Sample records for mitochondrial protease gene

  1. StAR enhances transcription of genes encoding the mitochondrial proteases involved in its own degradation.


    Bahat, Assaf; Perlberg, Shira; Melamed-Book, Naomi; Lauria, Ines; Langer, Thomas; Orly, Joseph


    Steroidogenic acute regulatory protein (StAR) is essential for steroid hormone synthesis in the adrenal cortex and the gonads. StAR activity facilitates the supply of cholesterol substrate into the inner mitochondrial membranes where conversion of the sterol to a steroid is catalyzed. Mitochondrial import terminates the cholesterol mobilization activity of StAR and leads to mounting accumulation of StAR in the mitochondrial matrix. Our studies suggest that to prevent mitochondrial impairment, StAR proteolysis is executed by at least 2 mitochondrial proteases, ie, the matrix LON protease and the inner membrane complexes of the metalloproteases AFG3L2 and AFG3L2:SPG7/paraplegin. Gonadotropin administration to prepubertal rats stimulated ovarian follicular development associated with increased expression of the mitochondrial protein quality control system. In addition, enrichment of LON and AFG3L2 is evident in StAR-expressing ovarian cells examined by confocal microscopy. Furthermore, reporter studies of the protease promoters examined in the heterologous cell model suggest that StAR expression stimulates up to a 3.5-fold increase in the protease gene transcription. Such effects are StAR-specific, are independent of StAR activity, and failed to occur upon expression of StAR mutants that do not enter the matrix. Taken together, the results of this study suggest the presence of a novel regulatory loop, whereby acute accumulation of an apparent nuisance protein in the matrix provokes a mitochondria to nucleus signaling that, in turn, activates selected transcription of genes encoding the enrichment of mitochondrial proteases relevant for enhanced clearance of StAR.

  2. Biochemical and functional analysis of the YME1 gene product, an ATP and zinc-dependent mitochondrial protease from S. cerevisiae.

    PubMed Central

    Weber, E R; Hanekamp, T; Thorsness, P E


    Inactivation of YME1 in yeast causes several distinct phenotypes: an increased rate of DNA escape from mitochondria, temperature-sensitive growth on nonfermentable carbon sources, extremely slow growth when mitochondrial DNA is completely absent from the cell, and altered morphology of the mitochondrial compartment. The protein encoded by YME1, Yme1p, contains two highly conserved sequence elements, one implicated in the binding and hydrolysis of ATP, and the second characteristic of active site residues found in neutral, zinc-dependent proteases. Both the putative ATPase and zinc-dependent protease elements are necessary for the function of Yme1p as genes having mutations in critical residues of either of these motifs are unable to suppress any of the phenotypes exhibited by yme1 deletion strains. Yme1p co-fractionates with proteins associated with the mitochondrial inner membrane, is tightly associated with this membrane, and is oriented with the bulk of the protein facing the matrix. Unassembled subunit II of cytochrome oxidase is stabilized in yme1 yeast strains. The data support a model in which Yme1p is an ATP and zinc-dependent protease associated with the matrix side of the inner mitochondrial membrane. Subunit II of cytochrome oxidase, when not assembled into a higher order complex, is a likely substrate of Yme1p. Images PMID:8688560

  3. Mitochondrial proteases and protein quality control in ageing and longevity.


    Hamon, Marie-Paule; Bulteau, Anne-Laure; Friguet, Bertrand


    Mitochondria have been implicated in the ageing process and the lifespan modulation of model organisms. Mitochondria are the main providers of energy in eukaryotic cells but also represent both a major source of reactive oxygen species and targets for protein oxidative damage. Since protein damage can impair mitochondrial function, mitochondrial proteases are critically important for protein maintenance and elimination of oxidized protein. In the mitochondrial matrix, protein quality control is mainly achieved by the Lon and Clp proteases which are also key players in damaged mitochondrial proteins degradation. Accumulation of damaged macromolecules resulting from oxidative stress and failure of protein maintenance constitutes a hallmark of cellular and organismal ageing and is believed to participate to the age-related decline of cellular function. Hence, age-related impairment of mitochondrial protein quality control may therefore contribute to the age-associated build-up of oxidized protein and alterations of mitochondrial redox and protein homeostasis.

  4. Mitochondrial cereblon functions as a Lon-type protease

    PubMed Central

    Kataoka, Kosuke; Nakamura, China; Asahi, Toru; Sawamura, Naoya


    Lon protease plays a major role in the protein quality control system in mammalian cell mitochondria. It is present in the mitochondrial matrix, and degrades oxidized and misfolded proteins, thereby protecting the cell from various extracellular stresses, including oxidative stress. The intellectual disability-associated and thalidomide-binding protein cereblon (CRBN) contains a large, highly conserved Lon domain. However, whether CRBN has Lon protease-like function remains unknown. Here, we determined if CRBN has a protective function against oxidative stress, similar to Lon protease. We report that CRBN partially distributes in mitochondria, suggesting it has a mitochondrial function. To specify the mitochondrial role of CRBN, we mitochondrially expressed CRBN in human neuroblastoma SH-SY5Y cells. The resulting stable SH-SY5Y cell line showed no apparent effect on the mitochondrial functions of fusion, fission, and membrane potential. However, mitochondrially expressed CRBN exhibited protease activity, and was induced by oxidative stress. In addition, stably expressed cells exhibited suppressed neuronal cell death induced by hydrogen peroxide. These results suggest that CRBN functions specifically as a Lon-type protease in mitochondria. PMID:27417535

  5. Mitochondrial cereblon functions as a Lon-type protease.


    Kataoka, Kosuke; Nakamura, China; Asahi, Toru; Sawamura, Naoya


    Lon protease plays a major role in the protein quality control system in mammalian cell mitochondria. It is present in the mitochondrial matrix, and degrades oxidized and misfolded proteins, thereby protecting the cell from various extracellular stresses, including oxidative stress. The intellectual disability-associated and thalidomide-binding protein cereblon (CRBN) contains a large, highly conserved Lon domain. However, whether CRBN has Lon protease-like function remains unknown. Here, we determined if CRBN has a protective function against oxidative stress, similar to Lon protease. We report that CRBN partially distributes in mitochondria, suggesting it has a mitochondrial function. To specify the mitochondrial role of CRBN, we mitochondrially expressed CRBN in human neuroblastoma SH-SY5Y cells. The resulting stable SH-SY5Y cell line showed no apparent effect on the mitochondrial functions of fusion, fission, and membrane potential. However, mitochondrially expressed CRBN exhibited protease activity, and was induced by oxidative stress. In addition, stably expressed cells exhibited suppressed neuronal cell death induced by hydrogen peroxide. These results suggest that CRBN functions specifically as a Lon-type protease in mitochondria.

  6. The Mitochondrial m-AAA Protease Prevents Demyelination and Hair Greying

    PubMed Central

    Jacquemyn, Julie; Barth, Esther; Langer, Thomas; Niessen, Carien M.; Rugarli, Elena I.


    The m-AAA protease preserves proteostasis of the inner mitochondrial membrane. It ensures a functional respiratory chain, by controlling the turnover of respiratory complex subunits and allowing mitochondrial translation, but other functions in mitochondria are conceivable. Mutations in genes encoding subunits of the m-AAA protease have been linked to various neurodegenerative diseases in humans, such as hereditary spastic paraplegia and spinocerebellar ataxia. While essential functions of the m-AAA protease for neuronal survival have been established, its role in adult glial cells remains enigmatic. Here, we show that deletion of the highly expressed subunit AFG3L2 in mature mouse oligodendrocytes provokes early-on mitochondrial fragmentation and swelling, as previously shown in neurons, but causes only late-onset motor defects and myelin abnormalities. In contrast, total ablation of the m-AAA protease, by deleting both Afg3l2 and its paralogue Afg3l1, triggers progressive motor dysfunction and demyelination, owing to rapid oligodendrocyte cell death. Surprisingly, the mice showed premature hair greying, caused by progressive loss of melanoblasts that share a common developmental origin with Schwann cells and are targeted in our experiments. Thus, while both neurons and glial cells are dependant on the m-AAA protease for survival in vivo, complete ablation of the complex is necessary to trigger death of oligodendrocytes, hinting to cell-autonomous thresholds of vulnerability to m-AAA protease deficiency. PMID:27911893

  7. Caveolin-1 controls mitochondrial function through regulation of m-AAA mitochondrial protease

    PubMed Central

    Volonte, Daniela; Liu, Zhongmin; Shiva, Sruti; Galbiati, Ferruccio


    Mitochondrial proteases ensure mitochondrial integrity and function after oxidative stress by providing mitochondrial protein quality control. However, the molecular mechanisms that regulate this basic biological function in eukaryotic cells remain largely unknown. Caveolin-1 is a scaffolding protein involved in signal transduction. We find that AFG3L2, a m-AAA type of mitochondrial protease, is a novel caveolin-1-interacting protein in vitro. We show that oxidative stress promotes the translocation of both caveolin-1 and AFG3L2 to mitochondria, enhances the interaction of caveolin-1 with AFG3L2 in mitochondria and stimulates mitochondrial protease activity in wild-type fibroblasts. Localization of AFG3L2 to mitochondria after oxidative stress is inhibited in fibroblasts lacking caveolin-1, which results in impaired mitochondrial protein quality control, an oxidative phosphorylation to aerobic glycolysis switch and reduced ATP production. Mechanistically, we demonstrate that a lack of caveolin-1 does not alter either mitochondrial number or morphology but leads to the cytoplasmic and proteasome-dependent degradation of complexes I, III, IV and V upon oxidant stimulation. Restoration of mitochondrial respiratory chain complexes in caveolin-1 null fibroblasts reverts the enhanced glycolysis observed in these cells. Expression of a mutant form of AFG3L2, which has reduced affinity for caveolin-1, fails to localize to mitochondria and promotes degradation of complex IV after oxidative stress. Thus, caveolin-1 maintains mitochondrial integrity and function when cells are challenged with free radicals by promoting the mitochondrial localization of m-AAA protease and its quality control functions. PMID:27705926

  8. Bcl-2 inhibits the mitochondrial release of an apoptogenic protease

    PubMed Central


    Bcl-2 belongs to a family of apoptosis-regulatory proteins which incorporate into the outer mitochondrial as well as nuclear membranes. The mechanism by which the proto-oncogene product Bcl-2 inhibits apoptosis is thus far elusive. We and others have shown previously that the first biochemical alteration detectable in cells undergoing apoptosis, well before nuclear changes become manifest, is a collapse of the mitochondrial inner membrane potential (delta psi m), suggesting the involvement of mitochondrial products in the apoptotic cascade. Here we show that mitochondria contain a pre-formed approximately 50-kD protein which is released upon delta psi m disruption and which, in a cell-free in vitro system, causes isolated nuclei to undergo apoptotic changes such as chromatin condensation and internucleosomal DNA fragmentation. This apoptosis-inducing factor (AIF) is blocked by N- benzyloxycarbonyl-Val-Ala-Asp.fluoromethylketone (Z-VAD.fmk), an antagonist of interleukin-1 beta-converting enzyme (ICE)-like proteases that is also an efficient inhibitor of apoptosis in cells. We have tested the effect of Bcl-2 on the formation, release, and action of AIF. When preventing mitochondrial permeability transition (which accounts for the pre-apoptotic delta psi m disruption in cells), Bcl-2 hyperexpressed in the outer mitochondrial membrane also impedes the release of AIF from isolated mitochondria in vitro. In contrast, Bcl-2 does not affect the formation of AIF, which is contained in comparable quantities in control mitochondria and in mitochondria from Bcl-2- hyperexpressing cells. Furthermore, the presence of Bcl-2 in the nuclear membrane does not interfere with the action of AIF on the nucleus, nor does Bcl-2 hyperexpression protect cells against AIF. It thus appears that Bcl-2 prevents apoptosis by favoring the retention of an apoptogenic protease in mitochondria. PMID:8879205

  9. Mitochondrial Lon protease in human disease and aging: Including an etiologic classification of Lon-related diseases and disorders

    PubMed Central

    Bota, Daniela A.; Davies, Kelvin J.A.


    The Mitochondrial Lon protease, also called LonP1 is a product of the nuclear gene LONP1. Lon is a major regulator of mitochondrial metabolism and response to free radical damage, as well as an essential factor for the maintenance and repair of mitochondrial DNA. Lon is an ATP-stimulated protease that cycles between being bound (at the inner surface of the inner mitochondrial membrane) to the mitochondrial genome, and being released into the mitochondrial matrix where it can degrade matrix proteins. At least three different roles or functions have been ascribed to Lon: 1) Proteolytic digestion of oxidized proteins and the turnover of specific essential mitochondrial enzymes such as aconitase, TFAM, and StAR; 2) Mitochondrial (mt)DNA-binding protein, involved in mtDNA replication and mitogenesis; and 3) Protein chaperone, interacting with the Hsp60–mtHsp70 complex. LONP1 orthologs have been studied in bacteria, yeast, flies, worms, and mammals, evincing the widespread importance of the gene, as well as its remarkable evolutionary conservation. In recent years, we have witnessed a significant increase in knowledge regarding Lon's involvement in physiological functions, as well as in an expanding array of human disorders, including cancer, neurodegeneration, heart disease, and stroke. In addition, Lon appears to have a significant role in the aging process. A number of mitochondrial diseases have now been identified whose mechanisms involve various degrees of Lon dysfunction. In this paper we review current knowledge of Lon's function, under normal conditions, and we propose a new classification of human diseases characterized by a either over-expression or decline or loss of function of Lon. Lon has also been implicated in human aging, and we review the data currently available as well as speculating about possible interactions of aging and disease. Finally, we also discuss Lon as potential therapeutic target in human disease. PMID:27387767

  10. CODAS syndrome is associated with mutations of LONP1, encoding mitochondrial AAA+ Lon protease.


    Strauss, Kevin A; Jinks, Robert N; Puffenberger, Erik G; Venkatesh, Sundararajan; Singh, Kamalendra; Cheng, Iteen; Mikita, Natalie; Thilagavathi, Jayapalraja; Lee, Jae; Sarafianos, Stefan; Benkert, Abigail; Koehler, Alanna; Zhu, Anni; Trovillion, Victoria; McGlincy, Madeleine; Morlet, Thierry; Deardorff, Matthew; Innes, A Micheil; Prasad, Chitra; Chudley, Albert E; Lee, Irene Nga Wing; Suzuki, Carolyn K


    CODAS syndrome is a multi-system developmental disorder characterized by cerebral, ocular, dental, auricular, and skeletal anomalies. Using whole-exome and Sanger sequencing, we identified four LONP1 mutations inherited as homozygous or compound-heterozygous combinations among ten individuals with CODAS syndrome. The individuals come from three different ancestral backgrounds (Amish-Swiss from United States, n = 8; Mennonite-German from Canada, n = 1; mixed European from Canada, n = 1). LONP1 encodes Lon protease, a homohexameric enzyme that mediates protein quality control, respiratory-complex assembly, gene expression, and stress responses in mitochondria. All four pathogenic amino acid substitutions cluster within the AAA(+) domain at residues near the ATP-binding pocket. In biochemical assays, pathogenic Lon proteins show substrate-specific defects in ATP-dependent proteolysis. When expressed recombinantly in cells, all altered Lon proteins localize to mitochondria. The Old Order Amish Lon variant (LONP1 c.2161C>G[p.Arg721Gly]) homo-oligomerizes poorly in vitro. Lymphoblastoid cell lines generated from affected children have (1) swollen mitochondria with electron-dense inclusions and abnormal inner-membrane morphology; (2) aggregated MT-CO2, the mtDNA-encoded subunit II of cytochrome c oxidase; and (3) reduced spare respiratory capacity, leading to impaired mitochondrial proteostasis and function. CODAS syndrome is a distinct, autosomal-recessive, developmental disorder associated with dysfunction of the mitochondrial Lon protease.

  11. The role of AAA+ proteases in mitochondrial protein biogenesis, homeostasis and activity control.


    Voos, Wolfgang; Ward, Linda A; Truscott, Kaye N


    Mitochondria are specialised organelles that are structurally and functionally integrated into cells in the vast majority of eukaryotes. They are the site of numerous enzymatic reactions, some of which are essential for life. The double lipid membrane of the mitochondrion, that spatially defines the organelle and is necessary for some functions, also creates a physical but semi-permeable barrier to the rest of the cell. Thus to ensure the biogenesis, regulation and maintenance of a functional population of proteins, an autonomous protein handling network within mitochondria is required. This includes resident mitochondrial protein translocation machinery, processing peptidases, molecular chaperones and proteases. This review highlights the contribution of proteases of the AAA+ superfamily to protein quality and activity control within the mitochondrion. Here they are responsible for the degradation of unfolded, unassembled and oxidatively damaged proteins as well as the activity control of some enzymes. Since most knowledge about these proteases has been gained from studies in the eukaryotic microorganism Saccharomyces cerevisiae, much of the discussion here centres on their role in this organism. However, reference is made to mitochondrial AAA+ proteases in other organisms, particularly in cases where they play a unique role such as the mitochondrial unfolded protein response. As these proteases influence mitochondrial function in both health and disease in humans, an understanding of their regulation and diverse activities is necessary.

  12. Identification of a Degradation Signal Sequence within Substrates of the Mitochondrial i-AAA Protease.


    Rampello, Anthony J; Glynn, Steven E


    The i-AAA protease is a component of the mitochondrial quality control machinery that regulates respiration, mitochondrial dynamics, and protein import. The protease is required to select specific substrates for degradation from among the diverse complement of proteins present in mitochondria, yet the rules that govern this selection are unclear. Here, we reconstruct the yeast i-AAA protease, Yme1p, to examine the in vitro degradation of two intermembrane space chaperone subunits, Tim9 and Tim10. Yme1p degrades Tim10 more rapidly than Tim9 despite high sequence and structural similarity, and loss of Tim10 is accelerated by the disruption of conserved disulfide bonds within the substrate. An unstructured N-terminal region of Tim10 is necessary and sufficient to target the substrate to the protease through recognition of a short phenylalanine-rich motif, and the presence of similar motifs in other small Tim proteins predicts robust degradation by the protease. Together, these results identify the first specific degron sequence within a native i-AAA protease substrate.

  13. Decreased expression of the mitochondrial matrix proteases Lon and ClpP in cells from a patient with hereditary spastic paraplegia (SPG13).


    Hansen, J; Corydon, T J; Palmfeldt, J; Dürr, A; Fontaine, B; Nielsen, M N; Christensen, J H; Gregersen, N; Bross, P


    The mitochondrial chaperonin heat shock protein 60 (Hsp60) assists the folding of a subset of proteins localized in mitochondria and is an essential component of the mitochondrial protein quality control system. Mutations in the HSPD1 gene that encodes Hsp60 have been identified in patients with an autosomal dominant form of hereditary spastic paraplegia (SPG13), a late-onset neurodegenerative disorder characterized by a progressive paraparesis of the lower limbs. The disease-associated Hsp60-(p.Val98Ile) protein, encoded by the c.292G>A HSPD1 allele, has reduced chaperonin activity, but how its expression affects mitochondrial functions has not been investigated. We have studied mitochondrial function and expression of genes encoding mitochondrial chaperones and proteases in a human lymphoblastoid cell line and fibroblast cells from a patient who is heterozygous for the c.292G>A HSPD1 allele. We found that both the c.292G>A RNA transcript and the corresponding Hsp60-(p.Val98Ile) protein were present at comparable levels to their wild-type counterparts in SPG13 patient cells. Compared with control cells, we found no significant cellular or mitochondrial dysfunctions in SPG13 patient cells by assessing the mitochondrial membrane potential, cell viability, and sensitivity toward oxidative stress. However, a decreased expression of the mitochondrial protein quality control proteases Lon and ClpP, both at the RNA and protein level, was demonstrated in SPG13 patient cells. We propose that decreased levels of mitochondrial proteases Lon and ClpP may allow Hsp60 substrate proteins to go through more folding attempts instead of being prematurely degraded, thereby supporting productive folding in cells with reduced Hsp60 chaperonin activity. In conclusion, our studies with SPG13 patient cells expressing the functionally impaired mutant Hsp60 chaperonin suggest that reduction of the degradative activity of the protein quality control system may represent a previously

  14. Approaches to mitochondrial gene therapy.


    D'Souza, Gerard G M; Weissig, Volkmar


    Since their discovery during the end of the 80's the number of diseases found to be associated with defects in the mitochondrial genome has grown significantly. Organs affected by mutations in mitochondrial DNA (mtDNA) include in decreasing order of vulnerability the brain, skeletal muscle, heart, kidney and liver. Hence neuromuscular and neurodegenerative diseases represent the two largest groups of mtDNA diseases. Despite major advances in understanding mtDNA defects at the genetic and biochemical level, there is however no satisfactory treatment available to the vast majority of patients. This is largely due to the fact that most of these patients have respiratory chain defects, i.e. defects that involve the final common pathway of oxidative metabolism, making it impossible to bypass the defect by administering alternative metabolic carriers of energy. Conventional biochemical treatment having reached an impasse, the exploration of gene therapeutic approaches for patients with mtDNA defects is warranted. For now mitochondrial gene therapy appears to be only theoretical and speculative. Any possibility for gene replacement is dependent on the development of an efficient mitochondrial transfection vector. In this review we describe the current state of the development of mitochondria-specific DNA delivery systems. We summarize our own efforts in exploring the properties of dequalinium and other similar cationic bolaamphiphiles with delocalized charge centers, for the design of a vector suited for the transport of DNA to mitochondria in living cells. Further, we outline some unique hurdles that need to be overcome if the development of such delivery systems is to progress.

  15. Role of Lon1 protease in post-germinative growth and maintenance of mitochondrial function in Arabidopsis thaliana.


    Rigas, Stamatis; Daras, Gerasimos; Laxa, Miriam; Marathias, Nikolas; Fasseas, Constantinos; Sweetlove, Lee J; Hatzopoulos, Polydefkis


    Maintenance of protein quality control and turnover is essential for cellular homeostasis. In plant organelles this biological process is predominantly performed by ATP-dependent proteases. Here, a genetic screen was performed that led to the identification of Arabidopsis thaliana Lon1 protease mutants that exhibit a post-embryonic growth retardation phenotype. Translational fusion to yellow fluorescent protein revealed AtLon1 subcellular localization in plant mitochondria, and the AtLon1 gene could complement the respiratory-deficient phenotype of the yeast PIM1 gene homolog. AtLon1 is highly expressed in rapidly growing plant organs of embryonic origin, including cotyledons and primary roots, and in inflorescences, which have increased mitochondria numbers per cell to fulfill their high energy requirements. In lon1 mutants, the expression of both mitochondrial and nuclear genes encoding respiratory proteins was normal. However, mitochondria isolated from lon1 mutants had a lower capacity for respiration of succinate and cytochrome c via complexes II and IV, respectively. Furthermore, the activity of key enzymes of the tricarboxylic acid (TCA) cycle was significantly reduced. Additionally, mitochondria in lon1 mutants had an aberrant morphology. These results shed light on the developmental mechanisms of selective proteolysis in plant mitochondria and suggest a critical role for AtLon1 protease in organelle biogenesis and seedling establishment.

  16. Detergent alkaline proteases: enzymatic properties, genes, and crystal structures.


    Saeki, Katsuhisa; Ozaki, Katsuya; Kobayashi, Tohru; Ito, Susumu


    Subtilisin-like serine proteases from bacilli have been used in various industrial fields worldwide, particularly in the production of laundry and automatic dishwashing detergents. They belong to family A of the subtilase superfamily, which is composed of three clans, namely, true subtilisins, high-alkaline proteases, and intracellular proteases. We succeeded in the large-scale production of a high-alkaline protease (M-protease) from alkaliphilic Bacillus clausii KSM-K16, and the enzyme has been introduced into compact heavy-duty laundry detergents. We have also succeeded in the industrial-scale production of a new alkaline protease, KP-43, which was originally resistant to chemical oxidants and to surfactants, produced by alkaliphilic Bacillus sp. strain KSM-KP43 and have incorporated it into laundry detergents. KP-43 and related proteases form a new clan, oxidatively stable proteases, in subtilase family A. In this review, we describe the enzymatic properties, gene sequences, and crystal structures of M-protease, KP-43, and related enzymes.

  17. The plant i-AAA protease controls the turnover of an essential mitochondrial protein import component.


    Opalińska, Magdalena; Parys, Katarzyna; Murcha, Monika W; Jańska, Hanna


    Mitochondria are multifunctional organelles that play a central role in energy metabolism. Owing to the life-essential functions of these organelles, mitochondrial content, quality and dynamics are tightly controlled. Across the species, highly conserved ATP-dependent proteases prevent malfunction of mitochondria through versatile activities. This study focuses on a molecular function of the plant mitochondrial inner membrane-embedded AAA protease (denoted i-AAA) FTSH4, providing its first bona fide substrate. Here, we report that the abundance of the Tim17-2 protein, an essential component of the TIM17:23 translocase (Tim17-2 together with Tim50 and Tim23), is directly controlled by the proteolytic activity of FTSH4. Plants that are lacking functional FTSH4 protease are characterized by significantly enhanced capacity of preprotein import through the TIM17:23-dependent pathway. Taken together, with the observation that FTSH4 prevents accumulation of Tim17-2, our data point towards the role of this i-AAA protease in the regulation of mitochondrial biogenesis in plants.

  18. ATP-dependent Lon protease controls tumor bioenergetics by reprogramming mitochondrial activity.


    Quirós, Pedro M; Español, Yaiza; Acín-Pérez, Rebeca; Rodríguez, Francisco; Bárcena, Clea; Watanabe, Kenta; Calvo, Enrique; Loureiro, Marta; Fernández-García, M Soledad; Fueyo, Antonio; Vázquez, Jesús; Enríquez, José Antonio; López-Otín, Carlos


    We generated mice deficient in Lon protease (LONP1), a major enzyme of the mitochondrial quality control machinery. Homozygous deletion of Lonp1 causes early embryonic lethality, whereas its haploinsufficiency protects against colorectal and skin tumors. Furthermore, LONP1 knockdown inhibits cellular proliferation and tumor and metastasis formation, whereas its overexpression increases tumorigenesis. Clinical studies indicate that high levels of LONP1 are a poor prognosis marker in human colorectal cancer and melanoma. Additionally, functional analyses show that LONP1 plays a key role in metabolic reprogramming by remodeling OXPHOS complexes and protecting against senescence. Our findings demonstrate the relevance of LONP1 for cellular and organismal viability and identify this protease as a central regulator of mitochondrial activity in oncogenesis.

  19. Differential expression of a protease gene family in African Trypanosomes

    PubMed Central

    Helm, Jared R.; Wilson, Mary E.; Donelson, John E.


    During their life cycle African trypanosomes must quickly adapt to the different environments of the tsetse fly midgut and the mammalian bloodstream by modulating expression of many of their genes. One group of these differentially expressed genes encodes different forms of a major surface protease. Using a luciferase reporter gene transiently or permanently transfected into trypanosomes, we show here that the 3′-UTRs of these protease genes are responsible for their differential expression. Deletion analysis of the 389-bp 3′-UTR of one of the protease genes, MSP-B, demonstrated that it contains a U-rich regulatory region of about 23 bp (UCGUCUGUUAUUUCUUAGUCCAG), which suppresses expression of the reporter protein in bloodstream trypanosomes by as much as 25-fold, but has little effect on the reporter expression in procyclic (tsetse fly) trypanosomes. Replacing the entire 3′-UTR with just this 23-bp element mimicked most of the suppression effect of the complete 3′-UTR. Northern blots showed that the 23-bp element influences the steady state RNA level, but not enough to account for the 25-fold suppression effect. Polysome analyses showed that in procyclic trypanosomes more of the total protease mRNA is associated with intermediate-sized and large polysomes than in bloodstream trypanosomes. Thus, the 23-bp element of this protease gene affects both the level of RNA and its translation. PMID:18848586

  20. Regulation of Skeletal Muscle Oxidative Capacity and Insulin Signaling by the Mitochondrial Rhomboid Protease PARL

    PubMed Central

    Civitarese, Anthony E.; MacLean, Paul S.; Carling, Stacy; Kerr-Bayles, Lyndal; McMillan, Ryan P.; Pierce, Anson; Becker, Thomas C.; Moro, Cedric; Finlayson, Jean; Lefort, Natalie; Newgard, Christopher B.; Mandarino, Lawrence; Cefalu, William; Walder, Ken; Collier, Greg R.; Hulver, Matthew W.; Smith, Steven R.; Ravussin, Eric


    SUMMARY Type 2 diabetes Mellitus (T2DM) and aging are characterized by insulin resistance, lower mitochondrial density and function and increased production of reactive oxygen species (ROS). In lower organisms continuous remodeling critically maintains the function and life cycle of mitochondria, in part by the protease pcp1 (PARL ortholog). We therefore examined whether variation in PARL protein content is associated with mitochondrial abnormalities and insulin resistance. Relative to healthy, young individuals (23±1y), PARL mRNA and mitochondrial mass were both reduced in elderly subjects (64.4±1.2 y; 51% and 44% respectively) and in subjects with T2DM (51.8±3 y; 31% and 41% respectively; all p<0.05). Muscle knock-down of PARL in mice resulted in lower mitochondrial content (−31±3%, p<0.05), lower OPA1 and PGC1α protein levels and impaired insulin signaling. Furthermore, mitochondrial cristae were malformed and resulted in elevated in vivo oxidative stress. Adenoviral suppression of PARL protein in healthy myotubes lowered mitochondrial mass (−33±8%), insulin stimulated glycogen synthesis (−33±9%) and increased ROS production (2-fold) (all p<0.05). We propose that lower PARL expression may contribute to the mitochondrial abnormalities seen in aging and T2DM. PMID:20444421

  1. Mycobacterial Caseinolytic Protease Gene Regulator ClgR Is a Substrate of Caseinolytic Protease

    PubMed Central

    Yamada, Yoshiyuki


    ABSTRACT The mycobacterial caseinolytic protease ClpP1P2 is a degradative protease that recently gained interest as a genetically and pharmacologically validated drug target for tuberculosis. The first whole-cell active ClpP1P2 inhibitor, the human proteasome inhibitor bortezomib, is currently undergoing lead optimization to introduce selectivity for the bacterial target. How inhibition of ClpP1P2 translates into whole-cell antimicrobial activity is little understood. Previous work has shown that the caseinolytic protease gene regulator ClgR is an activator of the clpP1P2 genes and also suggested that this transcription factor may be a substrate of the protease. Here, we employ promoter activity reporters and direct mRNA level measurements showing that bortezomib treatment of Mycobacterium bovis BCG increased transcription of clpP1P2 and other ClgR-dependent promoters, suggesting that inhibition of ClpP1P2 increases cellular ClgR levels. Then, we carried out red fluorescent protein-ClgR fusion analyses to show that ClgR is indeed a substrate of ClpP1P2 and to identify ClgR’s C-terminal nonapeptide APVVSLAVA as the signal sufficient for recognition and efficient protein degradation by ClpP1P2. Interestingly, accumulation of ClgR appears to be toxic for bacilli, suggesting a mechanism for how pharmacological inhibition of ClpP1P2 protease activity by bortezomib translates into whole-cell antibacterial activity. IMPORTANCE With 9 million new cases and more than 1 million deaths per year, tuberculosis, caused by Mycobacterium tuberculosis, is the biggest infectious disease killer globally. New drugs for the treatment of the drug-resistant forms of the disease are needed. Recently, a new target-lead couple, the mycobacterial protease ClpP1P2 and the human anticancer drug bortezomib, was identified. However, we know little about how expression of this protease is regulated, which proteins in the bacterium it degrades, how the protease recognizes its target proteins

  2. Mitochondrial and Nuclear Genes of Mitochondrial Components in Cancer

    PubMed Central

    Kirches, E


    Although the observation of aerobic glycolysis of tumor cells by Otto v. Warburg had demonstrated abnormalities of mitochondrial energy metabolism in cancer decades ago, there was no clear evidence for a functional role of mutant mitochondrial proteins in cancer development until the early years of the 21st century. In the year 2000, a major breakthrough was achieved by the observation, that several genes coding for subunits of the respiratory chain (ETC) complex II, succinate dehydrogenase (SDH) are tumor suppressor genes in heritable paragangliomas, fulfilling Knudson’s classical two-hit hypothesis. A functional inactivation of both alleles by germline mutations and chromosomal losses in the tumor tissue was found in the patients. Later, SDH mutations were also identified in sporadic paragangliomas and pheochromocytomas. Genes of the mitochondrial ATP-synthase and of mitochondrial iron homeostasis have been implicated in cancer development at the level of cell culture and mouse experiments. In contrast to the well established role of some nuclear SDH genes, a functional impact of the mitochondrial genome itself (mtDNA) in cancer development remains unclear. Nevertheless, the extremely high frequency of mtDNA mutations in solid tumors raises the question, whether this small circular genome might be applicable to early cancer detection. This is a meaningful approach, especially in cancers, which tend to spread tumor cells early into bodily fluids or faeces, which can be screened by non-invasive methods. PMID:19949549

  3. Proteases.


    Barrett, A J


    The processes of growth and remodeling of cells and tissues in multicellular organisms require the breakdown of old protein molecules, in concert with the synthesis of new ones. For example, many newly-synthesized molecules require proteolytic processing to convert them to biologically active forms. Proteolysis can terminate the activity of a protein--e.g., capsases mediate apoptosis, which is a vital step in the life cycle of the cell. Proteolysis contributes to defense systems too, as the recognition of peptide fragments of foreign proteins triggers the immune response. Proteases are the class of enzymes involved in these important reactions. This unit discusses the general categories of proteases, and sets the stage for addition of overview units on cysteine proteases, aspartic proteases, and metalloproteases, as well as protocol units featuring techniques for analyzing mammalian and yeast proteasomes and protease inhibitors, among other topics.

  4. Identification of potential mitochondrial CLPXP protease interactors and substrates suggests its central role in energy metabolism

    PubMed Central

    Fischer, Fabian; Langer, Julian D.; Osiewacz, Heinz D.


    Maintenance of mitochondria is achieved by several mechanisms, including the regulation of mitochondrial proteostasis. The matrix protease CLPXP, involved in protein quality control, has been implicated in ageing and disease. However, particularly due to the lack of knowledge of CLPXP’s substrate spectrum, only little is known about the pathways and mechanisms controlled by this protease. Here we report the first comprehensive identification of potential mitochondrial CLPXP in vivo interaction partners and substrates using a combination of tandem affinity purification and differential proteomics. This analysis reveals that CLPXP in the fungal ageing model Podospora anserina is mainly associated with metabolic pathways in mitochondria, e.g. components of the pyruvate dehydrogenase complex and the tricarboxylic acid cycle as well as subunits of electron transport chain complex I. These data suggest a possible function of mitochondrial CLPXP in the control and/or maintenance of energy metabolism. Since bioenergetic alterations are a common feature of neurodegenerative diseases, cancer, and ageing, our data comprise an important resource for specific studies addressing the role of CLPXP in these adverse processes. PMID:26679294

  5. Mitochondrial DNA Damage and its Consequences for Mitochondrial Gene Expression

    PubMed Central

    Cline, Susan D.


    How mitochondria process DNA damage and whether a change in the steady-state level of mitochondrial DNA damage (mtDNA) contributes to mitochondrial dysfunction are questions that fuel burgeoning areas of research into aging and disease pathogenesis. Over the past decade, researchers have identified and measured various forms of endogenous and environmental mtDNA damage and have elucidated mtDNA repair pathways. Interestingly, mitochondria do not appear to contain the full range of DNA repair mechanisms that operate in the nucleus, although mtDNA contains types of damage that are targets of each nuclear DNA repair pathway. The reduced repair capacity may, in part, explain the high mutation frequency of the mitochondrial chromosome. Since mtDNA replication is dependent on transcription, mtDNA damage may alter mitochondrial gene expression at three levels: by causing DNA polymerase γ nucleotide incorporation errors leading to mutations, by interfering with the priming of mtDNA replication by the mitochondrial RNA polymerase, or by inducing transcriptional mutagenesis or premature transcript termination. This review summarizes our current knowledge of mtDNA damage, its repair, and its effects on mtDNA integrity and gene expression. PMID:22728831

  6. Gene Conversion Shapes Linear Mitochondrial Genome Architecture

    PubMed Central

    Smith, David Roy; Keeling, Patrick J.


    Recently, it was shown that gene conversion between the ends of linear mitochondrial chromosomes can cause telomere expansion and the duplication of subtelomeric loci. However, it is not yet known how widespread this phenomenon is and how significantly it has impacted organelle genome architecture. Using linear mitochondrial DNAs and mitochondrial plasmids from diverse eukaryotes, we argue that telomeric recombination has played a major role in fashioning linear organelle chromosomes. We find that mitochondrial telomeres frequently expand into subtelomeric regions, resulting in gene duplications, homogenizations, and/or fragmentations. We suggest that these features are a product of subtelomeric gene conversion, provide a hypothetical model for this process, and employ genetic diversity data to support the idea that the greater the effective population size the greater the potential for gene conversion between subtelomeric loci. PMID:23572386

  7. The Mitochondrial Lon Protease Is Required for Age-Specific and Sex-Specific Adaptation to Oxidative Stress.


    Pomatto, Laura C D; Carney, Caroline; Shen, Brenda; Wong, Sarah; Halaszynski, Kelly; Salomon, Matthew P; Davies, Kelvin J A; Tower, John


    Multiple human diseases involving chronic oxidative stress show a significant sex bias, including neurodegenerative diseases, cancer, immune dysfunction, diabetes, and cardiovascular disease. However, a possible molecular mechanism for the sex bias in physiological adaptation to oxidative stress remains unclear. Here, we report that Drosophila melanogaster females but not males adapt to hydrogen peroxide stress, whereas males but not females adapt to paraquat (superoxide) stress. Stress adaptation in each sex requires the conserved mitochondrial Lon protease and is associated with sex-specific expression of Lon protein isoforms and proteolytic activity. Adaptation to oxidative stress is lost with age in both sexes. Transgenic expression of transformer gene during development transforms chromosomal males into pseudo-females and confers the female-specific pattern of Lon isoform expression, Lon proteolytic activity induction, and H2O2 stress adaptation; these effects were also observed using adult-specific transformation. Conversely, knockdown of transformer in chromosomal females eliminates the female-specific Lon isoform expression, Lon proteolytic activity induction, and H2O2 stress adaptation and produces the male-specific paraquat (superoxide) stress adaptation. Sex-specific expression of alternative Lon isoforms was also observed in mouse tissues. The results develop Drosophila melanogaster as a model for sex-specific stress adaptation regulated by the Lon protease, with potential implications for understanding sexual dimorphism in human disease.

  8. Evolution of mitochondrial gene order in Annelida.


    Weigert, Anne; Golombek, Anja; Gerth, Michael; Schwarz, Francine; Struck, Torsten H; Bleidorn, Christoph


    Annelida is a highly diverse animal group with over 21,000 described species. As part of Lophotrochozoa, the vast majority of annelids are currently classified into two groups: Errantia and Sedentaria, together forming Pleistoannelida. Besides these taxa, Sipuncula, Amphinomidae, Chaetopteridae, Oweniidae and Magelonidae can be found branching at the base of the tree. Comparisons of mitochondrial genomes have been used to investigate phylogenetic relationship within animal taxa. Complete annelid mitochondrial genomes are available for some Sedentaria and Errantia and in most cases exhibit a highly conserved gene order. Only two complete genomes have been published from the basal branching lineages and these are restricted to Sipuncula. We describe the first complete mitochondrial genome sequences for all other basal branching annelid families: Owenia fusiformis (Oweniidae), Magelona mirabilis (Magelonidae), Eurythoe complanata (Amphinomidae), Chaetopterus variopedatus and Phyllochaetopterus sp. (Chaetopteridae). The mitochondrial gene order of all these taxa is substantially different from the pattern found in Pleistoannelida. Additionally, we report the first mitochondrial genomes in Annelida that encode genes on both strands. Our findings demonstrate that the supposedly highly conserved mitochondrial gene order suggested for Annelida is restricted to Pleistoannelida, representing the ground pattern of this group. All investigated basal branching annelid taxa show a completely different arrangement of genes than observed in Pleistoannelida. The gene order of protein coding and ribosomal genes in Magelona mirabilis differs only in two transposition events from a putative lophotrochozoan ground pattern and might be the closest to an ancestral annelid pattern. The mitochondrial genomes of Myzostomida show the conserved pattern of Pleistoannelida, thereby supporting their inclusion in this taxon.

  9. A facile analytical method for the identification of protease gene profiles from Bacillus thuringiensis strains.


    Chen, Fu-Chu; Shen, Li-Fen; Chak, Kin-Fu


    Five pairs of degenerate universal primers have been designed to identify the general protease gene profiles from some distinct Bacillus thuringiensis strains. Based on the PCR amplification patterns and DNA sequences of the cloned fragments, it was noted that the protease gene profiles of the three distinct strains of B. thuringiensis subsp. kurstaki HD73, tenebrionis and israelensis T14001 are varied. Seven protease genes, neutral protease B (nprB), intracellular serine protease A (ispA), extracellular serine protease (vpr), envelope-associated protease (prtH), neutral protease F (nprF), thermostable alkaline serine protease and alkaline serine protease (aprS), with known functions were identified from three distinct B. thuringiensis strains. In addition, five DNA sequences with unknown functions were also identified by this facile analytical method. However, based on the alignment of the derived protein sequences with the protein domain database, it suggested that at least one of these unknown genes, yunA, might be highly protease-related. Thus, the proposed PCR-mediated amplification design could be a facile method for identifying the protease gene profiles as well as for detecting novel protease genes of the B. thuringiensis strains.

  10. Evolution of mitochondrial gene orders in echinoderms.


    Perseke, Marleen; Fritzsch, Guido; Ramsch, Kai; Bernt, Matthias; Merkle, Daniel; Middendorf, Martin; Bernhard, Detlef; Stadler, Peter F; Schlegel, Martin


    A comprehensive analysis of the mitochondrial gene orders of all previously published and two novel Antedon mediterranea (Crinoidea) and Ophiura albida (Ophiuroidea) complete echinoderm mitochondrial genomes shows that all major types of rearrangement operations are necessary to explain the evolution of mitochondrial genomes. In addition to protein coding genes we include all tRNA genes as well as the control region in our analysis. Surprisingly, 7 of the 16 genomes published in the GenBank database contain misannotations, mostly unannotated tRNAs and/or mistakes in the orientation of tRNAs, which we have corrected here. Although the gene orders of mt genomes appear very different, only 8 events are necessary to explain the evolutionary history of echinoderms with the exception of the ophiuroids. Only two of these rearrangements are inversions, while we identify three tandem-duplication-random-loss events and three transpositions.

  11. Development of mitochondrial gene replacement therapy.


    Khan, Shaharyar M; Bennett, James P


    Many "classic" mitochondrial diseases have been described that arise from single homoplasmic mutations in mitochondrial DNA (mtDNA). These diseases typically affect nonmitotic tissues (brain, retina, muscle), present with variable phenotypes, can appear sporadically, and are untreatable. Evolving evidence implicates mtDNA abnormalities in diseases such as Alzheimer's, Parkinson's, and type II diabetes, but specific causal mutations for these conditions remain to be defined. Understanding the mtDNA genotype-phenotype relationships and developing specific treatment for mtDNA-based diseases is hampered by inability to manipulate the mitochondrial genome. We present a novel protein transduction technology ("protofection") that allows insertion and expression of the human mitochondrial genome into mitochondria of living cells. With protofection, the mitochondrial genotype can be altered, or exogenous genes can be introduced to be expressed and either retained in mitochondria or be directed to other organelles. Protofection also delivers mtDNA in vivo, opening the way to rational development of mitochondrial gene replacement therapy of mtDNA-based diseases.

  12. HIV protease inhibitors elicit volume-sensitive Cl− current in cardiac myocytes via mitochondrial ROS

    PubMed Central

    Deng, Wu; Baki, Lia; Yin, Jun; Zhou, Huiping; Baumgarten, Clive M.


    HIV protease inhibitors (HIV PI) reduce morbidity and mortality of HIV infection but cause multiple untoward effects. Because certain HIV PI evoke production of reactive oxygen species (ROS) and volume-sensitive Cl− current (ICl,swell) is activated by ROS, we tested whether HIV PI stimulate ICl,swell in ventricular myocytes. Ritonavir and lopinavir elicited outwardly-rectifying Cl− currents under isosmotic conditions that were abolished by the selective ICl,swell-blocker DCPIB. In contrast, amprenavir, nelfinavir, and raltegravir, an integrase inhibitor, did not modulate ICl,swell acutely. Ritonavir also reduced action potential duration, but amprenavir did not. ICl,swell activation was attributed to ROS because ebselen, an H2O2, scavenger, suppressed ritonavir- and lopinavir-induced ICl,swell. Major ROS sources in cardiomyocytes are sarcolemmal NADPH oxidase and mitochondria. The specific NADPH oxidase inhibitor apocynin failed to block ritonavir- or lopinavir-induced currents, although it blocks ICl,swell elicited by osmotic swelling or stretch. In contrast, rotenone, a mitochondrial e− transport inhibitor, suppressed both ritonavir- and lopinavir-induced ICl,swell. ROS production was measured in HL-1 cardiomyocytes with C-H2DCFDA-AM and mitochondrial membrane potential (ΔΨm) with JC-1. Flow cytometry confirmed that ritonavir and lopinavir but not amprenavir, nelfinavir, or raltegravir augmented ROS production, and HIV PI-induced ROS production was suppressed by rotenone but not NADPH oxidase blockade. Moreover, ritonavir, but not amprenavir, depolarized ΔΨm. These data suggest ritonavir and lopinavir activated ICl,swell via mitochondrial ROS production that was independent of NADPH oxidase. ROS-dependent modulation of ICl,swell and other ion channels by HIV PI may contribute to some of their actions in heart and perhaps other tissues. PMID:20736017

  13. Mitochondrial genes at Cold Spring Harbor.


    Grivell, L A


    The flowering dogwood trees and green lawns of Cold Spring Harbor provided the setting for a meeting devoted to Mitochondrial Genes from May 13-17th, 1981. Dedicated to the memory of Boris Ephrussi, who pioneered mitochondrial genetics at a time when the only kinds of genetics were nuclear or unclear, the meeting showed that the study of mtDNA has had impact on many areas of molecular biology including the genetic code and decoding, tRNA function, mechanisms of splicing and molecular evolution. Curiously, as Herschel Roman pointed out in his opening address, Ephrussi took great pains to avoid any mention of mitochondrial DNA in connection with his observations on cytoplasmic inheritance, preferring instead to refer to 'cytoplasmic particles, endowed with genetic continuity' (Ephrussi 1953). This reticence was not shared by participants at the meeting, as the following, brief report will show.

  14. The Arabidopsis Mitochondrial Protease FtSH4 Is Involved in Leaf Senescence via Regulation of WRKY-Dependent Salicylic Acid Accumulation and Signaling.


    Zhang, Shengchun; Li, Cui; Wang, Rui; Chen, Yaxue; Shu, Si; Huang, Ruihua; Zhang, Daowei; Li, Jian; Xiao, Shi; Yao, Nan; Yang, Chengwei


    Mitochondria and autophagy play important roles in the networks that regulate plant leaf senescence and cell death. However, the molecular mechanisms underlying the interactions between mitochondrial signaling and autophagy are currently not well understood. This study characterized the function of the Arabidopsis (Arabidopsis thaliana) mitochondrial AAA-protease gene FtSH4 in regulating autophagy and senescence, finding that FtSH4 mediates WRKY-dependent salicylic acid (SA) accumulation and signaling. Knockout of FtSH4 in the ftsh4-4 mutant resulted in severe leaf senescence, cell death, and high autophagy levels. The level of SA increased dramatically in the ftsh4-4 mutant. Expression of nahG in the ftsh4-4 mutant led to decreased SA levels and suppressed the leaf senescence and cell death phenotypes. The transcript levels of several SA synthesis and signaling genes, including SALICYLIC ACIDINDUCTION DEFICIENT2 (SID2), NON-RACE-SPECIFIC DISEASE RESISTANCE1 (NDR1), and NONEXPRESSOR OF PATHOGENESIS-RELATED PROTEINS1 (NPR1), increased significantly in the ftsh4-4 mutants compared with the wild type. Loss of function of SID2, NDR1, or NPR1 in the ftsh4-4 mutant reversed the ftsh4-4 senescence and autophagy phenotypes. Furthermore, ftsh4-4 mutants had elevated levels of transcripts of several WRKY genes, including WRKY40, WRKY46, WRKY51, WRKY60, WRKY63, and WRKY75; all of these WRKY proteins can bind to the promoter of SID2 Loss of function of WRKY75 in the ftsh4-4 mutants decreased the levels of SA and reversed the senescence phenotype. Taken together, these results suggest that the mitochondrial ATP-dependent protease FtSH4 may regulate the expression of WRKY genes by modifying the level of reactive oxygen species and the WRKY transcription factors that control SA synthesis and signaling in autophagy and senescence.

  15. Distinct types of protease systems are involved in homeostasis regulation of mitochondrial morphology via balanced fusion and fission.


    Saita, Shotaro; Ishihara, Takaya; Maeda, Maki; Iemura, Shun-Ichiro; Natsume, Tohru; Mihara, Katsuyoshi; Ishihara, Naotada


    Mitochondrial morphology is dynamically regulated by fusion and fission. Several GTPase proteins control fusion and fission, and posttranslational modifications of these proteins are important for the regulation. However, it has not been clarified how the fusion and fission is balanced. Here, we report the molecular mechanism to regulate mitochondrial morphology in mammalian cells. Ablation of the mitochondrial fission, by repression of Drp1 or Mff, or by over-expression of MiD49 or MiD51, results in a reduction in the fusion GTPase mitofusins (Mfn1 and Mfn2) in outer membrane and long form of OPA1 (L-OPA1) in inner membrane. RNAi- or CRISPR-induced ablation of Drp1 in HeLa cells enhanced the degradation of Mfns via the ubiquitin-proteasome system (UPS). We further found that UPS-related protein BAT3/BAG6, here we identified as Mfn2-interacting protein, was implicated in the turnover of Mfns in the absence of mitochondrial fission. Ablation of the mitochondrial fission also enhanced the proteolytic cleavage of L-OPA1 to soluble S-OPA1, and the OPA1 processing was reversed by inhibition of the inner membrane protease OMA1 independent on the mitochondrial membrane potential. Our findings showed that the distinct degradation systems of the mitochondrial fusion proteins in different locations are enhanced in response to the mitochondrial morphology.

  16. Inhibition of the mitochondrial protease, ClpP, as a therapeutic strategy for human acute myeloid leuekmia

    PubMed Central

    Cole, Alicia; Wang, Zezhou; Coyaud, Etienne; Voisin, Veronique; Gronda, Marcela; Jitkova, Yulia; Mattson, Rachel; Hurren, Rose; Babovic, Sonja; Maclean, Neil; Restall, Ian; Wang, Xiaoming; Jeyaraju, Danny V.; Sukhai, Mahadeo A.; Prabha, Swayam; Bashir, Shaheena; Ramakrishnan, Ashwin; Leung, Elisa; Qia, Yi Hua; Zhang, Nianxian; Combes, Kevin R.; Ketela, Troy; Lin, Fengshu; Houry, Walid A.; Aman, Ahmed; Al-awar, Rima; Zheng, Wei; Wienholds, Erno; Xu, Chang Jiang; Dick, John; Wang, Jean C.Y.; Moffat, Jason; Minden, Mark D.; Eaves, Connie J.; Bader, Gary D.; Hao, Zhenyue; Kornblau, Steven M.; Raught, Brian; Schimmer, Aaron D.


    Summary From an shRNA screen, we identified ClpP as a member of the mitochondrial proteome whose knockdown reduced the viability of K562 leukemic cells. Expression of this mitochondrial protease that has structural similarity to the cytoplasmic proteosome is increased in the leukemic cells from approximately half of patients with AML. Genetic or chemical inhibition of ClpP killed cells from both human AML cell lines and primary samples in which the cells showed elevated ClpP expression, but did not affect their normal counterparts. Importantly, Clpp knockout mice were viable with normal hematopoiesis. Mechanistically, we found ClpP interacts with mitochondrial respiratory chain proteins and metabolic enzymes, and knockdown of ClpP in leukemic cells inhibited oxidative phosphorylation and mitochondrial metabolism. PMID:26058080

  17. Inhibition of the Mitochondrial Protease ClpP as a Therapeutic Strategy for Human Acute Myeloid Leukemia.


    Cole, Alicia; Wang, Zezhou; Coyaud, Etienne; Voisin, Veronique; Gronda, Marcela; Jitkova, Yulia; Mattson, Rachel; Hurren, Rose; Babovic, Sonja; Maclean, Neil; Restall, Ian; Wang, Xiaoming; Jeyaraju, Danny V; Sukhai, Mahadeo A; Prabha, Swayam; Bashir, Shaheena; Ramakrishnan, Ashwin; Leung, Elisa; Qia, Yi Hua; Zhang, Nianxian; Combes, Kevin R; Ketela, Troy; Lin, Fengshu; Houry, Walid A; Aman, Ahmed; Al-Awar, Rima; Zheng, Wei; Wienholds, Erno; Xu, Chang Jiang; Dick, John; Wang, Jean C Y; Moffat, Jason; Minden, Mark D; Eaves, Connie J; Bader, Gary D; Hao, Zhenyue; Kornblau, Steven M; Raught, Brian; Schimmer, Aaron D


    From an shRNA screen, we identified ClpP as a member of the mitochondrial proteome whose knockdown reduced the viability of K562 leukemic cells. Expression of this mitochondrial protease that has structural similarity to the cytoplasmic proteosome is increased in leukemic cells from approximately half of all patients with AML. Genetic or chemical inhibition of ClpP killed cells from both human AML cell lines and primary samples in which the cells showed elevated ClpP expression but did not affect their normal counterparts. Importantly, Clpp knockout mice were viable with normal hematopoiesis. Mechanistically, we found that ClpP interacts with mitochondrial respiratory chain proteins and metabolic enzymes, and knockdown of ClpP in leukemic cells inhibited oxidative phosphorylation and mitochondrial metabolism.

  18. Protochlamydia Induces Apoptosis of Human HEp-2 Cells through Mitochondrial Dysfunction Mediated by Chlamydial Protease-Like Activity Factor

    PubMed Central

    Matsuo, Junji; Nakamura, Shinji; Ito, Atsushi; Yamazaki, Tomohiro; Ishida, Kasumi; Hayashi, Yasuhiro; Yoshida, Mitsutaka; Takahashi, Kaori; Sekizuka, Tsuyoshi; Takeuchi, Fumihiko; Kuroda, Makoto; Nagai, Hiroki; Hayashida, Kyoko; Sugimoto, Chihiro; Yamaguchi, Hiroyuki


    Obligate amoebal endosymbiotic bacterium Protochlamydia with ancestral pathogenic chlamydial features evolved to survive within protist hosts, such as Acanthamoba, 0.7–1.4 billion years ago, but not within vertebrates including humans. This observation raises the possibility that interactions between Protochlamydia and human cells may result in a novel cytopathic effect, leading to new insights into host-parasite relationships. Previously, we reported that Protochlamydia induces apoptosis of the immortalized human cell line, HEp-2. In this study, we attempted to elucidate the molecular mechanism underlying this apoptosis. We first confirmed that, upon stimulation with the bacteria, poly (ADP-ribose) polymerase (PARP) was cleaved at an early stage in HEp-2 cells, which was dependent on the amount of bacteria. A pan-caspase inhibitor and both caspase-3 and -9 inhibitors similarly inhibited the apoptosis of HEp-2 cells. A decrease of the mitochondrial membrane potential was also confirmed. Furthermore, lactacystin, an inhibitor of chlamydial protease-like activity factor (CPAF), blocked the apoptosis. Cytochalasin D also inhibited the apoptosis, which was dependent on the drug concentration, indicating that bacterial entry into cells was required to induce apoptosis. Interestingly, Yersinia type III inhibitors (ME0052, ME0053, and ME0054) did not have any effect on the apoptosis. We also confirmed that the Protochlamydia used in this study possessed a homologue of the cpaf gene and that two critical residues, histidine-101 and serine-499 of C. trachomatis CPAF in the active center, were conserved. Thus, our results indicate that after entry, Protochlamydia-secreted CPAF induces mitochondrial dysfunction with a decrease of the membrane potential, followed by caspase-9, caspase-3 and PARP cleavages for apoptosis. More interestingly, because C. trachomatis infection can block the apoptosis, our finding implies unique features of CPAF between pathogenic and primitive

  19. Higher plant mitochondrial DNA: Genomes, genes, mutants, transcription, translation

    SciTech Connect

    Not Available


    This volume contains brief summaries of 63 presentations given at the International Workshop on Higher Plant Mitochondrial DNA. The presentations are organized into topical discussions addressing plant genomes, mitochondrial genes, cytoplasmic male sterility, transcription, translation, plasmids and tissue culture. (DT)

  20. The mitochondrial genome of Raphanus sativus and gene evolution of cruciferous mitochondrial types.


    Chang, Shengxin; Chen, Jianmei; Wang, Yankun; Gu, Bingchao; He, Jianbo; Chu, Pu; Guan, Rongzhan


    To explore the mitochondrial genes of the Cruciferae family, the mitochondrial genome of Raphanus sativus (sat) was sequenced and annotated. The circular mitochondrial genome of sat is 239,723 bp and includes 33 protein-coding genes, three rRNA genes and 17 tRNA genes. The mitochondrial genome also contains a pair of large repeat sequences 5.9 kb in length, which may mediate genome reorganization into two sub-genomic circles, with predicted sizes of 124.8 kb and 115.0 kb, respectively. Furthermore, gene evolution of mitochondrial genomes within the Cruciferae family was analyzed using sat mitochondrial type (mitotype), together with six other reported mitotypes. The cruciferous mitochondrial genomes have maintained almost the same set of functional genes. Compared with Cycas taitungensis (a representative gymnosperm), the mitochondrial genomes of the Cruciferae have lost nine protein-coding genes and seven mitochondrial-like tRNA genes, but acquired six chloroplast-like tRNAs. Among the Cruciferae, to maintain the same set of genes that are necessary for mitochondrial function, the exons of the genes have changed at the lowest rates, as indicated by the numbers of single nucleotide polymorphisms. The open reading frames (ORFs) of unknown function in the cruciferous genomes are not conserved. Evolutionary events, such as mutations, genome reorganizations and sequence insertions or deletions (indels), have resulted in the non-conserved ORFs in the cruciferous mitochondrial genomes, which is becoming significantly different among mitotypes. This work represents the first phylogenic explanation of the evolution of genes of known function in the Cruciferae family. It revealed significant variation in ORFs and the causes of such variation.

  1. Whole-exome sequencing identifies homozygous AFG3L2 mutations in a spastic ataxia-neuropathy syndrome linked to mitochondrial m-AAA proteases.


    Pierson, Tyler Mark; Adams, David; Bonn, Florian; Martinelli, Paola; Cherukuri, Praveen F; Teer, Jamie K; Hansen, Nancy F; Cruz, Pedro; Mullikin For The Nisc Comparative Sequencing Program, James C; Blakesley, Robert W; Golas, Gretchen; Kwan, Justin; Sandler, Anthony; Fuentes Fajardo, Karin; Markello, Thomas; Tifft, Cynthia; Blackstone, Craig; Rugarli, Elena I; Langer, Thomas; Gahl, William A; Toro, Camilo


    We report an early onset spastic ataxia-neuropathy syndrome in two brothers of a consanguineous family characterized clinically by lower extremity spasticity, peripheral neuropathy, ptosis, oculomotor apraxia, dystonia, cerebellar atrophy, and progressive myoclonic epilepsy. Whole-exome sequencing identified a homozygous missense mutation (c.1847G>A; p.Y616C) in AFG3L2, encoding a subunit of an m-AAA protease. m-AAA proteases reside in the mitochondrial inner membrane and are responsible for removal of damaged or misfolded proteins and proteolytic activation of essential mitochondrial proteins. AFG3L2 forms either a homo-oligomeric isoenzyme or a hetero-oligomeric complex with paraplegin, a homologous protein mutated in hereditary spastic paraplegia type 7 (SPG7). Heterozygous loss-of-function mutations in AFG3L2 cause autosomal-dominant spinocerebellar ataxia type 28 (SCA28), a disorder whose phenotype is strikingly different from that of our patients. As defined in yeast complementation assays, the AFG3L2(Y616C) gene product is a hypomorphic variant that exhibited oligomerization defects in yeast as well as in patient fibroblasts. Specifically, the formation of AFG3L2(Y616C) complexes was impaired, both with itself and to a greater extent with paraplegin. This produced an early-onset clinical syndrome that combines the severe phenotypes of SPG7 and SCA28, in additional to other "mitochondrial" features such as oculomotor apraxia, extrapyramidal dysfunction, and myoclonic epilepsy. These findings expand the phenotype associated with AFG3L2 mutations and suggest that AFG3L2-related disease should be considered in the differential diagnosis of spastic ataxias.

  2. Echinochrome A Increases Mitochondrial Mass and Function by Modulating Mitochondrial Biogenesis Regulatory Genes

    PubMed Central

    Jeong, Seung Hun; Kim, Hyoung Kyu; Song, In-Sung; Noh, Su Jin; Marquez, Jubert; Ko, Kyung Soo; Rhee, Byoung Doo; Kim, Nari; Mishchenko, Natalia P.; Fedoreyev, Sergey A.; Stonik, Valentin A.; Han, Jin


    Echinochrome A (Ech A) is a natural pigment from sea urchins that has been reported to have antioxidant properties and a cardio protective effect against ischemia reperfusion injury. In this study, we ascertained whether Ech A enhances the mitochondrial biogenesis and oxidative phosphorylation in rat cardio myoblast H9c2 cells. To study the effects of Ech A on mitochondrial biogenesis, we measured mitochondrial mass, level of oxidative phosphorylation, and mitochondrial biogenesis regulatory gene expression. Ech A treatment did not induce cytotoxicity. However, Ech A treatment enhanced oxygen consumption rate and mitochondrial ATP level. Likewise, Ech A treatment increased mitochondrial contents in H9c2 cells. Furthermore, Ech A treatment up-regulated biogenesis of regulatory transcription genes, including proliferator-activated receptor gamma co-activator (PGC)-1α, estrogen-related receptor (ERR)-α, peroxisome proliferator-activator receptor (PPAR)-γ, and nuclear respiratory factor (NRF)-1 and such mitochondrial transcription regulatory genes as mitochondrial transcriptional factor A (TFAM), mitochondrial transcription factor B2 (TFB2M), mitochondrial DNA direct polymerase (POLMRT), single strand binding protein (SSBP) and Tu translation elongation factor (TUFM). In conclusion, these data suggest that Ech A is a potentiated marine drug which enhances mitochondrial biogenesis. PMID:25196935

  3. A higher plant mitochondrial homologue of the yeast m-AAA protease. Molecular cloning, localization, and putative function.


    Kolodziejczak, Marta; Kolaczkowska, Anna; Szczesny, Bartosz; Urantowka, Adam; Knorpp, Carina; Kieleczawa, Jan; Janska, Hanna


    Mitochondrial AAA metalloproteases play a fundamental role in mitochondrial biogenesis and function. They have been identified in yeast and animals but not yet in plants. This work describes the isolation and sequence analysis of the full-length cDNA from the pea (Pisum sativum) with significant homology to the yeast matrix AAA (m-AAA) protease. The product of this clone was imported into isolated pea mitochondria where it was processed to its mature form (PsFtsH). We have shown that the central region of PsFtsH containing the chaperone domain is exposed to the matrix space. Furthermore, we have demonstrated that the pea protease can complement respiration deficiency in the yta10 and/or yta12 null yeast mutants, indicating that the plant protein can compensate for the loss of at least some of the important m-AAA functions in yeast. Based on biochemical experiments using isolated pea mitochondria, we propose that PsFtsH-like m-AAA is involved in the accumulation of the subunit 9 of the ATP synthase in the mitochondrial membrane.

  4. The Kunitz-protease inhibitor domain in amyloid precursor protein reduces cellular mitochondrial enzymes expression and function.


    Chua, Li-Min; Lim, Mei-Li; Wong, Boon-Seng


    Mitochondrial dysfunction is a prominent feature of Alzheimer's disease (AD) and this can be contributed by aberrant metabolic enzyme function. But, the mechanism causing this enzymatic impairment is unclear. Amyloid precursor protein (APP) is known to be alternatively spliced to produce three major isoforms in the brain (APP695, APP751, APP770). Both APP770 and APP751 contain the Kunitz Protease Inhibitory (KPI) domain, but the former also contain an extra OX-2 domain. APP695 on the other hand, lacks both domains. In AD, up-regulation of the KPI-containing APP isoforms has been reported. But the functional contribution of this elevation is unclear. In the present study, we have expressed and compared the effect of the non-KPI containing APP695 and the KPI-containing APP751 on mitochondrial function. We found that the KPI-containing APP751 significantly decreased the expression of three major mitochondrial metabolic enzymes; citrate synthase, succinate dehydrogenase and cytochrome c oxidase (COX IV). This reduction lowers the NAD(+)/NADH ratio, COX IV activity and mitochondrial membrane potential. Overall, this study demonstrated that up-regulation of the KPI-containing APP isoforms is likely to contribute to the impairment of metabolic enzymes and mitochondrial function in AD.

  5. A peep into mitochondrial disorder: multifaceted from mitochondrial DNA mutations to nuclear gene modulation.


    Chen, Chao; Chen, Ye; Guan, Min-Xin


    Mitochondrial genome is responsible for multiple human diseases in a maternal inherited pattern, yet phenotypes of patients in a same pedigree frequently vary largely. Genes involving in epigenetic modification, RNA processing, and other biological pathways, rather than "threshold effect" and environmental factors, provide more specific explanation to the aberrant phenotype. Thus, the double hit theory, mutations both in mitochondrial DNA and modifying genes aggravating the symptom, throws new light on mitochondrial dysfunction processes. In addition, mitochondrial retrograde signaling pathway that leads to reconfiguration of cell metabolism to adapt defects in mitochondria may as well play an active role. Here we review selected examples of modifier genes and mitochondrial retrograde signaling in mitochondrial disorders, which refine our understanding and will guide the rational design of clinical therapies.

  6. Prevalence of genes encoding extracellular proteases in Staphylococcus aureus - important targets triggering immune response in vivo.


    Zdzalik, Michal; Karim, Abdulkarim Y; Wolski, Krzysztof; Buda, Pawel; Wojcik, Kinga; Brueggemann, Sarah; Wojciechowski, Piotr; Eick, Sigrun; Calander, Ann-Marie; Jonsson, Ing-Marie; Kubica, Malgorzata; Polakowska, Klaudia; Miedzobrodzki, Jacek; Wladyka, Benedykt; Potempa, Jan; Dubin, Grzegorz


    Proteases of Staphylococcus aureus have long been considered to function as important virulence factors, although direct evidence of the role of particular enzymes remains incomplete and elusive. Here, we sought to provide a collective view of the prevalence of extracellular protease genes in genomes of commensal and pathogenic strains of S. aureus and their expression in the course of human and mouse infection. Data on V8 protease, staphopains A and B, aureolysin, and the recently described and poorly characterized group of six Spl proteases are provided. A phylogenetically diverse collection of 167 clinical isolates was analyzed, resulting in the comprehensive genetic survey of the prevalence of protease-encoding genes. No correlation between identified gene patterns with specific infections was established. Humoral response against the proteases of interest was examined in the sera derived from human patients and from a model mouse infection. The analysis suggests that at least some, if not all, tested proteases are expressed and secreted during the course of infection. Overall, the results presented in this study support the hypothesis that the secretory proteases as a group may contribute to the virulence of S. aureus.

  7. Mutations in nuclear genes alter post-transcriptional regulation of mitochondrial genes.

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Nuclear gene products are required for the expression of mitochondrial genes and elaboration of functional mitochondrial protein complexes. To better understand the roles of these nuclear genes, we exploited the mitochondrial encoded S-type of cytoplasmic male sterility (CMS-S) and developed a nove...

  8. Analysis of mitochondrial respiratory-related genes reveals nuclear and mitochondrial genome cooperation in allotetraploid hybrid.


    Peng, L-Y; Wang, J; Tao, M; You, C-P; Ye, L; Xiao, J; Zhang, C; Liu, Y; Liu, S-J


    An allotetraploid hybrid lineage derived from the distant hybridization of red crucian carp (Carassius auratus red var., ♀, 2n =100) × common carp (Cyprinus carpio L., ♂, 2n =100) was investigated for its mitochondrial and nuclear genome inheritance patterns. Based on liver transcriptomic data for this hybrid, red crucian carp, and common carp, we identified 94, 136, and 86 contigs corresponding to 41, 46, and 37 mitochondrial respiratory chain nuclear genes, respectively. Mitochondrial respiratory chain nuclear gene sequences from red crucian carp and common carp were both detected in the allotetraploid hybrid, indicating that both parental nuclear genomes were participated in the synthesis of mitochondrial respiratory protein complexes in the hybrid. For mitochondrial respiratory related genes, high sequence similarity (>90%) and a low nucleotide divergence rate (<0.2) between red crucian carp and common carp could be a critical factor allowing cooperation of the three genomes (red crucian carp mitochondrial genome, red crucian and common carp nuclear genomes) in the allotetraploid hybrid lineage. Interestingly, gene duplication events were identified in the allotetraploid hybrid, red crucian and common carp, as confirmed by analysis of orthologous gene trees for these fish. Our findings provide valuable information with which to study cooperation between the nuclear and mitochondrial genomes of other hybrids, and will provide basic genetic information of relevance to mitochondrial-related diseases in humans and animals.

  9. Mitochondrial serine protease HTRA2 p.G399S in a kindred with essential tremor and Parkinson disease.


    Unal Gulsuner, Hilal; Gulsuner, Suleyman; Mercan, Fatma Nazli; Onat, Onur Emre; Walsh, Tom; Shahin, Hashem; Lee, Ming K; Dogu, Okan; Kansu, Tulay; Topaloglu, Haluk; Elibol, Bulent; Akbostanci, Cenk; King, Mary-Claire; Ozcelik, Tayfun; Tekinay, Ayse B


    Essential tremor is one of the most frequent movement disorders of humans and can be associated with substantial disability. Some but not all persons with essential tremor develop signs of Parkinson disease, and the relationship between the conditions has not been clear. In a six-generation consanguineous Turkish kindred with both essential tremor and Parkinson disease, we carried out whole exome sequencing and pedigree analysis, identifying HTRA2 p.G399S as the allele likely responsible for both conditions. Essential tremor was present in persons either heterozygous or homozygous for this allele. Homozygosity was associated with earlier age at onset of tremor (P < 0.0001), more severe postural tremor (P < 0.0001), and more severe kinetic tremor (P = 0.0019). Homozygotes, but not heterozygotes, developed Parkinson signs in the middle age. Among population controls from the same Anatolian region as the family, frequency of HTRA2 p.G399S was 0.0027, slightly lower than other populations. HTRA2 encodes a mitochondrial serine protease. Loss of function of HtrA2 was previously shown to lead to parkinsonian features in motor neuron degeneration (mnd2) mice. HTRA2 p.G399S was previously shown to lead to mitochondrial dysfunction, altered mitochondrial morphology, and decreased protease activity, but epidemiologic studies of an association between HTRA2 and Parkinson disease yielded conflicting results. Our results suggest that in some families, HTRA2 p.G399S is responsible for hereditary essential tremor and that homozygotes for this allele develop Parkinson disease. This hypothesis has implications for understanding the pathogenesis of essential tremor and its relationship to Parkinson disease.



    Amiri, Azam; Bandani, Ali Reza; Alizadeh, Houshang


    Sunn pest, Eurygaster integriceps, is a serious pest of cereals in the wide area of the globe from Near and Middle East to East and South Europe and North Africa. This study described for the first time, identification of E. integriceps trypsin serine protease and cathepsin-L cysteine, transcripts involved in digestion, which might serve as targets for pest control management. A total of 478 and 500 base pair long putative trypsin and cysteine gene sequences were characterized and named Tryp and Cys, respectively. In addition, the tissue-specific relative gene expression levels of these genes as well as gluten hydrolase (Gl) were determined under different host kernels feeding conditions. Result showed that mRNA expression of Cys, Tryp, and Gl was significantly affected after feeding on various host plant species. Transcript levels of these genes were most abundant in the wheat-fed E. integriceps larvae compared to other hosts. The Cys transcript was detected exclusively in the gut, whereas the Gl and Tryp transcripts were detectable in both salivary glands and gut. Also possibility of Sunn pest gene silencing was studied by topical application of cysteine double-stranded RNA (dsRNA). The results indicated that topically applied dsRNA on fifth nymphal stage can penetrate the cuticle of the insect and induce RNA interference. The Cys gene mRNA transcript in the gut was reduced to 83.8% 2 days posttreatment. Also, it was found that dsRNA of Cys gene affected fifth nymphal stage development suggesting the involvement of this protease in the insect growth, development, and molting.

  11. Characterization of cysteine protease-like genes in the striped rice stem borer, Chilo suppressalis.


    Ge, Zhao-Yu; Wan, Pin-Jun; Li, Guo-Qing; Xia, Yong-Gui; Han, Zhao-Jun


    The striped rice stem borer, Chilo suppressalis (Walker), is a major pest for rice production in China and the rest of Southeast Asia. Chemical control is the main means to alleviate losses due to this pest, which causes serious environmental pollution. An effective and environmentally friendly approach is needed for the management of the striped rice stem borer. Cysteine proteases in insects could be useful targets for pest management either through engineering plant protease inhibitors, targeting insect digestive cysteine proteases, or through RNA interference-based silencing of cysteine proteases, disrupting developmental regulation of insects. In this study, eight cysteine protease-like genes were identified and partially characterized. The genes CCO2 and CCL4 were exclusively expressed in the larval gut, and their expression was affected by the state of nutrition in the insect. The expression of CCL2, CCL3, and CCO1 was significantly affected by the type of host plant, suggesting a role in host plant - insect interactions. Our initial characterization of the striped rice stem borer cysteine protease-like genes provides a foundation for further research on this important group of genes in this major insect pest of rice.

  12. Cloning of the gene encoding streptococcal immunoglobulin A protease and its expression in Escherichia coli.

    PubMed Central

    Gilbert, J V; Plaut, A G; Fishman, Y; Wright, A


    We have identified and cloned a 6-kilobase-pair segment of chromosomal DNA from Streptococcus sanguis ATCC 10556 that encodes immunoglobulin A (IgA) protease activity when cloned into Escherichia coli. The enzyme specified by the iga gene in plasmid pJG1 accumulates in the periplasm of E. coli MM294 cells and has a substrate specificity for human IgA1 identical to that of native S. sanguis protease. Hybridization experiments with probes from within the encoding DNA showed no detectable homology at the nucleotide sequence level with chromosomal DNA of gram-negative bacteria that excrete IgA protease. Moreover, the S. sanguis iga gene probes showed no detectable hybridization with chromosomal DNA of S. pneumoniae, although the IgA proteases of these two streptococcal species cleaved the identical peptide bond in the human IgA1 heavy-chain hinge region. Images PMID:3294181

  13. Regulation of mitochondrial gene expression, the epigenetic enigma.


    Mposhi, Archibold; Van der Wijst, Monique Gp; Faber, Klaas Nico; Rots, Marianne G


    Epigenetics provides an important layer of information on top of the DNA sequence and is essential for establishing gene expression profiles. Extensive studies have shown that nuclear DNA methylation and histone modifications influence nuclear gene expression. However, it remains unclear whether mitochondrial DNA (mtDNA) undergoes similar epigenetic changes to regulate mitochondrial gene expression. Recently, it has been shown that mtDNA is differentially methylated in various diseases such as diabetes and colorectal cancer. Interestingly, this differential methylation was often associated with altered mitochondrial gene expression. However, the direct role of mtDNA methylation on gene expression remains elusive. Alternatively, the activity of the mitochondrial transcription factor A (TFAM), a protein involved in mtDNA packaging, might also influence gene expression. This review discusses the role of mtDNA methylation and potential epigenetic-like modifications of TFAM with respect to mtDNA transcription and replication. We suggest three mechanisms: (1) methylation within the non-coding D-loop, (2) methylation at gene start sites (GSS) and (3) post-translational modifications (PTMs) of TFAM. Unraveling mitochondrial gene expression regulation could open new therapeutic avenues for mitochondrial diseases.

  14. A new member of the plasma protease inhibitor gene family.

    PubMed Central

    Ragg, H


    A 2.1-kb cDNA clone representing a new member of the protease inhibitor family was isolated from a human liver cDNA library. The inhibitor, named human Leuserpin 2 (hLS2), comprises 480 amino acids and contains a leucine residue at its putative reactive center. HLS2 is about 25-28% homologous to three human members of the plasma protease inhibitor family: antithrombin III, alpha 1-antitrypsin and alpha 1-antichymotrypsin. A comparison with published partial amino acid sequences shows that hLS2 is closely related to the thrombin inhibitor heparin cofactor II. Images PMID:3003690

  15. Purification and characterization of cloned alkaline protease gene of Geobacillus stearothermophilus.


    Iqbal, Irfana; Aftab, Muhammad Nauman; Afzal, Mohammed; Ur-Rehman, Asad; Aftab, Saima; Zafar, Asma; Ud-Din, Zia; Khuharo, Ateeque Rahman; Iqbal, Jawad; Ul-Haq, Ikram


    Thermostable alkaline serine protease gene of Geobacillus stearothermophilus B-1172 was cloned and expressed in Escherichia coli BL21 (DE3) using pET-22b(+), as an expression vector. The growth conditions were optimized for maximal production of the protease using variable fermentation parameters, i.e., pH, temperature, and addition of an inducer. Protease, thus produced, was purified by ammonium sulfate precipitation followed by ion exchange chromatography with 13.7-fold purification, with specific activity of 97.5 U mg(-1) , and a recovery of 23.6%. Molecular weight of the purified protease, 39 kDa, was determined by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). The enzyme was stable at 90 °C at pH 9. The enzyme activity was steady in the presence of EDTA indicating that the protease was not a metalloprotease. No significant change in the activity of protease after addition of various metal ions further strengthened this fact. However, an addition of 1% Triton X-100 or SDS surfactants constrained the enzyme specific activity to 34 and 19%, respectively. Among organic solvents, an addition of 1-butanol (20%) augmented the enzyme activity by 29% of the original activity. With casein as a substrate, the enzyme activity under optimized conditions was found to be 73.8 U mg(-1) . The effect of protease expression on the host cells growth was also studied and found to negatively affect E. coli cells to certain extent. Catalytic domains of serine proteases from eight important thermostable organisms were analyzed through WebLogo and found to be conserved in all serine protease sequences suggesting that protease of G. stearothermophilus could be beneficially used as a biocontrol agent and in many industries including detergent industry.

  16. Nuclear and mitochondrial genes for inferring Trichuris phylogeny.


    Callejón, Rocío; Cutillas, Cristina; Nadler, Steven A


    Nucleotide sequences of the triose phosphate isomerase (TPI) gene (624 bp) and mitochondrial cytochrome b (cob) gene (520 bp) were obtained by PCR and evaluated for utility in inferring the phylogenetic relationships among Trichuris species. Published sequences of one other nuclear gene (18S or SSU rRNA, 1816-1846 bp) and one additional mitochondrial (mtDNA) gene (cytochrome oxidase 1, cox1, 342 bp) were also analyzed. Maximum likelihood and Bayesian inference methods were used to infer phylogenies for each gene separately but also for the combined mitochondrial data (two genes), the combined nuclear data (two genes), and the total evidence (four gene) dataset. Few Trichuris clades were uniformly resolved across separate analyses of individual genes. For the mtDNA, the cob gene trees had greater phylogenetic resolution and tended to have higher support values than the cox1 analyses. For nuclear genes, the SSU gene trees had slightly greater resolution and support values than the TPI analyses, but TPI was the only gene with reliable support for the deepest nodes in the tree. Combined analyses of genes yielded strongly supported clades in most cases, with the exception of the relationship among Trichuris clades 1, 2, and 3, which showed conflicting results between nuclear and mitochondrial genes. Both the TPI and cob genes proved valuable for inferring Trichuris relationships, with greatest resolution and support values achieved through combined analysis of multiple genes. Based on the phylogeny of the combined analysis of nuclear and mitochondrial genes, parsimony mapping of definitive host utilization depicts artiodactyls as the ancestral hosts for these Trichuris, with host-shifts into primates, rodents, and Carnivora.

  17. Characterization, cloning, and heterologous expression of a subtilisin-like serine protease gene VlPr1 from Verticillium lecanii.


    Yu, Gang; Liu, Jin-Liang; Xie, Li-Qin; Wang, Xue-Liang; Zhang, Shi-Hong; Pan, Hong-Yu


    The entomopathogenic fungus Verticillium lecanii is a well-known biocontrol agent. V. lecanii produces subtilisin-like serine protease (Pr1), which is important in the biological control activity of some insect pests by degrading insect cuticles. In this study, a subtilisin-like serine protease gene VlPr1 was cloned from the fungus and the VlPr1 protein was expressed in Escherichia coli. The VlPr1 gene contains an open reading frame (ORF) interrupted by three short introns, and encodes a protein of 379 amino acids. Protein sequence analysis revealed high homology with subtilisin serine proteases. The molecular mass of the protease was 38 kDa, and the serine protease exhibited its maximal activity at 40°C and pH 9.0. Protease activity was also affected by Mg(2+) and Ca(2+) concentration. The protease showed inhibitory activity against several plant pathogens, especially towards Fusarium moniliforme.

  18. Resveratrol Co-Treatment Attenuates the Effects of HIV Protease Inhibitors on Rat Body Weight and Enhances Cardiac Mitochondrial Respiration

    PubMed Central

    Symington, Burger; Mapanga, Rudo F.; Norton, Gavin R.


    Since the early 1990s human immunodeficiency virus (HIV)/acquired immunodeficiency syndrome (AIDS) emerged as a global health pandemic, with sub-Saharan Africa the hardest hit. While the successful roll-out of antiretroviral (ARV) therapy provided significant relief to HIV-positive individuals, such treatment can also elicit damaging side-effects. Here especially HIV protease inhibitors (PIs) are implicated in the onset of cardio-metabolic complications such as type-2 diabetes and coronary heart disease. As there is a paucity of data regarding suitable co-treatments within this context, this preclinical study investigated whether resveratrol (RSV), aspirin (ASP) or vitamin C (VitC) co-treatment is able to blunt side-effects in a rat model of chronic PI exposure (Lopinavir/Ritonavir treatment for 4 months). Body weights and weight gain, blood metabolite levels (total cholesterol, HDL, LDL, triglycerides), echocardiography and cardiac mitochondrial respiration were assessed in PI-treated rats ± various co-treatments. Our data reveal that PI treatment significantly lowered body weight and cardiac respiratory function while no significant changes were found for heart function and blood metabolite levels. Moreover, all co-treatments ameliorated the PI-induced decrease in body weight after 4 months of PI treatment, while RSV co-treatment enhanced cardiac mitochondrial respiratory capacity in PI-treated rats. This pilot study therefore provides novel hypotheses regarding RSV co-treatment that should be further assessed in greater detail. PMID:28107484

  19. MALT1 Protease Activity Controls the Expression of Inflammatory Genes in Keratinocytes upon Zymosan Stimulation.


    Schmitt, Anja; Grondona, Paula; Maier, Tabea; Brändle, Marc; Schönfeld, Caroline; Jäger, Günter; Kosnopfel, Corinna; Eberle, Franziska C; Schittek, Birgit; Schulze-Osthoff, Klaus; Yazdi, Amir S; Hailfinger, Stephan


    The protease activity of the paracaspase mucosa-associated lymphoid tissue lymphoma translocation gene 1 (MALT1) plays an important role in antigen receptor-mediated lymphocyte activation by controlling the activity of the transcription factor nuclear factor-κB and is thus essential for the expression of inflammatory target genes. MALT1 is not only present in cells of the hematopoietic lineage, but is ubiquitously expressed. Here we report that stimulation with zymosan or Staphylococcus aureus induced MALT1 protease activity in human primary keratinocytes. Inhibition of the Src family of kinases or novel protein kinase C isoforms as well as silencing of CARMA2 or BCL10 interfered with activation of MALT1 protease. Silencing or inhibition of MALT1 protease strongly decreased the expression of important inflammatory genes such as TNFα, IL-17C, CXCL8 and HBD-2. MALT1-inhibited cells were unable to mount an antimicrobial response upon zymosan stimulation or phorbolester/ionomycin treatment, demonstrating a central role of MALT1 protease activity in keratinocyte immunity and suggesting MALT1 as a potential target in inflammatory skin diseases.

  20. Mitochondrial gene therapy augments mitochondrial physiology in a Parkinson's disease cell model.


    Keeney, Paula M; Quigley, Caitlin K; Dunham, Lisa D; Papageorge, Christina M; Iyer, Shilpa; Thomas, Ravindar R; Schwarz, Kathleen M; Trimmer, Patricia A; Khan, Shaharyar M; Portell, Francisco R; Bergquist, Kristen E; Bennett, James P


    Neurodegeneration in Parkinson's disease (PD) affects mainly dopaminergic neurons in the substantia nigra, where age-related, increasing percentages of cells lose detectable respiratory activity associated with depletion of intact mitochondrial DNA (mtDNA). Replenishment of mtDNA might improve neuronal bioenergetic function and prevent further cell death. We developed a technology ("ProtoFection") that uses recombinant human mitochondrial transcription factor A (TFAM) engineered with an N-terminal protein transduction domain (PTD) followed by the SOD2 mitochondrial localization signal (MLS) to deliver mtDNA cargo to the mitochondria of living cells. MTD-TFAM (MTD = PTD + MLS = "mitochondrial transduction domain") binds mtDNA and rapidly transports it across plasma membranes to mitochondria. For therapeutic proof-of-principle we tested ProtoFection technology in Parkinson's disease cybrid cells, using mtDNA generated from commercially available human genomic DNA (gDNA; Roche). Nine to 11 weeks after single exposures to MTD-TFAM + mtDNA complex, PD cybrid cells with impaired respiration and reduced mtDNA genes increased their mtDNA gene copy numbers up to 24-fold, mtDNA-derived RNAs up to 35-fold, TFAM and ETC proteins, cell respiration, and mitochondrial movement velocities. Cybrid cells with no or minimal basal mitochondrial impairments showed reduced or no responses to treatment, suggesting the possibility of therapeutic selectivity. Exposure of PD but not control cybrid cells to MTD-TFAM protein alone or MTD-TFAM + mtDNA complex increased expression of PGC-1alpha, suggesting activation of mitochondrial biogenesis. ProtoFection technology for mitochondrial gene therapy holds promise for improving bioenergetic function in impaired PD neurons and needs additional development to define its pharmacodynamics and delineate its molecular mechanisms. It also is unclear whether single-donor gDNA for generating mtDNA would be a preferred therapeutic compared with the pooled

  1. Gemini surfactants mediate efficient mitochondrial gene delivery and expression.


    Cardoso, Ana M; Morais, Catarina M; Cruz, A Rita; Cardoso, Ana L; Silva, Sandra G; do Vale, M Luísa; Marques, Eduardo F; Pedroso de Lima, Maria C; Jurado, Amália S


    Gene delivery targeting mitochondria has the potential to transform the therapeutic landscape of mitochondrial genetic diseases. Taking advantage of the nonuniversal genetic code used by mitochondria, a plasmid DNA construct able to be specifically expressed in these organelles was designed by including a codon, which codes for an amino acid only if read by the mitochondrial ribosomes. In the present work, gemini surfactants were shown to successfully deliver plasmid DNA to mitochondria. Gemini surfactant-based DNA complexes were taken up by cells through a variety of routes, including endocytic pathways, and showed propensity for inducing membrane destabilization under acidic conditions, thus facilitating cytoplasmic release of DNA. Furthermore, the complexes interacted extensively with lipid membrane models mimicking the composition of the mitochondrial membrane, which predicts a favored interaction of the complexes with mitochondria in the intracellular environment. This work unravels new possibilities for gene therapy toward mitochondrial diseases.

  2. Mitochondrial genes are altered in blood early in Alzheimer's disease.


    Lunnon, Katie; Keohane, Aoife; Pidsley, Ruth; Newhouse, Stephen; Riddoch-Contreras, Joanna; Thubron, Elisabeth B; Devall, Matthew; Soininen, Hikka; Kłoszewska, Iwona; Mecocci, Patrizia; Tsolaki, Magda; Vellas, Bruno; Schalkwyk, Leonard; Dobson, Richard; Malik, Afshan N; Powell, John; Lovestone, Simon; Hodges, Angela


    Although mitochondrial dysfunction is a consistent feature of Alzheimer's disease in the brain and blood, the molecular mechanisms behind these phenomena are unknown. Here we have replicated our previous findings demonstrating reduced expression of nuclear-encoded oxidative phosphorylation (OXPHOS) subunits and subunits required for the translation of mitochondrial-encoded OXPHOS genes in blood from people with Alzheimer's disease and mild cognitive impairment. Interestingly this was accompanied by increased expression of some mitochondrial-encoded OXPHOS genes, namely those residing closest to the transcription start site of the polycistronic heavy chain mitochondrial transcript (MT-ND1, MT-ND2, MT-ATP6, MT-CO1, MT-CO2, MT-C03) and MT-ND6 transcribed from the light chain. Further we show that mitochondrial DNA copy number was unchanged suggesting no change in steady-state numbers of mitochondria. We suggest that an imbalance in nuclear and mitochondrial genome-encoded OXPHOS transcripts may drive a negative feedback loop reducing mitochondrial translation and compromising OXPHOS efficiency, which is likely to generate damaging reactive oxygen species.

  3. Cysteine protease gene expression and proteolytic activity during senescence of Alstroemeria petals.


    Wagstaff, Carol; Leverentz, Michael K; Griffiths, Gareth; Thomas, Brian; Chanasut, Usawadee; Stead, Anthony D; Rogers, Hilary J


    The functional life of the flower is terminated by senescence and/or abscission. Multiple processes contribute to produce the visible signs of petal wilting and inrolling that typify senescence, but one of the most important is that of protein degradation and remobilization. This is mediated in many species through protein ubiquitination and the action of specific protease enzymes. This paper reports the changes in protein and protease activity during development and senescence of Alstroemeria flowers, a Liliaceous species that shows very little sensitivity to ethylene during senescence and which shows perianth abscission 8-10 d after flower opening. Partial cDNAs of ubiquitin (ALSUQ1) and a putative cysteine protease (ALSCYP1) were cloned from Alstroemeria using degenerate PCR primers and the expression pattern of these genes was determined semi-quantitatively by RT-PCR. While the levels of ALSUQ1 only fluctuated slightly during floral development and senescence, there was a dramatic increase in the expression of ALSCYP1 indicating that this gene may encode an important enzyme for the proteolytic process in this species. Three papain class cysteine protease enzymes showing different patterns of activity during flower development were identified on zymograms, one of which showed a similar expression pattern to the cysteine protease cDNA.

  4. Mitochondrial and Metabolic Gene Expression in the Aged Rat Heart

    PubMed Central

    Barton, Gregory P.; Sepe, Joseph J.; McKiernan, Susan H.; Aiken, Judd M.; Diffee, Gary M.


    Aging is associated with a decline in cardiac function. Exercise intervention has been suggested as a way to improve this decrement. Age-related decline in cardiac function is associated with decreases in fatty acid oxidation, mitochondrial function, and AMP-activated protein kinase (AMPK) activity. The molecular mechanisms involved with age-related changes in mitochondrial function and substrate metabolism are poorly understood. We determined gene expression differences in hearts of Young (6 mo), Old (33 mo), and old exercise trained (Old + EXE) (34 mo) FBN rats, using Qiagen PCR arrays for Glucose, Fatty acid, and Mitochondrial metabolism. Old rats demonstrated decreased (p < 0.05) expression for key genes in fatty acid oxidation, mitochondrial function, and AMPK signaling. There were no differences in the expression of genes involved in glucose metabolism with age. These gene expression changes occurred prior to altered protein translation as we found no differences in the protein content of peroxisome proliferator activated receptor gamma, coactivators 1 alpha (PGC-1α), peroxisome proliferator activated receptor alpha (PPARα), and AMPKα2 between young and old hearts. Four months of exercise training did not attenuate the decline in the gene expression in aged hearts. Despite this lack of change in gene expression, exercise-trained rats demonstrated increased exercise capacity compared to their sedentary counterparts. Taken together, our results show that differential expression of genes associated with fatty acid metabolism, AMPK signaling and mitochondrial function decrease in the aging heart which may play a role in age-related declines in fatty acid oxidation, AMPK activity, and mitochondrial function in the heart. PMID:27601998

  5. Inferring Kangaroo Phylogeny from Incongruent Nuclear and Mitochondrial Genes

    PubMed Central

    Phillips, Matthew J.; Haouchar, Dalal; Pratt, Renae C.; Gibb, Gillian C.; Bunce, Michael


    The marsupial genus Macropus includes three subgenera, the familiar large grazing kangaroos and wallaroos of M. (Macropus) and M. (Osphranter), as well as the smaller mixed grazing/browsing wallabies of M. (Notamacropus). A recent study of five concatenated nuclear genes recommended subsuming the predominantly browsing Wallabia bicolor (swamp wallaby) into Macropus. To further examine this proposal we sequenced partial mitochondrial genomes for kangaroos and wallabies. These sequences strongly favour the morphological placement of W. bicolor as sister to Macropus, although place M. irma (black-gloved wallaby) within M. (Osphranter) rather than as expected, with M. (Notamacropus). Species tree estimation from separately analysed mitochondrial and nuclear genes favours retaining Macropus and Wallabia as separate genera. A simulation study finds that incomplete lineage sorting among nuclear genes is a plausible explanation for incongruence with the mitochondrial placement of W. bicolor, while mitochondrial introgression from a wallaroo into M. irma is the deepest such event identified in marsupials. Similar such coalescent simulations for interpreting gene tree conflicts will increase in both relevance and statistical power as species-level phylogenetics enters the genomic age. Ecological considerations in turn, hint at a role for selection in accelerating the fixation of introgressed or incompletely sorted loci. More generally the inclusion of the mitochondrial sequences substantially enhanced phylogenetic resolution. However, we caution that the evolutionary dynamics that enhance mitochondria as speciation indicators in the presence of incomplete lineage sorting may also render them especially susceptible to introgression. PMID:23451266

  6. Inferring kangaroo phylogeny from incongruent nuclear and mitochondrial genes.


    Phillips, Matthew J; Haouchar, Dalal; Pratt, Renae C; Gibb, Gillian C; Bunce, Michael


    The marsupial genus Macropus includes three subgenera, the familiar large grazing kangaroos and wallaroos of M. (Macropus) and M. (Osphranter), as well as the smaller mixed grazing/browsing wallabies of M. (Notamacropus). A recent study of five concatenated nuclear genes recommended subsuming the predominantly browsing Wallabia bicolor (swamp wallaby) into Macropus. To further examine this proposal we sequenced partial mitochondrial genomes for kangaroos and wallabies. These sequences strongly favour the morphological placement of W. bicolor as sister to Macropus, although place M. irma (black-gloved wallaby) within M. (Osphranter) rather than as expected, with M. (Notamacropus). Species tree estimation from separately analysed mitochondrial and nuclear genes favours retaining Macropus and Wallabia as separate genera. A simulation study finds that incomplete lineage sorting among nuclear genes is a plausible explanation for incongruence with the mitochondrial placement of W. bicolor, while mitochondrial introgression from a wallaroo into M. irma is the deepest such event identified in marsupials. Similar such coalescent simulations for interpreting gene tree conflicts will increase in both relevance and statistical power as species-level phylogenetics enters the genomic age. Ecological considerations in turn, hint at a role for selection in accelerating the fixation of introgressed or incompletely sorted loci. More generally the inclusion of the mitochondrial sequences substantially enhanced phylogenetic resolution. However, we caution that the evolutionary dynamics that enhance mitochondria as speciation indicators in the presence of incomplete lineage sorting may also render them especially susceptible to introgression.

  7. Systematically fragmented genes in a multipartite mitochondrial genome

    PubMed Central

    Vlcek, Cestmir; Marande, William; Teijeiro, Shona; Lukeš, Julius; Burger, Gertraud


    Arguably, the most bizarre mitochondrial DNA (mtDNA) is that of the euglenozoan eukaryote Diplonema papillatum. The genome consists of numerous small circular chromosomes none of which appears to encode a complete gene. For instance, the cox1 coding sequence is spread out over nine different chromosomes in non-overlapping pieces (modules), which are transcribed separately and joined to a contiguous mRNA by trans-splicing. Here, we examine how many genes are encoded by Diplonema mtDNA and whether all are fragmented and their transcripts trans-spliced. Module identification is challenging due to the sequence divergence of Diplonema mitochondrial genes. By employing most sensitive protein profile search algorithms and comparing genomic with cDNA sequence, we recognize a total of 11 typical mitochondrial genes. The 10 protein-coding genes are systematically chopped up into three to 12 modules of 60–350 bp length. The corresponding mRNAs are all trans-spliced. Identification of ribosomal RNAs is most difficult. So far, we only detect the 3′-module of the large subunit ribosomal RNA (rRNA); it does not trans-splice with other pieces. The small subunit rRNA gene remains elusive. Our results open new intriguing questions about the biochemistry and evolution of mitochondrial trans-splicing in Diplonema. PMID:20935050

  8. Towards mitochondrial gene therapy: DQAsomes as a strategy.


    Weissig, V; Torchilin, V P


    Mitochondrial dysfunction is a cause, or major contributing factor in the development, of degenerative diseases, aging, cancer, many cases of Alzheimer's and Parkinson's disease and Type II diabetes (D. C. Wallace, Science 283, 1482-1488, 1999). Despite major advances in understanding mtDNA defects at the genetic and biochemical level, there is no satisfactory treatment for the vast majority of patients available. Objective limitations of conventional biochemical treatment for patients with defects of mtDNA warrant the exploration of gene therapeutic approaches. However, mitochondrial gene therapy has been elusive, due to the lack of any mitochondria-specific transfection vector. We review here the current state of the development of mitochondrial DNA delivery systems. In particular, we are summarizing our own efforts in exploring the mitochondriotropic properties of dequalinium, a cationic bolaamphiphile with delocalized charge centers, for the design of a vector suited for the transport of DNA to mitochondria in living cells.

  9. The Agaricus bisporus cox1 gene: the longest mitochondrial gene and the largest reservoir of mitochondrial group i introns.


    Férandon, Cyril; Moukha, Serge; Callac, Philippe; Benedetto, Jean-Pierre; Castroviejo, Michel; Barroso, Gérard


    In eukaryotes, introns are located in nuclear and organelle genes from several kingdoms. Large introns (up to 5 kbp) are frequent in mitochondrial genomes of plant and fungi but scarce in Metazoa, even if these organisms are grouped with fungi among the Opisthokonts. Mitochondrial introns are classified in two groups (I and II) according to their RNA secondary structure involved in the intron self-splicing mechanism. Most of these mitochondrial group I introns carry a "Homing Endonuclease Gene" (heg) encoding a DNA endonuclease acting in transfer and site-specific integration ("homing") and allowing intron spreading and gain after lateral transfer even between species from different kingdoms. Opposed to this gain mechanism, is another which implies that introns, which would have been abundant in the ancestral genes, would mainly evolve by loss. The importance of both mechanisms (loss and gain) is matter of debate. Here we report the sequence of the cox1 gene of the button mushroom Agaricus bisporus, the most widely cultivated mushroom in the world. This gene is both the longest mitochondrial gene (29,902 nt) and the largest group I intron reservoir reported to date with 18 group I and 1 group II. An exhaustive analysis of the group I introns available in cox1 genes shows that they are mobile genetic elements whose numerous events of loss and gain by lateral transfer combine to explain their wide and patchy distribution extending over several kingdoms. An overview of intron distribution, together with the high frequency of eroded heg, suggests that they are evolving towards loss. In this landscape of eroded and lost intron sequences, the A. bisporus cox1 gene exhibits a peculiar dynamics of intron keeping and catching, leading to the largest collection of mitochondrial group I introns reported to date in a Eukaryote.

  10. Alternative splicing, a new target to block cellular gene expression by poliovirus 2A protease

    SciTech Connect

    Alvarez, Enrique; Castello, Alfredo; Carrasco, Luis; Izquierdo, Jose M.


    Highlights: {yields} Novel role for poliovirus 2A protease as splicing modulator. {yields} Poliovirus 2A protease inhibits the alternative splicing of pre-mRNAs. {yields} Poliovirus 2A protease blocks the second catalytic step of splicing. -- Abstract: Viruses have developed multiple strategies to interfere with the gene expression of host cells at different stages to ensure their own survival. Here we report a new role for poliovirus 2A{sup pro} modulating the alternative splicing of pre-mRNAs. Expression of 2A{sup pro} potently inhibits splicing of reporter genes in HeLa cells. Low amounts of 2A{sup pro} abrogate Fas exon 6 skipping, whereas higher levels of protease fully abolish Fas and FGFR2 splicing. In vitro splicing of MINX mRNA using nuclear extracts is also strongly inhibited by 2A{sup pro}, leading to accumulation of the first exon and the lariat product containing the unspliced second exon. These findings reveal that the mechanism of action of 2A{sup pro} on splicing is to selectively block the second catalytic step.

  11. Protease Gene Duplication and Proteolytic Activity in Drosophila Female Reproductive Tracts

    PubMed Central

    Kelleher, Erin S.; Pennington, James E.


    Secreted proteases play integral roles in sexual reproduction in a broad range of taxa. In the genetic model Drosophila melanogaster, these molecules are thought to process peptides and activate enzymes inside female reproductive tracts, mediating critical postmating responses. A recent study of female reproductive tract proteins in the cactophilic fruit fly Drosophila arizonae, identified pervasive, lineage-specific gene duplication amongst secreted proteases. Here, we compare the evolutionary dynamics, biochemical nature, and physiological significance of secreted female reproductive serine endoproteases between D. arizonae and its congener D. melanogaster. We show that D. arizonae lower female reproductive tract (LFRT) proteins are significantly enriched for recently duplicated secreted proteases, particularly serine endoproteases, relative to D. melanogaster. Isolated lumen from D. arizonae LFRTs, furthermore, exhibits significant trypsin-like and elastase-like serine endoprotease acitivity, whereas no such activity is seen in D. melanogaster. Finally, trypsin- and elastase-like activity in D. arizonae female reproductive tracts is negatively regulated by mating. We propose that the intense proteolytic environment of the D. arizonae female reproductive tract relates to the extraordinary reproductive physiology of this species and that ongoing gene duplication amongst these proteases is an evolutionary consequence of sexual conflict. PMID:19546158

  12. Recombination sequences in plant mitochondrial genomes: diversity and homologies to known mitochondrial genes.

    PubMed Central

    Stern, D B; Palmer, J D


    Several plant mitochondrial genomes contain repeated sequences that are postulated to be sites of homologous intragenomic recombination (1-3). In this report, we have used filter hybridizations to investigate sequence relationships between the cloned mitochondrial DNA (mtDNA) recombination repeats from turnip, spinach and maize and total mtDNA isolated from thirteen species of angiosperms. We find that strong sequence homologies exist between the spinach and turnip recombination repeats and essentially all other mitochondrial genomes tested, whereas a major maize recombination repeat does not hybridize to any other mtDNA. The sequences homologous to the turnip repeat do not appear to function in recombination in any other genome, whereas the spinach repeat hybridizes to reiterated sequences within the mitochondrial genomes of wheat and two species of pokeweed that do appear to be sites of recombination. Thus, although intragenomic recombination is a widespread phenomenon in plant mitochondria, it appears that different sequences either serve as substrates for this function in different species, or else surround a relatively short common recombination site which does not cross-hybridize under our experimental conditions. Identified gene sequences from maize mtDNA were used in heterologous hybridizations to show that the repeated sequences implicated in recombination in turnip and spinach/pokeweed/wheat mitochondria include, or are closely linked to genes for subunit II of cytochrome c oxidase and 26S rRNA, respectively. Together with previous studies indicating that the 18S rRNA gene in wheat mtDNA is contained within a recombination repeat (3), these results imply an unexpectedly frequent association between recombination repeats and plant mitochondrial genes. Images PMID:6473104

  13. Transcriptional activation of LON Gene by a new form of mitochondrial stress: A role for the nuclear respiratory factor 2 in StAR overload response (SOR).


    Bahat, Assaf; Perlberg, Shira; Melamed-Book, Naomi; Isaac, Sara; Eden, Amir; Lauria, Ines; Langer, Thomas; Orly, Joseph


    High output of steroid hormone synthesis in steroidogenic cells of the adrenal cortex and the gonads requires the expression of the steroidogenic acute regulatory protein (StAR) that facilitates cholesterol mobilization to the mitochondrial inner membrane where the CYP11A1/P450scc enzyme complex converts the sterol to the first steroid. Earlier studies have shown that StAR is active while pausing on the cytosolic face of the outer mitochondrial membrane while subsequent import of the protein into the matrix terminates the cholesterol mobilization activity. Consequently, during repeated activity cycles, high level of post-active StAR accumulates in the mitochondrial matrix. To prevent functional damage due to such protein overload effect, StAR is degraded by a sequence of three to four ATP-dependent proteases of the mitochondria protein quality control system, including LON and the m-AAA membranous proteases AFG3L2 and SPG7/paraplegin. Furthermore, StAR expression in both peri-ovulatory ovarian cells, or under ectopic expression in cell line models, results in up to 3-fold enrichment of the mitochondrial proteases and their transcripts. We named this novel form of mitochondrial stress as StAR overload response (SOR). To better understand the SOR mechanism at the transcriptional level we analyzed first the unexplored properties of the proximal promoter of the LON gene. Our findings suggest that the human nuclear respiratory factor 2 (NRF-2), also known as GA binding protein (GABP), is responsible for 88% of the proximal promoter activity, including the observed increase of transcription in the presence of StAR. Further studies are expected to reveal if common transcriptional determinants coordinate the SOR induced transcription of all the genes encoding the SOR proteases.

  14. The Agaricus bisporus cox1 Gene: The Longest Mitochondrial Gene and the Largest Reservoir of Mitochondrial Group I Introns

    PubMed Central

    Férandon, Cyril; Moukha, Serge; Callac, Philippe; Benedetto, Jean-Pierre; Castroviejo, Michel; Barroso, Gérard


    In eukaryotes, introns are located in nuclear and organelle genes from several kingdoms. Large introns (up to 5 kbp) are frequent in mitochondrial genomes of plant and fungi but scarce in Metazoa, even if these organisms are grouped with fungi among the Opisthokonts. Mitochondrial introns are classified in two groups (I and II) according to their RNA secondary structure involved in the intron self-splicing mechanism. Most of these mitochondrial group I introns carry a “Homing Endonuclease Gene” (heg) encoding a DNA endonuclease acting in transfer and site-specific integration (“homing”) and allowing intron spreading and gain after lateral transfer even between species from different kingdoms. Opposed to this gain mechanism, is another which implies that introns, which would have been abundant in the ancestral genes, would mainly evolve by loss. The importance of both mechanisms (loss and gain) is matter of debate. Here we report the sequence of the cox1 gene of the button mushroom Agaricus bisporus, the most widely cultivated mushroom in the world. This gene is both the longest mitochondrial gene (29,902 nt) and the largest group I intron reservoir reported to date with 18 group I and 1 group II. An exhaustive analysis of the group I introns available in cox1 genes shows that they are mobile genetic elements whose numerous events of loss and gain by lateral transfer combine to explain their wide and patchy distribution extending over several kingdoms. An overview of intron distribution, together with the high frequency of eroded heg, suggests that they are evolving towards loss. In this landscape of eroded and lost intron sequences, the A. bisporus cox1 gene exhibits a peculiar dynamics of intron keeping and catching, leading to the largest collection of mitochondrial group I introns reported to date in a Eukaryote. PMID:21124976

  15. Yeast extracellular proteases.


    Ogrydziak, D M


    Many species of yeast secrete significant amounts of protease(s). In this article, results of numerous surveys of yeast extracellular protease production have been compiled and inconsistencies in the data and limitations of the methodology have been examined. Regulation, purification, characterization, and processing of yeast extracellular proteases are reviewed. Results obtained from the sequences of cloned genes, especially the Saccharomyces cerevisiae Bar protease, the Candida albicans acid protease, and the Yarrowia lipolytica alkaline protease, have been emphasized. Biotechnological applications and the medical relevance of yeast extracellular proteases are covered. Yeast extracellular proteases have potential in beer and wine stabilization, and they probably contribute to pathogenicity of Candida spp. Yeast extracellular protease genes also provide secretion and processing signals for yeast expression systems designed for secretion of heterologous proteins. Coverage of the secretion of foreign proteases such as prochymosin, urokinase, and tissue plasminogen activator by yeast in included.

  16. Transcriptional activation by heat and cold of a thiol protease gene in tomato. [Lycopersicon esculentum

    SciTech Connect

    Schaffer, M.A.; Fischer, R.L. )


    We previously determined that low temperature induces the accumulation in tomato (Lycopersicon esculentum) fruit of a cloned mRNA, designated C14, encoding a polypeptide related to thiol proteases. We now demonstrate that C14 mRNA accumulation is a response common to both high (40{degree}C) and low (4{degree}C) temperature stresses. Exposure of tomato fruit to 40{degree}C results in the accumulation of C14 mRNA, by 8 hours. This response is more rapid than that to 4{degree}C, but slower than the induction of many heat shock messages by 40{degree}C, and therefore unique. We have also studied the mechanism by which heat and cold exposure activate C14 gene expression. Both high and low temperature regulate protease gene expression through transcriptional induction of a single C14 gene. A hypothesis for the function of C14 thiol protease gene expression in response to heat and cold is discussed.

  17. Gene Expression in a Drosophila Model of Mitochondrial Disease

    PubMed Central

    Fernández-Ayala, Daniel J. M.; Chen, Shanjun; Kemppainen, Esko; O'Dell, Kevin M. C.; Jacobs, Howard T.


    Background A point mutation in the Drosophila gene technical knockout (tko), encoding mitoribosomal protein S12, was previously shown to cause a phenotype of respiratory chain deficiency, developmental delay, and neurological abnormalities similar to those presented in many human mitochondrial disorders, as well as defective courtship behavior. Methodology/Principal Findings Here, we describe a transcriptome-wide analysis of gene expression in tko25t mutant flies that revealed systematic and compensatory changes in the expression of genes connected with metabolism, including up-regulation of lactate dehydrogenase and of many genes involved in the catabolism of fats and proteins, and various anaplerotic pathways. Gut-specific enzymes involved in the primary mobilization of dietary fats and proteins, as well as a number of transport functions, were also strongly up-regulated, consistent with the idea that oxidative phosphorylation OXPHOS dysfunction is perceived physiologically as a starvation for particular biomolecules. In addition, many stress-response genes were induced. Other changes may reflect a signature of developmental delay, notably a down-regulation of genes connected with reproduction, including gametogenesis, as well as courtship behavior in males; logically this represents a programmed response to a mitochondrially generated starvation signal. The underlying signalling pathway, if conserved, could influence many physiological processes in response to nutritional stress, although any such pathway involved remains unidentified. Conclusions/Significance These studies indicate that general and organ-specific metabolism is transformed in response to mitochondrial dysfunction, including digestive and absorptive functions, and give important clues as to how novel therapeutic strategies for mitochondrial disorders might be developed. PMID:20066047

  18. Upregulation of mitochondrial protease HtrA2/Omi contributes to manganese-induced neuronal apoptosis in rat brain striatum.


    Jiang, J K; Ma, X; Wu, Q Y; Qian, W B; Wang, N; Shi, S S; Han, J L; Zhao, J Y; Jiang, S Y; Wan, C H


    Manganese (Mn) is an essential trace element that is required for normal brain functioning. However, excessive intake of Mn has been known to lead to neuronal loss and clinical symptoms resembling idiopathic Parkinson's disease (IPD), whose precise molecular mechanism remains largely elusive. In the study, we established a Mn-exposed rat model and identified a mitochondrial protease, the mature form of high temperature requirement A2 (HtrA2/Omi), which was significantly upregulated in rat brain striatum after Mn exposure. Western blot and immunohistochemical analyses revealed that the expression of mature HtrA2 was remarkably increased following Mn exposure. In addition, immunofluorescence assay demonstrated that overexposure to Mn could lead to significant elevation in the number of HtrA2-positive neurons. Accordingly, the expression of X-linked inhibitor of apoptosis protein (XIAP), a well-characterized target of HtrA2-mediated proteolysis, was progressively decreased following Mn exposure, and was correlated with increased level of active caspase-3. Further, we showed that Mn exposure decreased the viability and induced apparent apoptosis of NFG-differentiated PC12 cells. Importantly, the expression of HtrA2 was progressively increased, whereas the level of cellular XIAP was reduced during Mn-induced apoptosis. In addition, blockage of HtrA2 activity with UCF-101 restored Mn-induced reduction in XIAP expression. Finally, we observed that UCF-101 treatment ameliorated Mn-induced apoptosis in PC12 cells. Collectively, these findings suggested that upregulated HtrA2 played a role in Mn-induced neuronal death in brain striatum.

  19. Two-locus mitochondrial and nuclear gene models for mitochondrial disorders.


    Bu, X; Yang, H Y; Shohat, M; Rotter, J I


    Stimulated by a large pedigree with a cochlear form of deafness, for which we considered a two-locus mitochondrial and nuclear gene model, we have extended the classic methods of segregation analysis to these classes of two-locus disorders. Based on the unique maternal transmission pattern of the mitochondria, we demonstrate that utilization of the maternal line pedigree allows us to simplify the various two-locus mitochondrial models to "one nuclear locus" models. Classifying the nuclear families into different independent groups by the mother's phenotypes allows us to estimate the nuclear gene frequency in one group and to use this estimate as the expected value to test the fitness of the model on the other group. In addition, if we restrict the analysis to specific subsets of the mating type(s), we can also test the model on specific groups of nuclear families without estimating the gene frequency. Goodness-of-fit tests can be performed on pooled sibship data as well as individual sibship data. These methods of analysis should assume increasing importance as more disorders with features of mitochondrial inheritance are identified.

  20. Evidence of a bigenomic regulation of mitochondrial gene expression by thyroid hormone during rat brain development

    SciTech Connect

    Sinha, Rohit Anthony; Pathak, Amrita; Mohan, Vishwa; Babu, Satish; Pal, Amit; Khare, Drirh; Godbole, Madan M.


    Hypothyroidism during early mammalian brain development is associated with decreased expression of various mitochondrial encoded genes along with evidence for mitochondrial dysfunction. However, in-spite of the similarities between neurological disorders caused by perinatal hypothyroidism and those caused by various genetic mitochondrial defects we still do not know as to how thyroid hormone (TH) regulates mitochondrial transcription during development and whether this regulation by TH is nuclear mediated or through mitochondrial TH receptors? We here in rat cerebellum show that hypothyroidism causes reduction in expression of nuclear encoded genes controlling mitochondrial biogenesis like PGC-1{alpha}, NRF-1{alpha} and Tfam. Also, we for the first time demonstrate a mitochondrial localization of thyroid hormone receptor (mTR) isoform in developing brain capable of binding a TH response element (DR2) present in D-loop region of mitochondrial DNA. These results thus indicate an integrated nuclear-mitochondrial cross talk in regulation of mitochondrial transcription by TH during brain development.

  1. Obtusilactone A and (-)-sesamin induce apoptosis in human lung cancer cells by inhibiting mitochondrial Lon protease and activating DNA damage checkpoints.


    Wang, Hui-Min; Cheng, Kuo-Chen; Lin, Cheng-Jung; Hsu, Shu-Wei; Fang, Wei-Cheng; Hsu, Tai-Feng; Chiu, Chien-Chih; Chang, Hsueh-Wei; Hsu, Chun-Hua; Lee, Alan Yueh-Luen


    Several compounds from Cinnamomum kotoense show anticancer activities. However, the detailed mechanisms of most compounds from C. kotoense remain unknown. In this study, we investigated the anticancer activity of obtusilactone A (OA) and (-)-sesamin in lung cancer. Our results show that human Lon is upregulated in non-small-cell lung cancer (NSCLC) cell lines, and downregulation of Lon triggers caspase-3 mediated apoptosis. Through enzyme-based screening, we identified two small-molecule compounds, obtusilactone A (OA) and (-)-sesamin from C. kotoense, as potent Lon protease inhibitors. Obtusilactone A and (-)-sesamin interact with Ser855 and Lys898 residues in the active site of the Lon protease according to molecular docking analysis. Thus, we suggest that cancer cytotoxicity of the compounds is partly due to the inhibitory effects on Lon protease. In addition, the compounds are able to cause DNA double-strand breaks and activate checkpoints. Treatment with OA and (-)-sesamin induced p53-independent DNA damage responses in NSCLC cells, including G(1) /S checkpoint activation and apoptosis, as evidenced by phosphorylation of checkpoint proteins (H2AX, Nbs1, and Chk2), caspase-3 cleavage, and sub-G(1) accumulation. In conclusion, OA and (-)-sesamin act as both inhibitors of human mitochondrial Lon protease and DNA damage agents to activate the DNA damage checkpoints as well induce apoptosis in NSCLC cells. These dual functions open a bright avenue to develop more selective chemotherapy agents to overcome chemoresistance and sensitize cancer cells to other chemotherapeutics.

  2. Human mast cell tryptase: Multiple cDNAs and genes reveal a multigene serine protease family

    SciTech Connect

    Vanderslice, P.; Ballinger, S.M., Tam, E.K.; Goldstein, S.M.; Craik, C.S.; Caughey, G.H. )


    Three different cDNAs and a gene encoding human skin mast cell tryptase have been cloned and sequenced in their entirety. The deduced amino acid sequences reveal a 30-amino acid prepropeptide followed by a 245-amino acid catalytic domain. The C-terminal undecapeptide of the human preprosequence is identical in dog tryptase and appears to be part of a prosequence unique among serine proteases. The differences among the three human tryptase catalytic domains include the loss of a consensus N-glycosylation site in one cDNA, which may explain some of the heterogeneity in size and susceptibility to deglycosylation seen in tryptase preparations. All three tryptase cDNAs are distinct from a recently reported cDNA obtained from a human lung mast cell library. A skin tryptase cDNA was used to isolate a human tryptase gene, the exons of which match one of the skin-derived cDNAs. The organization of the {approx}1.8-kilobase-pair tryptase gene is unique and is not closely related to that of any other mast cell or leukocyte serine protease. The 5{prime} regulatory regions of the gene share features with those of other serine proteases, including mast cell chymase, but are unusual in being separated from the protein-coding sequence by an intron. High-stringency hybridization of a human genomic DNA blot with a fragment of the tryptase gene confirms the presence of multiple tryptase genes. These findings provide genetic evidence that human mast cell tryptases are the products of a multigene family.

  3. Human mast cell tryptase: multiple cDNAs and genes reveal a multigene serine protease family.

    PubMed Central

    Vanderslice, P; Ballinger, S M; Tam, E K; Goldstein, S M; Craik, C S; Caughey, G H


    Three different cDNAs and a gene encoding human skin mast cell tryptase have been cloned and sequenced in their entirety. The deduced amino acid sequences reveal a 30-amino acid prepropeptide followed by a 245-amino acid catalytic domain. The C-terminal undecapeptide of the human preprosequence is identical in dog tryptase and appears to be part of a prosequence unique among serine proteases. The differences among the three human tryptase catalytic domains include the loss of a consensus N-glycosylation site in one cDNA, which may explain some of the heterogeneity in size and susceptibility to deglycosylation seen in tryptase preparations. All three tryptase cDNAs are distinct from a recently reported cDNA obtained from a human lung mast cell library. A skin tryptase cDNA was used to isolate a human tryptase gene, the exons of which match one of the skin-derived cDNAs. The organization of the approximately 1.8-kilobase-pair tryptase gene is unique and is not closely related to that of any other mast cell or leukocyte serine protease. The 5' regulatory regions of the gene share features with those of other serine proteases, including mast cell chymase, but are unusual in being separated from the protein-coding sequence by an intron. High-stringency hybridization of a human genomic DNA blot with a fragment of the tryptase gene confirms the presence of multiple tryptase genes. These findings provide genetic evidence that human mast cell tryptases are the products of a multigene family. Images PMID:2187193

  4. Ancient Out-of-Africa Mitochondrial DNA Variants Associate with Distinct Mitochondrial Gene Expression Patterns

    PubMed Central

    Mishmar, Dan


    Mitochondrial DNA (mtDNA) variants have been traditionally used as markers to trace ancient population migrations. Although experiments relying on model organisms and cytoplasmic hybrids, as well as disease association studies, have served to underline the functionality of certain mtDNA SNPs, only little is known of the regulatory impact of ancient mtDNA variants, especially in terms of gene expression. By analyzing RNA-seq data of 454 lymphoblast cell lines from the 1000 Genomes Project, we found that mtDNA variants defining the most common African genetic background, the L haplogroup, exhibit a distinct overall mtDNA gene expression pattern, which was independent of mtDNA copy numbers. Secondly, intra-population analysis revealed subtle, yet significant, expression differences in four tRNA genes. Strikingly, the more prominent African mtDNA gene expression pattern best correlated with the expression of nuclear DNA-encoded RNA-binding proteins, and with SNPs within the mitochondrial RNA-binding proteins PTCD1 and MRPS7. Our results thus support the concept of an ancient regulatory transition of mtDNA-encoded genes as humans left Africa to populate the rest of the world. PMID:27812116

  5. Genes and languages in Europe: an analysis of mitochondrial lineages.


    Sajantila, A; Lahermo, P; Anttinen, T; Lukka, M; Sistonen, P; Savontaus, M L; Aula, P; Beckman, L; Tranebjaerg, L; Gedde-Dahl, T; Issel-Tarver, L; DiRienzo, A; Pääbo, S


    When mitochondrial DNA sequence variation is analyzed from a sample of 637 individuals in 14 European populations, most populations show little differentiation with respect to each other. However, the Saami distinguish themselves by a comparatively large amount of sequence difference when compared with the other populations, by a different distribution of sequence diversity within the population, and by the occurrence of particular sequence motifs. Thus, the Saami seem to have a long history distinct from other European populations. Linguistic affiliations are not reflected in the patterns of relationships of mitochondrial lineages in European populations, whereas prior studies of nuclear gene frequencies have shown a correlation between genetic and linguistic evolution. It is argued that this apparent contradiction is attributable to the fact that genetic lineages and gene frequencies reflect different time perspectives on population history, the latter being more in concordance with linguistic evolution.

  6. Massive Mitochondrial Gene Transfer in a Parasitic Flowering Plant Clade

    PubMed Central

    Bradley, Robert K.; Sugumaran, M.; Marx, Christopher J.; Rest, Joshua S.; Davis, Charles C.


    Recent studies have suggested that plant genomes have undergone potentially rampant horizontal gene transfer (HGT), especially in the mitochondrial genome. Parasitic plants have provided the strongest evidence of HGT, which appears to be facilitated by the intimate physical association between the parasites and their hosts. A recent phylogenomic study demonstrated that in the holoparasite Rafflesia cantleyi (Rafflesiaceae), whose close relatives possess the world's largest flowers, about 2.1% of nuclear gene transcripts were likely acquired from its obligate host. Here, we used next-generation sequencing to obtain the 38 protein-coding and ribosomal RNA genes common to the mitochondrial genomes of angiosperms from R. cantleyi and five additional species, including two of its closest relatives and two host species. Strikingly, our phylogenetic analyses conservatively indicate that 24%–41% of these gene sequences show evidence of HGT in Rafflesiaceae, depending on the species. Most of these transgenic sequences possess intact reading frames and are actively transcribed, indicating that they are potentially functional. Additionally, some of these transgenes maintain synteny with their donor and recipient lineages, suggesting that native genes have likely been displaced via homologous recombination. Our study is the first to comprehensively assess the magnitude of HGT in plants involving a genome (i.e., mitochondria) and a species interaction (i.e., parasitism) where it has been hypothesized to be potentially rampant. Our results establish for the first time that, although the magnitude of HGT involving nuclear genes is appreciable in these parasitic plants, HGT involving mitochondrial genes is substantially higher. This may represent a more general pattern for other parasitic plant clades and perhaps more broadly for angiosperms. PMID:23459037

  7. Massive mitochondrial gene transfer in a parasitic flowering plant clade.


    Xi, Zhenxiang; Wang, Yuguo; Bradley, Robert K; Sugumaran, M; Marx, Christopher J; Rest, Joshua S; Davis, Charles C


    Recent studies have suggested that plant genomes have undergone potentially rampant horizontal gene transfer (HGT), especially in the mitochondrial genome. Parasitic plants have provided the strongest evidence of HGT, which appears to be facilitated by the intimate physical association between the parasites and their hosts. A recent phylogenomic study demonstrated that in the holoparasite Rafflesia cantleyi (Rafflesiaceae), whose close relatives possess the world's largest flowers, about 2.1% of nuclear gene transcripts were likely acquired from its obligate host. Here, we used next-generation sequencing to obtain the 38 protein-coding and ribosomal RNA genes common to the mitochondrial genomes of angiosperms from R. cantleyi and five additional species, including two of its closest relatives and two host species. Strikingly, our phylogenetic analyses conservatively indicate that 24%-41% of these gene sequences show evidence of HGT in Rafflesiaceae, depending on the species. Most of these transgenic sequences possess intact reading frames and are actively transcribed, indicating that they are potentially functional. Additionally, some of these transgenes maintain synteny with their donor and recipient lineages, suggesting that native genes have likely been displaced via homologous recombination. Our study is the first to comprehensively assess the magnitude of HGT in plants involving a genome (i.e., mitochondria) and a species interaction (i.e., parasitism) where it has been hypothesized to be potentially rampant. Our results establish for the first time that, although the magnitude of HGT involving nuclear genes is appreciable in these parasitic plants, HGT involving mitochondrial genes is substantially higher. This may represent a more general pattern for other parasitic plant clades and perhaps more broadly for angiosperms.

  8. Purification, characterization and gene cloning of Da-36, a novel serine protease from Deinagkistrodon acutus venom.


    Zheng, Ying; Ye, Feng-Ping; Wang, Jie; Liao, Guo-Yang; Zhang, Yun; Fan, Quan-Shui; Lee, Wen-Hui


    A serine protease termed Da-36 was isolated from crude venom of Deinagkistrodon acutus. The enzyme was a single chain protein with an apparent molecular weight of 36,000 on SDS-PAGE with an isoelectric point of 6.59. Da-36 could clot human plasma by cleaving the Aα, Bβ and γ chains of fibrinogen and also exhibited arginine esterase activity. The proteolytic activity of Da-36 toward TAME was strongly inhibited by PMSF and moderately affected by benzamidine and aprotinin, indicating that it was a serine protease. Meanwhile, Da-36 showed stability with wide temperature (20-50 °C) and pH value ranges (pH 6-10). Divalent metal ions of Ca(2+), Mg(2+), and Mn(2+) had no effects but Zn(2+) and Cu(2+) inhibited the arginine esterase activity of Da-36. Total DNA was extracted directly from the lyophilized crude venom and the gene (5.5 kbp) coding for Da-36 had been successfully cloned. Sequence analysis revealed that the Da-36 gene contained five exons and four introns. The mature Da-36 was encoded by four separate exons. The deduced mature amino acid sequence of Da-36 was in good agreement with the determined N-terminal sequence of the purified protein and shared high homology with other serine proteases isolated from different snake venoms. Blast search using amino acid sequence of Da-36 against public database revealed that Da-36 showed a maximal identity of 90% with both Dav-X (Swiss-Prot: Q9I8W9.1) and thrombin-like protein 1 (GenBank: AAW56608.1) from the same snake species, indicating that Da-36 is a novel serine protease.

  9. Molecular mechanisms of extensive mitochondrial gene rearrangementin plethodontid salamanders

    SciTech Connect

    Mueller, Rachel Lockridge; Boore, Jeffrey L.


    Extensive gene rearrangement is reported in the mitochondrial genomes of lungless salamanders (Plethodontidae). In each genome with a novel gene order, there is evidence that the rearrangement was mediated by duplication of part of the mitochondrial genome, including the presence of both pseudogenes and additional, presumably functional, copies of duplicated genes. All rearrangement-mediating duplications include either the origin of light strand replication and the nearby tRNA genes or the regions flanking the origin of heavy strand replication. The latter regions comprise nad6, trnE, cob, trnT, an intergenic spacer between trnT and trnP and, in some genomes, trnP, the control region, trnF, rrnS, trnV, rrnL, trnL1, and nad1. In some cases, two copies of duplicated genes, presumptive regulatory regions, and/or sequences with no assignable function have been retained in the genome following the initial duplication; in other genomes, only one of the duplicated copies has been retained. Both tandem and non-tandem duplications are present in these genomes, suggesting different duplication mechanisms. In some of these mtDNAs, up to 25 percent of the total length is composed of tandem duplications of non-coding sequence that includes putative regulatory regions and/or pseudogenes of tRNAs and protein-coding genes along with otherwise unassignable sequences. These data indicate that imprecise initiation and termination of replication, slipped-strand mispairing, and intra-molecular recombination may all have played a role in generating repeats during the evolutionary history of plethodontid mitochondrial genomes.

  10. Characterization of a Clp Protease Gene Regulator and the Reaeration Response in Mycobacterium tuberculosis

    PubMed Central

    Sherrid, Ashley M.; Rustad, Tige R.; Cangelosi, Gerard A.; Sherman, David R.


    Mycobacterium tuberculosis (MTB) enters a non-replicating state when exposed to low oxygen tension, a condition the bacillus encounters in granulomas during infection. Determining how mycobacteria enter and maintain this state is a major focus of research. However, from a public health standpoint the importance of latent TB is its ability to reactivate. The mechanism by which mycobacteria return to a replicating state upon re-exposure to favorable conditions is not understood. In this study, we utilized reaeration from a defined hypoxia model to characterize the adaptive response of MTB following a return to favorable growth conditions. Global transcriptional analysis identified the ∼100 gene Reaeration Response, induced relative to both log-phase and hypoxic MTB. This response includes chaperones and proteases, as well as the transcription factor Rv2745c, which we characterize as a Clp protease gene regulator (ClgR) orthologue. During reaeration, genes repressed during hypoxia are also upregulated in a wave of transcription that includes genes crucial to transcription, translation and oxidative phosphorylation and culminates in bacterial replication. In sum, this study defines a new transcriptional response of MTB with potential relevance to disease, and implicates ClgR as a regulator involved in resumption of replication following hypoxia. PMID:20661284

  11. Decrypting the Mitochondrial Gene Pool of Modern Panamanians

    PubMed Central

    Angerhofer, Norman; Ekins, Jayne E.; Olivieri, Anna; Woodward, Scott R.; Pascale, Juan Miguel; Cooke, Richard; Motta, Jorge; Achilli, Alessandro


    The Isthmus of Panama–the narrow neck of land connecting the northern and southern American landmasses–was an obligatory corridor for the Paleo-Indians as they moved into South America. Archaeological evidence suggests an unbroken link between modern natives and their Paleo-Indian ancestors in some areas of Panama, even if the surviving indigenous groups account for only 12.3% of the total population. To evaluate if modern Panamanians have retained a larger fraction of the native pre-Columbian gene pool in their maternally-inherited mitochondrial genome, DNA samples and historical records were collected from more than 1500 volunteer participants living in the nine provinces and four indigenous territories of the Republic. Due to recent gene-flow, we detected ∼14% African mitochondrial lineages, confirming the demographic impact of the Atlantic slave trade and subsequent African immigration into Panama from Caribbean islands, and a small European (∼2%) component, indicating only a minor influence of colonialism on the maternal side. The majority (∼83%) of Panamanian mtDNAs clustered into native pan-American lineages, mostly represented by haplogroup A2 (51%). These findings reveal an overwhelming native maternal legacy in today's Panama, which is in contrast with the overall concept of personal identity shared by many Panamanians. Moreover, the A2 sub-clades A2ad and A2af (with the previously named 6 bp Huetar deletion), when analyzed at the maximum level of resolution (26 entire mitochondrial genomes), confirm the major role of the Pacific coastal path in the peopling of North, Central and South America, and testify to the antiquity of native mitochondrial genomes in Panama. PMID:22675545

  12. Decrypting the mitochondrial gene pool of modern Panamanians.


    Perego, Ugo A; Lancioni, Hovirag; Tribaldos, Maribel; Angerhofer, Norman; Ekins, Jayne E; Olivieri, Anna; Woodward, Scott R; Pascale, Juan Miguel; Cooke, Richard; Motta, Jorge; Achilli, Alessandro


    The Isthmus of Panama--the narrow neck of land connecting the northern and southern American landmasses--was an obligatory corridor for the Paleo-Indians as they moved into South America. Archaeological evidence suggests an unbroken link between modern natives and their Paleo-Indian ancestors in some areas of Panama, even if the surviving indigenous groups account for only 12.3% of the total population. To evaluate if modern Panamanians have retained a larger fraction of the native pre-Columbian gene pool in their maternally-inherited mitochondrial genome, DNA samples and historical records were collected from more than 1500 volunteer participants living in the nine provinces and four indigenous territories of the Republic. Due to recent gene-flow, we detected ~14% African mitochondrial lineages, confirming the demographic impact of the Atlantic slave trade and subsequent African immigration into Panama from Caribbean islands, and a small European (~2%) component, indicating only a minor influence of colonialism on the maternal side. The majority (~83%) of Panamanian mtDNAs clustered into native pan-American lineages, mostly represented by haplogroup A2 (51%). These findings reveal an overwhelming native maternal legacy in today's Panama, which is in contrast with the overall concept of personal identity shared by many Panamanians. Moreover, the A2 sub-clades A2ad and A2af (with the previously named 6 bp Huetar deletion), when analyzed at the maximum level of resolution (26 entire mitochondrial genomes), confirm the major role of the Pacific coastal path in the peopling of North, Central and South America, and testify to the antiquity of native mitochondrial genomes in Panama.

  13. Characterization of a novel serine protease inhibitor gene from a marine metagenome.


    Jiang, Cheng-Jian; Hao, Zhen-Yu; Zeng, Rong; Shen, Pei-Hong; Li, Jun-Fang; Wu, Bo


    A novel serine protease inhibitor (serpin) gene designated as Spi1C was cloned via the sequenced-based screening of a metagenomic library from uncultured marine microorganisms. The gene had an open reading frame of 642 base pairs, and encoded a 214-amino acid polypeptide with a predicted molecular mass of about 28.7 kDa. The deduced amino acid sequence comparison and phylogenetic analysis indicated that Spi1C and some partial proteinase inhibitor I4 serpins were closely related. Functional characterization demonstrated that the recombinant Spi1C protein could inhibit a series of serine proteases. The Spi1C protein exhibited inhibitory activity against α-chymotrypsin and trypsin with K(i) values of around 1.79 × 10(-8) and 1.52 × 10(-8) M, respectively. No inhibition activity was exhibited against elastase. Using H-d-Phe-Pip-Arg-pNA as the chromogenic substrate, the optimum pH and temperature of the inhibition activity against trypsin were 7.0-8.0 and 25 °C, respectively. The identification of a novel serpin gene underscores the potential of marine metagenome screening for novel biomolecules.

  14. The Drosophila Stubble-stubbloid gene encodes an apparent transmembrane serine protease required for epithelial morphogenesis.

    PubMed Central

    Appel, L F; Prout, M; Abu-Shumays, R; Hammonds, A; Garbe, J C; Fristrom, D; Fristrom, J


    The Stubble-stubbloid (Sb-sbd) gene is required for hormone-dependent epithelial morphogenesis of imaginal discs of Drosophila, including the formation of bristles, legs, and wings. The gene has been cloned by using Sb-sbd-associated DNA lesions in a 20-kilobase (kb) region of a 263-kb genomic walk. The region specifies an approximately 3.8-kb transcript that is induced by the steroid hormone 20-hydroxyecdysone in imaginal discs cultured in vitro. The conceptually translated protein is an apparent 786-residue type II transmembrane protein (N terminus in, C terminus out), including an intracellular N-terminal domain of at least 35 residues and an extracellular C-terminal trypsin-like serine protease domain of 244 residues. Sequence analyses indicate that the Sb-sbd-encoded protease could activate itself by proteolytic cleavage. Consistent with the cell-autonomous nature of the Sb-sbd bristle phenotype, a disulfide bond between cysteine residues in the noncatalytic N-terminal fragment and the C-terminal catalytic fragment could tether the protease to the membrane after activation. Both dominant Sb and recessive sbd mutations affect the organization of microfilament bundles during bristle morphogenesis. We propose that the Sb-sbd product has a dual function. (i) It acts through its proteolytic extracellular domain to detach imaginal disc cells from extracellular matrices, and (ii) it transmits an outside-to-inside signal to its intracellular domain to modify the cytoskeleton and facilitate cell shape changes underlying morphogenesis. Images Fig. 2 Fig. 3 Fig. 4 Fig. 5 PMID:7685111

  15. Evolutionary transfers of mitochondrial genes to the nucleus in the Populus lineage and coexpression of nuclear and mitochondrial Sdh4 genes.


    Choi, Catherine; Liu, Zhenlan; Adams, Keith L


    The transfer of mitochondrial genes to the nucleus is an ongoing evolutionary process in flowering plants. Evolutionarily recent gene transfers provide insights into the evolutionary dynamics of the process and the way in which transferred genes become functional in the nucleus. Genes that are present in the mitochondrion of some angiosperms but have been transferred to the nucleus in the Populus lineage were identified by searches of Populus sequence databases. Sequence analyses and expression experiments were used to characterize the transferred genes. Two succinate dehydrogenase genes and six mitochondrial ribosomal protein genes have been transferred to the nucleus in the Populus lineage and have become expressed. Three transferred genes have gained an N-terminal mitochondrial targeting presequence from other pre-existing genes and two of the transferred genes do not contain an N-terminal targeting presequence. Intact copies of the succinate dehydrogenase gene Sdh4 are present in both the mitochondrion and the nucleus. Both copies of Sdh4 are expressed in multiple organs of two Populus species and RNA editing occurs in the mitochondrial copy. These results provide a genome-wide perspective on mitochondrial genes that were transferred to the nucleus and became expressed, functional genes during the evolutionary history of Populus.

  16. Purification, characterization, and gene cloning of thermopsin, a thermostable acid protease from Sulfolobus acidocaldarius.


    Lin, X; Tang, J


    A thermostable, acid proteolytic activity has been found to be associated with the cells and in the culture medium of Sulfolobus acidocaldarius, an archaebacterium. This acid protease, which has been named thermopsin, was purified to homogeneity from the culture medium by a five-step procedure including column chromatographies on DEAE-Sepharose CL-6B, phenyl-Sepharose CL-4B, Sephadex G-100, monoQ (fast protein liquid chromatography), and gel filtration (high pressure liquid chromatography). The purified thermopsin produced a single band on sodium dodecyl sulfate-polyacrylamide gel electrophoresis and the proteolytic activity was associated with the band. Thermopsin is a single-chain protein as indicated by gel electrophoresis and by a single NH2-terminal sequence. It has maximal proteolytic activity at pH 2 and 90 degrees C. A genomic library of S. acidocaldarius was prepared and screened by an oligonucleotide probe designed from the NH2-terminal sequence of thermopsin. Five positive clones were isolated. From these clones the thermopsin gene was mapped and sequenced. The nucleotide sequence showed that the thermopsin structure is encoded in 1020 bases. In the deduced protein sequence, there are 41 amino acid residues (including the initiation Met) preceding the NH2-terminal position of thermopsin. Most of these residues appear to be characteristic of a leader sequence. However, the presence in this region of a short pro sequence cannot be ruled out. Thermopsin contains a single cysteine at residue 237 that is not essential for activity (Fusek, M., Lin, X.-L., Tang, J. (1990) J. Biol. Chem. 265, 1496-1501. Thermopsin has no apparent sequence similarity to aspartic proteases of the pepsin family nor to pepstatin-insensitive acid protease (Maita, T., Nagata, S., Matsuda, G., Murata, S., Oda, K., Murao, S., and Tsura, D. (1984) J. Biochem. 95, 465-475) and thus may represent a new class of acid proteases. Also absent is the characteristic active site aspartyl sequence

  17. Mitochondrial gene expression, antioxidant responses, and histopathology after cadmium exposure.


    Al Kaddissi, Simone; Legeay, Alexia; Elia, Antonia Concetta; Gonzalez, Patrice; Floriani, Magali; Cavalie, Isabelle; Massabuau, Jean-Charles; Gilbin, Rodolphe; Simon, Olivier


    The present study investigates cadmium effects on the transcription of mitochondrial genes of Procambarus clarkii after acute (0.05, 0.5, and 5 mg Cd/L; 4-10 days) and chronic exposures (10 μg Cd/L; 30-60 days). Transcriptional responses of cox1, atp6, and 12S using quantitative real-time RT-PCR were assessed in gills and hepatopancreas. Additionally, the expression levels of genes involved in detoxification and/or oxidative stress responses [mt, sod(Mn)] and enzymatic activities of antioxidants (SOD, CAT, GPX, and GST) were analyzed. The histopathological effects in hepatopancreas of crayfish were evaluated by light microscopy. Relationships between endpoints at different levels of biological organization and Cd bioaccumulation were also examined. Cd induced high levels of bioaccumulation, which was followed by mitochondrial dysfunction and histological alterations in both experiments. Moreover, perturbations in the defence mechanisms against oxidative stress tended to increase with time. Results also showed that molecular responses can vary depending on the intensity and duration of the chemical stress applied to the organisms and that the study of mt gene expression levels seemed to be the best tool to assess Cd intoxication.

  18. Syllidae mitochondrial gene order is unusually variable for Annelida.


    Aguado, M Teresa; Richter, Sandy; Sontowski, Rebekka; Golombek, Anja; Struck, Torsten H; Bleidorn, Christoph


    Complete mitochondrial genomes of five syllids (Streptosyllis sp., Eusyllis blomstrandi, Myrianida brachycephala, Typosyllis antoni and Typosyllis sp.) have been obtained using Illumina sequencing. Together with two previous studied taxa (Ramisyllis multicaudata and Trypanobia cryptica), the analysed sequences represent most of the main lineages within the family Syllidae (Anoplosyllinae, Eusyllinae, Autolytinae and Syllinae). The genomic features, gene order and phylogenetic relationships are examined. Unusual for annelids, syllid mitochondrial genomes are highly variable in their gene order. Considering genomic features, such as length, skewness, gene content, and codon bias, most similar to the rest of annelids are the genomes of E. blomstrandi and M. brachycephala, while Streptosyllis sp. and the analysed sylline taxa (R. multicaudata, T. cryptica, T. antoni and Typosyllis sp.) are the most dissimilar. Two methionine tRNA's (trnM) have been found in T. antoni and Typosyllis sp. The mt genomes of these latter taxa are the longest with numerous non-coding regions. The 13 protein coding genes, as well as the rRNA's are used to perform phylogenetic analyses that recovered the relationships within the family explored before by previous authors. The gene order in Syllidae shows very different patterns. E. blomstrandi and M. prolifera show a similar pattern to the one found in Pleistoannelida; however this might have changed at least twice within Syllidae: in Streptosyllis sp. and within Syllinae. All analysed Syllinae show different gene orders, thereby illustrating more variability as all other pleistoannelids analysed so far. The information provided herein allows a more accurate reconstruction of the possible evolutionary scenarios in Syllidae.

  19. Identification of two new keratinolytic proteases from a Bacillus pumilus strain using protein analysis and gene sequencing.


    Fellahi, Soltana; Chibani, Abdelwaheb; Feuk-Lagerstedt, Elisabeth; Taherzadeh, Mohammad J


    The Bacillus strain (CCUG 66887) has a high capacity to excrete keratinase with the ability to degrade both alpha- and beta keratin. In this study we aimed to show the characteristics of the keratinolytic protease and to identify its gene by using liquid chromatography-electrospray ionization tandem mass spectrometry methods (nanoHPLC-ESI-MS/MS) followed by Mascot data base search. The results showed that the enzyme in fact consists of two different keratinases, both with a molecular mass of 38 kDa. Further, DNA sequencing generated the open reading frame (ORF) of one of the genes (Ker1), and de novo genome sequencing identified the ORF of the second gene (Ker2). The two keratinase genes contain 1153 base pairs each and have a gene similarity of 67 %. In addition, the Bacillus strain was classified as Bacillus pumilus and its genes were annotated in the GeneBank at NCBI (accession: CP011109.1). Amino acid sequences alignment with known B. pumilus proteases indicated that the two keratinases of B. pumilus strain C4 are subtilisin-like serine proteases belonging to the Protease S8 family. Taken together, these result suggest the two keratinases as promising candidates for enzymatic processing of keratinous wastes in waste refinery.

  20. Critical COPD respiratory illness is linked to increased transcriptomic activity of neutrophil proteases genes

    PubMed Central


    essential role of neutrophil proteases in COPD patients with critical respiratory illness. Measurement and modulation of the expression of these genes could present an option for clinical monitoring and treatment of severe COPD exacerbations. PMID:22852767

  1. NGF induction of the gene encoding the protease transin accompanies neuronal differentiation in PC12 cells.


    Machida, C M; Rodland, K D; Matrisian, L; Magun, B E; Ciment, G


    Various proteases have been found to be released by the growth cones of developing neurons in culture and have been hypothesized to play a role in the process of axon elongation. We report here that nerve growth factor (NGF) induced the gene encoding the metalloprotease transin in PC12 cells with a time course coincident with the initial appearance of neurites by these cells. Acidic and basic fibroblast growth factors also stimulated transin mRNA expression and neurite outgrowth, whereas various other agents had no effects on either of these phenomena. In contrast, dexamethasone was found to inhibit the induction of transin mRNA when added with, or following, NGF treatment. Finally, we show that sequences contained within 750 bp of the 5' untranscribed region of the transin gene confer responsiveness to NGF and dexamethasone.

  2. Upregulation of the mitochondrial Lon Protease allows adaptation to acute oxidative stress but dysregulation is associated with chronic stress, disease, and aging.


    Ngo, Jenny K; Pomatto, Laura C D; Davies, Kelvin J A


    The elimination of oxidatively modified proteins is a crucial process in maintaining cellular homeostasis, especially during stress. Mitochondria are protein-dense, high traffic compartments, whose polypeptides are constantly exposed to superoxide, hydrogen peroxide, and other reactive species, generated by 'electron leakage' from the respiratory chain. The level of oxidative stress to mitochondrial proteins is not constant, but instead varies greatly with numerous metabolic and environmental factors. Oxidized mitochondrial proteins must be removed rapidly (by proteolytic degradation) or they will aggregate, cross-link, and cause toxicity. The Lon Protease is a key enzyme in the degradation of oxidized proteins within the mitochondrial matrix. Under conditions of acute stress Lon is highly inducible, possibly with the oxidant acting as the signal inducer, thereby providing increased protection. It seems that under chronic stress conditions, however, Lon levels actually decline. Lon levels also decline with age and with senescence, and senescent cells even lose the ability to induce Lon during acute stress. We propose that the regulation of Lon is biphasic, in that it is up-regulated during transient stress and down-regulated during chronic stress and aging, and we suggest that the loss of Lon responsiveness may be a significant factor in aging, and in age-related diseases.

  3. Local similarity search to find gene indicators in mitochondrial genomes.


    Moritz, Ruby L V; Bernt, Matthias; Middendorf, Martin


    Given a set of nucleotide sequences we consider the problem of identifying conserved substrings occurring in homologous genes in a large number of sequences. The problem is solved by identifying certain nodes in a suffix tree containing all substrings occurring in the given nucleotide sequences. Due to the large size of the targeted data set, our approach employs a truncated version of suffix trees. Two methods for this task are introduced: (1) The annotation guided marker detection method uses gene annotations which might contain a moderate number of errors; (2) The probability based marker detection method determines sequences that appear significantly more often than expected. The approach is successfully applied to the mitochondrial nucleotide sequences, and the corresponding annotations that are available in RefSeq for 2989 metazoan species. We demonstrate that the approach finds appropriate substrings.

  4. Using in silico techniques: Isolation and characterization of an insect cuticle-degrading-protease gene from Beauveria bassiana.


    Khan, Sehroon; Nadir, Sadia; Wang, Xuewen; Khan, Afsar; Xu, Jianchu; Li, Meng; Tao, Lihong; Khan, Siraj; Karunarathna, Samantha C


    Cuticle-degrading-proteases (CDPs) secreted by Beauveria spp. are pivotal biocontrol substances, possessing commercial potential for developing bio-pesticides. Therefore, a thoughtful and contemplative understanding and assessment of the structural and functional features of these proteases would markedly assist the development of biogenic pesticides. Computational molecular biology is a new facile alternative approach to the tedious experimental molecular biology; therefore, by using bioinformatics tools, we isolated and characterized an insect CDP gene from Beauveria bassiana 70 s.l. genomic DNA. The CDP gene (1240 bp with GeneBank accession no. KT804651.1) consisted of three introns and four CDS exons, and shared 74-100% sequence identity to the reference CDP genes. Its phylogenetic tree results showed a unique evolution pattern, and the predicted amino acid peptide (PAAP) consisted of 344 amino acid residues with pI, molecular weight, instability index, grand average hydropathicity value and aliphatic index of 7.2, 35.4 kDa, 24.45, -0.149, and 76.63, respectively. The gene possessed 74-89% amino acid sequence similarity to the 12 reference strains. Three motifs (Peptidase_S8 subtilase family) were detected in the PAAP, and the computed 3D structure possessed 79.09% structural identity to alkaline serine proteases. The PAAP had four (three serine proteases and one Pyridoxal-dependent decarboxylase) conserved domains, a disulfide bridge, two calcium binding sites, MY domain, and three predicted active sites in the serine family domains. These results will set the groundwork for further exploitation of proteases and understanding the mechanism of disease caused by cuticle-degrading-serine-proteases from entomopathogenic fungi.

  5. Cloning, characterization, expression analysis and inhibition studies of a novel gene encoding Bowman-Birk type protease inhibitor from rice bean

    Technology Transfer Automated Retrieval System (TEKTRAN)

    This paper presents the first study describing the isolation, cloning and characterization of a full length gene encoding Bowman-Birk protease inhibitor (RbTI) from rice bean (Vigna umbellata). A full-length protease inhibitor gene with complete open reading frame of 327bp encoding 109 amino acids w...

  6. The circadian Clock gene regulates acrosin activity of sperm through serine protease inhibitor A3K

    PubMed Central

    Cheng, Shuting; Liang, Xin; Wang, Yuhui; Jiang, Zhou; Liu, Yanyou; Hou, Wang; Li, Shiping; Zhang, Jing


    Our previous study found that CLOCK knockdown in the testes of male mice led to a reduced fertility, which might be associated with the lower acrosin activity. In this present study, we examined the differential expression in proteins of CLOCK knockdown sperm. Clock gene expression was knocked down in cells to confirm those differentially expressions and serine protease inhibitor SERPINA3K was identified as a potential target. The up-regulated SERPINA3K revealed an inverse relationship with Clock knockdown. Direct treatment of normal sperm with recombinant SERPINA3K protein inhibited the acrosin activity and reduced in vitro fertilization rate. The luciferase reporter gene assay showed that the down-regulated of Clock gene could activate the Serpina3k promoter, but this activation was not affected by the mutation of E-box core sequence. Co-IP demonstrated a natural interaction between SERPIAN3K and RORs (α and β). Taken together, these results demonstrated that SERPINA3K is involved in the Clock gene-mediated male fertility by regulating acrosin activity and provide the first evidence that SERPINA3K could be regulated by Clock gene via retinoic acid-related orphan receptor response elements. PMID:26264441

  7. Mutant alcohol dehydrogenase (ADH III) presequences that affect both in vitro mitochondrial import and in vitro processing by the matrix protease.

    PubMed Central

    Mooney, D T; Pilgrim, D B; Young, E T


    Point mutations in the presequence of the mitochondrial alcohol dehydrogerase isoenzyme (ADH III) have been shown to affect either the import of the precursor protein into yeast mitochondria in vivo or its processing within the organelle. In the present work, the behavior of these mutants during in vitro import into isolated mitochondria was investigated. All point mutants tested were imported with a slower initial rate than that of the wild-type precursor. This defect was corrected when the precursors were treated with urea prior to import. Once imported, the extent of processing to the mature form of mutant precursors varied greatly and correlated well with the defects observed in vivo. This result was not affected by prior urea treatment. When matrix extracts enriched for the processing protease were used, this defect was shown to be due to failure of the protease to efficiently recognize or cleave the presequence, rather than to a lack of access to the precursor. The rate of import of two ADH III precursors bearing internal deletions in the leader sequence was similar to those of the point mutants, whereas a deletion leading to the removal of the 15 amino-terminal amino acids was poorly imported. The mature amino terminus of wild-type ADH III was determined to be Gln-25. Mutant m01 (Ser-26 to Phe), which reduced the efficiency of cleavage in vitro by 80%, was cleaved at the correct site. Images PMID:2188098

  8. The N-terminal domain plays a crucial role in the structure of a full-length human mitochondrial Lon protease

    PubMed Central

    Kereïche, Sami; Kováčik, Lubomír; Bednár, Jan; Pevala, Vladimír; Kunová, Nina; Ondrovičová, Gabriela; Bauer, Jacob; Ambro, Ľuboš; Bellová, Jana; Kutejová, Eva; Raška, Ivan


    Lon is an essential, multitasking AAA+ protease regulating many cellular processes in species across all kingdoms of life. Altered expression levels of the human mitochondrial Lon protease (hLon) are linked to serious diseases including myopathies, paraplegia, and cancer. Here, we present the first 3D structure of full-length hLon using cryo-electron microscopy. hLon has a unique three-dimensional structure, in which the proteolytic and ATP-binding domains (AP-domain) form a hexameric chamber, while the N-terminal domain is arranged as a trimer of dimers. These two domains are linked by a narrow trimeric channel composed likely of coiled-coil helices. In the presence of AMP-PNP, the AP-domain has a closed-ring conformation and its N-terminal entry gate appears closed, but in ADP binding, it switches to a lock-washer conformation and its N-terminal gate opens, which is accompanied by a rearrangement of the N-terminal domain. We have also found that both the enzymatic activities and the 3D structure of a hLon mutant lacking the first 156 amino acids are severely disturbed, showing that hLon’s N-terminal domains are crucial for the overall structure of the hLon, maintaining a conformation allowing its proper functioning. PMID:27632940

  9. Transcriptional activation of the human cytotoxic serine protease gene CSP-B in T lymphocytes.

    PubMed Central

    Hanson, R D; Ley, T J


    The cytotoxic serine protease B (CSP-B) gene is activated during cytotoxic T-lymphocyte maturation. In this report, we demonstrate that the PEER T-cell line (bearing gamma/delta T-cell receptors) accumulates CSP-B mRNA following exposure to 12-O-tetradecanoylphorbol-13-acetate (TPA) and N6-2'-O-dibutyryladenosine 3',5'-cyclic monophosphate (bt2cAMP) because of transcriptional activation of the CSP-B gene. TPA and bt2cAMP act synergistically to induce CSP-B expression, since neither agent alone causes activation of CSP-B transcription or mRNA accumulation. Chromatin upstream from the CSP-B gene is resistant to DNase I digestion in untreated PEER cells, but becomes sensitive following TPA-bt2cAMP treatment. Upon activation of PEER cells, a DNase I-hypersensitive site forms upstream from the CSP-B gene within a region that is highly conserved in the mouse. Transient transfection of CSP-B promoter constructs identified two regulatory regions in the CSP-B 5'-flanking sequence, located at positions -609 to -202 and positions -202 to -80. The region from -615 to -63 is sufficient to activate a heterologous promoter in activated PEER cells, but activation is orientation specific, suggesting that this region behaves as an upstream promoter element rather than a classical enhancer. Consensus AP-1, AP-2, and cAMP response elements are found upstream from the CSP-B gene (as are several T-cell-specific consensus elements), but the roles of these elements in CSP-B gene activation have yet to be determined. Images PMID:2233710

  10. Gene trees reveal repeated instances of mitochondrial DNA introgression in orangethroat darters (percidae: etheostoma).


    Bossu, Christen M; Near, Thomas J


    Phylogenies of closely related animal species are often inferred using mitochondrial DNA (mtDNA) gene sequences. The accuracy of mtDNA gene trees is compromised through hybridization that leads to introgression of mitochondrial genomes. Using DNA sequences from 6 single-copy nuclear genes and 2 regions of the mitochondrial genome, we investigated the temporal and geographic signature of mitochondrial and nuclear introgression in the Etheostoma spectabile darter clade. Phylogenetic analyses of the nuclear genes result in the monophyly of the E. spectabile clade; however, with respect to sampled specimens of 5 species (Etheostoma fragi, Etheostoma uniporum, Etheostoma pulchellum, Etheostoma burri, and E. spectabile), the mitochondrial phylogeny is inconsistent with E. spectabile clade monophyly. Etheostoma uniporum and E. fragi are both fixed for heterospecific mitochondrial genomes. Limited nuclear introgression is restricted to E. uniporum. Our analyses show that the pattern of introgression is consistently asymmetric, with movement of heterospecific mitochondrial haplotypes and nuclear alleles into E. spectabile clade species; introgressive hybridization spans broad temporal scales; and introgression is restricted to species and populations in the Ozarks. The introgressed mitochondrial genome observed in E. fragi has an obscure phylogenetic placement among darters, an ancient age, and is possibly a mitochondrial fossil from an Etheostoma species that has subsequently gone extinct. These results indicate that introgression, both ancient and more contemporaneous, characterizes the history of diversification in the E. spectabile species clade and may be relatively common among clades comprising the species-rich North American freshwater fauna.

  11. Genes of the Mitochondrial Apoptotic Pathway in Mytilus galloprovincialis

    PubMed Central

    Figueras, Antonio; Novoa, Beatriz


    Bivalves play vital roles in marine, brackish, freshwater and terrestrial habitats. In recent years, these ecosystems have become affected through anthropogenic activities. The ecological success of marine bivalves is based on the ability to modify their physiological functions in response to environmental changes. One of the most important mechanisms involved in adaptive responses to environmental and biological stresses is apoptosis, which has been scarcely studied in mollusks, although the final consequence of this process, DNA fragmentation, has been frequently used for pollution monitoring. Environmental stressors induce apoptosis in molluscan cells via an intrinsic pathway. Many of the proteins involved in vertebrate apoptosis have been recognized in model invertebrates; however, this process might not be universally conserved. Mytilus galloprovincialis is presented here as a new model to study the linkage between molecular mechanisms that mediate apoptosis and marine bivalve ecological adaptations. Therefore, it is strictly necessary to identify the key elements involved in bivalve apoptosis. In the present study, six mitochondrial apoptotic-related genes were characterized, and their gene expression profiles following UV irradiation were evaluated. This is the first step for the development of potential biomarkers to assess the biological responses of marine organisms to stress. The results confirmed that apoptosis and, more specifically, the expression of the genes involved in this process can be used to assess the biological responses of marine organisms to stress. PMID:23626691

  12. Disruption of genes involved in CORVET complex leads to enhanced secretion of heterologous carboxylesterase only in protease deficient Pichia pastoris.


    Marsalek, Lukas; Gruber, Clemens; Altmann, Friedrich; Aleschko, Markus; Mattanovich, Diethard; Gasser, Brigitte; Puxbaum, Verena


    The methylotrophic yeast Pichia pastoris (Komagataella spp.) is a popular microbial host for the production of recombinant proteins. Previous studies have shown that mis-sorting to the vacuole can be a bottleneck during production of recombinant secretory proteins in yeast, however, no information was available for P. pastoris. In this work the authors have therefore generated vps (vacuolar protein sorting) mutant strains disrupted in genes involved in the CORVET (class C core vacuole/endosome tethering) complex at the early stages of endosomal sorting. Both Δvps8 and Δvps21 strains contained lower extracellular amounts of heterologous carboxylesterase (CES) compared to the control strain, which could be attributed to a high proteolytic activity present in the supernatants of CORVET engineered strains due to rerouting of vacuolar proteases. Serine proteases were identified to be responsible for this proteolytic degradation by liquid chromatography-mass spectrometry and protease inhibitor assays. Deletion of the major cellular serine protease Prb1 in Δvps8 and Δvps21 strains did not only rescue the extracellular CES levels, but even outperformed the parental CES strain (56 and 80% higher yields, respectively). Further deletion of Ybr139W, another serine protease, did not show a further increase in secretion levels. Higher extracellular CES activity and low proteolytic activity were detected also in fed batch cultivation of Δvps21Δprb1 strains, thus confirming that modifying early steps in the vacuolar pathway has a positive impact on heterologous protein secretion.

  13. Novel zinc protease gene isolated from Dictyostelium discoideum is structurally related to mammalian leukotriene A4 hydrolase.


    Fan, D; Hou, L S


    The allantoicase (allC) gene of Dictyostelium discoideum allC RNAi mutant strain was silenced using the RNA interference technique. The mutant strain is motile, aggregated, and could not undergo further morphological development. The growth rate is high and the cells show a shortened cell cycle comparing with wild-type D. discoideum. However, the mechanisms regarding these actions remain unclear. mRNA differential display was used in this study to identify genetic differences. A novel D. discoideum gene (GenBank accession number: KC759140) encoding a new zinc protease was cloned. The amino acid sequence of the novel gene exhibited a conserved zinc-binding domain (HEX2HX18E) that allowed its classification into the M1 family of metallopeptidases. The gene encoded a 345-amino acid protein with a theoretical molecular mass of 39.69 kDa and a theoretical pI of 6.05. This protein showed strong homology with leukotriene A4 (LTA4) hydrolase of Homo sapiens (41% identity and 60% similarity at the amino acid level). By analyzing quantitative reverse transcription-polymerase chain reaction data, this zinc protease gene was more highly expressed in D. discoideum allC RNAi mutant type than in wild-type KAx-3 cells during the trophophase. The novel zinc protease gene may function as an LTA4 hydrolase and contribute to the shortening of the allC RNAi mutant cell cycle.

  14. A complete mitochondrial genome of wheat (Triticum aestivum cv. Chinese Yumai), and fast evolving mitochondrial genes in higher plants.


    Cui, Peng; Liu, Huitao; Lin, Qiang; Ding, Feng; Zhuo, Guoyin; Hu, Songnian; Liu, Dongcheng; Yang, Wenlong; Zhan, Kehui; Zhang, Aimin; Yu, Jun


    Plant mitochondrial genomes, encoding necessary proteins involved in the system of energy production, play an important role in the development and reproduction of the plant. They occupy a specific evolutionary pattern relative to their nuclear counterparts. Here, we determined the winter wheat (Triticum aestivum cv. Chinese Yumai) mitochondrial genome in a length of 452 and 526 bp by shotgun sequencing its BAC library. It contains 202 genes, including 35 known protein-coding genes, three rRNA and 17 tRNA genes, as well as 149 open reading frames (ORFs; greater than 300 bp in length). The sequence is almost identical to the previously reported sequence of the spring wheat (T. aestivum cv. Chinese Spring); we only identified seven SNPs (three transitions and four transversions) and 10 indels (insertions and deletions) between the two independently acquired sequences, and all variations were found in non-coding regions. This result confirmed the accuracy of the previously reported mitochondrial sequence of the Chinese Spring wheat. The nucleotide frequency and codon usage of wheat are common among the lineage of higher plant with a high AT-content of 58%. Molecular evolutionary analysis demonstrated that plant mitochondrial genomes evolved at different rates, which may correlate with substantial variations in metabolic rate and generation time among plant lineages. In addition, through the estimation of the ratio of non-synonymous to synonymous substitution rates between orthologous mitochondrion-encoded genes of higher plants, we found an accelerated evolutionary rate that seems to be the result of relaxed selection.

  15. Dietary fatty acids affect mitochondrial phospholipid compositions and mitochondrial gene expression of rainbow trout liver at different ages.


    Almaida-Pagán, P F; De Santis, C; Rubio-Mejía, O L; Tocher, D R


    Mitochondria are among the first responders to various stressors that challenge the homeostasis of cells and organisms. Mitochondrial decay is generally associated with impairment in the organelle bioenergetics function and increased oxidative stress, and it appears that deterioration of mitochondrial inner membrane phospholipids (PL), particularly cardiolipin (CL), and accumulation of mitochondrial DNA (mtDNA) mutations are among the main mechanisms involved in this process. In the present study, liver mitochondrial membrane PL compositions, lipid peroxidation, and mtDNA gene expression were analyzed in rainbow trout fed three diets with the same base formulation but with lipid supplied either by fish oil (FO), rapeseed oil (RO), or high DHA oil (DHA) during 6 weeks. Specifically, two feeding trials were performed using fish from the same population of two ages (1 and 3 years), and PL class compositions of liver mitochondria, fatty acid composition of individual PL classes, TBARS content, and mtDNA expression were determined. Dietary fatty acid composition strongly affected mitochondrial membrane composition from trout liver but observed changes did not fully reflect the diet, particularly when it contained high DHA. The changes were PL specific, CL being particularly resistant to changes in DHA. Some significant differences observed in expression of mtDNA with diet may suggest long-term dietary effects in mitochondrial gene expression which could affect electron transport chain function. All the changes were influenced by fish age, which could be related to the different growth rates observed between 1- and 3-year-old trout but that could also indicate age-related changes in the ability to maintain structural homeostasis of mitochondrial membranes.

  16. Restoration of Mitochondrial Gene Expression Using a Cloned Human Gene in Chinese Hamster Lung Cell Mutant

    PubMed Central

    Sherif, Zaki A; Broome, Carolyn W


    Background Gal−32 is a Chinese hamster lung cell nuclear mutant that is unable to grow in galactose due to a defect in mitochondrial protein synthesis. Since the product of the Gal−32 gene was unknown, it was imperative to use phenotypic complementation to clone a human gene that corrected the Gal−32 mutation. Results Recessive Gal−32 cells were co-transformed with pSV2-neo plasmid DNA and recombinant DNA from a human genomic library containing the dominant human Gal+ gene and a chloramphenicol-resistance (camr) gene present in the pSV13 vector. Primary transformants were selected by growth in galactose and the neomycin analog G418. In order to rescue the human Gal+ gene, a genomic library was constructed with primary transformant DNA and the pCV108 cosmid vector. The camr gene was used to identify clones with the nearby human sequences. DNA from two camr, Alu-hybridizing clones was able to transform the recessive Gal−32 cells to the Gal+ phenotype and to restore mitochondrial protein synthesis. Conclusion These data demonstrate the isolation of two pCV108-transformant recombinant clones containing a human gene that complements the Chinese hamster Gal−32 mutation and restores galactose metabolism. PMID:26052559

  17. Identification and partial characterization of extracellular aspartic protease genes from Metschnikowia pulcherrima IWBT Y1123 and Candida apicola IWBT Y1384.


    Reid, Vernita J; Theron, Louwrens W; du Toit, Maret; Divol, Benoit


    The extracellular acid proteases of non-Saccharomyces wine yeasts may fulfill a number of roles in winemaking, which include increasing the available nitrogen sources for the growth of fermentative microbes, affecting the aroma profile of the wine, and potentially reducing protein haze formation. These proteases, however, remain poorly characterized, especially at genetic level. In this study, two extracellular aspartic protease-encoding genes were identified and sequenced, from two yeast species of enological origin: one gene from Metschnikowia pulcherrima IWBT Y1123, named MpAPr1, and the other gene from Candida apicola IWBT Y1384, named CaAPr1. In silico analysis of these two genes revealed a number of features peculiar to aspartic protease genes, and both the MpAPr1 and CaAPr1 putative proteins showed homology to proteases of yeast genera. Heterologous expression of MpAPr1 in Saccharomyces cerevisiae YHUM272 confirmed that it encodes an aspartic protease. MpAPr1 production, which was shown to be constitutive, and secretion were confirmed in the presence of bovine serum albumin (BSA), casein, and grape juice proteins. The MpAPr1 gene was found to be present in 12 other M. pulcherrima strains; however, plate assays revealed that the intensity of protease activity was strain dependent and unrelated to the gene sequence.

  18. Identification and Partial Characterization of Extracellular Aspartic Protease Genes from Metschnikowia pulcherrima IWBT Y1123 and Candida apicola IWBT Y1384

    PubMed Central

    Reid, Vernita J.; Theron, Louwrens W.; du Toit, Maret


    The extracellular acid proteases of non-Saccharomyces wine yeasts may fulfill a number of roles in winemaking, which include increasing the available nitrogen sources for the growth of fermentative microbes, affecting the aroma profile of the wine, and potentially reducing protein haze formation. These proteases, however, remain poorly characterized, especially at genetic level. In this study, two extracellular aspartic protease-encoding genes were identified and sequenced, from two yeast species of enological origin: one gene from Metschnikowia pulcherrima IWBT Y1123, named MpAPr1, and the other gene from Candida apicola IWBT Y1384, named CaAPr1. In silico analysis of these two genes revealed a number of features peculiar to aspartic protease genes, and both the MpAPr1 and CaAPr1 putative proteins showed homology to proteases of yeast genera. Heterologous expression of MpAPr1 in Saccharomyces cerevisiae YHUM272 confirmed that it encodes an aspartic protease. MpAPr1 production, which was shown to be constitutive, and secretion were confirmed in the presence of bovine serum albumin (BSA), casein, and grape juice proteins. The MpAPr1 gene was found to be present in 12 other M. pulcherrima strains; however, plate assays revealed that the intensity of protease activity was strain dependent and unrelated to the gene sequence. PMID:22820332

  19. Rapidly evolving mitochondrial genome and directional selection in mitochondrial genes in the parasitic wasp nasonia (hymenoptera: pteromalidae).


    Oliveira, Deodoro C S G; Raychoudhury, Rhitoban; Lavrov, Dennis V; Werren, John H


    We sequenced the nearly complete mtDNA of 3 species of parasitic wasps, Nasonia vitripennis (2 strains), Nasonia giraulti, and Nasonia longicornis, including all 13 protein-coding genes and the 2 rRNAs, and found unusual patterns of mitochondrial evolution. The Nasonia mtDNA has a unique gene order compared with other insect mtDNAs due to multiple rearrangements. The mtDNAs of these wasps also show nucleotide substitution rates over 30 times faster than nuclear protein-coding genes, indicating among the highest substitution rates found in animal mitochondria (normally <10 times faster). A McDonald and Kreitman test shows that the between-species frequency of fixed replacement sites relative to silent sites is significantly higher compared with within-species polymorphisms in 2 mitochondrial genes of Nasonia, atp6 and atp8, indicating directional selection. Consistent with this interpretation, the Ka/Ks (nonsynonymous/synonymous substitution rates) ratios are higher between species than within species. In contrast, cox1 shows a signature of purifying selection for amino acid sequence conservation, although rates of amino acid substitutions are still higher than for comparable insects. The mitochondrial-encoded polypeptides atp6 and atp8 both occur in F0F1ATP synthase of the electron transport chain. Because malfunction in this fundamental protein severely affects fitness, we suggest that the accelerated accumulation of replacements is due to beneficial mutations necessary to compensate mild-deleterious mutations fixed by random genetic drift or Wolbachia sweeps in the fast evolving mitochondria of Nasonia. We further propose that relatively high rates of amino acid substitution in some mitochondrial genes can be driven by a "Compensation-Draft Feedback"; increased fixation of mildly deleterious mutations results in selection for compensatory mutations, which lead to fixation of additional deleterious mutations in nonrecombining mitochondrial genomes, thus

  20. Rapidly Evolving Mitochondrial Genome and Directional Selection in Mitochondrial Genes in the Parasitic Wasp Nasonia (Hymenoptera: Pteromalidae)

    PubMed Central

    Raychoudhury, Rhitoban; Lavrov, Dennis V.; Werren, John H.


    We sequenced the nearly complete mtDNA of 3 species of parasitic wasps, Nasonia vitripennis (2 strains), Nasonia giraulti, and Nasonia longicornis, including all 13 protein-coding genes and the 2 rRNAs, and found unusual patterns of mitochondrial evolution. The Nasonia mtDNA has a unique gene order compared with other insect mtDNAs due to multiple rearrangements. The mtDNAs of these wasps also show nucleotide substitution rates over 30 times faster than nuclear protein-coding genes, indicating among the highest substitution rates found in animal mitochondria (normally <10 times faster). A McDonald and Kreitman test shows that the between-species frequency of fixed replacement sites relative to silent sites is significantly higher compared with within-species polymorphisms in 2 mitochondrial genes of Nasonia, atp6 and atp8, indicating directional selection. Consistent with this interpretation, the Ka/Ks (nonsynonymous/synonymous substitution rates) ratios are higher between species than within species. In contrast, cox1 shows a signature of purifying selection for amino acid sequence conservation, although rates of amino acid substitutions are still higher than for comparable insects. The mitochondrial-encoded polypeptides atp6 and atp8 both occur in F0F1ATP synthase of the electron transport chain. Because malfunction in this fundamental protein severely affects fitness, we suggest that the accelerated accumulation of replacements is due to beneficial mutations necessary to compensate mild-deleterious mutations fixed by random genetic drift or Wolbachia sweeps in the fast evolving mitochondria of Nasonia. We further propose that relatively high rates of amino acid substitution in some mitochondrial genes can be driven by a “Compensation-Draft Feedback”; increased fixation of mildly deleterious mutations results in selection for compensatory mutations, which lead to fixation of additional deleterious mutations in nonrecombining mitochondrial genomes, thus

  1. The mitochondrial genome of the onychophoran Opisthopatus cinctipes (Peripatopsidae) reflects the ancestral mitochondrial gene arrangement of Panarthropoda and Ecdysozoa.


    Braband, Anke; Cameron, Stephen L; Podsiadlowski, Lars; Daniels, Savel R; Mayer, Georg


    The ancestral genome composition in Onychophora (velvet worms) is unknown since only a single species of Peripatidae has been studied thus far, which shows a highly derived gene order with numerous translocated genes. Due to this lack of information from Onychophora, it is difficult to infer the ancestral mitochondrial gene arrangement patterns for Panarthropoda and Ecdysozoa. Hence, we analyzed the complete mitochondrial genome of the onychophoran Opisthopatus cinctipes, a representative of Peripatopsidae. Our data show that O. cinctipes possesses a highly conserved gene order, similar to that found in various arthropods. By comparing our results to those from different outgroups, we reconstruct the ancestral gene arrangement in Panarthropoda and Ecdysozoa. Our phylogenetic analysis of protein-coding gene sequences from 60 protostome species (including outgroups) provides some support for the sister group relationship of Onychophora and Arthropoda, which was not recovered by using a single species of Peripatidae, Epiperipatus biolleyi, in a previous study. A comparison of the strand-specific bias between onychophorans, arthropods, and a priapulid suggests that the peripatid E. biolleyi is less suitable for phylogenetic analyses of Ecdysozoa using mitochondrial genomic data than the peripatopsid O. cinctipes.

  2. Crystal structure of the caseinolytic protease gene regulator, a transcriptional activator in actinomycetes.


    Russo, Santina; Schweitzer, Jens-Eric; Polen, Tino; Bott, Michael; Pohl, Ehmke


    Human pathogens of the genera Corynebacterium and Mycobacterium possess the transcriptional activator ClgR (clp gene regulator) which in Corynebacterium glutamicum has been shown to regulate the expression of the ClpCP protease genes. ClgR specifically binds to pseudo-palindromic operator regions upstream of clpC and clpP1P2. Here, we present the first crystal structure of a ClgR protein from C. glutamicum. The structure was determined from two different crystal forms to resolutions of 1.75 and 2.05 A, respectively. ClgR folds into a five-helix bundle with a helix-turn-helix motif typical for DNA-binding proteins. Upon dimerization the two DNA-recognition helices are arranged opposite to each other at the protein surface in a distance of approximately 30 A, which suggests that they bind into two adjacent major grooves of B-DNA in an anti-parallel manner. A binding pocket is situated at a strategic position in the dimer interface and could possess a regulatory role altering the positions of the DNA-binding helices.

  3. Activation of the human mitochondrial transcription factor A gene by nuclear respiratory factors: a potential regulatory link between nuclear and mitochondrial gene expression in organelle biogenesis.

    PubMed Central

    Virbasius, J V; Scarpulla, R C


    Mitochondrial transcription factor A (mtTFA), the product of a nuclear gene, stimulates transcription from the two divergent mitochondrial promoters and is likely the principal activator of mitochondrial gene expression in vertebrates. Here we establish that the proximal promoter of the human mtTFA gene is highly dependent upon recognition sites for the nuclear respiratory factors, NRF-1 and NRF-2, for activity. These factors have been previously implicated in the activation of numerous nuclear genes that contribute to mitochondrial respiratory function. The affinity-purified factors from HeLa cells specifically bind to the mtTFA NRF-1 and NRF-2 sites through guanine nucleotide contacts that are characteristic for each site. Mutations in these contacts eliminate NRF-1 and NRF-2 binding and also dramatically reduce promoter activity in transfected cells. Although both factors contribute, NRF-1 binding appears to be the major determinant of promoter function. This dependence on NRF-1 activation is confirmed by in vitro transcription using highly purified recombinant proteins that display the same binding specificities as the HeLa cell factors. The activation of the mtTFA promoter by both NRF-1 and NRF-2 therefore provides a link between the expression of nuclear and mitochondrial genes and suggests a mechanism for their coordinate regulation during organelle biogenesis. Images PMID:8108407

  4. Gene identification and molecular characterization of solvent stable protease from a moderately haloalkaliphilic bacterium, Geomicrobium sp. EMB2.


    Karan, Ram; Singh, Raj Kumar Mohan; Kapoor, Sanjay; Khare, S K


    Cloning and characterization of the gene encoding a solvent-tolerant protease from the haloalkaliphilic bacterium Geomicrobium sp. EMB2 are described. Primers designed based on the N-terminal amino acid sequence of the purified EMB2 protease helped in the amplification of a 1,505-bp open reading frame that had a coding potential of a 42.7-kDa polypeptide. The deduced EMB2 protein contained a 35.4-kDa mature protein of 311 residues, with a high proportion of acidic amino acid residues. Phylogenetic analysis placed the EMB2 gene close to a known serine protease from Bacillus clausii KSM-K16. Primary sequence analysis indicated a hydrophobic inclination of the protein; and the 3D structure modeling elucidated a relatively higher percentage of small (glycine, alanine, and valine) and borderline (serine and threonine) hydrophobic residues on its surface. The structure analysis also highlighted enrichment of acidic residues at the cost of basic residues. The study indicated that solvent and salt stabilities in Geomicrobium sp. protease may be accorded to different structural features; that is, the presence of a number of small hydrophobic amino acid residues on the surface and a higher content of acidic amino acid residues, respectively.

  5. Type II Transmembrane Serine Protease Gene Variants Associate with Breast Cancer

    PubMed Central

    Luostari, Kaisa; Hartikainen, Jaana M.; Tengström, Maria; Palvimo, Jorma J.; Kataja, Vesa


    Type II transmembrane serine proteases (TTSPs) are related to tumor growth, invasion, and metastasis in cancer. Genetic variants in these genes may alter their function, leading to cancer onset and progression, and affect patient outcome. Here, 464 breast cancer cases and 370 controls were genotyped for 82 single-nucleotide polymorphisms covering eight genes. Association of the genotypes was estimated against breast cancer risk, breast cancer–specific survival, and survival in different treatment groups, and clinicopathological variables. SNPs in TMPRSS3 (rs3814903 and rs11203200), TMPRSS7 (rs1844925), and HGF (rs5745752) associated significantly with breast cancer risk (Ptrend = 0.008–0.042). SNPs in TMPRSS1 (rs12151195 and rs12461158), TMPRSS2 (rs2276205), TMPRSS3 (rs3814903), and TMPRSS7 (rs2399403) associated with prognosis (P = 0.004–0.046). When estimating the combined effect of the variants, the risk of breast cancer was higher with 4–5 alleles present compared to 0–2 alleles (P = 0.0001; OR, 2.34; 95% CI, 1.39–3.94). Women with 6–8 survival-associating alleles had a 3.3 times higher risk of dying of breast cancer compared to women with 1–3 alleles (P = 0.001; HR, 3.30; 95% CI, 1.58–6.88). The results demonstrate the combined effect of variants in TTSPs and their related genes in breast cancer risk and patient outcome. Functional analysis of these variants will lead to further understanding of this gene family, which may improve individualized risk estimation and development of new strategies for treatment of breast cancer. PMID:25029565

  6. Extensive mitochondrial gene rearrangement in a genus of plant parasitic nematodes

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The nematodes Globodera pallida and G. rostochiensis are two of the only animals known to have multipartite mitochondrial genomes. In such genomes, mitochondrial genes are distributed on multiple circles. The entire sequence of a nematode (Radopholus similis) that belongs to the same superfamily (...

  7. Extensive mitochondrial gene arrangements in coleoid Cephalopoda and their phylogenetic implications.


    Akasaki, Tetsuya; Nikaido, Masato; Tsuchiya, Kotaro; Segawa, Susumu; Hasegawa, Masami; Okada, Norihiro


    We determined the complete mitochondrial genomes of five cephalopods of the Subclass Coleoidea (Suborder Oegopsida: Watasenia scintillans, Todarodes pacificus, Suborder Myopsida: Sepioteuthis lessoniana, Order Sepiida: Sepia officinalis, and Order Octopoda: Octopus ocellatus) and used them to infer phylogenetic relationships. In our Maximum Likelihood (ML) tree, sepiids (cuttlefish) are at the most basal position of all decapodiformes, and oegopsids and myopsids form a monophyletic clade, thus supporting the traditional classification of the Order Teuthida. We detected extensive gene rearrangements in the mitochondrial genomes of broad cephalopod groups. It is likely that the arrangements of mitochondrial genes in Oegopsida and Sepiida were derived from those of Octopoda, which is thought to be the ancestral order, by entire gene duplication and random gene loss. Oegopsida in particular has undergone long-range gene duplications. We also found that the mitochondrial gene arrangement of Sepioteuthis lessoniana differs from that of Loligo bleekeri, although they belong to the same family. Analysis of both the phylogenetic tree and mitochondrial gene rearrangements of coleoid Cephalopoda suggests that each mitochondrial gene arrangement was acquired after the divergence of each lineage.

  8. Afrobatrachian mitochondrial genomes: genome reorganization, gene rearrangement mechanisms, and evolutionary trends of duplicated and rearranged genes

    PubMed Central


    Background Mitochondrial genomic (mitogenomic) reorganizations are rarely found in closely-related animals, yet drastic reorganizations have been found in the Ranoides frogs. The phylogenetic relationships of the three major ranoid taxa (Natatanura, Microhylidae, and Afrobatrachia) have been problematic, and mitogenomic information for afrobatrachians has not been available. Several molecular models for mitochondrial (mt) gene rearrangements have been proposed, but observational evidence has been insufficient to evaluate them. Furthermore, evolutionary trends in rearranged mt genes have not been well understood. To gain molecular and phylogenetic insights into these issues, we analyzed the mt genomes of four afrobatrachian species (Breviceps adspersus, Hemisus marmoratus, Hyperolius marmoratus, and Trichobatrachus robustus) and performed molecular phylogenetic analyses. Furthermore we searched for two evolutionary patterns expected in the rearranged mt genes of ranoids. Results Extensively reorganized mt genomes having many duplicated and rearranged genes were found in three of the four afrobatrachians analyzed. In fact, Breviceps has the largest known mt genome among vertebrates. Although the kinds of duplicated and rearranged genes differed among these species, a remarkable gene rearrangement pattern of non-tandemly copied genes situated within tandemly-copied regions was commonly found. Furthermore, the existence of concerted evolution was observed between non-neighboring copies of triplicated 12S and 16S ribosomal RNA regions. Conclusions Phylogenetic analyses based on mitogenomic data support a close relationship between Afrobatrachia and Microhylidae, with their estimated divergence 100 million years ago consistent with present-day endemism of afrobatrachians on the African continent. The afrobatrachian mt data supported the first tandem and second non-tandem duplication model for mt gene rearrangements and the recombination-based model for concerted

  9. Functional analysis of five trypsin-like protease genes in the oriental fruit fly, Bactrocera dorsalis (Diptera: Tephritidae).


    Li, Ya-Li; Hou, Ming-Zhe; Shen, Guang-Mao; Lu, Xue-Ping; Wang, Zhe; Jia, Fu-Xian; Wang, Jin-Jun; Dou, Wei


    Insect midgut proteases catalyze the release of free amino acids from dietary proteins and are essential for insect normal development. To date, digestive proteases as potential candidates have made great progress in pest control. To clarify the function of trypsin-like protease genes in the digestive system of Bactrocera dorsalis, a serious pest of a wide range of tropical and subtropical fruit and vegetable crops, five trypsin genes (BdTry1, BdTry2, BdTry3, BdTry4 and BdTry5) were identified from transcriptome dataset, and the effects of feeding condition on their expression levels were examined subsequently. RNA interference (RNAi) was applied to further explore their function on the growth of B. dorsalis. The results showed that all the BdTrys in starving midgut expressed at a minimal level but up-regulated upon feeding (except BdTry3). Besides, RNAi by feeding dsRNAs to larvae proved to be an effective method to cause gene silencing and the mixed dsRNAs of the five BdTrys slowed larvae growth of B. dorsalis. The current data suggest that trypsin genes are actively involved in digestion process of B. dorsalis larvae and thereafter play crucial roles in their development.

  10. Analyses of nuclearly encoded mitochondrial genes suggest gene duplication as a mechanism for resolving intralocus sexually antagonistic conflict in Drosophila.


    Gallach, Miguel; Chandrasekaran, Chitra; Betrán, Esther


    Gene duplication is probably the most important mechanism for generating new gene functions. However, gene duplication has been overlooked as a potentially effective way to resolve genetic conflicts. Here, we analyze the entire set of Drosophila melanogaster nuclearly encoded mitochondrial duplicate genes and show that both RNA- and DNA-mediated mitochondrial gene duplications exhibit an unexpectedly high rate of relocation (change in location between parental and duplicated gene) as well as an extreme tendency to avoid the X chromosome. These trends are likely related to our observation that relocated genes tend to have testis-specific expression. We also infer that these trends hold across the entire Drosophila genus. Importantly, analyses of gene ontology and functional interaction networks show that there is an overrepresentation of energy production-related functions in these mitochondrial duplicates. We discuss different hypotheses to explain our results and conclude that our findings substantiate the hypothesis that gene duplication for male germline function is likely a mechanism to resolve intralocus sexually antagonistic conflicts that we propose are common in testis. In the case of nuclearly encoded mitochondrial duplicates, our hypothesis is that past sexually antagonistic conflict related to mitochondrial energy function in Drosophila was resolved by gene duplication.

  11. Comparative study of human mitochondrial proteome reveals extensive protein subcellular relocalization after gene duplications

    PubMed Central


    Background Gene and genome duplication is the principle creative force in evolution. Recently, protein subcellular relocalization, or neolocalization was proposed as one of the mechanisms responsible for the retention of duplicated genes. This hypothesis received support from the analysis of yeast genomes, but has not been tested thoroughly on animal genomes. In order to evaluate the importance of subcellular relocalizations for retention of duplicated genes in animal genomes, we systematically analyzed nuclear encoded mitochondrial proteins in the human genome by reconstructing phylogenies of mitochondrial multigene families. Results The 456 human mitochondrial proteins selected for this study were clustered into 305 gene families including 92 multigene families. Among the multigene families, 59 (64%) consisted of both mitochondrial and cytosolic (non-mitochondrial) proteins (mt-cy families) while the remaining 33 (36%) were composed of mitochondrial proteins (mt-mt families). Phylogenetic analyses of mt-cy families revealed three different scenarios of their neolocalization following gene duplication: 1) relocalization from mitochondria to cytosol, 2) from cytosol to mitochondria and 3) multiple subcellular relocalizations. The neolocalizations were most commonly enabled by the gain or loss of N-terminal mitochondrial targeting signals. The majority of detected subcellular relocalization events occurred early in animal evolution, preceding the evolution of tetrapods. Mt-mt protein families showed a somewhat different pattern, where gene duplication occurred more evenly in time. However, for both types of protein families, most duplication events appear to roughly coincide with two rounds of genome duplications early in vertebrate evolution. Finally, we evaluated the effects of inaccurate and incomplete annotation of mitochondrial proteins and found that our conclusion of the importance of subcellular relocalization after gene duplication on the genomic scale was

  12. Mammalian mitochondrial ribosomal small subunit (MRPS) genes: A putative role in human disease.


    Gopisetty, Gopal; Thangarajan, Rajkumar


    Mitochondria are prominently understood as power houses producing ATP the primary energy currency of the cell. However, mitochondria are also known to play an important role in apoptosis and autophagy, and mitochondrial dysregulation can lead to pathological outcomes. Mitochondria are known to contain 1500 proteins of which only 13 are coded by mitochondrial DNA and the rest are coded by nuclear genes. Protein synthesis in mitochondria involves mitochondrial ribosomes which are 55-60S particles and are composed of small 28S and large 39S subunits. A feature of mammalian mitoribosome which differentiate it from bacterial ribosomes is the increased protein content. The human mitochondrial ribosomal protein (MRP) gene family comprises of 30 genes which code for mitochondrial ribosomal small subunit and 50 genes for the large subunit. The present review focuses on the mitochondrial ribosomal small subunit genes (MRPS), presents an overview of the literature and data gleaned from publicly available gene and protein expression databases. The survey revealed aberrations in MRPS gene expression patterns in varied human diseases indicating a putative role in their etiology.

  13. [MITO-Porter; a cutting-edge technology for mitochondrial gene therapy].


    Furukawa, Ryo; Yamada, Yuma; Harashima, Hideyoshi


    Gene therapy is an attractive strategy, for not only targeting nuclear genome, but the mitochondrial genome as well. Human mitochondrial DNA (mtDNA) encodes 13 subunits of the electron transport chain, 22 tRNAs, and 2 rRNAs and their mutations cause a wide range of mitochondrial diseases. Each cell contains hundreds to thousands of mtDNAs, and in the case of a diseased cell, the mitochondrion possesses both mutant mtDNA and wild-type mtDNA. It is generally accepted that the disease phenotype appears when the proportion of the pathogenic mutant mtDNA exceeds a certain threshold. Therefore, the suppression of mutant mtDNA or supplementing wild-type mtDNA will control the onset of mitochondrial disease. To achieve the transfection of an exogenous therapeutic gene to the mitochondrial matrix where mtDNA is transcribed and translated, it is necessary to transfer cargos through mitochondrial outer and inner membranes. Several methods have been examined for mitochondrial transfection, but a universal, wide-ranging transfection technique has yet not been established. We recently developed a mitochondrial targeting delivery system, namely the MITO-Porter. The MITO-Porter is liposomal nanocarrier with a mitochondrial fusogenic lipid composition. We reported that the MITO-Porter could deliver chemical compounds and proteins to the mitochondrial matrix via membrane fusion. In this review, we report (1) on the pharmacological enhancement of lecithinized superoxide dismutase (PC-SOD) using MITO-Porter, (2) the transcription activation of exogenous DNA by mitochondrial transcription factor A (TFAM), and (3) perspectives on a mitochondrial targeting device.

  14. Mitochondrial Genomes of Kinorhyncha: trnM Duplication and New Gene Orders within Animals

    PubMed Central

    Popova, Olga V.; Mikhailov, Kirill V.; Nikitin, Mikhail A.; Logacheva, Maria D.; Penin, Aleksey A.; Muntyan, Maria S.; Kedrova, Olga S.; Petrov, Nikolai B.; Panchin, Yuri V.


    Many features of mitochondrial genomes of animals, such as patterns of gene arrangement, nucleotide content and substitution rate variation are extensively used in evolutionary and phylogenetic studies. Nearly 6,000 mitochondrial genomes of animals have already been sequenced, covering the majority of animal phyla. One of the groups that escaped mitogenome sequencing is phylum Kinorhyncha—an isolated taxon of microscopic worm-like ecdysozoans. The kinorhynchs are thought to be one of the early-branching lineages of Ecdysozoa, and their mitochondrial genomes may be important for resolving evolutionary relations between major animal taxa. Here we present the results of sequencing and analysis of mitochondrial genomes from two members of Kinorhyncha, Echinoderes svetlanae (Cyclorhagida) and Pycnophyes kielensis (Allomalorhagida). Their mitochondrial genomes are circular molecules approximately 15 Kbp in size. The kinorhynch mitochondrial gene sequences are highly divergent, which precludes accurate phylogenetic inference. The mitogenomes of both species encode a typical metazoan complement of 37 genes, which are all positioned on the major strand, but the gene order is distinct and unique among Ecdysozoa or animals as a whole. We predict four types of start codons for protein-coding genes in E. svetlanae and five in P. kielensis with a consensus DTD in single letter code. The mitochondrial genomes of E. svetlanae and P. kielensis encode duplicated methionine tRNA genes that display compensatory nucleotide substitutions. Two distant species of Kinorhyncha demonstrate similar patterns of gene arrangements in their mitogenomes. Both genomes have duplicated methionine tRNA genes; the duplication predates the divergence of two species. The kinorhynchs share a few features pertaining to gene order that align them with Priapulida. Gene order analysis reveals that gene arrangement specific of Priapulida may be ancestral for Scalidophora, Ecdysozoa, and even Protostomia

  15. Mitochondrial Genomes of Kinorhyncha: trnM Duplication and New Gene Orders within Animals.


    Popova, Olga V; Mikhailov, Kirill V; Nikitin, Mikhail A; Logacheva, Maria D; Penin, Aleksey A; Muntyan, Maria S; Kedrova, Olga S; Petrov, Nikolai B; Panchin, Yuri V; Aleoshin, Vladimir V


    Many features of mitochondrial genomes of animals, such as patterns of gene arrangement, nucleotide content and substitution rate variation are extensively used in evolutionary and phylogenetic studies. Nearly 6,000 mitochondrial genomes of animals have already been sequenced, covering the majority of animal phyla. One of the groups that escaped mitogenome sequencing is phylum Kinorhyncha-an isolated taxon of microscopic worm-like ecdysozoans. The kinorhynchs are thought to be one of the early-branching lineages of Ecdysozoa, and their mitochondrial genomes may be important for resolving evolutionary relations between major animal taxa. Here we present the results of sequencing and analysis of mitochondrial genomes from two members of Kinorhyncha, Echinoderes svetlanae (Cyclorhagida) and Pycnophyes kielensis (Allomalorhagida). Their mitochondrial genomes are circular molecules approximately 15 Kbp in size. The kinorhynch mitochondrial gene sequences are highly divergent, which precludes accurate phylogenetic inference. The mitogenomes of both species encode a typical metazoan complement of 37 genes, which are all positioned on the major strand, but the gene order is distinct and unique among Ecdysozoa or animals as a whole. We predict four types of start codons for protein-coding genes in E. svetlanae and five in P. kielensis with a consensus DTD in single letter code. The mitochondrial genomes of E. svetlanae and P. kielensis encode duplicated methionine tRNA genes that display compensatory nucleotide substitutions. Two distant species of Kinorhyncha demonstrate similar patterns of gene arrangements in their mitogenomes. Both genomes have duplicated methionine tRNA genes; the duplication predates the divergence of two species. The kinorhynchs share a few features pertaining to gene order that align them with Priapulida. Gene order analysis reveals that gene arrangement specific of Priapulida may be ancestral for Scalidophora, Ecdysozoa, and even Protostomia.

  16. A novel aspartic acid protease gene from pineapple fruit (Ananas comosus): cloning, characterization and relation to postharvest chilling stress resistance.


    Raimbault, Astrid-Kim; Zuily-Fodil, Yasmine; Soler, Alain; Cruz de Carvalho, Maria H


    A full-length cDNA encoding a putative aspartic acid protease (AcAP1) was isolated for the first time from the flesh of pineapple (Ananas comosus) fruit. The deduced sequence of AcAP1 showed all the common features of a typical plant aspartic protease phytepsin precursor. Analysis of AcAP1 gene expression under postharvest chilling treatment in two pineapple varieties differing in their resistance to blackheart development revealed opposite trends. The resistant variety showed an up-regulation of AcAP1 precursor gene expression whereas the susceptible showed a down-regulation in response to postharvest chilling treatment. The same trend was observed regarding specific AP enzyme activity in both varieties. Taken together our results support the involvement of AcAP1 in postharvest chilling stress resistance in pineapple fruits.

  17. Independent replication of mitochondrial genes supports the transcriptional program in developing fiber cells of cotton (Gossypium hirsutum L.).

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The mitochondrial genomes of flowering plants exist both as a "master circle" chromosome and as numerous subgenomic sublimons that are generated by intramolecular recombination. Differential stability or replication of these sublimons allows individual mitochondrial gene copy numbers to vary indepe...

  18. Mitochondrial respiratory gene expression is suppressed in many cancers

    PubMed Central

    Reznik, Ed; Wang, Qingguo; La, Konnor; Schultz, Nikolaus; Sander, Chris


    The fundamental metabolic decision of a cell, the balance between respiration and fermentation, rests in part on expression of the mitochondrial genome (mtDNA) and coordination with expression of the nuclear genome (nuDNA). Previously we described mtDNA copy number depletion across many solid tumor types (Reznik et al., 2016). Here, we use orthogonal RNA-sequencing data to quantify mtDNA expression (mtRNA), and report analogously lower expression of mtRNA in tumors (relative to normal tissue) across a majority of cancer types. Several cancers exhibit a trio of mutually consistent evidence suggesting a drop in respiratory activity: depletion of mtDNA copy number, decreases in mtRNA levels, and decreases in expression of nuDNA-encoded respiratory proteins. Intriguingly, a minority of cancer types exhibit a drop in mtDNA expression but an increase in nuDNA expression of respiratory proteins, with unknown implications for respiratory activity. Our results indicate suppression of respiratory gene expression across many cancer types. DOI: PMID:28099114

  19. PCR-based bioprospecting for homing endonucleases in fungal mitochondrial rRNA genes.


    Hafez, Mohamed; Guha, Tuhin Kumar; Shen, Chen; Sethuraman, Jyothi; Hausner, Georg


    Fungal mitochondrial genomes act as "reservoirs" for homing endonucleases. These enzymes with their DNA site-specific cleavage activities are attractive tools for genome editing and gene therapy applications. Bioprospecting and characterization of naturally occurring homing endonucleases offers an alternative to synthesizing artificial endonucleases. Here, we describe methods for PCR-based screening of fungal mitochondrial rRNA genes for homing endonuclease encoding sequences, and we also provide protocols for the purification and biochemical characterization of putative native homing endonucleases.

  20. Isolation and gene expression analysis of a papain-type cysteine protease in thermogenic skunk cabbage (Symplocarpus renifolius).


    Ito-Inaba, Yasuko; Masuko, Hiromi; Watanabe, Masao; Inaba, Takehito


    Skunk cabbage (Symplocarpus renifolius) spadices contain abundant transcripts for cysteine protease (CP). From thermogenic spadices, we isolated SrCPA, a highly expressed CP gene that encoded a papain-type CP. SrCPA is structurally similar to other plant CPs, including the senescence-associated CPs found in aroids. The expression of SrCPA increased during floral development, and was observed in all floral tissues except for the stamens.

  1. PhAP protease from Pseudoalteromonas haloplanktis TAC125: Gene cloning, recombinant production in E. coli and enzyme characterization

    NASA Astrophysics Data System (ADS)

    de Pascale, D.; Giuliani, M.; De Santi, C.; Bergamasco, N.; Amoresano, A.; Carpentieri, A.; Parrilli, E.; Tutino, M. L.


    Cold-adapted proteases have been found to be the dominant activity throughout the cold marine environment, indicating their importance in bacterial acquisition of nitrogen-rich complex organic compounds. However, few extracellular proteases from marine organisms have been characterized so far, and the mechanisms that enable their activity in situ are still largely unknown. Aside from their ecological importance and use as model enzyme for structure/function investigations, cold-active proteolytic enzymes offer great potential for biotechnological applications. Our studies on cold adapted proteases were performed on exo-enzyme produced by the Antarctic marine bacterium Pseudoalteromonas haloplanktis TAC125. By applying a proteomic approach, we identified several proteolytic activities from its culture supernatant. PhAP protease was selected for further investigations. The encoding gene was cloned and the protein was recombinantly produced in E. coli cells. The homogeneous product was biochemically characterised and it turned out that the enzyme is a Zn-dependent aminopeptidase, with an activity dependence from assay temperature typical of psychrophilic enzymes.

  2. Cloning, expression, and characterization of a milk-clotting aspartic protease gene (Po-Asp) from Pleurotus ostreatus.


    Yin, Chaomin; Zheng, Liesheng; Chen, Liguo; Tan, Qi; Shang, Xiaodong; Ma, Aimin


    An aspartic protease gene from Pleurotus ostreatus (Po-Asp) had been cloned based on the 3' portion of cDNA in our previous work. The Po-Asp cDNA contained 1,324 nucleotides with an open reading frame (ORF) of 1,212 bp encoding 403 amino acid residues. The putative amino acid sequence included a signal peptide, an activation peptide, two most possible N-glycosylation sites and two conserved catalytic active site. The mature polypeptide with 327 amino acid residues had a calculated molecular mass of 35.3 kDa and a theoretical isoelectric point of 4.57. Basic Local Alignment Search Tool analysis showed 68-80 % amino acid sequence identical to other basidiomycetous aspartic proteases. Sequence comparison and evolutionary analysis revealed that Po-Asp is a member of fungal aspartic protease family. The DNA sequence of Po-Asp is 1,525 bp in length without untranslated region, consisting of seven exons and six introns. The Po-Asp cDNA without signal sequence was expressed in Pichia pastoris and sodium dodecyl sulfate-polyacrylamide gel electrophoresis demonstrated the molecular mass of recombinant Po-Asp was about 43 kDa. The crude recombinant aspartic protease had milk-clotting activity.

  3. The gene expression landscape of thermogenic skunk cabbage suggests critical roles for mitochondrial and vacuolar metabolic pathways in the regulation of thermogenesis.


    Ito-Inaba, Yasuko; Hida, Yamato; Matsumura, Hideo; Masuko, Hiromi; Yazu, Fumiko; Terauchi, Ryohei; Watanabe, Masao; Inaba, Takehito


    Floral thermogenesis has been described in several plant species. Because of the lack of comprehensive gene expression profiles in thermogenic plants, the molecular mechanisms by which floral thermogenesis is regulated remain to be established. We examined the gene expression landscape of skunk cabbage (Symplocarpus renifolius) during thermogenic and post-thermogenic stages and identified expressed sequence tags from different developmental stages of the inflorescences using super serial analysis of gene expression (SuperSAGE). In-depth analysis suggested that cellular respiration and mitochondrial functions are significantly enhanced during the thermogenic stage. In contrast, genes involved in stress responses and protein degradation were significantly up-regulated during post-thermogenic stages. Quantitative comparisons indicated that the expression levels of genes involved in cellular respiration were higher in thermogenic spadices than in Arabidopsis inflorescences. Thermogenesis-associated genes seemed to be expressed abundantly in the peripheral tissues of the spadix. Our results suggest that cellular respiration and mitochondrial metabolism play key roles in heat production during floral thermogenesis. On the other hand, vacuolar cysteine protease and other degradative enzymes seem to accelerate senescence and terminate thermogenesis in the post-thermogenic stage.

  4. In vivo and in vitro maturation of rabbit oocytes differently affects the gene expression profile, mitochondrial distribution, apoptosis and early embryo development.


    Arias-Álvarez, M; García-García, R M; López-Tello, J; Rebollar, P G; Gutiérrez-Adán, A; Lorenzo, P L


    In vivo-matured cumulus-oocyte complexes are valuable models in which to assess potential biomarkers of rabbit oocyte quality that contribute to enhanced IVM systems. In the present study we compared some gene markers of oocytes and cumulus cells (CCs) from immature, in vivo-matured and IVM oocytes. Moreover, apoptosis in CCs, nuclear maturation, mitochondrial reallocation and the developmental potential of oocytes after IVF were assessed. In relation to cumulus expansion, gene expression of gap junction protein, alpha 1, 43 kDa (Gja1) and prostaglandin-endoperoxide synthase 2 (Ptgs2) was significantly lower in CCs after in vivo maturation than IVM. In addition, there were differences in gene expression after in vivo maturation versus IVM in both oocytes and CCs for genes related to cell cycle regulation and apoptosis (V-Akt murine thymoma viral oncogene homologue 1 (Akt1), tumour protein 53 (Tp53), caspase 3, apoptosis-related cysteine protease (Casp3)), oxidative response (superoxide dismutase 2, mitochondrial (Sod2)) and metabolism (glucose-6-phosphate dehydrogenase (G6pd), glyceraldehyde-3-phosphate dehydrogenase (Gapdh)). In vivo-matured CCs had a lower apoptosis rate than IVM and immature CCs. Meiotic progression, mitochondrial migration to the periphery and developmental competence were higher for in vivo-matured than IVM oocytes. In conclusion, differences in oocyte developmental capacity after IVM or in vivo maturation are accompanied by significant changes in transcript abundance in oocytes and their surrounding CCs, meiotic rate, mitochondrial distribution and apoptotic index. Some of the genes investigated, such as Gja1, could be potential biomarkers for oocyte developmental competence in the rabbit model, helping improve in vitro culture systems in these species.

  5. Mitochondrial DNA of Vitis vinifera and the issue of rampant horizontal gene transfer.


    Goremykin, Vadim V; Salamini, Francesco; Velasco, Riccardo; Viola, Roberto


    The mitochondrial genome of grape (Vitis vinifera), the largest organelle genome sequenced so far, is presented. The genome is 773,279 nt long and has the highest coding capacity among known angiosperm mitochondrial DNAs (mtDNAs). The proportion of promiscuous DNA of plastid origin in the genome is also the largest ever reported for an angiosperm mtDNA, both in absolute and relative terms. In all, 42.4% of chloroplast genome of Vitis has been incorporated into its mitochondrial genome. In order to test if horizontal gene transfer (HGT) has also contributed to the gene content of the grape mtDNA, we built phylogenetic trees with the coding sequences of mitochondrial genes of grape and their homologs from plant mitochondrial genomes. Many incongruent gene tree topologies were obtained. However, the extent of incongruence between these gene trees is not significantly greater than that observed among optimal trees for chloroplast genes, the common ancestry of which has never been in doubt. In both cases, we attribute this incongruence to artifacts of tree reconstruction, insufficient numbers of characters, and gene paralogy. This finding leads us to question the recent phylogenetic interpretation of Bergthorsson et al. (2003, 2004) and Richardson and Palmer (2007) that rampant HGT into the mtDNA of Amborella best explains phylogenetic incongruence between mitochondrial gene trees for angiosperms. The only evidence for HGT into the Vitis mtDNA found involves fragments of two coding sequences stemming from two closteroviruses that cause the leaf roll disease of this plant. We also report that analysis of sequences shared by both chloroplast and mitochondrial genomes provides evidence for a previously unknown gene transfer route from the mitochondrion to the chloroplast.

  6. Sessile snails, dynamic genomes: gene rearrangements within the mitochondrial genome of a family of caenogastropod molluscs

    PubMed Central


    Background Widespread sampling of vertebrates, which comprise the majority of published animal mitochondrial genomes, has led to the view that mitochondrial gene rearrangements are relatively rare, and that gene orders are typically stable across major taxonomic groups. In contrast, more limited sampling within the Phylum Mollusca has revealed an unusually high number of gene order arrangements. Here we provide evidence that the lability of the molluscan mitochondrial genome extends to the family level by describing extensive gene order changes that have occurred within the Vermetidae, a family of sessile marine gastropods that radiated from a basal caenogastropod stock during the Cenozoic Era. Results Major mitochondrial gene rearrangements have occurred within this family at a scale unexpected for such an evolutionarily young group and unprecedented for any caenogastropod examined to date. We determined the complete mitochondrial genomes of four species (Dendropoma maximum, D. gregarium, Eualetes tulipa, and Thylacodes squamigerus) and the partial mitochondrial genomes of two others (Vermetus erectus and Thylaeodus sp.). Each of the six vermetid gastropods assayed possessed a unique gene order. In addition to the typical mitochondrial genome complement of 37 genes, additional tRNA genes were evident in D. gregarium (trnK) and Thylacodes squamigerus (trnV, trnLUUR). Three pseudogenes and additional tRNAs found within the genome of Thylacodes squamigerus provide evidence of a past duplication event in this taxon. Likewise, high sequence similarities between isoaccepting leucine tRNAs in Thylacodes, Eualetes, and Thylaeodus suggest that tRNA remolding has been rife within this family. While vermetids exhibit gene arrangements diagnostic of this family, they also share arrangements with littorinimorph caenogastropods, with which they have been linked based on sperm morphology and primary sequence-based phylogenies. Conclusions We have uncovered major changes in gene

  7. Extraordinary number of gene rearrangements in the mitochondrial genomes of lice (Phthiraptera: Insecta).


    Covacin, C; Shao, R; Cameron, S; Barker, S C


    The arrangement of genes in the mitochondrial (mt) genomes of most insects is the same, or near-identical, to that inferred to be ancestral for insects. We sequenced the entire mt genome of the small pigeon louse, Campanulotes bidentatus compar, and part of the mt genomes of nine other species of lice. These species were from six families and the three main suborders of the order Phthiraptera. There was no variation in gene arrangement among species within a family but there was much variation in gene arrangement among the three suborders of lice. There has been an extraordinary number of gene rearrangements in the mitochondrial genomes of lice!

  8. Establishment of mitochondrial pyruvate carrier 1 (MPC1) gene knockout mice with preliminary gene function analyses

    PubMed Central

    Li, Xiaoli; Li, Yaqing; Han, Gaoyang; Li, Xiaoran; Ji, Yasai; Fan, Zhirui; Zhong, Yali; Cao, Jing; Zhao, Jing; Mariusz, Goscinski; Zhang, Mingzhi; Wen, Jianguo; Nesland, Jahn M.; Suo, Zhenhe


    Pyruvate plays a critical role in the mitochondrial tricarboxylic acid (TCA) cycle, and it is the center product for the synthesis of amino acids, carbohydrates and fatty acids. Pyruvate transported across the inner mitochondrial membrane appears to be essential in anabolic and catabolic intermediary metabolism. The mitochondrial pyruvate carrier (MPC) mounted in the inner membrane of mitochondria serves as the channel to facilitate pyruvate permeating. In mammals, the MPC is formed by two paralogous subunits, MPC1 and MPC2. It is known that complete ablation of MPC2 in mice causes death on the 11th or 12th day of the embryonic period. However, MPC1 deletion and the knowledge of gene function in vivo are lacking. Using the new technology of gene manipulation known as Clustered Regularly Interspaced Short Palindromic Repeats/CRISPR-associated 9 (CRISPR/Cas9) systems, we gained stable MPC1 gene heterozygous mutation mice models, and the heterozygous mutations could be stably maintained in their offsprings. Only one line with homozygous 27 bases deletion in the first exon was established, but no offsprings could be obtained after four months of mating experiments, indicating infertility of the mice with such homozygous deletion. The other line of MPC1 knockout (KO) mice was only heterozygous, which mutated in the first exon with a terminator shortly afterwards. These two lines of MPC1 KO mice showed lower fertility and significantly higher bodyweight in the females. We concluded that heterozygous MPC1 KO weakens fertility and influences the metabolism of glucose and fatty acid and bodyweight in mice. PMID:27835892

  9. The human corticosteroid binding globulin gene is located on chromosome 14q31-q32.1 near two other serine protease inhibitor genes.


    Seralini, G E; Bérubé, D; Gagné, R; Hammond, G L


    Human corticosteroid binding globulin (CBG) cDNA fragments were radiolabeled and hybridized in situ to metaphase chromosome preparations. The results localized the CBG gene to the q31-q32.1 region of human chromosome 14. This location also contains the genes for two closely related serine protease inhibitors: alpha 1-proteinase inhibitor and alpha 1-antichymotrypsin. It is therefore likely that these genes evolved by duplication events, and it would appear that this region contains a series of functionally related genes.

  10. Weigh and wait: the prospect of mitochondrial gene replacement.


    Xu, Liang; Shi, Rui


    Mitochondrial DNA transfer has recently received attention from physicians. The transfer techniques place genetic material from the egg nucleus of a woman with a mitochondrial DNA mutation into a healthy donated egg from which the nuclear DNA was removed. This technology intends to reconstruct a mitochondria-competent egg to produce a baby. Three approaches: (1) pronuclear transfer; (2) metaphase II spindle transfer (ST); and (3) polar body (PB) transfer, have been proposed and applied in animal models with very low levels of heteroplasmy. Because there is no curative treatment for patients with mitochondrial dysfunction, the UK government has allowed the use of this pioneering technique to prevent the transmission of rare and devastating mitochondrial diseases. Despite general safety in the observation period, this technology involves germline modification, raising scientific and ethical questions in the public. In this review, we focus on this unprecedented technology and discuss its clinical application in the future.

  11. Phylogenetic incongruence inferred with two mitochondrial genes in Mepraia spp. and Triatoma eratyrusiformis(Hemiptera, Reduviidae)

    PubMed Central

    Campos-Soto, Ricardo; Torres-Pérez, Fernando; Solari, Aldo


    Mitochondrial DNA (mtDNA) is widely used to clarify phylogenetic relationships among and within species, and to determine population structure. Due to the linked nature of mtDNA genes it is expected that different genes will show similar results. Phylogenetic incongruence using mtDNA genes may result from processes such as heteroplasmy, nuclear integration of mitochondrial genes, polymerase errors, contamination, and recombination. In this study we used sequences from two mitochondrial genes (cytochrome b and cytochrome oxidase subunit I) from the wild vectors of Chagas disease, Triatoma eratyrusiformis and Mepraia species to test for topological congruence. The results showed some cases of phylogenetic incongruence due to misplacement of four haplotypes of four individuals. We discuss the possible causes of such incongruence and suggest that the explanation is an intra-individual variation likely due to heteroplasmy. This phenomenon is an independent evidence of common ancestry between these taxa. PMID:26500444

  12. Classical and Novel TSPO Ligands for the Mitochondrial TSPO Can Modulate Nuclear Gene Expression: Implications for Mitochondrial Retrograde Signaling.


    Yasin, Nasra; Veenman, Leo; Singh, Sukhdev; Azrad, Maya; Bode, Julia; Vainshtein, Alex; Caballero, Beatriz; Marek, Ilan; Gavish, Moshe


    It is known that knockdown of the mitochondrial 18 kDa translocator protein (TSPO) as well as TSPO ligands modulate various functions, including functions related to cancer. To study the ability of TSPO to regulate gene expression regarding such functions, we applied microarray analysis of gene expression to U118MG glioblastoma cells. Within 15 min, the classical TSPO ligand PK 11195 induced changes in expression of immediate early genes and transcription factors. These changes also included gene products that are part of the canonical pathway serving to modulate general gene expression. These changes are in accord with real-time, reverse transcriptase (RT) PCR. At the time points of 15, 30, 45, and 60 min, as well as 3 and 24 h of PK 11195 exposure, the functions associated with the changes in gene expression in these glioblastoma cells covered well known TSPO functions. These functions included cell viability, proliferation, differentiation, adhesion, migration, tumorigenesis, and angiogenesis. This was corroborated microscopically for cell migration, cell accumulation, adhesion, and neuronal differentiation. Changes in gene expression at 24 h of PK 11195 exposure were related to downregulation of tumorigenesis and upregulation of programmed cell death. In the vehicle treated as well as PK 11195 exposed cell cultures, our triple labeling showed intense TSPO labeling in the mitochondria but no TSPO signal in the cell nuclei. Thus, mitochondrial TSPO appears to be part of the mitochondria-to-nucleus signaling pathway for modulation of nuclear gene expression. The novel TSPO ligand 2-Cl-MGV-1 appeared to be very specific regarding modulation of gene expression of immediate early genes and transcription factors.

  13. Loss of mitochondrial protease OMA1 alters processing of the GTPase OPA1 and causes obesity and defective thermogenesis in mice

    PubMed Central

    Quirós, Pedro M; Ramsay, Andrew J; Sala, David; Fernández-Vizarra, Erika; Rodríguez, Francisco; Peinado, Juan R; Fernández-García, Maria Soledad; Vega, José A; Enríquez, José A; Zorzano, Antonio; López-Otín, Carlos


    Mitochondria are dynamic subcellular organelles that convert nutrient intermediates into readily available energy equivalents. Optimal mitochondrial function is ensured by a highly evolved quality control system, coordinated by protein machinery that regulates a process of continual fusion and fission. In this work, we provide in vivo evidence that the ATP-independent metalloprotease OMA1 plays an essential role in the proteolytic inactivation of the dynamin-related GTPase OPA1 (optic atrophy 1). We also show that OMA1 deficiency causes a profound perturbation of the mitochondrial fusion–fission equilibrium that has important implications for metabolic homeostasis. Thus, ablation of OMA1 in mice results in marked transcriptional changes in genes of lipid and glucose metabolic pathways and substantial alterations in circulating blood parameters. Additionally, Oma1-mutant mice exhibit an increase in body weight due to increased adipose mass, hepatic steatosis, decreased energy expenditure and impaired thermogenenesis. These alterations are especially significant under metabolic stress conditions, indicating that an intact OMA1-OPA1 system is essential for developing the appropriate adaptive response to different metabolic stressors such as a high-fat diet or cold-shock. This study provides the first description of an unexpected role in energy metabolism for the metalloprotease OMA1 and reinforces the importance of mitochondrial quality control for normal metabolic function. PMID:22433842

  14. A high-fat diet coordinately downregulates genes required for mitochondrial oxidative phosphorylation in skeletal muscle.


    Sparks, Lauren M; Xie, Hui; Koza, Robert A; Mynatt, Randall; Hulver, Matthew W; Bray, George A; Smith, Steven R


    Obesity and type 2 diabetes have been associated with a high-fat diet (HFD) and reduced mitochondrial mass and function. We hypothesized a HFD may affect expression of genes involved in mitochondrial function and biogenesis. To test this hypothesis, we fed 10 insulin-sensitive males an isoenergetic HFD for 3 days with muscle biopsies before and after intervention. Oligonucleotide microarray analysis revealed 297 genes were differentially regulated by the HFD (Bonferonni adjusted P < 0.001). Six genes involved in oxidative phosphorylation (OXPHOS) decreased. Four were members of mitochondrial complex I: NDUFB3, NDUFB5, NDUFS1, and NDUFV1; one was SDHB in complex II and a mitochondrial carrier protein SLC25A12. Peroxisome proliferator-activated receptor gamma coactivator-1 (PGC1) alpha and PGC1beta mRNA were decreased by -20%, P < 0.01, and -25%, P < 0.01, respectively. In a separate experiment, we fed C57Bl/6J mice a HFD for 3 weeks and found that the same OXPHOS and PGC1 mRNAs were downregulated by approximately 90%, cytochrome C and PGC1alpha protein by approximately 40%. Combined, these results suggest a mechanism whereby HFD downregulates genes necessary for OXPHOS and mitochondrial biogenesis. These changes mimic those observed in diabetes and insulin resistance and, if sustained, may result in mitochondrial dysfunction in the prediabetic/insulin-resistant state.

  15. Sensitivity of hematopoietic stem cells to mitochondrial dysfunction by SdhD gene deletion

    PubMed Central

    Bejarano-García, José Antonio; Millán-Uclés, África; Rosado, Iván V; Sánchez-Abarca, Luís Ignacio; Caballero-Velázquez, Teresa; Durán-Galván, María José; Pérez-Simón, José Antonio; Piruat, José I


    It is established that hematopoietic stem cells (HSC) in the hypoxic bone marrow have adapted their metabolism to oxygen-limiting conditions. This adaptation includes suppression of mitochondrial activity, induction of anerobic glycolysis, and activation of hypoxia-inducible transcription factor 1α (Hif1α)-dependent gene expression. During progression of hematopoiesis, a metabolic switch towards mitochondrial oxidative phosphorylation is observed, making this organelle essential for determining cell fate choice in bone marrow. However, given that HSC metabolism is essentially oxygen-independent, it is still unclear whether functional mitochondria are absolutely required for their survival. To assess the actual dependency of these undifferentiated cells on mitochondrial function, we have performed an analysis of the hematopoiesis in a mouse mutant, named SDHD-ESR, with inducible deletion of the mitochondrial protein-encoding SdhD gene. This gene encodes one of the subunits of the mitochondrial complex II (MCII). In this study, we demonstrate that, in contrast to what has been previously established, survival of HSC, and also myeloid and B-lymphoid progenitors, depends on proper mitochondrial activity. In addition, gene expression analysis of these hematopoietic lineages in SDHD-ESR mutants calls into question the proposed activation of Hif1α in response to MCII dysfunction. PMID:27929539

  16. Complete mitochondrial genomes of Trisidos kiyoni and Potiarca pilula: Varied mitochondrial genome size and highly rearranged gene order in Arcidae

    PubMed Central

    Sun, Shao’e; Li, Qi; Kong, Lingfeng; Yu, Hong


    We present the complete mitochondrial genomes (mitogenomes) of Trisidos kiyoni and Potiarca pilula, both important species from the family Arcidae (Arcoida: Arcacea). Typical bivalve mtDNA features were described, such as the relatively conserved gene number (36 and 37), a high A + T content (62.73% and 61.16%), the preference for A + T-rich codons, and the evidence of non-optimal codon usage. The mitogenomes of Arcidae species are exceptional for their extraordinarily large and variable sizes and substantial gene rearrangements. The mitogenome of T. kiyoni (19,614 bp) and P. pilula (28,470 bp) are the two smallest Arcidae mitogenomes. The compact mitogenomes are weakly associated with gene number and primarily reflect shrinkage of the non-coding regions. The varied size in Arcidae mitogenomes reflect a dynamic history of expansion. A significant positive correlation is observed between mitogenome size and the combined length of cox1-3, the lengths of Cytb, and the combined length of rRNAs (rrnS and rrnL) (P < 0.001). Both protein coding genes (PCGs) and tRNA rearrangements is observed in P. pilula and T. kiyoni mitogenomes. This analysis imply that the complicated gene rearrangement in mitochondrial genome could be considered as one of key characters in inferring higher-level phylogenetic relationship of Arcidae. PMID:27653979

  17. Global variability in gene expression and alternative splicing is modulated by mitochondrial content.


    Guantes, Raul; Rastrojo, Alberto; Neves, Ricardo; Lima, Ana; Aguado, Begoña; Iborra, Francisco J


    Noise in gene expression is a main determinant of phenotypic variability. Increasing experimental evidence suggests that genome-wide cellular constraints largely contribute to the heterogeneity observed in gene products. It is still unclear, however, which global factors affect gene expression noise and to what extent. Since eukaryotic gene expression is an energy demanding process, differences in the energy budget of each cell could determine gene expression differences. Here, we quantify the contribution of mitochondrial variability (a natural source of ATP variation) to global variability in gene expression. We find that changes in mitochondrial content can account for ∼50% of the variability observed in protein levels. This is the combined result of the effect of mitochondria dosage on transcription and translation apparatus content and activities. Moreover, we find that mitochondrial levels have a large impact on alternative splicing, thus modulating both the abundance and type of mRNAs. A simple mathematical model in which mitochondrial content simultaneously affects transcription rate and splicing site choice can explain the alternative splicing data. The results of this study show that mitochondrial content (and/or probably function) influences mRNA abundance, translation, and alternative splicing, which ultimately affects cellular phenotype.

  18. Global variability in gene expression and alternative splicing is modulated by mitochondrial content

    PubMed Central

    Guantes, Raul; Rastrojo, Alberto; Neves, Ricardo; Lima, Ana; Aguado, Begoña; Iborra, Francisco J.


    Noise in gene expression is a main determinant of phenotypic variability. Increasing experimental evidence suggests that genome-wide cellular constraints largely contribute to the heterogeneity observed in gene products. It is still unclear, however, which global factors affect gene expression noise and to what extent. Since eukaryotic gene expression is an energy demanding process, differences in the energy budget of each cell could determine gene expression differences. Here, we quantify the contribution of mitochondrial variability (a natural source of ATP variation) to global variability in gene expression. We find that changes in mitochondrial content can account for ∼50% of the variability observed in protein levels. This is the combined result of the effect of mitochondria dosage on transcription and translation apparatus content and activities. Moreover, we find that mitochondrial levels have a large impact on alternative splicing, thus modulating both the abundance and type of mRNAs. A simple mathematical model in which mitochondrial content simultaneously affects transcription rate and splicing site choice can explain the alternative splicing data. The results of this study show that mitochondrial content (and/or probably function) influences mRNA abundance, translation, and alternative splicing, which ultimately affects cellular phenotype. PMID:25800673

  19. Brief Report: High Frequency of Biochemical Markers for Mitochondrial Dysfunction in Autism: No Association with the Mitochondrial Aspartate/Glutamate Carrier "SLC25A12" Gene

    ERIC Educational Resources Information Center

    Correia, Catarina; Coutinho, Ana M.; Diogo, Luisa; Grazina, Manuela; Marques, Carla; Miguel, Teresa; Ataide, Assuncao; Almeida, Joana; Borges, Luis; Oliveira, Catarina; Oliveira, Guiomar; Vicente, Astrid M.


    In the present study we confirm the previously reported high frequency of biochemical markers of mitochondrial dysfunction, namely hyperlactacidemia and increased lactate/pyruvate ratio, in a significant fraction of 210 autistic patients. We further examine the involvement of the mitochondrial aspartate/glutamate carrier gene ("SLC25A12") in…

  20. CRISPR/Cas9 and mitochondrial gene replacement therapy: promising techniques and ethical considerations.


    Fogleman, Sarah; Santana, Casey; Bishop, Casey; Miller, Alyssa; Capco, David G


    Thousands of mothers are at risk of transmitting mitochondrial diseases to their offspring each year, with the most severe form of these diseases being fatal [1]. With no cure, transmission prevention is the only current hope for decreasing the disease incidence. Current methods of prevention rely on low mutant maternal mitochondrial DNA levels, while those with levels close to or above threshold (>60%) are still at a very high risk of transmission [2]. Two novel approaches may offer hope for preventing and treating mitochondrial disease: mitochondrial replacement therapy, and CRISPR/Cas9. Mitochondrial replacement therapy has emerged as a promising tool that has the potential to prevent transmission in patients with higher mutant mitochondrial loads. This method is the subject of many ethical concerns due its use of a donor embryo to transplant the patient's nuclear DNA; however, it has ultimately been approved for use in the United Kingdom and was recently declared ethically permissible by the FDA. The leading-edge CRISPR/Cas9 technology exploits the principles of bacterial immune function to target and remove specific sequences of mutated DNA. This may have potential in treating individuals with disease caused by mutant mitochondrial DNA. As the technology progresses, it is important that the ethical considerations herein emerge and become more established. The purpose of this review is to discuss current research surrounding the procedure and efficacy of the techniques, compare the ethical concerns of each approach, and look into the future of mitochondrial gene replacement therapy.

  1. CRISPR/Cas9 and mitochondrial gene replacement therapy: promising techniques and ethical considerations

    PubMed Central

    Fogleman, Sarah; Santana, Casey; Bishop, Casey; Miller, Alyssa; Capco, David G


    Thousands of mothers are at risk of transmitting mitochondrial diseases to their offspring each year, with the most severe form of these diseases being fatal [1]. With no cure, transmission prevention is the only current hope for decreasing the disease incidence. Current methods of prevention rely on low mutant maternal mitochondrial DNA levels, while those with levels close to or above threshold (>60%) are still at a very high risk of transmission [2]. Two novel approaches may offer hope for preventing and treating mitochondrial disease: mitochondrial replacement therapy, and CRISPR/Cas9. Mitochondrial replacement therapy has emerged as a promising tool that has the potential to prevent transmission in patients with higher mutant mitochondrial loads. This method is the subject of many ethical concerns due its use of a donor embryo to transplant the patient’s nuclear DNA; however, it has ultimately been approved for use in the United Kingdom and was recently declared ethically permissible by the FDA. The leading-edge CRISPR/Cas9 technology exploits the principles of bacterial immune function to target and remove specific sequences of mutated DNA. This may have potential in treating individuals with disease caused by mutant mitochondrial DNA. As the technology progresses, it is important that the ethical considerations herein emerge and become more established. The purpose of this review is to discuss current research surrounding the procedure and efficacy of the techniques, compare the ethical concerns of each approach, and look into the future of mitochondrial gene replacement therapy. PMID:27725916

  2. The natural killer cell serine protease gene Lmet1 maps to mouse chromosome 10

    SciTech Connect

    Thia, K.Y.T.; Smyth, M.J.; Jenkins, N.A.; Gilbert, D.J.; Copeland, N.G.


    Cytotoxic lymphocytes play a key role in immune responses against viruses and tumors. Lymphocyte-mediated cytolysis by both cytotoxic T lymphocytes (CTL) and natural killer (NK) cells is often associated with the formation of membrane lesions on target cells caused by exocytosis of cytoplasmic granule serine proteases and a pore-forming protein, perforin. A variety of granzymes have been found to reside within the cytoplasmic granules of cytotoxic lymphocytes, but unlike perforin, isolated serine proteases are not intrinsically lytic. However, a role for serine proteases in cellular cytotoxicity has been supported by the ability of protease inhibitors to completely abrogate lymphocyte cytotoxicity, and the demonstration that serine proteases can initiate DNA fragmentation in target cells transfected or pretreated with a sublytic concentration of perforin. Granzymes cloned in human, mouse, and rat encode four granzyme activities and all are expressed in either T cells, their thymic precursors, and/or NK cells. In particular, a rat granzyme that cleaves after methionine residues, but not phenylalanine residues and its human equivalent, human Met-ase 1, are unique granzymes with restricted expression in CD3-NK cells. 24 refs., 2 figs.

  3. Uniparental Inheritance of Mitochondrial Genes in Yeast: Dependence on Input Bias of Mitochondrial DNA and Preliminary Investigations of the Mechanism

    PubMed Central

    Birky, C. William; Demko, Catherine A.; Perlman, Philip S.; Strausberg, Robert


    In Saccharomyces cerevisiae, previous studies on the inheritance of mitochondrial genes controlling antibiotic resistance have shown that some crosses produce a substantial number of uniparental zygotes , which transmit to their diploid progeny mitochondrial alleles from only one parent. In this paper, we show that uniparental zygotes are formed especially when one parent (majority parent) contributes substantially more mitochondrial DNA molecules to the zygote than does the other (minority) parent. Cellular contents of mitochondrial DNA (mtDNA) are increased in these experiments by treatment with cycloheximide, alpha-factor, or the uvsρ5 nuclear mutation. In such a biased cross, some zygotes are uniparental for mitochondrial alleles from the majority parent, and the frequency of such zygotes increases with increasing bias. In two- and three-factor crosses, the cap1, ery1, and oli1 loci behave coordinately, rather than independently; minority markers tend to be transmitted or lost as a unit, suggesting that the uniparental mechanism acts on entire mtDNA molecules rather than on individual loci. This rules out the possibility that uniparental inheritance can be explained by the conversion of minority markers to the majority alleles during recombination. Exceptions to the coordinate behavior of different loci can be explained by marker rescue via recombination. Uniparental inheritance is largely independent of the position of buds on the zygote. We conclude that it is due to the failure of minority markers to replicate in some zygotes, possibly involving the rapid enzymatic destruction of such markers. We have considered two general classes of mechanisms: (1) random selection of molecules for replication, as for example by competition for replicating sites on a membrane; and (2) differential marking of mtDNA molecules in the two parents, possibly by modification enzymes, followed by a mechanism that "counts" molecules and replicates only the majority type. These

  4. RNA sequencing reveals differential expression of mitochondrial and oxidation reduction genes in the long-lived naked mole-rat when compared to mice.


    Yu, Chuanfei; Li, Yang; Holmes, Andrew; Szafranski, Karol; Faulkes, Chris G; Coen, Clive W; Buffenstein, Rochelle; Platzer, Matthias; de Magalhães, João Pedro; Church, George M


    The naked mole-rat (Heterocephalus glaber) is a long-lived, cancer resistant rodent and there is a great interest in identifying the adaptations responsible for these and other of its unique traits. We employed RNA sequencing to compare liver gene expression profiles between naked mole-rats and wild-derived mice. Our results indicate that genes associated with oxidoreduction and mitochondria were expressed at higher relative levels in naked mole-rats. The largest effect is nearly 300-fold higher expression of epithelial cell adhesion molecule (Epcam), a tumour-associated protein. Also of interest are the protease inhibitor, alpha2-macroglobulin (A2m), and the mitochondrial complex II subunit Sdhc, both ageing-related genes found strongly over-expressed in the naked mole-rat. These results hint at possible candidates for specifying species differences in ageing and cancer, and in particular suggest complex alterations in mitochondrial and oxidation reduction pathways in the naked mole-rat. Our differential gene expression analysis obviated the need for a reference naked mole-rat genome by employing a combination of Illumina/Solexa and 454 platforms for transcriptome sequencing and assembling transcriptome contigs of the non-sequenced species. Overall, our work provides new research foci and methods for studying the naked mole-rat's fascinating characteristics.

  5. Separate nuclear genes encode cytosolic and mitochondrial nucleoside diphosphate kinase in Dictyostelium discoideum.


    Troll, H; Winckler, T; Lascu, I; Müller, N; Saurin, W; Véron, M; Mutzel, R


    We have previously isolated cDNA clones for the gip17 gene encoding the cytosolic nucleoside diphosphate (NDP) kinase from Dictyostelium discoideum, and partial cDNAs for guk, a second member of the NDP kinase gene family (Wallet, V., Mutzel, R., Troll, H., Barzu, O., Wurster, B., Véron, M., and Lacombe, M. L. (1990) J. Natl. Cancer Inst. 80, 1199-1202). We now characterize genomic DNA clones for both NDP kinase genes, and we show that guk defines a nuclear-encoded mitochondrial NDP kinase. Isolated D. discoideum mitochondria contain 3% of the total cellular NDP kinase activity. Antibodies which specifically recognize and inhibit the activity of either cytosolic or mitochondrial NDP kinase unambiguously distinguish between these activities. The nascent mitochondrial NDP kinase contains a presequence of 57 amino acids that is removed during import into the organelle as shown by determination of the NH2 terminus of the mature protein from mitochondria. The genes for mitochondrial and cytosolic NDP kinases contain four and two introns, respectively. The positions of the of the introns in the gene for the cytosolic enzyme match exactly the positions of the second and fourth introns in the coding region of its mitochondrial homologue. From these results we conclude that the isozymes diverged from a common ancestor, and we discuss possible phylogenetic pathways for the evolution of cytosolic and organelle NDP kinases.

  6. Effects of dietary soybean stachyose and phytic acid on gene expressions of serine proteases in Japanese flounder ( Paralichthys olivaceus)

    NASA Astrophysics Data System (ADS)

    Mi, Haifeng; Mai, Kangsen; Zhang, Wenbing; Wu, Chenglong; Cai, Yinghua


    Soybean stachyose (SBS) and phytic acid (PA) are anti-nutritional factors (ANF) which have deleterious effects on the growth and digestibility in fish. The present research studied the effects of dietary SBS and PA on the expression of three serine protease genes in the liver of Japanese flounder ( Paralichthys olivaceus). These genes are trypsinogen 1 (poTRY), elastase 1 (poEL) and chymotrypsinogen 1 (poCTRY). Eight artificial diets with graded levels of supplemented ANFs were formulated to 4 levels of SBS (0.00, 0.40, 0.80 and 1.50%), 4 levels of PA (0.00, 0.20, 0.40 and 0.80), respectively. Japanese flounder (initial weight 2.45 g ± 0.01 g) were fed with these diets for 10 weeks with three replications per treatment. At the end of 10 weeks, supplementation of 0.40% of dietary SBS or PA significantly increased the gene expression of poTRY and poCTRY ( P<0.05). The same level of dietary SBS significantly decreased the gene expression of poEL. In comparison with the control group (ANF-free), dietary PA (0.2% and 0.8%) significantly decreased the gene expression of poTRY, poCTRY and poEL ( P<0.05). However, excessive supplement of dietary SBS (1.5%) has no significant effects on these gene expressions ( P>0.05). These results suggested that dietary SBS and dietary PA could directly affect the serine protease genes at the transcriptional level in Japanese flounder, and these genes' expression was more sensitive to dietary PA than to SBS under the current experimental conditions.

  7. Mitochondrial gene replacement in primate offspring and embryonic stem cells.


    Tachibana, Masahito; Sparman, Michelle; Sritanaudomchai, Hathaitip; Ma, Hong; Clepper, Lisa; Woodward, Joy; Li, Ying; Ramsey, Cathy; Kolotushkina, Olena; Mitalipov, Shoukhrat


    Mitochondria are found in all eukaryotic cells and contain their own genome (mitochondrial DNA or mtDNA). Unlike the nuclear genome, which is derived from both the egg and sperm at fertilization, the mtDNA in the embryo is derived almost exclusively from the egg; that is, it is of maternal origin. Mutations in mtDNA contribute to a diverse range of currently incurable human diseases and disorders. To establish preclinical models for new therapeutic approaches, we demonstrate here that the mitochondrial genome can be efficiently replaced in mature non-human primate oocytes (Macaca mulatta) by spindle-chromosomal complex transfer from one egg to an enucleated, mitochondrial-replete egg. The reconstructed oocytes with the mitochondrial replacement were capable of supporting normal fertilization, embryo development and produced healthy offspring. Genetic analysis confirmed that nuclear DNA in the three infants born so far originated from the spindle donors whereas mtDNA came from the cytoplast donors. No contribution of spindle donor mtDNA was detected in offspring. Spindle replacement is shown here as an efficient protocol replacing the full complement of mitochondria in newly generated embryonic stem cell lines. This approach may offer a reproductive option to prevent mtDNA disease transmission in affected families.

  8. Mitochondrial metagenomics: letting the genes out of the bottle.


    Crampton-Platt, Alex; Yu, Douglas W; Zhou, Xin; Vogler, Alfried P


    'Mitochondrial metagenomics' (MMG) is a methodology for shotgun sequencing of total DNA from specimen mixtures and subsequent bioinformatic extraction of mitochondrial sequences. The approach can be applied to phylogenetic analysis of taxonomically selected taxa, as an economical alternative to mitogenome sequencing from individual species, or to environmental samples of mixed specimens, such as from mass trapping of invertebrates. The routine generation of mitochondrial genome sequences has great potential both for systematics and community phylogenetics. Mapping of reads from low-coverage shotgun sequencing of environmental samples also makes it possible to obtain data on spatial and temporal turnover in whole-community phylogenetic and species composition, even in complex ecosystems where species-level taxonomy and biodiversity patterns are poorly known. In addition, read mapping can produce information on species biomass, and potentially allows quantification of within-species genetic variation. The success of MMG relies on the formation of numerous mitochondrial genome contigs, achievable with standard genome assemblers, but various challenges for the efficiency of assembly remain, particularly in the face of variable relative species abundance and intra-specific genetic variation. Nevertheless, several studies have demonstrated the power of mitogenomes from MMG for accurate phylogenetic placement, evolutionary analysis of species traits, biodiversity discovery and the establishment of species distribution patterns; it offers a promising avenue for unifying the ecological and evolutionary understanding of species diversity.

  9. Genome-wide identification, evolutuionary and expression analysis of aspartic proteases gene superfamily in grape

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Aspartic proteases (APs) are a large family of proteolytic enzymes in vertebrates, plants, yeast, nematodes, parasites, fungi, and viruses. In plants, they are involved in many biological processes, such as plant senescence, stress response, programmed cell death, and reproduction. Prior to the pr...

  10. Evidence for a novel mitochondrial promoter preceding the cox2 gene of perennial teosintes.

    PubMed Central

    Newton, K J; Winberg, B; Yamato, K; Lupold, S; Stern, D B


    We have characterized two promoters of the cytochrome oxidase subunit 2 (cox2) gene in Zea perennis mitochondria present in maize lines. Initiation at a site 907 bases upstream of the start codon results in the major approximately 1900 nt cox2 transcript. A sequence just upstream of this site conforms to the consensus described for maize mitochondrial promoters and its transcription is correctly initiated in a maize mitochondrial in vitro transcription extract. A second transcription initiation site (-347) is used only when the dominant allele of a nuclear gene, Mct, is present and its use results in an additional, shorter major transcript. Sequences flanking the Mct-dependent transcription initiation site, which we have termed the conditional promoter of cox2 (cpc), do not fit the maize mitochondrial promoter consensus and do not function in the maize in vitro transcription extract. The cpc region does not hybridize with mitochondrial, chloroplast or nuclear DNAs from most maize or teosinte lines. However, the cpc sequence is found in the same position upstream of the cox2 gene in Zea diploperennis mtDNA and it has striking similarity to the previously reported 'ORF of unknown origin' fused to the ATPase subunit 6 gene in maize CMS-C mitochondria. cpc appears to represent a new type of mitochondrial promoter. Further analysis of both conditional and constitutive promoters should help us to better understand the control of transcription in plant mitochondria. Images PMID:7859746

  11. Mitochondrial content is central to nuclear gene expression: Profound implications for human health.


    Muir, Rebecca; Diot, Alan; Poulton, Joanna


    We review a recent paper in Genome Research by Guantes et al. showing that nuclear gene expression is influenced by the bioenergetic status of the mitochondria. The amount of energy that mitochondria make available for gene expression varies considerably. It depends on: the energetic demands of the tissue; the mitochondrial DNA (mtDNA) mutant load; the number of mitochondria; stressors present in the cell. Hence, when failing mitochondria place the cell in energy crisis there are major effects on gene expression affecting the risk of degenerative diseases, cancer and ageing. In 2015 the UK parliament approved a change in the regulation of IVF techniques, allowing "Mitochondrial replacement therapy" to become a reproductive choice for women at risk of transmitting mitochondrial disease to their children. This is the first time that this technique will be available. Therefore understanding the interaction between mitochondria and the nucleus has never been more important.

  12. Gene organization and complete sequence of the mitochondrial genome of Linwu mallard.


    Tian, Ke-Xiong; Liu, Li-Li; Yu, Qi-Fang; He, Shao-Ping; He, Jian-Hua


    Linwu mallard is an excellent native breeds from Hunan province in China. This is the first study to determine the complete mitochondrial genome sequence of L. mallard using PCR-based amplification and Sanger sequencing. The characteristic of the entire mitochondrial genome was analyzed in detail, with the base composition of 29.19% A, 22.19% T, 32.83% C, 15.79% G in the L. mallard (16,605 bp in length). It contained 2 ribosomal RNA genes, 13 protein-coding genes, 22 transfer RNA genes and a major non-coding control region (D-loop region). The complete mitochondrial genome sequence of L. mallard will be useful for the phylogenetics of poultry, and be available as basic data for the genetics and breeding.

  13. Gene clusters for ribosomal proteins in the mitochondrial genome of a liverwort, Marchantia polymorpha.

    PubMed Central

    Takemura, M; Oda, K; Yamato, K; Ohta, E; Nakamura, Y; Nozato, N; Akashi, K; Ohyama, K


    We detected 16 genes for ribosomal proteins in the complete sequence of the mitochondrial DNA from a liverwort, Marchantia polymorpha. The genes formed two major clusters, rps12-rps7 and rps10-rpl2-rps19-rps3-rpl16-rpl5- rps14-rps8- rpl6-rps13-rps11-rps1, very similar in organization to Escherichia coli ribosomal protein operons (str and S10-spc-alpha operons, respectively). In contrast, rps2 and rps4 genes were located separately in the liverwort mitochondrial genome (the latter was part of the alpha operon in E. coli). Furthermore, several ribosomal proteins encoded by the liverwort mitochondrial genome differed substantially in size from their counterparts in E. coli and liverwort chloroplast. PMID:1620617

  14. Mitogenomic analyses propose positive selection in mitochondrial genes for high-altitude adaptation in galliform birds.


    Zhou, Taicheng; Shen, Xuejuan; Irwin, David M; Shen, Yongyi; Zhang, Yaping


    Galliform birds inhabit very diverse habitats, including plateaus that are above 3000 m in altitude. At high altitude, lower temperature and hypoxia are two important factors influencing survival. Mitochondria, as the ultimate oxygen transductor, play an important role in aerobic respiration through oxidative phosphorylation (OXPHOS). We analyzed the mitochondrial genomes of six high-altitude phasianidae birds and sixteen low-altitude relatives in an attempt to determine the role of mitochondrial genes in high-altitude adaptation. We reconstructed the phylogenetic relationships of these phasianidae birds and relatives and found at least four lineages that independently occupied this high-altitude habitat. Selective analyses revealed significant evidence for positive selection in the genes ND2, ND4, and ATP6 in three of the high-altitude lineages. This result strongly suggests that adaptive evolution of mitochondrial genes played a critical role during the independent acclimatization to high altitude by galliform birds.

  15. Mitochondrial content is central to nuclear gene expression: Profound implications for human health

    PubMed Central

    Muir, Rebecca; Diot, Alan


    We review a recent paper in Genome Research by Guantes et al. showing that nuclear gene expression is influenced by the bioenergetic status of the mitochondria. The amount of energy that mitochondria make available for gene expression varies considerably. It depends on: the energetic demands of the tissue; the mitochondrial DNA (mtDNA) mutant load; the number of mitochondria; stressors present in the cell. Hence, when failing mitochondria place the cell in energy crisis there are major effects on gene expression affecting the risk of degenerative diseases, cancer and ageing. In 2015 the UK parliament approved a change in the regulation of IVF techniques, allowing “Mitochondrial replacement therapy” to become a reproductive choice for women at risk of transmitting mitochondrial disease to their children. This is the first time that this technique will be available. Therefore understanding the interaction between mitochondria and the nucleus has never been more important. PMID:26725055

  16. Improved systematic tRNA gene annotation allows new insights into the evolution of mitochondrial tRNA structures and into the mechanisms of mitochondrial genome rearrangements

    PubMed Central

    Jühling, Frank; Pütz, Joern; Bernt, Matthias; Donath, Alexander; Middendorf, Martin; Florentz, Catherine; Stadler, Peter F.


    Transfer RNAs (tRNAs) are present in all types of cells as well as in organelles. tRNAs of animal mitochondria show a low level of primary sequence conservation and exhibit ‘bizarre’ secondary structures, lacking complete domains of the common cloverleaf. Such sequences are hard to detect and hence frequently missed in computational analyses and mitochondrial genome annotation. Here, we introduce an automatic annotation procedure for mitochondrial tRNA genes in Metazoa based on sequence and structural information in manually curated covariance models. The method, applied to re-annotate 1876 available metazoan mitochondrial RefSeq genomes, allows to distinguish between remaining functional genes and degrading ‘pseudogenes’, even at early stages of divergence. The subsequent analysis of a comprehensive set of mitochondrial tRNA genes gives new insights into the evolution of structures of mitochondrial tRNA sequences as well as into the mechanisms of genome rearrangements. We find frequent losses of tRNA genes concentrated in basal Metazoa, frequent independent losses of individual parts of tRNA genes, particularly in Arthropoda, and wide-spread conserved overlaps of tRNAs in opposite reading direction. Direct evidence for several recent Tandem Duplication-Random Loss events is gained, demonstrating that this mechanism has an impact on the appearance of new mitochondrial gene orders. PMID:22139921

  17. Biased introgression of mitochondrial and nuclear genes: a comparison of diploid and haplodiploid systems.


    Patten, Manus M; Carioscia, Sara A; Linnen, Catherine R


    Hybridization between recently diverged species, even if infrequent, can lead to the introgression of genes from one species into another. The rates of mitochondrial and nuclear introgression often differ, with some taxa showing biases for mitochondrial introgression and others for nuclear introgression. Several hypotheses exist to explain such biases, including adaptive introgression, sex differences in dispersal rates, sex-specific prezygotic isolation and sex-specific fitness of hybrids (e.g. Haldane's rule). We derive a simple population genetic model that permits an analysis of sex-specific demographic and fitness parameters and measures the relative rates of mitochondrial and nuclear introgression between hybridizing pairs. We do this separately for diploid and haplodiploid species. For diploid taxa, we recover results consistent with previous hypotheses: an excess of one sex among the hybridizing migrants or sex-specific prezygotic isolation causes a bias for one type of marker or the other; when Haldane's rule is obeyed, we find a mitochondrial bias in XY systems and a nuclear bias in ZW systems. For haplodiploid taxa, the model reveals that owing to their unique transmission genetics, they are seemingly assured of strong mitochondrial biases in introgression rates, unlike diploid taxa, where the relative fitness of male and female hybrids can tip the bias in either direction. This heretofore overlooked aspect of hybridization in haplodiploids provides what is perhaps the most likely explanation for differential introgression of mitochondrial and nuclear markers and raises concerns about the use of mitochondrial DNA barcodes for species delimitation in these taxa.

  18. The mitochondrial UPR - protecting organelle protein homeostasis.


    Haynes, Cole M; Ron, David


    Mitochondria are required for numerous essential metabolic processes including the regulation of apoptosis; therefore, proper maintenance of the mitochondrial proteome is crucial. The protein-folding environment in mitochondria is challenged by organelle architecture, the presence of reactive oxygen species and the difficulties associated with assembly of the electron transport chain, which consists of components encoded by both the mitochondrial and the nuclear genomes. Mitochondria have dedicated molecular chaperones and proteases that promote proper protein folding, complex assembly and quality control. Work in cultured mammalian cells and Caenorhabditis elegans has yielded clues to the mechanisms linking perturbations in the protein-folding environment in the mitochondrial matrix to the expression of nuclear genes encoding mitochondrial proteins. Here, we review the current knowledge of this mitochondrial unfolded protein response (UPR(mt)), compare it with the better understood UPR of the endoplasmic reticulum and highlight its potential impact on development and disease.

  19. Is Mitochondrial Donation Germ-Line Gene Therapy? Classifications and Ethical Implications.


    Newson, Ainsley J; Wrigley, Anthony


    The classification of techniques used in mitochondrial donation, including their role as purported germ-line gene therapies, is far from clear. These techniques exhibit characteristics typical of a variety of classifications that have been used in both scientific and bioethics scholarship. This raises two connected questions, which we address in this paper: (i) how should we classify mitochondrial donation techniques?; and (ii) what ethical implications surround such a classification? First, we outline how methods of genetic intervention, such as germ-line gene therapy, are typically defined or classified. We then consider whether techniques of mitochondrial donation fit into these, whether they might do so with some refinement of these categories, or whether they require some other approach to classification. To answer the second question, we discuss the relationship between classification and several key ethical issues arising from mitochondrial donation. We conclude that the properties characteristic of mitochondrial inheritance mean that most mitochondrial donation techniques belong to a new sub-class of genetic modification, which we call 'conditionally inheritable genomic modification' (CIGM).

  20. Two novel gene orders and the role of light-strand replication in rearrangement of the vertebrate mitochondrial genome.


    Macey, J R; Larson, A; Ananjeva, N B; Fang, Z; Papenfuss, T J


    Two novel mitochondrial gene arrangements are identified in an agamid lizard and a ranid frog. Statistical tests incorporating phylogeny indicate a link between novel vertebrate mitochondrial gene orders and movement of the origin of light-strand replication. A mechanism involving errors in light-strand replication and tandem duplication of genes is proposed for rearrangement of vertebrate mitochondrial genes. A second mechanism involving small direct repeats also is identified. These mechanisms implicate gene order as a reliable phylogenetic character. Shifts in gene order define major lineages without evidence of parallelism or reversal. The loss of the origin of light-strand replication from its typical vertebrate position evolves in parallel and, therefore, is a less reliable phylogenetic character. Gene junctions also evolve in parallel. Sequencing across multigenic regions, in particular transfer RNA genes, should be a major focus of future systematic studies to locate novel gene orders and to provide a better understanding of the evolution of the vertebrate mitochondrial genome.

  1. Deregulation of Genes Related to Iron and Mitochondrial Metabolism in Refractory Anemia with Ring Sideroblasts

    PubMed Central

    del Rey, Mónica; Benito, Rocío; Fontanillo, Celia; Campos-Laborie, Francisco J.; Janusz, Kamila; Velasco-Hernández, Talía; Abáigar, María; Hernández, María; Cuello, Rebeca; Borrego, Daniel; Martín-Zanca, Dionisio; De Las Rivas, Javier; Mills, Ken I.; Hernández-Rivas, Jesús M.


    The presence of SF3B1 gene mutations is a hallmark of refractory anemia with ring sideroblasts (RARS). However, the mechanisms responsible for iron accumulation that characterize the Myelodysplastic Syndrome with ring sideroblasts (MDS-RS) are not completely understood. In order to gain insight in the molecular basis of MDS-RS, an integrative study of the expression and mutational status of genes related to iron and mitochondrial metabolism was carried out. A total of 231 low-risk MDS patients and 81 controls were studied. Gene expression analysis revealed that iron metabolism and mitochondrial function had the highest number of genes deregulated in RARS patients compared to controls and the refractory cytopenias with unilineage dysplasia (RCUD). Thus mitochondrial transporters SLC25 (SLC25A37 and SLC25A38) and ALAD genes were over-expressed in RARS. Moreover, significant differences were observed between patients with SF3B1 mutations and patients without the mutations. The deregulation of genes involved in iron and mitochondrial metabolism provides new insights in our knowledge of MDS-RS. New variants that could be involved in the pathogenesis of these diseases have been identified. PMID:25955609

  2. Conservation of the structure and organization of lupin mitochondrial nad3 and rps12 genes.


    Rurek, M; Oczkowski, M; Augustyniak, H


    A high level of the nucleotide sequence conservation of mitochondrial nad3 and rps12 genes was found in four lupin species. The only differences concern three nucleotides in the Lupinus albus rps12 gene and three nucleotides insertion in the L. mutabilis spacer. Northern blot analysis as well as RT-PCR confirmed cotranscription of the L. luteus genes because the transcripts detected were long enough.

  3. Mitochondrial neurogastrointestinal encephalomyopathy: novel pathogenic mutations in thymidine phosphorylase gene in two Italian brothers.


    Libernini, Laura; Lupis, Chiara; Mastrangelo, Mario; Carrozzo, Rosalba; Santorelli, Filippo Maria; Inghilleri, Maurizio; Leuzzi, Vincenzo


    Mitochondrial neurogastrointestinal encephalomyopathy (MNGIE, MIM 603041) is an autosomal recessive multisystem disorder occurring due to mutations in a nuclear gene coding for the enzyme thymidine phosphorylase (TYMP). Clinical features of MNGIE include gastrointestinal dysmotility, cachexia, ptosis or ophthalmoparesis, peripheral neuropathy, diffuse leukoencephalopathy, and signs of mitochondrial dysfunction in tissues. We report the clinical and molecular findings in two brothers in whom novel TYMP gene mutations (c.215-13_215delinsGCGTGA; c.1159 + 2T > A) were associated with different clinical presentations and outcomes.

  4. Isolated respiratory chain enzyme deficiency in patients with a mitochondrial (encephalo-) myopathy: Sequence analysis of the mitochondrial complex and IV genes

    SciTech Connect

    Vries, D. de; Coo, I. de; Buddiger, P.


    The mitochondrial respiratory chain consists of four enzyme complexes. Deficiencies of complex I (NADH dehydrogenase) and complex IV (cytochrome c oxidase) are frequently found in muscle biopsies from patients with a mitochondrial (encephalo-)myopathy. Mutations in the mitochondrial-encoded subunits have been observed in a number of different mitochondrial (encephalo-)myophathies. We screened eight mitochondrial (encephalo-)myopathy patients with an isolated complex I deficiency for mutations in the ND genes by direct sequencing. No abnormality was detected. We also studied 9 mitochondrial (encephalo-)myopathy patients and an isolated complex IV deficiency. In the muscle biopsy of one patient a novel heteroplasmic mutation (T {r_arrow} C) at nucleotide position 6681 was found in the mitochondrial COX I gene. This mutation led to the substitution of a conserved Tyr for His. As this mutation changed the secondary structure of the protein and was not found in the healthy mother, we consider it likely that this mutation is pathological. In the other patients no abnormality was detected. Therefore, mutations in the mitochondrially-encoded subunits are not a frequent cause of isolated respiratory chain enzyme deficiency.

  5. A new point mutation in the ND1 mitochondrial gene identified in a type II diabetic patient

    SciTech Connect

    Kalinin, V.N.; Schmidt, W.; Olek, K.


    A novel mutation in a mitochondrial gene was identified in a patient with type II diabetes mellitus. G-to-A transition was localized at the nt3316 position of gene ND1 and resulted in alanine threonine replacement at position 4 of mitochondrial NAD-H-dehydrogenase. 6 refs., 2 figs.

  6. Genetic architecture of metabolic rate: environment specific epistasis between mitochondrial and nuclear genes in an insect.


    Arnqvist, Göran; Dowling, Damian K; Eady, Paul; Gay, Laurene; Tregenza, Tom; Tuda, Midori; Hosken, David J


    The extent to which mitochondrial DNA (mtDNA) variation is involved in adaptive evolutionary change is currently being reevaluated. In particular, emerging evidence suggests that mtDNA genes coevolve with the nuclear genes with which they interact to form the energy producing enzyme complexes in the mitochondria. This suggests that intergenomic epistasis between mitochondrial and nuclear genes may affect whole-organism metabolic phenotypes. Here, we use crossed combinations of mitochondrial and nuclear lineages of the seed beetle Callosobruchus maculatus and assay metabolic rate under two different temperature regimes. Metabolic rate was affected by an interaction between the mitochondrial and nuclear lineages and the temperature regime. Sequence data suggests that mitochondrial genetic variation has a role in determining the outcome of this interaction. Our genetic dissection of metabolic rate reveals a high level of complexity, encompassing genetic interactions over two genomes, and genotype × genotype × environment interactions. The evolutionary implications of these results are twofold. First, because metabolic rate is at the root of life histories, our results provide insights into the complexity of life-history evolution in general, and thermal adaptation in particular. Second, our results suggest a mechanism that could contribute to the maintenance of nonneutral mtDNA polymorphism.

  7. The yeast gene, MDM20, is necessary for mitochondrial inheritance and organization of the actin cytoskeleton.


    Hermann, G J; King, E J; Shaw, J M


    In Saccharomyces cerevisiae, the growing bud inherits a portion of the mitochondrial network from the mother cell soon after it emerges. Although this polarized transport of mitochondria is thought to require functions of the cytoskeleton, there are conflicting reports concerning the nature of the cytoskeletal element involved. Here we report the isolation of a yeast mutant, mdm20, in which both mitochondrial inheritance and actin cables (bundles of actin filaments) are disrupted. The MDM20 gene encodes a 93-kD polypeptide with no homology to other characterized proteins. Extra copies of TPM1, a gene encoding the actin filament-binding protein tropomyosin, suppress mitochondrial inheritance defects and partially restore actin cables in mdm20 delta cells. Synthetic lethality is also observed between mdm20 and tpm1 mutant strains. Overexpression of a second yeast tropomyosin, Tpm2p, rescues mutant phenotypes in the mdm20 strain to a lesser extent. Together, these results provide compelling evidence that mitochondrial inheritance in yeast is an actin-mediated process. MDM20 and TPM1 also exhibit the same pattern of genetic interactions; mutations in MDM20 are synthetically lethal with mutations in BEM2 and MYO2 but not SAC6. Although MDM20 and TPM1 are both required for the formation and/or stabilization of actin cables, mutations in these genes disrupt mitochondrial inheritance and nuclear segregation to different extents. Thus, Mdm20p and Tpm1p may act in vivo to establish molecular and functional heterogeneity of the actin cytoskeleton.

  8. Mitochondrial electron transport regulation of nuclear gene expression. Studies with the alternative oxidase gene of tobacco.

    PubMed Central

    Vanlerberghe, G C; McIntosh, L


    We have isolated a cDNA representing the tobacco (Nicotiana tabacum L. cv Bright Yellow) nuclear gene Aox1, which encodes the alternative oxidase of plant mitochondria. The clone contains the complete coding region (1059 base pairs) of a precursor protein of 353 amino acids with a calculated molecular mass of 39.8 kD. A putative transit peptide contains common signals believed to be important for import and processing of mitochondrially localized proteins. We have studied changes in Aox1 gene expression in tobacco in response to changes in cytochrome pathway activity. Inhibition of the cytochrome pathway by antimycin A resulted in a rapid and dramatic accumulation of Aox1 mRNA, whereas the level of mRNAs encoding two proteins of the cytochrome pathway did not change appreciably. This was accompanied by a dramatic increase in alternative pathway capacity and engagement in whole cells. Respiration under these conditions was unaffected by the uncoupler p-trifluoromethoxycarbonylcyanide (FCCP). When inhibition of the cytochrome pathway was relieved, levels of Aox1 mRNA returned to control levels, alternative pathway capacity and engagement declined, and respiration could once again be stimulated by FCCP. The results show that a mechanism involving changes in Aox1 gene expression exists whereby the capacity of the alternative pathway can be adjusted in response to changes in the activity of the cytochrome pathway. PMID:8058837

  9. The plant mitochondrial mat-r gene/nad1 gene complex

    SciTech Connect

    Wolstenhome, D.R.


    We have completed sequencing segments of the maize mitochondrial (mt) DNA that contains all five of the exons (A-E) of the gene (nad1) for subunit I of the respiratory chain NADH dehydrogenase. Analysis of these sequences indicates that exons B and C are joined by a continuous group II intron, but the remaining exons are associated with partial group II introns and are encoded at widely separated locations in the maize mtDNA molecule. We have shown that mature transcripts of the maize nad1 gene contain 23 edited nucleotides, and that transcripts of maize and soybean mat-r genes contain 15 and 14 edits, respectively. The majority of edits in nad1 transcripts result in amino acid replacements that increase similarity between the maize NAD1 protein and NAD1 proteins of other plant species and of animal species. We found that the intron between exons b and c is not edited. From data obtained using PCR and sequencing we have shown that transcripts containing all possible exon combinations exist in maize mitochondria.

  10. Gene Arrangement Convergence, Diverse Intron Content, and Genetic Code Modifications in Mitochondrial Genomes of Sphaeropleales (Chlorophyta)

    PubMed Central

    Fučíková, Karolina; Lewis, Paul O.; González-Halphen, Diego; Lewis, Louise A.


    The majority of our knowledge about mitochondrial genomes of Viridiplantae comes from land plants, but much less is known about their green algal relatives. In the green algal order Sphaeropleales (Chlorophyta), only one representative mitochondrial genome is currently available—that of Acutodesmus obliquus. Our study adds nine completely sequenced and three partially sequenced mitochondrial genomes spanning the phylogenetic diversity of Sphaeropleales. We show not only a size range of 25–53 kb and variation in intron content (0–11) and gene order but also conservation of 13 core respiratory genes and fragmented ribosomal RNA genes. We also report an unusual case of gene arrangement convergence in Neochloris aquatica, where the two rns fragments were secondarily placed in close proximity. Finally, we report the unprecedented usage of UCG as stop codon in Pseudomuriella schumacherensis. In addition, phylogenetic analyses of the mitochondrial protein-coding genes yield a fully resolved, well-supported phylogeny, showing promise for addressing systematic challenges in green algae. PMID:25106621

  11. Gene arrangement convergence, diverse intron content, and genetic code modifications in mitochondrial genomes of sphaeropleales (chlorophyta).


    Fučíková, Karolina; Lewis, Paul O; González-Halphen, Diego; Lewis, Louise A


    The majority of our knowledge about mitochondrial genomes of Viridiplantae comes from land plants, but much less is known about their green algal relatives. In the green algal order Sphaeropleales (Chlorophyta), only one representative mitochondrial genome is currently available-that of Acutodesmus obliquus. Our study adds nine completely sequenced and three partially sequenced mitochondrial genomes spanning the phylogenetic diversity of Sphaeropleales. We show not only a size range of 25-53 kb and variation in intron content (0-11) and gene order but also conservation of 13 core respiratory genes and fragmented ribosomal RNA genes. We also report an unusual case of gene arrangement convergence in Neochloris aquatica, where the two rns fragments were secondarily placed in close proximity. Finally, we report the unprecedented usage of UCG as stop codon in Pseudomuriella schumacherensis. In addition, phylogenetic analyses of the mitochondrial protein-coding genes yield a fully resolved, well-supported phylogeny, showing promise for addressing systematic challenges in green algae.

  12. Metazoan mitochondrial gene sequence reference datasets for taxonomic assignment of environmental samples

    PubMed Central

    Machida, Ryuji J.; Leray, Matthieu; Ho, Shian-Lei; Knowlton, Nancy


    Mitochondrial-encoded genes are increasingly targeted in studies using high-throughput sequencing approaches for characterizing metazoan communities from environmental samples (e.g., plankton, meiofauna, filtered water). Yet, unlike nuclear ribosomal RNA markers, there is to date no high-quality reference dataset available for taxonomic assignments. Here, we retrieved all metazoan mitochondrial gene sequences from GenBank, and then quality filtered and formatted the datasets for taxonomic assignments using taxonomic assignment tools. The reference datasets—‘Midori references’—are available for download at Two versions are provided: (I) Midori-UNIQUE that contains all unique haplotypes associated with each species and (II) Midori-LONGEST that contains a single sequence, the longest, for each species. Overall, the mitochondrial Cytochrome oxidase subunit I gene was the most sequence-rich gene. However, sequences of the mitochondrial large ribosomal subunit RNA and Cytochrome b apoenzyme genes were observed for a large number of species in some phyla. The Midori reference is compatible with some taxonomic assignment software. Therefore, automated high-throughput sequence taxonomic assignments can be particularly effective using these datasets. PMID:28291235

  13. Two genes encoding the bovine mitochondrial ATP synthase proteolipid specify precursors with different import sequences and are expressed in a tissue-specific manner.

    PubMed Central

    Gay, N J; Walker, J E


    Two cDNAs encoding different precursor proteins of the same mature proteolipid subunit of mitochondrial ATP synthase have been cloned from a bovine cDNA library. The hybridisation probe was a mixture of 17-mer oligonucleotides containing 256 discrete sequences. The coding sequences of the two cDNAs differ in 25 silent positions of codons and the 3' non-coding sequences are only weakly related. The precursor sequences, which direct the import of the proteolipid into the mitochondrion, are 61 and 68 amino acids long. They are related to each other in regions which probably are recognition signals for the processing protease. The corresponding genes are expressed differently in various tissues in a way that reflects their embryonic origin. Images Fig. 3. Fig. 6. Fig. 7. PMID:2868890

  14. Cloning and characteristic analysis of a novel aspartic protease gene Asp55 from Trichoderma asperellum ACCC30536.


    Dou, Kai; Wang, Zhiying; Zhang, Rongshu; Wang, Na; Fan, Haijuan; Diao, Guiping; Liu, Zhihua


    Proteases secreted by fungi belonging to the genus Trichoderma play important roles in biocontrol. In this study, the coding sequence and promoter region of the novel aspartic protease gene Asp55 were cloned from strain Trichoderma asperellum ACCC30536. Many cis-elements involved in phytopathogenic and environmental stress responses were identified in the Asp55 promoter region and may be recognized by MYB or WRKY transcription factors. The expression pattern of Asp55 under eight culture conditions was investigated by RT-qPCR. The expression level of Asp55 was up-regulated by poplar stem powder, Alternaria alternata cell wall fragments and A. alternata fermentation liquid, while it was down-regulated by carbon and nitrogen source starvation, and by powdered poplar leaves and roots. Additionally, the expression patterns of 15 genes encoding MYB transcription factors (Myb1 to Myb15) were also analyzed by RT-qPCR. Myb2 showed the most similar expression pattern with Asp55. The cDNA of Asp55 was expressed in Escherichia coli BL21, and recombinant ASP55 (rASP55) was purified. The purified rASP55 was evaluated for enzymatic activity and showed inhibitory effect on phytopathogenic A. alternata.

  15. Caenorhabditis elegans, a pluricellular model organism to screen new genes involved in mitochondrial genome maintenance.


    Addo, Matthew Glover; Cossard, Raynald; Pichard, Damien; Obiri-Danso, Kwasi; Rötig, Agnès; Delahodde, Agnès


    The inheritance of functional mitochondria depends on faithful replication and transmission of mitochondrial DNA (mtDNA). A large and heterogeneous group of human disorders is associated with mitochondrial genome quantitative and qualitative anomalies. Several nuclear genes have been shown to account for these severe OXPHOS disorders. However, in several cases, the disease-causing mutations still remain unknown. Caenorhabditis elegans has been largely used for studying various biological functions because this multicellular organism has short life cycle and is easy to grow in the laboratory. Mitochondrial functions are relatively well conserved between human and C.elegans, and heteroplasmy exists in this organism as in human. C. elegans therefore represents a useful tool for studying mtDNA maintenance. Suppression by RNA interference of genes involved in mtDNA replication such as polg-1, encoding the mitochondrial DNA polymerase, results in reduced mtDNA copy number but in a normal phenotype of the F1 worms. By combining RNAi of genes involved in mtDNA maintenance and EtBr exposure, we were able to reveal a strong and specific phenotype (developmental larval arrest) associated to a severe decrease of mtDNA copy number. Moreover, we tested and validated the screen efficiency for human orthologous genes encoding mitochondrial nucleoid proteins. This allowed us to identify several genes that seem to be closely related to mtDNA maintenance in C. elegans. This work reports a first step in the further development of a large-scale screening in C. elegans that should allow to identify new genes of mtDNA maintenance whose human orthologs will obviously constitute new candidate genes for patients with quantitative or qualitative mtDNA anomalies.

  16. Characterization of the entire cystatin gene family in barley and their target cathepsin L-like cysteine-proteases, partners in the hordein mobilization during seed germination.


    Martinez, Manuel; Cambra, Ines; Carrillo, Laura; Diaz-Mendoza, Mercedes; Diaz, Isabel


    Plant cystatins are inhibitors of cysteine-proteases of the papain C1A and legumain C13 families. Cystatin data from multiple plant species have suggested that these inhibitors act as defense proteins against pests and pathogens and as regulators of protein turnover. In this study, we characterize the entire cystatin gene family from barley (Hordeum vulgare), which contain 13 nonredundant genes, and identify and characterize their target enzymes, the barley cathepsin L-like proteases. Cystatins and proteases were expressed and purified from Escherichia coli cultures. Each cystatin was found to have different inhibitory capability against barley cysteine-proteases in in vitro inhibitory assays using specific substrates. Real-time reverse transcription-polymerase chain reaction revealed that inhibitors and enzymes present a wide variation in their messenger RNA expression patterns. Their transcripts were mainly detected in developing and germinating seeds, and some of them were also expressed in leaves and roots. Subcellular localization of cystatins and cathepsin L-like proteases fused to green fluorescent protein demonstrated the presence of both protein families throughout the endoplasmic reticulum and the Golgi complex. Proteases and cystatins not only colocalized but also interacted in vivo in the plant cell, as revealed by bimolecular fluorescence complementation. The functional relationship between cystatins and cathepsin L-like proteases was inferred from their common implication as counterparts of mobilization of storage proteins upon barley seed germination. The opposite pattern of transcription expression in gibberellin-treated aleurones presented by inhibitors and enzymes allowed proteases to specifically degrade B, C, and D hordeins stored in the endosperm of barley seeds.

  17. Octocoral mitochondrial genomes provide insights into the phylogenetic history of gene order rearrangements, order reversals, and cnidarian phylogenetics.


    Figueroa, Diego F; Baco, Amy R


    We use full mitochondrial genomes to test the robustness of the phylogeny of the Octocorallia, to determine the evolutionary pathway for the five known mitochondrial gene rearrangements in octocorals, and to test the suitability of using mitochondrial genomes for higher taxonomic-level phylogenetic reconstructions. Our phylogeny supports three major divisions within the Octocorallia and show that Paragorgiidae is paraphyletic, with Sibogagorgia forming a sister branch to the Coralliidae. Furthermore, Sibogagorgia cauliflora has what is presumed to be the ancestral gene order in octocorals, but the presence of a pair of inverted repeat sequences suggest that this gene order was not conserved but rather evolved back to this apparent ancestral state. Based on this we recommend the resurrection of the family Sibogagorgiidae to fix the paraphyly of the Paragorgiidae. This is the first study to show that in the Octocorallia, mitochondrial gene orders have evolved back to an ancestral state after going through a gene rearrangement, with at least one of the gene orders evolving independently in different lineages. A number of studies have used gene boundaries to determine the type of mitochondrial gene arrangement present. However, our findings suggest that this method known as gene junction screening may miss evolutionary reversals. Additionally, substitution saturation analysis demonstrates that while whole mitochondrial genomes can be used effectively for phylogenetic analyses within Octocorallia, their utility at higher taxonomic levels within Cnidaria is inadequate. Therefore for phylogenetic reconstruction at taxonomic levels higher than subclass within the Cnidaria, nuclear genes will be required, even when whole mitochondrial genomes are available.

  18. Peripheral neuropathy predicts nuclear gene defect in patients with mitochondrial ophthalmoplegia.


    Horga, Alejandro; Pitceathly, Robert D S; Blake, Julian C; Woodward, Catherine E; Zapater, Pedro; Fratter, Carl; Mudanohwo, Ese E; Plant, Gordon T; Houlden, Henry; Sweeney, Mary G; Hanna, Michael G; Reilly, Mary M


    Progressive external ophthalmoplegia is a common clinical feature in mitochondrial disease caused by nuclear DNA defects and single, large-scale mitochondrial DNA deletions and is less frequently associated with point mutations of mitochondrial DNA. Peripheral neuropathy is also a frequent manifestation of mitochondrial disease, although its prevalence and characteristics varies considerably among the different syndromes and genetic aetiologies. Based on clinical observations, we systematically investigated whether the presence of peripheral neuropathy could predict the underlying genetic defect in patients with progressive external ophthalmoplegia. We analysed detailed demographic, clinical and neurophysiological data from 116 patients with genetically-defined mitochondrial disease and progressive external ophthalmoplegia. Seventy-eight patients (67%) had a single mitochondrial DNA deletion, 12 (10%) had a point mutation of mitochondrial DNA and 26 (22%) had mutations in either POLG, C10orf2 or RRM2B, or had multiple mitochondrial DNA deletions in muscle without an identified nuclear gene defect. Seventy-seven patients had neurophysiological studies; of these, 16 patients (21%) had a large-fibre peripheral neuropathy. The prevalence of peripheral neuropathy was significantly lower in patients with a single mitochondrial DNA deletion (2%) as compared to those with a point mutation of mitochondrial DNA or with a nuclear DNA defect (44% and 52%, respectively; P<0.001). Univariate analyses revealed significant differences in the distribution of other clinical features between genotypes, including age at disease onset, gender, family history, progressive external ophthalmoplegia at clinical presentation, hearing loss, pigmentary retinopathy and extrapyramidal features. However, binomial logistic regression analysis identified peripheral neuropathy as the only independent predictor associated with a nuclear DNA defect (P=0.002; odds ratio 8.43, 95% confidence interval 2

  19. Cloning and targeted disruption, via Agrobacterium tumefaciens-mediated transformation, of a trypsin protease gene from the vascular wilt fungus Verticillium dahliae.


    Dobinson, Katherine F; Grant, Sandra J; Kang, Seogchan


    A gene encoding a trypsin protease was isolated from a tomato isolate of Verticillium dahliae. The gene, designated VTP1, contains two introns and is predicted to encode a protein of 256 amino acids. The gene is present in V. dahliae isolates from different host plants and in V. albo-atrum; weakly hybridizing sequences are present in V. tricorpus. VTP1 cDNA sequences were identified in a sequence tag analysis of genes expressed under growth conditions that promote microsclerotia development. Replacement of the gene, by Agrobacterium tumefaciens-mediated transformation (ATMT), with a mutant allele construct did not noticeably alter either pathogenicity or growth in culture. Searches of expressed sequence tag databases showed that, in addition to the VTP1 gene, V. dahliae contains two genes encoding subtilisin-like proteases similar to those produced by pathogenic Aspergillus spp. This is the first description of the application of ATMT to the molecular analysis of phytopathogenic Verticillium spp.

  20. Potential impact of human mitochondrial replacement on global policy regarding germline gene modification.


    Ishii, Tetsuya


    Previous discussions regarding human germline gene modification led to a global consensus that no germline should undergo genetic modification. However, the UK Human Fertilisation and Embryology Authority, having conducted at the UK Government's request a scientific review and a wide public consultation, provided advice to the Government on the pros and cons of Parliament's lifting a ban on altering mitochondrial DNA content of human oocytes and embryos, so as to permit the prevention of maternal transmission of mitochondrial diseases. In this commentary, relevant ethical and biomedical issues are examined and requirements for proceeding with this novel procedure are suggested. Additionally, potentially significant impacts of the UK legalization on global policy concerning germline gene modification are discussed in the context of recent advances in genome-editing technology. It is concluded that international harmonization is needed, as well as further ethical and practical consideration, prior to the legalization of human mitochondrial replacement.

  1. RNA editing of 10 Didymium iridis mitochondrial genes and comparison with the homologous genes in Physarum polycephalum.


    Traphagen, Stephen J; Dimarco, Michael J; Silliker, Margaret E


    Regions of the Didymium iridis mitochondrial genome were identified with similarity to typical mitochondrial genes; however, these regions contained numerous stop codons. We used RT-PCR and DNA sequencing to determine whether, through RNA editing, these regions were transcribed into mRNAs that could encode functional proteins. Ten putative gene regions were examined: atp1, atp6, atp8, atp9, cox1, cox2, cytb, nad4L, nad6, and nad7. The cDNA sequences of each gene could encode a functional mitochondrial protein that was highly conserved compared with homologous genes. The type of editing events and editing sequence features were very similar to those observed in the homologous genes of Physarum polycephalum, though the actual editing locations showed a variable degree of conservation. Edited sites were compared with encoded sites in D. iridis and P. polycephalum for all 10 genes. Edited sequence for a portion of the cox1 gene was available for six myxomycetes, which, when compared, showed a high degree of conservation at the protein level. Different types of editing events showed varying degrees of site conservation with C-to-U base changes being the least conserved. Several aspects of single C insertion editing events led to the preferential creation of hydrophobic amino acid codons that may help to minimize adverse effects on the resulting protein structure.

  2. Deleterious mutation in FDX1L gene is associated with a novel mitochondrial muscle myopathy.


    Spiegel, Ronen; Saada, Ann; Halvardson, Jonatan; Soiferman, Devorah; Shaag, Avraham; Edvardson, Simon; Horovitz, Yoseph; Khayat, Morad; Shalev, Stavit A; Feuk, Lars; Elpeleg, Orly


    Isolated metabolic myopathies encompass a heterogeneous group of disorders, with mitochondrial myopathies being a subgroup, with depleted skeletal muscle energy production manifesting either by recurrent episodes of myoglobinuria or progressive muscle weakness. In this study, we investigated the genetic cause of a patient from a consanguineous family who presented with adolescent onset autosomal recessive mitochondrial myopathy. Analysis of enzyme activities of the five respiratory chain complexes in our patients' skeletal muscle showed severely impaired activities of iron sulfur (Fe-S)-dependent complexes I, II and III and mitochondrial aconitase. We employed exome sequencing combined with homozygosity mapping to identify a homozygous mutation, c.1A>T, in the FDX1L gene, which encodes the mitochondrial ferredoxin 2 (Fdx2) protein. The mutation disrupts the ATG initiation translation site resulting in severe reduction of Fdx2 content in the patient muscle and fibroblasts mitochondria. Fdx2 is the second component of the Fe-S cluster biogenesis machinery, the first being IscU that is associated with isolated mitochondrial myopathy. We suggest adding genetic analysis of FDX1L in cases of mitochondrial myopathy especially when associated with reduced activity of the respiratory chain complexes I, II and III.

  3. Detection and quantification of Pfiesteria piscicida by using the mitochondrial cytochrome b gene.


    Zhang, Huan; Lin, Senjie


    Mitochondrial cytochrome b was isolated from the dinoflagellate Pfiesteria piscicida, and the utility of the gene for species identification was examined. One of the primer sets designed was shown to be highly specific for P. piscicida. A time step PCR protocol was used to demonstrate the potential of this primer set for quantification of this species.

  4. Host mitochondrial association evolved in the human parasite Toxoplasma gondii via neofunctionalization of a gene duplicate

    Technology Transfer Automated Retrieval System (TEKTRAN)

    In Toxoplasma gondii, an intracellular parasite of humans and other warm-blooded animals, the ability to associate with host mitochondria (HMA) is driven by a locally expanded gene family that encodes multiple mitochondrial association factor 1 (MAF1) proteins. The importance of copy number in the e...

  5. Evolutionary Inference across Eukaryotes Identifies Specific Pressures Favoring Mitochondrial Gene Retention.


    Johnston, Iain G; Williams, Ben P


    Since their endosymbiotic origin, mitochondria have lost most of their genes. Although many selective mechanisms underlying the evolution of mitochondrial genomes have been proposed, a data-driven exploration of these hypotheses is lacking, and a quantitatively supported consensus remains absent. We developed HyperTraPS, a methodology coupling stochastic modeling with Bayesian inference, to identify the ordering of evolutionary events and suggest their causes. Using 2015 complete mitochondrial genomes, we inferred evolutionary trajectories of mtDNA gene loss across the eukaryotic tree of life. We find that proteins comprising the structural cores of the electron transport chain are preferentially encoded within mitochondrial genomes across eukaryotes. A combination of high GC content and high protein hydrophobicity is required to explain patterns of mtDNA gene retention; a model that accounts for these selective pressures can also predict the success of artificial gene transfer experiments in vivo. This work provides a general method for data-driven inference of the ordering of evolutionary and progressive events, here identifying the distinct features shaping mitochondrial genomes of present-day species.

  6. A novel mutation in the mitochondrial DNA cytochrome b gene (MTCYB) in a patient with Prader Willi syndrome.


    Yiş, Uluç; Ezgü, Fatih Süheyl; Karakaya, Pakize; Polat, İpek; Arslan, Nur; Çankaya, Tufan; Bozkaya, Özlem Giray; Kurul, Semra Hız


    In recent years, it has been suggested that defects in energy metabolism may accompany Prader Willi syndrome. Mutations in the mitochondrial cytochrome b gene have been commonly associated isolated mitochondrial myopathy and exercise intolerance, rarely with multisystem disorders. The authors describe a novel mutation (mt. 15209T>C) in mitochondrial cytochrome b gene in a 2-year-old girl with Prader-Willi syndrome with a clinical history of lactic acidosis attacks, renal sodium loss, hepatopathy, progressive cerebral atrophy, and sudden death. The authors suggest that atypical clinical findings in patients with Prader-Willi syndrome should direct the physician to search for a mitochondrial disease.

  7. Mitochondrial impairment increases FL-PINK1 levels by calcium-dependent gene expression☆

    PubMed Central

    Gómez-Sánchez, Rubén; Gegg, Matthew E.; Bravo-San Pedro, José M.; Niso-Santano, Mireia; Alvarez-Erviti, Lydia; Pizarro-Estrella, Elisa; Gutiérrez-Martín, Yolanda; Alvarez-Barrientos, Alberto; Fuentes, José M.; González-Polo, Rosa Ana; Schapira, Anthony H.V.


    Mutations of the PTEN-induced kinase 1 (PINK1) gene are a cause of autosomal recessive Parkinson's disease (PD). This gene encodes a mitochondrial serine/threonine kinase, which is partly localized to mitochondria, and has been shown to play a role in protecting neuronal cells from oxidative stress and cell death, perhaps related to its role in mitochondrial dynamics and mitophagy. In this study, we report that increased mitochondrial PINK1 levels observed in human neuroblastoma SH-SY5Y cells after carbonyl cyanide m-chlorophelyhydrazone (CCCP) treatment were due to de novo protein synthesis, and not just increased stabilization of full length PINK1 (FL-PINK1). PINK1 mRNA levels were significantly increased by 4-fold after 24 h. FL-PINK1 protein levels at this time point were significantly higher than vehicle-treated, or cells treated with CCCP for 3 h, despite mitochondrial content being decreased by 29%. We have also shown that CCCP dissipated the mitochondrial membrane potential (Δψm) and induced entry of extracellular calcium through L/N-type calcium channels. The calcium chelating agent BAPTA-AM impaired the CCCP-induced PINK1 mRNA and protein expression. Furthermore, CCCP treatment activated the transcription factor c-Fos in a calcium-dependent manner. These data indicate that PINK1 expression is significantly increased upon CCCP-induced mitophagy in a calcium-dependent manner. This increase in expression continues after peak Parkin mitochondrial translocation, suggesting a role for PINK1 in mitophagy that is downstream of ubiquitination of mitochondrial substrates. This sensitivity to intracellular calcium levels supports the hypothesis that PINK1 may also play a role in cellular calcium homeostasis and neuroprotection. PMID:24184327

  8. Mitochondrial impairment increases FL-PINK1 levels by calcium-dependent gene expression.


    Gómez-Sánchez, Rubén; Gegg, Matthew E; Bravo-San Pedro, José M; Niso-Santano, Mireia; Alvarez-Erviti, Lydia; Pizarro-Estrella, Elisa; Gutiérrez-Martín, Yolanda; Alvarez-Barrientos, Alberto; Fuentes, José M; González-Polo, Rosa Ana; Schapira, Anthony H V


    Mutations of the PTEN-induced kinase 1 (PINK1) gene are a cause of autosomal recessive Parkinson's disease (PD). This gene encodes a mitochondrial serine/threonine kinase, which is partly localized to mitochondria, and has been shown to play a role in protecting neuronal cells from oxidative stress and cell death, perhaps related to its role in mitochondrial dynamics and mitophagy. In this study, we report that increased mitochondrial PINK1 levels observed in human neuroblastoma SH-SY5Y cells after carbonyl cyanide m-chlorophelyhydrazone (CCCP) treatment were due to de novo protein synthesis, and not just increased stabilization of full length PINK1 (FL-PINK1). PINK1 mRNA levels were significantly increased by 4-fold after 24h. FL-PINK1 protein levels at this time point were significantly higher than vehicle-treated, or cells treated with CCCP for 3h, despite mitochondrial content being decreased by 29%. We have also shown that CCCP dissipated the mitochondrial membrane potential (Δψm) and induced entry of extracellular calcium through L/N-type calcium channels. The calcium chelating agent BAPTA-AM impaired the CCCP-induced PINK1 mRNA and protein expression. Furthermore, CCCP treatment activated the transcription factor c-Fos in a calcium-dependent manner. These data indicate that PINK1 expression is significantly increased upon CCCP-induced mitophagy in a calcium-dependent manner. This increase in expression continues after peak Parkin mitochondrial translocation, suggesting a role for PINK1 in mitophagy that is downstream of ubiquitination of mitochondrial substrates. This sensitivity to intracellular calcium levels supports the hypothesis that PINK1 may also play a role in cellular calcium homeostasis and neuroprotection.

  9. The yeast VAS1 gene encodes both mitochondrial and cytoplasmic valyl-tRNA synthetases.


    Chatton, B; Walter, P; Ebel, J P; Lacroute, F; Fasiolo, F


    S1 mapping on the VAS1 structural gene indicates the existence of two classes of transcripts initiating at distinct in-frame translation start codons. The longer class of VAS1 transcripts initiates upstream of both ATG codons located 138 base pairs away and the shorter class downstream of the first ATG. A mutation that destroys the first AUG on the long message results in respiratory deficiency but does not affect viability. Mutation of the ATG at position 139 leads to lethality because the initiating methionine codon of the essential cytoplasmic valyl-tRNA synthetase has been destroyed. N-terminal protein sequence data further confirm translation initiation at ATG-139 for the cytoplasmic valyl-tRNA synthetase. From these results, we conclude that the VAS1 single gene encodes both mitochondrial and cytoplasmic valyl-tRNA synthetases. The presequence of the mitochondrial valyl-tRNA synthetase shows amino acid composition but not the amphiphilic character of imported mitochondrial proteins. From mutagenesis of the ATG-139 we conclude that the presequence specifically targets the cytoplasmically synthesized mitochondrial valyl-tRNA synthetase to the mitochondrial outer membrane and prevents binding of the enzyme core to cytoplasmic tRNAVal.

  10. A Novel MitoTimer Reporter Gene for Mitochondrial Content, Structure, Stress, and Damage in Vivo*

    PubMed Central

    Laker, Rhianna C.; Xu, Peng; Ryall, Karen A.; Sujkowski, Alyson; Kenwood, Brandon M.; Chain, Kristopher H.; Zhang, Mei; Royal, Mary A.; Hoehn, Kyle L.; Driscoll, Monica; Adler, Paul N.; Wessells, Robert J.; Saucerman, Jeffrey J.; Yan, Zhen


    Mitochondrial dysfunction plays important roles in many diseases, but there is no satisfactory method to assess mitochondrial health in vivo. Here, we engineered a MitoTimer reporter gene from the existing Timer reporter gene. MitoTimer encodes a mitochondria-targeted green fluorescent protein when newly synthesized, which shifts irreversibly to red fluorescence when oxidized. Confocal microscopy confirmed targeting of the MitoTimer protein to mitochondria in cultured cells, Caenorhabditis elegans touch receptor neurons, Drosophila melanogaster heart and indirect flight muscle, and mouse skeletal muscle. A ratiometric algorithm revealed that conditions that cause mitochondrial stress led to a significant shift toward red fluorescence as well as accumulation of pure red fluorescent puncta of damaged mitochondria targeted for mitophagy. Long term voluntary exercise resulted in a significant fluorescence shift toward green, in mice and D. melanogaster, as well as significantly improved structure and increased content in mouse FDB muscle. In contrast, high-fat feeding in mice resulted in a significant shift toward red fluorescence and accumulation of pure red puncta in skeletal muscle, which were completely ameliorated by voluntary wheel running. Hence, MitoTimer allows for robust analysis of multiple parameters of mitochondrial health under both physiological and pathological conditions and will be highly useful for future research of mitochondrial health in multiple disciplines in vivo. PMID:24644293

  11. Mitochondrial gene rearrangements confirm the parallel evolution of the crab-like form.


    Morrison, C L; Harvey, A W; Lavery, S; Tieu, K; Huang, Y; Cunningham, C W


    The repeated appearance of strikingly similar crab-like forms in independent decapod crustacean lineages represents a remarkable case of parallel evolution. Uncertainty surrounding the phylogenetic relationships among crab-like lineages has hampered evolutionary studies. As is often the case, aligned DNA sequences by themselves were unable to fully resolve these relationships. Four nested mitochondrial gene rearrangements--including one of the few reported movements of an arthropod protein-coding gene--are congruent with the DNA phylogeny and help to resolve a crucial node. A phylogenetic analysis of DNA sequences, and gene rearrangements, supported five independent origins of the crab-like form, and suggests that the evolution of the crab-like form may be irreversible. This result supports the utility of mitochondrial gene rearrangements in phylogenetic reconstruction.

  12. Complete sequence and gene organization of the mitochondrial genome of the land snail Albinaria coerulea.


    Hatzoglou, E; Rodakis, G C; Lecanidou, R


    The complete sequence (14,130 bp) of the mitochondrial DNA (mtDNA) of the land snail Albinaria coerulea was determined. It contains 13 protein, two rRNA and 22 tRNA genes. Twenty-four of these genes are encoded by one and 13 genes by the other strand. The gene arrangement shares almost no similarities with that of two other molluscs for which the complete gene content and arrangement are known, the bivalve Mytilus edulis and the chiton Katharina tunicata; the protein and rRNA gene order is similar to that of another terrestrial gastropod, Cepaea nemoralis. Unusual features include the following: (1) the absence of lengthy noncoding regions (there are only 141 intergenic nucleotides interspersed at different gene borders, the longest intergenic sequence being 42 nucleotides) (2) the presence of several overlapping genes (mostly tRNAs), (3) the presence of tRNA-like structures and other stem and loop structures within genes. An RNA editing system acting on tRNAs must necessarily be invoked for posttranscriptional extension of the overlapping tRNAs. Due to these features, and also because of the small size of its genes (e.g., it contains the smallest rRNA genes among the known coelomates), it is one of the most compact mitochondrial genomes known to date.

  13. Complete Sequence and Gene Organization of the Mitochondrial Genome of the Land Snail Albinaria Coerulea

    PubMed Central

    Hatzoglou, E.; Rodakis, G. C.; Lecanidou, R.


    The complete sequence (14,130 bp) of the mitochondrial DNA (mtDNA) of the land snail Albinaria coerulea was determined. It contains 13 protein, two rRNA and 22 tRNA genes. Twenty-four of these genes are encoded by one and 13 genes by the other strand. The gene arrangement shares almost no similarities with that of two other molluscs for which the complete gene content and arrangement are known, the bivalve Mytilus edulis and the chiton Katharina tunicata; the protein and rRNA gene order is similar to that of another terrestrial gastropod, Cepaea nemoralis. Unusual features include the following: (1) the absence of lengthy noncoding regions (there are only 141 intergenic nucleotides interspersed at different gene borders, the longest intergenic sequence being 42 nucleotides), (2) the presence of several overlapping genes (mostly tRNAs), (3) the presence of tRNA-like structures and other stem and loop structures within genes. An RNA editing system acting on tRNAs must necessarily be invoked for posttranscriptional extension of the overlapping tRNAs. Due to these features, and also because of the small size of its genes (e.g., it contains the smallest rRNA genes among the known coelomates), it is one of the most compact mitochondrial genomes known to date. PMID:7498775

  14. The mitochondrial genome of Iberobaenia (Coleoptera: Iberobaeniidae): first rearrangement of protein-coding genes in the beetles.


    Andujar, Carmelo; Arribas, Paula; Linard, Benjamin; Kundrata, Robin; Bocak, Ladislav; Vogler, Alfried P


    The complete mitochondrial genome of the recently discovered beetle family Iberobaeniidae is described and compared with known coleopteran mitogenomes. The mitochondrial sequence was obtained by shotgun metagenomic sequencing using the Illumina Miseq technology and resulted in an average coverage of 130 × and a minimum coverage of 35×. The mitochondrial genome of Iberobaeniidae includes 13 protein-coding genes, 2 rRNAs, 22 tRNAs genes, and 1 putative control region, and showed a unique rearrangement of protein-coding genes. This is the first rearrangement affecting the relative position of protein-coding and ribosomal genes reported for the order Coleoptera.

  15. Complete mitochondrial genome of Tubulipora flabellaris (Bryozoa: Stenolaemata): the first representative from the class Stenolaemata with unique gene order.


    Sun, Ming'an; Shen, Xin; Liu, Huilian; Liu, Xixing; Wu, Zhigang; Liu, Bin


    Mitochondrial genomes play a significant role in the reconstruction of phylogenetic relationships within metazoans. There are still many controversies concerning the phylogenetic position of the phylum Bryozoa. In this research, we have finished the complete mitochondrial genome of one bryozoan (Tubulipora flabellaris), which is the first representative from the class Stenolaemata. The complete mitochondrial genome of T. flabellaris is 13,763bp in length and contains 36 genes, which lacks the atp8 gene in contrast to the typical metazoan mitochondrial genomes. Gene arrangement comparisons indicate that the mitochondrial genome of T. flabellaris has unique gene order when compared with other metazoans. The four known bryozoans complete mitochondrial genomes also have very different gene arrangements, indicates that bryozoan mitochondrial genomes have experienced drastic rearrangements. To investigate the phylogenetic relationship of Bryozoa, phylogenetic analyses based on amino acid sequences of 11 protein coding genes (excluding atp6 and atp8) from 26 metazoan complete mitochondrial genomes were made utilizing Maximum Likelihood (ML) and Bayesian methods, respectively. The results indicate the monopoly of Lophotrochozoa and a close relationship between Chaetognatha and Bryozoa. However, more evidences are needed to clarify the relationship between two groups. Lophophorate appeared to be polyphyletic according to our analyses. Meanwhile, neither analysis supports close relationship between Branchiopod and Phoronida. Four bryozoans form a clade and the relationship among them is T. flabellaris+(F. hispida+(B. neritina+W. subtorquata)), which is in coincidence with traditional classification system.

  16. Prevalence of mitochondrial gene mutations among hearing impaired patients

    PubMed Central

    Usami, S.; Abe, S.; Akita, J.; Namba, A.; Shinkawa, H.; Ishii, M.; Iwasaki, S.; Hoshino, T.; Ito, J.; Doi, K.; Kubo, T.; Nakagawa, T.; Komiyama, S.; Tono, T.; Komune, S.


    The frequency of three mitochondrial point mutations, 1555A→G, 3243A→G, and 7445A→G, known to be associated with hearing impairment, was examined using restriction fragment length polymorphism (RFLP) analysis in two Japanese groups: (1) 319 unrelated SNHL outpatients (including 21 with aminoglycoside antibiotic injection history), and (2) 140 cochlear implantation patients (including 22 with aminoglycoside induced hearing loss). Approximately 3% of the outpatients and 10% of the cochlear implantation patients had the 1555A→G mutation. The frequency was higher in the patients with a history of aminoglycoside injection (outpatient group 33%, cochlear implantation group 59%). One outpatient (0.314%) had the 3243A→G mutation, but no outpatients had the 7445A→G mutation and neither were found in the cochlear implantation group. The significance of the 1555A→G mutation, the most prevalent mitochondrial mutation found in this study of a hearing impaired population in Japan, among subjects with specific backgrounds, such as aminoglycoside induced hearing loss, is evident.

Keywords: mitochondria; point mutation; hearing impairment; frequencies PMID:10633132

  17. Increased mitochondrial ROS formation by acetaminophen in human hepatic cells is associated with gene expression changes suggesting disruption of the mitochondrial electron transport chain.


    Jiang, Jian; Briedé, Jacob J; Jennen, Danyel G J; Van Summeren, Anke; Saritas-Brauers, Karen; Schaart, Gert; Kleinjans, Jos C S; de Kok, Theo M C M


    Acetaminophen (APAP) overdosage results in hepatotoxicity, but the underlying molecular mechanisms are still not completely understood. In the current study, we focused on mitochondrial-specific oxidative liver injury induced by APAP exposure. Owning to genetic polymorphisms in the CYP2E1 gene or varying inducibility by xenobiotics, the CYP2E1 mRNA level and protein activity vary extensively among individuals. As CYP2E1 is a known ROS generating enzyme, we chose HepG2 to minimize CYP2E1-induced ROS formation, which will help us better understand the APAP induced mitochondrial-specific hepatotoxicity in a subpopulation with low CYP2E1 activity. HepG2 cells were exposed to a low and toxic dose (0.5 and 10mM) of APAP and analyzed at four time points for genome-wide gene expression. Mitochondria were isolated and electron spin resonance spectroscopy was performed to measure the formation of mitochondrial ROS. The yield of ATP was measured to confirm the impact of the toxic dose of APAP on cellular energy production. Our results indicate that 10mM APAP significantly influences the expression of mitochondrial protein-encoding genes in association with an increase in mitochondrial ROS formation. Additionally, 10mM APAP affects the expression of genes encoding the subunits of electron transport chain (ETC) complexes, which may alter normal mitochondrial functions by disrupting the assembly, stability, and structural integrity of ETC complexes, leading to a measurable depletion of ATP, and cell death. The expression of mitochondrium-specific antioxidant enzyme, SOD2, is reduced which may limit the ROS scavenging ability and cause imbalance of the mitochondrial ROS homeostasis. Overall, transcriptome analysis reveals the molecular processes involved in the observed APAP-induced increase of mitochondrial ROS formation and the associated APAP-induced oxidative stress.

  18. Effects of TCDD on the expression of nuclear encoded mitochondrial genes

    SciTech Connect

    Forgacs, Agnes L.; Burgoon, Lyle D.; Lynn, Scott G.; LaPres, John J.; Zacharewski, Timothy


    Generation of mitochondrial reactive oxygen species (ROS) can be perturbed following exposure to environmental chemicals such as 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD). Reports indicate that the aryl hydrocarbon receptor (AhR) mediates TCDD-induced sustained hepatic oxidative stress by decreasing hepatic ATP levels and through hyperpolarization of the inner mitochondrial membrane. To further elucidate the effects of TCDD on the mitochondria, high-throughput quantitative real-time PCR (HTP-QRTPCR) was used to evaluate the expression of 90 nuclear genes encoding mitochondrial proteins involved in electron transport, oxidative phosphorylation, uncoupling, and associated chaperones. HTP-QRTPCR analysis of time course (30 {mu}g/kg TCDD at 2, 4, 8, 12, 18, 24, 72, and 168 h) liver samples obtained from orally gavaged immature, ovariectomized C57BL/6 mice identified 54 differentially expressed genes (|fold change| > 1.5 and P-value < 0.1). Of these, 8 exhibited a sigmoidal or exponential dose-response profile (0.03 to 300 {mu}g/kg TCDD) at 4, 24 or 72 h. Dose-responsive genes encoded proteins associated with electron transport chain (ETC) complexes I (NADH dehydrogenase), III (cytochrome c reductase), IV (cytochrome c oxidase), and V (ATP synthase) and could be generally categorized as having proton gradient, ATP synthesis, and chaperone activities. In contrast, transcript levels of ETC complex II, succinate dehydrogenase, remained unchanged. Putative dioxin response elements were computationally found in the promoter regions of all 8 dose-responsive genes. This high-throughput approach suggests that TCDD alters the expression of genes associated with mitochondrial function which may contribute to TCDD-elicited mitochondrial toxicity.

  19. Isolation and characterization of the hyperthermostable serine protease, pyrolysin, and its gene from the hyperthermophilic archaeon Pyrococcus furiosus.


    Voorhorst, W G; Eggen, R I; Geerling, A C; Platteeuw, C; Siezen, R J; Vos, W M


    The hyperthermostable serine protease pyrolysin from the hyperthermophilic archaeon Pyrococcus furiosus was purified from membrane fractions. Two proteolytically active fractions were obtained, designated high (HMW) and low (LMW) molecular weight pyrolysin, that showed immunological cross-reaction and identical NH2-terminal sequences in which the third residue could be glycosylated. The HMW pyrolysin showed a subunit mass of 150 kDa after acid denaturation. Incubation of HMW pyrolysin at 95 degrees C resulted in the formation of LMW pyrolysin, probably as a consequence of COOH-terminal autoproteolysis. The 4194-base pair pls gene encoding pyrolysin was isolated and characterized, and its transcription initiation site was identified. The deduced pyrolysin sequence indicated a prepro-enzyme organization, with a 1249-residue mature protein composed of an NH2-terminal catalytic domain with considerable homology to subtilisin-like serine proteases and a COOH-terminal domain that contained most of the 32 possible N-glycosylation sites. The archaeal pyrolysin showed highest homology with eucaryal tripeptidyl peptidases II on the amino acid level but a different cleavage specificity as shown by its endopeptidase activity toward caseins, casein fragments including alphaS1-casein and synthetic peptides.

  20. Molecular characterization of a gene encoding extracellular serine protease isolated from a subtilisin inhibitor-deficient mutant of Streptomyces albogriseolus S-3253.

    PubMed Central

    Taguchi, S; Odaka, A; Watanabe, Y; Momose, H


    An extracellular serine protease produced by a mutant, M1, derived from Streptomyces albogriseolus S-3253 that no longer produces a protease inhibitor (Streptomyces subtilisin inhibitor [SSI]) was isolated. A 20-kDa protein was purified by its affinity for SSI and designated SAM-P20. The amino acid sequence of the amino-terminal region of SAM-P20 revealed high homology with the sequences of Streptomyces griseus proteases A and B, and the gene sequence confirmed the relationships. The sequence also revealed a putative amino acid signal sequence for SAM-P20 that apparently functioned to allow secretion of SAM-P20 from Escherichia coli carrying the recombinant gene. SAM-P20 produced by E. coli cells was shown to be sensitive to SSI inhibition. PMID:7887600

  1. Complete mitochondrial genome of the Japanese snapping shrimp Alpheus japonicus (Crustacea: Decapoda: Caridea): gene rearrangement and phylogeny within Caridea.


    Shen, Xin; Li, Xiao; Sha, Zhongli; Yan, Binlun; Xu, Qihua


    The complete sequence of the mitochondrial genome of the Japanese snapping shrimp Alpheus japonicus Miers (Crustacea: Decapoda: Caridea) is presented here. A comparative analysis based on the currently available mitochondrial genomic data revealed many previously unknown characteristics of the mitochondrial genomes of caridean shrimps. The A. japonicus mitochondrial genome is 16487 bp long and contains the typical set of 37 metazoan genes. The gene arrangements in the mitochondrial genomes of four previously studied carideans (Macrobrachium rosenbergii, M. nipponense, M. lanchesteri and Halocaridina rubra) were found to be identical to the pancrustacean ground pattern; thus, it was considered that gene rearrangements probably did not occur in the suborder Caridea. In the present study, a translocation of the trnE gene involving inversion was found in Alpheus mitochondrial genomes. This phenomenon has not been reported in any other crustacean mitochondrial genome that has been studied so far; however, the translocation of one transfer RNA gene (trnP or trnT) was reported in the mitochondrial genome of Exopalaemon carinicauda. When the ratios of the nonsynonymous and synonymous substitutions rates (Ka/Ks) for the 13 protein coding genes from two Alpheus species (A. japonicus and A. distinguendus) and three Macrobrachium species (M. rosenbergii, M. nipponense, M. lanchesteri) were calculated, the Ka/Ks values for all the protein coding genes in Alpheus and Macrobrachium mitochondrial genomes were found to be less than 1 (between 0.0048 and 0.2057), indicating that a strong purification selection had occurred. The phylogenetic tree that was constructed based on the mitochondrial protein coding genes in the genomes of nine related species indicated that Palaemonidae and Alpheidae formed a monophyly and shared a statistically significant relationship, (Palaemonidae+Alpheidae)+Atyidae, at the family level.

  2. Multi-focal control of mitochondrial gene expression by oncogenic MYC provides potential therapeutic targets in cancer

    PubMed Central

    Oran, Amanda R.; Adams, Clare M.; Zhang, Xiao-yong; Gennaro, Victoria J.; Pfeiffer, Harla K.; Mellert, Hestia S.; Seidel, Hans E.; Mascioli, Kirsten; Kaplan, Jordan; Gaballa, Mahmoud R.; Shen, Chen; Rigoutsos, Isidore; King, Michael P.; Cotney, Justin L.; Arnold, Jamie J.; Sharma, Suresh D.; Martinez, Ubaldo E.; Vakoc, Christopher R.; Chodosh, Lewis A.; Thompson, James E.; Bradner, James E.; Cameron, Craig E.; Shadel, Gerald S.; Eischen, Christine M.; McMahon, Steven B.


    Despite ubiquitous activation in human cancer, essential downstream effector pathways of the MYC transcription factor have been difficult to define and target. Using a structure/function-based approach, we identified the mitochondrial RNA polymerase (POLRMT) locus as a critical downstream target of MYC. The multifunctional POLRMT enzyme controls mitochondrial gene expression, a process required both for mitochondrial function and mitochondrial biogenesis. We further demonstrate that inhibition of this newly defined MYC effector pathway causes robust and selective tumor cell apoptosis, via an acute, checkpoint-like mechanism linked to aberrant electron transport chain complex assembly and mitochondrial reactive oxygen species (ROS) production. Fortuitously, MYC-dependent tumor cell death can be induced by inhibiting the mitochondrial gene expression pathway using a variety of strategies, including treatment with FDA-approved antibiotics. In vivo studies using a mouse model of Burkitt's Lymphoma provide pre-clinical evidence that these antibiotics can successfully block progression of MYC-dependent tumors. PMID:27590350

  3. 5-HT2 Receptor Regulation of Mitochondrial Genes: Unexpected Pharmacological Effects of Agonists and Antagonists.


    Harmon, Jennifer L; Wills, Lauren P; McOmish, Caitlin E; Demireva, Elena Y; Gingrich, Jay A; Beeson, Craig C; Schnellmann, Rick G


    In acute organ injuries, mitochondria are often dysfunctional, and recent research has revealed that recovery of mitochondrial and renal functions is accelerated by induction of mitochondrial biogenesis (MB). We previously reported that the nonselective 5-HT2 receptor agonist DOI [1-(4-iodo-2,5-dimethoxyphenyl)propan-2-amine] induced MB in renal proximal tubular cells (RPTCs). The goal of this study was to determine the role of 5-HT2 receptors in the regulation of mitochondrial genes and oxidative metabolism in the kidney. The 5-HT2C receptor agonist CP-809,101 [2-[(3-chlorophenyl)methoxy]-6-(1-piperazinyl)pyrazine] and antagonist SB-242,084 [6-chloro-2,3-dihydro-5-methyl-N-[6-[(2-methyl-3-pyridinyl)oxy]-3-pyridinyl]-1H-indole-1-carboxyamide dihydrochloride] were used to examine the induction of renal mitochondrial genes and oxidative metabolism in RPTCs and in mouse kidneys in the presence and absence of the 5-HT2C receptor. Unexpectedly, both CP-809,101 and SB-242,084 increased RPTC respiration and peroxisome proliferator-activated receptor γ coactivator-1α (PGC-1α) mRNA expression in RPTCs at 1-10 nM. In addition, CP-809,101 and SB-242,084 increased mRNA expression of PGC-1α and the mitochondrial proteins NADH dehydrogenase subunit 1 and NADH dehydrogenase (ubiquinone) β subcomplex 8 in mice. These compounds increased mitochondrial genes in RPTCs in which the 5-HT2C receptor was downregulated with small interfering RNA and in the renal cortex of mice lacking the 5-HT2C receptor. By contrast, the ability of these compounds to increase PGC-1α mRNA and respiration was blocked in RPTCs treated with 5-HT2A receptor small interfering RNA or the 5-HT2A receptor antagonist eplivanserin. In addition, the 5-HT2A receptor agonist NBOH-2C-CN [4-[2-[[(2-hydroxyphenyl)methyl]amino]ethyl]-2,5-dimethoxybenzonitrile] increased RPTC respiration at 1-100 nM. These results suggest that agonism of the 5-HT2A receptor induces MB and that the classic 5-HT2C receptor agonist CP

  4. Co segregation of the m.1555A>G mutation in the MT-RNR1 gene and mutations in MT-ATP6 gene in a family with dilated mitochondrial cardiomyopathy and hearing loss: A whole mitochondrial genome screening.


    Alila-Fersi, Olfa; Chamkha, Imen; Majdoub, Imen; Gargouri, Lamia; Mkaouar-Rebai, Emna; Tabebi, Mouna; Tlili, Abdelaziz; Keskes, Leila; Mahfoudh, Abdelmajid; Fakhfakh, Faiza


    Mitochondrial disease refers to a heterogeneous group of disorders resulting in defective cellular energy production due to dysfunction of the mitochondrial respiratory chain, which is responsible for the generation of most cellular energy. Because cardiac muscles are one of the high energy demanding tissues, mitochondrial cardiomyopathies is one of the most frequent mitochondria disorders. Mitochondrial cardiomyopathy has been associated with several point mutations of mtDNA in both genes encoded mitochondrial proteins and mitochondrial tRNA and rRNA. We reported here the first description of mutations in MT-ATP6 gene in two patients with clinical features of dilated mitochondrial cardiomyopathy. The mutational analysis of the whole mitochondrial DNA revealed the presence of m.1555A>G mutation in MT-RNR1 gene associated to the m.8527A>G (p.M>V) and the m.8392C>T (p.136P>S) variations in the mitochondrial MT-ATP6 gene in patient1 and his family members with variable phenotype including hearing impairment. The second patient with isolated mitochondrial cardiomyopathy presented the m.8605C>T (p.27P>S) mutation in the MT-ATP6 gene. The three mutations p.M1V, p.P27S and p.P136S detected in MT-ATP6 affected well conserved residues of the mitochondrial protein ATPase 6. In addition, the substitution of proline residue at position 27 and 136 effect hydrophobicity and structure flexibility conformation of the protein.

  5. Cardiolipin content in mitochondria from cultured skin fibroblasts harboring mutations in the mitochondrial ATP6 gene.


    El-Hafidi, Mohammed; Meschini, Maria Chiara; Rizza, Teresa; Santorelli, Filippo M; Bertini, Enrico; Carrozzo, Rosalba; Vázquez-Memije, Martha Elisa


    The role of phospholipids in normal assembly and organization of the membrane proteins has been well documented. Cardiolipin, a unique tetra-acyl phospholipid localized in the inner mitochondrial membrane, is implicated in the stability of many inner-membrane protein complexes. Loss of cardiolipin content, alterations in its acyl chain composition and/or cardiolipin peroxidation have been associated with dysfunction in multiple tissues in a variety of pathological conditions. The aim of this study was to analyze the phospholipid composition of the mitochondrial membrane in the four most frequent mutations in the ATP6 gene: L156R, L217R, L156P and L217P but, more importantly, to investigate the possible changes in the cardiolipin profile. Mitochondrial membranes from fibroblasts with mutations at codon 217 of the ATP6 gene, showed a different cardiolipin content compared to controls. Conversely, results similar to controls were obtained for mutations at codon 156. These findings may be attributed to differences in the biosynthesis and remodeling of cardiolipin at the level of the inner mitochondrial transmembrane related to some mutations of the ATP6 gene.

  6. Unusual organization of a developmentally regulated mitochondrial RNA polymerase (TBMTRNAP) gene in Trypanosoma brucei

    PubMed Central

    Clement, Sandra L.; Koslowsky, Donna J.


    We report here the characterization of a developmentally regulated mitochondrial RNA polymerase transcript in the parasitic protozoan, Trypanosoma brucei. The 3822 bp protein-coding region of the T. brucei mitochondrial RNA polymerase (TBMTRNAP) gene is predicted to encode a 1274 amino acid polypeptide, the carboxyl-terminal domain of which exhibits 29–37% identity with the mitochondrial RNA polymerases from other organisms in the molecular databases. Interestingly, the TBMTRNAP mRNA is one of several mature mRNA species post-transcriptionally processed from a stable, polycistronic precursor. Alternative polyadenylation of the TBMTRNAP mRNA produces two mature transcripts that differ by 500 nt and that show stage-specific differences in abundance during the T. brucei life cycle. This alternative polyadenylation event appears to be accompanied by the alternative splicing of a high abundance, non-coding downstream transcript of unknown function. Our finding that the TBMTRNAP gene is transcribed into two distinct mRNAs subject to differential regulation during the T. brucei life cycle suggests that mitochondrial differentiation might be achieved in part through the regulated expression of this gene. PMID:11470527

  7. Effects of different dietary conditions on the expression of trypsin- and chymotrypsin-like protease genes in the digestive system of the migratory locust, Locusta migratoria.


    Spit, Jornt; Zels, Sven; Dillen, Senne; Holtof, Michiel; Wynant, Niels; Vanden Broeck, Jozef


    While technological advancements have recently led to a steep increase in genomic and transcriptomic data, and large numbers of protease sequences are being discovered in diverse insect species, little information is available about the expression of digestive enzymes in Orthoptera. Here we describe the identification of Locusta migratoria serine protease transcripts (cDNAs) involved in digestion, which might serve as possible targets for pest control management. A total of 5 putative trypsin and 15 putative chymotrypsin gene sequences were characterized. Phylogenetic analysis revealed that these are distributed among 3 evolutionary conserved clusters. In addition, we have determined the relative gene expression levels of representative members in the gut under different feeding conditions. This study demonstrated that the transcript levels for all measured serine proteases were strongly reduced after starvation. On the other hand, larvae of L. migratoria displayed compensatory effects to the presence of Soybean Bowman Birk (SBBI) and Soybean Trypsin (SBTI) inhibitors in their diet by differential upregulation of multiple proteases. A rapid initial upregulation was observed for all tested serine protease transcripts, while only for members belonging to class I, the transcript levels remained elevated after prolonged exposure. In full agreement with these results, we also observed an increase in proteolytic activity in midgut secretions of locusts that were accustomed to the presence of protease inhibitors in their diet, while no change in sensitivity to these inhibitors was observed. Taken together, this paper is the first comprehensive study on dietary dependent transcript levels of proteolytic enzymes in Orthoptera. Our data suggest that compensatory response mechanisms to protease inhibitor ingestion may have appeared early in insect evolution.

  8. The gene encoding DRAP (BACE2), a glycosylated transmembrane protein of the aspartic protease family, maps to the down critical region.


    Acquati, F; Accarino, M; Nucci, C; Fumagalli, P; Jovine, L; Ottolenghi, S; Taramelli, R


    We applied cDNA selection methods to a genomic clone (YAC 761B5) from chromosome 21 located in the so-called 'Down critical region' in 21q22.3. Starting from human fetal heart and brain mRNAs we obtained and sequenced several cDNA clones. One of these clones (Down region aspartic protease (DRAP), named also BACE2 according to the gene nomenclature) revealed a striking nucleotide and amino acid sequence identity with several motifs present in members of the aspartic protease family. In particular the amino acid sequences comprising the two catalytic sites found in all mammalian aspartic proteases are perfectly conserved. Interestingly, the predicted protein shows a typical membrane spanning region; this is at variance with most other known aspartic proteases, which are soluble molecules. We present preliminary evidence, on the basis of in vitro translation studies and cell transfection, that this gene encodes a glycosylated protein which localizes mainly intracellularly but to some extent also to the plasma membrane. Furthermore DRAP/BACE2 shares a high homology with a newly described beta-secretase enzyme (BACE-1) which is a transmembrane aspartic protease. The implications of this finding for Down syndrome are discussed.

  9. Adaptive evolution of mitochondrial energy metabolism genes associated with increased energy demand in flying insects.


    Yang, Yunxia; Xu, Shixia; Xu, Junxiao; Guo, Yan; Yang, Guang


    Insects are unique among invertebrates for their ability to fly, which raises intriguing questions about how energy metabolism in insects evolved and changed along with flight. Although physiological studies indicated that energy consumption differs between flying and non-flying insects, the evolution of molecular energy metabolism mechanisms in insects remains largely unexplored. Considering that about 95% of adenosine triphosphate (ATP) is supplied by mitochondria via oxidative phosphorylation, we examined 13 mitochondrial protein-encoding genes to test whether adaptive evolution of energy metabolism-related genes occurred in insects. The analyses demonstrated that mitochondrial DNA protein-encoding genes are subject to positive selection from the last common ancestor of Pterygota, which evolved primitive flight ability. Positive selection was also found in insects with flight ability, whereas no significant sign of selection was found in flightless insects where the wings had degenerated. In addition, significant positive selection was also identified in the last common ancestor of Neoptera, which changed its flight mode from direct to indirect. Interestingly, detection of more positively selected genes in indirect flight rather than direct flight insects suggested a stronger selective pressure in insects having higher energy consumption. In conclusion, mitochondrial protein-encoding genes involved in energy metabolism were targets of adaptive evolution in response to increased energy demands that arose during the evolution of flight ability in insects.

  10. Cloning and characterization of nuclear genes for two mitochondrial ribosomal proteins in Saccharomyces cerevisiae.

    PubMed Central

    Kitakawa, M; Grohmann, L; Graack, H R; Isono, K


    The genes for two large subunit proteins, YmL8 and YmL20, of the mitochondrial ribosome of Saccharomyces cerevisiae were cloned by hybridization with synthetic oligonucleotide mixtures corresponding to their N-terminal amino acid sequences. They were termed MRP-L8 and MRP-L20, respectively, and their nucleotide sequences were determined using a DNA sequencer. The MRP-L8 gene was found to encode a 26.8-kDa protein whose deduced amino acid sequence has a high degree of similarity to ribosomal protein L17 of Escherichia coli. The gene MRP-L20 was found to encode a 22.3-kDa protein with a presequence consisting of 18 amino acid residues. By Southern blot hybridization to the yeast chromosomes separated by field-inversion gel electrophoresis, the MRP-L8 and MRP-L20 genes were located on chromosomes X and XI, respectively. Gene disruption experiments indicate that their products, YmL8 and YmL20 proteins, are essential for the mitochondrial function and the absence of these proteins causes instability of the mitochondrial DNA. Images PMID:2183197

  11. The complete sequence and gene organization of the mitochondrial genome of the gadilid scaphopod Siphonondentalium lobatum (Mollusca).


    Dreyer, Hermann; Steiner, Gerhard


    Comparisons of mitochondrial gene sequences and gene arrangements can be informative for reconstructing high-level phylogenetic relationships. We determined the complete sequence of the mitochondrial genome of Siphonodentalium lobatum, (Mollusca, Scaphopoda). With only 13,932 bases, it is the shortest molluscan mitochondrial genome reported so far. The genome contains the usual 13 protein-coding genes, two rRNA and 22 tRNA genes. The ATPase subunit 8 gene is exceptionally short. Several transfer RNAs show truncated TpsiC arms or DHU arms. The gene arrangement of S. lobatum is markedly different from all other known molluscan mitochondrial genomes and shows low similarity even to an unpublished gene order of a dentaliid scaphopod. Phylogenetic analyses of all available complete molluscan mitochondrial genomes based on amino acid sequences of 11 protein-coding genes yield trees with low support for the basal branches. None of the traditionally accepted molluscan taxa and phylogenies are recovered in all analyses, except for the euthyneuran Gastropoda. S. lobatum appears as the sister taxon to two of the three bivalve species. We conclude that the deep molluscan phylogeny is probably beyond the resolution of mitochondrial protein sequences. Moreover, assessing the phylogenetic signal in gene order data requires a much larger taxon sample than is currently available, given the exceptional diversity of this character set in the Mollusca.

  12. Tomato transgenic plants expressing hairpin construct of a nematode protease gene conferred enhanced resistance to root-knot nematodes

    PubMed Central

    Dutta, Tushar K.; Papolu, Pradeep K.; Banakar, Prakash; Choudhary, Divya; Sirohi, Anil; Rao, Uma


    Root-knot nematodes (Meloidogyne incognita) cause substantial yield losses in vegetables worldwide, and are difficult to manage. Continuous withdrawal of environmentally-harmful nematicides from the global market warrants the need for novel nematode management strategies. Utility of host-delivered RNAi has been demonstrated in several plants (Arabidopsis, tobacco, and soybean) that exhibited resistance against root-knot and cyst nematodes. Herein, a M. incognita-specific protease gene, cathepsin L cysteine proteinase (Mi-cpl-1), was targeted to generate tomato transgenic lines to evaluate the genetically modified nematode resistance. In vitro knockdown of Mi-cpl-1 gene led to the reduced attraction and penetration of M. incognita in tomato, suggesting the involvement of Mi-cpl-1 in nematode parasitism. Transgenic expression of the RNAi construct of Mi-cpl-1 gene resulted in 60–80% reduction in infection and multiplication of M. incognita in tomato. Evidence for in vitro and in vivo silencing of Mi-cpl-1 was confirmed by expression analysis using quantitative PCR. Our study demonstrates that Mi-cpl-1 plays crucial role during plant-nematode interaction and plant-mediated downregulation of this gene elicits detrimental effect on M. incognita development, reinforcing the potential of RNAi technology for management of phytonematodes in crop plants. PMID:25883594

  13. The complete mitochondrial genome of Neobenedenia melleni (Platyhelminthes: Monogenea): mitochondrial gene content, arrangement and composition compared with two Benedenia species.


    Zhang, Juan; Wu, Xiangyun; Li, Yanwei; Zhao, Mengwei; Xie, Mingquan; Li, Anxing


    The complete mitochondrial (mt) genome sequences of Neobenedenia melleni were determined and compared with those of Benedenia seriolae and B. hoshinai. This circular genome comprises 13,270 bp and includes all 36 typical mt genes found in flatworms. Total AT content of N. melleni is 75.9 %. ATG is the most common start codon, while nad4L is initiated by GTG. All protein-coding genes are predicted to terminate with TAG and TAA. N. melleni has the trnR with a TCG anticodon, which is the same to B. seriolae but different from B. hoshinai (ACG). The mt gene arrangement of N. melleni is similar to that of B. seriolae and B. hoshinai with the exception of three translocations (trnF, trnT and trnG). The overlapped region between nad4L and nad4 was found in the N. melleni mt genome, which was also reported for the published Gyrodactylus species, but it was not found in those of B. seriolae and B. hoshinai, which are non-coding regions instead. The present study provides useful molecular characters for species or strain identification and systematic studies of this parasite.

  14. Strikingly Bacteria-Like and Gene-Rich Mitochondrial Genomes throughout Jakobid Protists

    PubMed Central

    Burger, Gertraud; Gray, Michael W.; Forget, Lise; Lang, B. Franz


    The most bacteria-like mitochondrial genome known is that of the jakobid flagellate Reclinomonas americana NZ. This genome also encodes the largest known gene set among mitochondrial DNAs (mtDNAs), including the RNA subunit of RNase P (transfer RNA processing), a reduced form of transfer–messenger RNA (translational control), and a four-subunit bacteria-like RNA polymerase, which in other eukaryotes is substituted by a nucleus-encoded, single-subunit, phage-like enzyme. Further, protein-coding genes are preceded by potential Shine–Dalgarno translation initiation motifs. Whether similarly ancestral mitochondrial characters also exist in relatives of R. americana NZ is unknown. Here, we report a comparative analysis of nine mtDNAs from five distant jakobid genera: Andalucia, Histiona, Jakoba, Reclinomonas, and Seculamonas. We find that Andalucia godoyi has an even larger mtDNA gene complement than R. americana NZ. The extra genes are rpl35 (a large subunit mitoribosomal protein) and cox15 (involved in cytochrome oxidase assembly), which are nucleus encoded throughout other eukaryotes. Andalucia cox15 is strikingly similar to its homolog in the free-living α-proteobacterium Tistrella mobilis. Similarly, a long, highly conserved gene cluster in jakobid mtDNAs, which is a clear vestige of prokaryotic operons, displays a gene order more closely resembling that in free-living α-proteobacteria than in Rickettsiales species. Although jakobid mtDNAs, overall, are characterized by bacteria-like features, they also display a few remarkably divergent characters, such as 3′-tRNA editing in Seculamonas ecuadoriensis and genome linearization in Jakoba libera. Phylogenetic analysis with mtDNA-encoded proteins strongly supports monophyly of jakobids with Andalucia as the deepest divergence. However, it remains unclear which α-proteobacterial group is the closest mitochondrial relative. PMID:23335123

  15. Constitutive over-expression of rice chymotrypsin protease inhibitor gene OCPI2 results in enhanced growth, salinity and osmotic stress tolerance of the transgenic Arabidopsis plants.


    Tiwari, Lalit Dev; Mittal, Dheeraj; Chandra Mishra, Ratnesh; Grover, Anil


    Protease inhibitors are involved primarily in defense against pathogens. In recent years, these proteins have also been widely implicated in response of plants to diverse abiotic stresses. Rice chymotrypsin protease inhibitor gene OCPI2 is highly induced under salt and osmotic stresses. The construct containing the complete coding sequence of OCPI2 cloned downstream to CaMV35S promoter was transformed in Arabidopsis and single copy, homozygous transgenic lines were produced. The transgenic plants exhibited significantly enhanced tolerance to NaCl, PEG and mannitol stress as compared to wild type plants. Importantly, the vegetative and reproductive growth of transgenic plants under unstressed, control conditions was also enhanced: transgenic plants were more vigorous than wild type, resulting into higher yield in terms of silique number. The RWC values and membrane stability index of transgenic in comparison to wild type plants was higher. Higher proline content was observed in the AtOCPI2 lines, which was associated with higher transcript expression of pyrroline-5-carboxylate synthase and lowered levels of proline dehydrogenase genes. The chymotrypsin protease activities were lower in the transgenic as against wild type plants, under both unstressed, control as well as stressed conditions. It thus appears that rice chymotrypsin protease inhibitor gene OCPI2 is a useful candidate gene for genetic improvement of plants against salt and osmotic stress.

  16. Genome-wide identification and immune response analysis of serine protease inhibitor genes in the silkworm, Bombyx mori.


    Zhao, Ping; Dong, Zhaoming; Duan, Jun; Wang, Genhong; Wang, Lingyan; Li, Youshan; Xiang, Zhonghuai; Xia, Qingyou


    In most insect species, a variety of serine protease inhibitors (SPIs) have been found in multiple tissues, including integument, gonad, salivary gland, and hemolymph, and are required for preventing unwanted proteolysis. These SPIs belong to different families and have distinct inhibitory mechanisms. Herein, we predicted and characterized potential SPI genes based on the genome sequences of silkworm, Bombyx mori. As a result, a total of eighty SPI genes were identified in B. mori. These SPI genes contain 10 kinds of SPI domains, including serpin, Kunitz_BPTI, Kazal, TIL, amfpi, Bowman-Birk, Antistasin, WAP, Pacifastin, and alpha-macroglobulin. Sixty-three SPIs contain single SPI domain while the others have at least two inhibitor units. Some SPIs also contain non-inhibitor domains for protein-protein interactions, including EGF, ADAM_spacer, spondin_N, reeler, TSP_1 and other modules. Microarray analysis showed that fourteen SPI genes from lineage-specific TIL family and Group F of serpin family had enriched expression in the silk gland. The roles of SPIs in resisting pathogens were investigated in silkworms when they were infected by four pathogens. Microarray and qRT-PCR experiments revealed obvious up-regulation of 8, 4, 3 and 3 SPI genes after infection with Escherichia coli, Bacillus bombysepticus, Beauveria bassiana or B. mori nuclear polyhedrosis virus (BmNPV), respectively. On the contrary, 4, 11, 7 and 9 SPI genes were down-regulated after infection with E. coli, B. bombysepticus, B. bassiana or BmNPV, respectively. These results suggested that these SPI genes may be involved in resistance to pathogenic microorganisms. These findings may provide valuable information for further clarifying the roles of SPIs in the development, immune defence, and efficient synthesis of silk gland protein.

  17. Differential Gene Expression Reveals Mitochondrial Dysfunction in an Imprinting Center Deletion Mouse Model of Prader-Willi Syndrome

    PubMed Central

    Fan, Weiwei; Coskun, Pinar E.; Nalbandian, Angèle; Knoblach, Susan; Resnick, James L.; Hoffman, Eric; Wallace, Douglas C.; Kimonis, Virginia E.


    Prader-Willi syndrome (PWS) is a genetic disorder caused by deficiency of imprinted gene expression from the paternal chromosome 15q11-15q13 and clinically characterized by neonatal hypotonia, short stature, cognitive impairment, hypogonadism, hyperphagia, morbid obesity and diabetes. Previous clinical studies suggest that a defect in energy metabolism may be involved in the pathogenesis of PWS. We focused our attention on the genes associated with energy metabolism and found that there were 95 and 66 mitochondrial genes differentially expressed in PWS muscle and brain, respectively. Assessment of enzyme activities of mitochondrial oxidative phosphorylation (OXPHOS) complexes in the brain, heart, liver and muscle were assessed. We found the enzyme activities of the cardiac mitochondrial complexes II+III were upregulated in the imprinting center deletion (PWS-IC) mice compared to the wild type littermates. These studies suggest that differential gene expression, especially of the mitochondrial genes may contribute to the pathophysiology of PWS. PMID:24127921

  18. Mitochondrial genomes of Clymenella torquata (Maldanidae) and Riftia pachyptila (Siboglinidae): evidence for conserved gene order in annelida.


    Jennings, Robert M; Halanych, Kenneth M


    Mitochondrial genomes are useful tools for inferring evolutionary history. However, many taxa are poorly represented by available data. Thus, to further understand the phylogenetic potential of complete mitochondrial genome sequence data in Annelida (segmented worms), we examined the complete mitochondrial sequence for Clymenella torquata (Maldanidae) and an estimated 80% of the sequence of Riftia pachyptila (Siboglinidae). These genomes have remarkably similar gene orders to previously published annelid genomes, suggesting that gene order is conserved across annelids. This result is interesting, given the high variation seen in the closely related Mollusca and Brachiopoda. Phylogenetic analyses of DNA sequence, amino acid sequence, and gene order all support the recent hypothesis that Sipuncula and Annelida are closely related. Our findings suggest that gene order data is of limited utility in annelids but that sequence data holds promise. Additionally, these genomes show AT bias (approximately 66%) and codon usage biases but have a typical gene complement for bilaterian mitochondrial genomes.

  19. Two complete mitochondrial genomes from Praticolella mexicana Perez, 2011 (Polygyridae) and gene order evolution in Helicoidea (Mollusca, Gastropoda)

    PubMed Central

    Minton, Russell L.; Cruz, Marco A. Martinez; Farman, Mark L.; Perez, Kathryn E.


    Abstract Helicoidea is a diverse group of land snails with a global distribution. While much is known regarding the relationships of helicoid taxa, comparatively little is known about the evolution of the mitochondrial genome in the superfamily. We sequenced two complete mitochondrial genomes from Praticolella mexicana Perez, 2011 representing the first such data from the helicoid family Polygyridae, and used them in an evolutionary analysis of mitogenomic gene order. We found the mitochondrial genome of Praticolella mexicana to be 14,008 bp in size, possessing the typical 37 metazoan genes. Multiple alternate stop codons are used, as are incomplete stop codons. Mitogenome size and nucleotide content is consistent with other helicoid species. Our analysis of gene order suggested that Helicoidea has undergone four mitochondrial rearrangements in the past. Two rearrangements were limited to tRNA genes only, and two involved protein coding genes. PMID:27833437

  20. Photoperiod-sensitive cytoplasmic male sterility in wheat: nuclear-mitochondrial incompatibility results in differential processing of the mitochondrial orf25 gene.


    Ogihara, Y; Kurihara, Y; Futami, K; Tsuji, K; Murai, K


    An alloplasmic wheat line with the cytoplasm of Aegilops crassa expresses photoperiod-sensitive cytoplasmic male sterility (PCMS). Southern- and Northern-hybridization analyses showed that this line contains alterations in both the gene structure and transcription patterns of the mitochondrial gene orf25. In this study, the nucleotide sequence around the orf25 gene of Ae. crassa (CR-orf25) and common wheat (AE-orf25) was determined, and we found that the upstream region of CR-orf25 had been replaced by that of rps7 of common wheat (AE-rps7) through recombination. A novel open reading frame (orf48) is present upstream of CR-orf25. In these three genes, transcription was initiated from the consensus promoter motif of plant mitochondrial genes located in the upstream regions. Processing enzymes in Ae. crassa and common wheat cleave the respective precursor mRNAs, namely CR-orf25 and AE-rps7, at sites similar to that of the premature mitochondrial 26S rRNA. In contrast, the precursor mRNA is not effectively processed at the target sequence of CR-orf25 in the alloplasmic wheat line. Because major transcripts of the euplasmic CR-orf25 and AE-rps7 genes would result in a truncated orf48 product, one possibility is that the orf48 protein might disturb mitochondrial function at a specific stage and hence affect the expression of the PCMS trait.

  1. Aging-induced alterations in gene transcripts and functional activity of mitochondrial oxidative phosphorylation complexes in the heart.


    Preston, Claudia C; Oberlin, Andrew S; Holmuhamedov, Ekhson L; Gupta, Anu; Sagar, Sandeep; Syed, Rashad H Khazi; Siddiqui, Sabeeh A; Raghavakaimal, Sreekumar; Terzic, Andre; Jahangir, Arshad


    Aging is associated with progressive decline in energetic reserves compromising cardiac performance and tolerance to injury. Although deviations in mitochondrial functions have been documented in senescent heart, the molecular bases for the decline in energy metabolism are only partially understood. Here, high-throughput transcription profiles of genes coding for mitochondrial proteins in ventricles from adult (6-months) and aged (24-months) rats were compared using microarrays. Out of 614 genes encoding for mitochondrial proteins, 94 were differentially expressed with 95% downregulated in the aged. The majority of changes affected genes coding for proteins involved in oxidative phosphorylation (39), substrate metabolism (14) and tricarboxylic acid cycle (6). Compared to adult, gene expression changes in aged hearts translated into a reduced mitochondrial functional capacity, with decreased NADH-dehydrogenase and F(0)F(1) ATPase complex activities and capacity for oxygen-utilization and ATP synthesis. Expression of genes coding for transcription co-activator factors involved in the regulation of mitochondrial metabolism and biogenesis were downregulated in aged ventricles without reduction in mitochondrial density. Thus, aging induces a selective decline in activities of oxidative phosphorylation complexes I and V within a broader transcriptional downregulation of mitochondrial genes, providing a substrate for reduced energetic efficiency associated with senescence.

  2. Aging-Induced Alterations in Gene Transcripts and Functional Activity of Mitochondrial Oxidative Phosphorylation Complexes in the Heart

    PubMed Central

    Preston, Claudia C.; Oberlin, Andrew S.; Holmuhamedov, Ekhson L.; Gupta, Anu; Sagar, Sandeep; Khazi Syed, Rashad H.; Siddiqui, Sabeeh; Raghavakaimal, Sreekumar; Terzic, Andre; Jahangir, Arshad


    Aging is associated with progressive decline in energetic reserves compromising cardiac performance and tolerance to injury. Although deviations in mitochondrial functions have been documented in senescent heart, the molecular bases for the decline in energy metabolism are only partially understood. Here, high-throughput transcription profiles of genes coding for mitochondrial proteins in ventricles from adult (6-months) and aged (24-months) rats were compared using microarrays. Out of 614 genes encoding for mitochondrial proteins, 94 were differentially expressed with 95% downregulated in the aged. The majority of changes affected genes coding for proteins involved in oxidative phosphorylation (39), substrate metabolism (14) and tricarboxylic acid cycle (6). Compared to adult, gene expression changes in aged hearts translated into a reduced mitochondrial functional capacity, with decreased NADH-dehydrogenase and F0F1-ATPase complex activities and capacity for oxygen-utilization and ATP synthesis. Expression of genes coding for transcription co-activator factors involved in the regulation of mitochondrial metabolism and biogenesis were downregulated in aged ventricles without reduction in mitochondrial density. Thus, aging induces a selective decline in activities of oxidative phosphorylation complexes I and V within a broader transcriptional downregulation of mitochondrial genes, providing a substrate for reduced energetic efficiency associated with senescence. PMID:18400259

  3. RNA editing is absent in a single mitochondrial gene of Didymium iridis.


    Hendrickson, Peter G; Silliker, Margaret E


    An open reading frame (ORF) was found in the mitochondrial genome of the Pan2-16 strain of Didymium iridis that showed high similarity to the NADH dehydrogenase subunit 3 (nad3) gene in other organisms. So far all other typical mitochondrial genes identified in this organism require RNA editing to generate ORFs capable of directing protein synthesis. The D. iridis sequence was compared to the putative nad3 gene in the related myxomycete Physarum polycephalum, which would require editing. Based on this comparison, editing sites could be predicted for the P. polycelphalum gene that would result in the synthesis of a highly conserved ND3 protein between the two organisms. To determine the editing status of the nad3 gene in other D. iridis strains, PCR was used to amplify this region from eight other independent isolates of the A1 Central American interbreeding series. In each case a 378 base pair ORF was detected by PCR amplification and sequencing. Three patterns of sequence variation were observed; however all base substitutions were in the third codon position and silent with respect to the amino acids encoded. The distribution of the sequence variants was mapped geographically. The requirement for RNA editing in all other typical mitochondrial genes of D. iridis and P. polycephalum and the presence of RNA editing in the nad3 gene of P. polycephalum suggest that the D. iridis nad3 gene might have been edited at one time. We propose that the D. iridis nad3 gene may have lost the requirement for RNA editing by reverse transcription of an edited transcript that subsequently was inserted into the genome.

  4. Gene expression profiling in equine polysaccharide storage myopathy revealed inflammation, glycogenesis inhibition, hypoxia and mitochondrial dysfunctions

    PubMed Central

    Barrey, Eric; Mucher, Elodie; Jeansoule, Nicolas; Larcher, Thibaut; Guigand, Lydie; Herszberg, Bérénice; Chaffaux, Stéphane; Guérin, Gérard; Mata, Xavier; Benech, Philippe; Canale, Marielle; Alibert, Olivier; Maltere, Péguy; Gidrol, Xavier


    Background Several cases of myopathies have been observed in the horse Norman Cob breed. Muscle histology examinations revealed that some families suffer from a polysaccharide storage myopathy (PSSM). It is assumed that a gene expression signature related to PSSM should be observed at the transcriptional level because the glycogen storage disease could also be linked to other dysfunctions in gene regulation. Thus, the functional genomic approach could be conducted in order to provide new knowledge about the metabolic disorders related to PSSM. We propose exploring the PSSM muscle fiber metabolic disorders by measuring gene expression in relationship with the histological phenotype. Results Genotypying analysis of GYS1 mutation revealed 2 homozygous (AA) and 5 heterozygous (GA) PSSM horses. In the PSSM muscles, histological data revealed PAS positive amylase resistant abnormal polysaccharides, inflammation, necrosis, and lipomatosis and active regeneration of fibers. Ultrastructural evaluation revealed a decrease of mitochondrial number and structural disorders. Extensive accumulation of an abnormal polysaccharide displaced and partially replaced mitochondria and myofibrils. The severity of the disease was higher in the two homozygous PSSM horses. Gene expression analysis revealed 129 genes significantly modulated (p < 0.05). The following genes were up-regulated over 2 fold: IL18, CTSS, LUM, CD44, FN1, GST01. The most down-regulated genes were the following: mitochondrial tRNA, SLC2A2, PRKCα, VEGFα. Data mining analysis showed that protein synthesis, apoptosis, cellular movement, growth and proliferation were the main cellular functions significantly associated with the modulated genes (p < 0.05). Several up-regulated genes, especially IL18, revealed a severe muscular inflammation in PSSM muscles. The up-regulation of glycogen synthase kinase-3 (GSK3β) under its active form could be responsible for glycogen synthase (GYS1) inhibition and hypoxia-inducible factor

  5. A One-Megabase Physical Map Provides Insights on Gene Organization in the Enormous Mitochondrial Genome of Cucumber

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Cucumber has one of the largest mitochondrial genomes known among all eukaryotes, due in part to the accumulation of short repetitive-DNA motifs. Recombination among these repetitive DNAs produces rearrangements affecting organization and expression of mitochondrial genes. In order to more efficie...

  6. Rearrangement of mitochondrial tRNA genes in flat bugs (Hemiptera: Aradidae)

    PubMed Central

    Song, Fan; Li, Hu; Shao, Renfu; Shi, Aimin; Bai, Xiaoshuan; Zheng, Xiaorong; Heiss, Ernst; Cai, Wanzhi


    The typical insect mitochondrial (mt) genome organization, which contains a single chromosome with 37 genes, was found in the infraorder Pentatomomorpha (suborder Heteroptera). The arrangement of mt genes in these true bugs is usually the same as the ancestral mt gene arrangement of insects. Rearrangement of transfer RNA (tRNA) genes, however, has been found in two subfamilies of flat bugs (Mezirinae and Calisiinae, family Aradidae). In this study, we sequenced the complete mt genomes of four species from three other subfamilies (Aradinae, Carventinae and Aneurinae). We found tRNA gene rearrangement in all of these four species. All of the rearranged tRNA genes are located between the mitochondrial control region and cox1, indicating this region as a hotspot for gene rearrangement in flat bugs; the rearrangement is likely caused by events of tandem duplication and random deletion of genes. Furthermore, our phylogenetic and dating analyses indicated that the swap of positions between trnQ and trnI occurred ~162 million years ago (MYA) in the most recent common ancestor of the five subfamilies of flat bugs investigated to date, whereas the swap of positions between trnC and trnW occurred later in the lineage leading to Calisiinae, and the translocation of trnC and trnY occurred later than 134 MYA in the lineage leading to Aradinae. PMID:27180804

  7. Rearrangement of mitochondrial tRNA genes in flat bugs (Hemiptera: Aradidae).


    Song, Fan; Li, Hu; Shao, Renfu; Shi, Aimin; Bai, Xiaoshuan; Zheng, Xiaorong; Heiss, Ernst; Cai, Wanzhi


    The typical insect mitochondrial (mt) genome organization, which contains a single chromosome with 37 genes, was found in the infraorder Pentatomomorpha (suborder Heteroptera). The arrangement of mt genes in these true bugs is usually the same as the ancestral mt gene arrangement of insects. Rearrangement of transfer RNA (tRNA) genes, however, has been found in two subfamilies of flat bugs (Mezirinae and Calisiinae, family Aradidae). In this study, we sequenced the complete mt genomes of four species from three other subfamilies (Aradinae, Carventinae and Aneurinae). We found tRNA gene rearrangement in all of these four species. All of the rearranged tRNA genes are located between the mitochondrial control region and cox1, indicating this region as a hotspot for gene rearrangement in flat bugs; the rearrangement is likely caused by events of tandem duplication and random deletion of genes. Furthermore, our phylogenetic and dating analyses indicated that the swap of positions between trnQ and trnI occurred ~162 million years ago (MYA) in the most recent common ancestor of the five subfamilies of flat bugs investigated to date, whereas the swap of positions between trnC and trnW occurred later in the lineage leading to Calisiinae, and the translocation of trnC and trnY occurred later than 134 MYA in the lineage leading to Aradinae.

  8. Mitochondrial gene replacement in human pluripotent stem cell-derived neural progenitors.


    Iyer, S; Xiao, E; Alsayegh, K; Eroshenko, N; Riggs, M J; Bennett, J P; Rao, R R


    Human pluripotent stem cell-derived neural progenitor (hNP) cells are an excellent resource for understanding early neural development and neurodegenerative disorders. Given that many neurodegenerative disorders can be correlated with defects in the mitochondrial genome, optimal utilization of hNP cells requires an ability to manipulate and monitor changes in the mitochondria. Here, we describe a novel approach that uses recombinant human mitochondrial transcription factor A (rhTFAM) protein to transfect and express a pathogenic mitochondrial genome (mtDNA) carrying the G11778A mutation associated with Leber's hereditary optic neuropathy (LHON) disease, into dideoxycytidine (ddC)-treated hNPs. Treatment with ddC reduced endogenous mtDNA and gene expression, without loss of hNP phenotypic markers. Entry of G11778A mtDNA complexed with the rhTFAM was observed in mitochondria of ddC-hNPs. Expression of the pathogenic RNA was confirmed by restriction enzyme analysis of the SfaN1-digested cDNA. On the basis of the expression of neuron-specific class III beta-tubulin, neuronal differentiation occurred. Our results show for the first time that pathogenic mtDNA can be introduced and expressed into hNPs without loss of phenotype or neuronal differentiation potential. This mitochondrial gene replacement technology allows for creation of in vitro stem cell-based models useful for understanding neuronal development and treatment of neurodegenerative disorders.

  9. Enhanced osteoclastogenesis by mitochondrial retrograde signaling through transcriptional activation of the cathepsin K gene.


    Guha, Manti; Srinivasan, Satish; Koenigstein, Alexander; Zaidi, Mone; Avadhani, Narayan G


    Mitochondrial dysfunction has emerged as an important factor in wide ranging human pathologies. We have previously defined a retrograde signaling pathway that originates from dysfunctional mitochondria (Mt-RS) and causes a global nuclear transcriptional reprograming as its end point. Mitochondrial dysfunction causing disruption of mitochondrial membrane potential and consequent increase in cytosolic calcium [Ca(2) ](c) activates calcineurin and the transcription factors NF-κB, NFAT, CREB, and C/EBPδ. In macrophages, this signaling complements receptor activator of nuclear factor kappa-B ligand (RANKL)-induced osteoclastic differentiation. Here, we show that the Mt-RS activated transcriptional coactivator heterogeneous ribonucleoprotein A2 (hnRNP A2) is induced by hypoxia in murine macrophages. We demonstrate that the cathepsin K gene (Ctsk), one of the key genes upregulated during osteoclast differentiation, is transcriptionally activated by Mt-RS factors. HnRNP A2 acts as a coactivator with nuclear transcription factors, cRel, and C/EBPδ for Ctsk promoter activation under hypoxic conditions. Notably, our study shows that hypoxia-induced activation of the stress target factors mediates effects similar to that of RANKL with regard to Ctsk activation. We therefore suggest that mitochondrial dysfunction and activation of Mt-RS, induced by various pathophysiologic conditions, is a potential risk factor for osteoclastogenesis and bone loss.

  10. Mitochondrial genome sequence and gene order of Sipunculus nudus give additional support for an inclusion of Sipuncula into Annelida

    PubMed Central

    Mwinyi, Adina; Meyer, Achim; Bleidorn, Christoph; Lieb, Bernhard; Bartolomaeus, Thomas; Podsiadlowski, Lars


    Background Mitochondrial genomes are a valuable source of data for analysing phylogenetic relationships. Besides sequence information, mitochondrial gene order may add phylogenetically useful information, too. Sipuncula are unsegmented marine worms, traditionally placed in their own phylum. Recent molecular and morphological findings suggest a close affinity to the segmented Annelida. Results The first complete mitochondrial genome of a member of Sipuncula, Sipunculus nudus, is presented. All 37 genes characteristic for metazoan mtDNA were detected and are encoded on the same strand. The mitochondrial gene order (protein-coding and ribosomal RNA genes) resembles that of annelids, but shows several derivations so far found only in Sipuncula. Sequence based phylogenetic analysis of mitochondrial protein-coding genes results in significant bootstrap support for Annelida sensu lato, combining Annelida together with Sipuncula, Echiura, Pogonophora and Myzostomida. Conclusion The mitochondrial sequence data support a close relationship of Annelida and Sipuncula. Also the most parsimonious explanation of changes in gene order favours a derivation from the annelid gene order. These results complement findings from recent phylogenetic analyses of nuclear encoded genes as well as a report of a segmental neural patterning in Sipuncula. PMID:19149868

  11. Probable presence of an ubiquitous cryptic mitochondrial gene on the antisense strand of the cytochrome oxidase I gene

    PubMed Central


    Background Mitochondria mediate most of the energy production that occurs in the majority of eukaryotic organisms. These subcellular organelles contain a genome that differs from the nuclear genome and is referred to as mitochondrial DNA (mtDNA). Despite a disparity in gene content, all mtDNAs encode at least two components of the mitochondrial electron transport chain, including cytochrome c oxidase I (Cox1). Presentation of the hypothesis A positionally conserved ORF has been found on the complementary strand of the cox1 genes of both eukaryotic mitochondria (protist, plant, fungal and animal) and alpha-proteobacteria. This putative gene has been named gau for gene antisense ubiquitous in mtDNAs. The length of the deduced protein is approximately 100 amino acids. In vertebrates, several stop codons have been found in the mt gau region, and potentially functional gau regions have been found in nuclear genomes. However, a recent bioinformatics study showed that several hypothetical overlapping mt genes could be predicted, including gau; this involves the possible import of the cytosolic AGR tRNA into the mitochondria and/or the expression of mt antisense tRNAs with anticodons recognizing AGR codons according to an alternative genetic code that is induced by the presence of suppressor tRNAs. Despite an evolutionary distance of at least 1.5 to 2.0 billion years, the deduced Gau proteins share some conserved amino acid signatures and structure, which suggests a possible conserved function. Moreover, BLAST analysis identified rare, sense-oriented ESTs with poly(A) tails that include the entire gau region. Immunohistochemical analyses using an anti-Gau monoclonal antibody revealed strict co-localization of Gau proteins and a mitochondrial marker. Testing the hypothesis This hypothesis could be tested by purifying the gau gene product and determining its sequence. Cell biological experiments are needed to determine the physiological role of this protein. Implications of

  12. The complete mitochondrial genome of the fire coral-inhabiting barnacle Megabalanus ajax (Sessilia: Balanidae): gene rearrangements and atypical gene content.


    Shen, Xin; Chu, Ka Hou; Chan, Benny Kwok Kan; Tsang, Ling Ming


    The complete mitochondrial genome of Megabalanus ajax Darwin, 1854 (Sessilia: Balanidae) is reported. Compared to typical gene content of metazoan mitochondrial genomes, duplication of one tRNA gene (trnL2) and absence of another tRNA gene (trnS1) are identified in M. ajax mitochondrial genome. There is a replacement of one tRNA (trnS1) by another tRNA (trnL2) in M. ajax mitochondrial genome compared to Megabalanus volcano mitochondrial genome. Inversion of a six-gene block (trnP-nd4L-nd4-trnH-nd5-trnF) is found between M. ajax/M. volcano and Tetraclita japonica mitochondrial genomes. With reference to the pancrustacean mitochondrial ground pattern, there is an inversion of a large gene block from the light strand to heavy strand in the two Megabalanus mitochondrial genomes, including three PCGs and two tRNAs (nd4L-nd4-trnH-nd5-trnF). Furthermore, four tRNAs (trnA, trnE, trnQ and trnC) exhibit translocation, while translocation and inversion occur in three tRNAs (trnP, trnY and trnK).

  13. Cadmium exposure affects mitochondrial bioenergetics and gene expression of key mitochondrial proteins in the eastern oyster Crassostrea virginica Gmelin (Bivalvia: Ostreidae).


    Sokolova, Inna M; Sokolov, Eugene P; Ponnappa, Kavita M


    Cadmium is a ubiquitous and extremely toxic metal, which strongly affects mitochondrial function of aquatic organisms in vitro; however, nothing is known about the in vivo effects of sublethal concentrations of this metal on mitochondrial bioenergetics. We have studied the effects of exposure to 0 (control) or 25 microg L-1 (Cd-exposed) Cd2+ on mitochondrial function and gene expression of key mitochondrial proteins in the eastern oyster Crassostrea virginica. Cadmium exposure in vivo resulted in considerable accumulation of cadmium in oyster mitochondria and in a significant decrease of ADP-stimulated respiration (state 3) by 30% indicating impaired capacity for ATP production. The decrease in state 3 respiration was similar to the level of inhibition expected from the direct effects of cadmium accumulated in oyster mitochondria. On the other hand, while no effect on proton leak was expected based on the mitochondrial accumulation of cadmium, Cd-exposed oysters in fact showed a significant decline of the proton leak rate (state 4+respiration) by 40%. This suggested a downregulation of proton leak, which correlated with a decrease in mRNA expression of a mitochondrial uncoupling protein UCP6 and two other potential uncouplers, mitochondrial substrate carriers MSC-1 and MSC-2. Expression of other key mitochondrial proteins including cytochrome c oxidase, adenine nucleotide transporter and voltage dependent anion channel was not affected by cadmium exposure. Adenylate energy charge (AEC) was significantly lower in Cd-exposed oysters; however, this was due to higher steady state ADP levels and not to the decrease in tissue ATP levels. Our data show that adjustment of the proton leak in cadmium-exposed oysters may be a compensatory mechanism, which allows them to maintain normal mitochondrial coupling and ATP levels despite the cadmium-induced inhibition of capacity for ATP production.

  14. The same Arabidopsis gene encodes both cytosolic and mitochondrial alanyl-tRNA synthetases.

    PubMed Central

    Mireau, H; Lancelin, D; Small, I D


    In plants, all aminoacyl-tRNA synthetases are nuclearly encoded, despite the fact that their activities are required in the three protein-synthesizing cell compartments (cytosol, mitochondria, and chloroplasts). To investigate targeting of these enzymes, we cloned cDNAs encoding alanyl-tRNA synthetase (AlaRS) and the corresponding nuclear gene, ALATS, from Arabidopsis by using degenerate polymerase chain reaction primers based on highly conserved regions shared between known AlaRSs from other organisms. Analysis of the transcription of the gene showed the presence of two potential translation initiation codons in some ALATS mRNAs. Translation from the upstream AUG would generate an N-terminal extension with features characteristic of mitochondrial targeting peptides. A polyclonal antibody raised against part of the Arabidopsis AlaRS revealed that the Arabidopsis cytosolic and mitochondrial AlaRSs are immunologically similar, suggesting that both isoforms are encoded by the ALATS gene. In vitro experiments confirmed that two polypeptides can be translated from AlATS transcripts, with most ribosomes initiating on the downstream AUG to give the shorter polypeptide corresponding in size to the cytosolic enzyme. The ability of the presequence encoded between the two initiation codons to direct polypeptides to mitochondria was demonstrated by expression of fusion proteins in tobacco protoplasts and in yeast. We conclude that the ALATS gene encodes both the cytosolic and the mitochondrial forms of AlaRS, depending on which of the two AUG codons is used to initiate translation. PMID:8672889

  15. Maintenance and Integrity of the Mitochondrial Genome: a Plethora of Nuclear Genes in the Budding Yeast

    PubMed Central

    Contamine, Véronique; Picard, Marguerite


    Instability of the mitochondrial genome (mtDNA) is a general problem from yeasts to humans. However, its genetic control is not well documented except in the yeast Saccharomyces cerevisiae. From the discovery, 50 years ago, of the petite mutants by Ephrussi and his coworkers, it has been shown that more than 100 nuclear genes directly or indirectly influence the fate of the rho+ mtDNA. It is not surprising that mutations in genes involved in mtDNA metabolism (replication, repair, and recombination) can cause a complete loss of mtDNA (rho0 petites) and/or lead to truncated forms (rho−) of this genome. However, most loss-of-function mutations which increase yeast mtDNA instability act indirectly: they lie in genes controlling functions as diverse as mitochondrial translation, ATP synthase, iron homeostasis, fatty acid metabolism, mitochondrial morphology, and so on. In a few cases it has been shown that gene overexpression increases the levels of petite mutants. Mutations in other genes are lethal in the absence of a functional mtDNA and thus convert this petite-positive yeast into a petite-negative form: petite cells cannot be recovered in these genetic contexts. Most of the data are explained if one assumes that the maintenance of the rho+ genome depends on a centromere-like structure dispensable for the maintenance of rho− mtDNA and/or the function of mitochondrially encoded ATP synthase subunits, especially ATP6. In fact, the real challenge for the next 50 years will be to assemble the pieces of this puzzle by using yeast and to use complementary models, especially in strict aerobes. PMID:10839818

  16. Regulation of the nuclear genes encoding the cytoplasmic and mitochondrial leucyl-tRNA synthetases of Neurospora crassa.

    PubMed Central

    Chow, C M; Rajbhandary, U L


    We show that the nuclear genes for the cytoplasmic and mitochondrial leucyl-tRNA synthetase (LeuRS) of Neurospora crassa are distinct in their encoded proteins, codon usage, mRNA levels, and regulation. The 4.2-kilobase-pair region representing the structural gene for cytoplasmic LeuRS and flanking regions has been sequenced. The positions of the 5' and 3' ends of mRNA and of a single 62-base-pair intron have been mapped. The methionine-initiated open reading frame encoded a protein of 1,123 amino acids and displayed a strong codon bias. Although cytoplasmic LeuRS shares with mitochondrial LeuRS some general features common to most aminoacyl-tRNA synthetases, there is little amino acid sequence similarity between them, mRNA levels for cytoplasmic LeuRS were much higher than those for mitochondrial LeuRS. This observation and the strong codon bias in the cytoplasmic LeuRS gene may contribute to a greater abundance of cytoplasmic LeuRS than mitochondrial LeuRS. The genes for cytoplasmic and mitochondrial LeuRS are regulated independently. The cytoplasmic LeuRS gene is regulated by the cross-pathway control system in N. crassa, which is analogous to general amino acid control in Saccharomyces cerevisiae. The cytoplasmic LeuRS mRNA levels are induced by amino acid starvation resulting from the addition of aminotriazole. Part of this increase is due to utilization of new transcription start sites. In contrast, the mitochondrial LeuRS gene is not induced by amino acid limitation. However, the mitochondrial LeuRS mRNA levels did increase dramatically upon inhibition of mitochondrial protein synthesis by chloramphenicol or ethidium bromide or in the temperature-sensitive strain leu-5 carrying a mutation in the mitochondrial LeuRS structural gene. Images PMID:2532300

  17. Three-parent in vitro fertilization: gene replacement for the prevention of inherited mitochondrial diseases.


    Amato, Paula; Tachibana, Masahito; Sparman, Michelle; Mitalipov, Shoukhrat


    The exchange of nuclear genetic material between oocytes and embryos offers a novel reproductive option for the prevention of inherited mitochondrial diseases. Mitochondrial dysfunction has been recognized as a significant cause of a number of serious multiorgan diseases. Tissues with a high metabolic demand, such as brain, heart, muscle, and central nervous system, are often affected. Mitochondrial disease can be due to mutations in mitochondrial DNA or in nuclear genes involved in mitochondrial function. There is no curative treatment for patients with mitochondrial disease. Given the lack of treatments and the limitations of prenatal and preimplantation diagnosis, attention has focused on prevention of transmission of mitochondrial disease through germline gene replacement therapy. Because mitochondrial DNA is strictly maternally inherited, two approaches have been proposed. In the first, the nuclear genome from the pronuclear stage zygote of an affected woman is transferred to an enucleated donor zygote. A second technique involves transfer of the metaphase II spindle from the unfertilized oocyte of an affected woman to an enucleated donor oocyte. Our group recently reported successful spindle transfer between human oocytes, resulting in blastocyst development and embryonic stem cell derivation, with very low levels of heteroplasmy. In this review we summarize these novel assisted reproductive techniques and their use to prevent transmission of mitochondrial disorders. The promises and challenges are discussed, focusing on their potential clinical application.

  18. Molecular anatomy of tunicate senescence: reversible function of mitochondrial and nuclear genes associated with budding cycles.


    Kawamura, Kaz; Kitamura, Seigo; Sekida, Satoko; Tsuda, Masayuki; Sunanaga, Takeshi


    Zooids of the asexual strain of Polyandrocarpa misakiensis have a lifespan of 4-5 months; before dying, they produce many buds, enabling continuation of the strain. This study was designed to investigate the nature of gene inactivation and reactivation during this continuous process of senescence and budding. During senescence, the zooidal epidermis showed acid β-galactosidase activity, lost proliferating cell nuclear antigen immunoreactivity and became ultrastructurally worn, indicating that the epidermis is a major tissue affected by the ageing process. Semi-quantitative PCR analysis showed that the genes encoding mitochondrial respiratory chains (MRCs) engaged in decreased transcriptional activity in senescent adults compared with younger adults. The results of in situ hybridization showed that the epidermis dramatically attenuates MRC expression during ageing but restores gene activity when budding commences. During budding and ageing, the nuclear gene Eed (a polycomb group component) was activated and inactivated in a pattern similar to that observed in MRCs. In buds, RNA interference (RNAi) of Eed attenuated Eed transcripts but did not affect the gene expression of pre-activated MRCs. A tunicate humoral factor, TC14-3, could induce Eed, accompanying the reactivation of MRC in adult zooids. When RNAi of Eed and Eed induction were performed simultaneously, zooidal cells and tissues failed to engage in MRC reactivation, indicating the involvement of Eed in MRC activation. Results of this study provide evidence that the mitochondrial gene activities of Polyandrocarpa can be reversed during senescence and budding, suggesting that they are regulated by nuclear polycomb group genes.

  19. Drosophila Erect wing (Ewg) controls mitochondrial fusion during muscle growth and maintenance by regulation of the Opa1-like gene.


    Rai, Mamta; Katti, Prasanna; Nongthomba, Upendra


    Mitochondrial biogenesis and morphological changes are associated with tissue-specific functional demand, but the factors and pathways that regulate these processes have not been completely identified. A lack of mitochondrial fusion has been implicated in various developmental and pathological defects. The spatiotemporal regulation of mitochondrial fusion in a tissue such as muscle is not well understood. Here, we show in Drosophila indirect flight muscles (IFMs) that the nuclear-encoded mitochondrial inner membrane fusion gene, Opa1-like, is regulated in a spatiotemporal fashion by the transcription factor/co-activator Erect wing (Ewg). In IFMs null for Ewg, mitochondria undergo mitophagy and/or autophagy accompanied by reduced mitochondrial functioning and muscle degeneration. By following the dynamics of mitochondrial growth and shape in IFMs, we found that mitochondria grow extensively and fuse during late pupal development to form the large tubular mitochondria. Our evidence shows that Ewg expression during early IFM development is sufficient to upregulate Opa1-like, which itself is a requisite for both late pupal mitochondrial fusion and muscle maintenance. Concomitantly, by knocking down Opa1-like during early muscle development, we show that it is important for mitochondrial fusion, muscle differentiation and muscle organization. However, knocking down Opa1-like, after the expression window of Ewg did not cause mitochondrial or muscle defects. This study identifies a mechanism by which mitochondrial fusion is regulated spatiotemporally by Ewg through Opa1-like during IFM differentiation and growth.

  20. Mitochondrial-related gene expression changes are sensitive to agonal-pH state: implications for brain disorders

    PubMed Central

    Vawter, MP; Tomita, H; Meng, F; Bolstad, B; Li, J; Evans, S; Choudary, P; Atz, M; Shao, L; Neal, C; Walsh, DM; Burmeister, M; Speed, T; Myers, R; Jones, EG; Watson, SJ; Akil, H; Bunney, WE


    Mitochondrial defects in gene expression have been implicated in the pathophysiology of bipolar disorder and schizophrenia. We have now contrasted control brains with low pH versus high pH and showed that 28% of genes in mitochondrial-related pathways meet criteria for differential expression. A majority of genes in the mitochondrial, chaperone and proteasome pathways of nuclear DNA-encoded gene expression were decreased with decreased brain pH, whereas a majority of genes in the apoptotic and reactive oxygen stress pathways showed an increased gene expression with a decreased brain pH. There was a significant increase in mitochondrial DNA copy number and mitochondrial DNA gene expression with increased agonal duration. To minimize effects of agonal-pH state on mood disorder comparisons, two classic approaches were used, removing all subjects with low pH and agonal factors from analysis, or grouping low and high pH as a separate variable. Three groups of potential candidate genes emerged that may be mood disorder related: (a) genes that showed no sensitivity to pH but were differentially expressed in bipolar disorder or major depressive disorder; (b) genes that were altered by agonal-pH in one direction but altered in mood disorder in the opposite direction to agonal-pH and (c) genes with agonal-pH sensitivity that displayed the same direction of changes in mood disorder. Genes from these categories such as NR4A1 and HSPA2 were confirmed with Q-PCR. The interpretation of postmortem brain studies involving broad mitochondrial gene expression and related pathway alterations must be monitored against the strong effect of agonal-pH state. Genes with the least sensitivity to agonal-pH could present a starting point for candidate gene search in neuropsychiatric disorders. PMID:16636682

  1. Parkinson's disease in relation to pesticide exposure and nuclear encoded mitochondrial complex I gene variants.


    Corder, Elizabeth H; Mellick, George D


    Parkinson's disease (PD) is a common age-related neurodegenerative disorder thought to result from the integrated effects of genetic background and exposure to neuronal toxins. Certain individual nuclear-encoded mitochondrial complex I gene polymorphisms were found to be associated with approximately 2-fold risk variation in an Australian case-control sample. We further characterized this sample of 306 cases and 321 controls to determine the mutual information contained in the 22 SNPs and, additionally, level of pesticide exposure: five distinct risk sets were identified using grade-of-membership analysis. Of these, one was robust to pesticide exposure (I), three were vulnerable (II, III, IV), and another (V) denoted low risk for unexposed persons. Risk for individual subjects varied > 16-fold according to level of membership in the vulnerable groups. We conclude that inherited variation in mitochondrial complex I genes and pesticide exposure together modulate risk for PD.

  2. Resolution of the African hominoid trichotomy by use of a mitochondrial gene sequence

    SciTech Connect

    Ruvolo, M.; Disotell, T.R.; Allard, M.W. ); Brown, W.M. ); Honeycutt, R.L. )


    Mitochondrial DNA sequences encoding the cytochrome oxidase subunit II gene have been determined for five primate species, siamang (Hylobates syndactylus), lowland gorilla (Gorilla gorilla), pygmy chimpanzee (Pan paniscus), crab-eating macaque (Macaca fascicularis), and green monkey (Cercopithecus aethiops), and compared with published sequences of other primate and nonprimate species. Comparisons of cytochrome oxidase subunit II gene sequences provide clear-cut evidence from the mitochondrial genome for the separation of the African ape trichotomy into two evolutionary lineages, one leading to gorillas and the other to humans and chimpanzees. Several different tree-building methods support this same phylogenetic tree topology. The comparisons also yield trees in which a substantial length separates the divergence point of gorillas from that of humans and chimpanzees, suggesting that the lineage most immediately ancestral to humans and chimpanzees may have been in existence for a relatively long time.

  3. MitoNuc: a database of nuclear genes coding for mitochondrial proteins. Update 2002.


    Attimonelli, Marcella; Catalano, Domenico; Gissi, Carmela; Grillo, Giorgio; Licciulli, Flavio; Liuni, Sabino; Santamaria, Monica; Pesole, Graziano; Saccone, Cecilia


    Mitochondria, besides their central role in energy metabolism, have recently been found to be involved in a number of basic processes of cell life and to contribute to the pathogenesis of many degenerative diseases. All functions of mitochondria depend on the interaction of nuclear and organelle genomes. Mitochondrial genomes have been extensively sequenced and analysed and data have been collected in several specialised databases. In order to collect information on nuclear coded mitochondrial proteins we developed MitoNuc, a database containing detailed information on sequenced nuclear genes coding for mitochondrial proteins in Metazoa. The MitoNuc database can be retrieved through SRS and is available via the web site where other mitochondrial databases developed by our group, the complete list of the sequenced mitochondrial genomes, links to other mitochondrial sites and related information, are available. The MitoAln database, related to MitoNuc in the previous release, reporting the multiple alignments of the relevant homologous protein coding regions, is no longer supported in the present release. In order to keep the links among entries in MitoNuc from homologous proteins, a new field in the database has been defined: the cluster identifier, an alpha numeric code used to identify each cluster of homologous proteins. A comment field derived from the corresponding SWISS-PROT entry has been introduced; this reports clinical data related to dysfunction of the protein. The logic scheme of MitoNuc database has been implemented in the ORACLE DBMS. This will allow the end-users to retrieve data through a friendly interface that will be soon implemented.

  4. Complete female mitochondrial genome of Anodonta anatina (Mollusca: Unionidae): confirmation of a novel protein-coding gene (F ORF).


    Soroka, Marianna; Burzyński, Artur


    Freshwater mussels are among animals having two different, gender-specific mitochondrial genomes. We sequenced complete female mitochondrial genomes from five individuals of Anodonta anatina, a bivalve species common in palearctic ecozone. The length of the genome was variable: 15,637-15,653 bp. This variation was almost entirely confined to the non-coding parts, which constituted approximately 5% of the genome. Nucleotide diversity was moderate, at 0.3%. Nucleotide composition was typically biased towards AT (66.0%). All genes normally seen in animal mtDNA were identified, as well as the ORF characteristic for unionid mitochondrial genomes, bringing the total number of genes present to 38. If this additional ORF does encode a protein, it must evolve under a very relaxed selection since all substitutions within this gene were non-synonymous. The gene order and structure of the genome were identical to those of all female mitochondrial genomes described in unionid bivalves except the Gonideini.

  5. Massively Convergent Evolution for Ribosomal Protein Gene Content in Plastid and Mitochondrial Genomes

    PubMed Central

    Maier, Uwe-G; Zauner, Stefan; Woehle, Christian; Bolte, Kathrin; Hempel, Franziska; Allen, John F.; Martin, William F.


    Plastid and mitochondrial genomes have undergone parallel evolution to encode the same functional set of genes. These encode conserved protein components of the electron transport chain in their respective bioenergetic membranes and genes for the ribosomes that express them. This highly convergent aspect of organelle genome evolution is partly explained by the redox regulation hypothesis, which predicts a separate plastid or mitochondrial location for genes encoding bioenergetic membrane proteins of either photosynthesis or respiration. Here we show that convergence in organelle genome evolution is far stronger than previously recognized, because the same set of genes for ribosomal proteins is independently retained by both plastid and mitochondrial genomes. A hitherto unrecognized selective pressure retains genes for the same ribosomal proteins in both organelles. On the Escherichia coli ribosome assembly map, the retained proteins are implicated in 30S and 50S ribosomal subunit assembly and initial rRNA binding. We suggest that ribosomal assembly imposes functional constraints that govern the retention of ribosomal protein coding genes in organelles. These constraints are subordinate to redox regulation for electron transport chain components, which anchor the ribosome to the organelle genome in the first place. As organelle genomes undergo reduction, the rRNAs also become smaller. Below size thresholds of approximately 1,300 nucleotides (16S rRNA) and 2,100 nucleotides (26S rRNA), all ribosomal protein coding genes are lost from organelles, while electron transport chain components remain organelle encoded as long as the organelles use redox chemistry to generate a proton motive force. PMID:24259312

  6. Modulation of mitochondrial gene expression in pulmonary epithelial cells exposed to oxidants.

    PubMed Central

    Janssen, Y M; Driscoll, K E; Timblin, C R; Hassenbein, D; Mossman, B T


    Oxidants are important in the regulation of signal transduction and gene expression. Multiple classes of genes are transcriptionally activated by oxidants and are implicated in different phenotypic responses. In the present study, we performed differential mRNA display to elucidate genes that are induced or repressed after exposure of rat lung epithelial (RLE) cells to H2O2 or crocidolite asbestos, a pathogenic mineral that generates oxidants. After 8 or 24 hr of exposure, RNA was extracted, reverse transcribed, and amplified by polymerase chain reaction with degenerate primers to visualize alterations in gene expression. The seven clones obtained were sequenced and encoded the mitochondrial genes, NADH dehydrogenase subunits ND5 and ND6, and 16S ribosomal RNA. Evaluation of their expression by Northern blot analysis revealed increased expression of 16S rRNA after 1 or 2 hr of exposure to H2O2. At later time periods (4 and 24 hr), mRNA levels of 16S rRNA and NADH dehydrogenase were decreased in H2O2-treated RLE cells when compared to sham controls. Crocidolite asbestos caused increases in 16S rRNA levels after 8 hr of exposure, whereas after 24 hr of exposure to asbestos, 16S rRNA levels were decreased in comparison to sham controls. In addition to these oxidants, the nitric oxide generator spermine NONOate caused similar decreases in NADH dehydrogenase mRNA levels after 4 hr of exposure. The present data and previous studies demonstrated that all oxidants examined resulted in apoptosis in RLE cells during the time frame where alterations of mitochondrial gene expression were observed. As the mitochondrion is a major organelle that controls apoptosis, alterations in expression of mitochondrial genes may be involved in the regulation of apoptosis. Images Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 PMID:9788897

  7. Phylogenetic relationship between Dermanyssus gallinae populations in European countries based on mitochondrial COI gene sequences.


    Marangi, M; de Luna, C J; Cafiero, M A; Camarda, A; le Bouquin, S; Huonnic, D; Giangaspero, A; Sparagano, O A E


    Phylogenetic analysis of Dermanyssus gallinae mites originating from UK, France and Italy was performed using partial amplification of the mitochondrial COI gene. Results showed that UK samples reveal the greatest variation and diversity and are linked to one of the French populations highlighting North-South genetic transitions in European red mite populations. Intra-farm variations between mite samples highlighted the diversity between national populations and possibly its origin from the different chemical strategies used in each country.

  8. Timing major conflict between mitochondrial and nuclear genes in species relationships of Polygonia butterflies (Nymphalidae: Nymphalini)

    PubMed Central

    Wahlberg, Niklas; Weingartner, Elisabet; Warren, Andrew D; Nylin, Sören


    Background Major conflict between mitochondrial and nuclear genes in estimating species relationships is an increasingly common finding in animals. Usually this is attributed to incomplete lineage sorting, but recently the possibility has been raised that hybridization is important in generating such phylogenetic patterns. Just how widespread ancient and/or recent hybridization is in animals and how it affects estimates of species relationships is still not well-known. Results We investigate the species relationships and their evolutionary history over time in the genus Polygonia using DNA sequences from two mitochondrial gene regions (COI and ND1, total 1931 bp) and four nuclear gene regions (EF-1α, wingless, GAPDH and RpS5, total 2948 bp). We found clear, strongly supported conflict between mitochondrial and nuclear DNA sequences in estimating species relationships in the genus Polygonia. Nodes at which there was no conflict tended to have diverged at the same time when analyzed separately, while nodes at which conflict was present diverged at different times. We find that two species create most of the conflict, and attribute the conflict found in Polygonia satyrus to ancient hybridization and conflict found in Polygonia oreas to recent or ongoing hybridization. In both examples, the nuclear gene regions tended to give the phylogenetic relationships of the species supported by morphology and biology. Conclusion Studies inferring species-level relationships using molecular data should never be based on a single locus. Here we show that the phylogenetic hypothesis generated using mitochondrial DNA gives a very different interpretation of the evolutionary history of Polygonia species compared to that generated from nuclear DNA. We show that possible cases of hybridization in Polygonia are not limited to sister species, but may be inferred further back in time. Furthermore, we provide more evidence that Haldane's effect might not be as strong a process in

  9. Molecular cloning and regulatory analysis of the cuticle-degrading-protease structural gene from the entomopathogenic fungus Metarhizium anisopliae.


    St Leger, R J; Frank, D C; Roberts, D W; Staples, R C


    The proteinaceous insect cuticle is an effective barrier against most microbes, but entomopathogenic fungi can breach it using extracellular proteases. We report here the isolation and characterization of a cDNA clone of the cuticle-degrading protease (Pr1) of Metarhizium anisopliae. The cDNA sequence revealed that Pr1 is synthesized as a large precursor (40.3 kDa) containing a signal peptide, a propeptide and the mature protein predicted to have a molecular mass of 28.6 kDa. The primary structure of Pr1 has extensive similarity with enzymes of the subtilisin subclass of serine endopeptidases and the serine, histidine and aspartate components of the active site in subtilisins are preserved. Proteinase K demonstrated the closest sequence similarity to Pr1 (61%) but Pr1 was twofold more effective than proteinase K at degrading isolated cuticles of Manduca sexta and 33-fold more effective at degrading structural proteins bound to the cuticle by covalent bonds. We postulate that the additional positively charged residues on the surface of the Pr1 molecule, as determined using proteinase K, may facilitate electrostatic binding to cuticle proteins which is a prerequisite for activity. Northern-blot analysis of RNA and nuclear run-on assays demonstrated transcriptional control of the expression of Pr1 during nutrient deprivation and during the formation of infection structures. Southern-blot analysis demonstrated that genes with significant homologies to Metarhizium Pr1 were present in the entomopathogens Aspergillus flavus and Verticillium lecanii but not Zoophthora (= Erynia) radicans.

  10. Assessing the Association of Mitochondrial Genetic Variation With Primary Open-Angle Glaucoma Using Gene-Set Analyses

    PubMed Central

    Khawaja, Anthony P.; Cooke Bailey, Jessica N.; Kang, Jae Hee; Allingham, R. Rand; Hauser, Michael A.; Brilliant, Murray; Budenz, Donald L.; Christen, William G.; Fingert, John; Gaasterland, Douglas; Gaasterland, Terry; Kraft, Peter; Lee, Richard K.; Lichter, Paul R.; Liu, Yutao; Medeiros, Felipe; Moroi, Syoko E.; Richards, Julia E.; Realini, Tony; Ritch, Robert; Schuman, Joel S.; Scott, William K.; Singh, Kuldev; Sit, Arthur J.; Vollrath, Douglas; Wollstein, Gadi; Zack, Donald J.; Zhang, Kang; Pericak-Vance, Margaret; Weinreb, Robert N.; Haines, Jonathan L.; Pasquale, Louis R.; Wiggs, Janey L.


    Purpose Recent studies indicate that mitochondrial proteins may contribute to the pathogenesis of primary open-angle glaucoma (POAG). In this study, we examined the association between POAG and common variations in gene-encoding mitochondrial proteins. Methods We examined genetic data from 3430 POAG cases and 3108 controls derived from the combination of the GLAUGEN and NEIGHBOR studies. We constructed biological-system coherent mitochondrial nuclear-encoded protein gene-sets by intersecting the MitoCarta database with the Kyoto Encyclopedia of Genes and Genomes (KEGG) database. We examined the mitochondrial gene-sets for association with POAG and with normal-tension glaucoma (NTG) and high-tension glaucoma (HTG) subsets using Pathway Analysis by Randomization Incorporating Structure. Results We identified 22 KEGG pathways with significant mitochondrial protein-encoding gene enrichment, belonging to six general biological classes. Among the pathway classes, mitochondrial lipid metabolism was associated with POAG overall (P = 0.013) and with NTG (P = 0.0006), and mitochondrial carbohydrate metabolism was associated with NTG (P = 0.030). Examining the individual KEGG pathway mitochondrial gene-sets, fatty acid elongation and synthesis and degradation of ketone bodies, both lipid metabolism pathways, were significantly associated with POAG (P = 0.005 and P = 0.002, respectively) and NTG (P = 0.0004 and P < 0.0001, respectively). Butanoate metabolism, a carbohydrate metabolism pathway, was significantly associated with POAG (P = 0.004), NTG (P = 0.001), and HTG (P = 0.010). Conclusions We present an effective approach for assessing the contributions of mitochondrial genetic variation to open-angle glaucoma. Our findings support a role for mitochondria in POAG pathogenesis and specifically point to lipid and carbohydrate metabolism pathways as being important. PMID:27661856

  11. A putative mitochondrial fission gene from the ectomycorrhizal ascomycete Tuber borchii Vittad.: cloning, characterisation and phylogeny.


    Guidi, C; Zeppa, S; Barbieri, E; Zambonelli, A; Polidori, E; Potenza, L; Stocchi, V


    Mitochondrial binary division is a complex process occurring in multiple steps, mediated by several proteins. In Saccharomyces cerevisiae, a mitochondrial membrane protein, Fis1p, is required for the proper assembly of the mitochondrial division apparatus. In this study, we report the cloning, characterisation and phylogenetic analysis of Tbfis1, a gene from the ectomycorrhizal ascomycetous truffle Tuber borchii, encoding for an orthologue of S. cerevisiae Fis1p. The Tbfis1 coding region consists of a 468-nucleotide open reading frame interrupted by four introns, which encodes for a polypeptide of 155 amino acids, having a predicted transmembrane domain structure typical of the Fis1p Family. Southern blot analysis revealed that Tbfis1 is a single-copy gene in the T. borchii genome. Tbfis1 is highly expressed during the first stages of T. borchii fruit body ripening, while its expression decreases during T. borchii mycelium ageing. Also, Virtual Northern blot analysis revealed Tbfis1 expression in the symbiotic phase of the fungus life cycle. Phylogenetic analysis allowed the identification of Tbfis1 orthologues in filamentous fungi, yeasts, plants, worms, flies and mammals, indicating that the function of the protein coded by this gene has been conserved during evolution.

  12. Identification of Sphaeroma terebrans via morphology and the mitochondrial cytochrome c oxidase subunit I (COI) gene

    PubMed Central

    LI, Xiu-Feng; HAN, Chong; ZHONG, Cai-Rong; XU, Jun-Qiu; HUANG, Jian-Rong


    Sphaeroma terebrans, a wood-boring isopoda, is distributed worldwide in tropical and subtropical mangroves. The taxonomy of S. terebrans is usually based on morphological characteristics, with its molecular identification still poorly understood. The number of teeth on the uropodal exopod and the length of the propodus of the seventh pereopod are considered as the major morphological characteristics in S. terebrans, which can cause difficulty in regards to accurate identification. In this study, we identified S. terebrans via molecular and morphological data. Furthermore, the validity of the mitochondrial cytochrome c oxidase subunit I (COI) gene as a DNA barcode for the identification of genus Sphaeroma, including species S. terebrans, S. retrolaeve, and S. serratum, was examined. The mitochondrial COI gene sequences of all specimens were sequenced and analysed. The interspecific Kimura 2-parameter distances were higher than intraspecific distances and no intraspecific-interspecific distance overlaps were observed. In addition, genetic distance and nucleotide diversity (π) exhibited no differences within S. terebrans. Our results revealed that the mitochondrial COI gene can serve as a valid DNA barcode for the identification of S. terebrans. Furthermore, the number of teeth on the uropodal exopod and the length of the propodus of the seventh pereopod were found to be unreliable taxonomic characteristics for S. terebrans. PMID:27686791

  13. Genetic Fingerprinting of Wheat and Its Progenitors by Mitochondrial Gene orf256

    PubMed Central

    El-Shehawi, Ahmed M.; Fahmi, Abdelmeguid I.; Sayed, Samy M.; Elseehy, Mona M.


    orf256 is a wheat mitochondrial gene associated with cytoplasmic male sterility (CMS) that has different organization in various species. This study exploited the orf256 gene as a mitochondrial DNA marker to study the genetic fingerprint of Triticum and Aegilops species. PCR followed by sequencing of common parts of the orf256 gene were employed to determine the fingerprint and molecular evolution of Triticum and Aegilops species. Although many primer pairs were used, two pairs of orf256 specific primers (5:-94/C: 482, 5:253/C: 482), amplified DNA fragments of 576 bp and 230 bp respectively in all species were tested. A common 500 bp of nine species of Triticum and Aegilops were aligned and showed consistent results with that obtained from other similar chloroplast or nuclear genes. Base alignment showed that there were various numbers of base substitutions in all species compared to S. cereal (Sc) (the outgroup species). Phylogenetic relationship revealed similar locations and proximity on phylogenetic trees established using plastid and nuclear genes. The results of this study open a good route to use unknown function genes of mitochondria in studying the molecular relationships and evolution of wheat and complex plant genomes. PMID:24970134

  14. Mitochondrial genomes of praying mantises (Dictyoptera, Mantodea): rearrangement, duplication, and reassignment of tRNA genes

    PubMed Central

    Ye, Fei; Lan, Xu-e; Zhu, Wen-bo; You, Ping


    Insect mitochondrial genomes (mitogenomes) contain a conserved set of 37 genes for an extensive diversity of lineages. Previously reported dictyopteran mitogenomes share this conserved mitochondrial gene arrangement, although surprisingly little is known about the mitogenome of Mantodea. We sequenced eight mantodean mitogenomes including the first representatives of two families: Hymenopodidae and Liturgusidae. Only two of these genomes retain the typical insect gene arrangement. In three Liturgusidae species, the trnM genes have translocated. Four species of mantis (Creobroter gemmata, Mantis religiosa, Statilia sp., and Theopompa sp.-HN) have multiple identical tandem duplication of trnR, and Statilia sp. additionally includes five extra duplicate trnW. These extra trnR and trnW in Statilia sp. are erratically arranged and form another novel gene order. Interestingly, the extra trnW is converted from trnR by the process of point mutation at anticodon, which is the first case of tRNA reassignment for an insect. Furthermore, no significant differences were observed amongst mantodean mitogenomes with variable copies of tRNA according to comparative analysis of codon usage. Combined with phylogenetic analysis, the characteristics of tRNA only possess limited phylogenetic information in this research. Nevertheless, these features of gene rearrangement, duplication, and reassignment provide valuable information toward understanding mitogenome evolution in insects. PMID:27157299

  15. Unequal and genotype-dependent expression of mitochondrial genes in larvae of the pacific oyster Crassostrea gigas.


    Curole, Jason P; Meyer, Eli; Manahan, Donal T; Hedgecock, Dennis


    Mitochondria are essential for regulation of energy metabolism, but little is known about patterns of mitochondrial genome expression in invertebrates. To explore the association of mitochondrial expression with differential growth of Crassostrea gigas, the Pacific oyster, we crossed two inbred lines to produce inbred and hybrid larvae, which grew at different rates under the same environmental conditions. Using high-throughput cloning and sequencing methods, we identified 1.1 million expressed sequence tags from the mitochondrial genome, 96.7% of which were perfect matches to genes targeted by the method. Expression varied significantly among genes, ranging over nearly four orders of magnitude, from mt:lRNA, which constituted 21% of all transcripts, to mt:CoII, which constituted less than 0.02% of all transcripts. Variable expression of genes coding for subunits of macromolecular complexes (e.g., mt:CoI and mt:CoII) implies that stoichiometry in these complexes must be regulated post-transcriptionally. Surprisingly, the mitochondrial transcriptome contained non-coding transcripts, which may play a role in the regulation of mitochondrial function. Finally, mitochondrial expression depended strongly on maternal factors and nuclear-cytoplasmic interactions, which may explain previously observed growth differences between reciprocal hybrids. Differences in mitochondrial gene expression could provide a biochemical index for the metabolic basis of genetically determined differences in larval growth.

  16. Octocoral Mitochondrial Genomes Provide Insights into the Phylogenetic History of Gene Order Rearrangements, Order Reversals, and Cnidarian Phylogenetics

    PubMed Central

    Figueroa, Diego F.; Baco, Amy R.


    We use full mitochondrial genomes to test the robustness of the phylogeny of the Octocorallia, to determine the evolutionary pathway for the five known mitochondrial gene rearrangements in octocorals, and to test the suitability of using mitochondrial genomes for higher taxonomic-level phylogenetic reconstructions. Our phylogeny supports three major divisions within the Octocorallia and show that Paragorgiidae is paraphyletic, with Sibogagorgia forming a sister branch to the Coralliidae. Furthermore, Sibogagorgia cauliflora has what is presumed to be the ancestral gene order in octocorals, but the presence of a pair of inverted repeat sequences suggest that this gene order was not conserved but rather evolved back to this apparent ancestral state. Based on this we recommend the resurrection of the family Sibogagorgiidae to fix the paraphyly of the Paragorgiidae. This is the first study to show that in the Octocorallia, mitochondrial gene orders have evolved back to an ancestral state after going through a gene rearrangement, with at least one of the gene orders evolving independently in different lineages. A number of studies have used gene boundaries to determine the type of mitochondrial gene arrangement present. However, our findings suggest that this method known as gene junction screening may miss evolutionary reversals. Additionally, substitution saturation analysis demonstrates that while whole mitochondrial genomes can be used effectively for phylogenetic analyses within Octocorallia, their utility at higher taxonomic levels within Cnidaria is inadequate. Therefore for phylogenetic reconstruction at taxonomic levels higher than subclass within the Cnidaria, nuclear genes will be required, even when whole mitochondrial genomes are available. PMID:25539723

  17. A cytoplasmic male sterility-associated mitochondrial peptide in common bean is post-translationally regulated.

    PubMed Central

    Sarria, R; Lyznik, A; Vallejos, C E; Mackenzie, S A


    Cytoplasmic male sterility in the common bean plant is associated with a dominant mitochondrial mutation designated pvs-or f 239 (for Phaseolus vulgaris sterility sequence open reading frame 239). The sequence is transcribed in both vegetative and reproductive tissues, but the translation product, ORF239, is present only in reproductive tissues. We present evidence to support a model of post-translational regulation of ORF239 expression based on the following observations. In organello translation experiments using purified mitochondria from young seedlings demonstrated accumulation of ORF239 only when a protease inhibitor was included. Proteolytic activity against ORF239 was observed in mitochondrial extracts fractionating with the mitochondrial inner membrane. The DNA sequence encoding a serine-type protease, similar to the lon protease gene of Escherichia coli, was cloned from the Arabidopsis genome. The expression product of this sequence demonstrated proteolytic activity against ORF239 in vitro, with features resembling the activity detected in mitochondrial inner membrane preparations. Antibodies generated against the overexpressed Lon homolog reduced proteolytic activity against ORF239 when added to mitochondrial extracts. Our data suggest that ORF239 was undetected in vegetative tissue due to rapid turnover by at least one mitochondrial protease that acts against ORF239 post-translationally. PMID:9668139

  18. Mitochondrial myopathy, lactic acidosis, and sideroblastic anemia (MLASA) plus associated with a novel de novo mutation (m.8969G>A) in the mitochondrial encoded ATP6 gene.


    Burrage, Lindsay C; Tang, Sha; Wang, Jing; Donti, Taraka R; Walkiewicz, Magdalena; Luchak, J Michael; Chen, Li-Chieh; Schmitt, Eric S; Niu, Zhiyv; Erana, Rodrigo; Hunter, Jill V; Graham, Brett H; Wong, Lee-Jun; Scaglia, Fernando


    Mitochondrial myopathy, lactic acidosis and sideroblastic anemia (MLASA) is a rare mitochondrial disorder that has previously been associated with mutations in PUS1 and YARS2. In the present report, we describe a 6-year old male with an MLASA plus phenotype. This patient had features of MLASA in the setting of developmental delay, sensorineural hearing loss, epilepsy, agenesis of the corpus callosum, failure to thrive, and stroke-like episodes. Sequencing of the mitochondrial genome identified a novel de novo, heteroplasmic mutation in the mitochondrial DNA (mtDNA) encoded ATP6 gene (m.8969G>A, p.S148N). Whole exome sequencing did not identify mutations or variants in PUS1 or YARS2 or any known nuclear genes that could affect mitochondrial function and explain this phenotype. Studies of fibroblasts derived from the patient revealed a decrease in oligomycin-sensitive respiration, a finding which is consistent with a complex V defect. Thus, this mutation in MT-ATP6 may represent the first mtDNA point mutation associated with the MLASA phenotype.

  19. The role of SIGMAR1 gene mutation and mitochondrial dysfunction in amyotrophic lateral sclerosis.


    Fukunaga, Kohji; Shinoda, Yasuharu; Tagashira, Hideaki


    Amyotrophic lateral sclerosis (ALS) patients exhibit diverse pathologies such as endoplasmic reticulum (ER) stress and mitochondrial dysfunction in motor neurons. Five to ten percent of patients have familial ALS, a form of the disease caused by mutations in ALS-related genes, while sporadic forms of the disease occur in 90-95% of patients. Recently, it was reported that familial ALS patients exhibit a missense mutation in SIGMAR1 (c.304G > C), which encodes sigma-1 receptor (Sig-1R), substituting glutamine for glutamic acid at amino acid residue 102 (p.E102Q). Expression of that mutant Sig-1R(E102Q) protein reduces mitochondrial ATP production, inhibits proteasome activity and causes mitochondrial injury, aggravating ER stress-induced neuronal death in neuro2A cells. In this issue, we discuss mechanisms underlying mitochondrial impairment seen in ALS motor neurons and propose that therapies that protect mitochondria might improve the quality of life (QOL) of ALS patients and should be considered for clinical trials.

  20. Prorenin processing enzyme (PPE) produced by Baculovirus-infected Sf-9 insect cells: PPE is the cysteine protease encoded in the acMNPV gene.


    Gotoh, Takeshi; Awa, Hirono; Kikuchi, Ken-Ichi; Nirasawa, Satoru; Takahashi, Saori


    In infection cultures of Spodoptera frugiperda (Sf-9) insect cells with a recombinant baculovirus, vhpR, carrying human preprorenin cDNA in the polyhedrin locus of Autographa californica multiple nuclear polyhedrosis virus (AcMNPV), the expressed inactive recombinant human (rh)-prorenin is reported to be proteolytically processed to yield active rh-renin in the very late phase of culture (Takahashi et al., Biosci. Biotechnol. Biochem., 71, 2610-2613 (2007)). To identify the enzyme that catalyzes the processing of rh-prorenin, referred to as prorenin processing enzyme (PPE), we purified potential PPE from virus-infected Sf-9 culture supernatant by the use of an internally quenched fluorescent (IQF) substrate for PPE. The 32-kDa protein band agreed well with PPE activity on the final Mono Q FPLC. By N-terminal amino acid sequence analysis, the protein was revealed to be a cysteine protease encoded by the AcMNPV gene. Enzyme activity was inhibited by cysteine protease inhibitors but not by other protease inhibitors. When the purified rh-prorenin was incubated with the 32-kDa protein, renin activity appeared concomitant with the disappearance of rh-prorenin. The N-terminal amino acid sequence of the activated product was identical to that of the rh-renin that had accumulated in the infection cultures. These results indicate that the 32-kDa cysteine protease derived from the AcMNPV gene is the enzyme PPE of virus-infected Sf-9 cells.

  1. RNAi-Mediated Knockdown of Serine Protease Inhibitor Genes Increases the Mortality of Plutella xylostella Challenged by Destruxin A

    PubMed Central

    Han, Pengfei; Fan, Jiqiao; Liu, Yu; Cuthbertson, Andrew G. S.; Yan, Shaoqiao; Qiu, Bao-Li; Ren, Shunxiang


    Destruxin A is a mycotoxin that is secreted by entomopathogenic fungi which has a broad-spectrum insecticidal effect. Previous transcript and protein profiling analysis showed that destruxin A has significant effects on the expression of serine protease inhibitor genes (serpin-2, 4, 5) in the larvae of Plutella xylostella. In the current study, we aimed to understand the role of serpins under application of destruxin A. We obtained two full-length cDNA sequences of P. xylostella serpins, named serpin-4 and serpin-5, and cloned the serpin-2 gene whose full-length has already been published. Phylogenetic analysis indicated that these two serpin genes were highly clustered with other serpins associated with the immune response in other insects. The temporal and spatial expression of serpin-2, serpin-4 and serpin-5 were determined to be the highest in the fat body and hemolymph of 4th larval stage using qRT-PCR and western blot detection techniques. RNA interference (RNAi) mediated knockdown of P. xylostella serpin genes was carried out by microinjection of double-stranded RNA (dsRNA). The expression levels of serpins decreased significantly after RNAi. Results showed that the depletion of serpins induced cecropins expression, increased phenoloxidase (PO) activity, body melanization and mortality in the larvae of P. xylostella under the same lethal concentration of destruxin A. The superimposed effects of serpins RNAi were similar with the destruxin A treatment upon mortality of P. xylostella larvae. We discovered for the first time that serpins play indispensable role in P. xylostella when challenged by destruxin A and deduced the possible function mechanism of destruxin A. Our findings are conducive to fully understanding the potential insecticidal mechanism of destruxin A and constitute a well-defined potential molecular target for novel insecticides. PMID:24837592

  2. RNAi-mediated knockdown of serine protease inhibitor genes increases the mortality of Plutella xylostella challenged by destruxin A.


    Han, Pengfei; Fan, Jiqiao; Liu, Yu; Cuthbertson, Andrew G S; Yan, Shaoqiao; Qiu, Bao-Li; Ren, Shunxiang


    Destruxin A is a mycotoxin that is secreted by entomopathogenic fungi which has a broad-spectrum insecticidal effect. Previous transcript and protein profiling analysis showed that destruxin A has significant effects on the expression of serine protease inhibitor genes (serpin-2, 4, 5) in the larvae of Plutella xylostella. In the current study, we aimed to understand the role of serpins under application of destruxin A. We obtained two full-length cDNA sequences of P. xylostella serpins, named serpin-4 and serpin-5, and cloned the serpin-2 gene whose full-length has already been published. Phylogenetic analysis indicated that these two serpin genes were highly clustered with other serpins associated with the immune response in other insects. The temporal and spatial expression of serpin-2, serpin-4 and serpin-5 were determined to be the highest in the fat body and hemolymph of 4th larval stage using qRT-PCR and western blot detection techniques. RNA interference (RNAi) mediated knockdown of P. xylostella serpin genes was carried out by microinjection of double-stranded RNA (dsRNA). The expression levels of serpins decreased significantly after RNAi. Results showed that the depletion of serpins induced cecropins expression, increased phenoloxidase (PO) activity, body melanization and mortality in the larvae of P. xylostella under the same lethal concentration of destruxin A. The superimposed effects of serpins RNAi were similar with the destruxin A treatment upon mortality of P. xylostella larvae. We discovered for the first time that serpins play indispensable role in P. xylostella when challenged by destruxin A and deduced the possible function mechanism of destruxin A. Our findings are conducive to fully understanding the potential insecticidal mechanism of destruxin A and constitute a well-defined potential molecular target for novel insecticides.

  3. Intrageneric phylogeny of Acomys (rodentia, muridae) using mitochondrial gene cytochrome b.


    Barome, P O; Monnerot, M; Gautun, J C


    This paper investigates interspecies relationships within the genus Acomys (spiny mice) by analyzing entire mitochondrial cytochrome b gene (1141 bp). This gene provides strong phylogenetic signal, as shown by high support of the topology obtained (bootstrap value and RNA support number). The phylogeny is congruent with inferences from allozymes for the species considered. Controversial taxonomy of Acomys cahirinus, dimidiatus, airensis, and ignitus is clarified, with their specific ranks confirmed on the basis of tree topology and nucleotide distances. Phylogenetic relationship between the undescribed species Acomys sp. from west Africa and A. airensis argue in favor of two distinct colonization events in this zone.

  4. Phylogenetic analysis of oryx species using partial sequences of mitochondrial rRNA genes.


    Khan, H A; Arif, I A; Al Farhan, A H; Al Homaidan, A A


    We conducted a comparative evaluation of 12S rRNA and 16S rRNA genes of the mitochondrial genome for molecular differentiation among three oryx species (Oryx leucoryx, Oryx dammah and Oryx gazella) with respect to two closely related outgroups, addax and roan. Our findings showed the failure of 12S rRNA gene to differentiate between the genus Oryx and addax, whereas a 342-bp partial sequence of 16S rRNA accurately grouped all five taxa studied, suggesting the utility of 16S rRNA segment for molecular phylogeny of oryx at the genus and possibly species levels.

  5. Prokaryotic origins for the mitochondrial alternative oxidase and plastid terminal oxidase nuclear genes.


    Finnegan, Patrick M; Umbach, Ann L; Wilce, Jackie A


    The mitochondrial alternative oxidase is a diiron carboxylate quinol oxidase (Dox) found in plants and some fungi and protists, but not animals. The plastid terminal oxidase is distantly related to alternative oxidase and is most likely also a Dox protein. Database searches revealed that the alpha-proteobacterium Novosphingobium aromaticivorans and the cyanobacteria Nostoc sp. PCC7120, Synechococcus sp. WH8102 and Prochlorococcus marinus subsp. pastoris CCMP1378 each possess a Dox homolog. Each prokaryotic protein conforms to the current structural models of the Dox active site and phylogenetic analyses suggest that the eukaryotic Dox genes arose from an ancestral prokaryotic gene.

  6. Independent replication of mitochondrial genes supports the transcriptional program in developing fiber cells of cotton (Gossypium hirsutum L.).


    Thyssen, Gregory N; Song, Xianliang; Naoumkina, Marina; Kim, Hee-Jin; Fang, David D


    The mitochondrial genomes of flowering plants exist both as a "master circle" chromosome and as numerous subgenomic sublimons that are generated by intramolecular recombination. Differential stability or replication of these sublimons allows individual mitochondrial gene copy numbers to vary independently between different cell types and developmental stages. Our objective was to determine the relationship between mitochondrial gene copy number and transcript abundance in the elongating fiber cells of Upland cotton (Gossypium hirsutum L.). We compared RNA and DNA from cotton fiber cells at five developmental time points from early elongation through secondary cell wall thickening from the Ligon-lintless 2 (Li2) short fiber mutant and its wild type near isogenic line (NIL) DP5690. Mitochondrial gene copy number decreased from 3 to 8-DPA in the developing cotton fiber cells while transcript levels remained low. As secondary cell wall biosynthesis began in developing fibers, the expression levels and copy numbers of mitochondrial genes involved in energy production and respiration were up-regulated in wild type cotton DP5690. However, the short fiber mutant Li2, failed to increase expression of these genes, which include three subunits of ATP synthase, atp1, atp8 and atp9 and two cytochrome genes cox1 and cob. At the same time, Li2 failed to increase the copy numbers of these highly expressed genes. Surprisingly, we found that when mitochondrial genes were highly transcribed, they also had very high copy numbers. This observation suggests that in developing cotton fibers, increased mitochondrial sublimon replication may support increases in gene transcription.

  7. Gene Expression Profiling Specifies Chemokine, Mitochondrial and Lipid Metabolism Signatures in Leprosy

    PubMed Central

    Guerreiro, Luana Tatiana Albuquerque; Robottom-Ferreira, Anna Beatriz; Ribeiro-Alves, Marcelo; Toledo-Pinto, Thiago Gomes; Rosa Brito, Tiana; Rosa, Patrícia Sammarco; Sandoval, Felipe Galvan; Jardim, Márcia Rodrigues; Antunes, Sérgio Gomes; Shannon, Edward J.; Sarno, Euzenir Nunes; Pessolani, Maria Cristina Vidal; Williams, Diana Lynn; Moraes, Milton Ozório


    Herein, we performed microarray experiments in Schwann cells infected with live M. leprae and identified novel differentially expressed genes (DEG) in M. leprae infected cells. Also, we selected candidate genes associated or implicated with leprosy in genetic studies and biological experiments. Forty-seven genes were selected for validation in two independent types of samples by multiplex qPCR. First, an in vitro model using THP-1 cells was infected with live Mycobacterium leprae and M. bovis bacillus Calmette-Guérin (BCG). In a second situation, mRNA obtained from nerve biopsies from patients with leprosy or other peripheral neuropathies was tested. We detected DEGs that discriminate M. bovis BCG from M. leprae infection. Specific signatures of susceptible responses after M. leprae infection when compared to BCG lead to repression of genes, including CCL2, CCL3, IL8 and SOD2. The same 47-gene set was screened in nerve biopsies, which corroborated the down-regulation of CCL2 and CCL3 in leprosy, but also evidenced the down-regulation of genes involved in mitochondrial metabolism, and the up-regulation of genes involved in lipid metabolism and ubiquitination. Finally, a gene expression signature from DEG was identified in patients confirmed of having leprosy. A classification tree was able to ascertain 80% of the cases as leprosy or non-leprous peripheral neuropathy based on the expression of only LDLR and CCL4. A general immune and mitochondrial hypo-responsive state occurs in response to M. leprae infection. Also, the most important genes and pathways have been highlighted providing new tools for early diagnosis and treatment of leprosy. PMID:23798993

  8. Three genes expressing Kunitz domains in the epididymis are related to genes of WFDC-type protease inhibitors and semen coagulum proteins in spite of lacking similarity between their protein products

    PubMed Central


    Background We have previously identified a locus on human chromosome 20q13.1, encompassing related genes of postulated WFDC-type protease inhibitors and semen coagulum proteins. Three of the genes with WFDC motif also coded for the Kunitz-type protease inhibitor motif. In this report, we have reinvestigated the locus for homologous genes encoding Kunitz motif only. The identified genes have been analyzed with respect to structure, expression and function. Results We identified three novel genes; SPINT3, SPINT4 and SPINT5, and the structure of their transcripts were determined by sequencing of DNA generated by rapid amplification of cDNA ends. Each gene encodes a Kunitz domain preceded by a typical signal peptide sequence, which indicates that the proteins of 7.6, 8.7, and 9.7 kDa are secreted. Analysis of transcripts in 26 tissues showed that the genes predominantly are expressed in the epididymis. The recombinantly produced proteins could not inhibit the amidolytic activity of trypsin, chymotrypsin, plasmin, thrombin, coagulation factor Xa, elastase, urokinase and prostate specific antigen, whereas similarly made bovine pancreatic trypsin inhibitor (BPTI) had the same bioactivity as the protein isolated from bovine pancreas. Conclusions The similar organization, chromosomal location and site of expression, suggests that the novel genes are homologous with the genes of WFDC-type protease inhibitors and semen coagulum proteins, despite the lack of similarity in primary structure of their protein products. Their restricted expression to the epididymis suggests that they could be important for male reproduction. The recombinantly produced proteins are presumably bioactive, as demonstrated with similarly made BPTI, but may have a narrower spectrum of inhibition, as indicated by the lacking activity against eight proteases with differing specificity. Another possibility is that they have lost the protease inhibiting properties, which is typical of Kunitz domains, in

  9. Loss of two introns from the Magnolia tripetala mitochondrial cox2 gene implicates horizontal gene transfer and gene conversion as a novel mechanism of intron loss.


    Hepburn, Nancy J; Schmidt, Derek W; Mower, Jeffrey P


    Intron loss is often thought to occur through retroprocessing, which is the reverse transcription and genomic integration of a spliced transcript. In plant mitochondria, several unambiguous examples of retroprocessing are supported by the parallel loss of an intron and numerous adjacent RNA edit sites, but in most cases, the evidence for intron loss via retroprocessing is weak or lacking entirely. To evaluate mechanisms of intron loss, we designed a polymerase chain reaction (PCR)-based assay to detect recent intron losses from the mitochondrial cox2 gene within genus Magnolia, which was previously suggested to have variability in cox2 intron content. Our assay showed that all 22 examined species have a cox2 gene with two introns. However, one species, Magnolia tripetala, contains an additional cox2 gene that lacks both introns. Quantitative PCR showed that both M. tripetala cox2 genes are present in the mitochondrial genome. Although the intronless gene has lost several ancestral RNA edit sites, their distribution is inconsistent with retroprocessing models. Instead, phylogenetic and gene conversion analyses indicate that the intronless gene was horizontally acquired from a eudicot and then underwent gene conversion with the native intron-containing gene. The models are presented to summarize the roles of horizontal gene transfer and gene conversion as a novel mechanism of intron loss.

  10. Stress and corticosteroids regulate rat hippocampal mitochondrial DNA gene expression via the glucocorticoid receptor

    PubMed Central

    Hunter, Richard G.; Seligsohn, Ma’ayan; Rubin, Todd G.; Griffiths, Brian B.; Ozdemir, Yildirim; Pfaff, Donald W.; Datson, Nicole A.; McEwen, Bruce S.


    Glucocorticoids (GCs) are involved in stress and circadian regulation, and produce many actions via the GC receptor (GR), which is classically understood to function as a nuclear transcription factor. However, the nuclear genome is not the only genome in eukaryotic cells. The mitochondria also contain a small circular genome, the mitochondrial DNA (mtDNA), that encodes 13 polypeptides. Recent work has established that, in the brain and other systems, the GR is translocated from the cytosol to the mitochondria and that stress and corticosteroids have a direct influence on mtDNA transcription and mitochondrial physiology. To determine if stress affects mitochondrially transcribed mRNA (mtRNA) expression, we exposed adult male rats to both acute and chronic immobilization stress and examined mtRNA expression using quantitative RT-PCR. We found that acute stress had a main effect on mtRNA expression and that expression of NADH dehydrogenase 1, 3, and 6 (ND-1, ND-3, ND-6) and ATP synthase 6 (ATP-6) genes was significantly down-regulated. Chronic stress induced a significant up-regulation of ND-6 expression. Adrenalectomy abolished acute stress-induced mtRNA regulation, demonstrating GC dependence. ChIP sequencing of GR showed that corticosterone treatment induced a dose-dependent association of the GR with the control region of the mitochondrial genome. These findings demonstrate GR and stress-dependent transcriptional regulation of the mitochondrial genome in vivo and are consistent with previous work linking stress and GCs with changes in the function of brain mitochondria. PMID:27457949

  11. The expression of a recombinant cry1Ac gene with subtilisin-like protease CDEP2 gene in acrystalliferous Bacillus thuringiensis by Red/ET homologous recombination.


    Xia, Liqiu; Zeng, Zhi; Ding, Xuezhi; Huang, Fan


    A novel cDNA encoding the subtilisin-like serine protease gene CDEP2 was isolated from Beauveria bassiana by reverse transcription polymerase chain reaction (RT-PCR). It contained an 1137 bp ORF that predicted a protein of 379 amino acids with M = 38863 Da and pI = 8.21. In an attempt to improve insecticidal activity, the CDEP2 gene and the cry1Ac gene from Bacillus thuringiensis were co-fused into the vector pHT315 as pHAc-CDEP2 plasmid by Red/ET homologous recombination. The co-fusion gene was attempted under the control of the native cry1Ac promoter. Plasmid pHAc-CDEP2 was electro-transformed into the B. thuringiensis subsp. kurstaki Cry(-)B. Analyzed by SDS-PAGE and Western blotting, the transformant Cry(-)B-pHAc-CDEP2 strain produced a 130 kDa Cry1Ac protein and 39 kDa CDEP2 protein. The 50% lethal concentration values (LC(50)) of Cry(-)B-pHAc-CDEP2 strain (8.5 microl/ml) to Helicoverpa armigera third instars larvae was clearly higher than the Cry(-)B-pHAc strain (16.7 microl/ml) at 72 h.

  12. Mutations in the helper component protease gene of zucchini yellow mosaic virus affect its ability to mediate aphid transmissibility.


    Huet, H; Gal-On, A; Meir, E; Lecoq, H; Raccah, B


    The nucleotide sequence of the helper component protease (HC-Pro) genes of three zucchini yellow mosaic virus (ZYMV) strains has been compared with that of a helper-deficient strain of ZYMV-HC. The comparisons revealed three unique deduced amino acid differences. Two of these mutations were located in regions which are conserved in other potyviruses. The role of these mutations in aphid transmissibility was examined by exchanging DNA fragments of part of the deficient HC-Pro gene with the respective section within the gene of the infectious full-length clone of the aphid-transmissible ZYMV. The first exchange included two of the three mutations, the first coding for a change from Asp to Gly (in a non-conserved region) and the second coding for a change from Arg to Ile [within the Phe-Arg-Asp-Lys (FRNK) conserved box]. This exchange resulted in a reduced transmission (20.6% for the mutated virus compared with 57.4% in the normal ZYMV when acquired from plants and 37.2% compared with 83.1%, respectively, when acquired from membranes). The second exchange incorporated a single mutation [conferring a change from Thr to Ala within the Pro-Thr-Lys (PTK) conserved box]. This single mutation resulted in almost total loss of HC activity in aphid transmission both from plants and from membranes. The Lys residue in the conserved Lys-Ile-Thr-Cys (KITC) box, which is related to loss of HC activity in potato virus Y, tobacco vein mottling virus and in the Michigan strain of ZYMV, is unchanged in the helper-deficient ZYMV. It is therefore proposed that more than one site in HC-Pro may be functionally related to aphid transmissibility. The possible reasons for the role of these mutations in helper activity in aphid transmission of ZYMV are discussed.

  13. Partial mitochondrial gene arrangements support a close relationship between Tardigrada and Arthropoda.


    Ryu, Shi Hyun; Lee, Ji Min; Jang, Kuem-Hee; Choi, Eun Hwa; Park, Shin Ju; Chang, Cheon Young; Kim, Won; Hwang, Ui Wook


    Regions (about 3.7-3.8 kb) of the mitochondrial genomes (rrnL-cox1) of two tardigrades, a heterotardigrade, Batillipes pennaki, and a eutardigrade, Pseudobiotus spinifer, were sequenced and characterized. The gene order in Batillipes was rrnL-V-rrnS-Q-I-M-nad2-W-C-Y-cox1, and in Pseudobiotus it was rrnL-V-rrnS-Q-M-nad2-W-C-Y-cox1. With the exception of the trnI gene, the two tardigrade regions have the same gene content and order. Their gene orders are strikingly similar to that of the chelicerate Limulus polyphemus (rrnL-V-rrnS-CR-I-Q-M-nad2-W-C-Y-cox1), which is considered to be ancestral for arthropods. Although the tardigrades do not have a distinct control region (CR) within this segment, the trnI gene in Pseudobiotus is located between rrnL-trnL1 and trnL2-nad1, and the trnI gene in Batillipes is located between trnQ and trnM. In addition, the 106-bp region between trnQ and trnM in Batillipes not only contains two plausible trnI genes with opposite orientations, but also exhibits some CR-like characteristics. The mitochondrial gene arrangements of 183 other protostomes were compared. 60 (52.2%) of the 115 arthropods examined have the M-nad2-W-C-Y-cox1 arrangement, and 88 (76.5%) the M-nad2-W arrangement, as found in the tardigrades. In contrast, no such arrangement was seen in the 70 non-arthropod protostomes studied. These are the first non-sequence molecular data that support the close relationship of tardigrades and arthropods.

  14. Supermarket Proteases.

    ERIC Educational Resources Information Center

    Hagar, William G.; Bullerwell, Lornie D.


    Presents a laboratory activity on enzymes. Uses common items found in the supermarket that contain protease enzymes, such as contact lens cleaner and meat tenderizer. Demonstrates the digestion of gelatin proteins as part of enzymatic reactions. (Author/SOE)

  15. Association of Genes, Pathways, and Haplogroups of the Mitochondrial Genome with the Risk of Colorectal Cancer: The Multiethnic Cohort.


    Li, Yuqing; Beckman, Kenneth B; Caberto, Christian; Kazma, Remi; Lum-Jones, Annette; Haiman, Christopher A; Le Marchand, Loïc; Stram, Daniel O; Saxena, Richa; Cheng, Iona


    The mitochondrial genome encodes for the synthesis of 13 proteins that are essential for the oxidative phosphorylation (OXPHOS) system. Inherited variation in mitochondrial genes may influence cancer development through changes in mitochondrial proteins, altering the OXPHOS process, and promoting the production of reactive oxidative species. To investigate the role of the OXPHOS pathway and mitochondrial genes in colorectal cancer (CRC) risk, we tested 185 mitochondrial SNPs (mtSNPs), located in 13 genes that comprise four complexes of the OXPHOS pathway and mtSNP groupings for rRNA and tRNA, in 2,453 colorectal cancer cases and 11,930 controls from the Multiethnic Cohort Study. Using the sequence kernel association test, we examined the collective set of 185 mtSNPs, as well as subsets of mtSNPs grouped by mitochondrial pathways, complexes, and genes, adjusting for age, sex, principal components of global ancestry, and self-reported maternal race/ethnicity. We also tested for haplogroup associations using unconditional logistic regression, adjusting for the same covariates. Stratified analyses were conducted by self-reported maternal race/ethnicity. In European Americans, a global test of all genetic variants of the mitochondrial genome identified an association with CRC risk (P = 0.04). In mtSNP-subset analysis, the NADH dehydrogenase 2 (MT-ND2) gene in Complex I was associated with CRC risk at a P-value of 0.001 (q = 0.015). In addition, haplogroup T was associated with CRC risk (OR = 1.66, 95% CI: 1.19-2.33, P = 0.003). No significant mitochondrial pathway and gene associations were observed in the remaining four racial/ethnic groups--African Americans, Asian Americans, Latinos, and Native Hawaiians. In summary, our findings suggest that variations in the mitochondrial genome and particularly in the MT-ND2 gene may play a role in CRC risk among European Americans, but not in other maternal racial/ethnic groups. Further replication is warranted and future studies

  16. Transcriptional Gene Silencing Maintained by OTS1 SUMO Protease Requires a DNA-Dependent Polymerase V-Dependent Pathway1[OPEN

    PubMed Central

    Liu, Lei; Yan, Xiaojing; Zhao, Yiqiang


    The expression of genes with aberrant structure is prevented at both the transcriptional and posttranscriptional regulation levels. Aberrant gene silencing at the posttranscriptional level is well studied; however, it is not well understood how aberrant genes are silenced at the transcriptional level. In this study, through genetic screening a transgenic report line that harbors an aberrant gene (35S-LUC, lacking 3′-untranslated region [3′-UTR]) and lacks luciferase (LUC) activity, we identify that the small ubiquitin-like modifier (SUMO) protease OTS1 gene is required for maintaining the silence of the reporter 35S-LUC and an endogenous mutator-like element MULE-F19G14 at the transcriptional level, which requires DNA-dependent RNA polymerase (Pol) V and DDR complex, but not Pol IV. The increased transcripts in ots1 mutants are terminated by the 3′-UTRs of downstream genes. In addition to ots1 mutations, mutations in several known or putative SUMO proteases and two SUMO E3 ligases, SIZ1 and MMS21, have similar effects on this silencing regulation. Taken together, our results reveal that the enzymes involved in the SUMOylation process restrain aberrant gene transcription by using a downstream gene 3′-UTR, and this regulation requires a functional Pol V-dependent pathway in Arabidopsis (Arabidopsis thaliana). PMID:27852949

  17. Copy Number Variation of Mitochondrial DNA Genes in Pneumocystis jirovecii According to the Fungal Load in BAL Specimens

    PubMed Central

    Valero, Clara; Buitrago, María José; Gits-Muselli, Maud; Benazra, Marion; Sturny-Leclère, Aude; Hamane, Samia; Guigue, Nicolas; Bretagne, Stéphane; Alanio, Alexandre


    Pneumocystis jirovecii is an unculturable fungus and the causative agent of Pneumocystis pneumonia, a life-threatening opportunistic infection. Although molecular diagnosis is often based on the detection of mtLSU rRNA mitochondrial gene, the number of copies of mitochondrial genes had not been investigated. We developed and optimized six real-time PCR assays in order to determine the copy number of four mitochondrial genes (mtSSU rRNA, mtLSU rRNA, NAD1, and CYTB) in comparison to nuclear genome (DHPS and HSP70) and tested 84 bronchoalveolar fluids of patients at different stages of the infection. Unexpectedly, we found that copy number of mitochondrial genes varied from gene to gene with mtSSU rRNA gene being more represented (37 copies) than NAD1 (23 copies), mtLSU rRNA (15 copies) and CYTB (6 copies) genes compared to nuclear genome. Hierarchical clustering analysis (HCA) allowed us to define five major clusters, significantly associated with fungal load (p = 0.029), in which copy number of mitochondrial genes was significantly different among them. More importantly, copy number of mtLSU rRNA, NAD1, and CYTB but not mtSSU rRNA differed according to P. jirovecii physiological state with a decreased number of copies when the fungal load is low. This suggests the existence of a mixture of various subspecies of mtDNA that can harbor different amplification rates. Overall, we revealed here an unexpected variability of P. jirovecii mtDNA copy number that fluctuates according to P. jirovecii’s physiological state, except for mtSSU that is the most stable and the most present mitochondrial gene. PMID:27672381

  18. Profiling of genes central to human mitochondrial energy metabolism following low intensity laser irradiation

    NASA Astrophysics Data System (ADS)

    Houreld, Nicolette N.; Masha, Roland; Abrahamse, Heidi


    Background: Wound healing involves three overlapping phases: inflammation, granulation and tissue remodelling. If this process is disrupted, delayed wound healing ensues, a common complication seen in diabetic patients. Low intensity laser irradiation (LILI) has been found to promote healing in such patients. However, the exact mechanisms of action are poorly understood. Purpose: This study aimed to profile the expression of key genes involved in mitochondrial respiration. Materials and Methods: Diabetic wounded fibroblast cells were exposed to a wavelength of 660 nm and a fluence of 5 J/cm2 and incubated for 30 min. Total RNA was isolated and 1 μg reverse transcribed into cDNA which was used for real-time polymerase chain reaction (PCR) array analysis. The array contained genes important for each of the mitochondrial complexes involved in the electron transport chain (ETC). Adenosine triphosphate (ATP) levels were also determined post-irradiation by ATP luminescence. Results: Genes involved in complex IV (cytochrome c oxidase), COX6B2 and COX6C, and PPA1 which is involved in complex V (ATP synthase) were significantly up-regulated. There was a significant increase in ATP levels in diabetic wounded cells post-irradiation. Discussion and Conclusion: LILI stimulates the ETC at a transcriptional level, resulting in an increase in ATP. This study helps understand the mechanisms of LILI in diabetic wound healing, and gives information on activation of genes in response to LILI.

  19. Molecular Phylogenetics of the Genus Trichosporon Inferred from Mitochondrial Cytochrome b Gene Sequences

    PubMed Central

    Biswas, Swarajit Kumar; Wang, Li; Yokoyama, Koji; Nishimura, Kazuko


    Mitochondrial cytochrome b (cyt b) genes of 42 strains representing 23 species of the genus Trichosporon were partially sequenced to determine their molecular phylogenetic relationships. Almost half of the 22 strains investigated (from 11 different species) contained introns in their sequences. Analysis of a 396-bp coding sequence from each strain of Trichosporon under investigation showed a total of 141 (35.6%) variable nucleotide sites. A phylogenetic tree based on the cyt b gene sequences revealed that all species of Trichosporon except Trichosporon domesticum and Trichosporon montevideense had species-specific cyt b genes. Trichosporon sp. strain CBS 5581 was identified as Trichosporon pullulans, and one clinical isolate, IFM 48794, was identified as Trichosporon faecale. Analysis of 132-bp deduced amino acid sequences showed a total of 34 (25.75%) variable amino acid sites. T. domesticum and T. montevideense, Trichosporon asahii and Trichosporon asteroides, and Trichosporon gracile and Trichosporon guehoae had identical amino acid sequences. A phylogenetic tree constructed with the ascomycetes Saccharomyces douglasii and Candida glabrata taken as outgroup species and including representative species from closely related genera species of Trichosporon clustered with other basidiomycetous yeasts that contain xylose in their cell wall compositions. These results indicate the effectiveness of mitochondrial cyt b gene sequences for both species identification and the phylogenetic analysis of Trichosporon species. PMID:16207980

  20. A Mutation in a Novel Yeast Proteasomal Gene, RPN11/MPR1, Produces a Cell Cycle Arrest, Overreplication of Nuclear and Mitochondrial DNA, and an Altered Mitochondrial Morphology

    PubMed Central

    Rinaldi, Teresa; Ricci, Carlo; Porro, Danilo; Bolotin-Fukuhara, Monique; Frontali, Laura


    We report here the functional characterization of an essential Saccharomyces cerevisiae gene, MPR1, coding for a regulatory proteasomal subunit for which the name Rpn11p has been proposed. For this study we made use of the mpr1-1 mutation that causes the following pleiotropic defects. At 24°C growth is delayed on glucose and impaired on glycerol, whereas no growth is seen at 36°C on either carbon source. Microscopic observation of cells growing on glucose at 24°C shows that most of them bear a large bud, whereas mitochondrial morphology is profoundly altered. A shift to the nonpermissive temperature produces aberrant elongated cell morphologies, whereas the nucleus fails to divide. Flow cytometry profiles after the shift to the nonpermissive temperature indicate overreplication of both nuclear and mitochondrial DNA. Consistently with the identification of Mpr1p with a proteasomal subunit, the mutation is complemented by the human POH1 proteasomal gene. Moreover, the mpr1-1 mutant grown to stationary phase accumulates ubiquitinated proteins. Localization of the Rpn11p/Mpr1p protein has been studied by green fluorescent protein fusion, and the fusion protein has been found to be mainly associated to cytoplasmic structures. For the first time, a proteasomal mutation has also revealed an associated mitochondrial phenotype. We actually showed, by the use of [rho°] cells derived from the mutant, that the increase in DNA content per cell is due in part to an increase in the amount of mitochondrial DNA. Moreover, microscopy of mpr1-1 cells grown on glucose showed that multiple punctate mitochondrial structures were present in place of the tubular network found in the wild-type strain. These data strongly suggest that mpr1-1 is a valuable tool with which to study the possible roles of proteasomal function in mitochondrial biogenesis. PMID:9763452

  1. Incongruence of mitochondrial and nuclear gene trees in the Carabid beetles Ohomopterus.


    Sota, T; Vogler, A P


    We studied the molecular phylogeny of the carabid subgenus Ohomopterus (genus Carabus), using two mitochondrial (mt) DNA regions (16SrRNA and NADH dehydrogenase subunit 5) and three nuclear DNA regions (wingless, phosphoenolpyruvate carboxykinase, and an anonymous locus). We revisited the previously reported incongruence between the distribution of mtDNA markers and morphologically defined species (Su et al., 1996; J. Mol. Evol. 43:662-671), which those authors attributed to "type switching", a concerted change in many morphological characters that results in the repeated evolution of a particular morphological type. Our mtDNA gene tree obtained from 44 individuals representing all 15 currently recognized species of Ohomopterus revealed that haplotypes isolated from individuals of a single "species" were frequently separated into distant clades, confirming the previous report. The three nuclear markers generally conformed better-with the morphologically defined species than did the mitochondrial markers. The phylogenetic signal in mtDNA and nuclear DNA data differed strongly, and these two partitions were significantly incongruent with each other according to the incongruence length difference test of Farris et al. (1994; Cladistics 10:315-320), although the three nuclear partitions were not homogeneous either. Our results did not support the type-switching hypothesis that had been proposed to fit the morphological data to the mitochondrial gene tree: The incongruence of the mtDNA tree with other nuclear markers indicates that the mtDNA-based tree does not reflect species history any better than the morphological data do. Incongruence of gene trees in Ohomopterus may have been promoted by the complex processes of geographic isolation and hybridization in the Japanese Archipelago that have led to occasional gene flow and recombination between separated entities. The occurrence of reticulate patterns in this group is intriguing, because species of Ohomopterus exhibit

  2. The dual role of cyclin C connects stress regulated gene expression to mitochondrial dynamics

    PubMed Central

    Strich, Randy; Cooper, Katrina F.


    Following exposure to cytotoxic agents, cellular damage is first recognized by a variety of sensor mechanisms. Thenceforth, the damage signal is transduced to the nucleus to install the correct gene expression program including the induction of genes whose products either detoxify destructive compounds or repair the damage they cause. Next, the stress signal is disseminated throughout the cell to effect the appropriate changes at organelles including the mitochondria. The mitochondria represent an important signaling platform for the stress response. An initial stress response of the mitochondria is extensive fragmentation. If the damage is prodigious, the mitochondria fragment (fission) and lose their outer membrane integrity leading to the release of pro-apoptotic factors necessary for programmed cell death (PCD) execution. As this complex biological process contains many moving parts, it must be exquisitely coordinated as the ultimate decision is life or death. The conserved C-type cyclin plays an important role in executing this molecular Rubicon by coupling changes in gene expression to mitochondrial fission and PCD. Cyclin C, along with its cyclin dependent kinase partner Cdk8, associates with the RNA polymerase holoenzyme to regulate transcription. In particular, cyclin C-Cdk8 repress many stress responsive genes. To relieve this repression, cyclin C is destroyed in cells exposed to pro-oxidants and other stressors. However, prior to its destruction, cyclin C, but not Cdk8, is released from its nuclear anchor (Med13), translocates from the nucleus to the cytoplasm where it interacts with the fission machinery and is both necessary and sufficient to induce extensive mitochondria fragmentation. Furthermore, cytoplasmic cyclin C promotes PCD indicating that it mediates both mitochondrial fission and cell death pathways. This review will summarize the role cyclin C plays in regulating stress-responsive transcription. In addition, we will detail this new function

  3. Lineage-specific fragmentation and nuclear relocation of the mitochondrial cox2 gene in chlorophycean green algae (Chlorophyta).


    Rodríguez-Salinas, Elizabeth; Riveros-Rosas, Héctor; Li, Zhongkui; Fucíková, Karolina; Brand, Jerry J; Lewis, Louise A; González-Halphen, Diego


    In most eukaryotes the subunit 2 of cytochrome c oxidase (COX2) is encoded in intact mitochondrial genes. Some green algae, however, exhibit split cox2 genes (cox2a and cox2b) encoding two polypeptides (COX2A and COX2B) that form a heterodimeric COX2 subunit. Here, we analyzed the distribution of intact and split cox2 gene sequences in 39 phylogenetically diverse green algae in phylum Chlorophyta obtained from databases (28 sequences from 22 taxa) and from new cox2 data generated in this work (23 sequences from 18 taxa). Our results support previous observations based on a smaller number of taxa, indicating that algae in classes Prasinophyceae, Ulvophyceae, and Trebouxiophyceae contain orthodox, intact mitochondrial cox2 genes. In contrast, all of the algae in Chlorophyceae that we examined exhibited split cox2 genes, and could be separated into two groups: one that has a mitochondrion-localized cox2a gene and a nucleus-localized cox2b gene ("Scenedesmus-like"), and another that has both cox2a and cox2b genes in the nucleus ("Chlamydomonas-like"). The location of the split cox2a and cox2b genes was inferred using five different criteria: differences in amino acid sequences, codon usage (mitochondrial vs. nuclear), codon preference (third position frequencies), presence of nucleotide sequences encoding mitochondrial targeting sequences and presence of spliceosomal introns. Distinct green algae could be grouped according to the form of cox2 gene they contain: intact or fragmented, mitochondrion- or nucleus-localized, and intron-containing or intron-less. We present a model describing the events that led to mitochondrial cox2 gene fragmentation and the independent and sequential migration of cox2a and cox2b genes to the nucleus in chlorophycean green algae. We also suggest that the distribution of the different forms of the cox2 gene provides important insights into the phylogenetic relationships among major groups of Chlorophyceae.

  4. Mutagenesis of a novel gene in the prcA-prtP protease locus affects expression of Treponema denticola membrane complexes.


    Bian, Xue-Lin; Wang, Hong-Tao; Ning, Yu; Lee, Si Young; Fenno, J Christopher


    A novel gene was identified in the Treponema denticola prcA-prtP protease operon. Strains with mutations in either the prcA-prtP or the msp region showed altered expression of a product(s) of the other locus. Together, these results provide information on the assembly of outer membrane complexes involved in T. denticola interaction with host cells and tissue.

  5. Mutagenesis of a Novel Gene in the prcA-prtP Protease Locus Affects Expression of Treponema denticola Membrane Complexes

    PubMed Central

    Bian, Xue-lin; Wang, Hong-tao; Ning, Yu; Lee, Si Young; Fenno, J. Christopher


    A novel gene was identified in the Treponema denticola prcA-prtP protease operon. Strains with mutations in either the prcA-prtP or the msp region showed altered expression of a product(s) of the other locus. Together, these results provide information on the assembly of outer membrane complexes involved in T. denticola interaction with host cells and tissue. PMID:15664975

  6. Conditional Depletion of the Chlamydomonas Chloroplast ClpP Protease Activates Nuclear Genes Involved in Autophagy and Plastid Protein Quality Control[W

    PubMed Central

    Ramundo, Silvia; Casero, David; Mühlhaus, Timo; Hemme, Dorothea; Sommer, Frederik; Crèvecoeur, Michèle; Rahire, Michèle; Schroda, Michael; Rusch, Jannette; Goodenough, Ursula; Pellegrini, Matteo; Perez-Perez, Maria Esther; Crespo, José Luis; Schaad, Olivier; Civic, Natacha; Rochaix, Jean David


    Plastid protein homeostasis is critical during chloroplast biogenesis and responses to changes in environmental conditions. Proteases and molecular chaperones involved in plastid protein quality control are encoded by the nucleus except for the catalytic subunit of ClpP, an evolutionarily conserved serine protease. Unlike its Escherichia coli ortholog, this chloroplast protease is essential for cell viability. To study its function, we used a recently developed system of repressible chloroplast gene expression in the alga Chlamydomonas reinhardtii. Using this repressible system, we have shown that a selective gradual depletion of ClpP leads to alteration of chloroplast morphology, causes formation of vesicles, and induces extensive cytoplasmic vacuolization that is reminiscent of autophagy. Analysis of the transcriptome and proteome during ClpP depletion revealed a set of proteins that are more abundant at the protein level, but not at the RNA level. These proteins may comprise some of the ClpP substrates. Moreover, the specific increase in accumulation, both at the RNA and protein level, of small heat shock proteins, chaperones, proteases, and proteins involved in thylakoid maintenance upon perturbation of plastid protein homeostasis suggests the existence of a chloroplast-to-nucleus signaling pathway involved in organelle quality control. We suggest that this represents a chloroplast unfolded protein response that is conceptually similar to that observed in the endoplasmic reticulum and in mitochondria. PMID:24879428

  7. Conditional Depletion of the Chlamydomonas Chloroplast ClpP Protease Activates Nuclear Genes Involved in Autophagy and Plastid Protein Quality Control.


    Ramundo, Silvia; Casero, David; Mühlhaus, Timo; Hemme, Dorothea; Sommer, Frederik; Crèvecoeur, Michèle; Rahire, Michèle; Schroda, Michael; Rusch, Jannette; Goodenough, Ursula; Pellegrini, Matteo; Perez-Perez, Maria Esther; Crespo, José Luis; Schaad, Olivier; Civic, Natacha; Rochaix, Jean David


    Plastid protein homeostasis is critical during chloroplast biogenesis and responses to changes in environmental conditions. Proteases and molecular chaperones involved in plastid protein quality control are encoded by the nucleus except for the catalytic subunit of ClpP, an evolutionarily conserved serine protease. Unlike its Escherichia coli ortholog, this chloroplast protease is essential for cell viability. To study its function, we used a recently developed system of repressible chloroplast gene expression in the alga Chlamydomonas reinhardtii. Using this repressible system, we have shown that a selective gradual depletion of ClpP leads to alteration of chloroplast morphology, causes formation of vesicles, and induces extensive cytoplasmic vacuolization that is reminiscent of autophagy. Analysis of the transcriptome and proteome during ClpP depletion revealed a set of proteins that are more abundant at the protein level, but not at the RNA level. These proteins may comprise some of the ClpP substrates. Moreover, the specific increase in accumulation, both at the RNA and protein level, of small heat shock proteins, chaperones, proteases, and proteins involved in thylakoid maintenance upon perturbation of plastid protein homeostasis suggests the existence of a chloroplast-to-nucleus signaling pathway involved in organelle quality control. We suggest that this represents a chloroplast unfolded protein response that is conceptually similar to that observed in the endoplasmic reticulum and in mitochondria.

  8. Interplay of CodY and ScoC in the Regulation of Major Extracellular Protease Genes of Bacillus subtilis

    PubMed Central

    Barbieri, Giulia; Albertini, Alessandra M.; Ferrari, Eugenio; Sonenshein, Abraham L.


    ABSTRACT AprE and NprE are two major extracellular proteases in Bacillus subtilis whose expression is directly regulated by several pleiotropic transcriptional factors, including AbrB, DegU, ScoC, and SinR. In cells growing in a rich, complex medium, the aprE and nprE genes are strongly expressed only during the post-exponential growth phase; mutations in genes encoding the known regulators affect the level of post-exponential-phase gene expression but do not permit high-level expression during the exponential growth phase. Using DNA-binding assays and expression and mutational analyses, we have shown that the genes for both exoproteases are also under strong, direct, negative control by the global transcriptional regulator CodY. However, because CodY also represses scoC, little or no derepression of aprE and nprE was seen in a codY null mutant due to overexpression of scoC. Thus, CodY is also an indirect positive regulator of these genes by limiting the synthesis of a second repressor. In addition, in cells growing under conditions that activate CodY, a scoC null mutation had little effect on aprE or nprE expression; full effects of scoC or codY null mutations could be seen only in the absence of the other regulator. However, even the codY scoC double mutant did not show high levels of aprE and nprE gene expression during exponential growth phase in a rich, complex medium. Only a third mutation, in abrB, allowed such expression. Thus, three repressors can contribute to reducing exoprotease gene expression during growth in the presence of excess nutrients. IMPORTANCE The major Bacillus subtilis exoproteases, AprE and NprE, are important metabolic enzymes whose genes are subject to complex regulation by multiple transcription factors. We show here that expression of the aprE and nprE genes is also controlled, both directly and indirectly, by CodY, a global transcriptional regulator that responds to the intracellular pools of amino acids. Direct Cod

  9. Nucleotide Sequence and Gene Organization of the Starfish Asterina Pectinifera Mitochondrial Genome

    PubMed Central

    Asakawa, S.; Himeno, H.; Miura, K. I.; Watanabe, K.


    The 16,260-bp mitochondrial DNA (mtDNA) from the starfish Asterina pectinifera has been sequenced. The genes for 13 proteins, two rRNAs and 22 tRNAs are organized in an extremely economical fashion, similar to those of other animal mtDNAs, with some of the genes overlapping each other. The gene organization is the same as that for another echinoderm, sea urchin, except for the inversion of a 4.6-kb segment that contains genes for two proteins, 13 tRNAs and the 16S rRNA. Judging from the organization of the protein coding genes, mammalian mtDNAs resemble the sea urchin mtDNA more than that of the starfish. The region around the 3' end of the 12S rRNA gene of the starfish shows a high similarity with those for vertebrates. This region encodes a possible stem and loop structure; similar potential structures occur in this region of vertebrate mtDNAs and also in nonmitochondrial small subunit rRNA. A similar stem and loop structure is also found at the 3' end of the 16S rRNA genes in A. pectinifera, in another starfish Pisaster ochraceus, in vertebrates and in Drosophila, but not in sea urchins. The full sequence data confirm the presumption that AGA/AGG, AUA and AAA codons, respectively, code for serine, isoleucine, and asparagine in the starfish mitochondria, and that AGA/AGG codons are read by tRNA(GCU)(Ser), which possesses a truncated dihydrouridine arm, that was previously suggested from a partial mtDNA sequence. The structural characteristics of tRNAs and possible mechanisms for the change in the mitochondrial genetic code are also discussed. PMID:7672576

  10. Analysis of 16S rRNA gene lactic acid bacteria (LAB) isolate from Markisa fruit (Passiflora sp.) as a producer of protease enzyme and probiotics

    NASA Astrophysics Data System (ADS)

    Hidayat, Habibi


    16S rRNA gene analysis of bacteria lactic acid (LAB) isolate from Markisa Kuning Fruit (Passiflora edulis var. flavicarpa) as a producer of protease enzyme and probiotics has been done. The aim of the study is to determine the protease enzyme activity and 16S rRNA gene amplification using PCR. The calculation procedure was done to M4 isolate bacteria lactic acid (LAB) Isolate which has been resistant to acids with pH 2.0 in the manner of screening protease enzyme activity test result 6.5 to clear zone is 13 mm againts colony diametre is 2 mm. The results of study enzyme activity used spectrophotometer UV-Vis obtainable the regression equation Y=0.02983+0.001312X, with levels of protein M4 isolate is 0.6594 mg/mL and enzyme activity of obtainable is 0.8626 unit/ml while the spesific enzyme activity produced is 1.308 unit/mg. Then, 16S rRNA gene amplificatiom and DNA sequencing has been done. The results of study showed that the bacteria species contained from M4 bacteria lactic acid (LAB) isolate is Weisella cibiria strain II-I-59. Weisella cibiria strain II-I-59 is one of bacteria could be utilized in the digestive tract.

  11. Gene therapy for mitochondrial diseases: Leber Hereditary Optic Neuropathy as the first candidate for a clinical trial.


    Cwerman-Thibault, Hélène; Augustin, Sébastien; Ellouze, Sami; Sahel, José-Alain; Corral-Debrinski, Marisol


    Mitochondrial disorders cannot be ignored anymore in most medical disciplines; indeed their minimum estimated prevalence is superior to 1 in 5000 births. Despite the progress made in the last 25 years on the identification of gene mutations causing mitochondrial pathologies, only slow progress was made towards their effective treatments. Ocular involvement is a frequent feature in mitochondrial diseases and corresponds to severe and irreversible visual handicap due to retinal neuron loss and optic atrophy. Interestingly, three clinical trials for Leber Congenital Amaurosis due to RPE65 mutations are ongoing since 2007. Overall, the feasibility and safety of ocular Adeno-Associated Virus delivery in adult and younger patients and consistent visual function improvements have been demonstrated. The success of gene-replacement therapy for RPE65 opens the way for the development of similar approaches for a broad range of eye disorders, including those with mitochondrial etiology such as Leber Hereditary Optic Neuropathy (LHON).

  12. Single nucleotide polymorphisms linked to mitochondrial uncoupling protein genes UCP2 and UCP3 affect mitochondrial metabolism and healthy aging in female nonagenarians.


    Kim, Sangkyu; Myers, Leann; Ravussin, Eric; Cherry, Katie E; Jazwinski, S Michal


    Energy expenditure decreases with age, but in the oldest-old, energy demand for maintenance of body functions increases with declining health. Uncoupling proteins have profound impact on mitochondrial metabolic processes; therefore, we focused attention on mitochondrial uncoupling protein genes. Alongside resting metabolic rate (RMR), two SNPs in the promoter region of UCP2 were associated with healthy aging. These SNPs mark potential binding sites for several transcription factors; thus, they may affect expression of the gene. A third SNP in the 3'-UTR of UCP3 interacted with RMR. This UCP3 SNP is known to impact UCP3 expression in tissue culture cells, and it has been associated with body weight and mitochondrial energy metabolism. The significant main effects of the UCP2 SNPs and the interaction effect of the UCP3 SNP were also observed after controlling for fat-free mass (FFM) and physical-activity related energy consumption. The association of UCP2/3 with healthy aging was not found in males. Thus, our study provides evidence that the genetic risk factors for healthy aging differ in males and females, as expected from the differences in the phenotypes associated with healthy aging between the two sexes. It also has implications for how mitochondrial function changes during aging.

  13. Mutations in the Reverse Transcriptase and Protease Genes of Human Immunodeficiency Virus-1 from Antiretroviral Naïve and Treated Pediatric Patients

    PubMed Central

    Bure, Dinesh; Makhdoomi, Muzamil A.; Lodha, Rakesh; Prakash, Somi Sankaran; Kumar, Rajesh; Parray, Hilal A.; Singh, Ravinder; Kabra, Sushil K.; Luthra, Kalpana


    The success of highly active antiretroviral therapy (HAART) is challenged by the emergence of resistance-associated mutations in human immunodeficiency virus-1 (HIV-1). In this study, resistance associated mutations in the reverse transcriptase (RT) and protease (PR) genes in antiretroviral therapy (ART) naïve and treated HIV-1 infected pediatric patients from North India were evaluated. Genotyping was successfully performed in 46 patients (30 ART naive and 16 treated) for the RT gene and in 53 patients (27 ART naive and 26 treated) for PR gene and mutations were identified using Stanford HIV Drug Resistance Database. A major drug resistant mutation in RT gene, L74I (NRTI), and two such mutations, K101E and G190A (NNRTI), were observed in two ART naïve patients, while M184V was detected in two ART treated patients. Overall, major resistance associated mutations in RT gene were observed in nine (30%) and seven (36%) of ART naïve and treated children respectively. Minor mutations were identified in PR gene in five children. Few non-clade C viral strains (≈30%) were detected, although subtype C was most predominant. The screening of ART naïve children for mutations in HIV-1 RT and protease genes, before and after initiation of ART is desirable for drug efficacy and good prognosis. PMID:25674767

  14. Mutations in the reverse transcriptase and protease genes of human immunodeficiency virus-1 from antiretroviral naïve and treated pediatric patients.


    Bure, Dinesh; Makhdoomi, Muzamil A; Lodha, Rakesh; Prakash, Somi Sankaran; Kumar, Rajesh; Parray, Hilal A; Singh, Ravinder; Kabra, Sushil K; Luthra, Kalpana


    The success of highly active antiretroviral therapy (HAART) is challenged by the emergence of resistance-associated mutations in human immunodeficiency virus-1 (HIV-1). In this study, resistance associated mutations in the reverse transcriptase (RT) and protease (PR) genes in antiretroviral therapy (ART) naïve and treated HIV-1 infected pediatric patients from North India were evaluated. Genotyping was successfully performed in 46 patients (30 ART naive and 16 treated) for the RT gene and in 53 patients (27 ART naive and 26 treated) for PR gene and mutations were identified using Stanford HIV Drug Resistance Database. A major drug resistant mutation in RT gene, L74I (NRTI), and two such mutations, K101E and G190A (NNRTI), were observed in two ART naïve patients, while M184V was detected in two ART treated patients. Overall, major resistance associated mutations in RT gene were observed in nine (30%) and seven (36%) of ART naïve and treated children respectively. Minor mutations were identified in PR gene in five children. Few non-clade C viral strains (≈30%) were detected, although subtype C was most predominant. The screening of ART naïve children for mutations in HIV-1 RT and protease genes, before and after initiation of ART is desirable for drug efficacy and good prognosis.

  15. Dynamic Regulation of Genes Involved in Mitochondrial DNA Replication and Transcription during Mouse Brown Fat Cell Differentiation and Recruitment

    PubMed Central

    Murholm, Maria; Dixen, Karen; Qvortrup, Klaus; Hansen, Lillian H. L.; Amri, Ez-Zoubir; Madsen, Lise; Barbatelli, Giorgio; Quistorff, Bjørn; Hansen, Jacob B.


    Background Brown adipocytes are specialised in dissipating energy through adaptive thermogenesis, whereas white adipocytes are specialised in energy storage. These essentially opposite functions are possible for two reasons relating to mitochondria, namely expression of uncoupling protein 1 (UCP1) and a remarkably higher mitochondrial abundance in brown adipocytes. Methodology/Principal Findings Here we report a comprehensive characterisation of gene expression linked to mitochondrial DNA replication, transcription and function during white and brown fat cell differentiation in vitro as well as in white and brown fat, brown adipose tissue fractions and in selected adipose tissues during cold exposure. We find a massive induction of the majority of such genes during brown adipocyte differentiation and recruitment, e.g. of the mitochondrial transcription factors A (Tfam) and B2 (Tfb2m), whereas only a subset of the same genes were induced during white adipose conversion. In addition, PR domain containing 16 (PRDM16) was found to be expressed at substantially higher levels in brown compared to white pre-adipocytes and adipocytes. We demonstrate that forced expression of Tfam but not Tfb2m in brown adipocyte precursor cells promotes mitochondrial DNA replication, and that silencing of PRDM16 expression during brown fat cell differentiation blunts mitochondrial biogenesis and expression of brown fat cell markers. Conclusions/Significance Using both in vitro and in vivo model systems of white and brown fat cell differentiation, we report a detailed characterisation of gene expression linked to mitochondrial biogenesis and function. We find significant differences in differentiating white and brown adipocytes, which might explain the notable increase in mitochondrial content observed during brown adipose conversion. In addition, our data support a key role of PRDM16 in triggering brown adipocyte differentiation, including mitochondrial biogenesis and expression of UCP1

  16. Changes in base composition bias of nuclear and mitochondrial genes in lice (Insecta: Psocodea).


    Yoshizawa, Kazunori; Johnson, Kevin P


    While it is well known that changes in the general processes of molecular evolution have occurred on a variety of timescales, the mechanisms underlying these changes are less well understood. Parasitic lice ("Phthiraptera") and their close relatives (infraorder Nanopsocetae of the insect order Psocodea) are a group of insects well known for their unusual features of molecular evolution. We examined changes in base composition across parasitic lice and bark lice. We identified substantial differences in percent GC content between the clade comprising parasitic lice plus closely related bark lice (=Nanopsocetae) versus all other bark lice. These changes occurred for both nuclear and mitochondrial protein coding and ribosomal RNA genes, often in the same direction. To evaluate whether correlations in base composition change also occurred within lineages, we used phylogenetically controlled comparisons, and in this case few significant correlations were identified. Examining more constrained sites (first/second codon positions and rRNA) revealed that, in comparison to the other bark lice, the GC content of parasitic lice and close relatives tended towards 50 % either up from less than 50 % GC or down from greater than 50 % GC. In contrast, less constrained sites (third codon positions) in both nuclear and mitochondrial genes showed less of a consistent change of base composition in parasitic lice and very close relatives. We conclude that relaxed selection on this group of insects is a potential explanation of the change in base composition for both mitochondrial and nuclear genes, which could lead to nucleotide frequencies closer to random expectation (i.e., 50 % GC) in the absence of any mutation bias. Evidence suggests this relaxed selection arose once in the non-parasitic common ancestor of Phthiraptera + Nanopsocetae and is not directly related to the evolution of the parasitism in lice.

  17. Adaptive evolution of the mitochondrial ND6 gene in the domestic horse.


    Ning, T; Xiao, H; Li, J; Hua, S; Zhang, Y P


    Mitochondria play a crucial role in energy metabolism through oxidative phosphorylation. Organisms living at high altitudes are potentially influenced by oxygen deficits and cold temperatures. The severe environmental conditions can impact on metabolism and direct selection of mitochondrial DNA. As a wide-ranging animal, the domestic horse (Equus caballus) has developed various morphological and physiological characteristics for adapting to different altitudes. Thus, this is a good species for studying adaption to high altitudes at a molecular level. We sequenced the complete NADH dehydrogenase 6 gene (ND6) of 509 horses from 24 sampling locations. By comparative analysis of three horse populations living at different altitudes (>2200 m, 1200-1700 m, and <900 m), we found that the high-altitude population had the lowest genetic diversity and significant negative Tajima's D; both values declined with increasing elevation. Moreover, non-directional selection was identified for the ND6 gene by a tree-based relative ratio test (P = 0.007); the highest proportion of high-altitude horses was found distributed on the selected branches. We conclude that the high-altitude environment has directed adaptive evolution of the mitochondrial ND6 gene in the plateau horse.

  18. Mutational Analysis of Mitochondrial tRNA Genes in Patients with Lung Cancer

    PubMed Central

    He, ZF; Zheng, LC; Xie, DY; Yu, SS; Zhao, J


    Abstract Mutations in mitochondrial tRNA (mt-tRNA) genes have been found to be associated with various diseases including lung cancer. To understand the possible relationship between mtRNA mutations and lung cancer, we sequenced the 22 mt-tRNA genes from 200 lung cancer blood samples, as well as 100 healthy subjects. As a result, five mutations were identified including the tRNAAla T5655C, tRNAArg T10454C, tRNALeu(CUN) A12330G, tRNASer(UCN) T7505C and tRNAThr G15927A. These mutations were absent in the healthy subjects. These mutations and polymorphisms were localized at the highly conserved nucleotides of the corresponding mitochondrial tRNAs, which are critical for the tRNA steady state level and may result in failure in the tRNA metabolism. Moreover, through the application of the pathogenicity scoring system, we found that only the T10454C mutation should be classified as a “neutral polymorphism,” while the other mutations were regarded as “definitely pathogenic.” Taken together, our data indicate that tRNA genes are the hot-spots for pathogenic mutations associated with lung cancer. Our findings may provide valuable information for pathophysiology, management and genetic counseling of lung cancer. PMID:28289588

  19. Overexpression of Citrus junos mitochondrial citrate synthase gene in Nicotiana benthamiana confers aluminum tolerance.


    Deng, Wei; Luo, Keming; Li, Zhengguo; Yang, Yingwu; Hu, Nan; Wu, Yu


    Aluminum (Al) toxicity is one of the major factors that limit plant growth in acid soils. Al-induced release of organic acids into rhizosphere from the root apex has been identified as a major Al-tolerance mechanism in many plant species. In this study, Al tolerance of Yuzu (Citrus Junos Sieb. ex Tanaka) was tested on the basis of root elongation and the results demonstrated that Yuzu was Al tolerant compared with other plant species. Exposure to Al triggered the exudation of citrate from the Yuzu root. Thus, the mechanism of Al tolerance in Yuzu involved an Al-inducible increase in citrate release. Aluminum also elicited an increase of citrate content and increased the expression level of mitochondrial citrate synthase (CjCS) gene and enzyme activity in Yuzu. The CjCS gene was cloned from Yuzu and overexpressed in Nicotiana benthamiana using Agrobacterium tumefaciens-mediated methods. Increased expression level of the CjCS gene and enhanced enzyme activity were observed in transgenic plants compared with the wild-type plants. Root growth experiments showed that transgenic plants have enhanced levels of Al tolerance. The transgenic Nicotiana plants showed increased levels of citrate in roots compared to wild-type plants. The exudation of citrate from roots of the transgenic plants significantly increased when exposed to Al. The results with transgenic plants suggest that overexpression of mitochondrial CS can be a useful tool to achieve Al tolerance.

  20. Characterization of the nuclear gene encoding mitochondrial aconitase in the marine red alga Gracilaria verrucosa.


    Zhou, Y H; Ragan, M A


    We have cloned a nuclear gene from the marine red alga Gracilaria verrucosa that encodes the complete 779 amino-acid mitochondrial aconitase (m-ACN), the first characterized from a photosynthetic organism. The N-terminal 28 deduced amino acids are predicted to constitute the mitochondrial transit peptide, the first described from a red alga. Putative transcriptional cis-acting elements were identified in the upstream untranslated region. The G. verrucosa m-ACN gene (m-ACN) is present in a single copy and is located ca. 1.5 kb upstream from the single-copy polyubiquitin gene. The single spliceosomal intron is located near the 5' end of the region encoding the mature m-ACN in precisely the same location and phase as intron 2 in Caenorhabditis elegans m-ACN; sequences at its 3' and 5' splice junctions and at the predicted lariat branch point conform well to the eukaryote consensus sequences. Multiple protein-sequence alignment of m-ACN, bacterial aconitase (b-ACN) and iron-responsive element-binding protein (IRE-BP), and phylogenetic analyses, revealed that m-ACN does not share a recent common ancestry with either b-ACN or IRE-BP.

  1. A mitochondrial complex I defect impairs cold-regulated nuclear gene expression.


    Lee, Byeong-ha; Lee, Hojoung; Xiong, Liming; Zhu, Jian-Kang


    To study low-temperature signaling in plants, we previously screened for cold stress response mutants using bioluminescent Arabidopsis plants that express the firefly luciferase reporter gene driven by the stress-responsive RD29A promoter. Here, we report on the characterization and cloning of one mutant, frostbite1 (fro1), which shows reduced luminescence induction by cold. fro1 plants display reduced cold induction of stress-responsive genes such as RD29A, KIN1, COR15A, and COR47. fro1 leaves have a reduced capacity for cold acclimation, appear water-soaked, leak electrolytes, and accumulate reactive oxygen species constitutively. FRO1 was isolated through positional cloning and found to encode a protein with high similarity to the 18-kD Fe-S subunit of complex I (NADH dehydrogenase, EC in the mitochondrial electron transfer chain. Confocal imaging shows that the FRO1:green fluorescent protein fusion protein is localized in mitochondria. These results suggest that cold induction of nuclear gene expression is modulated by mitochondrial function.

  2. RNA editing in six mitochondrial ribosomal protein genes of Didymium iridis.


    Hendrickson, Peter G; Silliker, Margaret E


    Similarity searches with Didymium iridis mitochondrial genomic DNA identified six possible ribosomal protein-coding regions, however, each region contained stop codons that would need to be removed by RNA editing to produce functional transcripts. RT-PCR was used to amplify these regions from total RNA for cloning and sequencing. Six functional transcripts were verified for the following ribosomal protein genes: rpS12, rpS7, rpL2, rpS19, rpS3, and rpL16. The editing events observed, such as single C and U nucleotide insertions and a dinucleotide insertion, were consistent with previously observed editing patterns seen in D. iridis. Additionally, a new form of insertional editing, a single A insertion, was observed in a conserved region of the rpL16 gene. While the majority of codons created by editing specify hydrophobic amino acids, a greater proportion of the codons created in these hydrophilic ribosomal proteins called for positively charged amino acids in comparison to the previously characterized hydrophobic respiratory protein genes. This first report of edited soluble mitochondrial ribosomal proteins in myxomycetes expands upon the RNA editing patterns previously seen; there was: a greater proportion of created codons specifying positively charged amino acids, a shift in the codon position edited, and the insertion of single A nucleotides.

  3. [Chloroplast Deg proteases].


    Grabsztunowicz, Magda; Luciński, Robert; Baranek, Małgorzata; Sikora, Bogna; Jackowski, Grzegorz


    For some chloroplast proteases ATP binding and hydrolysis is not necessary for their catalytic activity, most probably because even strongly unfolded substrates may penetrate their catalytic chamber. Deg1, 2, 5 and 8 are the best known of Arabidopsis thaliana ATP- independent chloroplast proteases, encoded by orthologues of genes coding for DegP, DegQ and DegS proteases of Escherichia coli. Current awareness in the area of structure and functions of chloroplast Degs is much more limited vs the one about their bacterial counterparts. Deg5 and Deg8 form a catalytic heterododecamer which is loosely attached to luminal side of thylakoid membrane. The complex catalyses--supported by Deg1 and one of FtsH proteases--the degradation of PsbA damaged due to plant exposition to elevated irradiance and thus these protease are of key importance for the plants' sensitivity to photoinhibition. Deg2 role in the disposal of damaged PsbA has not been elucidated. Recombinant Deg1 may degrade PsbO and plastocyanin in vitro but it is not clear whether this reaction is performed in vivo as well.

  4. Expression of the Bcl-2 family genes and complexes involved in the mitochondrial transport in prostate cancer cells.


    Asmarinah, Asmarinah; Paradowska-Dogan, Agnieszka; Kodariah, Ria; Tanuhardja, Budiana; Waliszewski, Przemyslaw; Mochtar, Chaidir Arif; Weidner, Wolfgang; Hinsch, Elvira


    Alteration of molecular pathways triggering apoptosis gives raise to various pathological tissue processes, such as tumorigenesis. The mitochondrial pathway is regulated by both the genes of the Bcl-2 family and the genes encoding mitochondrial transport molecules. Those proteins allow a release of cyctochrome c through the outer mitochondrial membrane. This release activates the caspase cascade resulting in death of cells. There are at least two main transport systems associated with the family of Bcl-2 proteins that are involved in transport of molecules through the outer mitochondrial membrane, i.e., the voltage dependent anion channels (VDACs) and translocases of the outer mitochondrial membrane proteins (TOMs). We investigated the expression of genes of the Bcl-2 family, i.e., pro-apoptotic Bak and Bid, and anti-apoptotic Bcl-2; VDAC gene, i.e., VDAC1, VDAC2 and VDAC3; and TOMM genes, i.e., TOMM20, TOMM22 and TOMM40. This study was performed at the mRNA and the protein level. Fourteen paraffin embedded prostate cancer tissues and five normal prostate tissues were analyzed by the quantitative PCR array and immunohistochemistry. We found a significant increase in both mRNA expression of the anti-apoptotic Bcl-2 gene and VDAC1 gene in prostate cancer tissue in comparison with their normal counterparts. Translation of the anti-apoptotic Bcl-2 and VDAC1 genes in prostate cancer tissue was slightly increased. We observed no significant differences in the mRNA expression of the pro-apoptotic Bak and Bid genes, VDAC2 or VDAC3 genes or the three TOMM genes in these tissues. The pro-apoptotic Bax protein was downtranslated significantly in secretory cells of prostate cancer as compared to normal prostate. We suggest that this protein is a good candidate as biomarker for prostate cancer.

  5. Mitochondrial Genes Reveal Triatoma jatai as a Sister Species to Triatoma costalimai (Reduviidae: Triatominae)

    PubMed Central

    Teves, Simone Caldas; Gardim, Sueli; Carbajal de la Fuente, Ana Laura; Lopes, Catarina Macedo; Gonçalves, Teresa Cristina Monte; Mallet, Jacenir Reis dos Santos; da Rosa, João Aristeu; Almeida, Carlos Eduardo


    Triatoma jatai was described using a set of morphological structures from specimens collected in Paranã municipality of Tocantins State, Brazil. Under a Bayesian framework and using two mitochondrial genes (16S and COI), phylogenetic analysis recovered T. jatai as a sister species to Triatoma costalimai with higher genetic distances than between other well-recognized species. Our results agree with previous suggestions based on morphometric analysis. In the light of the non-monophyly of Matogrossensis subcomplex, the inclusion of T. jatai shall be considered for reevaluating this group. PMID:26787157

  6. Mitochondrial Genes Reveal Triatoma jatai as a Sister Species to Triatoma costalimai (Reduviidae: Triatominae).


    Teves, Simone Caldas; Gardim, Sueli; Carbajal de la Fuente, Ana Laura; Lopes, Catarina Macedo; Gonçalves, Teresa Cristina Monte; dos Santos Mallet, Jacenir Reis; da Rosa, João Aristeu; Almeida, Carlos Eduardo


    Triatoma jatai was described using a set of morphological structures from specimens collected in Paranã municipality of Tocantins State, Brazil. Under a Bayesian framework and using two mitochondrial genes (16S and COI), phylogenetic analysis recovered T. jatai as a sister species to Triatoma costalimai with higher genetic distances than between other well-recognized species. Our results agree with previous suggestions based on morphometric analysis. In the light of the non-monophyly of Matogrossensis subcomplex, the inclusion of T. jatai shall be considered for reevaluating this group.

  7. Horizontal transfer and gene conversion as an important driving force in shaping the landscape of mitochondrial introns.


    Wu, Baojun; Hao, Weilong


    Group I introns are highly dynamic and mobile, featuring extensive presence-absence variation and widespread horizontal transfer. Group I introns can invade intron-lacking alleles via intron homing powered by their own encoded homing endonuclease gene (HEG) after horizontal transfer or via reverse splicing through an RNA intermediate. After successful invasion, the intron and HEG are subject to degeneration and sequential loss. It remains unclear whether these mechanisms can fully address the high dynamics and mobility of group I introns. Here, we found that HEGs undergo a fast gain-and-loss turnover comparable with introns in the yeast mitochondrial 21S-rRNA gene, which is unexpected, as the intron and HEG are generally believed to move together as a unit. We further observed extensively mosaic sequences in both the introns and HEGs, and evidence of gene conversion between HEG-containing and HEG-lacking introns. Our findings suggest horizontal transfer and gene conversion can accelerate HEG/intron degeneration and loss, or rescue and propagate HEG/introns, and ultimately result in high HEG/intron turnover rate. Given that up to 25% of the yeast mitochondrial genome is composed of introns and most mitochondrial introns are group I introns, horizontal transfer and gene conversion could have served as an important mechanism in introducing mitochondrial intron diversity, promoting intron mobility and consequently shaping mitochondrial genome architecture.

  8. Mitochondrial gene diversity associated with the atp9 stop codon in natural populations of wild carrot (Daucus carota ssp. carota).


    Mandel, Jennifer R; McAssey, Edward V; Roland, Katherine M; McCauley, David E


    Mitochondrial genomes extracted from the wild populations of Daucus carota have been used as a genetic resource by breeders of cultivated carrot, yet little is known concerning the extent of their diversity in nature. Of special interest is an SNP in the putative stop codon of the mitochondrial gene atp9 that has been associated previously with male-sterile and male-fertile phenotypic variants. In this study, either the sequence or PCR/RFLP genotypes were obtained from the mitochondrial genes atp1, atp9, and cox1 found in D. carota individuals collected from 24 populations in the eastern United States. More than half of the 128 individuals surveyed had a CAA or AAA, rather than TAA, genotype at the position usually thought to function as an atp9 stop codon in this species. We also found no evidence for mitochondrial RNA editing (Cytosine to Uridine) of the CAA stop codon in either floral or leaf tissue. Evidence for intragenic recombination, as opposed to the more common intergenic recombination in plant mitochondrial genomes, in our data set is presented. Indel and SNP variants elsewhere in atp9, and in the other 2 genes surveyed, were nonrandomly associated with the 3 atp9 stop codon variants, though further analysis suggested that multilocus genotypic diversity had been enhanced by recombination. Overall the mitochondrial genetic diversity was only modestly structured among populations with an F(ST) of 0.34.

  9. Mitochondrial genome of the Komodo dragon: efficient sequencing method with reptile-oriented primers and novel gene rearrangements.


    Kumazawa, Yoshinori; Endo, Hideki


    The mitochondrial genome of the Komodo dragon (Varanus komodoensis) was nearly completely sequenced, except for two highly repetitive noncoding regions. An efficient sequencing method for squamate mitochondrial genomes was established by combining the long polymerase chain reaction (PCR) technology and a set of reptile-oriented primers designed for nested PCR amplifications. It was found that the mitochondrial genome had novel gene arrangements in which genes from NADH dehydrogenase subunit 6 to proline tRNA were extensively shuffled with duplicate control regions. These control regions had 99% sequence similarity over 700 bp. Although snake mitochondrial genomes are also known to possess duplicate control regions with nearly identical sequences, the location of the second control region suggested independent occurrence of the duplication on lineages leading to snakes and the Komodo dragon. Another feature of the mitochondrial genome of the Komodo dragon was the considerable number of tandem repeats, including sequences with a strong secondary structure, as a possible site for the slipped-strand mispairing in replication. These observations are consistent with hypotheses that tandem duplications via the slipped-strand mispairing may induce mitochondrial gene rearrangements and may serve to maintain similar copies of the control region.

  10. Mitochondrial shaping cuts.


    Escobar-Henriques, Mafalda; Langer, Thomas


    A broad range of cellular processes are regulated by proteolytic events. Proteolysis has now also been established to control mitochondrial morphology which results from the balanced action of fusion and fission. Two out of three known core components of the mitochondrial fusion machinery are under proteolytic control. The GTPase Fzo1 in the outer membrane of mitochondria is degraded along two independent proteolytic pathways. One controls mitochondrial fusion in vegetatively growing cells, the other one acts upon mating factor-induced cell cycle arrest. Fusion also depends on proteolytic processing of the GTPase Mgm1 by the rhomboid protease Pcp1 in the inner membrane of mitochondria. Functional links of AAA proteases or other proteolytic components to mitochondrial dynamics are just emerging. This review summarises the current understanding of regulatory roles of proteolytic processes for mitochondrial plasticity.

  11. Mitochondrial gene arrangement of the horseshoe crab Limulus polyphemus L.: conservation of major features among arthropod classes

    NASA Technical Reports Server (NTRS)

    Staton, J. L.; Daehler, L. L.; Brown, W. M.; Jacobs, D. K. (Principal Investigator)


    Numerous complete mitochondrial DNA sequences have been determined for species within two arthropod groups, insects and crustaceans, but there are none for a third, the chelicerates. Most mitochondrial gene arrangements reported for crustaceans and insect species are identical or nearly identical to that of Drosophila yakuba. Sequences across 36 of the gene boundaries in the mitochondrial DNA (mtDNA) of a representative chelicerate. Limulus polyphemus L., also reveal an arrangement like that of Drosophila yakuba. Only the position of the tRNA(LEU)(UUR) gene differs; in Limulus it is between the genes for tRNA(LEU)(CUN) and ND1. This positioning is also found in onychophorans, mollusks, and annelids, but not in insects and crustaceans, and indicates that tRNA(LEU)(CUN)-tRNA(LEU)(UUR)-ND1 was the ancestral gene arrangement for these groups, as suggested earlier. There are no differences in the relative arrangements of protein-coding and ribosomal RNA genes between Limulus and Drosophila, and none have been observed within arthropods. The high degree of similarity of mitochondrial gene arrangements within arthropods is striking, since some taxa last shared a common ancestor before the Cambrian, and contrasts with the extensive mtDNA rearrangements occasionally observed within some other metazoan phyla (e.g., mollusks and nematodes).

  12. The complete mitochondrial genome of Taeniogonalos taihorina (Bischoff) (Hymenoptera: Trigonalyidae) reveals a novel gene rearrangement pattern in the Hymenoptera.


    Wu, Qiu-Ling; Li, Qian; Gu, Yun; Shi, Bao-Cai; van Achterberg, Cees; Wei, Shu-Jun; Chen, Xue-Xin


    The family Trigonalyidae is considered to be one of the most basal lineages in the suborder Apocrita of Hymenoptera. Here, we determine the first complete mitochondrial genome of the Trigonalyidae, from the species Taeniogonalos taihorina (Bischoff, 1914). This mitochondrial genome is 15,927bp long, with a high A+T-content of 84.60%. It contains all of the 37 typical animal mitochondrial genes and an A+T-rich region. The orders and directions of all genes are different from those of previously reported hymenopteran mitochondrial genomes. Eight tRNA genes, three protein-coding genes and the A+T-rich region were rearranged, with the dominant gene rearrangement events being translocation and local inversion. The arrangements of three tRNA clusters, trnY-trnM-trnI-trnQ, trnW-trnL2-trnC, and trnH-trnA-trnR-trnN-trnS-trnE-trnF, and the position of the cox1 gene, are novel to the Hymenoptera, even the insects. Six long intergenic spacers are present in the genome. The secondary structures of the RNA genes are normal, except for trnS2, in which the D-stem pairing is absent.

  13. Assembled Plastid and Mitochondrial Genomes, as well as Nuclear Genes, Place the Parasite Family Cynomoriaceae in the Saxifragales

    PubMed Central

    Bellot, Sidonie; Cusimano, Natalie; Luo, Shixiao; Sun, Guiling; Zarre, Shahin; Gröger, Andreas; Temsch, Eva


    Cynomoriaceae, one of the last unplaced families of flowering plants, comprise one or two species or subspecies of root parasites that occur from the Mediterranean to the Gobi Desert. Using Illumina sequencing, we assembled the mitochondrial and plastid genomes as well as some nuclear genes of a Cynomorium specimen from Italy. Selected genes were also obtained by Sanger sequencing from individuals collected in China and Iran, resulting in matrices of 33 mitochondrial, 6 nuclear, and 14 plastid genes and rDNAs enlarged to include a representative angiosperm taxon sampling based on data available in GenBank. We also compiled a new geographic map to discern possible discontinuities in the parasites’ occurrence. Cynomorium has large genomes of 13.70–13.61 (Italy) to 13.95–13.76 pg (China). Its mitochondrial genome consists of up to 49 circular subgenomes and has an overall gene content similar to that of photosynthetic angiosperms, while its plastome retains only 27 of the normally 116 genes. Nuclear, plastid and mitochondrial phylogenies place Cynomoriaceae in Saxifragales, and we found evidence for several horizontal gene transfers from different hosts, as well as intracellular gene transfers. PMID:27358425

  14. Phylogenetic analysis of mitochondrial protein coding genes confirms the reciprocal paraphyly of Hexapoda and Crustacea

    PubMed Central

    Carapelli, Antonio; Liò, Pietro; Nardi, Francesco; van der Wath, Elizabeth; Frati, Francesco


    Background The phylogeny of Arthropoda is still a matter of harsh debate among systematists, and significant disagreement exists between morphological and molecular studies. In particular, while the taxon joining hexapods and crustaceans (the Pancrustacea) is now widely accepted among zoologists, the relationships among its basal lineages, and particularly the supposed reciprocal paraphyly of Crustacea and Hexapoda, continues to represent a challenge. Several genes, as well as different molecular markers, have been used to tackle this problem in molecular phylogenetic studies, with the mitochondrial DNA being one of the molecules of choice. In this study, we have assembled the largest data set available so far for Pancrustacea, consisting of 100 complete (or almost complete) sequences of mitochondrial genomes. After removal of unalignable sequence regions and highly rearranged genomes, we used nucleotide and inferred amino acid sequences of the 13 protein coding genes to reconstruct the phylogenetic relationships among major lineages of Pancrustacea. The analysis was performed with Bayesian inference, and for the amino acid sequences a new, Pancrustacea-specific, matrix of amino acid replacement was developed and used in this study. Results Two largely congruent trees were obtained from the analysis of nucleotide and amino acid datasets. In particular, the best tree obtained based on the new matrix of amino acid replacement (MtPan) was preferred over those obtained using previously available matrices (MtArt and MtRev) because of its higher likelihood score. The most remarkable result is the reciprocal paraphyly of Hexapoda and Crustacea, with some lineages of crustaceans (namely the Malacostraca, Cephalocarida and, possibly, the Branchiopoda) being more closely related to the Insecta s.s. (Ectognatha) than two orders of basal hexapods, Collembola and Diplura. Our results confirm that the mitochondrial genome, unlike analyses based on morphological data or nuclear

  15. Species identification using genetic tools: the value of nuclear and mitochondrial gene sequences in whale conservation.


    Palumbi, S R; Cipriano, F


    DNA sequence analysis is a powerful tool for identifying the source of samples thought to be derived from threatened or endangered species. Analysis of mitochondrial DNA (mtDNA) from retail whale meat markets has shown consistently that the expected baleen whale in these markets, the minke whale, makes up only about half the products analyzed. The other products are either unregulated small toothed whales like dolphins or are protected baleen whales such as humpback, Bryde's, fin, or blue whales. Independent verification of such mtDNA identifications requires analysis of nuclear genetic loci, but this is technically more difficult than standard mtDNA sequencing. In addition, evolution of species-specific sequences (i.e., fixation of sequence differences to produce reciprocally monophyletic gene trees) is slower in nuclear than in mitochondrial genes primarily because genetic drift is slower at nuclear loci. When will use of nuclear sequences allow forensic DNA identification? Comparison of neutral theories of coalescence of mitochondrial and nuclear loci suggests a simple rule of thumb. The "three-times rule" suggests that phylogenetic sorting at nuclear loci is likely to produce species-specific sequences when mitochondrial alleles are reciprocally monophyletic and the branches leading to the mtDNA sequences of a species are three times longer than the average difference observed within species. A preliminary test of the three-times rule, which depends on many assumptions about the species and genes involved, suggests that blue and fin whales should have species-specific sequences at most neutral nuclear loci, whereas humpback and fin whales should show species-specific sequences at fewer nuclear loci. Partial sequences of actin introns from these species confirm the predictions of the three-times rule and show that blue and fin whales are reciprocally monophyletic at this locus. These intron sequences are thus good tools for the identification of these species

  16. Genetic improvement of the nematicidal fungus Lecanicillium attenuatum against Heterodera glycines by expression of the Beauveria bassiana Cdep1 protease gene.


    Xie, Ming; Zhang, Yan-Jun; Zhang, Xiao-Lin; Peng, De-Liang; Yu, Wen-Bin; Li, Qian


    Lecanicillium attenuatum is an important nematophagous fungus with potential as a biopesticide against plant-parasitic nematodes. The Pr1A-like cuticle-degrading protease (Cdep1) gene originating from the entomopathogenic fungus Beauveria bassiana was transformed into the nematophagous fungus L. attenuatum using a polyethylene-glycol mediated protoplast-based transformation system. Protease activity was increased 0.64- to 1.63-fold 2-10d after growth in the transformed L. attenuatum. Inhibition of egg-hatching and J2 motility of soybean cyst nematodes (Heterodera glycines) by cell-free fungal culture filtrates were enhanced by 17-76% 2-14d and 43-152% 1-13d after incubation, respectively.

  17. The protease inhibitor chagasin of Trypanosoma cruzi adopts an immunoglobulin-type fold and may have arisen by horizontal gene transfer.


    Rigden, D J; Monteiro, A C; Grossi de Sá, M F


    Chagasin, a protein from Trypanosoma cruzi, is the first member of a new family of tight binding cysteine protease inhibitors [Monteiro, A.C.S., Abrahamson, M., Lima, A.P.C., Vannier-Santos, M.A. and Scharfstein, J. (2001) J. Cell Sci., in press] [corrected]. Despite its lack of significant sequence identity with known proteins, convincing structural models, using variable light chain templates, could be constructed on the basis of threading results. Experimental support for the final structure came from inhibition data for overlapping oligopeptides spanning the chagasin sequence. Chagasin therefore exemplifies a new protease inhibitor structural class and a new natural use for an immunoglobulin-like domain. Limited sequence resemblance suggests that chagasin may represent the result of a rare horizontal gene transfer from host to parasite.

  18. An Andean origin of Phytophthora infestans inferred from mitochondrial and nuclear gene genealogies.


    Gómez-Alpizar, Luis; Carbone, Ignazio; Ristaino, Jean Beagle


    Phytophthora infestans (Mont.) de Bary caused the 19th century Irish Potato Famine. We assessed the genealogical history of P. infestans using sequences from portions of two nuclear genes (beta-tubulin and Ras) and several mitochondrial loci P3, (rpl14, rpl5, tRNA) and P4 (Cox1) from 94 isolates from South, Central, and North America, as well as Ireland. Summary statistics, migration analyses and the genealogy of current populations of P. infestans for both nuclear and mitochondrial loci are consistent with an "out of South America" origin for P. infestans. Mexican populations of P. infestans from the putative center of origin in Toluca Mexico harbored less nucleotide and haplotype diversity than Andean populations. Coalescent-based genealogies of all loci were congruent and demonstrate the existence of two lineages leading to present day haplotypes of P. infestans on potatoes. The oldest lineage associated with isolates from the section Anarrhichomenun including Solanum tetrapetalum from Ecuador was identified as Phytophthora andina and evolved from a common ancestor of P. infestans. Nuclear and mitochondrial haplotypes found in Toluca Mexico were derived from only one of the two lineages, whereas haplotypes from Andean populations in Peru and Ecuador were derived from both lineages. Haplotypes found in populations from the U.S. and Ireland was derived from both ancestral lineages that occur in South America suggesting a common ancestry among these populations. The geographic distribution of mutations on the rooted gene genealogies demonstrate that the oldest mutations in P. infestans originated in South America and are consistent with a South American origin.

  19. Complete nucleotide sequence and gene rearrangement of the mitochondrial genome of the bell-ring frog, Buergeria buergeri (family Rhacophoridae).


    Sano, Naomi; Kurabayashi, Atsushi; Fujii, Tamotsu; Yonekawa, Hiromichi; Sumida, Masayuki


    In this study we determined the complete nucleotide sequence (19,959 bp) of the mitochondrial DNA of the rhacophorid frog Buergeria buergeri. The gene content, nucleotide composition, and codon usage of B. buergeri conformed to those of typical vertebrate patterns. However, due to an accumulation of lengthy repetitive sequences in the D-loop region, this species possesses the largest mitochondrial genome among all the vertebrates examined so far. Comparison of the gene organizations among amphibian species (Rana, Xenopus, salamanders and caecilians) revealed that the positioning of four tRNA genes and the ND5 gene in the mtDNA of B. buergeri diverged from the common vertebrate gene arrangement shared by Xenopus, salamanders and caecilians. The unique positions of the tRNA genes in B. buergeri are shared by ranid frogs, indicating that the rearrangements of the tRNA genes occurred in a common ancestral lineage of ranids and rhacophorids. On the other hand, the novel position of the ND5 gene seems to have arisen in a lineage leading to rhacophorids (and other closely related taxa) after ranid divergence. Phylogenetic analysis based on nucleotide sequence data of all mitochondrial genes also supported the gene rearrangement pathway.

  20. Lack of FTSH4 Protease Affects Protein Carbonylation, Mitochondrial Morphology, and Phospholipid Content in Mitochondria of Arabidopsis: New Insights into a Complex Interplay.


    Smakowska, Elwira; Skibior-Blaszczyk, Renata; Czarna, Malgorzata; Kolodziejczak, Marta; Kwasniak-Owczarek, Malgorzata; Parys, Katarzyna; Funk, Christiane; Janska, Hanna


    FTSH4 is one of the inner membrane-embedded ATP-dependent metalloproteases in mitochondria of Arabidopsis (Arabidopsis thaliana). In mutants impaired to express FTSH4, carbonylated proteins accumulated and leaf morphology was altered when grown under a short-day photoperiod, at 22°C, and a long-day photoperiod, at 30°C. To provide better insight into the function of FTSH4, we compared the mitochondrial proteomes and oxyproteomes of two ftsh4 mutants and wild-type plants grown under conditions inducing the phenotypic alterations. Numerous proteins from various submitochondrial compartments were observed to be carbonylated in the ftsh4 mutants, indicating a widespread oxidative stress. One of the reasons for the accumulation of carbonylated proteins in ftsh4 was the limited ATP-dependent proteolytic capacity of ftsh4 mitochondria, arising from insufficient ATP amount, probably as a result of an impaired oxidative phosphorylation (OXPHOS), especially complex V. In ftsh4, we further observed giant, spherical mitochondria coexisting among normal ones. Both effects, the increased number of abnormal mitochondria and the decreased stability/activity of the OXPHOS complexes, were probably caused by the lower amount of the mitochondrial membrane phospholipid cardiolipin. We postulate that the reduced cardiolipin content in ftsh4 mitochondria leads to perturbations within the OXPHOS complexes, generating more reactive oxygen species and less ATP, and to the deregulation of mitochondrial dynamics, causing in consequence the accumulation of oxidative damage.

  1. Genes and Pathways Involved in Adult Onset Disorders Featuring Muscle Mitochondrial DNA Instability

    PubMed Central

    Ahmed, Naghia; Ronchi, Dario; Comi, Giacomo Pietro


    Replication and maintenance of mtDNA entirely relies on a set of proteins encoded by the nuclear genome, which include members of the core replicative machinery, proteins involved in the homeostasis of mitochondrial dNTPs pools or deputed to the control of mitochondrial dynamics and morphology. Mutations in their coding genes have been observed in familial and sporadic forms of pediatric and adult-onset clinical phenotypes featuring mtDNA instability. The list of defects involved in these disorders has recently expanded, including mutations in the exo-/endo-nuclease flap-processing proteins MGME1 and DNA2, supporting the notion that an enzymatic DNA repair system actively takes place in mitochondria. The results obtained in the last few years acknowledge the contribution of next-generation sequencing methods in the identification of new disease loci in small groups of patients and even single probands. Although heterogeneous, these genes can be conveniently classified according to the pathway to which they belong. The definition of the molecular and biochemical features of these pathways might be helpful for fundamental knowledge of these disorders, to accelerate genetic diagnosis of patients and the development of rational therapies. In this review, we discuss the molecular findings disclosed in adult patients with muscle pathology hallmarked by mtDNA instability. PMID:26251896

  2. Bcmimp1, a Botrytis cinerea Gene Transiently Expressed in planta, Encodes a Mitochondrial Protein

    PubMed Central

    Benito-Pescador, David; Santander, Daniela; Arranz, M.; Díaz-Mínguez, José M.; Eslava, Arturo P.; van Kan, Jan A. L.; Benito, Ernesto P.


    Botrytis cinerea is a widespread necrotrophic fungus which infects more than 200 plant species. In an attempt to characterize the physiological status of the fungus in planta and to identify genetic factors contributing to its ability to infect the host cells, a differential gene expression analysis during the interaction B. cinerea-tomato was carried out. Gene Bcmimp1 codes for a mRNA detected by differential display in the course of this analysis. During the interaction with the host, it shows a transient expression pattern with maximal expression levels during the colonization and maceration of the infected tissues. Bioinformatic analysis suggested that BCMIMP1 is an integral membrane protein located in the mitochondrial inner membrane. Co-localization experiments with a BCMIMP1-GFP fusion protein confirmed that the protein is targeted to the mitochondria. ΔBcmimp1 mutants do not show obvious phenotypic differences during saprophytic growth and their infection ability was unaltered as compared to the wild-type. Interestingly, the mutants produced increased levels of reactive oxygen species, likely as a consequence of disturbed mitochondrial function. Although Bcmimp1 expression is enhanced in planta it cannot be considered a pathogenicity factor. PMID:26952144

  3. Origins of Wohlfahrtia magnifica in Italy based on the identification of mitochondrial cytochrome b gene haplotypes.


    Marangi, Marianna; Hall, Martin J R; Aitken, Alex; Ready, Paul D; Giangaspero, Annunziata


    To identify the geographical origins of larvae of Wohlfahrtia magnifica (Diptera: Sarcophagidae) causing myiasis of sheep in Italy, comparative DNA sequence analysis of the mitochondrial cytochrome b gene was performed, based on gene fragments amplified by PCR from genomic DNA isolated from individual specimens. DNA extractions of 19 larvae from Lazio, Molise, Puglia, and Sicilia generated 17 readable sequences homologous to 2 haplotypes, either CB_magn01 or CB_magn02; DNA extracts from 4 adult flies from Calabria (reared from larvae) produced 4 readable sequences belonging to the haplotype CB_magn01. The two haplotypes found represent both the East and West phylogenetic lineages of W. magnifica, which is consistent with the species' arrival from central/southeast Europe (East lineage) and/or from southwest Europe/northwest Africa (West lineage). This is the first report of the sympatric occurrence of the two lineages, which could have resulted from natural or human-assisted dispersal. Polymorphic nuclear loci will have to be characterized in order to explain the origins and lack of mitochondrial haplotype diversity of this pest in Italy, where it poses increasing veterinary problems.

  4. Silencing of mitochondrial NADP{sup +}-dependent isocitrate dehydrogenase gene enhances glioma radiosensitivity

    SciTech Connect

    Kim, Sung Youl; Yoo, Young Hyun; Park, Jeen-Woo


    Highlights: •Silencing of the IDPm gene enhances IR-induced autophagy in glioma cells. •Autophagy inhibition augmented apoptosis of irradiated glioma cells. •Results offer a redox-active therapeutic strategy for the treatment of cancer. -- Abstract: Reactive oxygen species (ROS) levels are elevated in organisms that have been exposed to ionizing radiation and are protagonists in the induction of cell death. Recently, we demonstrated that the control of mitochondrial redox balance and the cellular defense against oxidative damage are primary functions of mitochondrial NADP{sup +}-dependent isocitrate dehydrogenase (IDPm) via the supply of NADPH for antioxidant systems. In the present study, we report an autophagic response to ionizing radiation in A172 glioma cells transfected with small interfering RNA (siRNA) targeting the IDPm gene. Autophagy in A172 transfectant cells was associated with enhanced autophagolysosome formation and GFP–LC3 punctuation/aggregation. Furthermore, we found that the inhibition of autophagy by chloroquine augmented apoptotic cell death of irradiated A172 cells transfected with IDPm siRNA. Taken together, our data suggest that autophagy functions as a survival mechanism in A172 cells against ionizing radiation-induced apoptosis and the sensitizing effect of IDPm siRNA and autophagy inhibitor on the ionizing radiation-induced apoptotic cell death of glioma cells offers a novel redox-active therapeutic strategy for the treatment of cancer.

  5. Genes and Pathways Involved in Adult Onset Disorders Featuring Muscle Mitochondrial DNA Instability.


    Ahmed, Naghia; Ronchi, Dario; Comi, Giacomo Pietro


    Replication and maintenance of mtDNA entirely relies on a set of proteins encoded by the nuclear genome, which include members of the core replicative machinery, proteins involved in the homeostasis of mitochondrial dNTPs pools or deputed to the control of mitochondrial dynamics and morphology. Mutations in their coding genes have been observed in familial and sporadic forms of pediatric and adult-onset clinical phenotypes featuring mtDNA instability. The list of defects involved in these disorders has recently expanded, including mutations in the exo-/endo-nuclease flap-processing proteins MGME1 and DNA2, supporting the notion that an enzymatic DNA repair system actively takes place in mitochondria. The results obtained in the last few years acknowledge the contribution of next-generation sequencing methods in the identification of new disease loci in small groups of patients and even single probands. Although heterogeneous, these genes can be conveniently classified according to the pathway to which they belong. The definition of the molecular and biochemical features of these pathways might be helpful for fundamental knowledge of these disorders, to accelerate genetic diagnosis of patients and the development of rational therapies. In this review, we discuss the molecular findings disclosed in adult patients with muscle pathology hallmarked by mtDNA instability.

  6. Genetic variation and origin of parthenogenesis in the Aspidoscelis cozumela complex: evidence from mitochondrial genes.


    Manríquez-Morán, Norma L; Cruz, Fausto R Méndez-de la; Murphy, Robert W


    Parthenogenesis is a form of clonal reproduction. Eggs develop in the absence of sperm and offspring are genetically identical to their mother. Although common in invertebrates, it occurs in only a few species of squamate reptiles. Parthenogenetic reptiles have their origin in interspecific hybridization, and their populations are exclusively female. Because of its high mutation rate and maternal inheritance, mitochondrial DNA sequence data can evaluate the origin and evolution of all-female vertebrates. Partial sequences from two mitochondrial genes, Cytb and ND4, were analyzed to investigate questions about the origin of parthenogenesis in the Aspidoscelis cozumela complex, which includes A. cozumela, A. maslini and A. rodecki. Low levels of divergence were detected among parthenogenetic species, and between them and A. angusticeps, confirming it as the maternal species of the parthenoforms. A gene tree was constructed using sequences from three populations of A. angusticeps and nine of its unisexual daughter species. The phylogeny suggests that two independent hybridization events between A. angusticeps and A. deppii formed three unisexual species. One hybridization resulted in A. rodecki and the other formed A. maslini and A. cozumela. Although A. cozumela has the haplotype characteristic of A. maslini from Puerto Morelos, it is considered to be a different species based on karyological and morphological characteristics and its geographical isolation.

  7. Transfer RNA gene arrangement and codon usage in vertebrate mitochondrial genomes: a new insight into gene order conservation

    PubMed Central


    Background Mitochondrial (mt) gene arrangement has been highly conserved among vertebrates from jawless fishes to mammals for more than 500 million years. It remains unclear, however, whether such long-term persistence is a consequence of some constraints on the gene order. Results Based on the analysis of codon usage and tRNA gene positions, we suggest that tRNA gene order of the typical vertebrate mt-genomes may be important for their translational efficiency. The vertebrate mt-genome encodes 2 rRNA, 22 tRNA, and 13 transmembrane proteins consisting mainly of hydrophobic domains. We found that the tRNA genes specifying the hydrophobic residues were positioned close to the control region (CR), where the transcription efficiency is estimated to be relatively high. Using 47 vertebrate mt-genome sequences representing jawless fishes to mammals, we further found a correlation between codon usage and tRNA gene positions, implying that highly-used tRNA genes are located close to the CR. In addition, an analysis considering the asymmetric nature of mtDNA replication suggested that the tRNA loci that remain in single-strand for a longer time tend to have more guanine and thymine not suffering deamination mutations in their anticodon sites. Conclusions Our analyses imply the existence of translational constraint acting on the vertebrate mt-gene arrangement. Such translational constraint, together with the deamination-related constraint, may have contributed to long-term maintenance of gene order. PMID:20723209

  8. The Mitochondrial Genome of Paraminabea aldersladei (Cnidaria: Anthozoa: Octocorallia) Supports Intramolecular Recombination as the Primary Mechanism of Gene Rearrangement in Octocoral Mitochondrial Genomes

    PubMed Central

    Brockman, Stephanie A.; McFadden, Catherine S.


    Sequencing of the complete mitochondrial genome of the soft coral Paraminabea aldersladei (Alcyoniidae) revealed a unique gene order, the fifth mt gene arrangement now known within the cnidarian subclass Octocorallia. At 19,886 bp, the mt genome of P. aldersladei is the second largest known for octocorals; its gene content and nucleotide composition are, however, identical to most other octocorals, and the additional length is due to the presence of two large, noncoding intergenic regions. Relative to the presumed ancestral octocoral gene order, in P. aldersladei a block of three protein-coding genes (nad6–nad3–nad4l) has been translocated and inverted. Mapping the distribution of mt gene arrangements onto a taxonomically comprehensive phylogeny of Octocorallia suggests that all of the known octocoral gene orders have evolved by successive inversions of one or more evolutionarily conserved blocks of protein-coding genes. This mode of genome evolution is unique among Metazoa, and contrasts strongly with that observed in Hexacorallia, in which extreme gene shuffling has occurred among taxonomic orders. Two of the four conserved gene blocks found in Octocorallia are, however, also conserved in the linear mt genomes of Medusozoa and in one group of Demospongiae. We speculate that the rate and mechanism of gene rearrangement in octocorals may be influenced by the presence in their mt genomes of mtMutS, a putatively active DNA mismatch repair protein that may also play a role in mediating intramolecular recombination. PMID:22975720

  9. A Case of Diphyllobothrium nihonkaiense Infection as Confirmed by Mitochondrial COX1 Gene Sequence Analysis

    PubMed Central

    Park, Sang Hyun; Eom, Keeseon S.; Park, Min Sun; Kwon, Oh Kyoung; Kim, Hyo Sun


    Diphyllobothrium nihonkaiense has been reported in Korea as Diphyllobothrium latum because of their close morphologic resemblance. We have identified a human case of D. nihonkaiense infection using the mitochondrial cytochrome c oxidase subunit I (cox1) gene sequence analysis. On 18 February 2012, a patient who had consumed raw fish a month earlier visited our outpatient clinic with a long tapeworm parasite excreted in the feces. The body of the segmented worm was 2 m long and divided into the scolex (head) and proglottids. It was morphologically close to D. nihonkaiense and D. latum. The cox1 gene analysis showed 99.4% (340/342 bp) homology with D. nihonkaiense but only 91.8% (314/342 bp) homology with D. latum. The present study suggested that the Diphyllobothrium spp. infection in Korea should be analyzed with specific DNA sequence for an accurate species identification. PMID:24039292

  10. Molecular phylogeny of the order Euryalida (Echinodermata: Ophiuroidea), based on mitochondrial and nuclear ribosomal genes.


    Okanishi, Masanori; O'Hara, Timothy D; Fujita, Toshihiko


    The existing taxonomy of Euryalida, one of the two orders of the Ophiuroidea (Echinodermata), is uncertain and characterized by controversial delimitation of taxonomic ranks from genus to family-level. Their phylogeny was not studied in detail until now. We investigated a dataset of sequence from a mitochondrial gene (16S rRNA) and two nucleic genes (18S rRNA and 28S rRNA) for 49 euryalid ophiuroids and four outgroup species from the order Ophiurida. The monophyly of the order Euryalida was supported as was the monophyly of Asteronychidae, Gorgonocephalidae and an Asteroschematidae+Euryalidae clade. However, the group currently known as the Asteroschematidae was paraphyletic with respect to the Euryalidae. The Asteroschematidae+Euryalidae clade, which we recognise as an enlarged Euryalidae, contains three natural groups: the Asteroschematinae (Asteroschema and Ophiocreas), a new subfamily Astrocharinae (Astrocharis) and the Euryalinae with remaining genera. These subfamilies can be distinguished by internal ossicle morphology.

  11. Mitochondrial Cardiomyopathies.


    El-Hattab, Ayman W; Scaglia, Fernando


    Mitochondria are found in all nucleated human cells and perform various essential functions, including the generation of cellular energy. Mitochondria are under dual genome control. Only a small fraction of their proteins are encoded by mitochondrial DNA (mtDNA), whereas more than 99% of them are encoded by nuclear DNA (nDNA). Mutations in mtDNA or mitochondria-related nDNA genes result in mitochondrial dysfunction leading to insufficient energy production required to meet the needs for various organs, particularly those with high energy requirements, including the central nervous system, skeletal and cardiac muscles, kidneys, liver, and endocrine system. Because cardiac muscles are one of the high energy demanding tissues, cardiac involvement occurs in mitochondrial diseases with cardiomyopathies being one of the most frequent cardiac manifestations found in these disorders. Cardiomyopathy is estimated to occur in 20-40% of children with mitochondrial diseases. Mitochondrial cardiomyopathies can vary in severity from asymptomatic status to severe manifestations including heart failure, arrhythmias, and sudden cardiac death. Hypertrophic cardiomyopathy is the most common type; however, mitochondrial cardiomyopathies might also present as dilated, restrictive, left ventricular non-compaction, and histiocytoid cardiomyopathies. Cardiomyopathies are frequent manifestations of mitochondrial diseases associated with defects in electron transport chain complexes subunits and their assembly factors, mitochondrial transfer RNAs, ribosomal RNAs, ribosomal proteins, translation factors, mtDNA maintenance, and coenzyme Q10 synthesis. Other mitochondrial diseases with cardiomyopathies include Barth syndrome, Sengers syndrome, TMEM70-related mitochondrial complex V deficiency, and Friedreich ataxia.

  12. Mitochondrial Cardiomyopathies

    PubMed Central

    El-Hattab, Ayman W.; Scaglia, Fernando


    Mitochondria are found in all nucleated human cells and perform various essential functions, including the generation of cellular energy. Mitochondria are under dual genome control. Only a small fraction of their proteins are encoded by mitochondrial DNA (mtDNA), whereas more than 99% of them are encoded by nuclear DNA (nDNA). Mutations in mtDNA or mitochondria-related nDNA genes result in mitochondrial dysfunction leading to insufficient energy production required to meet the needs for various organs, particularly those with high energy requirements, including the central nervous system, skeletal and cardiac muscles, kidneys, liver, and endocrine system. Because cardiac muscles are one of the high energy demanding tissues, cardiac involvement occurs in mitochondrial diseases with cardiomyopathies being one of the most frequent cardiac manifestations found in these disorders. Cardiomyopathy is estimated to occur in 20–40% of children with mitochondrial diseases. Mitochondrial cardiomyopathies can vary in severity from asymptomatic status to severe manifestations including heart failure, arrhythmias, and sudden cardiac death. Hypertrophic cardiomyopathy is the most common type; however, mitochondrial cardiomyopathies might also present as dilated, restrictive, left ventricular non-compaction, and histiocytoid cardiomyopathies. Cardiomyopathies are frequent manifestations of mitochondrial diseases associated with defects in electron transport chain complexes subunits and their assembly factors, mitochondrial transfer RNAs, ribosomal RNAs, ribosomal proteins, translation factors, mtDNA maintenance, and coenzyme Q10 synthesis. Other mitochondrial diseases with cardiomyopathies include Barth syndrome, Sengers syndrome, TMEM70-related mitochondrial complex V deficiency, and Friedreich ataxia. PMID:27504452

  13. The effects of mitochondrial genotype on hypoxic survival and gene expression in a hybrid population of the killifish, Fundulus heteroclitus.


    Flight, Patrick A; Nacci, Diane; Champlin, Denise; Whitehead, Andrew; Rand, David M


    The physiological link between oxygen availability and mitochondrial function is well established. However, whether or not fitness variation is associated with mitochondrial genotypes in the field remains a contested topic in evolutionary biology. In this study, we draw on a population of the teleost fish, Fundulus heteroclitus, where functionally distinct subspecies hybridize, likely as a result of past glacial events. We had two specific aims: (i) to determine the effect of mtDNA genotype on survivorship of male and female fish under hypoxic stress and (ii) to determine the effect of hypoxic stress, sex and mtDNA genotype on gene expression. We found an unexpected and highly significant effect of sex on survivorship under hypoxic conditions, but no significant effect of mtDNA genotype. Gene expression analyses revealed hundreds of transcripts differentially regulated by sex and hypoxia. Mitochondrial transcripts and other predicted pathways were among those influenced by hypoxic stress, and a transcript corresponding to the mtDNA control region was the most highly suppressed transcript under the conditions of hypoxia. An RT-PCR experiment on the control region was consistent with microarray results. Effects of mtDNA sequence variation on genome expression were limited; however, a potentially important epistasis between mtDNA sequence and expression of a nuclear-encoded mitochondrial translation protein was discovered. Overall, these results confirm that mitochondrial regulation is a major component of hypoxia tolerance and further suggest that purifying selection has been the predominant selective force on mitochondrial genomes in these two subspecies.

  14. On the value of nuclear and mitochondrial gene sequences for reconstructing the phylogeny of vanilloid orchids (Vanilloideae, Orchidaceae)

    PubMed Central

    Cameron, Kenneth M.


    Background and Aims Most molecular phylogenetic studies of Orchidaceae have relied heavily on DNA sequences from the plastid genome. Nuclear and mitochondrial loci have only been superficially examined for their systematic value. Since 40% of the genera within Vanilloideae are achlorophyllous mycoheterotrophs, this is an ideal group of orchids in which to evaluate non-plastid gene sequences. Methods Phylogenetic reconstructions for Vanilloideae were produced using independent and combined data from the nuclear 18S, 5·8S and 26S rDNA genes and the mitochondrial atpA gene and nad1b-c intron. Key Results These new data indicate placements for genera such as Lecanorchis and Galeola, for which plastid gene sequences have been mostly unavailable. Nuclear and mitochondrial parsimony jackknife trees are congruent with each other and previously published trees based solely on plastid data. Because of high rates of sequence divergence among vanilloid orchids, even the short 5·8S rDNA gene provides impressive levels of resolution and support. Conclusions Orchid systematists are encouraged to sequence nuclear and mitochondrial gene regions along with the growing number of plastid loci available. PMID:19251715

  15. Phylogeny and mitochondrial gene order variation in Lophotrochozoa in the light of new mitogenomic data from Nemertea

    PubMed Central

    Podsiadlowski, Lars; Braband, Anke; Struck, Torsten H; von Döhren, Jörn; Bartolomaeus, Thomas


    Background The new animal phylogeny established several taxa which were not identified by morphological analyses, most prominently the Ecdysozoa (arthropods, roundworms, priapulids and others) and Lophotrochozoa (molluscs, annelids, brachiopods and others). Lophotrochozoan interrelationships are under discussion, e.g. regarding the position of Nemertea (ribbon worms), which were discussed to be sister group to e.g. Mollusca, Brachiozoa or Platyhelminthes. Mitochondrial genomes contributed well with sequence data and gene order characters to the deep metazoan phylogeny debate. Results In this study we present the first complete mitochondrial genome record for a member of the Nemertea, Lineus viridis. Except two trnP and trnT, all genes are located on the same strand. While gene order is most similar to that of the brachiopod Terebratulina retusa, sequence based analyses of mitochondrial genes place nemerteans close to molluscs, phoronids and entoprocts without clear preference for one of these taxa as sister group. Conclusion Almost all recent analyses with large datasets show good support for a taxon comprising Annelida, Mollusca, Brachiopoda, Phoronida and Nemertea. But the relationships among these taxa vary between different studies. The analysis of gene order differences gives evidence for a multiple independent occurrence of a large inversion in the mitochondrial genome of Lophotrochozoa and a re-inversion of the same part in gastropods. We hypothesize that some regions of the genome have a higher chance for intramolecular recombination than others and gene order data have to be analysed carefully to detect convergent rearrangement events. PMID:19660126

  16. Deficiency in the mouse mitochondrial adenine nucleotide translocator isoform 2 gene is associated with cardiac noncompaction.


    Kokoszka, Jason E; Waymire, Katrina G; Flierl, Adrian; Sweeney, Katelyn M; Angelin, Alessia; MacGregor, Grant R; Wallace, Douglas C


    The mouse fetal and adult hearts express two adenine nucleotide translocator (ANT) isoform genes. The predominant isoform is the heart-muscle-brain ANT-isoform gene 1 (Ant1) while the other is the systemic Ant2 gene. Genetic inactivation of the Ant1 gene does not impair fetal development but results in hypertrophic cardiomyopathy in postnatal mice. Using a knockin X-linked Ant2 allele in which exons 3 and 4 are flanked by loxP sites combined in males with a protamine 1 promoter driven Cre recombinase we created females heterozygous for a null Ant2 allele. Crossing the heterozygous females with the Ant2(fl), PrmCre(+) males resulted in male and female ANT2-null embryos. These fetuses proved to be embryonic lethal by day E14.5 in association with cardiac developmental failure, immature cardiomyocytes having swollen mitochondria, cardiomyocyte hyperproliferation, and cardiac failure due to hypertrabeculation/noncompaction. ANTs have two main functions, mitochondrial-cytosol ATP/ADP exchange and modulation of the mitochondrial permeability transition pore (mtPTP). Previous studies imply that ANT2 biases the mtPTP toward closed while ANT1 biases the mtPTP toward open. It has been reported that immature cardiomyocytes have a constitutively opened mtPTP, the closure of which signals the maturation of cardiomyocytes. Therefore, we hypothesize that the developmental toxicity of the Ant2 null mutation may be the result of biasing the cardiomyocyte mtPTP to remain open thus impairing cardiomyocyte maturation and resulting in cardiomyocyte hyperproliferation and failure of trabecular maturation. This article is part of a Special Issue entitled 'EBEC 2016: 19th European Bioenergetics Conference, Riva del Garda, Italy, July 2-6, 2016', edited by Prof. Paolo Bernardi.

  17. Expression of a gene encoding mitochondrial aldehyde dehydrogenase in rice increases under submerged conditions.


    Nakazono, M; Tsuji, H; Li, Y; Saisho, D; Arimura, S; Tsutsumi, N; Hirai, A


    It is known that alcoholic fermentation is important for survival of plants under anaerobic conditions. Acetaldehyde, one of the intermediates of alcoholic fermentation, is not only reduced by alcohol dehydrogenase but also can be oxidized by aldehyde dehydrogenase (ALDH). To determine whether ALDH plays a role in anaerobic metabolism in rice (Oryza sativa L. cv Nipponbare), we characterized a cDNA clone encoding mitochondrial ALDH from rice (Aldh2a). Analysis of sub-cellular localization of ALDH2a protein using green fluorescent protein and an in vitro ALDH assay using protein extracts from Escherichia coli cells that overexpressed ALDH2a indicated that ALDH2a functions in the oxidation of acetaldehyde in mitochondria. A Southern-blot analysis indicated that mitochondrial ALDH is encoded by at least two genes in rice. We found that the Aldh2a mRNA was present at high levels in leaves of dark-grown seedlings, mature leaf sheaths, and panicles. It is interesting that expression of the rice Aldh2a gene, unlike the expression of the tobacco (Nicotiana tabacum) Aldh2a gene, was induced in rice seedlings by submergence. Experiments with ruthenium red, which is a blocker of Ca(2+) fluxes in rice as well as maize (Zea mays), suggest that the induction of expression of Adh1 and Pdc1 by low oxygen stress is regulated by elevation of the cytosolic Ca(2+) level. However, the induction of Aldh2a gene expression may not be controlled by the cytosolic Ca(2+) level elevation. A possible involvement of ALDH2a in the submergence tolerance of rice is discussed.

  18. Epigenetic regulation of the nuclear-coded GCAT and SHMT2 genes confers human age-associated mitochondrial respiration defects.


    Hashizume, Osamu; Ohnishi, Sakiko; Mito, Takayuki; Shimizu, Akinori; Ishikawa, Kaori; Iashikawa, Kaori; Nakada, Kazuto; Soda, Manabu; Mano, Hiroyuki; Togayachi, Sumie; Miyoshi, Hiroyuki; Okita, Keisuke; Hayashi, Jun-Ichi


    Age-associated accumulation of somatic mutations in mitochondrial DNA (mtDNA) has been proposed to be responsible for the age-associated mitochondrial respiration defects found in elderly human subjects. We carried out reprogramming of human fibroblast lines derived from elderly subjects by generating their induced pluripotent stem cells (iPSCs), and examined another possibility, namely that these aging phenotypes are controlled not by mutations but by epigenetic regulation. Here, we show that reprogramming of elderly fibroblasts restores age-associated mitochondrial respiration defects, indicating that these aging phenotypes are reversible and are similar to differentiation phenotypes in that both are controlled by epigenetic regulation, not by mutations in either the nuclear or the mitochondrial genome. Microarray screening revealed that epigenetic downregulation of the nuclear-coded GCAT gene, which is involved in glycine production in mitochondria, is partly responsible for these aging phenotypes. Treatment of elderly fibroblasts with glycine effectively prevented the expression of these aging phenotypes.

  19. Epigenetic regulation of the nuclear-coded GCAT and SHMT2 genes confers human age-associated mitochondrial respiration defects

    PubMed Central

    Hashizume, Osamu; Ohnishi, Sakiko; Mito, Takayuki; Shimizu, Akinori; Ishikawa, Kaori; Nakada, Kazuto; Soda, Manabu; Mano, Hiroyuki; Togayachi, Sumie; Miyoshi, Hiroyuki; Okita, Keisuke; Hayashi, Jun-Ichi


    Age-associated accumulation of somatic mutations in mitochondrial DNA (mtDNA) has been proposed to be responsible for the age-associated mitochondrial respiration defects found in elderly human subjects. We carried out reprogramming of human fibroblast lines derived from elderly subjects by generating their induced pluripotent stem cells (iPSCs), and examined another possibility, namely that these aging phenotypes are controlled not by mutations but by epigenetic regulation. Here, we show that reprogramming of elderly fibroblasts restores age-associated mitochondrial respiration defects, indicating that these aging phenotypes are reversible and are similar to differentiation phenotypes in that both are controlled by epigenetic regulation, not by mutations in either the nuclear or the mitochondrial genome. Microarray screening revealed that epigenetic downregulation of the nuclear-coded GCAT gene, which is involved in glycine production in mitochondria, is partly responsible for these aging phenotypes. Treatment of elderly fibroblasts with glycine effectively prevented the expression of these aging phenotypes. PMID:26000717

  20. Loss of Msp1p in Schizosaccharomyces pombe induces a ROS-dependent nuclear mutator phenotype that affects mitochondrial fission genes.


    Delerue, Thomas; Khosrobakhsh, Farnoosh; Daloyau, Marlène; Emorine, Laurent Jean; Dedieu, Adrien; Herbert, Christopher J; Bonnefoy, Nathalie; Arnauné-Pelloquin, Laetitia; Belenguer, Pascale


    Mitochondria continually fuse and divide to dynamically adapt to changes in metabolism and stress. Mitochondrial dynamics are also required for mitochondrial DNA (mtDNA) integrity; however, the underlying reason is not known. In this study, we examined the link between mitochondrial fusion and mtDNA maintenance in Schizosaccharomyces pombe, which cannot survive without mtDNA, by screening for suppressors of the lethality induced by loss of the dynamin-related large GTPase Msp1p. Our findings reveal that inactivation of Msp1p induces a ROS-dependent nuclear mutator phenotype that affects mitochondrial fission genes involved in suppressing mitochondrial fragmentation and mtDNA depletion. This indicates that mitochondrial fusion is crucial for maintaining the integrity of both mitochondrial and nuclear genetic information. Furthermore, our study suggests that the primary roles of Msp1p are to organize mitochondrial membranes, thus making them competent for fusion, and maintain the integrity of mtDNA.

  1. Large gene overlaps and tRNA processing in the compact mitochondrial genome of the crustacean Armadillidium vulgare

    PubMed Central

    Doublet, Vincent; Ubrig, Elodie; Alioua, Abdelmalek; Bouchon, Didier; Marcadé, Isabelle; Maréchal-Drouard, Laurence


    A faithful expression of the mitochondrial DNA is crucial for cell survival. Animal mitochondrial DNA (mtDNA) presents a highly compact gene organization. The typical 16.5 kbp animal mtDNA encodes 13 proteins, 2 rRNAs and 22 tRNAs. In the backyard pillbug Armadillidium vulgare, the rather small 13.9 kbp mtDNA encodes the same set of proteins and rRNAs as compared to animal kingdom mtDNA, but seems to harbor an incomplete set of tRNA genes. Here, we first confirm the expression of 13 tRNA genes in this mtDNA. Then we show the extensive repair of a truncated tRNA, the expression of tRNA involved in large gene overlaps and of tRNA genes partially or fully integrated within protein-coding genes in either direct or opposite orientation. Under selective pressure, overlaps between genes have been likely favored for strong genome size reduction. Our study underlines the existence of unknown biochemical mechanisms for the complete gene expression of A. vulgare mtDNA, and of co-evolutionary processes to keep overlapping genes functional in a compacted mitochondrial genome. PMID:26361137

  2. Large gene overlaps and tRNA processing in the compact mitochondrial genome of the crustacean Armadillidium vulgare.


    Doublet, Vincent; Ubrig, Elodie; Alioua, Abdelmalek; Bouchon, Didier; Marcadé, Isabelle; Maréchal-Drouard, Laurence


    A faithful expression of the mitochondrial DNA is crucial for cell survival. Animal mitochondrial DNA (mtDNA) presents a highly compact gene organization. The typical 16.5 kbp animal mtDNA encodes 13 proteins, 2 rRNAs and 22 tRNAs. In the backyard pillbug Armadillidium vulgare, the rather small 13.9 kbp mtDNA encodes the same set of proteins and rRNAs as compared to animal kingdom mtDNA, but seems to harbor an incomplete set of tRNA genes. Here, we first confirm the expression of 13 tRNA genes in this mtDNA. Then we show the extensive repair of a truncated tRNA, the expression of tRNA involved in large gene overlaps and of tRNA genes partially or fully integrated within protein-coding genes in either direct or opposite orientation. Under selective pressure, overlaps between genes have been likely favored for strong genome size reduction. Our study underlines the existence of unknown biochemical mechanisms for the complete gene expression of A. vulgare mtDNA, and of co-evolutionary processes to keep overlapping genes functional in a compacted mitochondrial genome.

  3. Species identification and phylogenetic analysis of genus Nassarius (Nassariidae) based on mitochondrial genes

    NASA Astrophysics Data System (ADS)

    Li, Haitao; Lin, Duan; Fang, Hongda; Zhu, Aijia; Gao, Yang


    Genus Nassarius contains many subgenera, such as Zeuxis, Telasco, Niotha, Varicinassa, Plicarcularia, Nassarius s. str. and Reticunassa. On the basis of morphological characteristics of the shell and radula and sequences of mitochondrial cytochrome oxidase subunit I (COI) and 16S rRNA genes, Nassarius specimens collected from the South China Sea were identified and phylogenetically analyzed. Although Nassarius sp. and Nassarius ( Varicinassa) variciferus were morphologically different in their shells, few variations were found among their radular teeth and sequences of mtCOI and mt16S RNA genes. Therefore, Nassarius sp. should be classified as N. (Varicinassa) variciferus. Nassarius (Zeuxis) sp. has only a subtle difference from Nassarius (Zeuxis) algidus on the shell, but it shows obvious differences in radular teeth and DNA sequence, indicating that they are two distinct species. Sequence divergence of mtCOI and mt16S RNA genes within Nassarius species was much lower than that between species, suggesting that these two genes are suitable for Nassarius species identification. Phylogenetic analysis (neighbor-joining and maximum parsimony) based on mtCOI and mt16S rRNA genes revealed the presence of two groups in genus Nassarius and a closest relationship between subgenera Zeuxis and Telasco. Species of subgenus Plicarcularia did not form a single clade. The molecular phylogeny was not congruent with the previous morphological phylogeny. The subgeneric divisions of genus Nassarius appear to be uncertain and unreliable.

  4. Structure and expression of mouse mitochondrial voltage dependent anion channel genes

    SciTech Connect

    Craigen, W.J.; Lovell, R.S.; Sampson, M.J.


    Voltage dependent anion channels (VDACs) are small abundant proteins of the outer mitochondrial membrane that interact with the adenine nucleotide translocater and bind glycerol kinase and hexokinase. Kinase binding is developmentally regulated, tissue specific, and increased in various tumor cell lines. VDACs are also components of the peripheral benzodiazepine receptor and GABA{sub A} receptor. Two human VDAC cDNAs have previously been reported, and expression of these isoforms appears ubiquitous. Genomic Southern analysis suggests the presence of other as yet uncharacterised VDAC genes. To study VDAC function in a mammal more amenable to experimental manipulation, we have isolated three mouse VDAC genes by cDNA cloning from a mouse brain cDNA library. DNA sequencing of the cDNAs shows that they share 65-75% amino acid identity. Northern analysis indicates that MVDAC1 is expressed most highly in kidney, heart, and brain. Using an MVDAC3 3{prime} untranslated exon as a probe, three distinct transcripts can be detected. The gene structure for MVDAC3 and MVDAC2 has been completed and suggests that the VDAC isoforms did not arise by gene duplication and divergence. The intron/exon boundaries are not conserved between MVDAC1 and MVDAC3, and MVDAC2 appears to be encoded by a single intronless gene.

  5. Patterns of Nucleotide Substitution in Mitochondrial Protein Coding Genes of Vertebrates

    PubMed Central

    Kumar, S.


    Maximum likelihood methods were used to study the differences in substitution rates among the four nucleotides and among different nucleotide sites in mitochondrial protein-coding genes of vertebrates. In the 1st+2nd codon position data, the frequency of nucleotide G is negatively correlated with evolutionary rates of genes, substitution rates vary substantially among sites, and the transition/transversion rate bias (R) is two to five times larger than that expected at random. Generally, largest transition biases and greatest differences in substitution rates among sites are found in the highly conserved genes. The 3rd positions in placental mammal genes exhibit strong nucleotide composition biases and the transitional rates exceed transversional rates by one to two orders of magnitude. Tamura-Nei and Hasegawa-Kishino-Yano models with gamma distributed variable rates among sites (gamma parameter, α) adequately describe the nucleotide substitution process in 1st+2nd position data. In these data, ignoring differences in substitution rates among sites leads to largest biases while estimating substitution rates. Kimura's two-parameter model with variable-rates among sites performs satisfactorily in likelihood estimation of R, α, and overall amount of evolution for 1st+2nd position data. It can also be used to estimate pairwise distances with appropriate values of α for a majority of genes. PMID:8722802

  6. Complete mitochondrial genome of Helicoverpa zea (Boddie) and expression profiles of mitochondrial-encoded genes in early and late embryos

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The mitochondrial genome of the bollworm, Helicoverpa zea, was assembled using paired-end nucleotide sequence reads generated with a next-generation sequencing platform. Assembly resulted in a mitogenome of 15,348 bp with greater than 17,000-fold average coverage. Organization of the H. zea mitogen...

  7. HnRNPA2 is a novel histone acetyltransferase that mediates mitochondrial stress-induced nuclear gene expression

    PubMed Central

    Guha, Manti; Srinivasan, Satish; Guja, Kip; Mejia, Edison; Garcia-Diaz, Miguel; Johnson, F Brad; Ruthel, Gordon; Kaufman, Brett A; Rappaport, Eric F; Glineburg, M Rebecca; Fang, Ji-Kang; Szanto, Andres Klein; Nakagawa, Hiroshi; Basha, Jeelan; Kundu, Tapas; Avadhani, Narayan G


    Reduced mitochondrial DNA copy number, mitochondrial DNA mutations or disruption of electron transfer chain complexes induce mitochondria-to-nucleus retrograde signaling, which induces global change in nuclear gene expression ultimately contributing to various human pathologies including cancer. Recent studies suggest that these mitochondrial changes cause transcriptional reprogramming of nuclear genes although the mechanism of this cross talk remains unclear. Here, we provide evidence that mitochondria-to-nucleus retrograde signaling regulates chromatin acetylation and alters nuclear gene expression through the heterogeneous ribonucleoprotein A2 (hnRNAP2). These processes are reversed when mitochondrial DNA content is restored to near normal cell levels. We show that the mitochondrial stress-induced transcription coactivator hnRNAP2 acetylates Lys 8 of H4 through an intrinsic histone lysine acetyltransferase (KAT) activity with Arg 48 and Arg 50 of hnRNAP2 being essential for acetyl-CoA binding and acetyltransferase activity. H4K8 acetylation at the mitochondrial stress-responsive promoters by hnRNAP2 is essential for transcriptional activation. We found that the previously described mitochondria-to-nucleus retrograde signaling-mediated transformation of C2C12 cells caused an increased expression of genes involved in various oncogenic processes, which is retarded in hnRNAP2 silenced or hnRNAP2 KAT mutant cells. Taken together, these data show that altered gene expression by mitochondria-to-nucleus retrograde signaling involves a novel hnRNAP2-dependent epigenetic mechanism that may have a role in cancer and other pathologies. PMID:27990297

  8. An extracellular serine protease produced by Vibrio vulnificus NCIMB 2137, a metalloprotease-gene negative strain isolated from a diseased eel.


    Miyoshi, Shin-Ichi; Wang, Jiyou; Katoh, Keizo; Senoh, Mitsutoshi; Mizuno, Tamaki; Maehara, Yoko


    Vibrio vulnificus is a ubiquitous estuarine microorganism but causes fatal systemic infections in immunocompromised humans, cultured eels or shrimps. An extracellular metalloprotease VVP/VvpE has been reported to be a potential virulence factor of the bacterium; however, a few strains isolated from a diseased eel or shrimp were recently found to produce a serine protease termed VvsA, but not VVP/VvpE. In the present study, we found that these strains had lost the 80 kb genomic region including the gene encoding VVP/VvpE. We also purified VvsA from the culture supernatant through ammonium sulfate fractionation, gel filtration and ion-exchange column chromatography, and the enzyme was demonstrated to be a chymotrypsin-like protease, as well as those from some vibrios. The gene vvsA was shown to constitute an operon with a downstream gene vvsB, and several Vibrio species were found to have orthologues of vvsAB. These findings indicate that the genes vvp/vvpE and vvsAB might be mobile genetic elements.

  9. Heteropolymorphism of mitochondrial NADH dehydrogenase subunit 3 gene for the population analysis of chum salmon, Oncorhynchus keta.


    Yoon, M; Choi, Y S; Jin, H J; Sohn, Y C; Lee, S K; Jin, D H


    Mitochondrial DNAs (mtDNAs) has been frequently used as genetic markers for the population genetic studies. In this study we used chum salmon (Oncorhynchus keta) from Korea, Japan andAmerica, and compared their mitochondrial NADH dehydrogenase subunit 3 (ND3) genes by DNA sequence analysis. Sequence variation was studied in the ND3 among total 11 individuals from three populations. The ND3 gene was amplified by PCR targeting parts of cytochrome oxidase III gene (COIII) and NADH dehydrogenase subunit 4L gene (ND4L). ND3 gene sequence, encoded 752 bps, presented some genetic variation in the chum salmon populations. The observed nucleotide variations inferred the distinct genetic differentiation of American salmons from Korean and Japanese chum salmons. Six sites of single nucleotide polymorphism (SNP) were explored in the ND3 locus. Denaturing gradient gel electrophoresis analysis also showed a clear heterogenous band in American salmons compared to Asian salmons.

  10. Maternal obesity programs mitochondrial and lipid metabolism gene expression in infant umbilical vein endothelial cells

    PubMed Central

    Ramos Costa, Suzana Maria; Isganaitis, Elvira; Matthews, Tucker; Hughes, Katelyn; Daher, Grace; Dreyfuss, Jonathan M.; Pontes da Silva, Giselia Alves; Patti, Mary-Elizabeth


    Background/Objectives Maternal obesity increases risk for childhood obesity, but molecular mechanisms are not well understood. We hypothesized that primary umbilical vein endothelial cells (HUVEC) from infants of overweight and obese mothers would harbor transcriptional patterns reflecting offspring obesity risk. Subjects/Methods In this observational cohort study, we recruited 13 lean (pre-pregnancy BMI <25.0 kg/m2) and 24 overweight-obese (‘ov-ob’, BMI ≥25.0 kg/m2) women. We isolated primary HUVEC, and analyzed both gene expression (Primeview, Affymetrix) and cord blood levels of hormones and adipokines. Results 142 transcripts were differentially expressed in HUVEC from infants of overweight-obese mothers (false discovery rate, FDR <0.05). Pathway analysis revealed that genes involved in mitochondrial and lipid metabolism were negatively correlated with maternal BMI (FDR <0.05). To test whether these transcriptomic patterns were associated with distinct nutrient exposures in the setting of maternal obesity, we analyzed the cord blood lipidome and noted significant increases in levels of total free fatty acids (lean: 95.5 ± 37.1 ug/ml, ov-ob: 124.1 ± 46.0 ug/ml, P=0.049), palmitate (lean: 34.5 ± 12.7 ug/ml, ov-ob: 46.3 ± 18.4 ug/ml, P=0.03) and stearate (lean: 20.8 ± 8.2 ug/ml, ov-ob: 29.7 ± 17.2 ug/ml, P=0.04), in infants of overweight-obese mothers. Conclusion Prenatal exposure to maternal obesity alters HUVEC expression of genes involved in mitochondrial and lipid metabolism, potentially reflecting developmentally-programmed differences in oxidative and lipid metabolism. PMID:27531045

  11. Molecular analysis of polymerase gamma gene and mitochondrial polymorphism in fertile and subfertile men.


    Harris, T P; Gomas, K P; Weir, F; Holyoake, A J; McHugh, P; Wu, M; Sin, Y; Sin, I L; Sin, F Y T


    CAG trinucleotide repeat length in the nuclear polymerase gamma gene (POLgamma) has been shown to be associated with men with reduced fertility. The present study investigated the frequency of CAG repeat length genotypes and three exonuclease motifs of the POLgamma in relation to the frequency of mitochondrial nucleotide substitutions. DNA from semen samples of 93 normozoospermic men and 192 non-normozoospermic men was isolated and the specific regions of the genes were amplified by polymerase chain reactions (PCR) and sequenced to identify mutations. The genotypic frequencies of pooled POLgamma CAG repeat lengths, =10/ not equal 10 heterozygotes and not equal 10/ not equal 10 homozygotes, were significantly different between normozoospermic and non-normozoospermic men (p < 0.05), with non-normozoospermic men having a slightly higher frequency of the =10/=10 genotypes. The allelic frequency for =10 is 0.79 and not equal10 is 0.21 for normozoospermic men and 0.85 and 0.15, respectively, for non-normozoospermic men (p < 0.025). There was no mutation detected in the exonuclease motifs in all the samples tested. Eighty normozoospermic and 124 non-normozoospermic semen samples were analysed for nucleotide substitutions in mitochondrial genes by PCR and sequencing. Heteroplasmic mutations were found in one azoospermic man, four asthenozoospermic men and two normozoospermic men. Only one asthenozoospermic man was heterozygous for the POLgamma genotype. Of the 17 men with non-synonymous nucleotide substitutions, 14 were homozygous for the POLgamma genotype. Non-normozoospermic men had twice as many nucleotide substitutions than normozoospermic men. However, there were no significant differences in the frequencies of nucleotide substitution and POLgamma genotypes in the two groups of men.

  12. Complete sequence of the mitochondrial genome of the tapeworm Hymenolepis diminuta: gene arrangements indicate that Platyhelminths are Eutrochozoans.


    von Nickisch-Rosenegk, M; Brown, W M; Boore, J L


    Using "long-PCR," we amplified in overlapping fragments the complete mitochondrial genome of the tapeworm Hymenolepis diminuta (Platyhelminthes: Cestoda) and determined its 13,900-nt sequence. The gene content is the same as that typically found for animal mitochondrial DNA (mtDNA) except that atp8 appears to be lacking, a condition found previously for several other animals. Despite the small size of this mtDNA, there are two large noncoding regions, one of which contains 13 repeats of a 31-nt sequence and a potential stem-loop structure of 25 bp with an 11-member loop. Large potential secondary structures were identified also for the noncoding regions of two other cestode mtDNAS: Comparison of the mitochondrial gene arrangement of H. diminuta with those previously published supports a phylogenetic position of flatworms as members of the Eutrochozoa, rather than placing them basal to either a clade of protostomes or a clade of coelomates.

  13. A novel mutation in the mitochondrial tRNA{sup Asn} gene associated with a lethal disease

    SciTech Connect

    Coulbault, Laurent; Herlicoviez, Danielle; Chapon, Francoise; Read, Marie-Helene; Penniello, Marie-Jose; Reynier, Pascal; Fayet, Guillemette; Lombes, Anne; Jauzac, Philippe; Allouche, Stephane . E-mail:


    We describe a lethal mitochondrial disease in a 10-month-old child who presented with encephalomyopathy. Histochemical and electron microscopy examinations of skeletal muscle biopsy revealed abnormal mitochondria associated with a combined deficiency of complexes I and IV. After excluding mitochondrial DNA deletions and depletion, direct sequencing was used to screen for mutation in all transfer RNA (tRNA) genes. A T-to-C substitution at position 5693 in the tRNA{sup Asn} gene was found in blood and muscle. Microdissection of muscle biopsy and its analysis revealed the highest level of this mutation in cytochrome c oxidase (COX)-negative fibres. We suggest that this novel mutation would affect the anticodon loop structure of the tRNA{sup Asn} and cause a fatal mitochondrial disease.

  14. Molecular phylogeny of Pakistani riverine buffalo based on genetic variability of mitochondrial cytochrome b gene.


    Saif, Rashid; Wasim, Muhammad; Babar, Masroor Ellahi


    Mitochondrial cytochrome b gene is considered to be one of the best markers for breed characterization as well as studying the ancestry in the vertebrates due to its exclusive maternal inheritance. DNA fingerprinting by single nucleotide polymorphism is most reliable and widely used molecular technique in modern forensics and is being considered in this study. Partial sequencing of 1,061 bp of aforementioned gene from 14580 to 15643 was conducted in two famous Pakistani buffalo breeds named Nili-Ravi and Kundi. In which we explore seven haplotypes within earlier and none in the latter breed. Nili-Ravi is polymorphic at four codons of this gene, and the protein translation is also different from the reference sample while monomorphic at three codons with no amino acid replacement. Haplotypes frequency distribution of these four haplotypes named NR3, NR4, NR5, NR7 revealed that the prevalence of each haplotype is 0.04 % in the Pakistani buffalo population of this Nili-Ravi breed while complete homoplasmy was observed in the Kundi breed population. Nili-Ravi breed of buffalo is genetically more variable than the Kundi breed as far as the gene in subject is concerned. It means later breed has spent more time to propagate its wild type haplotype which make this breed more ancestral as compare to Nili-Ravi. Secondly both breeds share their common ancestors with regional water buffalo rather than the swamp one.

  15. An evaluation of mitochondrial tRNA gene evolution and its relation to the genetic code.


    Cedergren, R J


    Extensive sequence data on mitochondrial (mt) tRNAs give for the first time an opportunity to evaluate tRNA gene evolution in this organelle. Deductions from these gene structures relate to the evolution of tRNA genes in other cellular systems and to the origin of the genetic code. Mt tRNAs, in contrast to the prokaryotic nature of chloroplastic tRNA structure, can not at the present time be definitely related to either prokaryotic or eukaryotic tRNAs, probably because of a higher mutation rate in mitochondria. Fungal mt tRNAs having the same anticodon and function are generally similar enough to be considered homologous. Comparisons af all mt tRNA sequences contained in the same mitochondrion indicate that some tRNAs originated by duplication of a prototypic gene which, after divergence, led to tRNAs having different amino acid specificities. The deviant mt genetic code, although admittedly permitting a simpler decoding mechanism, is not useful in determining whether the origin of mitochondria had preceded or was derived from prokaryotes or eukaryotes, since the genetic code is variable even among mitochondria. Variants of the mt genetic code lead to speculation on the nature of the primordial code and its relation to the present "universal" code.

  16. Mitochondrial DNA variants can mediate methylation status of inflammation, angiogenesis and signaling genes

    PubMed Central

    Atilano, Shari R.; Malik, Deepika; Chwa, Marilyn; Cáceres-Del-Carpio, Javier; Nesburn, Anthony B.; Boyer, David S.; Kuppermann, Baruch D.; Jazwinski, S. Michal; Miceli, Michael V.; Wallace, Douglas C.; Udar, Nitin; Kenney, M. Cristina


    Mitochondrial (mt) DNA can be classified into haplogroups representing different geographic and/or racial origins of populations. The H haplogroup is protective against age-related macular degeneration (AMD), while the J haplogroup is high risk for AMD. In the present study, we performed comparison analyses of human retinal cell cybrids, which possess identical nuclei, but mtDNA from subjects with either the H or J haplogroups, and demonstrate differences in total global methylation, and expression patterns for two genes related to acetylation and five genes related to methylation. Analyses revealed that untreated-H and -J cybrids have different expression levels for nuclear genes (CFH, EFEMP1, VEGFA and NFkB2). However, expression levels for these genes become equivalent after treatment with a methylation inhibitor, 5-aza-2′-deoxycytidine. Moreover, sequencing of the entire mtDNA suggests that differences in epigenetic status found in cybrids are likely due to single nucleotide polymorphisms (SNPs) within the haplogroup profiles rather than rare variants or private SNPs. In conclusion, our findings indicate that mtDNA variants can mediate methylation profiles and transcription for inflammation, angiogenesis and various signaling pathways, which are important in several common diseases. PMID:25964427

  17. Molecular evolution and adaptation of the mitochondrial cytochrome b gene in the subgenus Martes.


    Li, B; Malyarchuk, B; He, X B; Derenko, M


    Martes species represent a typical example of rapid evolutionary radiation and a recent speciation event. To identify regions of the genome that experienced adaptive evolution, which might provide clues to their functional importance and may be informative about the features that make each species unique, we sought evidence of molecular adaptation in the mitochondrial DNA (mtDNA) cytochrome b gene in the subgenus Martes. Complete sequences of the cytochrome b gene were obtained from 87 samples, including 49 sables, 28 pine martens, and 10 stone martens, and were combined with mtDNA sequences of other true martens, such as M. melampus and M. americana. Analysis of the cytochrome b gene variation in true martens has shown that the evolution of this gene is under negative selection. In contrast, positive selection on the cytochrome b protein has been detected by means of the software TreeSAAP using a phylogenetic reconstruction of Martes taxa. Signatures of adaptive variation in cytochrome b were restricted to the transmembrane domains, which likely function as proton pumps. We compared results of different methods for testing selection and molecular adaptation, and we supposed that the radical changes of the cytochrome b amino acid residues in the subgenus Martes may be the result of molecular adaptation to specific environmental conditions coupled with species dispersals.

  18. Mitochondrial evidence for panmixia despite perceived barriers to gene flow in a widely distributed waterbird.


    Oomen, Rebekah A; Reudink, Matthew W; Nocera, Joseph J; Somers, Christopher M; Green, M Clay; Kyle, Christopher J


    We examined the mitochondrial genetic structure of American white pelicans (Pelecanus erythrorhynchos) to: 1) verify or refute whether American white pelicans are panmictic and 2) understand if any lack of genetic structure is the result of contemporary processes or historical phenomena. Sequence analysis of mitochondrial DNA control region haplotypes of 367 individuals from 19 colonies located across their North American range revealed a lack of population genetic or phylogeographic structure. This lack of structure was unexpected because: 1) Major geographic barriers such as the North American Continental Divide are thought to limit dispersal; 2) Differences in migratory behavior are expected to promote population differentiation; and 3) Many widespread North American migratory bird species show historic patterns of differentiation resulting from having inhabited multiple glacial refugia. Further, high haplotype diversity and many rare haplotypes are maintained across the species' distribution, despite frequent local extinctions and recolonizations that are expected to decrease diversity. Our findings suggest that American white pelicans have a high effective population size and low natal philopatry. We suggest that the rangewide panmixia we observed in American white pelicans is due to high historical and contemporary gene flow, enabled by high mobility and a lack of effective physical or behavioral barriers.

  19. Functional characterization of the Drosophila MRP (mitochondrial RNA processing) RNA gene.


    Schneider, Mary D; Bains, Anupinder K; Rajendra, T K; Dominski, Zbigniew; Matera, A Gregory; Simmonds, Andrew J


    MRP RNA is a noncoding RNA component of RNase mitochondrial RNA processing (MRP), a multi-protein eukaryotic endoribonuclease reported to function in multiple cellular processes, including ribosomal RNA processing, mitochondrial DNA replication, and cell cycle regulation. A recent study predicted a potential Drosophila ortholog of MRP RNA (CR33682) by computer-based genome analysis. We have confirmed the expression of this gene and characterized the phenotype associated with this locus. Flies with mutations that specifically affect MRP RNA show defects in growth and development that begin in the early larval period and end in larval death during the second instar stage. We present several lines of evidence demonstrating a role for Drosophila MRP RNA in rRNA processing. The nuclear fraction of Drosophila MRP RNA localizes to the nucleolus. Further, a mutant strain shows defects in rRNA processing that include a defect in 5.8S rRNA processing, typical of MRP RNA mutants in other species, as well as defects in early stages of rRNA processing.

  20. A new mitochondrial DNA mutation in ND3 gene causing severe Leigh syndrome with early lethality.


    Crimi, Marco; Papadimitriou, Alexandros; Galbiati, Sara; Palamidou, Phani; Fortunato, Francesco; Bordoni, Andreina; Papandreou, Urania; Papadimitriou, Dimitra; Hadjigeorgiou, George M; Drogari, Eurydiki; Bresolin, Nereo; Comi, Giacomo Pietro


    We describe a new mitochondrial DNA mutation in a male infant who presented clinical and magnetic resonance imaging features of Leigh syndrome and died at the age of 9 mo. The patient's development was reportedly normal in the first months of life. At the age of 5 mo, he presented severe generalized hypotonia, nystagmus, and absent eye contact. Laboratory examination showed increased lactate and pyruvate in both serum and cerebrospinal fluid. Brain magnetic resonance imaging revealed multiple necrotic lesions in the basal ganglia, brain stem, and thalamus. Muscle histopathology was unremarkable, whereas respiratory chain enzyme analysis revealed a severe complex I deficiency. The patient died after an acidotic coma at age 9 mo. Sequence analysis of the entire mtDNA disclosed a new T10158C mutation with variable tissue heteroplasm (muscle: 83%; blood: 48%). The mutation was undetectable in the blood of his unaffected mother. The transition changes a serine residue into a proline, in a highly conserved region of the NADH dehydrogenase subunit 3 (ND3). This is the first description of a mitochondrial ND3 gene in Leigh syndrome with early lethality.

  1. An amino acid substitution in the pyruvate dehydrogenase E1{alpha} gene, affecting mitochondrial import of the precursor protein

    SciTech Connect

    Takakubo, F.; Thorburn, D.R.; Dahl, H.H.M.


    A mutation in the mitochondrial targeting sequence was characterized in a male patient with X chromosome-linked pyruvate dehydrogenase E1{alpha} deficiency. The mutation was a base substitution of G by C at nucleotide 134 in the mitochondrial targeting sequence of the PDHA1 gene, resulting in an arginine-to-proline substitution at codon 10 (R10P). Pyruvate dehydrogenase activity in cultured skin fibroblasts was 28% of the control value, and immunoblot analysis revealed a decreased level of pyruvate dehydrogenase E1{alpha}immunoreactivity. Chimeric constructs in which the normal and mutant pyruvate dehydrogenase E1{alpha} targeting sequences were attached to the mitochondrial matrix protein ornithine transcarbamylase were synthesized in a cell free translation system, and mitochondrial import of normal and mutant proteins was compared in vitro. The results show that ornithine transcarbamylase targeted by the mutant pyruvate dehydrogenase E1{alpha} sequence was translocated into the mitochondrial matrix at a reduced rate, suggesting that defective import is responsible for the reduced pyruvate dehydrogenase level in mitochondria. The mutation was also present in an affected brother and the mildly affected mother. The clinical presentations of this X chromosome-linked disorder in affected family members are discussed. To our knowledge, this is the first report of an amino acid substitution in a mitochondrial targeting sequence resulting in a human genetic disease. 58 refs., 5 figs., 1 tab.

  2. Historical divergence and gene flow: coalescent analyses of mitochondrial, autosomal and sex-linked loci in Passerina buntings.


    Carling, Matthew D; Lovette, Irby J; Brumfield, Robb T


    Quantifying the role of gene flow during the divergence of closely related species is crucial to understanding the process of speciation. We collected DNA sequence data from 20 loci (one mitochondrial, 13 autosomal, and six sex-linked) for population samples of Lazuli Buntings (Passerina amoena) and Indigo Buntings (Passerina cyanea) (Aves: Cardinalidae) to test explicitly between a strict allopatric speciation model and a model in which divergence occurred despite postdivergence gene flow. Likelihood ratio tests of coalescent-based population genetic parameter estimates indicated a strong signal of postdivergence gene flow and a strict allopatric speciation model was rejected. Analyses of partitioned datasets (mitochondrial, autosomal, and sex-linked) suggest the overall gene flow patterns are driven primarily by autosomal gene flow, as there is no evidence of mitochondrial gene flow and we were unable to reject an allopatric speciation model for the sex-linked data. This pattern is consistent with either a parapatric divergence model or repeated periods of allopatry with gene flow occurring via secondary contact. These results are consistent with the low fitness of female avian hybrids under Haldane's rule and demonstrate that sex-linked loci likely are important in the initial generation of reproductive isolation, not just its maintenance.

  3. Intragenomic diversity of the V1 regions of 16S rRNA genes in high-alkaline protease-producing Bacillus clausii spp.


    Kageyama, Yasushi; Takaki, Yoshihiro; Shimamura, Shigeru; Nishi, Shinro; Nogi, Yuichi; Uchimura, Kohsuke; Kobayashi, Tohru; Hitomi, Jun; Ozaki, Katsuya; Kawai, Shuji; Ito, Susumu; Horikoshi, Koki


    Alkaliphilic Bacillus sp. strain KSM-K16, which produces high-alkaline M-protease, was characterized phenotypically, biochemically and genetically. This strain was identified as Bacillus clausii based on the results of taxonomic studies, including sequencing of the 16S rRNA gene and DNA-DNA hybridization. Seven rRNA operons in the genome were identified by pulsed-field gel electrophoresis. Sequencing of cloned 16S rRNA genes revealed two distinct types of variable region V1. Moreover, some cloned 16S rRNA genes in some of the reference strains of B. clausii had a V1 region of yet another type. The B. clausii strains could clearly be divided into at least two subgroups based on the frequencies of the types of cloned V1 sequence. Bacillus sp. strain KSM-K16 was found to be in a different phylogenetic position from other high-alkaline protease-producing strains of B. clausii.

  4. Gene expression of key regulators of mitochondrial biogenesis is sex dependent in mice with growth hormone receptor deletion in liver

    PubMed Central

    Zawada, Ilona; Masternak, Michal M.; List, Edward O.; Stout, Michael B.; Berryman, Darlene E.; Lewinski, Andrzej; Kopchick, John J.; Bartke, Andrzej; Karbownik-Lewinska, Malgorzata; Gesing, Adam


    Mitochondrial biogenesis is an essential process for cell viability. Mice with disruption of the growth hormone receptor (GHR) gene (Ghr gene) in the liver (LiGHRKO), in contrast to long-lived mice with global deletion of the Ghr gene (GHRKO), are characterized by lack of improved insulin sensitivity and severe hepatic steatosis. Tissue-specific disruption of the GHR in liver results in a mouse model with dramatically altered GH/IGF1 axis. We have previously shown increased levels of key regulators of mitochondrial biogenesis in insulin-sensitive GHRKO mice. The aim of the present study is to assess, using real-time PCR, the gene expression of key regulators of mitochondrial biogenesis (Pgc1α, Ampk, Sirt1, Nrf2 and Mfn2) and a marker of mitochondrial activity (CoxIV) in brains, kidneys and livers of male and female LiGHRKO and wild-type (WT) mice. There were significant differences between males and females. In the brain, expression of Pgc1α, Ampk, Sirt1, Nrf2 and Mfn2 was lower in pooled females compared to pooled males. In the kidneys, expression of Ampk and Sirt1 was also lower in female mice. In the liver, no differences between males and females were observed. Sexual dimorphism may play an important role in regulating the biogenesis of mitochondria. PMID:25855408

  5. Gene expression of key regulators of mitochondrial biogenesis is sex dependent in mice with growth hormone receptor deletion in liver.


    Zawada, Ilona; Masternak, Michal M; List, Edward O; Stout, Michael B; Berryman, Darlene E; Lewinski, Andrzej; Kopchick, John J; Bartke, Andrzej; Karbownik-Lewinska, Malgorzata; Gesing, Adam


    Mitochondrial biogenesis is an essential process for cell viability. Mice with disruption of the growth hormone receptor (GHR) gene (Ghr gene) in the liver (LiGHRKO), in contrast to long-lived mice with global deletion of the Ghr gene (GHRKO), are characterized by lack of improved insulin sensitivity and severe hepatic steatosis. Tissue-specific disruption of the GHR in liver results in a mouse model with dramatically altered GH/IGF1 axis. We have previously shown increased levels of key regulators of mitochondrial biogenesis in insulin-sensitive GHRKO mice. The aim of the present study is to assess, using real-time PCR, the gene expression of key regulators of mitochondrial biogenesis (Pgc1α, Ampk, Sirt1, Nrf2 and Mfn2) and a marker of mitochondrial activity (CoxIV) in brains, kidneys and livers of male and female LiGHRKO and wild-type (WT) mice. There were significant differences between males and females. In the brain, expression of Pgc1α, Ampk, Sirt1, Nrf2 and Mfn2 was lower in pooled females compared to pooled males. In the kidneys, expression of Ampk and Sirt1 was also lower in female mice. In the liver, no differences between males and females were observed. Sexual dimorphism may play an important role in regulating the biogenesis of mitochondria.

  6. An araC-controlled bacterial cre expression system to produce DNA minicircle vectors for nuclear and mitochondrial gene therapy.


    Bigger, B W; Tolmachov, O; Collombet, J M; Fragkos, M; Palaszewski, I; Coutelle, C


    The presence of CpG motifs and their associated sequences in bacterial DNA causes an immunotoxic response following the delivery of these plasmid vectors into mammalian hosts. We describe a biotechnological approach to the elimination of this problem by the creation of a bacterial cre recombinase expression system, tightly controlled by the arabinose regulon. This permits the Cre-mediated and -directed excision of the entire bacterial vector sequences from plasmid constructs to create supercoiled gene expression minicircles for gene therapy. Minicircle yields using standard culture volumes are sufficient for most in vitro and in vivo applications whereas minicircle expression in vitro is significantly increased over standard plasmid transfection. By the simple expedient of removing the bacterial DNA complement, we significantly reduce the size and CpG content of these expression vectors, which should also reduce DNA-induced inflammatory responses in a dose-dependent manner. We further describe the generation of minicircle expression vectors for mammalian mitochondrial gene therapy, for which no other vector systems currently exist. The removal of bacterial vector sequences should permit appropriate transcription and correct transcriptional cleavage from the mitochondrial minicircle constructs in a mitochondrial environment and brings the realization of mitochondrial gene therapy a step closer.

  7. The model barnacle Balanus balanus Linnaeus, 1758 (Crustacea: Maxillopoda: Sessilia) mitochondrial genome and gene rearrangements within the family Balanidae.


    Shen, Xin; Tsoi, Kwok-Ho; Cheang, Chi-Chiu


    Balanus balanus Linnaeus, 1758, the model organism in the order Sessilia (Crustacea: Maxillopoda) is a cold water acorn barnacle in the family Balanidae distributing over the entire northern hemisphere. We present complete mitochondrial genome of this barnacle and analyze mitochondrial genomic characters of the family Balanidae. The length of mitochondrial genome is 15,955 bp, which is larger than those of the other barnacles in the same family. An inversion of a six-gene block (trnPro- nad4L- nad4- trnHis- nad5- trnPhe) is found between B. balanus and two Megabalanus (M. ajax and M. volcano). Three types of mitochondrial gene arrangements revealed in Balanidae have indicated the non-conserved gene orders even at intrafamilial level. Compared to pancrustacean ground pattern, large-scale gene rearrangements are found in B. balanus. Translocations of at least six tRNAs (trnAla, trnGlu/trnSer(AGY), trnPro/trnThr, trnLys, trnGln and trnCys) are identified and translocation and inversion occurred simultaneously in one tRNAs (trnTyr).

  8. Collection of mitochondrial cytochrome oxidase I gene sequences from Rhipicephalus ticks from various geographic locations around the world

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Determining the origin of the cattle tick, Rhipicephalus microplus, will be helpful to the effort to find biological control agents. Molecular phylogenetics can assist in this determination. Thus, we sequenced and assembled partial gene sequences from the mitochondrial cytochrome oxidase I coding r...

  9. The Human Gene SLC25A29, of Solute Carrier Family 25, Encodes a Mitochondrial Transporter of Basic Amino Acids*

    PubMed Central

    Porcelli, Vito; Fiermonte, Giuseppe; Longo, Antonella; Palmieri, Ferdinando


    The human genome encodes 53 members of the solute carrier family 25 (SLC25), also called the mitochondrial carrier family, many of which have been shown to transport carboxylates, amino acids, nucleotides, and cofactors across the inner mitochondrial membrane, thereby connecting cytosolic and matrix functions. In this work, a member of this family, SLC25A29, previously reported to be a mitochondrial carnitine/acylcarnitine- or ornithine-like carrier, has been thoroughly characterized biochemically. The SLC25A29 gene was overexpressed in Escherichia coli, and the gene product was purified and reconstituted in phospholipid vesicles. Its transport properties and kinetic parameters demonstrate that SLC25A29 transports arginine, lysine, homoarginine, methylarginine and, to a much lesser extent, ornithine and histidine. Carnitine and acylcarnitines were not transported by SLC25A29. This carrier catalyzed substantial uniport besides a counter-exchange transport, exhibited a high transport affinity for arginine and lysine, and was saturable and inhibited by mercurial compounds and other inhibitors of mitochondrial carriers to various degrees. The main physiological role of SLC25A29 is to import basic amino acids into mitochondria for mitochondrial protein synthesis and amino acid degradation. PMID:24652292

  10. The human gene SLC25A29, of solute carrier family 25, encodes a mitochondrial transporter of basic amino acids.


    Porcelli, Vito; Fiermonte, Giuseppe; Longo, Antonella; Palmieri, Ferdinando


    The human genome encodes 53 members of the solute carrier family 25 (SLC25), also called the mitochondrial carrier family, many of which have been shown to transport carboxylates, amino acids, nucleotides, and cofactors across the inner mitochondrial membrane, thereby connecting cytosolic and matrix functions. In this work, a member of this family, SLC25A29, previously reported to be a mitochondrial carnitine/acylcarnitine- or ornithine-like carrier, has been thoroughly characterized biochemically. The SLC25A29 gene was overexpressed in Escherichia coli, and the gene product was purified and reconstituted in phospholipid vesicles. Its transport properties and kinetic parameters demonstrate that SLC25A29 transports arginine, lysine, homoarginine, methylarginine and, to a much lesser extent, ornithine and histidine. Carnitine and acylcarnitines were not transported by SLC25A29. This carrier catalyzed substantial uniport besides a counter-exchange transport, exhibited a high transport affinity for arginine and lysine, and was saturable and inhibited by mercurial compounds and other inhibitors of mitochondrial carriers to various degrees. The main physiological role of SLC25A29 is to import basic amino acids into mitochondria for mitochondrial protein synthesis and amino acid degradation.

  11. Phylogenetic relationships of the Cobitoidea (Teleostei: Cypriniformes) inferred from mitochondrial and nuclear genes with analyses of gene evolution.


    Liu, Si-Qing; Mayden, Richard L; Zhang, Jia-Bo; Yu, Dan; Tang, Qiong-Ying; Deng, Xin; Liu, Huan-Zhang


    The superfamily Cobitoidea of the order Cypriniformes is a diverse group of fishes, inhabiting freshwater ecosystems across Eurasia and North Africa. The phylogenetic relationships of this well-corroborated natural group and diverse clade are critical to not only informing scientific communities of the phylogeny of the order Cypriniformes, the world's largest freshwater fish order, but are key to every area of comparative biology examining the evolution of traits, functional structures, and breeding behaviors to their biogeographic histories, speciation, anagenetic divergence, and divergence time estimates. In the present study, two mitochondrial gene sequences (COI, ND4+5) and four single-copy nuclear gene segments (RH1, RAG1, EGR2B, IRBP) were used to infer the phylogenetic relationships of the Cobitoidea as reconstructed from maximum likelihood (ML) and partitioned Bayesian Analysis (BA). Analyses of the combined mitochondrial/nuclear gene datasets revealed five strongly supported monophyletic Cobitoidea families and their sister-group relationships: Botiidae+(Vaillantellidae+(Cobitidae+(Nemacheilidae+Balitoridae))). These recovered relationships are in agreement with previous systematic studies on the order Cypriniformes and/or those focusing on the superfamily Cobitoidea. Using these relationships, our analyses revealed pattern lineage- or ecological-group-specific evolution of these genes for the Cobitoidea. These observations and results corroborate the hypothesis that these group-specific-ancestral ecological characters have contributed in the diversification and/or adaptations within these groups. Positive selections were detected in RH1 of nemacheilids and in RAG1 of nemacheilids and genus Vaillantella, which indicated that evolution of RH1 (related to eye's optic sense) and RAG1 (related to immunity) genes appeared to be important for the diversification of these groups. The balitorid lineage (those species inhabiting fast-flowing riverine habitats) had

  12. Phylogenetic relationships among onychophora from Australasia inferred from the mitochondrial cytochrome oxidase subunit I gene.


    Gleeson, D M; Rowell, D M; Tait, N N; Briscoe, D A; Higgins, A V


    Nucleotide sequence variation in a region of the mitochondrial cytochrome oxidase subunit I (COI) gene (456 bp) was examined for 26 onychophorans representing 15 genera of the family Peripatopsidae from Australasia. Sequence analysis revealed high intergeneric COI sequence divergence (up to 20.6% corrected) but low amino acid substitution rates, with high levels of transitional saturation evident. Among unambiguously alignable sequences, parsimony and distance analyses revealed a broadly congruent tree topology, robust to various algorithms and statistical analysis. There are two major groupings. One, largely unresolved, consists entirely of Australian mainland taxa. The other, for which there is convincing support, includes all of the New Zealand and Tasmanian taxa together with one mainland Australian species. In respect of the two major groupings, this topology is consistent with previous morphologically based phylogenies and provides further evidence for an ancient radiation within the mainland Australian Onychophora. The biogeographic implications of the close affinities revealed between the Tasmanian and New Zealand taxa are discussed.

  13. DNA barcoding of Oryx leucoryx using the mitochondrial cytochrome C oxidase gene.


    Elmeer, K; Almalki, A; Mohran, K A; Al-Qahtani, K N; Almarri, M


    The massive destruction and deterioration of the habitat of Oryx leucoryx and illegal hunting have decimated Oryx populations significantly, and now these animals are almost extinct in the wild. Molecular analyses can significantly contribute to captive breeding and reintroduction strategies for the conservation of this endangered animal. A representative 32 identical sequences used for species identification through BOLD and GenBank/NCBI showed maximum homology 96.06% with O. dammah, which is a species of Oryx from Northern Africa, the next closest species 94.33% was O. gazella, the African antelope. DNA barcode sequences of the mitochondrial cytochrome C oxidase (COI) gene were determined for O. leucoryx; identification through BOLD could only recognize the genus correctly, whereas the species could not be identified. This was due to a lack of sequence data for O. leucoryx on BOLD. Similarly, BLAST analysis of the NCBI data base also revealed no COI sequence data for the genus Oryx.

  14. Population structure of Tor tor inferred from mitochondrial gene cytochrome b.


    Pasi, Komal Shyamakant; Lakra, W S; Bhatt, J P; Goswami, M; Malakar, A Kr


    Tor tor, commonly called as Tor mahseer, is a high-valued food and game fish endemic to trans-Himalayan region. Mitochondrial cytochrome b (cyt b) gene region of 967 bp was used to estimate the population structure of T. tor. Three populations of T. tor were collected from Narmada (Hosangabad), Ken (Madla), and Parbati river (Sheopur) in Madhya Pradesh, India. The sequence analysis revealed that the nucleotide diversity (π) was low, ranging from 0.000 to 0.0150. Haplotype diversity (h) ranged from 0.000 to 1.000. The analysis of molecular variance analysis indicated significant genetic divergence among the three populations of T. tor. Neighboring-joining tree also showed that all individuals from three populations clustered into three distinct clades. The data generated by cyt b marker revealed interesting insight about population structure of T. tor, which would serve as baseline data for conservation and management of mahseer fishery.

  15. A phylogeny of cockroaches and related insects based on DNA sequence of mitochondrial ribosomal RNA genes.

    PubMed Central

    Kambhampati, S


    Cockroaches are among the most ancient winged insects, the earliest fossils dating back to about 400 million years. Several conflicting phylogenies for cockroach families, subfamilies, and genera have been proposed in the past. In addition, the relationship of Cryptocercidae to other cockroach families and the relationship between the cockroach, Cryptocercus punctulatus, and the termite, Mastotermes darwiniensis, have generated debate. In this paper, a phylogeny for cockroaches, mantids, and termites based on DNA sequence of the mitochondrial ribosomal RNA genes is presented. The results indicated that cockroaches are a monophyletic group, whose sister group is Mantoidea. The inferred relationship among cockroach families was in agreement with the presently accepted phylogeny. However, there was only partial congruence at the subfamily and the generic levels. The phylogeny inferred here does not support a close relationship between C. punctulatus and M. darwiniensis. The apparent synapomorphies of these two species are likely a manifestation of convergent evolution because there are similarities in biology and habitat. PMID:7534409

  16. Phylogeny of hammerhead sharks (Family Sphyrnidae) inferred from mitochondrial and nuclear genes.


    Lim, Douglas D; Motta, Philip; Mara, Kyle; Martin, Andrew P


    Hammerhead sharks (Family Sphyrnidae) get their name from their laterally expanded, dorsal-ventrally compressed head, a structure referred to as the cephalofoil. Species within the family vary for head size and shape and for body size in ways that are functionally significant. Here we infer the phylogeny for all species within the family based on analysis of mitochondrial and nuclear genes amounting to 6292 base pairs. Mixed model Bayesian analysis of the concatenated data and Bayesian estimation of the species tree (BEST) converged on the same topology of the relationships. Shimodaira-Hasegawa tests revealed that all previously proposed hypotheses could be refuted by the data. The new hypothesis for the group suggests that the ancestor of all extant sharks was large (>200 cms) and that small body size probably evolved twice at different times and places. Moreover, the results suggest that once the cephalofoil evolved, it underwent divergent evolution in different lineages presumably in response to unique selective regimes.

  17. The plant mitochondrial mat-r gene/nad1 gene complex. Progress report

    SciTech Connect

    Wolstenholme, D.R.


    The authors have completed sequencing the segments (totalling 19 kb, both complementary strands) of the maize mtDNA molecule that encode the entire NADH dehydrogenase subunit (nadl) gene. They have identified nucleotides in mature transcripts of the nadl gene that are edited and have generated clones of cDNAs of entire mature (fully spliced) nadl transcripts. They have examined the relative rates of splicing in transcripts of the four nadl gene group II introns and begun examining nadl intron cDNAs to determine the extent and distribution of RNA edits in introns, in order to evaluate the possibility that intron excision and exon splicing might be editing independent.

  18. Mitochondrial genomes of acrodont lizards: timing of gene rearrangements and phylogenetic and biogeographic implications

    PubMed Central


    Background Acrodonta consists of Agamidae and Chamaeleonidae that have the characteristic acrodont dentition. These two families and Iguanidae sensu lato are members of infraorder Iguania. Phylogenetic relationships and historical biogeography of iguanian lizards still remain to be elucidated in spite of a number of morphological and molecular studies. This issue was addressed by sequencing complete mitochondrial genomes from 10 species that represent major lineages of acrodont lizards. This study also provided a good opportunity to compare molecular evolutionary modes of mitogenomes among different iguanian lineages. Results Acrodontan mitogenomes were found to be less conservative than iguanid counterparts with respect to gene arrangement features and rates of sequence evolution. Phylogenetic relationships were constructed with the mitogenomic sequence data and timing of gene rearrangements was inferred on it. The result suggested highly lineage-specific occurrence of several gene rearrangements, except for the translocation of the tRNAPro gene from the 5' to 3' side of the control region, which likely occurred independently in both agamine and chamaeleonid lineages. Phylogenetic analyses strongly suggested the monophyly of Agamidae in relation to Chamaeleonidae and the non-monophyly of traditional genus Chamaeleo within Chamaeleonidae. Uromastyx and Brookesia were suggested to be the earliest shoot-off of Agamidae and Chamaeleonidae, respectively. Together with the results of relaxed-clock dating analyses, our molecular phylogeny was used to infer the origin of Acrodonta and historical biogeography of its descendant lineages. Our molecular data favored Gondwanan origin of Acrodonta, vicariant divergence of Agamidae and Chamaeleonidae in the drifting India-Madagascar landmass, and migration of the Agamidae to Eurasia with the Indian subcontinent, although Laurasian origin of Acrodonta was not strictly ruled out. Conclusions We detected distinct modes of

  19. Sequence and expression variations in 23 genes involved in mitochondrial and non-mitochondrial apoptotic pathways and risk of oral leukoplakia and cancer.


    Datta, Sayantan; Ray, Anindita; Singh, Richa; Mondal, Pinaki; Basu, Analabha; De Sarkar, Navonil; Majumder, Mousumi; Maiti, Guruparasad; Baral, Aradhita; Jha, Ganga Nath; Mukhopadhyay, Indranil; Panda, Chinmay; Chowdhury, Shantanu; Ghosh, Saurabh; Roychoudhury, Susanta; Roy, Bidyut


    Oral cancer is usually preceded by pre-cancerous lesion and related to tobacco abuse. Tobacco carcinogens damage DNA and cells harboring such damaged DNA normally undergo apoptotic death, but cancer cells are exceptionally resistant to apoptosis. Here we studied association between sequence and expression variations in apoptotic pathway genes and risk of oral cancer and precancer. Ninety nine tag SNPs in 23 genes, involved in mitochondrial and non-mitochondrial apoptotic pathways, were genotyped in 525 cancer and 253 leukoplakia patients and 538 healthy controls using Illumina Golden Gate assay. Six SNPs (rs1473418 at BCL2; rs1950252 at BCL2L2; rs8190315 at BID; rs511044 at CASP1; rs2227310 at CASP7 and rs13010627 at CASP10) significantly modified risk of oral cancer but SNPs only at BCL2, CASP1and CASP10 modulated risk of leukoplakia. Combination of SNPs showed a steep increase in risk of cancer with increase in "effective" number of risk alleles. In silico analysis of published data set and our unpublished RNAseq data suggest that change in expression of BID and CASP7 may have affected risk of cancer. In conclusion, three SNPs, rs1473418 in BCL2, rs1950252 in BCL2L2 and rs511044 in CASP1, are being implicated for the first time in oral cancer. Since SNPs at BCL2, CASP1 and CASP10 modulated risk of both leukoplakia and cancer, so, they should be studied in more details for possible biomarkers in transition of leukoplakia to cancer. This study also implies importance of mitochondrial apoptotic pathway gene (such as BCL2) in progression of leukoplakia to oral cancer.

  20. Mutational analysis of the mitochondrial 12S rRNA and tRNA{sup Ser(UCN)} genes in Tunisian patients with nonsyndromic hearing loss

    SciTech Connect

    Mkaouar-Rebai, Emna . E-mail:; Tlili, Abdelaziz; Masmoudi, Saber; Louhichi, Nacim; Charfeddine, Ilhem; Amor, Mohamed Ben; Lahmar, Imed; Driss, Nabil; Drira, Mohamed; Ayadi, Hammadi; Fakhfakh, Faiza


    We explored the mitochondrial 12S rRNA and the tRNA{sup Ser(UCN)} genes in 100 Tunisian families affected with NSHL and in 100 control individuals. We identified the mitochondrial A1555G mutation in one out of these 100 families and not in the 100 control individuals. Members of this family harbouring the A1555G mutation showed phenotypic heterogeneity which could be explained by an eventual nuclear-mitochondrial interaction. So, we have screened three nuclear genes: GJB2, GJB3, and GJB6 but we have not found correlation between the phenotypic heterogeneity and variants detected in these genes. We explored also the entire mitochondrial 12S rRNA and the tRNA{sup Ser(UCN)} genes. We detected five novel polymorphisms: T742C, T794A, A813G, C868T, and C954T, and 12 known polymorphisms in the mitochondrial 12S rRNA gene. None of the 100 families or the 100 controls were found to carry mutations in the tRNA{sup Ser(UCN)} gene. We report here First mutational screening of the mitochondrial 12S rRNA and the tRNA{sup Ser(UCN)} genes in the Tunisian population which describes the second family harbouring the A1555G mutation in Africa and reveals novel polymorphisms in the mitochondrial 12S rRNA gene.

  1. Mitochondrial 16S ribosomal RNA gene for forensic identification of crocodile species.


    Naga Jogayya, K; Meganathan, P R; Dubey, Bhawna; Haque, I


    All crocodilians are under various threats due to over exploitation and these species have been listed in Appendix I or II of CITES. Lack of molecular techniques for the forensic identification of confiscated samples makes it difficult to enforce the law. Therefore, we herein present a molecular method developed on the basis on 16S rRNA gene of mitochondrial DNA for identification of crocodile species. We have developed a set of 16S rRNA primers for PCR based identification of crocodilian species. These novel primers amplify partial 16S rRNA sequences of six crocodile species which can be later combined to obtain a larger region (1290 bp) of 16S rRNA gene. This 16S rRNA gene could be used as an effective tool for forensic authentication of crocodiles. The described primers hold great promise in forensic identification of crocodile species, which can aid in the effective enforcement of law and conservation of these species.

  2. Non-random base composition in codons of mitochondrial cytochrome b gene in vertebrates.


    Prusak, Beata; Grzybowski, Tomasz


    Cytochrome b is the central catalytic subunit of the quinol:cytochrome c oxidoreductase of complex III of the mitochondrial oxidative phosphorylation system and is essential to the viability of most eukaryotic cells. Partial cytochrome b gene sequences of 14 species representing mammals, birds, reptiles and amphibians are presented here including some species typical for Poland. For the analysed species a comparative analysis of the natural variation in the gene was performed. This information has been used to discuss some aspects of gene sequence - protein function relationships. Review of relevant literature indicates that similar comparisons have been made only for basic mammalian species. Moreover, there is little information about the Polish-specific species. We observed that there is a strong non-random distribution of nucleotides in the cytochrome b sequence in all tested species with the highest differences at the third codon position. This is also the codon position of the strongest compositional bias. Some tested species, representing distant systematic groups, showed unique base composition differing from the others. The quail, frog, python and elk prefer C over A in the light DNA strand. Species belonging to the artiodactyls stand out from the remaining ones and contain fewer pyrimidines. The observed overall rate of amino acid identity is about 61%. The region covering Q(o) center as well as histidines 82 and 96 (heme ligands) are totally conserved in all tested species. Additionally, the applied method and the sequences can also be used for diagnostic species identification by veterinary and conservation agencies.

  3. The mitochondrial folylpolyglutamate synthetase gene is required for nitrogen utilization during early seedling development in arabidopsis.


    Jiang, Ling; Liu, Yanyan; Sun, Hong; Han, Yueting; Li, Jinglai; Li, Changkun; Guo, Wenzhu; Meng, Hongyan; Li, Sha; Fan, Yunliu; Zhang, Chunyi


    Investigations into the biochemical processes and regulatory mechanisms of nitrogen (N) utilization can aid in understanding how N is used efficiently in plants. This report describes a deficiency in N utilization in an Arabidopsis (Arabidopsis thaliana) transfer DNA insertion mutant of the mitochondrial folylpolyglutamate synthetase gene DFC, which catalyzes the conjugation of glutamate residues to the tetrahydrofolate during folate synthesis. The mutant seedlings displayed several metabolic changes that are typical of plant responses to low-N stress, including increased levels of starch and anthocyanin synthesis as well as decreased levels of soluble protein and free amino acid, as compared with those in wild-type seedlings when external N was sufficient. More striking changes were observed when dfc seedlings were grown under N-limited conditions, including shorter primary roots, fewer lateral roots, higher levels of glycine and carbon-N ratios, and lower N content than those in wild-type seedlings. Gene expression studies in mutant seedlings revealed altered transcript levels of several genes involved in folate biosynthesis and N metabolism. The biochemical and metabolic changes also suggested that N assimilation is drastically perturbed due to a loss of DFC function. The observation that elevated CO(2) partly rescued the dfc phenotypes suggests that the alterations in N metabolism in dfc may be mainly due to a defect in photorespiration. These results indicate that DFC is required for N utilization in Arabidopsis and provide new insight into a potential interaction between folate and N metabolism.

  4. Systematic position of Pseudocorynosoma and Andracantha (Acanthocephala, Polymorphidae) based on nuclear and mitochondrial gene sequences.


    García-Varela, Martín; Pérez-Ponce de León, Gerardo; Aznar, Francisco J; Nadler, Steven A


    Species of Pseudocorynosoma are North and South American acanthocephalans that use waterfowl as definitive hosts and amphipods as intermediate hosts, whereas species of Andracantha occur in fish-eating birds with a worldwide distribution. Pseudocorynosoma and Andracantha were originally described as Corynosoma (now restricted to endoparasites of marine mammals). Morphologically, Andracantha is distinct from other genera of Polymorphidae in possessing 2 fields of spines on the trunk, whereas Corynosoma and Pseudocorynosoma have a single field. A recent phylogenetic hypothesis based on morphological characters suggested that Andracantha is closely related to Corynosoma, whereas Pseudocorynosoma was of uncertain phylogenetic position within the Polymorphidae. To test the systematic affinities of these 3 genera, we sequenced 2 nuclear genes (SSU and LSU ribosomal DNA) and 1 mitochondrial gene (cytochrome c oxidase subunit 1; cox 1) of species representing Corynosoma, Andracantha, and Pseudocorynosoma and analyzed the data, including available sequences of other polymorphids. Maximum parsimony (MP), maximum likelihood (ML), and Bayesian analyses of the combined (SSU + LSU) sequences and the concatenated data of 3 genes (SSU + LSU + cox 1) placed Andracantha as the sister taxon to Corynosoma with robust support values. All analyses also showed that Pseudocorynosoma is an independent lineage that does not share a common ancestry with Andracantha and Corynosoma. These phylogenetic hypotheses suggest that birds were the ancestral hosts of polymorphids and that the association of Corynosoma with marine mammals represents a subsequent episode of colonization.

  5. Cloning and sequencing of the PIF gene involved in repair and recombination of yeast mitochondrial DNA.

    PubMed Central

    Foury, F; Lahaye, A


    The nuclear gene PIF of Saccharomyces cerevisiae is required for both repair of mitochondrial DNA (mtDNA) and recognition of a recombinogenic signal characterized by a 26-bp palindromic AT sequence in the ery region of mtDNA. This gene has been cloned in yeast by genetic complementation of pif mutants. Its chromosomal disruption does not destroy the genetic function of mitochondria. The nucleotide sequence of the 3.5-kb insert from a complementing plasmid reveals an open reading frame encoding a potential protein of 857 amino acids and Mr = 97,500. An ATP-binding domain is present in the central part of the gene and in the carboxy-terminal region a putative DNA-binding site is present. Its alpha helix-turn-alpha helix motif is found in DNA-binding proteins such as lambda and lactose repressors which recognize symmetric sequences. Significant amino acid homology is observed with yeast RAD3 and E. coli UvrD (helicase II) proteins which are required for excision repair of damaged DNA. Images Fig. 1. Fig. 2. PMID:3038524

  6. Next-Generation Sequencing of Two Mitochondrial Genomes from Family Pompilidae (Hymenoptera: Vespoidea) Reveal Novel Patterns of Gene Arrangement

    PubMed Central

    Chen, Peng-Yan; Zheng, Bo-Ying; Liu, Jing-Xian; Wei, Shu-Jun


    Animal mitochondrial genomes have provided large and diverse datasets for evolutionary studies. Here, the first two representative mitochondrial genomes from the family Pompilidae (Hymenoptera: Vespoidea) were determined using next-generation sequencing. The sequenced region of these two mitochondrial genomes from the species Auplopus sp. and Agenioideus sp. was 16,746 bp long with an A + T content of 83.12% and 16,596 bp long with an A + T content of 78.64%, respectively. In both species, all of the 37 typical mitochondrial genes were determined. The secondary structure of tRNA genes and rRNA genes were predicted and compared with those of other insects. Atypical trnS1 using abnormal anticodons TCT and lacking D-stem pairings was identified. There were 49 helices belonging to six domains in rrnL and 30 helices belonging to three domains in rrns present. Compared with the ancestral organization, four and two tRNA genes were rearranged in mitochondrial genomes of Auplopus and Agenioideus, respectively. In both species, trnM was shuffled upstream of the trnI-trnQ-trnM cluster, and trnA was translocated from the cluster trnA-trnR-trnN-trnS1-trnE-trnF to the region between nad1 and trnL1, which is novel to the Vespoidea. In Auplopus, the tRNA cluster trnW-trnC-trnY was shuffled to trnW-trnY-trnC. Phylogenetic analysis within Vespoidea revealed that Pompilidae and Mutillidae formed a sister lineage, and then sistered Formicidae. The genomes presented in this study have enriched the knowledge base of molecular markers, which is valuable in respect to studies about the gene rearrangement mechanism, genomic evolutionary processes and phylogeny of Hymenoptera. PMID:27727175

  7. Resistance mutations in protease gene at baseline are not related to virological failure in patients treated with darunavir/ritonavir monotherapy

    PubMed Central

    Gutierrez-Liarte, Angela; Gomez-Berrocal, Ana; Saez, Carmen; Valencia, Jorge; Santos, Ignacio; Sanz, Jesus


    Introduction Monotherapy with darunavir plus ritonavir (DRV/r) is a good maintenance strategy for suppressed HIV-infected patients. The clinical trials designed to prove the efficacy of PI/r do not include patients with resistance mutation in protease gene [1,2]. Sometimes in routine practice, basically to avoid NRTIs toxicity, monotherapy with DRV/r is used despite PI resistance mutations. The aim of this study is to know the effect of previous protease resistance mutation on DRV/r monotherapy efficacy. Materials and Methods We designed an observational cohort study of adults in treatment with DRV/r monotherapy in a tertiary Spanish hospital since 2011 to 2014. Demographic data and clinical outcomes were described. The analysis of efficacy was done according to the snapshot algorithm (defining virological failure as viral load >50 copies/mL, ITTe, at 48 and 96 weeks). We analyzed the difference of efficacy between patients with and without baseline resistance mutations at 48 and 96 weeks by using the χ2 test; and during the follow-up by using the Kaplan–Meier test. The statistical analysis was done with SPSS 17.0. Results Eighty-nine patients were included in the cohort but 14 were excluded because they had not reached more than six months with monotherapy. The cohort was composed mainly by men (78%), the medium age was 51 years (SD±10), 35% were MSM and 19% were former IDU. Twenty-four patients (35%) had a previous diagnosis of AIDS. The mean time taking NRTIs was 10.5 years (SD±5.4). Sixty-four patients (85%) had been treated with PI in the past. Previous failure with PI had been reported in 15 (20%). A resistance mutation test had been done at baseline in 45 patients (51%). Twenty-two patients (29%) had some mutations in protease gene, 10 patients (13%) had major mutations and 1 patient had some mutations of resistance for darunavir (I64V). At 48 weeks, 93% (CI 95% 86–98%) had VL<50 copies/mL, and 79% (CI 95% 67–89%) at 96 weeks. There were not

  8. Gene rearrangements and evolution of tRNA pseudogenes in the mitochondrial genome of the parrotfish (Teleostei: Perciformes: Scaridae).


    Mabuchi, Kohji; Miya, Masaki; Satoh, Takashi P; Westneat, Mark W; Nishida, Mutsumi


    Genomic size of animal mitochondrial DNA is usually minimized over time. Thus, when regional duplications occur, they are followed by a rapid elimination of redundant material. In contrast to this general view, we report here long-sustained tRNA pseudogenes in the mitochondrial genome (mitogenome) of teleost fishes of the family Scaridae (parrotfishes). During the course of a molecular phylogenetic study of the suborder Labroidei, we determined the complete nucleotide sequence of the mitogenome for a parrotfish, Chlorurus sordidus, and found a gene rearrangement accompanied by a tRNA pseudogene. In the typical gene order of vertebrates, a tRNA-gene cluster between ND1 and ND2 genes includes tRNA(Ile) (I), tRNA(Gln) (Q), and tRNA(Met) (M) genes in this order (IQM). However, in the mitogenome of the parrotfish, the tRNA(Met) gene was inserted between the tRNA(Ile) and the tRNA(Gln) genes, and the tRNA(Gln) gene was followed by a putative tRNA(Met) pseudogene (psiM). Such a tRNA gene rearrangement including a pseudogene (IMQpsiM) was found in all of the 10 examined species, representing 7 of the 10 currently recognized scarid genera. All sister groups examined (20 species of Labridae and a single species of Odacidae) had the typical gene order of vertebrate mitogenomes. Phylogenetic analysis of the tRNA(Met) genes and the resulting pseudogenes demonstrated that the ancestral tRNA(Met) gene was duplicated in a common ancestor of the parrotfish. Based on the fossil record, these results indicate that the pseudogenes have survived at least 14 million years. Most of the vertebrate mitochondrial gene rearrangements involving the IQM region have held the tRNA(Met) gene just upstream of the ND2 gene, and even in a few exceptional cases, including the present ones, the tRNA pseudogenes have been found in that position. In addition, most of these tRNA(Met) pseudogenes maintained clover-leaf secondary structures, with the remainder sustaining the clover-leaf structure in the

  9. Regulation of the AEFG1 gene, a mitochondrial elongation factor G from the dimorphic yeast Arxula adeninivorans LS3.


    Wartmann, T; Gellissen, G; Kunze, G


    Oxygen influences the synthesis of mitochondrial proteins by alteration of the expression of mitochondrial genes and several nuclear genes. One of the genes localised in the nucleus is the EFG1 gene that encodes the mitochondrial elongation factor G (MEF-G). This unique gene (AEFG1) has been isolated from the non-conventional dimorphic yeast, Arxula adeninivorans LS3. The AEFG1 gene comprises a ORF of 2,274 bp, which corresponds to 757 amino acids. In the present study, the regulation of AEFG1 has been analysed for different morphological stages of A. adeninivorans and various culture conditions. It was demonstrated that the transfer of aerobically growing cultures to anaerobic conditions resulted in an accumulation of AEFG1 transcript, correlating with an increase in AMEF-G protein concentration. Since this regulation occurred in budding-cell culture growing at 30 degrees C and in both of the mycelial cultures grown at 45 degrees C and 30 degrees C, respectively, it was the oxygen level (but not the cultivation temperature or the morphological stage) which influenced the AEFG1 regulation.

  10. Expression of a Serine Protease Gene prC Is Up-Regulated by Oxidative Stress in the Fungus Clonostachys rosea: Implications for Fungal Survival

    PubMed Central

    Liu, Wen-Jing; Zhou, Wei; Tao, Nan; Tu, Hui-Hui; Huang, Xiao-Wei; Yang, Jin-Kui; Zhang, Ke-Qin


    Background Soil fungi face a variety of environmental stresses such as UV light, high temperature, and heavy metals. Adaptation of gene expression through transcriptional regulation is a key mechanism in fungal response to environmental stress. In Saccharomyces cerevisiae, the transcription factors Msn2/4 induce stress-mediated gene expression by binding to the stress response element. Previous studies have demonstrated that the expression of extracellular proteases is up-regulated in response to heat shock in fungi. However, the physiological significance of regulation of these extracellular proteases by heat shock remains unclear. The nematophagous fungus Clonostachys rosea can secret an extracellular serine protease PrC during the infection of nematodes. Since the promoter of prC has three copies of the stress response element, we investigated the effect of environmental stress on the expression of prC. Methodology/Principal Findings Our results demonstrated that the expression of prC was up-regulated by oxidants (H2O2 or menadione) and heat shock, most likely through the stress response element. After oxidant treatment or heat shock, the germination of conidia in the wild type strain was significantly higher than that in the prC mutant strain in the presence of nematode cuticle. Interestingly, the addition of nematode cuticle significantly attenuated the production of reactive oxygen species (ROS) induced by oxidants and heat shock in the wild type strain, but not in prC mutant strain. Moreover, low molecule weight (<3 kD) degradation products of nematode cuticle suppressed the inhibitory effect of conidial germination induced by oxidants and heat shock. Conclusions/Significance These results indicate that PrC plays a protective role in oxidative stress in C. rosea. PrC degrades the nematode cuticle to produce degradation products, which in turn offer a protective effect against oxidative stress by scavenging ROS. Our study reveals a novel strategy for fungi to

  11. Epigenetic regulation of human buccal mucosa mitochondrial superoxide dismutase gene expression by diet.


    Thaler, Roman; Karlic, Heidrun; Rust, Petra; Haslberger, Alexander G


    The impact of nutrition on the epigenetic machinery has increasingly attracted interest. The aim of the present study was to demonstrate the effects of various diets on methylation and gene expression. The antioxidative enzyme mitochondrial superoxide dismutase (MnSOD) was chosen as the model system because epigenetic regulation has been previously shown in cell lines for this gene. Promoter methylation and gene expression of MnSOD in buccal swabs from three sample groups were analysed. The three groups included: (1) forty vegetarians (aged 20-30 years); (2) age-matched omnivores; (3) elderly omnivores (aged>85 years). A 3-fold increase in the expression of the MnSOD gene was associated with decreased CpG methylation of the analysed promoter region in the vegetarian group compared with the age-matched omnivores group. Expression and promoter methylation of the MnSOD gene in elderly omnivores showed no significant differences compared with younger omnivores. In accordance with previous findings in various tissues, DNA global methylation was found to be significantly higher (30 %) in buccal swabs of younger subjects (independent of the diet), than in those of elderly omnivores. In the control experiment which was designed to verify the findings of the human buccal swab studies, the Caco-2 cell line was treated with zebularine. Results of the control study showed a 6-fold increase of MnSOD expression, an approximately 40 % decreased methylation of specified CpG in the MnSOD promoter and a 50 % reduction of global DNA methylation. These results indicate that diet affects the epigenetic regulation of human MnSOD.

  12. Mitochondrial genes and genomes support a cryptic species of tapeworm within Taenia taeniaeformis.


    Jia, Wanzhong; Yan, Hongbin; Lou, Zhongzi; Ni, Xingwei; Dyachenko, Viktor; Li, Hongmin; Littlewood, D Timothy J


    Taenia taeniaeformis is a globally distributed cestode, which uses felids as definitive and rodents as intermediate hosts. The complete mitochondrial DNA (mtDNA) of T. taeniaeformis from Germany (Tt-GER) was sequenced, and compared with that of another isolate from China (GenBank NC_014768; Tt-CHN), both taken from cats. Analysis of the two mtDNAs indicated that the isolates are significantly different from one another with 12.6% and 9.9% nucleotide and amino acid divergence between them, for concatenated protein-coding genes; overall difference based on a pairwise nucleotide alignment of complete mtDNAs was 11.8%. A phylogenetic analysis based on the 12 protein-coding genes of all available taeniid mtDNAs confirmed the two T. taeniaeformis isolates as sister taxa (likely separate species) and early divergent members of the genus, as suggested previously by morphology. Phylogenetic analysis of published fragments of mt genes rrnS, cox1 and nad1, which represent multiple geographic isolates of T. taeniaeformis also resolve two distinct clades that at present do not seem to be geographically isolated. Mean pairwise (nucleotide) differences between the two clades of T. taeniaeformis were approximately 11%, 10% and 13% in partial rrnS (182bp), cox1 (371bp) and nad1 (459bp) genes, respectively. Differences between entire mtDNAs and partial mt genes of the two T. taeniaeformis isolates are of a similar magnitude between established taeniid sister species. Tt-CHN differs from all other Taenia mtDNAs in lacking a short (∼69bp) non-coding region between trnY and trnL1. Partial mt fragment analysis highlighted likely misidentifications of T. taeniaeformis on GenBank.

  13. The complete mitochondrial genome of the sea spider Achelia bituberculata (Pycnogonida, Ammotheidae): arthropod ground pattern of gene arrangement

    PubMed Central

    Park, Shin-Ju; Lee, Yong-Seok; Hwang, Ui Wook


    Background The phylogenetic position of pycnogonids is a long-standing and controversial issue in arthropod phylogeny. This controversy has recently been rekindled by differences in the conclusions based on neuroanatomical data concerning the chelifore and the patterns of Hox expression. The mitochondrial genome of a sea spider, Nymphon gracile (Pycnogonida, Nymphonidae), was recently reported in an attempt to address this issue. However, N. gracile appears to be a long-branch taxon on the phylogenetic tree and exhibits a number of peculiar features, such as 10 tRNA translocations and even an inversion of several protein-coding genes. Sequences of other pycnogonid mitochondrial genomes are needed if the position of pycnogonids is to be elucidated on this basis. Results The complete mitochondrial genome (15,474 bp) of a sea spider (Achelia bituberculata) belonging to the family Ammotheidae, which combines a number of anatomical features considered plesiomorphic with respect to other pycnogonids, was sequenced and characterized. The genome organization shows the features typical of most metazoan animal genomes (37 tightly-packed genes). The overall gene arrangement is completely identical to the arthropod ground pattern, with one exception: the position of the trnQ gene between the rrnS gene and the control region. Maximum likelihood and Bayesian inference trees inferred from the amino acid sequences of mitochondrial protein-coding genes consistently indicate that the pycnogonids (A. bituberculata and N. gracile) may be closely related to the clade of Acari and Araneae. Conclusion The complete mitochondrial genome sequence of A. bituberculata (Family Ammotheidae) and the previously-reported partial sequence of Endeis spinosa show the gene arrangement patterns typical of arthropods (Limulus-like), but they differ markedly from that of N. gracile. Phylogenetic analyses based on mitochondrial protein-coding genes showed that Pycnogonida may be authentic arachnids

  14. Matrilineal genetic structure and female-mediated gene flow in red grouse (Lagopus lagopus scoticus): an analysis using mitochondrial DNA.


    Piertney, S B; MacColl, A D; Bacon, P J; Racey, P A; Lambin, X; Dallas, J F


    DNA sequence variation at the hypervariable 5' end of the mitochondrial control region was examined in 247 individuals to detect genetic divergence among 14 populations of red grouse (Lagopus lagopus scoticus) in northeastern Scotland. Ten haplotypes were resolved, several of which were shared among populations. Analysis of molecular variance, Nei's gamma ST, and a cladistic estimate of the amount of gene flow indicated a lack of overall population differentiation. Patterns of overall panmixia are in stark contrast to previous reports of localized subdivision among the same set of populations detected using hypervariable microsatellite markers. Because grouse cocks are territorial and show extreme natal philopatry and females are the dispersing sex, such discordance could be explained by sex-biased dispersal, with extensive female-mediated gene flow preventing mitochondrial DNA divergence. However, it is difficult to reconcile how effective dispersal of females would not homogenize both mitochondrial and nuclear structure simultaneously. We use a model that examines the spatial and temporal dynamics of diparentally and uniparentally inherited genes to show that, under realistic ecological scenarios and with specific differences in the dispersal of males and females, the local effective size of the nuclear genome can be less than that of the mitochondrial and the patterns of structuring we observe are meaningful.

  15. Aging-dependent alterations in gene expression and a mitochondrial signature of responsiveness to human influenza vaccination.


    Thakar, Juilee; Mohanty, Subhasis; West, A Phillip; Joshi, Samit R; Ueda, Ikuyo; Wilson, Jean; Meng, Hailong; Blevins, Tamara P; Tsang, Sui; Trentalange, Mark; Siconolfi, Barbara; Park, Koonam; Gill, Thomas M; Belshe, Robert B; Kaech, Susan M; Shadel, Gerald S; Kleinstein, Steven H; Shaw, Albert C


    To elucidate gene expression pathways underlying age-associated impairment in influenza vaccine response, we screened young (age 21-30) and older (age≥65) adults receiving influenza vaccine in two consecutive seasons and identified those with strong or absent response to vaccine, including a subset of older adults meeting criteria for frailty. PBMCs obtained prior to vaccination (Day 0) and at day 2 or 4, day 7 and day 28 post-vaccine were subjected to gene expression microarray analysis. We defined a response signature and also detected induction of a type I interferon response at day 2 and a plasma cell signature at day 7 post-vaccine in young responders. The response signature was dysregulated in older adults, with the plasma cell signature induced at day 2, and was never induced in frail subjects (who were all non-responders). We also identified a mitochondrial signature in young vaccine responders containing genes mediating mitochondrial biogenesis and oxidative phosphorylation that was consistent in two different vaccine seasons and verified by analyses of mitochondrial content and protein expression. These results represent the first genome-wide transcriptional profiling analysis of age-associated dynamics following influenza vaccination, and implicate changes in mitochondrial biogenesis and function as a critical factor in human vaccine responsiveness.

  16. [Variability of nucleotide sequences of the mitochondrial DNA cytochrome c gene in dolly varden and taranetz char].


    Radchenko, O A; Derenko, M V; Maliarchuk, B A


    Nucleotide sequence of the 307-bp fragment of the mitochondrial DNA cytochrome b gene was determined in representatives of the three species of the Salvelinus genus, specifically, dolly varden char (S. malma), taranetz char (S. taranetzi), and white-spotted char (S. leucomaenis). These results pointed to a high level of mitochondrial DNA (mtDNA) divergence between white-spotted char and dolly varden char, on the one hand, and taranetz char, on the other (the mean d value was 5.45%). However, the divergence between the dolly varden char and taranetz char was only 0.81%, which is comparable with the level of intraspecific divergence in the dolly varden char (d = 0.87%). It was shown that the dolly varden char mitochondrial gene pool contained DNA lineages differing from the main mtDNA pool at least in the taranetz char-specific mitochondrial lineages. One of these dolly varden char mtDNA lineages was characterized by the presence of the restriction endonuclease MspI-D variant of the cytochrome b gene. This lineage was widely distributed in the Chukotka populations but it was not detected in the Yana River (Okhotsk sea) populations. These findings suggest that dolly varden char has a more ancient evolutionary lineage, diverging from the common ancestor earlier than did taranetz char.

  17. Estrogen-related receptor {alpha} is essential for the expression of antioxidant protection genes and mitochondrial function

    SciTech Connect

    Rangwala, Shamina M. . E-mail:; Li, Xiaoyan; Lindsley, Loren; Wang, Xiaomei; Shaughnessy, Stacey; Daniels, Thomas G.; Szustakowski, Joseph; Nirmala, N.R.; Wu, Zhidan; Stevenson, Susan C.


    Estrogen-related receptor {alpha} (ERR{alpha}) is an important mediator of mitochondrial biogenesis and function. To investigate the transcriptional network controlling these phenomena, we investigated mitochondrial gene expression in embryonic fibroblasts isolated from ERR{alpha} null mice. Peroxisome proliferator-activated receptor {gamma} coactivator-1{alpha} (PGC-1{alpha}) stimulated mitochondrial gene expression program in control cells, but not in the ERR{alpha} null cells. Interestingly, the induction of levels of mitochondrial oxidative stress protection genes in response to increased PGC-1{alpha} levels was dependent on ERR{alpha}. Furthermore, we found that the PGC-1{alpha}-mediated induction of estrogen-related receptor {gamma} and nuclear respiratory factor 2 (NRF-2), was dependent on the presence of ERR{alpha}. Basal levels of NRF-2 were decreased in the absence of ERR{alpha}. The absence of ERR{alpha} resulted in a decrease in citrate synthase enzyme activity in response to PGC-1{alpha} overexpression. Our results indicate an essential role for ERR{alpha} as a key regulator of oxidative metabolism.

  18. The Infertility of Repeat-Breeder Cows During Summer Is Associated with Decreased Mitochondrial DNA and Increased Expression of Mitochondrial and Apoptotic Genes in Oocytes.


    Ferreira, Roberta Machado; Chiaratti, Marcos Roberto; Macabelli, Carolina Habermann; Rodrigues, Carlos Alberto; Ferraz, Márcio Leão; Watanabe, Yeda Fumie; Smith, Lawrence Charles; Meirelles, Flávio Vieira; Baruselli, Pietro Sampaio


    Oocyte quality is known to be a major cause of infertility in repeat-breeder (RB) and heat-stressed dairy cows. However, the mechanisms by which RB oocytes become less capable of supporting embryo development remain largely unknown. Thus, the aim of this study was to investigate whether the decreased oocyte competence of RB cows (RBs) during summer is associated with an altered gene expression profile and a decrease in mitochondrial DNA (mtDNA) copy number. Therefore, oocytes collected from heifers, non-RBs in peak lactation (PLs), and RBs were used to evaluate mtDNA amounts as well as the expression levels of genes associated with the mitochondria (MT-CO1, NRF1, POLG, POLG2, PPARGC1A, and TFAM), apoptosis (BAX, BCL2, and ITM2B), and oocyte maturation (BMP15, FGF8, FGF10, FGF16, FGF17, and GDF9). The oocytes retrieved from RBs during winter contained over eight times more mtDNA than those retrieved from RBs during summer. They also contained significantly less mtDNA than oocytes retrieved from heifers and PLs during summer. Moreover, the expression of mitochondria- (NRF1, POLG, POLG2, PPARGC1A, and TFAM) and apoptosis-related (BAX and ITM2B) genes, as well as of GDF9, in RB oocytes collected during summer was significantly greater than that in oocytes collected from heifers and PLs during the same season. In oocytes from heifers and PLs, the expression levels of these genes were lower in those collected during summer compared with winter, but this difference was not observed in oocytes collected from RBs. Altogether, these data provide evidence of altered gene expression and reduced mtDNA copy number in the oocytes collected from RBs during summer. This indicates a loss of fertility in RBs during summer, which might be caused by a possible mitochondrial dysfunction associated with a greater chance of oocytes to undergo apoptosis.

  19. Characterization of the Entire Cystatin Gene Family in Barley and Their Target Cathepsin L-Like Cysteine-Proteases, Partners in the Hordein Mobilization during Seed Germination1[W

    PubMed Central

    Martinez, Manuel; Cambra, Ines; Carrillo, Laura; Diaz-Mendoza, Mercedes; Diaz, Isabel


    Plant cystatins are inhibitors of cysteine-proteases of the papain C1A and legumain C13 families. Cystatin data from multiple plant species have suggested that these inhibitors act as defense proteins against pests and pathogens and as regulators of protein turnover. In this study, we characterize the entire cystatin gene family from barley (Hordeum vulgare), which contain 13 nonredundant genes, and identify and characterize their target enzymes, the barley cathepsin L-like proteases. Cystatins and proteases were expressed and purified from Escherichia coli cultures. Each cystatin was found to have different inhibitory capability against barley cysteine-proteases in in vitro inhibitory assays using specific substrates. Real-time reverse transcription-polymerase chain reaction revealed that inhibitors and enzymes present a wide variation in their messenger RNA expression patterns. Their transcripts were mainly detected in developing and germinating seeds, and some of them were also expressed in leaves and roots. Subcellular localization of cystatins and cathepsin L-like proteases fused to green fluorescent protein demonstrated the presence of both protein families throughout the endoplasmic reticulum and the Golgi complex. Proteases and cystatins not only colocalized but also interacted in vivo in the plant cell, as revealed by bimolecular fluorescence complementation. The functional relationship between cystatins and cathepsin L-like proteases was inferred from their common implication as counterparts of mobilization of storage proteins upon barley seed germination. The opposite pattern of transcription expression in gibberellin-treated aleurones presented by inhibitors and enzymes allowed proteases to specifically degrade B, C, and D hordeins stored in the endosperm of barley seeds. PMID:19759340

  20. A novel mitochondrial tRNAAla gene variant causes chronic progressive external ophthalmoplegia in a patient with Huntington disease

    PubMed Central

    Filosto, Massimiliano; Lanzi, Gaetana; Nesti, Claudia; Vielmi, Valentina; Marchina, Eleonora; Galvagni, Anna; Giliani, Silvia; Santorelli, Filippo M.; Padovani, Alessandro


    Chronic progressive external ophthalmoplegia is a mitochondrial disorder usually caused by single or multiple mitochondrial DNA (mtDNA) deletions and, more rarely, by maternally inherited mtDNA point mutations, most frequently in tRNA genes (MTT). We report on a patient presenting with a progressive eyelid ptosis with bilateral ophthalmoparesis, dysphagia, dysphonia and mild proximal limb weakness associate with a mild movement disorder characterized by abnormal involuntary movements involving head and limbs, imbalance and gait instability. Muscle biopsy demonstrated the presence of ragged red fibers and several cytochrome-C-oxidase negative fibers. Molecular analysis showed the novel m.5613T > C heteroplasmic mutation in the mitochondrial tRNAAla gene (MTTA) which disrupts a conserved site and fulfills the accepted criteria of pathogenicity. Moreover, a 38 CAG trinucleotide repeat expansion was found on the huntingtin gene, thus configuring a singular CPEO/“reduced penetrance” Huntington disease “double trouble”. With this novel MTTA point mutation, we extend the spectrum of provisional pathogenic changes in this gene, which is a very rare site of pathogenic mutation, and confirm that clinical expression of these mutations is hardly ever heterogeneous, including myopathy and CPEO. Mitochondrial involvement is an emerging key determinant in the pathogenesis of Huntington disease and it is well known that mutant huntingtin influences the mitochondrial respiratory complexes II and III. A synergist effect of the HTT and MTTA mutations on respiratory chain function may be hypothesized in our patient and should be regarded as a spur for further studies on the mtDNA/HTT reciprocal interactions. PMID:27014581

  1. Oxidative DNA damage drives carcinogenesis in MUTYH-associated-polyposis by specific mutations of mitochondrial and MAPK genes.


    Venesio, Tiziana; Balsamo, Antonella; Errichiello, Edoardo; Ranzani, Guglielmina N; Risio, Mauro


    MUTYH is a DNA-base-excision-repair gene implicated in the activation of nuclear and mitochondrial cell-death pathways. MUTYH germline mutations cause an inherited polyposis, MUTYH-associated-polyposis, characterized by multiple adenomas and increased susceptibility to colorectal cancer. Since this carcinogenesis remains partially unknown, we searched for nuclear and mitochondrial gene alterations that may drive the tumorigenic process. Ninety-six adenomas and 7 carcinomas from 12 MUTYH-associated-polyposis and 13 classical/attenuated adenomatous polyposis patients were investigated by sequencing and pyrosequencing for the presence of mutations in KRAS, BRAF, MT-CO1/MT-CO2 and MT-TD genes. KRAS mutations were identified in 24% MUTYH-associated-polyposis vs 15% classical/attenuated familial polyposis adenomas; mutated MUTYH-associated-polyposis adenomas exhibited only c.34G>T transversions in codon 12, an alteration typically associated with oxidative DNA damage, or mutations in codon 13; neither of these mutations was found in classical/attenuated familial polyposis adenomas (P<0.001). Mutated MUTYH-associated-polyposis carcinomas showed KRAS c.34G>T transversions, prevalently occurring with BRAFV600E; none of the classical/attenuated familial polyposis carcinomas displayed these alterations. Comparing mitochondrial DNA from lymphocytes and adenomas of the same individuals, we detected variants in 82% MUTYH-associated-polyposis vs 38% classical/attenuated familial polyposis patients (P=0.040). MT-CO1/MT-CO2 missense mutations, which cause aminoacid changes, were only found in MUTYH-associated-polyposis lesions and were significantly associated with KRAS mutations (P=0.0085). We provide evidence that MUTYH-associated-polyposis carcinogenesis is characterized by the occurrence of specific mutations in both KRAS and phylogenetically conserved genes of mitochondrial DNA which are involved in controlling oxidative phosphorylation; this implies the existence of a

  2. [Nuclear gene involves in phenotype of non-syndromic deafness associated with mitochondrial 12S rRNA mutation].


    Zhao, Su Ying; Zhang, Hai Jun; Xu, Chun Hong; Shan, Xiang Nian


    The human mitochondrial 12S rRNA gene mutation at position 1555 associated with non-syndromic deafness and aminoglycoside-induced deafness. Family of Huaiyin in Jiangsu is one of the biggest non-syndromic deafness family in the world. In this family, deafness is maternally inherited. After establishing immortal lymphoblastoid cell lines of the family by EB virus, we analysed 17 lymphoblastoid cell lines derived, respectively, from symptomatic, asymptomatic and controll members of the family. Compared with control members, symptomatic and asymptomatic members both exhibited significant decreases in the rate of growth as well as in the rates of mitochondrial protein synthesis. But the extent of decreases is different and the severity of mitochondrial defect is related with its clinical phenotype. These results supported that the nuclear factor involves in the phenotypic manifestation of the non-syndromic deafness associated with the A1555G mutation.

  3. Molecular systematics of armadillos (Xenarthra, Dasypodidae): contribution of maximum likelihood and Bayesian analyses of mitochondrial and nuclear genes.


    Delsuc, Frédéric; Stanhope, Michael J; Douzery, Emmanuel J P


    The 30 living species of armadillos, anteaters, and sloths (Mammalia: Xenarthra) represent one of the three major clades of placentals. Armadillos (Cingulata: Dasypodidae) are the earliest and most speciose xenarthran lineage with 21 described species. The question of their tricky phylogeny was here studied by adding two mitochondrial genes (NADH dehydrogenase subunit 1 [ND1] and 12S ribosomal RNA [12S rRNA]) to the three protein-coding nuclear genes (alpha2B adrenergic receptor [ADRA2B], breast cancer susceptibility exon 11 [BRCA1], and von Willebrand factor exon 28 [VWF]) yielding a total of 6869 aligned nucleotide sites for thirteen xenarthran species. The two mitochondrial genes were characterized by marked excesses of transitions over transversions-with a strong bias toward CT transitions for the 12S rRNA-and exhibited two- to fivefold faster evolutionary rates than the fastest nuclear gene (ADRA2B). Maximum likelihood and Bayesian phylogenetic analyses supported the monophyly of Dasypodinae, Tolypeutinae, and Euphractinae, with the latter two armadillo subfamilies strongly clustering together. Conflicting branching points between individual genes involved relationships within the subfamilies Tolypeutinae and Euphractinae. Owing to a greater number of informative sites, the overall concatenation favored the mitochondrial topology with the classical grouping of Cabassous and Priodontes within Tolypeutinae, and a close relationship between Euphractus and Chaetophractus within Euphractinae. However, low statistical support values associated with almost equal distributions of apomorphies among alternatives suggested that two parallel events of rapid speciation occurred within these two armadillo subfamilies.

  4. Product of Saccharomyces cerevisiae nuclear gene PET494 activates translation of a specific mitochondrial mRNA.

    PubMed Central

    Costanzo, M C; Fox, T D


    The product of Saccharomyces cerevisiae nuclear gene PET494 is known to be required for a posttranscriptional step in the accumulation of one mitochondrial gene product, subunit III of cytochrome c oxidase (coxIII). Here we show that the PET494 protein probably acts in mitochondria by demonstrating that both a PET494-beta-galactosidase fusion protein and unmodified PET494 are specifically associated with mitochondria. To define the PET494 site of action, we isolated mutations that suppress a pet494 deletion. These mutations were rearrangements of the mitochondrial gene oxi2 that encodes coxIII. The suppressor oxi2 genes had acquired the 5'-flanking sequences of other mitochondrial genes and gave rise to oxi2 transcripts carrying the 5'-untranslated leaders of their mRNAs. These results demonstrate that in wild-type cells PET494 specifically promotes coxIII translation, probably by interacting with the 5'-untranslated leader of the oxi2 mRNA. Images PMID:3099165

  5. Mitochondrial unfolded protein response controls matrix pre-RNA processing and translation.


    Münch, Christian; Harper, J Wade


    The mitochondrial matrix is unique in that it must integrate the folding and assembly of proteins derived from the nuclear and mitochondrial genomes. In Caenorhabditis elegans, the mitochondrial unfolded protein response (UPRmt) senses matrix protein misfolding and induces a program of nuclear gene expression, including mitochondrial chaperonins, to promote mitochondrial proteostasis. While misfolded mitochondrial-matrix-localized ornithine transcarbamylase induces chaperonin expression, our understanding of mammalian UPRmt is rudimentary, reflecting a lack of acute triggers for UPRmt activation. This limitation has prevented analysis of the cellular responses to matrix protein misfolding and the effects of UPRmt on mitochondrial translation to control protein folding loads. Here we combine pharmacological inhibitors of matrix-localized HSP90/TRAP1 (ref. 8) or LON protease, which promote chaperonin expression, with global transcriptional and proteomic analysis to reveal an extensive and acute response of human cells to UPRmt. This response encompasses widespread induction of nuclear genes, including matrix-localized proteins involved in folding, pre-RNA processing and translation. Functional studies revealed rapid but reversible translation inhibition in mitochondria occurring concurrently with defects in pre-RNA processing caused by transcriptional repression and LON-dependent turnover of the mitochondrial pre-RNA processing nuclease MRPP3 (ref. 10). This study reveals that acute mitochondrial protein folding stress activates both increased chaperone availability within the matrix and reduced matrix-localized protein synthesis through translational inhibition, and provides a framework for further dissection of mammalian UPRmt.

  6. Characterization of mitochondrial ribosomal RNA genes in gadiformes: sequence variations, secondary structural features, and phylogenetic implications.


    Bakke, Ingrid; Johansen, Steinar


    Secondary structure features of mitochondrial ribosomal RNAs (mt-rRNAs) of bony fishes were investigated by a DNA sequence alignment approach. The small subunit (SSU) and large subunit (LSU) mt-rRNA genes were found to contain several additional variable regions compared to their mammalian counterparts. Fish mt-LSU rRNA genes were found to be longer than the mammalians due to increased length of some of the variable regions. The 5' and 3' ends of Atlantic cod mt-rRNAs were precisely mapped. The 3' ends of mt-SSU rRNAs were found to be homogenous and mono-adenylated, whereas that of the mt-LSU rRNAs were heterogenous and oligo-adenylated. The 5' ends of mt-SSU rRNAs appeared to be heterogenous, corresponding to the presumed first and second positions of the gene. Sequences of the central domain and the D-domain of the mt-SSU and mt-LSU rRNA genes, respectively, were determined and characterized for 11 gadiform species (representing the families Gadidae, Lotidae, Ranicipitidae, Merlucciidae, Phycidae, and Macrouridae) and one Lophiidae species. Detailed secondary structure models of the RNA regions are presented for the Atlantic cod (Gadus morhua) and Roundnose grenadier (Coryphaeonides rupestris). Saturation plots revealed that DNA nucleotide positions corresponding to unpaired RNA regions become saturated with transitions at sequence divergence levels about 0.15. Phylogenetic analyses revealed some aspects of gadiform relationships. Gadidae was identified as the most derived of the gadiform families. Lotidae was found to be the family closest related to Gadidae, and Ranicipitidae was also recognized as a derived gadiform taxon.

  7. Insulin Sensitizing Pharmacology of Thiazolidinediones Correlates with Mitochondrial Gene Expression rather than Activation of PPARγ

    PubMed Central

    Bolten, Charles W.; Blanner, Patrick M.; McDonald, William G.; Staten, Nicholas R.; Mazzarella, Richard A.; Arhancet, Graciela B.; Meier, Martin F.; Weiss, David J.; Sullivan, Patrick M.; Hromockyj, Alexander E.; Kletzien, Rolf F.; Colca, Jerry R.


    Insulin sensitizing thiazolidinediones (TZDs) are generally considered to work as agonists for the nuclear receptor peroxisome proliferative activated receptor-gamma (PPARγ). However, TZDs also have acute, non-genomic metabolic effects and it is unclear which actions are responsible for the beneficial pharmacology of these compounds. We have taken advantage of an analog, based on the metabolism of pioglitazone, which has much reduced ability to activate PPARγ. This analog (PNU-91325) was compared to rosiglitazone, the most potent PPARγ activator approved for human use, in a variety of studies both in vitro and in vivo. The data demonstrate that PNU-91325 is indeed much less effective than rosiglitazone at activating PPARγ both in vitro and in vivo. In contrast, both compounds bound similarly to a mitochondrial binding site and acutely activated PI-3 kinase-directed phosphorylation of AKT, an action that was not affected by elimination of PPARγ activation. The two compounds were then compared in vivo in both normal C57 mice and diabetic KKAy mice to determine whether their pharmacology correlated with biomarkers of PPARγ activation or with the expression of other gene transcripts. As expected from previous studies, both compounds improved insulin sensitivity in the diabetic mice, and this occurred in spite of the fact that there was little increase in expression of the classic PPARγ target biomarker adipocyte binding protein-2 (aP2) with PNU-91325 under these conditions. An examination of transcriptional profiling of key target tissues from mice treated for one week with both compounds demonstrated that the relative pharmacology of the two thiazolidinediones correlated best with an increased expression of an array of mitochondrial proteins and with expression of PPARγ coactivator 1-alpha (PGC1α), the master regulator of mitochondrial biogenesis. Thus, important pharmacology of the insulin sensitizing TZDs may involve acute actions, perhaps on the

  8. Phylogeny of anopheline (Diptera: Culicidae) species in southern Africa, based on nuclear and mitochondrial genes.


    Norris, Laura C; Norris, Douglas E


    A phylogeny of anthropophilic and zoophilic anopheline mosquito species was constructed, using the nuclear internal transcribed spacer 2 (ITS2) and mitochondrial cytochrome oxidase subunit I (COI) genes. The ITS2 alignment, typically difficult due to its noncoding nature and large size variations, was aided by using predicted secondary structure, making this phylogenetically useful gene more amenable to investigation. This phylogeny is unique in explicitly including zoophilic, non-vector anopheline species in order to illustrate their relationships to malaria vectors. Two new, cryptic species, Anopheles funestus-like and Anopheles rivulorum-like, were found to be present in Zambia for the first time. Sequences from the D3 region of the 28S rDNA suggest that the Zambian An. funestus-like may be a hybrid or geographical variant of An. funestus-like, previously reported in Malawi. This is the first report of An. rivulorum-like sympatric with An. rivulorum (Leeson), suggesting that these are separate species rather than geographic variants.

  9. Application of mitochondrial genes sequences for measuring the genetic diversity of Arabian oryx.


    Khan, Haseeb A; Arif, Ibrahim A; Shobrak, Mohammad; Homaidan, Ali A Al; Farhan, Ahmad H Al; Sadoon, Mohammad Al


    Arabian oryx (Oryx leucoryx) had faced extinction in the wild more than three decades ago and was saved by the prudent efforts of captive breeding programs. A clear understanding of the molecular diversity of contemporary Arabian oryx population is important for the long term success of captive breeding and reintroduction of this potentially endangered species. We have sequenced the segments of mitochondrial DNA including12S rRNA, 16S rRNA, cytochrome b (Cyt-b) and control region (CR) genes of 24 captive-bred and reintroduced animals. Although the sequences of 12S rRNA, 16S rRNA and Cyt-b were found to be identical for all the samples, typical sequence variations in the CR gene were observed in the form of 7 haplotypes. One of these haplotypes has been reported earlier while the remaining 6 haplotypes are novel and represent different lineages from the founders. The haplotype and nucleotide diversities were found to be 0.789 and 0.009 respectively. The genetic distances among the 7 mtDNA haplotypes varied from 0.001 to 0.017. These findings are of potential relevance to the management of captive breeding programs for the conservation of Arabian oryx.

  10. Phylogeny of anopheline (Diptera: Culicidae) species in southern Africa, based on nuclear and mitochondrial genes

    PubMed Central

    Norris, Douglas E.


    A phylogeny of anthropophilic and zoophilic anopheline mosquito species was constructed, using the nuclear internal transcribed spacer 2 (ITS2) and mitochondrial cytochrome oxidase subunit I (COI) genes. The ITS2 alignment, typically difficult due to its noncoding nature and large size variations, was aided by using predicted secondary structure, making this phylogenetically useful gene more amenable to investigation. This phylogeny is unique in explicitly including zoophilic, non-vector anopheline species in order to illustrate their relationships to malaria vectors. Two new, cryptic species, Anopheles funestus-like and Anopheles rivulorum-like, were found to be present in Zambia for the first time. Sequences from the D3 region of the 28S rDNA suggest that the Zambian An. funestus-like may be a hybrid or geographical variant of An. funestus-like, previously reported in Malawi. This is the first report of An. rivulorum-like sympatric with An. rivulorum (Leeson), suggesting that these are separate species rather than geographic variants. PMID:26047180

  11. Polymorphisms of the murine mitochondrial ND4, CYTB and COX3 genes impact hematopoiesis during aging

    PubMed Central

    Timmer, Katrin; Sekora, Anett; Knübel, Gudrun; Escobar, Hugo Murua; Fuellen, Georg; Ibrahim, Saleh M.; Tiedge, Markus; Baltrusch, Simone; Jaster, Robert; Köhling, Rüdiger; Junghanss, Christian


    During aging, mitochondrial DNA (mtDNA) can accumulate mutations leading to increasing levels of reactive oxygen species (ROS). Increased ROS were described to activate formerly quiescent hematopoietic stem cells (HSC). Mutations in mtDNA were shown to enhance the risk for myelodysplastic syndrome and leukemia. However, the complex relationship between mtDNA variations, ROS and aging of the hematopoietic system is not fully understood. Herein, three mouse strains with mtDNA polymorphisms in genes of respiratory chain complexes I (ND4), III (CYTB) and IV (COX3) were compared to a reference strain during aging. Analysis focused on ROS and ATP levels, bone marrow composition and blood counts. Additionally, hematopoietic restoration capacity following cytotoxic stress was tested. Mice with polymorphisms in ND4 and CYTB gene had significantly decreasing ROS levels in bone marrow cells during aging, without effecting ATP levels. In addition, the frequency of stem and progenitor cells increased during aging but the amount of lymphocytes in the peripheral blood decreased during aging. In summary, the presence of mtDNA polymorphisms affecting the respiratory chain complexes I, III and IV was associated with altered ROS levels as well as changes in BM and peripheral blood composition during aging. PMID:27626489

  12. A horizontally transferred tRNA(Cys) gene in the sugar beet mitochondrial genome: evidence that the gene is present in diverse angiosperms and its transcript is aminoacylated.


    Kitazaki, Kazuyoshi; Kubo, Tomohiko; Kagami, Hiroyo; Matsumoto, Takuma; Fujita, Asami; Matsuhira, Hiroaki; Matsunaga, Muneyuki; Mikami, Tetsuo


    Of the two tRNA(Cys) (GCA) genes, trnC1-GCA and trnC2-GCA, previously identified in mitochondrial genome of sugar beet, the former is a native gene and probably a pseudo-copy, whereas the latter, of unknown origin, is transcribed into a tRNA [tRNA(Cys2) (GCA)]. In this study, the trnC2-GCA sequence was mined from various public databases. To evaluate whether or not the trnC2-GCA sequence is located in the mitochondrial genome, the relative copy number of its sequence to nuclear gene was assessed in a number of angiosperm species, using a quantitative real-time PCR assay. The trnC2-GCA seque