men TFR was similar for both groups (2.0 vs. 1.8) P = 0.27). Conclusion Age- specific fertility was decreased in female CRC survivors with Lynch syndrome aged 20–24, but not in older women or in men. PMID:25754680

  15. Penetrance of colorectal cancer among MLH1/MSH2 carriers participating in the colorectal cancer familial registry in Ontario

    PubMed Central

    Choi, Yun-Hee; Cotterchio, Michelle; McKeown-Eyssen, Gail; Neerav, Monga; Bapat, Bharati; Boyd, Kevin; Gallinger, Steven; McLaughlin, John; Aronson, Melyssa; Briollais, Laurent

    2009-01-01

    Background Several DNA mismatch repair (MMR) genes, responsible for the majority of Lynch Syndrome cancers, have been identified, predominantly MLH1 and MSH2, but the risk associated with these mutations is still not well established. The aim of this study is to provide population-based estimates of the risks of colorectal cancer (CRC) by gender and mutation type from the Ontario population. Methods We analyzed 32 families segregating MMR mutations selected from the Ontario Familial Colorectal Cancer Registry and including 199 first-degree and 421 second-degree relatives. The cumulative risks were estimated using a modified segregation-based approach, which allows correction for the ascertainment of the Lynch Syndrome families and permits account to be taken for missing genotype information. Results The risks of developing CRC by age 70 were 60% and 47% among men and women carriers of any MMR mutation, respectively. Among MLH1 mutation carriers, males had significantly higher risks than females at all ages (67% vs. 35% by age 70, p-value = 0.02), while the risks were similar in MSH2 carriers (about 54%). The relative risk associated with MLH1 was almost constant with age (hazard ratio (HR) varied between 5.5-5.1 over age 30–70), while the HR for MSH2 decreased with age (from 13.1 at age 30 to 5.4 at age 70). Conclusion This study provides a unique population-based study of CRC risks among MSH2/MLH1 mutation carriers in a Canadian population and can help to better define and understand the patterns of risks among members of Lynch Syndrome families. PMID:19698169

  16. An intact Pms2 ATPase domain is not essential for male fertility

    PubMed Central

    Fischer, Jared M; Dudley, Sandra; Miller, Ashleigh J; Liskay, R Michael

    2016-01-01

    The DNA mismatch repair (MMR) machinery in mammals plays critical roles in both mutation avoidance and spermatogenesis. Meiotic analysis of knockout mice of two different MMR genes, Mlh1 and Mlh3, revealed both male and female infertility associated with a defect in meiotic crossing over. In contrast, another MMR gene knockout, Pms2 (Pms2ko/ko), which contained a deletion of a portion of the ATPase domain, produced animals that were male sterile but female fertile. However, the meiotic phenotype of Pms2ko/ko males was less clear-cut than for Mlh1- or Mlh3-deficient meiosis. More recently, we generated a different Pms2 mutant allele (Pms2cre), which results in deletion of the same portion of the ATPase domain. Surprisingly, Pms2cre/cre male mice were completely fertile, suggesting that the ATPase domain of Pms2 is not required for male fertility. To explore the difference in male fertility, we examined the Pms2 RNA and found that alternative splicing of the Pms2cre allele results in a predicted Pms2 containing the C-terminus, which contains the Mlh1-interaction domain, a possible candidate for stabilizing Mlh1 levels. To study further the basis of male fertility, we examined Mlh1 levels in testes and found that whereas Pms2 loss in Pms2ko/ko mice results in severely reduced levels of Mlh1 expression in the testes, Mlh1 levels in Pms2cre/cre testes were reduced to a lesser extent. Thus, we propose that a primary function of Pms2 during spermatogenesis is to stabilize Mlh1 levels prior to its critical crossing over function with Mlh3. PMID:26753533

  17. Protein-losing enteropathy

    MedlinePlus

    ... this page: //medlineplus.gov/ency/article/007338.htm Protein-losing enteropathy To use the sharing features on this page, please enable JavaScript. Protein-losing enteropathy is an abnormal loss of protein ...

  18. Protein in diet

    MedlinePlus

    ... basic structure of protein is a chain of amino acids. You need protein in your diet to help ... Protein foods are broken down into parts called amino acids during digestion. The human body needs a number ...

  19. Protein splicing: selfish genes invade cellular proteins.

    PubMed

    Neff, N F

    1993-12-01

    Protein splicing is a series of enzymatic events involving intramolecular protein breakage, rejoining and intron homing, in which introns are able to promote the recombinative transposition of their own coding sequences. Eukaryotic and prokaryotic spliced proteins have conserved similar gene structure, but little amino acid identity. The genes coding for these spliced proteins contain internal in-frame introns that encode polypeptides that apparently self-excise from the resulting host protein sequences. Excision of the 'protein intron' is coupled with joining of the two flanking protein regions encoded by exons of the host gene. Some introns of this type encode DNA endonucleases, related to Group I RNA intron gene products, that stimulate gene conversion and self-transmission.

  20. PREFACE: Protein protein interactions: principles and predictions

    NASA Astrophysics Data System (ADS)

    Nussinov, Ruth; Tsai, Chung-Jung

    2005-06-01

    Proteins are the `workhorses' of the cell. Their roles span functions as diverse as being molecular machines and signalling. They carry out catalytic reactions, transport, form viral capsids, traverse membranes and form regulated channels, transmit information from DNA to RNA, making possible the synthesis of new proteins, and they are responsible for the degradation of unnecessary proteins and nucleic acids. They are the vehicles of the immune response and are responsible for viral entry into the cell. Given their importance, considerable effort has been centered on the prediction of protein function. A prime way to do this is through identification of binding partners. If the function of at least one of the components with which the protein interacts is known, that should let us assign its function(s) and the pathway(s) in which it plays a role. This holds since the vast majority of their chores in the living cell involve protein-protein interactions. Hence, through the intricate network of these interactions we can map cellular pathways, their interconnectivities and their dynamic regulation. Their identification is at the heart of functional genomics; their prediction is crucial for drug discovery. Knowledge of the pathway, its topology, length, and dynamics may provide useful information for forecasting side effects. The goal of predicting protein-protein interactions is daunting. Some associations are obligatory, others are continuously forming and dissociating. In principle, from the physical standpoint, any two proteins can interact, but under what conditions and at which strength? The principles of protein-protein interactions are general: the non-covalent interactions of two proteins are largely the outcome of the hydrophobic effect, which drives the interactions. In addition, hydrogen bonds and electrostatic interactions play important roles. Thus, many of the interactions observed in vitro are the outcome of experimental overexpression. Protein disorder

  1. Protein sequence comparison and protein evolution

    SciTech Connect

    Pearson, W.R.

    1995-12-31

    This tutorial was one of eight tutorials selected to be presented at the Third International Conference on Intelligent Systems for Molecular Biology which was held in the United Kingdom from July 16 to 19, 1995. This tutorial examines how the information conserved during the evolution of a protein molecule can be used to infer reliably homology, and thus a shared proteinfold and possibly a shared active site or function. The authors start by reviewing a geological/evolutionary time scale. Next they look at the evolution of several protein families. During the tutorial, these families will be used to demonstrate that homologous protein ancestry can be inferred with confidence. They also examine different modes of protein evolution and consider some hypotheses that have been presented to explain the very earliest events in protein evolution. The next part of the tutorial will examine the technical aspects of protein sequence comparison. Both optimal and heuristic algorithms and their associated parameters that are used to characterize protein sequence similarities are discussed. Perhaps more importantly, they survey the statistics of local similarity scores, and how these statistics can both be used to improve the selectivity of a search and to evaluate the significance of a match. They them examine distantly related members of three protein families, the serine proteases, the glutathione transferases, and the G-protein-coupled receptors (GCRs). Finally, the discuss how sequence similarity can be used to examine internal repeated or mosaic structures in proteins.

  2. Whey protein fractionation

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Concentrated whey protein products from cheese whey, such as whey protein concentrate (WPC) and whey protein isolate (WPI), contain more than seven different types of proteins: alpha-lactalbumin (alpha-LA), beta-lactoglobulin (beta-LG), bovine serum albumin (BSA), immunoglobulins (Igs), lactoferrin ...

  3. Patient with eight metachronous gastrointestinal cancers thought to be hereditary nonpolyposis colorectal cancer (HNPCC).

    PubMed

    Yamasaki, Yasushi; Matsushima, Masashi; Tanaka, Hisae; Tajiri, Sakurako; Fukuda, Ryuki; Ozawa, Hideki; Takagi, Atsushi; Hirabayashi, Ken-ichi; Sadahiro, Sohtaro

    2010-01-01

    An 81-year-old woman presented with a chief complaint of swelling of both lower legs. She had a history of surgery for cancers of the stomach, rectum and colon. Among her immediate family members, her son had colon and rectal cancers, and her sister had ovarian cancer. After close examination the patient was diagnosed with small intestine cancer and ascending colon cancer. Gene mutation analyses did not reveal any mutations in DNA mismatch repair genes, but MSH-2 protein expression was lost only in the cancer lesions. Here, we report this rare case of eight metachronous gastrointestinal cancers thought to be HNPCC.

  4. Mapping individual cosmid DNAs by direct AFM imaging.

    PubMed

    Allison, D P; Kerper, P S; Doktycz, M J; Thundat, T; Modrich, P; Larimer, F W; Johnson, D K; Hoyt, P R; Mucenski, M L; Warmack, R J

    1997-05-01

    Individual cosmid clones have been restriction mapped by directly imaging, with the atomic force microscope (AFM), a mutant EcoRI endonuclease site-specifically bound to DNA. Images and data are presented that locate six restriction sites, predicted from gel electrophoresis, on a 35-kb cosmid isolated from mouse chromosome 7. Measured distances between endonuclease molecules bound to lambda DNA, when compared to known values, demonstrate the accuracy of AFM mapping to better than 1%. These results may be extended to identify other important site-specific protein-DNA interactions, such as transcription factor and mismatch repair enzyme binding, difficult to resolve by current techniques.

  5. DNA repair systems as targets of cadmium toxicity

    SciTech Connect

    Giaginis, Constantinos; Gatzidou, Elisavet; Theocharis, Stamatios . E-mail: theocharis@ath.forthnet.gr

    2006-06-15

    Cadmium (Cd) is a heavy metal and a potent carcinogen implicated in tumor development through occupational and environmental exposure. Recent evidence suggests that proteins participating in the DNA repair systems, especially in excision and mismatch repair, are sensitive targets of Cd toxicity. Cd by interfering and inhibiting these DNA repair processes might contribute to increased risk for tumor formation in humans. In the present review, the information available on the interference of Cd with DNA repair systems and their inhibition is summarized. These actions could possibly explain the indirect contribution of Cd to mutagenic effects and/or carcinogenicity.

  6. Genetic polymorphisms associated with rubella virus-specific cellular immunity following MMR vaccination.

    PubMed

    Kennedy, Richard B; Ovsyannikova, Inna G; Haralambieva, Iana H; Lambert, Nathaniel D; Pankratz, V Shane; Poland, Gregory A

    2014-11-01

    Rubella virus causes a relatively benign disease in most cases, although infection during pregnancy can result in serious birth defects. An effective vaccine has been available since the early 1970s and outbreaks typically do not occur among highly vaccinated (≥2 doses) populations. Nevertheless, considerable inter-individual variation in immune response to rubella immunization does exist, with single-dose seroconversion rates ~95 %. Understanding the mechanisms behind this variability may provide important insights into rubella immunity. In the current study, we examined associations between single nucleotide polymorphisms (SNPs) in selected cytokine, cytokine receptor, and innate/antiviral genes and immune responses following rubella vaccination in order to understand genetic influences on vaccine response. Our approach consisted of a discovery cohort of 887 subjects aged 11-22 at the time of enrollment and a replication cohort of 542 older adolescents and young adults (age 18-40). Our data indicate that SNPs near the butyrophilin genes (BTN3A3/BTN2A1) and cytokine receptors (IL10RB/IFNAR1) are associated with variations in IFNγ secretion and that multiple SNPs in the PVR gene, as well as SNPs located in the ADAR gene, exhibit significant associations with rubella virus-specific IL-6 secretion. This information may be useful, not only in furthering our understanding immune responses to rubella vaccine, but also in identifying key pathways for targeted adjuvant use to boost immunity in those with weak or absent immunity following vaccination.

  7. MMR (measles, mumps, and rubella) vaccine - what you need to know

    MedlinePlus

    ... in women), and mild fever. If a woman gets rubella while she is pregnant, she could have a miscarriage or her baby could be born with serious birth defects. These diseases spread from person to person through the air. You can easily ...

  8. MMR (Measles, Mumps and Rubella) Vaccine: What You Need to Know

    MedlinePlus

    ... in women), and mild fever. • If a woman gets rubella while she is pregnant, she could have a miscarriage or her baby could be born with serious birth defects. These diseases spread from person to person through the air. You can easily ...

  9. Risk Characterization for Future Training Scenarios at the Massachusetts Military Reservation (MMR), Final Results

    DTIC Science & Technology

    2005-08-01

    irritation to the respiratory system. The non- carcinogenic and carcinogenic risks were estimated according to the route of exposure , i.e., dermal... exposure and effect through the air inhalation pathway/route. However, lack of input toxicological data for most of the 219 chemicals limited the...impacts. More realistic emission durations could be used and would reduce conservatism. The assumption of no degradation overestimated exposure

  10. The origin and 9:7 MMR dynamics of the Kepler-29 system

    NASA Astrophysics Data System (ADS)

    Migaszewski, Cezary; Goździewski, Krzysztof; Panichi, Federico

    2017-02-01

    We analyse the transit timing variation measurements of a system of two super-Earths detected as Kepler-29, in order to constrain the planets' masses and orbital parameters. A dynamical analysis of the best-fitting configurations constrains the masses to be ∼6 and ∼5 Earth masses for the inner and the outer planets, respectively. The analysis also reveals that the system is likely locked in the 9:7 mean motion resonance. However, a variety of orbital architectures regarding eccentricities and the relative orientation of orbits is permitted by the observations as well as by stability constraints. We attempt to find configurations preferred by the planet formation scenarios as an additional, physical constraint. We show that configurations with low eccentricities and anti-aligned apsidal lines of the orbits are a natural and most likely outcome of the convergent migration. However, we show that librations of the critical angles are not necessary for the Kepler-29 system to be dynamically resonant, and such configurations may be formed on the way of migration as well. We argue, on the other hand, that aligned configurations with e ≳ 0.03 may be not consistent with the migration scenario.

  11. Protein- protein interaction detection system using fluorescent protein microdomains

    DOEpatents

    Waldo, Geoffrey S.; Cabantous, Stephanie

    2010-02-23

    The invention provides a protein labeling and interaction detection system based on engineered fragments of fluorescent and chromophoric proteins that require fused interacting polypeptides to drive the association of the fragments, and further are soluble and stable, and do not change the solubility of polypeptides to which they are fused. In one embodiment, a test protein X is fused to a sixteen amino acid fragment of GFP (.beta.-strand 10, amino acids 198-214), engineered to not perturb fusion protein solubility. A second test protein Y is fused to a sixteen amino acid fragment of GFP (.beta.-strand 11, amino acids 215-230), engineered to not perturb fusion protein solubility. When X and Y interact, they bring the GFP strands into proximity, and are detected by complementation with a third GFP fragment consisting of GFP amino acids 1-198 (strands 1-9). When GFP strands 10 and 11 are held together by interaction of protein X and Y, they spontaneous association with GFP strands 1-9, resulting in structural complementation, folding, and concomitant GFP fluorescence.

  12. Molecular modelling of protein-protein/protein-solvent interactions

    NASA Astrophysics Data System (ADS)

    Luchko, Tyler

    The inner workings of individual cells are based on intricate networks of protein-protein interactions. However, each of these individual protein interactions requires a complex physical interaction between proteins and their aqueous environment at the atomic scale. In this thesis, molecular dynamics simulations are used in three theoretical studies to gain insight at the atomic scale about protein hydration, protein structure and tubulin-tubulin (protein-protein) interactions, as found in microtubules. Also presented, in a fourth project, is a molecular model of solvation coupled with the Amber molecular modelling package, to facilitate further studies without the need of explicitly modelled water. Basic properties of a minimally solvated protein were calculated through an extended study of myoglobin hydration with explicit solvent, directly investigating water and protein polarization. Results indicate a close correlation between polarization of both water and protein and the onset of protein function. The methodology of explicit solvent molecular dynamics was further used to study tubulin and microtubules. Extensive conformational sampling of the carboxy-terminal tails of 8-tubulin was performed via replica exchange molecular dynamics, allowing the characterisation of the flexibility, secondary structure and binding domains of the C-terminal tails through statistical analysis methods. Mechanical properties of tubulin and microtubules were calculated with adaptive biasing force molecular dynamics. The function of the M-loop in microtubule stability was demonstrated in these simulations. The flexibility of this loop allowed constant contacts between the protofilaments to be maintained during simulations while the smooth deformation provided a spring-like restoring force. Additionally, calculating the free energy profile between the straight and bent tubulin configurations was used to test the proposed conformational change in tubulin, thought to cause microtubule

  13. Surface Mediated Protein Disaggregation

    NASA Astrophysics Data System (ADS)

    Radhakrishna, Mithun; Kumar, Sanat K.

    2014-03-01

    Preventing protein aggregation is of both biological and industrial importance. Biologically these aggregates are known to cause amyloid type diseases like Alzheimer's and Parkinson's disease. Protein aggregation leads to reduced activity of the enzymes in industrial applications. Inter-protein interactions between the hydrophobic residues of the protein are known to be the major driving force for protein aggregation. In the current paper we show how surface chemistry and curvature can be tuned to mitigate these inter-protein interactions. Our results calculated in the framework of the Hydrophobic-Polar (HP) lattice model show that, inter-protein interactions can be drastically reduced by increasing the surface hydrophobicity to a critical value corresponding to the adsorption transition of the protein. At this value of surface hydrophobicity, proteins lose inter-protein contacts to gain surface contacts and thus the surface helps in reducing the inter-protein interactions. Further, we show that the adsorption of the proteins inside hydrophobic pores of optimal sizes are most efficient both in reducing inter-protein contacts and simultaneously retaining most of the native-contacts due to strong protein-surface interactions coupled with stabilization due to the confinement. Department of Energy (Grant No DE-FG02-11ER46811).

  14. Physics of protein motility and motor proteins

    NASA Astrophysics Data System (ADS)

    Kolomeisky, Anatoly B.

    2013-09-01

    Motor proteins are enzymatic molecules that transform chemical energy into mechanical motion and work. They are critically important for supporting various cellular activities and functions. In the last 15 years significant progress in understanding the functioning of motor proteins has been achieved due to revolutionary breakthroughs in single-molecule experimental techniques and strong advances in theoretical modelling. However, microscopic mechanisms of protein motility are still not well explained, and the collective efforts of many scientists are needed in order to solve these complex problems. In this special section the reader will find the latest advances on the difficult road to mapping motor proteins dynamics in various systems. Recent experimental developments have allowed researchers to monitor and to influence the activity of single motor proteins with a high spatial and temporal resolution. It has stimulated significant theoretical efforts to understand the non-equilibrium nature of protein motility phenomena. The latest results from all these advances are presented and discussed in this special section. We would like to thank the scientists from all over the world who have reported their latest research results for this special section. We are also grateful to the staff and editors of Journal of Physics: Condensed Matter for their invaluable help in handling all the administrative and refereeing activities. The field of motor proteins and protein motility is fast moving, and we hope that this collection of articles will be a useful source of information in this highly interdisciplinary area. Physics of protein motility and motor proteins contents Physics of protein motility and motor proteinsAnatoly B Kolomeisky Identification of unique interactions between the flexible linker and the RecA-like domains of DEAD-box helicase Mss116 Yuan Zhang, Mirkó Palla, Andrew Sun and Jung-Chi Liao The load dependence of the physical properties of a molecular motor

  15. Protein C blood test

    MedlinePlus

    ... a normal substance in the body that prevents blood clotting. A blood test can be done to see ... history of blood clots. Protein C helps control blood clotting. A lack of this protein or problem with ...

  16. Protein S blood test

    MedlinePlus

    ... a normal substance in your body that prevents blood clotting. A blood test can be done to see ... family history of blood clots. Protein S helps control blood clotting. A lack of this protein or problem with ...

  17. Learning about Proteins

    MedlinePlus

    ... body, and protecting you from disease. All About Amino Acids When you eat foods that contain protein, the ... called amino (say: uh-MEE-no) acids. The amino acids then can be reused to make the proteins ...

  18. Aetiology of colorectal cancer and relevance of monogenic inheritance

    PubMed Central

    Ponz de Leon, M; Benatti, P; Borghi, F; Pedroni, M; Scarselli, A; Di Gregorio, C; Losi, L; Viel, A; Genuardi, M; Abbati, G; Rossi, G; Menigatti, M; Lamberti, I; Ponti, G; Roncucci, L

    2004-01-01

    Background and aims: Although diet and lifestyle are associated with the development of colorectal malignancies, the only clearly identified aetiological factors in colorectal cancer are inheritance (hereditary non-polyposis colorectal cancer (HNPCC) and familial polyposis), inflammatory bowel diseases, papillomavirus, and acquired immunodeficiency syndrome (AIDS). Our aim was to determine what proportion of colorectal neoplasms could be attributed to these specific factors. Patients and methods: Data from a colorectal cancer registry were analysed over a 15 year period, during which nearly 2500 cases were recorded. In patients with suspected HNPCC, microsatellite instability and immunohistochemical expression of proteins encoded by the main DNA mismatch repair genes were assessed. In families with unstable neoplasms, constitutional mutations of the mismatch repair genes hMSH2, hMLH1, and hMSH6 were evaluated by single strand conformation polymorphism analysis and sequencing. Results: Inflammatory bowel diseases, familial polyposis, and AIDS were rare causes of colorectal cancer (three, three, and one case, respectively). Anal squamous carcinoma developed in 27 patients (1.0%) and could be attributed to papillomavirus infection. In 58 patients (from 34 families) a clinical diagnosis of HNPCC was established (2.4%). In total, cases with a known aetiology were 92 (3.7% of all patients). Microsatellite instability was detected in 15 cancers from HNPCC families, and germline mutations in six families (12 patients, 0.5% of the total). Families with unstable tumours, with or without mutations, were clinically similar, suggesting the involvement of the mismatch repair system even when mutations were not detected. Conclusions: The study suggests that the aetiology of colorectal malignancies remains elusive in the large majority of cases. Among specific causes, HNPCC represents the most frequent. However, with a population based approach, constitutional mutations of the

  19. Modeling Protein Self Assembly

    ERIC Educational Resources Information Center

    Baker, William P.; Jones, Carleton Buck; Hull, Elizabeth

    2004-01-01

    Understanding the structure and function of proteins is an important part of the standards-based science curriculum. Proteins serve vital roles within the cell and malfunctions in protein self assembly are implicated in degenerative diseases. Experience indicates that this topic is a difficult one for many students. We have found that the concept…

  20. CSF total protein

    MedlinePlus

    CSF total protein is a test to determine the amount of protein in your spinal fluid, also called cerebrospinal fluid (CSF). ... The normal protein range varies from lab to lab, but is typically about 15 to 60 milligrams per deciliter (mg/dL) ...

  1. Modeling Protein Domain Function

    ERIC Educational Resources Information Center

    Baker, William P.; Jones, Carleton "Buck"; Hull, Elizabeth

    2007-01-01

    This simple but effective laboratory exercise helps students understand the concept of protein domain function. They use foam beads, Styrofoam craft balls, and pipe cleaners to explore how domains within protein active sites interact to form a functional protein. The activity allows students to gain content mastery and an understanding of the…

  2. Destabilized bioluminescent proteins

    DOEpatents

    Allen, Michael S.; Rakesh, Gupta; Gary, Sayler S.

    2007-07-31

    Purified nucleic acids, vectors and cells containing a gene cassette encoding at least one modified bioluminescent protein, wherein the modification includes the addition of a peptide sequence. The duration of bioluminescence emitted by the modified bioluminescent protein is shorter than the duration of bioluminescence emitted by an unmodified form of the bioluminescent protein.

  3. Texturized dairy proteins

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Dairy proteins are amenable to structural modifications induced by high temperature, shear and moisture; in particular, whey proteins can change conformation to new unfolded states. The change in protein state is a basis for creating new foods. The dairy products, nonfat dried milk (NDM), whey prote...

  4. Overview of Protein Microarrays

    PubMed Central

    Reymond Sutandy, FX; Qian, Jiang; Chen, Chien-Sheng; Zhu, Heng

    2013-01-01

    Protein microarray is an emerging technology that provides a versatile platform for characterization of hundreds of thousands of proteins in a highly parallel and high-throughput way. Two major classes of protein microarrays are defined to describe their applications: analytical and functional protein microarrays. In addition, tissue or cell lysates can also be fractionated and spotted on a slide to form a reverse-phase protein microarray. While the fabrication technology is maturing, applications of protein microarrays, especially functional protein microarrays, have flourished during the past decade. Here, we will first review recent advances in the protein microarray technologies, and then present a series of examples to illustrate the applications of analytical and functional protein microarrays in both basic and clinical research. The research areas will include detection of various binding properties of proteins, study of protein posttranslational modifications, analysis of host-microbe interactions, profiling antibody specificity, and identification of biomarkers in autoimmune diseases. As a powerful technology platform, it would not be surprising if protein microarrays will become one of the leading technologies in proteomic and diagnostic fields in the next decade. PMID:23546620

  5. The E5 Proteins

    PubMed Central

    DiMaio, Daniel; Petti, Lisa

    2013-01-01

    The E5 proteins are short transmembrane proteins encoded by many animal and human papillomaviruses. These proteins display transforming activity in cultured cells and animals, and they presumably also play a role in the productive virus life cycle. The E5 proteins are thought to act by modulating the activity of cellular proteins. Here, we describe the biological activities of the best-studied E5 proteins and discuss the evidence implicating specific protein targets and pathways in mediating these activities. The primary target of the 44-amino acid BPV1 E5 is the PDGF β receptor, whereas the EGF receptor appears to be an important target of the 83-amino acid HPV16 E5 protein. Both E5 proteins also bind to the vacuolar ATPase and affect MHC class I expression and cell-cell communication. Continued studies of the E5 proteins will elucidate important aspects of transmembrane protein-protein interactions, cellular signal transduction, cell biology, virus replication, and tumorigenesis. PMID:23731971

  6. Protopia: a protein-protein interaction tool

    PubMed Central

    Real-Chicharro, Alejandro; Ruiz-Mostazo, Iván; Navas-Delgado, Ismael; Kerzazi, Amine; Chniber, Othmane; Sánchez-Jiménez, Francisca; Medina, Miguel Ángel; Aldana-Montes, José F

    2009-01-01

    Background Protein-protein interactions can be considered the basic skeleton for living organism self-organization and homeostasis. Impressive quantities of experimental data are being obtained and computational tools are essential to integrate and to organize this information. This paper presents Protopia, a biological tool that offers a way of searching for proteins and their interactions in different Protein Interaction Web Databases, as a part of a multidisciplinary initiative of our institution for the integration of biological data . Results The tool accesses the different Databases (at present, the free version of Transfac, DIP, Hprd, Int-Act and iHop), and results are expressed with biological protein names or databases codes and can be depicted as a vector or a matrix. They can be represented and handled interactively as an organic graph. Comparison among databases is carried out using the Uniprot codes annotated for each protein. Conclusion The tool locates and integrates the current information stored in the aforementioned databases, and redundancies among them are detected. Results are compatible with the most important network analysers, so that they can be compared and analysed by other world-wide known tools and platforms. The visualization possibilities help to attain this goal and they are especially interesting for handling multiple-step or complex networks. PMID:19828077

  7. Protein-protein interactions in multienzyme megasynthetases.

    PubMed

    Weissman, Kira J; Müller, Rolf

    2008-04-14

    The multienzyme polyketide synthases (PKSs), nonribosomal polypeptide synthetases (NRPSs), and their hybrids are responsible for the construction in bacteria of numerous natural products of clinical value. These systems generate high structural complexity by using a simple biosynthetic logic--that of the assembly line. Each of the individual steps in building the metabolites is designated to an independently folded domain within gigantic polypeptides. The domains are clustered into functional modules, and the modules are strung out along the proteins in the order in which they act. Every metabolite results, therefore, from the successive action of up to 100 individual catalysts. Despite the conceptual simplicity of this division-of-labor organization, we are only beginning to decipher the molecular details of the numerous protein-protein interactions that support assembly-line biosynthesis, and which are critical to attempts to re-engineer these systems as a tool in drug discovery. This review aims to summarize the state of knowledge about several aspects of protein-protein interactions, including current architectural models for PKS and NRPS systems, the central role of carrier proteins, and the structural basis for intersubunit recognition.

  8. Highly thermostable fluorescent proteins

    DOEpatents

    Bradbury, Andrew M [Santa Fe, NM; Waldo, Geoffrey S [Santa Fe, NM; Kiss, Csaba [Los Alamos, NM

    2012-05-01

    Thermostable fluorescent proteins (TSFPs), methods for generating these and other stability-enhanced proteins, polynucleotides encoding such proteins, and assays and method for using the TSFPs and TSFP-encoding nucleic acid molecules are provided. The TSFPs of the invention show extremely enhanced levels of stability and thermotolerance. In one case, for example, a TSFP of the invention is so stable it can be heated to 99.degree. C. for short periods of time without denaturing, and retains 85% of its fluorescence when heated to 80.degree. C. for several minutes. The invention also provides a method for generating stability-enhanced variants of a protein, including but not limited to fluorescent proteins.

  9. Highly thermostable fluorescent proteins

    DOEpatents

    Bradbury, Andrew M.; Waldo, Geoffrey S.; Kiss, Csaba

    2011-03-22

    Thermostable fluorescent proteins (TSFPs), methods for generating these and other stability-enhanced proteins, polynucleotides encoding such proteins, and assays and method for using the TSFPs and TSFP-encoding nucleic acid molecules are provided. The TSFPs of the invention show extremely enhanced levels of stability and thermotolerance. In one case, for example, a TSFP of the invention is so stable it can be heated to 99.degree. C. for short periods of time without denaturing, and retains 85% of its fluorescence when heated to 80.degree. C. for several minutes. The invention also provides a method for generating stability-enhanced variants of a protein, including but not limited to fluorescent proteins.

  10. Highly thermostable fluorescent proteins

    DOEpatents

    Bradbury, Andrew M [Santa Fe, NM; Waldo, Geoffrey S [Santa Fe, NM; Kiss, Csaba [Los Alamos, NM

    2011-11-29

    Thermostable fluorescent proteins (TSFPs), methods for generating these and other stability-enhanced proteins, polynucleotides encoding such proteins, and assays and method for using the TSFPs and TSFP-encoding nucleic acid molecules are provided. The TSFPs of the invention show extremely enhanced levels of stability and thermotolerance. In one case, for example, a TSFP of the invention is so stable it can be heated to 99.degree. C. for short periods of time without denaturing, and retains 85% of its fluorescence when heated to 80.degree. C. for several minutes. The invention also provides a method for generating stability-enhanced variants of a protein, including but not limited to fluorescent proteins.

  11. Protein crystallization with paper

    NASA Astrophysics Data System (ADS)

    Matsuoka, Miki; Kakinouchi, Keisuke; Adachi, Hiroaki; Maruyama, Mihoko; Sugiyama, Shigeru; Sano, Satoshi; Yoshikawa, Hiroshi Y.; Takahashi, Yoshinori; Yoshimura, Masashi; Matsumura, Hiroyoshi; Murakami, Satoshi; Inoue, Tsuyoshi; Mori, Yusuke; Takano, Kazufumi

    2016-05-01

    We developed a new protein crystallization method that incorporates paper. A small piece of paper, such as facial tissue or KimWipes, was added to a drop of protein solution in the traditional sitting drop vapor diffusion technique, and protein crystals grew by incorporating paper. By this method, we achieved the growth of protein crystals with reducing osmotic shock. Because the technique is very simple and the materials are easy to obtain, this method will come into wide use for protein crystallization. In the future, it could be applied to nanoliter-scale crystallization screening on a paper sheet such as in inkjet printing.

  12. [Atypical ubiquitination of proteins].

    PubMed

    Buneeva, O A; Medvedev, A E

    2016-07-01

    Ubiquitination is a type of posttranslational modification of intracellular proteins characterized by covalent attachment of one (monoubiquitination) or several (polyubiquitination) of ubiquitin molecules to target proteins. In the case of polyubiquitination, linear or branched polyubiquitin chains are formed. Their formation involves various lysine residues of monomeric ubiquitin. The best studied is Lys48-polyubiquitination, which targets proteins for proteasomal degradation. In this review we have considered examples of so-called atypical polyubiquitination, which mainly involves other lysine residues (Lys6, Lys11, Lys27, Lys29, Lys33, Lys63) and also N-terminal methionine. The considered examples convincingly demonstrate that polyubiquitination of proteins not necessarily targets proteins for their proteolytic degradation in proteasomes. Atypically polyubiquitinated proteins are involved in regulation of various processes and altered polyubiquitination of certain proteins is crucial for development of serious diseases.

  13. Protein and vegetarian diets.

    PubMed

    Marsh, Kate A; Munn, Elizabeth A; Baines, Surinder K

    2013-08-19

    A vegetarian diet can easily meet human dietary protein requirements as long as energy needs are met and a variety of foods are eaten. Vegetarians should obtain protein from a variety of plant sources, including legumes, soy products, grains, nuts and seeds. Eggs and dairy products also provide protein for those following a lacto-ovo-vegetarian diet. There is no need to consciously combine different plant proteins at each meal as long as a variety of foods are eaten from day to day, because the human body maintains a pool of amino acids which can be used to complement dietary protein. The consumption of plant proteins rather than animal proteins by vegetarians may contribute to their reduced risk of chronic diseases such as diabetes and heart disease.

  14. Protein solubility modeling

    NASA Technical Reports Server (NTRS)

    Agena, S. M.; Pusey, M. L.; Bogle, I. D.

    1999-01-01

    A thermodynamic framework (UNIQUAC model with temperature dependent parameters) is applied to model the salt-induced protein crystallization equilibrium, i.e., protein solubility. The framework introduces a term for the solubility product describing protein transfer between the liquid and solid phase and a term for the solution behavior describing deviation from ideal solution. Protein solubility is modeled as a function of salt concentration and temperature for a four-component system consisting of a protein, pseudo solvent (water and buffer), cation, and anion (salt). Two different systems, lysozyme with sodium chloride and concanavalin A with ammonium sulfate, are investigated. Comparison of the modeled and experimental protein solubility data results in an average root mean square deviation of 5.8%, demonstrating that the model closely follows the experimental behavior. Model calculations and model parameters are reviewed to examine the model and protein crystallization process. Copyright 1999 John Wiley & Sons, Inc.

  15. Predictions of Protein-Protein Interfaces within Membrane Protein Complexes

    PubMed Central

    Asadabadi, Ebrahim Barzegari; Abdolmaleki, Parviz

    2013-01-01

    Background Prediction of interaction sites within the membrane protein complexes using the sequence data is of a great importance, because it would find applications in modification of molecules transport through membrane, signaling pathways and drug targets of many diseases. Nevertheless, it has gained little attention from the protein structural bioinformatics community. Methods In this study, a wide variety of prediction and classification tools were applied to distinguish the residues at the interfaces of membrane proteins from those not in the interfaces. Results The tuned SVM model achieved the high accuracy of 86.95% and the AUC of 0.812 which outperforms the results of the only previous similar study. Nevertheless, prediction performances obtained using most employed models cannot be used in applied fields and needs more effort to improve. Conclusion Considering the variety of the applied tools in this study, the present investigation could be a good starting point to develop more efficient tools to predict the membrane protein interaction site residues. PMID:23919118

  16. Mammalian Exo1 encodes both structural and catalytic functions that play distinct roles in essential biological processes.

    PubMed

    Schaetzlein, Sonja; Chahwan, Richard; Avdievich, Elena; Roa, Sergio; Wei, Kaichun; Eoff, Robert L; Sellers, Rani S; Clark, Alan B; Kunkel, Thomas A; Scharff, Matthew D; Edelmann, Winfried

    2013-07-02

    Mammalian Exonuclease 1 (EXO1) is an evolutionarily conserved, multifunctional exonuclease involved in DNA damage repair, replication, immunoglobulin diversity, meiosis, and telomere maintenance. It has been assumed that EXO1 participates in these processes primarily through its exonuclease activity, but recent studies also suggest that EXO1 has a structural function in the assembly of higher-order protein complexes. To dissect the enzymatic and nonenzymatic roles of EXO1 in the different biological processes in vivo, we generated an EXO1-E109K knockin (Exo1(EK)) mouse expressing a stable exonuclease-deficient protein and, for comparison, a fully EXO1-deficient (Exo1(null)) mouse. In contrast to Exo1(null/null) mice, Exo1(EK/EK) mice retained mismatch repair activity and displayed normal class switch recombination and meiosis. However, both Exo1-mutant lines showed defects in DNA damage response including DNA double-strand break repair (DSBR) through DNA end resection, chromosomal stability, and tumor suppression, indicating that the enzymatic function is required for those processes. On a transformation-related protein 53 (Trp53)-null background, the DSBR defect caused by the E109K mutation altered the tumor spectrum but did not affect the overall survival as compared with p53-Exo1(null) mice, whose defects in both DSBR and mismatch repair also compromised survival. The separation of these functions demonstrates the differential requirement for the structural function and nuclease activity of mammalian EXO1 in distinct DNA repair processes and tumorigenesis in vivo.

  17. Modeling Protein Expression and Protein Signaling Pathways

    PubMed Central

    Telesca, Donatello; Müller, Peter; Kornblau, Steven M.; Suchard, Marc A.; Ji, Yuan

    2015-01-01

    High-throughput functional proteomic technologies provide a way to quantify the expression of proteins of interest. Statistical inference centers on identifying the activation state of proteins and their patterns of molecular interaction formalized as dependence structure. Inference on dependence structure is particularly important when proteins are selected because they are part of a common molecular pathway. In that case, inference on dependence structure reveals properties of the underlying pathway. We propose a probability model that represents molecular interactions at the level of hidden binary latent variables that can be interpreted as indicators for active versus inactive states of the proteins. The proposed approach exploits available expert knowledge about the target pathway to define an informative prior on the hidden conditional dependence structure. An important feature of this prior is that it provides an instrument to explicitly anchor the model space to a set of interactions of interest, favoring a local search approach to model determination. We apply our model to reverse-phase protein array data from a study on acute myeloid leukemia. Our inference identifies relevant subpathways in relation to the unfolding of the biological process under study. PMID:26246646

  18. Protein kinesis: The dynamics of protein trafficking and stability

    SciTech Connect

    1995-12-31

    The purpose of this conference is to provide a multidisciplinary forum for exchange of state-of-the-art information on protein kinesis. This volume contains abstracts of papers in the following areas: protein folding and modification in the endoplasmic reticulum; protein trafficking; protein translocation and folding; protein degradation; polarity; nuclear trafficking; membrane dynamics; and protein import into organelles.

  19. Protein flexibility as a biosignal.

    PubMed

    Zhao, Qinyi

    2010-01-01

    Dynamic properties of a protein are crucial for all protein functions, and those of signaling proteins are closely related to the biological function of living beings. The protein flexibility signal concept can be used to analyze this relationship. Protein flexibility controls the rate of protein conformational change and influences protein function. The modification of protein flexibility results in a change of protein activity. The logical nature of protein flexibility cannot be explained by applying the principles of protein three-dimensional structure theory or conformation concept. Signaling proteins show high protein flexibility. Many properties of signaling can be traced back to the dynamic natures of signaling protein. The action mechanism of volatile anesthetics and universal cellular reactions are related to flexibility in the change of signaling proteins. We conclude that protein dynamics is an enzyme-enhanced process, called dynamicase.

  20. Antimicrobial proteins: From old proteins, new tricks.

    PubMed

    Smith, Valerie J; Dyrynda, Elisabeth A

    2015-12-01

    This review describes the main types of antimicrobial peptides (AMPs) synthesised by crustaceans, primarily those identifi