Science.gov

Sample records for mismatch-repair mmr proteins

  1. Microsecond dynamics of mismatch repair proteins

    NASA Astrophysics Data System (ADS)

    Salsbury, Freddie; Thompson, William

    We will present the results of long-time simulations (250ns-1microsecond) of the mismatch repair protein complexes Mutsalpha bound to various substrates, both normal and damaged. We do so to demonstrate the importance of long-range fluctuations and generalized allostery in such systems and how long-scale GPU-enabled simulations can enabled such analysis.

  2. Functional interactions and signaling properties of mammalian DNA mismatch repair proteins.

    PubMed

    Bellacosa, A

    2001-11-01

    The mismatch repair (MMR) system promotes genomic fidelity by repairing base-base mismatches, insertion-deletion loops and heterologies generated during DNA replication and recombination. This function is critically dependent on the assembling of multimeric complexes involved in mismatch recognition and signal transduction to downstream repair events. In addition, MMR proteins coordinate a complex network of physical and functional interactions that mediate other DNA transactions, such as transcription-coupled repair, base excision repair and recombination. MMR proteins are also involved in activation of cell cycle checkpoint and induction of apoptosis when DNA damage overwhelms a critical threshold. For this reason, they play a role in cell death by alkylating agents and other chemotherapeutic drugs, including cisplatin. Inactivation of MMR genes in hereditary and sporadic cancer is associated with a mutator phenotype and inhibition of apoptosis. In the future, a deeper understanding of the molecular mechanisms and functional interactions of MMR proteins will lead to the development of more effective cancer prevention and treatment strategies. PMID:11687886

  3. Mismatch repair protein expression and colorectal cancer in Hispanics from Puerto Rico.

    PubMed

    De Jesus-Monge, Wilfredo E; Gonzalez-Keelan, Carmen; Zhao, Ronghua; Hamilton, Stanley R; Rodriguez-Bigas, Miguel; Cruz-Correa, Marcia

    2010-06-01

    Colorectal cancer (CRC) is a leading cause of morbidity and mortality and alterations in mismatch repair (MMR) genes, leading to absent protein (negative) expression, are responsible for approximately 20% of CRC cases. Immunohistochemistry is a tool for prescreening of MMR protein expression in CRC but the literature on its use on Hispanics is scarce. However, Hispanics represent the second leading ethnicity in the United States (US) and CRC is a public health burden in this group. Our objectives were to determine the frequency of MMR protein-negative CRC and to evaluate its association with clinical and pathological characteristics among Hispanics from Puerto Rico, for the first time to our knowledge. A retrospective observational study of unselected CRC patients from the Puerto Rico Medical Center from 2001 to 2005 was done. MLH1 and MSH2, the most commonly altered MMR genes, protein expression was evaluated using immunohistochemistry, with microsatellite instability (MSI) and BRAF gene analyses in the absence of MLH1 protein expression. One-hundred sixty-four CRC patients were evaluated: the overall MMR protein-negative frequency was 4.3%, with 0.6% frequency of co-occurrence of MLH1-protein negative expression, MSI-high, and normal BRAF gene. MMR protein-negative expression was associated with proximal colon location (P = 0.02) and poor histological tumor differentiation (P = 0.001), but not with other characteristics. The frequency of MMR protein-negative CRC in Hispanics from Puerto Rico was lower than reported in other populations. This finding may explain the lower CRC incidence rate among US Hispanics as compared to US non-Hispanic whites and blacks.

  4. Alterations of DNA mismatch repair proteins and microsatellite instability levels in gastric cancer cell lines.

    PubMed

    Yao, Yuan; Tao, Hong; Kim, Jae J; Burkhead, Benjamin; Carloni, Emilia; Gasbarrini, Antonio; Sepulveda, Antonia R

    2004-07-01

    Alterations in DNA mismatch repair (MMR) proteins result in microsatellite instability (MSI), increased mutation accumulation at target genes and cancer development. About one-third of gastric cancers display high-level microsatellite instability (MSI-High) and low-level microsatellite instability (MSI-Low) is frequently detected. To determine whether variations in the levels of MMR proteins or mutations in the main DNA MMR genes are associated with MSI-Low and MSI-High in gastric cancer cell lines, the MSI status (MSI-High, MSI-Low or MS-Stable (MSS)) of 14 gastric cancer lines was determined using multiple clone analysis with a panel of five microsatellite markers. Protein levels of hMLH1, hMSH2, hMSH6, hPMS2 and hPMS1 were determined by Western blot. Sequence analysis of hMLH1 and hMSH2 was performed and the methylation status of the hMLH1 promoter was examined. The cell lines SNU1 and SNU638 showed MSI-High, decreased to essentially absent hMLH1 and hPMS2 and reduced hPMS1 and hMSH6 protein levels. The hMLH1 promoter region was hypermethylated in SNU638 cells. The MKN28, MKN87, KATOIII and SNU601 cell lines showed MSI-Low. The MMR protein levels of cells with MSI-Low status was similar to the levels detected in MSS cells. A marked decrease in the expression levels of MutL MMR proteins (hMLH1, hPMS2 and hPMS1) is associated with high levels of MSI mutations in gastric cancer cells. Gastric cancer cell lines with MSI-Low status do not show significant changes in the levels of the main DNA MMR proteins or mutations in the DNA mismatch repair genes hMSH2 and hMLH1. These well-characterized gastric cancer cell lines are a valuable resource to further our understanding of DNA MMR deficiency in cancer development, progression and prognosis. PMID:15133479

  5. Complex relationship between mismatch repair proteins and MBD4 during immunoglobulin class switch recombination.

    PubMed

    Grigera, Fernando; Bellacosa, Alfonso; Kenter, Amy L

    2013-01-01

    Mismatch repair (MMR) safeguards against genomic instability and is required for efficient Ig class switch recombination (CSR). Methyl CpG binding domain protein 4 (MBD4) binds to MutL homologue 1 (MLH1) and controls the post-transcriptional level of several MMR proteins, including MutS homologue 2 (MSH2). We show that in WT B cells activated for CSR, MBD4 is induced and interacts with MMR proteins, thereby implying a role for MBD4 in CSR. However, CSR is in the normal range in Mbd4 deficient mice deleted for exons 2-5 despite concomitant reduction of MSH2. We show by comparison in Msh2(+/-) B cells that a two-fold reduction of MSH2 and MBD4 proteins is correlated with impaired CSR. It is therefore surprising that CSR occurs at normal frequencies in the Mbd4 deficient B cells where MSH2 is reduced. We find that a variant Mbd4 transcript spanning exons 1,6-8 is expressed in Mbd4 deficient B cells. This transcript can be ectopically expressed and produces a truncated MBD4 peptide. Thus, the 3' end of the Mbd4 locus is not silent in Mbd4 deficient B cells and may contribute to CSR. Our findings highlight a complex relationship between MBD4 and MMR proteins in B cells and a potential reconsideration of their role in CSR.

  6. Uncertainty in the Utility of Immunohistochemistry in Mismatch Repair Protein Expression in Epithelial Ovarian Cancer

    PubMed Central

    Copppola, Domenico; Nicosia, Santo V.; Doty, Andrea; Sellers, Thomas A; Lee, Ji-Hyun; Fulp, Jimmy; Thompson, Zachary; Galeb, Sanja; McLaughlin, John; Narod, Steven A; Schildkraut, Joellen; Pal, Tuya

    2014-01-01

    Background Utility of immunohistochemistry (IHC) for mismatch repair (MMR) protein expression has been demonstrated in colorectal cancer but remains incompletely defined in ovarian cancer. We evaluated MMR protein expression in three population-based samples of epithelial ovarian cancers. Methods IHC staining was performed on full section (FS) or tissue microarray (TMA) slides for MLH1, MSH2, and MSH6 expression. Results Of 487 cases, 147 and 340 were performed through FS and TMA, respectively. Overall, Loss of Expression (LoE) of at least one MMR protein was observed in 12.7% based on an expression score of ≤3 (on a scale of 9). Notably, LoE was significantly higher in TMAs (17.9%) compared to FS cases (0.7%) (p <0.001). Conclusions A substantial proportion of epithelial ovarian cancers have a loss of MMR protein expression. Protein expression results vary significantly by the tissue sampling methodology utilized, raising concerns about the clinical utility of this test for ovarian tumors. PMID:23155266

  7. Nuclear localization of human DNA mismatch repair protein exonuclease 1 (hEXO1)

    PubMed Central

    Knudsen, Nina Østergaard; Nielsen, Finn Cilius; Vinther, Lena; Bertelsen, Ronni; Holten-Andersen, Steen; Liberti, Sascha Emilie; Hofstra, Robert; Kooi, Krista; Rasmussen, Lene Juel

    2007-01-01

    Human exonuclease 1 (hEXO1) is implicated in DNA mismatch repair (MMR) and mutations in hEXO1 may be associated with hereditary nonpolyposis colorectal cancer (HNPCC). Since the subcellular localization of MMR proteins is essential for proper MMR function, we characterized possible nuclear localization signals (NLSs) in hEXO1. Using fluorescent fusion proteins, we show that the sequence 418KRPR421, which exhibit strong homology to other monopartite NLS sequences, is responsible for correct nuclear localization of hEXO1. This NLS sequence is located in a region that is also required for hEXO1 interaction with hMLH1 and we show that defective nuclear localization of hEXO1 mutant proteins could be rescued by hMLH1 or hMSH2. Both hEXO1 and hMLH1 form complexes with the nuclear import factors importin β/α1,3,7 whereas hMSH2 specifically recognizes importin β/α3. Taken together, we infer that hEXO1, hMLH1 and hMSH2 form complexes and are imported to the nucleus together, and that redundant NLS import signals in the proteins may safeguard nuclear import and thereby MMR activity. PMID:17426132

  8. Mitotic crossovers between diverged sequences are regulated by mismatch repair proteins in Saccaromyces cerevisiae.

    PubMed Central

    Datta, A; Adjiri, A; New, L; Crouse, G F; Jinks Robertson, S

    1996-01-01

    Mismatch repair systems correct replication- and recombination-associated mispaired bases and influence the stability of simple repeats. These systems thus serve multiple roles in maintaining genetic stability in eukaryotes, and human mismatch repair defects have been associated with hereditary predisposition to cancer. In prokaryotes, mismatch repair systems also have been shown to limit recombination between diverged (homologous) sequences. We have developed a unique intron-based assay system to examine the effects of yeast mismatch repair genes (PMS1, MSH2, and MSH3) on crossovers between homologous sequences. We find that the apparent antirecombination effects of mismatch repair proteins in mitosis are related to the degree of substrate divergence. Defects in mismatch repair can elevate homologous recombination between 91% homologous substrates as much as 100-fold while having only modest effects on recombination between 77% homologous substrates. These observations have implications for genome stability and general mechanisms of recombination in eukaryotes. PMID:8622653

  9. SWI/SNF complex deficiency and mismatch repair protein expression in undifferentiated and dedifferentiated endometrial carcinoma.

    PubMed

    Stewart, Colin J R; Crook, Maxine L

    2015-08-01

    Undifferentiated endometrial carcinoma (UEC) is a relatively uncommon but clinically aggressive uterine malignancy. In common with a subset of poorly differentiated carcinomas arising in other sites, UEC may exhibit rhabdoid morphology and be associated with a low-grade tumour component (dedifferentiated carcinoma). Recent studies have implicated inactivation of the SWI/SNF complex subunits in the aforementioned extrauterine tumours. Therefore we have examined INI1 (SMARCB1), BRG1 (SMARCA4), and BAF250a (ARID1A) immunostaining, and also expression of the DNA mismatch repair (MMR) proteins MLH1, PMS2, MSH2 and MSH6 in 22 UEC, seventeen of which were dedifferentiated. Abnormal SWI/SNF subunit expression was detected in four dedifferentiated carcinomas including three with loss of BRG1 staining limited to the undifferentiated tumour component and one case with loss of INI1 expression in both low- and high-grade elements; the latter case also showed BAF250a deficiency in the undifferentiated tumour cells. Abnormal MMR protein expression was identified in 13 tumours (59%) including nine with concurrent loss of MLH1 and PMS2. These findings suggest that SWI/SNF subunit alterations may play a role in the progression/ dedifferentiation of endometrial carcinoma, and that SWI/SNF and MMR protein deficiencies may act synergistically in deregulating DNA repair mechanisms in these tumours.

  10. Expression of Mismatch Repair Proteins in Early and Advanced Gastric Cancer in Poland.

    PubMed

    Karpińska-Kaczmarczyk, Katarzyna; Lewandowska, Magdalena; Ławniczak, Małgorzata; Białek, Andrzej; Urasińska, Elżbieta

    2016-01-01

    BACKGROUND Mutations in DNA of mismatch repair (MMR) genes result in failure to repair errors that occur during DNA replication in microsatellites, resulting in accumulation of frameshift mutations in these genes and leading to DNA mismatch replication errors and microsatellite instability. Gastric cancers (GCs) with high MSI (MSI-H) are a well-defined subset of carcinomas showing distinctive clinicopathological features. In this study we investigated the rate of MSI and the correlation between MSI status and clinicopathological features of GC. MATERIAL AND METHODS The study included 107 patients with GCs: 61 with advanced gastric cancers (AGC) and 46 with early gastric cancer (EGC). MSI deficiency in GCs was assessed by the immunohistochemical analysis of expression of MMR proteins - MLH1, MSH2, MSH6, and PMS2 - using formalin-fixed and paraffin-embedded tissue. RESULTS A total of 6 (5.6%) MSI-H were observed. The loss of MMR proteins expression was associated with the intestinal type of GC in Lauren classification, and tubular and papillary architecture in WHO classification. There was no statistically significant association between negative MMR expression and other selected clinical parameters: age, sex, tumor location, depth of invasion (EGC and AGC), lymph nodes status, presence of the ulceration, and lymphocytic infiltrate. CONCLUSIONS In the present era of personalized medicine, the histological type of GC and MMR proteins status in cancer cells are very important for the proper surveillance of patients with familial GC and sporadic GCs, as well as for selecting the proper follow-up and treatment. Larger collaborative studies are needed to verify the features of MSI-H GCs in Poland. PMID:27527654

  11. Expression of Mismatch Repair Proteins in Early and Advanced Gastric Cancer in Poland

    PubMed Central

    Karpińska-Kaczmarczyk, Katarzyna; Lewandowska, Magdalena; Ławniczak, Małgorzata; Białek, Andrzej; Urasińska, Elżbieta

    2016-01-01

    Background Mutations in DNA of mismatch repair (MMR) genes result in failure to repair errors that occur during DNA replication in microsatellites, resulting in accumulation of frameshift mutations in these genes and leading to DNA mismatch replication errors and microsatellite instability. Gastric cancers (GCs) with high MSI (MSI-H) are a well-defined subset of carcinomas showing distinctive clinicopathological features. In this study we investigated the rate of MSI and the correlation between MSI status and clinicopathological features of GC. Material/Methods The study included 107 patients with GCs: 61 with advanced gastric cancers (AGC) and 46 with early gastric cancer (EGC). MSI deficiency in GCs was assessed by the immunohistochemical analysis of expression of MMR proteins – MLH1, MSH2, MSH6, and PMS2 – using formalin-fixed and paraffin-embedded tissue. Results A total of 6 (5.6%) MSI-H were observed. The loss of MMR proteins expression was associated with the intestinal type of GC in Lauren classification, and tubular and papillary architecture in WHO classification. There was no statistically significant association between negative MMR expression and other selected clinical parameters: age, sex, tumor location, depth of invasion (EGC and AGC), lymph nodes status, presence of the ulceration, and lymphocytic infiltrate. Conclusions In the present era of personalized medicine, the histological type of GC and MMR proteins status in cancer cells are very important for the proper surveillance of patients with familial GC and sporadic GCs, as well as for selecting the proper follow-up and treatment. Larger collaborative studies are needed to verify the features of MSI-H GCs in Poland. PMID:27527654

  12. Interdependence of DNA mismatch repair proteins MLH1 and MSH2 in apoptosis in human colorectal carcinoma cell lines.

    PubMed

    Hassen, Samar; Ali, Akhtar A; Kilaparty, Surya P; Al-Anbaky, Qudes A; Majeed, Waqar; Boman, Bruce M; Fields, Jeremy Z; Ali, Nawab

    2016-01-01

    The mammalian DNA mismatch repair (MMR) system consists of a number of proteins that play important roles in repair of base pair mismatch mutations and in maintenance of genomic integrity. A defect in this system can cause genetic instability, which can lead to carcinogenesis. For instance, a germline mutation in one of the mismatch repair proteins, especially MLH1 or MSH2, is responsible for hereditary non-polyposis colorectal cancer. These MMR proteins also play an important role in the induction of apoptosis. Accordingly, altered expression of or a defect in MLH1 or MSH2 may confer resistance to anti-cancer drugs used in chemotherapy. We hypothesized that the ability of these two MMR proteins to regulate apoptosis are interdependent. Moreover, a defect in either one may confer resistance to chemotherapy by an inability to trigger apoptosis. To this end, we studied three cell lines-SW480, LoVo, and HTC116. These cell lines were selected based on their differential expression of MLH1 and MSH2 proteins. SW480 expresses both MLH1 and MSH2; LoVo expresses only MLH1 but not MSH2; HCT116 expresses only MSH2 but not MLH1 protein. MTT assays, a measure of cytotoxicity, showed that there were different cytotoxic effects of an anti-cancer drug, etoposide, on these cell lines, effects that were correlated with the MMR status of the cells. Cells that are deficient in MLH1 protein (HCT116 cells) were resistant to the drug. Cells that express both MLH1 and MSH2 proteins (SW480 cells) showed caspase-3 cleavage, an indicator of apoptosis. Cells that lack MLH1 (HCT116 cells) did not show any caspase-3 cleavage. Expression of full-length MLH1 protein was decreased in MMR proficient (SW480) cells during apoptosis; it remained unchanged in cells that lack MSH2 (LoVo cells). The expression of MSH2 protein remained unchanged during apoptosis both in MMR proficient (SW480) and deficient (HCT116) cells. Studies on translocation of MLH1 protein from nucleus to cytosolic fraction, an

  13. Role of Cell Cycle Regulation and MLH1, A Key DNA Mismatch Repair Protein, In Adaptive Survival Responses. Final Report

    SciTech Connect

    David A. Boothman

    1999-08-11

    Due to several interesting findings on both adaptive survival responses (ASRs) and DNA mismatch repair (MMR), this grant was separated into two discrete Specific Aim sets (each with their own discrete hypotheses). The described experiments were simultaneously performed.

  14. Rapid induction of chromatin-associated DNA mismatch repair proteins after MNNG treatment

    PubMed Central

    Schroering, Allen G.; Williams, Kandace J.

    2008-01-01

    Treatment with low concentrations of monofunctional alkylating agents induces a G2 arrest only after the second round of DNA synthesis in mammalian cells and requires a proficient mismatch repair (MMR) pathway. Here we have investigated rapid alkylation-induced recruitment of DNA repair proteins to chromosomal DNA within synchronized populations of MMR proficient cells (HeLa MR) after MNNG treatment. Within the first hour, the concentrations of MutSα and PCNA increase well beyond their constitutive chromosomally bound levels and MutLα is newly recruited to the chromatin-bound MutSα. Remarkably, immunoprecipitation experiments demonstrate rapid association of these proteins on the alkylation-damaged chromatin, even when DNA replication is completely blocked. The extent of association of PCNA and MMR proteins on the chromatin is dependent upon the concentration of MNNG and on the specific type of replication block. A subpopulation of the MutSα-associated PCNA also becomes monoubiquitinated, a known requirement for PCNA to interact with translesion synthesis (TLS) polymerases. In addition, chromatin-bound SMC1 and NBS1 proteins, associated with DNA double-strand-breaks (DSBs), become phosphorylated within one to two hours of exposure to MNNG. However, these activated proteins are not colocalized on the chromatin with MutSα in response to MNNG exposure. PCNA, MutSα/MutLα and activated SMC1/NBS1 remain chromatin-bound for at least 6–8 hours after alkylation damage. Thus, cells that are exposed to low levels of alkylation treatment undergo rapid recruitment to and/or activation of key proteins already on the chromatin without the requirement for DNA replication, apparently via different DNA-damage signaling pathways. PMID:18468964

  15. Roles for mismatch repair family proteins in promoting meiotic crossing over.

    PubMed

    Manhart, Carol M; Alani, Eric

    2016-02-01

    The mismatch repair (MMR) family complexes Msh4-Msh5 and Mlh1-Mlh3 act with Exo1 and Sgs1-Top3-Rmi1 in a meiotic double strand break repair pathway that results in the asymmetric cleavage of double Holliday junctions (dHJ) to form crossovers. This review discusses how meiotic roles for Msh4-Msh5 and Mlh1-Mlh3 do not fit paradigms established for post-replicative MMR. We also outline models used to explain how these factors promote the formation of meiotic crossovers required for the accurate segregation of chromosome homologs during the Meiosis I division.

  16. Helicobacter pylori infection and expression of DNA mismatch repair proteins

    PubMed Central

    Mirzaee, Vahid; Molaei, Mahsa; Shalmani, Hamid Mohaghegh; Zali, Mohammad Reza

    2008-01-01

    AIM: To determine the expression of DNA (MMR) proteins, including hMLH1 and hMSH2, in gastric epithelial cells in the patients with or without Helicobacter pylori (H pylori)-infected gastritis. METHODS: Fifty H pylori-positive patients and 50 H pylori-negative patients were enrolled in the study. During endoscopy of patients with non-ulcer dyspepsia, two antral and two corpus biopsies were taken for histological examination (Giemsa stain) and for immunohistochemical staining of hMLH1 and hMSH2. RESULTS: The percentage of epithelial cell nuclei that demonstrated positivity for hMLH1 staining was 84.14 ± 7.32% in H pylori-negative patients, while it was 73.34 ± 10.10% in H pylori-positive patients (P < 0.0001). No significant difference was seen between the two groups regarding the percentage of epithelial cell nuclei that demonstrated positivity for hMSH2 staining (81.16 ± 8.32% in H pylori-negative versus 78.24 ± 8.71% in H pylori-positive patients; P = 0.09). CONCLUSION: This study indicates that H pylori might promote development of gastric carcinoma at least in part through its ability to affect the DNA MMR system. PMID:19034977

  17. Minor changes in expression of the mismatch repair protein MSH2 exert a major impact on glioblastoma response to temozolomide

    PubMed Central

    McFaline-Figueroa, José L.; Braun, Christian J.; Stanciu, Monica; Nagel, Zachary D.; Mazzucato, Patrizia; Sangaraju, Dewakar; Cerniauskas, Edvinas; Barford, Kelly; Vargas, Amanda; Chen, Yimin; Tretyakova, Natalia; Lees, Jacqueline A.; Hemann, Michael T.; White, Forest M.; Samson, Leona D.

    2015-01-01

    Glioblastoma (GBM) is often treated with the cytotoxic drug temozolomide (TMZ) but the disease inevitably recurs in a drug-resistant form after initial treatment. Here we report that in GBM cells even a modest decrease in the mismatch repair (MMR) components MSH2 and MSH6 have profound effects on TMZ sensitivity. RNAi-mediated attenuation of MSH2 and MSH6 showed that such modest decreases provided an unexpectedly strong mechanism of TMZ resistance. In a mouse xenograft model of human GBM, small changes in MSH2 were sufficient to suppress TMZ-induced tumor regression. Using the Cancer Genome Atlas to analyze mRNA expression patterns in tumors from TMZ-treated GBM patients, we found that MSH2 transcripts in primary GBM could predict patient responses to initial TMZ therapy. In recurrent disease, the absence of microsatellite instability (the standard marker for MMR deficiency) suggests a lack of involvement of MMR in the resistant phenotype of recurrent disease. However, more recent studies reveal that decreased MMR protein levels occur often in recurrent GBM. In accordance with our findings, these reported decreases may constitute a mechanism by which GBM evades TMZ sensitivity while maintaining microsatellite stability. Overall, our results highlight the powerful effects of MSH2 attenuation as a potent mediator of TMZ resistance, and argue that MMR activity offers a predictive marker for initial therapeutic response to TMZ treatment. PMID:26025730

  18. Proteasome inhibition rescues clinically significant unstable variants of the mismatch repair protein Msh2

    PubMed Central

    Arlow, Tim; Scott, Kristan; Wagenseller, Aubrey; Gammie, Alison

    2013-01-01

    MSH2 is required for DNA mismatch repair recognition in eukaryotes. Deleterious mutations in human MSH2 account for approximately half of the alleles associated with a common hereditary cancer syndrome. Previously, we characterized clinically identified MSH2 missense mutations, using yeast as a model system, and found that the most common cause of defective DNA mismatch repair was low levels of the variant Msh2 proteins. Here, we show that increased protein turnover is responsible for the reduced cellular levels. Increasing gene dosage of more than half of the missense alleles fully restored function. A titration experiment revealed that raising the expression level of one variant to less than wild-type levels restored mismatch repair, suggesting that overexpression is not always required to regain function. We found that the ubiquitin-mediated proteasome degradation pathway is the major mechanism for increased turnover of the Msh2 variants and identified the primary ubiquitin ligase as San1. Deletion of San1 restored protein levels for all but one variant, but did not elevate wild-type Msh2 levels. The unstable variants interacted with San1, whereas wild-type Msh2 did not. Additionally, san1Δ suppressed the mismatch repair defect of unstable variants. Of medical significance, the clinically approved drug Bortezomib partially restored protein levels and mismatch repair function for low-level variants and reversed the resistance to cisplatin, a common chemotherapeutic. Our results provide the foundation for an innovative therapeutic regime for certain mismatch-repair-defective cancers that are refractory to conventional chemotherapies. PMID:23248292

  19. Regulation of mismatch repair by histone code and posttranslational modifications in eukaryotic cells.

    PubMed

    Li, Feng; Ortega, Janice; Gu, Liya; Li, Guo-Min

    2016-02-01

    DNA mismatch repair (MMR) protects genome integrity by correcting DNA replication-associated mispairs, modulating DNA damage-induced cell cycle checkpoints and regulating homeologous recombination. Loss of MMR function leads to cancer development. This review describes progress in understanding how MMR is carried out in the context of chromatin and how chromatin organization/compaction, epigenetic mechanisms and posttranslational modifications of MMR proteins influence and regulate MMR in eukaryotic cells.

  20. Mismatch repair proteins MSH2, MLH1, and EXO1 are important for class-switch recombination events occurring in B cells that lack nonhomologous end joining.

    PubMed

    Eccleston, Jennifer; Yan, Catherine; Yuan, Karen; Alt, Frederick W; Selsing, Erik

    2011-02-15

    In the absence of core nonhomologous end-joining (NHEJ) factors, Ab gene class-switch recombination (CSR) uses an alternative end-joining (A-EJ) pathway to recombine switch (S) region DNA breaks. Previous reports showing decreased S-junction microhomologies in MSH2-deficient mice and an exonuclease 1 (EXO1) role in yeast microhomology-mediated end joining suggest that mismatch repair (MMR) proteins might influence A-EJ-mediated CSR. We have directly investigated whether MMR proteins collectively or differentially influence the A-EJ mechanism of CSR by analyzing CSR in mice deficient in both XRCC4 and individual MMR proteins. We find CSR is reduced and that Igh locus chromosome breaks are reduced in the MMR/XRCC4 double-deficient B cells compared with B cells deficient in XRCC4 alone, suggesting MMR proteins function upstream of double-strand break formation to influence CSR efficiency in these cells. Our results show that MLH1, EXO1, and MSH2 are all important for efficient A-EJ-mediated CSR, and we propose that MMR proteins convert DNA nicks and point mutations into dsDNA breaks for both C-NHEJ and A-EJ pathways of CSR. We also find Mlh1-XRCC4(-) B cells have an increased frequency of direct S junctions, suggesting that MLH1 proteins may have additional functions that influence A-EJ-mediated CSR.

  1. Binding of mismatch repair protein MutS to mispaired DNA adducts of intercalating ruthenium(II) arene complexes.

    PubMed

    Castellano-Castillo, Maria; Kostrhunova, Hana; Marini, Victoria; Kasparkova, Jana; Sadler, Peter J; Malinge, Jean-Marc; Brabec, Viktor

    2008-08-01

    The present study was performed to examine the affinity of Escherichia coli mismatch repair (MMR) protein MutS for DNA damaged by an intercalating compound. We examined the binding properties of this protein with various DNA substrates containing a single centrally located adduct of ruthenium(II) arene complexes [(eta(6)-arene)Ru(II)(en)Cl][PF(6)] [arene is tetrahydroanthracene (THA) or p-cymene (CYM); en is ethylenediamine]. These two complexes were chosen as representatives of two different classes of monofunctional ruthenium(II) arene compounds which differ in DNA-binding modes: one that involves combined coordination to G N7 along with noncovalent, hydrophobic interactions, such as partial arene intercalation (tricyclic-ring Ru-THA), and the other that binds to DNA only via coordination to G N7 and does not interact with double-helical DNA by intercalation (monoring Ru-CYM). Using electrophoretic mobility shift assays, we examined the binding properties of MutS protein with various DNA duplexes (homoduplexes or mismatched duplexes) containing a single centrally located adduct of ruthenium(II) arene compounds. We have shown that presence of the ruthenium(II) arene adducts decreases the affinity of MutS for ruthenated DNA duplexes that either have a regular sequence or contain a mismatch and that intercalation of the arene contributes considerably to this inhibitory effect. Since MutS initiates MMR by recognizing DNA lesions, the results of the present work support the view that DNA damage due to intercalation is removed from DNA by a mechanism(s) other than MMR.

  2. Café-au-lait macules and pediatric malignancy caused by biallelic mutations in the DNA mismatch repair (MMR) gene PMS2.

    PubMed

    Jackson, Carl-Christian; Holter, Spring; Pollett, Aaron; Clendenning, Mark; Chou, Shirley; Senter, Leigha; Ramphal, Raveena; Gallinger, Steven; Boycott, Kym

    2008-06-01

    A 14-year-old male presented with a T4 sigmoid adenocarcinoma, <10 colonic adenomas and multiple café-au-lait macules. Family history was not suggestive of a dominant hereditary form of colorectal cancer. Evaluation of the tumor revealed abnormal immunohistochemical staining of the PMS2 protein and high frequency microsatellite instability. Germline analysis identified biallelic PMS2 missense mutations. A new cancer syndrome caused by biallelic mutations in the mismatch repair genes, including PMS2, is now emerging and is characterized by café-au-lait macules, colonic polyps and a distinctive tumor spectrum.

  3. Reduction of DNA mismatch repair protein expression in airway epithelial cells of premenopausal women chronically exposed to biomass smoke.

    PubMed

    Mukherjee, Bidisha; Dutta, Anindita; Chowdhury, Saswati; Roychoudhury, Sanghita; Ray, Manas Ranjan

    2014-02-01

    Biomass burning is a major source of indoor air pollution in rural India. This study examined whether chronic inhalation of biomass smoke causes change in the DNA mismatch repair (MMR) pathway in the airway cells. For this, airway cells exfoliated in sputum were collected from 72 premenopausal nonsmoking rural women (median age 34 years) who cooked with biomass (wood, dung, crop residues) and 68 control women who cooked with cleaner fuel liquefied petroleum gas (LPG) for the past 5 years or more. The levels of particulate matters with diameters less than 10 and 2.5 μm (PM10 and PM2.5) in indoor air were measured by real-time aerosol monitor. Benzene exposure was monitored by measuring trans,trans-muconic acid (t,t-MA) in urine by high-performance liquid chromatography with ultraviolet detector. Generation of reactive oxygen species (ROS) and level of superoxide dismutase (SOD) in airway cells were measured by flow cytometry and spectrophotometry, respectively. Immunocytochemical assay revealed lower percentage of airway epithelial cells expressing MMR proteins mutL homolog 1 (MLH1) and mutS homolog 2 (MSH2) in biomass-using women compared to LPG-using controls. Women who cooked with biomass had 6.7 times higher level of urinary t,t-MA, twofold increase in ROS generation, and 31 % depletion of SOD. Indoor air of biomass-using households had three times more particulate matters than that of controls. ROS, urinary t,t-MA, and particulate pollution in biomass-using kitchen had negative correlation, while SOD showed positive correlation with MSH2 and MLH1 expression. It appears that chronic exposure to biomass smoke reduces MMR response in airway epithelial cells, and oxidative stress plays an important role in the process.

  4. Selenium compounds activate ATM-dependent DNA damage responses via the mismatch repair protein hMLH1 in colorectal cancer cells

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Epidemiological and animal studies indicate that selenium supplementation suppresses risk of colorectal and other cancers. The majority of colorectal cancers are characterized by a defective DNA mismatch repair (MMR) process. Here, we have employed the MMR-deficient HCT 116 colorectal cancer cells ...

  5. Mismatch repair mRNA and protein expression in intestinal adenocarcinoma in sika deer (Cervus nippon) resembling heritable non-polyposis colorectal cancer in man.

    PubMed

    Jahns, H; Browne, J A

    2015-01-01

    Intestinal adenocarcinomas seen in an inbred herd of farmed sika deer (Cervus nippon) morphologically resembled human hereditary non-polyposis colorectal cancer (HNPCC). Features common to both included multiple de novo sites of tumourigenesis in the proximal colon, sessile and non-polyposis mucosal changes, the frequent finding of mucinous type adenocarcinoma, lymphocyte infiltration into the neoplastic tubules and Crohn's-like lymphoid follicles at the deep margin of the tumour. HNPCC is defined by a germline mutation of mismatch repair (MMR) genes resulting in their inactivation and loss of expression. To test the hypothesis that similar MMR gene inactivation occurs in the deer tumours, the expression of the four most important MMR genes, MSH2, MLH1, MSH6 and PMS2, was examined at the mRNA level by reverse transcriptase polymerase chain reaction (n = 12) and at the protein level by immunohistochemistry (n = 40) in tumour and control tissues. All four genes were expressed equally in normal and neoplastic tissues, so MMR gene inactivation could not be implicated in the carcinogenesis of this tumour in sika deer. PMID:25678423

  6. Novel DNA mismatch repair activity involving YB-1 in human mitochondria

    PubMed Central

    de Souza-Pinto, Nadja C.; Mason, Penelope A.; Hashiguchi, Kazunari; Weissman, Lior; Tian, Jingyan; Guay, David; Lebel, Michel; Stevnsner, Tinna V.; Rasmussen, Lene Juel; Bohr, Vilhelm A.

    2009-01-01

    Maintenance of the mitochondrial genome (mtDNA) is essential for proper cellular function. The accumulation of damage and mutations in the mtDNA leads to diseases, cancer, and aging. Mammalian mitochondria have proficient base excision repair, but the existence of other DNA repair pathways is still unclear. Deficiencies in DNA mismatch repair (MMR), which corrects base mismatches and small loops, are associated with DNA microsatellite instability, accumulation of mutations, and cancer. MMR proteins have been identified in yeast and coral mitochondria; however, MMR proteins and function have not yet been detected in human mitochondria. Here we show that human mitochondria have a robust mismatch-repair activity, which is distinct from nuclear MMR. Key nuclear MMR factors were not detected in mitochondria, and similar mismatch-binding activity was observed in mitochondrial extracts from cells lacking MSH2, suggesting distinctive pathways for nuclear and mitochondrial MMR. We identified the repair factor YB-1 as a key candidate for a mitochondrial mismatch-binding protein. This protein localizes to mitochondria in human cells, and contributes significantly to the mismatch-binding and mismatch-repair activity detected in HeLa mitochondrial extracts, which are significantly decreased when the intracellular levels of YB-1 are diminished. Moreover, YB-1 depletion in cells increases mitochondrial DNA mutagenesis. Our results show that human mitochondria contain a functional MMR repair pathway in which YB-1 participates, likely in the mismatch binding and recognition steps. PMID:19272840

  7. DNA Mismatch Repair

    PubMed Central

    MARINUS, M. G.

    2014-01-01

    DNA mismatch repair functions to correct replication errors in newly synthesized DNA and to prevent recombination between related, but not identical (homeologous), DNA sequences. The mechanism of mismatch repair is best understood in Escherichia coli and is the main focus of this review. The early genetic studies of mismatch repair are described as a basis for the subsequent biochemical characterization of the system. The effects of mismatch repair on homologous and homeologous recombination are described. The relationship of mismatch repair to cell toxicity induced by various drugs is included. The VSP (Very Short Patch) repair system is described in detail. PMID:26442827

  8. Immunohistochemistry staining for mismatch repair proteins: the endoscopic biopsy material provides useful and coherent results.

    PubMed

    Vilkin, Alex; Leibovici-Weissman, Ya'ara; Halpern, Marisa; Morgenstern, Sara; Brazovski, Eli; Gingold-Belfer, Rachel; Wasserberg, Nir; Brenner, Baruch; Niv, Yaron; Sneh-Arbib, Orly; Levi, Zohar

    2015-11-01

    Immunohistochemistry (IHC) testing for mismatch repair proteins (MMRP) in patients with colorectal cancer can be performed on endoscopic biopsy material or the surgical resection material. Data are continuing to accumulate regarding the deleterious effect of neoadjuvant chemoradiation on MMRP expression. However, despite continuing rise in the use of endoscopic biopsies for IHC, most pathology departments still use mainly the surgical materials for IHC testing. In this study we compared the quality of stains among 96 colon cancer subjects with paired endoscopic and surgical material available for MLH1, MSH2, MSH6, and PMS2 stains (96 × 4, yielding 384 paired stains). Each slide received both a quantitative score (immunoreactivity [0-3] × percent positivity [0-4]) and a qualitative score (absent; weak and focal; strong). The quantitative scores of all MMRP were significantly higher among the endoscopic material (P<.001 for all). In 358 pairs (93.2%), both the endoscopic and operative material stained either strong (322, 83.9%) or absent (36, 9.4%). In 26 pairs (6.8%), the endoscopic material stained strong, whereas the operative material stained focal and weak. No endoscopic biopsy materials stained focal and weak. Our findings indicate that the biopsy material may provide more coherent results. Although these results may indicate that biopsy material provides coherent and useful results, it is yet to be determined if the demonstrated differences pose a real clinical problem in interpreting final results of IHC staining of such kind. Hence, we suggest that when available, the endoscopic material rather than the operative one should serve as the primary substrate for IHC staining.

  9. Human mismatch-repair protein MutL homologue 1 (MLH1) interacts with Escherichia coli MutL and MutS in vivo and in vitro: a simple genetic system to assay MLH1 function.

    PubMed Central

    Quaresima, Barbara; Alifano, Pietro; Tassone, Pierfrancesco; Avvedimento, Enrico V; Costanzo, Francesco S; Venuta, Salvatore

    2003-01-01

    A simple genetic system has been developed to test the effect of over-expression of wild-type or mutated human MutL homologue 1 (hMLH1) proteins on methyl-directed mismatch repair (MMR) in Escherichia coli. The system relies on detection of Lac(+) revertants using MMR-proficient or MMR-deficient E. coli strains carrying a lac +1 frameshift mutation expressing hMLH1 proteins. We report that expression of wild-type hMLH1 protein causes an approx. 19-fold increase in mutation rates. The mutator phenotype was due to the ability of hMLH1 protein to interact with bacterial MutL and MutS proteins, thereby interfering with the formation of complexes between MMR proteins and mismatched DNA. Conversely, expression of proteins encoded by alleles deriving from hereditary-non-polyposis-colon-cancer (HNPCC) families decreases mutation rates, depending on the specific amino acid substitutions. These effects parallel the MutL-and MutS-binding and ATP-binding/hydrolysis activities of the mutated proteins. PMID:12513688

  10. Influence of very short patch mismatch repair on SOS inducing lesions after aminoglycoside treatment in Escherichia coli.

    PubMed

    Baharoglu, Zeynep; Mazel, Didier

    2014-01-01

    Low concentrations of aminoglycosides induce the SOS response in Vibrio cholerae but not in Escherichia coli. In order to determine whether a specific factor present in E. coli prevents this induction, we developed a genetic screen where only SOS inducing mutants are viable. We identified the vsr gene coding for the Vsr protein of the very short patch mismatch repair (VSPR) pathway. The effect of mismatch repair (MMR) mutants was also studied. We propose that lesions formed upon aminoglycoside treatment are preferentially repaired by VSPR without SOS induction in E. coli and by MMR when VSPR is impaired.

  11. Role of endometrial cancer abnormal MMR protein in screening Lynch-syndrome families

    PubMed Central

    Long, Qiongxian; Peng, Yong; Tang, Zhirong; Wu, Cailiang

    2014-01-01

    Objective: To identify patients with endometrial cancer with potential Lynch-related DNA mismatch repair (MMR) protein expression defects and to explore the role of these defects in screening for LS. Methods: Endometrial cancers from 173 patients recruited to the Nanchong Central Hospital were tested for MMR (MLH1, MSH2, PMS2, and MSH6) protein expression using immunohistochemistry (IHC). Results: In the 173 tumor tissue samples, the expression loss rates of MSH6, MSH2, PMS2 and MLH1 protein were 16.18% (28/173), 12.14% (21/173), 7.51% (13/173) and 5.78% (10/173), respectively. The total loss rate of MMR protein was 29.89% (27/87). There were 19 patients with a family history of cancer, of which 18 patients demonstrated loss of expression of MMR protein. In the 22 abnormal MMR patients without family history, five families were found to have Lynch-associated cancer (colorectal cancer, endometrial cancer, ovarian cancer, stomach cancer) after follow-up for two years. Conclusion: MMR proteins play an important role in the progress of endometrial cancer. The routine testing of MMR proteins in endometrial cancer can contribute to the screening of LS families, especially small families. PMID:25400828

  12. DNA Triplet Repeat Expansion and Mismatch Repair

    PubMed Central

    Iyer, Ravi R.; Pluciennik, Anna; Napierala, Marek; Wells, Robert D.

    2016-01-01

    DNA mismatch repair is a conserved antimutagenic pathway that maintains genomic stability through rectification of DNA replication errors and attenuation of chromosomal rearrangements. Paradoxically, mutagenic action of mismatch repair has been implicated as a cause of triplet repeat expansions that cause neurological diseases such as Huntington disease and myotonic dystrophy. This mutagenic process requires the mismatch recognition factor MutSβ and the MutLα (and/or possibly MutLγ) endonuclease, and is thought to be triggered by the transient formation of unusual DNA structures within the expanded triplet repeat element. This review summarizes the current knowledge of DNA mismatch repair involvement in triplet repeat expansion, which encompasses in vitro biochemical findings, cellular studies, and various in vivo transgenic animal model experiments. We present current mechanistic hypotheses regarding mismatch repair protein function in mediating triplet repeat expansions and discuss potential therapeutic approaches targeting the mismatch repair pathway. PMID:25580529

  13. Production of truncated MBD4 protein by frameshift mutation in DNA mismatch repair-deficient cells enhances 5-fluorouracil sensitivity that is independent of hMLH1 status.

    PubMed

    Suzuki, Satoshi; Iwaizumi, Moriya; Tseng-Rogenski, Stephanie; Hamaya, Yasushi; Miyajima, Hiroaki; Kanaoka, Shigeru; Sugimoto, Ken; Carethers, John M

    2016-07-01

    Methyl-CpG binding domain protein 4 (MBD4) is a DNA glycosylase that can remove 5-fluorodeoxyuracil from DNA as well as repair T:G or U:G mismatches. MBD4 is a target for frameshift mutation with DNA mismatch repair (MMR) deficiency, creating a truncated MBD4 protein (TruMBD4) that lacks its glycosylase domain. Here we show that TruMBD4 plays an important role for enhancing 5-fluorouracil (5FU) sensitivity in MMR-deficient colorectal cancer cells. We found biochemically that TruMBD4 binds to 5FU incorporated into DNA with higher affinity than MBD4. TruMBD4 reduced the 5FU affinity of the MMR recognition complexes that determined 5FU sensitivity by previous reports, suggesting other mechanisms might be operative to trigger cytotoxicity. To analyze overall 5FU sensitivity with TruMBD4, we established TruMBD4 overexpression in hMLH1-proficient or -deficient colorectal cancer cells followed by treatment with 5FU. 5FU-treated TruMBD4 cells demonstrated diminished growth characteristics compared to controls, independently of hMLH1 status. Flow cytometry revealed more 5FU-treated TruMBD4 cells in S phase than controls. We conclude that patients with MMR-deficient cancers, which show characteristic resistance to 5FU therapy, may be increased for 5FU sensitivity via secondary frameshift mutation of the base excision repair gene MBD4.

  14. Deficient mismatch repair: Read all about it (Review).

    PubMed

    Richman, Susan

    2015-10-01

    Defects in the DNA mismatch repair (MMR) proteins, result in a phenotype called microsatellite instability (MSI), occurring in up to 15% of sporadic colorectal cancers. Approximately one quarter of colon cancers with deficient MMR (dMMR) develop as a result of an inherited predisposition syndrome, Lynch syndrome (formerly known as HNPCC). It is essential to identify patients who potentially have Lynch syndrome, as not only they, but also family members, may require screening and monitoring. Diagnostic criteria have been developed, based primarily on Western populations, and several methodologies are available to identify dMMR tumours, including immunohistochemistry and microsatellite testing. These criteria have provided evidence supporting the introduction of reflex testing. Yet, it is becoming increasingly clear that tests have a limited sensitivity and specificity and may yet be superseded by next generation sequencing. In this review, the limitations of diagnostic criteria are discussed, and current and emerging screening technologies explained. There is now useful evidence supporting the prognostic and predictive value of dMMR status in colorectal tumours, but much less is known about their value in extracolonic tumours, that may also feature in Lynch syndrome. This review assesses current literature relating to dMMR in endometrial, ovarian, gastric and melanoma cancers, which it would seem, may benefit from large-scale clinical trials in order to further close the gap in knowledge between colorectal and extracolonic tumours. PMID:26315971

  15. Deficient mismatch repair: Read all about it (Review)

    PubMed Central

    RICHMAN, SUSAN

    2015-01-01

    Defects in the DNA mismatch repair (MMR) proteins, result in a phenotype called microsatellite instability (MSI), occurring in up to 15% of sporadic colorectal cancers. Approximately one quarter of colon cancers with deficient MMR (dMMR) develop as a result of an inherited predisposition syndrome, Lynch syndrome (formerly known as HNPCC). It is essential to identify patients who potentially have Lynch syndrome, as not only they, but also family members, may require screening and monitoring. Diagnostic criteria have been developed, based primarily on Western populations, and several methodologies are available to identify dMMR tumours, including immunohistochemistry and microsatellite testing. These criteria have provided evidence supporting the introduction of reflex testing. Yet, it is becoming increasingly clear that tests have a limited sensitivity and specificity and may yet be superseded by next generation sequencing. In this review, the limitations of diagnostic criteria are discussed, and current and emerging screening technologies explained. There is now useful evidence supporting the prognostic and predictive value of dMMR status in colorectal tumours, but much less is known about their value in extracolonic tumours, that may also feature in Lynch syndrome. This review assesses current literature relating to dMMR in endometrial, ovarian, gastric and melanoma cancers, which it would seem, may benefit from large-scale clinical trials in order to further close the gap in knowledge between colorectal and extracolonic tumours. PMID:26315971

  16. Immunohistochemical expression pattern of MMR protein can specifically identify patients with colorectal cancer microsatellite instability.

    PubMed

    Amira, Arfaoui Toumi; Mouna, Trabelsi; Ahlem, Blel; Raoudha, Aloui; Majid, Ben Hmida; Amel, Hamza; Rachida, Zermani; Nadia, Kourdaa

    2014-07-01

    The microsatellite instability (MSI) pathway is found in most cases of hereditary nonpolyposis colorectal cancer (HNPCC) and in 12 % of sporadic colorectal cancer (CRC). It involves inactivation of deoxyribonucleic acid mismatch repair (MMR) genes MLH1, MSH2, PMS2, and MSH6. MMR germline mutation detections are an important supplement to HNPCC clinical diagnosis. It enables at-risk and mutation-positive relatives to be informed about their cancer risks and to benefit from intensive surveillance programs that have been proven to reduce the incidence of CRC. In this study, we analyzed for the first time in Tunisia the potential value of immunohistochemical assessment of MMR protein to identify microsatellite instability in CRC. We evaluate by immunohistochemistry MMR protein expression loss in tumoral tissue compared to positive expression in normal mucosa. Immunohistochemistry revealed loss of expression for MLH1, MSH2, MSH6, and PMS2 in 15, 21, 13, and 15 % of cases, respectively. Here, we report a more elevated frequency of MSI compared to data of the literature. In fact, by immunohistochemistry, 70 % of cases were shown to be MSS phenotype, whereas 30 % of cases, in our set, were instable. Moreover, according to molecular investigation, 71 % of cases were instable (MSI-H) and remaining cases were stable (29 %). Thus, we found a perfect association between MMR immunohistochemical analyses and MSI molecular investigation. Immunohistochemical analysis of MMR gene product expression may allow one to specifically identify MSI phenotype of patients with colorectal carcinomas.

  17. Purification, crystallization and preliminary X-ray diffraction analysis of the human mismatch repair protein MutS[beta

    SciTech Connect

    Tseng, Quincy; Orans, Jillian; Hast, Michael A.; Iyer, Ravi R.; Changela, Anita; Modrich, Paul L.; Beese, Lorena S.

    2012-03-16

    MutS{beta} is a eukaryotic mismatch repair protein that preferentially targets extrahelical unpaired nucleotides and shares partial functional redundancy with MutS{alpha} (MSH2-MSH6). Although mismatch recognition by MutS{alpha} has been shown to involve a conserved Phe-X-Glu motif, little is known about the lesion-binding mechanism of MutS{beta}. Combined MSH3/MSH6 deficiency triggers a strong predisposition to cancer in mice and defects in msh2 and msh6 account for roughly half of hereditary nonpolyposis colorectal cancer mutations. These three MutS homologs are also believed to play a role in trinucleotide repeat instability, which is a hallmark of many neurodegenerative disorders. The baculovirus overexpression and purification of recombinant human MutS{beta} and three truncation mutants are presented here. Binding assays with heteroduplex DNA were carried out for biochemical characterization. Crystallization and preliminary X-ray diffraction analysis of the protein bound to a heteroduplex DNA substrate are also reported.

  18. Disease-associated repeat instability and mismatch repair.

    PubMed

    Schmidt, Monika H M; Pearson, Christopher E

    2016-02-01

    Expanded tandem repeat sequences in DNA are associated with at least 40 human genetic neurological, neurodegenerative, and neuromuscular diseases. Repeat expansion can occur during parent-to-offspring transmission, and arise at variable rates in specific tissues throughout the life of an affected individual. Since the ongoing somatic repeat expansions can affect disease age-of-onset, severity, and progression, targeting somatic expansion holds potential as a therapeutic target. Thus, understanding the factors that regulate this mutation is crucial. DNA repair, in particular mismatch repair (MMR), is the major driving force of disease-associated repeat expansions. In contrast to its anti-mutagenic roles, mammalian MMR curiously drives the expansion mutations of disease-associated (CAG)·(CTG) repeats. Recent advances have broadened our knowledge of both the MMR proteins involved in disease repeat expansions, including: MSH2, MSH3, MSH6, MLH1, PMS2, and MLH3, as well as the types of repeats affected by MMR, now including: (CAG)·(CTG), (CGG)·(CCG), and (GAA)·(TTC) repeats. Mutagenic slipped-DNA structures have been detected in patient tissues, and the size of the slip-out and their junction conformation can determine the involvement of MMR. Furthermore, the formation of other unusual DNA and R-loop structures is proposed to play a key role in MMR-mediated instability. A complex correlation is emerging between tissues showing varying amounts of repeat instability and MMR expression levels. Notably, naturally occurring polymorphic variants of DNA repair genes can have dramatic effects upon the levels of repeat instability, which may explain the variation in disease age-of-onset, progression and severity. An increasing grasp of these factors holds prognostic and therapeutic potential.

  19. Involvement of pelvic inflammation-related mismatch repair abnormalities and microsatellite instability in the malignant transformation of ovarian endometriosis.

    PubMed

    Fuseya, Chiho; Horiuchi, Akiko; Hayashi, Akiko; Suzuki, Akihisa; Miyamoto, Tsutomu; Hayashi, Takuma; Shiozawa, Tanri

    2012-11-01

    Inflammation in the ovary, including ovulation and pelvic inflammatory disease, has been proposed to play a role in the pathogenesis of ovarian cancer. Endometriotic lesions trigger a local inflammatory reaction and have been reported to be associated with an increased risk of epithelial ovarian cancer. However, the precise molecular mechanisms of ovarian cancer arising from endometriosis are still to be elucidated. To clarify the involvement of mismatch repair (MMR) abnormalities in the inflammation-associated malignant transformation of endometriosis, the immunohistochemical expression of mismatch repair proteins (human mutL homolog 1 [hMLH1] and human mutS homolog 2 [hMSH2]) was examined in 27 cases of ovarian endometriosis, 25 cases of ovarian carcinoma accompanied by endometriosis, and 39 cases of solitary ovarian carcinoma. In addition, the relationship between mismatch repair abnormalities including the microsatellite instability, PTEN (phosphatase and tensin homolog) mutation, and clinicopathologic parameters was analyzed. The expression of mismatch repair proteins was stepwisely decreased in endometriosis, ovarian carcinoma accompanied by endometriosis, and ovarian carcinoma. Tumors harboring multiple microsatellite instability (high-frequency microsatellite instability [MSI-H]) were detected in 4 (14.8%) of 27 cases of endometriosis and 7 (30.4%) of 23 cases of ovarian carcinomas. The frequency of PTEN mutations was higher in MSI-H cases than in microsatellite instability-stable (MSI-S) cases. In 2 cases of ovarian carcinoma accompanied by endometriosis, the decreased expression of mismatch repair proteins and MSI-H was observed in both the endometriosis and carcinoma lesions. Clinicopathologically, the MSI-H cases were associated with elevated serum levels of C-reactive protein and higher white blood cell counts. These findings suggest that mismatch repair abnormalities might be involved in the malignant transformation of ovarian endometriosis and that

  20. New Therapeutic Opportunities Based on DNA Mismatch Repair and BRAF Status in Metastatic Colorectal Cancer.

    PubMed

    Cohen, Romain; Svrcek, Magali; Dreyer, Chantal; Cervera, Pascale; Duval, Alex; Pocard, Marc; Fléjou, Jean-François; de Gramont, Aimery; André, Thierry

    2016-03-01

    Recently, colorectal cancer (CRC) subtyping consortium identified four consensus molecular subtypes (CMS1-4). CMS1 is enriched for deficient mismatch repair (dMMR) and BRAF (V600E) tumors. Intriguingly, this subtype has better relapse-free survival but worse overall survival after relapse compared with the other subtypes. Growing evidence is accumulating on the benefit of specific therapeutic strategies such as immune checkpoint inhibition therapy in dMMR tumors and mitogen-activated protein kinase (MAPK) pathway targeted therapy in tumors harboring BRAF (V600E) mutation. After reviewing dMMR prognostic value, immune checkpoints as major targets for dMMR carcinomas will be highlighted. Following, BRAF (V600E) prognostic impact will be reviewed and therapeutic strategies with the combination of cytotoxic agents and especially the combinations of BRAF and MAPK inhibitors will be discussed. PMID:26861657

  1. Evidence That the DNA Mismatch Repair System Removes 1-Nucleotide Okazaki Fragment Flaps*♦

    PubMed Central

    Kadyrova, Lyudmila Y.; Dahal, Basanta K.; Kadyrov, Farid A.

    2015-01-01

    The DNA mismatch repair (MMR) system plays a major role in promoting genome stability and suppressing carcinogenesis. In this work, we investigated whether the MMR system is involved in Okazaki fragment maturation. We found that in the yeast Saccharomyces cerevisiae, the MMR system and the flap endonuclease Rad27 act in overlapping pathways that protect the nuclear genome from 1-bp insertions. In addition, we determined that purified yeast and human MutSα proteins recognize 1-nucleotide DNA and RNA flaps. In reconstituted human systems, MutSα, proliferating cell nuclear antigen, and replication factor C activate MutLα endonuclease to remove the flaps. ATPase and endonuclease mutants of MutLα are defective in the flap removal. These results suggest that the MMR system contributes to the removal of 1-nucleotide Okazaki fragment flaps. PMID:26224637

  2. Isolation and Characterization of Two Saccharomyces Cerevisiae Genes Encoding Homologs of the Bacterial Hexa and Muts Mismatch Repair Proteins

    PubMed Central

    Reenan, R. A.; Kolodner, R. D.

    1992-01-01

    Homologs of the Escherichia coli (mutL, S and uvrD) and Streptococcus pneumoniae (hexA, B) genes involved in mismatch repair are known in several distantly related organisms. Degenerate oligonucleotide primers based on conserved regions of E. coli MutS protein and its homologs from Salmonella typhimurium, S. pneumoniae and human were used in the polymerase chain reaction (PCR) to amplify and clone mutS/hexA homologs from Saccharomyces cerevisiae. Two DNA sequences were amplified whose deduced amino acid sequences both shared a high degree of homology with MutS. These sequences were then used to clone the full-length genes from a yeast genomic library. Sequence analysis of the two MSH genes (MSH = mutS homolog), MSH1 and MSH2, revealed open reading frames of 2877 bp and 2898 bp. The deduced amino acid sequences predict polypeptides of 109.3 kD and 109.1 kD, respectively. The overall amino acid sequence identity with the E. coli MutS protein is 28.6% for MSH1 and 25.2% for MSH2. Features previously found to be shared by MutS homologs, such as the nucleotide binding site and the helix-turn-helix DNA binding motif as well as other highly conserved regions whose function remain unknown, were also found in the two yeast homologs. Evidence presented in this and a companion study suggest that MSH1 is involved in repair of mitochondrial DNA and that MSH2 is involved in nuclear DNA repair. PMID:1459447

  3. The dual nature of mismatch repair as antimutator and mutator: for better or for worse.

    PubMed

    Bak, Sara Thornby; Sakellariou, Despoina; Pena-Diaz, Javier

    2014-01-01

    DNA is constantly under attack by a number of both exogenous and endogenous agents that challenge its integrity. Among the mechanisms that have evolved to counteract this deleterious action, mismatch repair (MMR) has specialized in removing DNA biosynthetic errors that occur when replicating the genome. Malfunction or inactivation of this system results in an increase in spontaneous mutability and a strong predisposition to tumor development. Besides this key corrective role, MMR proteins are involved in other pathways of DNA metabolism such as mitotic and meiotic recombination and processing of oxidative damage. Surprisingly, MMR is also required for certain mutagenic processes. The mutagenic MMR has beneficial consequences contributing to the generation of a vast repertoire of antibodies through class switch recombination and somatic hypermutation processes. However, this non-canonical mutagenic MMR also has detrimental effects; it promotes repeat expansions associated with neuromuscular and neurodegenerative diseases and may contribute to cancer/disease-related aberrant mutations and translocations. The reaction responsible for replication error correction has been the most thoroughly studied and it is the subject to numerous reviews. This review describes briefly the biochemistry of MMR and focuses primarily on the non-canonical MMR activities described in mammals as well as emerging research implicating interplay of MMR and chromatin.

  4. Visualization of mismatch repair complexes using fluorescence microscopy.

    PubMed

    Schmidt, Tobias T; Hombauer, Hans

    2016-02-01

    DNA mismatch repair (MMR) is a surveillance mechanism present in most living organisms, which repairs errors introduced by DNA polymerases. Importantly, loss of MMR function due to inactivating mutations and/or epigenetic silencing results in the accumulation of mutations and as consequence increased cancer susceptibility, as observed in Lynch syndrome patients. During the past decades important progress has been made in the MMR field resulting in the identification and characterization of essential MMR components, culminating in the in vitro reconstitution of 5' and 3' nick-directed MMR. However, several mechanistic aspects of the MMR reaction remain not fully understood, therefore alternative approaches and further investigations are needed. Recently, the use of imaging techniques and, more specifically, visualization of MMR components in living cells, has broadened our mechanistic understanding of the repair reaction providing more detailed information about the spatio-temporal organization of MMR in vivo. In this review we would like to comment on mechanistic aspects of the MMR reaction in light of these and other recent findings. Moreover, we will discuss the current limitations and provide future perspectives regarding imaging of mismatch repair components in diverse organisms. PMID:26725956

  5. Phosphorylation of PCNA by EGFR inhibits mismatch repair and promotes misincorporation during DNA synthesis.

    PubMed

    Ortega, Janice; Li, Jessie Y; Lee, Sanghee; Tong, Dan; Gu, Liya; Li, Guo-Min

    2015-05-01

    Proliferating cell nuclear antigen (PCNA) plays essential roles in eukaryotic cells during DNA replication, DNA mismatch repair (MMR), and other events at the replication fork. Earlier studies show that PCNA is regulated by posttranslational modifications, including phosphorylation of tyrosine 211 (Y211) by the epidermal growth factor receptor (EGFR). However, the functional significance of Y211-phosphorylated PCNA remains unknown. Here, we show that PCNA phosphorylation by EGFR alters its interaction with mismatch-recognition proteins MutSα and MutSβ and interferes with PCNA-dependent activation of MutLα endonuclease, thereby inhibiting MMR at the initiation step. Evidence is also provided that Y211-phosphorylated PCNA induces nucleotide misincorporation during DNA synthesis. These findings reveal a novel mechanism by which Y211-phosphorylated PCNA promotes cancer development and progression via facilitating error-prone DNA replication and suppressing the MMR function.

  6. Mismatch repair proficiency is not required for radioenhancement by gemcitabine

    SciTech Connect

    Bree, Chris van . E-mail: c.vanbree@amc.uva.nl; Rodermond, Hans M.; Vos, Judith de; Haveman, Jaap; Franken, Nicolaas

    2005-08-01

    Purpose: Mismatch repair (MMR) proficiency has been reported to either increase or decrease radioenhancement by 24-h incubations with gemcitabine. This study aimed to establish the importance of MMR for radioenhancement by gemcitabine after short-exposure, high-dose treatment and long-exposure, low-dose treatment. Methods and Materials: Survival of MMR-deficient HCT116 and MMR-proficient HCT116 + 3 cells was analyzed by clonogenic assays. Mild, equitoxic gemcitabine treatments (4 h, 0.1 {mu}M vs. 24 h, 6 nM) were combined with {gamma}-irradiation to determine the radioenhancement with or without recovery. Gemcitabine metabolism and cell-cycle effects were evaluated by high-performance liquid chromatography analysis and bivariate flow cytometry. Results: Radioenhancement after 4 h of 0.1 {mu}M of gemcitabine was similar in both cell lines, but the radioenhancement after 24 h of 6 nM of gemcitabine was reduced in MMR-proficient cells. No significant differences between both cell lines were observed in the gemcitabine metabolism or cell-cycle effects after these treatments. Gemcitabine radioenhancement after recovery was also lower in MMR-proficient cells than in MMR-deficient cells. Conclusion: Mismatch repair proficiency decreases radioenhancement by long incubations of gemcitabine but does not affect radioenhancement by short exposures to a clinically relevant gemcitabine dose. Our data suggest that MMR contributes to the recovery from gemcitabine treatment.

  7. DNA mismatch repair pathway defects in the pathogenesis and evolution of myeloma.

    PubMed

    Velangi, Mark R; Matheson, Elizabeth C; Morgan, Gareth J; Jackson, Graham H; Taylor, Penelope R; Hall, Andrew G; Irving, Julie A E

    2004-10-01

    Genetic instability is a prominent feature in multiple myeloma and progression of this disease from monoclonal gammopathy of uncertain significance (MGUS) and smouldering myeloma (SMM) is associated with increasing molecular and chromosomal abnormalities. The DNA mismatch repair (MMR) pathway is a post-replicational DNA repair system that maintains genetic stability by repairing mismatched bases and insertion/deletion loops mistakenly incorporated during DNA replication. Deficiencies in proteins pivotal to this pathway result in a higher mutation rate, particularly at regions of microsatellite DNA. We have investigated the proficiency of the MMR pathway in clinical samples and myeloma cell lines. Microsatellite analysis showed instability at one or more of nine loci examined in 15 from 92 patients: 7.7% of MGUS/SMM, 20.7% of MM/plasma cell leukaemia (PCL) and 12.5% of relapsed MM/PCL. An in vitro heteroduplex G/T repair assay found reduced repair in two cell lines, JIM1 and JIM3, and in two of four PCL cases and was associated with aberrant expression of at least one mismatch repair protein. Thus we show that MMR defects are found in plasma cell dyscrasias and the increased frequency during more active stages of the disease suggests a contributory role in disease progression. PMID:15142887

  8. DNA mismatch repair: molecular mechanisms and biological function.

    PubMed

    Schofield, Mark J; Hsieh, Peggy

    2003-01-01

    DNA mismatch repair (MMR) guards the integrity of the genome in virtually all cells. It contributes about 1000-fold to the overall fidelity of replication and targets mispaired bases that arise through replication errors, during homologous recombination, and as a result of DNA damage. Cells deficient in MMR have a mutator phenotype in which the rate of spontaneous mutation is greatly elevated, and they frequently exhibit microsatellite instability at mono- and dinucleotide repeats. The importance of MMR in mutation avoidance is highlighted by the finding that defects in MMR predispose individuals to hereditary nonpolyposis colorectal cancer. In addition to its role in postreplication repair, the MMR machinery serves to police homologous recombination events and acts as a barrier to genetic exchange between species. PMID:14527292

  9. Interplay between mismatch repair and chromatin assembly

    PubMed Central

    Schöpf, Barbara; Bregenhorn, Stephanie; Quivy, Jean-Pierre; Kadyrov, Farid A.; Almouzni, Genevieve; Jiricny, Josef

    2012-01-01

    Single strand nicks and gaps in DNA have been reported to increase the efficiency of nucleosome loading mediated by chromatin assembly factor 1 (CAF-1). However, on mismatch-containing substrates, these strand discontinuities are utilized by the mismatch repair (MMR) system as loading sites for exonuclease 1, at which degradation of the error-containing strand commences. Because packaging of DNA into chromatin might inhibit MMR, we were interested to learn whether chromatin assembly is differentially regulated on heteroduplex and homoduplex substrates. We now show that the presence of a mismatch in a nicked plasmid substrate delays nucleosome loading in human cell extracts. Our data also suggest that, once the mismatch is removed, repair of the single-stranded gap is accompanied by efficient nucleosome loading. We postulated that the balance between MMR and chromatin assembly might be governed by proliferating cell nuclear antigen (PCNA), the processivity factor of replicative DNA polymerases, which is loaded at DNA termini and which interacts with the MSH6 subunit of the mismatch recognition factor MutSα, as well as with CAF-1. We now show that this regulation might be more complex; MutSα and CAF-1 interact not only with PCNA, but also with each other. In vivo this interaction increases during S-phase and may be controlled by the phosphorylation status of the p150 subunit of CAF-1. PMID:22232658

  10. Proteogenomic analysis reveals unanticipated adaptations of colorectal tumor cells to deficiencies in DNA mismatch repair

    PubMed Central

    Halvey, Patrick J.; Wang, Xiaojing; Wang, Jing; Bhat, Ajaz A.; Dhawan, Punita; Li, Ming; Zhang, Bing; Liebler, Daniel C.; Slebos, Robbert J.C.

    2014-01-01

    Summary A growing body of genomic data on human cancers poses the critical question of how genomic variations translate to cancer phenotypes. We employed standardized shotgun proteomics and targeted protein quantitation platforms to analyze a panel of 10 colon cancer cell lines differing by mutations in DNA mismatch repair (MMR) genes. In addition, we performed transcriptome sequencing (RNA-seq) to enable detection of protein sequence variants from the proteomic data. Biological replicate cultures yielded highly consistent proteomic inventories with a cumulative total of 6,513 protein groups with a protein FDR of 3.17% across all cell lines. Networks of co-expressed proteins with differential expression based on MMR status revealed impact on protein folding, turnover and transport, on cellular metabolism and on DNA and RNA synthesis and repair. Analysis of variant amino acid sequences suggested higher stability of proteins affected by naturally occurring germline polymorphisms than of proteins affected by somatic protein sequence changes. The data provide evidence for multi-system adaptation to MMR deficiency with a stress response that targets misfolded proteins for degradation through the ubiquitin-dependent proteasome pathway. Enrichment analysis suggested epithelial-to-mesenchymal transition (EMT) in RKO cells, as evidenced by increased mobility and invasion properties compared to SW480. The observed proteomic profiles demonstrate previously unknown consequences of altered DNA repair and provide an expanded basis for mechanistic interpretation of MMR phenotypes. PMID:24247723

  11. Proteomic Analysis Reveals a Novel Mutator S (MutS) Partner Involved in Mismatch Repair Pathway.

    PubMed

    Chen, Zhen; Tran, Mykim; Tang, Mengfan; Wang, Wenqi; Gong, Zihua; Chen, Junjie

    2016-04-01

    The mismatch repair (MMR) family is a highly conserved group of proteins that function in correcting base-base and insertion-deletion mismatches generated during DNA replication. Disruption of this process results in characteristic microsatellite instability (MSI), repair defects, and susceptibility to cancer. However, a significant fraction of MSI-positive cancers express MMR genes at normal levels and do not carry detectable mutation in known MMR genes, suggesting that additional factors and/or mechanisms may exist to explain these MSI phenotypes in patients. To systematically investigate the MMR pathway, we conducted a proteomic analysis and identified MMR-associated protein complexes using tandem-affinity purification coupled with mass spectrometry (TAP-MS) method. The mass spectrometry data have been deposited to the ProteomeXchange with identifier PXD003014 and DOI 10.6019/PXD003014. We identified 230 high-confidence candidate interaction proteins (HCIPs). We subsequently focused on MSH2, an essential component of the MMR pathway and uncovered a novel MSH2-binding partner, WDHD1. We further demonstrated that WDHD1 forms a stable complex with MSH2 and MSH3 or MSH6,i.e.the MutS complexes. The specific MSH2/WDHD1 interaction is mediated by the second lever domain of MSH2 and Ala(1123)site of WDHD1. Moreover, we showed that, just like MSH2-deficient cells, depletion of WDHD1 also led to 6-thioguanine (6-TG) resistance, indicating that WDHD1 likely contributes to the MMR pathway. Taken together, our study uncovers new components involved in the MMR pathway, which provides candidate genes that may be responsible for the development of MSI-positive cancers.

  12. Conjugational hyperrecombination achieved by derepressing the LexA regulon, altering the properties of RecA protein and inactivating mismatch repair in Escherichia coli K-12.

    PubMed Central

    Lanzov, Vladislav A; Bakhlanova, Irina V; Clark, Alvin J

    2003-01-01

    The frequency of recombinational exchanges (FRE) that disrupt co-inheritance of transferred donor markers in Escherichia coli Hfr by F(-) crosses differs by up to a factor of two depending on physiological factors and culture conditions. Under standard conditions we found FRE to be 5.01 +/- 0.43 exchanges per 100-min units of DNA length for wild-type strains of the AB1157 line. Using these conditions we showed a cumulative effect of various mutations on FRE. Constitutive SOS expression by lexA gene inactivation (lexA71::Tn5) and recA gene mutation (recA730) showed, respectively, approximately 4- and 7-fold increases of FRE. The double lexA71 recA730 combination gave an approximately 17-fold increase in FRE. Addition of mutS215::Tn10, inactivating the mismatch repair system, to the double lexA recA mutant increased FRE to approximately 26-fold above wild-type FRE. Finally, we showed that another recA mutation produced as much SOS expression as recA730 but increased FRE only 3-fold. We conclude that three factors contribute to normally low FRE under standard conditions: repression of the LexA regulon, the properties of wild-type RecA protein, and a functioning MutSHL mismatch repair system. We discuss mechanisms by which the lexA, recA, and mutS mutations may elevate FRE cumulatively to obtain hyperrecombination. PMID:12702672

  13. Mismatch repair genes expression defects & association with clinicopathological characteristics in colorectal carcinoma

    PubMed Central

    Kaur, Gurjeet; Masoud, Abdelhafid; Raihan, N.; Radzi, M.; Khamizar, W.; Kam, Lee Suk

    2011-01-01

    Background & objectives: DNA mismatch repair gene (MMR) abnormalities are seen in 95 per cent of hereditary nonpolyposis colorectal cancer (HNPCC) and 10-15 per cent of sporadic colorectal cancers. There are no data on MMR abnormalities in Malaysian colorectal cancer patients. This study was aimed to determine the frequency of abnormal MMR gene protein expression in colorectal carcinoma in Northern Peninsular Malaysia using immunohistochemistry. Methods: Clinicopathological information was obtained from 148 patients’ records who underwent bowel resection for colorectal cancer (CRC) at the three hospitals in Malaysia. Immunohistochemistry for MLH1, MSH2, MSH6 and PMS2 proteins were performed on paraffin embedded tissue containing carcinoma. Results: A total of 148 subjects and 150 colorectal carcinomas of sporadic and hereditary types were assessed. Three patients had synchronous tumours. Twenty eight cancers (18.6%) from 26 subjects (17.6%) had absent immunohistochemical expression of any one of the MMR gene proteins. This comprised absent MLH1 only – 3 cancers, absent MSH2 only – 3, absent MSH6 only – 2, absent PMS2 only – 3, absent MLH1 and PMS2 – 14, absent MSH2 and MSH6 – 2 and absent MLH1, MSH6 and PMS2 – 1. There was significant association between abnormal MMR gene protein expression and proximal colon cancers, mucinous, signet ring and poorly differentiated morphology. Interpretation & conclusions: Cancers with abnormal MMR gene expression were associated with microsatellite instability-high (MSI-H) phenotype. About 15 per cent demonstrated absent MSH2, MSH6 and PMS2 protein expression in isolation or in combination with other MMR genes, which often predicts a germline mutation, synonymous with a diagnosis of HNPCC. This appears to be high frequency compared to reported data. PMID:21911971

  14. DNA mismatch repair gene mutations in human cancer.

    PubMed Central

    Peltomäki, P

    1997-01-01

    A new pathogenetic mechanism leading to cancer has been delineated in the past 3 years when human homologues of DNA mismatch repair (MMR) genes have been identified and shown to be involved in various types of cancer. Germline mutations of MMR genes cause susceptibility to a hereditary form of colon cancer, hereditary nonpolyposis colon cancer (HNPCC), which represents one of the most common syndromes associated with cancer predisposition in man. Tumors from HNPCC patients are hypermutable and show length variation at short tandem repeat sequences, a phenomenon referred to as microsatellite instability or replication errors. A similar abnormality is found in a proportion of sporadic tumors of the colorectum as well as a variety of other organs; acquired mutations in MMR genes or other endogenous or exogenous causes may underlie these cases. Genetic and biochemical characterization of the functions of normal and mutated MMR genes elucidates mechanisms of cancer development and provides tools for diagnostic applications. PMID:9255561

  15. LNA modification of single-stranded DNA oligonucleotides allows subtle gene modification in mismatch-repair-proficient cells

    PubMed Central

    van Ravesteyn, Thomas W.; Dekker, Marleen; Fish, Alexander; Sixma, Titia K.; Wolters, Astrid; Dekker, Rob J.; te Riele, Hein P. J.

    2016-01-01

    Synthetic single-stranded DNA oligonucleotides (ssODNs) can be used to generate subtle genetic modifications in eukaryotic and prokaryotic cells without the requirement for prior generation of DNA double-stranded breaks. However, DNA mismatch repair (MMR) suppresses the efficiency of gene modification by >100-fold. Here we present a commercially available ssODN design that evades MMR and enables subtle gene modification in MMR-proficient cells. The presence of locked nucleic acids (LNAs) in the ssODNs at mismatching bases, or also at directly adjacent bases, allowed 1-, 2-, or 3-bp substitutions in MMR-proficient mouse embryonic stem cells as effectively as in MMR-deficient cells. Additionally, in MMR-proficient Escherichia coli, LNA modification of the ssODNs enabled effective single-base-pair substitution. In vitro, LNA modification of mismatches precluded binding of purified E. coli MMR protein MutS. These findings make ssODN-directed gene modification particularly well suited for applications that require the evaluation of a large number of sequence variants with an easy selectable phenotype. PMID:26951689

  16. Tumor Mismatch Repair Immunohistochemistry and DNA MLH1 Methylation Testing of Patients With Endometrial Cancer Diagnosed at Age Younger Than 60 Years Optimizes Triage for Population-Level Germline Mismatch Repair Gene Mutation Testing

    PubMed Central

    Buchanan, Daniel D.; Tan, Yen Y.; Walsh, Michael D.; Clendenning, Mark; Metcalf, Alexander M.; Ferguson, Kaltin; Arnold, Sven T.; Thompson, Bryony A.; Lose, Felicity A.; Parsons, Michael T.; Walters, Rhiannon J.; Pearson, Sally-Ann; Cummings, Margaret; Oehler, Martin K.; Blomfield, Penelope B.; Quinn, Michael A.; Kirk, Judy A.; Stewart, Colin J.; Obermair, Andreas; Young, Joanne P.; Webb, Penelope M.; Spurdle, Amanda B.

    2014-01-01

    Purpose Clinicopathologic data from a population-based endometrial cancer cohort, unselected for age or family history, were analyzed to determine the optimal scheme for identification of patients with germline mismatch repair (MMR) gene mutations. Patients and Methods Endometrial cancers from 702 patients recruited into the Australian National Endometrial Cancer Study (ANECS) were tested for MMR protein expression using immunohistochemistry (IHC) and for MLH1 gene promoter methylation in MLH1-deficient cases. MMR mutation testing was performed on germline DNA of patients with MMR-protein deficient tumors. Prediction of germline mutation status was compared for combinations of tumor characteristics, age at diagnosis, and various clinical criteria (Amsterdam, Bethesda, Society of Gynecologic Oncology, ANECS). Results Tumor MMR-protein deficiency was detected in 170 (24%) of 702 cases. Germline testing of 158 MMR-deficient cases identified 22 truncating mutations (3% of all cases) and four unclassified variants. Tumor MLH1 methylation was detected in 99 (89%) of 111 cases demonstrating MLH1/PMS2 IHC loss; all were germline MLH1 mutation negative. A combination of MMR IHC plus MLH1 methylation testing in women younger than 60 years of age at diagnosis provided the highest positive predictive value for the identification of mutation carriers at 46% versus ≤ 41% for any other criteria considered. Conclusion Population-level identification of patients with MMR mutation-positive endometrial cancer is optimized by stepwise testing for tumor MMR IHC loss in patients younger than 60 years, tumor MLH1 methylation in individuals with MLH1 IHC loss, and germline mutations in patients exhibiting loss of MSH6, MSH2, or PMS2 or loss of MLH1/PMS2 with absence of MLH1 methylation. PMID:24323032

  17. Proliferation rate but not mismatch repair affects the long-term response of colon carcinoma cells to 5FU treatment.

    PubMed

    Choudhary, B; Hanski, M L; Zeitz, M; Hanski, C

    2012-07-01

    The role of mismatch repair (MMR) in the response of colon carcinoma cells to 5-fluorouracil (5FU) is not well understood. In most of the in vitro studies only short-term response was investigated. We focussed here on the influence of MMR status on the mechanism of the short- and long-term response to clinically relevant 5FU concentrations by using isogenic or semiisogenic cell line pairs expressing/nonexpressing the hMLH1 protein, an important component of the MMR system. We show that the lower survival of MMR-proficient than of MMR-deficient cells in the clonogenic survival assay is due to a more frequent early cell arrest and to subsequent senescence. By contrast, the long-term cell growth after treatment, which is also affected by long-term arrest and senescence, is independent from the MMR status. The overall effect on the long-term cell growth is a cumulative result of cell proliferation rate-dependent growth inhibition, apoptosis and necrotic cell death. The main long-term cytotoxic effect of 5FU is the inhibition of growth while apoptosis and the necrotic cell death are minor contributions.

  18. ARID1A loss correlates with mismatch repair deficiency and intact p53 expression in high-grade endometrial carcinomas

    PubMed Central

    Allo, Ghassan; Bernardini, Marcus Q; Wu, Ren-Chin; Shih, Ie-Ming; Kalloger, Steve; Pollett, Aaron; Gilks, C Blake; Clarke, Blaise A

    2015-01-01

    BAF250a (ARID1A) loss is a frequent event in high-grade endometrial cancers. It has been proposed that ARID1A is a driver gene, with ARID1A mutations occurring secondary to deregulated mismatch repair mechanism in gastric cancers, representing an alternative oncogenic pathway to p53 alteration. The prognostic significance of ARID1A loss is controversial. In this study, we investigated the frequency of BAF250a immunohistochemical loss in a cohort of high-grade endometrial cancers (n = 190) and correlated it with mismatch repair (hMLH1, hMSH2, hMSH6, and hPMS2) and p53 protein expression. The 190 cases consisted of 82 high-grade endometrioid, 88 serous, 10 clear cell, and 10 mixed (carcinosarcomas and mixed histology). There was BAF250a loss in 55/190 (29%) cancers, most commonly in high-grade endometrioid carcinomas (46 vs 9% in serous carcinomas, P<0.0001). Loss of any mismatch repair proteins was observed in 63/190 (33%) cancers, most commonly in high-grade endometrioid carcinomas (57 vs 10% in serous carcinomas, P<0.0001). Aberrant p53 expression was found in 86/190 (45%) cancers, more commonly in serous carcinomas (77 vs 18% in high-grade endometrioid carcinomas, P<0.0001). BAF250a loss was associated with mismatch repair loss (P<0.0001) and normal p53 expression (P<0.0001). These associations were maintained in the subset analysis within the high-grade endometrioid (P = 0.026 and P = 0.0083, respectively) and serous carcinoma cases (P = 0.0031 and P<0.0001, respectively). Survival analysis revealed a superior progression-free survival (P = 0.017) for patients with BAF250a loss within the entire cohort but not within the high-grade endometrioid and serous subtypes. Additionally, data from The Cancer Genome Atlas were extracted to correlate mutations in ARID1A, TP53, and MMR genes; we found that ARID1A mutations were negatively associated with TP53 mutations but were unrelated to mismatch repair gene mutations. In conclusion, BAF250a loss is more common in high

  19. FANCJ localization by mismatch repair is vital to maintain genomic integrity after UV irradiation.

    PubMed

    Guillemette, Shawna; Branagan, Amy; Peng, Min; Dhruva, Aashana; Schärer, Orlando D; Cantor, Sharon B

    2014-02-01

    Nucleotide excision repair (NER) is critical for the repair of DNA lesions induced by UV radiation, but its contribution in replicating cells is less clear. Here, we show that dual incision by NER endonucleases, including XPF and XPG, promotes the S-phase accumulation of the BRCA1 and Fanconi anemia-associated DNA helicase FANCJ to sites of UV-induced damage. FANCJ promotes replication protein A phosphorylation and the arrest of DNA synthesis following UV irradiation. Interaction defective mutants of FANCJ reveal that BRCA1 binding is not required for FANCJ localization, whereas interaction with the mismatch repair (MMR) protein MLH1 is essential. Correspondingly, we find that FANCJ, its direct interaction with MLH1, and the MMR protein MSH2 function in a common pathway in response to UV irradiation. FANCJ-deficient cells are not sensitive to killing by UV irradiation, yet we find that DNA mutations are significantly enhanced. Thus, we considered that FANCJ deficiency could be associated with skin cancer. Along these lines, in melanoma we found several somatic mutations in FANCJ, some of which were previously identified in hereditary breast cancer and Fanconi anemia. Given that, mutations in XPF can also lead to Fanconi anemia, we propose collaborations between Fanconi anemia, NER, and MMR are necessary to initiate checkpoint activation in replicating human cells to limit genomic instability.

  20. Replication stalling and heteroduplex formation within CAG/CTG trinucleotide repeats by mismatch repair.

    PubMed

    Viterbo, David; Michoud, Grégoire; Mosbach, Valentine; Dujon, Bernard; Richard, Guy-Franck

    2016-06-01

    Trinucleotide repeat expansions are responsible for at least two dozen neurological disorders. Mechanisms leading to these large expansions of repeated DNA are still poorly understood. It was proposed that transient stalling of the replication fork by the repeat tract might trigger slippage of the newly-synthesized strand over its template, leading to expansions or contractions of the triplet repeat. However, such mechanism was never formally proven. Here we show that replication fork pausing and CAG/CTG trinucleotide repeat instability are not linked, stable and unstable repeats exhibiting the same propensity to stall replication forks when integrated in a yeast natural chromosome. We found that replication fork stalling was dependent on the integrity of the mismatch-repair system, especially the Msh2p-Msh6p complex, suggesting that direct interaction of MMR proteins with secondary structures formed by trinucleotide repeats in vivo, triggers replication fork pauses. We also show by chromatin immunoprecipitation that Msh2p is enriched at trinucleotide repeat tracts, in both stable and unstable orientations, this enrichment being dependent on MSH3 and MSH6. Finally, we show that overexpressing MSH2 favors the formation of heteroduplex regions, leading to an increase in contractions and expansions of CAG/CTG repeat tracts during replication, these heteroduplexes being dependent on both MSH3 and MSH6. These heteroduplex regions were not detected when a mutant msh2-E768A gene in which the ATPase domain was mutated was overexpressed. Our results unravel two new roles for mismatch-repair proteins: stabilization of heteroduplex regions and transient blocking of replication forks passing through such repeats. Both roles may involve direct interactions between MMR proteins and secondary structures formed by trinucleotide repeat tracts, although indirect interactions may not be formally excluded. PMID:27045900

  1. Biomarkers for immune therapy in colorectal cancer: mismatch-repair deficiency and others

    PubMed Central

    Bupathi, Manojkumar

    2016-01-01

    Colorectal cancer (CRC) is a heterogeneous disease for which the treatment backbone has primarily been cytotoxic chemotherapy. With better understanding of the involved molecular mechanisms, it is now known that there are a number of epigenetic and genetic events, which are involved in CRC pathogenesis. Specific biomarkers have been identified which can be used to determine the clinical outcome of patients beyond tumor staging and predict for treatment efficacy. Molecular testing is now routinely performed to select for patients that will benefit the most from targeted agents and immunotherapy. In addition to KRAS, NRAS, and BRAF mutation (MT), analysis of DNA mismatch repair (MMR) status, tumor infiltrating lymphocytes, and checkpoint protein expression may be helpful to determine whether patients are eligible for certain therapies. The focus of this article is to discuss present and upcoming biomarkers for immunotherapy in CRC. PMID:27747085

  2. The Kub5-Hera/RPRD1B interactome: a novel role in preserving genetic stability by regulating DNA mismatch repair

    PubMed Central

    Patidar, Praveen L.; Motea, Edward A.; Fattah, Farjana J.; Zhou, Yunyun; Morales, Julio C.; Xie, Yang; Garner, Harold R.; Boothman, David A.

    2016-01-01

    Ku70-binding protein 5 (Kub5)-Hera (K-H)/RPRD1B maintains genetic integrity by concomitantly minimizing persistent R-loops and promoting repair of DNA double strand breaks (DSBs). We used tandem affinity purification-mass spectrometry, co-immunoprecipitation and gel-filtration chromatography to define higher-order protein complexes containing K-H scaffolding protein to gain insight into its cellular functions. We confirmed known protein partners (Ku70, RNA Pol II, p15RS) and discovered several novel associated proteins that function in RNA metabolism (Topoisomerase 1 and RNA helicases), DNA repair/replication processes (PARP1, MSH2, Ku, DNA-PKcs, MCM proteins, PCNA and DNA Pol δ) and in protein metabolic processes, including translation. Notably, this approach directed us to investigate an unpredicted involvement of K-H in DNA mismatch repair (MMR) where K-H depletion led to concomitant MMR deficiency and compromised global microsatellite stability. Mechanistically, MMR deficiency in K-H-depleted cells was a consequence of reduced stability of the core MMR proteins (MLH1 and PMS2) caused by elevated basal caspase-dependent proteolysis. Pan-caspase inhibitor treatment restored MMR protein loss. These findings represent a novel mechanism to acquire MMR deficiency/microsatellite alterations. A significant proportion of colon, endometrial and ovarian cancers exhibit k-h expression/copy number loss and may have severe mutator phenotypes with enhanced malignancies that are currently overlooked based on sporadic MSI+ screening. PMID:26819409

  3. DNA Mismatch Repair System: Repercussions in Cellular Homeostasis and Relationship with Aging

    PubMed Central

    Conde-Pérezprina, Juan Cristóbal; León-Galván, Miguel Ángel; Konigsberg, Mina

    2012-01-01

    The mechanisms that concern DNA repair have been studied in the last years due to their consequences in cellular homeostasis. The diverse and damaging stimuli that affect DNA integrity, such as changes in the genetic sequence and modifications in gene expression, can disrupt the steady state of the cell and have serious repercussions to pathways that regulate apoptosis, senescence, and cancer. These altered pathways not only modify cellular and organism longevity, but quality of life (“health-span”). The DNA mismatch repair system (MMR) is highly conserved between species; its role is paramount in the preservation of DNA integrity, placing it as a necessary focal point in the study of pathways that prolong lifespan, aging, and disease. Here, we review different insights concerning the malfunction or absence of the DNA-MMR and its impact on cellular homeostasis. In particular, we will focus on DNA-MMR mechanisms regulated by known repair proteins MSH2, MSH6, PMS2, and MHL1, among others. PMID:23213348

  4. Dynamic control of strand excision during human DNA mismatch repair.

    PubMed

    Jeon, Yongmoon; Kim, Daehyung; Martín-López, Juana V; Lee, Ryanggeun; Oh, Jungsic; Hanne, Jeungphill; Fishel, Richard; Lee, Jong-Bong

    2016-03-22

    Mismatch repair (MMR) is activated by evolutionarily conserved MutS homologs (MSH) and MutL homologs (MLH/PMS). MSH recognizes mismatched nucleotides and form extremely stable sliding clamps that may be bound by MLH/PMS to ultimately authorize strand-specific excision starting at a distant 3'- or 5'-DNA scission. The mechanical processes associated with a complete MMR reaction remain enigmatic. The purified human (Homo sapien or Hs) 5'-MMR excision reaction requires the HsMSH2-HsMSH6 heterodimer, the 5' → 3' exonuclease HsEXOI, and the single-stranded binding heterotrimer HsRPA. The HsMLH1-HsPMS2 heterodimer substantially influences 5'-MMR excision in cell extracts but is not required in the purified system. Using real-time single-molecule imaging, we show that HsRPA or Escherichia coli EcSSB restricts HsEXOI excision activity on nicked or gapped DNA. HsMSH2-HsMSH6 activates HsEXOI by overcoming HsRPA/EcSSB inhibition and exploits multiple dynamic sliding clamps to increase tract length. Conversely, HsMLH1-HsPMS2 regulates tract length by controlling the number of excision complexes, providing a link to 5' MMR.

  5. Combined mismatch repair and POLE/POLD1 defects explain unresolved suspected Lynch syndrome cancers.

    PubMed

    Jansen, Anne Ml; van Wezel, Tom; van den Akker, Brendy Ewm; Ventayol Garcia, Marina; Ruano, Dina; Tops, Carli Mj; Wagner, Anja; Letteboer, Tom Gw; Gómez-García, Encarna B; Devilee, Peter; Wijnen, Juul T; Hes, Frederik J; Morreau, Hans

    2016-07-01

    Many suspected Lynch Syndrome (sLS) patients who lack mismatch repair (MMR) germline gene variants and MLH1 or MSH2 hypermethylation are currently explained by somatic MMR gene variants or, occasionally, by germline POLE variants. To further investigate unexplained sLS patients, we analyzed leukocyte and tumor DNA of 62 sLS patients using gene panel sequencing including the POLE, POLD1 and MMR genes. Forty tumors showed either one, two or more somatic MMR variants predicted to affect function. Nine sLS tumors showed a likely ultramutated phenotype and were found to carry germline (n=2) or somatic variants (n=7) in the POLE/POLD1 exonuclease domain (EDM). Six of these POLE/POLD1-EDM mutated tumors also carried somatic MMR variants. Our findings suggest that faulty proofreading may result in loss of MMR and thereby in microsatellite instability.

  6. Combined mismatch repair and POLE/POLD1 defects explain unresolved suspected Lynch syndrome cancers

    PubMed Central

    Jansen, Anne ML; van Wezel, Tom; van den Akker, Brendy EWM; Ventayol Garcia, Marina; Ruano, Dina; Tops, Carli MJ; Wagner, Anja; Letteboer, Tom GW; Gómez-García, Encarna B; Devilee, Peter; Wijnen, Juul T; Hes, Frederik J; Morreau, Hans

    2016-01-01

    Many suspected Lynch Syndrome (sLS) patients who lack mismatch repair (MMR) germline gene variants and MLH1 or MSH2 hypermethylation are currently explained by somatic MMR gene variants or, occasionally, by germline POLE variants. To further investigate unexplained sLS patients, we analyzed leukocyte and tumor DNA of 62 sLS patients using gene panel sequencing including the POLE, POLD1 and MMR genes. Forty tumors showed either one, two or more somatic MMR variants predicted to affect function. Nine sLS tumors showed a likely ultramutated phenotype and were found to carry germline (n=2) or somatic variants (n=7) in the POLE/POLD1 exonuclease domain (EDM). Six of these POLE/POLD1-EDM mutated tumors also carried somatic MMR variants. Our findings suggest that faulty proofreading may result in loss of MMR and thereby in microsatellite instability. PMID:26648449

  7. Risk of colorectal cancer for people with a mutation in both a MUTYH and a DNA mismatch repair gene.

    PubMed

    Win, Aung Ko; Reece, Jeanette C; Buchanan, Daniel D; Clendenning, Mark; Young, Joanne P; Cleary, Sean P; Kim, Hyeja; Cotterchio, Michelle; Dowty, James G; MacInnis, Robert J; Tucker, Katherine M; Winship, Ingrid M; Macrae, Finlay A; Burnett, Terrilea; Le Marchand, Loïc; Casey, Graham; Haile, Robert W; Newcomb, Polly A; Thibodeau, Stephen N; Lindor, Noralane M; Hopper, John L; Gallinger, Steven; Jenkins, Mark A

    2015-12-01

    The base excision repair protein, MUTYH, functionally interacts with the DNA mismatch repair (MMR) system. As genetic testing moves from testing one gene at a time, to gene panel and whole exome next generation sequencing approaches, understandin g the risk associated with co-existence of germline mutations in these genes will be important for clinical interpretation and management. From the Colon Cancer Family Registry, we identified 10 carriers who had both a MUTYH mutation (6 with c.1187G>A p.(Gly396Asp), 3 with c.821G>A p.(Arg274Gln), and 1 with c.536A>G p.(Tyr179Cys)) and a MMR gene mutation (3 in MLH1, 6 in MSH2, and 1 in PMS2), 375 carriers of a single (monoallelic) MUTYH mutation alone, and 469 carriers of a MMR gene mutation alone. Of the 10 carriers of both gene mutations, 8 were diagnosed with colorectal cancer. Using a weighted cohort analysis, we estimated that risk of colorectal cancer for carriers of both a MUTYH and a MMR gene mutation was substantially higher than that for carriers of a MUTYH mutation alone [hazard ratio (HR) 21.5, 95% confidence interval (CI) 9.19-50.1; p < 0.001], but not different from that for carriers of a MMR gene mutation alone (HR 1.94, 95% CI 0.63-5.99; p = 0.25). Within the limited power of this study, there was no evidence that a monoallelic MUTYH gene mutation confers additional risk of colorectal cancer for carriers of a MMR gene mutation alone. Our finding suggests MUTYH mutation testing in MMR gene mutation carriers is not clinically informative.

  8. Mismatch repair-dependent G2 checkpoint induced by low doses of SN1 type methylating agents requires the ATR kinase.

    PubMed

    Stojic, Lovorka; Mojas, Nina; Cejka, Petr; Di Pietro, Massimiliano; Ferrari, Stefano; Marra, Giancarlo; Jiricny, Josef

    2004-06-01

    S(N)1-type alkylating agents represent an important class of chemotherapeutics, but the molecular mechanisms underlying their cytotoxicity are unknown. Thus, although these substances modify predominantly purine nitrogen atoms, their toxicity appears to result from the processing of O(6)-methylguanine ((6Me)G)-containing mispairs by the mismatch repair (MMR) system, because cells with defective MMR are highly resistant to killing by these agents. In an attempt to understand the role of the MMR system in the molecular transactions underlying the toxicity of alkylating agents, we studied the response of human MMR-proficient and MMR-deficient cells to low concentrations of the prototypic methylating agent N-methyl-N'-nitro-N-nitrosoguanidine (MNNG). We now show that MNNG treatment induced a cell cycle arrest that was absolutely dependent on functional MMR. Unusually, the cells arrested only in the second G(2) phase after treatment. Downstream targets of both ATM (Ataxia telangiectasia mutated) and ATR (ATM and Rad3-related) kinases were modified, but only the ablation of ATR, or the inhibition of CHK1, attenuated the arrest. The checkpoint activation was accompanied by the formation of nuclear foci containing the signaling and repair proteins ATR, the S(*)/T(*)Q substrate, gamma-H2AX, and replication protein A (RPA). The persistence of these foci implied that they may represent sites of irreparable damage. PMID:15175264

  9. Functional analysis of the interaction between the mismatch repair protein MutS and the replication processivity factor β clamp in Pseudomonas aeruginosa.

    PubMed

    Monti, Mariela R; Miguel, Virginia; Borgogno, Maria V; Argaraña, Carlos E

    2012-05-01

    Interaction between MutS and the replication factor β clamp has been extensively studied in a Mismatch Repair context; however, its functional consequences are not well understood. We have analyzed the role of the MutS-β clamp interaction in Pseudomonas aeruginosa by characterizing a β clamp binding motif mutant, denominated MutSβ, which does not interact with the replication factor. A detailed characterization of P. aeruginosa strain PAO1 harboring a chromosomal mutSβ allele demonstrated that this mutant strain exhibited mutation rates to rifampicin and ciprofloxacin resistance comparable to that of the parental strain. mutSβ PAO1 was as proficient as the parental strain for DNA repair under highly mutagenic conditions imposed by the adenine base analog 2-aminopurine. In addition, using a tetracycline resistance reversion assay to assess the repair of a frameshift mutation, we determined that the parental and mutSβ strains exhibited similar reversion rates. Our results clearly indicate that the MutS-β clamp interaction does not have a central role in the methylation-independent Mismatch Repair of P. aeruginosa.

  10. Mismatch Repair Modulation of MutY Activity Drives Bacillus subtilis Stationary-Phase Mutagenesis ▿

    PubMed Central

    Debora, Bernardo N.; Vidales, Luz E.; Ramírez, Rosario; Ramírez, Mariana; Robleto, Eduardo A.; Yasbin, Ronald E.; Pedraza-Reyes, Mario

    2011-01-01

    Stress-promoted mutations that occur in nondividing cells (adaptive mutations) have been implicated strongly in causing genetic variability as well as in species survival and evolutionary processes. Oxidative stress-induced DNA damage has been associated with generation of adaptive His+ and Met+ but not Leu+ revertants in strain Bacillus subtilis YB955 (hisC952 metB5 leuC427). Here we report that an interplay between MutY and MutSL (mismatch repair system [MMR]) plays a pivotal role in the production of adaptive Leu+ revertants. Essentially, the genetic disruption of MutY dramatically reduced the reversion frequency to the leu allele in this model system. Moreover, the increased rate of adaptive Leu+ revertants produced by a MutSL knockout strain was significantly diminished following mutY disruption. Interestingly, although the expression of mutY took place during growth and stationary phase and was not under the control of RecA, PerR, or σB, a null mutation in the mutSL operon increased the expression of mutY several times. Thus, in starved cells, saturation of the MMR system may induce the expression of mutY, disturbing the balance between MutY and MMR proteins and aiding in the production of types of mutations detected by reversion to leucine prototrophy. In conclusion, our results support the idea that MMR regulation of the mutagenic/antimutagenic properties of MutY promotes stationary-phase mutagenesis in B. subtilis cells. PMID:20971907

  11. Physical and functional interactions between Werner syndrome helicase and mismatch-repair initiation factors

    PubMed Central

    Saydam, Nurten; Kanagaraj, Radhakrishnan; Dietschy, Tobias; Garcia, Patrick L.; Peña-Diaz, Javier; Shevelev, Igor; Stagljar, Igor; Janscak, Pavel

    2007-01-01

    Werner syndrome (WS) is a severe recessive disorder characterized by premature aging, cancer predisposition and genomic instability. The gene mutated in WS encodes a bi-functional enzyme called WRN that acts as a RecQ-type DNA helicase and a 3′-5′ exonuclease, but its exact role in DNA metabolism is poorly understood. Here we show that WRN physically interacts with the MSH2/MSH6 (MutSα), MSH2/MSH3 (MutSβ) and MLH1/PMS2 (MutLα) heterodimers that are involved in the initiation of mismatch repair (MMR) and the rejection of homeologous recombination. MutSα and MutSβ can strongly stimulate the helicase activity of WRN specifically on forked DNA structures with a 3′-single-stranded arm. The stimulatory effect of MutSα on WRN-mediated unwinding is enhanced by a G/T mismatch in the DNA duplex ahead of the fork. The MutLα protein known to bind to the MutS α–heteroduplex complexes has no effect on WRN-mediated DNA unwinding stimulated by MutSα, nor does it affect DNA unwinding by WRN alone. Our data are consistent with results of genetic experiments in yeast suggesting that MMR factors act in conjunction with a RecQ-type helicase to reject recombination between divergent sequences. PMID:17715146

  12. Interaction between Mismatch Repair and Genetic Recombination in Saccharomyces Cerevisiae

    PubMed Central

    Alani, E.; Reenan, RAG.; Kolodner, R. D.

    1994-01-01

    The yeast Saccharomyces cerevisiae encodes a set of genes that show strong amino acid sequence similarity to MutS and MutL, proteins required for mismatch repair in Escherichia coli. We examined the role of MSH2 and PMS1, yeast homologs of mutS and mutL, respectively, in the repair of base pair mismatches formed during meiotic recombination. By using specifically marked HIS4 and ARG4 alleles, we showed that msh2 mutants displayed a severe defect in the repair of all base pair mismatches as well as 1-, 2- and 4-bp insertion/deletion mispairs. The msh2 and pms1 phenotypes were indistinguishable, suggesting that the wild-type gene products act in the same repair pathway. A comparison of gene conversion events in wild-type and msh2 mutants indicated that mismatch repair plays an important role in genetic recombination. (1) Tetrad analysis at five different loci revealed that, in msh2 mutants, the majority of aberrant segregants displayed a sectored phenotype, consistent with a failure to repair mismatches created during heteroduplex formation. In wild type, base pair mismatches were almost exclusively repaired toward conversion rather than restoration. (2) In msh2 strains 10-19% of the aberrant tetrads were Ab4:4. (3) Polarity gradients at HIS4 and ARG4 were nearly abolished in msh2 mutants. The frequency of gene conversion at the 3' end of these genes was increased and was nearly the frequency observed at the 5' end. (4) Co-conversion studies were consistent with mismatch repair acting to regulate heteroduplex DNA tract length. We favor a model proposing that recombination events occur through the formation and resolution of heteroduplex intermediates and that mismatch repair proteins specifically interact with recombination enzymes to regulate the length of symmetric heteroduplex DNA. PMID:8056309

  13. Immunohistochemistry and microsatellite instability analysis in molecular subtyping of colorectal carcinoma based on mismatch repair competency

    PubMed Central

    Yuan, Lin; Chi, Yayun; Chen, Weixiang; Chen, Xiaochen; Wei, Ping; Sheng, Weiqi; Zhou, Xiaoyan; Shi, Daren

    2015-01-01

    Mismatch repair defective (MMRd) colorectal carcinoma (CRC) is a distinct molecular phenotype of colorectal cancer, including 12% of sporadic CRC and 3% of Lynch Syndrome. In order to investigate the clinicopathological characteristics of MMRd colorectal carcinoma, and to find the most effective method for preliminary screening, 296 CRC fulfilled revised Bethesda Guideline (RB) were selected from 1450 CRCs to perform both IHC staining for MLH1, MSH2, MSH6, PMS2 and MSI analysis. Sixty-eight tumors were classified as MSI-H by MSI test. Colorectal carcinomas with MSI-H were prone to be proximal located, poorly differentiated, and relatively early staged, with infrequent metastasis to lymph node as well as to distant organs, compared with MSS ones. All of the 68 MMRd CRCs presented abnormal expression of at least one mismatch repair protein (MMRP), with 48 concurrent negative of MLH1 and PMS2, 14 concurrent negative of MSH2 and MSH6, 4 isolated negative of MSH6, 1 isolated negative of PMS2, and 1 concurrent negative of 4 MMRPs. All of the MLH1 negative tumors also showed abnormal expression of PMS2. All of the MSH2 negative cases also presented negative expression of MSH6. The sensitivity and specificity of the 2-antibody IHC test contained only PMS2 and MSH6 for screening for MMRd CRC were 100% and 98.2% respectively, exactly the same as that of the 4-antibody IHC test with all of the 4 MMRPs. The diagnostic accordance rate of the 2-antibody approach and MSI analysis was 98.6%. In conclusion, MMRd CRC has characteristic clinicopathological features different from MSS CRCs. The 2-antibody IHC approach containing MSH6 and PMS2 is the most easy and effective way to detecting MMR deficiency in CRC. PMID:26885030

  14. Functional domains of the Saccharomyces cerevisiae Mlh1p and Pms1p DNA mismatch repair proteins and their relevance to human hereditary nonpolyposis colorectal cancer-associated mutations.

    PubMed Central

    Pang, Q; Prolla, T A; Liskay, R M

    1997-01-01

    The MutL protein is an essential component of the Escherichia coli methyl-directed mismatch repair system but has no known enzymatic function. In the yeast Saccharomyces cerevisiae, the MutL equivalent, an Mlh1p and Pms1p heterodimer, interacts with Msh2p bound to mismatch-containing DNA. Little is known of the functional domains of Mlh1p and Pms1p. In this report, we define the Mlh1p and Pms1p domains required for Mlh1p-Pms1p interaction. The Mlh1p-interactive domain of Pms1p is comprised of 260 amino acids near the carboxyl terminus while the Pms1p-interactive domain of Mlh1p resides in the final 212 residues. The two domains are sufficient for Mlh1p-Pms1p interaction, as determined by the two-hybrid assay and by in vitro protein affinity chromatography. Deletions within the domains completely eliminated Mlh1p-Pms1p interaction. Using site-directed mutagenesis, we altered a number of highly conserved residues in the Mlh1p and Pms1p proteins, including some alterations that mimic germline mutations observed for human hereditary nonpolyposis colorectal cancer. Alterations either in the consensus MutL box located in the amino-terminal portion of each protein or in the carboxyl-terminal homology motif of Mlh1p eliminated DNA mismatch repair function but had no effect on Mlh1p-Pms1p interaction. In addition, certain MLH1 and PMS1 mutant alleles caused a dominant negative mutator effect when overexpressed. We discuss the implications of these findings for the structural organization of the Mlh1p and Pms1p proteins and the importance of Mlh1p-Pms1p interaction. PMID:9234704

  15. Hydrolytic function of Exo1 in mammalian mismatch repair

    PubMed Central

    Shao, Hongbing; Baitinger, Celia; Soderblom, Erik J.; Burdett, Vickers; Modrich, Paul

    2014-01-01

    Genetic and biochemical studies have previously implicated exonuclease 1 (Exo1) in yeast and mammalian mismatch repair, with results suggesting that function of the protein in the reaction depends on both its hydrolytic activity and its ability to interact with other components of the repair system. However, recent analysis of an Exo1-E109K knockin mouse has concluded that Exo1 function in mammalian mismatch repair is restricted to a structural role, a conclusion based on a prior report that N-terminal His-tagged Exo1-E109K is hydrolytically defective. Because Glu-109 is distant from the nuclease hydrolytic center, we have compared the activity of untagged full-length Exo1-E109K with that of wild type Exo1 and the hydrolytically defective active site mutant Exo1-D173A. We show that the activity of Exo1-E109K is comparable to that of wild type enzyme in a conventional exonuclease assay and that in contrast to a D173A active site mutant, Exo1-E109K is fully functional in mismatch-provoked excision and repair. We conclude that the catalytic function of Exo1 is required for its participation in mismatch repair. We also consider the other phenotypes of the Exo1-E109K mouse in the context of Exo1 hydrolytic function. PMID:24829455

  16. Role of Deficient Mismatch Repair in the Personalized Management of Colorectal Cancer

    PubMed Central

    Zhang, Cong-Min; Lv, Jin-Feng; Gong, Liang; Yu, Lin-Yu; Chen, Xiao-Ping; Zhou, Hong-Hao; Fan, Lan

    2016-01-01

    Colorectal cancer (CRC) represents the third most common type of cancer in developed countries and one of the leading causes of cancer deaths worldwide. Personalized management of CRC has gained increasing attention since there are large inter-individual variations in the prognosis and response to drugs used to treat CRC owing to molecular heterogeneity. Approximately 15% of CRCs are caused by deficient mismatch repair (dMMR) characterized by microsatellite instability (MSI) phenotype. The present review is aimed at highlighting the role of MMR status in informing prognosis and personalized treatment of CRC including adjuvant chemotherapy, targeted therapy, and immune checkpoint inhibitor therapy to guide the individualized therapy of CRC. PMID:27618077

  17. Microsatellites in the Eukaryotic DNA Mismatch Repair Genes as Modulators of Evolutionary Mutation Rate

    NASA Technical Reports Server (NTRS)

    Chang, Dong Kyung; Metzgar, David; Wills, Christopher; Boland, C. Richard

    2003-01-01

    All "minor" components of the human DNA mismatch repair (MMR) system-MSH3, MSH6, PMS2, and the recently discovered MLH3-contain mononucleotide microsatellites in their coding sequences. This intriguing finding contrasts with the situation found in the major components of the DNA MMR system-MSH2 and MLH1-and, in fact, most human genes. Although eukaryotic genomes are rich in microsatellites, non-triplet microsatellites are rare in coding regions. The recurring presence of exonal mononucleotide repeat sequences within a single family of human genes would therefore be considered exceptional.

  18. Role of Deficient Mismatch Repair in the Personalized Management of Colorectal Cancer.

    PubMed

    Zhang, Cong-Min; Lv, Jin-Feng; Gong, Liang; Yu, Lin-Yu; Chen, Xiao-Ping; Zhou, Hong-Hao; Fan, Lan

    2016-01-01

    Colorectal cancer (CRC) represents the third most common type of cancer in developed countries and one of the leading causes of cancer deaths worldwide. Personalized management of CRC has gained increasing attention since there are large inter-individual variations in the prognosis and response to drugs used to treat CRC owing to molecular heterogeneity. Approximately 15% of CRCs are caused by deficient mismatch repair (dMMR) characterized by microsatellite instability (MSI) phenotype. The present review is aimed at highlighting the role of MMR status in informing prognosis and personalized treatment of CRC including adjuvant chemotherapy, targeted therapy, and immune checkpoint inhibitor therapy to guide the individualized therapy of CRC. PMID:27618077

  19. Impact of DNA mismatch repair system alterations on human fertility and related treatments*

    PubMed Central

    Hu, Min-hao; Liu, Shu-yuan; Wang, Ning; Wu, Yan; Jin, Fan

    2016-01-01

    DNA mismatch repair (MMR) is one of the biological pathways, which plays a critical role in DNA homeostasis, primarily by repairing base-pair mismatches and insertion/deletion loops that occur during DNA replication. MMR also takes part in other metabolic pathways and regulates cell cycle arrest. Defects in MMR are associated with genomic instability, predisposition to certain types of cancers and resistance to certain therapeutic drugs. Moreover, genetic and epigenetic alterations in the MMR system demonstrate a significant relationship with human fertility and related treatments, which helps us to understand the etiology and susceptibility of human infertility. Alterations in the MMR system may also influence the health of offspring conceived by assisted reproductive technology in humans. However, further studies are needed to explore the specific mechanisms by which the MMR system may affect human infertility. This review addresses the physiological mechanisms of the MMR system and associations between alterations of the MMR system and human fertility and related treatments, and potential effects on the next generation. PMID:26739522

  20. Impact of DNA mismatch repair system alterations on human fertility and related treatments.

    PubMed

    Hu, Min-hao; Liu, Shu-yuan; Wang, Ning; Wu, Yan; Jin, Fan

    2016-01-01

    DNA mismatch repair (MMR) is one of the biological pathways, which plays a critical role in DNA homeostasis, primarily by repairing base-pair mismatches and insertion/deletion loops that occur during DNA replication. MMR also takes part in other metabolic pathways and regulates cell cycle arrest. Defects in MMR are associated with genomic instability, predisposition to certain types of cancers and resistance to certain therapeutic drugs. Moreover, genetic and epigenetic alterations in the MMR system demonstrate a significant relationship with human fertility and related treatments, which helps us to understand the etiology and susceptibility of human infertility. Alterations in the MMR system may also influence the health of offspring conceived by assisted reproductive technology in humans. However, further studies are needed to explore the specific mechanisms by which the MMR system may affect human infertility. This review addresses the physiological mechanisms of the MMR system and associations between alterations of the MMR system and human fertility and related treatments, and potential effects on the next generation.

  1. MutSα maintains the mismatch repair capability by inhibiting PCNA unloading

    PubMed Central

    Kawasoe, Yoshitaka; Tsurimoto, Toshiki; Nakagawa, Takuro; Masukata, Hisao; Takahashi, Tatsuro S

    2016-01-01

    Eukaryotic mismatch repair (MMR) utilizes single-strand breaks as signals to target the strand to be repaired. DNA-bound PCNA is also presumed to direct MMR. The MMR capability must be limited to a post-replicative temporal window during which the signals are available. However, both identity of the signal(s) involved in the retention of this temporal window and the mechanism that maintains the MMR capability after DNA synthesis remain unclear. Using Xenopus egg extracts, we discovered a mechanism that ensures long-term retention of the MMR capability. We show that DNA-bound PCNA induces strand-specific MMR in the absence of strand discontinuities. Strikingly, MutSα inhibited PCNA unloading through its PCNA-interacting motif, thereby extending significantly the temporal window permissive to strand-specific MMR. Our data identify DNA-bound PCNA as the signal that enables strand discrimination after the disappearance of strand discontinuities, and uncover a novel role of MutSα in the retention of the post-replicative MMR capability. DOI: http://dx.doi.org/10.7554/eLife.15155.001 PMID:27402201

  2. Evidence for presence of mismatch repair gene expression positive Lynch syndrome cases in India.

    PubMed

    Bashyam, Murali D; Kotapalli, Viswakalyan; Raman, Ratheesh; Chaudhary, Ajay K; Yadav, Brijesh K; Gowrishankar, Swarnalata; Uppin, Shantveer G; Kongara, Ravikanth; Sastry, Regulagadda A; Vamsy, Mohana; Patnaik, Sujit; Rao, Satish; Dsouza, Shoba; Desai, Devendra; Tester, Ashavaid

    2015-12-01

    Lynch syndrome (LS), the most common form of familial CRC predisposition that causes tumor onset at a young age, is characterized by the presence of microsatellite instability (MSI) in tumors due to germline inactivation of mismatch repair (MMR) system. Two MMR genes namely MLH1 and MSH2 account for majority of LS cases while MSH6 and PMS2 may account for a minor proportion. In order to identify MMR genes causing LS in India, we analyzed MSI and determined expression status of the four MMR genes in forty eight suspected LS patient colorectal tumor samples. Though a majority exhibited MSI, only 58% exhibited loss of MMR expression, a significantly low proportion compared to reports from other populations. PCR-DNA sequencing and MLPA-based mutation and exonic deletion/duplication screening respectively, revealed genetic lesions in samples with and without MMR gene expression. Interestingly, tumor samples with and without MMR expression exhibited significant differences with respect to histological (mucin content) and molecular (instability exhibited by mononucleotide microsatellites) features. The study has revealed for the first time a significant proportion of LS tumors not exhibiting loss of MMR expression.

  3. Fusion tyrosine kinase NPM-ALK Deregulates MSH2 and suppresses DNA mismatch repair function novel insights into a potent oncoprotein.

    PubMed

    Young, Leah C; Bone, Kathleen M; Wang, Peng; Wu, Fang; Adam, Benjamin A; Hegazy, Samar; Gelebart, Pascal; Holovati, Jelena; Li, Liang; Andrew, Susan E; Lai, Raymond

    2011-07-01

    The fusion tyrosine kinase NPM-ALK is central to the pathogenesis of ALK-positive anaplastic large cell lymphoma (ALK(+)ALCL). We recently identified that MSH2, a key DNA mismatch repair (MMR) protein integral to the suppression of tumorigenesis, is an NPM-ALK-interacting protein. In this study, we found in vitro evidence that enforced expression of NPM-ALK in HEK293 cells suppressed MMR function. Correlating with these findings, six of nine ALK(+)ALCL tumors displayed evidence of microsatellite instability, as opposed to none of the eight normal DNA control samples (P = 0.007, Student's t-test). Using co-immunoprecipitation, we found that increasing levels of NPM-ALK expression in HEK293 cells resulted in decreased levels of MSH6 bound to MSH2, whereas MSH2·NPM-ALK binding was increased. The NPM-ALK·MSH2 interaction was dependent on the activation/autophosphorylation of NPM-ALK, and the Y191 residue of NPM-ALK was a crucial site for this interaction and NPM-ALK-mediated MMR suppression. MSH2 was found to be tyrosine phosphorylated in the presence of NPM-ALK. Finally, NPM-ALK impeded the expected DNA damage-induced translocation of MSH2 out of the cytoplasm. To conclude, our data support a model in which the suppression of MMR by NPM-ALK is attributed to its ability to interfere with normal MSH2 biochemistry and function.

  4. Multivariate analysis of MLH1 c.1664T>C (p.Leu555Pro) mismatch repair gene variant demonstrates its pathogenicity.

    PubMed

    Farrell, M P; Hughes, D J; Drost, M; Wallace, A J; Cummins, R J; Fletcher, T A; Meany, M A; Kay, E W; de Wind, N; Power, D G; Andrews, E J; Green, A J; Gallagher, D J

    2013-12-01

    Genetic testing of an Irish kindred identified an exonic nucleotide substitution c.1664T>C (p.Leu555Pro) in the MLH1 mismatch repair (MMR) gene. This previously unreported variant is classified as a "variant of uncertain significance" (VUS). Immunohistochemical (IHC) analysis and microsatellite instability (MSI) studies, genetic testing, a literature and online MMR mutation database review, in silico phenotype prediction tools, and an in vitro MMR activity assay were used to study the clinical significance of this variant. The MLH1 c.1664T>C (p.Leu555Pro) VUS co-segregated with three cases of classic Lynch syndrome-associated malignancies over two generations, with consistent loss of MLH1 and PMS2 protein expression on IHC, and evidence of the MSI-High mutator phenotype. The leucine at position 555 is well conserved across a number of species, and this novel variant has not been reported as a normal polymorphism in the general population. In silico and in vitro analyses suggest that this variant may have a deleterious effect on the MLH1 protein and abrogate MMR activity. Evidence from clinical, histological, immunohistochemical, and molecular genetic data suggests that MLH1 c.1664T>C (p.Leu555Pro) is likely to be the pathogenic cause of Lynch syndrome in this family.

  5. The CREB Coactivator CRTC2 is a Lymphoma Tumor Suppressor that Preserves Genome Integrity Through Transcription of DNA Mismatch Repair Genes

    PubMed Central

    Fang, Minggang; Pak, Magnolia L.; Chamberlain, Lynn; Xing, Wei; Yu, Hongbo; Green, Michael R.

    2015-01-01

    SUMMARY The CREB-regulated transcription coactivator CRTC2 stimulates CREB target gene expression and has a well-established role in modulating glucose and lipid metabolism. Here we find, unexpectedly, that loss of CRTC2, as well as CREB1 and its coactivator CREB-binding protein (CBP), results in a deficiency in DNA mismatch repair (MMR) and a resultant increased mutation frequency. We show that CRTC2, CREB1 and CBP are transcriptional activators of well-established MMR genes, including EXO1, MSH6, PMS1 and POLD2. Mining of expression profiling databases and analysis of patient samples reveal that CRTC2 and its target MMR genes are down-regulated in specific T-cell lymphoma subtypes, which are microsatellite unstable. The levels of acetylated histone H3 on the CRTC2 promoter are significantly reduced in lymphoma compared to normal tissue, explaining the decreased CRTC2 expression. Our results establish a role for CRTC2 as a lymphoma tumor suppressor gene that preserves genome integrity by stimulating transcription of MMR genes. PMID:26004186

  6. High frequency of mismatch repair deficiency among pediatric high grade gliomas in Jordan.

    PubMed

    Amayiri, Nisreen; Tabori, Uri; Campbell, Brittany; Bakry, Doua; Aronson, Melyssa; Durno, Carol; Rakopoulos, Patricia; Malkin, David; Qaddoumi, Ibrahim; Musharbash, Awni; Swaidan, Maisa; Bouffet, Eric; Hawkins, Cynthia; Al-Hussaini, Maysa

    2016-01-15

    Biallelic mismatch repair deficiency (bMMRD) is a cancer predisposition syndrome affecting primarily individuals from consanguinous families resulting in multiple childhood cancers including high grade gliomas (HGG). This is the first study to assess the prevalence of bMMRD among patients with HGG in countries where consanguinity is high. We collected molecular and clinical information on all children diagnosed with HGG and supratentorial primitive neuroectodermal tumors (sPNET) between 2003 and 2013 at King Hussein Cancer Center, Jordan. Comparison was made to a similar cohort from Toronto. Clinical data regarding presence of café au lait macules(CAL), family history of cancer, consanguinity, pathology and treatment were collected. Tumors were centrally reviewed and tested for MMRD by immunohistochemistry of the corresponding proteins. Forty-two patients fulfilled the inclusion criteria, including 36 with HGG. MMRD was observed in 39% of HGG of whom 79% also lost MMR staining in the corresponding normal cells suggestive of bMMRD. P53 dysfunction was highly enriched in MMR deficient tumors (p = 0.0003).The frequency of MMRD was significantly lower in Toronto cohort (23%, p = 0.03). Both evidence of CAL and consanguinity correlated with bMMRD (p = 0.005 and 0.05,respectively) but family history of cancer didn't. HGG with all three bMMRD risk factors had evidence of MMRD and all children affected by multiple bMMRD related cancers had identical gene loss by immunohistochemical staining. In Jordan, the frequency of clinical and immunohistochemical alterations suggestive of bMMRD in pediatric HGG is high. Genetic testing will enable appropriate counseling and cancer screening to improve survival of these patients.

  7. [DNA mismatch repair and BRAF status in colorectal cancer: Interest for the therapeutic management?].

    PubMed

    Cohen, Romain; Cervera, Pascale; Svrcek, Magali; Dumont, Clément; Garcia, Marie-Line; Chibaudel, Benoist; de Gramont, Aimery; Pocard, Marc; Duval, Alex; Fléjou, Jean-François; André, Thierry

    2015-06-01

    Colorectal cancer (CRC) is the second leading cause of cancer-related mortality in France. Recently, colorectal cancer subtyping consortium (CRCSC) identified 4 consensus molecular subtypes (CMS). CMS1 is enriched for CRC with deficient DNA mismatch repair system (dMMR) and tumors with mutated BRAF. Intriguingly, CMS1 is characterized by better relapse-free survival but worse survival after relapse, compared with the other subtypes. In this review, we provide a comprehensive overview of prognostic and predictive impacts of MMR and BRAF status. We highlight immune checkpoints inhibitors as potentially future therapeutics for CRC with deficient MMR. We also focus on the management of BRAF mutant metastatic CRC, with a particular interest on targeted therapies. PMID:26118880

  8. Human Pluripotent Stem Cells Have a Novel Mismatch Repair-dependent Damage Response*

    PubMed Central

    Lin, Bo; Gupta, Dipika; Heinen, Christopher D.

    2014-01-01

    Human pluripotent stem cells (PSCs) are presumed to have robust DNA repair pathways to ensure genome stability. PSCs likely need to protect against mutations that would otherwise be propagated throughout all tissues of the developing embryo. How these cells respond to genotoxic stress has only recently begun to be investigated. Although PSCs appear to respond to certain forms of damage more efficiently than somatic cells, some DNA damage response pathways such as the replication stress response may be lacking. Not all DNA repair pathways, including the DNA mismatch repair (MMR) pathway, have been well characterized in PSCs to date. MMR maintains genomic stability by repairing DNA polymerase errors. MMR is also involved in the induction of cell cycle arrest and apoptosis in response to certain exogenous DNA-damaging agents. Here, we examined MMR function in PSCs. We have demonstrated that PSCs contain a robust MMR pathway and are highly sensitive to DNA alkylation damage in an MMR-dependent manner. Interestingly, the nature of this alkylation response differs from that previously reported in somatic cell types. In somatic cells, a permanent G2/M cell cycle arrest is induced in the second cell cycle after DNA damage. The PSCs, however, directly undergo apoptosis in the first cell cycle. This response reveals that PSCs rely on apoptotic cell death as an important defense to avoid mutation accumulation. Our results also suggest an alternative molecular mechanism by which the MMR pathway can induce a response to DNA damage that may have implications for tumorigenesis. PMID:25012654

  9. Inactivation of the Mismatch Repair System in Pseudomonas aeruginosa Attenuates Virulence but Favors Persistence of Oropharyngeal Colonization in Cystic Fibrosis Mice▿

    PubMed Central

    Mena, Ana; Maciá, María D.; Borrell, Nuria; Moya, Bartolomé; de Francisco, Teresa; Pérez, José L.; Oliver, Antonio

    2007-01-01

    The inactivation of the mismatch repair (MMR) system of Pseudomonas aeruginosa modestly reduced in vitro fitness, attenuated virulence in murine models of acute systemic and respiratory infections, and decreased the initial oropharyngeal colonization potential. In contrast, the inactivation of the MMR system favored long-term persistence of oropharyngeal colonization in cystic fibrosis mice. These results may help in understanding the reasons for the low and high prevalences, respectively, of hypermutable P. aeruginosa strains in acute and chronic infections. PMID:17307847

  10. Dual daughter strand incision is processive and increases the efficiency of DNA mismatch repair.

    PubMed

    Hermans, Nicolaas; Laffeber, Charlie; Cristovão, Michele; Artola-Borán, Mariela; Mardenborough, Yannicka; Ikpa, Pauline; Jaddoe, Aruna; Winterwerp, Herrie H K; Wyman, Claire; Jiricny, Josef; Kanaar, Roland; Friedhoff, Peter; Lebbink, Joyce H G

    2016-08-19

    DNA mismatch repair (MMR) is an evolutionarily-conserved process responsible for the repair of replication errors. In Escherichia coli, MMR is initiated by MutS and MutL, which activate MutH to incise transiently-hemimethylated GATC sites. MMR efficiency depends on the distribution of these GATC sites. To understand which molecular events determine repair efficiency, we quantitatively studied the effect of strand incision on unwinding and excision activity. The distance between mismatch and GATC site did not influence the strand incision rate, and an increase in the number of sites enhanced incision only to a minor extent. Two GATC sites were incised by the same activated MMR complex in a processive manner, with MutS, the closed form of MutL and MutH displaying different roles. Unwinding and strand excision were more efficient on a substrate with two nicks flanking the mismatch, as compared to substrates containing a single nick or two nicks on the same side of the mismatch. Introduction of multiple nicks by the human MutLα endonuclease also contributed to increased repair efficiency. Our data support a general model of prokaryotic and eukaryotic MMR in which, despite mechanistic differences, mismatch-activated complexes facilitate efficient repair by creating multiple daughter strand nicks.

  11. Involvement of MBD4 inactivation in mismatch repair-deficient tumorigenesis

    PubMed Central

    Tricarico, Rossella; Cortellino, Salvatore; Riccio, Antonio; Jagmohan-Changur, Shantie; van der Klift, Heleen; Wijnen, Juul; Turner, David; Ventura, Andrea; Rovella, Valentina; Percesepe, Antonio; Lucci-Cordisco, Emanuela; Radice, Paolo; Bertario, Lucio; Pedroni, Monica; de Leon, Maurizio Ponz; Mancuso, Pietro; Devarajan, Karthik; Cai, Kathy Q.; Klein-Szanto, Andres J.P.; Neri, Giovanni; Møller, Pål; Viel, Alessandra; Genuardi, Maurizio; Fodde, Riccardo; Bellacosa, Alfonso

    2015-01-01

    The DNA glycosylase gene MBD4 safeguards genomic stability at CpG sites and is frequently mutated at coding poly-A tracks in mismatch repair (MMR)-defective colorectal tumors (CRC). Mbd4 biallelic inactivation in mice provided conflicting results as to its role in tumorigenesis. Thus, it is unclear whether MBD4 alterations are only secondary to MMR defects without functional consequences or can contribute to the mutator phenotype. We investigated MBD4 variants in a large series of hereditary/familial and sporadic CRC cases. Whereas MBD4 frameshifts were only detected in tumors, missense variants were found in both normal and tumor DNA. In CRC with double-MBD4/MMR and single-MBD4 variants, transition mutation frequency was increased, indicating that MBD4 defects may affect the mutational landscape independently of MMR defect. Mbd4-deficient mice showed reduced survival when combined with Mlh1−/− genotype. Taken together, these data suggest that MBD4 inactivation may contribute to tumorigenesis, acting as a modifier of MMR-deficient cancer phenotype. PMID:26503472

  12. An interplay of the base excision repair and mismatch repair pathways in active DNA demethylation

    PubMed Central

    Grin, Inga; Ishchenko, Alexander A.

    2016-01-01

    Active DNA demethylation (ADDM) in mammals occurs via hydroxylation of 5-methylcytosine (5mC) by TET and/or deamination by AID/APOBEC family enzymes. The resulting 5mC derivatives are removed through the base excision repair (BER) pathway. At present, it is unclear how the cell manages to eliminate closely spaced 5mC residues whilst avoiding generation of toxic BER intermediates and whether alternative DNA repair pathways participate in ADDM. It has been shown that non-canonical DNA mismatch repair (ncMMR) can remove both alkylated and oxidized nucleotides from DNA. Here, a phagemid DNA containing oxidative base lesions and methylated sites are used to examine the involvement of various DNA repair pathways in ADDM in murine and human cell-free extracts. We demonstrate that, in addition to short-patch BER, 5-hydroxymethyluracil and uracil mispaired with guanine can be processed by ncMMR and long-patch BER with concomitant removal of distant 5mC residues. Furthermore, the presence of multiple mispairs in the same MMR nick/mismatch recognition region together with BER-mediated nick formation promotes proficient ncMMR resulting in the reactivation of an epigenetically silenced reporter gene in murine cells. These findings suggest cooperation between BER and ncMMR in the removal of multiple mismatches that might occur in mammalian cells during ADDM. PMID:26843430

  13. Evolving approach and clinical significance of detecting DNA mismatch repair deficiency in colorectal carcinoma

    PubMed Central

    Shia, Jinru

    2016-01-01

    The last two decades have seen significant advancement in our understanding of colorectal tumors with DNA mismatch repair (MMR) deficiency. The ever-emerging revelations of new molecular and genetic alterations in various clinical conditions have necessitated constant refinement of disease terminology and classification. Thus, a case with the clinical condition of hereditary non-polyposis colorectal cancer as defined by the Amsterdam criteria may be one of Lynch syndrome characterized by a germline defect in one of the several MMR genes, one of the yet-to-be-defined “Lynch-like syndrome” if there is evidence of MMR deficiency in the tumor but no detectable germline MMR defect or tumor MLH1 promoter methylation, or “familial colorectal cancer type X” if there is no evidence of MMR deficiency. The detection of these conditions carries significant clinical implications. The detection tools and strategies are constantly evolving. The Bethesda guidelines symbolize a selective approach that uses clinical information and tumor histology as the basis to select high-risk individuals. Such a selective approach has subsequently been found to have limited sensitivity, and is thus gradually giving way to the alternative universal approach that tests all newly diagnosed colorectal cancers. Notably, the universal approach also has its own limitations; its cost-effectiveness in real practice, in particular, remains to be determined. Meanwhile, technological advances such as the next-generation sequencing are offering the promise of direct genetic testing for MMR deficiency at an affordable cost probably in the near future. This article reviews the up-to-date molecular definitions of the various conditions related to MMR deficiency, and discusses the tools and strategies that have been used in detecting these conditions. Special emphasis will be placed on the evolving nature and the clinical importance of the disease definitions and the detection strategies. PMID:25716099

  14. Evolving approach and clinical significance of detecting DNA mismatch repair deficiency in colorectal carcinoma.

    PubMed

    Shia, Jinru

    2015-09-01

    The last two decades have seen significant advancement in our understanding of colorectal tumors with DNA mismatch repair (MMR) deficiency. The ever-emerging revelations of new molecular and genetic alterations in various clinical conditions have necessitated constant refinement of disease terminology and classification. Thus, a case with the clinical condition of hereditary non-polyposis colorectal cancer as defined by the Amsterdam criteria may be one of Lynch syndrome characterized by a germline defect in one of the several MMR genes, one of the yet-to-be-defined "Lynch-like syndrome" if there is evidence of MMR deficiency in the tumor but no detectable germline MMR defect or tumor MLH1 promoter methylation, or "familial colorectal cancer type X" if there is no evidence of MMR deficiency. The detection of these conditions carries significant clinical implications. The detection tools and strategies are constantly evolving. The Bethesda guidelines symbolize a selective approach that uses clinical information and tumor histology as the basis to select high-risk individuals. Such a selective approach has subsequently been found to have limited sensitivity, and is thus gradually giving way to the alternative universal approach that tests all newly diagnosed colorectal cancers. Notably, the universal approach also has its own limitations; its cost-effectiveness in real practice, in particular, remains to be determined. Meanwhile, technological advances such as the next-generation sequencing are offering the promise of direct genetic testing for MMR deficiency at an affordable cost probably in the near future. This article reviews the up-to-date molecular definitions of the various conditions related to MMR deficiency, and discusses the tools and strategies that have been used in detecting these conditions. Special emphasis will be placed on the evolving nature and the clinical importance of the disease definitions and the detection strategies.

  15. MonoSeq Variant Caller Reveals Novel Mononucleotide Run Indel Mutations in Tumors with Defective DNA Mismatch Repair

    PubMed Central

    Walker, Christopher J.; Miranda, Mario A.; O’Hern, Matthew J.; Blachly, James S.; Moyer, Cassandra L.; Ivanovich, Jennifer; Kroll, Karl W.; Eisfeld, Ann-Kathrin; Sapp, Caroline E.; Mutch, David G.; Cohn, David E.; Bundschuh, Ralf; Goodfellow, Paul J

    2016-01-01

    Next-generation sequencing has revolutionized cancer genetics, but accurately detecting mutations in repetitive DNA sequences, especially mononucleotide runs, remains a challenge. This is a particular concern for tumors with defective mismatch repair (MMR) that accumulate strand-slippage mutations. We developed MonoSeq to improve indel mutation detection in mononucleotide runs, and used MonoSeq to investigate strand-slippage mutations in endometrial cancers, a tumor type that has frequent loss of MMR. We performed extensive Sanger sequencing to validate both clonal and sub-clonal MonoSeq mutation calls. Eighty-one regions containing mononucleotide runs were sequenced in 542 primary endometrial cancers (223 with defective MMR). Our analyses revealed that the overall mutation rate in MMR-deficient tumors was 20–30-fold higher than in MMR normal tumors. MonoSeq analysis identified several previously unreported mutations, including a novel hotspot in an A7 run in the terminal exon of ARID5B.The ARID5B indel mutations were seen in both MMR-deficient and MMR normal tumors, suggesting biologic selection. Analysis of tumor mRNAs revealed the presence of mutant transcripts that could result in translation of neopeptides. Improved detection of mononucleotide run strand-slippage mutations has clear implications for comprehensive mutation detection in tumors with defective MMR. Indel frameshift mutations and the resultant antigenic peptides could help guide immunotherapy strategies. PMID:27346418

  16. NPM-ALK mediates phosphorylation of MSH2 at tyrosine 238, creating a functional deficiency in MSH2 and the loss of mismatch repair.

    PubMed

    Bone, K M; Wang, P; Wu, F; Wu, C; Li, L; Bacani, J T; Andrew, S E; Lai, R

    2015-05-15

    The vast majority of anaplastic lymphoma kinase-positive anaplastic large cell lymphoma (ALK+ALCL) tumors express the characteristic oncogenic fusion protein NPM-ALK, which mediates tumorigenesis by exerting its constitutive tyrosine kinase activity on various substrates. We recently identified MSH2, a protein central to DNA mismatch repair (MMR), as a novel binding partner and phosphorylation substrate of NPM-ALK. Here, using liquid chromatography-mass spectrometry, we report for the first time that MSH2 is phosphorylated by NPM-ALK at a specific residue, tyrosine 238. Using GP293 cells transfected with NPM-ALK, we confirmed that the MSH2(Y238F) mutant is not tyrosine phosphorylated. Furthermore, transfection of MSH2(Y238F) into these cells substantially decreased the tyrosine phosphorylation of endogenous MSH2. Importantly, gene transfection of MSH2(Y238F) abrogated the binding of NPM-ALK with endogenous MSH2, re-established the dimerization of MSH2:MSH6 and restored the sensitivity to DNA mismatch-inducing drugs, indicative of MMR return. Parallel findings were observed in two ALK+ALCL cell lines, Karpas 299 and SUP-M2. In addition, we found that enforced expression of MSH2(Y238F) into ALK+ALCL cells alone was sufficient to induce spontaneous apoptosis. In conclusion, our findings have identified NPM-ALK-induced phosphorylation of MSH2 at Y238 as a crucial event in suppressing MMR. Our studies have provided novel insights into the mechanism by which oncogenic tyrosine kinases disrupt MMR.

  17. Integration of Principles of Systems Biology and Radiation Biology: Toward Development of in silico Models to Optimize IUdR-Mediated Radiosensitization of DNA Mismatch Repair Deficient (Damage Tolerant) Human Cancers

    PubMed Central

    Kinsella, Timothy J.; Gurkan-Cavusoglu, Evren; Du, Weinan; Loparo, Kenneth A.

    2011-01-01

    Over the last 7 years, we have focused our experimental and computational research efforts on improving our understanding of the biochemical, molecular, and cellular processing of iododeoxyuridine (IUdR) and ionizing radiation (IR) induced DNA base damage by DNA mismatch repair (MMR). These coordinated research efforts, sponsored by the National Cancer Institute Integrative Cancer Biology Program (ICBP), brought together system scientists with expertise in engineering, mathematics, and complex systems theory and translational cancer researchers with expertise in radiation biology. Our overall goal was to begin to develop computational models of IUdR- and/or IR-induced base damage processing by MMR that may provide new clinical strategies to optimize IUdR-mediated radiosensitization in MMR deficient (MMR−) “damage tolerant” human cancers. Using multiple scales of experimental testing, ranging from purified protein systems to in vitro (cellular) and to in vivo (human tumor xenografts in athymic mice) models, we have begun to integrate and interpolate these experimental data with hybrid stochastic biochemical models of MMR damage processing and probabilistic cell cycle regulation models through a systems biology approach. In this article, we highlight the results and current status of our integration of radiation biology approaches and computational modeling to enhance IUdR-mediated radiosensitization in MMR− damage tolerant cancers. PMID:22649757

  18. Defective mismatch repair and benefit from bevacizumab for colon cancer: findings from NSABP C-08.

    PubMed

    Pogue-Geile, Kay; Yothers, Greg; Taniyama, Yusuke; Tanaka, Noriko; Gavin, Patrick; Colangelo, Linda; Blackmon, Nicole; Lipchik, Corey; Kim, Seong Rim; Sharif, Saima; Allegra, Carmen; Petrelli, Nicholas; O'Connell, Michael J; Wolmark, Norman; Paik, Soonmyung

    2013-07-01

    National Surgical Adjuvant Breast and Bowel Project protocol C-08 tested the worth of adding 1 year of bevacizumab to oxaliplatin-based standard adjuvant chemotherapy regimen in the treatment of stage II/III colon cancer. Although the overall result was negative, the possibility that a molecularly defined subset could benefit from bevacizumab cannot be ruled out. We performed post hoc Cox regression analyses to test for marker-by-treatment interactions for standard pathological features and survival analyses using the Kaplan-Meier method. All statistical tests were two-sided and considered statistically significant at the .05 level. Patients diagnosed with mismatch repair defective (dMMR) tumors derived statistically significant survival benefit from the addition of bevacizumab (hazard ratio [HR] = 0.52; 95% confidence interval [CI] = 0.29 to 0.94; P = .02) in contrast with no benefit in patients diagnosed with mismatch repair proficient tumors (HR = 1.03; 95% CI = 0.84 to 1.27; p = .78; P(interaction)= .04). Although a post hoc finding, this data suggests that a molecularly defined subset of colon cancer patients may derive clinical benefit from antiangiogenesis agents and underscores the need for independent validation in other clinical trials.

  19. Defective Mismatch Repair and Benefit from Bevacizumab for Colon Cancer: Findings from NSABP C-08

    PubMed Central

    2013-01-01

    National Surgical Adjuvant Breast and Bowel Project protocol C-08 tested the worth of adding 1 year of bevacizumab to oxaliplatin-based standard adjuvant chemotherapy regimen in the treatment of stage II/III colon cancer. Although the overall result was negative, the possibility that a molecularly defined subset could benefit from bevacizumab cannot be ruled out. We performed post hoc Cox regression analyses to test for marker-by-treatment interactions for standard pathological features and survival analyses using the Kaplan–Meier method. All statistical tests were two-sided and considered statistically significant at the .05 level. Patients diagnosed with mismatch repair defective (dMMR) tumors derived statistically significant survival benefit from the addition of bevacizumab (hazard ratio [HR] = 0.52; 95% confidence interval [CI] = 0.29 to 0.94; P = .02) in contrast with no benefit in patients diagnosed with mismatch repair proficient tumors (HR = 1.03; 95% CI = 0.84 to 1.27; p = .78; P interaction = .04). Although a post hoc finding, this data suggests that a molecularly defined subset of colon cancer patients may derive clinical benefit from antiangiogenesis agents and underscores the need for independent validation in other clinical trials. PMID:23821759

  20. Mismatch repair gene defects in sporadic colorectal cancer enhance immune surveillance

    PubMed Central

    Canal, Fabio; Scarpa, Melania; Basato, Silvia; Erroi, Francesca; Fiorot, Alain; Dall'Agnese, Lucia; Pozza, Anna; Porzionato, Andrea; Castagliuolo, Ignazio; Dei Tos, Angelo P.; Bassi, Nicolò; Castoro, Carlo

    2015-01-01

    Background There is evidence that colorectal cancers (CRC) with DNA mismatch repair deficiency (MMR-D) are associated with a better prognosis than the generality of large bowel malignancies. Since an active immune surveillance process has been demonstrated to influence CRC outcome, we investigated whether MMR-D can enhance the immune response in CRC. Patients and Methods A group of 113 consecutive patients operated for CRC (42 stage I or II and 71 with stage III or IV) was retrospectively analyzed. The expression of MMR genes (MSH2, MLH1, MSH6 and PSM2) and co-stimulatory molecule CD80 was assessed by tissue microarray immunohistochemistry. In addition, tumor infiltrating mononuclear cells (TIMC) and T cell subpopulations (CD4, CD8, T-bet and FoxP-3) were quantified. The effect of specific siRNA (siMSH2, siMLH1, siMSH6 and siPSM2) transfection in HT29 on CD80 expression was quantified by flow cytometry. Non parametric statistics and survival analysis were used. Results Patients with MMR-D showed a higher T-bet/CD4 ratio (p = 0.02), a higher rate of CD80 expression and CD8 lymphocyte infiltration compared to those with no MMR-D. Moreover, in the MMR-D group, the Treg marker FoxP-3 was not expressed (p = 0.05). MMR-D patients with stage I or II and T-bet expression had a significant better survival (p = 0.009). Silencing of MSH2, MLH1 and MSH6, but not PSM2, significantly increased the rate of CD80+ HT29 cells (p = 0.007, p = 0.023 and p = 0.015, respectively). Conclusions CRC with MMR-D showed a higher CD80 expression, and CD8+ and Th1 T-cell infiltration. In vitro silencing of MSH2, MLH1 and MSH6 significantly increased CD80+ cell rate. These results suggest an enhanced immune surveillance mechanism in presence of MMR-D. PMID:26496037

  1. Rapid accumulation of mutations during seed-to-seed propagation of mismatch-repair-defective Arabidopsis.

    PubMed

    Hoffman, Peter D; Leonard, Jeffrey M; Lindberg, Gerrick E; Bollmann, Stephanie R; Hays, John B

    2004-11-01

    During the many cell divisions that precede formation of plant gametes, their apical-meristem and floral antecedents are continually exposed to endogenous and environmental mutagenic threats. Although some deleterious recessive mutations may be eliminated during growth of haploid gametophytes and functionally haploid early embryos ("haplosufficiency quality-checking"), the multiplicity of plant genome-maintenance systems suggests aggressive quality control during prior diploid growth. To test in Arabidopsis a hypothesis that prior mismatch repair (MMR) is paramount in defense of plant genetic fidelity, we propagated in parallel 36 MMR-defective (Atmsh2-1) and 36 wild-type lines. The Atmsh2-1 lines rapidly accumulated a wide variety of mutations: fifth-generation (G5) plants showed abnormalities in morphology and development, fertility, germination efficiency, seed/silique development, and seed set. Only two Atmsh2-1, but all 36 wild-type lines, appeared normal at G5. Analyses of insertion/deletion mutation at six repeat-sequence (microsatellite) loci showed each Atmsh2-1 line to have evolved its own "fingerprint," the results of as many as 10 microsatellite mutations in a single line. Thus, MMR during diploid growth is essential for plant genomic integrity.

  2. The role of Drosophila mismatch repair in suppressing recombination between diverged sequences.

    PubMed

    Do, Anthony T; LaRocque, Jeannine R

    2015-11-30

    DNA double-strand breaks (DSBs) must be accurately repaired to maintain genomic integrity. DSBs can be repaired by homologous recombination (HR), which uses an identical sequence as a template to restore the genetic information lost at the break. Suppression of recombination between diverged sequences is essential to the repair of DSBs without aberrant and potentially mutagenic recombination between non-identical sequences, such as Alu repeats in the human genome. The mismatch repair (MMR) machinery has been found to suppress recombination between diverged sequences in murine cells. To test if this phenomenon is conserved in whole organisms, two DSB repair systems were utilized in Drosophila melanogaster. The DR-white and DR-white.mu assays provide a method of measuring DSB repair outcomes between identical and diverged sequences respectively. msh6(-/-) flies, deficient in MMR, were not capable of suppressing recombination between sequences with 1.4% divergence, and the average gene conversion tract length did not differ between msh6(-/+) and msh6(-/-)flies. These findings suggest that MMR has an early role in suppressing recombination between diverged sequences that is conserved in Drosophila.

  3. Mismatch repair at stop codons is directed independent of GATC methylation on the Escherichia coli chromosome

    NASA Astrophysics Data System (ADS)

    Sneppen, Kim; Semsey, Szabolcs

    2014-12-01

    The mismatch repair system (MMR) corrects replication errors that escape proofreading. Previous studies on extrachromosomal DNA in Escherichia coli suggested that MMR uses hemimethylated GATC sites to identify the newly synthesized strand. In this work we asked how the distance of GATC sites and their methylation status affect the occurrence of single base substitutions on the E. coli chromosome. As a reporter system we used a lacZ gene containing an early TAA stop codon. We found that occurrence of point mutations at this stop codon is unaffected by GATC sites located more than 115 base pairs away. However, a GATC site located about 50 base pairs away resulted in a decreased mutation rate. This effect was independent of Dam methylation. The reversion rate of the stop codon increased only slightly in dam mutants compared to mutL and mutS mutants. We suggest that unlike on extrachromosomal DNA, GATC methylation is not the only strand discrimination signal for MMR on the E. coli chromosome.

  4. Differences in genome-wide repeat sequence instability conferred by proofreading and mismatch repair defects

    PubMed Central

    Lujan, Scott A.; Clark, Alan B.; Kunkel, Thomas A.

    2015-01-01

    Mutation rates are used to calibrate molecular clocks and to link genetic variants with human disease. However, mutation rates are not uniform across each eukaryotic genome. Rates for insertion/deletion (indel) mutations have been found to vary widely when examined in vitro and at specific loci in vivo. Here, we report the genome-wide rates of formation and repair of indels made during replication of yeast nuclear DNA. Using over 6000 indels accumulated in four mismatch repair (MMR) defective strains, and statistical corrections for false negatives, we find that indel rates increase by 100 000-fold with increasing homonucleotide run length, representing the greatest effect on replication fidelity of any known genomic parameter. Nonetheless, long genomic homopolymer runs are overrepresented relative to random chance, implying positive selection. Proofreading defects in the replicative polymerases selectively increase indel rates in short repetitive tracts, likely reflecting the distance over which Pols δ and ϵ interact with duplex DNA upstream of the polymerase active site. In contrast, MMR defects hugely increase indel mutagenesis in long repetitive sequences. Because repetitive sequences are not uniformly distributed among genomic functional elements, the quantitatively different consequences on genome-wide repeat sequence instability conferred by defects in proofreading and MMR have important biological implications. PMID:25824945

  5. Detection of coding microsatellite frameshift mutations in DNA mismatch repair-deficient mouse intestinal tumors.

    PubMed

    Woerner, Stefan M; Tosti, Elena; Yuan, Yan P; Kloor, Matthias; Bork, Peer; Edelmann, Winfried; Gebert, Johannes

    2015-11-01

    Different DNA mismatch repair (MMR)-deficient mouse strains have been developed as models for the inherited cancer predisposing Lynch syndrome. It is completely unresolved, whether coding mononucleotide repeat (cMNR) gene mutations in these mice can contribute to intestinal tumorigenesis and whether MMR-deficient mice are a suitable molecular model of human microsatellite instability (MSI)-associated intestinal tumorigenesis. A proof-of-principle study was performed to identify mouse cMNR-harboring genes affected by insertion/deletion mutations in MSI murine intestinal tumors. Bioinformatic algorithms were developed to establish a database of mouse cMNR-harboring genes. A panel of five mouse noncoding mononucleotide markers was used for MSI classification of intestinal matched normal/tumor tissues from MMR-deficient (Mlh1(-/-) , Msh2(-/-) , Msh2(LoxP/LoxP) ) mice. cMNR frameshift mutations of candidate genes were determined by DNA fragment analysis. Murine MSI intestinal tumors but not normal tissues from MMR-deficient mice showed cMNR frameshift mutations in six candidate genes (Elavl3, Tmem107, Glis2, Sdccag1, Senp6, Rfc3). cMNRs of mouse Rfc3 and Elavl3 are conserved in type and length in their human orthologs that are known to be mutated in human MSI colorectal, endometrial and gastric cancer. We provide evidence for the utility of a mononucleotide marker panel for detection of MSI in murine tumors, the existence of cMNR instability in MSI murine tumors, the utility of mouse subspecies DNA for identification of polymorphic repeats, and repeat conservation among some orthologous human/mouse genes, two of them showing instability in human and mouse MSI intestinal tumors. MMR-deficient mice hence are a useful molecular model system for analyzing MSI intestinal carcinogenesis.

  6. Mismatch repair deficiency: a temozolomide resistance factor in medulloblastoma cell lines that is uncommon in primary medulloblastoma tumours

    PubMed Central

    von Bueren, A O; Bacolod, M D; Hagel, C; Heinimann, K; Fedier, A; Kordes, U; Pietsch, T; Koster, J; Grotzer, M A; Friedman, H S; Marra, G; Kool, M; Rutkowski, S

    2012-01-01

    Background: Tumours are responsive to temozolomide (TMZ) if they are deficient in O6-methylguanine-DNA methyltransferase (MGMT), and mismatch repair (MMR) proficient. Methods: The effect of TMZ on medulloblastoma (MB) cell killing was analysed with clonogenic survival assays. Expression of DNA repair genes and enzymes was investigated using microarrays, western blot, and immunohistochemistry. DNA sequencing and promoter methylation analysis were employed to investigate the cause of loss of the expression of MMR gene MLH1. Results: Temozolomide exhibited potent cytotoxic activity in D425Med (MGMT deficient, MLH1 proficient; IC50=1.7 μℳ), moderate activity against D341Med (MGMT proficient, MLH1 deficient), and DAOY MB cells (MGMT proficient, MLH1 proficient). MGMT inhibitor O6-benzylguanine sensitised DAOY, but not D341Med cells to TMZ. Of 12 MB cell lines, D341Med, D283Med, and 1580WÜ cells exhibited MMR deficiency due to MLH1 promoter hypermethylation. DNA sequencing of these cells provided no evidence for somatic genetic alterations in MLH1. Expression analyses of MMR and MGMT in MB revealed that all patient specimens (n=74; expression array, n=61; immunostaining, n=13) are most likely MMR proficient, whereas some tumours had low MGMT expression levels (according to expression array) or were totally MGMT deficient (3 out of 13 according to immunohistochemistry). Conclusion: A subset of MB may respond to TMZ as some patient specimens are MGMT deficient, and tumours appear to be MMR proficient. PMID:22976800

  7. Structural, molecular and cellular functions of MSH2 and MSH6 during DNA mismatch repair, damage signaling and other noncanonical activities

    PubMed Central

    Edelbrock, Michael A.; Kaliyaperumal, Saravanan; Williams, Kandace J.

    2013-01-01

    The field of DNA mismatch repair (MMR) has rapidly expanded after the discovery of the MutHLS repair system in bacteria. By the mid 1990s yeast and human homologues to bacterial MutL and MutS had been identified and their contribution to hereditary non-polyposis colorectal cancer (HNPCC; Lynch Syndrome) was under intense investigation. The human MutS homologue 6 protein (hMSH6), was first reported in 1995 as a G:T binding partner (GTBP) of hMSH2, forming the hMutSα mismatch-binding complex. Signal transduction from each DNA-bound hMutSα complex is accomplished by the hMutLα heterodimer (hMLH1 and hPMS2). Molecular mechanisms and cellular regulation of individual MMR proteins are now areas of intensive research. This review will focus on molecular mechanisms associated with mismatch binding, as well as emerging evidence that MutSα and in particular, MSH6, is a key protein in MMR-dependent DNA damage response and communication with other DNA repair pathways within the cell. MSH6 is unstable in the absence of MSH2, however it is the DNA lesion-binding partner of this heterodimer. MSH6, but not MSH2, has a conserved Phe-X-Glu motif that recognizes and binds several different DNA structural distortions, initiating different cellular responses. hMSH6 also contains the nuclear localization sequences required to shuttle hMutSα into the nucleus. For example, upon binding to O6meG:T, MSH6 triggers a DNA damage response that involves altered phosphorylation within the N-terminal disordered domain of this unique protein. While many investigations have focused on MMR as a post-replication DNA repair mechanism, MMR proteins are expressed and active in all phases of the cell cycle. There is much more to be discovered about regulatory cellular roles that require the presence of MutSα and, in particular, MSH6. PMID:23391514

  8. Mismatch repair status and synchronous metastases in colorectal cancer: A nationwide cohort study.

    PubMed

    Nordholm-Carstensen, Andreas; Krarup, Peter-Martin; Morton, Dion; Harling, Henrik

    2015-11-01

    The causality between the metastatic potential, mismatch repair status (MMR) and survival in colorectal cancer (CRC) is complex. This study aimed to investigate the impact of MMR in CRC on the occurrence of synchronous metastases (SCCM) and survival in patients with SCCM on a national basis. A nationwide cohort study of 6,692 patients diagnosed with CRC between 2010 and 2012 was conducted. Data were prospectively entered into the Danish Colorectal Cancer Group's database and merged with data from the Danish Pathology Registry and the National Patient Registry. Multivariable and multinomial logistic- and Cox-regression and proportional excess hazards analyses were used for confounder adjustment and to adjust for the general population mortality. In total, 983 of 6,692 patients (14.7%) had dMMR and 935 (14.0%) had SCCM. dMMR was associated with a decreased risk of SCCM, adjusted Odds Ratio (aOR) = 0.54 (95% confidence interval (CI):0.40-0.70, p < 0.001). The association only applied to confined hepatic metastases (aOR = 0.30, 95%CI: 0.18-0.49, p < 0.001), whereas the presence of confined pulmonary metastases (aOR = 0.71, 95% CI: 0.39-1.29, p = 0.258) or synchronous hepatic and pulmonary metastases (aOR = 0.69, 95% CI:0.26-1.29, p = 0.436) were unaffected by MMR. MMR in patients with SCCM had no impact on survival (Cox: adjusted Hazard Ratio (aHR) = 0.76, 95% CI: 0.54-1.06, p = 0.101; Proportional excess hazards: aHR = 0.73, 95% CI: 0.50-1.07, p = 0.111) when adjusting for other prognostic factors. The metastatic pattern varied according to MMR status. MMR had no impact on survival in patients with UICC Stage IV CRC. These findings may be important for the understanding of the metastatic processes and thus for optimizing staging and treatment in CRC patients. PMID:25921209

  9. A novel DNA damage response mediated by DNA mismatch repair in Caenorhabditis elegans: induction of programmed autophagic cell death in non-dividing cells

    PubMed Central

    Moriwaki, Takahito; Kato, Yuichi; Nakamura, Chihiro; Ishikawa, Satoru; Zhang-Akiyama, Qiu-Mei

    2015-01-01

    DNA mismatch repair (MMR) contributes to genome integrity by correcting errors of DNA polymerase and inducing cell death in response to DNA damage. Dysfunction of MMR results in increased mutation frequency and cancer risk. Clinical researches revealed that MMR abnormalities induce cancers of non-dividing tissues, such as kidney and liver. However, how MMR suppresses cancer in non-dividing tissues is not understood. To address that mechanism, we analyzed the roles of MMR in non-dividing cells using Caenorhabditis elegans (C. elegans), in which all somatic cells are non-dividing in the adult stage. In this study, we used stable MMR-mutant lines with a balancer chromosome. First, we confirmed that deficiency of MMR leads to resistance to various mutagens in C. elegans dividing cells. Next, we performed drug resistance assays, and found that MMR-deficient adult worms were resistant to SN1-type alkylating and oxidizing agents. In addition, dead cell staining and reporter assays of an autophagy-related gene demonstrated that the cell death was autophagic cell death. Interestingly, this autophagic cell death was not suppressed by caffeine, implying that MMR induces death of non-dividing cells in an atl-1-independent manner. Hence, we propose the hypothesis that MMR prevents cancers in non-dividing tissues by directly inducing cell death. PMID:26413217

  10. The mismatch repair system reduces meiotic homeologous recombination and stimulates recombination-dependent chromosome loss.

    PubMed

    Chambers, S R; Hunter, N; Louis, E J; Borts, R H

    1996-11-01

    Efficient genetic recombination requires near-perfect homology between participating molecules. Sequence divergence reduces the frequency of recombination, a process that is dependent on the activity of the mismatch repair system. The effects of chromosomal divergence in diploids of Saccharomyces cerevisiae in which one copy of chromosome III is derived from a closely related species, Saccharomyces paradoxus, have been examined. Meiotic recombination between the diverged chromosomes is decreased by 25-fold. Spore viability is reduced with an observable increase in the number of tetrads with only two or three viable spores. Asci with only two viable spores are disomic for chromosome III, consistent with meiosis I nondisjunction of the homeologs. Asci with three viable spores are highly enriched for recombinants relative to tetrads with four viable spores. In 96% of the class with three viable spores, only one spore possesses a recombinant chromosome III, suggesting that the recombination process itself contributes to meiotic death. This phenomenon is dependent on the activities of the mismatch repair genes PMS1 and MSH2. A model of mismatch-stimulated chromosome loss is proposed to account for this observation. As expected, crossing over is increased in pms1 and msh2 mutants. Furthermore, genetic exchange in pms1 msh2 double mutants is affected to a greater extent than in either mutant alone, suggesting that the two proteins act independently to inhibit homeologous recombination. All mismatch repair-deficient strains exhibited reductions in the rate of chromosome III nondisjunction. PMID:8887641

  11. DNA mismatch repair: Dr. Jekyll and Mr. Hyde?

    PubMed

    Hsieh, Peggy

    2012-09-14

    In this issue, Peña-Diaz et al. (2012) describe a pathway for somatic mutation in nonlymphoid cells termed noncanonical DNA mismatch repair, whereby the error-prone translesion polymerase Pol-η substitutes for high-fidelity replicative polymerases to resynthesize excised regions opposite DNA damage. PMID:22980456

  12. Mechanisms in E. coli and Human Mismatch Repair (Nobel Lecture).

    PubMed

    Modrich, Paul

    2016-07-18

    DNA molecules are not completely stable, they are subject to chemical or photochemical damage and errors that occur during DNA replication resulting in mismatched base pairs. Through mechanistic studies Paul Modrich showed how replication errors are corrected by strand-directed mismatch repair in Escherichia coli and human cells.

  13. Avalanching mutations in biallelic mismatch repair deficiency syndrome.

    PubMed

    Waterfall, Joshua J; Meltzer, Paul S

    2015-03-01

    Tumors from pediatric patients generally contain relatively few somatic mutations. A new study reports a striking exception in individuals in whom biallelic germline deficiency for mismatch repair is compounded by somatic loss of function in DNA proofreading polymerases, resulting in 'ultra-hypermutated' malignant brain tumors. PMID:25711864

  14. Avalanching mutations in biallelic mismatch repair deficiency syndrome.

    PubMed

    Waterfall, Joshua J; Meltzer, Paul S

    2015-03-01

    Tumors from pediatric patients generally contain relatively few somatic mutations. A new study reports a striking exception in individuals in whom biallelic germline deficiency for mismatch repair is compounded by somatic loss of function in DNA proofreading polymerases, resulting in 'ultra-hypermutated' malignant brain tumors.

  15. Both microsatellite length and sequence context determine frameshift mutation rates in defective DNA mismatch repair.

    PubMed

    Chung, Heekyung; Lopez, Claudia G; Holmstrom, Joy; Young, Dennis J; Lai, Jenny F; Ream-Robinson, Deena; Carethers, John M

    2010-07-01

    It is generally accepted that longer microsatellites mutate more frequently in defective DNA mismatch repair (MMR) than shorter microsatellites. Indeed, we have previously observed that the A10 microsatellite of transforming growth factor beta type II receptor (TGFBR2) frameshifts -1 bp at a faster rate than the A8 microsatellite of activin type II receptor (ACVR2), although both genes become frameshift-mutated in >80% of MMR-defective colorectal cancers. To experimentally determine the effect of microsatellite length upon frameshift mutation in gene-specific sequence contexts, we altered the microsatellite length within TGFBR2 exon 3 and ACVR2 exon 10, generating A7, A10 and A13 constructs. These constructs were cloned 1 bp out of frame of EGFP, allowing a -1 bp frameshift to drive EGFP expression, and stably transfected into MMR-deficient cells. Subsequent non-fluorescent cells were sorted, cultured for 7-35 days and harvested for EGFP analysis and DNA sequencing. Longer microsatellites within TGFBR2 and ACVR2 showed significantly higher mutation rates than shorter ones, with TGFBR2 A13, A10 and A7 frameshifts measured at 22.38x10(-4), 2.17x10(-4) and 0.13x10(-4), respectively. Surprisingly, shorter ACVR2 constructs showed three times higher mutation rates at A7 and A10 lengths than identical length TGFBR2 constructs but comparably lower at the A13 length, suggesting influences from both microsatellite length as well as the sequence context. Furthermore, the TGFBR2 A13 construct mutated into 33% A11 sequences (-2 bp) in addition to expected A12 (-1 bp), indicating that this construct undergoes continual subsequent frameshift mutation. These data demonstrate experimentally that both the length of a mononucleotide microsatellite and its sequence context influence mutation rate in defective DNA MMR.

  16. When does MMR loss occur during HNPCC progression?

    PubMed

    Shibata, Darryl

    2006-01-01

    Inactivation of DNA mismatch repair (MMR) is the hallmark of hereditary nonpolyposis colorectal cancer (HNPCC) and sporadic colorectal cancers with microsatellite instability (MSI+). MMR loss results in a markedly elevated mutation rate, and many MS mutations are found in MSI+ cancers. In theory, it is possible to estimate the interval between MMR loss and cancer removal by counting numbers of cancer MS mutations--the more MS mutations, the longer the intervals since MMR loss. Using this somatic molecular clock approach, MMR loss is estimated to precede transformation (clonal expansion) and likely occurs in normal appearing colon. Surprising, ages at MMR loss are more consistent with MMR loss as a relatively late event during progression to MSI+ cancer. PMID:17192057

  17. Relationship between PTEN, DNA mismatch repair, and tumor histotype in endometrial carcinoma: retained positive expression of PTEN preferentially identifies sporadic non-endometrioid carcinomas.

    PubMed

    Djordjevic, Bojana; Barkoh, Bedia A; Luthra, Rajyalakshmi; Broaddus, Russell R

    2013-10-01

    Loss of PTEN (phosphatase and tensin homolog) expression and microsatellite instability are two of the more common molecular alterations in endometrial carcinoma. From the published literature, it is controversial as to whether there is a relationship between these different molecular mechanisms. Therefore, a cohort of 187 pure endometrioid and non-endometrioid endometrial carcinomas, carefully characterized as to clinical and pathological features, was examined for PTEN sequence abnormalities and the immunohistochemical expression of PTEN and the DNA mismatch repair proteins MLH1, MSH2, MSH6, and PMS2. MLH1 methylation analysis was performed when tumors had loss of MLH1 protein. Mismatch repair protein loss was more frequent in endometrioid carcinomas compared with non-endometrioid carcinomas, a difference primarily attributable to the presence of MLH1 methylation in a greater proportion of endometrioid tumors. Among the non-endometrioid group, mixed endometrioid/non-endometrioid carcinomas were the histotype that most commonly had loss of a mismatch repair protein. In endometrioid tumors, the frequency of PTEN loss measured by immunohistochemistry and mutation did not differ significantly between the mismatch repair protein intact or mismatch repair protein loss groups, suggesting that PTEN loss is independent of mismatch protein repair status in this group. However, in non-endometrioid carcinomas, both intact positive PTEN immunohistochemical expression and PTEN wild type were highly associated with retained positive expression of mismatch repair proteins in the tumor. Relevant to screening endometrial cancers for Lynch Syndrome, an initial PTEN immunohistochemistry determination may be able to replace the use of four mismatch repair immunohistochemical markers in 63% of patients with non-endometrioid endometrial carcinoma. Therefore, PTEN immunohistochemistry, in combination with tumor histotype, is a useful adjunct in the clinical evaluation of endometrial

  18. Modified bases enable high-efficiency oligonucleotide-mediated allelic replacement via mismatch repair evasion.

    PubMed

    Wang, Harris H; Xu, George; Vonner, Ashley J; Church, George

    2011-09-01

    Genome engineering using single-stranded oligonucleotides is an efficient method for generating small chromosomal and episomal modifications in a variety of host organisms. The efficiency of this allelic replacement strategy is highly dependent on avoidance of the endogenous mismatch repair (MMR) machinery. However, global MMR inactivation generally results in significant accumulation of undesired background mutations. Here, we present a novel strategy using oligos containing chemically modified bases (2'-Fluoro-Uridine, 5-Methyl-deoxyCytidine, 2,6-Diaminopurine or Iso-deoxyGuanosine) in place of the standard T, C, A or G to avoid mismatch detection and repair, which we tested in Escherichia coli. This strategy increases transient allelic-replacement efficiencies by up to 20-fold, while maintaining a 100-fold lower background mutation level. We further show that the mismatched bases between the full length oligo and the chromosome are often not incorporated at the target site, probably due to nuclease activity at the 5' and 3' termini of the oligo. These results further elucidate the mechanism of oligo-mediated allelic replacement (OMAR) and enable improved methodologies for efficient, large-scale engineering of genomes.

  19. DREMECELS: A Curated Database for Base Excision and Mismatch Repair Mechanisms Associated Human Malignancies.

    PubMed

    Shukla, Ankita; Moussa, Ahmed; Singh, Tiratha Raj

    2016-01-01

    DNA repair mechanisms act as a warrior combating various damaging processes that ensue critical malignancies. DREMECELS was designed considering the malignancies with frequent alterations in DNA repair pathways, that is, colorectal and endometrial cancers, associated with Lynch syndrome (also known as HNPCC). Since lynch syndrome carries high risk (~40-60%) for both cancers, therefore we decided to cover all three diseases in this portal. Although a large population is presently affected by these malignancies, many resources are available for various cancer types but no database archives information on the genes specifically for only these cancers and disorders. The database contains 156 genes and two repair mechanisms, base excision repair (BER) and mismatch repair (MMR). Other parameters include some of the regulatory processes that have roles in these disease progressions due to incompetent repair mechanisms, specifically BER and MMR. However, our unique database mainly provides qualitative and quantitative information on these cancer types along with methylation, drug sensitivity, miRNAs, copy number variation (CNV) and somatic mutations data. This database would serve the scientific community by providing integrated information on these disease types, thus sustaining diagnostic and therapeutic processes. This repository would serve as an excellent accompaniment for researchers and biomedical professionals and facilitate in understanding such critical diseases. DREMECELS is publicly available at http://www.bioinfoindia.org/dremecels.

  20. DREMECELS: A Curated Database for Base Excision and Mismatch Repair Mechanisms Associated Human Malignancies.

    PubMed

    Shukla, Ankita; Moussa, Ahmed; Singh, Tiratha Raj

    2016-01-01

    DNA repair mechanisms act as a warrior combating various damaging processes that ensue critical malignancies. DREMECELS was designed considering the malignancies with frequent alterations in DNA repair pathways, that is, colorectal and endometrial cancers, associated with Lynch syndrome (also known as HNPCC). Since lynch syndrome carries high risk (~40-60%) for both cancers, therefore we decided to cover all three diseases in this portal. Although a large population is presently affected by these malignancies, many resources are available for various cancer types but no database archives information on the genes specifically for only these cancers and disorders. The database contains 156 genes and two repair mechanisms, base excision repair (BER) and mismatch repair (MMR). Other parameters include some of the regulatory processes that have roles in these disease progressions due to incompetent repair mechanisms, specifically BER and MMR. However, our unique database mainly provides qualitative and quantitative information on these cancer types along with methylation, drug sensitivity, miRNAs, copy number variation (CNV) and somatic mutations data. This database would serve the scientific community by providing integrated information on these disease types, thus sustaining diagnostic and therapeutic processes. This repository would serve as an excellent accompaniment for researchers and biomedical professionals and facilitate in understanding such critical diseases. DREMECELS is publicly available at http://www.bioinfoindia.org/dremecels. PMID:27276067

  1. DREMECELS: A Curated Database for Base Excision and Mismatch Repair Mechanisms Associated Human Malignancies

    PubMed Central

    Shukla, Ankita; Singh, Tiratha Raj

    2016-01-01

    DNA repair mechanisms act as a warrior combating various damaging processes that ensue critical malignancies. DREMECELS was designed considering the malignancies with frequent alterations in DNA repair pathways, that is, colorectal and endometrial cancers, associated with Lynch syndrome (also known as HNPCC). Since lynch syndrome carries high risk (~40–60%) for both cancers, therefore we decided to cover all three diseases in this portal. Although a large population is presently affected by these malignancies, many resources are available for various cancer types but no database archives information on the genes specifically for only these cancers and disorders. The database contains 156 genes and two repair mechanisms, base excision repair (BER) and mismatch repair (MMR). Other parameters include some of the regulatory processes that have roles in these disease progressions due to incompetent repair mechanisms, specifically BER and MMR. However, our unique database mainly provides qualitative and quantitative information on these cancer types along with methylation, drug sensitivity, miRNAs, copy number variation (CNV) and somatic mutations data. This database would serve the scientific community by providing integrated information on these disease types, thus sustaining diagnostic and therapeutic processes. This repository would serve as an excellent accompaniment for researchers and biomedical professionals and facilitate in understanding such critical diseases. DREMECELS is publicly available at http://www.bioinfoindia.org/dremecels. PMID:27276067

  2. Emerging importance of mismatch repair components including UvrD helicase and their cross-talk with the development of drug resistance in malaria parasite.

    PubMed

    Ahmad, Moaz; Tuteja, Renu

    2014-12-01

    Human malaria is an important parasitic infection responsible for a significant number of deaths worldwide, particularly in tropical and subtropical regions. The recent scenario has worsened mainly because of the emergence of drug-resistant malaria parasites having the potential to spread across the world. Drug-resistant parasites possess a defective mismatch repair (MMR); therefore, it is essential to explore its mechanism in detail to determine the underlying cause. Recently, artemisinin-resistant parasites have been reported to exhibit nonsynonymous single nucleotide polymorphisms in genes involved in MMR pathways such as MutL homolog (MLH) and UvrD. Plasmodium falciparum MLH is an endonuclease required to restore the defective MMR in drug-resistant W2 strain of P. falciparum. Although the role of helicases in eukaryotic MMR has been questioned, the identification and characterization of the UvrD helicase and their cross-talk with MLH in P. falciparum suggests the possible involvement of UvrD in MMR. A comparative genome-wide analysis revealed the presence of the UvrD helicase in Plasmodium species, while it is absent in human host. Therefore, PfUvrD may emerge as a suitable drug target to control malaria. This review study is focused on recent developments in MMR biochemistry, emerging importance of the UvrD helicase, possibility of its involvement in MMR and the emerging cross-talk between MMR components and drug resistance in malaria parasite. PMID:25771870

  3. Review: Clinical aspects of hereditary DNA Mismatch repair gene mutations.

    PubMed

    Sijmons, Rolf H; Hofstra, Robert M W

    2016-02-01

    Inherited mutations of the DNA Mismatch repair genes MLH1, MSH2, MSH6 and PMS2 can result in two hereditary tumor syndromes: the adult-onset autosomal dominant Lynch syndrome, previously referred to as Hereditary Non-Polyposis Colorectal Cancer (HNPCC) and the childhood-onset autosomal recessive Constitutional Mismatch Repair Deficiency syndrome. Both conditions are important to recognize clinically as their identification has direct consequences for clinical management and allows targeted preventive actions in mutation carriers. Lynch syndrome is one of the more common adult-onset hereditary tumor syndromes, with thousands of patients reported to date. Its tumor spectrum is well established and includes colorectal cancer, endometrial cancer and a range of other cancer types. However, surveillance for cancers other than colorectal cancer is still of uncertain value. Prophylactic surgery, especially for the uterus and its adnexa is an option in female mutation carriers. Chemoprevention of colorectal cancer with aspirin is actively being investigated in this syndrome and shows promising results. In contrast, the Constitutional Mismatch Repair Deficiency syndrome is rare, features a wide spectrum of childhood onset cancers, many of which are brain tumors with high mortality rates. Future studies are very much needed to improve the care for patients with this severe disorder. PMID:26746812

  4. Frequent PIK3CA Mutations in Colorectal and Endometrial Cancer with Double Somatic Mismatch Repair Mutations

    PubMed Central

    Cohen, Stacey A.; Turner, Emily H.; Beightol, Mallory B.; Jacobson, Angela; Gooley, Ted A.; Salipante, Stephen J.; Haraldsdottir, Sigurdis; Smith, Christina; Scroggins, Sheena; Tait, Jonathan F.; Grady, William M.; Lin, Edward H.; Cohn, David E.; Goodfellow, Paul J.; Arnold, Mark W.; de la Chapelle, Albert; Pearlman, Rachel; Hampel, Heather; Pritchard, Colin C.

    2016-01-01

    Background & Aims Double somatic mutations in mismatch repair (MMR) genes have recently been described in colorectal and endometrial cancers with microsatellite instability (MSI) not attributable to MLH1 hypermethylation or germline mutation. We sought to define the molecular phenotype of this newly recognized tumor subtype. Methods From two prospective Lynch syndrome screening studies, we identified patients with colorectal and endometrial tumors harboring ≥2 somatic MMR mutations, but normal germline MMR testing (“double somatic”). We determined the frequencies of tumor PIK3CA, BRAF, KRAS, NRAS, and PTEN mutations by targeted next-generation sequencing and used logistic-regression models to compare them to: Lynch syndrome, MLH1 hypermethylated, and microsatellite stable (MSS) tumors. We validated our findings using independent datasets from The Cancer Genome Atlas (TCGA). Results Among colorectal cancer cases, we found that 14/21 (67%) of double somatic cases had PIK3CA mutations vs. 4/18 (22%) Lynch syndrome, 2/10 (20%) MLH1 hypermethylated, and 12/78 (15%) MSS tumors; p<0.0001. PIK3CA mutations were detected in 100% of 13 double somatic endometrial cancers (p=0.04). BRAF mutations were absent in double somatic and Lynch syndrome colorectal tumors. We found highly similar results in a validation cohort from TCGA (113 colorectal, 178 endometrial cancer), with 100% of double somatic cases harboring a PIK3CA mutation (p<0.0001). Conclusions PIK3CA mutations are present in double somatic mutated colorectal and endometrial cancers at substantially higher frequencies than other MSI subgroups. PIK3CA mutation status may better define an emerging molecular entity in colorectal and endometrial cancers, with the potential to inform screening and therapeutic decision making. PMID:27302833

  5. The Significance of Mismatch Repair Deficiency in Young Patients With Endometrial Cancer.

    PubMed

    Chu, Mandy Man-Yee; Liu, Stephanie Si; Tam, Kar-Fai; Ip, Philip Pun-Ching; Cheung, Annie Nga-Yin; Ngan, Hextan Yuen-Sheung

    2015-09-01

    The objective of this study was to identify the tumor characteristics associated with mismatch repair deficiency in young patients with endometrial carcinoma. Young patients (45 yr old or younger) with endometrial carcinoma treated by hysterectomy in our institution between July 2001 and June 2009 were identified. The clinical and pathologic data were obtained by review of clinical records. Among the 122 cases identified, paraffin sections were available in 67 cases for immunohistochemical staining and frozen tissue available in 62 cases for microsatellite instability (MSI) analysis. Both paraffin sections and frozen tissue were available in 36 cases. Among the 67 cases with immunohistochemical staining, 22 (32.8%) showed loss of expression of at least 1 mismatch repair protein. Defective MLH1 or MSH2 expression was associated with poor prognostic factors, including a higher incidence of pelvic lymph nodes metastasis (P=0.018) and higher stage (P=0.022) for MLH1, and an increased risk of lymphovascular permeation (P=0.015) for MSH2. On the contrary, defective MSH6 protein expression was associated with a lower incidence of high-grade tumors (P=0.04). Among the 62 cases with MSI analysis, 12 (19.4%) tumors were classified as microsatellite-high (MSI-H), whereas 2 (3.2%) were classified as microsatellite-low (MSI-L). There was no difference in the pathologic characteristics between MSI-stable and MSI-H tumor. We concluded that defective mismatch repair expression is important in young patients with endometrial carcinoma, with MSH6 protein being most commonly affected. The phenotype resulting from defective MSH6 expression was different from that caused by MLH1 or MSH2 loss.

  6. Loss of ARID1A Expression in Gastric Cancer: Correlation with Mismatch Repair Deficiency and Clinicopathologic Features

    PubMed Central

    Kim, Kyung-Ju; Jung, Hae Yoen; Oh, Mee-Hye; Cho, Hyundeuk; Lee, Ji-Hye; Lee, Hyun Ju; Jang, Si-Hyong

    2015-01-01

    Purpose The AT-rich interactive domain 1A (ARID1A) gene encodes BRG1-associated factor 250a, a component of the SWItch/Sucrose NonFermentable chromatin remodeling complex, which is considered a tumor suppressor in many tumors. We aimed to investigate the prognostic significance of ARID1A expression in gastric cancers and explore its relationship with clinicopathologic parameters such as mismatch repair protein expression. Materials and Methods Four tissue microarrays were constructed from 191 resected specimens obtained at Soonchunhyang University Cheonan Hospital from 2006 to 2008. Nuclear expression of ARID1A was semiquantitatively assessed and binarized into retained and lost expression. Results Loss of ARID1A expression was observed in 62 cases (32.5%). This was associated with more frequent vascular invasion (P=0.019) and location in the upper third of the stomach (P=0.001), and trended toward more poorly differentiated subtypes (P=0.054). ARID1A loss was significantly associated with the mismatch repair-deficient phenotype (P=0.003). ARID1A loss showed a statistically significant correlation with loss of MLH1 (P=0.001) but not MSH2 expression (P=1.000). Kaplan-Meier survival analysis showed no statistically significant difference in overall survival; however, patients with retained ARID1A expression tended to have better overall survival than those with loss of ARID1A expression (P=0.053). In both mismatch repair-deficient and mismatch repair-proficient groups, survival analysis showed no differences related to ARID1A expression status. Conclusions Our results demonstrated that loss of ARID1A expression is closely associated with the mismatch repair-deficient phenotype, especially in sporadic microsatellite instability-high gastric cancers. PMID:26468418

  7. DNA Mismatch Repair Interacts with CAF-1- and ASF1A-H3-H4-dependent Histone (H3-H4)2 Tetramer Deposition.

    PubMed

    Rodriges Blanko, Elena; Kadyrova, Lyudmila Y; Kadyrov, Farid A

    2016-04-22

    DNA mismatch repair (MMR) is required for the maintenance of genome stability and protection of humans from several types of cancer. Human MMR occurs in the chromatin environment, but little is known about the interactions between MMR and the chromatin environment. Previous research has suggested that MMR coincides with replication-coupled assembly of the newly synthesized DNA into nucleosomes. The first step in replication-coupled nucleosome assembly is CAF-1-dependent histone (H3-H4)2 tetramer deposition, a process that involves ASF1A-H3-H4 complex. In this work we used reconstituted human systems to investigate interactions between MMR and CAF-1- and ASF1A-H3-H4-dependent histone (H3-H4)2 tetramer deposition. We have found that MutSα inhibits CAF-1- and ASF1A-H3-H4-dependent packaging of a DNA mismatch into a tetrasome. This finding supports the idea that MMR occurs before the DNA mismatch is packaged into the tetrasome. Our experiments have also revealed that CAF-1- and ASF1A-H3-H4-dependent deposition of the histone (H3-H4)2 tetramers does not interfere with MMR reactions. In addition, we have established that unnecessary degradation of the discontinuous strand that takes place in both DNA polymerase δ (Pol δ)- and DNA polymerase ϵ (Pol ϵ)-dependent MMR reactions is suppressed by CAF-1- and ASF1A-H3-H4-dependent deposition of the histone (H3-H4)2 tetramers. These data suggest that CAF-1- and ASF1A-H3-H4-dependent deposition of the histone (H3-H4)2 tetramers is compatible with MMR and protects the discontinuous daughter strand from unnecessary degradation by MMR machinery.

  8. The Rate and Spectrum of Spontaneous Mutations in Mycobacterium smegmatis, a Bacterium Naturally Devoid of the Postreplicative Mismatch Repair Pathway.

    PubMed

    Kucukyildirim, Sibel; Long, Hongan; Sung, Way; Miller, Samuel F; Doak, Thomas G; Lynch, Michael

    2016-01-01

    Mycobacterium smegmatis is a bacterium that is naturally devoid of known postreplicative DNA mismatch repair (MMR) homologs, mutS and mutL, providing an opportunity to investigate how the mutation rate and spectrum has evolved in the absence of a highly conserved primary repair pathway. Mutation accumulation experiments of M. smegmatis yielded a base-substitution mutation rate of 5.27 × 10(-10) per site per generation, or 0.0036 per genome per generation, which is surprisingly similar to the mutation rate in MMR-functional unicellular organisms. Transitions were found more frequently than transversions, with the A:T→G:C transition rate significantly higher than the G:C→A:T transition rate, opposite to what is observed in most studied bacteria. We also found that the transition-mutation rate of M. smegmatis is significantly lower than that of other naturally MMR-devoid or MMR-knockout organisms. Two possible candidates that could be responsible for maintaining high DNA fidelity in this MMR-deficient organism are the ancestral-like DNA polymerase DnaE1, which contains a highly efficient DNA proofreading histidinol phosphatase (PHP) domain, and/or the existence of a uracil-DNA glycosylase B (UdgB) homolog that might protect the GC-rich M. smegmatis genome against DNA damage arising from oxidation or deamination. Our results suggest that M. smegmatis has a noncanonical Dam (DNA adenine methylase) methylation system, with target motifs differing from those previously reported. The mutation features of M. smegmatis provide further evidence that genomes harbor alternative routes for improving replication fidelity, even in the absence of major repair pathways. PMID:27194804

  9. The Rate and Spectrum of Spontaneous Mutations in Mycobacterium smegmatis, a Bacterium Naturally Devoid of the Postreplicative Mismatch Repair Pathway

    PubMed Central

    Kucukyildirim, Sibel; Long, Hongan; Sung, Way; Miller, Samuel F.; Doak, Thomas G.; Lynch, Michael

    2016-01-01

    Mycobacterium smegmatis is a bacterium that is naturally devoid of known postreplicative DNA mismatch repair (MMR) homologs, mutS and mutL, providing an opportunity to investigate how the mutation rate and spectrum has evolved in the absence of a highly conserved primary repair pathway. Mutation accumulation experiments of M. smegmatis yielded a base-substitution mutation rate of 5.27 × 10−10 per site per generation, or 0.0036 per genome per generation, which is surprisingly similar to the mutation rate in MMR-functional unicellular organisms. Transitions were found more frequently than transversions, with the A:T→G:C transition rate significantly higher than the G:C→A:T transition rate, opposite to what is observed in most studied bacteria. We also found that the transition-mutation rate of M. smegmatis is significantly lower than that of other naturally MMR-devoid or MMR-knockout organisms. Two possible candidates that could be responsible for maintaining high DNA fidelity in this MMR-deficient organism are the ancestral-like DNA polymerase DnaE1, which contains a highly efficient DNA proofreading histidinol phosphatase (PHP) domain, and/or the existence of a uracil-DNA glycosylase B (UdgB) homolog that might protect the GC-rich M. smegmatis genome against DNA damage arising from oxidation or deamination. Our results suggest that M. smegmatis has a noncanonical Dam (DNA adenine methylase) methylation system, with target motifs differing from those previously reported. The mutation features of M. smegmatis provide further evidence that genomes harbor alternative routes for improving replication fidelity, even in the absence of major repair pathways. PMID:27194804

  10. Relevance of GC content to the conservation of DNA polymerase III/mismatch repair system in Gram-positive bacteria

    PubMed Central

    Akashi, Motohiro; Yoshikawa, Hirofumi

    2013-01-01

    The mechanism of DNA replication is one of the driving forces of genome evolution. Bacterial DNA polymerase III, the primary complex of DNA replication, consists of PolC and DnaE. PolC is conserved in Gram-positive bacteria, especially in the Firmicutes with low GC content, whereas DnaE is widely conserved in most Gram-negative and Gram-positive bacteria. PolC contains two domains, the 3′-5′exonuclease domain and the polymerase domain, while DnaE only possesses the polymerase domain. Accordingly, DnaE does not have the proofreading function; in Escherichia coli, another enzyme DnaQ performs this function. In most bacteria, the fidelity of DNA replication is maintained by 3′-5′ exonuclease and a mismatch repair (MMR) system. However, we found that most Actinobacteria (a group of Gram-positive bacteria with high GC content) appear to have lost the MMR system and chromosomes may be replicated by DnaE-type DNA polymerase III with DnaQ-like 3′-5′ exonuclease. We tested the mutation bias of Bacillus subtilis, which belongs to the Firmicutes and found that the wild type strain is AT-biased while the mutS-deletant strain is remarkably GC-biased. If we presume that DnaE tends to make mistakes that increase GC content, these results can be explained by the mutS deletion (i.e., deletion of the MMR system). Thus, we propose that GC content is regulated by DNA polymerase and MMR system, and the absence of polC genes, which participate in the MMR system, may be the reason for the increase of GC content in Gram-positive bacteria such as Actinobacteria. PMID:24062730

  11. The swi4+ gene of Schizosaccharomyces pombe encodes a homologue of mismatch repair enzymes.

    PubMed Central

    Fleck, O; Michael, H; Heim, L

    1992-01-01

    The swi4+ gene of Schizosaccharomyces pombe is involved in termination of copy-synthesis during mating-type switching. The gene was cloned by functional complementation of a swi4 mutant transformed with a genomic library. Determination of the nucleotide sequence revealed an open reading frame of 2979 nucleotides which is interrupted by a 68 bp long intron. The putative Swi4 protein shows homology to Duc-1 (human), Rep-3 (mouse), HexA (Streptococcus pneumoniae) and MutS (Salmonella typhimurium). The prokaryotic proteins are known as essential components involved in mismatch repair. A strain with a disrupted swi4+ gene was constructed and analysed with respect to the switching process. As in swi4 mutants duplications occur in the mating-type region of the swi4 (null) strain, reducing the efficiency of switching. Images PMID:1317550

  12. Common variants in mismatch repair genes associated with increased risk of sperm DNA damage and male infertility

    PubMed Central

    2012-01-01

    Background The mismatch repair (MMR) pathway plays an important role in the maintenance of the genome integrity, meiotic recombination and gametogenesis. This study investigated whether genetic variations in MMR genes are associated with an increased risk of sperm DNA damage and male infertility. Methods We selected and genotyped 21 tagging single nucleotide polymorphisms (SNPs) in five MMR genes (MLH1, MLH3, PMS2, MSH4 and MSH5) using the SNPstream 12-plex platform in a case-control study of 1,292 idiopathic infertility patients and 480 fertile controls in a Chinese population. Sperm DNA damage levels were detected with the Tdt-mediated dUTP nick end labelling (TUNEL) assay in 450 cases. Fluorescence resonance energy transfer (FRET) and co-immunoprecipitation techniques were employed to determine the effects of functional variants. Results One intronic SNP in MLH1 (rs4647269) and two non-synonymous SNPs in PMS2 (rs1059060, Ser775Asn) and MSH5 (rs2075789, Pro29Ser) seem to be risk factors for the development of azoospermia or oligozoospermia. Meanwhile, we also identified a possible contribution of PMS2 rs1059060 to the risk of male infertility with normal sperm count. Among patients with normal sperm count, MLH1 rs4647269 and PMS2 rs1059060 were associated with increased sperm DNA damage. Functional analysis revealed that the PMS2 rs1059060 can affect the interactions between MLH1 and PMS2. Conclusions Our results provide evidence supporting the involvement of genetic polymorphisms in MMR genes in the aetiology of male infertility. PMID:22594646

  13. Mismatch repair gene defects contribute to the genetic basis of double primary cancers of the colorectum and endometrium.

    PubMed

    Millar, A L; Pal, T; Madlensky, L; Sherman, C; Temple, L; Mitri, A; Cheng, H; Marcus, V; Gallinger, S; Redston, M; Bapat, B; Narod, S

    1999-05-01

    Hereditary non-polyposis colorectal cancer (HNPCC) is a dominantly inherited cancer syndrome caused by germline defects of mismatch repair (MMR) genes. Endometrial cancer is the most common extracolonic neoplasm in HNPCC and is the primary clinical manifestation of the syndrome in some families. The cumulative incidence of endometrial cancer among HNPCC mutation carriers is high, estimated to be from 22 to 43%. We hypothesized that women with double primary cancers of the colorectum and endometrium are likely to be members of HNPCC families. In order to determine how frequently HNPCC manifests in the context of double primary cancers, we examined alterations of two MMR genes, hMSH2 and hMLH1, in 40 unrelated women affected with double primary cancers. These cases were identified using hospital-based and population-based cancer registries in Ontario, Canada. MMR gene mutations were screened by single-strand conformation polymorphism analysis and confirmed by direct sequencing. Eighteen percent (seven of 40) were found to harbor mutations of one of the two MMR genes. Analysis of colorectal and/or endometrial tumors of mutation-negative probands found microsatellite instability in seven of 20 cases. Six of seven mutation-positive probands had strong family histories suggestive of HNPCC. First degree relatives of mutation-positive probands had a very high relative risk (RR) of colorectal cancer (RR = 8.1, CI 3. 5-15.9) and endometrial cancer (RR = 23.8, CI 6.4-61.0). The relative risk of mutation-negative cases was 2.8 (CI 1.7-4.5) for colorectal cancer and 5.4 (CI 2.0-11.7) for endometrial cancer. We recommend that all double primary patients with cancers at these sites should have a genetic evaluation, including molecular analysis for HNPCC where appropriate. PMID:10196371

  14. Mismatch repair genes Mlh1 and Mlh3 modify CAG instability in Huntington's disease mice: genome-wide and candidate approaches.

    PubMed

    Pinto, Ricardo Mouro; Dragileva, Ella; Kirby, Andrew; Lloret, Alejandro; Lopez, Edith; St Claire, Jason; Panigrahi, Gagan B; Hou, Caixia; Holloway, Kim; Gillis, Tammy; Guide, Jolene R; Cohen, Paula E; Li, Guo-Min; Pearson, Christopher E; Daly, Mark J; Wheeler, Vanessa C

    2013-10-01

    The Huntington's disease gene (HTT) CAG repeat mutation undergoes somatic expansion that correlates with pathogenesis. Modifiers of somatic expansion may therefore provide routes for therapies targeting the underlying mutation, an approach that is likely applicable to other trinucleotide repeat diseases. Huntington's disease Hdh(Q111) mice exhibit higher levels of somatic HTT CAG expansion on a C57BL/6 genetic background (B6.Hdh(Q111) ) than on a 129 background (129.Hdh(Q111) ). Linkage mapping in (B6x129).Hdh(Q111) F2 intercross animals identified a single quantitative trait locus underlying the strain-specific difference in expansion in the striatum, implicating mismatch repair (MMR) gene Mlh1 as the most likely candidate modifier. Crossing B6.Hdh(Q111) mice onto an Mlh1 null background demonstrated that Mlh1 is essential for somatic CAG expansions and that it is an enhancer of nuclear huntingtin accumulation in striatal neurons. Hdh(Q111) somatic expansion was also abolished in mice deficient in the Mlh3 gene, implicating MutLγ (MLH1-MLH3) complex as a key driver of somatic expansion. Strikingly, Mlh1 and Mlh3 genes encoding MMR effector proteins were as critical to somatic expansion as Msh2 and Msh3 genes encoding DNA mismatch recognition complex MutSβ (MSH2-MSH3). The Mlh1 locus is highly polymorphic between B6 and 129 strains. While we were unable to detect any difference in base-base mismatch or short slipped-repeat repair activity between B6 and 129 MLH1 variants, repair efficiency was MLH1 dose-dependent. MLH1 mRNA and protein levels were significantly decreased in 129 mice compared to B6 mice, consistent with a dose-sensitive MLH1-dependent DNA repair mechanism underlying the somatic expansion difference between these strains. Together, these data identify Mlh1 and Mlh3 as novel critical genetic modifiers of HTT CAG instability, point to Mlh1 genetic variation as the likely source of the instability difference in B6 and 129 strains and suggest that MLH1

  15. Germline variants in POLE are associated with early onset mismatch repair deficient colorectal cancer

    PubMed Central

    Elsayed, Fadwa A; Kets, C Marleen; Ruano, Dina; van den Akker, Brendy; Mensenkamp, Arjen R; Schrumpf, Melanie; Nielsen, Maartje; Wijnen, Juul T; Tops, Carli M; Ligtenberg, Marjolijn J; Vasen, Hans FA; Hes, Frederik J; Morreau, Hans; van Wezel, Tom

    2015-01-01

    Germline variants affecting the exonuclease domains of POLE and POLD1 predispose to multiple colorectal adenomas and/or colorectal cancer (CRC). The aim of this study was to estimate the prevalence of previously described heterozygous germline variants POLE c.1270C>G, p.(Leu424Val) and POLD1 c.1433G>A, p.(Ser478Asn) in a Dutch series of unexplained familial, early onset CRC and polyposis index cases. We examined 1188 familial CRC and polyposis index patients for POLE p.(Leu424Val) and POLD1 p.(Ser478Asn) variants using competitive allele-specific PCR. In addition, protein expression of the POLE and DNA mismatch repair genes was studied by immunohistochemistry in tumours from POLE carriers. Somatic mutations were screened using semiconductor sequencing. We detected three index patients (0.25%) with a POLE p.(Leu424Val) variant. In one patient, the variant was found to be de-novo. Tumours from three patients from two families were microsatellite instable, and immunohistochemistry showed MSH6/MSH2 deficiency suggestive of Lynch syndrome. Somatic mutations but no germline MSH6 and MSH2 variants were subsequently found, and one tumour displayed a hypermutator phenotype. None of the 1188 patients carried the POLD1 p.(Ser478Asn) variant. POLE germline variant carriers are also associated with a microsatellite instable CRC. POLE DNA analysis now seems warranted in microsatellite instable CRC, especially in the absence of a causative DNA mismatch repair gene germline variant. PMID:25370038

  16. CYS3, a hotspot of meiotic recombination in Saccharomyces cerevisiae. Effects of heterozygosity and mismatch repair functions on gene conversion and recombination intermediates.

    PubMed Central

    Vedel, M; Nicolas, A

    1999-01-01

    We have examined meiotic recombination at the CYS3 locus. Genetic analysis indicates that CYS3 is a hotspot of meiotic gene conversion, with a putative 5'-3' polarity gradient of conversion frequencies. This gradient is relieved in the presence of msh2 and pms1 mutations, indicating an involvement of mismatch repair functions in meiotic recombination. To investigate the role of mismatch repair proteins in meiotic recombination, we performed a physical analysis of meiotic DNA in wild-type and msh2 pms1 strains in the presence or absence of allelic differences at CYS3. Neither the mutations in CYS3 nor the absence of mismatch repair functions affects the frequency and distribution of nearby recombination-initiating DNA double-strand breaks (DSBs). Processing of DSBs is also similar in msh2 pms1 and wild-type strains. We conclude that mismatch repair functions do not control the distribution of meiotic gene conversion events at the initiating steps. In the MSH2 PMS1 background, strains heteroallelic for frameshift mutations in CYS3 exhibit a frequency of gene conversion greater than that observed for either marker alone. Physical analysis revealed no modification in the formation of DSBs, suggesting that this marker effect results from subsequent processing events that are not yet understood. PMID:10101154

  17. A Study of Molecular Signals Deregulating Mismatch Repair Genes in Prostate Cancer Compared to Benign Prostatic Hyperplasia

    PubMed Central

    Basu, Sanmitra; Majumder, Subhadipa; Bhowal, Ankur; Ghosh, Alip; Naskar, Sukla; Nandy, Sumit; Mukherjee, Subhabrata; Sinha, Rajan Kumar; Basu, Keya; Karmakar, Dilip; Banerjee, Soma; Sengupta, Sanghamitra

    2015-01-01

    Prostate cancer is one of the leading causes of mortality among aging males. There is an unmet requirement of clinically useful biomarkers for early detection of prostate cancer to reduce the liabilities of overtreatment and accompanying morbidity. The present population-based study investigates the factors disrupting expression of multiple functionally related genes of DNA mismatch repair pathway in prostate cancer patients to identify molecular attributes distinguishing adenocarcinoma from benign hyperplasia of prostate. Gene expression was compared between tissue samples from prostate cancer and benign prostatic hyperplasia using real-time-PCR, western blot and immunohistochemistry. Assessment of genotypes of seven single-nucleotide-polymorphisms of three MMR genes was conducted using PCR-coupled RFLP and sequencing. Promoter methylation was interrogated by methylation-specific-PCR and bisulfite-sequencing. Interaction between microRNAs and MMR genes was verified by 3'UTR-based dual luciferase assays. Concurrent reduction of three MMR genes namely hMLH1, hMSH6 and hMSH2 (34-85%, P<0.05) was observed in prostate cancer tissues. hMSH6 polymorphism rs1800932(Pro92Pro) conferred a borderline protection in cancer patients (OR = 0.33, 95% CI = 0.15-0.75). Relative transcript level of hMLH1 was inversely related (r = -0.59, P<0.05) with methylation quotient of its promoter which showed a significantly higher methylation density (P = 0.008, Z = -2.649) in cancer patients. hsa-miR-155, hsa-miR-141 and hsa-miR-21 gene expressions were significantly elevated (66-85%, P<0.05) in tumor specimens and negatively correlated (r = -0.602 to -0.527, P<0.05) with that of MMR genes. hsa-miR-155 & hsa-miR-141 and hsa-miR-155 & hsa-miR-21 were demonstrated to bind to their putative seed sequences in hMLH1 and hMSH6 3’UTRs respectively. Relatively higher expression of DNA methyl-transferases (DNMT1 and DNMT3b) and HIF-1α genes (34-50%, P<0.05) were also detected in tumor tissues

  18. Evaluating the performance of clinical criteria for predicting mismatch repair gene mutations in Lynch syndrome: a comprehensive analysis of 3,671 families.

    PubMed

    Steinke, Verena; Holzapfel, Stefanie; Loeffler, Markus; Holinski-Feder, Elke; Morak, Monika; Schackert, Hans K; Görgens, Heike; Pox, Christian; Royer-Pokora, Brigitte; von Knebel-Doeberitz, Magnus; Büttner, Reinhard; Propping, Peter; Engel, Christoph

    2014-07-01

    Carriers of mismatch repair (MMR) gene mutations have a high lifetime risk for colorectal and endometrial cancers, as well as other malignancies. As mutation analysis to detect these patients is expensive and time-consuming, clinical criteria and tumor-tissue analysis are widely used as pre-screening methods. The aim of our study was to evaluate the performance of commonly applied clinical criteria (the Amsterdam I and II Criteria, and the original and revised Bethesda Guidelines) and the results of tumor-tissue analysis in predicting MMR gene mutations. We analyzed 3,671 families from the German HNPCC Registry and divided them into nine mutually exclusive groups with different clinical criteria. A total of 680 families (18.5%) were found to have a pathogenic MMR gene mutation. Among all 1,284 families with microsatellite instability-high (MSI-H) colorectal cancer, the overall mutation detection rate was 53.0%. Mutation frequencies and their distribution between the four MMR genes differed significantly between clinical groups (p < 0.001). The highest frequencies were found in families fulfilling the Amsterdam Criteria (46.4%). Families with loss of MSH2 expression had higher mutation detection rates (69.5%) than families with loss of MLH1 expression (43.1%). MMR mutations were found significantly more often in families with at least one MSI-H small-bowel cancer (p < 0.001). No MMR mutations were found among patients under 40-years-old with only colorectal adenoma. Familial clustering of Lynch syndrome-related tumors, early age of onset, and familial occurrence of small-bowel cancer were clinically relevant predictors for Lynch syndrome.

  19. Completion of meiosis in male zebrafish (Danio rerio) despite lack of DNA mismatch repair gene mlh1.

    PubMed

    Leal, Marcelo C; Feitsma, Harma; Cuppen, Edwin; França, Luiz R; Schulz, Rüdiger W

    2008-04-01

    Mlh1 is a member of DNA mismatch repair (MMR) machinery and is also essential for the stabilization of crossovers during the first meiotic division. Recently, we have shown that zebrafish mlh1 mutant males are completely infertile because of a block in metaphase I, whereas females are fertile but have aneuploid progeny. When studying fertility in males in a two-fold more inbred background, we have however observed low numbers of fertilized eggs (approximately 0.4%). Histological examination of the testis has revealed that all spermatogenic stages prior to spermatids (spermatogonia, primary spermatocytes, and secondary spermatocytes) are significantly increased in the mutant, whereas the total weight of spermatids and spermatozoa is highly decreased (1.8 mg in wild-type vs. 0.1 mg in mutants), a result clearly different from our previous study in which outbred males lack secondary spermatocytes or postmeiotic cells. Thus, a delay of both meiotic divisions occurs rather than complete arrest during meiosis I in these males. Eggs fertilized with mutant sperm develop as malformed embryos and are aneuploid making this male phenotype much more similar to that previously described in the mutant females. Therefore, crossovers are still essential for proper meiosis, but meiotic cell divisions can progress without it, suggesting that this mutant is a suitable model for studying the cellular mechanisms of completing meiosis without crossover stabilization. PMID:18247060

  20. Association of genomic instability, and the methylation status of imprinted genes and mismatch-repair genes, with neural tube defects.

    PubMed

    Liu, Zhuo; Wang, Zhigang; Li, Yuanyuan; Ouyang, Shengrong; Chang, Huibo; Zhang, Ting; Zheng, Xiaoying; Wu, Jianxin

    2012-05-01

    We studied the genomic instability and methylation status of the mismatch-repair (MMR) genes hMLH1 and hMSH2, and the imprinted genes H19/IGF2, in fetuses with neural tube defects (NTDs) to explore the pathogenesis of the disease. Microsatellite instability (MSI) was observed in 23 of 50 NTD patients. Five NTD patients showed high-degree MSI (MSI-H) and 18 showed low-degree MSI (MSI-L). The frequencies of mutated microsatellite loci were 3/50 (6%) for BatT-25, 10/50 (20%) for Bat-26, 3/50 (6%) for Bat34C4, 6/50 (12%) for D2S123, 4/50 (8%) for D2S119, and 3/50 (6%) for D3S1611. The promoter regions of the hMLH1 and hMSH2 genes were unmethylated in NTD patients, as determined by methylation-specific PCR. The hMLH1 and hMSH2 promoter methylation patterns, the methylation levels of H19 DMR1, and IGF2 DMR0 were detected by bisulfite sequencing PCR, sub-cloning, and sequencing. The hMSH2 promoter sequence was unmethylated, and the hMLH1 promoter showed a specific methylation pattern at two CpG sites. The methylation levels of H19 DMR1 in the NTD and control groups are 73.3% ± 15.9 and 58.3% ± 11.2, respectively. The methylation level of the NTD group was higher than that of the control group (Student's t-test, P<0.05). There is no significant difference in IGF2 DMR0 methylation level between the two groups. All of the results presented here suggest that genomic instability, the MMR system, and hyper-methylation of the H19 DMR1 may be correlated with the occurrence of NTDs.

  1. Methylation Analysis of DNA Mismatch Repair Genes Using DNA Derived from the Peripheral Blood of Patients with Endometrial Cancer: Epimutation in Endometrial Carcinogenesis.

    PubMed

    Takeda, Takashi; Banno, Kouji; Yanokura, Megumi; Adachi, Masataka; Iijima, Moito; Kunitomi, Haruko; Nakamura, Kanako; Iida, Miho; Nogami, Yuya; Umene, Kiyoko; Masuda, Kenta; Kobayashi, Yusuke; Yamagami, Wataru; Hirasawa, Akira; Tominaga, Eiichiro; Susumu, Nobuyuki; Aoki, Daisuke

    2016-10-14

    Germline mutation of DNA mismatch repair (MMR) genes is a cause of Lynch syndrome. Methylation of MutL homolog 1 (MLH1) and MutS homolog 2 (MSH2) has been detected in peripheral blood cells of patients with colorectal cancer. This methylation is referred to as epimutation. Methylation of these genes has not been studied in an unselected series of endometrial cancer cases. Therefore, we examined methylation of MLH1, MSH2, and MSH6 promoter regions of peripheral blood cells in 206 patients with endometrial cancer using a methylation-specific polymerase chain reaction (MSP). Germline mutation of MMR genes, microsatellite instability (MSI), and immunohistochemistry (IHC) were also analyzed in each case with epimutation. MLH1 epimutation was detected in a single patient out of a total of 206 (0.49%)-1 out of 58 (1.72%) with an onset age of less than 50 years. The patient with MLH1 epimutation showed high level MSI (MSI-H), loss of MLH1 expression and had developed endometrial cancer at 46 years old, complicated with colorectal cancer. No case had epimutation of MSH2 or MSH6. The MLH1 epimutation detected in a patient with endometrial cancer may be a cause of endometrial carcinogenesis. This result indicates that it is important to check epimutation in patients with endometrial cancer without a germline mutation of MMR genes.

  2. Methylation Analysis of DNA Mismatch Repair Genes Using DNA Derived from the Peripheral Blood of Patients with Endometrial Cancer: Epimutation in Endometrial Carcinogenesis

    PubMed Central

    Takeda, Takashi; Banno, Kouji; Yanokura, Megumi; Adachi, Masataka; Iijima, Moito; Kunitomi, Haruko; Nakamura, Kanako; Iida, Miho; Nogami, Yuya; Umene, Kiyoko; Masuda, Kenta; Kobayashi, Yusuke; Yamagami, Wataru; Hirasawa, Akira; Tominaga, Eiichiro; Susumu, Nobuyuki; Aoki, Daisuke

    2016-01-01

    Germline mutation of DNA mismatch repair (MMR) genes is a cause of Lynch syndrome. Methylation of MutL homolog 1 (MLH1) and MutS homolog 2 (MSH2) has been detected in peripheral blood cells of patients with colorectal cancer. This methylation is referred to as epimutation. Methylation of these genes has not been studied in an unselected series of endometrial cancer cases. Therefore, we examined methylation of MLH1, MSH2, and MSH6 promoter regions of peripheral blood cells in 206 patients with endometrial cancer using a methylation-specific polymerase chain reaction (MSP). Germline mutation of MMR genes, microsatellite instability (MSI), and immunohistochemistry (IHC) were also analyzed in each case with epimutation. MLH1 epimutation was detected in a single patient out of a total of 206 (0.49%)—1 out of 58 (1.72%) with an onset age of less than 50 years. The patient with MLH1 epimutation showed high level MSI (MSI-H), loss of MLH1 expression and had developed endometrial cancer at 46 years old, complicated with colorectal cancer. No case had epimutation of MSH2 or MSH6. The MLH1 epimutation detected in a patient with endometrial cancer may be a cause of endometrial carcinogenesis. This result indicates that it is important to check epimutation in patients with endometrial cancer without a germline mutation of MMR genes. PMID:27754426

  3. Synthesis and Quantitative Structure–Activity Relationship of Imidazotetrazine Prodrugs with Activity Independent of O6-Methylguanine-DNA-methyltransferase, DNA Mismatch Repair and p53

    PubMed Central

    Pletsas, Dimitrios; Garelnabi, Elrashied A.E.; Li, Li; Phillips, Roger M.; Wheelhouse, Richard T.

    2014-01-01

    The antitumor prodrug Temozolomide is compromised by its dependence for activity on DNA mismatch repair (MMR) and the repair of the chemosensitive DNA lesion, O6-methylguanine (O6-MeG), by O6-methylguanine-DNA-methyltransferase (EC 2.1.1.63, MGMT). Tumor response is also dependent on wild-type p53. Novel 3-(2-anilinoethyl)-substituted imidazotetrazines are reported that have activity independent of MGMT, MMR and p53. This is achieved through a switch of mechanism so that bioactivity derives from imidazotetrazine-generated arylaziridinium ions that principally modify guanine-N7 sites on DNA. Mono- and bi-functional analogs are reported and a quantitative structure-activity relationship (QSAR) study identified the p-tolyl-substituted bi-functional congener as optimized for potency, MGMT-independence and MMR-independence. NCI60 data show the tumor cell response is distinct from other imidazotetrazines and DNA-guanine-N7 active agents such as nitrogen mustards and cisplatin. The new imidazotetrazine compounds are promising agents for further development and their improved in vitro activity validates the principles on which they were designed. PMID:23895620

  4. Roles of DNA adenine methylation in host-pathogen interactions: mismatch repair, transcriptional regulation, and more

    PubMed Central

    Marinus, Martin G.; Casadesus, Josep

    2010-01-01

    The Dam methylase of gamma-proteobacteria and the CcrM methylase of alpha-proteobacteria catalyze an identical reaction (methylation of adenosine moieties using S-adenosyl-methionine as methyl donor) at similar DNA targets (GATC and GANTC, respectively). Dam and CcrM are of independent evolutionary origin. Each may have evolved from an ancestral restriction-modification system that lost its restriction component, leaving an “orphan” methylase devoted solely to epigenetic genome modification. Formation of 6-methyladenine lowers the thermodynamic stability of DNA and changes DNA curvature. As a consequence, the methylation state of specific adenosine moieties can affect DNA-protein interactions. Well known examples include binding of the replication initiation complex to the methylated oriC, recognition of hemimethylated GATCs in newly replicated DNA by the MutHLS mismatch repair complex, and discrimination of methylation states in promoters and regulatory DNA motifs by RNA polymerase and transcription factors. In recent years, Dam and CcrM have been shown to play roles in host-pathogen interactions. These roles are diverse and only partially understood. Especially intriguing is the evidence that Dam methylation regulates virulence genes in E. coli, Salmonella, and Yersinia at the postranscriptional level. PMID:19175412

  5. Clinical features and mismatch repair gene mutation screening in Chinese patients with hereditary nonpolyposis colorectal carcinoma

    PubMed Central

    Liu, Shan-Run; Zhao, Bo; Wang, Zhen-Jun; Wan, Yuan-Lian; Huang, Yan-Ting

    2004-01-01

    AIM: Hereditary nonpolyposis colorectal cancer (HNPCC) is an autosomal dominantly-inherited cancer-susceptibility syndrome that confers an increased risk for colorectal cancer and a variety of other tumors at a young age. It has been associated with germline mutations in five mismatch repair (MMR) genes (hMSH2, hMLH1, hPMS1, hPMS2, and hMSH6/GTBP). The great majority of germline mutations were found in hMSH2 and hMLH1. The purpose of this study was to analyze the clinical features of Chinese HNPCC patients and to screen hMSH2 and hMLH1 gene mutations. METHODS: Twenty-eight independent Chinese families were collected, of which 15 met Amsterdam criteria I and 13 met the Japanese clinical diagnosis criteria. The data were recorded including sex, site of colorectal cancer (CRC), age of diagnosis, history of synchronous and/or metachronous CRC, instance of extracolonic cancers, and histopathology of tumors. Peripheral blood samples were collected from all pedigrees after formal written consents were signed. PCR and denaturing high-performance liquid chromatography (DHPLC) were used to screen the coding regions of hMSH2 and hMLH1 genes. The samples showing abnormal DHPLC profiles were sequenced by a 377 DNA sequencer. RESULTS: One hundred and seventy malignant neoplasms were found in one hundred and twenty-six patients (multiple cancer in twenty-three), including one hundred and twenty-seven CRCs, fifteen gastric, seven endometrial, and five esophageal cancers. Seventy-seven point eight percent of the patients had CRCs, sharing the features of early occurrence (average age of onset, 45.9 years) and of the right-sided predominance reported in the literature. In Chinese HNPCC patients, gastric cancer occurred more frequently, accounting for 11.9% of all cancers patients and ranking second in the spectrum of HNPCC predisposing cancers. Synchronous CRCs occurred less frequently, only accounting for 3.1% of the total CRCs. Twenty percent of the colorectal patients had

  6. Escherichia Coli Mutator Mutd5 Is Defective in the Muthls Pathway of DNA Mismatch Repair

    PubMed Central

    Schaaper, R. M.

    1989-01-01

    We have previously reported that the Escherichia coli mutator strain mutD5 was defective in the correction of bacteriophage M13mp2 heteroduplex DNA containing a T·G mismatch. Here, this defect was further investigated with regard to its interaction with the mutHLS pathway of mismatch repair. A set of 15 different M13mp2 heteroduplexes was used to measure the mismatch-repair capability of wild-type, mutL and mutD5 cells. Throughout the series, the mutD5 strain proved as deficient in mismatch repair as the mutL strain, indicating that the repair defect is similar in the two strains in both extent and specificity. [One exception was noted in the case of a T·G mispair that was subject to VSP (Very Short Patch) repair. VSP repair was abolished by mutL but not by mutD.] Variation in the dam-methylation state of the heteroduplex molecules clearly affected repair in the wild-type strain but had no effect on either the mutD or mutL strain. Finally, mutDmutL or mutDmutS double-mutator strains were no more deficient in mismatch repair as were the single mutator strains. The combined results strongly argue that the mismatch-repair deficiency of mutD5 cells resides in the mutH,L,S-dependent pathway of mismatch repair and that the high mutation rate of mutD strains derives in part from this defect. PMID:2659431

  7. Mutation rates, spectra, and genome-wide distribution of spontaneous mutations in mismatch repair deficient yeast.

    PubMed

    Lang, Gregory I; Parsons, Lance; Gammie, Alison E

    2013-09-01

    DNA mismatch repair is a highly conserved DNA repair pathway. In humans, germline mutations in hMSH2 or hMLH1, key components of mismatch repair, have been associated with Lynch syndrome, a leading cause of inherited cancer mortality. Current estimates of the mutation rate and the mutational spectra in mismatch repair defective cells are primarily limited to a small number of individual reporter loci. Here we use the yeast Saccharomyces cerevisiae to generate a genome-wide view of the rates, spectra, and distribution of mutation in the absence of mismatch repair. We performed mutation accumulation assays and next generation sequencing on 19 strains, including 16 msh2 missense variants implicated in Lynch cancer syndrome. The mutation rate for DNA mismatch repair null strains was approximately 1 mutation per genome per generation, 225-fold greater than the wild-type rate. The mutations were distributed randomly throughout the genome, independent of replication timing. The mutation spectra included insertions/deletions at homopolymeric runs (87.7%) and at larger microsatellites (5.9%), as well as transitions (4.5%) and transversions (1.9%). Additionally, repeat regions with proximal repeats are more likely to be mutated. A bias toward deletions at homopolymers and insertions at (AT)n microsatellites suggests a different mechanism for mismatch generation at these sites. Interestingly, 5% of the single base pair substitutions might represent double-slippage events that occurred at the junction of immediately adjacent repeats, resulting in a shift in the repeat boundary. These data suggest a closer scrutiny of tumor suppressors with homopolymeric runs with proximal repeats as the potential drivers of oncogenesis in mismatch repair defective cells. PMID:23821616

  8. Loss of Cdx2 Expression in Primary Tumors and Lymph Node Metastases is Specific for Mismatch Repair-Deficiency in Colorectal Cancer

    PubMed Central

    Dawson, Heather; Koelzer, Viktor H.; Lukesch, Anne C.; Mallaev, Makhmudbek; Inderbitzin, Daniel; Lugli, Alessandro; Zlobec, Inti

    2013-01-01

    Background: Approximately 20% of all colorectal cancers are hypothesized to arise from the “serrated pathway” characterized by mutation in BRAF, high-level CpG Island Methylator Phenotype, and microsatellite instability/mismatch repair (MMR)-deficiency. MMR-deficient cancers show frequent losses of Cdx2, a homeodomain transcription factor. Here, we determine the predictive value of Cdx2 expression for MMR-deficiency and investigate changes in expression between primary cancers and matched lymph node metastases. Methods: Immunohistochemistry for Cdx2, Mlh1, Msh2, Msh6, and Pms2 was performed on whole tissue sections from 201 patients with primary colorectal cancer and 59 cases of matched lymph node metastases. Receiver operating characteristic curve analysis and Area under the Curve (AUC) were investigated; association of Cdx2 with clinicopathological features and patient survival was carried out. Results: Loss of Cdx2 expression was associated with higher tumor grade (p = 0.0002), advanced pT (p = 0.0166), and perineural invasion (p = 0.0228). Cdx2 loss was an unfavorable prognostic factor in univariate (p = 0.0145) and multivariate [p = 0.0427; HR (95% CI): 0.58 (0.34–0.98)] analysis. The accuracy (AUC) for discriminating MMR-proficient and – deficient cancers was 87% [OR (95% CI): 0.96 (0.95–0.98); p < 0.0001]. Specificity and negative predictive value for MMR-deficiency was 99.1 and 96.3%. One hundred and seventy-four patients had MMR-proficient cancers, of which 60 (34.5%) showed Cdx2 loss. Cdx2 loss in metastases was related to MMR-deficiency (p < 0.0001). There was no difference in expression between primary tumors and matched metastases. Conclusion: Loss of Cdx2 is a sensitive and specific predictor of MMR-deficiency, but is not limited to these tumors, suggesting that events “upstream” of the development of microsatellite instability may impact Cdx2 expression. PMID:24130965

  9. Saturation of DNA mismatch repair and error catastrophe by a base analogue in Escherichia coli.

    PubMed Central

    Negishi, Kazuo; Loakes, David; Schaaper, Roel M

    2002-01-01

    Deoxyribosyl-dihydropyrimido[4,5-c][1,2]oxazin-7-one (dP) is a potent mutagenic deoxycytidine-derived base analogue capable of pairing with both A and G, thereby causing G. C --> A. T and A. T --> G. C transition mutations. We have found that the Escherichia coli DNA mismatch-repair system can protect cells against this mutagenic action. At a low dose, dP is much more mutagenic in mismatch-repair-defective mutH, mutL, and mutS strains than in a wild-type strain. At higher doses, the difference between the wild-type and the mutator strains becomes small, indicative of saturation of mismatch repair. Introduction of a plasmid containing the E. coli mutL(+) gene significantly reduces dP-induced mutagenesis. Together, the results indicate that the mismatch-repair system can remove dP-induced replication errors, but that its capacity to remove dP-containing mismatches can readily be saturated. When cells are cultured at high dP concentration, mutant frequencies reach exceptionally high levels and viable cell counts are reduced. The observations are consistent with a hypothesis in which dP-induced cell killing and growth impairment result from excess mutations (error catastrophe), as previously observed spontaneously in proofreading-deficient mutD (dnaQ) strains. PMID:12196386

  10. The DNA-mismatch repair enzyme hMSH2 modulates UV-B-induced cell cycle arrest and apoptosis in melanoma cells.

    PubMed

    Seifert, Markus; Scherer, Stefan J; Edelmann, Wilfried; Böhm, Markus; Meineke, Viktor; Löbrich, Markus; Tilgen, Wolfgang; Reichrath, Jörg

    2008-01-01

    The mechanisms by which the post-replicative DNA mismatch repair (MMR) enzyme MSH2 is involved in the complex response mechanisms to UV damage are yet to be clarified. Here, we show increased levels of MSH2 mRNA in malignant melanoma, metastases of melanoma, and melanoma cell (MeWo) lines as compared with melanocytic nevi or primary cultured benign melanocytes. UV-B treatment modulated MSH2 expression and silencing of MSH2 gene expression using small interfering RNA technology regulated UV-B-induced cell cycle arrest and apoptosis in human MeWo. We show that MSH2-deficient non-malignant mouse fibroblasts (MEF-/-) are partially resistant against UV-B-induced apoptosis and show reduced S-Phase accumulation. In addition, we show that an Msh2 point mutation (MEFGA) that affects MMR does not affect UV-B-induced apoptosis. In conclusion, we demonstrate that MSH2 modulates in human melanocytes both UV-B-induced cell cycle regulation and apoptosis, most likely via independent, uncoupled mechanisms.

  11. Microsatellite instability in yeast: dependence on repeat unit size and DNA mismatch repair genes.

    PubMed Central

    Sia, E A; Kokoska, R J; Dominska, M; Greenwell, P; Petes, T D

    1997-01-01

    We examined the stability of microsatellites of different repeat unit lengths in Saccharomyces cerevisiae strains deficient in DNA mismatch repair. The msh2 and msh3 mutations destabilized microsatellites with repeat units of 1, 2, 4, 5, and 8 bp; a poly(G) tract of 18 bp was destabilized several thousand-fold by the msh2 mutation and about 100-fold by msh3. The msh6 mutations destabilized microsatellites with repeat units of 1 and 2 bp but had no effect on microsatellites with larger repeats. These results argue that coding sequences containing repetitive DNA tracts will be preferred target sites for mutations in human tumors with mismatch repair defects. We find that the DNA mismatch repair genes destabilize microsatellites with repeat units from 1 to 13 bp but have no effect on the stability of minisatellites with repeat units of 16 or 20 bp. Our data also suggest that displaced loops on the nascent strand, resulting from DNA polymerase slippage, are repaired differently than loops on the template strand. PMID:9111357

  12. Splicing analysis for exonic and intronic mismatch repair gene variants associated with Lynch syndrome confirms high concordance between minigene assays and patient RNA analyses

    PubMed Central

    van der Klift, Heleen M; Jansen, Anne M L; van der Steenstraten, Niki; Bik, Elsa C; Tops, Carli M J; Devilee, Peter; Wijnen, Juul T

    2015-01-01

    A subset of DNA variants causes genetic disease through aberrant splicing. Experimental splicing assays, either RT-PCR analyses of patient RNA or functional splicing reporter minigene assays, are required to evaluate the molecular nature of the splice defect. Here, we present minigene assays performed for 17 variants in the consensus splice site regions, 14 exonic variants outside these regions, and two deep intronic variants, all in the DNA mismatch-repair (MMR) genes MLH1, MSH2, MSH6, and PMS2, associated with Lynch syndrome. We also included two deep intronic variants in APC and PKD2. For one variant (MLH1 c.122A>G), our minigene assay and patient RNA analysis could not confirm the previously reported aberrant splicing. The aim of our study was to further investigate the concordance between minigene splicing assays and patient RNA analyses. For 30 variants results from patient RNA analyses were available, either performed by our laboratory or presented in literature. Some variants were deliberately included in this study because they resulted in multiple aberrant transcripts in patient RNA analysis, or caused a splice effect other than the prevalent exon skip. While both methods were completely concordant in the assessment of splice effects, four variants exhibited major differences in aberrant splice patterns. Based on the present and earlier studies, together showing an almost 100% concordance of minigene assays with patient RNA analyses, we discuss the weight given to minigene splicing assays in the current criteria proposed by InSiGHT for clinical classification of MMR variants. PMID:26247049

  13. The Prevention of Repeat-Associated Deletions in Saccharomyces Cerevisiae by Mismatch Repair Depends on Size and Origin of Deletions

    PubMed Central

    Tran, H. T.; Gordenin, D. A.; Resnick, M. A.

    1996-01-01

    We have investigated the effects of mismatch repair on 1- to 61-bp deletions in the yeast Saccharomyces cerevisiae. The deletions are likely to involve unpaired loop intermediates resulting from DNA polymerase slippage. The mutator effects of mutations in the DNA polymerase δ (POL3) gene and the recombinational repair RAD52 gene were studied in combination with mismatch repair defects. The pol3-t mutation increased up to 1000-fold the rate of extended (7-61 bp) but not of 1-bp deletions. In a rad52 null mutant only the 1-bp deletions were increased (12-fold). The mismatch repair mutations pms1, msh2 and msh3 did not affect 31- and 61-bp deletions in the pol3-t but increased the rates of 7- and 1-bp deletions. We propose that loops less than or equal to seven bases generated during replication are subject to mismatch repair by the PMS1, MSH2, MSH3 system and that it cannot act on loops >=31 bases. In contrast to the pol3-t, the enhancement of 1-bp deletions in a rad52 mutant is not altered by a pms1 mutation. Thus, mismatch repair appears to be specific to errors of DNA synthesis generated during semiconservative replication. PMID:8844147

  14. Predictive genetic testing in children: constitutional mismatch repair deficiency cancer predisposing syndrome.

    PubMed

    Bruwer, Zandrè; Algar, Ursula; Vorster, Alvera; Fieggen, Karen; Davidson, Alan; Goldberg, Paul; Wainwright, Helen; Ramesar, Rajkumar

    2014-04-01

    Biallelic germline mutations in mismatch repair genes predispose to constitutional mismatch repair deficiency syndrome (CMMR-D). The condition is characterized by a broad spectrum of early-onset tumors, including hematological, brain and bowel and is frequently associated with features of Neurofibromatosis type 1. Few definitive screening recommendations have been suggested and no published reports have described predictive testing. We report on the first case of predictive testing for CMMR-D following the identification of two non-consanguineous parents, with the same heterozygous mutation in MLH1: c.1528C > T. The genetic counseling offered to the family, for their two at-risk daughters, is discussed with a focus on the ethical considerations of testing children for known cancer-causing variants. The challenges that are encountered when reporting on heterozygosity in a child younger than 18 years (disclosure of carrier status and risk for Lynch syndrome), when discovered during testing for homozygosity, are addressed. In addition, the identification of CMMR-D in a three year old, and the recommended clinical surveillance that was proposed for this individual is discussed. Despite predictive testing and presymptomatic screening, the sudden death of the child with CMMR-D syndrome occurred 6 months after her last surveillance MRI. This report further highlights the difficulty of developing guidelines, as a result of the rarity of cases and diversity of presentation.

  15. Mismatch Repair in Schizosaccharomyces Pombe Requires the Mutl Homologous Gene Pms1: Molecular Cloning and Functional Analysis

    PubMed Central

    Schar, P.; Baur, M.; Schneider, C.; Kohli, J.

    1997-01-01

    Homologues of the bacterial mutS and mutL genes involved in DNA mismatch repair have been found in organisms from bacteria to humans. Here, we describe the structure and function of a newly identified Schizosaccharomyces pombe gene that encodes a predicted amino acid sequence of 794 residues with a high degree of homology to MutL related proteins. On the basis of its closer relationship to the eukaryotic ``PMS'' genes than to the ``MLH'' genes, we have designated the S. pombe homologue pms1. Disruption of the pms1 gene causes a significant increase of spontaneous mutagenesis as documented by reversion rate measurements. Tetrad analyses of crosses homozygous for the pms1 mutation reveal a reduction of spore viability from >92% to 80% associated with a low proportion (~50%) of meioses producing four viable spores and a significant, allele-dependent increase of the level of post-meiotic segregation of genetic marker allele pairs. The mutant phenotypes are consistent with a general function of pms1 in correction of mismatched base pairs arising as a consequence of DNA polymerase errors during DNA synthesis, or of hybrid DNA formation between homologous but not perfectly complementary DNA strands during meiotic recombination. PMID:9258673

  16. Evidence for independent mismatch repair processing on opposite sides of a double-strand break in Saccharomyces cerevisiae.

    PubMed Central

    Weng, Y S; Nickoloff, J A

    1998-01-01

    Double-strand break (DSB) induced gene conversion in Saccharomyces cerevisiae during meiosis and MAT switching is mediated primarily by mismatch repair of heteroduplex DNA (hDNA). We used nontandem ura3 duplications containing palindromic frameshift insertion mutations near an HO nuclease recognition site to test whether mismatch repair also mediates DSB-induced mitotic gene conversion at a non-MAT locus. Palindromic insertions included in hDNA are expected to produce a stem-loop mismatch, escape repair, and segregate to produce a sectored (Ura+/-) colony. If conversion occurs by gap repair, the insertion should be removed on both strands, and converted colonies will not be sectored. For both a 14-bp palindrome, and a 37-bp near-palindrome, approximately 75% of recombinant colonies were sectored, indicating that most DSB-induced mitotic gene conversion involves mismatch repair of hDNA. We also investigated mismatch repair of well-repaired markers flanking an unrepaired palindrome. As seen in previous studies, these additional markers increased loop repair (likely reflecting corepair). Among sectored products, few had additional segregating markers, indicating that the lack of repair at one marker is not associated with inefficient repair at nearby markers. Clear evidence was obtained for low levels of short tract mismatch repair. As seen with full gene conversions, donor alleles in sectored products were not altered. Markers on the same side of the DSB as the palindrome were involved in hDNA less often among sectored products than nonsectored products, but markers on the opposite side of the DSB showed similar hDNA involvement among both product classes. These results can be explained in terms of corepair, and they suggest that mismatch repair on opposite sides of a DSB involves distinct repair tracts. PMID:9475721

  17. Management of Acute Myeloblastic Leukemia in a Child With Biallelic Mismatch Repair Deficiency.

    PubMed

    Elhasid, Ronit; Dvir, Rina; Rosenfeld Keidar, Hila; Ben Shachar, Shay; Bitan, Menachem; Solar, Irit; Durno, Carol; Aronson, Melyssa; Malkin, David; Hawkins, Cynthia; Bouffet, Eric; Tabori, Uri

    2015-11-01

    Germline biallelic mismatch repair deficiency (bMMRD) results in a unique cancer predisposition syndrome in which the affected children are susceptible to the development of malignancies, especially brain, gastrointestinal, and lymphoid cancers. Acute myeloblastic leukemia is rarely reported in this syndrome. Here we report the decision-making challenges in a bMMRD child with acute myeloblastic leukemia. Our experience should alert physicians to include bMMRD in the differential diagnosis of a child with hyper/hypopigmented spots and leukemia. Furthermore, the presence of the above and consanguinity emphasizes the need to rule out bMMRD when an allogeneic bone marrow transplant is considered and to enable the surveillance of other family members for earlier detection of cancers in these children.

  18. Mismatch repair of heteroduplex DNA intermediates of extrachromosomal recombination in mammalian cells.

    PubMed Central

    Deng, W P; Nickoloff, J A

    1994-01-01

    Previous work indicated that extrachromosomal recombination in mammalian cells could be explained by the single-strand annealing (SSA) model. This model predicts that extrachromosomal recombination leads to nonconservative crossover products and that heteroduplex DNA (hDNA) is formed by annealing of complementary single strands. Mismatched bases in hDNA may subsequently be repaired to wild-type or mutant sequences, or they may remain unrepaired and segregate following DNA replication. We describe a system to examine the formation and mismatch repair of hDNA in recombination intermediates. Our results are consistent with extrachromosomal recombination occurring via SSA and producing crossover recombinant products. As predicted by the SSA model, hDNA was present in double-strand break-induced recombination intermediates. By placing either silent or frameshift mutations in the predicted hDNA region, we have shown that mismatches are efficiently repaired prior to DNA replication. Images PMID:8264607

  19. Management of Acute Myeloblastic Leukemia in a Child With Biallelic Mismatch Repair Deficiency.

    PubMed

    Elhasid, Ronit; Dvir, Rina; Rosenfeld Keidar, Hila; Ben Shachar, Shay; Bitan, Menachem; Solar, Irit; Durno, Carol; Aronson, Melyssa; Malkin, David; Hawkins, Cynthia; Bouffet, Eric; Tabori, Uri

    2015-11-01

    Germline biallelic mismatch repair deficiency (bMMRD) results in a unique cancer predisposition syndrome in which the affected children are susceptible to the development of malignancies, especially brain, gastrointestinal, and lymphoid cancers. Acute myeloblastic leukemia is rarely reported in this syndrome. Here we report the decision-making challenges in a bMMRD child with acute myeloblastic leukemia. Our experience should alert physicians to include bMMRD in the differential diagnosis of a child with hyper/hypopigmented spots and leukemia. Furthermore, the presence of the above and consanguinity emphasizes the need to rule out bMMRD when an allogeneic bone marrow transplant is considered and to enable the surveillance of other family members for earlier detection of cancers in these children. PMID:26274037

  20. Marker Effects of G to C Transversions on Intragenic Recombination and Mismatch Repair in Schizosaccharomyces Pombe

    PubMed Central

    Schar, P.; Kohli, J.

    1993-01-01

    G to C transversion mutations show very strong allele-specific marker effects on the frequency of wild-type recombinants in intragenic two-factor crosses. Here we present a detailed study of the marker effect of one representative, the ade6-M387 mutation of Schizosaccharomyces pombe. Crosses of M387 with other mutations at varying distance reveal highly increased prototroph frequencies in comparison with the C to T transition mutation ade6-51 (control without any known marker effect) located four nucleotides from M387. The marker effect of M387 is strongest (>40-fold) for crosses with mutations less than 15 nucleotides from M387. It decreases to an intermediate level (5-10-fold) in crosses with mutations located 25-150 base pairs from M387/51 and is very low in crosses with mutations beyond 200 base pairs. On the basis of these results and the quantitation of the low efficiency of C/C mismatch repair presented in the accompanying publication we propose the existence of at least two different types of mechanisms for base mismatch repair in fission yeast. The major system is suggested to recognize all base mismatches except C/C with high efficiency and to generate long excision tracts (approximately 100 nucleotides unidirectionally). The minor system is proposed to recognize all base mismatches including C/C with low and variable efficiency and to have short excision tracts (approximately 10 nucleotides unidirectionally). We estimate from the M387 marker effect that the minor system accounts for approximately 1-8% repair of non-C/C mismatches (depending on the nature of the mutation) in fission yeast meiosis. PMID:8462844

  1. An alkylation-tolerant, mutator human cell line is deficient in strand-specific mismatch repair

    SciTech Connect

    Kat, A.; Thilly, W.G. ); Fang, W.H.; Longley, M.J.; Li, G.M.; Modrich, P. )

    1993-07-15

    The human lymphoblastoid MT1 B-cell line was previously isolated as one of a series of mutant cells able to survive the cytotoxic effects of N-methyl-N'-nitro-N-nitrosoguanidine (MNNG). MT1 cells nevertheless remain sensitive to mutagenesis by MNNG and display a mutator phenotype. These phenotypes have been attributed to a single genetic alteration postulated to confer a defect in strand-specific mismatch repair, a proposal that attributes the cytotoxic effect of DNA alkylation in wild-type cells to futile attempts to correct mispairs that arise during replication of alkylated template strands. Our results support this view. MNNG-induced mutations in the HPRT gene of MT1 cells are almost exclusively GC [yields] AT transitions, while spontaneous mutations observed in this mutator cell line are single-nucleotide insertions, transversions, and AT [yields] GC transitions. In vitro assay has demonstrated that the MT1 line is in fact deficient in strand-specific correction of all eight base-base mispairs. This defect, which is manifest at or prior to the excision stage of the reaction, is due to simple deficiency of a required activity because MT1 nuclear extracts can be complemented by a partially purified HeLa fraction to restore in vitro repair. These findings substantiate the idea that strand-specific mismatch repair contributes to alkylation-induced cytotoxicity and imply that this process serves as a barrier to spontaneous transition, transversion, and insertion/deletion mutations in mammalian cells. 22 refs., 3 figs., 1 tab.

  2. A unique horizontal gene transfer event has provided the octocoral mitochondrial genome with an active mismatch repair gene that has potential for an unusual self-contained function

    PubMed Central

    2011-01-01

    Background The mitochondrial genome of the Octocorallia has several characteristics atypical for metazoans, including a novel gene suggested to function in DNA repair. This mtMutS gene is favored for octocoral molecular systematics, due to its high information content. Several hypotheses concerning the origins of mtMutS have been proposed, and remain equivocal, although current weight of support is for a horizontal gene transfer from either an epsilonproteobacterium or a large DNA virus. Here we present new and compelling evidence on the evolutionary origin of mtMutS, and provide the very first data on its activity, functional capacity and stability within the octocoral mitochondrial genome. Results The mtMutS gene has the expected conserved amino acids, protein domains and predicted tertiary protein structure. Phylogenetic analysis indicates that mtMutS is not a member of the MSH family and therefore not of eukaryotic origin. MtMutS clusters closely with representatives of the MutS7 lineage; further support for this relationship derives from the sharing of a C-terminal endonuclease domain that confers a self-contained mismatch repair function. Gene expression analyses confirm that mtMutS is actively transcribed in octocorals. Rates of mitochondrial gene evolution in mtMutS-containing octocorals are lower than in their hexacoral sister-group, which lacks the gene, although paradoxically the mtMutS gene itself has higher rates of mutation than other octocoral mitochondrial genes. Conclusions The octocoral mtMutS gene is active and codes for a protein with all the necessary components for DNA mismatch repair. A lower rate of mitochondrial evolution, and the presence of a nicking endonuclease domain, both indirectly support a theory of self-sufficient DNA mismatch repair within the octocoral mitochondrion. The ancestral affinity of mtMutS to non-eukaryotic MutS7 provides compelling support for an origin by horizontal gene transfer. The immediate vector of transmission

  3. Measles, Mumps, Rubella (MMR)

    MedlinePlus

    ... Pediatrics (AAP): Patient handout Measles - Fact Sheet for Parents Centers for Disease Control and Prevention (CDC) Measles and the Vaccine (Shot) ... of Pediatrics (AAP): Measles information in Spanish for parents Understanding MMR Vaccine Safety Centers for Disease Control and Prevention ... Supporting Organizations ...

  4. Rapid Identification of Chemoresistance Mechanisms Using Yeast DNA Mismatch Repair Mutants.

    PubMed

    Ojini, Irene; Gammie, Alison

    2015-07-21

    Resistance to cancer therapy is a major obstacle in the long-term treatment of cancer. A greater understanding of drug resistance mechanisms will ultimately lead to the development of effective therapeutic strategies to prevent resistance from occurring. Here, we exploit the mutator phenotype of mismatch repair defective yeast cells combined with whole genome sequencing to identify drug resistance mutations in key pathways involved in the development of chemoresistance. The utility of this approach was demonstrated via the identification of the known CAN1 and TOP1 resistance targets for two compounds, canavanine and camptothecin, respectively. We have also experimentally validated the plasma membrane transporter HNM1 as the primary drug resistance target of mechlorethamine. Furthermore, the sequencing of mitoxantrone-resistant strains identified inactivating mutations within IPT1, a gene encoding inositolphosphotransferase, an enzyme involved in sphingolipid biosynthesis. In the case of bactobolin, a promising anticancer drug, the endocytosis pathway was identified as the drug resistance target responsible for conferring resistance. Finally, we show that that rapamycin, an mTOR inhibitor previously shown to alter the fitness of the ipt1 mutant, can effectively prevent the formation of mitoxantrone resistance. The rapid and robust nature of these techniques, using Saccharomyces cerevisiae as a model organism, should accelerate the identification of drug resistance targets and guide the development of novel therapeutic combination strategies to prevent the development of chemoresistance in various cancers.

  5. Evolution and adaptation in Pseudomonas aeruginosa biofilms driven by mismatch repair system-deficient mutators.

    PubMed

    Luján, Adela M; Maciá, María D; Yang, Liang; Molin, Søren; Oliver, Antonio; Smania, Andrea M

    2011-01-01

    Pseudomonas aeruginosa is an important opportunistic pathogen causing chronic airway infections, especially in cystic fibrosis (CF) patients. The majority of the CF patients acquire P. aeruginosa during early childhood, and most of them develop chronic infections resulting in severe lung disease, which are rarely eradicated despite intensive antibiotic therapy. Current knowledge indicates that three major adaptive strategies, biofilm development, phenotypic diversification, and mutator phenotypes [driven by a defective mismatch repair system (MRS)], play important roles in P. aeruginosa chronic infections, but the relationship between these strategies is still poorly understood. We have used the flow-cell biofilm model system to investigate the impact of the mutS associated mutator phenotype on development, dynamics, diversification and adaptation of P. aeruginosa biofilms. Through competition experiments we demonstrate for the first time that P. aeruginosa MRS-deficient mutators had enhanced adaptability over wild-type strains when grown in structured biofilms but not as planktonic cells. This advantage was associated with enhanced micro-colony development and increased rates of phenotypic diversification, evidenced by biofilm architecture features and by a wider range and proportion of morphotypic colony variants, respectively. Additionally, morphotypic variants generated in mutator biofilms showed increased competitiveness, providing further evidence for mutator-driven adaptive evolution in the biofilm mode of growth. This work helps to understand the basis for the specific high proportion and role of mutators in chronic infections, where P. aeruginosa develops in biofilm communities.

  6. Single-molecule motions and interactions in live cells reveal target search dynamics in mismatch repair

    PubMed Central

    Liao, Yi; Schroeder, Jeremy W.; Gao, Burke; Simmons, Lyle A.; Biteen, Julie S.

    2015-01-01

    MutS is responsible for initiating the correction of DNA replication errors. To understand how MutS searches for and identifies rare base-pair mismatches, we characterized the dynamic movement of MutS and the replisome in real time using superresolution microscopy and single-molecule tracking in living cells. We report that MutS dynamics are heterogeneous in cells, with one MutS population exploring the nucleoid rapidly, while another MutS population moves to and transiently dwells at the replisome region, even in the absence of appreciable mismatch formation. Analysis of MutS motion shows that the speed of MutS is correlated with its separation distance from the replisome and that MutS motion slows when it enters the replisome region. We also show that mismatch detection increases MutS speed, supporting the model for MutS sliding clamp formation after mismatch recognition. Using variants of MutS and the replication processivity clamp to impair mismatch repair, we find that MutS dynamically moves to and from the replisome before mismatch binding to scan for errors. Furthermore, a block to DNA synthesis shows that MutS is only capable of binding mismatches near the replisome. It is well-established that MutS engages in an ATPase cycle, which is necessary for signaling downstream events. We show that a variant of MutS with a nucleotide binding defect is no longer capable of dynamic movement to and from the replisome, showing that proper nucleotide binding is critical for MutS to localize to the replisome in vivo. Our results provide mechanistic insight into the trafficking and movement of MutS in live cells as it searches for mismatches. PMID:26575623

  7. Metachronous T-Lymphoblastic Lymphoma and Burkitt Lymphoma in a Child With Constitutional Mismatch Repair Deficiency Syndrome.

    PubMed

    Alexander, Thomas B; McGee, Rose B; Kaye, Erica C; McCarville, Mary Beth; Choi, John K; Cavender, Cary P; Nichols, Kim E; Sandlund, John T

    2016-08-01

    Constitutional mismatch repair deficiency (CMMRD) is a cancer predisposition syndrome associated with a high risk of developing early-onset malignancies of the blood, brain, and intestinal tract. We present the case of a patient with T-lymphoblastic lymphoma at the age of 3 years, followed by Burkitt lymphoma 10 years later. This patient also exhibited numerous nonmalignant findings including café au lait spots, lipomas, bilateral renal nodules, a nonossifying fibroma, multiple colonic adenomas, and a rapidly enlarging pilomatrixoma. The spectrum of malignant and nonmalignant neoplasms in this patient highlights the remarkable diversity, and early onset, of lesions seen in children with CMMRD. PMID:27037742

  8. The chromosome bias of misincorporations during double-strand break repair is not altered in mismatch repair-defective strains of Saccharomyces cerevisiae.

    PubMed Central

    McGill, C B; Holbeck, S L; Strathern, J N

    1998-01-01

    Recombinational repair of a site-specific, double-strand DNA break (DSB) results in increased reversion frequency for nearby mutations. Although some models for DSB repair predict that newly synthesized DNA will be inherited equally by both the originally broken chromosome and the chromosome that served as a template, the DNA synthesis errors are almost exclusively found on the chromosome that had the original DSB (introduced by the HO endonuclease). To determine whether mismatch repair acts on the template chromosome in a directed fashion to restore mismatches to the initial sequence, these experiments were repeated in mismatch repair-defective (pms1, mlh1, and msh2) backgrounds. The results suggest that mismatch repair is not responsible for the observed bias. PMID:9560371

  9. TaMSH7: A cereal mismatch repair gene that affects fertility in transgenic barley (Hordeum vulgare L.)

    PubMed Central

    Lloyd, Andrew H; Milligan, Andrew S; Langridge, Peter; Able, Jason A

    2007-01-01

    Background Chromosome pairing, recombination and DNA repair are essential processes during meiosis in sexually reproducing organisms. Investigating the bread wheat (Triticum aestivum L.) Ph2 (Pairing homoeologous) locus has identified numerous candidate genes that may have a role in controlling such processes, including TaMSH7, a plant specific member of the DNA mismatch repair family. Results Sequencing of the three MSH7 genes, located on the short arms of wheat chromosomes 3A, 3B and 3D, has revealed no significant sequence divergence at the amino acid level suggesting conservation of function across the homoeogroups. Functional analysis of MSH7 through the use of RNAi loss-of-function transgenics was undertaken in diploid barley (Hordeum vulgare L.). Quantitative real-time PCR revealed several T0 lines with reduced MSH7 expression. Positive segregants from two T1 lines studied in detail showed reduced MSH7 expression when compared to transformed controls and null segregants. Expression of MSH6, another member of the mismatch repair family which is most closely related to the MSH7 gene, was not significantly reduced in these lines. In both T1 lines, reduced seed set in positive segregants was observed. Conclusion Results presented here indicate, for the first time, a distinct functional role for MSH7 in vivo and show that expression of this gene is necessary for wild-type levels of fertility. These observations suggest that MSH7 has an important function during meiosis and as such remains a candidate for Ph2. PMID:18096080

  10. Immunohistochemistry for hMLH1 and hMSH2: a practical test for DNA mismatch repair-deficient tumors.

    PubMed

    Marcus, V A; Madlensky, L; Gryfe, R; Kim, H; So, K; Millar, A; Temple, L K; Hsieh, E; Hiruki, T; Narod, S; Bapat, B V; Gallinger, S; Redston, M

    1999-10-01

    Inactivation of deoxyribonucleic acid (DNA) mismatch repair genes, most commonly human mutL homologue 1 (hMLH1) or human mutS homologue 2 (hMSH2), is a recently described alternate pathway in cancer development and progression. The resulting genetic instability is characterized by widespread somatic mutations in tumor DNA, and is termed high-frequency microsatellite instability (MSI-H). Although described in a variety of tumors, mismatch repair deficiency has been studied predominantly in colorectal carcinoma. Most MSI-H colorectal carcinomas are sporadic, but some occur in patients with hereditary nonpolyposis colorectal cancer (HNPCC), and are associated with germline mutations in mismatch repair genes. Until now, the identification of MSI-H cancers has required molecular testing. To evaluate the role of immunohistochemistry as a new screening tool for mismatch repair-deficient neoplasms, the authors studied the expression of hMLH1 and hMSH2, using commercially available monoclonal antibodies, in 72 formalin-fixed, paraffin-embedded tumors that had been tested previously for microsatellite instability. They compared immunohistochemical patterns of 38 MSI-H neoplasms, including 16 cases from HNPCC patients with known germline mutations in hMLH1 or hMSH2, with 34 neoplasms that did not show microsatellite instability. Thirty-seven of 38 MSI-H neoplasms were predicted to have a mismatch repair gene defect, as demonstrated by the absence of hMLH1 and/or hMSH2 expression. This included correspondence with all 16 cases with germline mutations. All 34 microsatellite-stable cancers had intact staining with both antibodies. These findings clearly demonstrate that immunohistochemistry can discriminate accurately between MSI-H and microsatellite-stable tumors, providing a practical new technique with important clinical and research applications. PMID:10524526

  11. Development of DNA mismatch repair gene, MutS, as a diagnostic marker for detection and phylogenetic analysis of algal Megaviruses.

    PubMed

    Wilson, William H; Gilg, Ilana C; Duarte, Amy; Ogata, Hiroyuki

    2014-10-01

    Megaviruses are generically defined as giant viruses with genomes up to 1.26Mb that infect eukaryotic unicellular protists; they are clearly delineated in DNA polymerase B phylogenetic trees; in addition, common features often include an associated virophage observed during infection; the presence of an amino acyl tRNA synthetase gene; and a nucleic acid mismatch repair protein, MutS gene. The archetypal representative of this evolving putative family is Mimivirus, an opportunistic pathogen of Acanthamoeba spp. originally thought to be a bacterium until its genome sequence was published in 2004. Subsequent analysis of marine metagenomic data revealed Megaviruses are likely ubiquitous on the surface ocean. Analysis of genome sequences of giant viruses isolated from naturally occurring marine protists such as microalgae and a microflagellate grazer, started the expansion of the Megaviridae. Here, we explored the possibility of developing Megavirus specific markers for mutS that could be used in virus molecular ecology studies. MutS is split into 15 different clades representing a wide range of cellular life, and two that contain Megaviruses, clade MutS7 and clade MutS8. We developed specific PCR primers that recognized Megavirus clade MutS8, a clade that we propose discriminates most of the algal Megaviruses. Analysis of seawater off the coast of Maine, US, revealed novel groups of algal Megaviruses that were present in all samples tested. The Megavirus clade MutS8 marker should be considered as a tool to reveal new diversity and distribution of this enigmatic group of viruses.

  12. Heteroduplex formation and mismatch repair of the "stuck" mutation during mating-type switching in Saccharomyces cerevisiae.

    PubMed Central

    Ray, B L; White, C I; Haber, J E

    1991-01-01

    We sequenced two alleles of the MATa locus of Saccharomyces cerevisiae that reduce homothallic switching and confer viability to HO rad52 strains. Both the MATa-stk (J. E. Haber, W. T. Savage, S. M. Raposa, B. Weiffenbach, and L. B. Rowe, Proc. Natl. Acad. Sci. USA 77:2824-2828, 1980) and MATa-survivor (R. E. Malone and D. Hyman, Curr. Genet. 7:439-447, 1983) alleles result from a T----A base change at position Z11 of the MAT locus. These strains also contain identical base substitutions at HMRa, so that the mutation is reintroduced when MAT alpha switches to MATa. Mating-type switching in a MATa-stk strain relative to a MATa Z11T strain is reduced at least 50-fold but can be increased by expression of HO from a galactose-inducible promoter. We confirmed by Southern analysis that the Z11A mutation reduced the efficiency of double-strand break formation compared with the Z11T variant; the reduction was more severe in MAT alpha than in MATa. In MAT alpha, the Z11A mutation also creates a mat alpha 1 (sterile) mutation that distinguishes switches of MATa-stk to either MAT alpha or mat alpha 1-stk. Pedigree analysis of cells induced to switch in G1 showed that MATa-stk switched frequently (23% of the time) to produce one mat alpha 1-stk and one MAT alpha progeny. This postswitching segregation suggests that Z11 was often present in heteroduplex DNA that was not mismatch repaired. When mismatch repair was prevented by deletion of the PMS1 gene, there was an increase in the proportion of mat alpha 1-stk/MAT alpha sectors (59%) and in pairs of switched cells that both retained the stk mutation (27%). We conclude that at least one strand of DNA only 4 bp from the HO cut site is not degraded in most of the gene conversion events that accompany MAT switching. Images PMID:1922052

  13. Mismatch repair hMSH2, hMLH1, hMSH6 and hPMS2 mRNA expression profiles in precancerous and cancerous urothelium.

    PubMed

    Vageli, Dimitra P; Giannopoulos, Stavros; Doukas, Sotirios G; Kalaitzis, Christos; Giannakopoulos, Stilianos; Giatromanolaki, Alexandra; Koukoulis, George K; Touloupidis, Stavros

    2013-01-01

    Changes in the expression of the mismatch repair (MMR) genes hMSH2, hMLH1, hMSH6 and hPMS2 reflect dysfunction of the DNA repair system that may allow the malignant transformation of tissue cells. The aim of the present study was to address the mRNA expression profiles of the mismatch DNA repair system in cancerous and precancerous urothelium. This is the first study to quantify MMR mRNA expression by applying quantitative real-time PCR (qPCR) and translate the results to mRNA phenotypic profiles (r, reduced; R, regular or elevated) in bladder tumors [24 urothelial cell carcinomas (UCCs) and 1 papillary urothelial neoplasm of low malignant potential (PUNLMP)] paired with their adjacent normal tissues (ANTs). Genetic instability analysis was applied at polymorphic sites distal or close to the hMSH2 and hMLH1 locus. Presenting our data, reduced hMSH2, hMSH6 and hPMS2 mRNA expression profiles were observed in cancerous and precancerous urothelia. Significantly, the ANTs of UCCs revealed the highest percentages of reduced hMSH2 (r(2)), hMSH6 (r(6)) and hPMS2 (p(2)) mRNA phenotypes relative to their tumors (P<0.03). In particular, combined r(2)r(6) (P<0.02) presented a greater difference between ANTs of low-grade UCCs vs. their tumors compared with ANTs of high-grade UCCs (P= 0.000). Reduced hMLH1 (r(1)) phenotype was not expressed in precancerous or cancerous urothelia. The hMSH6 mRNA was the most changed in UCCs (47.8%), while hMSH2, hMLH1 and hPMS2 showed overexpression (47.8, 35 and 30%, respectively) that was associated with gender and histological tumor grading or staging. Genetic instability was rare in polymorphic regions distal to hMLH1. Our data reveal a previously unrecognized hMSH2 and hMSH6 mRNA combined phenotype (r(2)r(6)) correlated with a precancerous urothelium and show that hMLH1 is transcriptionally activated in precancerous or cancerous urothelium. In the present study, it is demonstrated that reduction of hMSH6 mRNA is a frequent event in bladder

  14. MMR Vaccine (Measles, Mumps, and Rubella)

    MedlinePlus

    ... who is already infected.Measles, mumps, and rubella (MMR) vaccine can protect children (and adults) from all three ... Who should get MMR vaccine and when?Children should get 2 doses of MMR vaccine: First Dose: 12 to 15 months of age Second ...

  15. Mutation Rate, Spectrum, Topology, and Context-Dependency in the DNA Mismatch Repair-Deficient Pseudomonas fluorescens ATCC948

    PubMed Central

    Long, Hongan; Sung, Way; Miller, Samuel F.; Ackerman, Matthew S.; Doak, Thomas G.; Lynch, Michael

    2015-01-01

    High levels of genetic diversity exist among natural isolates of the bacterium Pseudomonas fluorescens, and are especially elevated around the replication terminus of the genome, where strain-specific genes are found. In an effort to understand the role of genetic variation in the evolution of Pseudomonas, we analyzed 31,106 base substitutions from 45 mutation accumulation lines of P. fluorescens ATCC948, naturally deficient for mismatch repair, yielding a base-substitution mutation rate of 2.34 × 10−8 per site per generation (SE: 0.01 × 10−8) and a small-insertion-deletion mutation rate of 1.65 × 10−9 per site per generation (SE: 0.03 × 10−9). We find that the spectrum of mutations in prophage regions, which often contain virulence factors and antibiotic resistance, is highly similar to that in the intergenic regions of the host genome. Our results show that the mutation rate varies around the chromosome, with the lowest mutation rate found near the origin of replication. Consistent with observations from other studies, we find that site-specific mutation rates are heavily influenced by the immediately flanking nucleotides, indicating that mutations are context dependent. PMID:25539726

  16. Frequency of mutations in mismatch repair genes in a population-based study of women with ovarian cancer

    PubMed Central

    Pal, T; Akbari, M R; Sun, P; Lee, J-H; Fulp, J; Thompson, Z; Coppola, D; Nicosia, S; Sellers, T A; McLaughlin, J; Risch, H A; Rosen, B; Shaw, P; Schildkraut, J; Narod, S A

    2012-01-01

    Background: Mutations in genes for hereditary non-polyposis colorectal cancer (HNPCC) in ovarian cancer patients remains poorly defined. We sought to estimate the frequency and characteristics of HNPCC gene mutations in a population-based sample of women with epithelial ovarian cancer. Methods: The analysis included 1893 women with epithelial ovarian cancer ascertained from three population-based studies. Full-germline DNA sequencing of the coding regions was performed on three HNPCC genes, MLH1, MSH2 and MSH6. Collection of demographic, clinical and family history information was attempted in all women. Results: Nine clearly pathogenic mutations were identified, including five in MSH6, two each in MLH1 and MSH2. In addition, 28 unique predicted pathogenic missense variants were identified in 55 patients. Pathogenic mutation carriers had an earlier mean age at diagnosis of ovarian cancer, overrepresentation of cancers with non-serous histologies and a higher number of relatives with HNPCC-related cancers. Conclusions: Our findings suggest that fewer than 1% of women with ovarian cancer harbour a germline mutation in the HNPCC genes, with overrepresentation of MSH6 mutations. This represents a lower-range estimate due to the large number of predicted pathogenic variants in which pathogenicity could not definitively be determined. Identification of mismatch repair gene mutations has the potential to impact screening and treatment decisions in these women. PMID:23047549

  17. Rubella and the MMR vaccine.

    PubMed

    Bedford, Helen; Tookey, Pat

    Rubella is often thought of as a disease of childhood that has few complications. However, congenital rubella resulting from transmission from mother to baby during pregnancy can result in multiple severe defects. There are concerns about the uptake of the MMR vaccine and that any outbreak of rubella would affect disproportionately minority groups in the UK who may not have had the vaccine. Helen Bedford explains. PMID:16475584

  18. Structural Features and Functional Dependency on β-Clamp Define Distinct Subfamilies of Bacterial Mismatch Repair Endonuclease MutL.

    PubMed

    Fukui, Kenji; Baba, Seiki; Kumasaka, Takashi; Yano, Takato

    2016-08-12

    In early reactions of DNA mismatch repair, MutS recognizes mismatched bases and activates MutL endonuclease to incise the error-containing strand of the duplex. DNA sliding clamp is responsible for directing the MutL-dependent nicking to the newly synthesized/error-containing strand. In Bacillus subtilis MutL, the β-clamp-interacting motif (β motif) of the C-terminal domain (CTD) is essential for both in vitro direct interaction with β-clamp and in vivo repair activity. A large cluster of negatively charged residues on the B. subtilis MutL CTD prevents nonspecific DNA binding until β clamp interaction neutralizes the negative charge. We found that there are some bacterial phyla whose MutL endonucleases lack the β motif. For example, the region corresponding to the β motif is completely missing in Aquifex aeolicus MutL, and critical amino acid residues in the β motif are not conserved in Thermus thermophilus MutL. We then revealed the 1.35 Å-resolution crystal structure of A. aeolicus MutL CTD, which lacks the β motif but retains the metal-binding site for the endonuclease activity. Importantly, there was no negatively charged cluster on its surface. It was confirmed that CTDs of β motif-lacking MutLs, A. aeolicus MutL and T. thermophilus MutL, efficiently incise DNA even in the absence of β-clamp and that β-clamp shows no detectable enhancing effect on their activity. In contrast, CTD of Streptococcus mutans, a β motif-containing MutL, required β-clamp for the digestion of DNA. We propose that MutL endonucleases are divided into three subfamilies on the basis of their structural features and dependence on β-clamp. PMID:27369079

  19. An Efficient Site-Specific Method for Irreversible Covalent Labeling of Proteins with a Fluorophore

    PubMed Central

    Liu, Jiaquan; Hanne, Jeungphill; Britton, Brooke M.; Shoffner, Matthew; Albers, Aaron E.; Bennett, Jared; Zatezalo, Rachel; Barfield, Robyn; Rabuka, David; Lee, Jong-Bong; Fishel, Richard

    2015-01-01

    Fluorophore labeling of proteins while preserving native functions is essential for bulk Förster resonance energy transfer (FRET) interaction and single molecule imaging analysis. Here we describe a versatile, efficient, specific, irreversible, gentle and low-cost method for labeling proteins with fluorophores that appears substantially more robust than a similar but chemically distinct procedure. The method employs the controlled enzymatic conversion of a central Cys to a reactive formylglycine (fGly) aldehyde within a six amino acid Formylglycine Generating Enzyme (FGE) recognition sequence in vitro. The fluorophore is then irreversibly linked to the fGly residue using a Hydrazinyl-Iso-Pictet-Spengler (HIPS) ligation reaction. We demonstrate the robust large-scale fluorophore labeling and purification of E.coli (Ec) mismatch repair (MMR) components. Fluorophore labeling did not alter the native functions of these MMR proteins in vitro or in singulo. Because the FGE recognition sequence is easily portable, FGE-HIPS fluorophore-labeling may be easily extended to other proteins. PMID:26582263

  20. An Efficient Site-Specific Method for Irreversible Covalent Labeling of Proteins with a Fluorophore.

    PubMed

    Liu, Jiaquan; Hanne, Jeungphill; Britton, Brooke M; Shoffner, Matthew; Albers, Aaron E; Bennett, Jared; Zatezalo, Rachel; Barfield, Robyn; Rabuka, David; Lee, Jong-Bong; Fishel, Richard

    2015-01-01

    Fluorophore labeling of proteins while preserving native functions is essential for bulk Förster resonance energy transfer (FRET) interaction and single molecule imaging analysis. Here we describe a versatile, efficient, specific, irreversible, gentle and low-cost method for labeling proteins with fluorophores that appears substantially more robust than a similar but chemically distinct procedure. The method employs the controlled enzymatic conversion of a central Cys to a reactive formylglycine (fGly) aldehyde within a six amino acid Formylglycine Generating Enzyme (FGE) recognition sequence in vitro. The fluorophore is then irreversibly linked to the fGly residue using a Hydrazinyl-Iso-Pictet-Spengler (HIPS) ligation reaction. We demonstrate the robust large-scale fluorophore labeling and purification of E.coli (Ec) mismatch repair (MMR) components. Fluorophore labeling did not alter the native functions of these MMR proteins in vitro or in singulo. Because the FGE recognition sequence is easily portable, FGE-HIPS fluorophore-labeling may be easily extended to other proteins. PMID:26582263

  1. Simple sequence repeats together with mismatch repair deficiency can bias mutagenic pathways in Pseudomonas aeruginosa during chronic lung infection.

    PubMed

    Moyano, Alejandro J; Feliziani, Sofía; Di Rienzo, Julio A; Smania, Andrea M

    2013-01-01

    Pseudomonas aeruginosa is an opportunistic pathogen that chronically infects the airways of cystic fibrosis (CF) patients and undergoes a process of genetic adaptation based on mutagenesis. We evaluated the role of mononucleotide G:C and A:T simple sequence repeats (SSRs) in this adaptive process. An in silico survey of the genome sequences of 7 P. aeruginosa strains showed that mononucleotide G:C SSRs but not A:T SSRs were greatly under-represented in coding regions, suggesting a strong counterselection process for G:C SSRs with lengths >5 bp but not for A:T SSRs. A meta-analysis of published whole genome sequence data for a P. aeruginosa strain from a CF patient with chronic airway infection showed that G:C SSRs but not A:T SSRs were frequently mutated during the infection process through the insertion or deletion of one or more SSR subunits. The mutation tendency of G:C SSRs was length-dependent and increased exponentially as a function of SSR length. When this strain naturally became a stable Mismatch Repair System (MRS)-deficient mutator, the degree of increase of G:C SSRs mutations (5-fold) was much higher than that of other types of mutation (2.2-fold or less). Sequence analysis of several mutated genes reported for two different collections, both containing mutator and non-mutator strains of P. aeruginosa from CF chronic infections, showed that the proportion of G:C SSR mutations was significantly higher in mutators than in non-mutators, whereas no such difference was observed for A:T SSR mutations. Our findings, taken together, provide genome-scale evidences that under a MRS-deficient background, long G:C SSRs are able to stochastically bias mutagenic pathways by making the genes in which they are harbored more prone to mutation. The combination of MRS deficiency and virulence-related genes that contain long G:C SSRs is therefore a matter of concern in P. aeruginosa CF chronic infection.

  2. Population Modelling with M&M's[R

    ERIC Educational Resources Information Center

    Winkel, Brian

    2009-01-01

    Several activities in which population dynamics can be modelled by tossing M&M's[R] candy are presented. Physical activities involving M&M's[R] can be modelled by difference equations and several population phenomena, including death and immigration, are studied. (Contains 1 note.)

  3. Mismatch repair genes on chromosomes 2p and 3p account for a major share of hereditary nonpolyposis colorectal cancer families evaluable by linkage

    SciTech Connect

    Nystroem-Lahti, M.; Pylkkaenen, L.; Aaltonen, L.A.; Parsons, R.; Leach, F.S.; Hamilton, S.R.; Sistonen, P. |; Watson, P.; Bronson, E.; Fusaro, R.

    1994-10-01

    Two susceptibility loci for hereditary nonpolyposis colorectal cancer (HNPCC) have been identified, and each contains a mismatch repair gene: MSH2 on chromosome 2p and MLH1 on chromosome 3p. We studied the involvement of these loci in 13 large HNPCC kindreds originating from three different continents. Six families showed close linkage to the 2p locus, and a heritable mutation of the MSH2 gene was subsequently found in four. The 2p-linked kindreds included a family characterized by the lack of extracolonic manifestations (Lynch I syndrome), as well as two families with cutaneous manifestations typical of the Muir-Torre syndrome. Four families showed evidence for linkage to the 3p locus, and a heritable mutation of the MLH1 gene was later detected in three. One 3p-linked kindred was of Amerindian origin. Of the remaining three families studied for linkage, one showed lod scores compatible with exclusion of both MSH2 and MLH1, while lod scores obtained in the other two families suggested exclusion of one HNPCC locus (MSH2 or MLH1) but were uninformative for markers flanking the other locus. Our results suggest that mismatch repair genes on 2p and 3p account for a major share of HNPCC in kindreds that can be evaluated by linkage analysis. 36 refs., 2 figs., 3 tabs.

  4. A multifactorial likelihood model for MMR gene variant classification incorporating probabilities based on sequence bioinformatics and tumor characteristics: a report from the Colon Cancer Family Registry.

    PubMed

    Thompson, Bryony A; Goldgar, David E; Paterson, Carol; Clendenning, Mark; Walters, Rhiannon; Arnold, Sven; Parsons, Michael T; Michael D, Walsh; Gallinger, Steven; Haile, Robert W; Hopper, John L; Jenkins, Mark A; Lemarchand, Loic; Lindor, Noralane M; Newcomb, Polly A; Thibodeau, Stephen N; Young, Joanne P; Buchanan, Daniel D; Tavtigian, Sean V; Spurdle, Amanda B

    2013-01-01

    Mismatch repair (MMR) gene sequence variants of uncertain clinical significance are often identified in suspected Lynch syndrome families, and this constitutes a challenge for both researchers and clinicians. Multifactorial likelihood model approaches provide a quantitative measure of MMR variant pathogenicity, but first require input of likelihood ratios (LRs) for different MMR variation-associated characteristics from appropriate, well-characterized reference datasets. Microsatellite instability (MSI) and somatic BRAF tumor data for unselected colorectal cancer probands of known pathogenic variant status were used to derive LRs for tumor characteristics using the Colon Cancer Family Registry (CFR) resource. These tumor LRs were combined with variant segregation within families, and estimates of prior probability of pathogenicity based on sequence conservation and position, to analyze 44 unclassified variants identified initially in Australasian Colon CFR families. In addition, in vitro splicing analyses were conducted on the subset of variants based on bioinformatic splicing predictions. The LR in favor of pathogenicity was estimated to be ~12-fold for a colorectal tumor with a BRAF mutation-negative MSI-H phenotype. For 31 of the 44 variants, the posterior probabilities of pathogenicity were such that altered clinical management would be indicated. Our findings provide a working multifactorial likelihood model for classification that carefully considers mode of ascertainment for gene testing.

  5. Mismatch repair hMSH2, hMLH1, hMSH6 and hPMS2 mRNA expression profiles in precancerous and cancerous urothelium

    PubMed Central

    VAGELI, DIMITRA P.; GIANNOPOULOS, STAVROS; DOUKAS, SOTIRIOS G.; KALAITZIS, CHRISTOS; GIANNAKOPOULOS, STILIANOS; GIATROMANOLAKI, ALEXANDRA; KOUKOULIS, GEORGE K.; TOULOUPIDIS, STAVROS

    2013-01-01

    Changes in the expression of the mismatch repair (MMR) genes hMSH2, hMLH1, hMSH6 and hPMS2 reflect dysfunction of the DNA repair system that may allow the malignant transformation of tissue cells. The aim of the present study was to address the mRNA expression profiles of the mismatch DNA repair system in cancerous and precancerous urothelium. This is the first study to quantify MMR mRNA expression by applying quantitative real-time PCR (qPCR) and translate the results to mRNA phenotypic profiles (r, reduced; R, regular or elevated) in bladder tumors [24 urothelial cell carcinomas (UCCs) and 1 papillary urothelial neoplasm of low malignant potential (PUNLMP)] paired with their adjacent normal tissues (ANTs). Genetic instability analysis was applied at polymorphic sites distal or close to the hMSH2 and hMLH1 locus. Presenting our data, reduced hMSH2, hMSH6 and hPMS2 mRNA expression profiles were observed in cancerous and precancerous urothelia. Significantly, the ANTs of UCCs revealed the highest percentages of reduced hMSH2 (r2), hMSH6 (r6) and hPMS2 (p2) mRNA phenotypes relative to their tumors (P<0.03). In particular, combined r2r6 (P<0.02) presented a greater difference between ANTs of low-grade UCCs vs. their tumors compared with ANTs of high-grade UCCs (P= 0.000). Reduced hMLH1 (r1) phenotype was not expressed in precancerous or cancerous urothelia. The hMSH6 mRNA was the most changed in UCCs (47.8%), while hMSH2, hMLH1 and hPMS2 showed overexpression (47.8, 35 and 30%, respectively) that was associated with gender and histological tumor grading or staging. Genetic instability was rare in polymorphic regions distal to hMLH1. Our data reveal a previously unrecognized hMSH2 and hMSH6 mRNA combined phenotype (r2r6) correlated with a precancerous urothelium and show that hMLH1 is transcriptionally activated in precancerous or cancerous urothelium. In the present study, it is demonstrated that reduction of hMSH6 mRNA is a frequent event in bladder tumorigenesis and

  6. Overexpression of MutSα Complex Proteins Predicts Poor Prognosis in Oral Squamous Cell Carcinoma

    PubMed Central

    Wagner, Vivian Petersen; Webber, Liana Preto; Salvadori, Gabriela; Meurer, Luise; Fonseca, Felipe Paiva; Castilho, Rogério Moraes; Squarize, Cristiane Helena; Vargas, Pablo Agustin; Martins, Manoela Domingues

    2016-01-01

    Abstract The DNA mismatch repair (MMR) system is responsible for the detection and correction of errors created during DNA replication, thereby avoiding the incorporation of mutations in dividing cells. The prognostic value of alterations in MMR system has not previously been analyzed in oral squamous cell carcinoma (OSCC). The study comprised 115 cases of OSCC diagnosed between 1996 and 2010. The specimens collected were constructed into tissue microarray blocks. Immunohistochemical staining for MutSα complex proteins hMSH2 and hMSH6 was performed. The slides were subsequently scanned into high-resolution images, and nuclear staining of hMSH2 and hMSH6 was analyzed using the Nuclear V9 algorithm. Univariable and multivariable Cox proportional hazard regression models were performed to evaluate the prognostic value of hMSH2 and hMSH6 in OSCC. All cases in the present cohort were positive for hMSH2 and hMSH6 and a direct correlation was found between the expression of the proteins (P < 0.05). The mean number of positive cells for hMSH2 and hMSH6 was 64.44 ± 15.21 and 31.46 ± 22.38, respectively. These values were used as cutoff points to determine high protein expression. Cases with high expression of both proteins simultaneously were classified as having high MutSα complex expression. In the multivariable analysis, high expression of the MutSα complex was an independent prognostic factor for poor overall survival (hazard ratio: 2.75, P = 0.02). This study provides a first insight of the prognostic value of alterations in MMR system in OSCC. We found that MutSα complex may constitute a molecular marker for the poor prognosis of OSCC. PMID:27258499

  7. Role of the Mmr Efflux Pump in Drug Resistance in Mycobacterium tuberculosis

    PubMed Central

    Rodrigues, Liliana; Villellas, Cristina; Bailo, Rebeca; Viveiros, Miguel

    2013-01-01

    Efflux pumps are membrane proteins capable of actively transporting a broad range of substrates from the cytoplasm to the exterior of the cell. Increased efflux activity in response to drug treatment may be the first step in the development of bacterial drug resistance. Previous studies showed that the efflux pump Mmr was significantly overexpressed in strains exposed to isoniazid. In the work to be described, we constructed mutants lacking or overexpressing Mmr in order to clarify the role of this efflux pump in the development of resistance to isoniazid and other drugs in M. tuberculosis. The mmr knockout mutant showed an increased susceptibility to ethidium bromide, tetraphenylphosphonium, and cetyltrimethylammonium bromide (CTAB). Overexpression of mmr caused a decreased susceptibility to ethidium bromide, acriflavine, and safranin O that was obliterated in the presence of the efflux inhibitors verapamil and carbonyl cyanide m-chlorophenylhydrazone. Isoniazid susceptibility was not affected by the absence or overexpression of mmr. The fluorometric method allowed the detection of a decreased efflux of ethidium bromide in the knockout mutant, whereas the overexpressed strain showed increased efflux of this dye. This increased efflux activity was inhibited in the presence of efflux inhibitors. Under our experimental conditions, we have found that efflux pump Mmr is mainly involved in the susceptibility to quaternary compounds such as ethidium bromide and disinfectants such as CTAB. The contribution of this efflux pump to isoniazid resistance in Mycobacterium tuberculosis still needs to be further elucidated. PMID:23165464

  8. Temozolomide Resistance in Glioblastoma Cell Lines: Implication of MGMT, MMR, P-Glycoprotein and CD133 Expression

    PubMed Central

    Prados, Jose; Caba, Octavio; Cabeza, Laura; Berdasco, Maria; Gónzalez, Beatriz; Melguizo, Consolación

    2015-01-01

    Background The use of temozolomide (TMZ) has improved the prognosis for glioblastoma multiforme patients. However, TMZ resistance may be one of the main reasons why treatment fails. Although this resistance has frequently been linked to the expression of O6-methylguanine-DNA methyltransferase (MGMT) it seems that this enzyme is not the only molecular mechanism that may account for the appearance of drug resistance in glioblastoma multiforme patients as the mismatch repair (MMR) complex, P-glycoprotein, and/or the presence of cancer stem cells may also be implicated. Methods Four nervous system tumor cell lines were used to analyze the modulation of MGMT expression and MGMT promoter methylation by TMZ treatment. Furthermore, 5-aza-2’-deoxycytidine was used to demethylate the MGMT promoter and O(6)-benzylguanine to block GMT activity. In addition, MMR complex and P-glycoprotein expression were studied before and after TMZ exposure and correlated with MGMT expression. Finally, the effect of TMZ exposure on CD133 expression was analyzed. Results Our results showed two clearly differentiated groups of tumor cells characterized by low (A172 and LN229) and high (SF268 and SK-N-SH) basal MGMT expression. Interestingly, cell lines with no MGMT expression and low TMZ IC50 showed a high MMR complex expression, whereas cell lines with high MGMT expression and high TMZ IC50 did not express the MMR complex. In addition, modulation of MGMT expression in A172 and LN229 cell lines was accompanied by a significant increase in the TMZ IC50, whereas no differences were observed in SF268 and SK-N-SH cell lines. In contrast, P-glycoprotein and CD133 was found to be unrelated to TMZ resistance in these cell lines. Conclusions These results may be relevant in understanding the phenomenon of TMZ resistance, especially in glioblastoma multiforme patients laking MGMT expression, and may also aid in the design of new therapeutic strategies to improve the efficacy of TMZ in glioblastoma

  9. Function of high-mobility group A proteins in the DNA damage signaling for the induction of apoptosis

    PubMed Central

    Fujikane, Ryosuke; Komori, Kayoko; Sekiguchi, Mutsuo; Hidaka, Masumi

    2016-01-01

    O6-Methylguanine produced in DNA can pair with thymine during DNA replication, thus leading to a G-to-A transition mutation. To prevent such outcomes, cells harboring O6-methylguanine-containing mispair undergo apoptosis that requires the function of mismatch repair (MMR) protein complex. To identify the genes involved in the induction of apoptosis, we performed gene-trap mutagenesis and isolated a clone of mouse cells exhibiting an increased resistance to the killing effect of an alkylating agent, N-methyl-N-nitrosourea (MNU). The mutant carries an insertion in the Hmga2 gene, which belongs to a gene family encoding the high-mobility group A non-histone chromatin proteins. To elucidate the function of HMGA proteins in the apoptosis pathway, we introduced siRNAs for HMGA1 and/or HMGA2 into human HeLa MR cells defective in O6-methylguanine-DNA methyltransferase. HMGA1- and HMGA2-single knockdown cells showed an increased resistance to MNU, and HMGA1/HMGA2-double knockdown cells exhibited further increased tolerance compared to the control. The phosphorylation of ATR and CHK1, the appearance of a sub-G1 population, and caspase-9 activation were suppressed in the knockdown cells, although the formation of mismatch recognition complex was unaffected. These results suggest that HMGA family proteins function at the step following the damage recognition in the process of apoptosis triggered by O6-methylguanine. PMID:27538817

  10. The contribution of deleterious germline mutations in BRCA1, BRCA2 and the mismatch repair genes to ovarian cancer in the population.

    PubMed

    Song, Honglin; Cicek, Mine S; Dicks, Ed; Harrington, Patricia; Ramus, Susan J; Cunningham, Julie M; Fridley, Brooke L; Tyrer, Jonathan P; Alsop, Jennifer; Jimenez-Linan, Mercedes; Gayther, Simon A; Goode, Ellen L; Pharoah, Paul D P

    2014-09-01

    The aim of this study was to estimate the contribution of deleterious mutations in BRCA1, BRCA2, MLH1, MSH2, MSH6 and PMS2 to invasive epithelial ovarian cancer (EOC) in the population. The coding sequence and splice site boundaries of all six genes were amplified in germline DNA from 2240 invasive EOC cases and 1535 controls. Barcoded fragment libraries were sequenced using the Illumina GAII or HiSeq and sequence data for each subject de-multiplexed prior to interpretation. GATK and Annovar were used for variant detection and annotation. After quality control 2222 cases (99.2%) and 1528 controls (99.5%) were included in the final analysis. We identified 193 EOC cases (8.7%) carrying a deleterious mutation in at least one gene compared with 10 controls (0.65%). Mutations were most frequent in BRCA1 and BRCA2, with 84 EOC cases (3.8%) carrying a BRCA1 mutation and 94 EOC cases (4.2%) carrying a BRCA2 mutation. The combined BRCA1 and BRCA2 mutation prevalence was 11% in high-grade serous disease. Seventeen EOC cases carried a mutation in a mismatch repair gene, including 10 MSH6 mutation carriers (0.45%) and 4 MSH2 mutation carriers (0.18%). At least 1 in 10 women with high-grade serous EOC has a BRCA1 or BRCA2 mutation. The development of next generation sequencing technologies enables rapid mutation screening for multiple susceptibility genes at once, suggesting that routine clinical testing of all incidence cases should be considered.

  11. Recombinagenic Processing of Uv-Light Photoproducts in Nonreplicating Phage DNA by the Escherichia Coli Methyl-Directed Mismatch Repair System

    PubMed Central

    Feng, W. Y.; Lee, E.; Hays, J. B.

    1991-01-01

    Nonreplicating λ phage DNA in homoimmune Escherichia coli lysogens provides a useful model system for study of processes that activate DNA for homologous recombination. We measured recombination by extracting phage DNA from infected cells, using it to transfect recA recipient cells, and scoring the frequency of recombinant infective centers. With unirradiated phage, recombinant frequencies were less than 0.1%. However, recombination could be increased over 300-fold by prior UV irradiation of the phages. The dependence of recombination on UvrA function varied greatly with UV dose. With phage irradiated to 20 J/m(2), recombinant frequencies in repressed infections of uvr(+) bacteria were one-fifth those in uvrA infections; with phages irradiated to 100 J/m(2), frequencies in uvr(+) infections were thirty times higher than in uvrA infections. Most UV-stimulated recombination in uvrA infections appeared to depend on the bacterial methyl-directed mismatch-repair system: frequencies were depressed 5-20-fold in uvrA bacteria also lacking MutH, MutL or MutS functions, and recombinant frequencies decreased with increasing GATC-adenine methylation of phage stocks. The biological activity of nonreplicating UV-irradiated phage DNA declined with time after infection of uvrA cells; this decline was photoproduct-dependent, more marked for undermethylated than overmethylated phage DNA, and depended on host MutHLS functions. In uvr(+) bacteria, where the UvrABC system provided an alternative, apparently less efficient, route to recombinagenic DNA, UV-stimulated recombinant frequencies were about twice as high in mutH or mutLS as in mut(+) cells, in agreement with hyper-rec mut effects previously described by others. PMID:1838344

  12. The contribution of deleterious germline mutations in BRCA1, BRCA2 and the mismatch repair genes to ovarian cancer in the population

    PubMed Central

    Song, Honglin; Cicek, Mine S.; Dicks, Ed; Harrington, Patricia; Ramus, Susan J.; Cunningham, Julie M.; Fridley, Brooke L.; Tyrer, Jonathan P.; Alsop, Jennifer; Jimenez-Linan, Mercedes; Gayther, Simon A.; Goode, Ellen L.; Pharoah, Paul D.P.

    2014-01-01

    The aim of this study was to estimate the contribution of deleterious mutations in BRCA1, BRCA2, MLH1, MSH2, MSH6 and PMS2 to invasive epithelial ovarian cancer (EOC) in the population. The coding sequence and splice site boundaries of all six genes were amplified in germline DNA from 2240 invasive EOC cases and 1535 controls. Barcoded fragment libraries were sequenced using the Illumina GAII or HiSeq and sequence data for each subject de-multiplexed prior to interpretation. GATK and Annovar were used for variant detection and annotation. After quality control 2222 cases (99.2%) and 1528 controls (99.5%) were included in the final analysis. We identified 193 EOC cases (8.7%) carrying a deleterious mutation in at least one gene compared with 10 controls (0.65%). Mutations were most frequent in BRCA1 and BRCA2, with 84 EOC cases (3.8%) carrying a BRCA1 mutation and 94 EOC cases (4.2%) carrying a BRCA2 mutation. The combined BRCA1 and BRCA2 mutation prevalence was 11% in high-grade serous disease. Seventeen EOC cases carried a mutation in a mismatch repair gene, including 10 MSH6 mutation carriers (0.45%) and 4 MSH2 mutation carriers (0.18%). At least 1 in 10 women with high-grade serous EOC has a BRCA1 or BRCA2 mutation. The development of next generation sequencing technologies enables rapid mutation screening for multiple susceptibility genes at once, suggesting that routine clinical testing of all incidence cases should be considered. PMID:24728189

  13. MMR and autism: further evidence against a causal association.

    PubMed

    Farrington, C P; Miller, E; Taylor, B

    2001-06-14

    The hypothesis that MMR vaccines cause autism was first raised by reports of cases in which developmental regression occurred soon after MMR vaccination. A previous study found no evidence to support this hypothesis. It has recently been suggested that MMR vaccine might cause autism, but that the induction interval need not be short. The data from the earlier study were reanalysed to test this second hypothesis. Our results do not support this hypothesis, and provide further evidence against a causal association between MMR vaccination and autism. PMID:11395196

  14. Influence of a single-nucleotide polymorphism of the DNA mismatch repair-related gene exonuclease-1 (rs9350) with prostate cancer risk among Chinese people.

    PubMed

    Zhang, Yiming; Li, Pengju; Xu, Abai; Chen, Jie; Ma, Chao; Sakai, Akiko; Xie, Liping; Wang, Lei; Na, Yanqun; Kaku, Haruki; Xu, Peng; Jin, Zhong; Li, Xiezhao; Guo, Kai; Shen, Haiyan; Zheng, Shaobo; Kumon, Hiromi; Liu, Chunxiao; Huang, Peng

    2016-05-01

    In this study, we aimed to identify the influence of exonuclease 1 (EXO1) single-nucleotide polymorphism rs9350, which is involved in DNA mismatch repair, on prostate cancer risk in Chinese people. In our hospital-based case-control study, 214 prostate cancer patients and 253 cancer-free control subjects were enrolled from three hospitals in China. Genotyping for rs9350 was performed by the SNaPshot(®) method using peripheral blood samples. Consequently, a significantly higher prostate cancer risk was observed in patients with the CC genotype [odds ratio (OR) = 1.678, 95 % confidence interval (CI) = 1.130-2.494, P = 0.010] than in those with the CT genotype. Further, the CT/TT genotypes were significantly associated with increased prostate cancer risk (adjusted OR = 1.714, 95 % CI = 1.176-2.500, P = 0.005), and the C allele had a statistically significant compared with T allele (P = 0.009) of EXO1 (rs9350). Through stratified analysis, significant associations were revealed for the CT/TT genotype in the subgroup with diagnosis age >72 (adjusted OR = 1.776, 95 % CI = 1.051-3.002, P = 0.032) and in patients with localized disease subgroup (adjusted OR = 1.798, 95 % CI = 1.070-3.022, P = 0.027). In addition, we observed that patients with prostate-specific antigen (PSA) levels of ≤10 ng/mL were more likely to have the CT/TT genotypes than those with PSA levels of >10 ng/mL (P = 0.006). For the first time, we present evidence that the inherited EXO1 polymorphism rs9350 may have a substantial influence on prostate cancer risk in Chinese people. We believe that the rs9350 could be a useful biomarker for assessing predisposition for and early diagnosis of prostate cancer.

  15. Intralesional tuberculin (PPD) versus measles, mumps, rubella (MMR) vaccine in treatment of multiple warts: a comparative clinical and immunological study.

    PubMed

    Shaheen, Maha Adel; Salem, Samar Abdallah M; Fouad, Dina Adel; El-Fatah, Abeer Aly Abd

    2015-01-01

    Intralesional purified protein derivative (PPD) or mumps, measles, rubella (MMR) were not previously compared regarding their efficacy or mechanism of action in treatment of warts. We aimed to compare their efficacy in treatment of multiple warts and investigate their effect on serum interleukin (IL)-4 and IL-12. Thirty patients with multiple warts were included (10 treated with PPD, 10 with MMR, and 10 with normal saline (control)). Injection was done every 3 weeks until clearance or maximum of three treatments. Clinical response of target and distant warts was evaluated. Serum ILs-4 and -12 were assessed before and after treatment. A significantly higher rate of complete response was found in target and distant warts with PPD (60% each) and MMR (80%, 40%, respectively) compared with controls (0%), with no significant difference between both treatments. After treatment, the control group showed the lowest serum IL-12 and IL-4 levels compared with the MMR- and PPD-treated groups with statistically significant difference in between. MMR resulted in a significantly higher serum IL-12 than PPD. With PPD, IL-4 was increased with statistically significant change compared with pretreat-ment level. Intralesional PPD and MMR show comparable efficacy and safety in treatment of multiple warts. Serum ILs-4 and-12 increase following antigen injection.

  16. Unintended events following immunization with MMR: a systematic review.

    PubMed

    Jefferson, Tom; Price, Deirdre; Demicheli, Vittorio; Bianco, Elvira

    2003-09-01

    Public debate over the safety of the trivalent measles, mumps and rubella (MMR) vaccine and the drop in vaccination rates in several countries persists despite its almost universal use and accepted effectiveness. We carried out a systematic review to assess the evidence of unintended effects (beneficial or harmful) associated with MMR and the applicability of systematic reviewing methods to the field of safety evaluation. Eligible studies were comparative prospective or retrospective on healthy individuals up to 15 years of age, carried out or published by 2003. We identified 120 articles satisfying our inclusion criteria and included 22. MMR is associated with a lower incidence of upper respiratory tract infections, a higher incidence of irritability, similar incidence of other adverse effects compared to placebo and is likely to be associated with benign thrombocytopenic purpura (TP), parotitis, joint and limb complaints and aseptic meningitis (mumps Urabe strain-containing MMR). Exposure to MMR is unlikely to be associated with Crohn's disease, ulcerative colitis, autism or aseptic meningitis (mumps Jeryl-Lynn strain-containing MMR). The design and reporting of safety outcomes in MMR vaccine studies, both pre- and post-marketing, are largely inadequate. The evidence of adverse events following immunization with MMR cannot be separated from its role in preventing the target diseases.

  17. In vivo-selected mutations in methyl-directed mismatch repair suppress the virulence attenuation of Salmonella dam mutant strains following intraperitoneal, but not oral, infection of naïve mice.

    PubMed

    Heithoff, Douglas M; Badie, Golnaz; Julio, Steven M; Enioutina, Elena Y; Daynes, Raymond A; Sinsheimer, Robert L; Mahan, Michael J

    2007-07-01

    Salmonella enterica serovar Typhimurium that lacks the DNA adenine methylase (Dam) ectopically expresses multiple genes that are preferentially expressed during infection, is attenuated for virulence, and confers heightened immunity in vaccinated hosts. The safety of dam mutant Salmonella vaccines was evaluated by screening within infected mice for isolates that have an increased capacity to cause disease relative to the attenuated parental strain. Since dam mutant strains are sensitive to the DNA base analog 2-aminopurine (2-AP), we screened for 2-AP-resistant (2-AP(r)) isolates in systemic tissues of mice infected with dam mutant Salmonella. Such 2-AP(r) derivatives were isolated following intraperitoneal but not oral administration and were shown to be competent for infectivity via intraperitoneal but not oral infection of naïve mice. These 2-AP(r) derivatives were deficient in methyl-directed mismatch repair and were resistant to nitric oxide, yet they retained the bile-sensitive phenotype of the parental dam mutant strain. Additionally, introduction of a mutH null mutation into dam mutant cells suppressed the inherent defects in intraperitoneal infectivity and nitric oxide resistance, as well as overexpression of SpvB, an actin cytotoxin required for Salmonella systemic survival. These data suggest that restoration of intraperitoneal virulence of dam mutant strains is associated with deficiencies in methyl-directed mismatch repair that correlate with the production of systemically related virulence functions.

  18. Addressing MMR Vaccine Resistance in Minnesota's Somali Community.

    PubMed

    Bahta, Lynn; Ashkir, Asli

    2015-10-01

    Over the past 10 years, Minnesota clinicians have noticed increased resistance to MMR vaccination among Somali Minnesotans. Misinformation about a discredited study asserting a link between the MMR vaccine and autism has permeated this community as parents have increasingly become concerned about the prevalence of autism spectrum disorder among their children. As a result, MMR vaccination rates among U.S.-born children of Somali descent are declining. This article reports findings from an investigation by the Minnesota Department of Health, which was undertaken to better understand vaccine hesitancy among Somali Minnesotans. Based on these and other findings, we propose a multi-pronged approach for increasing vaccination rates in this population.

  19. Parents' perspectives on the MMR immunisation: a focus group study.

    PubMed Central

    Evans, M; Stoddart, H; Condon, L; Freeman, E; Grizzell, M; Mullen, R

    2001-01-01

    BACKGROUND: The uptake of the combined measles, mumps and rubella immunisation (MMR) in Britain has fallen since 1998, when a link was hypothesised with the development of bowel disorders and childhood autism. Despite reassurances about the safety of MMR, uptake levels remain lower than optimal. We need to understand what influences parents' decisions on whether to accept MMR or not so that health professionals can provide a service responsive to their needs. AIM: To investigate what influences parents' decisions on whether to accept or refuse the primary MMR immunisation and the impact of the recent controversy over its safety. DESIGN: Qualitative study using focus group discussions. SETTING: Forty-eight parents, whose youngest child was between 14 months and three years old, attended groups at community halls in six localities in Avon and Gloucestershire. METHODS: Purposive sampling strategy was used to include parents from a variety of socioeconomic backgrounds. Three groups comprised parents who had accepted MMR and three groups comprised parents who had refused MMR. Data analysis used modified grounded theory techniques incorporating the constant comparative method. RESULTS: All parents felt that the decision about MMR was difficult and stressful, and experienced unwelcome pressure from health professionals to comply. Parents were not convinced by Department of Health reassurances that MMR was the safest and best option for their children and many had accepted MMR unwillingly. Four key factors influenced parents' decisions: (a) beliefs about the risks and benefits of MMR compared with contracting the diseases, (b) information from the media and other sources about the safety of MMR, (c) confidence and trust in the advice of health professionals and attitudes towards compliance with this advice, and (d) views on the importance of individual choice within Government policy on immunisation. CONCLUSIONS: Parents wanted up-to-date information about the risks and

  20. Journalists and jabs: media coverage of the MMR vaccine.

    PubMed

    Speers, Tammy; Lewis, Justin

    2004-01-01

    The MMR vaccine became front-page news in early February 2002, in a much reported controversy about alleged links between MMR and autism. We examine both media content and public opinion and knowledge to explore how this controversy was presented, and, in turn, how this coverage influenced public perceptions. The news coverage of MMR was monitored over a seven and a half month period from 28 January to 15 September, 2002. Two national surveys were conducted-in April and in October, 2002-both based on over 1000 face to face interviews, with the purpose of exploring what the public learned from the coverage, and how this information may have influenced attitudes towards the vaccine. We will argue that the media's critical scrutiny of those supporting MMR was not matched by a rigorous examination of the case against it, and that the public was, as a consequence, often misinformed about the level of risk involved.

  1. Acute hemorrhagic edema of infancy after MMR vaccine.

    PubMed

    Binamer, Yousef

    2015-01-01

    Acute hemorrhagic edema of infancy (AHEI) is a rare type of leuckocytoclastic vasculitis. It affects mainly children less than two years of age. Many precipitating factors have been reported, including infectious etiology and vaccination. We are reporting a two-year-old boy with AHEI after measles, mumps, and rubella (MMR) vaccine. To our knowledge this is the second reported case after an MMR vaccine.

  2. Acute hemorrhagic edema of infancy after MMR vaccine.

    PubMed

    Binamer, Yousef

    2015-01-01

    Acute hemorrhagic edema of infancy (AHEI) is a rare type of leuckocytoclastic vasculitis. It affects mainly children less than two years of age. Many precipitating factors have been reported, including infectious etiology and vaccination. We are reporting a two-year-old boy with AHEI after measles, mumps, and rubella (MMR) vaccine. To our knowledge this is the second reported case after an MMR vaccine. PMID:26409801

  3. Addressing MMR Vaccine Resistance in Minnesota's Somali Community.

    PubMed

    Bahta, Lynn; Ashkir, Asli

    2015-10-01

    Over the past 10 years, Minnesota clinicians have noticed increased resistance to MMR vaccination among Somali Minnesotans. Misinformation about a discredited study asserting a link between the MMR vaccine and autism has permeated this community as parents have increasingly become concerned about the prevalence of autism spectrum disorder among their children. As a result, MMR vaccination rates among U.S.-born children of Somali descent are declining. This article reports findings from an investigation by the Minnesota Department of Health, which was undertaken to better understand vaccine hesitancy among Somali Minnesotans. Based on these and other findings, we propose a multi-pronged approach for increasing vaccination rates in this population. PMID:26596077

  4. Site-specific frame-shift mutagenesis by the 1-nitropyrene-DNA adduct N-(deoxyguanosin-8-y1)-1-aminopyrene located in the (CG)3 sequence: effects of SOS, proofreading, and mismatch repair.

    PubMed

    Malia, S A; Vyas, R R; Basu, A K

    1996-04-01

    1-Nitropyrene (1-NP), the predominant nitropolycyclic hydrocarbon found in diesel exhaust, is a mutagen and tumorigen. Nitroreduction is a major pathway by which 1-NP is metabolized. Reductively activated 1-NP forms a major DNA adduct, N-(deoxyguanosin-8-yl)-1-aminopyrene (dGAP), both in vitro and in vivo. In Salmonella typhimurium 1-NP induces a CpG deletion in a CGCGCGCG sequence. In Escherichia coli, however, mostly -1 and +1 frame-shifts are observed, which occur predominantly in 5'-CG, 5'-GC, and 5'-GG sequences. In order to determine the mechanism of mutagenesis by dGAP in a CpG repetitive sequence, we constructed a single-stranded M13 genome containing the adduct at the underscored deoxyguanosine of an inserted CGCGCG sequence. In E. coli strains with normal repair capability the adduct induced approximately 2% CpG deletions, which was 20-fold that of the control. With SOS, the frequency of frame-shift mutations increased to 2.6%, even though the frequency of CpG deletion accompanied 50% reduction. The enhancement in mutagenesis was due to a +1 frame-shift that occurred at a high frequency. In strains with a defect in methyl-directed mismatch repair, 50-70% increase in mutation frequency was observed. When these strains were SOS induced, frame-shift mutagenesis increased by approximately 100%. When transfections were carried out in dnaQ strains that are impaired in 3'-->5'exonuclease activity of DNA polymerase III, frame-shift mutagenesis increased 5-7-fold. dGAP-induced frame-shifts in the (CG)3 sequence, therefore, varied from 2% to 17% depending on the state of repair of the host cells. We conclude that dGAP induces both -2 and +1 frame-shifts in a CpG repetitive sequence and that these two mutagenic events are competing pathways. The CpG deletion does not require SOS functions, whereas the +1 frame-shifts are SOS-dependent. On the basis of the data in repair-deficient strains, it appears that both types of frame-shifts occurred as a result of

  5. Rubella in Israel after the MMR vaccine: elimination or containment?

    PubMed

    Anis, Emilia; Grotto, Itamar; Moerman, Larisa; Kaliner, Ehud; Warshavsky, Bruce; Slater, Paul E; Lev, Boaz

    2013-05-01

    Since 1996, after the full institution of the two-dose measles, mumps, and rubella vaccine (MMR) regimen in Israel, rubella incidence has declined dramatically and has remained extremely low. Cyclical outbreaks ended; the two brief outbreaks that did occur were quickly contained; and epidemiological data indicate that the disease is practically absent from the country. But similar steep declines in the incidence of measles and mumps, the two other MMR-preventable diseases, were followed by major outbreaks in 2007 and 2010. Epidemiological analyses show that undervaccination of subgroups within the Jewish ultra-orthodox population, both in Israel and abroad, and virus importation into Israel, continue to be risk factors for all three MMR-preventable diseases. Israel's public health system, therefore, should focus on a policy of containment: improve MMR coverage among undervaccinated subgroups and assure that virus importation is no longer a risk. Then the goal of rubella elimination will become feasible. We discuss how the Israeli experience may contribute to the World Health Organization Initiative to eliminate simultaneously measles and rubella.

  6. MMR (measles, mumps, and rubella) vaccine - what you need to know

    MedlinePlus

    ... who is already infected. Measles, mumps, and rubella (MMR) vaccine can protect children (and adults) from all three ... stopped vaccinating they would return. Who should get MMR vaccine and when? Children should get 2 doses of ...

  7. MMR-Vaccine and Regression in Autism Spectrum Disorders: Negative Results Presented from Japan

    ERIC Educational Resources Information Center

    Uchiyama, Tokio; Kurosawa, Michiko; Inaba, Yutaka

    2007-01-01

    It has been suggested that the measles, mumps, and rubella vaccine (MMR) is a cause of regressive autism. As MMR was used in Japan only between 1989 and 1993, this time period affords a natural experiment to examine this hypothesis. Data on 904 patients with autism spectrum disorders (ASD) were analyzed. During the period of MMR usage no…

  8. Promoter hypermethylation and inactivation of hMLH1, a DNA mismatch repair gene, in head and neck squamous cell carcinoma.

    PubMed

    Liu, Kela; Zuo, Chunlai; Luo, Q Kevin; Suen, James Y; Hanna, Ehab; Fan, Chun-Yang

    2003-03-01

    Head and neck squamous cell carcinoma (HNSCC) is a multistage process during which adverse genetic alterations accumulate resulting in loss of cell cycle control, selective cell overgrowth, and ultimately formation of malignancy. Among various genetic alterations in HNSCC is increased microsatellite instability (MSI). hMLH1 is one of the major mismatch DNA repair genes, the inactivation of which caused increased MSI in a variety of human cancers including HNSCC. While somatic mutation is a major mechanism of the hMLH1 gene inactivation in hereditary form of human cancer, promoter hypermethylation appears to be primarily involved in the inactivation of the hMLH1 gene in sporadic form of human cancers. In the current study, we analyzed 78 cases of HNSCC for hMLH1 protein expression and promoter hypermethylation by IHC and methylation-specific PCR (MSP). Twenty-four of 78 cases (31%) of HNSCC contained markedly reduced levels of the hMLH1 protein. Based on the IHC results, 8 cases without and 8 with hMLH1 protein expression (total of 16) were further analyzed by MSP. Seven of 8 cases (88%) that were negative for the hMLH1 protein displayed promoter hypermethylation, whereas 7 of 7 cases (100%) strongly positive for the protein were free of promoter methylation. This study confirms our previous conclusion that promoter hypermethylation represents a major mechanism of the hMLH1 gene inactivation in HNSCC.

  9. Antibody persistence in young adults 1 year after MMR immunization by aerosol or by subcutaneous route.

    PubMed

    Díaz-Ortega, José Luis; Bennett, John V; Castañeda, D; Martinez, D; de Castro, J Fernandez

    2010-10-18

    Information on antibody persistence after aerosol revaccination with MMR components is limited. Thus, antibody titers were determined in 283 adult participants in a MMR vaccine trial 12 months after revaccination. One group had received aerosolized Triviraten vaccine while two other groups received either injected Triviraten or MMR II vaccine. Both MMR vaccines contained the same rubella strain, but different measles and mumps strains. Seropositivity to measles persisted in 98% of aerosolized vaccine recipients, 92% of injected Triviraten, and 95% of injected MMR II. All participants in the three groups retained seropositivity to rubella, while less than 50% remained seropositive to mumps.

  10. MMR vaccine uptake rates: a data validation study.

    PubMed

    Ghebrehewet, S; Falconer, M; McDonald, P; Schlecht, B

    2003-06-01

    As part of our investigation into the decrease in the measles, mumps and rubella (MMR) vaccine uptake rates, we validated MMR vaccination records of all children born between 01/09/1998 and 31/08/1999 in our area (North Cheshire, South Cheshire, and Wirral). A significant number of children had received their MMR vaccine but were not recorded as such by the Child Health Computer System (CHCS). Reported COVER (cover of vaccination evaluated rapidly) data uptake (combined) for North Cheshire, South Cheshire, and Wirral Health Authorities for the period covered by the data validation study was 90.5%, the corrected uptake following the validation was 92.6%, 2.1% higher than the reported coverage. If the coverage data were to continue to form part of the NHS indicators of PCT performance, action by all PCTs to improve accuracy of immunisation data would be highly desirable. Electronic transfer of information from practices to the CHCS and between CHCSs, i.e. across boundaries, could improve data accuracy.

  11. Application of a 5-tiered scheme for standardized classification of 2,360 unique mismatch repair gene variants in the InSiGHT locus-specific database.

    PubMed

    Thompson, Bryony A; Spurdle, Amanda B; Plazzer, John-Paul; Greenblatt, Marc S; Akagi, Kiwamu; Al-Mulla, Fahd; Bapat, Bharati; Bernstein, Inge; Capellá, Gabriel; den Dunnen, Johan T; du Sart, Desiree; Fabre, Aurelie; Farrell, Michael P; Farrington, Susan M; Frayling, Ian M; Frebourg, Thierry; Goldgar, David E; Heinen, Christopher D; Holinski-Feder, Elke; Kohonen-Corish, Maija; Robinson, Kristina Lagerstedt; Leung, Suet Yi; Martins, Alexandra; Moller, Pal; Morak, Monika; Nystrom, Minna; Peltomaki, Paivi; Pineda, Marta; Qi, Ming; Ramesar, Rajkumar; Rasmussen, Lene Juel; Royer-Pokora, Brigitte; Scott, Rodney J; Sijmons, Rolf; Tavtigian, Sean V; Tops, Carli M; Weber, Thomas; Wijnen, Juul; Woods, Michael O; Macrae, Finlay; Genuardi, Maurizio

    2014-02-01

    The clinical classification of hereditary sequence variants identified in disease-related genes directly affects clinical management of patients and their relatives. The International Society for Gastrointestinal Hereditary Tumours (InSiGHT) undertook a collaborative effort to develop, test and apply a standardized classification scheme to constitutional variants in the Lynch syndrome-associated genes MLH1, MSH2, MSH6 and PMS2. Unpublished data submission was encouraged to assist in variant classification and was recognized through microattribution. The scheme was refined by multidisciplinary expert committee review of the clinical and functional data available for variants, applied to 2,360 sequence alterations, and disseminated online. Assessment using validated criteria altered classifications for 66% of 12,006 database entries. Clinical recommendations based on transparent evaluation are now possible for 1,370 variants that were not obviously protein truncating from nomenclature. This large-scale endeavor will facilitate the consistent management of families suspected to have Lynch syndrome and demonstrates the value of multidisciplinary collaboration in the curation and classification of variants in public locus-specific databases.

  12. Risk, its perception and the media: the MMR controversy.

    PubMed

    Hackett, Alison Jane

    2008-07-01

    This article aims to explore how the media contributes to and generates 'risk' and 'risk perception.' The example of parents refusing to have their children immunised with the measles, mumps and rubella (MMR) vaccine following negative media reporting will be discussed. The media appears to have an important influence on the perception of risk. We are living in a society that is increasingly aware of risk, and in which risk is socially constructed. It is important that healthcare professionals provide clear, consistent, evidence-based information to clients, ensuring that any areas of uncertainty are acknowledged. Otherwise, the public's trust in the healthcare professional will be undermined. PMID:18655642

  13. Pattern of hMLH1, hMSH2 and hMSH6 expression and clinical characteristics in a sample of Malaysian colorectal carcinoma cases.

    PubMed

    Khoo, J J; Gunn, A; Peh, S C

    2013-06-01

    Malignant transformation from normal colonic mucosa to carcinomas may be accelerated by genetic loss or inactivation of genes of the DNA mismatch repair system. The aim of the study was to determine the local incidence and pattern of immunohistochemical expression of mismatch repair proteins namely: hMLH1, hMSH2 and hMSH6 in a series of colorectal carcinomas (CRCs) and correlate this to their clinical and pathological features. Forty-three out of 298 cases of CRCs (14.4%) showed abnormal staining pattern for mismatch repair proteins with a majority (65.1%) showing single hMLH1 loss. Tumours with mismatch repair defect (MMR-d) were frequently found at the right side of colon (p<0.001), poorly differentiated carcinomas (p<0.001), produced more mucin (p=0.007), exophytic growth (p=0.007) and were bigger (p=0.002) than tumours with no mismatch repair defect. Immunohistochemical stains for mismatch repair proteins could be done in local laboratories on these selected cases before referring for the expensive molecular test.

  14. A pilot study on the effects of individually tailored education for MMR vaccine-hesitant parents on MMR vaccination intention.

    PubMed

    Gowda, Charitha; Schaffer, Sarah E; Kopec, Kristin; Markel, Arielle; Dempsey, Amanda F

    2013-02-01

    Healthcare providers need strategies to better address the concerns of vaccine-hesitant parents. We studied whether individually tailored education was more effective than untailored education at improving vaccination intention among MMR vaccine-hesitant parents. In an intervention pilot study of parents (n = 77) of children < 6 y who screened as hesitant to vaccinate against MMR (first or second dose), parents were randomly assigned to receive either (1) educational web pages that were individually tailored to address their specific vaccine concerns; or (2) web pages similar in appearance to the intervention but containing untailored information. The main outcome, change in vaccination intention before and after the intervention, was assessed using an 11-pt scale (higher values indicated greater intent). We found that a greater proportion of parents in the tailored than untailored arm had positive vaccination intentions after viewing educational information (58% vs. 46%). Furthermore, parents in the tailored group had a greater magnitude of change in vaccination intention (1.08 vs. 0.49 points) than participants in the untailored group. However, neither of these results was statistically significant. From this pilot study we conclude message tailoring may be an effective way to improve vaccine compliance among vaccine hesitant parents. However, larger studies are warranted to further investigate the efficacy of providing tailored education for increasing vaccine acceptance among parents with diverse beliefs.

  15. Media Reports of Links between MMR and Autism: A Discourse Analysis

    ERIC Educational Resources Information Center

    O'Dell, Lindsay; Brownlow, Charlotte

    2005-01-01

    This paper details an analysis of BBC reporting of the proposed links between MMR and autism. The study aimed to identify main issues arising from the media reports into the link between MMR and the development of autism, and how these contribute to common understandings about people with autism. The study employed a form of discourse analysis to…

  16. No Effect of MMR Withdrawal on the Incidence of Autism: A Total Population Study

    ERIC Educational Resources Information Center

    Honda, Hideo; Shimizu, Yasuo; Rutter, Michael

    2005-01-01

    Background: A causal relationship between the measles, mumps, and rubella (MMR) vaccine and occurrence of autism spectrum disorders (ASD) has been claimed, based on an increase in ASD in the USA and the UK after introduction of the MMR vaccine. However, the possibility that this increase is coincidental has not been eliminated. The unique…

  17. Low vaccine efficacy of mumps component among MMR vaccine recipients in Chennai, India.

    PubMed

    Malaiyan, Jeevan; Menon, Thangam

    2014-05-01

    Introduction of MMR vaccine was believed to have resulted in a decline in the incidence of measles, mumps and rubella infections. However, recent reports suggest the re-emergence of mumps infection worldwide in the vaccinated populations. It was proposed that the reason for this re-emergence was poor efficacy of MMR vaccine. The present study was aimed to investigate mumps infection in MMR vaccinated and non-vaccinated populations in Chennai, India. Blood samples were collected from acute mumps cases (n=74, 42<12 yr age, 54% males) and investigated for IgM antibody against mumps, IgG antibody against measles, mumps and rubella viruses by ELISA. Sixty seven (91%) patients had received MMR vaccine. All the 67 vaccinated cases were positive for parotitis, and mumps IgM. However, only 10 (15%) were positive for IgG. All samples (100%) were positive for rubella and measles IgG. These findings showed the occurrence of mumps infection among MMR vaccinated individuals in Chennai, India. The MMR vaccine failed to generate anti-mumps IgG. The reason may be low vaccine efficacy of the mumps component of the MMR vaccine used.

  18. Protective potential of MMR vaccine against complete Freund's adjuvant-induced inflammation in rats.

    PubMed

    Abd El-Rahman, Rehab S; Suddek, Ghada M; Gameil, Nariman M; El-Kashef, Hassan A

    2011-12-01

    The aim of the present study was to investigate the effect of MMR vaccine on inflammation which was induced by complete Freund's adjuvant (CFA) in male Sprague-Dawley rats. Rats were randomly divided into the control, CFA, MMR and CFA + MMR groups. Inflammatory symptoms such as paw oedema was measured in CFA-injected rats' paw. Body weight changes and alterations in some haematological parameters and oxidative stress markers following CFA injection were checked. In CFA-inflammed rats, there was a significant increase in rat paw thickness and decrease in body weight increment. MMR exhibited a significant anti-inflammatory effect as manifested by reduction in paw thickness and normal gain in body weight when administered 1 week prior to induction of inflammation. The altered haematological parameters (TLC) and oxidative stress markers (MDA, GSH, SOD) in the inflammed rats were significantly brought back to near normal by MMR treatment. In conclusion, MMR vaccine showed a reduction in rat paw thickness and it could significantly normalize the haematological and biochemical abnormalities in CFA-induced inflammatory pain model in rats. Our data suggested that MMR could be a potential protective agent against certain types of inflammatory pain. Further histopathological and radiological studies are required to confirm the possibility of developing novel therapeutic vaccines against some forms of arthritis.

  19. Glioblastoma multiforme in the Muir–Torre syndrome☆

    PubMed Central

    Binder, Zev A.; Johnson, Michael W.; Joshi, Avadhut; Hann, Christine L; Griffin, Constance A.; Olivi, Alessandro; Riggins, Gregory J.; Gallia, Gary L.

    2015-01-01

    Muir–Torre syndrome (MTS) is an autosomal dominant subtype of nonpolyposis colorectal carcinoma (HNPCC) characterized by the development of sebaceous gland tumors and visceral malignancies. The most common subtype of MTS is characterized by germline mutations in mismatch repair (MMR) genes leading to microsatellite instability (MSI). Central nervous system tumors have only rarely been associated with MTS. In this report, we describe the development of a glioblastoma multiforme (GBM) in a patient with MTS. Immunohistochemical analysis of the patient's colon carcinoma and his GBM both revealed loss of the mismatch repair proteins mutS homolog 2 (MSH2) and mutS homolog 6 (MSH6). PMID:21288634

  20. BOREAS RSS-3 Reflectance Measured from a Helicopter-Mounted Barnes MMR

    NASA Technical Reports Server (NTRS)

    Hall, Forrest G. (Editor); Nickeson, Jaime (Editor); Walthall, Charles L.; Loechel, Sara; deColstoun, Eric Brown

    2000-01-01

    The BOREAS RSS-3 team acquired helicopter-based radiometric measurements of forested sites with a Barnes MMR. The data were collected in 1994 during the three BOREAS IFCs at numerous tower and auxiliary sites in both the NSA and SSA. The 15-degree FOV of the MMR yielded approximately 79-m ground resolution from an altitude of 300 m. The MMR has seven spectral bands that are similar to the Landsat TM bands, ranging from the blue region to the thermal. The data are stored in tabular ASCII files. The data are stored in tabular ASCII files.

  1. Paediatric immunisation: special emphasis on measles and MMR vaccinations.

    PubMed

    Das, M K; Bhattacharyya, N

    2002-05-01

    The dictum, 'prevention is better than cure', is applicable to all ailments but it can be most easily followed for infectious diseases, increasing numbers of which are being contained by specific vaccinations since the first discovery of smallpox vaccine by Edward Jenner in 1796. Advances in immunology and laboratory techniques including cell culture, genetic engineering and animal experiments have contributed significantly to the production of more and more vaccines, used successfully in preventive programmes. Infectious diseases are widely prevalent in the developing countries. The child population is specially vulnerable to many of them. These infections contribute to high morbidity and mortality and immunisation programmes have been undertaken as preventive measures against them at the national level. Paediatricians and experts are actively engaged in formulating and improving these programmes as problems are faced in their implementation. Much new information is continuously being available in the literature, mostly in specialised journals. The general practitioners, particularly those serving in the remote and vast rural areas, are not likely to have access to these recent developments which they need for self-motivation in initiating the parents with confident advice to have their children properly immunised and also for tackling effectively any problem arising out of immunisation. This paper attempts to discuss the subject of paediatric immunisation with special emphasis being laid on measles and MMR vaccinations. PMID:12418635

  2. MMR (Measles, Mumps and Rubella) Vaccine: What You Need to Know

    MedlinePlus

    VACCINE INFORMATION STATEMENT MMR Vaccine (Measles, Mumps and Rubella) What You Need to Know Many Vaccine Information ... vis 1 Why get vaccinated? Measles, mumps, and rubella are serious diseases. Before vaccines they were very ...

  3. [The relationship between MMR vaccination level and the number of new cases of autism in children].

    PubMed

    Mrozek-Budzyn, Dorota; Kiełtyka, Agnieszka

    2008-01-01

    The MMR vaccination coverage in Malopolskie voivodeship improved rapidly and finally reached a high level during last years. The number of new cases of autism spectrum disorders in children during that time revealed a slightly rising but not significant trend, while the number of childhood autism were stable. Ecological study showed no correlation between MMR vaccination and an increased risk of childhood autism and autism spectrum disorders in children.

  4. Mismatch-mediated error prone repair at the immunoglobulin genes.

    PubMed

    Chahwan, Richard; Edelmann, Winfried; Scharff, Matthew D; Roa, Sergio

    2011-12-01

    The generation of effective antibodies depends upon somatic hypermutation (SHM) and class-switch recombination (CSR) of antibody genes by activation induced cytidine deaminase (AID) and the subsequent recruitment of error prone base excision and mismatch repair. While AID initiates and is required for SHM, more than half of the base changes that accumulate in V regions are not due to the direct deamination of dC to dU by AID, but rather arise through the recruitment of the mismatch repair complex (MMR) to the U:G mismatch created by AID and the subsequent perversion of mismatch repair from a high fidelity process to one that is very error prone. In addition, the generation of double-strand breaks (DSBs) is essential during CSR, and the resolution of AID-generated mismatches by MMR to promote such DSBs is critical for the efficiency of the process. While a great deal has been learned about how AID and MMR cause hypermutations and DSBs, it is still unclear how the error prone aspect of these processes is largely restricted to antibody genes. The use of knockout models and mice expressing mismatch repair proteins with separation-of-function point mutations have been decisive in gaining a better understanding of the roles of each of the major MMR proteins and providing further insight into how mutation and repair are coordinated. Here, we review the cascade of MMR factors and repair signals that are diverted from their canonical error free role and hijacked by B cells to promote genetic diversification of the Ig locus. This error prone process involves AID as the inducer of enzymatically-mediated DNA mismatches, and a plethora of downstream MMR factors acting as sensors, adaptors and effectors of a complex and tightly regulated process from much of which is not yet well understood.

  5. Opportunistic MMR vaccination for unimmunized children at the time of routine teenage booster vaccination in secondary schools: implications for policy.

    PubMed

    Paranthaman, K; Bunce, A

    2012-09-01

    With the aim of minimizing adverse health outcomes and reducing the risk of outbreaks, we offered one dose of MMR vaccine to children known to be incompletely immunized at the time of teenage booster vaccination in secondary schools in Swindon in 2011. The Child Health Department database was queried to identify Year 10 children who had had zero or one dose of MMR vaccine previously. Of the 316 children offered vaccination, 60 received a first dose and 87 received a second dose of MMR vaccine. Fourteen children had two documented doses in the past and two had contraindications to the vaccine. Overall uptake of two doses of MMR vaccine increased from 86·3% to 90·6%. The valuable uptake achieved demonstrates that an opportunistic offer of MMR vaccine for unimmunized children at schools is feasible and beneficial. MMR vaccine should be offered routinely to unimmunized children at the time of school vaccination programmes, especially in areas with sub-optimal coverage.

  6. Safety and Immunogenicity of Human Serum Albumin-Free MMR Vaccine in US Children Aged 12–15 Months

    PubMed Central

    Mufson, Maurice A.; Diaz, Clemente; Leonardi, Michael; Harrison, Christopher J.; Grogg, Stanley; Carbayo, Antonio; Carlo-Torres, Simon; JeanFreau, Robert; Quintero-Del-Rio, Ana; Bautista, Gisele; Povey, Michael; Da Costa, Christopher; Nicholson, Ouzama; Innis, Bruce L.

    2015-01-01

    Background M-M-RTMII (MMRII; Merck & Co) is currently the only measles-mumps-rubella (MMR) vaccine licensed in the United States. Another licensed vaccine would reinforce MMR supply. This study assessed the immunogenicity of a candidate vaccine (PriorixTM, GlaxoSmithKline Vaccines [MMR-RIT]) when used as a first dose among eligible children in the United States. Methods In this exploratory Phase-2, multicenter, observer-blind study, 1220 healthy subjects aged 12–15 months were randomized (3:3:3:3) and received 1 dose of 1 of 3 MMR-RIT lots with differing mumps virus titers (MMR-RIT-1 [4.8 log10]; MMR-RIT-2 [4.1 log10]; MMR-RIT-3 [3.7 log10] CCID50) or MMRII co-administered with hepatitis A vaccine (HAV), varicella vaccine (VAR) and 7-valent pneumococcal conjugate vaccine (PCV7). Immune response to measles, mumps, and rubella viruses was evaluated at Day 42 post-vaccination. Incidence of solicited injection site, general, and serious adverse events was assessed. Results Seroresponse rates for MMR vaccine viral components in MMR-RIT lots were 98.3–99.2% (measles), 89.7–90.7% (mumps), and 97.5–98.8% (rubella), and for MMRII were 99.6%, 91.1%, and 100%, respectively. Immune responses to HAV, VAR, and PCV7 were similar when co-administered with any of the 3 MMR-RIT lots or MMRII. There were no apparent differences in solicited or serious adverse events among the 4 groups. Conclusions Immune responses were above threshold levels for projected protection against the 3 viruses from MMR-RIT lots with differing mumps virus titers. MMR-RIT had an acceptable safety profile when co-administered with HAV, VAR, and PCV7. Clinical Trials Registration NCT00861744; etrack; 111870 PMID:26582873

  7. Common variants associated with general and MMR vaccine-related febrile seizures.

    PubMed

    Feenstra, Bjarke; Pasternak, Björn; Geller, Frank; Carstensen, Lisbeth; Wang, Tongfei; Huang, Fen; Eitson, Jennifer L; Hollegaard, Mads V; Svanström, Henrik; Vestergaard, Mogens; Hougaard, David M; Schoggins, John W; Jan, Lily Yeh; Melbye, Mads; Hviid, Anders

    2014-12-01

    Febrile seizures represent a serious adverse event following measles, mumps and rubella (MMR) vaccination. We conducted a series of genome-wide association scans comparing children with MMR-related febrile seizures, children with febrile seizures unrelated to vaccination and controls with no history of febrile seizures. Two loci were distinctly associated with MMR-related febrile seizures, harboring the interferon-stimulated gene IFI44L (rs273259: P = 5.9 × 10(-12) versus controls, P = 1.2 × 10(-9) versus MMR-unrelated febrile seizures) and the measles virus receptor CD46 (rs1318653: P = 9.6 × 10(-11) versus controls, P = 1.6 × 10(-9) versus MMR-unrelated febrile seizures). Furthermore, four loci were associated with febrile seizures in general, implicating the sodium channel genes SCN1A (rs6432860: P = 2.2 × 10(-16)) and SCN2A (rs3769955: P = 3.1 × 10(-10)), a TMEM16 family gene (ANO3; rs114444506: P = 3.7 × 10(-20)) and a region associated with magnesium levels (12q21.33; rs11105468: P = 3.4 × 10(-11)). Finally, we show the functional relevance of ANO3 (TMEM16C) with electrophysiological experiments in wild-type and knockout rats.

  8. Measles, mumps, rubella vaccine (Priorix; GSK-MMR): a review of its use in the prevention of measles, mumps and rubella.

    PubMed

    Wellington, Keri; Goa, Karen L

    2003-01-01

    GSK-MMR (Priorix) is a trivalent live attenuated measles, mumps and rubella (MMR) vaccine which contains the Schwarz measles, the RIT 4385 mumps (derived from the Jeryl Lynn mumps strain) and the Wistar RA 27/3 rubella strains. GSK-MMR as a primary vaccination demonstrated high immunogenicity in clinical trials in >7500 infants aged 9-27 months, and was as immunogenic as Merck-MMR (MMR II). However, antimumps seroconversion rates and geometric mean titres (GMTs) were significantly higher in infants receiving GSK-MMR compared with Berna-MMR (Triviraten trade mark ) recipients. Coadministration of GSK-MMR with a varicella vaccine (Varilrix; GSK-MMR/V) did not significantly affect the immunogenicity of GSK-MMR. A persistent immune response to GSK-MMR has been demonstrated in follow-up data from several randomised trials. GMTs for measles, mumps and rubella antibodies remained high in GSK-MMR recipients 1-2 years post-vaccination and were similar to those in Merck-MMR recipients. The immunogenicity of GSK-MMR was high, and similar to that of Merck-MMR, when used as a second dose in children aged 4-6 or 11-12 years who had received a primary vaccination with Merck-MMR in their second year of life. Although there are no protective efficacy data concerning the GSK-MMR vaccine to date, the rubella Wistar RA 27/3 rubella and Schwarz measles strains have well established protective efficacy; the new RIT 4385 mumps strain is expected to afford similar protection from mumps to that achieved with mumps vaccines that contain the Jeryl Lynn mumps strain (e.g. Merck-MMR). GSK-MMR was well tolerated as a primary or secondary vaccination, and in most clinical studies comparing GSK-MMR with Merck-MMR as a primary vaccination in infants, GSK-MMR was associated with significantly fewer local adverse events (e.g. pain, swelling and redness). The incidence of local adverse events with GSK-MMR, GSK-MMR/V or Berna-MMR was similar. GSK-MMR and Merck-MMR were associated with similar rates of

  9. Long-term persistence of antibodies after one or two doses of MMR-vaccine.

    PubMed

    Vandermeulen, Corinne; Mathieu, Roelants; Geert, Leroux-Roels; Pierre, Van Damme; Karel, Hoppenbrouwers

    2007-09-17

    Outbreaks of measles, mumps and rubella have occurred recently despite long-standing mass immunization with MMR. Antibody titres for measles, mumps and rubella of 160 students (17-23 years) with proof of at least one MMR-vaccine were studied according to the number of MMR-vaccines received. The proportion of subjects with positive antibody titres was significantly higher in those who received two vaccines against measles (77.1% versus 58.7%, p=0.05), mumps (67.5% versus 55.6%, p=0.009) and rubella (99.2% versus 71.4%, p=0.008). Comparable significant trends were seen for GMTs for measles and mumps. A similar non-significant trend was noted for rubella.

  10. Seroprevalence of antibodies to measles, mumps, and rubella among Thai population: evaluation of measles/MMR immunization programme.

    PubMed

    Tharmaphornpilas, Piyanit; Yoocharean, Pornsak; Rasdjarmrearnsook, Aim-Orn; Theamboonlers, Apiradee; Poovorawan, Yong

    2009-02-01

    Stored serum specimens, from four regions of Thailand, of healthy children attending well baby clinics and of healthy people with acute illnesses visiting outpatient clinics were randomly sampled and tested for IgG antibody to measles, mumps, and rubella (MMR). The immunity patterns of rubella and mumps fitted well with the history of rubella and MMR vaccination, seroprotective rates being over 85% among those aged over seven years. A high proportion of younger children acquired the infection before the age of vaccination. MMR vaccination should preferably be given to children at an earlier age. For measles, 73% seroprotective rates among children, aged 8-14 years, who should have received two doses of measles/MMR vaccine, were lower than expected. This finding was consistent with the age-group reported in outbreaks of measles in Thailand. The apparent ineffectiveness (in relation to measles) of MMR immunization of 1st grade students warrants further studies.

  11. Seroprevalence of Antibodies to Measles, Mumps, and Rubella among Thai Population: Evaluation of Measles/MMR Immunization Programme

    PubMed Central

    Yoocharean, Pornsak; Rasdjarmrearnsook, Aim-orn; Theamboonlers, Apiradee; Poovorawan, Yong

    2009-01-01

    Stored serum specimens, from four regions of Thailand, of healthy children attending well baby clinics and of healthy people with acute illnesses visiting outpatient clinics were randomly sampled and tested for IgG antibody to measles, mumps, and rubella (MMR). The immunity patterns of rubella and mumps fitted well with the history of rubella and MMR vaccination, seroprotective rates being over 85% among those aged over seven years. A high proportion of younger children acquired the infection before the age of vaccination. MMR vaccination should preferably be given to children at an earlier age. For measles, 73% seroprotective rates among children, aged 8-14 years, who should have received two doses of measles/MMR vaccine, were lower than expected. This finding was consistent with the age-group reported in outbreaks of measles in Thailand. The apparent ineffectiveness (in relation to measles) of MMR immunization of 1st grade students warrants further studies. PMID:19248651

  12. Anatomy of a health scare: education, income and the MMR controversy in the UK.

    PubMed

    Anderberg, Dan; Chevalier, Arnaud; Wadsworth, Jonathan

    2011-05-01

    The measles, mumps and rubella (MMR) controversy provides an interesting case where, for a short period of time, research publicized in the media, suggested a potential risk of serious side-effects associated with the vaccine, where there was also a sharp behavioral response from the public, and where the initial information was subsequently overturned. We consider the controversy from the perspective of health inequalities and the assimilation of information, focusing on whether and how vaccine uptake behavior in the wake of the controversy differed among groups of parents by education and income. Using panel data on the variation in the uptake of the MMR, and other childhood immunizations, across local Health Authority areas we find that the uptake rate of the MMR declined faster in areas where a larger fraction of parents had stayed in education past the age of 18 than in areas with less educated parents. We also find that the same areas reduced their relative uptake of other uncontroversial childhood immunizations, suggesting a "spillover" effect. Using a supplementary data source we find evidence of a corresponding positive income effect, indicating that wealthier parents avoided the MMR dilemma by purchasing single vaccines.

  13. Anatomy of a health scare: education, income and the MMR controversy in the UK.

    PubMed

    Anderberg, Dan; Chevalier, Arnaud; Wadsworth, Jonathan

    2011-05-01

    The measles, mumps and rubella (MMR) controversy provides an interesting case where, for a short period of time, research publicized in the media, suggested a potential risk of serious side-effects associated with the vaccine, where there was also a sharp behavioral response from the public, and where the initial information was subsequently overturned. We consider the controversy from the perspective of health inequalities and the assimilation of information, focusing on whether and how vaccine uptake behavior in the wake of the controversy differed among groups of parents by education and income. Using panel data on the variation in the uptake of the MMR, and other childhood immunizations, across local Health Authority areas we find that the uptake rate of the MMR declined faster in areas where a larger fraction of parents had stayed in education past the age of 18 than in areas with less educated parents. We also find that the same areas reduced their relative uptake of other uncontroversial childhood immunizations, suggesting a "spillover" effect. Using a supplementary data source we find evidence of a corresponding positive income effect, indicating that wealthier parents avoided the MMR dilemma by purchasing single vaccines. PMID:21439663

  14. Similar immunogenicity of measles-mumps-rubella (MMR) vaccine administrated at 8 months versus 12 months age in children.

    PubMed

    He, Hanqing; Chen, Enfu; Chen, Haiping; Wang, Zhifang; Li, Qian; Yan, Rui; Guo, Jing; Zhou, Yang; Pan, Jinren; Xie, Shuyun

    2014-06-30

    Two doses of measles-mumps-rubella (MMR) strategy has been recommended by World Health Organization and is also widely adopted in many countries. In order to provide the evidence for perfecting the immunization strategy of MMR, this study evaluated the safety and immunogenicity of MMR with different two-dose schedule in infants. 280 participants were enrolled and randomly allocated to Group 1 (first dose at 8 months) or Group 2 (first dose at 12 months), and both groups administered the second dose at 10 months later. Solicited local and general symptoms after each vaccination with MMR were mild and infrequent in all participants of two groups. After administration of the first dose of MMR, seropositive rates were 100% in both groups for measles, 89.3% in Group 1 and 87.1% in Group 2 for mumps (P=0.578), 92.0% in Group 1 and 92.9% in Group 2 (P=0.393). The seropositive rates of mumps decreased significantly (from >86% to <65%) both in two groups (P<0.001) 10 months after the first dose of MMR, but no significant change was found in measles and rubella. All children get the positive titer for three vaccines in two groups after given the second dose MMR, higher seroconversion rate was found for mumps both in two groups (71.7% vs 77.2%, P=0.370). In conclusion, this study indicated that the MMR was well tolerated and immunogenic against measles, mumps and rubella with schedule of first dose both at 8 months and 12 months age. Our findings strongly supported that two doses of MMR can be introduced by replacing the first dose of MR in current EPI with MMR at 8 months age and the second dose at 18 months in China.

  15. Delayed adaptive immunity is related to higher MMR vaccine-induced antibody titers in children.

    PubMed

    Strömbeck, Anna; Lundell, Anna-Carin; Nordström, Inger; Andersson, Kerstin; Adlerberth, Ingegerd; Wold, Agnes E; Rudin, Anna

    2016-04-01

    There are notable inter-individual variations in vaccine-specific antibody responses in vaccinated children. The aim of our study was to investigate whether early-life environmental factors and adaptive immune maturation prior and close to measles-mumps-rubella (MMR) immunization relate to magnitudes of vaccine-specific antibody titers. In the FARMFLORA birth cohort, including both farming and non-farming families, children were immunized with the MMR vaccine at 18 months of age. MMR vaccine-induced antibody titers were measured in plasma samples obtained at 36 months of age. Infants' blood samples obtained at birth, 3-5 days and at 4 and 18 months of age were analyzed for T- and B-cell numbers, proportions of naive and memory T and B cells, and fractions of putative regulatory T cells. Multivariate factor analyses show that higher anti-MMR antibody titers were associated with a lower degree of adaptive immune maturation, that is, lower proportions of memory T cells and a lower capacity of mononuclear cells to produce cytokines, but with higher proportions of putative regulatory T cells. Further, children born by cesarean section (CS) had significantly higher anti-measles titers than vaginally-born children; and CS was found to be associated with delayed adaptive immunity. Also, girls presented with significantly higher anti-mumps and anti-rubella antibody levels than boys at 36 months of age. These results indicate that delayed adaptive immune maturation before and in close proximity to immunization seems to be advantageous for the ability of children to respond with higher anti-MMR antibody levels after vaccination.

  16. [Varicella vaccination in Germany. A provisional appraisal in the context of MMR vaccination].

    PubMed

    Siedler, A; Hecht, J; Rieck, T; Tolksdorf, K; Hengel, H

    2013-09-01

    In 2004, a general varicella immunization was introduced in Germany for infants from the age of 11 months, followed by the subsequent recommendation in 2009 of a second vaccine dose. The vaccination is carried out at the same time as the immunization against measles, mumps, and rubella (MMR). Results of the nationwide sentinel surveillance of varicella and herpes zoster implemented by the Varicella Working Group (Arbeitsgemeinschaft Varizellen, AGV) show that the defined goals for varicella immunization (reduction of varicella-related morbidity, complications and hospitalizations) have been reached within a few years owing to the advances in vaccine coverage. Although coverage rates for varicella have not yet reached the same levels as for MMR, varicella immunization seems to have benefited from the established MMR immunization schedule. Moreover, there is no evidence for an adverse effect on the use and acceptance of the MMR vaccine. Lessons learnt in measles epidemiology (such as trends in the incidence of the disease in adolescents and infants), as well as in the history of MMR recommendations, may be useful for the evaluation of future epidemiological changes with respect to varicella and herpes zoster. In view of a rapidly waning immunity against the varicella zoster virus after vaccination with one dose and the lifelong persistence of the virus, achieving a robust and sustainable immunity in the general population seems to be an ambitious goal. However, this accomplishment will be indispensable in preventing breakthrough infections and a shift of varicella to older ages and in avoiding an increase in herpes zoster incidence.

  17. Delayed adaptive immunity is related to higher MMR vaccine-induced antibody titers in children.

    PubMed

    Strömbeck, Anna; Lundell, Anna-Carin; Nordström, Inger; Andersson, Kerstin; Adlerberth, Ingegerd; Wold, Agnes E; Rudin, Anna

    2016-04-01

    There are notable inter-individual variations in vaccine-specific antibody responses in vaccinated children. The aim of our study was to investigate whether early-life environmental factors and adaptive immune maturation prior and close to measles-mumps-rubella (MMR) immunization relate to magnitudes of vaccine-specific antibody titers. In the FARMFLORA birth cohort, including both farming and non-farming families, children were immunized with the MMR vaccine at 18 months of age. MMR vaccine-induced antibody titers were measured in plasma samples obtained at 36 months of age. Infants' blood samples obtained at birth, 3-5 days and at 4 and 18 months of age were analyzed for T- and B-cell numbers, proportions of naive and memory T and B cells, and fractions of putative regulatory T cells. Multivariate factor analyses show that higher anti-MMR antibody titers were associated with a lower degree of adaptive immune maturation, that is, lower proportions of memory T cells and a lower capacity of mononuclear cells to produce cytokines, but with higher proportions of putative regulatory T cells. Further, children born by cesarean section (CS) had significantly higher anti-measles titers than vaginally-born children; and CS was found to be associated with delayed adaptive immunity. Also, girls presented with significantly higher anti-mumps and anti-rubella antibody levels than boys at 36 months of age. These results indicate that delayed adaptive immune maturation before and in close proximity to immunization seems to be advantageous for the ability of children to respond with higher anti-MMR antibody levels after vaccination. PMID:27195118

  18. Evaluating a Web-Based MMR Decision Aid to Support Informed Decision-Making by UK Parents: A Before-and-After Feasibility Study

    ERIC Educational Resources Information Center

    Jackson, Cath; Cheater, Francine M.; Peacock, Rose; Leask, Julie; Trevena, Lyndal

    2010-01-01

    Objective: The objective of this feasibility study was to evaluate the acceptability and potential effectiveness of a web-based MMR decision aid in supporting informed decision-making for the MMR vaccine. Design: This was a prospective before-and-after evaluation. Setting: Thirty parents of children eligible for MMR vaccination were recruited from…

  19. Knowledge, attitudes, beliefs and practices of general practitioners towards measles and MMR vaccination in southeastern France in 2012.

    PubMed

    Pulcini, C; Massin, S; Launay, O; Verger, P

    2014-01-01

    As a result of sub-optimal immunization levels, measles has re-emerged in the EU since 2008 (30 ,567 cases in 2011), and nearly half of the cases reported are in France. Our objectives were to assess knowledge, attitudes, beliefs and practices of French general practitioners (GPs) towards measles and measles-mumps-rubella (MMR) vaccination. In 2012, we surveyed 329 GPs in southeastern France. Forty-five percent reported that they saw patients with measles in 2011. They considered the risk of complications low among 2-5-year-old children and young adults without co-morbidity. Twenty percent knew that two MMR doses are 99% effective in preventing measles. Nearly all (95%) GPs stated that they verified the MMR status for patients <30 years old in 2011 (42% systematically, 37% often, 15% sometimes). Seventy-nine percent reported proposing MMR vaccination to non-immune relatives in contact with a patient with measles. Participation in continuing medical education courses and considering measles to be a serious disease were independently associated with such post-exposure vaccination. GPs considered the following were potential barriers to the second dose of MMR (MMR2): parents/patients' belief that measles is harmless (80%), parents/patients' fear of the vaccine's side effects (50%), difficulty in documenting vaccination (48%) and lack of reminders for MMR2 (16%). Finally, some GPs also had misconceptions about the severity of measles (13%) and the usefulness of MMR2 (12%), which also served as barriers. In conclusion, it is essential to raise GPs' awareness of this disease and fill any gaps in their knowledge, by providing them with evidence-based information on measles and MMR vaccination.

  20. Aerosolized MMR vaccine: evaluating potential transmission of components to vaccine administrators and contacts of vaccinees.

    PubMed

    Diaz-Ortega, Jose-Luis; Bennett, John V; Castaneda, Deyanira; Martinez, David; Fernandez de Castro, Jorge

    2012-07-01

    Although numerous operative and immunological advantages accompany aerosol immunization, potential vaccine virus transmission from the aerosol device to vaccine administrators or from aerosol vaccinees to their contacts requires further study. We conducted a clinical and serological follow-up study of vaccine administrators and matched classroom or household contacts of young adults who received the MMR vaccines by aerosol or injection. Differences in incidence of clinical adverse events between vaccinees and contacts were not statistically significant. No seroresponses to any components of MMR vaccine were noted among 25 matched contacts of persons receiving injected vaccines, and only one equivocal seroresponse was noted among 25 matched contacts of aerosol recipients. No seroresponses were observed in 3 persons who administered aerosol vaccine. The composite findings of this study provide additional evidence of the safety of this approach.

  1. The blame frame: media attribution of culpability about the MMR-autism vaccination scare.

    PubMed

    Holton, Avery; Weberling, Brooke; Clarke, Christopher E; Smith, Michael J

    2012-01-01

    Scholars have examined how news media frame events, including responsibility for causing and fixing problems, and how these frames inform public judgment. This study analyzed 281 newspaper articles about a controversial medical study linking the measles, mumps, and rubella (MMR) vaccination with autism. Given criticism of the study and its potential negative impact on vaccination rates across multiple countries, the current study examined actors to whom news media attributed blame for the MMR-vaccine association, sources used to support those attributions, and what solutions (e.g., mobilizing information), if any, were offered. This study provides unique insight by examining the evolution of these attributions over the lifetime of the controversy. Findings emphasize how news media may attribute blame in health risk communication and how that ascription plays a potentially vital role in shaping public behavior. Theoretical and practical implications are discussed.

  2. The blame frame: media attribution of culpability about the MMR-autism vaccination scare.

    PubMed

    Holton, Avery; Weberling, Brooke; Clarke, Christopher E; Smith, Michael J

    2012-01-01

    Scholars have examined how news media frame events, including responsibility for causing and fixing problems, and how these frames inform public judgment. This study analyzed 281 newspaper articles about a controversial medical study linking the measles, mumps, and rubella (MMR) vaccination with autism. Given criticism of the study and its potential negative impact on vaccination rates across multiple countries, the current study examined actors to whom news media attributed blame for the MMR-vaccine association, sources used to support those attributions, and what solutions (e.g., mobilizing information), if any, were offered. This study provides unique insight by examining the evolution of these attributions over the lifetime of the controversy. Findings emphasize how news media may attribute blame in health risk communication and how that ascription plays a potentially vital role in shaping public behavior. Theoretical and practical implications are discussed. PMID:22236220

  3. Evidence and policymaking: The introduction of MMR vaccine in the Netherlands

    PubMed Central

    Blume, Stuart; Tump, Janneke

    2010-01-01

    Based on a case-study of the introduction of measles-mumps-rubella (MMR) vaccine in the Netherlands two decades ago, using documentary and archival sources, this paper examines the way evidence is used in policymaking. Starting from the question of ‘what counts as evidence’, two central claims are developed. First, the decision to introduce MMR was not one but a series of decisions going back at least seven years, over the course of which the significance attached to various forms of evidence changed. Second, results of international studies were coming gradually to be of greater significance than evidence gathered from within the Netherlands itself. These developments had, and continue to have, major consequences for national scientific competences. PMID:20667640

  4. Factors associated with poor adherence to MMR vaccination in parents who follow vaccination schedule.

    PubMed

    Restivo, Vincenzo; Napoli, Giuseppe; Marsala, Maria Grazia Laura; Bonanno, Valentina; Sciuto, Valentina; Amodio, Emanuele; Calamusa, Giuseppe; Vitale, Francesco; Firenze, Alberto

    2015-01-01

    Due to median vaccination coverage far from elimination level, Italy is still an European country with high number of measles cases per million of people. In this study we explored potential socioeconomic, medical and demographic factors which could influence the propensity of family members for measles vaccination schedule. A cross-sectional study was performed through a questionnaire administered to the parents of children who received the first dose of MMR vaccine in two different vaccination centers in the Palermo area from November 2012 to May 2013. Overall, the role played by internet (OR 19.8 P = 0.001) and the large number of children in a family (OR 7.3 P ≤ 0.001) were the factors more associated to be unvaccinated, whereas the birth order of the child (OR 0.3 P = < 0.05 for the oldest children vs. the closer young one) and reporting a lack of MMR vaccination as a "personal decision" (OR 0.19 P ≤ 0.01) inversely correlated with the risk of quitting vaccination. These findings can be useful for a better knowledge of disaffection to vaccination practice in local settings and could contribute to improve and maintain timely uptake, suggesting approaches to optimize the uptake of MMR tailored to the needs of local populations.

  5. Tides alone cannot explain Kepler planets close to 2:1 MMR

    NASA Astrophysics Data System (ADS)

    Silburt, Ari; Rein, Hanno

    2015-11-01

    A number of Kepler planet pairs lie just wide of first-order mean motion resonances (MMRs). Tides have been frequently proposed to explain these pileups, but it is still an ongoing discussion. We contribute to this discussion by calculating an optimistic theoretical estimate on the minimum initial eccentricity required by Kepler planets to explain the current observed spacing, and complement these calculations with N-body simulations. In particular, we investigate 27 Kepler systems having planets within 6 per cent of the 2:1 MMR, and find that the initial eccentricities required to explain the observed spacings are unreasonable from simple dynamical arguments. Furthermore, our numerical simulations reveal resonant tugging, an effect which conspires against the migration of resonant planets away from the 2:1 MMR, requiring even higher initial eccentricities in order to explain the current Kepler distribution. Overall, we find that tides alone cannot explain planets close to 2:1 MMR, and additional mechanisms are required to explain these systems.

  6. Kinetics of antibody and memory B cell responses after MMR immunization in children and young adults.

    PubMed

    Kakoulidou, Maria; Ingelman-Sundberg, Hanna; Johansson, Elin; Cagigi, Alberto; Farouk, Salah Eldin; Nilsson, Anna; Johansen, Kari

    2013-01-11

    The persistence of antigen-specific memory B-cells (MBCs) in children and young adults long time after vaccination against measles, mumps and rubella (MMR) is not known. Here we have looked at the Swedish immunization program and examined children 1-10 years after the first MMR dose in early childhood, as well as young adults 7-18 years after the second dose of MMR. We show that Ab titers and MBCs against measles and rubella have different kinetics, indicating that the MBC pool and the corresponding Ab titers are regulated independently. These data fit well with other findings that continuous IgG secretion comes from long-lived plasma cells and not MBCs. We also demonstrate that individuals with low post-vaccination Ab titers might have an adequate MBC response. It remains to be shown if memory B-cells provide the same protection as specific antibodies, but our data is a valuable complement to the incomplete knowledge about correlates of protection after vaccination. PMID:23174196

  7. Healthcare workers and measles-mumps-rubella (MMR) status: how worried should we be about further outbreaks?

    PubMed

    Basu, S; Giri, P; Adisesh, A; McNAUGHT, R

    2014-08-01

    Recently, a number of outbreaks of measles and mumps have occurred within the UK and Europe. Healthcare workers (HCWs) are at risk of contracting and transmitting disease to patients and staff. To examine this risk at the point of entry to healthcare, we assessed the serological results of new HCWs presenting for pre-placement clearance without evidence of measles-mumps-rubella (MMR) immunity between 1 April 2010 and 31 March 2012. Overall rates of serological positivity to MMR across all age groups were 88·2%, 68·8% and 93·9%, respectively. With regard to measles and mumps, there were statistically significant decreases in the percentage of HCWs born after 1980 that had positive serology (P < 0·05). No such differences were seen between healthcare groups. Most seronegative HCWs accepted MMR vaccination. Despite our entry-level findings, the ongoing risk of a MMR outbreak within this cohort of HCWs appears low.

  8. [Lack of association between MMR vaccination and the incidence of autism in children: a case-control study].

    PubMed

    Mrozek-Budzyn, Dorota; Kiełtyka, Agnieszka; Majewska, Renata

    2009-01-01

    The matched case-control study has been undertook to investigate whether measles, mumps, and rubella (MMR) vaccine may be casually associated with autism in children. Cases were children to 14-year old with diagnosis of core autism or atypical autism. Controls were matched on age, sex and general practice. The 96 cases and 192 controls were included. The study provides strong evidence against association of autism with both MMR and a single measles individual vaccine. Additionally children vaccinated with MMR, regardless of age of vaccination (to 18th, 24th and 36th month of life), had risk equal half of that of single measles vaccinated (for vaccinated to 18th month OR=0.41 95%PU: 0.20-0.85). Our findings confirm that MMR vaccination is not associated with an increased risk of autism in children. PMID:19522237

  9. [Lack of association between MMR vaccination and the incidence of autism in children: a case-control study].

    PubMed

    Mrozek-Budzyn, Dorota; Kiełtyka, Agnieszka; Majewska, Renata

    2009-01-01

    The matched case-control study has been undertook to investigate whether measles, mumps, and rubella (MMR) vaccine may be casually associated with autism in children. Cases were children to 14-year old with diagnosis of core autism or atypical autism. Controls were matched on age, sex and general practice. The 96 cases and 192 controls were included. The study provides strong evidence against association of autism with both MMR and a single measles individual vaccine. Additionally children vaccinated with MMR, regardless of age of vaccination (to 18th, 24th and 36th month of life), had risk equal half of that of single measles vaccinated (for vaccinated to 18th month OR=0.41 95%PU: 0.20-0.85). Our findings confirm that MMR vaccination is not associated with an increased risk of autism in children.

  10. Second dose of MMR vaccine: health professionals' level of confidence in the vaccine and attitudes towards the second dose.

    PubMed

    Smith, A; McCann, R; McKinlay, I

    2001-12-01

    Public concerns have been raised about the safety of MMR vaccine following the publication of two studies linking the vaccine to inflammatory bowel disease and to a syndrome of Ileal-lymphoid-nodular hyperplasia, non-specific colitis and pervasive developmental disorder. Our study had two aims, to determine whether health professionals' confidence in MMR vaccine was affected and to assess professional knowledge and attitudes towards the second dose of MMR. In July 1998 we undertook a questionnaire survey of general practitioners, practice nurses and health visitors in an inner city area. A significant fall was found in professional confidence following the two publications and the subsequent media coverage (from 59.4% to 40.9%). Forty percent of respondents were unsure about the need for a second dose of MMR vaccine and more than one in ten professionals stated that it was not necessary. It is reasonable to assume that this reduced confidence in the safety of MMR and the professional uncertainty about the second dose have contributed to the observed decline in MMR uptake rates. More professional and public education appears to be needed.

  11. Comparison of immunogenicity of simultaneous and nonsimultaneous vaccination with MMR and JE vaccine among 15-month-old children.

    PubMed

    Tseng, C Y; Hwang, K P; Lin, K H; Chen, H Y; Lu, C C; Chiang, C H

    1999-01-01

    To evaluate the immunogenicity of measles- mumps- rubella (MMR) vaccination with Japanese encephalitis (JE) vaccine nonsimultaneously and simultaneously, 145 babies, aged 15 months were enrolled into two groups. Group A received MMR and JE vaccines nonsimultaneously at an interval of 6 weeks; group B received the vaccinations simultaneously. Antibody titers of MMR and JE were detected before and 8 weeks after vaccination. A total of 118 babies (61 in group A; 57 in group B) completed the study. In group A, mean increments of logarithmic geometric mean titers (GMTs) of MMR and JE were 4.51, 5.93, 4.07 and 1.99; seroresponse rates were 100% (61/61), 77.05% (47/61), 96.72% (59/61) and 59.02% (36/61) respectively. In group B, mean increments of logarithmic GMTs of MMR and JE were 4.35, 5.37, 4.44 and 1.93; seroresponse rates were 98.25% (56/57), 77.19% (44/57), 98.25% (56/57) and 57.89% (33/57) respectively. There were no significant differences between these two groups. These results suggest that simultaneous and nonsimultaneous vaccination with MMR and JE vaccines were similar in immunogenicity.

  12. Genotype Directed Therapy in Murine Mismatch Repair Deficient Tumors

    PubMed Central

    Kucherlapati, Melanie H.; Esfahani, Shadi; Habibollahi, Peiman; Wang, Junning; Still, Eric R.; Bronson, Roderick T.; Mahmood, Umar; Kucherlapati, Raju S.

    2013-01-01

    The PI3K/AKT/mTOR pathway has frequently been found activated in human tumors. We show that in addition to Wnt signaling dysfunction, the PI3K/AKT/mTOR pathway is often upregulated in mouse Msh2−/− initiated intestinal tumors. NVP-BEZ235 is a dual PI3K/mTOR inhibitor toxic to many cancer cell lines and currently involved in clinical trials. We have treated two mouse models involving Msh2 that develop small intestinal and/or colonic tumors with NVP-BEZ235, and a subset of animals with NVP-BEZ235 and MEK inhibitor ADZ4266. The disease phenotype has been followed with pathology, 18F FDG PET imaging, and endoscopy. Intestinal adenocarcinomas are significantly decreased in multiplicity by both drug regimens. The majority of tumors treated with combined therapy regress significantly, while a small number of highly progressed tumors persist. We have examined PTEN, AKT, MEK 1&2, MAPK, S6K, mTOR, PDPK1, and Cyclin D1 and find variable alterations that include downregulation of PTEN, upregulation of AKT and changes in its phosphorylated forms, upregulation of pMEK 1&2, p42p44MAPK, pS6K, and Cyclin D1. Apoptosis has been found intact in some tumors and not in others. Our data indicate that NVP-BEZ235 alone and in combination with ADZ4266 are effective in treating a proportion of colorectal cancers, but that highly progressed resistant tumors grow in the presence of the drugs. Pathways upregulated in some resistant tumors also include PDPK1, suggesting that metabolic inhibitors may also be useful in treating these tumors. PMID:23935891

  13. What are parents' perspectives on psychological empowerment in the MMR vaccination decision? A focus group study

    PubMed Central

    Fadda, Marta; Galimberti, Elisa; Carraro, Valter; Schulz, Peter J

    2016-01-01

    Objectives Most developed countries do not have compulsory immunisation requirements, but instead issue recommendations. Although parents are expected to make an informed, autonomous (ie, empowered) decision regarding their children's vaccinations, there is no evidence about how parents' interpret this demand nor on the latitude of their decision-making. The goal of this study is to gain insights from parents residing in a low measles-mumps-rubella (MMR) uptake area on what constitutes feelings of empowerment in the decision they have to make on their child's MMR vaccination. Design A qualitative study employing focus group interviews. Setting 11 vaccination centres and hospitals in the Province of Trento, Italy. Participants 24 mothers and 4 fathers of children for whom the MMR vaccination decision was still pending participated in 6 focus groups. Results Autonomy and competence were salient themes in relation to empowerment, and were further connected with beliefs regarding legal responsibility and ethics of freedom concerning the decision, parents' relationship with the paediatrician (trust), feelings of relevance of the decision and related stress, and seeking, avoidance, or fear of vaccination-related information. Competence was interpreted as medical knowledge and information-seeking skills, but it was also related to the extent parents perceived the paediatrician to be competent. Conclusions Since parents' interpretation of empowerment goes beyond mere perceptions of being informed and autonomous and differs across individuals, it is important that this construct be correctly interpreted and implemented by best practice, for instance by explicitly adopting a relational conception of autonomy. Knowing whether parents want to make an empowered decision and what their information and autonomy needs are might help health professionals adapt their communication about immunisation, and promote parental perception of making an informed, autonomous decision. PMID

  14. Serologic responses to measles, mumps, and rubella (MMR) vaccine in healthy infants: failure to respond to measles and mumps components may influence decisions on timing of the second dose of MMR.

    PubMed

    Mitchell, L A; Tingle, A J; Décarie, D; Lajeunesse, C

    1998-01-01

    Measles, mumps, and rubella-specific IgG antibodies were evaluated in 134 healthy infants routinely immunized with trivalent live attenuated measles-mumps-rubella (MMR) vaccine at one year of age. Blood samples were collected just before, and at 1, 3, and 12 months after MMR. Specific IgG was measured by commercial enzyme immunoassays. Before vaccination, 98.5%, 99.2%, and 98.5% of the infants tested were seronegative for measles, mumps, and rubella, respectively. One year after MMR, 16.4% and 22.4% of vaccinees lacked demonstrable antibody to measles and mumps while none were found to be seronegative for rubella. Response profile analysis revealed primary failure rates of 12.1% (measles) and 8.6% (mumps) while 4% (measles) and 13.8% (mumps) of the infants responded initially but became seronegative within one year. These observations suggest that earlier administration (at age 18 months) of the second dose of MMR may be more desirable than revaccination at school entry.

  15. [The putative link between the MMR vaccine and autism and refusal to vaccinate].

    PubMed

    Segura Benedicto, Andreu

    2012-01-01

    The paper of Wakefield et al. in The Lancet, triggered a negative reaction to the MMR vaccine, even though it was just a series of cases and the association between vaccination and autism could well be anecdotal. However, it was found that this association was spurious, not only because of hidden biases but also to alterations of the data and other improper behavior of the two authors that they were expelled from medical council. Finally, the article was removed from the magazine. This episode invites to think about the credibility and trust in the authorities and professionals to the population, as well as the suspicions that may arise when there are potential conflicts of interest among professionals, industry magazines and the population. A special area of interest is on the distorted expectations of health interventions, including vaccination, particularly with regard to both individual and collective prevention. PMID:22444516

  16. [The putative link between the MMR vaccine and autism and refusal to vaccinate].

    PubMed

    Segura Benedicto, Andreu

    2012-01-01

    The paper of Wakefield et al. in The Lancet, triggered a negative reaction to the MMR vaccine, even though it was just a series of cases and the association between vaccination and autism could well be anecdotal. However, it was found that this association was spurious, not only because of hidden biases but also to alterations of the data and other improper behavior of the two authors that they were expelled from medical council. Finally, the article was removed from the magazine. This episode invites to think about the credibility and trust in the authorities and professionals to the population, as well as the suspicions that may arise when there are potential conflicts of interest among professionals, industry magazines and the population. A special area of interest is on the distorted expectations of health interventions, including vaccination, particularly with regard to both individual and collective prevention.

  17. Persistence of measles antibodies, following changes in the recommended age for the second dose of MMR-vaccine in Portugal.

    PubMed

    Gonçalves, Guilherme; Frade, João; Nunes, Carla; Mesquita, João Rodrigo; Nascimento, Maria São José

    2015-09-22

    In populations vaccinated with two doses of combined measles-mumps-rubella vaccine (MMR), the serum levels of antibodies against measles depend on the vaccination schedule, time elapsed from the last dose and the area-specific epidemiological situation. Variables measuring "schedule" are age at first and second doses of MMR and intervals derived from that. Changes in vaccination schedules have been made in Portugal. The specific objectives of this study were to measure the association between those potential determinants and the concentration of measles-specific IgG antibodies, after the second dose of MMR. Convenience samples of three Portuguese birth cohorts were selected for this study (41, 66 and 60 born, respectively, in 2001-2003, 1990-1993 and 1994-1995). Geometric mean concentrations (GMC) for measles IgG were, respectively, 934, 251 and 144mIU/ml; p<0.001). Anti-measles-IgG serum concentration decreased with time since last vaccination (waning immunity) and was not influenced by any other component of vaccination schedule, namely age at vaccination with the second dose of MMR. Waning levels of measles antibodies have been observed elsewhere but not as fast as it was observed in Portuguese birth cohorts in this study. Changes in the vaccination schedules might have to be considered in the future.

  18. Reasons for measles cases not being vaccinated with MMR: investigation into parents' and carers' views following a large measles outbreak.

    PubMed

    McHale, P; Keenan, A; Ghebrehewet, S

    2016-03-01

    Uptake rates for the combined measles, mumps and rubella (MMR) vaccine have been below the required 95% in the UK since a retracted and discredited article linking the MMR vaccine with autism and inflammatory bowel disease was released in 1998. This study undertook semi-structured telephone interviews among parents or carers of 47 unvaccinated measles cases who were aged between 13 months and 9 years, during a large measles outbreak in Merseyside. Results showed that concerns over the specific links with autism remain an important cause of refusal to vaccinate, with over half of respondents stating this as a reason. A quarter stated child illness during scheduled vaccination time, while other reasons included general safety concerns and access issues. Over half of respondents felt that more information or a discussion with a health professional would help the decision-making process, while a third stated improved access. There was clear support for vaccination among respondents when asked about current opinions regarding MMR vaccine. The findings support the hypothesis that safety concerns remain a major barrier to MMR vaccination, and also support previous evidence that experience of measles is an important determinant in the decision to vaccinate.

  19. Reasons for measles cases not being vaccinated with MMR: investigation into parents' and carers' views following a large measles outbreak.

    PubMed

    McHale, P; Keenan, A; Ghebrehewet, S

    2016-03-01

    Uptake rates for the combined measles, mumps and rubella (MMR) vaccine have been below the required 95% in the UK since a retracted and discredited article linking the MMR vaccine with autism and inflammatory bowel disease was released in 1998. This study undertook semi-structured telephone interviews among parents or carers of 47 unvaccinated measles cases who were aged between 13 months and 9 years, during a large measles outbreak in Merseyside. Results showed that concerns over the specific links with autism remain an important cause of refusal to vaccinate, with over half of respondents stating this as a reason. A quarter stated child illness during scheduled vaccination time, while other reasons included general safety concerns and access issues. Over half of respondents felt that more information or a discussion with a health professional would help the decision-making process, while a third stated improved access. There was clear support for vaccination among respondents when asked about current opinions regarding MMR vaccine. The findings support the hypothesis that safety concerns remain a major barrier to MMR vaccination, and also support previous evidence that experience of measles is an important determinant in the decision to vaccinate. PMID:26265115

  20. Persistence of measles antibodies, following changes in the recommended age for the second dose of MMR-vaccine in Portugal.

    PubMed

    Gonçalves, Guilherme; Frade, João; Nunes, Carla; Mesquita, João Rodrigo; Nascimento, Maria São José

    2015-09-22

    In populations vaccinated with two doses of combined measles-mumps-rubella vaccine (MMR), the serum levels of antibodies against measles depend on the vaccination schedule, time elapsed from the last dose and the area-specific epidemiological situation. Variables measuring "schedule" are age at first and second doses of MMR and intervals derived from that. Changes in vaccination schedules have been made in Portugal. The specific objectives of this study were to measure the association between those potential determinants and the concentration of measles-specific IgG antibodies, after the second dose of MMR. Convenience samples of three Portuguese birth cohorts were selected for this study (41, 66 and 60 born, respectively, in 2001-2003, 1990-1993 and 1994-1995). Geometric mean concentrations (GMC) for measles IgG were, respectively, 934, 251 and 144mIU/ml; p<0.001). Anti-measles-IgG serum concentration decreased with time since last vaccination (waning immunity) and was not influenced by any other component of vaccination schedule, namely age at vaccination with the second dose of MMR. Waning levels of measles antibodies have been observed elsewhere but not as fast as it was observed in Portuguese birth cohorts in this study. Changes in the vaccination schedules might have to be considered in the future. PMID:26319061

  1. iPE-MMR: An integrated approach to accurately assign monoisotopic precursor masses to tandem mass spectrometric data

    PubMed Central

    Jung, Hee-Jung; Purvine, Samuel O.; Kim, Hokeun; Petyuk, Vladislav A.; Hyung, Seok-Won; Monroe, Matthew E.; Mun, Dong-Gi; Kim, Kyong-Chul; Park, Jong-Moon; Kim, Su-Jin; Tolic, Nikola; Slysz, Gordon W.; Moore, Ronald J.; Zhao, Rui; Adkins, Joshua N.; Anderson, Gordon A.; Lee, Hookeun; Camp, David G.; Yu, Myeong-Hee; Smith, Richard D.; Lee, Sang-Won

    2010-01-01

    Accurate assignment of monoisotopic precursor masses to tandem mass spectrometric (MS/MS) data is a fundamental and critically important step for successful peptide identifications in mass spectrometry based proteomics. Here we describe an integrated approach that combines three previously reported methods of treating MS/MS data for precursor mass refinement. This combined method, “integrated Post-Experiment Monoisotopic Mass Refinement” (iPE-MMR), integrates steps: 1) generation of refined MS/MS data by DeconMSn; 2) additional refinement of the resultant MS/MS data by a modified version of PE-MMR; 3) elimination of systematic errors of precursor masses using DtaRefinery. iPE-MMR is the first method that utilizes all MS information from multiple MS scans of a precursor ion including multiple charge states, in an MS scan, to determine precursor mass. By combining these methods, iPE-MMR increases sensitivity in peptide identification and provides increased accuracy when applied to complex high-throughput proteomics data. PMID:20863060

  2. Healthcare workers role in keeping MMR vaccination uptake high in Europe: a review of evidence.

    PubMed

    Simone, B; Carrillo-Santisteve, P; Lopalco, P L

    2012-06-28

    Measles is a highly contagious and potentially fatal disease. Europe is far from the 95% coverage rates necessary for elimination of the disease, although a safe and cost-effective vaccine is available. We reviewed the literature on studies carried out in European countries from January 1991 to September 2011 on knowledge, attitudes and practices of health professionals towards measles vaccination and on how health professionals have an impact on parental vaccination choices. Both quantitative and qualitative studies were considered: a total of 28 eligible articles were retrieved. Healthcare workers are considered by parents as a primary and trustworthy source of information on childhood vaccination. Gaps in knowledge and poor communication from healthcare workers are detrimental to high immunisation rates. Correct and transparent information for parents plays a key role in parental decisions on whether to have their children vaccinated. Healthcare workers' knowledge of and positive attitudes towards measles-mumps-rubella (MMR) vaccination are crucial to meeting the measles elimination goal. An effort should be made to overcome potential communication barriers and to strengthen vaccine education among healthcare professionals.

  3. Timely MMR vaccination in infancy: influence of attitudes and medical advice on the willingness to vaccinate.

    PubMed

    Schönberger, K; Ludwig, M-S; Wildner, M; Kalies, H

    2012-11-01

    In light of the failure to eliminate measles by 2010, the closure of any gaps in immunisation coverage is of paramount importance to interrupt transmission and to protect vulnerable individuals. Not only vaccination-critical attitudes of parents but furthermore the medical advice by physician in charge influence the vaccine uptake. 3 groups of factors which potentially influence parental decisions on child vaccination were analysed by univariable and multivariable logistic regression for the timely uptake of the first and the second dose of measles vaccination: parents' attitudes towards immunization, the influence of medical and laypersons and the influence of the advice of a medical doctor. A total of 3 041 children were eligible for the analysis. 53.0% of these received the first and 42.9% the second MMR dose in time. If parents considered that vaccinations are important and protective as well as the consulted physician advices towards vaccinations, children had significantly higher chances of a timely vaccination. Whereas, if parents were afraid of vaccinations or get advised by an alternative practitioner, the children had lower chances of being vaccinated in time. If medical providers help parents to reduce uncertainties about vaccination the chance for children to be vaccinated in time increased. It appeared that there still are unmet information needs after the medical consultation. By and large the medical advice plays an important role for vaccination uptake and its timing. In order to raise the vaccination rates further target-population specific approaches are needed.

  4. Dilemmas of a vitalizing vaccine market: lessons from the MMR vaccine/autism debate.

    PubMed

    Bragesjö, Fredrik; Hallberg, Margareta

    2011-03-01

    A number of issues related to vaccines and vaccinations in society are discussed in this paper. Our purpose is to merge an analysis of some recent changes in the vaccine market with social science research on the relationship between citizens and authorities. The article has two empirical parts. The first shows how the vaccine market, which for many years has had immense financial problems, nowadays seems to becoming economically vitalized, mostly due to the production of new and profitable vaccines. However prosperous the future may appear, certain reactions from the public regarding vaccination initiatives offer insight into inherent problems of vaccine policies in many Western countries. In the second part of the article, these problems are exemplified with the recent controversy over the MMR (measles, mumps, and rubella) vaccine. We conclude that in spite of the improving profit-margins, the vaccine market remains vulnerable and insecure. Vaccines are permeated by society, even more so than pharmaceutics that are used to cure or alleviate illnesses. Radical changes in financial conditions with promises of a more profitable market will not, we argue, solve other even more fundamental problems. PMID:21560548

  5. Dilemmas of a vitalizing vaccine market: lessons from the MMR vaccine/autism debate.

    PubMed

    Bragesjö, Fredrik; Hallberg, Margareta

    2011-03-01

    A number of issues related to vaccines and vaccinations in society are discussed in this paper. Our purpose is to merge an analysis of some recent changes in the vaccine market with social science research on the relationship between citizens and authorities. The article has two empirical parts. The first shows how the vaccine market, which for many years has had immense financial problems, nowadays seems to becoming economically vitalized, mostly due to the production of new and profitable vaccines. However prosperous the future may appear, certain reactions from the public regarding vaccination initiatives offer insight into inherent problems of vaccine policies in many Western countries. In the second part of the article, these problems are exemplified with the recent controversy over the MMR (measles, mumps, and rubella) vaccine. We conclude that in spite of the improving profit-margins, the vaccine market remains vulnerable and insecure. Vaccines are permeated by society, even more so than pharmaceutics that are used to cure or alleviate illnesses. Radical changes in financial conditions with promises of a more profitable market will not, we argue, solve other even more fundamental problems.

  6. MutS Homologues hMSH4 and hMSH5: Genetic Variations, Functions, and Implications in Human Diseases.

    PubMed

    Clark, Nicole; Wu, Xiling; Her, Chengtao

    2013-04-01

    The prominence of the human mismatch repair (MMR) pathway is clearly reflected by the causal link between MMR gene mutations and the occurrence of Lynch syndrome (or HNPCC). The MMR family of proteins also carries out a plethora of diverse cellular functions beyond its primary role in MMR and homologous recombination. In fact, members of the MMR family of proteins are being increasingly recognized as critical mediators between DNA damage repair and cell survival. Thus, a better functional understanding of MMR proteins will undoubtedly aid the development of strategies to effectively enhance apoptotic signaling in response to DNA damage induced by anti-cancer therapeutics. Among the five known human MutS homologs, hMSH4 and hMSH5 form a unique heterocomplex. However, the expression profiles of the two genes are not correlated in a number of cell types, suggesting that they may function independently as well. Consistent with this, these two proteins are promiscuous and thought to play distinct roles through interacting with different binding partners. Here, we describe the gene and protein structures of eukaryotic MSH4 and MSH5 with a particular emphasis on their human homologues, and we discuss recent findings of the roles of these two genes in DNA damage response and repair. Finally, we delineate the potential links of single nucleotide polymorphism (SNP) loci of these two genes with several human diseases.

  7. MutS Homologues hMSH4 and hMSH5: Genetic Variations, Functions, and Implications in Human Diseases.

    PubMed

    Clark, Nicole; Wu, Xiling; Her, Chengtao

    2013-04-01

    The prominence of the human mismatch repair (MMR) pathway is clearly reflected by the causal link between MMR gene mutations and the occurrence of Lynch syndrome (or HNPCC). The MMR family of proteins also carries out a plethora of diverse cellular functions beyond its primary role in MMR and homologous recombination. In fact, members of the MMR family of proteins are being increasingly recognized as critical mediators between DNA damage repair and cell survival. Thus, a better functional understanding of MMR proteins will undoubtedly aid the development of strategies to effectively enhance apoptotic signaling in response to DNA damage induced by anti-cancer therapeutics. Among the five known human MutS homologs, hMSH4 and hMSH5 form a unique heterocomplex. However, the expression profiles of the two genes are not correlated in a number of cell types, suggesting that they may function independently as well. Consistent with this, these two proteins are promiscuous and thought to play distinct roles through interacting with different binding partners. Here, we describe the gene and protein structures of eukaryotic MSH4 and MSH5 with a particular emphasis on their human homologues, and we discuss recent findings of the roles of these two genes in DNA damage response and repair. Finally, we delineate the potential links of single nucleotide polymorphism (SNP) loci of these two genes with several human diseases. PMID:24082819

  8. 'That's just what's expected of you … so you do it': mothers discussions around choice and the MMR vaccination.

    PubMed

    Johnson, Sally; Capdevila, Rose

    2014-01-01

    One of the major shifts in the form and experience of contemporary family life has been the increasing insertion of the 'expert' voice into the relationship between parents and children. This paper focuses on an exploration of mothers' engagement with advice around the combined measles, mumps and rubella (MMR) vaccine. Much of the previous literature utilises a 'decision-making' framework, based on 'risk assessment' whereby mothers' decisions are conceptualised as rooted in complex belief systems, and supposes that that by gaining an understanding of these systems, beliefs and behaviour can be modified and uptake improved. However, less attention has been paid to the ways in which mothers negotiate such advice or the ways in which advice is mediated by positionings, practices and relationships. Analysis of data from a focus group with five mothers identified three themes: (i) Sourcing advice and information, (ii) Constructing 'Mother knows best' and (iii) Negotiating agency. Despite the trustworthiness of advice and information being questioned, an awareness of concerns about the MMR, and health professionals being constructed as remote, ultimate conformity to, and compliance with, the 'system' and 'society' were described as determining MMR 'decisions'.

  9. 'That's just what's expected of you … so you do it': mothers discussions around choice and the MMR vaccination.

    PubMed

    Johnson, Sally; Capdevila, Rose

    2014-01-01

    One of the major shifts in the form and experience of contemporary family life has been the increasing insertion of the 'expert' voice into the relationship between parents and children. This paper focuses on an exploration of mothers' engagement with advice around the combined measles, mumps and rubella (MMR) vaccine. Much of the previous literature utilises a 'decision-making' framework, based on 'risk assessment' whereby mothers' decisions are conceptualised as rooted in complex belief systems, and supposes that that by gaining an understanding of these systems, beliefs and behaviour can be modified and uptake improved. However, less attention has been paid to the ways in which mothers negotiate such advice or the ways in which advice is mediated by positionings, practices and relationships. Analysis of data from a focus group with five mothers identified three themes: (i) Sourcing advice and information, (ii) Constructing 'Mother knows best' and (iii) Negotiating agency. Despite the trustworthiness of advice and information being questioned, an awareness of concerns about the MMR, and health professionals being constructed as remote, ultimate conformity to, and compliance with, the 'system' and 'society' were described as determining MMR 'decisions'. PMID:24580033

  10. Distinct structural alterations in PCNA block DNA mismatch repair†

    PubMed Central

    Dieckman, Lynne M.; Boehm, Elizabeth M.; Hingorani, Manju M.; Washington, M. Todd

    2013-01-01

    During DNA replication, mismatches and small loops in the DNA resulting from insertions or deletions are repaired by the mismatch repair (MMR) machinery. Proliferating cell nuclear antigen (PCNA) plays an important role in both mismatch-recognition and resynthesis stages of MMR. Previously, two mutant forms of PCNA were identified that cause defects in MMR with little, if any, other defects. The C22Y mutant PCNA protein completely blocks MutSα-dependent MMR, and the C81R mutant PCNA protein partially blocks both MutSα-dependent and MutSβ-dependent MMR. In order to understand the structural and mechanistic basis by which these two amino acid substitutions in PCNA proteins block MMR, we solved the X-ray crystal structures of both mutant proteins and carried out further biochemical studies. We found that these amino acid substitutions lead to subtle, distinct structural changes in PCNA. The C22Y substitution alters the positions of the α-helices lining the central hole of the PCNA ring, whereas the C81R substitution creates a distortion in an extended loop near the PCNA subunit interface. We conclude that the structural integrity of the α-helices lining the central hole and this loop are both necessary to form productive complexes with MutS α and mismatch-containing DNA. PMID:23869605

  11. Microsatellite Instability Predicts Improved Response to Adjuvant Therapy With Irinotecan, Fluorouracil, and Leucovorin in Stage III Colon Cancer: Cancer and Leukemia Group B Protocol 89803

    PubMed Central

    Bertagnolli, Monica M.; Niedzwiecki, Donna; Compton, Carolyn C.; Hahn, Hejin P.; Hall, Margaret; Damas, Beatrice; Jewell, Scott D.; Mayer, Robert J.; Goldberg, Richard M.; Saltz, Leonard B.; Warren, Robert S.; Redston, Mark

    2009-01-01

    Purpose Colon cancers exhibiting DNA mismatch repair (MMR) defects demonstrate distinct clinical and pathologic features, including better prognosis and reduced response to fluorouracil (FU) –based chemotherapy. This prospective study investigated adjuvant chemotherapy containing FU and irinotecan in patients with MMR deficient (MMR-D) colon cancers. Patients and Methods Cancer and Leukemia Group B 89803 randomly assigned 1,264 patients with stage III colon cancer to postoperative weekly bolus FU/leucovorin (LV) or weekly bolus irinotecan, FU, and LV (IFL). The primary end point was overall survival; disease-free survival (DFS) was a secondary end point. Tumor expression of the MMR proteins, MLH1 and MSH2, was determined by immunohistochemistry (IHC). DNA microsatellite instability was also assessed using a panel of mono- and dinucleotide markers. Tumors with MMR defects were those demonstrating loss of MMR protein expression (MMR-D) and/or microsatellite instability high (MSI-H) genotype. Results Of 723 tumor cases examined by genotyping and IHC, 96 (13.3%) were MMR-D/MSI-H. Genotyping results were consistent with IHC in 702 cases (97.1%). IFL-treated patients with MMR-D/MSI-H tumors showed improved 5-year DFS as compared with those with mismatch repair intact tumors (0.76; 95% CI, 0.64 to 0.88 v 0.59; 95% CI, 0.53 to 0.64; P = .03). This relationship was not observed among patients treated with FU/LV. A trend toward longer DFS was observed in IFL-treated patients with MMR-D/MSI-H tumors as compared with those receiving FU/LV (0.57; 95% CI, 0.42 to 0.71 v 0.76; 95% CI, 0.64 to 0.88; P = .07; hazard ratio interaction between tumor status and treatment, 0.51; likelihood ratio P = .117). Conclusion Loss of tumor MMR function may predict improved outcome in patients treated with the IFL regimen as compared with those receiving FU/LV. PMID:19273709

  12. Missed Opportunities for Measles, Mumps, and Rubella (MMR) Immunization in Mesoamerica: Potential Impact on Coverage and Days at Risk

    PubMed Central

    Mokdad, Ali H.; Gagnier, Marielle C.; Colson, K. Ellicott; Dansereau, Emily; Zúñiga-Brenes, Paola; Ríos-Zertuche, Diego; Haakenstad, Annie; Johanns, Casey K.; Palmisano, Erin B.; Hernandez, Bernardo; Iriarte, Emma

    2015-01-01

    Background Recent outbreaks of measles in the Americas have received news and popular attention, noting the importance of vaccination to population health. To estimate the potential increase in immunization coverage and reduction in days at risk if every opportunity to vaccinate a child was used, we analyzed vaccination histories of children 11–59 months of age from large household surveys in Mesoamerica. Methods Our study included 22,234 children aged less than 59 months in El Salvador, Guatemala, Honduras, Mexico, Nicaragua, and Panama. Child vaccination cards were used to calculate coverage of measles, mumps, and rubella (MMR) and to compute the number of days lived at risk. A child had a missed opportunity for vaccination if their card indicated a visit for vaccinations at which the child was not caught up to schedule for MMR. A Cox proportional hazards model was used to compute the hazard ratio associated with the reduction in days at risk, accounting for missed opportunities. Results El Salvador had the highest proportion of children with a vaccine card (91.2%) while Nicaragua had the lowest (76.5%). Card MMR coverage ranged from 44.6% in Mexico to 79.6% in Honduras while potential coverage accounting for missed opportunities ranged from 70.8% in Nicaragua to 96.4% in El Salvador. Younger children were less likely to have a missed opportunity. In Panama, children from households with higher expenditure were more likely to have a missed opportunity for MMR vaccination compared to the poorest (OR 1.62, 95% CI: 1.06–2.47). In Nicaragua, compared to children of mothers with no education, children of mothers with primary education and secondary education were less likely to have a missed opportunity (OR 0.46, 95% CI: 0.24–0.88 and OR 0.25, 95% CI: 0.096–0.65, respectively). Mean days at risk for MMR ranged from 158 in Panama to 483 in Mexico while potential days at risk ranged from 92 in Panama to 239 in El Salvador. Conclusions Our study found high levels

  13. [Effects of the MMR vaccination on the epidemiology of mumps in Germany].

    PubMed

    Koch, J; Takla, A

    2013-09-01

    Mumps is an acute viral infectious disease characterized by fever and swelling and tenderness of one or more salivary glands, usually the parotid gland. Since 1976, the German Standing Committee on Vaccination (STIKO) has recommended a mumps vaccination as part of the routine immunization schedule in former West Germany. In East Germany, the vaccination was only introduced in 1991 after reunification. In the preceding decades, no comprehensive surveillance system existed in Germany. However, for East Germany and the successional federal states of former East Germany, data on mumps incidence are available from different Eastern surveillance systems for the time period 1968-2012. According to these data, the incidence of mumps has dropped from > 200 cases/100,000 annually in the pre-vaccine era to currently <1/100,000. Recently, an age shift has been noted predominantly in the Western federal states. Based on data from school entry examinations and seroprevalence studies, the age shift is likely due to insufficient vaccination coverage and secondary vaccine failure ("waning immunity"). In view of the changes in mumps epidemiology and the increase of outbreaks among adolescents and young adults, the implementation of a nationwide mandatory notification was initiated and came into effect in March 2013. Mandatory notification enables the early detection of outbreaks and obtainment of comprehensive data for evaluation of the immunization program in place. Regarding the long-term prevention of mumps in Germany, it is hoped that--as part of the measles and rubella elimination effort--coverage rates for the second MMR dose among children will increase nationwide above 95% and existing vaccination gaps among adults will be closed.

  14. [Effects of the MMR vaccination on the epidemiology of mumps in Germany].

    PubMed

    Koch, J; Takla, A

    2013-09-01

    Mumps is an acute viral infectious disease characterized by fever and swelling and tenderness of one or more salivary glands, usually the parotid gland. Since 1976, the German Standing Committee on Vaccination (STIKO) has recommended a mumps vaccination as part of the routine immunization schedule in former West Germany. In East Germany, the vaccination was only introduced in 1991 after reunification. In the preceding decades, no comprehensive surveillance system existed in Germany. However, for East Germany and the successional federal states of former East Germany, data on mumps incidence are available from different Eastern surveillance systems for the time period 1968-2012. According to these data, the incidence of mumps has dropped from > 200 cases/100,000 annually in the pre-vaccine era to currently <1/100,000. Recently, an age shift has been noted predominantly in the Western federal states. Based on data from school entry examinations and seroprevalence studies, the age shift is likely due to insufficient vaccination coverage and secondary vaccine failure ("waning immunity"). In view of the changes in mumps epidemiology and the increase of outbreaks among adolescents and young adults, the implementation of a nationwide mandatory notification was initiated and came into effect in March 2013. Mandatory notification enables the early detection of outbreaks and obtainment of comprehensive data for evaluation of the immunization program in place. Regarding the long-term prevention of mumps in Germany, it is hoped that--as part of the measles and rubella elimination effort--coverage rates for the second MMR dose among children will increase nationwide above 95% and existing vaccination gaps among adults will be closed. PMID:23990094

  15. Characterization of Pathogenic Human MSH2 Missense Mutations Using Yeast as a Model System: A Laboratory Course in Molecular Biology

    PubMed Central

    Gammie, Alison E.; Erdeniz, Naz

    2004-01-01

    This work describes the project for an advanced undergraduate laboratory course in cell and molecular biology. One objective of the course is to teach students a variety of cellular and molecular techniques while conducting original research. A second objective is to provide instruction in science writing and data presentation by requiring comprehensive laboratory reports modeled on the primary literature. The project for the course focuses on a gene, MSH2, implicated in the most common form of inherited colorectal cancer. Msh2 is important for maintaining the fidelity of genetic material where it functions as an important component of the DNA mismatch repair machinery. The goal of the project has two parts. The first part is to create mapped missense mutation listed in the human databases in the cognate yeast MSH2 gene and to assay for defects in DNA mismatch repair. The second part of the course is directed towards understanding in what way are the variant proteins defective for mismatch repair. Protein levels are analyzed to determine if the missense alleles display decreased expression. Furthermore, the students establish whether the Msh2p variants are properly localized to the nucleus using indirect immunofluorescence and whether the altered proteins have lost their ability to interact with other subunits of the MMR complex by creating recombinant DNA molecules and employing the yeast 2-hybrid assay. PMID:22039344

  16. Measles, mumps and rubella (MMR) vaccination has no effect on cognitive development in children – the results of the Polish prospective cohort study

    PubMed Central

    Kiełtyka, Agnieszka; Majewska, Renata; Augustyniak, Małgorzata

    2013-01-01

    Objectives The aim of the study was to examine the hypothesis that MMR exposure has a negative influence on cognitive development in children. Furthermore, MMR was compared to single measles vaccine to determine the potential difference of these vaccines safety regarding children’s cognitive development. Methods The prospective birth cohort study with sample consisted of 369 infants born in Krakow. Vaccination history against measles (date and the type of the vaccine) was extracted from physicians’ records. Child development was assessed using the Bayley Scales of Infant Development (BSID-II) up to 3rd year of life, Raven test in 5th and 8th year and Wechsler (WISC-R) in 6th and 7th year. Data on possible confounders came from mothers’ interview, medical records and analyses of lead and mercury level at birth and at the end of 5th year of life. Linear and logistic regression models adjusted for potential confounders were used to assess the association. Results No significant differences in cognitive and intelligence tests results were observed between children vaccinated with MMR and those not vaccinated up to the end of the 2nd year of life. Children vaccinated with MMR had significantly higher Mental BSID-II Index (MDI) in the 36th month than those vaccinated with single measles vaccine (103.8±10.3 vs. 97.2±11.2, p=0.004). Neither results of Raven test nor WISC-R were significantly different between groups of children vaccinated with MMR and with single measles vaccine. After standardization to child’s gender, maternal education, family economical status, maternal IQ, birth order and passive smoking all developmental tests were statistically insignificant. Conclusion The results suggest that there is no relationship between MMR exposure and children’s cognitive development. Furthermore, the safety of triple MMR is the same as the single measles vaccine with respect to cognitive development. PMID:23588083

  17. Lynch Syndrome-Associated Breast Cancers Do Not Overexpress Chromosome 11 Encoded Mucins

    PubMed Central

    Walsh, Michael D; Cummings, Margaret C; Pearson, Sally-Ann; Clendenning, Mark; Walters, Rhiannon J; Nagler, Belinda; Hopper, John L; Jenkins, Mark A; Suthers, Graeme K; Goldblatt, Jack; Tucker, Kathy; Gattas, Michael R; Arnold, Julie; Parry, Susan; Macrae, Finlay A; McGuckin, Michael A; Young, Joanne P; Buchanan, Daniel D

    2014-01-01

    Mismatch repair (MMR) deficient breast cancers may be identified in Lynch syndrome mutation carriers, and have clinicopathological features in common with MMR deficient colorectal and endometrial cancers such as tumour infiltrating lymphocytes and poor differentiation. MMR deficient colorectal cancers frequently show mucinous differentiation associated with upregulation of chromosome 11 mucins. The aim of this study was to compare the protein expression of these mucins in MMR deficient and MMR proficient breast cancers. Cases of breast cancer (n = 100) were identified from families where 1) both breast and colon cancer co-occurred, 2) families met either modified Amsterdam criteria, or had at least one early onset (<50 years) colorectal cancer, and 3) biospecimens were available for MMR protein expression, microsatellite instability (MSI) status, and MMR gene mutation testing. Tumour sections were stained for the epithelial mucins MUC2, MUC5AC, MUC5B, and MUC6, and the homeobox protein CDX2, a regulator of MUC2 expression. Sixteen MMR deficient Lynch syndrome breast cancers and 84 non-Lynch breast cancers were assessed for altered mucin expression. No significant difference in the expression of MUC2, MUC5AC or MUC6 was observed between the MMR deficient and MMR proficient breast cancers, however, there was a trend for MMR deficient tumours to express high levels of MUC5B less frequently (p = 0.07, OR = 0.2 [0.0 – 1.0]. Co-expression of two or more gel-forming mucins was common. Ectopic expression of CDX2 was associated with expression of MUC2 (p = 0.035, OR = 8.7 [1.3 – 58.4]). MMR deficient breast cancers do not show differential expression of the mucins genes on chromosome 11 when compared to MMR proficient breast cancers, contrasting with MMR deficient colorectal and endometrial cancers which frequently have increased mucin protein expression when compared to their MMR proficient counterparts. In addition, ectopic CDX2 expression is positively associated

  18. Identification of Nuclear Protein Targets for Six Leukemogenic Tyrosine Kinases Governed by Post-Translational Regulation

    PubMed Central

    Pierce, Andrew; Williamson, Andrew; Jaworska, Ewa; Griffiths, John R.; Taylor, Sam; Walker, Michael; O’Dea, Mark Aspinall; Spooncer, Elaine; Unwin, Richard D.; Poolman, Toryn; Ray, David; Whetton, Anthony D.

    2012-01-01

    Mutated tyrosine kinases are associated with a number of different haematological malignancies including myeloproliferative disorders, lymphoma and acute myeloid leukaemia. The potential commonalities in the action of six of these leukemogenic proteins on nuclear proteins were investigated using systematic proteomic analysis. The effects on over 3600 nuclear proteins and 1500 phosphopeptide sites were relatively quantified in seven isogenic cell lines. The effects of the kinases were diverse although some commonalities were found. Comparison of the nuclear proteomic data with transcriptome data and cytoplasmic proteomic data indicated that the major changes are due to post-translational mechanisms rather than changes in mRNA or protein distribution. Analysis of the promoter regions of genes whose protein levels changed in response to the kinases showed the most common binding site found was that for NFκB whilst other sites such as those for the glucocorticoid receptor were also found. Glucocorticoid receptor levels and phosphorylation were decreased by all 6 PTKs. Whilst Glucocorticoid receptor action can potentiate NFκB action those proteins where genes have NFκB binding sites were in often regulated post-translationally. However all 6 PTKs showed evidence of NFkB pathway modulation via activation via altered IkB and NFKB levels. Validation of a common change was also undertaken with PMS2, a DNA mismatch repair protein. PMS2 nuclear levels were decreased in response to the expression of all 6 kinases, with no concomitant change in mRNA level or cytosolic protein level. Response to thioguanine, that requires the mismatch repair pathway, was modulated by all 6 oncogenic kinases. In summary common targets for 6 oncogenic PTKs have been found that are regulated by post-translational mechanisms. They represent potential new avenues for therapies but also demonstrate the post-translational regulation is a key target of leukaemogenic kinases. PMID:22745689

  19. Radiometric calibration of the reflective bands of NS001-Thematic Mapper Simulator (TMS) and modular multispectral radiometers (MMR)

    NASA Technical Reports Server (NTRS)

    Markham, Brian L.; Wood, Frank M., Jr.; Ahmad, Suraiya P.

    1988-01-01

    The NS001 Thematic Mapper Simulator scanner (TMS) and several modular multispectral radiometers (MMRs) are among the primary instruments used in the First ISLSCP (International Satellite Land Surface Climatology Project) Field Experiment (FIFE). The NS001 has a continuously variable gain setting. Calibration of the NS001 data is influenced by drift in the dark current level of up to six counts during a mirror scan at typical gain settings. The MMR instruments are being used in their 1 deg FOV configuration on the helicopter and 15 deg FOV on the ground.

  20. Development of a sandwich enzyme-linked immunosorbent assay (ELISA) for determining of bovine serum albumin (BSA) in trivalent measles-mump-rubella (MMR) vaccines.

    PubMed

    Khamehchian, Sedigheh; Madani, Rasool; Golchinfar, Fariba; Taghavian, Mohammad

    2008-01-01

    A sandwich enzyme-linked immunosorbent assay (ELISA), using polyclonal antibody, was developed and compared with the commercial kit for detecting and estimating of BSA content in Measles-Mump-Rubella (MMR) vaccine samples in detection limit of nanogram level. The test depends on the capturing and detecting of BSA antigen by the polyclonal antibody. Initially, a detection range of 0-64 ng/ml was established, could be used for estimation of BSA content according to WHO requirement (50 ng/ml) in MMR vaccines. Comparative analysis of the test results for 85 MMR vaccine samples obtained with the commercial kit gave a sensitivity of 58.8% and a specificity of 97%. A high correlation (r = 0.94) was observed between BSA sandwich ELISA and commercial kit for BSA content in MMR samples. However, variations in values also were observed for the two assays. These variations may have been due to difference of upper limit of detection range of BSA content in commercial kit (32 ng/ml) and new sandwich ELISA (64 ng/ml) as well as the use of a different polyclonal antibody. In concerning the cutoff value for the WHO requirement and employment of standard solution of 64 ng/ml in developing assay, it would be adequate to use this test for assessing BSA content in viral vaccines same as MMR vaccines.

  1. [Wakefield's affair: 12 years of uncertainty whereas no link between autism and MMR vaccine has been proved].

    PubMed

    Maisonneuve, Hervé; Floret, Daniel

    2012-09-01

    In 1998, a Lancet paper described 12 cases of children with autism, and having been vaccinated (MMR) in the United Kingdom; medias presented the information to the lay public, stating that a link was possible. In 2004, The Lancet published letters responding to allegations against the paper. Later, it was established that no link existed between MMR and autism; few years and many publications were necessary to conclude to the absence of evidence. In 2010, the General Medical Council published a report against Dr Wakefield, first author of the 1998 paper, and showing that the children hospital records did not contain the evidence; hospital records differed from the published paper; the Lancet retracted the 1998 paper. In 2011, Brian Deer, a journalist, published the complete story in theBMJ: in 1996, Wakefield was approached by lawyers representing an anti-vaccine lobby, and they supported the Wakefield research. Dr Wakefield left England; in 2012 he works in Texas, USA, for anti-vaccine lobbies. PMID:22748860

  2. [Wakefield's affair: 12 years of uncertainty whereas no link between autism and MMR vaccine has been proved].

    PubMed

    Maisonneuve, Hervé; Floret, Daniel

    2012-09-01

    In 1998, a Lancet paper described 12 cases of children with autism, and having been vaccinated (MMR) in the United Kingdom; medias presented the information to the lay public, stating that a link was possible. In 2004, The Lancet published letters responding to allegations against the paper. Later, it was established that no link existed between MMR and autism; few years and many publications were necessary to conclude to the absence of evidence. In 2010, the General Medical Council published a report against Dr Wakefield, first author of the 1998 paper, and showing that the children hospital records did not contain the evidence; hospital records differed from the published paper; the Lancet retracted the 1998 paper. In 2011, Brian Deer, a journalist, published the complete story in theBMJ: in 1996, Wakefield was approached by lawyers representing an anti-vaccine lobby, and they supported the Wakefield research. Dr Wakefield left England; in 2012 he works in Texas, USA, for anti-vaccine lobbies.

  3. Widening inequalities in MMR vaccine uptake rates among ethnic groups in an urban area of the UK during a period of vaccine controversy (1994-2000).

    PubMed

    Hawker, Jeremy I; Olowokure, Babatunde; Wood, Annette L; Wilson, Richard C; Johnson, Richard

    2007-10-23

    We examined MMR vaccine uptake among ethnic groups in Birmingham, UK between 1994 and 2000, a period incorporating adverse MMR vaccine publicity. From 1994 to 2000 overall uptake: (1) fell significantly from 91.1% in 1994 to 89.8% (chi(2) for trend p<0.001) in 2000, (2) in Asian children significantly increased (chi(2) for trend p<0.001), and (3) in White children significantly decreased (chi(2) for trend p<0.001). Differences between ethnic groups with the highest (Asian) and the lowest (Black Caribbean) uptake rates increased from 2.1% in 1994 (p=ns) to 6.8% in 2000 (p<0.001). This study suggests underlying ethnic inequalities in MMR vaccine uptake and differential response to adverse vaccine publicity.

  4. Successful seroresponses to measles and rubella following aerosolized Triviraten vaccine, but poor response to aerosolized mumps (Rubini) component: comparisons with injected MMR.

    PubMed

    Diaz-Ortega, Jose Luis; Bennett, John V; Castaneda, Deyanira; Vieyra, Jose-Raul; Valdespino-Gomez, Jose Luis; de Castro, Jorge Fernandez

    2010-01-01

    Seroresponses to measles, rubella and mumps were evaluated following the injection of MMR II and injection or aerosol administration of Triviraten in young adults. Response to aerosolized Rubini mumps strain was a focus of interest, given robust responses to aerosolized mumps vaccine (Leningrad-Zagreb strain) in a prior study using aerosolized MMR vaccine. The aerosolized Edmonston-Zagreb (EZ) measles vaccine was significantly more immunogenic than injected EZ vaccine, and comparable to results following injected Moraten measles vaccine having twice the dosage. Responses to rubella were comparable in the three MMR study groups. Aerosolized Rubini vaccine was very highly and unexpectedly less immunogenic than either injected Rubini or Jeryl-Lyn strains. The high attenuation of Rubini vaccine appears to have limited its affinity for respiratory tract receptors, which may underlie its lack of clinical effectiveness.

  5. Minimizing adsorption of histidine-tagged proteins for the study of protein-deoxyribonucleic acid interactions by kinetic capillary electrophoresis.

    PubMed

    Liyanage, Ruchi; Krylova, Svetlana M; Krylov, Sergey N

    2013-12-27

    Affinity interactions between DNA and proteins play a crucial role in many cellular processes. Kinetic Capillary Electrophoresis is a highly efficient tool for kinetic and equilibrium studies of protein-DNA interactions. Recombinant proteins, which are typically used for in vitro studies of protein-DNA interactions, are often expressed with a His tag to aid in their purification. In this work, we study how His tags affect Kinetic Capillary Electrophoresis analysis of protein-DNA interactions. We found that the addition of a His tag can increase or decrease protein adsorption to a bare-silica capillary wall, dependent on the protein. For Kinetic Capillary Electrophoresis measurements, it is essential to have as little protein adsorption as possible. We screened a number of capillary coatings to reduce adsorption of the His-tagged DNA mismatch repair protein MutS to the capillary wall and found that UltraTrol LN was the most effective coating. The effectiveness of the coating was confirmed with the prevention of adsorption of His-tagged fat mass and obesity-associated protein. Under typical conditions, the coating reduced protein adsorption to a level at which accurate Kinetic Capillary Electrophoresis analysis of protein-DNA interactions was possible. We further used Kinetic Capillary Electrophoresis to study how the His tag affected Kd of protein-DNA interactions for the MutS protein. Using UltraTrol LN, we found that the effect of the His tag was insignificant.

  6. Generation of DNA nanocircles containing mismatched bases.

    PubMed

    Xiao, Yu; Jung, Caroline; Marx, Andreas D; Winkler, Ines; Wyman, Claire; Lebbink, Joyce H G; Friedhoff, Peter; Cristovao, Michele

    2011-10-01

    The DNA mismatch repair (MMR) system recognizes and repairs errors that escaped the proofreading function of DNA polymerases. To study molecular details of the MMR mechanism, in vitro biochemical assays require specific DNA substrates carrying mismatches and strand discrimination signals. Current approaches used to generate MMR substrates are time-consuming and/or not very flexible with respect to sequence context. Here we report an approach to generate small circular DNA containing a mismatch (nanocircles). Our method is based on the nicking of PCR products resulting in single-stranded 3' overhangs, which form DNA circles after annealing and ligation. Depending on the DNA template, one can generate mismatched circles containing a single hemimethylated GATC site (for use with the bacterial system) and/or nicking sites to generate DNA circles nicked in the top or bottom strand (for assays with the bacterial or eukaryotic MMR system). The size of the circles varied (323 to 1100 bp), their sequence was determined by the template DNA, and purification of the circles was achieved by ExoI/ExoIII digestion and/or gel extraction. The quality of the nanocircles was assessed by scanning-force microscopy and their suitability for in vitro repair initiation was examined using recombinant Escherichia coli MMR proteins.

  7. Excision of translesion synthesis errors orchestrates responses to helix-distorting DNA lesions

    PubMed Central

    Tsaalbi-Shtylik, Anastasia; Ferrás, Cristina; Pauw, Bea; Hendriks, Giel; Temviriyanukul, Piya; Carlée, Leone; Calléja, Fabienne; van Hees, Sandrine; Akagi, Jun-Ichi; Iwai, Shigenori; Hanaoka, Fumio; Jansen, Jacob G.

    2015-01-01

    In addition to correcting mispaired nucleotides, DNA mismatch repair (MMR) proteins have been implicated in mutagenic, cell cycle, and apoptotic responses to agents that induce structurally aberrant nucleotide lesions. Here, we investigated the mechanistic basis for these responses by exposing cell lines with single or combined genetic defects in nucleotide excision repair (NER), postreplicative translesion synthesis (TLS), and MMR to low-dose ultraviolet light during S phase. Our data reveal that the MMR heterodimer Msh2/Msh6 mediates the excision of incorrect nucleotides that are incorporated by TLS opposite helix-distorting, noninstructive DNA photolesions. The resulting single-stranded DNA patches induce canonical Rpa–Atr–Chk1-mediated checkpoints and, in the next cell cycle, collapse to double-stranded DNA breaks that trigger apoptosis. In conclusion, a novel MMR-related DNA excision repair pathway controls TLS a posteriori, while initiating cellular responses to environmentally relevant densities of genotoxic lesions. These results may provide a rationale for the colorectal cancer tropism in Lynch syndrome, which is caused by inherited MMR gene defects. PMID:25869665

  8. Non-canonical uracil processing in DNA gives rise to double-strand breaks and deletions: relevance to class switch recombination

    PubMed Central

    Bregenhorn, Stephanie; Kallenberger, Lia; Artola-Borán, Mariela; Peña-Diaz, Javier; Jiricny, Josef

    2016-01-01

    During class switch recombination (CSR), antigen-stimulated B-cells rearrange their immunoglobulin constant heavy chain (CH) loci to generate antibodies with different effector functions. CSR is initiated by activation-induced deaminase (AID), which converts cytosines in switch (S) regions, repetitive sequences flanking the CH loci, to uracils. Although U/G mispairs arising in this way are generally efficiently repaired to C/Gs by uracil DNA glycosylase (UNG)-initiated base excision repair (BER), uracil processing in S-regions of activated B-cells occasionally gives rise to double strand breaks (DSBs), which trigger CSR. Surprisingly, genetic experiments revealed that CSR is dependent not only on AID and UNG, but also on mismatch repair (MMR). To elucidate the role of MMR in CSR, we studied the processing of uracil-containing DNA substrates in extracts of MMR-proficient and –deficient human cells, as well as in a system reconstituted from recombinant BER and MMR proteins. Here, we show that the interplay of these repair systems gives rise to DSBs in vitro and to genomic deletions and mutations in vivo, particularly in an S-region sequence. Our findings further suggest that MMR affects pathway choice in DSB repair. Given its amenability to manipulation, our system represents a powerful tool for the molecular dissection of CSR. PMID:26743004

  9. Non-canonical uracil processing in DNA gives rise to double-strand breaks and deletions: relevance to class switch recombination.

    PubMed

    Bregenhorn, Stephanie; Kallenberger, Lia; Artola-Borán, Mariela; Peña-Diaz, Javier; Jiricny, Josef

    2016-04-01

    During class switch recombination (CSR), antigen-stimulated B-cells rearrange their immunoglobulin constant heavy chain (CH) loci to generate antibodies with different effector functions. CSR is initiated by activation-induced deaminase (AID), which converts cytosines in switch (S) regions, repetitive sequences flanking the CH loci, to uracils. Although U/G mispairs arising in this way are generally efficiently repaired to C/Gs by uracil DNA glycosylase (UNG)-initiated base excision repair (BER), uracil processing in S-regions of activated B-cells occasionally gives rise to double strand breaks (DSBs), which trigger CSR. Surprisingly, genetic experiments revealed that CSR is dependent not only on AID and UNG, but also on mismatch repair (MMR). To elucidate the role of MMR in CSR, we studied the processing of uracil-containing DNA substrates in extracts of MMR-proficient and -deficient human cells, as well as in a system reconstituted from recombinant BER and MMR proteins. Here, we show that the interplay of these repair systems gives rise to DSBs in vitro and to genomic deletions and mutations in vivo, particularly in an S-region sequence. Our findings further suggest that MMR affects pathway choice in DSB repair. Given its amenability to manipulation, our system represents a powerful tool for the molecular dissection of CSR.

  10. A randomized comparative trial in order to assess the reactogenicity and immunogenicity of a new measles mumps rubella (MMR) vaccine when given as a first dose at 12-24 months of age.

    PubMed

    Gatchalian, S; Cordero-Yap, L; Lu-Fong, M; Soriano, R; Ludan, A; Chitour, K; Bock, H L

    1999-09-01

    An open, randomized multi-center trial, involving 700 infants, was conducted in order to compare a new measles mumps rubella (MMR) vaccine, SB MMR (containing a Jeryl Lynn derived mumps strain RIT 4385) with a widely used vaccine, Merck MMR, when given to children between 12-24 months. Infants were divided between 2 groups; group 1 received SB MMR while group 2 received Merck MMR. Solicited local and general symptoms were recorded using diary cards and antibody levels were measured using ELISA assays. There was a significantly lower incidence of redness (p < 0.001) and swelling (p = 0.03) observed in group 1 compared with group 2. The incidence of all other solicited local and general symptoms were comparable between groups. In initially seronegative subjects equivalent seroconversion rates and post-vaccination GMTs were observed between groups. In conclusion, these results demonstrate that SB MMR is safe and well tolerated when given to children at this age range, and has an equivalent immunogenic profile compared to the widely used Merck MMR vaccine.

  11. Information is in the eye of the beholder: Seeking information on the MMR vaccine through an Internet search engine.

    PubMed

    Yom-Tov, Elad; Fernandez-Luque, Luis

    2014-01-01

    Vaccination campaigns are one of the most important and successful public health programs ever undertaken. People who want to learn about vaccines in order to make an informed decision on whether to vaccinate are faced with a wealth of information on the Internet, both for and against vaccinations. In this paper we develop an automated way to score Internet search queries and web pages as to the likelihood that a person making these queries or reading those pages would decide to vaccinate. We apply this method to data from a major Internet search engine, while people seek information about the Measles, Mumps and Rubella (MMR) vaccine. We show that our method is accurate, and use it to learn about the information acquisition process of people. Our results show that people who are pro-vaccination as well as people who are anti-vaccination seek similar information, but browsing this information has differing effect on their future browsing. These findings demonstrate the need for health authorities to tailor their information according to the current stance of users.

  12. Information is in the eye of the beholder: Seeking information on the MMR vaccine through an Internet search engine

    PubMed Central

    Yom-Tov, Elad; Fernandez-Luque, Luis

    2014-01-01

    Vaccination campaigns are one of the most important and successful public health programs ever undertaken. People who want to learn about vaccines in order to make an informed decision on whether to vaccinate are faced with a wealth of information on the Internet, both for and against vaccinations. In this paper we develop an automated way to score Internet search queries and web pages as to the likelihood that a person making these queries or reading those pages would decide to vaccinate. We apply this method to data from a major Internet search engine, while people seek information about the Measles, Mumps and Rubella (MMR) vaccine. We show that our method is accurate, and use it to learn about the information acquisition process of people. Our results show that people who are pro-vaccination as well as people who are anti-vaccination seek similar information, but browsing this information has differing effect on their future browsing. These findings demonstrate the need for health authorities to tailor their information according to the current stance of users. PMID:25954435

  13. Immune response to the mumps component of the MMR vaccine in the routine of immunisation services in the Brazilian National Immunisation Program.

    PubMed

    Santos, Eliane Matos dos; Silva e Sá, Gloria Regina da; Siqueira, Marilda Mendonça; Martins, Reinaldo de Menezes; Camacho, Luiz Antonio Bastos; von Doellinger, Vanessa dos Reis; Maia, Maria de Lourdes de Sousa

    2014-06-01

    A non-controlled longitudinal study was conducted to evaluate the combined vaccine against measles, mumps and rubella (MMR) immunogenicity in 150 children vaccinated in the routine of three health units in the city of Rio de Janeiro, Brazil, 2008-2009, without other vaccines administered during the period from 30 days before to 30 days after vaccination. A previous study conducted in Brazil in 2007, in 1,769 children ranging from 12-15 months of age vaccinated against yellow fever and MMR simultaneously or at intervals of 30 days or more between doses, had shown low seroconversion for mumps regardless of the interval between administration of the two vaccines. The current study showed 89.5% (95% confidence interval: 83.3; 94.0) seroconversion rate for mumps. All children seroconverted for measles and rubella. After revaccination, high antibody titres and seroconversion rates were achieved against mumps. The results of this study and others suggest that two MMR doses confer optimal immunoresponses for all three antigens and the possible need for additional doses should be studied taking into account not only serological, but also epidemiological data, as there is no serological correlate of protection for mumps.

  14. Immune response to the mumps component of the MMR vaccine in the routine of immunisation services in the Brazilian National Immunisation Program.

    PubMed

    Santos, Eliane Matos dos; Silva e Sá, Gloria Regina da; Siqueira, Marilda Mendonça; Martins, Reinaldo de Menezes; Camacho, Luiz Antonio Bastos; von Doellinger, Vanessa dos Reis; Maia, Maria de Lourdes de Sousa

    2014-06-01

    A non-controlled longitudinal study was conducted to evaluate the combined vaccine against measles, mumps and rubella (MMR) immunogenicity in 150 children vaccinated in the routine of three health units in the city of Rio de Janeiro, Brazil, 2008-2009, without other vaccines administered during the period from 30 days before to 30 days after vaccination. A previous study conducted in Brazil in 2007, in 1,769 children ranging from 12-15 months of age vaccinated against yellow fever and MMR simultaneously or at intervals of 30 days or more between doses, had shown low seroconversion for mumps regardless of the interval between administration of the two vaccines. The current study showed 89.5% (95% confidence interval: 83.3; 94.0) seroconversion rate for mumps. All children seroconverted for measles and rubella. After revaccination, high antibody titres and seroconversion rates were achieved against mumps. The results of this study and others suggest that two MMR doses confer optimal immunoresponses for all three antigens and the possible need for additional doses should be studied taking into account not only serological, but also epidemiological data, as there is no serological correlate of protection for mumps. PMID:24821058

  15. The impact of the media on the decision of parents in South Wales to accept measles-mumps-rubella (MMR) immunization.

    PubMed

    Walsh, S; Thomas, D Rh; Mason, B W; Evans, M R

    2015-02-01

    A large measles outbreak occurred in South Wales in 2012/2013. The outbreak has been attributed to low take-up of measles-mumps-rubella (MMR) immunization in the early 2000s. To understand better the factors that led to this outbreak we present the findings of a case-control study carried out in the outbreak area in 2001 to investigate parents' decision on whether to accept MMR. Parents who decided not to take-up MMR at the time were more likely to be older and better educated, more likely to report being influenced by newspapers [adjusted odds ratio (aOR) 3·07, 95% confidence interval (CI) 1·62-5·80], television (aOR 3·30, 95% CI 1·70-6·43), the internet (aOR 7·23, 3·26-16·06) and vaccine pressure groups (aOR 5·20, 95% CI 2·22-12·16), and less likely to be influenced by a health visitor (aOR 0·30, 95% CI 0·16-0·57). In this area of Wales, daily English-language regional newspapers, UK news programmes and the internet appeared to have a powerful negative influence. We consider the relevance of these findings to the epidemiology of the outbreak and the subsequent public health response. PMID:25600667

  16. Immunogenicity and safety of measles-mumps-rubella-varicella (MMRV) vaccine followed by one dose of varicella vaccine in children aged 15 months-2 years or 2-6 years primed with measles-mumps-rubella (MMR) vaccine.

    PubMed

    Gillet, Y; Steri, G C; Behre, U; Arsène, J P; Lanse, X; Helm, K; Esposito, S; Meister, N; Desole, M G; Douha, M; Willems, P

    2009-01-14

    In this open, randomized, comparative study (105908/NCT00353288), 458 age-stratified children (15 months-2 years and 2-6 years) previously primed with MMR received one dose of either a combined MMRV vaccine (Priorix-Tetra, MMRV group) or concomitant MMR and varicella vaccines (Priorix and Varilrix, MMR+V group), followed 42-56 days later by another dose of varicella vaccine (Varilrix) in both groups. Post-vaccination measles, mumps and rubella seropositivity rates and antibody geometric mean titers (GMTs) were high (99.5% for anti-measles and 100% for anti-mumps and anti-rubella) in both vaccine groups. In the two age strata, varicella seroconversion rates were, post-dose 1: > or =97.6% (MMRV), > or =96.6% (MMR+V) and, post-dose 2: 100% in both groups. Post-dose 2, anti-varicella GMTs increased respectively 14.1- and 12.6-fold (MMRV), and 9.8- and 13.1-fold (MMR+V). Both vaccine regimens were well-tolerated. Post-dose 1, the incidence of any solicited local symptom during the 4-days follow-up was < or =28.2% (MMRV) and < or =19.8% (MMR+V) and the incidence of fever >39.5 degrees C (rectal temperature) within 15 days was < or =2.8% (MMRV) and < or =2.6% (MMR+V). This MMRV vaccine appears an immunogenic and safe substitute for a second dose of MMR vaccine in young children. The increase in anti-varicella antibodies observed after a second dose of varicella vaccine supports a two-dose schedule for varicella-containing vaccine.

  17. A comparison of booster immunisation with a combination DTPa-IPV vaccine or DTPa plus IPV in separate injections when co-administered with MMR, at age 4-6 years.

    PubMed

    Marshall, H; Nolan, T; Roberton, D; Richmond, P; Lambert, S; Jacquet, J M; Schuerman, L

    2006-08-28

    This study evaluated GSK's combined DTPa-IPV vaccine (Infanrix-IPV) given as a fifth consecutive acellular pertussis booster dose in conjunction with the second dose of MMR vaccine (Priorix) in children aged 4-6 years. The immunogenicity and reactogenicity of this vaccine regimen was compared with separate injections of DTPa and IPV when given concomitantly with MMR. A cohort of 362 children previously primed with four doses of DTPa and OPV, and a single dose of MMR were randomized to receive either DTPa-IPV+MMR (N=181) or DTPa+IPV+MMR (N=181). Antibody concentrations were measured prior to and 1 month after the booster dose. After immunisation all subjects from both groups had seroprotective antibody levels against diphtheria, tetanus and the three poliovirus serotypes, > or = 96% showed vaccine response to PT, FHA and PRN, all were seropositive to mumps and rubella, and all but one subject were seropositive to measles. Immunogenicity results for each component antigen were similar for DTPa-IPV and separately co-administered DTPa and IPV. Local reactions were common with 24.0% and 31.1% of children experiencing swelling >50mm at the DTPa-IPV and DTPa injection sites, respectively. The DTPa-IPV combination did not increase the incidence or intensity of adverse events compared with separately administered DTPa+IPV. The response to the concomitantly administered MMR vaccine was similar in the two groups and similar to previously reported responses for a second dose of MMR. This combined DTPa-IPV vaccine has a similar reactogenicity profile to DTPa, is immunogenic when given as a booster dose at 4-6 years of age, and has no impact on the immunogenicity of a co-administered second dose of MMR vaccine.

  18. Immunogenicity and safety of a varicella vaccine, Okavax, and a trivalent measles, mumps and rubella vaccine, MMR-II, administered concomitantly in healthy Filipino children aged 12-24 months.

    PubMed

    Gatchalian, Salvacion; Leboulleux, Didier; Desauziers, Eric; Bermal, Nancy; Borja-Tabora, Charissa

    2003-09-01

    This trial was conducted to assess the immunogenicity and safety of the varicella vaccine, Okavax, when administered concomitantly with the measles, mumps and rubella vaccine, MMR-II, to children aged 12-24 months. A total of 299 children were randomized into three groups, those receiving Okavax only, MMR-II only, or both vaccines concomitantly. Antibody titers were determined by ELISA in blood samples taken immediately before, and 6 weeks after, vaccination. Parents recorded local and systemic reactions. Okavax elicited similar varicella seroconversion rates (> or = 93.9%) and high GMTs when given alone or with MMR-II (99.6 and 95.7 mIU/ml, respectively). The seroconversion rates (measles and rubella 100%, mumps > or = 75.0%) and high GMTs elicited by MMR-II were not affected by concomitant administration of Okavax. The incidence of adverse events was similar whether MMR-II and Okavax were administered concomitantly or separately, and the majority of local reactions were mild and transient, with fever the most frequent systemic event in all groups. In conclusion, these results show that the immune response and the reactogenicity profile of Okavax and MMR-II were similar when given together or alone. Concomitant administration of these vaccines can therefore be recommended for children in their second year of life.

  19. Parental reports of adverse events following simultaneously given dT-IPV and MMR vaccines in healthy 9-year-old children.

    PubMed

    Kemmeren, Jeanet M; van der Maas, Nicoline A T; de Melker, Hester E

    2011-03-01

    In the Netherlands, children at 9 years of age receive a booster dT-IPV together with their second measles, mumps, and rubella (MMR) vaccination within the national immunization program. Safety is monitored continuously by enhanced passive surveillance. This population-based study was conducted to obtain more information on adverse events after vaccination at 9 years of age. Questionnaires on local and systemic reactions were distributed 1 and 3 weeks after vaccination, respectively, to parents of 1,250 healthy children who received their MMR and diphtheria, tetanus, and inactivated poliovirus injection (dT-IPV) vaccination as scheduled. Response to the questionnaires was 57.0% and 46.5%, respectively. Local reactions occurred in 86.5% of the children within 7 days after vaccination, more often at the dT-IPV (83.4%) than at the MMR site (32.7%). Pain was the most reported symptom (80.8% at the dT-IPV site; 29.1% at the MMR site). Systemic events occurred in 33.4% children within 7 days after vaccination, with headache as the most frequently reported (20.8%). Systemic events occurred in 20.8% children 8-21 days after vaccination. Children with local reactions at only the dT-IPV site had significantly more systemic events (19.3%) than those without local reactions (3.4%, p < 0.01). Such difference was not found for the MMR site. No serious adverse events were reported. Medical intervention was applied to 133 children (130 used analgesics and for three children the GP was consulted by phone). In conclusion, the frequency of reported local reactions is high, especially at the dT-IPV site, but all symptoms were transient. However, the use of reduced antigen content vaccines in association with the occurrence of adverse events is meaningful to explore. Furthermore, the overall rates are useful for monitoring variations in adverse events rates in the general population.

  20. Yeast mutator phenotype enforced by Arabidopsis PMS1 expression.

    PubMed

    Galles, Celina; Spampinato, Claudia P

    2013-03-01

    The DNA mismatch repair (MMR) system is a major DNA repair pathway whose function is critical for the correction of DNA biosynthetic errors. MMR is initiated by the binding of MutS proteins to mismatches and unpaired nucleotides followed by the recruitment of MutL proteins. The major MutL activity in eukaryotes is performed by MutLα, the heterocomplex of MLH1-PMS1 in yeast and plants and MLH1-PMS2 in humans. We here report the effect the expression of Arabidopsis PMS1 protein exerts on Saccharomyces cerevisiae genomic stability. A strain carrying specific microsatellite instability reporter systems was chosen for the study. The plant protein failed to complement the hypermutator phenotype of a pms1 deficient strain but increased approximately 14-fold and 2,000-fold the mutation rates of his7-2 and lys2::InsE-A 14 loci of MMR proficient strains when compared to wild-type strains, respectively. Overexpressing AtMLH1 in the AtPMS1-overproducing strain generated an increase in mutation rate comparable to that of AtPMS1 expression alone. Deletion of the C-terminal residues implicated in protein-protein interaction and including the putative endonuclease sequence of AtPMS1 completely eliminated the mutator phenotype. Taken together, these results indicate that the plant proteins affect yeast genomic stability, very possibly altering protein-protein interactions that are necessary to complete repair.

  1. The aromatic stacking interactions between proteins and their macromolecular ligands.

    PubMed

    Rahman, Mohammad Mizanur; Muhseen, Ziyad Tariq; Junaid, Muhammad; Zhang, Houjin

    2015-01-01

    Aromatic stacking interactions arise from the attractive force between the π-electron clouds in the neighboring aromatic groups. The aromatic stacking is common between proteins and small molecules. The stacking interactions at the interfaces of proteins and other macromolecules are relatively rare. However it contributes to a significant portion of the stabilizing forces. In the proteinprotein complexes, aromatic interactions are involved in the protein oligomerization, such as dimer, trimer and tetramer formation. Also, aromatic residues can bind to nanoparticles through stacking interactions which offer them stronger affinity than other residues. These interactions play crucial roles in proteinnanoparticle conjugation. In the protein-nucleotide complexes, the specific recognitions are realized through stacking interactions between aromatic residues and the bases in the nucleotides. Many nucleoproteins use aromatic stacking to recognize binding site on DNA or RNA. Stacking interactions are involved in the process of mismatch repair, strand separation, deadenylation, degradation and RNA cap binding. They are proved to be important for the stability of complexes. The aromatic stacking is also the underlying reasons of many fatal diseases such as Alzheimer, cancer and cardiovascular diseases. The chemicals that can block the stacking interactions could have potential pharmaceutical values. In this review, we summarize recent finding regarding the functions of aromatic stacking interactions in the protein-macromolecule complexes. Our aim is to understand the mechanisms underlying the stacking-mediated complex formation and facilitate the development of drugs and other bio-products.

  2. The single-stranded DNA-binding protein of Escherichia coli.

    PubMed Central

    Meyer, R R; Laine, P S

    1990-01-01

    The single-stranded DNA-binding protein (SSB) of Escherichia coli is involved in all aspects of DNA metabolism: replication, repair, and recombination. In solution, the protein exists as a homotetramer of 18,843-kilodalton subunits. As it binds tightly and cooperatively to single-stranded DNA, it has become a prototypic model protein for studying protein-nucleic acid interactions. The sequences of the gene and protein are known, and the functional domains of subunit interaction, DNA binding, and protein-protein interactions have been probed by structure-function analyses of various mutations. The ssb gene has three promoters, one of which is inducible because it lies only two nucleotides from the LexA-binding site of the adjacent uvrA gene. Induction of the SOS response, however, does not lead to significant increases in SSB levels. The binding protein has several functions in DNA replication, including enhancement of helix destabilization by DNA helicases, prevention of reannealing of the single strands and protection from nuclease digestion, organization and stabilization of replication origins, primosome assembly, priming specificity, enhancement of replication fidelity, enhancement of polymerase processivity, and promotion of polymerase binding to the template. E. coli SSB is required for methyl-directed mismatch repair, induction of the SOS response, and recombinational repair. During recombination, SSB interacts with the RecBCD enzyme to find Chi sites, promotes binding of RecA protein, and promotes strand uptake. PMID:2087220

  3. Improvement of ENU Mutagenesis Efficiency Using Serial Injection and Mismatch Repair Deficiency Mice.

    PubMed

    Gallego-Llamas, Jabier; Timms, Andrew E; Pitstick, Rose; Peters, Janet; Carlson, George A; Beier, David R

    2016-01-01

    ENU mutagenesis is a powerful method for generating novel lines of mice that are informative with respect to both fundamental biological processes and human disease. Rapid developments in genomic technology have made the task of identifying causal mutations by positional cloning remarkably efficient. One limitation of this approach remains the mutation frequency achievable using standard treatment protocols, which currently generate approximately 1-2 sequence changes per megabase when optimized. In this study we used two strategies to attempt to increase the number of mutations induced by ENU treatment. One approach employed mice carrying a mutation in the DNA repair enzyme Msh6. The second strategy involved injection of ENU to successive generations of mice. To evaluate the number of ENU-induced mutations, single mice or pooled samples were analyzed using whole exome sequencing. The results showed that there is considerable variability in the induced mutation frequency using these approaches, but an overall increase in ENU-induced variants from one generation to another was observed. The analysis of the mice deficient for Msh6 also showed an increase in the ENU-induced variants compared to the wild-type ENU-treated mice. However, in both cases the increase in ENU-induced mutation frequency was modest. PMID:27441645

  4. Improvement of ENU Mutagenesis Efficiency Using Serial Injection and Mismatch Repair Deficiency Mice

    PubMed Central

    Pitstick, Rose; Peters, Janet; Carlson, George A.

    2016-01-01

    ENU mutagenesis is a powerful method for generating novel lines of mice that are informative with respect to both fundamental biological processes and human disease. Rapid developments in genomic technology have made the task of identifying causal mutations by positional cloning remarkably efficient. One limitation of this approach remains the mutation frequency achievable using standard treatment protocols, which currently generate approximately 1–2 sequence changes per megabase when optimized. In this study we used two strategies to attempt to increase the number of mutations induced by ENU treatment. One approach employed mice carrying a mutation in the DNA repair enzyme Msh6. The second strategy involved injection of ENU to successive generations of mice. To evaluate the number of ENU-induced mutations, single mice or pooled samples were analyzed using whole exome sequencing. The results showed that there is considerable variability in the induced mutation frequency using these approaches, but an overall increase in ENU-induced variants from one generation to another was observed. The analysis of the mice deficient for Msh6 also showed an increase in the ENU-induced variants compared to the wild-type ENU-treated mice. However, in both cases the increase in ENU-induced mutation frequency was modest. PMID:27441645

  5. Meta-Analysis of Mismatch Repair Polymorphisms within the Cogent Consortium for Colorectal Cancer Susceptibility

    PubMed Central

    Chang-Claude, Jenny; Hoffmeister, Michael; Fernández-Rozadilla, Ceres; Carracedo, Angel; Castells, Antoni; Castellví-Bel, Sergi; Juan, Diego Morillas; Raquel, Muñoz; Marisa, Manzano; Francisco, Colina; Jose, Díaz; Carolina, Ibarrola; Guadalupe, López; Alberto, Ibáñez; Antoni, Castells; Virgínia, Piñol; Sergi, Castellví-Bel; Francesc, Balaguer; Victoria, Gonzalo; Teresa, Ocaña; María Dolores, Giráldez; Maria, Pellisé; Anna, Serradesanferm; Leticia, Moreira; Miriam, Cuatrecasas; Josep, M. Piqué; Ángel, Lanas; Javier, Alcedo; Javier, Ortego; Joaquin, Cubiella; Ma, Soledad Díez; Mercedes, Salgado; Eloy, Sánchez; Mariano, Vega; Montserrat, Andreu; Anna, Abuli; Xavier, Bessa; Mar, Iglesias; Agustín, Seoane; Felipe, Bory; Gemma, Navarro; Beatriz, Bellosillo; Josep, Ma Dedeu; Cristina, Álvarez; Marc, Puigvehí; Luis, Bujanda; Ángel, Cosme; Inés, Gil; Mikel, Larzabal; Carlos, Placer; María, del Mar Ramírez; Elisabeth, Hijona; Jose, M. Enríquez-Navascués; Jose, L. Elosegui; Artemio, Payá; Rodrigo, Jover; Cristina, Alenda; Laura, Sempere; Nuria, Acame; Estefanía, Rojas; Lucía, Pérez-Carbonell; Joaquim, Rigau; Ángel, Serrano; Anna, Giménez; Joan, Saló; Eduard, Batiste-Alentorn; Josefina, Autonell; Ramon, Barniol; Ana, María García; Fernando, Carballo; Antonio, Bienvenido; Eduardo, Sanz; Fernando, González; Jaime, Sánchez; Akiko, Ono; Mercedes, Latorre; Enrique, Medina; Jaime, Cuquerella; Pilar, Canelles; Miguel, Martorell; José, Ángel García; Francisco, Quiles; Elisa, Orti; Juan, Clofent; Jaime, Seoane; Antoni, Tardío; Eugenia, Sanchez; Ma, Luisa de Castro; Antoni, Tardío; Juan, Clofent; Vicent, Hernández; Xavier, Llor; Rosa, M. Xicola; Marta, Piñol; Mercè, Rosinach; Anna, Roca; Elisenda, Pons; José, M. Hernández; Miquel, A. Gassull; Fernando, Fernández-Bañares; Josep, M. Viver; Antonio, Salas; Jorge, Espinós; Montserrat, Forné; Maria, Esteve; Josep, M. Reñé; Carmen, Piñol; Juan, Buenestado; Joan, Viñas; Enrique, Quintero; David, Nicolás; Adolfo, Parra; Antonio, Martín; Lidia, Argüello; Vicente, Pons; Virginia, Pertejo; Teresa, Sala; Dolors, Gonzalez; Eva, Roman; Teresa, Ramon; Maria, Poca; Ma, Mar Concepción; Marta, Martin; Lourdes, Pétriz; Daniel, Martinez; Ángel, Carracedo; Clara, Ruiz-Ponte; Ceres, Fernández-Rozadilla; Ma, Magdalena Castro; Sabino, Riestra; Luis, Rodrigo; Javier, Fernández; Jose, Luis Cabriada; Luis, Carreño; Susana, Oquiñena; Federico, Bolado; Elena, Peña; José, Manuel Blas; Gloria, Ceña; Juan, José Sebastián; Antonio, Naranjo; Naccarati, Alessio; Pardini, Barbara; Vodickova, Ludmila; Müller, Heiko; Talseth-Palmer, Bente A.; Stibbard, Geoffrey; Peterlongo, Paolo; Nici, Carmela; Veneroni, Silvia; Li, Li; Casey, Graham; Tenesa, Albert; Farrington, Susan M.; Tomlinson, Ian; Moreno, Victor; van Wezel, Tom; Wijnen, Juul; Dunlop, Malcolm; Radice, Paolo; Scott, Rodney J.; Vodicka, Pavel; Ruiz-Ponte, Clara; Brenner, Hermann; Buch, Stephan; Völzke, Henry; Hampe, Jochen; Schafmayer, Clemens; Lindblom, Annika

    2013-01-01

    In the last four years, Genome-Wide Association Studies (GWAS) have identified sixteen low-penetrance polymorphisms on fourteen different loci associated with colorectal cancer (CRC). Due to the low risks conferred by known common variants, most of the 35% broad-sense heritability estimated by twin studies remains unexplained. Recently our group performed a case-control study for eight Single Nucleotide Polymorphisms (SNPs) in 4 CRC genes. The present investigation is a follow-up of that study. We have genotyped six SNPs that showed a positive association and carried out a meta-analysis based on eight additional studies comprising in total more than 8000 cases and 6000 controls. The estimated recessive odds ratio for one of the SNPs, rs3219489 (MUTYH Q338H), decreased from 1.52 in the original Swedish study, to 1.18 in the Swedish replication, and to 1.08 in the initial meta-analysis. Since the corresponding summary probability value was 0.06, we decided to retrieve additional information for this polymorphism. The incorporation of six further studies resulted in around 13000 cases and 13000 controls. The newly updated OR was 1.03. The results from the present large, multicenter study illustrate the possibility of decreasing effect sizes with increasing samples sizes. Phenotypic heterogeneity, differential environmental exposures, and population specific linkage disequilibrium patterns may explain the observed difference of genetic effects between Sweden and the other investigated cohorts. PMID:24039736

  6. Clinical characterization and mutation spectrum in Caribbean Hispanic families with Lynch syndrome.

    PubMed

    Cruz-Correa, Marcia; Diaz-Algorri, Yaritza; Pérez-Mayoral, Julyann; Suleiman-Suleiman, Wasilah; Gonzalez-Pons, Maria del Mar; Bertrán, Carlos; Casellas, Nicolás; Rodríguez, Natalia; Pardo, Sherly; Rivera, Keyla; Mosquera, Rafael; Rodriguez-Quilichini, Segundo

    2015-09-01

    Lynch syndrome (LS) is an inherited form of colorectal cancer (CRC) caused by germline mutations in the mismatch repair (MMR) genes. It accounts for approximately 5% of all CRCs. The prevalence of LS among US Hispanics is unknown. The objective of this study was to describe the germline mutations of LS in Caribbean Hispanics from Puerto Rico and Dominican Republic. A total of 89 subjects were recruited through the Puerto Rico Familial Colorectal Cancer Registry and were classified according to Amsterdam and Bethesda clinical guidelines. For those tumors with lack of expression of MMR protein, gene sequencing was ordered. A total of 35 individuals with deficient MMR system were identified: 22 had MMR mutations and 13 had tumors with absent MMR protein expression. Our results show that the mutation spectrum of Caribbean Hispanic LS patients was composed mostly of MSH2 (66.7%) mutations, followed by MLH1 (25.0%). One mutation was identified in MSH6 (8.3%). A previously unidentified mutation in MLH1 gene c.2044_2045del was found in one Caribbean Hispanic family. MMR mutation-positive individuals were found to be more likely to have a prominent family history of CRC and tumors located at the proximal colon. Compared to MSH2 mutation carriers, MLH1 mutation-positive individuals were more likely to have a strong family history of CRC and LS associated cancers. Furthermore, insurance coverage for genetic testing was found to be limited in the study population with 65.1% of the individuals recruited were denied coverage. This report presents the first description of the mutation spectrum and clinicopathologic characteristics of LS Caribbean Hispanics patients.

  7. Localization of MLH3 at the Centrosomes

    PubMed Central

    Roesner, Lennart M.; Mielke, Christian; Faehnrich, Silke; Merkhoffer, Yvonne; Dittmar, Kurt E. J.; Drexler, Hans G.; Dirks, Wilhelm G.

    2014-01-01

    Mutations in human DNA mismatch repair (MMR) genes are commonly associated with hereditary nonpolyposis colorectal cancer (HNPCC). MLH1 protein heterodimerizes with PMS2, PMS1, and MLH3 to form MutLα, MutLβ, and MutLγ, respectively. We reported recently stable expression of GFP-linked MLH3 in human cell lines. Monitoring these cell lines during the cell cycle using live cell imaging combined with confocal microscopy, we detected accumulation of MLH3 at the centrosomes. Fluorescence recovery after photobleaching (FRAP) revealed high mobility and fast exchange rates at the centrosomes as it has been reported for other DNA repair proteins. MLH3 may have a role in combination with other repair proteins in the control of centrosome numbers. PMID:25116689

  8. Persistence of antibodies in 4-8 year old Austrian children after vaccination with hexavalent DTaP-HBV-IPV/Hib and MMR vaccines.

    PubMed

    Paulke-Korinek, Maria; Fischmeister, Gustav; Grac, Ana; Rendi-Wagner, Pamela; Kundi, Michael; Mohsenzadeh-Rabbani, Afsaneh; Moritz, Katharina; Fenninger, Beate; Jarisch, Reinhart; Jasinska, Joanna; Holzmann, Heidemarie; Wiedermann, Ursula; Kollaritsch, Herwig

    2011-07-18

    To determine the proficiency of the Austrian childhood vaccination schedule to induce long lasting seroprotection against vaccine preventable diseases a seroepidemiological study in 348 children between four and eight years of age was conducted. Antibodies against diphtheria, tetanus, pertussis, hepatitis B, measles, mumps and rubella antigens were assessed in children, who had been vaccinated with hexavalent DTaP-HBV-IPV/Hib vaccines at three, four, five months and in the second year of life and/or MMR vaccines in the second year of life at least once, but mostly twice. High seroprotection rates (SPRs) were detected for tetanus (96%) and measles (90%). SPRs regarding diphtheria and mumps were 81% and 72%, respectively. Rubella-SPRs were 68% in females and 58% in males. Hepatitis B-antibody levels ≥10 mIU/mL were present in 52%; antibodies against pertussis were detected in 27% of the children. SPRs for measles and rubella depended on the interval since last vaccination; mumps-antibodies were significantly lower after one MMR-vaccination only. Antibodies against diphtheria, tetanus and pertussis depended on the interval since last vaccination while HBs-antibodies did not. The low levels of antibodies 1-7 years after vaccination against pertussis, rubella and mumps after only one vaccination should be considered when recommending new vaccination schedules.

  9. Reactogenicity and immunogenicity of a new combined measles-mumps-rubella vaccine: results of a multicentre trial. The Cooperative Group for the Study of MMR vaccines.

    PubMed

    Crovari, P; Gabutti, G; Giammanco, G; Dentico, P; Moiraghi, A R; Ponzio, F; Soncini, R

    2000-06-15

    A large single blind, multi-centre study involving 1779 children was performed in Italy. Infants, aged between 12 and 27 months were divided between two groups: group A received a single dose of a new MMR vaccine, 'Priorix'(3), while group B received a widely used MMR vaccine, Triviraten(4). Solicited local and general symptoms were recorded using diary cards and antibody levels were measured, prior to and 60 days post-vaccination, using ELISA assays. The incidence of solicited symptoms (evaluated in 1754 subjects) was comparable between groups, with the exception of fever which was significantly lower in group B. Immunogenicity was evaluated in 686 subjects. Of note, was the significantly higher anti-mumps seroconversion rate (p<0.001) observed in group A (97.0%) compared to group B (35.4%). However the anti-measles and anti-rubella seroconversion rates were equivalent between groups. Significantly higher (p<0.001) post-vaccination GMTs were in group A vs group B for anti-measles (2830 vs 784 IU/ml) and anti-mumps (1640 vs 469 U/ml), however the anti-rubella GMTs were significantly higher (p<0.001) in group B (117.6 IU/ml) compared to group A (92.6 IU/ml). The persistence of antibodies in 35 subjects was assessed 1 year after vaccination and the results showed no appreciable decline in titres with either vaccine. The trial demonstrates 'Priorix' is well tolerated and highly immunogenic.

  10. Single nucleotide polymorphisms/haplotypes associated with multiple rubella-specific immune response outcomes post-MMR immunization in healthy children.

    PubMed

    Ovsyannikova, Inna G; Salk, Hannah M; Larrabee, Beth R; Pankratz, V Shane; Poland, Gregory A

    2015-10-01

    The observed heterogeneity in rubella-specific immune response phenotypes post-MMR vaccination is thought to be explained, in part, by inter-individual genetic variation. In this study, single nucleotide polymorphisms (SNPs) and multiple haplotypes in several candidate genes were analyzed for associations with more than one rubella-specific immune response outcome, including secreted IFN-γ, secreted IL-6, and neutralizing antibody titers. Overall, we identified 23 SNPs in 10 different genes that were significantly associated with at least two rubella-specific immune responses. Of these SNPs, we detected eight in the PVRL3 gene, five in the PVRL1 gene, one in the TRIM22 gene, two in the IL10RB gene, two in the TLR4 gene, and five in other genes (PVR, ADAR, ZFP57, MX1, and BTN2A1/BTN3A3). The PVRL3 gene haplotype GACGGGGGCAGCAAAAAGAAGAGGAAAGAACAA was significantly associated with both higher IFN-γ secretion (t-statistic 4.43, p < 0.0001) and higher neutralizing antibody titers (t-statistic 3.14, p = 0.002). Our results suggest that there is evidence of multigenic associations among identified gene SNPs and that polymorphisms in these candidate genes contribute to the overall observed differences between individuals in response to live rubella virus vaccine. These results will aid our understanding of mechanisms behind rubella-specific immune response to MMR vaccine and influence the development of vaccines in the future.

  11. Investigation of a mumps outbreak among university students with two measles-mumps-rubella (MMR) vaccinations, Virginia, September-December 2006.

    PubMed

    Rota, J S; Turner, J C; Yost-Daljev, M K; Freeman, M; Toney, D M; Meisel, E; Williams, N; Sowers, S B; Lowe, L; Rota, P A; Nicolai, L A; Peake, L; Bellini, W J

    2009-10-01

    Following the clinical diagnosis of the first case of mumps on September 22, 2006 at the University of Virginia (UVA), 52 suspected cases were identified through active surveillance for mumps by the end of December 2006. Samples were collected from 47 students who presented with parotitis despite a documented history of two doses of measles, mumps, and rubella (MMR) vaccine. Six of 47 serum samples (13%) were positive for mumps IgM, and 46/47 specimens were positive for mumps IgG. Endpoint titration of acute phase serum samples from laboratory-confirmed cases did not provide evidence that elevated serum IgG is a consistent marker for infection among cases due to secondary vaccine failure. Buccal swab samples from 39 of the 47 students were tested by real-time reverse transcription-polymerase chain reaction (RT-PCR) and/or viral culture. Mumps virus or mumps RNA was detected in 12 of 39 buccal samples (31%). Genetic analysis of the virus from the outbreak at UVA indicated that the outbreak was not linked to the large mumps outbreak in the Midwestern US that occurred earlier in 2006. Our findings support the use of viral detection to improve laboratory diagnosis of mumps among persons who have received two doses of MMR.

  12. Single nucleotide polymorphisms/haplotypes associated with multiple rubella-specific immune response outcomes post-MMR immunization in healthy children.

    PubMed

    Ovsyannikova, Inna G; Salk, Hannah M; Larrabee, Beth R; Pankratz, V Shane; Poland, Gregory A

    2015-10-01

    The observed heterogeneity in rubella-specific immune response phenotypes post-MMR vaccination is thought to be explained, in part, by inter-individual genetic variation. In this study, single nucleotide polymorphisms (SNPs) and multiple haplotypes in several candidate genes were analyzed for associations with more than one rubella-specific immune response outcome, including secreted IFN-γ, secreted IL-6, and neutralizing antibody titers. Overall, we identified 23 SNPs in 10 different genes that were significantly associated with at least two rubella-specific immune responses. Of these SNPs, we detected eight in the PVRL3 gene, five in the PVRL1 gene, one in the TRIM22 gene, two in the IL10RB gene, two in the TLR4 gene, and five in other genes (PVR, ADAR, ZFP57, MX1, and BTN2A1/BTN3A3). The PVRL3 gene haplotype GACGGGGGCAGCAAAAAGAAGAGGAAAGAACAA was significantly associated with both higher IFN-γ secretion (t-statistic 4.43, p < 0.0001) and higher neutralizing antibody titers (t-statistic 3.14, p = 0.002). Our results suggest that there is evidence of multigenic associations among identified gene SNPs and that polymorphisms in these candidate genes contribute to the overall observed differences between individuals in response to live rubella virus vaccine. These results will aid our understanding of mechanisms behind rubella-specific immune response to MMR vaccine and influence the development of vaccines in the future. PMID:26329766

  13. Visualizing Protein Movement on DNA at the Single-molecule Level using DNA Curtains

    PubMed Central

    Silverstein, Timothy D.; Gibb, Bryan; Greene, Eric C.

    2014-01-01

    A fundamental feature of many nucleic-acid binding proteins is their ability to move along DNA either by diffusion-based mechanisms or by ATP-hydrolysis driven translocation. For example, most site-specific DNA-binding proteins must diffuse to some extent along DNA to either find their target sites, or to otherwise fulfill their biological roles. Similarly, nucleic-acid translocases such as helicases and polymerases must move along DNA to fulfill their functions. In both instances, the proteins must also be capable of moving in crowded environments while navigating through DNA-bound obstacles. These types of behaviors can be challenging to analyze by bulk biochemical methods because of the transient nature of the interactions, and/or heterogeneity of the reaction intermediates. The advent of single-molecule methodologies has overcome some of these problems, and has led to many new insights into the mechanisms that contribute to protein motion along DNA. We have developed DNA curtains as a tool to facilitate single molecule observations of protein-nucleic acid interactions, and we have applied these new research tools to systems involving both diffusive-based motion as well as ATP directed translocation. Here we highlight these studies by first discussing how diffusion contributes to target searches by proteins involved in post-replicative mismatch repair. We then discuss DNA curtain assays of two different DNA translocases, RecBCD and FtsK, which participate in homologous DNA recombination and site-specific DNA recombination, respectively. PMID:24598576

  14. Absence of detectable measles virus genome sequence in blood of autistic children who have had their MMR vaccination during the routine childhood immunization schedule of UK.

    PubMed

    Afzal, M A; Ozoemena, L C; O'Hare, A; Kidger, K A; Bentley, M L; Minor, P D

    2006-05-01

    Leukocyte preparations from children with documented evidence of MMR vaccination and confirmed diagnosis of autism were examined by several assays designed to target multiple regions of the measles virus genome sequence. No sample was found positive by any method. The assays applied were highly sensitive, specific and robust in nature, and were based on the amplification of measles virus RNA transcripts by real-time quantitative RT-PCR (QRT-PCR) as well as by conventional RT-PCR-nested PCR. The assays applied were potentially able to detect measles virus RNA down to single figure copy numbers per reaction. The amount of total nucleic acid extract of leukocytes subjected to various measles virus-specific investigations was several fold higher than minimally required of a sample where measles virus persistence is well documented. This study failed to substantiate reports of the persistence of measles virus in autistic children with development regression.

  15. MSH6 and MUTYH Deficiency Is a Frequent Event in Early-Onset Colorectal Cancer

    PubMed Central

    Giráldez, María Dolores; Balaguer, Francesc; Bujanda, Luis; Cuatrecasas, Miriam; Muñoz, Jenifer; Alonso-Espinaco, Virginia; Larzabal, Mikel; Petit, Anna; Gonzalo, Victoria; Ocaña, Teresa; Moreira, Leticia; Enríquez-Navascués, José María; Boland, C. Richard; Goel, Ajay; Castells, Antoni; Castellví-Bel, Sergi

    2011-01-01

    Purpose Early-onset colorectal cancer (CRC) is suggestive of a hereditary predisposition. Lynch syndrome is the most frequent CRC hereditary cause. The MUTYH gene has also been related to hereditary CRC. A systematic characterization of these two diseases has not been reported previously in this population. Experimental Design We studied a retrospectively collected series of 140 patients ≤50 years old diagnosed with nonpolyposis CRC. Demographic, clinical, and familial features were obtained. Mismatch repair (MMR) deficiency was determined by microsatellite instability (MSI) analysis, and immunostaining for MLH1, MSH2, MSH6, and PMS2 proteins. Germline MMR mutations were evaluated in all MMR-deficient cases. Tumor samples with loss of MLH1 or MSH2 protein expression were analyzed for somatic methylation. Germline MUTYH mutations were evaluated in all cases. BRAF V600E and KRAS somatic mutational status was also determined. Results Fifteen tumors (11.4%) were MSI, and 20 (14.3%) showed loss of protein expression (7 for MLH1/PMS2, 2 for isolated MLH1, 3 for MSH2/MSH6, 7 for isolated MSH6, and 1 for MSH6/PMS2). We identified 11 (7.8%) germline MMR mutations, 4 in MLH1, 1 in MSH2, and 6 in MSH6. Methylation analysis revealed one case with somatic MLH1 methylation. Biallelic MUTYH mutations were detected in four (2.8%) cases. KRAS and BRAF V600E mutations were present in 39 (27.9%) and 5 (3.6%) cases, respectively. Conclusions Loss of MSH6 expression is the predominant cause of MMR deficiency in early-onset CRC. Our findings prompt the inclusion of MSH6 and MUTYH screening as part of the genetic counseling of these patients and their relatives. PMID:20924129

  16. Do children who receive an ‘early dose’ of MMR vaccine during a measles outbreak return for their regularly scheduled dose? A retrospective population-based study

    PubMed Central

    Guo, Xiaoyan; Simmonds, Kimberley A; Svenson, Jill; MacDonald, Shannon E

    2016-01-01

    Background Children under the age of 12 months may receive an early dose of measles–mumps–rubella (MMR) vaccine to provide short-term protection in the case of a disease outbreak. Following a measles outbreak in Alberta, Canada, there was concern that children who received an early dose may not be returning for their routinely scheduled dose at 12 months, leaving them vulnerable to disease in the long term. Methods This population-based study of children born between 2006 and 2014 used administrative health data to assess coverage and timeliness of the first routine dose of MMR vaccine administered at age 12–24 months for children who received an early dose of the vaccine due to a disease outbreak. We compared this group to children who received an early dose due to travel to a measles-endemic region and to children who did not receive an early dose. Results Only 5.5% of 366 351 children received an early dose. Coverage for the routine dose at age 24 months was 96.5% for children receiving an outbreak dose, 92.2% for those travelling to measles-endemic regions and 86.6% for those without an early dose (p<0.0001). The multivariable Cox proportional hazard analysis, controlling for neighbourhood income, place of residence and interaction effects, determined that, as compared to the general cohort, the outbreak group was most likely to obtain the first routine dose (adjusted HR (aHR): 1.52, 95% CI 1.44 to 1.60), followed by the travel group (aHR: 1.26, 95% CI 1.18 to 1.34). Conclusions It is reassuring that the majority of children who received an early dose returned for their routine dose and did so in a timely manner. PMID:27580838

  17. A Genetic Incompatibility Accelerates Adaptation in Yeast.

    PubMed

    Bui, Duyen T; Dine, Elliot; Anderson, James B; Aquadro, Charles F; Alani, Eric E

    2015-07-01

    During mismatch repair (MMR) MSH proteins bind to mismatches that form as the result of DNA replication errors and recruit MLH factors such as Mlh1-Pms1 to initiate excision and repair steps. Previously, we identified a negative epistatic interaction involving naturally occurring polymorphisms in the MLH1 and PMS1 genes of baker's yeast. Here we hypothesize that a mutagenic state resulting from this negative epistatic interaction increases the likelihood of obtaining beneficial mutations that can promote adaptation to stress conditions. We tested this by stressing yeast strains bearing mutagenic (incompatible) and non-mutagenic (compatible) mismatch repair genotypes. Our data show that incompatible populations adapted more rapidly and without an apparent fitness cost to high salt stress. The fitness advantage of incompatible populations was rapid but disappeared over time. The fitness gains in both compatible and incompatible strains were due primarily to mutations in PMR1 that appeared earlier in incompatible evolving populations. These data demonstrate a rapid and reversible role (by mating) for genetic incompatibilities in accelerating adaptation in eukaryotes. They also provide an approach to link experimental studies to observational population genomics. PMID:26230253

  18. Anaplastic oligodendroglioma in an adolescent with Lynch syndrome.

    PubMed

    Heath, John A; Ng, Jessica; Beshay, Victoria; Coleman, Lee; Lo, Patrick; Amor, David J

    2013-06-01

    Lynch syndrome (hereditary non-polyposis colorectal cancer; HNPCC) is an autosomal dominant cancer predisposition syndrome with high penetrance. It is caused by heterozygous germline mutations in one of the DNA mismatch repair (MMR) genes MLH1, MSH2, MSH6, and PMS2. Carriers are at high-risk for developing colorectal carcinomas, as well as various extracolonic malignancies. This case report describes a 15 year-old male with a confirmed germline mutation of MSH2 and early onset anaplastic oligodendroglioma. The patient's tumor showed loss of expression of MSH2 and MSH6 proteins with normal microsatellite stability. The immunohistochemical staining pattern provided strong evidence to support the inclusion of anaplastic oligodendroglioma as part of the spectrum of tumors found in Lynch syndrome.

  19. Trypanosoma cruzi MSH2: Functional analyses on different parasite strains provide evidences for a role on the oxidative stress response☆

    PubMed Central

    Campos, Priscila C.; Silva, Viviane G.; Furtado, Carolina; Machado-Silva, Alice; DaRocha, Wanderson D.; Peloso, Eduardo F.; Gadelha, Fernanda R.; Medeiros, Marisa H.G.; Lana, Gustavo de Carvalho; Chen, Ying; Barnes, Rebecca L.; Passos-Silva, Danielle Gomes; McCulloch, Richard; Machado, Carlos Renato; Teixeira, Santuza M.R.

    2011-01-01

    Components of the DNA mismatch repair (MMR) pathway are major players in processes known to generate genetic diversity, such as mutagenesis and DNA recombination. Trypanosoma cruzi, the protozoan parasite that causes Chagas disease has a highly heterogeneous population, composed of a pool of strains with distinct characteristics. Studies with a number of molecular markers identified up to six groups in the T. cruzi population, which showed distinct levels of genetic variability. To investigate the molecular basis for such differences, we analyzed the T. cruzi MSH2 gene, which encodes a key component of MMR, and showed the existence of distinct isoforms of this protein. Here we compared cell survival rates after exposure to genotoxic agents and levels of oxidative stress-induced DNA in different parasite strains. Analyses of msh2 mutants in both T. cruzi and T. brucei were also used to investigate the role of Tcmsh2 in the response to various DNA damaging agents. The results suggest that the distinct MSH2 isoforms have differences in their activity. More importantly, they also indicate that, in addition to its role in MMR, TcMSH2 acts in the parasite response to oxidative stress through a novel mitochondrial function that may be conserved in T. brucei. PMID:21073906

  20. Novel Mutations in MLH1 and MSH2 Genes in Mexican Patients with Lynch Syndrome.

    PubMed

    Moreno-Ortiz, Jose Miguel; Ayala-Madrigal, María de la Luz; Corona-Rivera, Jorge Román; Centeno-Flores, Manuel; Maciel-Gutiérrez, Víctor; Franco-Topete, Ramón Antonio; Armendáriz-Borunda, Juan; Hotchkiss, Erin; Pérez-Carbonell, Lucia; Rhees, Jennifer; Boland, Clement Richard; Gutiérrez-Angulo, Melva

    2016-01-01

    Background. Lynch Syndrome (LS) is characterized by germline mutations in the DNA mismatch repair (MMR) genes MLH1, MSH2, MSH6, and PMS2. This syndrome is inherited in an autosomal dominant pattern and is characterized by early onset colorectal cancer (CRC) and extracolonic tumors. The aim of this study was to identify mutations in MMR genes in three Mexican patients with LS. Methods. Immunohistochemical analysis was performed as a prescreening method to identify absent protein expression. PCR, Denaturing High Performance Liquid Chromatography (dHPLC), and Sanger sequencing complemented the analysis. Results. Two samples showed the absence of nuclear staining for MLH1 and one sample showed loss of nuclear staining for MSH2. The mutations found in MLH1 gene were c.2103+1G>C in intron 18 and compound heterozygous mutants c.1852_1854delAAG (p.K618del) and c.1852_1853delinsGC (p.K618A) in exon 16. In the MSH2 gene, we identified mutation c.638dupT (p.L213fs) in exon 3. Conclusions. This is the first report of mutations in MMR genes in Mexican patients with LS and these appear to be novel.

  1. Novel Mutations in MLH1 and MSH2 Genes in Mexican Patients with Lynch Syndrome

    PubMed Central

    Moreno-Ortiz, Jose Miguel; Ayala-Madrigal, María de la Luz; Corona-Rivera, Jorge Román; Maciel-Gutiérrez, Víctor; Franco-Topete, Ramón Antonio; Armendáriz-Borunda, Juan; Pérez-Carbonell, Lucia; Rhees, Jennifer; Gutiérrez-Angulo, Melva

    2016-01-01

    Background. Lynch Syndrome (LS) is characterized by germline mutations in the DNA mismatch repair (MMR) genes MLH1, MSH2, MSH6, and PMS2. This syndrome is inherited in an autosomal dominant pattern and is characterized by early onset colorectal cancer (CRC) and extracolonic tumors. The aim of this study was to identify mutations in MMR genes in three Mexican patients with LS. Methods. Immunohistochemical analysis was performed as a prescreening method to identify absent protein expression. PCR, Denaturing High Performance Liquid Chromatography (dHPLC), and Sanger sequencing complemented the analysis. Results. Two samples showed the absence of nuclear staining for MLH1 and one sample showed loss of nuclear staining for MSH2. The mutations found in MLH1 gene were c.2103+1G>C in intron 18 and compound heterozygous mutants c.1852_1854delAAG (p.K618del) and c.1852_1853delinsGC (p.K618A) in exon 16. In the MSH2 gene, we identified mutation c.638dupT (p.L213fs) in exon 3. Conclusions. This is the first report of mutations in MMR genes in Mexican patients with LS and these appear to be novel. PMID:27247567

  2. Multiplicity and molecular heterogeneity of colorectal carcinomas in individuals with serrated polyposis.

    PubMed

    Rosty, Christophe; Walsh, Michael D; Walters, Rhiannon J; Clendenning, Mark; Pearson, Sally-Ann; Jenkins, Mark A; Win, Aung Ko; Hopper, John L; Sweet, Kevin; Frankel, Wendy L; Aronson, Melyssa; Gallinger, Steve; Goldblatt, Jack; Tucker, Kathy; Greening, Sian; Gattas, Michael R; Woodall, Sonja; Arnold, Julie; Walker, Neal I; Parry, Susan; Young, Joanne P; Buchanan, Daniel D

    2013-03-01

    Serrated polyposis (SP) is a clinically defined syndrome characterized by the occurrence of multiple serrated polyps in the large intestine. Individuals with SP and their relatives are at increased risk of colorectal carcinoma (CRC). We aimed to determine the pathologic and molecular profiles of CRCs in individuals fulfilling World Health Organization criteria for SP. A total of 45 CRCs were obtained from 38 individuals with SP (27 female and 11 male patients; median age at CRC diagnosis, 58.5 y) attending genetics clinics. Tumor samples were pathologically reviewed, screened for somatic BRAF and KRAS mutations, and analyzed immunohistochemically for mismatch repair protein (MMR) expression. Tumors were spread throughout the large intestine, with 64% located in the proximal colon. Mutations in BRAF and KRAS and immunohistochemical evidence of MMR deficiency were found in 46%, 5%, and 38%, respectively. Nearly half of CRCs were BRAF/KRAS wild type, and these were associated with distal location (63%) and MMR proficiency (84%). Overexpression of p53 and/or evidence of β-catenin activation were identified in 13 CRCs. Ten patients (26%) had synchronous or metachronous CRCs. In conclusion, the majority of CRCs arising in individuals with SP do not harbor molecular hallmarks of serrated pathway CRCs but show a diverse range of molecular profiles. The high proportion of multiple CRCs suggests that individuals with SP would benefit from frequent colonoscopic surveillance and from a consideration of a more extensive colectomy at the time of CRC diagnosis.

  3. When, and how, should we introduce a combination measles-mumps-rubella (MMR) vaccine into the national childhood expanded immunization programme in South Africa?

    PubMed

    Cameron, Neil A

    2012-09-01

    This article briefly reviews the history and epidemiology of measles, mumps and rubella disease and the case for introducing combination measles-mumps-rubella (MMR) vaccine into the national childhood immunization schedule in South Africa. Despite adopting the World Health Organization's Measles Elimination strategy in 1996 and achieving a significant decrease the incidence of measles, added effort is needed in South and southern Africa to reach the goal to eliminate endogenous spread measles. Mumps is still common disease of childhood and while there are few sequelae, even the rare complications are important in large populations. Congenital rubella syndrome is seldom reported, but it is estimated that of the million or so children born every year in South Africa over 600 infants are affected to some degree by rubella infection. The naturally acquired immunity to rubella in women of childbearing age in South Africa has been estimated at over 90%, so that introducing a rubella containing vaccine in childhood may paradoxically increase the proportion of girls reaching puberty still susceptible to rubella. The elimination of endogenous measles and rubella is being achieved in many countries in South America, and despite the recent measles epidemic, must still be seriously considered for South and southern Africa. Current constraints and potential steps needed to reach the goal in South Africa are discussed.

  4. The budding yeast Msh4 protein functions in chromosome synapsis and the regulation of crossover distribution.

    PubMed Central

    Novak, J E; Ross-Macdonald, P B; Roeder, G S

    2001-01-01

    The budding yeast MSH4 gene encodes a MutS homolog produced specifically in meiotic cells. Msh4 is not required for meiotic mismatch repair or gene conversion, but it is required for wild-type levels of crossing over. Here, we show that a msh4 null mutation substantially decreases crossover interference. With respect to the defect in interference and the level of crossing over, msh4 is similar to the zip1 mutant, which lacks a structural component of the synaptonemal complex (SC). Furthermore, epistasis tests indicate that msh4 and zip1 affect the same subset of meiotic crossovers. In the msh4 mutant, SC formation is delayed compared to wild type, and full synapsis is achieved in only about half of all nuclei. The simultaneous defects in synapsis and interference observed in msh4 (and also zip1 and ndj1/tam1) suggest a role for the SC in mediating interference. The Msh4 protein localizes to discrete foci on meiotic chromosomes and colocalizes with Zip2, a protein involved in the initiation of chromosome synapsis. Both Zip2 and Zip1 are required for the normal localization of Msh4 to chromosomes, raising the possibility that the zip1 and zip2 defects in crossing over are indirect, resulting from the failure to localize Msh4 properly. PMID:11454751

  5. A screen for hydroxymethylcytosine and formylcytosine binding proteins suggests functions in transcription and chromatin regulation

    PubMed Central

    2013-01-01

    Background DNA methylation (5mC) plays important roles in epigenetic regulation of genome function. Recently, TET hydroxylases have been found to oxidise 5mC to hydroxymethylcytosine (5hmC), formylcytosine (5fC) and carboxylcytosine (5caC) in DNA. These derivatives have a role in demethylation of DNA but in addition may have epigenetic signaling functions in their own right. A recent study identified proteins which showed preferential binding to 5-methylcytosine (5mC) and its oxidised forms, where readers for 5mC and 5hmC showed little overlap, and proteins bound to further oxidation forms were enriched for repair proteins and transcription regulators. We extend this study by using promoter sequences as baits and compare protein binding patterns to unmodified or modified cytosine using DNA from mouse embryonic stem cell extracts. Results We compared protein enrichments from two DNA probes with different CpG composition and show that, whereas some of the enriched proteins show specificity to cytosine modifications, others are selective for both modification and target sequences. Only a few proteins were identified with a preference for 5hmC (such as RPL26, PRP8 and the DNA mismatch repair protein MHS6), but proteins with a strong preference for 5fC were more numerous, including transcriptional regulators (FOXK1, FOXK2, FOXP1, FOXP4 and FOXI3), DNA repair factors (TDG and MPG) and chromatin regulators (EHMT1, L3MBTL2 and all components of the NuRD complex). Conclusions 0ur screen has identified novel proteins that bind to 5fC in genomic sequences with different CpG composition and suggests they regulate transcription and chromatin, hence opening up functional investigations of 5fC readers. PMID:24156278

  6. Proteins.

    ERIC Educational Resources Information Center

    Doolittle, Russell F.

    1985-01-01

    Examines proteins which give rise to structure and, by virtue of selective binding to other molecules, make genes. Binding sites, amino acids, protein evolution, and molecular paleontology are discussed. Work with encoding segments of deoxyribonucleic acid (exons) and noncoding stretches (introns) provides new information for hypotheses. (DH)

  7. Protein

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Proteins are the major structural and functional components of all cells in the body. They are macromolecules that comprise 1 or more chains of amino acids that vary in their sequence and length and are folded into specific 3-dimensional structures. The sizes and conformations of proteins, therefor...

  8. Mlh1 Can Function in Antibody Class Switch Recombination Independently of Msh2

    PubMed Central

    Schrader, Carol E.; Vardo, Joycelyn; Stavnezer, Janet

    2003-01-01

    Mismatch repair proteins participate in antibody class switch recombination, although their roles are unknown. Previous nucleotide sequence analyses of switch recombination junctions indicated that the roles of Msh2 and the MutL homologues, Mlh1 and Pms2, differ. We now asked if Msh2 and Mlh1 function in the same pathway during switch recombination. Splenic B cells from mice deficient in both these proteins were induced to undergo switching in culture. The frequency of switching is reduced, similarly to that of B cells singly deficient in Msh2 or Mlh1. However, the nucleotide sequences of the Sμ-Sγ3 junctions resemble junctions from Mlh1- but not from Msh2-deficient cells, suggesting Mlh1 functions either independently of or before Msh2. The substitution mutations within S regions that are known to accompany switch recombination are increased in Msh2- and Mlh1 single-deficient cells and further increased in the double-deficient cells, again suggesting these proteins function independently in class switch recombination. The finding that MMR functions to reduce mutations in switch regions is unexpected since MMR proteins have been shown to contribute to somatic hypermutation of antibody variable region genes. PMID:12743174

  9. RNA 3'-end mismatch excision by the severe acute respiratory syndrome coronavirus nonstructural protein nsp10/nsp14 exoribonuclease complex.

    PubMed

    Bouvet, Mickaël; Imbert, Isabelle; Subissi, Lorenzo; Gluais, Laure; Canard, Bruno; Decroly, Etienne

    2012-06-12

    The replication/transcription complex of severe acute respiratory syndrome coronavirus is composed of at least 16 nonstructural proteins (nsp1-16) encoded by the ORF-1a/1b. This complex includes replication enzymes commonly found in positive-strand RNA viruses, but also a set of RNA-processing activities unique to some nidoviruses. The nsp14 protein carries both exoribonuclease (ExoN) and (guanine-N7)-methyltransferase (N7-MTase) activities. The nsp14 ExoN activity ensures a yet-uncharacterized function in the virus life cycle and must be regulated to avoid nonspecific RNA degradation. In this work, we show that the association of nsp10 with nsp14 stimulates >35-fold the ExoN activity of the latter while playing no effect on N7-MTase activity. Nsp10 mutants unable to interact with nsp14 are not proficient for ExoN activation. The nsp10/nsp14 complex hydrolyzes double-stranded RNA in a 3' to 5' direction as well as a single mismatched nucleotide at the 3'-end mimicking an erroneous replication product. In contrast, di-, tri-, and longer unpaired ribonucleotide stretches, as well as 3'-modified RNAs, resist nsp10/nsp14-mediated excision. In addition to the activation of nsp16-mediated 2'-O-MTase activity, nsp10 also activates nsp14 in an RNA processing function potentially connected to a replicative mismatch repair mechanism. PMID:22635272

  10. Proteins

    NASA Astrophysics Data System (ADS)

    Regnier, Fred E.; Gooding, Karen M.

    Because of the complexity of cellular material and body fluids, it is seldom possible to analyze a natural product directly. Qualitative and quantitative analyses must often be preceded by some purification step that separates the molecular species being examined from interfering materials. In the case of proteins, column liquid chromatography has been used extensively for these fractionations. With the advent of gel permeation, cation exchange, anion exchange, hydrophobic, and affinity chromatography, it became possible to resolve proteins through their fundamental properties of size, charge, hydrophobicity, and biological affinity. The chromatographic separations used in the early isolation and characterization of many proteins later became analytical tools in their routine analysis. Unfortunately, these inherently simple and versatile column chromatographic techniques introduced in the 50s and 60s have a severe limitation in routine analysis-separation time. It is common to encounter 1-24 h separation times with the classical gel-type supports.

  11. Human MSH2 protein

    DOEpatents

    Chapelle, A. de la; Vogelstein, B.; Kinzler, K.W.

    1997-01-07

    The human MSH2 gene, responsible for hereditary non-polyposis colorectal cancer, was identified by virtue of its homology to the MutS class of genes, which are involved in DNA mismatch repair. The sequence of cDNA clones of the human gene are provided, and the sequence of the gene can be used to demonstrate the existence of germ line mutations in hereditary non-polyposis colorectal cancer (HNPCC) kindreds, as well as in replication error{sup +} (RER{sup +}) tumor cells. 19 figs.

  12. Human MSH2 protein

    DOEpatents

    de la Chapelle, Albert; Vogelstein, Bert; Kinzler, Kenneth W.

    1997-01-01

    The human MSH2 gene, responsible for hereditary non-polyposis colorectal cancer, was identified by virtue of its homology to the MutS class of genes, which are involved in DNA mismatch repair. The sequence of cDNA clones of the human gene are provided, and the sequence of the gene can be used to demonstrate the existence of germ line mutations in hereditary non-polyposis colorectal cancer (HNPCC) kindreds, as well as in replication error.sup.+ (RER.sup.+) tumor cells.

  13. Genetic analysis of mlh3 mutations reveals interactions between crossover promoting factors during meiosis in baker's yeast.

    PubMed

    Sonntag Brown, Megan; Lim, Elisha; Chen, Cheng; Nishant, K T; Alani, Eric

    2013-01-01

    Crossing over between homologous chromosomes occurs during the prophase of meiosis I and is critical for chromosome segregation. In baker's yeast, two heterodimeric complexes, Msh4-Msh5 and Mlh1-Mlh3, act in meiosis to promote interference-dependent crossing over. Mlh1-Mlh3 also plays a role in DNA mismatch repair (MMR) by interacting with Msh2-Msh3 to repair insertion and deletion mutations. Mlh3 contains an ATP-binding domain that is highly conserved among MLH proteins. To explore roles for Mlh3 in meiosis and MMR, we performed a structure-function analysis of eight mlh3 ATPase mutants. In contrast to previous work, our data suggest that ATP hydrolysis by both Mlh1 and Mlh3 is important for both meiotic and MMR functions. In meiotic assays, these mutants showed a roughly linear relationship between spore viability and genetic map distance. To further understand the relationship between crossing over and meiotic viability, we analyzed crossing over on four chromosomes of varying lengths in mlh3Δ mms4Δ strains and observed strong decreases (6- to 17-fold) in crossing over in all intervals. Curiously, mlh3Δ mms4Δ double mutants displayed spore viability levels that were greater than observed in mms4Δ strains that show modest defects in crossing over. The viability in double mutants also appeared greater than would be expected for strains that show such severe defects in crossing over. Together, these observations provide insights for how Mlh1-Mlh3 acts in crossover resolution and MMR and for how chromosome segregation in Meiosis I can occur in the absence of crossing over.

  14. Association Between IHC and MSI Testing to Identify Mismatch Repair–Deficient Patients with Ovarian Cancer

    PubMed Central

    Lee, Ji-Hyun; Cragun, Deborah; Thompson, Zachary; Coppola, Domenico; Nicosia, Santo V.; Akbari, Mohammad; Zhang, Shiyu; McLaughlin, John; Narod, Steven; Schildkraut, Joellen; Sellers, Thomas A.

    2014-01-01

    Objective: In epithelial ovarian cancer, concordance between results of microsatellite instability (MSI) and immunohistochemical (IHC) testing has not been demonstrated. This study evaluated the association of MSI-high (MSI-H) status with loss of expression (LoE) of mismatch repair (MMR) proteins on IHC and assessed for potential factors affecting the strength of the association. Methods: Tumor specimens from three population-based studies of epithelial ovarian cancer were stained for MMR proteins through manual or automated methods, and results were interpreted by one of two pathologists. Tumor and germline DNA was extracted and MSI testing performed. Multivariable logistic regression models were fitted to predict loss of IHC expression based on MSI status after adjusting for staining method and reading pathologist. Results: Of 834 cases, 564 (67.6%) were concordant; 41 were classified as MSI-H with LoE and 523 as microsatellite stable (MSS) with no LoE. Of the 270 discordant cases, 83 were MSI-H with no LoE and 187 were MSS with LoE. Both IHC staining method and reading pathologist were strongly associated with discordant results. Conclusions: Lack of concordance in the current study may be related to inconsistencies in IHC testing methods and interpretation. Results support the need for validation studies before routine screening of ovarian tumors is implemented in clinical practice for the purpose of identifying Lynch syndrome. PMID:24592941

  15. Lack of Association between Membrane-Type 1 Matrix Metalloproteinase Expression and Clinically Relevant Molecular or Morphologic Tumor Characteristics at the Leading Edge of Invasive Colorectal Carcinoma

    PubMed Central

    Arndt, Annette; Kraft, Klaus; Wardelmann, Eva; Steinestel, Konrad

    2015-01-01

    Colorectal cancer (CRC) is one of the leading causes of death from cancer in the western world, but tumor biology and clinical course show great interindividual variation. Molecular and morphologic tumor characteristics, such as KRAS/BRAF mutation status, mismatch repair (MMR) protein expression, tumor growth pattern, and tumor cell budding, have been shown to be of key therapeutic and/or prognostic relevance in CRC. Membrane-type 1 matrix metalloproteinase (MT1-MMP) is a membrane-anchored zinc-binding endopeptidase that is expressed at the leading edge of various invasive carcinomas and promotes tumor cell invasion through degradation of the extracellular matrix. The aim of this study was to investigate possible associations between MT1-MMP expression and molecular tumor characteristics as well as morphologic features of tumor aggressiveness in a consecutive series of 79 CRC tissue samples. However, although MT1-MMP was expressed in 41/79 samples (52%), there was no significant association between MT1-MMP expression and KRAS/BRAF mutation status, MMR protein expression, presence of lymphovascular invasion, tumor growth pattern, tumor-infiltrating lymphocytes, or tumor cell budding in our sample cohort (P > 0.05). Thus, we conclude that although MT1-MMP may play a role in CRC invasion, it is not of key relevance to the current models of CRC invasion and aggressiveness. PMID:26106602

  16. Site- and strand-specific nicking of DNA by fusion proteins derived from MutH and I-SceI or TALE repeats.

    PubMed

    Gabsalilow, Lilia; Schierling, Benno; Friedhoff, Peter; Pingoud, Alfred; Wende, Wolfgang

    2013-04-01

    Targeted genome engineering requires nucleases that introduce a highly specific double-strand break in the genome that is either processed by homology-directed repair in the presence of a homologous repair template or by non-homologous end-joining (NHEJ) that usually results in insertions or deletions. The error-prone NHEJ can be efficiently suppressed by 'nickases' that produce a single-strand break rather than a double-strand break. Highly specific nickases have been produced by engineering of homing endonucleases and more recently by modifying zinc finger nucleases (ZFNs) composed of a zinc finger array and the catalytic domain of the restriction endonuclease FokI. These ZF-nickases work as heterodimers in which one subunit has a catalytically inactive FokI domain. We present two different approaches to engineer highly specific nickases; both rely on the sequence-specific nicking activity of the DNA mismatch repair endonuclease MutH which we fused to a DNA-binding module, either a catalytically inactive variant of the homing endonuclease I-SceI or the DNA-binding domain of the TALE protein AvrBs4. The fusion proteins nick strand specifically a bipartite recognition sequence consisting of the MutH and the I-SceI or TALE recognition sequences, respectively, with a more than 1000-fold preference over a stand-alone MutH site. TALE-MutH is a programmable nickase.

  17. A novel protein, Rsf1/Pxd1, is critical for the single-strand annealing pathway of double-strand break repair in Schizosaccharomyces pombe.

    PubMed

    Wang, Hanqian; Zhang, Zhanlu; Zhang, Lan; Zhang, Qiuxue; Zhang, Liang; Zhao, Yangmin; Wang, Weibu; Fan, Yunliu; Wang, Lei

    2015-06-01

    The process of single-strand annealing (SSA) repairs DNA double-strand breaks that are flanked by direct repeat sequences through the coordinated actions of a series of proteins implicated in recombination, mismatch repair and nucleotide excision repair (NER). Many of the molecular and mechanistic insights gained in SSA repair have principally come from studies in the budding yeast Saccharomyces cerevisiae. However, there is little molecular understanding of the SSA pathway in the fission yeast Schizosaccharomyces pombe. To further our understanding of this important process, we established a new chromosome-based SSA assay in fission yeast. Our genetic analyses showed that, although many homologous components participate in SSA repair in these species indicating that some evolutionary conservation, Saw1 and Slx4 are not principal agents in the SSA repair pathway in fission yeast. This is in marked contrast to the function of Saw1 and Slx4 in budding yeast. Additionally, a novel genus-specific protein, Rsf1/Pxd1, physically interacts with Rad16, Swi10 and Saw1 in vitro and in vivo. We find that Rsf1/Pxd1 is not required for NER and demonstrate that, in fission yeast, Rsf1/Pxd1, but not Saw1, plays a critical role in SSA recombination.

  18. Prevalence of Lynch Syndrome among Patients with Newly Diagnosed Endometrial Cancers

    PubMed Central

    Egoavil, Cecilia; Alenda, Cristina; Castillejo, Adela; Paya, Artemio; Peiro, Gloria; Sánchez-Heras, Ana-Beatriz; Castillejo, Maria-Isabel; Rojas, Estefanía; Barberá, Víctor-Manuel; Cigüenza, Sonia; Lopez, Jose-Antonio; Piñero, Oscar; Román, Maria-Jose; Martínez-Escoriza, Juan-Carlos; Guarinos, Carla; Perez-Carbonell, Lucia; Aranda, Francisco-Ignacio; Soto, Jose-Luis

    2013-01-01

    Background Lynch syndrome (LS) is a hereditary condition that increases the risk for endometrial and other cancers. The identification of endometrial cancer (EC) patients with LS has the potential to influence life-saving interventions. We aimed to study the prevalence of LS among EC patients in our population. Methods Universal screening for LS was applied for a consecutive series EC. Tumor testing using microsatellite instability (MSI), immunohistochemistry (IHC) for mismatch-repair (MMR) protein expression and MLH1-methylation analysis, when required, was used to select LS-suspicious cases. Sequencing of corresponding MMR genes was performed. Results One hundred and seventy-three EC (average age, 63 years) were screened. Sixty-one patients (35%) had abnormal IHC or MSI results. After MLH1 methylation analysis, 27 cases were considered suspicious of LS. From these, 22 were contacted and referred for genetic counseling. Nineteen pursued genetic testing and eight were diagnosed of LS. Mutations were more frequent in younger patients (<50 yrs). Three cases had either intact IHC or MSS and reinforce the need of implement the EC screening with both techniques. Conclusion The prevalence of LS among EC patients was 4.6% (8/173); with a predictive frequency of 6.6% in the Spanish population. Universal screening of EC for LS is recommended. PMID:24244552

  19. The Medicinal Chemistry of Imidazotetrazine Prodrugs

    PubMed Central

    Moody, Catherine L.; Wheelhouse, Richard T

    2014-01-01

    Temozolomide (TMZ) is the standard first line treatment for malignant glioma, reaching “blockbuster” status in 2010, yet it remains the only drug in its class. The main constraints on the clinical effectiveness of TMZ therapy are its requirement for active DNA mismatch repair (MMR) proteins for activity, and inherent resistance through O6-methyl guanine-DNA methyl transferase (MGMT) activity. Moreover, acquired resistance, due to MMR mutation, results in aggressive TMZ-resistant tumour regrowth following good initial responses. Much of the attraction in TMZ as a drug lies in its PK/PD properties: it is acid stable and has 100% oral bioavailability; it also has excellent distribution properties, crosses the blood-brain barrier, and there is direct evidence of tumour localisation. This review seeks to unravel some of the mysteries of the imidazotetrazine class of compounds to which TMZ belongs. In addition to an overview of different synthetic strategies, we explore the somewhat unusual chemical reactivity of the imidazotetrazines, probing their mechanisms of reaction, examining which attributes are required for an active drug molecule and reviewing the use of this combined knowledge towards the development of new and improved anti-cancer agents. PMID:25014631

  20. Structure of the Human MutSa DNA Lesion Recognition Complex

    SciTech Connect

    Warren,J.; Pohlhaus, T.; Changela, A.; Iyer, R.; Modrich, P.; Beese, L.

    2007-01-01

    Mismatch repair (MMR) ensures the fidelity of DNA replication, initiates the cellular response to certain classes of DNA damage, and has been implicated in the generation of immune diversity. Each of these functions depends on MutS{alpha} (MSH2{center_dot}MSH6 heterodimer). Inactivation of this protein complex is responsible for tumor development in about half of known hereditary nonpolyposis colorectal cancer kindreds and also occurs in sporadic tumors in a variety of tissues. Here, we describe a series of crystal structures of human MutS{alpha} bound to different DNA substrates, each known to elicit one of the diverse biological responses of the MMR pathway. All lesions are recognized in a similar manner, indicating that diversity of MutS{alpha}-dependent responses to DNA lesions is generated in events downstream of this lesion recognition step. This study also allows rigorous mapping of cancer-causing mutations and furthermore suggests structural pathways for allosteric communication between different regions within the heterodimer.

  1. A highly precise and portable genome engineering method allows comparison of mutational effects across bacterial species

    PubMed Central

    Nyerges, Ákos; Csörgő, Bálint; Nagy, István; Bálint, Balázs; Bihari, Péter; Lázár, Viktória; Apjok, Gábor; Umenhoffer, Kinga; Bogos, Balázs; Pósfai, György; Pál, Csaba

    2016-01-01

    Currently available tools for multiplex bacterial genome engineering are optimized for a few laboratory model strains, demand extensive prior modification of the host strain, and lead to the accumulation of numerous off-target modifications. Building on prior development of multiplex automated genome engineering (MAGE), our work addresses these problems in a single framework. Using a dominant-negative mutant protein of the methyl-directed mismatch repair (MMR) system, we achieved a transient suppression of DNA repair in Escherichia coli, which is necessary for efficient oligonucleotide integration. By integrating all necessary components into a broad-host vector, we developed a new workflow we term pORTMAGE. It allows efficient modification of multiple loci, without any observable off-target mutagenesis and prior modification of the host genome. Because of the conserved nature of the bacterial MMR system, pORTMAGE simultaneously allows genome editing and mutant library generation in other biotechnologically and clinically relevant bacterial species. Finally, we applied pORTMAGE to study a set of antibiotic resistance-conferring mutations in Salmonella enterica and E. coli. Despite over 100 million y of divergence between the two species, mutational effects remained generally conserved. In sum, a single transformation of a pORTMAGE plasmid allows bacterial species of interest to become an efficient host for genome engineering. These advances pave the way toward biotechnological and therapeutic applications. Finally, pORTMAGE allows systematic comparison of mutational effects and epistasis across a wide range of bacterial species. PMID:26884157

  2. Cadmium-induced genetic instability in mice testis.

    PubMed

    Oliveira, Helena; Lopes, Tina; Almeida, Tânia; Pereira, Maria de Lourdes; Santos, Conceição

    2012-12-01

    Cadmium is a well recognized carcinogenic, cytotoxic and mutagenic transition metal. Recent evidence suggests that the proteins participating in the DNA repair systems, especially in excision and mismatch repair (MMR), are sensitive targets of cadmium toxicity. Microsatellite instability (MSI) is regarded as one of the phenotypes of defective DNA MMR and, consequently, as a marker of high risk for cancer. The purpose of this work is to determine whether cadmium, in the form of cadmium chloride (CdCl(2)), may induce microsatellite mutations in murine testes. For this study, 2-month-old male ICR-CD1 mice were treated by a single subcutaneous injection of 1, 2 and 3 mg CdCl(2)/kg body weight and killed after 35 days. A panel of six microsatellite markers, previously reported as being the most sensitive in detecting MSI in murine tumours, was used in this study. The results show that CdCl(2) in the doses of 2 and 3 mg/kg induced a decrease in the testis weight and severe histopathologic changes with complete disorganization of testicular structure and evidences of severe necrosis. In addition, the animals exposed to the lowest CdCl(2) dose presented MSI in the testis. The results indicate the existence of MSI in at least two nuclear loci suggesting putative genotoxic effects induced by cadmium. PMID:22699117

  3. Thyroid cancer in a patient with a germline MSH2 mutation. Case report and review of the Lynch syndrome expanding tumour spectrum

    PubMed Central

    Stulp, Rein P; Herkert, Johanna C; Karrenbeld, Arend; Mol, Bart; Vos, Yvonne J; Sijmons, Rolf H

    2008-01-01

    Lynch syndrome (HNPCC) is a dominantly inherited disorder characterized by germline defects in DNA mismatch repair (MMR) genes and the development of a variety of cancers, predominantly colorectal and endometrial. We present a 44-year-old woman who was shown to carry the truncating MSH2 gene mutation that had previously been identified in her family. Recently, she had been diagnosed with an undifferentiated carcinoma of the thyroid and an adenoma of her coecum. Although the thyroid carcinoma was not MSI-high (1 out of 5 microsatellites instable), it did show complete loss of immunohistochemical expression for the MSH2 protein, suggesting that this tumour was not coincidental. Although the risks for some tumour types, including breast cancer, soft tissue sarcoma and prostate cancer, are not significantly increased in Lynch syndrome, MMR deficiency in the presence of a corresponding germline defect has been demonstrated in incidental cases of a growing range of tumour types, which is reviewed in this paper. Interestingly, the MSH2-associated tumour spectrum appears to be wider than that of MLH1 and generally the risk for most extra-colonic cancers appears to be higher for MSH2 than for MLH1 mutation carriers. Together with a previously reported case, our findings show that anaplastic thyroid carcinoma can develop in the setting of Lynch syndrome. Uncommon Lynch syndrome-associated tumour types might be useful in the genetic analysis of a Lynch syndrome suspected family if samples from typical Lynch syndrome tumours are unavailable. PMID:19706203

  4. Germline mutation analysis of MLH1 and MSH2 in Malaysian Lynch syndrome patients

    PubMed Central

    Zahary, Mohd Nizam; Kaur, Gurjeet; Abu Hassan, Muhammad Radzi; Singh, Harjinder; Naik, Venkatesh R; Ankathil, Ravindran

    2012-01-01

    AIM: To investigate the protein expression profile of mismatch repair (MMR) genes in suspected cases of Lynch syndrome and to characterize the associated germline mutations. METHODS: Immunohistochemical analysis of tumor samples was performed to determine the protein expression profile of MMR protein. Germline mutation screening was carried out on peripheral blood samples. The entire exon regions of MLH1 and MSH2 genes were amplified by polymerase chain reaction, screened by denaturing high performance liquid chromatography (dHPLC) and analyzed by DNA sequencing to characterize the germline mutations. RESULTS: Three out of 34 tissue samples (8.8%) and four out of 34 tissue samples (11.8%) showed loss of nuclear staining by immunohistochemistry, indicating the absence of MLH1 and MSH2 protein expression in carcinoma cells, respectively. dHPLC analysis followed by DNA sequencing showed these samples to have germline mutations of MSH2 gene. However, no deleterious mutations were identified in any of the 19 exons or coding regions of MLH1 gene, but we were able to identify MLH1 promoter polymorphism, -93G > A (rs1800734), in 21 out of 34 patients (61.8%). We identified one novel mutation, transversion mutation c.2005G > C, which resulted in a missense mutation (Gly669Arg), a transversion mutation in exon 1, c.142G > T, which resulted in a nonsense mutation (Glu48Stop) and splice-site mutation, c.2006-6T > C, which was adjacent to exon 13 of MSH2 gene. CONCLUSION: Germline mutations were identified in four Malaysian Lynch syndrome patients. Immunohistochemical analysis of tumor tissue proved to be a good pre-screening test before proceeding to germline mutation analysis of DNA MMR genes. PMID:22371642

  5. Early onset of colorectal cancer in a 13-year-old girl with Lynch syndrome

    PubMed Central

    Ahn, Do Hee; Rho, Jung Hee; Tchah, Hann

    2016-01-01

    Lynch syndrome is the most common inherited colon cancer syndrome. Patients with Lynch syndrome develop a range of cancers including colorectal cancer (CRC) and carry a mutation on one of the mismatched repair (MMR) genes. Although CRC usually occurs after the fourth decade in patients with Lynch syndrome harboring a heterozygous MMR gene mutation, it can occur in children with Lynch syndrome who have a compound heterozygous or homozygous MMR gene mutation. We report a case of CRC in a 13-year-old patient with Lynch syndrome and congenital heart disease. This patient had a heterozygous mutation in MLH1 (an MMR gene), but no compound MMR gene defects, and a K-RAS somatic mutation in the cancer cells. PMID:26893603

  6. Four novel MSH2 / MLH1 gene mutations in portuguese HNPCC families.

    PubMed

    Isidro, G; Veiga, I; Matos, P; Almeida, S; Bizarro, S; Marshall, B; Baptista, M; Leite, J; Regateiro, F; Soares, J; Castedo, S; Boavida, M G

    2000-01-01

    Hereditary non-polyposis colorectal cancer (HNPCC) is considered to be determined by germline mutations in the mismatch repair (MMR) genes, especially MSH2 and MLH1. While screening for mutations in these two genes in HNPCC portuguese families, 3 previously unreported MSH2 and 1 MLH1 mutations have been identified in families meeting strict Amsterdam criteria. Hum Mutat 15:116, 2000. PMID:10612836

  7. Somatic molecular changes and histo-pathological features of colorectal cancer in Tunisia

    PubMed Central

    Aissi, Sana; Buisine, Marie Pierre; Zerimech, Farid; Kourda, Nadia; Moussa, Amel; Manai, Mohamed; Porchet, Nicole

    2013-01-01

    AIM: To determine correlations between family history, clinical features and mutational status of genes involved in the progression of colorectal cancer (CRC). METHODS: Histo-pathological features and molecular changes [KRAS, BRAF and CTNNB1 genes mutations, microsatellite instability (MSI) phenotype, expression of mismatch repair (MMR) and mucin (MUC) 5AC proteins, mutation and expression analysis of TP53, MLH1 promoter hypermethylation analysis] were examined in a series of 51 unselected Tunisian CRC patients, 10 of them had a proven or probable hereditary disease, on the track of new tumoral markers for CRC susceptibility in Tunisian patients. RESULTS: As expected, MSI and MMR expression loss were associated to the presence of familial CRC (75% vs 9%, P < 0.001). However, no significant associations have been detected between personal or familial cancer history and KRAS (codons 12 and 13) or TP53 (exons 4-9) alterations. A significant inverse relationship has been observed between the presence of MSI and TP53 accumulation (10.0% vs 48.8%, P = 0.0335) in CRC tumors, suggesting different molecular pathways to CRC that in turn may reflect different environmental exposures. Interestingly, MUC5AC expression was significantly associated to the presence of MSI (46.7% vs 8.3%, P = 0.0039), MMR expression loss (46.7% vs 8.3%, P = 0.0039) and the presence of familial CRC (63% vs 23%, P = 0.039). CONCLUSION: These findings suggest that MUC5AC expression analysis may be useful in the screening of Tunisian patients with high risk of CRC. PMID:23983431

  8. Efficacy of Adjuvant 5-Fluorouracil Therapy for Patients with EMAST-Positive Stage II/III Colorectal Cancer

    PubMed Central

    Hamaya, Yasushi; Guarinos, Carla; Tseng-Rogenski, Stephanie S.; Iwaizumi, Moriya; Das, Ritabrata; Jover, Rodrigo; Castells, Antoni; Llor, Xavier; Andreu, Montserrat; Carethers, John M.

    2015-01-01

    Elevated Microsatellite Alterations at Selected Tetranucleotide repeats (EMAST) is a genetic signature found in up to 60% of colorectal cancers (CRCs) that is caused by somatic dysfunction of the DNA mismatch repair (MMR) protein hMSH3. We have previously shown in vitro that recognition of 5-fluorouracil (5-FU) within DNA and subsequent cytotoxicity was most effective when both hMutSα (hMSH2-hMSH6 heterodimer) and hMutSβ (hMSH2-hMSH3 heterodimer) MMR complexes were present, compared to hMutSα > hMutSβ alone. We tested if patients with EMAST CRCs (hMutSβ defective) had diminished response to adjuvant 5-FU chemotherapy, paralleling in vitro findings. We analyzed 230 patients with stage II/III sporadic colorectal cancers for which we had 5-FU treatment and survival data. Archival DNA was analyzed for EMAST (>2 of 5 markers mutated among UT5037, D8S321, D9S242, D20S82, D20S85 tetranucleotide loci). Kaplan-Meier survival curves were generated and multivariate analysis was used to determine contribution to risk. We identified 102 (44%) EMAST cancers. Ninety-four patients (41%) received adjuvant 5-FU chemotherapy, and median follow-up for all patients was 51 months. Patients with EMAST CRCs demonstrated improved survival with adjuvant 5FU to the same extent as patients with non-EMAST CRCs (P<0.05). We observed no difference in survival between patients with stage II/III EMAST and non-EMAST cancers (P = 0.36). There is improved survival for stage II/III CRC patients after adjuvant 5-FU-based chemotherapy regardless of EMAST status. The loss of contribution of hMSH3 for 5-FU cytotoxicity may not adversely affect patient outcome, contrasting patients whose tumors completely lack DNA MMR function (MSI-H). PMID:25996601

  9. Extensive Microsatellite Variation in Rice Induced by Introgression from Wild Rice (Zizania latifolia Griseb.)

    PubMed Central

    Dong, Zhenying; Wang, Hongyan; Dong, Yuzhu; Wang, Yongming; Liu, Wei; Miao, Gaojian; Lin, Xiuyun; Wang, Daqing; Liu, Bao

    2013-01-01

    Background It is widely accepted that interspecific hybridization may induce genomic instability in the resultant hybrids. However, few studies have been performed on the genomic analysis of homoploid hybrids and introgression lines. We have reported previously that by introgressive hybridization, a set of introgression lines between rice (Oryza sativa L.) and wild rice (Zizania latifolia Griseb.) was successfully generated, and which have led to the release of several cultivars. Methodology Using 96 microsatellite markers located in the nuclear and organelle genomes of rice, we investigated microsatellite stability in three typical introgression lines. Expression of a set of mismatch repair (MMR) genes and microsatellite-containing genes was also analyzed. Results/Conclusions Compared with the recipient rice cultivar (Matsumae), 55 of the 96 microsatellite loci revealed variation in one or more of the introgression lines, and 58.2% of the altered alleles were shared by at least two lines, indicating that most of the alterations had occurred in the early stages of introgression before their further differentiation. 73.9% of the non-shared variations were detected only in one introgression line, i.e. RZ2. Sequence alignment showed that the variations included substitutions and indels that occurred both within the repeat tracts and in the flanking regions. Interestingly, expression of a set of MMR genes altered dramatically in the introgression lines relative to their rice parent, suggesting participation of the MMR system in the generation of microsatellite variants. Some of the altered microsatellite loci are concordant with changed expression of the genes harboring them, suggesting their possible cis-regulatory roles in controlling gene expression. Because these genes bear meaningful homology to known-functional proteins, we conclude that the introgression-induced extensive variation of microsatellites may have contributed to the novel phenotypes in the

  10. Protein signatures as potential surrogate biomarkers for stratification and prediction of treatment response in chronic myeloid leukemia patients

    PubMed Central

    Alaiya, Ayodele A.; Aljurf, Mahmoud; Shinwari, Zakia; Almohareb, Fahad; Malhan, Hafiz; Alzahrani, Hazzaa; Owaidah, Tarek; Fox, Jonathan; Alsharif, Fahad; Mohamed, Said Y.; Rasheed, Walid; Aldawsari, Ghuzayel; Hanbali, Amr; Ahmed, Syed Osman; Chaudhri, Naeem

    2016-01-01

    There is unmet need for prediction of treatment response for chronic myeloid leukemia (CML) patients. The present study aims to identify disease-specific/disease-associated protein biomarkers detectable in bone marrow and peripheral blood for objective prediction of individual’s best treatment options and prognostic monitoring of CML patients. Bone marrow plasma (BMP) and peripheral blood plasma (PBP) samples from newly-diagnosed chronic-phase CML patients were subjected to expression-proteomics using quantitative two-dimensional gel electrophoresis (2-DE) and label-free liquid chromatography tandem mass spectrometry (LC-MS/MS). Analysis of 2-DE protein fingerprints preceding therapy commencement accurately predicts 13 individuals that achieved major molecular response (MMR) at 6 months from 12 subjects without MMR (No-MMR). Results were independently validated using LC-MS/MS analysis of BMP and PBP from patients that have more than 24 months followed-up. One hundred and sixty-four and 138 proteins with significant differential expression profiles were identified from PBP and BMP, respectively and only 54 proteins overlap between the two datasets. The protein panels also discriminates accurately patients that stay on imatinib treatment from patients ultimately needing alternative treatment. Among the identified proteins are TYRO3, a member of TAM family of receptor tyrosine kinases (RTKs), the S100A8, and MYC and all of which have been implicated in CML. Our findings indicate analyses of a panel of protein signatures is capable of objective prediction of molecular response and therapy choice for CML patients at diagnosis as ‘personalized-medicine-model’. PMID:27573699

  11. Protein signatures as potential surrogate biomarkers for stratification and prediction of treatment response in chronic myeloid leukemia patients.

    PubMed

    Alaiya, Ayodele A; Aljurf, Mahmoud; Shinwari, Zakia; Almohareb, Fahad; Malhan, Hafiz; Alzahrani, Hazzaa; Owaidah, Tarek; Fox, Jonathan; Alsharif, Fahad; Mohamed, Said Y; Rasheed, Walid; Aldawsari, Ghuzayel; Hanbali, Amr; Ahmed, Syed Osman; Chaudhri, Naeem

    2016-09-01

    There is unmet need for prediction of treatment response for chronic myeloid leukemia (CML) patients. The present study aims to identify disease-specific/disease-associated protein biomarkers detectable in bone marrow and peripheral blood for objective prediction of individual's best treatment options and prognostic monitoring of CML patients. Bone marrow plasma (BMP) and peripheral blood plasma (PBP) samples from newly-diagnosed chronic-phase CML patients were subjected to expression-proteomics using quantitative two-dimensional gel electrophoresis (2-DE) and label-free liquid chromatography tandem mass spectrometry (LC-MS/MS). Analysis of 2-DE protein fingerprints preceding therapy commencement accurately predicts 13 individuals that achieved major molecular response (MMR) at 6 months from 12 subjects without MMR (No-MMR). Results were independently validated using LC-MS/MS analysis of BMP and PBP from patients that have more than 24 months followed-up. One hundred and sixty-four and 138 proteins with significant differential expression profiles were identified from PBP and BMP, respectively and only 54 proteins overlap between the two datasets. The protein panels also discriminates accurately patients that stay on imatinib treatment from patients ultimately needing alternative treatment. Among the identified proteins are TYRO3, a member of TAM family of receptor tyrosine kinases (RTKs), the S100A8, and MYC and all of which have been implicated in CML. Our findings indicate analyses of a panel of protein signatures is capable of objective prediction of molecular response and therapy choice for CML patients at diagnosis as 'personalized-medicine-model'. PMID:27573699

  12. Lynch syndrome and Lynch syndrome mimics: The growing complex landscape of hereditary colon cancer

    PubMed Central

    Carethers, John M; Stoffel, Elena M

    2015-01-01

    Hereditary non-polyposis colorectal cancer (HNPCC) was previously synonymous with Lynch syndrome; however, identification of the role of germline mutations in the DNA mismatch repair (MMR) genes has made it possible to differentiate Lynch syndrome from other conditions associated with familial colorectal cancer (CRC). Broadly, HNPCC may be dichotomized into conditions that demonstrate defective DNA MMR and microsatellite instability (MSI) vs those conditions that demonstrate intact DNA MMR. Conditions characterized by MMR deficient CRCs include Lynch syndrome (germline MMR mutation), Lynch-like syndrome (biallelic somatic MMR mutations), constitutional MMR deficiency syndrome (biallelic germline MMR mutations), and sporadic MSI CRC (somatic biallelic methylation of MLH1). HNPCC conditions with intact DNA MMR associated with familial CRC include polymerase proofreading associated polyposis and familial colorectal cancer type X. Although next generation sequencing technologies have elucidated the genetic cause for some HNPCC conditions, others remain genetically undefined. Differentiating between Lynch syndrome and the other HNPCC disorders has profound implications for cancer risk assessment and surveillance of affected patients and their at-risk relatives. Clinical suspicion coupled with molecular tumor analysis and testing for germline mutations can help differentiate the clinical mimicry within HNPCC and facilitate diagnosis and management. PMID:26309352

  13. The C-terminal domain of the MutL homolog from Neisseria gonorrhoeae forms an inverted homodimer.

    PubMed

    Namadurai, Sivakumar; Jain, Deepti; Kulkarni, Dhananjay S; Tabib, Chaitanya R; Friedhoff, Peter; Rao, Desirazu N; Nair, Deepak T

    2010-01-01

    The mismatch repair (MMR) pathway serves to maintain the integrity of the genome by removing mispaired bases from the newly synthesized strand. In E. coli, MutS, MutL and MutH coordinate to discriminate the daughter strand through a mechanism involving lack of methylation on the new strand. This facilitates the creation of a nick by MutH in the daughter strand to initiate mismatch repair. Many bacteria and eukaryotes, including humans, do not possess a homolog of MutH. Although the exact strategy for strand discrimination in these organisms is yet to be ascertained, the required nicking endonuclease activity is resident in the C-terminal domain of MutL. This activity is dependent on the integrity of a conserved metal binding motif. Unlike their eukaryotic counterparts, MutL in bacteria like Neisseria exist in the form of a homodimer. Even though this homodimer would possess two active sites, it still acts a nicking endonuclease. Here, we present the crystal structure of the C-terminal domain (CTD) of the MutL homolog of Neisseria gonorrhoeae (NgoL) determined to a resolution of 2.4 Å. The structure shows that the metal binding motif exists in a helical configuration and that four of the six conserved motifs in the MutL family, including the metal binding site, localize together to form a composite active site. NgoL-CTD exists in the form of an elongated inverted homodimer stabilized by a hydrophobic interface rich in leucines. The inverted arrangement places the two composite active sites in each subunit on opposite lateral sides of the homodimer. Such an arrangement raises the possibility that one of the active sites is occluded due to interaction of NgoL with other protein factors involved in MMR. The presentation of only one active site to substrate DNA will ensure that nicking of only one strand occurs to prevent inadvertent and deleterious double stranded cleavage. PMID:21060849

  14. Diagnostic method employing MSH2 protein

    DOEpatents

    Chapelle, A. de la; Vogelstein, B.; Kinzler, K.W.

    1998-11-17

    The human MSH2 gene, responsible for hereditary non-polyposis colorectal cancer, was identified by virtue of its homology to the MutS class of genes, which are involved in DNA mismatch repair. The sequence of cDNA clones of the human gene are provided, and the sequence of the gene can be used to demonstrate the existence of germ line mutations in hereditary non-polyposis colorectal cancer (HNPCC) kindreds, as well as in replication error{sup +} (RER{sup +}) tumor cells. 19 figs.

  15. Diagnostic method employing MSH2 protein

    DOEpatents

    de la Chapelle, Albert; Vogelstein, Bert; Kinzler, Kenneth W.

    1998-01-01

    The human MSH2 gene, responsible for hereditary non-polyposis colorectal cancer, was identified by virtue of its homology to the MutS class of genes, which are involved in DNA mismatch repair. The sequence of cDNA clones of the human gene are provided, and the sequence of the gene can be used to demonstrate the existence of germ line mutations in hereditary non-polyposis colorectal cancer (HNPCC) kindreds, as well as in replication error.sup.+ (RER.sup.+) tumor cells.

  16. MLH1 promoter hypermethylation in the analytical algorithm of Lynch syndrome: a cost-effectiveness study

    PubMed Central

    Gausachs, Mireia; Mur, Pilar; Corral, Julieta; Pineda, Marta; González, Sara; Benito, Llúcia; Menéndez, Mireia; Espinàs, Josep Alfons; Brunet, Joan; Iniesta, María Dolores; Gruber, Stephen B; Lázaro, Conxi; Blanco, Ignacio; Capellá, Gabriel

    2012-01-01

    The analytical algorithm of Lynch syndrome (LS) is increasingly complex. BRAF V600E mutation and MLH1 promoter hypermethylation have been proposed as a screening tool for the identification of LS. The aim of this study was to assess the clinical usefulness and cost-effectiveness of both somatic alterations to improve the yield of the diagnostic algorithm of LS. A total of 122 colorectal tumors from individuals with family history of colorectal cancer that showed microsatellite instability and/or loss of mismatch repair (MMR) protein expression were studied. MMR germline mutations were detected in 57 cases (40 MLH1, 15 MSH2 and 2 MSH6). BRAF V600E mutation was assessed by single-nucleotide primer extension. MLH1 promoter hypermethylation was assessed by methylation-specific multiplex ligation-dependent probe amplification in a subset of 71 cases with loss of MLH1 protein. A decision model was developed to estimate the incremental costs of alternative case-finding methods for detecting MLH1 mutation carriers. One-way sensitivity analysis was performed to assess robustness of estimations. Sensitivity of the absence of BRAF mutations for depiction of LS patients was 96% (23/24) and specificity was 28% (13/47). Specificity of MLH1 promoter hypermethylation for depiction of sporadic tumors was 66% (31/47) and sensitivity of 96% (23/24). The cost per additional mutation detected when using hypermethylation analysis was lower when compared with BRAF study and germinal MLH1 mutation study. Somatic hypermethylation of MLH1 is an accurate and cost-effective pre-screening method in the selection of patients that are candidates for MLH1 germline analysis when LS is suspected and MLH1 protein expression is absent. PMID:22274583

  17. A large observational study to concurrently assess persistence of measles specific B-cell and T-cell immunity in individuals following two doses of MMR vaccine.

    PubMed

    Haralambieva, Iana H; Ovsyannikova, Inna G; O'Byrne, Megan; Pankratz, V Shane; Jacobson, Robert M; Poland, Gregory A

    2011-06-15

    The measurement of measles-specific neutralizing antibodies, directed against the surface measles virus hemagglutinin and fusion proteins, is considered the gold standard in measles serology. We assessed functional measles-specific neutralizing antibody levels in a racially diverse cohort of 763 young healthy adolescents after receipt of two doses of measles-mumps-rubella vaccine, by the use of an automated plaque reduction microneutralization (PRMN) assay, and evaluated their relevance to protective antibody levels, as well as their associations with demographic and clinical variables. We also concurrently assessed measles-specific IFNγ Elispot responses and their relation to the observed antibody concentrations. The geometric mean titer for our cohort was 832mIU/mL (95% CIs: 776; 891). Sixty-eight subjects (8.9%) had antibody concentrations of less than the protective threshold of 210mIU/mL (corresponding to PRMN titer of 120; suggesting protection against symptomatic disease), and 177 subjects (23.2%) demonstrated persisting antibody concentrations above 1841mIU/mL (corresponding to PRMN titer of 1052; suggesting total protection against viral infection), 7.4 years after vaccination, in the absence of wild-type virus boosting. The mean measles-specific IFNγ Elispot response for our cohort was 46 (95% CIs: 43; 49) IFNγ-positive spots per 200,000 cells with no relation of cellular immunity measures to the observed antibody concentrations. No significant associations between antibody titers and demographic and clinical variables, including gender and race, were observed in our study. In conclusion, in a large observational study of measles immunity, we used an automated high-throughput measles virus-specific neutralization assay to measure humoral immunity, and concurrently determined measles-specific cellular immunity to aid the assessment of potential susceptibility to measles in vaccinated populations.

  18. A large observational study to concurrently assess persistence of measles specific B-cell and T-cell immunity in individuals following two doses of MMR vaccine

    PubMed Central

    Haralambieva, Iana H.; Ovsyannikova, Inna G.; O’Byrne, Megan; Pankratz, V. Shane; Jacobson, Robert M.; Poland, Gregory A.

    2011-01-01

    The measurement of measles-specific neutralizing antibodies, directed against the surface measles virus hemagglutinin and fusion proteins, is considered the gold standard in measles serology. We assessed functional measles-specific neutralizing antibody levels in a racially diverse cohort of 763 young healthy adolescents after receipt of two doses of measles-mumps-rubella vaccine, by the use of an automated plaque reduction microneutralization (PRMN) assay, and evaluated their relevance to protective antibody levels, as well as their associations with demographic and clinical variables. We also concurrently assessed measles-specific IFNγ Elispot responses and their relation to the observed antibody concentrations. The geometric mean titer for our cohort was 832 mIU/mL (95% CIs: 776; 891). Sixty-eight subjects (8.9%) had antibody concentrations of less than the protective threshold of 210 mIU/mL (corresponding to PRMN titer of 120; suggesting protection against symptomatic disease), and 177 subjects (23.2%) demonstrated persisting antibody concentrations above 1,841 mIU/mL (corresponding to PRMN titer of 1,052; suggesting total protection against viral infection), 7.4 years after vaccination, in the absence of wild-type virus boosting. The mean measles-specific IFNγ Elispot response for our cohort was 46 (95% CIs: 43; 49) IFNγ-positive spots per 200,000 cells with no relation of cellular immunity measures to the observed antibody concentrations. No significant associations between antibody titers and demographic and clinical variables, including gender and race, were observed in our study. In conclusion, in a large observational study of measles immunity, we used an automated high-throughput measles virus-specific neutralization assay to measure humoral immunity, and concurrently determined measles-specific cellular immunity to aid the assessment of potential susceptibility to measles in vaccinated populations. PMID:21539880

  19. Alignment of Homologous Chromosomes and Effective Repair of Programmed DNA Double-Strand Breaks during Mouse Meiosis Require the Minichromosome Maintenance Domain Containing 2 (MCMDC2) Protein

    PubMed Central

    Ravindranathan, Ramya; Dereli, Ihsan; Stanzione, Marcello; Tóth, Attila

    2016-01-01

    Orderly chromosome segregation during the first meiotic division requires meiotic recombination to form crossovers between homologous chromosomes (homologues). Members of the minichromosome maintenance (MCM) helicase family have been implicated in meiotic recombination. In addition, they have roles in initiation of DNA replication, DNA mismatch repair and mitotic DNA double-strand break repair. Here, we addressed the function of MCMDC2, an atypical yet conserved MCM protein, whose function in vertebrates has not been reported. While we did not find an important role for MCMDC2 in mitotically dividing cells, our work revealed that MCMDC2 is essential for fertility in both sexes due to a crucial function in meiotic recombination. Meiotic recombination begins with the introduction of DNA double-strand breaks into the genome. DNA ends at break sites are resected. The resultant 3-prime single-stranded DNA overhangs recruit RAD51 and DMC1 recombinases that promote the invasion of homologous duplex DNAs by the resected DNA ends. Multiple strand invasions on each chromosome promote the alignment of homologous chromosomes, which is a prerequisite for inter-homologue crossover formation during meiosis. We found that although DNA ends at break sites were evidently resected, and they recruited RAD51 and DMC1 recombinases, these recombinases were ineffective in promoting alignment of homologous chromosomes in the absence of MCMDC2. Consequently, RAD51 and DMC1 foci, which are thought to mark early recombination intermediates, were abnormally persistent in Mcmdc2-/- meiocytes. Importantly, the strand invasion stabilizing MSH4 protein, which marks more advanced recombination intermediates, did not efficiently form foci in Mcmdc2-/- meiocytes. Thus, our work suggests that MCMDC2 plays an important role in either the formation, or the stabilization, of DNA strand invasion events that promote homologue alignment and provide the basis for inter-homologue crossover formation during

  20. Clinicopathologic Features of Colorectal Carcinoma in HIV-Positive Patients

    PubMed Central

    Sigel, Carlie; Cavalcanti, Marcela S.; Daniel, Tanisha; Vakiani, Efsevia; Shia, Jinru; Sigel, Keith

    2016-01-01

    Background Emerging evidence suggests differences in colo-rectal cancer in HIV-infected patients (HIV+) compared with HIV− patients. Microsatellite instability (MSI), occurring in a subset of colorectal cancer, is present at a higher rate in certain cancers in HIV+ patients. Colorectal cancer with MSI share some characteristics with those reported for HIV+ colorectal cancer. On this premise, we studied clinical and pathologic features of HIV+ colorectal cancer and evaluated for MSI using matched HIV− colorectal cancer controls. Methods Two nested, matched cohorts were identified from a hospital-based cohort of colorectal cancer patients. HIV+ colo-rectal cancers were identified and random control patients were matched for selected characteristics. Mismatch repair protein (MMR) IHC was performed as the detection method for MSI. Variables were compared between cases and controls using fixed-effects logit modeling to account for matching. Results We included 184 colorectal cancer samples (38 HIV+, 146 HIV− control). Median patient age at colorectal cancer onset was 55. When compared with HIV− colorectal cancer, HIV+patients were more likely to have smoked (P = 0.001), have right-sided colorectal cancer (37% vs. 14%; P = 0.003), and tumor-infiltrating lymphocytes (TIL) above 50/10 high-power fields (21% vs. 7%). There was no difference in MMR protein expression (P = 0.6). HIV+ colorectal cancer patients had reduced overall survival (P = 0.02) but no difference in progression-free survival. Conclusions HIV+ patients developed colorectal cancer at a lower median age than population estimates, had a higher frequency of right-sided disease, and increased TILs, suggesting potential biologic differences compared with uninfected patients. Impact Clinicopathologic differences in colorectal cancer of HIV+ persons may have implications for tumor pathogenesis. PMID:27197294

  1. Functional testing strategy for coding genetic variants of unclear significance in MLH1 in Lynch syndrome diagnosis.

    PubMed

    Hinrichsen, Inga; Schäfer, Dieter; Langer, Deborah; Köger, Nicole; Wittmann, Margarethe; Aretz, Stefan; Steinke, Verena; Holzapfel, Stefanie; Trojan, Jörg; König, Rainer; Zeuzem, Stefan; Brieger, Angela; Plotz, Guido

    2015-02-01

    Lynch syndrome is caused by inactivating mutations in the MLH1 gene, but genetic variants of unclear significance frequently preclude diagnosis. Functional testing can reveal variant-conferred defects in gene or protein function. Based on functional defect frequencies and clinical applicability of test systems, we developed a functional testing strategy aimed at efficiently detecting pathogenic defects in coding MLH1 variants. In this strategy, tests of repair activity and expression are prioritized over analyses of subcellular protein localization and messenger RNA (mRNA) formation. This strategy was used for four unclear coding MLH1 variants (p.Asp41His, p.Leu507Phe, p.Gln689Arg, p.Glu605del + p.Val716Met). Expression was analyzed using a transfection system, mismatch repair (MMR) activity by complementation in vitro, mRNA formation by reverse transcriptase-PCR in carrier lymphocyte mRNA, and subcellular localization with dye-labeled fusion constructs. All tests included clinically meaningful controls. The strategy enabled efficient identification of defects in two unclear variants: the p.Asp41His variant showed loss of MMR activity, whereas the compound variant p.Glu605del + p.Val716Met had a defect of expression. This expression defect was significantly stronger than the pathogenic expression reference variant analyzed in parallel, therefore the defect of the compound variant is also pathogenic. Interestingly, the expression defect was caused additively by both of the compound variants, at least one of which is non-pathogenic when occurring by itself. Tests were neutral for p.Leu507Phe and p.Gln689Arg, and the results were consistent with available clinical data. We finally discuss the improved sensitivity and efficiency of the applied strategy and its limitations in analyzing unclear coding MLH1 variants.

  2. Predominance of CIN versus MSI in the development of rectal cancer at young age

    PubMed Central

    Fernebro, Eva; Halvarsson, Britta; Baldetorp, Bo; Nilbert, Mef

    2002-01-01

    Background Development of proximal and distal colorectal cancers involve partly different mechanisms associated with the microsatellite instability (MSI) and the chromosomal instability (CIN) pathways. Colorectal cancers in patients under 50 years of age represent about 5% of the total number of tumors and have been associated with an increased frequency of MSI tumors. However, MSI and CIN may play different roles in the development of colon cancer and rectal cancer, and we have specifically investigated their contribution to the development of rectal cancer at young age. Methods Thirty rectal cancers diagnosed before the age of 50 were characterized for DNA-ploidy, MSI, mutations of KRAS and CTNNB1 and immunohistochemical expression of p53, β-catenin and of the mismatch repair (MMR) proteins MLH1 and MSH2. Results DNA aneuploidy was detected in 21/30 tumors, KRAS mutations in 6 tumors, no mutations of CTNNB1 were detected but immunohistochemical staining for β-catenin showed nuclear staining in 6 tumors, and immunohistochemical expression of p53 was detected in 18 tumors. MSI was detected in 3/30 tumors, all of which showed and immunohistochemical loss of staining for the MMR protein MSH2, which strongly indicates a phenotype associated with hereditary nonpolyposis colorectal cancer (HNPCC). Conclusions MSI occurs only in a small fraction of the tumors from young patients with rectal cancer, but when present it strongly indicates an underlying HNPCC-causing mutation, and other mechanisms than HNPCC thus cause rectal cancer in the majority of young patients. PMID:12379157

  3. [HNPCC (hereditary non-polyposis colorectal cancer) or Lynch syndrome: a syndrome related to a failure of DNA repair system].

    PubMed

    Manceau, Gilles; Karoui, Mehdi; Charachon, Antoine; Delchier, Jean-Charles; Sobhani, Iradj

    2011-03-01

    The HNPCC syndrome (hereditary non polyposis colon cancer) or Lynch syndrome stands for an autosomic dominant condition leading to the most prevalent hereditary colo-rectal cancers (CCR). MMR (mismatch repair)'s genes are involved in carcinogenesis as they play a role in ADNA mismatch repair. Microsatellite instability (MSI+ phenotype) induced by germline mutations is characteristic of such tumors and is necessary to assert the diagnosis. The HNPCC syndrome is associated with a significant increased risk of CCR altogether with endometrium, upper urinary tract and small bowel carcinomas as well as ovarian, biliary system and gastric cancers although of lesser extent. It is of importance to diagnose HNPCC syndrome prior to the treatment starts because it may influence patient's (as well as her/his relatives) disease management (type of surgery, surveillance and screening exams). New French recommendations, developed in 2009, about prophylactic colo-rectal and gynecologic surgeries and monitoring update latest ones published on 2004. PMID:21459714

  4. The key role of CYC2 during meiosis in Tetrahymena thermophila.

    PubMed

    Xu, Qianlan; Wang, Ruoyu; Ghanam, A R; Yan, Guanxiong; Miao, Wei; Song, Xiaoyuan

    2016-04-01

    Meiotic recombination is carried out through a specialized pathway for the formation and repair of DNA double-strand breaks (DSBs) made by the Spo11 protein. The present study shed light on the functional role of cyclin, CYC2, in Tetrahymena thermophila which has transcriptionally high expression level during meiosis process. Knocking out the CYC2 gene results in arrest of meiotic conjugation process at 2.5-3.5 h after conjugation initiation, before the meiosis division starts, and in company with the absence of DSBs. To investigate the underlying mechanism of this phenomenon, a complete transcriptome profile was performed between wild-type strain and CYC2 knock-out strain. Functional analysis of RNA-Seq results identifies related differentially expressed genes (DEGs) including SPO11 and these DEGs are enriched in DNA repair/mismatch repair (MMR) terms in homologous recombination (HR), which indicates that CYC2 could play a crucial role in meiosis by regulating SPO11 and participating in HR.

  5. Assessment of functional effects of unclassified genetic variants.

    PubMed

    Couch, Fergus J; Rasmussen, Lene Juel; Hofstra, Robert; Monteiro, Alvaro N A; Greenblatt, Marc S; de Wind, Niels

    2008-11-01

    Inherited predisposition to disease is often linked to reduced activity of a disease associated gene product. Thus, quantitation of the influence of inherited variants on gene function can potentially be used to predict the disease relevance of these variants. While many disease genes have been extensively characterized at the functional level, few assays based on functional properties of the encoded proteins have been established for the purpose of predicting the contribution of rare inherited variants to disease. Much of the difficulty in establishing predictive functional assays stems from the technical complexity of the assays. However, perhaps the most challenging aspect of functional assay development for clinical testing purposes is the absolute requirement for validation of the sensitivity and specificity of the assays and the determination of positive predictive values (PPVs) and negative predictive values (NPVs) of the assays relative to a "gold standard" measure of disease predisposition. In this commentary, we provide examples of some of the functional assays under development for several cancer predisposition genes (BRCA1, BRCA2, CDKN2A, and mismatch repair [MMR] genes MLH1, MSH2, MSH6, and PMS2) and present a detailed review of the issues associated with functional assay development. We conclude that validation is paramount for all assays that will be used for clinical interpretation of inherited variants of any gene, but note that in certain circumstances information derived from incompletely validated assays may be valuable for classification of variants for clinical purposes when used to supplement data derived from other sources. PMID:18951449

  6. UvrD limits the number and intensities of RecA-green fluorescent protein structures in Escherichia coli K-12.

    PubMed

    Centore, Richard C; Sandler, Steven J

    2007-04-01

    RecA is important for recombination, DNA repair, and SOS induction. In Escherichia coli, RecBCD, RecFOR, and RecJQ prepare DNA substrates onto which RecA binds. UvrD is a 3'-to-5' helicase that participates in methyl-directed mismatch repair and nucleotide excision repair. uvrD deletion mutants are sensitive to UV irradiation, hypermutable, and hyper-rec. In vitro, UvrD can dissociate RecA from single-stranded DNA. Other experiments suggest that UvrD removes RecA from DNA where it promotes unproductive reactions. To test if UvrD limits the number and/or the size of RecA-DNA structures in vivo, an uvrD mutation was combined with recA-gfp. This recA allele allows the number of RecA structures and the amount of RecA at these structures to be assayed in living cells. uvrD mutants show a threefold increase in the number of RecA-GFP foci, and these foci are, on average, nearly twofold higher in relative intensity. The increased number of RecA-green fluorescent protein foci in the uvrD mutant is dependent on recF, recO, recR, recJ, and recQ. The increase in average relative intensity is dependent on recO and recQ. These data support an in vivo role for UvrD in removing RecA from the DNA. PMID:17259317

  7. Elimination of Chromosomal Island SpyCIM1 from Streptococcus pyogenes Strain SF370 Reverses the Mutator Phenotype and Alters Global Transcription

    PubMed Central

    Nguyen, Scott V.; Rahman, Maliha; McCullor, Kimberly A.; King, Catherine J.; Fischetti, Vincent A.; McShan, W. Michael

    2015-01-01

    Streptococcus pyogenes chromosomal island M1 (SpyCIM1) integrates by site-specific recombination into the 5’ end of DNA mismatch repair (MMR) gene mutL in strain SF370SmR, blocking transcription of it and the downstream operon genes. During exponential growth, SpyCIM1 excises from the chromosome and replicates as an episome, restoring mutL transcription. This process is reversed in stationary phase with SpyCIM1 re-integrating into mutL, returning the cells to a mutator phenotype. Here we show that elimination of SpyCIM1 relieves this mutator phenotype. The downstream MMR operon genes, multidrug efflux pump lmrP, Holliday junction resolution helicase ruvA, and DNA base excision repair glycosylase tag, are also restored to constitutive expression by elimination of SpyCIM1. The presence of SpyCIM1 alters global transcription patterns in SF370SmR. RNA sequencing (RNA-Seq) demonstrated that loss of SpyCIM1 in the SpyCIM1 deletion mutant, CEM1Δ4, impacted the expression of over 100 genes involved in virulence and metabolism both in early exponential phase, when the SpyCIM1 is episomal, as well as at the onset of stationary phase, when SpyCIM1 has reintegrated into mutL. Among these changes, the up-regulation of the genes for the antiphagocytic M protein (emm1), streptolysin O (slo), capsule operon (hasABC), and streptococcal pyrogenic exotoxin (speB), are particularly notable. The expression pattern of the MMR operon confirmed our earlier observations that these genes are transcribed in early exponential phase but silenced as stationary phase is approached. Thus, the direct role of SpyCIM1 in causing the mutator phenotype is confirmed, and further, its influence upon the biology of S. pyogenes was found to impact multiple genes in addition to the MMR operon, which is a novel function for a mobile genetic element. We suggest that such chromosomal islands are a remarkable evolutionary adaptation to promote the survival of its S. pyogenes host cell in changing

  8. Elimination of Chromosomal Island SpyCIM1 from Streptococcus pyogenes Strain SF370 Reverses the Mutator Phenotype and Alters Global Transcription.

    PubMed

    Hendrickson, Christina; Euler, Chad W; Nguyen, Scott V; Rahman, Maliha; McCullor, Kimberly A; King, Catherine J; Fischetti, Vincent A; McShan, W Michael

    2015-01-01

    Streptococcus pyogenes chromosomal island M1 (SpyCIM1) integrates by site-specific recombination into the 5' end of DNA mismatch repair (MMR) gene mutL in strain SF370SmR, blocking transcription of it and the downstream operon genes. During exponential growth, SpyCIM1 excises from the chromosome and replicates as an episome, restoring mutL transcription. This process is reversed in stationary phase with SpyCIM1 re-integrating into mutL, returning the cells to a mutator phenotype. Here we show that elimination of SpyCIM1 relieves this mutator phenotype. The downstream MMR operon genes, multidrug efflux pump lmrP, Holliday junction resolution helicase ruvA, and DNA base excision repair glycosylase tag, are also restored to constitutive expression by elimination of SpyCIM1. The presence of SpyCIM1 alters global transcription patterns in SF370SmR. RNA sequencing (RNA-Seq) demonstrated that loss of SpyCIM1 in the SpyCIM1 deletion mutant, CEM1Δ4, impacted the expression of over 100 genes involved in virulence and metabolism both in early exponential phase, when the SpyCIM1 is episomal, as well as at the onset of stationary phase, when SpyCIM1 has reintegrated into mutL. Among these changes, the up-regulation of the genes for the antiphagocytic M protein (emm1), streptolysin O (slo), capsule operon (hasABC), and streptococcal pyrogenic exotoxin (speB), are particularly notable. The expression pattern of the MMR operon confirmed our earlier observations that these genes are transcribed in early exponential phase but silenced as stationary phase is approached. Thus, the direct role of SpyCIM1 in causing the mutator phenotype is confirmed, and further, its influence upon the biology of S. pyogenes was found to impact multiple genes in addition to the MMR operon, which is a novel function for a mobile genetic element. We suggest that such chromosomal islands are a remarkable evolutionary adaptation to promote the survival of its S. pyogenes host cell in changing environments.

  9. Chromosomal islands of Streptococcus pyogenes and related streptococci: molecular switches for survival and virulence.

    PubMed

    Nguyen, Scott V; McShan, William M

    2014-01-01

    Streptococcus pyogenes is a significant pathogen of humans, annually causing over 700,000,000 infections and 500,000 deaths. Virulence in S. pyogenes is closely linked to mobile genetic elements like phages and chromosomal islands (CI). S. pyogenes phage-like chromosomal islands (SpyCI) confer a complex mutator phenotype on their host. SpyCI integrate into the 5' end of DNA mismatch repair (MMR) gene mutL, which also disrupts downstream operon genes lmrP, ruvA, and tag. During early logarithmic growth, SpyCI excise from the bacterial chromosome and replicate as episomes, relieving the mutator phenotype. As growth slows and the cells enter stationary phase, SpyCI reintegrate into the chromosome, again silencing the MMR operon. This system creates a unique growth-dependent and reversible mutator phenotype. Additional CI using the identical attachment site in mutL have been identified in related species, including Streptococcus dysgalactiae subsp. equisimilis, Streptococcus anginosus, Streptococcus intermedius, Streptococcus parauberis, and Streptococcus canis. These CI have small genomes, which range from 13 to 20 kB, conserved integrase and DNA replication genes, and no identifiable genes encoding capsid proteins. SpyCI may employ a helper phage for packaging and dissemination in a fashion similar to the Staphylococcus aureus pathogenicity islands (SaPI). Outside of the core replication and integration genes, SpyCI and related CI show considerable diversity with the presence of many indels that may contribute to the host cell phenotype or fitness. SpyCI are a subset of a larger family of streptococcal CI who potentially regulate the expression of other host genes. The biological and phylogenetic analysis of streptococcal chromosomal islands provides important clues as to how these chromosomal islands help S. pyogenes and other streptococcal species persist in human populations in spite of antibiotic therapy and immune challenges.

  10. The chromatin remodelling component SMARCB1/INI1 influences the metastatic behavior of colorectal cancer through a gene signature mapping to chromosome 22

    PubMed Central

    2013-01-01

    Background INI1 (Integrase interactor 1), also known as SMARCB1, is the most studied subunit of chromatin remodelling complexes. Its role in colorectal tumorigenesis is not known. Methods We examined SMARCB1/INI1 protein expression in 134 cases of colorectal cancer (CRC) and 60 matched normal mucosa by using tissue microarrays and western blot and categorized the results according to mismatch repair status (MMR), CpG island methylator phenotype, biomarkers of tumor differentiation CDX2, CK20, vimentin and p53. We validated results in two independent data sets and in cultured CRC cell lines. Results Herein, we show that negative SMARCB1/INI1 expression (11% of CRCs) associates with loss of CDX2, poor differentiation, liver metastasis and shorter patients’ survival regardless of the MMR status or tumor stage. Unexpectedly, even CRCs displaying diffuse nuclear INI1 staining (33%) show an adverse prognosis and vimentin over-expression, in comparison with the low expressing group (56%). The negative association of SMARCB1/INI1-lack of expression with a metastatic behavior is enhanced by the TP53 status. By interrogating global gene expression from two independent cohorts of 226 and 146 patients, we confirm the prognostic results and identify a gene signature characterized by SMARCB1/INI1 deregulation. Notably, the top genes of the signature (BCR, COMT, MIF) map on the long arm of chromosome 22 and are closely associated with SMARCB1/INI1. Conclusion Our findings suggest that SMARCB1/INI1-dysregulation and genetic hot-spots on the long arm of chromosome 22 might play an important role in the CRC metastatic behavior and be clinically relevant as novel biomarkers. PMID:24286138

  11. p27Kip1 in Stage III Colon Cancer: Implications for Outcome Following Adjuvant Chemotherapy in CALGB 89803

    PubMed Central

    Bertagnolli, Monica M.; Warren, Robert S.; Niedzwiecki, Donna; Mueller, Elke; Compton, Carolyn C.; Redston, Mark; Hall, Margaret; Hahn, Hejin P.; Jewell, Scott D.; Mayer, Robert J.; Goldberg, Richard M.; Saltz, Leonard B.; Loda, Massimo

    2010-01-01

    Background In retrospective studies, loss of p27Kip1 (p27), a cyclin dependent kinase inhibitor, has been associated with poor prognosis following colorectal cancer treatment. In a prospective study, we validated this relationship in patients enrolled on a trial of adjuvant chemotherapy for Stage III colon cancer. Methods Cancer and Leukemia Group B (CALGB) protocol 89803 randomized 1264 stage III colon cancer patients to receive weekly bolus fluorouracil/leucovorin (5FU/LV) or weekly bolus irinotecan, fluorouracil, and leucovorin (IFL). The primary endpoint was overall survival (OS); disease-free survival (DFS) was a secondary endpoint. Expression of p27 and DNA mismatch repair (MMR) proteins were determined by immunohistochemistry (IHC) in primary tumor and normal tissue from paraffin blocks. Data were analyzed using logrank test. Results Of 601 tumors analyzed, 207 (34.4%) demonstrated p27 loss, 377 (62.8%) retained p27, and 17 (2.8%) were indeterminate. Patients with p27 negative tumors showed reduced OS (5-year 66%; 95%CI 0.59-0.72 vs. 75%; 95%CI 0.70-0.79, logrank p=0.021). This relationship was not influenced by treatment arm. Combination of p27 status with MMR status, however, identified a small subset of patients that may benefit from IFL (n=36; 5-year DFS 81%; 95%CI 0.64-0.98 vs. 47%; 95%CI 0.21-0.72, logrank p=0.042; 5-year OS 81%; 95%CI 0.64-0.98 vs. 60%; 95%CI 0.35-0.85; logrank p=0.128). Conclusions Loss of p27 is associated with reduced survival in stage III colon cancer, but by itself does not indicate a significant difference in outcome between patients treated IFL or 5FU-LV. PMID:19276255

  12. Pre-trial inter-laboratory analytical validation of the FOCUS4 personalised therapy trial

    PubMed Central

    Richman, Susan D; Adams, Richard; Quirke, Phil; Butler, Rachel; Hemmings, Gemma; Chambers, Phil; Roberts, Helen; James, Michelle D; Wozniak, Sue; Bathia, Riya; Pugh, Cheryl; Maughan, Timothy; Jasani, Bharat

    2016-01-01

    Introduction Molecular characterisation of tumours is increasing personalisation of cancer therapy, tailored to an individual and their cancer. FOCUS4 is a molecularly stratified clinical trial for patients with advanced colorectal cancer. During an initial 16-week period of standard first-line chemotherapy, tumour tissue will undergo several molecular assays, with the results used for cohort allocation, then randomisation. Laboratories in Leeds and Cardiff will perform the molecular testing. The results of a rigorous pre-trial inter-laboratory analytical validation are presented and discussed. Methods Wales Cancer Bank supplied FFPE tumour blocks from 97 mCRC patients with consent for use in further research. Both laboratories processed each sample according to an agreed definitive FOCUS4 laboratory protocol, reporting results directly to the MRC Trial Management Group for independent cross-referencing. Results Pyrosequencing analysis of mutation status at KRAS codons12/13/61/146, NRAS codons12/13/61, BRAF codon600 and PIK3CA codons542/545/546/1047, generated highly concordant results. Two samples gave discrepant results; in one a PIK3CA mutation was detected only in Leeds, and in the other, a PIK3CA mutation was only detected in Cardiff. pTEN and mismatch repair (MMR) protein expression was assessed by immunohistochemistry (IHC) resulting in 6/97 discordant results for pTEN and 5/388 for MMR, resolved upon joint review. Tumour heterogeneity was likely responsible for pyrosequencing discrepancies. The presence of signet-ring cells, necrosis, mucin, edge-effects and over-counterstaining influenced IHC discrepancies. Conclusions Pre-trial assay analytical validation is essential to ensure appropriate selection of patients for targeted therapies. This is feasible for both mutation testing and immunohistochemical assays and must be built into the workup of such trials. Trial registration number ISRCTN90061564. PMID:26350752

  13. VE1 immunohistochemistry predicts BRAF V600E mutation status and clinical outcome in colorectal cancer

    PubMed Central

    Schafroth, Christian; Galván, José A.; Centeno, Irene; Koelzer, Viktor H.; Dawson, Heather E.; Sokol, Lena; Rieger, Gregor; Berger, Martin D.; Hädrich, Marion; Rosenberg, Robert; Nitsche, Ulrich; Schnüriger, Beat; Langer, Rupert; Inderbitzin, Daniel; Lugli, Alessandro; Zlobec, Inti

    2015-01-01

    Aim VE1 is a monoclonal antibody detecting mutant BRAFV600E protein by immunohistochemistry. Here we aim to determine the inter-observer agreement and concordance of VE1 with mutational status, investigate heterogeneity in colorectal cancers and metastases and determine the prognostic effect of VE1 in colorectal cancer patients. Methods Concordance of VE1 with mutational status and inter-observer agreement were tested on a pilot cohort of colorectal cancers (n = 34), melanomas (n = 23) and thyroid cancers (n = 8). Two prognostic cohorts were evaluated (n = 259, Cohort 1 and n = 226, Cohort 2) by multiple-punch tissue microarrays. VE1 staining on preoperative biopsies (n = 118 patients) was compared to expression in resections. Primary tumors and metastases from 13 patients were tested for VE1 heterogeneity using a tissue microarray generated from all available blocks (n = 100 blocks). Results Inter-observer agreement was 100% (kappa = 1.0). Concordance between VE1 and V600E mutation was 98.5%. Cohort 1: VE1 positivity (seen in 13.5%) was associated with older age (p = 0.0175) and MLH1 deficiency (p < 0.0001). Cohort 2: VE1 positivity (seen in 12.8%) was associated with female gender (p = 0.0016), right-sided tumor location (p < 0.0001), higher tumor grade (p < 0.0001) and mismatch repair (MMR)-deficiency (p < 0.0001). In survival analysis, MMR status and postoperative therapy were identified as possible confounding factors. Adjusting for these features, VE1 was an unfavorable prognostic factor. Preoperative biopsy staining matched resections in all cases except one. No heterogeneity was found across any primary/metastatic tumor blocks. Conclusion VE1 is highly concordant for V600E and homogeneously expressed suggesting staining can be analysed on resection specimens, preoperative biopsies, metastatic lesions and tissue microarrays. PMID:26496026

  14. Chromosomal islands of Streptococcus pyogenes and related streptococci: molecular switches for survival and virulence.

    PubMed

    Nguyen, Scott V; McShan, William M

    2014-01-01

    Streptococcus pyogenes is a significant pathogen of humans, annually causing over 700,000,000 infections and 500,000 deaths. Virulence in S. pyogenes is closely linked to mobile genetic elements like phages and chromosomal islands (CI). S. pyogenes phage-like chromosomal islands (SpyCI) confer a complex mutator phenotype on their host. SpyCI integrate into the 5' end of DNA mismatch repair (MMR) gene mutL, which also disrupts downstream operon genes lmrP, ruvA, and tag. During early logarithmic growth, SpyCI excise from the bacterial chromosome and replicate as episomes, relieving the mutator phenotype. As growth slows and the cells enter stationary phase, SpyCI reintegrate into the chromosome, again silencing the MMR operon. This system creates a unique growth-dependent and reversible mutator phenotype. Additional CI using the identical attachment site in mutL have been identified in related species, including Streptococcus dysgalactiae subsp. equisimilis, Streptococcus anginosus, Streptococcus intermedius, Streptococcus parauberis, and Streptococcus canis. These CI have small genomes, which range from 13 to 20 kB, conserved integrase and DNA replication genes, and no identifiable genes encoding capsid proteins. SpyCI may employ a helper phage for packaging and dissemination in a fashion similar to the Staphylococcus aureus pathogenicity islands (SaPI). Outside of the core replication and integration genes, SpyCI and related CI show considerable diversity with the presence of many indels that may contribute to the host cell phenotype or fitness. SpyCI are a subset of a larger family of streptococcal CI who potentially regulate the expression of other host genes. The biological and phylogenetic analysis of streptococcal chromosomal islands provides important clues as to how these chromosomal islands help S. pyogenes and other streptococcal species persist in human populations in spite of antibiotic therapy and immune challenges. PMID:25161960

  15. Association of a let-7 miRNA binding region of TGFBR1 with hereditary mismatch repair proficient colorectal cancer (MSS HNPCC).

    PubMed

    Xicola, Rosa M; Bontu, Sneha; Doyle, Brian J; Rawson, Jamie; Garre, Pilar; Lee, Esther; de la Hoya, Miguel; Bessa, Xavier; Clofent, Joan; Bujanda, Luis; Balaguer, Francesc; Castellví-Bel, Sergi; Alenda, Cristina; Jover, Rodrigo; Ruiz-Ponte, Clara; Syngal, Sapna; Andreu, Montserrat; Carracedo, Angel; Castells, Antoni; Newcomb, Polly A; Lindor, Noralane; Potter, John D; Baron, John A; Ellis, Nathan A; Caldes, Trinidad; LLor, Xavier

    2016-08-01

    The purpose of this study was to identify novel colorectal cancer (CRC)-causing alleles in unexplained familial CRC cases. In order to do so, coding regions in five candidate genes (MGMT, AXIN2, CTNNB1, TGFBR1 and TGFBR2) were sequenced in 11 unrelated microsatellite-stable hereditary non-polyposis CRC (MSS HNPCC) cases. Selected genetic variants were genotyped in a discovery set of 27 MSS HNPCC cases and 85 controls. One genetic variant, rs67687202, in TGFBR1 emerged as significant (P = 0.002), and it was genotyped in a replication set of 87 additional MSS HNPCC-like cases and 338 controls where it was also significantly associated with MSS HNPCC cases (P = 0.041). In the combined genotype data, rs67687202 was associated with a moderate increase in CRC risk (OR = 1.68; 95% CI = 1.13-2.50; P = 0.010). We tested a highly correlated SNP rs868 in 723 non-familial CRC cases compared with 629 controls, and it was not significantly associated with CRC risk (P = 0.370). rs868 is contained in a let-7 miRNA binding site in the 3'UTR of TGFBR1, which might provide a functional basis for the association in MSS HNPCC. In luciferase assays, the risk-associated allele for rs868 was associated with half the luciferase expression in the presence of miRNA let-7b-5p compared with protective allele, suggesting more binding of let-7b-5p and less TGFBR1 expression. Thus, rs868 potentially is a CRC risk-causing allele. Our results support the concept that rs868 is associated with lower TGFBR1 expression thereby increasing CRC risk. PMID:27234654

  16. The role of germline mutations in the BRCA1/2 and mismatch repair genes in men ascertained for early-onset and/or familial prostate cancer.

    PubMed

    Maia, Sofia; Cardoso, Marta; Paulo, Paula; Pinheiro, Manuela; Pinto, Pedro; Santos, Catarina; Pinto, Carla; Peixoto, Ana; Henrique, Rui; Teixeira, Manuel R

    2016-01-01

    Prostate cancer (PrCa) is one of the most common cancers diagnosed worldwide and 5-10 % of all cases are estimated to be associated with inherited predisposition. Even though there is strong evidence that the genetic component is significant in PrCa, the genetic etiology of familial and early-onset disease is largely unknown. Although it has been suggested that men from families with hereditary breast/ovarian cancer (HBOC) and, more recently, with Lynch syndrome may have an increased risk for PrCa, the contribution of these syndromes to PrCa predisposition in families ascertained for early-onset and/or familial PrCa, independently of the presence of other cancers in the family, is uncertain. To quantify the contribution of genes associated with HBOC and Lynch syndromes to PrCa predisposition, we have tested for germline mutations 460 early-onset and/or familial PrCa patients. All patients were screened for the six mutations that are particularly common in Portugal and 38 of them were selected for complete sequencing of BRCA1/2 and/or MLH1, MSH2 and MSH6. Two patients were found to harbor the same MSH2 mutation and a third patient carried a Portuguese BRCA2 founder mutation. None of the alterations were identified in 288 control subjects. Furthermore, we reviewed the 62 PrCa diagnoses in all HBOC (n = 161) and Lynch syndrome (n = 124) families previously diagnosed at our department, and found five other BRCA2 mutation carriers and two additional MSH2 mutation carriers. The clinicopathological characteristics of mutation carriers are in concordance with earlier data suggesting an aggressive PrCa phenotype and support the hypothesis that mutation carriers might benefit from targeted screening according to the gene mutated in the germline.

  17. Immunogenicity and safety of a combined DTaP-IPV vaccine compared with separate DTaP and IPV vaccines when administered as pre-school booster doses with a second dose of MMR vaccine to healthy children aged 4-6 years.

    PubMed

    Black, Steven; Friedland, Leonard R; Schuind, Anne; Howe, Barbara

    2006-08-28

    Combination vaccines represent one solution to the problem of increased numbers of injections during single clinic visits. A combined DTaP-IPV (Infanrix-IPV) vaccine has been developed for use as a pre-school booster. Four hundred healthy children aged 4-6 years previously primed with 4 doses of DTaP vaccine (Infanrix), 3 doses of poliovirus vaccine and 1 dose of MMR vaccine were randomized to receive single doses of either the combined DTaP-IPV vaccine or separate DTaP and IPV vaccines in a Phase II trial (DTaP-IPV-047). All children also received a second dose of MMR vaccine. Immunogenicity was assessed in serum samples taken before and 1 month after booster administration. Safety was actively assessed for 42 days post-vaccination. Non-inferiority of the DTaP-IPV vaccine to separate DTaP and IPV vaccines was demonstrated for all DTaP antigen booster response rates and poliovirus geometric mean titers of antibody ratios. Post-vaccination, > or =99.4% of children in both groups had seroprotective levels of anti-diphtheria and anti-tetanus antibodies (> or =0.1IU/mL) and seroprotective anti-poliovirus antibody titers (> or =1:8). All children in both groups were seropositive for measles, mumps and rubella antibodies, with similar post-vaccination geometric mean concentrations/titers. No significant differences were observed in the incidence of solicited local or general symptoms, unsolicited symptoms and serious adverse events between the two groups. This combined DTaP-IPV appeared safe and immunogenic when given as a booster dose at 4-6 years of age. The DTaP-IPV vaccine had no negative effect on the response to co-administered MMR vaccine, making it well-suited for use as a pre-school booster.

  18. Msh2 deficiency leads to chromosomal abnormalities, centrosome amplification, and telomere capping defect

    SciTech Connect

    Wang, Yisong; Liu, Yie

    2006-01-01

    Msh2 is a key mammalian DNA mismatch repair (MMR) gene and mutations or deficiencies in mammalian Msh2 gene result in microsatellite instability (MSI+) and the development of cancer. Here, we report that primary mouse embryonic fibroblasts (MEFs) deficient in the murine MMR gene Msh2 (Msh2-/-) showed a significant increase in chromosome aneuploidy, centrosome amplification, and defective mitotic spindle organization and unequal chromosome segregation. Although Msh2-/- mouse tissues or primary MEFs had no apparent change in telomerase activity, telomere length, or recombination at telomeres, Msh2-/- MEFs showed an increase in chromosome end-to-end fusions or chromosome ends without detectable telomeric DNA. These data suggest that MSH2 helps to maintain genomic stability through the regulation of the centrosome and normal telomere capping in vivo and that defects in MMR can contribute to oncogenesis through multiple pathways.

  19. miRNA Expression in Colon Polyps Provides Evidence for a Multihit Model of Colon Cancer

    PubMed Central

    Oberg, Ann L.; French, Amy J.; Sarver, Aaron L.; Subramanian, Subbaya; Morlan, Bruce W.; Riska, Shaun M.; Borralho, Pedro M.; Cunningham, Julie M.; Boardman, Lisa A.; Wang, Liang; Smyrk, Thomas C.; Asmann, Yan; Steer, Clifford J.; Thibodeau, Stephen N.

    2011-01-01

    Changes in miRNA expression are a common feature in colon cancer. Those changes occurring in the transition from normal to adenoma and from adenoma to carcinoma, however, have not been well defined. Additionally, miRNA changes among tumor subgroups of colon cancer have also not been adequately evaluated. In this study, we examined the global miRNA expression in 315 samples that included 52 normal colonic mucosa, 41 tubulovillous adenomas, 158 adenocarcinomas with proficient DNA mismatch repair (pMMR) selected for stage and age of onset, and 64 adenocarcinomas with defective DNA mismatch repair (dMMR) selected for sporadic (n = 53) and inherited colon cancer (n = 11). Sporadic dMMR tumors all had MLH1 inactivation due to promoter hypermethylation. Unsupervised PCA and cluster analysis demonstrated that normal colon tissue, adenomas, pMMR carcinomas and dMMR carcinomas were all clearly discernable. The majority of miRNAs that were differentially expressed between normal and polyp were also differentially expressed with a similar magnitude in the comparison of normal to both the pMMR and dMMR tumor groups, suggesting a stepwise progression for transformation from normal colon to carcinoma. Among the miRNAs demonstrating the largest fold up- or down-regulated changes (≥4), four novel (miR-31, miR-1, miR-9 and miR-99a) and two previously reported (miR-137 and miR-135b) miRNAs were identified in the normal/adenoma comparison. All but one of these (miR-99a) demonstrated similar expression differences in the two normal/carcinoma comparisons, suggesting that these early tumor changes are important in both the pMMR- and dMMR-derived cancers. The comparison between pMMR and dMMR tumors identified four miRNAs (miR-31, miR-552, miR-592 and miR-224) with statistically significant expression differences (≥2-fold change). PMID:21694772

  20. [Aspirin suppresses microsatellite instability].

    PubMed

    Wallinger, S; Dietmaier, W; Beyser, K; Bocker, T; Hofstädter, F; Fishel, R; Rüschoff, J

    1999-01-01

    Nonsteroidal anti-inflammatory drugs (NSAIDs) exhibit cancer preventive effects and have been shown to induce regression of adenomas in FAP patients. In order to elucidate the probable underlying mechanism, the effect of NSAIDs on mismatch repair related microsatellite instability was investigated. Six colorectal cancer cell lines all but one deficient for human mismatch repair (MMR) genes were examined for microsatellite instability (MSI) prior and after treatment with Aspirin or Sulindac. For rapid in vitro analysis of MSI a microcloning assay was developed by combining Laser microdissection and random (PEP-) PCR prior to specific MSI-PCR. Effects of NSAIDs on cell cycle and apoptosis were systematically investigated by using flow cytometry and cell-sorting. MSI frequency in cells deficient of MMR genes (hMSH2, hMLH1, hMSH6) was markedly reduced after long-term (> 10 weeks) NSAID treatment. This effect was reversible, time- and concentration dependent. However, in the hPMS2 deficient endometrial cancer cell line (HEC-1-A) the MSI phenotype kept unchanged. According to cell sorting, non-apoptotic cells were stable and apoptotic cells were unstable. These results suggest that aspirin/sulindac induces a genetic selection for microsatellite stability in a subset of MMR-deficient cells and may thus provide an effective prophylactic therapy for HNPCC related colorectal carcinomas.

  1. Microsatellite instability and frameshift mutations in BAX and transforming growth factor-beta RII genes are very uncommon in acute lymphoblastic leukemia in vivo but not in cell lines.

    PubMed

    Molenaar, J J; Gérard, B; Chambon-Pautas, C; Cavé, H; Duval, M; Vilmer, E; Grandchamp, B

    1998-07-01

    Mutations in the DNA mismatch repair (MMR) system lead to an instability of simple repetitive DNA sequences involved in several cancer types. This instability is reflected in a high mutation rate of microsatellites, and recent studies in colon cancer indicate that defects in MMR result in frequent frameshift mutations in mononucleotide repeats located in the coding regions of BAX and transforming growth factor-beta (TGF-beta) receptor genes. Circumstantial evidence suggests that the MMR defect may be involved in some lymphoid malignancies, although several allelotype analyses have concluded on the low level of microsatellite instability in acute lymphoblastic leukemias. To further evaluate the implication of MMR defects in leukemogenesis, we have studied a series of 98 children with acute lymphoblastic leukemia and 14 leukemic cell lines using several indicators of MMR defects. Microsatellite markers were compared between blast and normal DNA from the same patients and mutations were sought in mononucleotide repeat sequences of BAX and TGF-beta receptor II (TGF-beta RII). The absence of microsatellite instability (MI) and the absence of mutations in the genes examined from patient's leukemic cells contrasted with the observation that half of the cell lines displayed a high degree of MI and that three of seven of these mutator cell lines harbored mutations in BAX and/or TGF-beta RII. From these results we conclude that MMR defects are very uncommon in freshly isolated blasts but are likely to be selected for during the establishment of cell lines.

  2. Communication of Genetic Test Results to Family and Health Care Providers Following Disclosure of Research Results

    PubMed Central

    Graves, Kristi D.; Sinicrope, Pamela S.; Esplen, Mary Jane; Peterson, Susan K.; Patten, Christi A.; Lowery, Jan; Sinicrope, Frank A.; Nigon, Sandra K.; Borgen, Joyce; Gorin, Sherri Sheinfeld; Keogh, Louise A.; Lindor, Noralane M.

    2014-01-01

    Purpose Few studies have examined methods to promote communication following the return of DNA mismatch repair (MMR) genetic test results obtained during research. The purpose of the present study was to evaluate a telephone protocol for returning research results of MMR gene testing to identify Lynch Syndrome. Methods We invited individuals with known MMR mutations in their family who were enrolled in the Colon Cancer Family Registry at the Mayo Clinic to participate. Participants completed surveys before and 6-months after MMR test result disclosure. Results Among 107 participants, 79% opted to learn their MMR test results; of these, 44 (41%) carried MMR mutations. Post-disclosure, 54% reported screening for any type of cancer. Among carriers, >74% reported communicating results to family; communication was predicted by baseline confidence in coping with the genetic test result (Z=1.97, P=.04). Result disclosure to a physician was predicted by greater perceived cancer risk (Z=2.08, P=.03) and greater intention to share results with family (Z=3.07, P=.002). Conclusions Research vs. clinically-based gene disclosure presents challenges. A telephone disclosure process for the return of research-based results among Lynch syndrome families led to high rates of result uptake and participant communication of results to providers and family members. PMID:24091800

  3. Microsatellite Instability and Loss of Heterozygosity at Chromosomal Location 18q: Prospective Evaluation of Biomarkers for Stages II and III Colon Cancer—A Study of CALGB 9581 and 89803

    PubMed Central

    Bertagnolli, Monica M.; Redston, Mark; Compton, Carolyn C.; Niedzwiecki, Donna; Mayer, Robert J.; Goldberg, Richard M.; Colacchio, Thomas A.; Saltz, Leonard B.; Warren, Robert S.

    2011-01-01

    Purpose Colorectal cancer (CRC) develops as a result of a series of accumulated genomic changes that produce oncogene activation and tumor suppressor gene loss. These characteristics may classify CRC into subsets of distinct clinical behaviors. Patients and Methods We studied two of these genomic defects—mismatch repair deficiency (MMR-D) and loss of heterozygosity at chromosomal location 18q (18qLOH)—in patients enrolled onto two phase III cooperative group trials for treatment of potentially curable colon cancer. These trials included prospective secondary analyses to determine the relationship between these markers and treatment outcome. A total of 1,852 patients were tested for MMR status and 955 (excluding patients with MMR-D tumors) for 18qLOH. Results Compared with stage III, more stage II tumors were MMR-D (21.3% v 14.4%; P < .001) and were intact at 18q (24.2% v 15.1%; P = .001). For the combined cohort, patients with MMR-D tumors had better 5-year disease-free survival (DFS; 0.76 v 0.67; P < .001) and overall survival (OS; 0.81 v 0.78; P = .029) than those with MMR intact (MMR-I) tumors. Among patients with MMR-I tumors, the status of 18q did not affect outcome, with 5-year values for patients with 18q intact versus 18qLOH tumors of 0.74 versus 0.65 (P = .18) for DFS and 0.81 versus 0.77 (P = .18) for OS. Conclusion We conclude that MMR-D tumor status, but not the presence of 18qLOH, has prognostic value for stages II and III colon cancer. PMID:21747089

  4. Multiple genetic switches spontaneously modulating bacterial mutability

    PubMed Central

    2010-01-01

    Background All life forms need both high genetic stability to survive as species and a degree of mutability to evolve for adaptation, but little is known about how the organisms balance the two seemingly conflicting aspects of life: genetic stability and mutability. The DNA mismatch repair (MMR) system is essential for maintaining genetic stability and defects in MMR lead to high mutability. Evolution is driven by genetic novelty, such as point mutation and lateral gene transfer, both of which require genetic mutability. However, normally a functional MMR system would strongly inhibit such genomic changes. Our previous work indicated that MMR gene allele conversion between functional and non-functional states through copy number changes of small tandem repeats could occur spontaneously via slipped-strand mis-pairing during DNA replication and therefore may play a role of genetic switches to modulate the bacterial mutability at the population level. The open question was: when the conversion from functional to defective MMR is prohibited, will bacteria still be able to evolve by accepting laterally transferred DNA or accumulating mutations? Results To prohibit allele conversion, we "locked" the MMR genes through nucleotide replacements. We then scored changes in bacterial mutability and found that Salmonella strains with MMR locked at the functional state had significantly decreased mutability. To determine the generalizability of this kind of mutability 'switching' among a wider range of bacteria, we examined the distribution of tandem repeats within MMR genes in over 100 bacterial species and found that multiple genetic switches might exist in these bacteria and may spontaneously modulate bacterial mutability during evolution. Conclusions MMR allele conversion through repeats-mediated slipped-strand mis-pairing may function as a spontaneous mechanism to switch between high genetic stability and mutability during bacterial evolution. PMID:20836863

  5. Role of AtMSH7 in UV-B-induced DNA damage recognition and recombination.

    PubMed

    Lario, Luciana Daniela; Botta, Pablo; Casati, Paula; Spampinato, Claudia Patricia

    2015-06-01

    The mismatch repair (MMR) system maintains genome integrity by correcting replication-associated errors and inhibiting recombination between divergent DNA sequences. The basic features of the pathway have been highly conserved throughout evolution, although the nature and number of the proteins involved in this DNA repair system vary among organisms. Plants have an extra mismatch recognition protein, MutSγ, which is a heterodimer: MSH2-MSH7. To further understand the role of MSH7 in vivo, we present data from this protein in Arabidopsis thaliana. First, we generated transgenic plants that express β-glucuronidase (GUS) under the control of the MSH7 promoter. Histochemical staining of the transgenic plants indicated that MSH7 is preferentially expressed in proliferating tissues. Then, we identified msh7 T-DNA insertion mutants. Plants deficient in MSH7 show increased levels of UV-B-induced cyclobutane pyrimidine dimers relative to wild-type (WT) plants. Consistent with the patterns of MSH7 expression, we next analysed the role of the protein during somatic and meiotic recombination. The frequency of somatic recombination between homologous or homeologous repeats (divergence level of 1.6%) was monitored using a previously described GUS recombination reporter assay. Disruption of MSH7 has no effect on the rates of somatic homologous or homeologous recombination under control conditions or after UV-B exposure. However, the rate of meiotic recombination between two genetically linked seed-specific fluorescent markers was 97% higher in msh7 than in WT plants. Taken together, these results suggest that MSH7 is involved in UV-B-induced DNA damage recognition and in controlling meiotic recombination.

  6. Participation of DNA repair in the response to 5-fluorouracil

    PubMed Central

    Wyatt, Michael D.; Wilson, David M.

    2008-01-01

    The anti-metabolite 5-fluorouracil (5-FU) is employed clinically to manage solid tumors including colorectal and breast cancer. Intracellular metabolites of 5-FU can exert cytotoxic effects via inhibition of thymidylate synthetase, or through incorporation into RNA and DNA, events that ultimately activate apoptosis. In this review, we cover the current data implicating DNA repair processes in cellular responsiveness to 5-FU treatment. Evidence points to roles for base excision repair (BER) and mismatch repair (MMR). However, mechanistic details remain unexplained, and other pathways have not been exhaustively interrogated. Homologous recombination is of particular interest, because it resolves unrepaired DNA intermediates not properly dealt with by BER or MMR. Furthermore, crosstalk among DNA repair pathways and S-phase checkpoint signaling has not been examined. Ongoing efforts aim to design approaches and reagents that (i) approximate repair capacity and (ii) mediate strategic regulation of DNA repair in order to improve the efficacy of current anti-cancer treatments. PMID:18979208

  7. High incidence of microsatellite instability and loss of heterozygosity in three loci in breast cancer patients receiving chemotherapy: a prospective study

    PubMed Central

    2012-01-01

    Background The aim of the study was to evaluate potential chemotherapy-induced microsatellite instability, loss of heterozygosity, loss of expression in mismatch repair proteins and associations with clinical findings in breast cancer patients, especially resistance to chemotherapy and/or development of other tumors in the four years following chemotherapy treatment. Methods A comprehensive study of chemotherapy-related effects with a follow-up period of 48 months post treatment was conducted. A total of 369 peripheral blood samples were collected from 123 de novo breast cancer patients. Microsatellite instability and loss of heterozygosity in five commonly used marker loci (including Tp53-Alu of the tumor suppressor gene TP53) were analyzed in blood samples. Sampling was conducted on three occasions; 4–5 weeks prior to the first chemotherapy session (pre-treatment), to serve as a baseline, followed by two consecutive draws at 12 weeks intervals from the first collection. Mismatch repair protein expression was evaluated in cancer tissues using immunohistochemistry for three mismatch-repair related proteins. Results A total of 70.7% of the patients showed microsatellite instability for at least one locus, including 18.6% marked as high-positive and 52.1% as low-positive; 35.8% showed loss of heterozygosity in addition to microsatellite instability, while 29.3% exhibited microsatellite stability. The following incidence rates for microsatellite instability and loss of heterozygosity were detected: 39.1% positive for Tp53-Alu, 31.1% for locus Mfd41, and 25.3% for locus Mfd28. A higher occurrence of loss of heterozygosity was noted with alleles 399 and 404 of Tp53-Alu. The mismatch repair protein expression analysis showed that the chemotherapy caused a loss of 29.3% in hMLH1 expression, and 18.7% and 25.2% loss in hMSH2 and P53 expression, respectively. A strong correlation between low or deficient hMSH2 protein expression and occurrence of mismatch repair

  8. How Trypanosoma cruzi deals with oxidative stress: Antioxidant defence and DNA repair pathways.

    PubMed

    Machado-Silva, Alice; Cerqueira, Paula Gonçalves; Grazielle-Silva, Viviane; Gadelha, Fernanda Ramos; Peloso, Eduardo de Figueiredo; Teixeira, Santuza Maria Ribeiro; Machado, Carlos Renato

    2016-01-01

    Trypanosoma cruzi, the causative agent of Chagas disease, is an obligatory intracellular parasite with a digenetic life cycle. Due to the variety of host environments, it faces several sources of oxidative stress. In addition to reactive oxygen species (ROS) produced by its own metabolism, T. cruzi must deal with high ROS levels generated as part of the host's immune responses. Hence, the conclusion that T. cruzi has limited ability to deal with ROS (based on the lack of a few enzymes involved with oxidative stress responses) seems somewhat paradoxical. Actually, to withstand such variable sources of oxidative stress, T. cruzi has developed complex defence mechanisms. This includes ROS detoxification pathways that are distinct from the ones in the mammalian host, DNA repair pathways and specialized polymerases, which not only protect its genome from the resulting oxidative damage but also contribute to the generation of genetic diversity within the parasite population. Recent studies on T. cruzi's DNA repair pathways as mismatch repair (MMR) and GO system suggested that, besides a role associated with DNA repair, some proteins of these pathways may also be involved in signalling oxidative damage. Recent data also suggested that an oxidative environment might be beneficial for parasite survival within the host cell as it contributes to iron mobilization from the host's intracellular storages. Besides contributing to the understanding of basic aspects of T. cruzi biology, these studies are highly relevant since oxidative stress pathways are part of the poorly understood mechanisms behind the mode of action of drugs currently used against this parasite. By unveiling new peculiar aspects of T. cruzi biology, emerging data on DNA repair pathways and other antioxidant defences from this parasite have revealed potential new targets for a much needed boost in drug development efforts towards a better treatment for Chagas disease. PMID:27036062

  9. Cancer predisposition in mutant mice defective in multiple genetic pathways: uncovering important genetic interactions.

    PubMed

    Meira, L B; Reis, A M; Cheo, D L; Nahari, D; Burns, D K; Friedberg, E C

    2001-06-01

    Mouse models that mimic the human skin cancer-prone disease xeroderma pigmentosum (XP) provide an useful experimental system with which to study the relationship between the DNA repair process of nucleotide excision repair (NER) and ultraviolet- (UV) induced skin carcinogenesis. We have generated Xpc mutant mice and documented their deficiency in the process of NER of UV-induced DNA damage. Xpc mutant mice are highly predisposed to UV-B radiation-induced skin cancer, both in the homozygous and the heterozygous state. The combination of Xpc and Trp53 mutations enhances this predisposition and alters the tumor spectrum observed in single mutant mice. These results suggest a synergism between NER and the function of Trp53 in suppression of cancer. We have examined the mutational spectrum in the Trp53 gene from skin cancers in Trp53+/+ and Trp53+/- mice of all three Xpc genotypes and have found evidence for signature mutations associated with defective NER. In addition, we have demonstrated that Xpc mutant mice are highly predisposed to the induction of lung and liver cancers by treatment with 2-acetylaminofluorene (2-AAF) and N-OH-2-AAF. By combining the Xpc mutation with other mutations in genes involved in repair of DNA damage we have identified additional genetic interactions important in carcinogenesis. The mouse Apex gene is a critical component of the base excision repair (BER) pathway as well as the redox regulation of transcription factors important in growth control and the cellular response to DNA damage. By combining mutations in Xpc, Trp53 and Apex we have obtained genetic evidence for a functional interaction between Apex and Trp53 which probably involves the activation of the Trp53 protein by Apex. Mutations in the mismatch repair (MMR) gene Msh2 also influence the carcinogenesis observed in Xpc Trp53 mutant mice. Our results demonstrate that multiple repair pathways operate in prevention of tumor formation. PMID:11376686

  10. Nimotuzumab enhances temozolomide-induced growth suppression of glioma cells expressing mutant EGFR in vivo.

    PubMed

    Nitta, Yusuke; Shimizu, Saki; Shishido-Hara, Yukiko; Suzuki, Kaori; Shiokawa, Yoshiaki; Nagane, Motoo

    2016-03-01

    A mutant form of epidermal growth factor receptor (EGFR), EGFRvIII, is common in glioblastoma (GBM) and confers enhanced tumorigenic activity and drug resistance. Nimotuzumab, an anti-EGFR antibody, has shown preclinical and clinical activity to GBM, but its specific activity against EGFRvIII has not been fully investigated. Human glioma U87MG or LNZ308 cells overexpressing either wild-type (wt) EGFR or EGFRvIII were treated with nimotuzumab, temozolomide, or both. Expression and phosphorylation status of molecules were determined by Western blot analysis. Methylation status of promoter region of O(6) -methylguanine-DNA methyltransferase (MGMT) was detected by methylation-specific PCR. Antitumor activity was tested using nude mice bearing either subcutaneous or intracerebral xenografts along with analyses of EGFR phosphorylation status, proliferation, apoptosis, and vessel density. Nimotuzumab treatment resulted in reduction of EGFRvIII tyrosine phosphorylation with a decrease in Akt phosphorylation that was greater than that of wtEGFR. Correspondingly, antitumor effects, growth suppression and survival elongation, were more significant in mice bearing either subcutaneous or intracerebral tumor expressing EGFRvIII than in those expressing wtEGFR. These effects were markedly increased when temozolomide was combined with nimotuzumab. The post-treatment recurrent brain tumors exhibited a decrease in expression of the mismatch repair (MMR) proteins, MSH6 and MLH1, but their methylated MGMT status did not changed. Nimotuzumab has in vivo antitumor activity against GBM, especially those expressing EGFRvIII, when combined with temozolomide. This could provide a basis for preselection of patients with GBM by EGFR status who might benefit from the nimotuzumab and temozolomide combination therapy. PMID:26778701

  11. Immunohistochemical staining for p16 and BRAFV600E is useful to distinguish between sporadic and hereditary (Lynch syndrome-related) microsatellite instable colorectal carcinomas.

    PubMed

    Boissière-Michot, Florence; Frugier, Hélène; Ho-Pun-Cheung, Alexandre; Lopez-Crapez, Evelyne; Duffour, Jacqueline; Bibeau, Frédéric

    2016-08-01

    DNA mismatch repair (MMR) protein analysis by immunohistochemistry (IHC) can identify colorectal cancer (CRC) with microsatellite instability (MSI). As MLH1-deficient CRC can be hereditary or sporadic, markers to distinguish between them are needed. MLH1 promoter methylation assay is the reference method; however, sometimes, it is challenging on formalin-fixed paraffin-embedded tissue samples. We assessed by IHC the expression of BRAFV600E, p16, MGMT, and CDX2 in 55 MLH1-deficient MSI CRC samples (of which 8 had a germline MLH1 mutation) to determine whether this panel differentiates between sporadic and hereditary CRCs. We also analyzed MLH1 promoter methylation by methylation-specific PCR and pyrosequencing and BRAF status by genotyping. None of the hereditary CRCs showed MLH1 methylation, BRAF mutation, BRAFV600E-positive immunostaining, or loss of p16 expression. We detected MLH1 promoter methylation in 67 % and a BRAF mutation in 42 % of CRC, all showing MLH1 promoter methylation. BRAFV600E IHC and BRAF genotyping gave concordant results in all but two samples. Loss of expression of p16 was found in 30 % of CRC with methylation of the MLH1 promoter, but its expression was retained in all non-methylated and part of MLH1-methylated tumors (100 % specificity, 30 % sensitivity). CDX2 and MGMT expression was not associated with MLH1 status. Thus, BRAFV600E and p16 IHC may help in differentiating sporadic from hereditary MLH1-deficient CRC with MSI. Specifically, p16 IHC might be used as a surrogate marker for MLH1 promoter methylation, because all p16-negative CRCs displayed MLH1 methylation, whereas hereditary CRCs were all p16-positive. PMID:27220764

  12. Requirement of p53 targets in chemosensitization of colonic carcinoma to death ligand therapy.

    PubMed

    Wang, Shulin; El-Deiry, Wafik S

    2003-12-01

    Tumor necrosis factor-related apoptosis-inducing ligand (TRAIL) exhibits specific tumoricidal activity and is under development for cancer therapy. Mismatch-repair-deficient colonic tumors evade TRAIL-induced apoptosis through mutational inactivation of Bax, but chemotherapeutics including Camptosar (CPT-11) restore TRAIL sensitivity. However, the signaling pathways in restoring TRAIL sensitivity remain to be elucidated. Here, we imaged p53 transcriptional activity in Bax-/- carcinomas by using bioluminescence, in vivo, and find that p53 is required for sensitization to TRAIL by CPT-11. Small interfering RNAs directed at proapoptotic p53 targets reveal TRAIL receptor KILLER/DR5 contributes significantly to TRAIL sensitization, whereas Bak plays a minor role. Caspase 8 inhibition protects both CPT-11 pretreated wild-type and Bax-/- HCT116 cells from TRAIL-induced apoptosis, whereas caspase 9 inhibition only rescued the wild-type HCT116 cells from death induced by TRAIL. The results suggest a conversion in the apoptotic mechanism in HCT116 colon carcinoma from a type II pathway involving Bax and the mitochondria to a type I pathway involving efficient extrinsic pathway caspase activation. In contrast to Bax-/- cells, Bak-deficient human cancers undergo apoptosis in response to TRAIL or CPT-11, implying that these proteins have nonoverlapping functions. Our studies elucidate a mechanism for restoration of TRAIL sensitivity in MMR-deficient Bax-/- human cancers through p53-dependent activation of KILLER/DR5 and reconstitution of a type I death pathway. Efforts to identify agents that up-regulate DR5 may be useful in cancer therapies restoring TRAIL sensitivity. PMID:14645705

  13. Association of Family History with Cancer Recurrence and Survival Among Patients with Stage III Colon Cancer

    PubMed Central

    Chan, Jennifer A.; Meyerhardt, Jeffrey A.; Niedzwiecki, Donna; Hollis, Donna; Saltz, Leonard B.; Mayer, Robert J.; Thomas, James; Schaefer, Paul; Whittom, Renaud; Hantel, Alexander; Goldberg, Richard M.; Warren, Robert S.; Bertagnolli, Monica; Fuchs, Charles S.

    2011-01-01

    Context A family history of colorectal cancer in a first-degree relative increases the risk of developing colorectal cancer. However, the influence of family history on cancer recurrence and survival among patients with established disease remains uncertain. Objective To examine the association of family history of colorectal cancer with cancer recurrence and survival of patients with colon cancer. Design, Setting, and Participants Prospective observational study of 1,087 patients with stage III colon cancer enrolled in a randomized adjuvant chemotherapy trial (CALGB 89803) between April 1999 and May 2001. Patients provided data on family history at baseline and were followed up until March 2007 for disease recurrence and death (median follow-up 5.6 years). In a subset of patients, we assessed microsatellite instability (MSI) and expression of the mismatch repair (MMR) proteins, MLH1 and MSH2, in tumor specimens. Main Outcome Measure Disease-free survival, recurrence-free survival, and overall survival according to the presence or absence of a family history of colorectal cancer. Results Among 1,087 eligible patients, 195 (17.9%) reported a family history of colorectal cancer in a first-degree relative. Cancer recurrence or death occurred in 57/195 patients (29%; 95% confidence interval [CI], 23%-36%) with a family history of colorectal cancer and 343/892 patients (38%; 95% CI, 35%-42%) without a family history. Compared to patients without a family history, the adjusted hazard ratios (HR) among those with ≥1 affected first-degree relatives were 0.72 (95% CI, 0.54-0.96) for disease-free survival (DFS), 0.74 (95% CI, 0.55-0.99) for recurrence-free survival (RFS), and 0.75 (95% CI, 0.54-1.05) for overall survival (OS). This reduction in risk of cancer recurrence or death associated with a family history became stronger with an increasing number of affected first-degree relatives. Compared to participants without a family history of colorectal cancer, those with 1

  14. Protein Condensation

    NASA Astrophysics Data System (ADS)

    Gunton, James D.; Shiryayev, Andrey; Pagan, Daniel L.

    2007-09-01

    Preface; 1. Introduction; 2. Globular protein structure; 3. Experimental methods; 4. Thermodynamics and statistical mechanics; 5. Protein-protein interactions; 6. Theoretical studies of equilibrium; 7. Nucleation theory; 8. Experimental studies of nucleation; 9. Lysozyme; 10. Some other globular proteins; 11. Membrane proteins; 12. Crystallins and cataracts; 13. Sickle hemoglobin and sickle cell anemia; 14, Alzheimer's disease; Index.

  15. Protein Condensation

    NASA Astrophysics Data System (ADS)

    Gunton, James D.; Shiryayev, Andrey; Pagan, Daniel L.

    2014-07-01

    Preface; 1. Introduction; 2. Globular protein structure; 3. Experimental methods; 4. Thermodynamics and statistical mechanics; 5. Protein-protein interactions; 6. Theoretical studies of equilibrium; 7. Nucleation theory; 8. Experimental studies of nucleation; 9. Lysozyme; 10. Some other globular proteins; 11. Membrane proteins; 12. Crystallins and cataracts; 13. Sickle hemoglobin and sickle cell anemia; 14, Alzheimer's disease; Index.

  16. A common cancer-associated DNA polymerase ε mutation causes an exceptionally strong mutator phenotype, indicating fidelity defects distinct from loss of proofreading.

    PubMed

    Kane, Daniel P; Shcherbakova, Polina V

    2014-04-01

    Exonucleolytic proofreading and DNA mismatch repair (MMR) act in series to maintain high-fidelity DNA replication and to avoid mutagenesis. MMR defects elevate the overall mutation rate and are associated with increased cancer incidence. Hypermutable colorectal and endometrial tumors with functional MMR were recently reported to carry amino acid substitutions in the exonuclease domain of DNA polymerase ε (Polε). This created a notion that loss of the proofreading activity of Polε is an initiating cause of some sporadic human cancers. In this study, we identified a somatic P286R substitution in the conserved ExoI motif of Polε in a collection of 52 sporadic colorectal tumor specimens. This change has been repeatedly observed in colorectal and endometrial tumors in previous studies despite many possible ways to inactivate Polε proofreading. To understand the reasons for the recurrent appearance of the P286R variant, we characterized its functional consequences using the yeast model system. An analogous substitution in the yeast Polε produced an unusually strong mutator phenotype exceeding that of proofreading-deficient mutants by two orders of magnitude. This argues that the P286R mutation acts at some level other than loss of exonuclease to elevate cancer risk. Heterozygosity for the variant allele caused a strong mutator effect comparable with that of complete MMR deficiency, providing an explanation for why loss of heterozygosity is not required for the development of Polε-mutant human tumors.

  17. Evolution in Fast Forward: a Potential Role for Mutators in Accelerating Staphylococcus aureus Pathoadaptation

    PubMed Central

    Canfield, Gregory S.; Schwingel, Johanna M.; Foley, Matthew H.; Vore, Kelly L.; Boonanantanasarn, Kanitsak; Gill, Ann L.; Sutton, Mark D.

    2013-01-01

    Pathogen evolution and subsequent phenotypic heterogeneity during chronic infection are proposed to enhance Staphylococcus aureus survival during human infection. We tested this theory by genetically and phenotypically characterizing strains with mutations constructed in the mismatch repair (MMR) and oxidized guanine (GO) system, termed mutators, which exhibit increased spontaneous-mutation frequencies. Analysis of these mutators revealed not only strain-dependent increases in the spontaneous-mutation frequency but also shifts in mutational type and hot spots consistent with loss of GO or MMR functions. Although the GO and MMR systems are relied upon in some bacterial species to prevent reactive oxygen species-induced DNA damage, no deficit in hydrogen peroxide sensitivity was found when either of these DNA repair pathways was lost in S. aureus. To gain insight into the contribution of increased mutation supply to S. aureus pathoadaptation, we measured the rate of α-hemolysin and staphyloxanthin inactivation during serial passage. Detection of increased rates of α-hemolysin and staphyloxanthin inactivation in GO and MMR mutants suggests that these strains are capable of modifying virulence phenotypes implicated in mediating infection. Accelerated derivation of altered virulence phenotypes, combined with the absence of increased ROS sensitivity, highlights the potential of mutators to drive pathoadaptation in the host and serve as catalysts for persistent infections. PMID:23204459

  18. MMR vaccine and autism: an update of the scientific evidence.

    PubMed

    DeStefano, Frank; Thompson, William W

    2004-02-01

    An hypothesis published in 1998 suggested that measles-mumps-rubella vaccine may cause autism as a result of persistent measles virus infection of the gastrointestinal tract. Results of early studies were not supportive and in 2001 a review by the Institute of Medicine concluded that the evidence favors the rejection of a causal relationship at the population level between measles-mumps-rubella vaccine and autistic spectrum disorder. Studies published since the Institute of Medicine report have continued not to find an increased risk of autistic spectrum disorder associated with measles-mumps-rubella. The vaccine also has not been found to be associated with a unique syndrome of developmental regression and gastrointestinal disorders. The evidence now is convincing that the measles-mumps-rubella vaccine does not cause autism or any particular subtypes of autistic spectrum disorder.

  19. Measles, Mumps, Rubella and the MMR Vaccine during Pregnancy

    MedlinePlus

    ... vaccination programs have greatly decreased their incidence. These viruses are still common in some parts of the ... rare to get it again. Because these are viruses, there is no cure, but you can treat ...

  20. Gly322Asp and Asn127Ser single nucleotide polymorphisms (SNPs) of hMSH2 mismatch repair gene and the risk of triple-negative breast cancer in Polish women.

    PubMed

    Smolarz, Beata; Makowska, Marianna; Samulak, Dariusz; Michalska, Magdalena M; Romanowicz, Hanna

    2015-03-01

    Triple-negative breast cancer (TNBC) is characterised by worse clinical outcome and poor prognosis. The alterations in the oncogenes and tumor suppressor genes as well as microsatellite instability (MSI) have been associated with breast cancer development. It is knowledge that the most common mechanism inducing MSI in many cancer is genomic rearrangements found in the hMSH2 (human MutS homolog 2) gene. In this report we genotyped two polymorphisms of hMSH2 DNA repair gene in 70 TNBC patients and 70 age-matched cancer-free women using RFLP-PCR. The following polymorphisms were studied: an A/G transition at 127 positions producing an Asn/Ser substitution at codon 127 (the Asn127Ser polymorphism, rs17217772) and a G/A transition at 1032 position resulting in a Gly/Asp change at codon 322 (the Gly322Asp polymorphism, rs4987188). We found an association between the hMSH2 Asp/Asp and Gly/Asp genotypes and TNBC occurence. Variant Asp allele of hMSH2 decreased cancer risk [odds ratio (OR) 0.11; 95 % confidence interval (CI) 0.05-0.21]. The risk of TNBC in the carriers of the Gly322Gly-Asn127Ser combined genotype was increased (OR 3.71; 95 % CI 1.36-10.10). However the risk of TNBC was not alter by polymorphism Asn127Ser of the hMSH2 gene. The Gly322Asp polymorphism of the hMSH2 gene may be linked with TNBC occurrence in Polish women.

  1. Very short patch repair of T:G mismatches in vivo: importance of context and accessory proteins.

    PubMed Central

    Lieb, M; Rehmat, S

    1995-01-01

    In Escherichia coli, T:G mismatches in specific contexts are corrected by a very short patch (VSP) repair system. Previous studies have shown that the product of gene vsr mediates correction of T:G to C:G in the 5'CTAGG/3'GGTCC context and in some related contexts. Amber mutations that arose in CAG sequences in gene cI of bacteriophage lambda were used to determine the effect of flanking bases on the repair of T:G mispairs arising during phage recombination. The experimental findings were combined with published data on mismatch repair of mutations in lambda gene P and E. coli gene lacI. While VSP repair was most efficient in the context 5'CTAGG, there was very significant correction when either the 5'C or the 3' G was replaced by another base. Some mismatch repair of TAG to CAG occurred in all contexts tested. Reduction in VSP repair caused by the lack of MutL or MutS was fully complemented by the addition of vsr+ plasmids when the T:G mispair was in the 5'CTAGG/3'GGTCC context. VSP repair was decreased in bacteria containing mutS+ on a multicopy plasmid. It is suggested that VSP repair maintains sequences such as the repetitive extragenic palindromic (REP) and Chi sequences, which have important roles in E. coli and closely related bacteria. PMID:7836300

  2. Whole Gene Capture Analysis of 15 CRC Susceptibility Genes in Suspected Lynch Syndrome Patients

    PubMed Central

    van Wezel, Tom; Jagmohan-Changur, Shantie C.; Ruano, Dina; van der Klift, Heleen M.; van den Akker, Brendy E. W. M.; Laros, Jeroen F. J.; van Galen, Michiel; Wagner, Anja; Letteboer, Tom G. W.; Gómez-García, Encarna B.; Tops, Carli M. J.; Vasen, Hans F.; Devilee, Peter; Hes, Frederik J.; Morreau, Hans; Wijnen, Juul T.

    2016-01-01

    Background and Aims Lynch Syndrome (LS) is caused by pathogenic germline variants in one of the mismatch repair (MMR) genes. However, up to 60% of MMR-deficient colorectal cancer cases are categorized as suspected Lynch Syndrome (sLS) because no pathogenic MMR germline variant can be identified, which leads to difficulties in clinical management. We therefore analyzed the genomic regions of 15 CRC susceptibility genes in leukocyte DNA of 34 unrelated sLS patients and 11 patients with MLH1 hypermethylated tumors with a clear family history. Methods Using targeted next-generation sequencing, we analyzed the entire non-repetitive genomic sequence, including intronic and regulatory sequences, of 15 CRC susceptibility genes. In addition, tumor DNA from 28 sLS patients was analyzed for somatic MMR variants. Results Of 1979 germline variants found in the leukocyte DNA of 34 sLS patients, one was a pathogenic variant (MLH1 c.1667+1delG). Leukocyte DNA of 11 patients with MLH1 hypermethylated tumors was negative for pathogenic germline variants in the tested CRC susceptibility genes and for germline MLH1 hypermethylation. Somatic DNA analysis of 28 sLS tumors identified eight (29%) cases with two pathogenic somatic variants, one with a VUS predicted to pathogenic and LOH, and nine cases (32%) with one pathogenic somatic variant (n = 8) or one VUS predicted to be pathogenic (n = 1). Conclusions This is the first study in sLS patients to include the entire genomic sequence of CRC susceptibility genes. An underlying somatic or germline MMR gene defect was identified in ten of 34 sLS patients (29%). In the remaining sLS patients, the underlying genetic defect explaining the MMRdeficiency in their tumors might be found outside the genomic regions harboring the MMR and other known CRC susceptibility genes. PMID:27300758

  3. Validation and extension of the PREMM1,2 model in a population-based cohort of colorectal cancer patients

    PubMed Central

    Balaguer, Francesc; Balmaña, Judith; Castellví-Bel, Sergi; Steyerberg, Ewout W.; Andreu, Montserrat; Llor, Xavier; Jover, Rodrigo; Syngal, Sapna; Castells, Antoni

    2008-01-01

    Summary Background and aims Early recognition of patients at risk for Lynch syndrome is critical but often difficult. Recently, a predictive algorithm -the PREMM1,2 model- has been developed to quantify the risk of carrying a germline mutation in the mismatch repair (MMR) genes, MLH1 and MSH2. However, its performance in an unselected, population-based colorectal cancer population as well as its performance in combination with tumor MMR testing are unknown. Methods We included all colorectal cancer cases from the EPICOLON study, a prospective, multicenter, population-based cohort (n=1,222). All patients underwent tumor microsatellite instability analysis and immunostaining for MLH1 and MSH2, and those with MMR deficiency (n=91) underwent tumor BRAF V600E mutation analysis and MLH1/MSH2 germline testing. Results The PREMM1,2 model with a ≥5% cut-off had a sensitivity, specificity and positive predictive value (PPV) of 100%, 68% and 2%, respectively. The use of a higher PREMM1,2 cut-off provided a higher specificity and PPV, at expense of a lower sensitivity. The combination of a ≥5% cut-off with tumor MMR testing maintained 100% sensitivity with an increased specificity (97%) and PPV (21%). The PPV of a PREMM1,2 score ≥20% alone (16%) approached the PPV obtained with PREMM1,2 score ≥5% combined with tumor MMR testing. In addition, a PREMM1,2 score of <5% was associated with a high likelihood of a BRAF V600E mutation. Conclusions The PREMM1,2 model is useful to identify MLH1/MSH2 mutation carriers among unselected colorectal cancer patients. Quantitative assessment of the genetic risk might be useful to decide on subsequent tumor MMR and germline testing. PMID:18061181

  4. Association of MSH6 mutation with glioma susceptibility, drug resistance and progression

    PubMed Central

    Xie, Chaoran; Sheng, Hansong; Zhang, Nu; Li, Shiting; Wei, Xiangyu; Zheng, Xuesheng

    2016-01-01

    MutS homolog 6 (MSH6) is one of the mismatch repair proteins and is encoded by the MSH6 gene, which is located on chromosome 2 and is 23,806 bp in length, including 10 exons and 83 untranslated regions. The MSH6 protein consists of 1,358 amino acid residues and forms a heterodimer with another mismatch repair protein, MSH2. The MSH2-MSH6 heterodimeric complex is able to recognize base-base substitution and single-base insertion/deletion mismatches. Germline mutations of MSH6 lead to high susceptibility to glioma, as well as a number of benign or malignant tumors in other organs. However, somatic MSH6 mutations are not associated with susceptibility to glioma. Somatic MSH6 mutations usually follow temozolomide treatment and result in resistance to temozolomide. Subsequently, MSH6 mutations cause a hypermutation in the glioma cell genome, which may accelerate tumor progression. PMID:27446556

  5. Total protein

    MedlinePlus

    ... page: //medlineplus.gov/ency/article/003483.htm Total protein To use the sharing features on this page, please enable JavaScript. The total protein test measures the total amount of two classes ...

  6. Protein Microarrays

    NASA Astrophysics Data System (ADS)

    Ricard-Blum, S.

    Proteins are key actors in the life of the cell, involved in many physiological and pathological processes. Since variations in the expression of messenger RNA are not systematically correlated with variations in the protein levels, the latter better reflect the way a cell functions. Protein microarrays thus supply complementary information to DNA chips. They are used in particular to analyse protein expression profiles, to detect proteins within complex biological media, and to study protein-protein interactions, which give information about the functions of those proteins [3-9]. They have the same advantages as DNA microarrays for high-throughput analysis, miniaturisation, and the possibility of automation. Section 18.1 gives a brief overview of proteins. Following this, Sect. 18.2 describes how protein microarrays can be made on flat supports, explaining how proteins can be produced and immobilised on a solid support, and discussing the different kinds of substrate and detection method. Section 18.3 discusses the particular format of protein microarrays in suspension. The diversity of protein microarrays and their applications are then reported in Sect. 18.4, with applications to therapeutics (protein-drug interactions) and diagnostics. The prospects for future developments of protein microarrays are then outlined in the conclusion. The bibliography provides an extensive list of reviews and detailed references for those readers who wish to go further in this area. Indeed, the aim of the present chapter is not to give an exhaustive or detailed analysis of the state of the art, but rather to provide the reader with the basic elements needed to understand how proteins are designed and used.

  7. Dietary Proteins

    MedlinePlus

    ... meat, dairy products, nuts, and certain grains and beans. Proteins from meat and other animal products are complete proteins. This means they supply all of the amino acids the body can't make on its own. Most plant proteins are incomplete. You should eat different types ...

  8. Protein Structure

    ERIC Educational Resources Information Center

    Asmus, Elaine Garbarino

    2007-01-01

    Individual students model specific amino acids and then, through dehydration synthesis, a class of students models a protein. The students clearly learn amino acid structure, primary, secondary, tertiary, and quaternary structure in proteins and the nature of the bonds maintaining a protein's shape. This activity is fun, concrete, inexpensive and…

  9. [Lynch syndrome: case report and review of the literature].

    PubMed

    Bouguenouch, Laila; Samri, Imane; Belhassan, Khadija; Sayel, Hanane; Abbassi, Meriame; Bennis, Sanae; Benajah, Dafr Allah; Ibrahimi, Adil; Amarti, Afaf; Ouldim, Karim

    2016-01-01

    Lynch syndrome or hereditary nonpolyposis colorectal cancer (HNPCC) is the most common form of hereditary colorectal cancers. It increases cancer susceptibility, the risk of colorectal cancer in first-degree, endometrial cancer in women, and to a lesser extent, other cancers (ovarian, small bowel, stomach, urinary tract and hepatobiliary). Thus, the cumulative risk of developing colorectal cancer or endometrial cancer at the age of 80 years rises to 20 and 40% respectively. These cancers are characterized by a positive family history, their occurrence at an early age, and by the development of metachronous cancers in the same individual. This syndrome is transmitted in an autosomal dominant manner. The genes whose alteration is associated with the presence of an HNPCC belong to the family of DNA mismatch repair genes (DNA mismatch repair or MMR): MSH2, MLH1, and MSH6 are involved, in decreasing order of frequency, in 35%, 25% and 2% of cases respectively. Colonoscopic and gynecological monitoring is recommended for patients with a constitutional mutation in MSH2, MLH1 or Msh6 genes. We report one of the first moroccan case with Lynch syndrome whose constitutional mutation in the MLH1 gene was identified in a family member with colon cancer. In reply to the inquiry ofother healthy family members, a presymptomatic diagnosis was made allowing to formulate an appropriate monitoring strategy. Our study aims to highlight the role of oncogenetics in the management of patients with cancer and their families. PMID:27642480

  10. A proposal: Evolution of PCNA's role as a marker of newly replicated DNA

    PubMed Central

    Georgescu, Roxana; Langston, Lance; O'Donnell, Mike

    2015-01-01

    Processivity clamps that hold DNA polymerases to DNA for processivity were the first proteins known to encircle the DNA duplex. At the time, polymerase processivity was thought to be the only function of ring shaped processivity clamps. But studies from many laboratories have identified numerous proteins that bind and function with sliding clamps. Among these processes are mismatch repair and nucleosome assembly. Interestingly, there exist polymerases that are highly processive and do not require clamps. Hence, DNA polymerase processivity does not intrinsically require that sliding clamps evolved for this purpose. We propose that polymerases evolved to require clamps as a way of ensuring that clamps are deposited on newly replicated DNA. These clamps are then used on the newly replicated daughter strands, for processes important to genomic integrity, such as mismatch repair and the assembly of nucleosomes to maintain epigenetic states of replicating cells during development. PMID:25704660

  11. A proposal: Evolution of PCNA's role as a marker of newly replicated DNA.

    PubMed

    Georgescu, Roxana; Langston, Lance; O'Donnell, Mike

    2015-05-01

    Processivity clamps that hold DNA polymerases to DNA for processivity were the first proteins known to encircle the DNA duplex. At the time, polymerase processivity was thought to be the only function of ring shaped processivity clamps. But studies from many laboratories have identified numerous proteins that bind and function with sliding clamps. Among these processes are mismatch repair and nucleosome assembly. Interestingly, there exist polymerases that are highly processive and do not require clamps. Hence, DNA polymerase processivity does not intrinsically require that sliding clamps evolved for this purpose. We propose that polymerases evolved to require clamps as a way of ensuring that clamps are deposited on newly replicated DNA. These clamps are then used on the newly replicated daughter strands, for processes important to genomic integrity, such as mismatch repair and the assembly of nucleosomes to maintain epigenetic states of replicating cells during development. PMID:25704660

  12. A Detailed Immunohistochemical Analysis of a Large Series of Cervical and Vaginal Gastric-type Adenocarcinomas.

    PubMed

    Carleton, Claire; Hoang, Lien; Sah, Shatrughan; Kiyokawa, Takako; Karamurzin, Yevgeniy S; Talia, Karen L; Park, Kay J; McCluggage, W Glenn

    2016-05-01

    Adenocarcinomas exhibiting gastric differentiation represent a recently described and uncommon subtype of non-human papillomavirus (HPV)-related cervical adenocarcinoma. They comprise a spectrum from a well-differentiated variant (adenoma malignum/mucinous variant of minimal deviation adenocarcinoma) to a more poorly differentiated overtly malignant form, generally referred to as gastric-type adenocarcinoma. Rarely, such tumors have also been described as primary vaginal neoplasms. Gastric-type adenocarcinomas exhibit considerable morphologic overlap with adenocarcinomas originating outside the female genital tract, especially mucinous adenocarcinomas arising in the pancreas and biliary tract. Moreover, they often metastasize to unusual sites, such as the ovary and peritoneum/omentum, where they can be mistaken for metastatic adenocarcinomas from other, nongynecologic sites. There is little information regarding the immunophenotype of gastric-type adenocarcinomas, and knowledge of this is important to aid in the distinction from other adenocarcinomas. In this study, we undertook a detailed immunohistochemical analysis of a large series of cervical (n=45) and vaginal (n=2) gastric-type adenocarcinomas. Markers included were cytokeratin (CK)7, CK20, CDX2, carcinoembryonic antigen, CA125, CA19.9, p16, estrogen receptor, progesterone receptor, MUC6, PAX8, PAX2, p53, hepatocyte nuclear factor 1 beta, carbonic anhydrase IX, human epidermal receptor 2 (HER2), and mismatch repair (MMR) proteins. All markers were classified as negative, focal (<50% of tumor cells positive), or diffuse (≥50% tumor cells positive) except for p53 (classified as "wild-type" or "mutation-type"), HER2 (scored using the College of American Pathologists guidelines for gastric carcinomas), and MMR proteins (categorized as retained or lost). There was positive staining with CK7 (47/47-45 diffuse, 2 focal), MUC6 (17/21-6 diffuse, 11 focal), carcinoembryonic antigen (25/31-12 diffuse, 13 focal

  13. Transport proteins.

    PubMed

    Thatcher, Jack D

    2013-04-16

    This Teaching Resource provides and describes two animated lessons that illustrate general properties of transport proteins. The lesson called "transport protein classes" depicts major classes and subclasses of transport proteins. The "transporters, mechanism of action" lesson explains how transporters and P class ATPase (adenosine triphosphatase) pumps function. These animations serve as valuable resources for any collegiate-level course that describes these important factors. Courses that might use them include introductory biology, biochemistry, cell biology, physiology, and biophysics.

  14. Proteins wriggle.

    PubMed Central

    Cahill, Michael; Cahill, Sean; Cahill, Kevin

    2002-01-01

    We propose an algorithmic strategy for improving the efficiency of Monte Carlo searches for the low-energy states of proteins. Our strategy is motivated by a model of how proteins alter their shapes. In our model, when proteins fold under physiological conditions, their backbone dihedral angles change synchronously in groups of four or more to avoid steric clashes and respect the kinematic conservation laws. They wriggle; they do not thrash. We describe a simple algorithm that can be used to incorporate wriggling in Monte Carlo simulations of protein folding. We have tested this wriggling algorithm against a code in which the dihedral angles are varied independently (thrashing). Our standard of success is the average root-mean-square distance (rmsd) between the alpha-carbons of the folding protein and those of its native structure. After 100,000 Monte Carlo sweeps, the relative decrease in the mean rmsd, as one switches from thrashing to wriggling, rises from 11% for the protein 3LZM with 164 amino acids (aa) to 40% for the protein 1A1S with 313 aa and 47% for the protein 16PK with 415 aa. These results suggest that wriggling is useful and that its utility increases with the size of the protein. One may implement wriggling on a parallel computer or a computer farm. PMID:11964253

  15. Ubiquitin-specific Peptidase 10 (USP10) Deubiquitinates and Stabilizes MutS Homolog 2 (MSH2) to Regulate Cellular Sensitivity to DNA Damage.

    PubMed

    Zhang, Mu; Hu, Chen; Tong, Dan; Xiang, Shengyan; Williams, Kendra; Bai, Wenlong; Li, Guo-Min; Bepler, Gerold; Zhang, Xiaohong

    2016-05-13

    MSH2 is a key DNA mismatch repair protein, which plays an important role in genomic stability. In addition to its DNA repair function, MSH2 serves as a sensor for DNA base analogs-provoked DNA replication errors and binds to various DNA damage-induced adducts to trigger cell cycle arrest or apoptosis. Loss or depletion of MSH2 from cells renders resistance to certain DNA-damaging agents. Therefore, the level of MSH2 determines DNA damage response. Previous studies showed that the level of MSH2 protein is modulated by the ubiquitin-proteasome pathway, and histone deacetylase 6 (HDAC6) serves as an ubiquitin E3 ligase. However, the deubiquitinating enzymes, which regulate MSH2 remain unknown. Here we report that ubiquitin-specific peptidase 10 (USP10) interacts with and stabilizes MSH2. USP10 deubiquitinates MSH2 in vitro and in vivo Moreover, the protein level of MSH2 is positively correlated with the USP10 protein level in a panel of lung cancer cell lines. Knockdown of USP10 in lung cancer cells exhibits increased cell survival and decreased apoptosis upon the treatment of DNA-methylating agent N-methyl-N'-nitro-N-nitrosoguanidine (MNNG) and antimetabolite 6-thioguanine (6-TG). The above phenotypes can be rescued by ectopic expression of MSH2. In addition, knockdown of MSH2 decreases the cellular mismatch repair activity. Overall, our results suggest a novel USP10-MSH2 pathway regulating DNA damage response and DNA mismatch repair.

  16. DNA repair mechanisms in eukaryotes: Special focus in Entamoeba histolytica and related protozoan parasites.

    PubMed

    López-Camarillo, César; Lopez-Casamichana, Mavil; Weber, Christian; Guillen, Nancy; Orozco, Esther; Marchat, Laurence A

    2009-12-01

    Eukaryotic cell viability highly relies on genome stability and DNA integrity maintenance. The cellular response to DNA damage mainly consists of six biological conserved pathways known as homologous recombination repair (HRR), non-homologous end-joining (NHEJ), base excision repair (BER), mismatch repair (MMR), nucleotide excision repair (NER), and methyltransferase repair that operate in a concerted way to minimize genetic information loss due to a DNA lesion. Particularly, protozoan parasites survival depends on DNA repair mechanisms that constantly supervise chromosomes to correct damaged nucleotides generated by cytotoxic agents, host immune pressure or cellular processes. Here we reviewed the current knowledge about DNA repair mechanisms in the most relevant human protozoan pathogens. Additionally, we described the recent advances to understand DNA repair mechanisms in Entamoeba histolytica with special emphasis in the use of genomic approaches based on bioinformatic analysis of parasite genome sequence and microarrays technology.

  17. [Diagnosis and treatment of Lynch syndrome].

    PubMed

    Seppälä, Toni; Pylvänäinen, Kirsi; Renkonen-Sinisalo, Laura; Böhm, Jan; Kuopio, Teijo; Järvinen, Heikki J; Mecklin, Jukka-Pekka

    2016-01-01

    Lynch syndrome (LS) refers to an autosomal dominant genetic predisposition to develop colon cancer or cancers or the uterine corpus, stomach, urinary tract, ovaries, small intestine, mammary gland or bile ducts at a young age. The predisposition to cancer is caused by a germline mutation in one of the genes of the mismatch repair (MMR) system. International recommendations suggest immunohistochemical analysis of tumor tissue from at least those having developed colorectal cancer or endometrial cancer at an age of less than 70 years. This would allow the selection of patients to be referred for gene testing as well as identification of mutation carriers, for whom a regular colonoscopy follow-up is arranged at an interval of 2 to 3 years. PMID:26951027

  18. Attitudes toward childbearing and prenatal testing in individuals undergoing genetic testing for Lynch Syndrome

    PubMed Central

    Dewanwala, Akriti; Chittenden, Anu; Rosenblatt, Margery; Mercado, Rowena; Garber, Judy E.; Syngal, Sapna

    2011-01-01

    To examine attitudes toward childbearing and prenatal genetic testing among individuals at risk for Lynch Syndrome (LS), the most common type of hereditary colorectal cancer. Individuals undergoing clinical genetic testing for mismatch repair (MMR) gene mutations completed written questionnaires before and after testing. 161 of 192 (84%) eligible individuals participated in the study. Mean age was 46 years (range 20–75), 71% were female, 53% had a personal diagnosis of cancer, and 68% had children. Eighty percent worried about their children’s risk for developing cancer; however only 9% reported their decision to have children was affected by their family history of cancer. When asked whether providing prenatal testing to carriers of MMR gene mutations was ethical, 66% (86/130) of respondents agreed/strongly agreed, 25% (32) were neutral and 9% (12) disagreed/strongly disagreed. Of 48 individuals planning to have children in the future, 57% (27) intended to have children regardless of their genetic test result. If found to carry a MMR gene mutation that confirmed LS, 42% (20) would consider prenatal testing for a future pregnancy and 20% (7/35) of women would consider having children earlier in order to have prophylactic surgery to reduce their risk for gynecologic cancers. Individuals undergoing genetic testing for LS may utilize test results to make reproductive decisions. Clinicians should be prepared to discuss options of reproductive genetic technologies during counseling of LS patients of childbearing age. PMID:21567236

  19. Regulation of plant MSH2 and MSH6 genes in the UV-B-induced DNA damage response.

    PubMed

    Lario, Luciana D; Ramirez-Parra, Elena; Gutierrez, Crisanto; Casati, Paula; Spampinato, Claudia P

    2011-05-01

    Deleterious effects of UV-B radiation on DNA include the formation of cyclobutane pyrimidine dimers (CPDs) and pyrimidine (6-4) pyrimidone photoproducts (6-4PPs). These lesions must be repaired to maintain the integrity of DNA and provide genetic stability. Of the several repair systems involved in the recognition and removal of UV-B-induced lesions in DNA, the focus in the present study was on the mismatch repair system (MMR). The contribution of MutSα (MSH2-MSH6) to UV-induced DNA lesion repair and cell cycle regulation was investigated. MSH2 and MSH6 genes in Arabidopsis and maize are up-regulated by UV-B, indicating that MMR may have a role in UV-B-induced DNA damage responses. Analysis of promoter sequences identified MSH6 as a target of the E2F transcription factors. Using electrophoretic mobility shift assays, MSH6 was experimentally validated as an E2F target gene, suggesting an interaction between MMR genes and the cell cycle control. Mutations in MSH2 or MSH6 caused an increased accumulation of CPDs relative to wild-type plants. In addition, msh2 mutant plants showed a different expression pattern of cell cycle marker genes after the UV-B treatment when compared with wild-type plants. Taken together, these data provide evidence that plant MutSα is involved in a UV-B-induced DNA damage response pathway.

  20. Mature Microsatellites: Mechanisms Underlying Dinucleotide Microsatellite Mutational Biases in Human Cells

    PubMed Central

    Baptiste, Beverly A.; Ananda, Guruprasad; Strubczewski, Noelle; Lutzkanin, Andrew; Khoo, Su Jen; Srikanth, Abhinaya; Kim, Nari; Makova, Kateryna D.; Krasilnikova, Maria M.; Eckert, Kristin A.

    2013-01-01

    Dinucleotide microsatellites are dynamic DNA sequences that affect genome stability. Here, we focused on mature microsatellites, defined as pure repeats of lengths above the threshold and unlikely to mutate below it in a single mutational event. We investigated the prevalence and mutational behavior of these sequences by using human genome sequence data, human cells in culture, and purified DNA polymerases. Mature dinucleotides (≥10 units) are present within exonic sequences of >350 genes, resulting in vulnerability to cellular genetic integrity. Mature dinucleotide mutagenesis was examined experimentally using ex vivo and in vitro approaches. We observe an expansion bias for dinucleotide microsatellites up to 20 units in length in somatic human cells, in agreement with previous computational analyses of germ-line biases. Using purified DNA polymerases and human cell lines deficient for mismatch repair (MMR), we show that the expansion bias is caused by functional MMR and is not due to DNA polymerase error biases. Specifically, we observe that the MutSα and MutLα complexes protect against expansion mutations. Our data support a model wherein different MMR complexes shift the balance of mutations toward deletion or expansion. Finally, we show that replication fork progression is stalled within long dinucleotides, suggesting that mutational mechanisms within long repeats may be distinct from shorter lengths, depending on the biochemistry of fork resolution. Our work combines computational and experimental approaches to explain the complex mutational behavior of dinucleotide microsatellites in humans. PMID:23450065

  1. Homozygous PMS2 germline mutations in two families with early-onset haematological malignancy, brain tumours, HNPCC-associated tumours, and signs of neurofibromatosis type 1.

    PubMed

    Krüger, Stefan; Kinzel, Miriam; Walldorf, Constanze; Gottschling, Sven; Bier, Andrea; Tinschert, Sigrid; von Stackelberg, Arend; Henn, Wolfram; Görgens, Heike; Boue, Stephanie; Kölble, Konrad; Büttner, Reinhard; Schackert, Hans K

    2008-01-01

    Heterozygous germline mutations in mismatch repair (MMR) genes MLH1, PMS2, MSH2, and MSH6 cause Lynch syndrome. New studies have indicated that biallelic mutations lead to a distinctive syndrome, childhood cancer syndrome (CCS), with haematological malignancies and tumours of brain and bowel early in childhood, often associated with signs of neurofibromatosis type 1. We provide further evidence for CCS reporting on six children from two consanguineous families carrying homozygous PMS2 germline mutations. In family 1, all four children had the homozygous p.I590Xfs mutation. Two had a glioblastoma at the age of 6 years and one of them had three additional Lynch-syndrome associated tumours at 15. Another sibling suffered from a glioblastoma at age 9, and the fourth sibling had infantile myofibromatosis at 1. In family 2, two of four siblings were homozygous for the p.G271V mutation. One had two colorectal cancers diagnosed at ages 13 and 14, the other had a Non-Hodgkin's lymphoma and a colorectal cancer at ages 10 and 11, respectively. All children with malignancies had multiple café-au-lait spots. After reviewing published cases of biallelic MMR gene mutations, we provide a concise description of CCS, revealing similarities in age distribution with carriers of heterozygous MMR gene mutations.

  2. Immunohistochemical characterisation of molecular subtypes in endometrial cancer

    PubMed Central

    Łapińska-Szumczyk, Sylwia M; Supernat, Anna M; Majewska, Hanna I; Gulczyński, Jacek; Biernat, Wojciech; Wydra, Dariusz; Żaczek, Anna J

    2015-01-01

    Four molecular subtypes have lately been established in endometrial cancer basing on estrogen receptor (ER), progesterone receptor (PR) and HER2 status: ER+/PR+/HER2+, ER+/PR+/HER2-, ER-/PR-/HER2+ and ER-/PR-/HER2-. The subtypes have shown diversity in terms of prognosis, clinicopathological and molecular characteristics, with ER+/PR+/HER2- and ER-/PR-/HER2+ group exhibiting exceptionally benign and aggressive behavior, respectively. We have further characterized the subtypes in the context of pathways known to drive endometrial carcinogenesis: phosphatidylinositol 3-kinase (PI3K)-AKT pathway (ERBB/PI3K pathway), TP53 system, and the mismatch repair (MMR) mechanism. Analysis of tumor heterogeneity was also included. ER+/PR+/HER2+ was characterized by active ERBB/PI3K pathway occurring in 58% of cases. Subtype ER-/PR-/HER2+ was characterized by the most frequent TP53 mutations (83% of cases). Triple negative phenotype utterly lacked active ERBB/PI3K pathway. Analyzed major pathways rarely correlated with clinicopathologial data but mutated TP53 and retained MMR did correlate with shorter overall survival (both P<0.01). The presence of tumor heterogeneity was most frequent in ER-/PR-/HER2+ subtype (53% of all cases). The presented results further emphasize that the molecular subtype distinction, along with MMR and TP53 status, could be a useful diagnostic tool in guiding individualized therapy. PMID:26885170

  3. A population-based study of hereditary non-polyposis colorectal cancer: evidence of pathologic and genetic heterogeneity.

    PubMed

    Warden, G; Harnett, D; Green, J; Wish, T; Woods, M O; Green, R; Dicks, E; Rahman, P; Zhai, G; Parfrey, P

    2013-12-01

    Hereditary non-polyposis colorectal cancer (HNPCC) may be the result of Lynch syndrome (LS) caused by mutations in mismatch repair (MMR) genes, a syndrome of unknown etiology called familial colorectal cancer type-X (FCCTX), or familial serrated neoplasia associated with the colorectal cancer (CRC) somatic BRAF mutation. To determine the cause of HNPCC in the founder population of the island of Newfoundland, we studied 37 families with LS and 29 families without LS who fulfilled the Amsterdam I criteria. In non-LS, four index CRCs were BRAF mutation positive, one of which was microsatellite instable. Geographic clustering of LS families caused by three different founder mutations in MSH2 was observed. Nine unique MMR mutations in four MMR genes were identified in single families distributed in different geographic isolates. The geographic distribution of non-LS was similar to LS. The coefficient of relatedness using genotype data was significantly higher for non-LS than for all CRC. Extensive genealogic investigation failed to connect non-LS families and in some clusters pathologic CRC heterogeneity was observed. We conclude that non-LS HNPCC may be a heterogeneous disorder with different pathogenic pathways, and that the geographic distribution is consistent with multiple different mutations in unknown CRC susceptibility gene(s).

  4. Opportunities for immunotherapy in microsatellite instable colorectal cancer.

    PubMed

    Westdorp, Harm; Fennemann, Felix L; Weren, Robbert D A; Bisseling, Tanya M; Ligtenberg, Marjolijn J L; Figdor, Carl G; Schreibelt, Gerty; Hoogerbrugge, Nicoline; Wimmers, Florian; de Vries, I Jolanda M

    2016-10-01

    Microsatellite instability (MSI), the somatic accumulation of length variations in repetitive DNA sequences called microsatellites, is frequently observed in both hereditary and sporadic colorectal cancer (CRC). It has been established that defects in the DNA mismatch repair (MMR) pathway underlie the development of MSI in CRC. After the inactivation of the DNA MMR pathway, misincorporations, insertions and deletions introduced by DNA polymerase slippage are not properly recognized and corrected. Specific genomic regions, including microsatellites, are more prone for DNA polymerase slippage and, therefore, more susceptible for the introduction of these mutations if the DNA MMR capacity is lost. Some of these susceptible genomic regions are located within the coding regions of genes. Insertions and deletions in these regions may alter their reading frame, potentially resulting in the transcription and translation of frameshift peptides with c-terminally altered amino acid sequences. These frameshift peptides are called neoantigens and are highly immunogenic, which explains the enhanced immunogenicity of MSI CRC. Neoantigens contribute to increased infiltration of tumor tissue with activated neoantigen-specific cytotoxic T lymphocytes, a hallmark of MSI tumors. Currently, neoantigen-based vaccination is being studied in a clinical trial for Lynch syndrome and in a trial for sporadic MSI CRC of advanced stage. In this Focussed Research Review, we summarize current knowledge on molecular mechanisms and address immunological features of tumors with MSI. Finally, we describe their implications for immunotherapeutic approaches and provide an outlook on next-generation immunotherapy involving neoantigens and combinatorial therapies in the setting of MSI CRC. PMID:27060000

  5. Meat intake, cooking methods, dietary carcinogens, and colorectal cancer risk: findings from the Colorectal Cancer Family Registry.

    PubMed

    Joshi, Amit D; Kim, Andre; Lewinger, Juan Pablo; Ulrich, Cornelia M; Potter, John D; Cotterchio, Michelle; Le Marchand, Loic; Stern, Mariana C

    2015-06-01

    Diets high in red meat and processed meats are established colorectal cancer (CRC) risk factors. However, it is still not well understood what explains this association. We conducted comprehensive analyses of CRC risk and red meat and poultry intakes, taking into account cooking methods, level of doneness, estimated intakes of heterocyclic amines (HCAs) that accumulate during meat cooking, tumor location, and tumor mismatch repair proficiency (MMR) status. We analyzed food frequency and portion size data including a meat cooking module for 3364 CRC cases, 1806 unaffected siblings, 136 unaffected spouses, and 1620 unaffected population-based controls, recruited into the CRC Family Registry. Odds ratios (OR) and 95% confidence intervals (CI) for nutrient density variables were estimated using generalized estimating equations. We found no evidence of an association between total nonprocessed red meat or total processed meat and CRC risk. Our main finding was a positive association with CRC for pan-fried beefsteak (P(trend) < 0.001), which was stronger among MMR deficient cases (heterogeneity P = 0.059). Other worth noting associations, of borderline statistical significance after multiple testing correction, were a positive association between diets high in oven-broiled short ribs or spareribs and CRC risk (P(trend) = 0.002), which was also stronger among MMR-deficient cases, and an inverse association with grilled hamburgers (P(trend) = 0.002). Our results support the role of specific meat types and cooking practices as possible sources of human carcinogens relevant for CRC risk.

  6. Polymorphisms in DNA repair genes, recreational physical activity and breast cancer risk.

    PubMed

    McCullough, Lauren E; Santella, Regina M; Cleveland, Rebecca J; Millikan, Robert C; Olshan, Andrew F; North, Kari E; Bradshaw, Patrick T; Eng, Sybil M; Terry, Mary Beth; Shen, Jing; Crew, Katherine D; Rossner, Pavel; Teitelbaum, Susan L; Neugut, Alfred I; Gammon, Marilie D

    2014-02-01

    The mechanisms driving the inverse association between recreational physical activity (RPA) and breast cancer risk are complex. While exercise is associated with increased reactive oxygen species production it may also improve damage repair systems, particularly those that operate on single-strand breaks including base excision repair (BER), nucleotide excision repair (NER) and mismatch repair (MMR). Of these repair pathways, the role of MMR in breast carcinogenesis is least investigated. Polymorphisms in MMR or other DNA repair gene variants may modify the association between RPA and breast cancer incidence. We investigated the individual and joint effects of variants in three MMR pathway genes (MSH3, MLH1 and MSH2) on breast cancer occurrence using resources from the Long Island Breast Cancer Study Project. We additionally characterized interactions between RPA and genetic polymorphisms in MMR, BER and NER pathways. We found statistically significant multiplicative interactions (p < 0.05) between MSH2 and MLH1, as well as between postmenopausal RPA and four variants in DNA repair (XPC-Ala499Val, XPF-Arg415Gln, XPG-Asp1104His and MLH1-lle219Val). Significant risk reductions were observed among highly active women with the common genotype for XPC (OR = 0.54; 95% CI, 0.36-0.81) and XPF (OR = 0.62; 95% CI, 0.44-0.87), as well as among active women who carried at least one variant allele in XPG (OR = 0.46; 95% CI, 0.29-0.77) and MLH1 (OR = 0.46; 95% CI, 0.30-0.71). Our data show that women with minor alleles in both MSH2 and MLH1 could be at increased breast cancer risk. RPA may be modified by genes in the DNA repair pathway, and merit further investigation.

  7. Polymorphisms in DNA Repair Genes, Recreational Physical Activity and Breast Cancer Risk

    PubMed Central

    McCullough, Lauren E.; Santella, Regina M.; Cleveland, Rebecca J.; Millikan, Robert C.; Olshan, Andrew F.; North, Kari E.; Bradshaw, Patrick T.; Eng, Sybil M.; Terry, Mary Beth; Shen, Jing; Crew, Katherine D.; Rossner, Pavel; Teitelbaum, Susan L.; Neugut, Alfred I.; Gammon, Marilie D.

    2013-01-01

    The mechanisms driving the inverse association between recreational physical activity (RPA) and breast cancer risk are complex. While exercise is associated with increased reactive oxygen species production it may also improve damage repair systems, particularly those that operate on single-strand breaks including base excision repair (BER), nucleotide excision repair (NER) and mismatch repair (MMR). Of these repair pathways, the role of MMR in breast carcinogenesis is least investigated. Polymorphisms in MMR or other DNA repair gene variants may modify the association between RPA and breast cancer incidence. We investigated the individual and joint effects of variants in three MMR pathway genes (MSH3, MLH1 and MSH2) on breast cancer occurrence using resources from the Long Island Breast Cancer Study Project. We additionally characterized interactions between RPA and genetic polymorphisms in MMR, BER and NER pathways. We found statistically significant multiplicative interactions (p<0.05) between MSH2 and MLH1, as well as between postmenopausal RPA and four variants in DNA repair (XPC-Ala499Val, XPF-Arg415Gln, XPG-Asp1104His and MLH1-lle219Val). Significant risk reductions were observed among highly active women with the common genotype for XPC (OR=0.54; 95% CI, 0.36–0.81) and XPF (OR=0.62; 95% CI, 0.44–0.87), as well as among active women who carried at least one variant allele in XPG (OR=0.46; 95% CI, 0.29–0.77) and MLH1 (OR=0.46; 95% CI, 0.30–0.71). Our data show that women with minor alleles in both MSH2 and MLH1 could be at increased breast cancer risk. RPA may be modified by genes in the DNA repair pathway, and merit further investigation. PMID:23852586

  8. Biologic Determinants of Tumor Recurrence in Stage II Colon Cancer: Validation Study of the 12-Gene Recurrence Score in Cancer and Leukemia Group B (CALGB) 9581

    PubMed Central

    Venook, Alan P.; Niedzwiecki, Donna; Lopatin, Margarita; Ye, Xing; Lee, Mark; Friedman, Paula N.; Frankel, Wendy; Clark-Langone, Kim; Millward, Carl; Shak, Steven; Goldberg, Richard M.; Mahmoud, Najjia N.; Warren, Robert S.; Schilsky, Richard L.; Bertagnolli, Monica M.

    2013-01-01

    Purpose A greater understanding of the biology of tumor recurrence should improve adjuvant treatment decision making. We conducted a validation study of the 12-gene recurrence score (RS), a quantitative assay integrating stromal response and cell cycle gene expression, in tumor specimens from patients enrolled onto Cancer and Leukemia Group B (CALGB) 9581. Patients and Methods CALGB 9581 randomly assigned 1,713 patients with stage II colon cancer to treatment with edrecolomab or observation and found no survival difference. The analysis reported here included all patients with available tissue and recurrence (n = 162) and a random (approximately 1:3) selection of nonrecurring patients. RS was assessed in 690 formalin-fixed paraffin-embedded tumor samples with quantitative reverse transcriptase polymerase chain reaction by using prespecified genes and a previously validated algorithm. Association of RS and recurrence was analyzed by weighted Cox proportional hazards regression. Results Continuous RS was significantly associated with risk of recurrence (P = .013) as was mismatch repair (MMR) gene deficiency (P = .044). In multivariate analyses, RS was the strongest predictor of recurrence (P = .004), independent of T stage, MMR, number of nodes examined, grade, and lymphovascular invasion. In T3 MMR-intact (MMR-I) patients, prespecified low and high RS groups had average 5-year recurrence risks of 13% (95% CI, 10% to 16%) and 21% (95% CI, 16% to 26%), respectively. Conclusion The 12-gene RS predicts recurrence in stage II colon cancer in CALGB 9581. This is consistent with the importance of stromal response and cell cycle gene expression in colon tumor recurrence. RS appears to be most discerning for patients with T3 MMR-I tumors, although markers such as grade and lymphovascular invasion did not add value in this subset of patients. PMID:23530100

  9. Structure of the Endonuclease Domain of MutL: Unlicensed to Cut

    SciTech Connect

    Pillon, M.; Lorenowicz, J; Uckelmann, M; Klocko, A; Chung, Y; Modrich, P; Walker, G; Simmons, L; Friedhoff, P; Guarne, A

    2010-01-01

    DNA mismatch repair corrects errors that have escaped polymerase proofreading, increasing replication fidelity 100- to 1000-fold in organisms ranging from bacteria to humans. The MutL protein plays a central role in mismatch repair by coordinating multiple protein-protein interactions that signal strand removal upon mismatch recognition by MutS. Here we report the crystal structure of the endonuclease domain of Bacillus subtilis MutL. The structure is organized in dimerization and regulatory subdomains connected by a helical lever spanning the conserved endonuclease motif. Additional conserved motifs cluster around the lever and define a Zn{sup 2+}-binding site that is critical for MutL function in vivo. The structure unveils a powerful inhibitory mechanism to prevent undesired nicking of newly replicated DNA and allows us to propose a model describing how the interaction with MutS and the processivity clamp could license the endonuclease activity of MutL. The structure also provides a molecular framework to propose and test additional roles of MutL in mismatch repair.

  10. Identification and evaluation of a potent novel ATR inhibitor, NU6027, in breast and ovarian cancer cell lines

    PubMed Central

    Peasland, A; Wang, L-Z; Rowling, E; Kyle, S; Chen, T; Hopkins, A; Cliby, W A; Sarkaria, J; Beale, G; Edmondson, R J; Curtin, N J

    2011-01-01

    Background: The ataxia telangiectasia mutated and Rad3-related kinase (ATR) has a key role in the signalling of stalled replication forks and DNA damage to cell cycle checkpoints and DNA repair. It has long been recognised as an important target for cancer therapy but inhibitors have proved elusive. As NU6027, originally developed as a CDK2 inhibitor, potentiated cisplatin in a CDK2-independent manner we postulated that it may inhibit ATR. Methods: Cellular ATR kinase activity was determined by CHK1 phosphorylation in human fibroblasts with inducible dominant-negative ATR-kinase dead expression and human breast cancer MCF7 cells. Cell cycle effects and chemo- and radiopotentiation by NU6027 were determined in MCF7 cells and the role of mismatch repair and p53 was determined in isogenically matched ovarian cancer A2780 cells. Results: NU6027 is a potent inhibitor of cellular ATR activity (IC50=6.7 μ) and enhanced hydroxyurea and cisplatin cytotoxicity in an ATR-dependent manner. NU6027 attenuated G2/M arrest following DNA damage, inhibited RAD51 focus formation and increased the cytotoxicity of the major classes of DNA-damaging anticancer cytotoxic therapy but not the antimitotic, paclitaxel. In A2780 cells sensitisation to cisplatin was greatest in cells with functional p53 and mismatch repair (MMR) and sensitisation to temozolomide was greatest in p53 mutant cells with functional MMR. Importantly, NU6027 was synthetically lethal when DNA single-strand break repair is impaired either through poly(ADP-ribose) polymerase (PARP) inhibition or defects in XRCC1. Conclusion: NU6027 inhibits ATR, impairing G2/M arrest and homologous recombination thus increasing sensitivity to DNA-damaging agents and PARP inhibitors. It provides proof of concept data for clinical development of ATR inhibitors. PMID:21730979

  11. Hereditary nonpolyposis colorectal cancer: Review of clinical, molecular genetics, and counseling aspects

    SciTech Connect

    Bellacosa, A.; Genuardi, M.; Anti, M.; Viel, A.; Ponz de Leon, M.

    1996-04-24

    Lynch syndrome, or hereditary nonpolyposis colon cancer (HNPCC), is an autosomal dominant disease accounting for approximately 1-5% of all colorectal cancer cases. Due to the lack of pathognomonic morphological or biomolecular markers, HNPCC has traditionally posed unique problems to clinicians and geneticists alike, both in terms of diagnosis and clinical management. Recently, novel insight into the pathogenesis of this syndrome has been provided by the identification of its molecular basis. In HNPCC families, germline mutations in any of four genes encoding proteins of a specialized DNA repair system, the mismatch repair, predispose to cancer development. Mutations in mismatch repair genes lead to an overall increase of the mutation rate and are associated with a phenotype of length instability of microsatellite loci. The present report summarizes the clinicopathological aspects of HNPCC and reviews the most recent molecular and biochemical findings. 115 refs., 2 figs., 3 tabs.

  12. Msh2 deficiency leads to dysmyelination of the corpus callosum, impaired locomotion, and altered sensory function in mice

    PubMed Central

    Diouf, Barthelemy; Devaraju, Prakash; Janke, Laura J.; Fan, Yiping; Frase, Sharon; Eddins, Donnie; Peters, Jennifer L.; Kim, Jieun; Pei, Deqing; Cheng, Cheng; Zakharenko, Stanislav S.; Evans, William E.

    2016-01-01

    A feature in patients with constitutional DNA-mismatch repair deficiency is agenesis of the corpus callosum, the cause of which has not been established. Here we report a previously unrecognized consequence of deficiency in MSH2, a protein known primarily for its function in correcting nucleotide mismatches or insertions and deletions in duplex DNA caused by errors in DNA replication or recombination. We documented that Msh2 deficiency causes dysmyelination of the axonal projections in the corpus callosum. Evoked action potentials in the myelinated corpus callosum projections of Msh2-null mice were smaller than wild-type mice, whereas unmyelinated axons showed no difference. Msh2-null mice were also impaired in locomotive activity and had an abnormal response to heat. These findings reveal a novel pathogenic consequence of MSH2 deficiency, providing a new mechanistic hint to previously recognized neurological disorders in patients with inherited DNA-mismatch repair deficiency. PMID:27476972

  13. Heterozygous colon cancer-associated mutations of SAMHD1 have functional significance

    PubMed Central

    Rentoft, Matilda; Lindell, Kristoffer; Tran, Phong; Chabes, Anna Lena; Watt, Danielle L.; Marjavaara, Lisette; Nilsson, Anna Karin; Melin, Beatrice; Trygg, Johan; Johansson, Erik

    2016-01-01

    Even small variations in dNTP concentrations decrease DNA replication fidelity, and this observation prompted us to analyze genomic cancer data for mutations in enzymes involved in dNTP metabolism. We found that sterile alpha motif and histidine-aspartate domain-containing protein 1 (SAMHD1), a deoxyribonucleoside triphosphate triphosphohydrolase that decreases dNTP pools, is frequently mutated in colon cancers, that these mutations negatively affect SAMHD1 activity, and that several SAMHD1 mutations are found in tumors with defective mismatch repair. We show that minor changes in dNTP pools in combination with inactivated mismatch repair dramatically increase mutation rates. Determination of dNTP pools in mouse embryos revealed that inactivation of one SAMHD1 allele is sufficient to elevate dNTP pools. These observations suggest that heterozygous cancer-associated SAMHD1 mutations increase mutation rates in cancer cells. PMID:27071091

  14. Msh2 deficiency leads to dysmyelination of the corpus callosum, impaired locomotion, and altered sensory function in mice.

    PubMed

    Diouf, Barthelemy; Devaraju, Prakash; Janke, Laura J; Fan, Yiping; Frase, Sharon; Eddins, Donnie; Peters, Jennifer L; Kim, Jieun; Pei, Deqing; Cheng, Cheng; Zakharenko, Stanislav S; Evans, William E

    2016-08-01

    A feature in patients with constitutional DNA-mismatch repair deficiency is agenesis of the corpus callosum, the cause of which has not been established. Here we report a previously unrecognized consequence of deficiency in MSH2, a protein known primarily for its function in correcting nucleotide mismatches or insertions and deletions in duplex DNA caused by errors in DNA replication or recombination. We documented that Msh2 deficiency causes dysmyelination of the axonal projections in the corpus callosum. Evoked action potentials in the myelinated corpus callosum projections of Msh2-null mice were smaller than wild-type mice, whereas unmyelinated axons showed no difference. Msh2-null mice were also impaired in locomotive activity and had an abnormal response to heat. These findings reveal a novel pathogenic consequence of MSH2 deficiency, providing a new mechanistic hint to previously recognized neurological disorders in patients with inherited DNA-mismatch repair deficiency.

  15. GNL3L Is a Nucleo-Cytoplasmic Shuttling Protein: Role in Cell Cycle Regulation.

    PubMed

    Thoompumkal, Indu Jose; Subba Rao, Malireddi Rama Krishna; Kumaraswamy, Anbarasu; Krishnan, Rehna; Mahalingam, Sundarasamy

    2015-01-01

    GNL3L is an evolutionarily conserved high molecular weight GTP binding nucleolar protein belonging to HSR1-MMR1 subfamily of GTPases. The present investigation reveals that GNL3L is a nucleo-cytoplasmic shuttling protein and its export from the nucleus is sensitive to Leptomycin B. Deletion mutagenesis reveals that the C-terminal domain (amino acids 501-582) is necessary and sufficient for the export of GNL3L from the nucleus and the exchange of hydrophobic residues (M567, L570 and 572) within the C-terminal domain impairs this process. Results from the protein-protein interaction analysis indicate that GNL3L interaction with CRM1 is critical for its export from the nucleus. Ectopic expression of GNL3L leads to lesser accumulation of cells in the 'G2/M' phase of cell cycle whereas depletion of endogenous GNL3L results in 'G2/M' arrest. Interestingly, cell cycle analysis followed by BrdU labeling assay indicates that significantly increased DNA synthesis occurs in cells expressing nuclear export defective mutant (GNL3L∆NES) compared to the wild type or nuclear import defective GNL3L. Furthermore, increased hyperphosphorylation of Rb at Serine 780 and the upregulation of E2F1, cyclins A2 and E1 upon ectopic expression of GNL3L∆NES results in faster 'S' phase progression. Collectively, the present study provides evidence that GNL3L is exported from the nucleus in CRM1 dependent manner and the nuclear localization of GNL3L is important to promote 'S' phase progression during cell proliferation.

  16. Protein Crystallization

    NASA Technical Reports Server (NTRS)

    Chernov, Alexander A.

    2005-01-01

    Nucleation, growth and perfection of protein crystals will be overviewed along with crystal mechanical properties. The knowledge is based on experiments using optical and force crystals behave similar to inorganic crystals, though with a difference in orders of magnitude in growing parameters. For example, the low incorporation rate of large biomolecules requires up to 100 times larger supersaturation to grow protein, rather than inorganic crystals. Nucleation is often poorly reproducible, partly because of turbulence accompanying the mixing of precipitant with protein solution. Light scattering reveals fluctuations of molecular cluster size, its growth, surface energies and increased clustering as protein ages. Growth most often occurs layer-by-layer resulting in faceted crystals. New molecular layer on crystal face is terminated by a step where molecular incorporation occurs. Quantitative data on the incorporation rate will be discussed. Rounded crystals with molecularly disordered interfaces will be explained. Defects in crystals compromise the x-ray diffraction resolution crucially needed to find the 3D atomic structure of biomolecules. The defects are immobile so that birth defects stay forever. All lattice defects known for inorganics are revealed in protein crystals. Contribution of molecular conformations to lattice disorder is important, but not studied. This contribution may be enhanced by stress field from other defects. Homologous impurities (e.g., dimers, acetylated molecules) are trapped more willingly by a growing crystal than foreign protein impurities. The trapped impurities induce internal stress eliminated in crystals exceeding a critical size (part of mni for ferritin, lysozyme). Lesser impurities are trapped from stagnant, as compared to the flowing, solution. Freezing may induce much more defects unless quickly amorphysizing intracrystalline water.

  17. Down-regulated expression of monocyte/macrophage major histocompatibility complex receptors in human and mouse monocytes by expression of their ligands

    PubMed Central

    Yamana, H; Tashiro-Yamaji, J; Hayashi, M; Maeda, S; Shimizu, T; Tanigawa, N; Uchiyama, K; Kubota, T; Yoshida, R

    2014-01-01

    Mouse monocyte/macrophage major histocompatibility complex (MHC) receptor 1 (MMR1; or MMR2) specific for H-2Dd (or H-2Kd) molecules is expressed on monocytes from non-H-2Dd (or non-H-2Kd), but not those from H-2Dd (or H-2Kd), inbred mice. The MMR1 and/or MMR2 is essential for the rejection of H-2Dd- and/or H-2Kd-transgenic mouse skin onto C57BL/6 (H-2DbKb) mice. Recently, we found that human leucocyte antigen (HLA)-B44 was the sole ligand of human MMR1 using microbeads that had been conjugated with 80 types of HLA class I molecules covering 94·2% (or 99·4%) and 92·4% (or 96·2%) of HLA-A and B molecules of Native Americans (or Japanese), respectively. In the present study, we also explored the ligand specificity of human MMR2 using microbeads. Microbeads coated with HLA-A32, HLA-B13 or HLA-B62 antigens bound specifically to human embryonic kidney (HEK)293T or EL-4 cells expressing human MMR2 and to the solubilized MMR2-green fluorescent protein (GFP) fusion protein; and MMR2+ monocytes from a volunteer bound HLA-B62 molecules with a Kd of 8·7 × 10−9 M, implying a three times down-regulation of MMR2 expression by the ligand expression. H-2Kd (or H-2Dd) transgene into C57BL/6 mice down-regulated not only MMR2 (or MMR1) but also MMR1 (or MMR2) expression, leading to further down-regulation of MMR expression. In fact, monocytes from two (i.e. MMR1+/MMR2+ and MMR1–/MMR2–) volunteers bound seven to nine types of microbeads among 80, indicating ≤ 10 types of MMR expression on monocytes. The physiological role of constitutive MMRs on monocytes possibly towards allogeneic (e.g. fetal) cells in the blood appears to be distinct from that of inducible MMRs on macrophages toward allografts in tissue. PMID:24842626

  18. Molecular Features and Methylation Status in Early Onset (≤40 Years) Colorectal Cancer: A Population Based, Case-Control Study

    PubMed Central

    Magnani, Giulia; Furlan, Daniela; Sahnane, Nora; Reggiani Bonetti, Luca; Domati, Federica; Pedroni, Monica

    2015-01-01

    Colorectal cancer is usually considered a disease of the elderly. However, a small fraction of patients develops colorectal cancer earlier. The aim of our study was to define the frequency of known hereditary colorectal syndromes and to characterise genetic and epigenetic features of early nonhereditary tumors. Thirty-three patients ≤40 years with diagnosis of colorectal cancer and 41 patients with disease at >60 years of age were investigated for MSI, Mismatch Repair proteins expression, KRAS and BRAF mutations, hypermethylation, and LINE-1 hypomethylation. Detection of germline mutations was performed in Mismatch Repair, APC and MUTYH genes. Early onset colorectal cancer showed a high incidence of hereditary forms (18%). KRAS mutations were detected in 36% of early nonhereditary tumors. Early onset colorectal cancer disclosed an average number of methylated genes significantly lower when compared to the controls (p = 0.02). Finally both of the two groups were highly methylated in ESR1, GATA5, and WT1 genes and were similar for LINE-1 hypomethylation. The genetic make-up of carcinomas differs from young to elderly patients. Early onset tumors showed more frequently a constitutional defective of Mismatch Repair System and a minor number of methylated genes. Hypermethylation of ESR1, GATA5, and WT1 genes suggests possible markers in the earlier diagnosis of colorectal tumorigenesis. PMID:26557847

  19. Bacteriophage protein-protein interactions.

    PubMed

    Häuser, Roman; Blasche, Sonja; Dokland, Terje; Haggård-Ljungquist, Elisabeth; von Brunn, Albrecht; Salas, Margarita; Casjens, Sherwood; Molineux, Ian; Uetz, Peter

    2012-01-01

    Bacteriophages T7, λ, P22, and P2/P4 (from Escherichia coli), as well as ϕ29 (from Bacillus subtilis), are among the best-studied bacterial viruses. This chapter summarizes published protein interaction data of intraviral protein interactions, as well as known phage-host protein interactions of these phages retrieved from the literature. We also review the published results of comprehensive protein interaction analyses of Pneumococcus phages Dp-1 and Cp-1, as well as coliphages λ and T7. For example, the ≈55 proteins encoded by the T7 genome are connected by ≈43 interactions with another ≈15 between the phage and its host. The chapter compiles published interactions for the well-studied phages λ (33 intra-phage/22 phage-host), P22 (38/9), P2/P4 (14/3), and ϕ29 (20/2). We discuss whether different interaction patterns reflect different phage lifestyles or whether they may be artifacts of sampling. Phages that infect the same host can interact with different host target proteins, as exemplified by E. coli phage λ and T7. Despite decades of intensive investigation, only a fraction of these phage interactomes are known. Technical limitations and a lack of depth in many studies explain the gaps in our knowledge. Strategies to complete current interactome maps are described. Although limited space precludes detailed overviews of phage molecular biology, this compilation will allow future studies to put interaction data into the context of phage biology. PMID:22748812

  20. Recombinant protein production technology

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Recombinant protein production is an important technology for antibody production, biochemical activity study, and structural determination during the post-genomic era. Limiting factors in recombinant protein production include low-level protein expression, protein precipitation, and loss of protein...

  1. Mycobacterium tuberculosis efpA encodes an efflux protein of the QacA transporter family.

    PubMed Central

    Doran, J L; Pang, Y; Mdluli, K E; Moran, A J; Victor, T C; Stokes, R W; Mahenthiralingam, E; Kreiswirth, B N; Butt, J L; Baron, G S; Treit, J D; Kerr, V J; Van Helden, P D; Roberts, M C; Nano, F E

    1997-01-01

    The Mycobacterium tuberculosis H37Rv efpA gene encodes a putative efflux protein, EfpA, of 55,670 Da. The deduced EfpA protein was similar in secondary structure to Pur8, MmrA, TcmA, LfrA, EmrB, and other members of the QacA transporter family (QacA TF) which mediate antibiotic and chemical resistance in bacteria and yeast. The predicted EfpA sequence possessed all transporter motifs characteristic of the QacA TF, including those associated with proton-antiport function and the motif considered to be specific to exporters. The 1,590-bp efpA open reading frame was G+C rich (65%), whereas the 40-bp region immediately upstream had an A+T bias (35% G+C). Reverse transcriptase-PCR assays indicated that efpA was expressed in vitro and in situ. Putative promoter sequences were partially overlapped by the A+T-rich region and by a region capable of forming alternative secondary structures indicative of transcriptional regulation in analogous systems. PCR single-stranded conformational polymorphism analysis demonstrated that these upstream flanking sequences and the 231-bp, 5' coding region are highly conserved among both drug-sensitive and multiply-drug-resistant isolates of M. tuberculosis. The efpA gene was present in the slow-growing human pathogens M. tuberculosis, Mycobacterium leprae, and Mycobacterium bovis and in the opportunistic human pathogens Mycobacterium avium and Mycobacterium intracellular. However, efpA was not present in 17 other opportunistically pathogenic or nonpathogenic mycobacterial species. PMID:9008277

  2. Distinct Phenotypes Caused by Mutation of MSH2 in Trypanosome Insect and Mammalian Life Cycle Forms Are Associated with Parasite Adaptation to Oxidative Stress

    PubMed Central

    Bolderson, Jason; Campos, Priscila C.; Miranda, Julia B.; Alves, Ceres L.; Machado, Carlos R.; McCulloch, Richard; Teixeira, Santuza M. R.

    2015-01-01

    Background DNA repair mechanisms are crucial for maintenance of the genome in all organisms, including parasites where successful infection is dependent both on genomic stability and sequence variation. MSH2 is an early acting, central component of the Mismatch Repair (MMR) pathway, which is responsible for the recognition and correction of base mismatches that occur during DNA replication and recombination. In addition, recent evidence suggests that MSH2 might also play an important, but poorly understood, role in responding to oxidative damage in both African and American trypanosomes. Methodology/Principal Findings To investigate the involvement of MMR in the oxidative stress response, null mutants of MSH2 were generated in Trypanosoma brucei procyclic forms and in Trypanosoma cruzi epimastigote forms. Unexpectedly, the MSH2 null mutants showed increased resistance to H2O2 exposure when compared with wild type cells, a phenotype distinct from the previously observed increased sensitivity of T. brucei bloodstream forms MSH2 mutants. Complementation studies indicated that the increased oxidative resistance of procyclic T. brucei was due to adaptation to MSH2 loss. In both parasites, loss of MSH2 was shown to result in increased tolerance to alkylation by MNNG and increased accumulation of 8-oxo-guanine in the nuclear and mitochondrial genomes, indicating impaired MMR. In T. cruzi, loss of MSH2 also increases the parasite capacity to survive within host macrophages. Conclusions/Significance Taken together, these results indicate MSH2 displays conserved, dual roles in MMR and in the response to oxidative stress. Loss of the latter function results in life cycle dependent differences in phenotypic outcomes in T. brucei MSH2 mutants, most likely because of the greater burden of oxidative stress in the insect stage of the parasite. PMID:26083967

  3. Mutation Profiling and Microsatellite Instability in Stage II and III Colon Cancer: An Assessment of Their Prognostic and Oxaliplatin Predictive Value

    PubMed Central

    Gavin, Patrick G.; Colangelo, Linda H.; Fumagalli, Debora; Tanaka, Noriko; Remillard, Matthew Y.; Yothers, Greg; Kim, Chungyeul; Taniyama, Yusuke; Kim, Seung Il; Choi, Hyun Joo; Blackmon, Nicole L.; Lipchik, Corey; Petrelli, Nicholas J.; O'Connell, Michael J.; Wolmark, Norman; Paik, Soonmyung; Pogue-Geile, Kay L.

    2014-01-01

    Purpose The purpose of this study was to examine the prognostic and oxaliplatin predictive value of mismatch repair (MMR) status and common hot spot mutations, which we previously identified in stage II and III colon cancer. Experimental Design Mutations in BRAF, KRAS, NRAS, MET, and PIK3CA were profiled in 2,299 stage II and III colon tumors from National Surgical Adjuvant Breast and Bowel Project (NSABP) clinical trials C-07 (n = 1,836) and C-08 (n = 463) with Type Plex chemistry and mass spectrometry. C-07 tested the worth of adding oxaliplatin to 5-fluorouracil plus leucovorin, and C-08 tested the worth of adding bevacizumab to FOLFOX. Cox proportional hazard models were used to assess prognostic or oxaliplatin predictive value of mutations for tumor recurrence, overall survival (OS), and survival after recurrence (SAR). Results BRAF mutations were associated with MMR-deficient tumors (P < 0.0001), poor OS [HR, 1.46; 95% confidence interval (CI), 1.20–1.79; P S: 0.0002], and poor SAR (HR, 2.31; 95% CI, 1.83–2.95; P < 0.0001). Mutations in KRAS, NRAS, MET, and PIK3CA were not associated with recurrence, OS, or SAR. MMR-deficient tumors were associated with an improved prognosis based on recurrence (HR, 0.48; 95% CI, 0.33–0.70; P < 0.0001). Mutations and MMR status were not predictive for oxaliplatin benefit. Conclusions This study shows that BRAF mutations profiled from stage II and III colon cancer tumors were associated with poor SAR and validates and explains, at least in part, previous observations associating it with poor OS. Profiling of all of these mutations is warranted for future clinical trials testing new targeted therapies that block relevant signaling pathways. Such clinical trials are under development at NSABP. PMID:23045248

  4. Background Mutational Features of the Radiation-Resistant Bacterium Deinococcus radiodurans.

    PubMed

    Long, Hongan; Kucukyildirim, Sibel; Sung, Way; Williams, Emily; Lee, Heewook; Ackerman, Matthew; Doak, Thomas G; Tang, Haixu; Lynch, Michael

    2015-09-01

    Deinococcus bacteria are extremely resistant to radiation, oxidation, and desiccation. Resilience to these factors has been suggested to be due to enhanced damage prevention and repair mechanisms, as well as highly efficient antioxidant protection systems. Here, using mutation-accumulation experiments, we find that the GC-rich Deinococcus radiodurans has an overall background genomic mutation rate similar to that of E. coli, but differs in mutation spectrum, with the A/T to G/C mutation rate (based on a total count of 88 A:T → G:C transitions and 82 A:T → C:G transversions) per site per generation higher than that in the other direction (based on a total count of 157 G:C → A:T transitions and 33 G:C → T:A transversions). We propose that this unique spectrum is shaped mainly by the abundant uracil DNA glycosylases reducing G:C → A:T transitions, adenine methylation elevating A:T → C:G transversions, and absence of cytosine methylation decreasing G:C → A:T transitions. As opposed to the greater than 100× elevation of the mutation rate in MMR(-) (DNA Mismatch Repair deficient) strains of most other organisms, MMR(-) D. radiodurans only exhibits a 4-fold elevation, raising the possibility that other DNA repair mechanisms compensate for a relatively low-efficiency DNA MMR pathway. As D. radiodurans has plentiful insertion sequence (IS) elements in the genome and the activities of IS elements are rarely directly explored, we also estimated the insertion (transposition) rate of the IS elements to be 2.50 × 10(-3) per genome per generation in the wild-type strain; knocking out MMR did not elevate the IS element insertion rate in this organism.

  5. Female Hormonal Factors and the Risk of Endometrial Cancer in Lynch Syndrome

    PubMed Central

    Dashti, Seyedeh Ghazaleh; Chau, Rowena; Ouakrim, Driss Ait; Buchanan, Daniel D.; Clendenning, Mark; Young, Joanne P.; Winship, Ingrid M.; Arnold, Julie; Ahnen, Dennis J.; Haile, Robert W.; Casey, Graham; Gallinger, Steven; Thibodeau, Stephen N.; Lindor, Noralane M.; Le Marchand, Loïc; Newcomb, Polly A.; Potter, John D.; Baron, John A.; Hopper, John L.; Jenkins, Mark A.; Win, Aung Ko

    2015-01-01

    Importance Apart from hysterectomy, there is no consensus recommendation for reducing endometrial cancer risk for women with a mismatch repair (MMR) gene mutation (Lynch syndrome). Objective To investigate the association between hormonal factors and endometrial cancer risk in Lynch syndrome. Design, Setting, and Participants A retrospective cohort study including 1,128 women with a MMR gene mutation identified from the Colon Cancer Family Registry was conducted. Data were analyzed using a weighted cohort approach. Participants were recruited between 1997 and 2012, from centers across the United States, Australia, Canada, and New Zealand. Exposures Age at menarche, first and last live birth, and menopause, number of live births, hormonal contraceptive use, and postmenopausal hormone use. Main Outcome and Measures Self-reported diagnosis of endometrial cancer. Results Endometrial cancer was diagnosed in 133 women (incidence per 100 person-years, 0.29; 95% confidence interval [CI], 0.24 to 0.34). A lower risk of endometrial cancer was associated with later age at menarche (hazard ratio [HR] per year, 0.85 [95%CI, 0.73 to 0.99]; P=.04), parity (parous vs nulliparous: HR, 0.21 [95%CI, 0.10 to 0.42]; P<.001), and hormonal contraceptive use (≥1 year vs <1 year: HR, 0.39 [95%CI, 0.23 to 0.64]; P<.001). There was no statistically significant association between endometrial cancer and age at first and last live birth, age at menopause, and postmenopausal hormone use. Conclusions and Relevance For women with a MMR gene mutation, some endogenous and exogenous hormonal factors were associated with a lower risk of endometrial cancer. These directions and strengths of associations were similar to those for the general population. If replicated, these findings suggest that women with a MMR gene mutation may be counseled like the general population in regard to hormonal influences on endometrial cancer risk. PMID:26151267

  6. Protein electrophoresis - serum

    MedlinePlus

    ... of protein and fat, called lipoproteins (such as LDL cholesterol). ... globulin proteins may indicate: Abnormally low level of LDL cholesterol Malnutrition Increased gamma globulin proteins may indicate: Bone ...

  7. Protein sulfhydration.

    PubMed

    Paul, Bindu D; Snyder, Solomon H

    2015-01-01

    Hydrogen sulfide (H2S) is one of the gasotransmitters that modulates various biological processes and participates in multiple signaling pathways. H2S signals by a process termed sulfhydration. Sulfhydration has recently been recognized as a posttranslational modification similar to nitrosylation. Sulfhydration occurs at reactive cysteine residues in proteins and results in the conversion of an -SH group of cysteine to an -SSH or a persulfide group. Sulfhydration is highly prevalent in vivo, and aberrant sulfhydration patterns have been observed under several pathological conditions ranging from heart disease to neurodegenerative diseases such as Parkinson's disease. The biotin switch assay, originally developed to detect nitrosylation, has been modified to detect sulfhydration. In this chapter, we discuss the physiological roles of sulfhydration and the methodologies used to detect this modification.

  8. CD46 measles virus receptor polymorphisms influence receptor protein expression and primary measles vaccine responses in naive Australian children.

    PubMed

    Clifford, Holly D; Hayden, Catherine M; Khoo, Siew-Kim; Zhang, Guicheng; Le Souëf, Peter N; Richmond, Peter

    2012-05-01

    Despite the availability of measles vaccines, infants continue to die from measles. Measles vaccine responses vary between individuals, and poor immunogenicity is likely to preclude protection against measles. CD46 is a ubiquitously expressed specific receptor for vaccine strains of measles virus. CD46 polymorphisms have not been functionally investigated but may affect CD46 protein expression, which in turn may mediate primary measles antibody responses in infants. In a cohort of children aged 12 to 14 months from Perth, Australia (n = 137), after their first dose of measles-mumps-rubella (MMR) vaccine, CD46 polymorphisms were genotyped, and postvaccination measles IgG and CD46 protein expression before and after measles lysate stimulation of cells were measured. Three CD46 variants (rs7144, rs11118580, and rs2724384) were significantly associated with measles virus-specific IgG levels (P = 0.008, P = 0.026, and P = 0.018, respectively). There were significant differences between CD46 rs7144 genotypes and CD46 protein expression on T cells, as well as the downregulation of CD46 and T-cell frequency after measles lysate stimulation. We show that CD46 polymorphisms were associated with primary measles antibody responses in naive infants. We also report the first association of a measles virus receptor polymorphism with functional effects on the receptor, suggesting a possible mechanism through which antibody responses are altered. Elucidating all of the interconnecting genetic factors that alter primary measles vaccine responses may be important for identifying children at risk of poor immunogenicity or vaccine failure and for the future design of vaccine strategies to help these children.

  9. Age related microsatellite instability in T cells from healthy individuals.

    PubMed

    Krichevsky, Svetlana; Pawelec, Graham; Gural, Alexander; Effros, Rita B; Globerson, Amiela; Yehuda, Dina Ben; Yehuda, Arie Ben

    2004-04-01

    Many immune functions decline with age and may jeopardize the elderly, as illustrated, for example by the significantly higher mortality rate from influenza in old age. Although innate and humoral immunity are affected by aging, it is the T cell compartment, which manifests most alterations. The mechanisms behind these alterations are still unclear, and several explanations have been offered including thymic involution and Telomere attrition leading to cell senescence. Age related accumulation of mutations has been documented and could serve as an additional mechanism of T cell dysfunction. One effective repair mechanism capable of rectifying errors in DNA replications is the mismatch repair (MMR) system. We previously reported a comparative examination of individual DNA samples from blood cells obtained at 10 year intervals from young and old subjects. We showed significantly higher rates of microsatellite instability (MSI), an indicator of MMR dysfunction in older subjects, compared to young. In the present study we confirm this result, using direct automated sequencing and in addition, we demonstrate that as CD8 lymphocytes from aged individuals, undergo repeated population doublings (PDs) in culture, they develop MSI. CD4 clones that also undergo repeated PDs in culture develop significant MSI as well. Elucidation of this previously unexplored facet of lymphocyte dynamics in relation to aging may help identify novel mechanisms of immunosenescence and pathways that could serve as targets for interventions to restore immune function.

  10. The stem cell renewal and DNA damage response pathways are frequently altered in fibroepithelial tumors of breast in Indian patients.

    PubMed

    Mukherjee, Nupur; Islam, Md Saimul; Roychowdhury, Anirban; Bhattacharya, Rittwika; Chunder, Nilanjana; Bhattacharya, Nilanjana; Sinha, Satyabrata; Alam, Neyaz; Roy, Anup; Roychoudhury, Susanta; Panda, Chinmay Kumar

    2016-03-01

    Genetic and epigenetic alterations in genes associated with distinct cellular pathways were checked in fibroepithelial tumors, including fibroadenomas, benign and malignant phyllode and atypical ductal hyperplasia. A panel of 22 genes associated with different cellular pathways such as stem cell renewal (Wnt and Hedgehog), DNA damage response [homologous recombination (HR), mismatch repair (MMR) and nucleotide excision repair (NER)] and cell proliferation signaling pathway were tested. Alterations (genetic/epigenetic) of the genes associated with Wnt signaling pathway were detected in 100% (20/20) of the breast tumors for at least one out of the six Wnt antagonists tested. Frequent molecular alterations (57-64%) were detected in HR and MMR pathway and low frequency of alterations (8-25%) were seen in cell-proliferation and cell signaling pathways showing a differential pattern of alterations in different tumor types. The patterns of alterations, in particular the epigenetic alterations, differed little from that seen previously in breast carcinoma cells, suggesting epigenetic alterations to be an early event in the development of the tumors. In gene ontology analysis, it was evident that Wnt signaling pathway [GO: 0030111, Kegg: 04310], cell proliferation pathway [GO: 0008285] and pathways in cancer [Kegg: 05200] were significantly enriched by differentially altered genes in fibroadenoma and phyllode tumor types. All these results may provide a new breakthrough in early diagnosis, prognosis and treatment of these tumors. PMID:26774289

  11. Epigenetic Loss of MLH1 Expression in Normal Human Hematopoietic Stem Cell Clones is Defined by the Promoter CpG Methylation Pattern Observed by High-Throughput Methylation Specific Sequencing

    PubMed Central

    Kenyon, Jonathan; Nickel-Meester, Gabrielle; Qing, Yulan; Santos-Guasch, Gabriela; Drake, Ellen; PingfuFu; Sun, Shuying; Bai, Xiaodong; Wald, David; Arts, Eric; Gerson, Stanton L.

    2016-01-01

    Normal human hematopoietic stem and progenitor cells (HPC) lose expression of MLH1, an important mismatch repair (MMR) pathway gene, with age. Loss of MMR leads to replication dependent mutational events and microsatellite instability observed in secondary acute myelogenous leukemia and other hematologic malignancies. Epigenetic CpG methylation upstream of the MLH1 promoter is a contributing factor to acquired loss of MLH1 expression in tumors of the epithelia and proximal mucosa. Using single molecule high-throughput bisulfite sequencing we have characterized the CpG methylation landscape from −938 to −337 bp upstream of the MLH1 transcriptional start site (position +0), from 30 hematopoietic colony forming cell clones (CFC) either expressing or not expressing MLH1. We identify a correlation between MLH1 promoter methylation and loss of MLH1 expression. Additionally, using the CpG site methylation frequencies obtained in this study we were able to generate a classification algorithm capable of sorting the expressing and non-expressing CFC. Thus, as has been previously described for many tumor cell types, we report for the first time a correlation between the loss of MLH1 expression and increased MLH1 promoter methylation in CFC derived from CD34+ selected hematopoietic stem and progenitor cells. PMID:27570841

  12. The Effect of Msh2 Knockdown on Toxicity Induced by tert-Butyl-hydroperoxide, Potassium Bromate, and Hydrogen Peroxide in Base Excision Repair Proficient and Deficient Cells

    PubMed Central

    Cooley, N.; Elder, R. H.; Povey, A. C.

    2013-01-01

    The DNA mismatch repair (MMR) and base excision repair (BER) systems are important determinants of cellular toxicity following exposure to agents that cause oxidative DNA damage. To examine the interactions between these different repair systems, we examined whether toxicity, induced by t-BOOH and KBrO3, differs in BER proficient (Mpg+/+, Nth1+/+) and deficient (Mpg−/−, Nth1−/−) mouse embryonic fibroblasts (MEFs) following Msh2 knockdown of between 79 and 88% using an shRNA expression vector. Msh2 knockdown in Nth1+/+ cells had no effect on t-BOOH and KBrO3 induced toxicity as assessed by an MTT assay; knockdown in Nth1−/− cells resulted in increased resistance to t-BOOH and KBrO3, a result consistent with Nth1 removing oxidised pyrimidines. Msh2 knockdown in Mpg+/+ cells had no effect on t-BOOH toxicity but increased resistance to KBrO3; in Mpg−/− cells, Msh2 knockdown increased cellular sensitivity to KBrO3 but increased resistance to t-BOOH, suggesting a role for Mpg in removing DNA damage induced by these agents. MSH2 dependent and independent pathways then determine cellular toxicity induced by oxidising agents. A complex interaction between MMR and BER repair systems, that is, exposure dependent, also exists to determine cellular toxicity. PMID:23984319

  13. A human RNA polymerase II subunit is encoded by a recently generated multigene family

    PubMed Central

    Grandemange, Sylvie; Schaller, Sophie; Yamano, Shigeru; Du Manoir, Stanislas; Shpakovski, George V; Mattei, Marie-Geneviève; Kedinger, Claude; Vigneron, Marc

    2001-01-01

    Background The sequences encoding the yeast RNA polymerase II (RPB) subunits are single copy genes. Results While those characterized so far for the human (h) RPB are also unique, we show that hRPB subunit 11 (hRPB11) is encoded by a multigene family, mapping on chromosome 7 at loci p12, q11.23 and q22. We focused on two members of this family, hRPB11a and hRPB11b: the first encodes subunit hRPB11a, which represents the major RPB11 component of the mammalian RPB complex ; the second generates polypeptides hRPB11bα and hRPB11bβ through differential splicing of its transcript and shares homologies with components of the hPMS2L multigene family related to genes involved in mismatch-repair functions (MMR). Both hRPB11a and b genes are transcribed in all human tissues tested. Using an inter-species complementation assay, we show that only hRPB11bα is functional in yeast. In marked contrast, we found that the unique murine homolog of RPB11 gene maps on chromosome 5 (band G), and encodes a single polypeptide which is identical to subunit hRPB11a. Conclusions The type hRPB11b gene appears to result from recent genomic recombination events in the evolution of primates, involving sequence elements related to the MMR apparatus. PMID:11747469

  14. Fusion-protein-assisted protein crystallization.

    PubMed

    Kobe, Bostjan; Ve, Thomas; Williams, Simon J

    2015-07-01

    Fusion proteins can be used directly in protein crystallization to assist crystallization in at least two different ways. In one approach, the `heterologous fusion-protein approach', the fusion partner can provide additional surface area to promote crystal contact formation. In another approach, the `fusion of interacting proteins approach', protein assemblies can be stabilized by covalently linking the interacting partners. The linker connecting the proteins plays different roles in the two applications: in the first approach a rigid linker is required to reduce conformational heterogeneity; in the second, conversely, a flexible linker is required that allows the native interaction between the fused proteins. The two approaches can also be combined. The recent applications of fusion-protein technology in protein crystallization from the work of our own and other laboratories are briefly reviewed.

  15. EDITORIAL: Precision proteins Precision proteins

    NASA Astrophysics Data System (ADS)

    Demming, Anna

    2010-06-01

    Since the birth of modern day medicine, during the times of Hippocrates in ancient Greece, the profession has developed from the rudimentary classification of disease into a rigorous science with an inspiring capability to treat and cure. Scientific methodology has distilled clinical diagnostic tools from the early arts of prognosis, which used to rely as much on revelation and prophecy, as intuition and judgement [1]. Over the past decade, research into the interactions between proteins and nanosystems has provided some ingenious and apt techniques for delving into the intricacies of anatomical systems. In vivo biosensing has emerged as a vibrant field of research, as much of medical diagnosis relies on the detection of substances or an imbalance in the chemicals in the body. The inherent properties of nanoscale structures, such as cantilevers, make them well suited to biosensing applications that demand the detection of molecules at very low concentrations. Measurable deflections in cantilevers functionalised with antibodies provide quantitative indicators of the presence of specific antigens when the two react. Such developments have roused mounting interest in the interactions of proteins with nanostructures, such as carbon nanotubes [3], which have demonstrated great potential as generic biomarkers. Plasmonic properties are also being exploited in sensing applications, such as the molecular sentinel recently devised by researchers in the US. The device uses the plasmonic properties of a silver nanoparticle linked to a Raman labelled hairpin DNA probe to signal changes in the probe geometry resulting from interactions with substances in the environment. Success stories so far include the detection of two specific genes associated with breast cancer [4]. A greater understanding of how RNA interference regulates gene expression has highlighted the potential of using this natural process as another agent for combating disease in personalized medicine. However, the

  16. EDITORIAL: Precision proteins Precision proteins

    NASA Astrophysics Data System (ADS)

    Demming, Anna

    2010-06-01

    Since the birth of modern day medicine, during the times of Hippocrates in ancient Greece, the profession has developed from the rudimentary classification of disease into a rigorous science with an inspiring capability to treat and cure. Scientific methodology has distilled clinical diagnostic tools from the early arts of prognosis, which used to rely as much on revelation and prophecy, as intuition and judgement [1]. Over the past decade, research into the interactions between proteins and nanosystems has provided some ingenious and apt techniques for delving into the intricacies of anatomical systems. In vivo biosensing has emerged as a vibrant field of research, as much of medical diagnosis relies on the detection of substances or an imbalance in the chemicals in the body. The inherent properties of nanoscale structures, such as cantilevers, make them well suited to biosensing applications that demand the detection of molecules at very low concentrations. Measurable deflections in cantilevers functionalised with antibodies provide quantitative indicators of the presence of specific antigens when the two react. Such developments have roused mounting interest in the interactions of proteins with nanostructures, such as carbon nanotubes [3], which have demonstrated great potential as generic biomarkers. Plasmonic properties are also being exploited in sensing applications, such as the molecular sentinel recently devised by researchers in the US. The device uses the plasmonic properties of a silver nanoparticle linked to a Raman labelled hairpin DNA probe to signal changes in the probe geometry resulting from interactions with substances in the environment. Success stories so far include the detection of two specific genes associated with breast cancer [4]. A greater understanding of how RNA interference regulates gene expression has highlighted the potential of using this natural process as another agent for combating disease in personalized medicine. However, the

  17. Protein Crystal Based Nanomaterials

    NASA Technical Reports Server (NTRS)

    Bell, Jeffrey A.; VanRoey, Patrick

    2001-01-01

    This is the final report on a NASA Grant. It concerns a description of work done, which includes: (1) Protein crystals cross-linked to form fibers; (2) Engineering of protein to favor crystallization; (3) Better knowledge-based potentials for protein-protein contacts; (4) Simulation of protein crystallization.

  18. Shotgun protein sequencing.

    SciTech Connect

    Faulon, Jean-Loup Michel; Heffelfinger, Grant S.

    2009-06-01

    A novel experimental and computational technique based on multiple enzymatic digestion of a protein or protein mixture that reconstructs protein sequences from sequences of overlapping peptides is described in this SAND report. This approach, analogous to shotgun sequencing of DNA, is to be used to sequence alternative spliced proteins, to identify post-translational modifications, and to sequence genetically engineered proteins.

  19. Protein immobilization strategies for protein biochips.

    PubMed

    Rusmini, Federica; Zhong, Zhiyuan; Feijen, Jan

    2007-06-01

    In the past few years, protein biochips have emerged as promising proteomic and diagnostic tools for obtaining information about protein functions and interactions. Important technological innovations have been made. However, considerable development is still required, especially regarding protein immobilization, in order to fully realize the potential of protein biochips. In fact, protein immobilization is the key to the success of microarray technology. Proteins need to be immobilized onto surfaces with high density in order to allow the usage of small amount of sample solution. Nonspecific protein adsorption needs to be avoided or at least minimized in order to improve detection performances. Moreover, full retention of protein conformation and activity is a challenging task to be accomplished. Although a large number of review papers on protein biochips have been published in recent years, few have focused on protein immobilization technology. In this review, current protein immobilization strategies, including physical, covalent, and bioaffinity immobilization for the fabrication of protein biochips, are described. Particular consideration has been given to oriented immobilization, also referred to as site-specific immobilization, which is believed will improve homogeneous surface covering and accessibility of the active site.

  20. Protein-losing enteropathy

    MedlinePlus

    ... this page: //medlineplus.gov/ency/article/007338.htm Protein-losing enteropathy To use the sharing features on this page, please enable JavaScript. Protein-losing enteropathy is an abnormal loss of protein ...

  1. Protein in diet

    MedlinePlus

    ... basic structure of protein is a chain of amino acids. You need protein in your diet to help ... Protein foods are broken down into parts called amino acids during digestion. The human body needs a number ...

  2. Immunogenicity and safety of measles-mumps-rubella and varicella vaccines coadministered with a fourth dose of Haemophilus influenzae type b and Neisseria meningitidis serogroups C and Y-tetanus toxoid conjugate vaccine in toddlers: a pooled analysis of randomized trials.

    PubMed

    Bryant, Kristina; McVernon, Jodie; Marchant, Colin; Nolan, Terry; Marshall, Gary; Richmond, Peter; Marshall, Helen; Nissen, Michael; Lambert, Stephen; Aris, Emmanuel; Mesaros, Narcisa; Miller, Jacqueline

    2012-08-01

    A pooled analysis was conducted of 1257 toddlers who received a fourth dose of Haemophilus influenzae type b-Neisseria meningitidis serogroups C and Y-tetanus toxoid conjugate vaccine (HibMenCY-TT) or Hib conjugate vaccine (Hib polysaccharide conjugated to N. meningitidis outer membrane protein) coadministered with measles-mumps-rubella (MMR) and varicella (VAR) vaccines (NCT00134719/NCT00289783). Noninferiority of immunological responses to MMR and VAR was demonstrated between groups and incidences of MMR- and VAR-specific solicited symptoms were similar, indicating that HibMenCY-TT can be coadministered with MMR and VAR.

  3. Nanotechnologies in protein microarrays.

    PubMed

    Krizkova, Sona; Heger, Zbynek; Zalewska, Marta; Moulick, Amitava; Adam, Vojtech; Kizek, Rene

    2015-01-01

    Protein microarray technology became an important research tool for study and detection of proteins, protein-protein interactions and a number of other applications. The utilization of nanoparticle-based materials and nanotechnology-based techniques for immobilization allows us not only to extend the surface for biomolecule immobilization resulting in enhanced substrate binding properties, decreased background signals and enhanced reporter systems for more sensitive assays. Generally in contemporarily developed microarray systems, multiple nanotechnology-based techniques are combined. In this review, applications of nanoparticles and nanotechnologies in creating protein microarrays, proteins immobilization and detection are summarized. We anticipate that advanced nanotechnologies can be exploited to expand promising fields of proteins identification, monitoring of protein-protein or drug-protein interactions, or proteins structures. PMID:26039143

  4. Protein domain architectures.

    PubMed

    Mulder, Nicola J

    2010-01-01

    Proteins are composed of functional units, or domains, that can be found alone or in combination with other domains. Analysis of protein domain architectures and the movement of protein domains within and across different genomes provide clues about the evolution of protein function. The classification of proteins into families and domains is provided through publicly available tools and databases that use known protein domains to predict other members in new proteins sequences. Currently at least 80% of the main protein sequence databases can be classified using these tools, thus providing a large data set to work from for analyzing protein domain architectures. Each of the protein domain databases provide intuitive web interfaces for viewing and analyzing their domain classifications and provide their data freely for downloading. Some of the main protein family and domain databases are described here, along with their Web-based tools for analyzing domain architectures.

  5. PREFACE: Protein protein interactions: principles and predictions

    NASA Astrophysics Data System (ADS)

    Nussinov, Ruth; Tsai, Chung-Jung

    2005-06-01

    Proteins are the `workhorses' of the cell. Their roles span functions as diverse as being molecular machines and signalling. They carry out catalytic reactions, transport, form viral capsids, traverse membranes and form regulated channels, transmit information from DNA to RNA, making possible the synthesis of new proteins, and they are responsible fo