Science.gov

Sample records for mitochondrial protease gene

  1. StAR Enhances Transcription of Genes Encoding the Mitochondrial Proteases Involved in Its Own Degradation

    PubMed Central

    Bahat, Assaf; Perlberg, Shira; Melamed-Book, Naomi; Lauria, Ines; Langer, Thomas

    2014-01-01

    Steroidogenic acute regulatory protein (StAR) is essential for steroid hormone synthesis in the adrenal cortex and the gonads. StAR activity facilitates the supply of cholesterol substrate into the inner mitochondrial membranes where conversion of the sterol to a steroid is catalyzed. Mitochondrial import terminates the cholesterol mobilization activity of StAR and leads to mounting accumulation of StAR in the mitochondrial matrix. Our studies suggest that to prevent mitochondrial impairment, StAR proteolysis is executed by at least 2 mitochondrial proteases, ie, the matrix LON protease and the inner membrane complexes of the metalloproteases AFG3L2 and AFG3L2:SPG7/paraplegin. Gonadotropin administration to prepubertal rats stimulated ovarian follicular development associated with increased expression of the mitochondrial protein quality control system. In addition, enrichment of LON and AFG3L2 is evident in StAR-expressing ovarian cells examined by confocal microscopy. Furthermore, reporter studies of the protease promoters examined in the heterologous cell model suggest that StAR expression stimulates up to a 3.5-fold increase in the protease gene transcription. Such effects are StAR-specific, are independent of StAR activity, and failed to occur upon expression of StAR mutants that do not enter the matrix. Taken together, the results of this study suggest the presence of a novel regulatory loop, whereby acute accumulation of an apparent nuisance protein in the matrix provokes a mitochondria to nucleus signaling that, in turn, activates selected transcription of genes encoding the enrichment of mitochondrial proteases relevant for enhanced clearance of StAR. PMID:24422629

  2. StAR enhances transcription of genes encoding the mitochondrial proteases involved in its own degradation.

    PubMed

    Bahat, Assaf; Perlberg, Shira; Melamed-Book, Naomi; Lauria, Ines; Langer, Thomas; Orly, Joseph

    2014-02-01

    Steroidogenic acute regulatory protein (StAR) is essential for steroid hormone synthesis in the adrenal cortex and the gonads. StAR activity facilitates the supply of cholesterol substrate into the inner mitochondrial membranes where conversion of the sterol to a steroid is catalyzed. Mitochondrial import terminates the cholesterol mobilization activity of StAR and leads to mounting accumulation of StAR in the mitochondrial matrix. Our studies suggest that to prevent mitochondrial impairment, StAR proteolysis is executed by at least 2 mitochondrial proteases, ie, the matrix LON protease and the inner membrane complexes of the metalloproteases AFG3L2 and AFG3L2:SPG7/paraplegin. Gonadotropin administration to prepubertal rats stimulated ovarian follicular development associated with increased expression of the mitochondrial protein quality control system. In addition, enrichment of LON and AFG3L2 is evident in StAR-expressing ovarian cells examined by confocal microscopy. Furthermore, reporter studies of the protease promoters examined in the heterologous cell model suggest that StAR expression stimulates up to a 3.5-fold increase in the protease gene transcription. Such effects are StAR-specific, are independent of StAR activity, and failed to occur upon expression of StAR mutants that do not enter the matrix. Taken together, the results of this study suggest the presence of a novel regulatory loop, whereby acute accumulation of an apparent nuisance protein in the matrix provokes a mitochondria to nucleus signaling that, in turn, activates selected transcription of genes encoding the enrichment of mitochondrial proteases relevant for enhanced clearance of StAR.

  3. Multifunctional Mitochondrial AAA Proteases

    PubMed Central

    Glynn, Steven E.

    2017-01-01

    Mitochondria perform numerous functions necessary for the survival of eukaryotic cells. These activities are coordinated by a diverse complement of proteins encoded in both the nuclear and mitochondrial genomes that must be properly organized and maintained. Misregulation of mitochondrial proteostasis impairs organellar function and can result in the development of severe human diseases. ATP-driven AAA+ proteins play crucial roles in preserving mitochondrial activity by removing and remodeling protein molecules in accordance with the needs of the cell. Two mitochondrial AAA proteases, i-AAA and m-AAA, are anchored to either face of the mitochondrial inner membrane, where they engage and process an array of substrates to impact protein biogenesis, quality control, and the regulation of key metabolic pathways. The functionality of these proteases is extended through multiple substrate-dependent modes of action, including complete degradation, partial processing, or dislocation from the membrane without proteolysis. This review discusses recent advances made toward elucidating the mechanisms of substrate recognition, handling, and degradation that allow these versatile proteases to control diverse activities in this multifunctional organelle. PMID:28589125

  4. Biochemical and functional analysis of the YME1 gene product, an ATP and zinc-dependent mitochondrial protease from S. cerevisiae.

    PubMed Central

    Weber, E R; Hanekamp, T; Thorsness, P E

    1996-01-01

    Inactivation of YME1 in yeast causes several distinct phenotypes: an increased rate of DNA escape from mitochondria, temperature-sensitive growth on nonfermentable carbon sources, extremely slow growth when mitochondrial DNA is completely absent from the cell, and altered morphology of the mitochondrial compartment. The protein encoded by YME1, Yme1p, contains two highly conserved sequence elements, one implicated in the binding and hydrolysis of ATP, and the second characteristic of active site residues found in neutral, zinc-dependent proteases. Both the putative ATPase and zinc-dependent protease elements are necessary for the function of Yme1p as genes having mutations in critical residues of either of these motifs are unable to suppress any of the phenotypes exhibited by yme1 deletion strains. Yme1p co-fractionates with proteins associated with the mitochondrial inner membrane, is tightly associated with this membrane, and is oriented with the bulk of the protein facing the matrix. Unassembled subunit II of cytochrome oxidase is stabilized in yme1 yeast strains. The data support a model in which Yme1p is an ATP and zinc-dependent protease associated with the matrix side of the inner mitochondrial membrane. Subunit II of cytochrome oxidase, when not assembled into a higher order complex, is a likely substrate of Yme1p. Images PMID:8688560

  5. Mitochondrial proteases and protein quality control in ageing and longevity.

    PubMed

    Hamon, Marie-Paule; Bulteau, Anne-Laure; Friguet, Bertrand

    2015-09-01

    Mitochondria have been implicated in the ageing process and the lifespan modulation of model organisms. Mitochondria are the main providers of energy in eukaryotic cells but also represent both a major source of reactive oxygen species and targets for protein oxidative damage. Since protein damage can impair mitochondrial function, mitochondrial proteases are critically important for protein maintenance and elimination of oxidized protein. In the mitochondrial matrix, protein quality control is mainly achieved by the Lon and Clp proteases which are also key players in damaged mitochondrial proteins degradation. Accumulation of damaged macromolecules resulting from oxidative stress and failure of protein maintenance constitutes a hallmark of cellular and organismal ageing and is believed to participate to the age-related decline of cellular function. Hence, age-related impairment of mitochondrial protein quality control may therefore contribute to the age-associated build-up of oxidized protein and alterations of mitochondrial redox and protein homeostasis.

  6. Mitochondrial cereblon functions as a Lon-type protease.

    PubMed

    Kataoka, Kosuke; Nakamura, China; Asahi, Toru; Sawamura, Naoya

    2016-07-15

    Lon protease plays a major role in the protein quality control system in mammalian cell mitochondria. It is present in the mitochondrial matrix, and degrades oxidized and misfolded proteins, thereby protecting the cell from various extracellular stresses, including oxidative stress. The intellectual disability-associated and thalidomide-binding protein cereblon (CRBN) contains a large, highly conserved Lon domain. However, whether CRBN has Lon protease-like function remains unknown. Here, we determined if CRBN has a protective function against oxidative stress, similar to Lon protease. We report that CRBN partially distributes in mitochondria, suggesting it has a mitochondrial function. To specify the mitochondrial role of CRBN, we mitochondrially expressed CRBN in human neuroblastoma SH-SY5Y cells. The resulting stable SH-SY5Y cell line showed no apparent effect on the mitochondrial functions of fusion, fission, and membrane potential. However, mitochondrially expressed CRBN exhibited protease activity, and was induced by oxidative stress. In addition, stably expressed cells exhibited suppressed neuronal cell death induced by hydrogen peroxide. These results suggest that CRBN functions specifically as a Lon-type protease in mitochondria.

  7. Mitochondrial cereblon functions as a Lon-type protease

    PubMed Central

    Kataoka, Kosuke; Nakamura, China; Asahi, Toru; Sawamura, Naoya

    2016-01-01

    Lon protease plays a major role in the protein quality control system in mammalian cell mitochondria. It is present in the mitochondrial matrix, and degrades oxidized and misfolded proteins, thereby protecting the cell from various extracellular stresses, including oxidative stress. The intellectual disability-associated and thalidomide-binding protein cereblon (CRBN) contains a large, highly conserved Lon domain. However, whether CRBN has Lon protease-like function remains unknown. Here, we determined if CRBN has a protective function against oxidative stress, similar to Lon protease. We report that CRBN partially distributes in mitochondria, suggesting it has a mitochondrial function. To specify the mitochondrial role of CRBN, we mitochondrially expressed CRBN in human neuroblastoma SH-SY5Y cells. The resulting stable SH-SY5Y cell line showed no apparent effect on the mitochondrial functions of fusion, fission, and membrane potential. However, mitochondrially expressed CRBN exhibited protease activity, and was induced by oxidative stress. In addition, stably expressed cells exhibited suppressed neuronal cell death induced by hydrogen peroxide. These results suggest that CRBN functions specifically as a Lon-type protease in mitochondria. PMID:27417535

  8. New roles for mitochondrial proteases in health, ageing and disease.

    PubMed

    Quirós, Pedro M; Langer, Thomas; López-Otín, Carlos

    2015-06-01

    Recent advances in mitochondrial biology have revealed the high diversity and complexity of proteolytic enzymes that regulate mitochondrial function. We have classified mitochondrial proteases, or mitoproteases, on the basis of their function and location, and defined the human mitochondrial degradome as the complete set of mitoproteases that are encoded by the human genome. In addition to their nonspecific degradative functions, mitoproteases perform highly regulated proteolytic reactions that are important in mitochondrial function, integrity and homeostasis. These include protein synthesis, quality control, mitochondrial biogenesis and dynamics, mitophagy and apoptosis. Impaired or dysregulated function of mitoproteases is associated with ageing and with many pathological conditions such as neurodegenerative disorders, metabolic syndromes and cancer. A better understanding of the mitochondrial proteolytic landscape and its modulation may contribute to improving human lifespan and 'healthspan'.

  9. The Mitochondrial m-AAA Protease Prevents Demyelination and Hair Greying

    PubMed Central

    Jacquemyn, Julie; Barth, Esther; Langer, Thomas; Niessen, Carien M.; Rugarli, Elena I.

    2016-01-01

    The m-AAA protease preserves proteostasis of the inner mitochondrial membrane. It ensures a functional respiratory chain, by controlling the turnover of respiratory complex subunits and allowing mitochondrial translation, but other functions in mitochondria are conceivable. Mutations in genes encoding subunits of the m-AAA protease have been linked to various neurodegenerative diseases in humans, such as hereditary spastic paraplegia and spinocerebellar ataxia. While essential functions of the m-AAA protease for neuronal survival have been established, its role in adult glial cells remains enigmatic. Here, we show that deletion of the highly expressed subunit AFG3L2 in mature mouse oligodendrocytes provokes early-on mitochondrial fragmentation and swelling, as previously shown in neurons, but causes only late-onset motor defects and myelin abnormalities. In contrast, total ablation of the m-AAA protease, by deleting both Afg3l2 and its paralogue Afg3l1, triggers progressive motor dysfunction and demyelination, owing to rapid oligodendrocyte cell death. Surprisingly, the mice showed premature hair greying, caused by progressive loss of melanoblasts that share a common developmental origin with Schwann cells and are targeted in our experiments. Thus, while both neurons and glial cells are dependant on the m-AAA protease for survival in vivo, complete ablation of the complex is necessary to trigger death of oligodendrocytes, hinting to cell-autonomous thresholds of vulnerability to m-AAA protease deficiency. PMID:27911893

  10. The Mitochondrial m-AAA Protease Prevents Demyelination and Hair Greying.

    PubMed

    Wang, Shuaiyu; Jacquemyn, Julie; Murru, Sara; Martinelli, Paola; Barth, Esther; Langer, Thomas; Niessen, Carien M; Rugarli, Elena I

    2016-12-01

    The m-AAA protease preserves proteostasis of the inner mitochondrial membrane. It ensures a functional respiratory chain, by controlling the turnover of respiratory complex subunits and allowing mitochondrial translation, but other functions in mitochondria are conceivable. Mutations in genes encoding subunits of the m-AAA protease have been linked to various neurodegenerative diseases in humans, such as hereditary spastic paraplegia and spinocerebellar ataxia. While essential functions of the m-AAA protease for neuronal survival have been established, its role in adult glial cells remains enigmatic. Here, we show that deletion of the highly expressed subunit AFG3L2 in mature mouse oligodendrocytes provokes early-on mitochondrial fragmentation and swelling, as previously shown in neurons, but causes only late-onset motor defects and myelin abnormalities. In contrast, total ablation of the m-AAA protease, by deleting both Afg3l2 and its paralogue Afg3l1, triggers progressive motor dysfunction and demyelination, owing to rapid oligodendrocyte cell death. Surprisingly, the mice showed premature hair greying, caused by progressive loss of melanoblasts that share a common developmental origin with Schwann cells and are targeted in our experiments. Thus, while both neurons and glial cells are dependant on the m-AAA protease for survival in vivo, complete ablation of the complex is necessary to trigger death of oligodendrocytes, hinting to cell-autonomous thresholds of vulnerability to m-AAA protease deficiency.

  11. Lon protease: A key enzyme controlling mitochondrial bioenergetics in cancer.

    PubMed

    Quirós, Pedro M; Bárcena, Clea; López-Otín, Carlos

    2014-01-01

    We have recently explored the in vivo functional and oncologic relevance of Lon protease (LONP1), an enzyme involved in mitochondrial quality control. We found that LONP1 is an essential protein for life and that it also performs a critical function in tumorigenesis by regulating the bioenergetics of cancer cells.

  12. Caveolin-1 controls mitochondrial function through regulation of m-AAA mitochondrial protease

    PubMed Central

    Volonte, Daniela; Liu, Zhongmin; Shiva, Sruti; Galbiati, Ferruccio

    2016-01-01

    Mitochondrial proteases ensure mitochondrial integrity and function after oxidative stress by providing mitochondrial protein quality control. However, the molecular mechanisms that regulate this basic biological function in eukaryotic cells remain largely unknown. Caveolin-1 is a scaffolding protein involved in signal transduction. We find that AFG3L2, a m-AAA type of mitochondrial protease, is a novel caveolin-1-interacting protein in vitro. We show that oxidative stress promotes the translocation of both caveolin-1 and AFG3L2 to mitochondria, enhances the interaction of caveolin-1 with AFG3L2 in mitochondria and stimulates mitochondrial protease activity in wild-type fibroblasts. Localization of AFG3L2 to mitochondria after oxidative stress is inhibited in fibroblasts lacking caveolin-1, which results in impaired mitochondrial protein quality control, an oxidative phosphorylation to aerobic glycolysis switch and reduced ATP production. Mechanistically, we demonstrate that a lack of caveolin-1 does not alter either mitochondrial number or morphology but leads to the cytoplasmic and proteasome-dependent degradation of complexes I, III, IV and V upon oxidant stimulation. Restoration of mitochondrial respiratory chain complexes in caveolin-1 null fibroblasts reverts the enhanced glycolysis observed in these cells. Expression of a mutant form of AFG3L2, which has reduced affinity for caveolin-1, fails to localize to mitochondria and promotes degradation of complex IV after oxidative stress. Thus, caveolin-1 maintains mitochondrial integrity and function when cells are challenged with free radicals by promoting the mitochondrial localization of m-AAA protease and its quality control functions. PMID:27705926

  13. Transcriptional response to mitochondrial protease IMMP2L knockdown in human primary astrocytes.

    PubMed

    Gokoolparsadh, Akira; Fang, Zhiming; Braidy, Nady; Lin, Peijie; Pardy, Christopher J; Eapen, Valsamma; Clarke, Raymond; Voineagu, Irina

    2017-01-22

    IMMP2L encodes the inner membrane peptidase subunit 2, a mitochondrial protease involved in cleaving the space-sorting signals of mitochondrial membrane proteins. IMMP2L has been implicated in Tourette syndrome, but how its dysfunction contributes to the neurodevelopmental phenotype remains unclear. Here we show that IMMP2L transcription requires Topoisomerase I in human primary astrocytes, and characterize the downstream effects of IMMP2L knockdown on gene expression. We demonstrate that IMMP2L knockdown leads to dysregulation of genes involved in central nervous system development. We also find that the transcriptional response to IMMP2L knockdown partially overlaps the one induced by mitochondrial complex III inhibition. Overall, these data bring further insight into the molecular consequences of IMMP2L dysfunction in the brain. Crown Copyright © 2016. Published by Elsevier Inc. All rights reserved.

  14. Bcl-2 inhibits the mitochondrial release of an apoptogenic protease

    PubMed Central

    1996-01-01

    Bcl-2 belongs to a family of apoptosis-regulatory proteins which incorporate into the outer mitochondrial as well as nuclear membranes. The mechanism by which the proto-oncogene product Bcl-2 inhibits apoptosis is thus far elusive. We and others have shown previously that the first biochemical alteration detectable in cells undergoing apoptosis, well before nuclear changes become manifest, is a collapse of the mitochondrial inner membrane potential (delta psi m), suggesting the involvement of mitochondrial products in the apoptotic cascade. Here we show that mitochondria contain a pre-formed approximately 50-kD protein which is released upon delta psi m disruption and which, in a cell-free in vitro system, causes isolated nuclei to undergo apoptotic changes such as chromatin condensation and internucleosomal DNA fragmentation. This apoptosis-inducing factor (AIF) is blocked by N- benzyloxycarbonyl-Val-Ala-Asp.fluoromethylketone (Z-VAD.fmk), an antagonist of interleukin-1 beta-converting enzyme (ICE)-like proteases that is also an efficient inhibitor of apoptosis in cells. We have tested the effect of Bcl-2 on the formation, release, and action of AIF. When preventing mitochondrial permeability transition (which accounts for the pre-apoptotic delta psi m disruption in cells), Bcl-2 hyperexpressed in the outer mitochondrial membrane also impedes the release of AIF from isolated mitochondria in vitro. In contrast, Bcl-2 does not affect the formation of AIF, which is contained in comparable quantities in control mitochondria and in mitochondria from Bcl-2- hyperexpressing cells. Furthermore, the presence of Bcl-2 in the nuclear membrane does not interfere with the action of AIF on the nucleus, nor does Bcl-2 hyperexpression protect cells against AIF. It thus appears that Bcl-2 prevents apoptosis by favoring the retention of an apoptogenic protease in mitochondria. PMID:8879205

  15. Mitochondrial Lon protease in human disease and aging: Including an etiologic classification of Lon-related diseases and disorders

    PubMed Central

    Bota, Daniela A.; Davies, Kelvin J.A.

    2016-01-01

    The Mitochondrial Lon protease, also called LonP1 is a product of the nuclear gene LONP1. Lon is a major regulator of mitochondrial metabolism and response to free radical damage, as well as an essential factor for the maintenance and repair of mitochondrial DNA. Lon is an ATP-stimulated protease that cycles between being bound (at the inner surface of the inner mitochondrial membrane) to the mitochondrial genome, and being released into the mitochondrial matrix where it can degrade matrix proteins. At least three different roles or functions have been ascribed to Lon: 1) Proteolytic digestion of oxidized proteins and the turnover of specific essential mitochondrial enzymes such as aconitase, TFAM, and StAR; 2) Mitochondrial (mt)DNA-binding protein, involved in mtDNA replication and mitogenesis; and 3) Protein chaperone, interacting with the Hsp60–mtHsp70 complex. LONP1 orthologs have been studied in bacteria, yeast, flies, worms, and mammals, evincing the widespread importance of the gene, as well as its remarkable evolutionary conservation. In recent years, we have witnessed a significant increase in knowledge regarding Lon's involvement in physiological functions, as well as in an expanding array of human disorders, including cancer, neurodegeneration, heart disease, and stroke. In addition, Lon appears to have a significant role in the aging process. A number of mitochondrial diseases have now been identified whose mechanisms involve various degrees of Lon dysfunction. In this paper we review current knowledge of Lon's function, under normal conditions, and we propose a new classification of human diseases characterized by a either over-expression or decline or loss of function of Lon. Lon has also been implicated in human aging, and we review the data currently available as well as speculating about possible interactions of aging and disease. Finally, we also discuss Lon as potential therapeutic target in human disease. PMID:27387767

  16. CODAS syndrome is associated with mutations of LONP1, encoding mitochondrial AAA+ Lon protease.

    PubMed

    Strauss, Kevin A; Jinks, Robert N; Puffenberger, Erik G; Venkatesh, Sundararajan; Singh, Kamalendra; Cheng, Iteen; Mikita, Natalie; Thilagavathi, Jayapalraja; Lee, Jae; Sarafianos, Stefan; Benkert, Abigail; Koehler, Alanna; Zhu, Anni; Trovillion, Victoria; McGlincy, Madeleine; Morlet, Thierry; Deardorff, Matthew; Innes, A Micheil; Prasad, Chitra; Chudley, Albert E; Lee, Irene Nga Wing; Suzuki, Carolyn K

    2015-01-08

    CODAS syndrome is a multi-system developmental disorder characterized by cerebral, ocular, dental, auricular, and skeletal anomalies. Using whole-exome and Sanger sequencing, we identified four LONP1 mutations inherited as homozygous or compound-heterozygous combinations among ten individuals with CODAS syndrome. The individuals come from three different ancestral backgrounds (Amish-Swiss from United States, n = 8; Mennonite-German from Canada, n = 1; mixed European from Canada, n = 1). LONP1 encodes Lon protease, a homohexameric enzyme that mediates protein quality control, respiratory-complex assembly, gene expression, and stress responses in mitochondria. All four pathogenic amino acid substitutions cluster within the AAA(+) domain at residues near the ATP-binding pocket. In biochemical assays, pathogenic Lon proteins show substrate-specific defects in ATP-dependent proteolysis. When expressed recombinantly in cells, all altered Lon proteins localize to mitochondria. The Old Order Amish Lon variant (LONP1 c.2161C>G[p.Arg721Gly]) homo-oligomerizes poorly in vitro. Lymphoblastoid cell lines generated from affected children have (1) swollen mitochondria with electron-dense inclusions and abnormal inner-membrane morphology; (2) aggregated MT-CO2, the mtDNA-encoded subunit II of cytochrome c oxidase; and (3) reduced spare respiratory capacity, leading to impaired mitochondrial proteostasis and function. CODAS syndrome is a distinct, autosomal-recessive, developmental disorder associated with dysfunction of the mitochondrial Lon protease.

  17. CODAS Syndrome Is Associated with Mutations of LONP1, Encoding Mitochondrial AAA+ Lon Protease

    PubMed Central

    Strauss, Kevin A.; Jinks, Robert N.; Puffenberger, Erik G.; Venkatesh, Sundararajan; Singh, Kamalendra; Cheng, Iteen; Mikita, Natalie; Thilagavathi, Jayapalraja; Lee, Jae; Sarafianos, Stefan; Benkert, Abigail; Koehler, Alanna; Zhu, Anni; Trovillion, Victoria; McGlincy, Madeleine; Morlet, Thierry; Deardorff, Matthew; Innes, A. Micheil; Prasad, Chitra; Chudley, Albert E.; Lee, Irene Nga Wing; Suzuki, Carolyn K.

    2015-01-01

    CODAS syndrome is a multi-system developmental disorder characterized by cerebral, ocular, dental, auricular, and skeletal anomalies. Using whole-exome and Sanger sequencing, we identified four LONP1 mutations inherited as homozygous or compound-heterozygous combinations among ten individuals with CODAS syndrome. The individuals come from three different ancestral backgrounds (Amish-Swiss from United States, n = 8; Mennonite-German from Canada, n = 1; mixed European from Canada, n = 1). LONP1 encodes Lon protease, a homohexameric enzyme that mediates protein quality control, respiratory-complex assembly, gene expression, and stress responses in mitochondria. All four pathogenic amino acid substitutions cluster within the AAA+ domain at residues near the ATP-binding pocket. In biochemical assays, pathogenic Lon proteins show substrate-specific defects in ATP-dependent proteolysis. When expressed recombinantly in cells, all altered Lon proteins localize to mitochondria. The Old Order Amish Lon variant (LONP1 c.2161C>G[p.Arg721Gly]) homo-oligomerizes poorly in vitro. Lymphoblastoid cell lines generated from affected children have (1) swollen mitochondria with electron-dense inclusions and abnormal inner-membrane morphology; (2) aggregated MT-CO2, the mtDNA-encoded subunit II of cytochrome c oxidase; and (3) reduced spare respiratory capacity, leading to impaired mitochondrial proteostasis and function. CODAS syndrome is a distinct, autosomal-recessive, developmental disorder associated with dysfunction of the mitochondrial Lon protease. PMID:25574826

  18. Gene expression and activity of digestive proteases in Daphnia: effects of cyanobacterial protease inhibitors

    PubMed Central

    2010-01-01

    Background The frequency of cyanobacterial blooms has increased worldwide, and these blooms have been claimed to be a major factor leading to the decline of the most important freshwater herbivores, i.e. representatives of the genus Daphnia. This suppression of Daphnia is partly attributed to the presence of biologically active secondary metabolites in cyanobacteria. Among these metabolites, protease inhibitors are found in almost every natural cyanobacterial bloom and have been shown to specifically inhibit Daphnia's digestive proteases in vitro, but to date no physiological responses of these serine proteases to cyanobacterial protease inhibitors in Daphnia have been reported in situ at the protein and genetic levels. Results Nine digestive proteases were detected in D. magna using activity-stained SDS-PAGE. Subsequent analyses by LC-MS/MS and database search led to the identification of respective protease genes. D. magna responded to dietary protease inhibitors by up-regulation of the expression of these respective proteases at the RNA-level and by the induction of new and less sensitive protease isoforms at the protein level. The up-regulation in response to dietary trypsin- and chymotrypsin-inhibitors ranged from 1.4-fold to 25.6-fold. These physiological responses of Daphnia, i.e. up-regulation of protease expression and the induction of isoforms, took place even after feeding on 20% cyanobacterial food for only 24 h. These physiological responses proved to be independent from microcystin effects. Conclusion Here for the first time it was shown in situ that a D. magna clone responds physiologically to dietary cyanobacterial protease inhibitors by phenotypic plasticity of the targets of these specific inhibitors, i.e. Daphnia gut proteases. These regulatory responses are adaptive for D. magna, as they increase the capacity for protein digestion in the presence of dietary protease inhibitors. The type and extent of these responses in protease expression might

  19. The role of AAA+ proteases in mitochondrial protein biogenesis, homeostasis and activity control.

    PubMed

    Voos, Wolfgang; Ward, Linda A; Truscott, Kaye N

    2013-01-01

    Mitochondria are specialised organelles that are structurally and functionally integrated into cells in the vast majority of eukaryotes. They are the site of numerous enzymatic reactions, some of which are essential for life. The double lipid membrane of the mitochondrion, that spatially defines the organelle and is necessary for some functions, also creates a physical but semi-permeable barrier to the rest of the cell. Thus to ensure the biogenesis, regulation and maintenance of a functional population of proteins, an autonomous protein handling network within mitochondria is required. This includes resident mitochondrial protein translocation machinery, processing peptidases, molecular chaperones and proteases. This review highlights the contribution of proteases of the AAA+ superfamily to protein quality and activity control within the mitochondrion. Here they are responsible for the degradation of unfolded, unassembled and oxidatively damaged proteins as well as the activity control of some enzymes. Since most knowledge about these proteases has been gained from studies in the eukaryotic microorganism Saccharomyces cerevisiae, much of the discussion here centres on their role in this organism. However, reference is made to mitochondrial AAA+ proteases in other organisms, particularly in cases where they play a unique role such as the mitochondrial unfolded protein response. As these proteases influence mitochondrial function in both health and disease in humans, an understanding of their regulation and diverse activities is necessary.

  20. Effect of Lon protease knockdown on mitochondrial function in HeLa cells.

    PubMed

    Bayot, Aurélien; Gareil, Monique; Chavatte, Laurent; Hamon, Marie-Paule; L'Hermitte-Stead, Caroline; Beaumatin, Florian; Priault, Muriel; Rustin, Pierre; Lombès, Anne; Friguet, Bertrand; Bulteau, Anne-Laure

    2014-05-01

    ATP-dependent proteases are currently emerging as key regulators of mitochondrial functions. Among these proteolytic systems, Lon protease is involved in the control of selective protein turnover in the mitochondrial matrix. In the absence of Lon, yeast cells have been shown to accumulate electron-dense inclusion bodies in the matrix space, to loose integrity of mitochondrial genome and to be respiratory deficient. In order to address the role of Lon in mitochondrial functionality in human cells, we have set up a HeLa cell line stably transfected with a vector expressing a shRNA under the control of a promoter which is inducible with doxycycline. We have demonstrated that reduction of Lon protease results in a mild phenotype in this cell line in contrast with what have been observed in other cell types such as WI-38 fibroblasts. Nevertheless, deficiency in Lon protease led to an increase in ROS production and to an accumulation of carbonylated protein in the mitochondria. Our study suggests that Lon protease has a wide variety of targets and is likely to play different roles depending of the cell type. Copyright © 2013 Elsevier Masson SAS. All rights reserved.

  1. Lon protease: a novel mitochondrial matrix protein in the interconnection between drug-induced mitochondrial dysfunction and ER stress.

    PubMed

    Polo, Miriam; Alegre, Fernando; Moragrega, Angela B; Gibellini, Lara; Marti-Rodrigo, Alberto; Blas-Garcia, Ana; Esplugues, Juan V; Apostolova, Nadezda

    2017-09-23

    Mitochondria-associated membranes (MAMs) are specific ER-domains that enable direct interaction with mitochondria and mediate metabolic flow and Ca(2+) transfer. A growing list of proteins have been identified as MAMs components, but how they are recruited and function during complex cell stress situations is still not understood while the participation of mitochondrial matrix proteins is largely undervalued. This work compares mitochondrial/ER contact during combined ER stress/mitochondrial dysfunction using a model of human hepatoma cells (Hep3B cell line) treated for 24h with classic pharmacological inducers of ER stress (thapsigargin), mitochondrial dysfunction (CCCP or rotenone) or both (the antiretroviral drug Efavirenz used at clinically relevant concentrations). Markers of mitochondrial dynamics (Drp1, OPA1, Mfn2) were expressed differentially with these stimuli, pointing to a specificity of combined ER/mitochondrial stress. Lon, a matrix protease involved in protein and mtDNA quality control, was upregulated at mRNA and protein levels under all conditions. However, only with efavirenz, the mitochondrial content of Lon was diminished while its extramitochondrial presence was increased, as did its localization to MAMs, where it enhanced mitochondria/ER interaction as shown by co-immunoprecipitation experiments of MAM protein partners and confocal microscopy imaging. A specific dual drug-induced mitochondria-ER effect enhances MAMs content and extramitochondrial Lon expression. This is the first report of this phenomenon and suggests a novel MAM-linked function of Lon protease. This article is protected by copyright. All rights reserved.

  2. Emerging role of Lon protease as a master regulator of mitochondrial functions.

    PubMed

    Pinti, Marcello; Gibellini, Lara; Nasi, Milena; De Biasi, Sara; Bortolotti, Carlo Augusto; Iannone, Anna; Cossarizza, Andrea

    2016-08-01

    Lon protease is a nuclear-encoded, mitochondrial ATP-dependent protease highly conserved throughout the evolution, crucial for the maintenance of mitochondrial homeostasis. Lon acts as a chaperone of misfolded proteins, and is necessary for maintaining mitochondrial DNA. The impairment of these functions has a deep impact on mitochondrial functionality and morphology. An altered expression of Lon leads to a profound reprogramming of cell metabolism, with a switch from respiration to glycolysis, which is often observed in cancer cells. Mutations of Lon, which likely impair its chaperone properties, are at the basis of a genetic inherited disease named of the cerebral, ocular, dental, auricular, skeletal (CODAS) syndrome. This article is part of a Special Issue entitled 'EBEC 2016: 19th European Bioenergetics Conference, Riva del Garda, Italy, July 2-6, 2016', edited by Prof. Paolo Bernardi. Copyright © 2016 Elsevier B.V. All rights reserved.

  3. Downregulation of mitochondrial lon protease impairs mitochondrial function and causes hepatic insulin resistance in human liver SK-HEP-1 cells.

    PubMed

    Lee, H J; Chung, K; Lee, H; Lee, K; Lim, J H; Song, J

    2011-06-01

    Lon protease degrades oxidatively damaged proteins in mitochondrial matrix. To examine the relationships between mitochondrial quality control, mitochondrial functions and diabetes, we investigated whether lon protease deficiency influences insulin resistance by affecting mitochondrial function. Lon protease-specific small interfering RNA (siRNA) was transfected into human liver SK-HEP-1 cells and changes in molecules related to insulin resistance were analysed. Reduction in lon protease was achieved using specific siRNA-induced mitochondrial dysfunction in human liver SK-HEP-1 cells. Concurrently, insulin signalling and subsequent insulin action were impaired and levels of gluconeogenic enzymes were increased by lon protein deficiency. Moreover, the activity of mitogen-activated protein kinases and transcription factors related to hepatic gluconeogenesis were elevated in LON (also known as LONP1) siRNA-transfected cells via increased intracellular reactive oxygen species production. Overproduction of lon protease restored mitochondrial function and also diminished the insulin resistance induced by treatment with cholesterol and palmitate. In addition, levels of lon protease decreased dramatically in livers of diabetic db/db mice compared with their lean mice counterparts. Here we have demonstrated that reduction of lon protease induced hepatic insulin resistance by lowering mitochondrial function. This is the first study to report that defects in mitochondrial protein quality control could cause insulin resistance and diabetes.

  4. Inactivation of brain mitochondrial Lon protease by peroxynitrite precedes electron transport chain dysfunction.

    PubMed

    Stanyer, Lee; Jorgensen, Wenche; Hori, Osamu; Clark, John B; Heales, Simon J R

    2008-09-01

    The accumulation of oxidatively modified proteins has been shown to be a characteristic feature of many neurodegenerative disorders and its regulation requires efficient proteolytic processing. One component of the mitochondrial proteolytic system is Lon, an ATP-dependent protease that has been shown to degrade oxidatively modified aconitase in vitro and may thus play a role in defending against the accumulation of oxidized matrix proteins in mitochondria. Using an assay system that allowed us to distinguish between basal and ATP-stimulated Lon protease activity, we have shown in isolated non-synaptic rat brain mitochondria that Lon protease is highly susceptible to oxidative inactivation by peroxynitrite (ONOO(-)). This susceptibility was more pronounced with regard to ATP-stimulated activity, which was inhibited by 75% in the presence of a bolus addition of 1mM ONOO(-), whereas basal unstimulated activity was inhibited by 45%. Treatment of mitochondria with a range of peroxynitrite concentrations (10-1000 microM) revealed that a decline in Lon protease activity preceded electron transport chain (ETC) dysfunction (complex I, II-III and IV) and that ATP-stimulated activity was approximately fivefold more sensitive than basal Lon protease activity. Furthermore, supplementation of mitochondrial matrix extracts with reduced glutathione, following ONOO(-) exposure, resulted in partial restoration of basal and ATP-stimulated activity, thus suggesting possible redox regulation of this enzyme complex. Taken together these findings suggest that Lon protease may be particularly vulnerable to inactivation in conditions associated with GSH depletion and elevated oxidative stress.

  5. Identification of a Degradation Signal Sequence within Substrates of the Mitochondrial i-AAA Protease.

    PubMed

    Rampello, Anthony J; Glynn, Steven E

    2017-03-24

    The i-AAA protease is a component of the mitochondrial quality control machinery that regulates respiration, mitochondrial dynamics, and protein import. The protease is required to select specific substrates for degradation from among the diverse complement of proteins present in mitochondria, yet the rules that govern this selection are unclear. Here, we reconstruct the yeast i-AAA protease, Yme1p, to examine the in vitro degradation of two intermembrane space chaperone subunits, Tim9 and Tim10. Yme1p degrades Tim10 more rapidly than Tim9 despite high sequence and structural similarity, and loss of Tim10 is accelerated by the disruption of conserved disulfide bonds within the substrate. An unstructured N-terminal region of Tim10 is necessary and sufficient to target the substrate to the protease through recognition of a short phenylalanine-rich motif, and the presence of similar motifs in other small Tim proteins predicts robust degradation by the protease. Together, these results identify the first specific degron sequence within a native i-AAA protease substrate.

  6. [Effect of gamma-radiation and mitochondrial apoptogenic factors on nuclear protease activity].

    PubMed

    Kutsyĭ, M P; Kuznetsova, E A; Gluiaeva, N A; Gaziev, A I

    2002-01-01

    An increase in protease activity was shown in thymus nuclei of rats exposed to gamma-radiation. The activation of histone-specific proteases depended on the duration of postradiation period. Also, it was revealed that incubation of thymus nuclear with the intermembrane fraction of liver mitochondria caused degradation of histones and nonhistone nuclear proteins, as well as internucleosomal fragmentation of DNA. Simultaneously, nuclear proteases tightly bound to histones and specifically cleaving histones were observed to be activated by apoptogenic factors of the mitochondrial intermembrane fraction. Probably, the apoptogenic action of gamma-radiation involves not only a direct DNA damage that induces activation of DNA-dependent proteases but also an indirect component: destructive alterations in mitochondria leading to the exit of apoptogenic factors from the intermembrane space.

  7. Decreased expression of the mitochondrial matrix proteases Lon and ClpP in cells from a patient with hereditary spastic paraplegia (SPG13).

    PubMed

    Hansen, J; Corydon, T J; Palmfeldt, J; Dürr, A; Fontaine, B; Nielsen, M N; Christensen, J H; Gregersen, N; Bross, P

    2008-05-02

    The mitochondrial chaperonin heat shock protein 60 (Hsp60) assists the folding of a subset of proteins localized in mitochondria and is an essential component of the mitochondrial protein quality control system. Mutations in the HSPD1 gene that encodes Hsp60 have been identified in patients with an autosomal dominant form of hereditary spastic paraplegia (SPG13), a late-onset neurodegenerative disorder characterized by a progressive paraparesis of the lower limbs. The disease-associated Hsp60-(p.Val98Ile) protein, encoded by the c.292G>A HSPD1 allele, has reduced chaperonin activity, but how its expression affects mitochondrial functions has not been investigated. We have studied mitochondrial function and expression of genes encoding mitochondrial chaperones and proteases in a human lymphoblastoid cell line and fibroblast cells from a patient who is heterozygous for the c.292G>A HSPD1 allele. We found that both the c.292G>A RNA transcript and the corresponding Hsp60-(p.Val98Ile) protein were present at comparable levels to their wild-type counterparts in SPG13 patient cells. Compared with control cells, we found no significant cellular or mitochondrial dysfunctions in SPG13 patient cells by assessing the mitochondrial membrane potential, cell viability, and sensitivity toward oxidative stress. However, a decreased expression of the mitochondrial protein quality control proteases Lon and ClpP, both at the RNA and protein level, was demonstrated in SPG13 patient cells. We propose that decreased levels of mitochondrial proteases Lon and ClpP may allow Hsp60 substrate proteins to go through more folding attempts instead of being prematurely degraded, thereby supporting productive folding in cells with reduced Hsp60 chaperonin activity. In conclusion, our studies with SPG13 patient cells expressing the functionally impaired mutant Hsp60 chaperonin suggest that reduction of the degradative activity of the protein quality control system may represent a previously

  8. Detergent alkaline proteases: enzymatic properties, genes, and crystal structures.

    PubMed

    Saeki, Katsuhisa; Ozaki, Katsuya; Kobayashi, Tohru; Ito, Susumu

    2007-06-01

    Subtilisin-like serine proteases from bacilli have been used in various industrial fields worldwide, particularly in the production of laundry and automatic dishwashing detergents. They belong to family A of the subtilase superfamily, which is composed of three clans, namely, true subtilisins, high-alkaline proteases, and intracellular proteases. We succeeded in the large-scale production of a high-alkaline protease (M-protease) from alkaliphilic Bacillus clausii KSM-K16, and the enzyme has been introduced into compact heavy-duty laundry detergents. We have also succeeded in the industrial-scale production of a new alkaline protease, KP-43, which was originally resistant to chemical oxidants and to surfactants, produced by alkaliphilic Bacillus sp. strain KSM-KP43 and have incorporated it into laundry detergents. KP-43 and related proteases form a new clan, oxidatively stable proteases, in subtilase family A. In this review, we describe the enzymatic properties, gene sequences, and crystal structures of M-protease, KP-43, and related enzymes.

  9. Approaches to mitochondrial gene therapy.

    PubMed

    D'Souza, Gerard G M; Weissig, Volkmar

    2004-09-01

    Since their discovery during the end of the 80's the number of diseases found to be associated with defects in the mitochondrial genome has grown significantly. Organs affected by mutations in mitochondrial DNA (mtDNA) include in decreasing order of vulnerability the brain, skeletal muscle, heart, kidney and liver. Hence neuromuscular and neurodegenerative diseases represent the two largest groups of mtDNA diseases. Despite major advances in understanding mtDNA defects at the genetic and biochemical level, there is however no satisfactory treatment available to the vast majority of patients. This is largely due to the fact that most of these patients have respiratory chain defects, i.e. defects that involve the final common pathway of oxidative metabolism, making it impossible to bypass the defect by administering alternative metabolic carriers of energy. Conventional biochemical treatment having reached an impasse, the exploration of gene therapeutic approaches for patients with mtDNA defects is warranted. For now mitochondrial gene therapy appears to be only theoretical and speculative. Any possibility for gene replacement is dependent on the development of an efficient mitochondrial transfection vector. In this review we describe the current state of the development of mitochondria-specific DNA delivery systems. We summarize our own efforts in exploring the properties of dequalinium and other similar cationic bolaamphiphiles with delocalized charge centers, for the design of a vector suited for the transport of DNA to mitochondria in living cells. Further, we outline some unique hurdles that need to be overcome if the development of such delivery systems is to progress.

  10. The plant i-AAA protease controls the turnover of an essential mitochondrial protein import component.

    PubMed

    Opalińska, Magdalena; Parys, Katarzyna; Murcha, Monika W; Jańska, Hanna

    2017-03-06

    Mitochondria are multifunctional organelles that play a central role in energy metabolism. Owing to the life-essential functions of these organelles, mitochondrial content, quality and dynamics are tightly controlled. Across the species, highly conserved ATP-dependent proteases prevent malfunction of mitochondria through versatile activities. This study focuses on a molecular function of the plant mitochondrial inner membrane-embedded AAA protease (denoted i-AAA) FTSH4, providing its first bona fide substrate. Here, we report that the abundance of the Tim17-2 protein, an essential component of the TIM17:23 translocase (Tim17-2 together with Tim50 and Tim23), is directly controlled by the proteolytic activity of FTSH4. Plants that are lacking functional FTSH4 protease are characterized by significantly enhanced capacity of preprotein import through the TIM17:23-dependent pathway. Taken together, with the observation that FTSH4 prevents accumulation of Tim17-2, our data point towards the role of this i-AAA protease in the regulation of mitochondrial biogenesis in plants.

  11. ATP-dependent Lon protease controls tumor bioenergetics by reprogramming mitochondrial activity.

    PubMed

    Quirós, Pedro M; Español, Yaiza; Acín-Pérez, Rebeca; Rodríguez, Francisco; Bárcena, Clea; Watanabe, Kenta; Calvo, Enrique; Loureiro, Marta; Fernández-García, M Soledad; Fueyo, Antonio; Vázquez, Jesús; Enríquez, José Antonio; López-Otín, Carlos

    2014-07-24

    We generated mice deficient in Lon protease (LONP1), a major enzyme of the mitochondrial quality control machinery. Homozygous deletion of Lonp1 causes early embryonic lethality, whereas its haploinsufficiency protects against colorectal and skin tumors. Furthermore, LONP1 knockdown inhibits cellular proliferation and tumor and metastasis formation, whereas its overexpression increases tumorigenesis. Clinical studies indicate that high levels of LONP1 are a poor prognosis marker in human colorectal cancer and melanoma. Additionally, functional analyses show that LONP1 plays a key role in metabolic reprogramming by remodeling OXPHOS complexes and protecting against senescence. Our findings demonstrate the relevance of LONP1 for cellular and organismal viability and identify this protease as a central regulator of mitochondrial activity in oncogenesis.

  12. Differential expression of a protease gene family in African Trypanosomes

    PubMed Central

    Helm, Jared R.; Wilson, Mary E.; Donelson, John E.

    2008-01-01

    During their life cycle African trypanosomes must quickly adapt to the different environments of the tsetse fly midgut and the mammalian bloodstream by modulating expression of many of their genes. One group of these differentially expressed genes encodes different forms of a major surface protease. Using a luciferase reporter gene transiently or permanently transfected into trypanosomes, we show here that the 3′-UTRs of these protease genes are responsible for their differential expression. Deletion analysis of the 389-bp 3′-UTR of one of the protease genes, MSP-B, demonstrated that it contains a U-rich regulatory region of about 23 bp (UCGUCUGUUAUUUCUUAGUCCAG), which suppresses expression of the reporter protein in bloodstream trypanosomes by as much as 25-fold, but has little effect on the reporter expression in procyclic (tsetse fly) trypanosomes. Replacing the entire 3′-UTR with just this 23-bp element mimicked most of the suppression effect of the complete 3′-UTR. Northern blots showed that the 23-bp element influences the steady state RNA level, but not enough to account for the 25-fold suppression effect. Polysome analyses showed that in procyclic trypanosomes more of the total protease mRNA is associated with intermediate-sized and large polysomes than in bloodstream trypanosomes. Thus, the 23-bp element of this protease gene affects both the level of RNA and its translation. PMID:18848586

  13. Regulation of Skeletal Muscle Oxidative Capacity and Insulin Signaling by the Mitochondrial Rhomboid Protease PARL

    PubMed Central

    Civitarese, Anthony E.; MacLean, Paul S.; Carling, Stacy; Kerr-Bayles, Lyndal; McMillan, Ryan P.; Pierce, Anson; Becker, Thomas C.; Moro, Cedric; Finlayson, Jean; Lefort, Natalie; Newgard, Christopher B.; Mandarino, Lawrence; Cefalu, William; Walder, Ken; Collier, Greg R.; Hulver, Matthew W.; Smith, Steven R.; Ravussin, Eric

    2010-01-01

    SUMMARY Type 2 diabetes Mellitus (T2DM) and aging are characterized by insulin resistance, lower mitochondrial density and function and increased production of reactive oxygen species (ROS). In lower organisms continuous remodeling critically maintains the function and life cycle of mitochondria, in part by the protease pcp1 (PARL ortholog). We therefore examined whether variation in PARL protein content is associated with mitochondrial abnormalities and insulin resistance. Relative to healthy, young individuals (23±1y), PARL mRNA and mitochondrial mass were both reduced in elderly subjects (64.4±1.2 y; 51% and 44% respectively) and in subjects with T2DM (51.8±3 y; 31% and 41% respectively; all p<0.05). Muscle knock-down of PARL in mice resulted in lower mitochondrial content (−31±3%, p<0.05), lower OPA1 and PGC1α protein levels and impaired insulin signaling. Furthermore, mitochondrial cristae were malformed and resulted in elevated in vivo oxidative stress. Adenoviral suppression of PARL protein in healthy myotubes lowered mitochondrial mass (−33±8%), insulin stimulated glycogen synthesis (−33±9%) and increased ROS production (2-fold) (all p<0.05). We propose that lower PARL expression may contribute to the mitochondrial abnormalities seen in aging and T2DM. PMID:20444421

  14. Mycobacterial Caseinolytic Protease Gene Regulator ClgR Is a Substrate of Caseinolytic Protease

    PubMed Central

    Yamada, Yoshiyuki

    2017-01-01

    ABSTRACT The mycobacterial caseinolytic protease ClpP1P2 is a degradative protease that recently gained interest as a genetically and pharmacologically validated drug target for tuberculosis. The first whole-cell active ClpP1P2 inhibitor, the human proteasome inhibitor bortezomib, is currently undergoing lead optimization to introduce selectivity for the bacterial target. How inhibition of ClpP1P2 translates into whole-cell antimicrobial activity is little understood. Previous work has shown that the caseinolytic protease gene regulator ClgR is an activator of the clpP1P2 genes and also suggested that this transcription factor may be a substrate of the protease. Here, we employ promoter activity reporters and direct mRNA level measurements showing that bortezomib treatment of Mycobacterium bovis BCG increased transcription of clpP1P2 and other ClgR-dependent promoters, suggesting that inhibition of ClpP1P2 increases cellular ClgR levels. Then, we carried out red fluorescent protein-ClgR fusion analyses to show that ClgR is indeed a substrate of ClpP1P2 and to identify ClgR’s C-terminal nonapeptide APVVSLAVA as the signal sufficient for recognition and efficient protein degradation by ClpP1P2. Interestingly, accumulation of ClgR appears to be toxic for bacilli, suggesting a mechanism for how pharmacological inhibition of ClpP1P2 protease activity by bortezomib translates into whole-cell antibacterial activity. IMPORTANCE With 9 million new cases and more than 1 million deaths per year, tuberculosis, caused by Mycobacterium tuberculosis, is the biggest infectious disease killer globally. New drugs for the treatment of the drug-resistant forms of the disease are needed. Recently, a new target-lead couple, the mycobacterial protease ClpP1P2 and the human anticancer drug bortezomib, was identified. However, we know little about how expression of this protease is regulated, which proteins in the bacterium it degrades, how the protease recognizes its target proteins

  15. Proteases.

    PubMed

    Barrett, A J

    2001-05-01

    The processes of growth and remodeling of cells and tissues in multicellular organisms require the breakdown of old protein molecules, in concert with the synthesis of new ones. For example, many newly-synthesized molecules require proteolytic processing to convert them to biologically active forms. Proteolysis can terminate the activity of a protein--e.g., capsases mediate apoptosis, which is a vital step in the life cycle of the cell. Proteolysis contributes to defense systems too, as the recognition of peptide fragments of foreign proteins triggers the immune response. Proteases are the class of enzymes involved in these important reactions. This unit discusses the general categories of proteases, and sets the stage for addition of overview units on cysteine proteases, aspartic proteases, and metalloproteases, as well as protocol units featuring techniques for analyzing mammalian and yeast proteasomes and protease inhibitors, among other topics.

  16. Mitochondrial and Nuclear Genes of Mitochondrial Components in Cancer

    PubMed Central

    Kirches, E

    2009-01-01

    Although the observation of aerobic glycolysis of tumor cells by Otto v. Warburg had demonstrated abnormalities of mitochondrial energy metabolism in cancer decades ago, there was no clear evidence for a functional role of mutant mitochondrial proteins in cancer development until the early years of the 21st century. In the year 2000, a major breakthrough was achieved by the observation, that several genes coding for subunits of the respiratory chain (ETC) complex II, succinate dehydrogenase (SDH) are tumor suppressor genes in heritable paragangliomas, fulfilling Knudson’s classical two-hit hypothesis. A functional inactivation of both alleles by germline mutations and chromosomal losses in the tumor tissue was found in the patients. Later, SDH mutations were also identified in sporadic paragangliomas and pheochromocytomas. Genes of the mitochondrial ATP-synthase and of mitochondrial iron homeostasis have been implicated in cancer development at the level of cell culture and mouse experiments. In contrast to the well established role of some nuclear SDH genes, a functional impact of the mitochondrial genome itself (mtDNA) in cancer development remains unclear. Nevertheless, the extremely high frequency of mtDNA mutations in solid tumors raises the question, whether this small circular genome might be applicable to early cancer detection. This is a meaningful approach, especially in cancers, which tend to spread tumor cells early into bodily fluids or faeces, which can be screened by non-invasive methods. PMID:19949549

  17. Gene Conversion Shapes Linear Mitochondrial Genome Architecture

    PubMed Central

    Smith, David Roy; Keeling, Patrick J.

    2013-01-01

    Recently, it was shown that gene conversion between the ends of linear mitochondrial chromosomes can cause telomere expansion and the duplication of subtelomeric loci. However, it is not yet known how widespread this phenomenon is and how significantly it has impacted organelle genome architecture. Using linear mitochondrial DNAs and mitochondrial plasmids from diverse eukaryotes, we argue that telomeric recombination has played a major role in fashioning linear organelle chromosomes. We find that mitochondrial telomeres frequently expand into subtelomeric regions, resulting in gene duplications, homogenizations, and/or fragmentations. We suggest that these features are a product of subtelomeric gene conversion, provide a hypothetical model for this process, and employ genetic diversity data to support the idea that the greater the effective population size the greater the potential for gene conversion between subtelomeric loci. PMID:23572386

  18. Mitochondrial DNA Damage and its Consequences for Mitochondrial Gene Expression

    PubMed Central

    Cline, Susan D.

    2012-01-01

    How mitochondria process DNA damage and whether a change in the steady-state level of mitochondrial DNA damage (mtDNA) contributes to mitochondrial dysfunction are questions that fuel burgeoning areas of research into aging and disease pathogenesis. Over the past decade, researchers have identified and measured various forms of endogenous and environmental mtDNA damage and have elucidated mtDNA repair pathways. Interestingly, mitochondria do not appear to contain the full range of DNA repair mechanisms that operate in the nucleus, although mtDNA contains types of damage that are targets of each nuclear DNA repair pathway. The reduced repair capacity may, in part, explain the high mutation frequency of the mitochondrial chromosome. Since mtDNA replication is dependent on transcription, mtDNA damage may alter mitochondrial gene expression at three levels: by causing DNA polymerase γ nucleotide incorporation errors leading to mutations, by interfering with the priming of mtDNA replication by the mitochondrial RNA polymerase, or by inducing transcriptional mutagenesis or premature transcript termination. This review summarizes our current knowledge of mtDNA damage, its repair, and its effects on mtDNA integrity and gene expression. PMID:22728831

  19. Cell-free mitochondrial fusion assay detected by specific protease reaction revealed Ca2+ as regulator of mitofusin-dependent mitochondrial fusion.

    PubMed

    Ishihara, Naotada; Maeda, Maki; Ban, Tadato; Mihara, Katsuyoshi

    2017-04-27

    Mitochondrial dynamic by frequent fusion and fission have important roles in various cellular signaling processes and pathophysiology in vivo. However, the molecular mechanisms that regulate mitochondrial fusion, especially in mammalian cells, are not well understood. Accordingly, we developed a novel biochemical cell-free mitochondrial fusion assay system using isolated human mitochondria. We used a protease and its specific substrate that are essential for yeast autophagy; Atg4 protease is required for maturation and the de-conjugation of the ubiquitin-like modifier Atg8. Atg4-FLAG and Atg8-GFP were separately expressed in the mitochondrial matrix of HeLa cells. Isolated mitochondria were then mixed and packed in the presence of energy regeneration mix. Immunoblotting with an anti-GFP antibody revealed Atg8 processing, suggesting that the double membranes of isolated mitochondria were indeed fused. The mitochondrial fusion reaction required GTP hydrolysis, mitochondrial membrane potential, and intact outer membrane proteins containing two mitofusin isoforms. Using this assay, we searched for stimulators of mitochondrial fusion and found that rabbit reticulocyte lysate and Ca2+ chelator EGTA stimulate mitochondrial fusion. This novel cell-free assay system using isolated human mitochondria is simple, sensitive, and reproducible; thus, it is useful for screening proteins and molecules that modulate mitochondrial fusion. © The Authors 2017. Published by Oxford University Press on behalf of the Japanese Biochemical Society. All rights reserved.

  20. The Mitochondrial Lon Protease Is Required for Age-Specific and Sex-Specific Adaptation to Oxidative Stress.

    PubMed

    Pomatto, Laura C D; Carney, Caroline; Shen, Brenda; Wong, Sarah; Halaszynski, Kelly; Salomon, Matthew P; Davies, Kelvin J A; Tower, John

    2017-01-09

    Multiple human diseases involving chronic oxidative stress show a significant sex bias, including neurodegenerative diseases, cancer, immune dysfunction, diabetes, and cardiovascular disease. However, a possible molecular mechanism for the sex bias in physiological adaptation to oxidative stress remains unclear. Here, we report that Drosophila melanogaster females but not males adapt to hydrogen peroxide stress, whereas males but not females adapt to paraquat (superoxide) stress. Stress adaptation in each sex requires the conserved mitochondrial Lon protease and is associated with sex-specific expression of Lon protein isoforms and proteolytic activity. Adaptation to oxidative stress is lost with age in both sexes. Transgenic expression of transformer gene during development transforms chromosomal males into pseudo-females and confers the female-specific pattern of Lon isoform expression, Lon proteolytic activity induction, and H2O2 stress adaptation; these effects were also observed using adult-specific transformation. Conversely, knockdown of transformer in chromosomal females eliminates the female-specific Lon isoform expression, Lon proteolytic activity induction, and H2O2 stress adaptation and produces the male-specific paraquat (superoxide) stress adaptation. Sex-specific expression of alternative Lon isoforms was also observed in mouse tissues. The results develop Drosophila melanogaster as a model for sex-specific stress adaptation regulated by the Lon protease, with potential implications for understanding sexual dimorphism in human disease.

  1. A facile analytical method for the identification of protease gene profiles from Bacillus thuringiensis strains.

    PubMed

    Chen, Fu-Chu; Shen, Li-Fen; Chak, Kin-Fu

    2004-01-01

    Five pairs of degenerate universal primers have been designed to identify the general protease gene profiles from some distinct Bacillus thuringiensis strains. Based on the PCR amplification patterns and DNA sequences of the cloned fragments, it was noted that the protease gene profiles of the three distinct strains of B. thuringiensis subsp. kurstaki HD73, tenebrionis and israelensis T14001 are varied. Seven protease genes, neutral protease B (nprB), intracellular serine protease A (ispA), extracellular serine protease (vpr), envelope-associated protease (prtH), neutral protease F (nprF), thermostable alkaline serine protease and alkaline serine protease (aprS), with known functions were identified from three distinct B. thuringiensis strains. In addition, five DNA sequences with unknown functions were also identified by this facile analytical method. However, based on the alignment of the derived protein sequences with the protein domain database, it suggested that at least one of these unknown genes, yunA, might be highly protease-related. Thus, the proposed PCR-mediated amplification design could be a facile method for identifying the protease gene profiles as well as for detecting novel protease genes of the B. thuringiensis strains.

  2. Evolution of mitochondrial gene order in Annelida.

    PubMed

    Weigert, Anne; Golombek, Anja; Gerth, Michael; Schwarz, Francine; Struck, Torsten H; Bleidorn, Christoph

    2016-01-01

    Annelida is a highly diverse animal group with over 21,000 described species. As part of Lophotrochozoa, the vast majority of annelids are currently classified into two groups: Errantia and Sedentaria, together forming Pleistoannelida. Besides these taxa, Sipuncula, Amphinomidae, Chaetopteridae, Oweniidae and Magelonidae can be found branching at the base of the tree. Comparisons of mitochondrial genomes have been used to investigate phylogenetic relationship within animal taxa. Complete annelid mitochondrial genomes are available for some Sedentaria and Errantia and in most cases exhibit a highly conserved gene order. Only two complete genomes have been published from the basal branching lineages and these are restricted to Sipuncula. We describe the first complete mitochondrial genome sequences for all other basal branching annelid families: Owenia fusiformis (Oweniidae), Magelona mirabilis (Magelonidae), Eurythoe complanata (Amphinomidae), Chaetopterus variopedatus and Phyllochaetopterus sp. (Chaetopteridae). The mitochondrial gene order of all these taxa is substantially different from the pattern found in Pleistoannelida. Additionally, we report the first mitochondrial genomes in Annelida that encode genes on both strands. Our findings demonstrate that the supposedly highly conserved mitochondrial gene order suggested for Annelida is restricted to Pleistoannelida, representing the ground pattern of this group. All investigated basal branching annelid taxa show a completely different arrangement of genes than observed in Pleistoannelida. The gene order of protein coding and ribosomal genes in Magelona mirabilis differs only in two transposition events from a putative lophotrochozoan ground pattern and might be the closest to an ancestral annelid pattern. The mitochondrial genomes of Myzostomida show the conserved pattern of Pleistoannelida, thereby supporting their inclusion in this taxon.

  3. Evolution of mitochondrial gene orders in echinoderms.

    PubMed

    Perseke, Marleen; Fritzsch, Guido; Ramsch, Kai; Bernt, Matthias; Merkle, Daniel; Middendorf, Martin; Bernhard, Detlef; Stadler, Peter F; Schlegel, Martin

    2008-05-01

    A comprehensive analysis of the mitochondrial gene orders of all previously published and two novel Antedon mediterranea (Crinoidea) and Ophiura albida (Ophiuroidea) complete echinoderm mitochondrial genomes shows that all major types of rearrangement operations are necessary to explain the evolution of mitochondrial genomes. In addition to protein coding genes we include all tRNA genes as well as the control region in our analysis. Surprisingly, 7 of the 16 genomes published in the GenBank database contain misannotations, mostly unannotated tRNAs and/or mistakes in the orientation of tRNAs, which we have corrected here. Although the gene orders of mt genomes appear very different, only 8 events are necessary to explain the evolutionary history of echinoderms with the exception of the ophiuroids. Only two of these rearrangements are inversions, while we identify three tandem-duplication-random-loss events and three transpositions.

  4. Development of mitochondrial gene replacement therapy.

    PubMed

    Khan, Shaharyar M; Bennett, James P

    2004-08-01

    Many "classic" mitochondrial diseases have been described that arise from single homoplasmic mutations in mitochondrial DNA (mtDNA). These diseases typically affect nonmitotic tissues (brain, retina, muscle), present with variable phenotypes, can appear sporadically, and are untreatable. Evolving evidence implicates mtDNA abnormalities in diseases such as Alzheimer's, Parkinson's, and type II diabetes, but specific causal mutations for these conditions remain to be defined. Understanding the mtDNA genotype-phenotype relationships and developing specific treatment for mtDNA-based diseases is hampered by inability to manipulate the mitochondrial genome. We present a novel protein transduction technology ("protofection") that allows insertion and expression of the human mitochondrial genome into mitochondria of living cells. With protofection, the mitochondrial genotype can be altered, or exogenous genes can be introduced to be expressed and either retained in mitochondria or be directed to other organelles. Protofection also delivers mtDNA in vivo, opening the way to rational development of mitochondrial gene replacement therapy of mtDNA-based diseases.

  5. HIV protease inhibitors elicit volume-sensitive Cl− current in cardiac myocytes via mitochondrial ROS

    PubMed Central

    Deng, Wu; Baki, Lia; Yin, Jun; Zhou, Huiping; Baumgarten, Clive M.

    2010-01-01

    HIV protease inhibitors (HIV PI) reduce morbidity and mortality of HIV infection but cause multiple untoward effects. Because certain HIV PI evoke production of reactive oxygen species (ROS) and volume-sensitive Cl− current (ICl,swell) is activated by ROS, we tested whether HIV PI stimulate ICl,swell in ventricular myocytes. Ritonavir and lopinavir elicited outwardly-rectifying Cl− currents under isosmotic conditions that were abolished by the selective ICl,swell-blocker DCPIB. In contrast, amprenavir, nelfinavir, and raltegravir, an integrase inhibitor, did not modulate ICl,swell acutely. Ritonavir also reduced action potential duration, but amprenavir did not. ICl,swell activation was attributed to ROS because ebselen, an H2O2, scavenger, suppressed ritonavir- and lopinavir-induced ICl,swell. Major ROS sources in cardiomyocytes are sarcolemmal NADPH oxidase and mitochondria. The specific NADPH oxidase inhibitor apocynin failed to block ritonavir- or lopinavir-induced currents, although it blocks ICl,swell elicited by osmotic swelling or stretch. In contrast, rotenone, a mitochondrial e− transport inhibitor, suppressed both ritonavir- and lopinavir-induced ICl,swell. ROS production was measured in HL-1 cardiomyocytes with C-H2DCFDA-AM and mitochondrial membrane potential (ΔΨm) with JC-1. Flow cytometry confirmed that ritonavir and lopinavir but not amprenavir, nelfinavir, or raltegravir augmented ROS production, and HIV PI-induced ROS production was suppressed by rotenone but not NADPH oxidase blockade. Moreover, ritonavir, but not amprenavir, depolarized ΔΨm. These data suggest ritonavir and lopinavir activated ICl,swell via mitochondrial ROS production that was independent of NADPH oxidase. ROS-dependent modulation of ICl,swell and other ion channels by HIV PI may contribute to some of their actions in heart and perhaps other tissues. PMID:20736017

  6. The Multifaceted Poliovirus 2A Protease: Regulation of Gene Expression by Picornavirus Proteases

    PubMed Central

    Castelló, Alfredo; Álvarez, Enrique; Carrasco, Luis

    2011-01-01

    After entry into animal cells, most viruses hijack essential components involved in gene expression. This is the case of poliovirus, which abrogates cellular translation soon after virus internalization. Abrogation is achieved by cleavage of both eIF4GI and eIF4GII by the viral protease 2A. Apart from the interference of poliovirus with cellular protein synthesis, other gene expression steps such as RNA and protein trafficking between nucleus and cytoplasm are also altered. Poliovirus 2Apro is capable of hydrolyzing components of the nuclear pore, thus preventing an efficient antiviral response by the host cell. Here, we compare in detail poliovirus 2Apro with other viral proteins (from picornaviruses and unrelated families) as regard to their activity on key host factors that control gene expression. It is possible that future analyses to determine the cellular proteins targeted by 2Apro will uncover other cellular functions ablated by poliovirus infection. Further understanding of the cellular proteins hydrolyzed by 2Apro will add further insight into the molecular mechanism by which poliovirus and other viruses interact with the host cell. PMID:21541224

  7. The Arabidopsis Mitochondrial Protease FtSH4 Is Involved in Leaf Senescence via Regulation of WRKY-Dependent Salicylic Acid Accumulation and Signaling.

    PubMed

    Zhang, Shengchun; Li, Cui; Wang, Rui; Chen, Yaxue; Shu, Si; Huang, Ruihua; Zhang, Daowei; Li, Jian; Xiao, Shi; Yao, Nan; Yang, Chengwei

    2017-04-01

    Mitochondria and autophagy play important roles in the networks that regulate plant leaf senescence and cell death. However, the molecular mechanisms underlying the interactions between mitochondrial signaling and autophagy are currently not well understood. This study characterized the function of the Arabidopsis (Arabidopsis thaliana) mitochondrial AAA-protease gene FtSH4 in regulating autophagy and senescence, finding that FtSH4 mediates WRKY-dependent salicylic acid (SA) accumulation and signaling. Knockout of FtSH4 in the ftsh4-4 mutant resulted in severe leaf senescence, cell death, and high autophagy levels. The level of SA increased dramatically in the ftsh4-4 mutant. Expression of nahG in the ftsh4-4 mutant led to decreased SA levels and suppressed the leaf senescence and cell death phenotypes. The transcript levels of several SA synthesis and signaling genes, including SALICYLIC ACIDINDUCTION DEFICIENT2 (SID2), NON-RACE-SPECIFIC DISEASE RESISTANCE1 (NDR1), and NONEXPRESSOR OF PATHOGENESIS-RELATED PROTEINS1 (NPR1), increased significantly in the ftsh4-4 mutants compared with the wild type. Loss of function of SID2, NDR1, or NPR1 in the ftsh4-4 mutant reversed the ftsh4-4 senescence and autophagy phenotypes. Furthermore, ftsh4-4 mutants had elevated levels of transcripts of several WRKY genes, including WRKY40, WRKY46, WRKY51, WRKY60, WRKY63, and WRKY75; all of these WRKY proteins can bind to the promoter of SID2 Loss of function of WRKY75 in the ftsh4-4 mutants decreased the levels of SA and reversed the senescence phenotype. Taken together, these results suggest that the mitochondrial ATP-dependent protease FtSH4 may regulate the expression of WRKY genes by modifying the level of reactive oxygen species and the WRKY transcription factors that control SA synthesis and signaling in autophagy and senescence.

  8. Mitochondrial genes at Cold Spring Harbor.

    PubMed

    Grivell, L A

    1981-12-01

    The flowering dogwood trees and green lawns of Cold Spring Harbor provided the setting for a meeting devoted to Mitochondrial Genes from May 13-17th, 1981. Dedicated to the memory of Boris Ephrussi, who pioneered mitochondrial genetics at a time when the only kinds of genetics were nuclear or unclear, the meeting showed that the study of mtDNA has had impact on many areas of molecular biology including the genetic code and decoding, tRNA function, mechanisms of splicing and molecular evolution. Curiously, as Herschel Roman pointed out in his opening address, Ephrussi took great pains to avoid any mention of mitochondrial DNA in connection with his observations on cytoplasmic inheritance, preferring instead to refer to 'cytoplasmic particles, endowed with genetic continuity' (Ephrussi 1953). This reticence was not shared by participants at the meeting, as the following, brief report will show.

  9. Distinct types of protease systems are involved in homeostasis regulation of mitochondrial morphology via balanced fusion and fission.

    PubMed

    Saita, Shotaro; Ishihara, Takaya; Maeda, Maki; Iemura, Shun-Ichiro; Natsume, Tohru; Mihara, Katsuyoshi; Ishihara, Naotada

    2016-05-01

    Mitochondrial morphology is dynamically regulated by fusion and fission. Several GTPase proteins control fusion and fission, and posttranslational modifications of these proteins are important for the regulation. However, it has not been clarified how the fusion and fission is balanced. Here, we report the molecular mechanism to regulate mitochondrial morphology in mammalian cells. Ablation of the mitochondrial fission, by repression of Drp1 or Mff, or by over-expression of MiD49 or MiD51, results in a reduction in the fusion GTPase mitofusins (Mfn1 and Mfn2) in outer membrane and long form of OPA1 (L-OPA1) in inner membrane. RNAi- or CRISPR-induced ablation of Drp1 in HeLa cells enhanced the degradation of Mfns via the ubiquitin-proteasome system (UPS). We further found that UPS-related protein BAT3/BAG6, here we identified as Mfn2-interacting protein, was implicated in the turnover of Mfns in the absence of mitochondrial fission. Ablation of the mitochondrial fission also enhanced the proteolytic cleavage of L-OPA1 to soluble S-OPA1, and the OPA1 processing was reversed by inhibition of the inner membrane protease OMA1 independent on the mitochondrial membrane potential. Our findings showed that the distinct degradation systems of the mitochondrial fusion proteins in different locations are enhanced in response to the mitochondrial morphology. © 2016 Molecular Biology Society of Japan and John Wiley & Sons Australia, Ltd.

  10. Inhibition of the mitochondrial protease, ClpP, as a therapeutic strategy for human acute myeloid leuekmia

    PubMed Central

    Cole, Alicia; Wang, Zezhou; Coyaud, Etienne; Voisin, Veronique; Gronda, Marcela; Jitkova, Yulia; Mattson, Rachel; Hurren, Rose; Babovic, Sonja; Maclean, Neil; Restall, Ian; Wang, Xiaoming; Jeyaraju, Danny V.; Sukhai, Mahadeo A.; Prabha, Swayam; Bashir, Shaheena; Ramakrishnan, Ashwin; Leung, Elisa; Qia, Yi Hua; Zhang, Nianxian; Combes, Kevin R.; Ketela, Troy; Lin, Fengshu; Houry, Walid A.; Aman, Ahmed; Al-awar, Rima; Zheng, Wei; Wienholds, Erno; Xu, Chang Jiang; Dick, John; Wang, Jean C.Y.; Moffat, Jason; Minden, Mark D.; Eaves, Connie J.; Bader, Gary D.; Hao, Zhenyue; Kornblau, Steven M.; Raught, Brian; Schimmer, Aaron D.

    2015-01-01

    Summary From an shRNA screen, we identified ClpP as a member of the mitochondrial proteome whose knockdown reduced the viability of K562 leukemic cells. Expression of this mitochondrial protease that has structural similarity to the cytoplasmic proteosome is increased in the leukemic cells from approximately half of patients with AML. Genetic or chemical inhibition of ClpP killed cells from both human AML cell lines and primary samples in which the cells showed elevated ClpP expression, but did not affect their normal counterparts. Importantly, Clpp knockout mice were viable with normal hematopoiesis. Mechanistically, we found ClpP interacts with mitochondrial respiratory chain proteins and metabolic enzymes, and knockdown of ClpP in leukemic cells inhibited oxidative phosphorylation and mitochondrial metabolism. PMID:26058080

  11. Inhibition of the Mitochondrial Protease ClpP as a Therapeutic Strategy for Human Acute Myeloid Leukemia.

    PubMed

    Cole, Alicia; Wang, Zezhou; Coyaud, Etienne; Voisin, Veronique; Gronda, Marcela; Jitkova, Yulia; Mattson, Rachel; Hurren, Rose; Babovic, Sonja; Maclean, Neil; Restall, Ian; Wang, Xiaoming; Jeyaraju, Danny V; Sukhai, Mahadeo A; Prabha, Swayam; Bashir, Shaheena; Ramakrishnan, Ashwin; Leung, Elisa; Qia, Yi Hua; Zhang, Nianxian; Combes, Kevin R; Ketela, Troy; Lin, Fengshu; Houry, Walid A; Aman, Ahmed; Al-Awar, Rima; Zheng, Wei; Wienholds, Erno; Xu, Chang Jiang; Dick, John; Wang, Jean C Y; Moffat, Jason; Minden, Mark D; Eaves, Connie J; Bader, Gary D; Hao, Zhenyue; Kornblau, Steven M; Raught, Brian; Schimmer, Aaron D

    2015-06-08

    From an shRNA screen, we identified ClpP as a member of the mitochondrial proteome whose knockdown reduced the viability of K562 leukemic cells. Expression of this mitochondrial protease that has structural similarity to the cytoplasmic proteosome is increased in leukemic cells from approximately half of all patients with AML. Genetic or chemical inhibition of ClpP killed cells from both human AML cell lines and primary samples in which the cells showed elevated ClpP expression but did not affect their normal counterparts. Importantly, Clpp knockout mice were viable with normal hematopoiesis. Mechanistically, we found that ClpP interacts with mitochondrial respiratory chain proteins and metabolic enzymes, and knockdown of ClpP in leukemic cells inhibited oxidative phosphorylation and mitochondrial metabolism.

  12. Protochlamydia Induces Apoptosis of Human HEp-2 Cells through Mitochondrial Dysfunction Mediated by Chlamydial Protease-Like Activity Factor

    PubMed Central

    Matsuo, Junji; Nakamura, Shinji; Ito, Atsushi; Yamazaki, Tomohiro; Ishida, Kasumi; Hayashi, Yasuhiro; Yoshida, Mitsutaka; Takahashi, Kaori; Sekizuka, Tsuyoshi; Takeuchi, Fumihiko; Kuroda, Makoto; Nagai, Hiroki; Hayashida, Kyoko; Sugimoto, Chihiro; Yamaguchi, Hiroyuki

    2013-01-01

    Obligate amoebal endosymbiotic bacterium Protochlamydia with ancestral pathogenic chlamydial features evolved to survive within protist hosts, such as Acanthamoba, 0.7–1.4 billion years ago, but not within vertebrates including humans. This observation raises the possibility that interactions between Protochlamydia and human cells may result in a novel cytopathic effect, leading to new insights into host-parasite relationships. Previously, we reported that Protochlamydia induces apoptosis of the immortalized human cell line, HEp-2. In this study, we attempted to elucidate the molecular mechanism underlying this apoptosis. We first confirmed that, upon stimulation with the bacteria, poly (ADP-ribose) polymerase (PARP) was cleaved at an early stage in HEp-2 cells, which was dependent on the amount of bacteria. A pan-caspase inhibitor and both caspase-3 and -9 inhibitors similarly inhibited the apoptosis of HEp-2 cells. A decrease of the mitochondrial membrane potential was also confirmed. Furthermore, lactacystin, an inhibitor of chlamydial protease-like activity factor (CPAF), blocked the apoptosis. Cytochalasin D also inhibited the apoptosis, which was dependent on the drug concentration, indicating that bacterial entry into cells was required to induce apoptosis. Interestingly, Yersinia type III inhibitors (ME0052, ME0053, and ME0054) did not have any effect on the apoptosis. We also confirmed that the Protochlamydia used in this study possessed a homologue of the cpaf gene and that two critical residues, histidine-101 and serine-499 of C. trachomatis CPAF in the active center, were conserved. Thus, our results indicate that after entry, Protochlamydia-secreted CPAF induces mitochondrial dysfunction with a decrease of the membrane potential, followed by caspase-9, caspase-3 and PARP cleavages for apoptosis. More interestingly, because C. trachomatis infection can block the apoptosis, our finding implies unique features of CPAF between pathogenic and primitive

  13. Mgr3p and Mgr1p Are Adaptors for the Mitochondrial i-AAA Protease Complex

    PubMed Central

    Dunn, Cory D.; Tamura, Yasushi; Sesaki, Hiromi

    2008-01-01

    By screening yeast knockouts for their dependence upon the mitochondrial genome, we identified Mgr3p, a protein that associates with the i-AAA protease complex in the mitochondrial inner membrane. Mgr3p and Mgr1p, another i-AAA-interacting protein, form a subcomplex that bind to the i-AAA subunit Yme1p. We find that loss of Mgr3p, like the lack of Mgr1p, reduces proteolysis by Yme1p. Mgr3p and Mgr1p can bind substrate even in the absence of Yme1p, and both proteins are needed for maximal binding of an unfolded substrate by the i-AAA complex. We speculate that Mgr3p and Mgr1p function in an adaptor complex that targets substrates to the i-AAA protease for degradation. PMID:18843051

  14. Higher plant mitochondrial DNA: Genomes, genes, mutants, transcription, translation

    SciTech Connect

    Not Available

    1986-01-01

    This volume contains brief summaries of 63 presentations given at the International Workshop on Higher Plant Mitochondrial DNA. The presentations are organized into topical discussions addressing plant genomes, mitochondrial genes, cytoplasmic male sterility, transcription, translation, plasmids and tissue culture. (DT)

  15. The mitochondrial protease AtFTSH4 safeguards Arabidopsis shoot apical meristem function.

    PubMed

    Dolzblasz, Alicja; Smakowska, Elwira; Gola, Edyta M; Sokołowska, Katarzyna; Kicia, Marta; Janska, Hanna

    2016-06-20

    The shoot apical meristem (SAM) ensures continuous plant growth and organogenesis. In LD 30 °C, plants lacking AtFTSH4, an ATP-dependent mitochondrial protease that counteracts accumulation of internal oxidative stress, exhibit a puzzling phenotype of premature SAM termination. We aimed to elucidate the underlying cellular and molecular processes that link AtFTSH4 with SAM arrest. We studied AtFTSH4 expression, internal oxidative stress accumulation, and SAM morphology. Directly in the SAM we analysed H2O2 accumulation, mitochondria behaviour, and identity of stem cells using WUS/CLV3 expression. AtFTSH4 was expressed in proliferating tissues, particularly during the reproductive phase. In the mutant, SAM, in which internal oxidative stress accumulates predominantly at 30 °C, lost its meristematic fate. This process was progressive and stage-specific. Premature meristem termination was associated with an expansion in SAM area, where mitochondria lost their functionality. All these effects destabilised the identity of the stem cells. SAM termination in ftsh4 mutants is caused both by internal oxidative stress accumulation with time/age and by the tissue-specific role of AtFTSH4 around the flowering transition. Maintaining mitochondria functionality within the SAM, dependent on AtFTSH4, is vital to preserving stem cell activity throughout development.

  16. The mitochondrial genome of Raphanus sativus and gene evolution of cruciferous mitochondrial types.

    PubMed

    Chang, Shengxin; Chen, Jianmei; Wang, Yankun; Gu, Bingchao; He, Jianbo; Chu, Pu; Guan, Rongzhan

    2013-03-20

    To explore the mitochondrial genes of the Cruciferae family, the mitochondrial genome of Raphanus sativus (sat) was sequenced and annotated. The circular mitochondrial genome of sat is 239,723 bp and includes 33 protein-coding genes, three rRNA genes and 17 tRNA genes. The mitochondrial genome also contains a pair of large repeat sequences 5.9 kb in length, which may mediate genome reorganization into two sub-genomic circles, with predicted sizes of 124.8 kb and 115.0 kb, respectively. Furthermore, gene evolution of mitochondrial genomes within the Cruciferae family was analyzed using sat mitochondrial type (mitotype), together with six other reported mitotypes. The cruciferous mitochondrial genomes have maintained almost the same set of functional genes. Compared with Cycas taitungensis (a representative gymnosperm), the mitochondrial genomes of the Cruciferae have lost nine protein-coding genes and seven mitochondrial-like tRNA genes, but acquired six chloroplast-like tRNAs. Among the Cruciferae, to maintain the same set of genes that are necessary for mitochondrial function, the exons of the genes have changed at the lowest rates, as indicated by the numbers of single nucleotide polymorphisms. The open reading frames (ORFs) of unknown function in the cruciferous genomes are not conserved. Evolutionary events, such as mutations, genome reorganizations and sequence insertions or deletions (indels), have resulted in the non-conserved ORFs in the cruciferous mitochondrial genomes, which is becoming significantly different among mitotypes. This work represents the first phylogenic explanation of the evolution of genes of known function in the Cruciferae family. It revealed significant variation in ORFs and the causes of such variation.

  17. Whole-exome sequencing identifies homozygous AFG3L2 mutations in a spastic ataxia-neuropathy syndrome linked to mitochondrial m-AAA proteases.

    PubMed

    Pierson, Tyler Mark; Adams, David; Bonn, Florian; Martinelli, Paola; Cherukuri, Praveen F; Teer, Jamie K; Hansen, Nancy F; Cruz, Pedro; Mullikin For The Nisc Comparative Sequencing Program, James C; Blakesley, Robert W; Golas, Gretchen; Kwan, Justin; Sandler, Anthony; Fuentes Fajardo, Karin; Markello, Thomas; Tifft, Cynthia; Blackstone, Craig; Rugarli, Elena I; Langer, Thomas; Gahl, William A; Toro, Camilo

    2011-10-01

    We report an early onset spastic ataxia-neuropathy syndrome in two brothers of a consanguineous family characterized clinically by lower extremity spasticity, peripheral neuropathy, ptosis, oculomotor apraxia, dystonia, cerebellar atrophy, and progressive myoclonic epilepsy. Whole-exome sequencing identified a homozygous missense mutation (c.1847G>A; p.Y616C) in AFG3L2, encoding a subunit of an m-AAA protease. m-AAA proteases reside in the mitochondrial inner membrane and are responsible for removal of damaged or misfolded proteins and proteolytic activation of essential mitochondrial proteins. AFG3L2 forms either a homo-oligomeric isoenzyme or a hetero-oligomeric complex with paraplegin, a homologous protein mutated in hereditary spastic paraplegia type 7 (SPG7). Heterozygous loss-of-function mutations in AFG3L2 cause autosomal-dominant spinocerebellar ataxia type 28 (SCA28), a disorder whose phenotype is strikingly different from that of our patients. As defined in yeast complementation assays, the AFG3L2(Y616C) gene product is a hypomorphic variant that exhibited oligomerization defects in yeast as well as in patient fibroblasts. Specifically, the formation of AFG3L2(Y616C) complexes was impaired, both with itself and to a greater extent with paraplegin. This produced an early-onset clinical syndrome that combines the severe phenotypes of SPG7 and SCA28, in additional to other "mitochondrial" features such as oculomotor apraxia, extrapyramidal dysfunction, and myoclonic epilepsy. These findings expand the phenotype associated with AFG3L2 mutations and suggest that AFG3L2-related disease should be considered in the differential diagnosis of spastic ataxias.

  18. A higher plant mitochondrial homologue of the yeast m-AAA protease. Molecular cloning, localization, and putative function.

    PubMed

    Kolodziejczak, Marta; Kolaczkowska, Anna; Szczesny, Bartosz; Urantowka, Adam; Knorpp, Carina; Kieleczawa, Jan; Janska, Hanna

    2002-11-15

    Mitochondrial AAA metalloproteases play a fundamental role in mitochondrial biogenesis and function. They have been identified in yeast and animals but not yet in plants. This work describes the isolation and sequence analysis of the full-length cDNA from the pea (Pisum sativum) with significant homology to the yeast matrix AAA (m-AAA) protease. The product of this clone was imported into isolated pea mitochondria where it was processed to its mature form (PsFtsH). We have shown that the central region of PsFtsH containing the chaperone domain is exposed to the matrix space. Furthermore, we have demonstrated that the pea protease can complement respiration deficiency in the yta10 and/or yta12 null yeast mutants, indicating that the plant protein can compensate for the loss of at least some of the important m-AAA functions in yeast. Based on biochemical experiments using isolated pea mitochondria, we propose that PsFtsH-like m-AAA is involved in the accumulation of the subunit 9 of the ATP synthase in the mitochondrial membrane.

  19. The dissemination of C10 cysteine protease genes in Bacteroides fragilis by mobile genetic elements

    PubMed Central

    2010-01-01

    Background The C10 family of cysteine proteases includes enzymes that contribute to the virulence of bacterial pathogens, such as SpeB in Streptococcus pyogenes. The presence of homologues of cysteine protease genes in human commensal organisms has not been examined. Bacteroides fragilis is a member of the dominant Bacteroidetes phylum of the human intestinal microbiota, and is a significant opportunistic pathogen. Results Four homologues of the streptococcal virulence factor SpeB were identified in the B. fragilis genome. These four protease genes, two were directly contiguous to open reading frames predicted to encode staphostatin-like inhibitors, with which the protease genes were co-transcribed. Two of these protease genes are unique to B. fragilis 638R and are associated with two large genomic insertions. Gene annotation indicated that one of these insertions was a conjugative Tn-like element and the other was a prophage-like element, which was shown to be capable of excision. Homologues of the B. fragilis C10 protease genes were present in a panel of clinical isolates, and in DNA extracted from normal human faecal microbiota. Conclusions This study suggests a mechanism for the evolution and dissemination of an important class of protease in major members of the normal human microbiota. PMID:20416045

  20. Echinochrome A Increases Mitochondrial Mass and Function by Modulating Mitochondrial Biogenesis Regulatory Genes

    PubMed Central

    Jeong, Seung Hun; Kim, Hyoung Kyu; Song, In-Sung; Noh, Su Jin; Marquez, Jubert; Ko, Kyung Soo; Rhee, Byoung Doo; Kim, Nari; Mishchenko, Natalia P.; Fedoreyev, Sergey A.; Stonik, Valentin A.; Han, Jin

    2014-01-01

    Echinochrome A (Ech A) is a natural pigment from sea urchins that has been reported to have antioxidant properties and a cardio protective effect against ischemia reperfusion injury. In this study, we ascertained whether Ech A enhances the mitochondrial biogenesis and oxidative phosphorylation in rat cardio myoblast H9c2 cells. To study the effects of Ech A on mitochondrial biogenesis, we measured mitochondrial mass, level of oxidative phosphorylation, and mitochondrial biogenesis regulatory gene expression. Ech A treatment did not induce cytotoxicity. However, Ech A treatment enhanced oxygen consumption rate and mitochondrial ATP level. Likewise, Ech A treatment increased mitochondrial contents in H9c2 cells. Furthermore, Ech A treatment up-regulated biogenesis of regulatory transcription genes, including proliferator-activated receptor gamma co-activator (PGC)-1α, estrogen-related receptor (ERR)-α, peroxisome proliferator-activator receptor (PPAR)-γ, and nuclear respiratory factor (NRF)-1 and such mitochondrial transcription regulatory genes as mitochondrial transcriptional factor A (TFAM), mitochondrial transcription factor B2 (TFB2M), mitochondrial DNA direct polymerase (POLMRT), single strand binding protein (SSBP) and Tu translation elongation factor (TUFM). In conclusion, these data suggest that Ech A is a potentiated marine drug which enhances mitochondrial biogenesis. PMID:25196935

  1. The Kunitz-protease inhibitor domain in amyloid precursor protein reduces cellular mitochondrial enzymes expression and function.

    PubMed

    Chua, Li-Min; Lim, Mei-Li; Wong, Boon-Seng

    2013-08-09

    Mitochondrial dysfunction is a prominent feature of Alzheimer's disease (AD) and this can be contributed by aberrant metabolic enzyme function. But, the mechanism causing this enzymatic impairment is unclear. Amyloid precursor protein (APP) is known to be alternatively spliced to produce three major isoforms in the brain (APP695, APP751, APP770). Both APP770 and APP751 contain the Kunitz Protease Inhibitory (KPI) domain, but the former also contain an extra OX-2 domain. APP695 on the other hand, lacks both domains. In AD, up-regulation of the KPI-containing APP isoforms has been reported. But the functional contribution of this elevation is unclear. In the present study, we have expressed and compared the effect of the non-KPI containing APP695 and the KPI-containing APP751 on mitochondrial function. We found that the KPI-containing APP751 significantly decreased the expression of three major mitochondrial metabolic enzymes; citrate synthase, succinate dehydrogenase and cytochrome c oxidase (COX IV). This reduction lowers the NAD(+)/NADH ratio, COX IV activity and mitochondrial membrane potential. Overall, this study demonstrated that up-regulation of the KPI-containing APP isoforms is likely to contribute to the impairment of metabolic enzymes and mitochondrial function in AD.

  2. The peroxisomal Lon protease LonP2 in aging and disease: functions and comparisons with mitochondrial Lon protease LonP1

    PubMed Central

    Pomatto, Laura C. D.; Raynes, Rachel; Davies, Kelvin J. A.

    2016-01-01

    Peroxisomes are ubiquitous eukaryotic organelles with the primary role of breaking down very long- and branched-chain fatty acids for subsequent β-oxidation in the mitochondrion. Like mitochondria, peroxisomes are major sites for oxygen utilization and potential contributors to cellular oxidative stress. The accumulation of oxidatively damaged proteins, which often develop into inclusion bodies (of oxidized, aggregated, and cross-linked proteins) within both mitochondria and peroxisomes, results in loss of organelle function that may contribute to the aging process. Both organelles possess an isoform of the Lon protease that is responsible for degrading proteins damaged by oxidation. While the importance of mitochondrial Lon (LonP1) in relation to oxidative stress and aging has been established, little is known regarding the role of LonP2 and aging-related changes in the peroxisome. Recently, peroxisome dysfunction has been associated with aging-related diseases indicating that peroxisome maintenance is a critical component of ‘healthy aging’. Although mitochondria and peroxisomes are both needed for fatty acid metabolism, little work has focused on understanding the relationship between these two organelles including how age-dependent changes in one organelle may be detrimental for the other. Herein, we summarize findings that establish proteolytic degradation of damaged proteins by the Lon protease as a vital mechanism to maintain protein homeostasis within the peroxisome. Due to the metabolic coordination between peroxisomes and mitochondria, understanding the role of Lon in the aging peroxisome may help to elucidate cellular causes for both peroxisome and mitochondrial dysfunction. PMID:26852705

  3. Prevalence of genes encoding extracellular proteases in Staphylococcus aureus - important targets triggering immune response in vivo.

    PubMed

    Zdzalik, Michal; Karim, Abdulkarim Y; Wolski, Krzysztof; Buda, Pawel; Wojcik, Kinga; Brueggemann, Sarah; Wojciechowski, Piotr; Eick, Sigrun; Calander, Ann-Marie; Jonsson, Ing-Marie; Kubica, Malgorzata; Polakowska, Klaudia; Miedzobrodzki, Jacek; Wladyka, Benedykt; Potempa, Jan; Dubin, Grzegorz

    2012-11-01

    Proteases of Staphylococcus aureus have long been considered to function as important virulence factors, although direct evidence of the role of particular enzymes remains incomplete and elusive. Here, we sought to provide a collective view of the prevalence of extracellular protease genes in genomes of commensal and pathogenic strains of S. aureus and their expression in the course of human and mouse infection. Data on V8 protease, staphopains A and B, aureolysin, and the recently described and poorly characterized group of six Spl proteases are provided. A phylogenetically diverse collection of 167 clinical isolates was analyzed, resulting in the comprehensive genetic survey of the prevalence of protease-encoding genes. No correlation between identified gene patterns with specific infections was established. Humoral response against the proteases of interest was examined in the sera derived from human patients and from a model mouse infection. The analysis suggests that at least some, if not all, tested proteases are expressed and secreted during the course of infection. Overall, the results presented in this study support the hypothesis that the secretory proteases as a group may contribute to the virulence of S. aureus.

  4. A peep into mitochondrial disorder: multifaceted from mitochondrial DNA mutations to nuclear gene modulation.

    PubMed

    Chen, Chao; Chen, Ye; Guan, Min-Xin

    2015-12-01

    Mitochondrial genome is responsible for multiple human diseases in a maternal inherited pattern, yet phenotypes of patients in a same pedigree frequently vary largely. Genes involving in epigenetic modification, RNA processing, and other biological pathways, rather than "threshold effect" and environmental factors, provide more specific explanation to the aberrant phenotype. Thus, the double hit theory, mutations both in mitochondrial DNA and modifying genes aggravating the symptom, throws new light on mitochondrial dysfunction processes. In addition, mitochondrial retrograde signaling pathway that leads to reconfiguration of cell metabolism to adapt defects in mitochondria may as well play an active role. Here we review selected examples of modifier genes and mitochondrial retrograde signaling in mitochondrial disorders, which refine our understanding and will guide the rational design of clinical therapies.

  5. Mutations in nuclear genes alter post-transcriptional regulation of mitochondrial genes.

    USDA-ARS?s Scientific Manuscript database

    Nuclear gene products are required for the expression of mitochondrial genes and elaboration of functional mitochondrial protein complexes. To better understand the roles of these nuclear genes, we exploited the mitochondrial encoded S-type of cytoplasmic male sterility (CMS-S) and developed a nove...

  6. Mitochondrial gene expression: influence of nutrients and hormones.

    PubMed

    Berdanier, Carolyn D

    2006-11-01

    Mitochondrial gene transcription research has exploded over the last decade. Nuclear-encoded proteins, nutrients, and hormones all work to regulate the transcription of this genome. To date, very few of the transcription factors have been shown to have negative effects on mitochondrial gene expression, although there are likely conditions where such downregulation may occur.

  7. Molecular cloning and characterization of an extracellular protease gene from Aeromonas hydrophila.

    PubMed Central

    Rivero, O; Anguita, J; Paniagua, C; Naharro, G

    1990-01-01

    A structural gene which codes for an extracellular protease in Aeromonas hydrophilia SO2/2 and D13 was cloned in Escherichia coli C600-1 by using pBR322 as a vector. The gene codes for a temperature-stable protease with a molecular mass of approximately 38,000 daltons. The protein was secreted to the periplasm of E. coli C600-1 and purified by osmotic shock. Cloned protease (P3) was identical in molecular mass and properties to the one purified from A. hydrophila SO2/2 culture supernatant as an extracellular product. Images PMID:2193924

  8. Horizontal acquisition of multiple mitochondrial genes from a parasitic plant followed by gene conversion with host mitochondrial genes

    PubMed Central

    2010-01-01

    Background Horizontal gene transfer (HGT) is relatively common in plant mitochondrial genomes but the mechanisms, extent and consequences of transfer remain largely unknown. Previous results indicate that parasitic plants are often involved as either transfer donors or recipients, suggesting that direct contact between parasite and host facilitates genetic transfer among plants. Results In order to uncover the mechanistic details of plant-to-plant HGT, the extent and evolutionary fate of transfer was investigated between two groups: the parasitic genus Cuscuta and a small clade of Plantago species. A broad polymerase chain reaction (PCR) survey of mitochondrial genes revealed that at least three genes (atp1, atp6 and matR) were recently transferred from Cuscuta to Plantago. Quantitative PCR assays show that these three genes have a mitochondrial location in the one species line of Plantago examined. Patterns of sequence evolution suggest that these foreign genes degraded into pseudogenes shortly after transfer and reverse transcription (RT)-PCR analyses demonstrate that none are detectably transcribed. Three cases of gene conversion were detected between native and foreign copies of the atp1 gene. The identical phylogenetic distribution of the three foreign genes within Plantago and the retention of cytidines at ancestral positions of RNA editing indicate that these genes were probably acquired via a single, DNA-mediated transfer event. However, samplings of multiple individuals from two of the three species in the recipient Plantago clade revealed complex and perplexing phylogenetic discrepancies and patterns of sequence divergence for all three of the foreign genes. Conclusions This study reports the best evidence to date that multiple mitochondrial genes can be transferred via a single HGT event and that transfer occurred via a strictly DNA-level intermediate. The discovery of gene conversion between co-resident foreign and native mitochondrial copies suggests

  9. Analysis of mitochondrial respiratory-related genes reveals nuclear and mitochondrial genome cooperation in allotetraploid hybrid.

    PubMed

    Peng, L-Y; Wang, J; Tao, M; You, C-P; Ye, L; Xiao, J; Zhang, C; Liu, Y; Liu, S-J

    2014-01-01

    An allotetraploid hybrid lineage derived from the distant hybridization of red crucian carp (Carassius auratus red var., ♀, 2n =100) × common carp (Cyprinus carpio L., ♂, 2n =100) was investigated for its mitochondrial and nuclear genome inheritance patterns. Based on liver transcriptomic data for this hybrid, red crucian carp, and common carp, we identified 94, 136, and 86 contigs corresponding to 41, 46, and 37 mitochondrial respiratory chain nuclear genes, respectively. Mitochondrial respiratory chain nuclear gene sequences from red crucian carp and common carp were both detected in the allotetraploid hybrid, indicating that both parental nuclear genomes were participated in the synthesis of mitochondrial respiratory protein complexes in the hybrid. For mitochondrial respiratory related genes, high sequence similarity (>90%) and a low nucleotide divergence rate (<0.2) between red crucian carp and common carp could be a critical factor allowing cooperation of the three genomes (red crucian carp mitochondrial genome, red crucian and common carp nuclear genomes) in the allotetraploid hybrid lineage. Interestingly, gene duplication events were identified in the allotetraploid hybrid, red crucian and common carp, as confirmed by analysis of orthologous gene trees for these fish. Our findings provide valuable information with which to study cooperation between the nuclear and mitochondrial genomes of other hybrids, and will provide basic genetic information of relevance to mitochondrial-related diseases in humans and animals.

  10. Chymotrypsin protease inhibitor gene family in rice: Genomic organization and evidence for the presence of a bidirectional promoter shared between two chymotrypsin protease inhibitor genes.

    PubMed

    Singh, Amanjot; Sahi, Chandan; Grover, Anil

    2009-01-01

    Protease inhibitors play important roles in stress and developmental responses of plants. Rice genome contains 17 putative members in chymotrypsin protease inhibitor (ranging in size from 7.21 to 11.9 kDa) gene family with different predicted localization sites. Full-length cDNA encoding for a putative subtilisin-chymotrypsin protease inhibitor (OCPI2) was obtained from Pusa basmati 1 (indica) rice seedlings. 620 bp-long OCPI2 cDNA contained 219 bp-long ORF, coding for 72 amino acid-long 7.7 kDa subtilisin-chymotrypsin protease inhibitor (CPI) cytoplasmic protein. Expression analysis by semi-quantitative RT-PCR analysis showed that OCPI2 transcript is induced by varied stresses including salt, ABA, low temperature and mechanical injury in both root and shoot tissues of the seedlings. Transgenic rice plants produced with OCPI2 promoter-gus reporter gene showed that this promoter directs high salt- and ABA-regulated expression of the GUS gene. Another CPI gene (OCPI1) upstream to OCPI2 (with 1126 bp distance between the transcription initiation sites of the two genes; transcription in the reverse orientation) was noted in genome sequence of rice genome. A vector that had GFP and GUS reporter genes in opposite orientations driven by 1881 bp intergenic sequence between the OCPI2 and OCPI1 (encompassing the region between the translation initiation sites of the two genes) was constructed and shot in onion epidermal cells by particle bombardment. Expression of both GFP and GUS from the same epidermal cell showed that this sequence represents a bidirectional promoter. Examples illustrating gene pairs showing co-expression of two divergent neighboring genes sharing a bidirectional promoter have recently been extensively worked out in yeast and human systems. We provide an example of a gene pair constituted of two homologous genes showing co-expression governed by a bidirectional promoter in rice.

  11. Whole-Exome Sequencing Identifies Homozygous AFG3L2 Mutations in a Spastic Ataxia-Neuropathy Syndrome Linked to Mitochondrial m-AAA Proteases

    PubMed Central

    Martinelli, Paola; Cherukuri, Praveen F.; Teer, Jamie K.; Hansen, Nancy F.; Cruz, Pedro; Mullikin for the NISC Comparative Sequencing Program, James C.; Blakesley, Robert W.; Golas, Gretchen; Kwan, Justin; Sandler, Anthony; Fuentes Fajardo, Karin; Markello, Thomas; Tifft, Cynthia; Blackstone, Craig; Rugarli, Elena I.; Langer, Thomas; Gahl, William A.; Toro, Camilo

    2011-01-01

    We report an early onset spastic ataxia-neuropathy syndrome in two brothers of a consanguineous family characterized clinically by lower extremity spasticity, peripheral neuropathy, ptosis, oculomotor apraxia, dystonia, cerebellar atrophy, and progressive myoclonic epilepsy. Whole-exome sequencing identified a homozygous missense mutation (c.1847G>A; p.Y616C) in AFG3L2, encoding a subunit of an m-AAA protease. m-AAA proteases reside in the mitochondrial inner membrane and are responsible for removal of damaged or misfolded proteins and proteolytic activation of essential mitochondrial proteins. AFG3L2 forms either a homo-oligomeric isoenzyme or a hetero-oligomeric complex with paraplegin, a homologous protein mutated in hereditary spastic paraplegia type 7 (SPG7). Heterozygous loss-of-function mutations in AFG3L2 cause autosomal-dominant spinocerebellar ataxia type 28 (SCA28), a disorder whose phenotype is strikingly different from that of our patients. As defined in yeast complementation assays, the AFG3L2Y616C gene product is a hypomorphic variant that exhibited oligomerization defects in yeast as well as in patient fibroblasts. Specifically, the formation of AFG3L2Y616C complexes was impaired, both with itself and to a greater extent with paraplegin. This produced an early-onset clinical syndrome that combines the severe phenotypes of SPG7 and SCA28, in additional to other “mitochondrial” features such as oculomotor apraxia, extrapyramidal dysfunction, and myoclonic epilepsy. These findings expand the phenotype associated with AFG3L2 mutations and suggest that AFG3L2-related disease should be considered in the differential diagnosis of spastic ataxias. PMID:22022284

  12. Expression of petite mitochondrial DNA in vivo: zygotic gene rescue.

    PubMed

    Strausberg, R L; Butow, R A

    1977-07-01

    A protocol is introduced for probing the organization and regulation of expression of the yeast mitochondrial genome, termed "zygotic gene rescue." The procedure is based on the notion that genes retained on mitochondrial DNA of on the notion that genes retained on mitochondrial DNA of petites can be expressed in zygotes of a cross between petite and wild type. To test the validity of this notion, we have taken advantage of our ability to discriminate, by mobility differences on sodium dodecyl sulfate/polyacrylamide gels, different forms of the product of alleles of the mitochondrial gene, varI. In petite strains that have retained the varI gene, its characteristic product appears in zygotes 4-5 hr after mating; no product is observed in petite strains deleted in the varI locus. Our studies indicate that (i) expression in the zygote of the varI gene in the petite genome is not exclusively the result of recombination with mitochondrial DNA of the wild-type tester, and (ii) the varI gene is probably reiterated in the petite mitochondrial genome. The strength of the technique of zygotic gene rescue in the analysis of the mitochondrial genome is discussed.

  13. MOLECULAR IDENTIFICATION OF CYSTEINE AND TRYPSIN PROTEASE, EFFECT OF DIFFERENT HOSTS ON PROTEASE EXPRESSION, AND RNAI MEDIATED SILENCING OF CYSTEINE PROTEASE GENE IN THE SUNN PEST.

    PubMed

    Amiri, Azam; Bandani, Ali Reza; Alizadeh, Houshang

    2016-04-01

    Sunn pest, Eurygaster integriceps, is a serious pest of cereals in the wide area of the globe from Near and Middle East to East and South Europe and North Africa. This study described for the first time, identification of E. integriceps trypsin serine protease and cathepsin-L cysteine, transcripts involved in digestion, which might serve as targets for pest control management. A total of 478 and 500 base pair long putative trypsin and cysteine gene sequences were characterized and named Tryp and Cys, respectively. In addition, the tissue-specific relative gene expression levels of these genes as well as gluten hydrolase (Gl) were determined under different host kernels feeding conditions. Result showed that mRNA expression of Cys, Tryp, and Gl was significantly affected after feeding on various host plant species. Transcript levels of these genes were most abundant in the wheat-fed E. integriceps larvae compared to other hosts. The Cys transcript was detected exclusively in the gut, whereas the Gl and Tryp transcripts were detectable in both salivary glands and gut. Also possibility of Sunn pest gene silencing was studied by topical application of cysteine double-stranded RNA (dsRNA). The results indicated that topically applied dsRNA on fifth nymphal stage can penetrate the cuticle of the insect and induce RNA interference. The Cys gene mRNA transcript in the gut was reduced to 83.8% 2 days posttreatment. Also, it was found that dsRNA of Cys gene affected fifth nymphal stage development suggesting the involvement of this protease in the insect growth, development, and molting.

  14. The Parkinson's disease-related genes act in mitochondrial homeostasis.

    PubMed

    Sai, Yan; Zou, Zhongmin; Peng, Kaige; Dong, Zhaojun

    2012-10-01

    Neurons are metabolically active cells with high energy demands. Thus, neurons are particularly reliant on mitochondrial function, especially on the homeostasis properties of mitochondria. This is reflected by the observation that mitochondrial abnormalities have been well recognized to contribute to neurodegenerative diseases, like Parkinson's disease (PD). Mitochondria are highly complex and dynamic organelles continuously undergoing different alterations. The dynamic property of mitochondria is named as mitochondrial homeostasis. Imbalance of mitochondrial homeostasis is associated with neurodegenerative disease, such as Parkinson's diseases. Recently, the related genes of PD-familial, such as alpha-synuclein, Parkin, PINK1, DJ-1 and LRRK2, are observed to be associated with mitochondria, and capable of modulating normal mitochondrial integrity and functions under certain conditions. Therefore, in this review, we will focus on the action of PD-related genes in mitochondrial homeostasis. Crown Copyright © 2012. Published by Elsevier Ltd. All rights reserved.

  15. Mitochondrial serine protease HTRA2 p.G399S in a kindred with essential tremor and Parkinson disease.

    PubMed

    Unal Gulsuner, Hilal; Gulsuner, Suleyman; Mercan, Fatma Nazli; Onat, Onur Emre; Walsh, Tom; Shahin, Hashem; Lee, Ming K; Dogu, Okan; Kansu, Tulay; Topaloglu, Haluk; Elibol, Bulent; Akbostanci, Cenk; King, Mary-Claire; Ozcelik, Tayfun; Tekinay, Ayse B

    2014-12-23

    Essential tremor is one of the most frequent movement disorders of humans and can be associated with substantial disability. Some but not all persons with essential tremor develop signs of Parkinson disease, and the relationship between the conditions has not been clear. In a six-generation consanguineous Turkish kindred with both essential tremor and Parkinson disease, we carried out whole exome sequencing and pedigree analysis, identifying HTRA2 p.G399S as the allele likely responsible for both conditions. Essential tremor was present in persons either heterozygous or homozygous for this allele. Homozygosity was associated with earlier age at onset of tremor (P < 0.0001), more severe postural tremor (P < 0.0001), and more severe kinetic tremor (P = 0.0019). Homozygotes, but not heterozygotes, developed Parkinson signs in the middle age. Among population controls from the same Anatolian region as the family, frequency of HTRA2 p.G399S was 0.0027, slightly lower than other populations. HTRA2 encodes a mitochondrial serine protease. Loss of function of HtrA2 was previously shown to lead to parkinsonian features in motor neuron degeneration (mnd2) mice. HTRA2 p.G399S was previously shown to lead to mitochondrial dysfunction, altered mitochondrial morphology, and decreased protease activity, but epidemiologic studies of an association between HTRA2 and Parkinson disease yielded conflicting results. Our results suggest that in some families, HTRA2 p.G399S is responsible for hereditary essential tremor and that homozygotes for this allele develop Parkinson disease. This hypothesis has implications for understanding the pathogenesis of essential tremor and its relationship to Parkinson disease.

  16. Characterization of cysteine protease-like genes in the striped rice stem borer, Chilo suppressalis.

    PubMed

    Ge, Zhao-Yu; Wan, Pin-Jun; Li, Guo-Qing; Xia, Yong-Gui; Han, Zhao-Jun

    2014-02-01

    The striped rice stem borer, Chilo suppressalis (Walker), is a major pest for rice production in China and the rest of Southeast Asia. Chemical control is the main means to alleviate losses due to this pest, which causes serious environmental pollution. An effective and environmentally friendly approach is needed for the management of the striped rice stem borer. Cysteine proteases in insects could be useful targets for pest management either through engineering plant protease inhibitors, targeting insect digestive cysteine proteases, or through RNA interference-based silencing of cysteine proteases, disrupting developmental regulation of insects. In this study, eight cysteine protease-like genes were identified and partially characterized. The genes CCO2 and CCL4 were exclusively expressed in the larval gut, and their expression was affected by the state of nutrition in the insect. The expression of CCL2, CCL3, and CCO1 was significantly affected by the type of host plant, suggesting a role in host plant - insect interactions. Our initial characterization of the striped rice stem borer cysteine protease-like genes provides a foundation for further research on this important group of genes in this major insect pest of rice.

  17. Cloning of the gene encoding streptococcal immunoglobulin A protease and its expression in Escherichia coli.

    PubMed Central

    Gilbert, J V; Plaut, A G; Fishman, Y; Wright, A

    1988-01-01

    We have identified and cloned a 6-kilobase-pair segment of chromosomal DNA from Streptococcus sanguis ATCC 10556 that encodes immunoglobulin A (IgA) protease activity when cloned into Escherichia coli. The enzyme specified by the iga gene in plasmid pJG1 accumulates in the periplasm of E. coli MM294 cells and has a substrate specificity for human IgA1 identical to that of native S. sanguis protease. Hybridization experiments with probes from within the encoding DNA showed no detectable homology at the nucleotide sequence level with chromosomal DNA of gram-negative bacteria that excrete IgA protease. Moreover, the S. sanguis iga gene probes showed no detectable hybridization with chromosomal DNA of S. pneumoniae, although the IgA proteases of these two streptococcal species cleaved the identical peptide bond in the human IgA1 heavy-chain hinge region. Images PMID:3294181

  18. Purification and characterization of cloned alkaline protease gene of Geobacillus stearothermophilus.

    PubMed

    Iqbal, Irfana; Aftab, Muhammad Nauman; Afzal, Mohammed; Ur-Rehman, Asad; Aftab, Saima; Zafar, Asma; Ud-Din, Zia; Khuharo, Ateeque Rahman; Iqbal, Jawad; Ul-Haq, Ikram

    2015-02-01

    Thermostable alkaline serine protease gene of Geobacillus stearothermophilus B-1172 was cloned and expressed in Escherichia coli BL21 (DE3) using pET-22b(+), as an expression vector. The growth conditions were optimized for maximal production of the protease using variable fermentation parameters, i.e., pH, temperature, and addition of an inducer. Protease, thus produced, was purified by ammonium sulfate precipitation followed by ion exchange chromatography with 13.7-fold purification, with specific activity of 97.5 U mg(-1) , and a recovery of 23.6%. Molecular weight of the purified protease, 39 kDa, was determined by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). The enzyme was stable at 90 °C at pH 9. The enzyme activity was steady in the presence of EDTA indicating that the protease was not a metalloprotease. No significant change in the activity of protease after addition of various metal ions further strengthened this fact. However, an addition of 1% Triton X-100 or SDS surfactants constrained the enzyme specific activity to 34 and 19%, respectively. Among organic solvents, an addition of 1-butanol (20%) augmented the enzyme activity by 29% of the original activity. With casein as a substrate, the enzyme activity under optimized conditions was found to be 73.8 U mg(-1) . The effect of protease expression on the host cells growth was also studied and found to negatively affect E. coli cells to certain extent. Catalytic domains of serine proteases from eight important thermostable organisms were analyzed through WebLogo and found to be conserved in all serine protease sequences suggesting that protease of G. stearothermophilus could be beneficially used as a biocontrol agent and in many industries including detergent industry.

  19. Differential expression of conserved protease genes in crucifer-attacking pathovars of Xanthomonas campestris.

    PubMed

    Dow, J M; Fan, M J; Newman, M A; Daniels, M J

    1993-12-01

    Strains of Xanthomonas campestris pathovars armoraciae and raphani, which cause leaf spotting diseases in brassicas, produce a major extracellular protease in liquid culture which was partially purified. The protease (PRT 3) was a zinc-requiring metalloenzyme and was readily distinguishable from the two previously characterized proteases (PRT 1 and PRT 2) of X. campestris pv. campestris by the pattern of degradation of beta-casein and sensitivity to inhibitors. PRT 3 was produced at a low level in the vascular brassica pathogen X. campestris pv. campestris (five strains tested), in which PRT 1 and PRT 2 predominate. In contrast, expression of PRT 1, a serine protease, could not be detected in the six tested strains of the leaf spotting mesophyll pathogens. However, all these strains had DNA fragments which hybridized to a prtA probe and which probably carry a functional prtA (the structural gene for PRT 1). The structural gene for PRT 3 (prtC) was cloned by screening a genomic library of X. campestris pv. raphani in a protease-deficient X. campestris pv. campestris strain. Subcloning and Tn5 mutagenesis located the structural gene to 1.2 kb of DNA. DNA fragments which hybridized to the structural gene were found in all strains of the crucifer-attacking X. campestris pathovars tested as well as in a number of other pathovars. Experiments in which the pattern of protease production of the pathovars was manipulated by introduction of cloned genes into heterologous pathovars suggested that no determinative relationship exists between the pattern of protease gene expression and the (vascular or mesophyllic) mode of pathogenesis.

  20. Regulation of mitochondrial gene expression, the epigenetic enigma.

    PubMed

    Mposhi, Archibold; Van der Wijst, Monique Gp; Faber, Klaas Nico; Rots, Marianne G

    2017-03-01

    Epigenetics provides an important layer of information on top of the DNA sequence and is essential for establishing gene expression profiles. Extensive studies have shown that nuclear DNA methylation and histone modifications influence nuclear gene expression. However, it remains unclear whether mitochondrial DNA (mtDNA) undergoes similar epigenetic changes to regulate mitochondrial gene expression. Recently, it has been shown that mtDNA is differentially methylated in various diseases such as diabetes and colorectal cancer. Interestingly, this differential methylation was often associated with altered mitochondrial gene expression. However, the direct role of mtDNA methylation on gene expression remains elusive. Alternatively, the activity of the mitochondrial transcription factor A (TFAM), a protein involved in mtDNA packaging, might also influence gene expression. This review discusses the role of mtDNA methylation and potential epigenetic-like modifications of TFAM with respect to mtDNA transcription and replication. We suggest three mechanisms: (1) methylation within the non-coding D-loop, (2) methylation at gene start sites (GSS) and (3) post-translational modifications (PTMs) of TFAM. Unraveling mitochondrial gene expression regulation could open new therapeutic avenues for mitochondrial diseases.

  1. Nuclear and mitochondrial genes for inferring Trichuris phylogeny.

    PubMed

    Callejón, Rocío; Cutillas, Cristina; Nadler, Steven A

    2015-12-01

    Nucleotide sequences of the triose phosphate isomerase (TPI) gene (624 bp) and mitochondrial cytochrome b (cob) gene (520 bp) were obtained by PCR and evaluated for utility in inferring the phylogenetic relationships among Trichuris species. Published sequences of one other nuclear gene (18S or SSU rRNA, 1816-1846 bp) and one additional mitochondrial (mtDNA) gene (cytochrome oxidase 1, cox1, 342 bp) were also analyzed. Maximum likelihood and Bayesian inference methods were used to infer phylogenies for each gene separately but also for the combined mitochondrial data (two genes), the combined nuclear data (two genes), and the total evidence (four gene) dataset. Few Trichuris clades were uniformly resolved across separate analyses of individual genes. For the mtDNA, the cob gene trees had greater phylogenetic resolution and tended to have higher support values than the cox1 analyses. For nuclear genes, the SSU gene trees had slightly greater resolution and support values than the TPI analyses, but TPI was the only gene with reliable support for the deepest nodes in the tree. Combined analyses of genes yielded strongly supported clades in most cases, with the exception of the relationship among Trichuris clades 1, 2, and 3, which showed conflicting results between nuclear and mitochondrial genes. Both the TPI and cob genes proved valuable for inferring Trichuris relationships, with greatest resolution and support values achieved through combined analysis of multiple genes. Based on the phylogeny of the combined analysis of nuclear and mitochondrial genes, parsimony mapping of definitive host utilization depicts artiodactyls as the ancestral hosts for these Trichuris, with host-shifts into primates, rodents, and Carnivora.

  2. Proteases and oxidant stress control organic dust induction of inflammatory gene expression in lung epithelial cells.

    PubMed

    Natarajan, Kartiga; Gottipati, Koteswara R; Berhane, Kiflu; Samten, Buka; Pendurthi, Usha; Boggaram, Vijay

    2016-10-22

    Persistant inflammatory responses to infectious agents and other components in organic dust underlie lung injury and development of respiratory diseases. Organic dust components responsible for eliciting inflammation and the mechanisms by which they cause lung inflammation are not fully understood. We studied the mechanisms by which protease activities in poultry dust extracts and intracellular oxidant stress induce inflammatory gene expression in A549 and Beas2B lung epithelial cells. The effects of dust extracts on inflammatory gene expression were analyzed by quantitative polymerase chain reaction (qPCR), enzyme linked immunosorbent (ELISA) and western blot assays. Oxidant stress was probed by dihydroethidium (DHE) labeling, and immunostaining for 4-hydroxynonenal (4-HNE). Effects on interleukin-8 (IL-8) promoter regulation were determined by transient transfection assay. Dust extracts contained trypsin and elastase activities, and activated protease activated receptor (PAR)-1 and -2. Serine protease inhibitors and PAR-1 or PAR-2 knockdown suppressed inflammatory gene induction. Dust extract induction of IL-8 gene expression was associated with increased DHE-fluorescence and 4-HNE staining, and antioxidants suppressed inflammatory gene induction. Protease inhibitors and antioxidants suppressed protein kinase C and NF-κB activation and induction of IL-8 promoter activity in cells exposed to dust extract. Our studies demonstrate that proteases and intracellular oxidants control organic dust induction of inflammatory gene expression in lung epithelial cells. Targeting proteases and oxidant stress may serve as novel approaches for the treatment of organic dust induced lung diseases. This is the first report on the involvement of oxidant stress in the induction of inflammatory gene expression by organic dust.

  3. Characterization, cloning, and heterologous expression of a subtilisin-like serine protease gene VlPr1 from Verticillium lecanii.

    PubMed

    Yu, Gang; Liu, Jin-Liang; Xie, Li-Qin; Wang, Xue-Liang; Zhang, Shi-Hong; Pan, Hong-Yu

    2012-12-01

    The entomopathogenic fungus Verticillium lecanii is a well-known biocontrol agent. V. lecanii produces subtilisin-like serine protease (Pr1), which is important in the biological control activity of some insect pests by degrading insect cuticles. In this study, a subtilisin-like serine protease gene VlPr1 was cloned from the fungus and the VlPr1 protein was expressed in Escherichia coli. The VlPr1 gene contains an open reading frame (ORF) interrupted by three short introns, and encodes a protein of 379 amino acids. Protein sequence analysis revealed high homology with subtilisin serine proteases. The molecular mass of the protease was 38 kDa, and the serine protease exhibited its maximal activity at 40°C and pH 9.0. Protease activity was also affected by Mg(2+) and Ca(2+) concentration. The protease showed inhibitory activity against several plant pathogens, especially towards Fusarium moniliforme.

  4. The effect of environmental conditions on expression of Bacteroides fragilis and Bacteroides thetaiotaomicron C10 protease genes

    PubMed Central

    2012-01-01

    Background Bacteroides fragilis and Bacteroides thetaiotaomicron are members of the normal human intestinal microbiota. However, both organisms are capable of causing opportunistic infections, during which the environmental conditions to which the bacteria are exposed change dramatically. To further explore their potential for contributing to infection, we have characterized the expression in B. thetaiotaomicron of four homologues of the gene encoding the C10 cysteine protease SpeB, a potent extracellular virulence factor produced by Streptococcus pyogenes. Results We identified a paralogous set of genes (btp genes) in the B. thetaiotaomicron genome, that were related to C10 protease genes we recently identified in B. fragilis. Similar to C10 proteases found in B. fragilis, three of the B. thetaiotaomicron homologues were transcriptionally coupled to genes encoding small proteins that are similar in structural architecture to Staphostatins, protease inhibitors associated with Staphopains in Staphylococcus aureus. The expression of genes for these C10 proteases in both B. fragilis and B. thetaiotaomicron was found to be regulated by environmental stimuli, in particular by exposure to oxygen, which may be important for their contribution to the development of opportunistic infections. Conclusions Genes encoding C10 proteases are increasingly identified in operons which also contain genes encoding proteins homologous to protease inhibitors. The Bacteroides C10 protease gene expression levels are responsive to different environmental stimuli suggesting they may have distinct roles in the bacterial-host interaction. PMID:22943521

  5. The effect of environmental conditions on expression of Bacteroides fragilis and Bacteroides thetaiotaomicron C10 protease genes.

    PubMed

    Thornton, Roibeard F; Murphy, Elizabeth C; Kagawa, Todd F; O'Toole, Paul W; Cooney, Jakki C

    2012-09-03

    Bacteroides fragilis and Bacteroides thetaiotaomicron are members of the normal human intestinal microbiota. However, both organisms are capable of causing opportunistic infections, during which the environmental conditions to which the bacteria are exposed change dramatically. To further explore their potential for contributing to infection, we have characterized the expression in B. thetaiotaomicron of four homologues of the gene encoding the C10 cysteine protease SpeB, a potent extracellular virulence factor produced by Streptococcus pyogenes. We identified a paralogous set of genes (btp genes) in the B. thetaiotaomicron genome, that were related to C10 protease genes we recently identified in B. fragilis. Similar to C10 proteases found in B. fragilis, three of the B. thetaiotaomicron homologues were transcriptionally coupled to genes encoding small proteins that are similar in structural architecture to Staphostatins, protease inhibitors associated with Staphopains in Staphylococcus aureus. The expression of genes for these C10 proteases in both B. fragilis and B. thetaiotaomicron was found to be regulated by environmental stimuli, in particular by exposure to oxygen, which may be important for their contribution to the development of opportunistic infections. Genes encoding C10 proteases are increasingly identified in operons which also contain genes encoding proteins homologous to protease inhibitors. The Bacteroides C10 protease gene expression levels are responsive to different environmental stimuli suggesting they may have distinct roles in the bacterial-host interaction.

  6. MALT1 Protease Activity Controls the Expression of Inflammatory Genes in Keratinocytes upon Zymosan Stimulation.

    PubMed

    Schmitt, Anja; Grondona, Paula; Maier, Tabea; Brändle, Marc; Schönfeld, Caroline; Jäger, Günter; Kosnopfel, Corinna; Eberle, Franziska C; Schittek, Birgit; Schulze-Osthoff, Klaus; Yazdi, Amir S; Hailfinger, Stephan

    2016-04-01

    The protease activity of the paracaspase mucosa-associated lymphoid tissue lymphoma translocation gene 1 (MALT1) plays an important role in antigen receptor-mediated lymphocyte activation by controlling the activity of the transcription factor nuclear factor-κB and is thus essential for the expression of inflammatory target genes. MALT1 is not only present in cells of the hematopoietic lineage, but is ubiquitously expressed. Here we report that stimulation with zymosan or Staphylococcus aureus induced MALT1 protease activity in human primary keratinocytes. Inhibition of the Src family of kinases or novel protein kinase C isoforms as well as silencing of CARMA2 or BCL10 interfered with activation of MALT1 protease. Silencing or inhibition of MALT1 protease strongly decreased the expression of important inflammatory genes such as TNFα, IL-17C, CXCL8 and HBD-2. MALT1-inhibited cells were unable to mount an antimicrobial response upon zymosan stimulation or phorbolester/ionomycin treatment, demonstrating a central role of MALT1 protease activity in keratinocyte immunity and suggesting MALT1 as a potential target in inflammatory skin diseases.

  7. Resveratrol Co-Treatment Attenuates the Effects of HIV Protease Inhibitors on Rat Body Weight and Enhances Cardiac Mitochondrial Respiration

    PubMed Central

    Symington, Burger; Mapanga, Rudo F.; Norton, Gavin R.

    2017-01-01

    Since the early 1990s human immunodeficiency virus (HIV)/acquired immunodeficiency syndrome (AIDS) emerged as a global health pandemic, with sub-Saharan Africa the hardest hit. While the successful roll-out of antiretroviral (ARV) therapy provided significant relief to HIV-positive individuals, such treatment can also elicit damaging side-effects. Here especially HIV protease inhibitors (PIs) are implicated in the onset of cardio-metabolic complications such as type-2 diabetes and coronary heart disease. As there is a paucity of data regarding suitable co-treatments within this context, this preclinical study investigated whether resveratrol (RSV), aspirin (ASP) or vitamin C (VitC) co-treatment is able to blunt side-effects in a rat model of chronic PI exposure (Lopinavir/Ritonavir treatment for 4 months). Body weights and weight gain, blood metabolite levels (total cholesterol, HDL, LDL, triglycerides), echocardiography and cardiac mitochondrial respiration were assessed in PI-treated rats ± various co-treatments. Our data reveal that PI treatment significantly lowered body weight and cardiac respiratory function while no significant changes were found for heart function and blood metabolite levels. Moreover, all co-treatments ameliorated the PI-induced decrease in body weight after 4 months of PI treatment, while RSV co-treatment enhanced cardiac mitochondrial respiratory capacity in PI-treated rats. This pilot study therefore provides novel hypotheses regarding RSV co-treatment that should be further assessed in greater detail. PMID:28107484

  8. Mitochondrial gene therapy augments mitochondrial physiology in a Parkinson's disease cell model.

    PubMed

    Keeney, Paula M; Quigley, Caitlin K; Dunham, Lisa D; Papageorge, Christina M; Iyer, Shilpa; Thomas, Ravindar R; Schwarz, Kathleen M; Trimmer, Patricia A; Khan, Shaharyar M; Portell, Francisco R; Bergquist, Kristen E; Bennett, James P

    2009-08-01

    Neurodegeneration in Parkinson's disease (PD) affects mainly dopaminergic neurons in the substantia nigra, where age-related, increasing percentages of cells lose detectable respiratory activity associated with depletion of intact mitochondrial DNA (mtDNA). Replenishment of mtDNA might improve neuronal bioenergetic function and prevent further cell death. We developed a technology ("ProtoFection") that uses recombinant human mitochondrial transcription factor A (TFAM) engineered with an N-terminal protein transduction domain (PTD) followed by the SOD2 mitochondrial localization signal (MLS) to deliver mtDNA cargo to the mitochondria of living cells. MTD-TFAM (MTD = PTD + MLS = "mitochondrial transduction domain") binds mtDNA and rapidly transports it across plasma membranes to mitochondria. For therapeutic proof-of-principle we tested ProtoFection technology in Parkinson's disease cybrid cells, using mtDNA generated from commercially available human genomic DNA (gDNA; Roche). Nine to 11 weeks after single exposures to MTD-TFAM + mtDNA complex, PD cybrid cells with impaired respiration and reduced mtDNA genes increased their mtDNA gene copy numbers up to 24-fold, mtDNA-derived RNAs up to 35-fold, TFAM and ETC proteins, cell respiration, and mitochondrial movement velocities. Cybrid cells with no or minimal basal mitochondrial impairments showed reduced or no responses to treatment, suggesting the possibility of therapeutic selectivity. Exposure of PD but not control cybrid cells to MTD-TFAM protein alone or MTD-TFAM + mtDNA complex increased expression of PGC-1alpha, suggesting activation of mitochondrial biogenesis. ProtoFection technology for mitochondrial gene therapy holds promise for improving bioenergetic function in impaired PD neurons and needs additional development to define its pharmacodynamics and delineate its molecular mechanisms. It also is unclear whether single-donor gDNA for generating mtDNA would be a preferred therapeutic compared with the pooled

  9. Adaptations required for mitochondrial import following mitochondrial to nucleus gene transfer of ribosomal protein S10.

    PubMed

    Murcha, Monika W; Rudhe, Charlotta; Elhafez, Dina; Adams, Keith L; Daley, Daniel O; Whelan, James

    2005-08-01

    The minimal requirements to support protein import into mitochondria were investigated in the context of the phenomenon of ongoing gene transfer from the mitochondrion to the nucleus in plants. Ribosomal protein 10 of the small subunit is encoded in the mitochondrion in soybean and many other angiosperms, whereas in several other species it is nuclear encoded and thus must be imported into the mitochondrial matrix to function. When encoded by the nuclear genome, it has adopted different strategies for mitochondrial targeting and import. In lettuce (Lactuca sativa) and carrot (Daucus carota), Rps10 independently gained different N-terminal extensions from other genes, following transfer to the nucleus. (The designation of Rps10 follows the following convention. The gene is indicated in italics. If encoded in the mitochondrion, it is rps10; if encoded in the nucleus, it is Rps10.) Here, we show that the N-terminal extensions of Rps10 in lettuce and carrot are both essential for mitochondrial import. In maize (Zea mays), Rps10 has not acquired an extension upon transfer but can be readily imported into mitochondria. Deletion analysis located the mitochondrial targeting region to the first 20 amino acids. Using site directed mutagenesis, we changed residues in the first 20 amino acids of the mitochondrial encoded soybean (Glycine max) rps10 to the corresponding amino acids in the nuclear encoded maize Rps10 until import was achieved. Changes were required that altered charge, hydrophobicity, predicted ability to form an amphipathic alpha-helix, and generation of a binding motif for the outer mitochondrial membrane receptor, translocase of the outer membrane 20. In addition to defining the changes required to achieve mitochondrial localization, the results demonstrate that even proteins that do not present barriers to import can require substantial changes to acquire a mitochondrial targeting signal.

  10. Evidence for mitochondrial genetic control of autosomal gene expression.

    PubMed

    Kassam, Irfahan; Qi, Tuan; Lloyd-Jones, Luke; Holloway, Alexander; Jan Bonder, Marc; Henders, Anjali K; Martin, Nicholas G; Powell, Joseph E; Franke, Lude; Montgomery, Grant W; Visscher, Peter M; McRae, Allan F

    2016-12-15

    The mitochondrial and nuclear genomes coordinate and co-evolve in eukaryotes in order to adapt to environmental changes. Variation in the mitochondrial genome is capable of affecting expression of genes on the nuclear genome. Sex-specific mitochondrial genetic control of gene expression has been demonstrated in Drosophila melanogaster, where males were found to drive most of the total variation in gene expression. This has potential implications for male-related health and disease resulting from variation in mtDNA solely inherited from the mother. We used a family-based study comprised of 47,323 gene expression probes and 78 mitochondrial SNPs (mtSNPs) from n = 846 individuals to examine the extent of mitochondrial genetic control of gene expression in humans. This identified 15 significant probe-mtSNP associations (P<10-8) corresponding to 5 unique genes on the mitochondrial and nuclear genomes, with three of these genes corresponding to mitochondrial genetic control of gene expression in the nuclear genome. The associated mtSNPs for three genes (one cis and two trans associations) were replicated (P < 0.05) in an independent dataset of n = 452 unrelated individuals. There was no evidence for sexual dimorphic gene expression in any of these five probes. Sex-specific effects were examined by applying our analysis to males and females separately and testing for differences in effect size. The MEST gene was identified as having the most significantly different effect sizes across the sexes (P≈10-7). MEST was similarly expressed in males and females with the G allele; however, males with the C allele are highly expressed for MEST, while females show no expression of the gene. This study provides evidence for the mitochondrial genetic control of expression of several genes in humans, with little evidence found for sex-specific effects. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  11. Cyclophilin-D: a resident regulator of mitochondrial gene expression.

    PubMed

    Radhakrishnan, Jeejabai; Bazarek, Stanley; Chandran, Bala; Gazmuri, Raúl J

    2015-07-01

    Cyclophilin-D (Cyp-D) is a mitochondrial matrix peptidyl-prolyl isomerase. Because cyclophilins can regulate nuclear gene expression, we examined whether Cyp-D could regulate mitochondrial gene expression. We demonstrated in HEK 293T cells that transfected Cyp-D interacts with mitochondrial transcription factors B1 and B2 (TFB2M) but not with mitochondrial transcription factor A. We also demonstrated that Cyp-D interacts in vivo with TFB2M. Genetic silencing of Cyp-D and pharmacologic inhibition of Cyp-D markedly reduced mitochondrial transcription to 18 ± 5% (P < 0.05) and 24 ± 3% (P < 0.05) of respective controls. The level of interaction between Cyp-D and TFB2M correlated with the level of nascent mitochondrial RNA intensity (r = 0.896; P = 0.0156). Cyp-D silencing down-regulated mitochondrial transcripts initiated from the heavy strand promoter 2 [i.e., NADH dehydrogenase 1 (ND1) by 11-fold, P < 0.005; cytochrome oxidase 1 (COX1) by 4-fold, P < 0.001; and ATP synthase subunit 6 (ATP6) by 6.5-fold, P < 0.005); but not NADH dehydrogenase 6 (ND6)], which is initiated from the light strand promoter. Cyp-D silencing reduced mitochondrial membrane potential and cellular oxygen consumption (from 59 ± 5 to 34 ± 1 µmol oxygen/min/10(6) cells, P < 0.001); the latter without a statistically significant reversal after uncoupling electron transport from ATP synthesis, consistent with down-regulation of electron transport complexes. Accordingly, these studies provide novel evidence that Cyp-D could play a key role in regulating mitochondrial gene expression. © FASEB.

  12. Cysteine protease gene expression and proteolytic activity during senescence of Alstroemeria petals.

    PubMed

    Wagstaff, Carol; Leverentz, Michael K; Griffiths, Gareth; Thomas, Brian; Chanasut, Usawadee; Stead, Anthony D; Rogers, Hilary J

    2002-02-01

    The functional life of the flower is terminated by senescence and/or abscission. Multiple processes contribute to produce the visible signs of petal wilting and inrolling that typify senescence, but one of the most important is that of protein degradation and remobilization. This is mediated in many species through protein ubiquitination and the action of specific protease enzymes. This paper reports the changes in protein and protease activity during development and senescence of Alstroemeria flowers, a Liliaceous species that shows very little sensitivity to ethylene during senescence and which shows perianth abscission 8-10 d after flower opening. Partial cDNAs of ubiquitin (ALSUQ1) and a putative cysteine protease (ALSCYP1) were cloned from Alstroemeria using degenerate PCR primers and the expression pattern of these genes was determined semi-quantitatively by RT-PCR. While the levels of ALSUQ1 only fluctuated slightly during floral development and senescence, there was a dramatic increase in the expression of ALSCYP1 indicating that this gene may encode an important enzyme for the proteolytic process in this species. Three papain class cysteine protease enzymes showing different patterns of activity during flower development were identified on zymograms, one of which showed a similar expression pattern to the cysteine protease cDNA.

  13. Gemini surfactants mediate efficient mitochondrial gene delivery and expression.

    PubMed

    Cardoso, Ana M; Morais, Catarina M; Cruz, A Rita; Cardoso, Ana L; Silva, Sandra G; do Vale, M Luísa; Marques, Eduardo F; Pedroso de Lima, Maria C; Jurado, Amália S

    2015-03-02

    Gene delivery targeting mitochondria has the potential to transform the therapeutic landscape of mitochondrial genetic diseases. Taking advantage of the nonuniversal genetic code used by mitochondria, a plasmid DNA construct able to be specifically expressed in these organelles was designed by including a codon, which codes for an amino acid only if read by the mitochondrial ribosomes. In the present work, gemini surfactants were shown to successfully deliver plasmid DNA to mitochondria. Gemini surfactant-based DNA complexes were taken up by cells through a variety of routes, including endocytic pathways, and showed propensity for inducing membrane destabilization under acidic conditions, thus facilitating cytoplasmic release of DNA. Furthermore, the complexes interacted extensively with lipid membrane models mimicking the composition of the mitochondrial membrane, which predicts a favored interaction of the complexes with mitochondria in the intracellular environment. This work unravels new possibilities for gene therapy toward mitochondrial diseases.

  14. Mitochondrial genes are altered in blood early in Alzheimer's disease.

    PubMed

    Lunnon, Katie; Keohane, Aoife; Pidsley, Ruth; Newhouse, Stephen; Riddoch-Contreras, Joanna; Thubron, Elisabeth B; Devall, Matthew; Soininen, Hikka; Kłoszewska, Iwona; Mecocci, Patrizia; Tsolaki, Magda; Vellas, Bruno; Schalkwyk, Leonard; Dobson, Richard; Malik, Afshan N; Powell, John; Lovestone, Simon; Hodges, Angela

    2017-01-07

    Although mitochondrial dysfunction is a consistent feature of Alzheimer's disease in the brain and blood, the molecular mechanisms behind these phenomena are unknown. Here we have replicated our previous findings demonstrating reduced expression of nuclear-encoded oxidative phosphorylation (OXPHOS) subunits and subunits required for the translation of mitochondrial-encoded OXPHOS genes in blood from people with Alzheimer's disease and mild cognitive impairment. Interestingly this was accompanied by increased expression of some mitochondrial-encoded OXPHOS genes, namely those residing closest to the transcription start site of the polycistronic heavy chain mitochondrial transcript (MT-ND1, MT-ND2, MT-ATP6, MT-CO1, MT-CO2, MT-C03) and MT-ND6 transcribed from the light chain. Further we show that mitochondrial DNA copy number was unchanged suggesting no change in steady-state numbers of mitochondria. We suggest that an imbalance in nuclear and mitochondrial genome-encoded OXPHOS transcripts may drive a negative feedback loop reducing mitochondrial translation and compromising OXPHOS efficiency, which is likely to generate damaging reactive oxygen species.

  15. Mitochondrial and Metabolic Gene Expression in the Aged Rat Heart

    PubMed Central

    Barton, Gregory P.; Sepe, Joseph J.; McKiernan, Susan H.; Aiken, Judd M.; Diffee, Gary M.

    2016-01-01

    Aging is associated with a decline in cardiac function. Exercise intervention has been suggested as a way to improve this decrement. Age-related decline in cardiac function is associated with decreases in fatty acid oxidation, mitochondrial function, and AMP-activated protein kinase (AMPK) activity. The molecular mechanisms involved with age-related changes in mitochondrial function and substrate metabolism are poorly understood. We determined gene expression differences in hearts of Young (6 mo), Old (33 mo), and old exercise trained (Old + EXE) (34 mo) FBN rats, using Qiagen PCR arrays for Glucose, Fatty acid, and Mitochondrial metabolism. Old rats demonstrated decreased (p < 0.05) expression for key genes in fatty acid oxidation, mitochondrial function, and AMPK signaling. There were no differences in the expression of genes involved in glucose metabolism with age. These gene expression changes occurred prior to altered protein translation as we found no differences in the protein content of peroxisome proliferator activated receptor gamma, coactivators 1 alpha (PGC-1α), peroxisome proliferator activated receptor alpha (PPARα), and AMPKα2 between young and old hearts. Four months of exercise training did not attenuate the decline in the gene expression in aged hearts. Despite this lack of change in gene expression, exercise-trained rats demonstrated increased exercise capacity compared to their sedentary counterparts. Taken together, our results show that differential expression of genes associated with fatty acid metabolism, AMPK signaling and mitochondrial function decrease in the aging heart which may play a role in age-related declines in fatty acid oxidation, AMPK activity, and mitochondrial function in the heart. PMID:27601998

  16. Computationally Driven, Quantitative Experiments Discover Genes Required for Mitochondrial Biogenesis

    PubMed Central

    Hess, David C.; Hayes, Alicia P.; Paw, Jadine; Clore, John J.; Mendoza, Rosa M.; Luis, Bryan San; Nislow, Corey; Giaever, Guri; Costanzo, Michael; Troyanskaya, Olga G.; Caudy, Amy A.

    2009-01-01

    Mitochondria are central to many cellular processes including respiration, ion homeostasis, and apoptosis. Using computational predictions combined with traditional quantitative experiments, we have identified 100 proteins whose deficiency alters mitochondrial biogenesis and inheritance in Saccharomyces cerevisiae. In addition, we used computational predictions to perform targeted double-mutant analysis detecting another nine genes with synthetic defects in mitochondrial biogenesis. This represents an increase of about 25% over previously known participants. Nearly half of these newly characterized proteins are conserved in mammals, including several orthologs known to be involved in human disease. Mutations in many of these genes demonstrate statistically significant mitochondrial transmission phenotypes more subtle than could be detected by traditional genetic screens or high-throughput techniques, and 47 have not been previously localized to mitochondria. We further characterized a subset of these genes using growth profiling and dual immunofluorescence, which identified genes specifically required for aerobic respiration and an uncharacterized cytoplasmic protein required for normal mitochondrial motility. Our results demonstrate that by leveraging computational analysis to direct quantitative experimental assays, we have characterized mutants with subtle mitochondrial defects whose phenotypes were undetected by high-throughput methods. PMID:19300474

  17. Inferring Kangaroo Phylogeny from Incongruent Nuclear and Mitochondrial Genes

    PubMed Central

    Phillips, Matthew J.; Haouchar, Dalal; Pratt, Renae C.; Gibb, Gillian C.; Bunce, Michael

    2013-01-01

    The marsupial genus Macropus includes three subgenera, the familiar large grazing kangaroos and wallaroos of M. (Macropus) and M. (Osphranter), as well as the smaller mixed grazing/browsing wallabies of M. (Notamacropus). A recent study of five concatenated nuclear genes recommended subsuming the predominantly browsing Wallabia bicolor (swamp wallaby) into Macropus. To further examine this proposal we sequenced partial mitochondrial genomes for kangaroos and wallabies. These sequences strongly favour the morphological placement of W. bicolor as sister to Macropus, although place M. irma (black-gloved wallaby) within M. (Osphranter) rather than as expected, with M. (Notamacropus). Species tree estimation from separately analysed mitochondrial and nuclear genes favours retaining Macropus and Wallabia as separate genera. A simulation study finds that incomplete lineage sorting among nuclear genes is a plausible explanation for incongruence with the mitochondrial placement of W. bicolor, while mitochondrial introgression from a wallaroo into M. irma is the deepest such event identified in marsupials. Similar such coalescent simulations for interpreting gene tree conflicts will increase in both relevance and statistical power as species-level phylogenetics enters the genomic age. Ecological considerations in turn, hint at a role for selection in accelerating the fixation of introgressed or incompletely sorted loci. More generally the inclusion of the mitochondrial sequences substantially enhanced phylogenetic resolution. However, we caution that the evolutionary dynamics that enhance mitochondria as speciation indicators in the presence of incomplete lineage sorting may also render them especially susceptible to introgression. PMID:23451266

  18. Inferring kangaroo phylogeny from incongruent nuclear and mitochondrial genes.

    PubMed

    Phillips, Matthew J; Haouchar, Dalal; Pratt, Renae C; Gibb, Gillian C; Bunce, Michael

    2013-01-01

    The marsupial genus Macropus includes three subgenera, the familiar large grazing kangaroos and wallaroos of M. (Macropus) and M. (Osphranter), as well as the smaller mixed grazing/browsing wallabies of M. (Notamacropus). A recent study of five concatenated nuclear genes recommended subsuming the predominantly browsing Wallabia bicolor (swamp wallaby) into Macropus. To further examine this proposal we sequenced partial mitochondrial genomes for kangaroos and wallabies. These sequences strongly favour the morphological placement of W. bicolor as sister to Macropus, although place M. irma (black-gloved wallaby) within M. (Osphranter) rather than as expected, with M. (Notamacropus). Species tree estimation from separately analysed mitochondrial and nuclear genes favours retaining Macropus and Wallabia as separate genera. A simulation study finds that incomplete lineage sorting among nuclear genes is a plausible explanation for incongruence with the mitochondrial placement of W. bicolor, while mitochondrial introgression from a wallaroo into M. irma is the deepest such event identified in marsupials. Similar such coalescent simulations for interpreting gene tree conflicts will increase in both relevance and statistical power as species-level phylogenetics enters the genomic age. Ecological considerations in turn, hint at a role for selection in accelerating the fixation of introgressed or incompletely sorted loci. More generally the inclusion of the mitochondrial sequences substantially enhanced phylogenetic resolution. However, we caution that the evolutionary dynamics that enhance mitochondria as speciation indicators in the presence of incomplete lineage sorting may also render them especially susceptible to introgression.

  19. Production, characterization, gene cloning, and nematocidal activity of the extracellular protease from Stenotrophomonas maltophilia N4.

    PubMed

    Jankiewicz, Urszula; Larkowska, Ewa; Swiontek Brzezinska, Maria

    2016-06-01

    A rhizosphere strain of the bacterium Stenotrophomonas maltophilia N4 secretes the serine protease PN4, whose molecular mass is approximately 42 kDa. The optimal temperature for the enzyme activity of the 11-fold purified protein was 50°C and the optimal pH was 10.5. The activity of the enzyme was strongly inhibited by specific serine protease inhibitors, which allowed for its classification as an alkaline serine protease family. Ca(2+) ions stimulated the activity of the protease PN4, while Mg(2+) ions stabilized its activity, and Zn(2+) and Cd(2+) ions strongly inhibited its activity. The enzyme has broad substrate specificity. For example, it is able to hydrolyse casein, keratin, albumin, haemoglobin, and gelatin, as well as the insoluble modified substrates azure keratin and azocoll. The gene that encodes the 1740 bp precursor form of the enzyme (accession number: LC031815) was cloned. We then deduced that its amino acid sequence includes the region of the conserved domain of the S8 family of peptidases as well as the catalytic triad Asp/His/Ser. The bacterial culture fluid as well as the purified protease PN4 demonstrated biocidal activity with regard to the nematodes Caenorhabditis elegans and Panagrellus spp. Copyright © 2016 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

  20. Systematically fragmented genes in a multipartite mitochondrial genome

    PubMed Central

    Vlcek, Cestmir; Marande, William; Teijeiro, Shona; Lukeš, Julius; Burger, Gertraud

    2011-01-01

    Arguably, the most bizarre mitochondrial DNA (mtDNA) is that of the euglenozoan eukaryote Diplonema papillatum. The genome consists of numerous small circular chromosomes none of which appears to encode a complete gene. For instance, the cox1 coding sequence is spread out over nine different chromosomes in non-overlapping pieces (modules), which are transcribed separately and joined to a contiguous mRNA by trans-splicing. Here, we examine how many genes are encoded by Diplonema mtDNA and whether all are fragmented and their transcripts trans-spliced. Module identification is challenging due to the sequence divergence of Diplonema mitochondrial genes. By employing most sensitive protein profile search algorithms and comparing genomic with cDNA sequence, we recognize a total of 11 typical mitochondrial genes. The 10 protein-coding genes are systematically chopped up into three to 12 modules of 60–350 bp length. The corresponding mRNAs are all trans-spliced. Identification of ribosomal RNAs is most difficult. So far, we only detect the 3′-module of the large subunit ribosomal RNA (rRNA); it does not trans-splice with other pieces. The small subunit rRNA gene remains elusive. Our results open new intriguing questions about the biochemistry and evolution of mitochondrial trans-splicing in Diplonema. PMID:20935050

  1. Protease Gene Duplication and Proteolytic Activity in Drosophila Female Reproductive Tracts

    PubMed Central

    Kelleher, Erin S.; Pennington, James E.

    2009-01-01

    Secreted proteases play integral roles in sexual reproduction in a broad range of taxa. In the genetic model Drosophila melanogaster, these molecules are thought to process peptides and activate enzymes inside female reproductive tracts, mediating critical postmating responses. A recent study of female reproductive tract proteins in the cactophilic fruit fly Drosophila arizonae, identified pervasive, lineage-specific gene duplication amongst secreted proteases. Here, we compare the evolutionary dynamics, biochemical nature, and physiological significance of secreted female reproductive serine endoproteases between D. arizonae and its congener D. melanogaster. We show that D. arizonae lower female reproductive tract (LFRT) proteins are significantly enriched for recently duplicated secreted proteases, particularly serine endoproteases, relative to D. melanogaster. Isolated lumen from D. arizonae LFRTs, furthermore, exhibits significant trypsin-like and elastase-like serine endoprotease acitivity, whereas no such activity is seen in D. melanogaster. Finally, trypsin- and elastase-like activity in D. arizonae female reproductive tracts is negatively regulated by mating. We propose that the intense proteolytic environment of the D. arizonae female reproductive tract relates to the extraordinary reproductive physiology of this species and that ongoing gene duplication amongst these proteases is an evolutionary consequence of sexual conflict. PMID:19546158

  2. Alternative splicing, a new target to block cellular gene expression by poliovirus 2A protease

    SciTech Connect

    Alvarez, Enrique; Castello, Alfredo; Carrasco, Luis; Izquierdo, Jose M.

    2011-10-14

    Highlights: {yields} Novel role for poliovirus 2A protease as splicing modulator. {yields} Poliovirus 2A protease inhibits the alternative splicing of pre-mRNAs. {yields} Poliovirus 2A protease blocks the second catalytic step of splicing. -- Abstract: Viruses have developed multiple strategies to interfere with the gene expression of host cells at different stages to ensure their own survival. Here we report a new role for poliovirus 2A{sup pro} modulating the alternative splicing of pre-mRNAs. Expression of 2A{sup pro} potently inhibits splicing of reporter genes in HeLa cells. Low amounts of 2A{sup pro} abrogate Fas exon 6 skipping, whereas higher levels of protease fully abolish Fas and FGFR2 splicing. In vitro splicing of MINX mRNA using nuclear extracts is also strongly inhibited by 2A{sup pro}, leading to accumulation of the first exon and the lariat product containing the unspliced second exon. These findings reveal that the mechanism of action of 2A{sup pro} on splicing is to selectively block the second catalytic step.

  3. Towards mitochondrial gene therapy: DQAsomes as a strategy.

    PubMed

    Weissig, V; Torchilin, V P

    2001-01-01

    Mitochondrial dysfunction is a cause, or major contributing factor in the development, of degenerative diseases, aging, cancer, many cases of Alzheimer's and Parkinson's disease and Type II diabetes (D. C. Wallace, Science 283, 1482-1488, 1999). Despite major advances in understanding mtDNA defects at the genetic and biochemical level, there is no satisfactory treatment for the vast majority of patients available. Objective limitations of conventional biochemical treatment for patients with defects of mtDNA warrant the exploration of gene therapeutic approaches. However, mitochondrial gene therapy has been elusive, due to the lack of any mitochondria-specific transfection vector. We review here the current state of the development of mitochondrial DNA delivery systems. In particular, we are summarizing our own efforts in exploring the mitochondriotropic properties of dequalinium, a cationic bolaamphiphile with delocalized charge centers, for the design of a vector suited for the transport of DNA to mitochondria in living cells.

  4. The Agaricus bisporus cox1 gene: the longest mitochondrial gene and the largest reservoir of mitochondrial group i introns.

    PubMed

    Férandon, Cyril; Moukha, Serge; Callac, Philippe; Benedetto, Jean-Pierre; Castroviejo, Michel; Barroso, Gérard

    2010-11-18

    In eukaryotes, introns are located in nuclear and organelle genes from several kingdoms. Large introns (up to 5 kbp) are frequent in mitochondrial genomes of plant and fungi but scarce in Metazoa, even if these organisms are grouped with fungi among the Opisthokonts. Mitochondrial introns are classified in two groups (I and II) according to their RNA secondary structure involved in the intron self-splicing mechanism. Most of these mitochondrial group I introns carry a "Homing Endonuclease Gene" (heg) encoding a DNA endonuclease acting in transfer and site-specific integration ("homing") and allowing intron spreading and gain after lateral transfer even between species from different kingdoms. Opposed to this gain mechanism, is another which implies that introns, which would have been abundant in the ancestral genes, would mainly evolve by loss. The importance of both mechanisms (loss and gain) is matter of debate. Here we report the sequence of the cox1 gene of the button mushroom Agaricus bisporus, the most widely cultivated mushroom in the world. This gene is both the longest mitochondrial gene (29,902 nt) and the largest group I intron reservoir reported to date with 18 group I and 1 group II. An exhaustive analysis of the group I introns available in cox1 genes shows that they are mobile genetic elements whose numerous events of loss and gain by lateral transfer combine to explain their wide and patchy distribution extending over several kingdoms. An overview of intron distribution, together with the high frequency of eroded heg, suggests that they are evolving towards loss. In this landscape of eroded and lost intron sequences, the A. bisporus cox1 gene exhibits a peculiar dynamics of intron keeping and catching, leading to the largest collection of mitochondrial group I introns reported to date in a Eukaryote.

  5. Yeast extracellular proteases.

    PubMed

    Ogrydziak, D M

    1993-01-01

    Many species of yeast secrete significant amounts of protease(s). In this article, results of numerous surveys of yeast extracellular protease production have been compiled and inconsistencies in the data and limitations of the methodology have been examined. Regulation, purification, characterization, and processing of yeast extracellular proteases are reviewed. Results obtained from the sequences of cloned genes, especially the Saccharomyces cerevisiae Bar protease, the Candida albicans acid protease, and the Yarrowia lipolytica alkaline protease, have been emphasized. Biotechnological applications and the medical relevance of yeast extracellular proteases are covered. Yeast extracellular proteases have potential in beer and wine stabilization, and they probably contribute to pathogenicity of Candida spp. Yeast extracellular protease genes also provide secretion and processing signals for yeast expression systems designed for secretion of heterologous proteins. Coverage of the secretion of foreign proteases such as prochymosin, urokinase, and tissue plasminogen activator by yeast in included.

  6. Transcriptional activation of LON Gene by a new form of mitochondrial stress: A role for the nuclear respiratory factor 2 in StAR overload response (SOR).

    PubMed

    Bahat, Assaf; Perlberg, Shira; Melamed-Book, Naomi; Isaac, Sara; Eden, Amir; Lauria, Ines; Langer, Thomas; Orly, Joseph

    2015-06-15

    High output of steroid hormone synthesis in steroidogenic cells of the adrenal cortex and the gonads requires the expression of the steroidogenic acute regulatory protein (StAR) that facilitates cholesterol mobilization to the mitochondrial inner membrane where the CYP11A1/P450scc enzyme complex converts the sterol to the first steroid. Earlier studies have shown that StAR is active while pausing on the cytosolic face of the outer mitochondrial membrane while subsequent import of the protein into the matrix terminates the cholesterol mobilization activity. Consequently, during repeated activity cycles, high level of post-active StAR accumulates in the mitochondrial matrix. To prevent functional damage due to such protein overload effect, StAR is degraded by a sequence of three to four ATP-dependent proteases of the mitochondria protein quality control system, including LON and the m-AAA membranous proteases AFG3L2 and SPG7/paraplegin. Furthermore, StAR expression in both peri-ovulatory ovarian cells, or under ectopic expression in cell line models, results in up to 3-fold enrichment of the mitochondrial proteases and their transcripts. We named this novel form of mitochondrial stress as StAR overload response (SOR). To better understand the SOR mechanism at the transcriptional level we analyzed first the unexplored properties of the proximal promoter of the LON gene. Our findings suggest that the human nuclear respiratory factor 2 (NRF-2), also known as GA binding protein (GABP), is responsible for 88% of the proximal promoter activity, including the observed increase of transcription in the presence of StAR. Further studies are expected to reveal if common transcriptional determinants coordinate the SOR induced transcription of all the genes encoding the SOR proteases. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  7. Functional diversification of a protease inhibitor gene in the genus Drosophila and its molecular basis.

    PubMed

    Börner, Stefan; Ragg, Hermann

    2008-05-31

    The mutually exclusive use of alternative reactive site loop (RSL) cassettes due to alternative splicing of serpin (serine protease inhibitor) gene transcripts is a widespread strategy to create target-selective protease inhibitors in the animal kingdom. Since molecular basis and evolution of serpin RSL cassette exon amplification and diversification are unexplored, the exon-intron organization of the serpin gene spn4 from 12 species of the genus Drosophila was studied. The analysis of the gene structures shows that both number and target enzyme specificities of Spn4 RSL cassettes are highly variable in fruit flies and includes inhibitor variants with novel antiproteolytic activities in some species, indicating that RSL diversity is the result of adaptive evolution. Comparative genomics suggests that interallelic gene conversion and/or recombination events contribute to RSL cassette exon amplification. Due to an intron that is located at the most suitable position within the RSL region, multiple inhibitors can be formed in an economic manner that are both efficient and target-selective, allowing fruit flies to control an astonishing variety of proteases with different cleavage chemistry and evolutionary ancestry.

  8. Transcriptional activation by heat and cold of a thiol protease gene in tomato. [Lycopersicon esculentum

    SciTech Connect

    Schaffer, M.A.; Fischer, R.L. )

    1990-08-01

    We previously determined that low temperature induces the accumulation in tomato (Lycopersicon esculentum) fruit of a cloned mRNA, designated C14, encoding a polypeptide related to thiol proteases. We now demonstrate that C14 mRNA accumulation is a response common to both high (40{degree}C) and low (4{degree}C) temperature stresses. Exposure of tomato fruit to 40{degree}C results in the accumulation of C14 mRNA, by 8 hours. This response is more rapid than that to 4{degree}C, but slower than the induction of many heat shock messages by 40{degree}C, and therefore unique. We have also studied the mechanism by which heat and cold exposure activate C14 gene expression. Both high and low temperature regulate protease gene expression through transcriptional induction of a single C14 gene. A hypothesis for the function of C14 thiol protease gene expression in response to heat and cold is discussed.

  9. Recombination sequences in plant mitochondrial genomes: diversity and homologies to known mitochondrial genes.

    PubMed Central

    Stern, D B; Palmer, J D

    1984-01-01

    Several plant mitochondrial genomes contain repeated sequences that are postulated to be sites of homologous intragenomic recombination (1-3). In this report, we have used filter hybridizations to investigate sequence relationships between the cloned mitochondrial DNA (mtDNA) recombination repeats from turnip, spinach and maize and total mtDNA isolated from thirteen species of angiosperms. We find that strong sequence homologies exist between the spinach and turnip recombination repeats and essentially all other mitochondrial genomes tested, whereas a major maize recombination repeat does not hybridize to any other mtDNA. The sequences homologous to the turnip repeat do not appear to function in recombination in any other genome, whereas the spinach repeat hybridizes to reiterated sequences within the mitochondrial genomes of wheat and two species of pokeweed that do appear to be sites of recombination. Thus, although intragenomic recombination is a widespread phenomenon in plant mitochondria, it appears that different sequences either serve as substrates for this function in different species, or else surround a relatively short common recombination site which does not cross-hybridize under our experimental conditions. Identified gene sequences from maize mtDNA were used in heterologous hybridizations to show that the repeated sequences implicated in recombination in turnip and spinach/pokeweed/wheat mitochondria include, or are closely linked to genes for subunit II of cytochrome c oxidase and 26S rRNA, respectively. Together with previous studies indicating that the 18S rRNA gene in wheat mtDNA is contained within a recombination repeat (3), these results imply an unexpectedly frequent association between recombination repeats and plant mitochondrial genes. Images PMID:6473104

  10. The Agaricus bisporus cox1 Gene: The Longest Mitochondrial Gene and the Largest Reservoir of Mitochondrial Group I Introns

    PubMed Central

    Férandon, Cyril; Moukha, Serge; Callac, Philippe; Benedetto, Jean-Pierre; Castroviejo, Michel; Barroso, Gérard

    2010-01-01

    In eukaryotes, introns are located in nuclear and organelle genes from several kingdoms. Large introns (up to 5 kbp) are frequent in mitochondrial genomes of plant and fungi but scarce in Metazoa, even if these organisms are grouped with fungi among the Opisthokonts. Mitochondrial introns are classified in two groups (I and II) according to their RNA secondary structure involved in the intron self-splicing mechanism. Most of these mitochondrial group I introns carry a “Homing Endonuclease Gene” (heg) encoding a DNA endonuclease acting in transfer and site-specific integration (“homing”) and allowing intron spreading and gain after lateral transfer even between species from different kingdoms. Opposed to this gain mechanism, is another which implies that introns, which would have been abundant in the ancestral genes, would mainly evolve by loss. The importance of both mechanisms (loss and gain) is matter of debate. Here we report the sequence of the cox1 gene of the button mushroom Agaricus bisporus, the most widely cultivated mushroom in the world. This gene is both the longest mitochondrial gene (29,902 nt) and the largest group I intron reservoir reported to date with 18 group I and 1 group II. An exhaustive analysis of the group I introns available in cox1 genes shows that they are mobile genetic elements whose numerous events of loss and gain by lateral transfer combine to explain their wide and patchy distribution extending over several kingdoms. An overview of intron distribution, together with the high frequency of eroded heg, suggests that they are evolving towards loss. In this landscape of eroded and lost intron sequences, the A. bisporus cox1 gene exhibits a peculiar dynamics of intron keeping and catching, leading to the largest collection of mitochondrial group I introns reported to date in a Eukaryote. PMID:21124976

  11. Mitochondrial Gene Therapy Augments Mitochondrial Physiology in a Parkinson's Disease Cell Model

    PubMed Central

    Keeney, Paula M.; Quigley, Caitlin K.; Dunham, Lisa D.; Papageorge, Christina M.; Iyer, Shilpa; Thomas, Ravindar R.; Schwarz, Kathleen M.; Trimmer, Patricia A.; Khan, Shaharyar M.; Portell, Francisco R.; Bergquist, Kristen E.

    2009-01-01

    Abstract Neurodegeneration in Parkinson's disease (PD) affects mainly dopaminergic neurons in the substantia nigra, where age-related, increasing percentages of cells lose detectable respiratory activity associated with depletion of intact mitochondrial DNA (mtDNA). Replenishment of mtDNA might improve neuronal bioenergetic function and prevent further cell death. We developed a technology (“ProtoFection”) that uses recombinant human mitochondrial transcription factor A (TFAM) engineered with an N-terminal protein transduction domain (PTD) followed by the SOD2 mitochondrial localization signal (MLS) to deliver mtDNA cargo to the mitochondria of living cells. MTD–TFAM (MTD = PTD + MLS = “mitochondrial transduction domain”) binds mtDNA and rapidly transports it across plasma membranes to mitochondria. For therapeutic proof-of-principle we tested ProtoFection technology in Parkinson's disease cybrid cells, using mtDNA generated from commercially available human genomic DNA (gDNA; Roche). Nine to 11 weeks after single exposures to MTD–TFAM + mtDNA complex, PD cybrid cells with impaired respiration and reduced mtDNA genes increased their mtDNA gene copy numbers up to 24-fold, mtDNA-derived RNAs up to 35-fold, TFAM and ETC proteins, cell respiration, and mitochondrial movement velocities. Cybrid cells with no or minimal basal mitochondrial impairments showed reduced or no responses to treatment, suggesting the possibility of therapeutic selectivity. Exposure of PD but not control cybrid cells to MTD–TFAM protein alone or MTD–TFAM + mtDNA complex increased expression of PGC-1α, suggesting activation of mitochondrial biogenesis. ProtoFection technology for mitochondrial gene therapy holds promise for improving bioenergetic function in impaired PD neurons and needs additional development to define its pharmacodynamics and delineate its molecular mechanisms. It also is unclear whether single-donor gDNA for generating mtDNA would be a

  12. Mitochondrial gene order is not conserved in arthropods: prostriate and metastriate tick mitochondrial genomes.

    PubMed

    Black, W C; Roehrdanz, R L

    1998-12-01

    The entire mitochondrial genome was sequenced in a prostriate tick, Ixodes hexagonus, and a metastriate tick, Rhipicephalus sanguineus. Both genomes encode 22 tRNAs, 13 proteins, and two ribosomal RNAs. Prostriate ticks are basal members of Ixodidae and have the same gene order as Limulus polyphemus. In contrast, in R. sanguineus, a block of genes encoding NADH dehydrogenase subunit 1 (ND1), tRNA(Leu)(UUR), tRNA(Leu)(CUN), 16S rDNA, tRNA(Val), 12S rDNA, the control region, and the tRNA(Ile) and tRNA(Gln) have translocated to a position between the tRNA(Glu) and tRNA(Phe) genes. The tRNA(Cys) gene has translocated between the control region and the tRNA(Met) gene, and the tRNA(Leu)(CUN) gene has translocated between the tRNA(Ser)(UCN) gene and the control region. Furthermore, the control region is duplicated, and both copies undergo concerted evolution. Primers that flank these rearrangements confirm that this gene order is conserved in all metastriate ticks examined. Correspondence analysis of amino acid and codon use in the two ticks and in nine other arthropod mitochondrial genomes indicate a strong bias in R. sanguineus towards amino acids encoded by AT-rich codons.

  13. IS195, an Insertion Sequence-Like Element Associated with Protease Genes in Porphyromonas gingivalis

    PubMed Central

    Lewis, Janina P.; Macrina, Francis L.

    1998-01-01

    Porphyromonas gingivalis is recognized as an important etiologic agent in adult and early-onset periodontal disease. Proteases produced by this organism contribute to its virulence in mice. Protease-encoding genes have been shown to contain multiple copies of repeated nucleotide sequences. These conserved sequences have also been found in hemagglutinin genes. In the process of studying the genetic loci containing the conserved repeated sequences, we have characterized a prtP gene homolog from P. gingivalis W83 encoding a cysteine protease with Lys-X specificity. However, this prtP gene was interrupted by an insertion sequence-like element which we designated IS195. Furthermore, IS195 and another element, IS1126, were present downstream of prtP gene homologs (kgp) found in P. gingivalis H66 and 381. IS195, a 1,068-bp insertion sequence-like element, contained 11-bp inverted repeats at its termini and was bordered by 9-bp direct repeats presumed to be a transposition-mediated target site duplication. Its central region contained one large open reading frame encoding a predicted 300-amino-acid protein which appeared to be a transposase. We isolated two naturally occurring variants of P. gingivalis W83, one carrying IS195 within the coding region of the prtP gene and another containing an intact prtP gene. Biochemical characterization revealed a lack of trypsin-like Lys-X specific proteolytic activity in the P. gingivalis W83 variant carrying the disrupted prtP gene. Studies using a mouse model revealed a reduction of virulence resulting from insertion of IS195 into the coding region of the prtP gene. An allelic-exchange mutant defective in the prtP gene also was constructed and tested in vivo. It displayed intermediate virulence compared to that of the wild-type and prtP::IS195 mutant strains. We conclude that the Lys-X cysteine protease contributes to virulence in soft tissue infections. PMID:9632563

  14. Nuclear gene dosage effects upon the expression of maize mitochondrial genes.

    PubMed Central

    Auger, D L; Newton, K J; Birchler, J A

    2001-01-01

    Each mitochondrion possesses a genome that encodes some of its own components. The nucleus encodes most of the mitochondrial proteins, including the polymerases and factors that regulate the expression of mitochondrial genes. Little is known about the number or location of these nuclear factors. B-A translocations were used to create dosage series for 14 different chromosome arms in maize plants with normal cytoplasm. The presence of one or more regulatory factors on a chromosome arm was indicated when variation of its dosage resulted in the alteration in the amount of a mitochondrial transcript. We used quantitative Northern analysis to assay the transcript levels of three mitochondrially encoded components of the cytochrome c oxidase complex (cox1, cox2, and cox3). Data for a nuclearly encoded component (cox5b) and for two mitochondrial genes that are unrelated to cytochrome c oxidase, ATP synthase alpha-subunit and 18S rRNA, were also determined. Two tissues, embryo and endosperm, were compared and most effects were found to be tissue specific. Significantly, the array of dosage effects upon mitochondrial genes was similar to what had been previously found for nuclear genes. These results support the concept that although mitochondrial genes are prokaryotic in origin, their regulation has been extensively integrated into the eukaryotic cell. PMID:11290725

  15. Upregulation of mitochondrial protease HtrA2/Omi contributes to manganese-induced neuronal apoptosis in rat brain striatum.

    PubMed

    Jiang, J K; Ma, X; Wu, Q Y; Qian, W B; Wang, N; Shi, S S; Han, J L; Zhao, J Y; Jiang, S Y; Wan, C H

    2014-05-30

    Manganese (Mn) is an essential trace element that is required for normal brain functioning. However, excessive intake of Mn has been known to lead to neuronal loss and clinical symptoms resembling idiopathic Parkinson's disease (IPD), whose precise molecular mechanism remains largely elusive. In the study, we established a Mn-exposed rat model and identified a mitochondrial protease, the mature form of high temperature requirement A2 (HtrA2/Omi), which was significantly upregulated in rat brain striatum after Mn exposure. Western blot and immunohistochemical analyses revealed that the expression of mature HtrA2 was remarkably increased following Mn exposure. In addition, immunofluorescence assay demonstrated that overexposure to Mn could lead to significant elevation in the number of HtrA2-positive neurons. Accordingly, the expression of X-linked inhibitor of apoptosis protein (XIAP), a well-characterized target of HtrA2-mediated proteolysis, was progressively decreased following Mn exposure, and was correlated with increased level of active caspase-3. Further, we showed that Mn exposure decreased the viability and induced apparent apoptosis of NFG-differentiated PC12 cells. Importantly, the expression of HtrA2 was progressively increased, whereas the level of cellular XIAP was reduced during Mn-induced apoptosis. In addition, blockage of HtrA2 activity with UCF-101 restored Mn-induced reduction in XIAP expression. Finally, we observed that UCF-101 treatment ameliorated Mn-induced apoptosis in PC12 cells. Collectively, these findings suggested that upregulated HtrA2 played a role in Mn-induced neuronal death in brain striatum.

  16. Gene Expression in a Drosophila Model of Mitochondrial Disease

    PubMed Central

    Fernández-Ayala, Daniel J. M.; Chen, Shanjun; Kemppainen, Esko; O'Dell, Kevin M. C.; Jacobs, Howard T.

    2010-01-01

    Background A point mutation in the Drosophila gene technical knockout (tko), encoding mitoribosomal protein S12, was previously shown to cause a phenotype of respiratory chain deficiency, developmental delay, and neurological abnormalities similar to those presented in many human mitochondrial disorders, as well as defective courtship behavior. Methodology/Principal Findings Here, we describe a transcriptome-wide analysis of gene expression in tko25t mutant flies that revealed systematic and compensatory changes in the expression of genes connected with metabolism, including up-regulation of lactate dehydrogenase and of many genes involved in the catabolism of fats and proteins, and various anaplerotic pathways. Gut-specific enzymes involved in the primary mobilization of dietary fats and proteins, as well as a number of transport functions, were also strongly up-regulated, consistent with the idea that oxidative phosphorylation OXPHOS dysfunction is perceived physiologically as a starvation for particular biomolecules. In addition, many stress-response genes were induced. Other changes may reflect a signature of developmental delay, notably a down-regulation of genes connected with reproduction, including gametogenesis, as well as courtship behavior in males; logically this represents a programmed response to a mitochondrially generated starvation signal. The underlying signalling pathway, if conserved, could influence many physiological processes in response to nutritional stress, although any such pathway involved remains unidentified. Conclusions/Significance These studies indicate that general and organ-specific metabolism is transformed in response to mitochondrial dysfunction, including digestive and absorptive functions, and give important clues as to how novel therapeutic strategies for mitochondrial disorders might be developed. PMID:20066047

  17. NADH dehydrogenase subunit genes in the mitochondrial DNA of yeasts.

    PubMed Central

    Nosek, J; Fukuhara, H

    1994-01-01

    The genes encoding the NADH dehydrogenase subunits of respiratory complex I have not been identified so far in the mitochondrial DNA (mtDNA) of yeasts. In the linear mtDNA of Candida parapsilosis, we found six new open reading frames whose sequences were unambiguously homologous to those of the genes known to code for NADH dehydrogenase subunit proteins of different organisms, i.e., ND1, ND2, ND3, ND4L, ND5, and ND6. The gene for ND4 also appears to be present, as judged from hybridization experiments with a Podospora gene probe. Specific transcripts from these open reading frames (ND genes) could be detected in the mitochondria. Hybridization experiments using C. parapsilosis genes as probes suggested that ND genes are present in the mtDNAs of a wide range of yeast species including Candida catenulata, Pichia guilliermondii, Clavispora lusitaniae, Debaryomyces hansenii, Hansenula polymorpha, and others. Images PMID:7521869

  18. Obtusilactone A and (-)-sesamin induce apoptosis in human lung cancer cells by inhibiting mitochondrial Lon protease and activating DNA damage checkpoints.

    PubMed

    Wang, Hui-Min; Cheng, Kuo-Chen; Lin, Cheng-Jung; Hsu, Shu-Wei; Fang, Wei-Cheng; Hsu, Tai-Feng; Chiu, Chien-Chih; Chang, Hsueh-Wei; Hsu, Chun-Hua; Lee, Alan Yueh-Luen

    2010-12-01

    Several compounds from Cinnamomum kotoense show anticancer activities. However, the detailed mechanisms of most compounds from C. kotoense remain unknown. In this study, we investigated the anticancer activity of obtusilactone A (OA) and (-)-sesamin in lung cancer. Our results show that human Lon is upregulated in non-small-cell lung cancer (NSCLC) cell lines, and downregulation of Lon triggers caspase-3 mediated apoptosis. Through enzyme-based screening, we identified two small-molecule compounds, obtusilactone A (OA) and (-)-sesamin from C. kotoense, as potent Lon protease inhibitors. Obtusilactone A and (-)-sesamin interact with Ser855 and Lys898 residues in the active site of the Lon protease according to molecular docking analysis. Thus, we suggest that cancer cytotoxicity of the compounds is partly due to the inhibitory effects on Lon protease. In addition, the compounds are able to cause DNA double-strand breaks and activate checkpoints. Treatment with OA and (-)-sesamin induced p53-independent DNA damage responses in NSCLC cells, including G(1) /S checkpoint activation and apoptosis, as evidenced by phosphorylation of checkpoint proteins (H2AX, Nbs1, and Chk2), caspase-3 cleavage, and sub-G(1) accumulation. In conclusion, OA and (-)-sesamin act as both inhibitors of human mitochondrial Lon protease and DNA damage agents to activate the DNA damage checkpoints as well induce apoptosis in NSCLC cells. These dual functions open a bright avenue to develop more selective chemotherapy agents to overcome chemoresistance and sensitize cancer cells to other chemotherapeutics.

  19. Human mast cell tryptase: Multiple cDNAs and genes reveal a multigene serine protease family

    SciTech Connect

    Vanderslice, P.; Ballinger, S.M., Tam, E.K.; Goldstein, S.M.; Craik, C.S.; Caughey, G.H. )

    1990-05-01

    Three different cDNAs and a gene encoding human skin mast cell tryptase have been cloned and sequenced in their entirety. The deduced amino acid sequences reveal a 30-amino acid prepropeptide followed by a 245-amino acid catalytic domain. The C-terminal undecapeptide of the human preprosequence is identical in dog tryptase and appears to be part of a prosequence unique among serine proteases. The differences among the three human tryptase catalytic domains include the loss of a consensus N-glycosylation site in one cDNA, which may explain some of the heterogeneity in size and susceptibility to deglycosylation seen in tryptase preparations. All three tryptase cDNAs are distinct from a recently reported cDNA obtained from a human lung mast cell library. A skin tryptase cDNA was used to isolate a human tryptase gene, the exons of which match one of the skin-derived cDNAs. The organization of the {approx}1.8-kilobase-pair tryptase gene is unique and is not closely related to that of any other mast cell or leukocyte serine protease. The 5{prime} regulatory regions of the gene share features with those of other serine proteases, including mast cell chymase, but are unusual in being separated from the protein-coding sequence by an intron. High-stringency hybridization of a human genomic DNA blot with a fragment of the tryptase gene confirms the presence of multiple tryptase genes. These findings provide genetic evidence that human mast cell tryptases are the products of a multigene family.

  20. Human mast cell tryptase: multiple cDNAs and genes reveal a multigene serine protease family.

    PubMed Central

    Vanderslice, P; Ballinger, S M; Tam, E K; Goldstein, S M; Craik, C S; Caughey, G H

    1990-01-01

    Three different cDNAs and a gene encoding human skin mast cell tryptase have been cloned and sequenced in their entirety. The deduced amino acid sequences reveal a 30-amino acid prepropeptide followed by a 245-amino acid catalytic domain. The C-terminal undecapeptide of the human preprosequence is identical in dog tryptase and appears to be part of a prosequence unique among serine proteases. The differences among the three human tryptase catalytic domains include the loss of a consensus N-glycosylation site in one cDNA, which may explain some of the heterogeneity in size and susceptibility to deglycosylation seen in tryptase preparations. All three tryptase cDNAs are distinct from a recently reported cDNA obtained from a human lung mast cell library. A skin tryptase cDNA was used to isolate a human tryptase gene, the exons of which match one of the skin-derived cDNAs. The organization of the approximately 1.8-kilobase-pair tryptase gene is unique and is not closely related to that of any other mast cell or leukocyte serine protease. The 5' regulatory regions of the gene share features with those of other serine proteases, including mast cell chymase, but are unusual in being separated from the protein-coding sequence by an intron. High-stringency hybridization of a human genomic DNA blot with a fragment of the tryptase gene confirms the presence of multiple tryptase genes. These findings provide genetic evidence that human mast cell tryptases are the products of a multigene family. Images PMID:2187193

  1. Characterization of a Casuarina glauca nodule-specific subtilisin-like protease gene, a homolog of Alnus glutinosa ag12.

    PubMed

    Laplaze, L; Ribeiro, A; Franche, C; Duhoux, E; Auguy, F; Bogusz, D; Pawlowski, K

    2000-01-01

    In search of plant genes expressed during early interactions between Casuarina glauca and Frankia, we have isolated and characterized a C. glauca gene that has strong homology to subtilisin-like protease gene families of several plants including the actinorhizal nodulin gene ag12 of another actinorhizal plant, Alnus glutinosa. Based on the expression pattern of cg12 in the course of nodule development, it represents an early actinorhizal nodulin gene. Our results suggest that subtilisin-like proteases may be a common element in the process of infection of plant cells by Frankia in both Betulaceae (Alnus glutinosa) and Casuarinaceae (Casuarina glauca) symbioses.

  2. Two-locus mitochondrial and nuclear gene models for mitochondrial disorders.

    PubMed

    Bu, X; Yang, H Y; Shohat, M; Rotter, J I

    1992-01-01

    Stimulated by a large pedigree with a cochlear form of deafness, for which we considered a two-locus mitochondrial and nuclear gene model, we have extended the classic methods of segregation analysis to these classes of two-locus disorders. Based on the unique maternal transmission pattern of the mitochondria, we demonstrate that utilization of the maternal line pedigree allows us to simplify the various two-locus mitochondrial models to "one nuclear locus" models. Classifying the nuclear families into different independent groups by the mother's phenotypes allows us to estimate the nuclear gene frequency in one group and to use this estimate as the expected value to test the fitness of the model on the other group. In addition, if we restrict the analysis to specific subsets of the mating type(s), we can also test the model on specific groups of nuclear families without estimating the gene frequency. Goodness-of-fit tests can be performed on pooled sibship data as well as individual sibship data. These methods of analysis should assume increasing importance as more disorders with features of mitochondrial inheritance are identified.

  3. Effect of a polymorphism in the ND1 mitochondrial gene on human skeletal muscle mitochondrial function.

    PubMed

    Jackman, Matthew R; Ravussin, E; Rowe, M J; Pratley, R; Milner, M R; Willis, W T

    2008-02-01

    A non-silent polymorphism in the mitochondrial coding region of the ND1 gene, a subunit of reduced nicotinamide adenine dinucleotide (NADH) dehydrogenase is associated with resting metabolic rate (RMR) in 245 non-diabetic Pima Indians. The purpose of this investigation was to determine the effect of the ND1 gene polymorphism on mitochondrial function in 14 male Pima Indians. Seven subjects with an A at site 3547 of the ND1 gene (Ile at amino acid 81), and seven with a G at this site (Val) were studied. Mitochondria were isolated from 0.8 to 1.5 g of skeletal muscle obtained by needle biopsy of the lateral quadriceps muscle. In intact mitochondria, maximal (state-3) and resting (state-4) respiration rates were measured polarographically at 37 degrees C with a variety of single substrates or substrate combinations. Disrupted mitochondria were analyzed for maximal capacities through the entire electron transport chain (ETC) (NADH oxidase (NADHOX)), as well as through a segment of Complex I that is independent of the ND1 component (NADH-ferricyanide (NADH-FeCN) reductase). Mitochondria were well coupled and exhibited higher respiratory control ratios (RCRs) than rodent muscle. There were no differences between the two groups for any of the measured parameters. These results indicate that the cause of the observed association between RMR and the ND1 polymorphism is not related to in vitro mitochondrial function.

  4. Evidence of a bigenomic regulation of mitochondrial gene expression by thyroid hormone during rat brain development

    SciTech Connect

    Sinha, Rohit Anthony; Pathak, Amrita; Mohan, Vishwa; Babu, Satish; Pal, Amit; Khare, Drirh; Godbole, Madan M.

    2010-07-02

    Hypothyroidism during early mammalian brain development is associated with decreased expression of various mitochondrial encoded genes along with evidence for mitochondrial dysfunction. However, in-spite of the similarities between neurological disorders caused by perinatal hypothyroidism and those caused by various genetic mitochondrial defects we still do not know as to how thyroid hormone (TH) regulates mitochondrial transcription during development and whether this regulation by TH is nuclear mediated or through mitochondrial TH receptors? We here in rat cerebellum show that hypothyroidism causes reduction in expression of nuclear encoded genes controlling mitochondrial biogenesis like PGC-1{alpha}, NRF-1{alpha} and Tfam. Also, we for the first time demonstrate a mitochondrial localization of thyroid hormone receptor (mTR) isoform in developing brain capable of binding a TH response element (DR2) present in D-loop region of mitochondrial DNA. These results thus indicate an integrated nuclear-mitochondrial cross talk in regulation of mitochondrial transcription by TH during brain development.

  5. Purification, characterization and gene cloning of Da-36, a novel serine protease from Deinagkistrodon acutus venom.

    PubMed

    Zheng, Ying; Ye, Feng-Ping; Wang, Jie; Liao, Guo-Yang; Zhang, Yun; Fan, Quan-Shui; Lee, Wen-Hui

    2013-06-01

    A serine protease termed Da-36 was isolated from crude venom of Deinagkistrodon acutus. The enzyme was a single chain protein with an apparent molecular weight of 36,000 on SDS-PAGE with an isoelectric point of 6.59. Da-36 could clot human plasma by cleaving the Aα, Bβ and γ chains of fibrinogen and also exhibited arginine esterase activity. The proteolytic activity of Da-36 toward TAME was strongly inhibited by PMSF and moderately affected by benzamidine and aprotinin, indicating that it was a serine protease. Meanwhile, Da-36 showed stability with wide temperature (20-50 °C) and pH value ranges (pH 6-10). Divalent metal ions of Ca(2+), Mg(2+), and Mn(2+) had no effects but Zn(2+) and Cu(2+) inhibited the arginine esterase activity of Da-36. Total DNA was extracted directly from the lyophilized crude venom and the gene (5.5 kbp) coding for Da-36 had been successfully cloned. Sequence analysis revealed that the Da-36 gene contained five exons and four introns. The mature Da-36 was encoded by four separate exons. The deduced mature amino acid sequence of Da-36 was in good agreement with the determined N-terminal sequence of the purified protein and shared high homology with other serine proteases isolated from different snake venoms. Blast search using amino acid sequence of Da-36 against public database revealed that Da-36 showed a maximal identity of 90% with both Dav-X (Swiss-Prot: Q9I8W9.1) and thrombin-like protein 1 (GenBank: AAW56608.1) from the same snake species, indicating that Da-36 is a novel serine protease.

  6. Ancient Out-of-Africa Mitochondrial DNA Variants Associate with Distinct Mitochondrial Gene Expression Patterns

    PubMed Central

    Mishmar, Dan

    2016-01-01

    Mitochondrial DNA (mtDNA) variants have been traditionally used as markers to trace ancient population migrations. Although experiments relying on model organisms and cytoplasmic hybrids, as well as disease association studies, have served to underline the functionality of certain mtDNA SNPs, only little is known of the regulatory impact of ancient mtDNA variants, especially in terms of gene expression. By analyzing RNA-seq data of 454 lymphoblast cell lines from the 1000 Genomes Project, we found that mtDNA variants defining the most common African genetic background, the L haplogroup, exhibit a distinct overall mtDNA gene expression pattern, which was independent of mtDNA copy numbers. Secondly, intra-population analysis revealed subtle, yet significant, expression differences in four tRNA genes. Strikingly, the more prominent African mtDNA gene expression pattern best correlated with the expression of nuclear DNA-encoded RNA-binding proteins, and with SNPs within the mitochondrial RNA-binding proteins PTCD1 and MRPS7. Our results thus support the concept of an ancient regulatory transition of mtDNA-encoded genes as humans left Africa to populate the rest of the world. PMID:27812116

  7. Genes and languages in Europe: an analysis of mitochondrial lineages.

    PubMed

    Sajantila, A; Lahermo, P; Anttinen, T; Lukka, M; Sistonen, P; Savontaus, M L; Aula, P; Beckman, L; Tranebjaerg, L; Gedde-Dahl, T; Issel-Tarver, L; DiRienzo, A; Pääbo, S

    1995-08-01

    When mitochondrial DNA sequence variation is analyzed from a sample of 637 individuals in 14 European populations, most populations show little differentiation with respect to each other. However, the Saami distinguish themselves by a comparatively large amount of sequence difference when compared with the other populations, by a different distribution of sequence diversity within the population, and by the occurrence of particular sequence motifs. Thus, the Saami seem to have a long history distinct from other European populations. Linguistic affiliations are not reflected in the patterns of relationships of mitochondrial lineages in European populations, whereas prior studies of nuclear gene frequencies have shown a correlation between genetic and linguistic evolution. It is argued that this apparent contradiction is attributable to the fact that genetic lineages and gene frequencies reflect different time perspectives on population history, the latter being more in concordance with linguistic evolution.

  8. Genes related to mitochondrial functions are differentially expressed in phosphine-resistant and -susceptible Tribolium castaneum.

    PubMed

    Oppert, Brenda; Guedes, Raul N C; Aikins, Michael J; Perkin, Lindsey; Chen, Zhaorigetu; Phillips, Thomas W; Zhu, Kun Yan; Opit, George P; Hoon, Kelly; Sun, Yongming; Meredith, Gavin; Bramlett, Kelli; Hernandez, Natalie Supunpong; Sanderson, Brian; Taylor, Madison W; Dhingra, Dalia; Blakey, Brandon; Lorenzen, Marcé; Adedipe, Folukemi; Arthur, Frank

    2015-11-18

    Phosphine is a valuable fumigant to control pest populations in stored grains and grain products. However, recent studies indicate a substantial increase in phosphine resistance in stored product pests worldwide. To understand the molecular bases of phosphine resistance in insects, we used RNA-Seq to compare gene expression in phosphine-resistant and susceptible laboratory populations of the red flour beetle, Tribolium castaneum. Each population was evaluated as either phosphine-exposed or no phosphine (untreated controls) in triplicate biological replicates (12 samples total). Pairwise analysis indicated there were eight genes differentially expressed between susceptible and resistant insects not exposed to phosphine (i.e., basal expression) or those exposed to phopshine (>8-fold expression and 90 % C.I.). However, 214 genes were differentially expressed among all four treatment groups at a statistically significant level (ANOVA, p < 0.05). Increased expression of 44 cytochrome P450 genes was found in resistant vs. susceptible insects, and phosphine exposure resulted in additional increases of 21 of these genes, five of which were significant among all treatment groups (p < 0.05). Expression of two genes encoding anti-diruetic peptide was 2- to 8-fold reduced in phosphine-resistant insects, and when exposed to phosphine, expression was further reduced 36- to 500-fold compared to susceptible. Phosphine-resistant insects also displayed differential expression of cuticle, carbohydrate, protease, transporter, and many mitochondrial genes, among others. Gene ontology terms associated with mitochondrial functions (oxidation biological processes, monooxygenase and catalytic molecular functions, and iron, heme, and tetrapyyrole binding) were enriched in the significantly differentially expressed dataset. Sequence polymorphism was found in transcripts encoding a known phosphine resistance gene, dihydrolipoamide dehydrogenase, in both susceptible and resistant

  9. Massive Mitochondrial Gene Transfer in a Parasitic Flowering Plant Clade

    PubMed Central

    Bradley, Robert K.; Sugumaran, M.; Marx, Christopher J.; Rest, Joshua S.; Davis, Charles C.

    2013-01-01

    Recent studies have suggested that plant genomes have undergone potentially rampant horizontal gene transfer (HGT), especially in the mitochondrial genome. Parasitic plants have provided the strongest evidence of HGT, which appears to be facilitated by the intimate physical association between the parasites and their hosts. A recent phylogenomic study demonstrated that in the holoparasite Rafflesia cantleyi (Rafflesiaceae), whose close relatives possess the world's largest flowers, about 2.1% of nuclear gene transcripts were likely acquired from its obligate host. Here, we used next-generation sequencing to obtain the 38 protein-coding and ribosomal RNA genes common to the mitochondrial genomes of angiosperms from R. cantleyi and five additional species, including two of its closest relatives and two host species. Strikingly, our phylogenetic analyses conservatively indicate that 24%–41% of these gene sequences show evidence of HGT in Rafflesiaceae, depending on the species. Most of these transgenic sequences possess intact reading frames and are actively transcribed, indicating that they are potentially functional. Additionally, some of these transgenes maintain synteny with their donor and recipient lineages, suggesting that native genes have likely been displaced via homologous recombination. Our study is the first to comprehensively assess the magnitude of HGT in plants involving a genome (i.e., mitochondria) and a species interaction (i.e., parasitism) where it has been hypothesized to be potentially rampant. Our results establish for the first time that, although the magnitude of HGT involving nuclear genes is appreciable in these parasitic plants, HGT involving mitochondrial genes is substantially higher. This may represent a more general pattern for other parasitic plant clades and perhaps more broadly for angiosperms. PMID:23459037

  10. Massive mitochondrial gene transfer in a parasitic flowering plant clade.

    PubMed

    Xi, Zhenxiang; Wang, Yuguo; Bradley, Robert K; Sugumaran, M; Marx, Christopher J; Rest, Joshua S; Davis, Charles C

    2013-01-01

    Recent studies have suggested that plant genomes have undergone potentially rampant horizontal gene transfer (HGT), especially in the mitochondrial genome. Parasitic plants have provided the strongest evidence of HGT, which appears to be facilitated by the intimate physical association between the parasites and their hosts. A recent phylogenomic study demonstrated that in the holoparasite Rafflesia cantleyi (Rafflesiaceae), whose close relatives possess the world's largest flowers, about 2.1% of nuclear gene transcripts were likely acquired from its obligate host. Here, we used next-generation sequencing to obtain the 38 protein-coding and ribosomal RNA genes common to the mitochondrial genomes of angiosperms from R. cantleyi and five additional species, including two of its closest relatives and two host species. Strikingly, our phylogenetic analyses conservatively indicate that 24%-41% of these gene sequences show evidence of HGT in Rafflesiaceae, depending on the species. Most of these transgenic sequences possess intact reading frames and are actively transcribed, indicating that they are potentially functional. Additionally, some of these transgenes maintain synteny with their donor and recipient lineages, suggesting that native genes have likely been displaced via homologous recombination. Our study is the first to comprehensively assess the magnitude of HGT in plants involving a genome (i.e., mitochondria) and a species interaction (i.e., parasitism) where it has been hypothesized to be potentially rampant. Our results establish for the first time that, although the magnitude of HGT involving nuclear genes is appreciable in these parasitic plants, HGT involving mitochondrial genes is substantially higher. This may represent a more general pattern for other parasitic plant clades and perhaps more broadly for angiosperms.

  11. Characterization of a Clp Protease Gene Regulator and the Reaeration Response in Mycobacterium tuberculosis

    PubMed Central

    Sherrid, Ashley M.; Rustad, Tige R.; Cangelosi, Gerard A.; Sherman, David R.

    2010-01-01

    Mycobacterium tuberculosis (MTB) enters a non-replicating state when exposed to low oxygen tension, a condition the bacillus encounters in granulomas during infection. Determining how mycobacteria enter and maintain this state is a major focus of research. However, from a public health standpoint the importance of latent TB is its ability to reactivate. The mechanism by which mycobacteria return to a replicating state upon re-exposure to favorable conditions is not understood. In this study, we utilized reaeration from a defined hypoxia model to characterize the adaptive response of MTB following a return to favorable growth conditions. Global transcriptional analysis identified the ∼100 gene Reaeration Response, induced relative to both log-phase and hypoxic MTB. This response includes chaperones and proteases, as well as the transcription factor Rv2745c, which we characterize as a Clp protease gene regulator (ClgR) orthologue. During reaeration, genes repressed during hypoxia are also upregulated in a wave of transcription that includes genes crucial to transcription, translation and oxidative phosphorylation and culminates in bacterial replication. In sum, this study defines a new transcriptional response of MTB with potential relevance to disease, and implicates ClgR as a regulator involved in resumption of replication following hypoxia. PMID:20661284

  12. Molecular mechanisms of extensive mitochondrial gene rearrangementin plethodontid salamanders

    SciTech Connect

    Mueller, Rachel Lockridge; Boore, Jeffrey L.

    2005-06-01

    Extensive gene rearrangement is reported in the mitochondrial genomes of lungless salamanders (Plethodontidae). In each genome with a novel gene order, there is evidence that the rearrangement was mediated by duplication of part of the mitochondrial genome, including the presence of both pseudogenes and additional, presumably functional, copies of duplicated genes. All rearrangement-mediating duplications include either the origin of light strand replication and the nearby tRNA genes or the regions flanking the origin of heavy strand replication. The latter regions comprise nad6, trnE, cob, trnT, an intergenic spacer between trnT and trnP and, in some genomes, trnP, the control region, trnF, rrnS, trnV, rrnL, trnL1, and nad1. In some cases, two copies of duplicated genes, presumptive regulatory regions, and/or sequences with no assignable function have been retained in the genome following the initial duplication; in other genomes, only one of the duplicated copies has been retained. Both tandem and non-tandem duplications are present in these genomes, suggesting different duplication mechanisms. In some of these mtDNAs, up to 25 percent of the total length is composed of tandem duplications of non-coding sequence that includes putative regulatory regions and/or pseudogenes of tRNAs and protein-coding genes along with otherwise unassignable sequences. These data indicate that imprecise initiation and termination of replication, slipped-strand mispairing, and intra-molecular recombination may all have played a role in generating repeats during the evolutionary history of plethodontid mitochondrial genomes.

  13. The Armc10/SVH gene: genome context, regulation of mitochondrial dynamics and protection against Aβ-induced mitochondrial fragmentation

    PubMed Central

    Serrat, R; Mirra, S; Figueiro-Silva, J; Navas-Pérez, E; Quevedo, M; López-Doménech, G; Podlesniy, P; Ulloa, F; Garcia-Fernàndez, J; Trullas, R; Soriano, E

    2014-01-01

    Mitochondrial function and dynamics are essential for neurotransmission, neural function and neuronal viability. Recently, we showed that the eutherian-specific Armcx gene cluster (Armcx1–6 genes), located in the X chromosome, encodes for a new family of proteins that localise to mitochondria, regulating mitochondrial trafficking. The Armcx gene cluster evolved by retrotransposition of the Armc10 gene mRNA, which is present in all vertebrates and is considered to be the ancestor gene. Here we investigate the genomic organisation, mitochondrial functions and putative neuroprotective role of the Armc10 ancestor gene. The genomic context of the Armc10 locus shows considerable syntenic conservation among vertebrates, and sequence comparisons and CHIP-data suggest the presence of at least three conserved enhancers. We also show that the Armc10 protein localises to mitochondria and that it is highly expressed in the brain. Furthermore, we show that Armc10 levels regulate mitochondrial trafficking in neurons, but not mitochondrial aggregation, by controlling the number of moving mitochondria. We further demonstrate that the Armc10 protein interacts with the KIF5/Miro1-2/Trak2 trafficking complex. Finally, we show that overexpression of Armc10 in neurons prevents Aβ-induced mitochondrial fission and neuronal death. Our data suggest both conserved and differential roles of the Armc10/Armcx gene family in regulating mitochondrial dynamics in neurons, and underscore a protective effect of the Armc10 gene against Aβ-induced toxicity. Overall, our findings support a further degree of regulation of mitochondrial dynamics in the brain of more evolved mammals. PMID:24722288

  14. Characterization of a novel serine protease inhibitor gene from a marine metagenome.

    PubMed

    Jiang, Cheng-Jian; Hao, Zhen-Yu; Zeng, Rong; Shen, Pei-Hong; Li, Jun-Fang; Wu, Bo

    2011-01-01

    A novel serine protease inhibitor (serpin) gene designated as Spi1C was cloned via the sequenced-based screening of a metagenomic library from uncultured marine microorganisms. The gene had an open reading frame of 642 base pairs, and encoded a 214-amino acid polypeptide with a predicted molecular mass of about 28.7 kDa. The deduced amino acid sequence comparison and phylogenetic analysis indicated that Spi1C and some partial proteinase inhibitor I4 serpins were closely related. Functional characterization demonstrated that the recombinant Spi1C protein could inhibit a series of serine proteases. The Spi1C protein exhibited inhibitory activity against α-chymotrypsin and trypsin with K(i) values of around 1.79 × 10(-8) and 1.52 × 10(-8) M, respectively. No inhibition activity was exhibited against elastase. Using H-d-Phe-Pip-Arg-pNA as the chromogenic substrate, the optimum pH and temperature of the inhibition activity against trypsin were 7.0-8.0 and 25 °C, respectively. The identification of a novel serpin gene underscores the potential of marine metagenome screening for novel biomolecules.

  15. Decrypting the Mitochondrial Gene Pool of Modern Panamanians

    PubMed Central

    Angerhofer, Norman; Ekins, Jayne E.; Olivieri, Anna; Woodward, Scott R.; Pascale, Juan Miguel; Cooke, Richard; Motta, Jorge; Achilli, Alessandro

    2012-01-01

    The Isthmus of Panama–the narrow neck of land connecting the northern and southern American landmasses–was an obligatory corridor for the Paleo-Indians as they moved into South America. Archaeological evidence suggests an unbroken link between modern natives and their Paleo-Indian ancestors in some areas of Panama, even if the surviving indigenous groups account for only 12.3% of the total population. To evaluate if modern Panamanians have retained a larger fraction of the native pre-Columbian gene pool in their maternally-inherited mitochondrial genome, DNA samples and historical records were collected from more than 1500 volunteer participants living in the nine provinces and four indigenous territories of the Republic. Due to recent gene-flow, we detected ∼14% African mitochondrial lineages, confirming the demographic impact of the Atlantic slave trade and subsequent African immigration into Panama from Caribbean islands, and a small European (∼2%) component, indicating only a minor influence of colonialism on the maternal side. The majority (∼83%) of Panamanian mtDNAs clustered into native pan-American lineages, mostly represented by haplogroup A2 (51%). These findings reveal an overwhelming native maternal legacy in today's Panama, which is in contrast with the overall concept of personal identity shared by many Panamanians. Moreover, the A2 sub-clades A2ad and A2af (with the previously named 6 bp Huetar deletion), when analyzed at the maximum level of resolution (26 entire mitochondrial genomes), confirm the major role of the Pacific coastal path in the peopling of North, Central and South America, and testify to the antiquity of native mitochondrial genomes in Panama. PMID:22675545

  16. Decrypting the mitochondrial gene pool of modern Panamanians.

    PubMed

    Perego, Ugo A; Lancioni, Hovirag; Tribaldos, Maribel; Angerhofer, Norman; Ekins, Jayne E; Olivieri, Anna; Woodward, Scott R; Pascale, Juan Miguel; Cooke, Richard; Motta, Jorge; Achilli, Alessandro

    2012-01-01

    The Isthmus of Panama--the narrow neck of land connecting the northern and southern American landmasses--was an obligatory corridor for the Paleo-Indians as they moved into South America. Archaeological evidence suggests an unbroken link between modern natives and their Paleo-Indian ancestors in some areas of Panama, even if the surviving indigenous groups account for only 12.3% of the total population. To evaluate if modern Panamanians have retained a larger fraction of the native pre-Columbian gene pool in their maternally-inherited mitochondrial genome, DNA samples and historical records were collected from more than 1500 volunteer participants living in the nine provinces and four indigenous territories of the Republic. Due to recent gene-flow, we detected ~14% African mitochondrial lineages, confirming the demographic impact of the Atlantic slave trade and subsequent African immigration into Panama from Caribbean islands, and a small European (~2%) component, indicating only a minor influence of colonialism on the maternal side. The majority (~83%) of Panamanian mtDNAs clustered into native pan-American lineages, mostly represented by haplogroup A2 (51%). These findings reveal an overwhelming native maternal legacy in today's Panama, which is in contrast with the overall concept of personal identity shared by many Panamanians. Moreover, the A2 sub-clades A2ad and A2af (with the previously named 6 bp Huetar deletion), when analyzed at the maximum level of resolution (26 entire mitochondrial genomes), confirm the major role of the Pacific coastal path in the peopling of North, Central and South America, and testify to the antiquity of native mitochondrial genomes in Panama.

  17. Purification, characterization, and gene cloning of thermopsin, a thermostable acid protease from Sulfolobus acidocaldarius.

    PubMed

    Lin, X; Tang, J

    1990-01-25

    A thermostable, acid proteolytic activity has been found to be associated with the cells and in the culture medium of Sulfolobus acidocaldarius, an archaebacterium. This acid protease, which has been named thermopsin, was purified to homogeneity from the culture medium by a five-step procedure including column chromatographies on DEAE-Sepharose CL-6B, phenyl-Sepharose CL-4B, Sephadex G-100, monoQ (fast protein liquid chromatography), and gel filtration (high pressure liquid chromatography). The purified thermopsin produced a single band on sodium dodecyl sulfate-polyacrylamide gel electrophoresis and the proteolytic activity was associated with the band. Thermopsin is a single-chain protein as indicated by gel electrophoresis and by a single NH2-terminal sequence. It has maximal proteolytic activity at pH 2 and 90 degrees C. A genomic library of S. acidocaldarius was prepared and screened by an oligonucleotide probe designed from the NH2-terminal sequence of thermopsin. Five positive clones were isolated. From these clones the thermopsin gene was mapped and sequenced. The nucleotide sequence showed that the thermopsin structure is encoded in 1020 bases. In the deduced protein sequence, there are 41 amino acid residues (including the initiation Met) preceding the NH2-terminal position of thermopsin. Most of these residues appear to be characteristic of a leader sequence. However, the presence in this region of a short pro sequence cannot be ruled out. Thermopsin contains a single cysteine at residue 237 that is not essential for activity (Fusek, M., Lin, X.-L., Tang, J. (1990) J. Biol. Chem. 265, 1496-1501. Thermopsin has no apparent sequence similarity to aspartic proteases of the pepsin family nor to pepstatin-insensitive acid protease (Maita, T., Nagata, S., Matsuda, G., Murata, S., Oda, K., Murao, S., and Tsura, D. (1984) J. Biochem. 95, 465-475) and thus may represent a new class of acid proteases. Also absent is the characteristic active site aspartyl sequence

  18. The Drosophila Stubble-stubbloid gene encodes an apparent transmembrane serine protease required for epithelial morphogenesis.

    PubMed Central

    Appel, L F; Prout, M; Abu-Shumays, R; Hammonds, A; Garbe, J C; Fristrom, D; Fristrom, J

    1993-01-01

    The Stubble-stubbloid (Sb-sbd) gene is required for hormone-dependent epithelial morphogenesis of imaginal discs of Drosophila, including the formation of bristles, legs, and wings. The gene has been cloned by using Sb-sbd-associated DNA lesions in a 20-kilobase (kb) region of a 263-kb genomic walk. The region specifies an approximately 3.8-kb transcript that is induced by the steroid hormone 20-hydroxyecdysone in imaginal discs cultured in vitro. The conceptually translated protein is an apparent 786-residue type II transmembrane protein (N terminus in, C terminus out), including an intracellular N-terminal domain of at least 35 residues and an extracellular C-terminal trypsin-like serine protease domain of 244 residues. Sequence analyses indicate that the Sb-sbd-encoded protease could activate itself by proteolytic cleavage. Consistent with the cell-autonomous nature of the Sb-sbd bristle phenotype, a disulfide bond between cysteine residues in the noncatalytic N-terminal fragment and the C-terminal catalytic fragment could tether the protease to the membrane after activation. Both dominant Sb and recessive sbd mutations affect the organization of microfilament bundles during bristle morphogenesis. We propose that the Sb-sbd product has a dual function. (i) It acts through its proteolytic extracellular domain to detach imaginal disc cells from extracellular matrices, and (ii) it transmits an outside-to-inside signal to its intracellular domain to modify the cytoskeleton and facilitate cell shape changes underlying morphogenesis. Images Fig. 2 Fig. 3 Fig. 4 Fig. 5 PMID:7685111

  19. Genome-wide identification, evolutionary and expression analysis of the aspartic protease gene superfamily in grape

    PubMed Central

    2013-01-01

    Background Aspartic proteases (APs) are a large family of proteolytic enzymes found in almost all organisms. In plants, they are involved in many biological processes, such as senescence, stress responses, programmed cell death, and reproduction. Prior to the present study, no grape AP gene(s) had been reported, and their research on woody species was very limited. Results In this study, a total of 50 AP genes (VvAP) were identified in the grape genome, among which 30 contained the complete ASP domain. Synteny analysis within grape indicated that segmental and tandem duplication events contributed to the expansion of the grape AP family. Additional analysis between grape and Arabidopsis demonstrated that several grape AP genes were found in the corresponding syntenic blocks of Arabidopsis, suggesting that these genes arose before the divergence of grape and Arabidopsis. Phylogenetic relationships of the 30 VvAPs with the complete ASP domain and their Arabidopsis orthologs, as well as their gene and protein features were analyzed and their cellular localization was predicted. Moreover, expression profiles of VvAP genes in six different tissues were determined, and their transcript abundance under various stresses and hormone treatments were measured. Twenty-seven VvAP genes were expressed in at least one of the six tissues examined; nineteen VvAPs responded to at least one abiotic stress, 12 VvAPs responded to powdery mildew infection, and most of the VvAPs responded to SA and ABA treatments. Furthermore, integrated synteny and phylogenetic analysis identified orthologous AP genes between grape and Arabidopsis, providing a unique starting point for investigating the function of grape AP genes. Conclusions The genome-wide identification, evolutionary and expression analyses of grape AP genes provide a framework for future analysis of AP genes in defining their roles during stress response. Integrated synteny and phylogenetic analyses provide novel insight into the

  20. A genomewide screen for petite-negative yeast strains yields a new subunit of the i-AAA protease complex.

    PubMed

    Dunn, Cory D; Lee, Marina S; Spencer, Forrest A; Jensen, Robert E

    2006-01-01

    Unlike many other organisms, the yeast Saccharomyces cerevisiae can tolerate the loss of mitochondrial DNA (mtDNA). Although a few proteins have been identified that are required for yeast cell viability without mtDNA, the mechanism of mtDNA-independent growth is not completely understood. To probe the relationship between the mitochondrial genome and cell viability, we conducted a microarray-based, genomewide screen for mitochondrial DNA-dependent yeast mutants. Among the several genes that we discovered is MGR1, which encodes a novel subunit of the i-AAA protease complex located in the mitochondrial inner membrane. mgr1Delta mutants retain some i-AAA protease activity, yet mitochondria lacking Mgr1p contain a misassembled i-AAA protease and are defective for turnover of mitochondrial inner membrane proteins. Our results highlight the importance of the i-AAA complex and proteolysis at the inner membrane in cells lacking mitochondrial DNA.

  1. Identification of two new keratinolytic proteases from a Bacillus pumilus strain using protein analysis and gene sequencing.

    PubMed

    Fellahi, Soltana; Chibani, Abdelwaheb; Feuk-Lagerstedt, Elisabeth; Taherzadeh, Mohammad J

    2016-12-01

    The Bacillus strain (CCUG 66887) has a high capacity to excrete keratinase with the ability to degrade both alpha- and beta keratin. In this study we aimed to show the characteristics of the keratinolytic protease and to identify its gene by using liquid chromatography-electrospray ionization tandem mass spectrometry methods (nanoHPLC-ESI-MS/MS) followed by Mascot data base search. The results showed that the enzyme in fact consists of two different keratinases, both with a molecular mass of 38 kDa. Further, DNA sequencing generated the open reading frame (ORF) of one of the genes (Ker1), and de novo genome sequencing identified the ORF of the second gene (Ker2). The two keratinase genes contain 1153 base pairs each and have a gene similarity of 67 %. In addition, the Bacillus strain was classified as Bacillus pumilus and its genes were annotated in the GeneBank at NCBI (accession: CP011109.1). Amino acid sequences alignment with known B. pumilus proteases indicated that the two keratinases of B. pumilus strain C4 are subtilisin-like serine proteases belonging to the Protease S8 family. Taken together, these result suggest the two keratinases as promising candidates for enzymatic processing of keratinous wastes in waste refinery.

  2. Evolutionary transfers of mitochondrial genes to the nucleus in the Populus lineage and coexpression of nuclear and mitochondrial Sdh4 genes.

    PubMed

    Choi, Catherine; Liu, Zhenlan; Adams, Keith L

    2006-01-01

    The transfer of mitochondrial genes to the nucleus is an ongoing evolutionary process in flowering plants. Evolutionarily recent gene transfers provide insights into the evolutionary dynamics of the process and the way in which transferred genes become functional in the nucleus. Genes that are present in the mitochondrion of some angiosperms but have been transferred to the nucleus in the Populus lineage were identified by searches of Populus sequence databases. Sequence analyses and expression experiments were used to characterize the transferred genes. Two succinate dehydrogenase genes and six mitochondrial ribosomal protein genes have been transferred to the nucleus in the Populus lineage and have become expressed. Three transferred genes have gained an N-terminal mitochondrial targeting presequence from other pre-existing genes and two of the transferred genes do not contain an N-terminal targeting presequence. Intact copies of the succinate dehydrogenase gene Sdh4 are present in both the mitochondrion and the nucleus. Both copies of Sdh4 are expressed in multiple organs of two Populus species and RNA editing occurs in the mitochondrial copy. These results provide a genome-wide perspective on mitochondrial genes that were transferred to the nucleus and became expressed, functional genes during the evolutionary history of Populus.

  3. Mitochondrial gene expression, antioxidant responses, and histopathology after cadmium exposure.

    PubMed

    Al Kaddissi, Simone; Legeay, Alexia; Elia, Antonia Concetta; Gonzalez, Patrice; Floriani, Magali; Cavalie, Isabelle; Massabuau, Jean-Charles; Gilbin, Rodolphe; Simon, Olivier

    2014-08-01

    The present study investigates cadmium effects on the transcription of mitochondrial genes of Procambarus clarkii after acute (0.05, 0.5, and 5 mg Cd/L; 4-10 days) and chronic exposures (10 μg Cd/L; 30-60 days). Transcriptional responses of cox1, atp6, and 12S using quantitative real-time RT-PCR were assessed in gills and hepatopancreas. Additionally, the expression levels of genes involved in detoxification and/or oxidative stress responses [mt, sod(Mn)] and enzymatic activities of antioxidants (SOD, CAT, GPX, and GST) were analyzed. The histopathological effects in hepatopancreas of crayfish were evaluated by light microscopy. Relationships between endpoints at different levels of biological organization and Cd bioaccumulation were also examined. Cd induced high levels of bioaccumulation, which was followed by mitochondrial dysfunction and histological alterations in both experiments. Moreover, perturbations in the defence mechanisms against oxidative stress tended to increase with time. Results also showed that molecular responses can vary depending on the intensity and duration of the chemical stress applied to the organisms and that the study of mt gene expression levels seemed to be the best tool to assess Cd intoxication.

  4. Syllidae mitochondrial gene order is unusually variable for Annelida.

    PubMed

    Aguado, M Teresa; Richter, Sandy; Sontowski, Rebekka; Golombek, Anja; Struck, Torsten H; Bleidorn, Christoph

    2016-12-05

    Complete mitochondrial genomes of five syllids (Streptosyllis sp., Eusyllis blomstrandi, Myrianida brachycephala, Typosyllis antoni and Typosyllis sp.) have been obtained using Illumina sequencing. Together with two previous studied taxa (Ramisyllis multicaudata and Trypanobia cryptica), the analysed sequences represent most of the main lineages within the family Syllidae (Anoplosyllinae, Eusyllinae, Autolytinae and Syllinae). The genomic features, gene order and phylogenetic relationships are examined. Unusual for annelids, syllid mitochondrial genomes are highly variable in their gene order. Considering genomic features, such as length, skewness, gene content, and codon bias, most similar to the rest of annelids are the genomes of E. blomstrandi and M. brachycephala, while Streptosyllis sp. and the analysed sylline taxa (R. multicaudata, T. cryptica, T. antoni and Typosyllis sp.) are the most dissimilar. Two methionine tRNA's (trnM) have been found in T. antoni and Typosyllis sp. The mt genomes of these latter taxa are the longest with numerous non-coding regions. The 13 protein coding genes, as well as the rRNA's are used to perform phylogenetic analyses that recovered the relationships within the family explored before by previous authors. The gene order in Syllidae shows very different patterns. E. blomstrandi and M. prolifera show a similar pattern to the one found in Pleistoannelida; however this might have changed at least twice within Syllidae: in Streptosyllis sp. and within Syllinae. All analysed Syllinae show different gene orders, thereby illustrating more variability as all other pleistoannelids analysed so far. The information provided herein allows a more accurate reconstruction of the possible evolutionary scenarios in Syllidae.

  5. Critical COPD respiratory illness is linked to increased transcriptomic activity of neutrophil proteases genes

    PubMed Central

    2012-01-01

    essential role of neutrophil proteases in COPD patients with critical respiratory illness. Measurement and modulation of the expression of these genes could present an option for clinical monitoring and treatment of severe COPD exacerbations. PMID:22852767

  6. NGF induction of the gene encoding the protease transin accompanies neuronal differentiation in PC12 cells.

    PubMed

    Machida, C M; Rodland, K D; Matrisian, L; Magun, B E; Ciment, G

    1989-06-01

    Various proteases have been found to be released by the growth cones of developing neurons in culture and have been hypothesized to play a role in the process of axon elongation. We report here that nerve growth factor (NGF) induced the gene encoding the metalloprotease transin in PC12 cells with a time course coincident with the initial appearance of neurites by these cells. Acidic and basic fibroblast growth factors also stimulated transin mRNA expression and neurite outgrowth, whereas various other agents had no effects on either of these phenomena. In contrast, dexamethasone was found to inhibit the induction of transin mRNA when added with, or following, NGF treatment. Finally, we show that sequences contained within 750 bp of the 5' untranscribed region of the transin gene confer responsiveness to NGF and dexamethasone.

  7. Effects of dietary fatty acids on mitochondrial phospholipid compositions, oxidative status and mitochondrial gene expression of zebrafish at different ages.

    PubMed

    Betancor, M B; Almaida-Pagán, P F; Hernández, A; Tocher, D R

    2015-10-01

    Mitochondrial decay is generally associated with impairment in the organelle bioenergetics function and increased oxidative stress, and it appears that deterioration of mitochondrial inner membrane phospholipids (PL) and accumulation of mitochondrial DNA (mtDNA) mutations are among the main mechanisms involved in this process. In the present study, mitochondrial membrane PL compositions, oxidative status (TBARS content and SOD activity) and mtDNA gene expression of muscle and liver were analyzed in zebrafish fed two diets with lipid supplied either by rapeseed oil (RO) or a blend 60:40 of RO and DHA500 TG oil (DHA). Two feeding trials were performed using zebrafish from the same population of two ages (8 and 21 months). Dietary FA composition affected fish growth in 8-month-old animals, which could be related to an increase in stress promoted by diet composition. Lipid peroxidation was considerably higher in mitochondria of 8-month-old zebrafish fed the DHA diet than in animals fed the RO diet. This could indicate higher oxidative damage to mitochondrial lipids, very likely due to increased incorporation of DHA in PL of mitochondrial membranes. Lipids would be among the first molecules affected by mitochondrial reactive oxygen species, and lipid peroxidation could propagate oxidative reactions that would damage other molecules, including mtDNA. Mitochondrial lipid peroxidation and gene expression of 21-month-old fish showed lower responsiveness to diet composition than those of younger fish. Differences found in the effect of diet composition on mitochondrial lipids between the two age groups could be indicating age-related changes in the ability to maintain structural homeostasis of mitochondrial membranes.

  8. Frequency and patterns of protease gene resistance mutations in HIV-infected patients treated with lopinavir/ritonavir as their first protease inhibitor.

    PubMed

    Barber, Tristan J; Harrison, Linda; Asboe, David; Williams, Ian; Kirk, Stuart; Gilson, Richard; Bansi, Loveleen; Pillay, Deenan; Dunn, David

    2012-04-01

    Selection of protease mutations on antiretroviral therapy (ART) including a ritonavir-boosted protease inhibitor (PI) has been reported infrequently. Scarce data exist from long-term cohorts on resistance incidence or mutational patterns emerging to different PIs. We studied UK patients receiving lopinavir/ritonavir as their first PI, either while naive to ART or having previously received non-PI-based ART. Virological failure was defined as viral load ≥ 400 copies/mL after previous suppression <400 copies/mL, or failure to achieve <400 copies/mL during the first 6 months. pol sequences whilst failing lopinavir or within 30 days after stopping were analysed. Major and minor mutations (IAS-USA 2008-after exclusion of polymorphisms) were considered. Predicted susceptibility was determined using the Stanford HIVdb algorithm. Three thousand and fifty-six patients were followed for a median (IQR) of 14 (6-30) months, of whom 811 (27%) experienced virological failure. Of these, resistance test results were available on 291 (36%). One or more protease mutations were detected in 32 (11%) patients; the most frequent were I54V (n = 12), M46I (n = 11), V82A (n = 7) and L76V (n = 3). No association with viral subtype was evident. Many patients retained virus predicted to be susceptible to lopinavir (14, 44%), tipranavir (26, 81%) and darunavir (27, 84%). This study reflects the experience of patients in routine care. Selection of protease gene mutations by lopinavir/ritonavir occurred at a much higher rate than in clinical trials. The mutations observed showed only partial overlap with those previously identified by structural chemistry models, serial cell culture passage and genotype-phenotype analyses. There remained a low degree of predicted cross-resistance to other widely used PIs.

  9. Upregulation of the mitochondrial Lon Protease allows adaptation to acute oxidative stress but dysregulation is associated with chronic stress, disease, and aging.

    PubMed

    Ngo, Jenny K; Pomatto, Laura C D; Davies, Kelvin J A

    2013-02-09

    The elimination of oxidatively modified proteins is a crucial process in maintaining cellular homeostasis, especially during stress. Mitochondria are protein-dense, high traffic compartments, whose polypeptides are constantly exposed to superoxide, hydrogen peroxide, and other reactive species, generated by 'electron leakage' from the respiratory chain. The level of oxidative stress to mitochondrial proteins is not constant, but instead varies greatly with numerous metabolic and environmental factors. Oxidized mitochondrial proteins must be removed rapidly (by proteolytic degradation) or they will aggregate, cross-link, and cause toxicity. The Lon Protease is a key enzyme in the degradation of oxidized proteins within the mitochondrial matrix. Under conditions of acute stress Lon is highly inducible, possibly with the oxidant acting as the signal inducer, thereby providing increased protection. It seems that under chronic stress conditions, however, Lon levels actually decline. Lon levels also decline with age and with senescence, and senescent cells even lose the ability to induce Lon during acute stress. We propose that the regulation of Lon is biphasic, in that it is up-regulated during transient stress and down-regulated during chronic stress and aging, and we suggest that the loss of Lon responsiveness may be a significant factor in aging, and in age-related diseases.

  10. Using in silico techniques: Isolation and characterization of an insect cuticle-degrading-protease gene from Beauveria bassiana.

    PubMed

    Khan, Sehroon; Nadir, Sadia; Wang, Xuewen; Khan, Afsar; Xu, Jianchu; Li, Meng; Tao, Lihong; Khan, Siraj; Karunarathna, Samantha C

    2016-08-01

    Cuticle-degrading-proteases (CDPs) secreted by Beauveria spp. are pivotal biocontrol substances, possessing commercial potential for developing bio-pesticides. Therefore, a thoughtful and contemplative understanding and assessment of the structural and functional features of these proteases would markedly assist the development of biogenic pesticides. Computational molecular biology is a new facile alternative approach to the tedious experimental molecular biology; therefore, by using bioinformatics tools, we isolated and characterized an insect CDP gene from Beauveria bassiana 70 s.l. genomic DNA. The CDP gene (1240 bp with GeneBank accession no. KT804651.1) consisted of three introns and four CDS exons, and shared 74-100% sequence identity to the reference CDP genes. Its phylogenetic tree results showed a unique evolution pattern, and the predicted amino acid peptide (PAAP) consisted of 344 amino acid residues with pI, molecular weight, instability index, grand average hydropathicity value and aliphatic index of 7.2, 35.4 kDa, 24.45, -0.149, and 76.63, respectively. The gene possessed 74-89% amino acid sequence similarity to the 12 reference strains. Three motifs (Peptidase_S8 subtilase family) were detected in the PAAP, and the computed 3D structure possessed 79.09% structural identity to alkaline serine proteases. The PAAP had four (three serine proteases and one Pyridoxal-dependent decarboxylase) conserved domains, a disulfide bridge, two calcium binding sites, MY domain, and three predicted active sites in the serine family domains. These results will set the groundwork for further exploitation of proteases and understanding the mechanism of disease caused by cuticle-degrading-serine-proteases from entomopathogenic fungi.

  11. Detection of enterotoxin and protease genes among Hungarian clinical Bacteroides fragilis isolates.

    PubMed

    Sárvári, Károly Péter; Sóki, József; Iván, Miklós; Miszti, Cecília; Latkóczy, Krisztina; Melegh, Szilvia Zsóka; Urbán, Edit

    2017-07-25

    Bacteroides fragilis as a commensal bacterium is a member of the human intestinal flora, but as an opportunistic pathogen it can cause serious infections as well. Some of them, harbouring an enterotoxin gene (bft), may cause diarrhoea mainly in young children. Recently it has been shown that a member of C11 proteases called fragipain (fpn) can activate the enterotoxin, while C10 protease (bfp) is suspected of playing an important role in the invasiveness of the B. fragilis isolates. The objective of this study was to investigate the prevalence and distribution of the bft isotypes in 200 Hungarian B. fragilis isolates collected recently; and in a subset of 72 strains, we wanted to determine the prevalence of bfp1-4 and fpn genes in bft-positive and bft-negative strains. Using the MALDI-TOF MS cfiA identification project file, 19 B. fragilis strains belonging to Division II were identified and the presence of the cfiA gene was confirmed by RT-PCR. Twenty six (13.0%) B. fragilis isolates turned out to be bft gene positive by RT-PCR; 20 isolates harboured bft-1 and six bft-2 isotypes, but no bft-3 isotype containing strains were found. A melting curve analysis and the PCR-RFLP were performed to differentiate between the bft-1 and bft-2 isotypes confirmed by sequencing. Thirty eight strains harboured bfp1, 58 isolates contained bfp2 gene, while 17 isolates proved positive for bfp3. Morever, no bfp4 positive isolate was found, and some of the B. fragilis strains tested harboured two or three bfp isotypes simultaneously. Among the 26 bft-positive strains, 24 contained the fpn gene, which confirms the role of fragipain in the activation of B. fragilis enterotoxin. In experiments, a significant negative correlation between fpn and cfiA was demonstrated (p < 0.000), a positive correlation was found between bfp2 and fpn genes (p = 0.0000803), and a negative correlation between bfp2 and cfiA genes (p = 0.011). Copyright © 2017 Elsevier Ltd. All rights reserved.

  12. Dramatic mitochondrial gene rearrangements in the hermit crab Pagurus longicarpus (Crustacea, anomura).

    PubMed

    Hickerson, M J; Cunningham, C W

    2000-04-01

    The entire mitochondrial gene order of the crustacean Pagurus longicarpus was determined by sequencing all but approximately 300 bp of the mitochondrial genome. We report the first major gene rearrangements found in the clade including Crustacea and Insecta. At least eight mitochondrial gene rearrangements have dramatically altered the gene order of the hermit crab P. longicarpus relative to the putatively ancestral crustacean gene order. These include two rearrangements of protein-coding genes, the first reported for any nonchelicerate arthropod. Codon usage and amino acid sequences do not deviate substantially from those reported for other crustaceans. Investigating the phylogenetic distribution of these eight rearrangements will add additional characters to help resolve decapod phylogeny.

  13. Successive bouts of cycling stimulates genes associated with mitochondrial biogenesis.

    PubMed

    Dumke, Charles L; Mark Davis, J; Angela Murphy, E; Nieman, David C; Carmichael, Martin D; Quindry, John C; Travis Triplett, N; Utter, Alan C; Gross Gowin, Sarah J; Henson, Dru A; McAnulty, Steven R; McAnulty, Lisa S

    2009-11-01

    Exercise increases mRNA for genes involved in mitochondrial biogenesis and oxidative enzyme capacity. However, little is known about how these genes respond to consecutive bouts of prolonged exercise. We examined the effects of 3 h of intensive cycling performed on three consecutive days on the mRNA associated with mitochondrial biogenesis in trained human subjects. Forty trained cyclists were tested for VO(2max) (54.7 +/- 1.1 ml kg(-1) min(-1)). The subjects cycled at 57% watts(max) for 3 h using their own bicycles on CompuTrainer Pro Model trainers (RacerMate, Seattle, WA) on three consecutive days. Muscle biopsies were obtained from the vastus lateralis pre- and post-exercise on days one and three. Muscle samples were analyzed for mRNA content of peroxisome proliferator receptor gamma coactivator-1 alpha (PGC-1alpha), sirtuin 1 (Sirt-1), cytochrome c, and citrate synthase. Data were analyzed using a 2 (time) x 2 (day) repeated measures ANOVA. Of the mRNA analyzed, the following increased from pre to post 3 h rides: cytochrome c (P = 0.006), citrate synthase (P = 0.03), PGC-1alpha (P < 0.001), and Sirt-1 (P = 0.005). The following mRNA showed significant effects from days one to three: cytochrome c (P < 0.001) and citrate synthase (P = 0.01). These data show that exhaustive cycling performed on three consecutive days resulted in both acute and chronic stimuli for mRNA associated with mitochondrial biogenesis in already trained subjects. This is the first study to illustrate an increase in sirtuin-1 mRNA with acute and chronic exercise. These data contribute to the understanding of mRNA expression during both acute and successive bouts of prolonged exercise.

  14. Cloning, characterization, expression analysis and inhibition studies of a novel gene encoding Bowman-Birk type protease inhibitor from rice bean

    USDA-ARS?s Scientific Manuscript database

    This paper presents the first study describing the isolation, cloning and characterization of a full length gene encoding Bowman-Birk protease inhibitor (RbTI) from rice bean (Vigna umbellata). A full-length protease inhibitor gene with complete open reading frame of 327bp encoding 109 amino acids w...

  15. The circadian Clock gene regulates acrosin activity of sperm through serine protease inhibitor A3K

    PubMed Central

    Cheng, Shuting; Liang, Xin; Wang, Yuhui; Jiang, Zhou; Liu, Yanyou; Hou, Wang; Li, Shiping; Zhang, Jing

    2015-01-01

    Our previous study found that CLOCK knockdown in the testes of male mice led to a reduced fertility, which might be associated with the lower acrosin activity. In this present study, we examined the differential expression in proteins of CLOCK knockdown sperm. Clock gene expression was knocked down in cells to confirm those differentially expressions and serine protease inhibitor SERPINA3K was identified as a potential target. The up-regulated SERPINA3K revealed an inverse relationship with Clock knockdown. Direct treatment of normal sperm with recombinant SERPINA3K protein inhibited the acrosin activity and reduced in vitro fertilization rate. The luciferase reporter gene assay showed that the down-regulated of Clock gene could activate the Serpina3k promoter, but this activation was not affected by the mutation of E-box core sequence. Co-IP demonstrated a natural interaction between SERPIAN3K and RORs (α and β). Taken together, these results demonstrated that SERPINA3K is involved in the Clock gene-mediated male fertility by regulating acrosin activity and provide the first evidence that SERPINA3K could be regulated by Clock gene via retinoic acid-related orphan receptor response elements. PMID:26264441

  16. Isolation of cDNA from Jacaratia mexicana encoding a mexicain-like cysteine protease gene.

    PubMed

    Ramos-Martínez, Erick M; Herrera-Ramírez, Alejandra C; Badillo-Corona, Jesús Agustín; Garibay-Orijel, Claudio; González-Rábade, Nuria; Oliver-Salvador, María Del Carmen

    2012-07-01

    Cysteine proteases (CPs) from the C1 family, which are similar to papain, can be found in animals and plants, as well as some viruses and prokaryotes. These enzymes have diverse physiological functions and are thus very attractive for science and industry. Jacaratia mexicana, a member of the Caricaceae plant family, contains several CPs, the principal being mexicain, found to favorably compete against papain for many industrial applications due to its high stability and specific activity. In this study, leaves of J. mexicana were used to isolate a CP-coding gene, similar to those that code for mexicain and chymomexicain. By using rapid amplification of cDNA ends (RACE) as well as oligonucleotide design from papain-like conserved amino acids (aa), a sequence of 1404 bp consisting of a 5' terminal untranslated region (UTR) of 153 bp, a 3' terminal UTR of 131 bp, with a polyadenylation (poly(A)) signal sequence and a poly(A) tail, and an open reading frame (ORF) of 1046 bp, was obtained by overlapping three partial sequences. Two full-length cDNA sequences that encode for mexicain-like proteases were cloned from mRNA (JmCP4 and JmCP5). JmCP4 is predicted to have an ORF of 1044 bp, which codifies for polypeptides that have a 26 aa signal peptide region, a 108 aa propeptide region and a mature enzyme of 214 aa. A 969 bp fragment (JmCP5) encodes for a partial sequence of a CP gene, without the signal peptide region but with a full-length propeptide region. The sequence analysis showed that this protease presented a high similarity to other plant CPs from J. mexicana, Vasconcellea cundinamarcensis, Vasconcellea stipulata, and Carica papaya, among others, mainly at the conserved catalytic site. Obtaining the sequence of this CP gene from J. mexicana provides an alternative for production in a standard system and could be an initial step towards the commercialization of this enzyme.

  17. Local similarity search to find gene indicators in mitochondrial genomes.

    PubMed

    Moritz, Ruby L V; Bernt, Matthias; Middendorf, Martin

    2014-03-11

    Given a set of nucleotide sequences we consider the problem of identifying conserved substrings occurring in homologous genes in a large number of sequences. The problem is solved by identifying certain nodes in a suffix tree containing all substrings occurring in the given nucleotide sequences. Due to the large size of the targeted data set, our approach employs a truncated version of suffix trees. Two methods for this task are introduced: (1) The annotation guided marker detection method uses gene annotations which might contain a moderate number of errors; (2) The probability based marker detection method determines sequences that appear significantly more often than expected. The approach is successfully applied to the mitochondrial nucleotide sequences, and the corresponding annotations that are available in RefSeq for 2989 metazoan species. We demonstrate that the approach finds appropriate substrings.

  18. Mitochondrial gene order change in Schistosoma (Platyhelminthes: Digenea: Schistosomatidae).

    PubMed

    Webster, Bonnie L; Littlewood, D Timothy J

    2012-01-01

    In the flatworm genus Schistosoma, species of which include parasites of biomedical and veterinary importance, mitochondrial gene order is radically different in some species. A PCR-based survey of 19 schistosomatid spp. established which of 14 Schistosoma spp. have the ancestral (plesiomorphic) or derived gene order condition. A phylogeny for Schistosoma was estimated and used to infer the origin of the gene order change which is present in all members of a clade containing Schistosoma incognitum and members of the traditionally recognised Schistosoma indicum, Schistosoma mansoni and Schistosomahaematobium spp. groups. Schistosoma turkestanicum, with the plesiomorphic gene order state, is sister to this clade. Common interval analysis suggests change in gene order, from ancestral to derived, consisted of two sequential transposition events: (a) nad1_nad3 to nad3_nad1 and (b) [atp6,nad2]_[nad3,-nad1,cox1,rrnL,rrnS,cox2,nad6] to [nad3,nad1,cox1,rrnL,rrnS,cox2,nad6]_[atp6,nad2], where gene order offragments within square brackets remain unchanged. Gene order change is rare in parasitic flatworms and is a robust synapomorphy for schistosome spp. that exhibit it. The schistosomatid phylogeny casts some doubt on the origin of Schistosoma (Asian or African), highlights the propensity for species to hosts witch amongst mammalian (definitive) hosts, and indicates the likely importance of snail (intermediate)hosts in determining and defining patterns of schistosome radiation and continental invasion. Mitogenomic sampling of Schistosoma dattai and Schistosoma harinasutai to determine gene order, and within key species, especially S. turkestanicum and S. incognitum, to determine ancestral ranges, may help discover the geographic origins of gene order change in the genus. Samples of S. incognitum from India and Thailand suggest this taxon may include cryptic species. Crown Copyright 2012 Published by Elsevier Ltd. on behalf of Australian Society for Parasitology Inc. Allrights

  19. Enlightenment of Yeast Mitochondrial Homoplasmy: Diversified Roles of Gene Conversion

    PubMed Central

    Ling, Feng; Mikawa, Tsutomu; Shibata, Takehiko

    2011-01-01

    Mitochondria have their own genomic DNA. Unlike the nuclear genome, each cell contains hundreds to thousands of copies of mitochondrial DNA (mtDNA). The copies of mtDNA tend to have heterogeneous sequences, due to the high frequency of mutagenesis, but are quickly homogenized within a cell (“homoplasmy”) during vegetative cell growth or through a few sexual generations. Heteroplasmy is strongly associated with mitochondrial diseases, diabetes and aging. Recent studies revealed that the yeast cell has the machinery to homogenize mtDNA, using a common DNA processing pathway with gene conversion; i.e., both genetic events are initiated by a double-stranded break, which is processed into 3′ single-stranded tails. One of the tails is base-paired with the complementary sequence of the recipient double-stranded DNA to form a D-loop (homologous pairing), in which repair DNA synthesis is initiated to restore the sequence lost by the breakage. Gene conversion generates sequence diversity, depending on the divergence between the donor and recipient sequences, especially when it occurs among a number of copies of a DNA sequence family with some sequence variations, such as in immunoglobulin diversification in chicken. MtDNA can be regarded as a sequence family, in which the members tend to be diversified by a high frequency of spontaneous mutagenesis. Thus, it would be interesting to determine why and how double-stranded breakage and D-loop formation induce sequence homogenization in mitochondria and sequence diversification in nuclear DNA. We will review the mechanisms and roles of mtDNA homoplasmy, in contrast to nuclear gene conversion, which diversifies gene and genome sequences, to provide clues toward understanding how the common DNA processing pathway results in such divergent outcomes. PMID:24710143

  20. Eliminate mitochondrial diseases by gene editing in germ-line cells and embryos.

    PubMed

    Wang, Si; Yi, Fei; Qu, Jing

    2015-07-01

    Nuclease-based gene editing technologies have opened up opportunities for correcting human genetic diseases. For the first time, scientists achieved targeted gene editing of mitochondrial DNA in mouse oocytes fused with patient cells. This fascinating progression may encourage the development of novel therapy for human maternally inherent mitochondrial diseases.

  1. Fragmentary 5S rRNA gene in the human mitochondrial genome

    SciTech Connect

    Nierlich, D.P.

    1982-02-01

    The human mitochondrial genoma contains a 23-nucleodtide sequence that is homologous to a part of the 5S rRNA's of bacteria. This homology, the structure of the likely transcript, and the location of the sequence relative to the mitochondrial rRNA genes suggest that the sequence represents a fragmentary 5S rRNA gene.

  2. The spectrum of low molecular weight alpha-amylase/protease inhibitor genes expressed in the US bread wheat Butte 86

    USDA-ARS?s Scientific Manuscript database

    The complement of genes encoding alpha-amylase/protease inhibitors expressed in Triticum aestivum cv. Butte 86 was characterized by transcript and proteomic analysis. Coding sequences for 18 distinct proteins were identified among a collection of expressed sequence tags (ESTs) from Butte 86 developi...

  3. The N-terminal domain plays a crucial role in the structure of a full-length human mitochondrial Lon protease

    PubMed Central

    Kereïche, Sami; Kováčik, Lubomír; Bednár, Jan; Pevala, Vladimír; Kunová, Nina; Ondrovičová, Gabriela; Bauer, Jacob; Ambro, Ľuboš; Bellová, Jana; Kutejová, Eva; Raška, Ivan

    2016-01-01

    Lon is an essential, multitasking AAA+ protease regulating many cellular processes in species across all kingdoms of life. Altered expression levels of the human mitochondrial Lon protease (hLon) are linked to serious diseases including myopathies, paraplegia, and cancer. Here, we present the first 3D structure of full-length hLon using cryo-electron microscopy. hLon has a unique three-dimensional structure, in which the proteolytic and ATP-binding domains (AP-domain) form a hexameric chamber, while the N-terminal domain is arranged as a trimer of dimers. These two domains are linked by a narrow trimeric channel composed likely of coiled-coil helices. In the presence of AMP-PNP, the AP-domain has a closed-ring conformation and its N-terminal entry gate appears closed, but in ADP binding, it switches to a lock-washer conformation and its N-terminal gate opens, which is accompanied by a rearrangement of the N-terminal domain. We have also found that both the enzymatic activities and the 3D structure of a hLon mutant lacking the first 156 amino acids are severely disturbed, showing that hLon’s N-terminal domains are crucial for the overall structure of the hLon, maintaining a conformation allowing its proper functioning. PMID:27632940

  4. Mutant alcohol dehydrogenase (ADH III) presequences that affect both in vitro mitochondrial import and in vitro processing by the matrix protease.

    PubMed Central

    Mooney, D T; Pilgrim, D B; Young, E T

    1990-01-01

    Point mutations in the presequence of the mitochondrial alcohol dehydrogerase isoenzyme (ADH III) have been shown to affect either the import of the precursor protein into yeast mitochondria in vivo or its processing within the organelle. In the present work, the behavior of these mutants during in vitro import into isolated mitochondria was investigated. All point mutants tested were imported with a slower initial rate than that of the wild-type precursor. This defect was corrected when the precursors were treated with urea prior to import. Once imported, the extent of processing to the mature form of mutant precursors varied greatly and correlated well with the defects observed in vivo. This result was not affected by prior urea treatment. When matrix extracts enriched for the processing protease were used, this defect was shown to be due to failure of the protease to efficiently recognize or cleave the presequence, rather than to a lack of access to the precursor. The rate of import of two ADH III precursors bearing internal deletions in the leader sequence was similar to those of the point mutants, whereas a deletion leading to the removal of the 15 amino-terminal amino acids was poorly imported. The mature amino terminus of wild-type ADH III was determined to be Gln-25. Mutant m01 (Ser-26 to Phe), which reduced the efficiency of cleavage in vitro by 80%, was cleaved at the correct site. Images PMID:2188098

  5. Recombinant Mitochondrial Transcription Factor A with N-terminal Mitochondrial Transduction Domain Increases Respiration and Mitochondrial Gene Expression

    PubMed Central

    Iyer, Shilpa; Thomas, Ravindar R.; Portell, Francisco R.; Dunham, Lisa D.; Quigley, Caitlin K.; Bennett, James P.

    2009-01-01

    We developed a scalable procedure to produce human mitochondrial transcription factor A (TFAM) modified with an N-terminal protein transduction domain (PTD) and mitochondrial localization signal (MLS) that allow it to cross membranes and enter mitochondria through its “mitochondrial transduction domain” (MTD=PTD+MLS). Alexa488-labeled MTD-TFAM rapidly entered the mitochondrial compartment of cybrid cells carrying the G11778A LHON mutation. MTD-TFAM reversibly increased respiration and levels of respiratory proteins. In vivo treatment of mice with MTD-TFAM increased motor endurance and complex I-driven respiration in mitochondria from brain and skeletal muscle. MTD-TFAM increases mitochondrial bioenergetics and holds promise for treatment of mitochondrial diseases involving deficiencies of energy production. PMID:19460293

  6. Proliferation of mitochondria in chronically stimulated rabbit skeletal muscle--transcription of mitochondrial genes and copy number of mitochondrial DNA.

    PubMed

    Schultz, J; Wiesner, R J

    2000-12-01

    Mitochondrial proliferation was studied in chronically stimulated rabbit skeletal muscle over a period of 50 days. After this time, subunits of COX had increased about fourfold. Corresponding mRNAs, encoded on mitochondrial DNA as well as on nuclear genes, were unchanged when related to total tissue RNA, however, they were elevated two- to fivefold when the massive increase of ribosomes per unit mass of muscle was taken into account. The same was true for the mRNA encoding mitochondrial transcription factor A. Surprisingly, tissue levels of mtTFA protein were reduced about twofold, together with mitochondrial DNA. In conclusion, mitochondria are able to maintain high rates of mitochondrial transcription even in the presence of reduced mtTFA protein and mtDNA levels. Therefore, stimulated mtTFA gene expression accompanies stimulated mitochondrial transcription, as in other models, but it is not sufficient for an increase of mtDNA copy number and other, yet unknown, factors have to be postulated.

  7. Physella acuta: atypical mitochondrial gene order among panpulmonates (Gastropoda)

    PubMed Central

    Nolan, Journey R.; Bergthorsson, Ulfar; Adema, Coen M.

    2014-01-01

    Mitochondrial (mt) sequences are frequently used for phylogenetic reconstruction and for identification of species of molluscs. This study expands the phylogenetic range of Hygrophila (Panpulmonata) for which such sequence data are available by characterizing the full mt genome of the invasive freshwater snail Physella acuta (Physidae). The mt genome sequences of two P. acuta isolates from Stubblefield Lake, New Mexico, USA, differed in length (14,490 vs 14,314 bp) and showed 11.49% sequence divergence, whereas ITS1 and ITS2 sequences from the nuclear genome differed by 1.75%. The mt gene order of P. acuta (cox1, P, nad6, nad5, nad1, D, F, cox2, Y, W, nad4L, C, Q, atp6, R, E, rrnS, M, T, cox3, I, nad2, K, V, rrnL, L1, A, cytb, G, H, L2, atp8, N, nad2, S1, S2, nad4) differs considerably from the relatively conserved gene order within Panpulmonata. Phylogenetic trees show that the 13 protein-encoding mt gene sequences (equivalent codons) of P. acuta group according to gastropod phylogeny, yet branch lengths and dN/dS ratios for P. acuta indicate elevated amino acid substitutions relative to other gastropods. This study indicates that mt sequences of P. acuta are phylogenetically informative despite a considerable intraspecific divergence and the atypical gene order in its mt genome. PMID:25368439

  8. Physella acuta: atypical mitochondrial gene order among panpulmonates (Gastropoda).

    PubMed

    Nolan, Journey R; Bergthorsson, Ulfar; Adema, Coen M

    2014-11-01

    Mitochondrial (mt) sequences are frequently used for phylogenetic reconstruction and for identification of species of molluscs. This study expands the phylogenetic range of Hygrophila (Panpulmonata) for which such sequence data are available by characterizing the full mt genome of the invasive freshwater snail Physella acuta (Physidae). The mt genome sequences of two P. acuta isolates from Stubblefield Lake, New Mexico, USA, differed in length (14,490 vs 14,314 bp) and showed 11.49% sequence divergence, whereas ITS1 and ITS2 sequences from the nuclear genome differed by 1.75%. The mt gene order of P. acuta (cox1, P, nad6, nad5, nad1, D, F, cox2, Y, W, nad4L, C, Q, atp6, R, E, rrnS, M, T, cox3, I, nad2, K, V, rrnL, L1, A, cytb, G, H, L2, atp8, N, nad2, S1, S2, nad4) differs considerably from the relatively conserved gene order within Panpulmonata. Phylogenetic trees show that the 13 protein-encoding mt gene sequences (equivalent codons) of P. acuta group according to gastropod phylogeny, yet branch lengths and dN/dS ratios for P. acuta indicate elevated amino acid substitutions relative to other gastropods. This study indicates that mt sequences of P. acuta are phylogenetically informative despite a considerable intraspecific divergence and the atypical gene order in its mt genome.

  9. Mitochondrial bioenergetics and redox state are unaltered in Trypanosoma cruzi isolates with compromised mitochondrial complex I subunit genes.

    PubMed

    Carranza, Julio César; Kowaltowski, Alicia J; Mendonça, Marco Aurélio G; de Oliveira, Thays C; Gadelha, Fernanda R; Zingales, Bianca

    2009-06-01

    In trypanosomatids the involvement of mitochondrial complex I in NADH oxidation has long been debated. Here, we took advantage of natural Trypanosoma cruzi mutants which present conspicuous deletions in ND4, ND5 and ND7 genes coding for complex I subunits to further investigate its functionality. Mitochondrial bioenergetics of wild type and complex I mutants showed no significant differences in oxygen consumption or respiratory control ratios in the presence of NADH-linked substrates or FADH(2)-generating succinate. No correlation could be established between mitochondrial membrane potentials and ND deletions. Since release of reactive oxygen species occurs at complex I, we measured mitochondrial H(2)O(2) formation induced by different substrates. Significant differences not associated to ND deletions were observed among the parasite isolates, demonstrating that these mutations are not important for the control of oxidant production. Our data support the notion that complex I has a limited function in T. cruzi.

  10. Transcriptional activation of the human cytotoxic serine protease gene CSP-B in T lymphocytes.

    PubMed Central

    Hanson, R D; Ley, T J

    1990-01-01

    The cytotoxic serine protease B (CSP-B) gene is activated during cytotoxic T-lymphocyte maturation. In this report, we demonstrate that the PEER T-cell line (bearing gamma/delta T-cell receptors) accumulates CSP-B mRNA following exposure to 12-O-tetradecanoylphorbol-13-acetate (TPA) and N6-2'-O-dibutyryladenosine 3',5'-cyclic monophosphate (bt2cAMP) because of transcriptional activation of the CSP-B gene. TPA and bt2cAMP act synergistically to induce CSP-B expression, since neither agent alone causes activation of CSP-B transcription or mRNA accumulation. Chromatin upstream from the CSP-B gene is resistant to DNase I digestion in untreated PEER cells, but becomes sensitive following TPA-bt2cAMP treatment. Upon activation of PEER cells, a DNase I-hypersensitive site forms upstream from the CSP-B gene within a region that is highly conserved in the mouse. Transient transfection of CSP-B promoter constructs identified two regulatory regions in the CSP-B 5'-flanking sequence, located at positions -609 to -202 and positions -202 to -80. The region from -615 to -63 is sufficient to activate a heterologous promoter in activated PEER cells, but activation is orientation specific, suggesting that this region behaves as an upstream promoter element rather than a classical enhancer. Consensus AP-1, AP-2, and cAMP response elements are found upstream from the CSP-B gene (as are several T-cell-specific consensus elements), but the roles of these elements in CSP-B gene activation have yet to be determined. Images PMID:2233710

  11. Disruption of genes involved in CORVET complex leads to enhanced secretion of heterologous carboxylesterase only in protease deficient Pichia pastoris.

    PubMed

    Marsalek, Lukas; Gruber, Clemens; Altmann, Friedrich; Aleschko, Markus; Mattanovich, Diethard; Gasser, Brigitte; Puxbaum, Verena

    2017-02-23

    The methylotrophic yeast Pichia pastoris (Komagataella spp.) is a popular microbial host for the production of recombinant proteins. Previous studies have shown that mis-sorting to the vacuole can be a bottleneck during production of recombinant secretory proteins in yeast, however, no information was available for P. pastoris. In this work the authors have therefore generated vps (vacuolar protein sorting) mutant strains disrupted in genes involved in the CORVET (class C core vacuole/endosome tethering) complex at the early stages of endosomal sorting. Both Δvps8 and Δvps21 strains contained lower extracellular amounts of heterologous carboxylesterase (CES) compared to the control strain, which could be attributed to a high proteolytic activity present in the supernatants of CORVET engineered strains due to rerouting of vacuolar proteases. Serine proteases were identified to be responsible for this proteolytic degradation by liquid chromatography-mass spectrometry and protease inhibitor assays. Deletion of the major cellular serine protease Prb1 in Δvps8 and Δvps21 strains did not only rescue the extracellular CES levels, but even outperformed the parental CES strain (56 and 80% higher yields, respectively). Further deletion of Ybr139W, another serine protease, did not show a further increase in secretion levels. Higher extracellular CES activity and low proteolytic activity were detected also in fed batch cultivation of Δvps21Δprb1 strains, thus confirming that modifying early steps in the vacuolar pathway has a positive impact on heterologous protein secretion.

  12. Protease-activated receptor-2 induces proinflammatory cytokine and chemokine gene expression in canine keratinocytes.

    PubMed

    Maeda, Shingo; Maeda, Sadatoshi; Ohno, Koichi; Kaji, Noriyuki; Hori, Masatoshi; Fujino, Yasuhito; Tsujimoto, Hajime

    2013-05-15

    Although the molecular basis of the allergenicity remains to be fully elucidated, the ability of allergens to elicit allergic responses is at least partly attributed to their proteolytic activity. Protease-activated receptor-2 (PAR-2) is a G protein-coupled receptor that is activated by site-specific proteolysis by serine proteases and is known to mediate inflammatory processes in various tissues. In this study, we investigated the effects of trypsin, a major serine protease, and a human PAR-2 agonist peptide (SLIGKV-NH2) on proinflammatory cytokine and chemokine gene expression in the canine keratinocyte cell line CPEK. The expression of PAR-2 mRNA and protein in CPEK cells was detected by RT-PCR and Western blotting, respectively. The localization of PAR-2 in CPEK was examined by immunofluorescence. The mRNA expression levels of proinflammatory cytokines and chemokines were quantified by real-time RT-PCR. The free intracellular Ca(2+) concentration was measured using the Ca(2+)-sensitive fluorescent dye. CPEK cells constitutively expressed PAR-2 mRNA and protein. Stimulation of CPEK cells with trypsin induced significant upregulation of the mRNA expression levels of tumor necrosis factor alpha (TNF-α, P<0.05), granulocyte-macrophage colony-stimulating factor (GM-CSF, P<0.01), thymus and activation regulated chemokine (TARC/CCL17, P<0.01), and interleukin 8 (IL-8/CXCL8, P<0.01). Similarly, the PAR-2 agonist peptide increased the mRNA expression levels of TNF-α (P<0.05), GM-CSF (P<0.05), TARC/CCL17 (P<0.05), and IL-8/CXCL8 (P<0.05) in CPEK cells. Both trypsin and the PAR-2 agonist peptide increased the intracellular Ca(2+) concentration and PAR-2 internalization. These results suggest that PAR-2 activation can augment inflammatory cytokine and chemokine expression in canine keratinocytes, and it may initiate allergic inflammation through the proteolytic activity of allergens in canine atopic dermatitis. Copyright © 2013 Elsevier B.V. All rights reserved.

  13. Effects of Enterococcus faecalis fsr genes on production of gelatinase and a serine protease and virulence.

    PubMed

    Qin, X; Singh, K V; Weinstock, G M; Murray, B E

    2000-05-01

    Three agr-like genes (fsrA, fsrB, and fsrC, for Enterococcus faecalis regulator) were found upstream of the previously reported gelatinase gene (gelE) and a downstream putative serine protease gene (sprE; accession number Z12296) of Enterococcus faecalis OG1RF. The deduced amino acid sequence of fsrA shows 26% identity and 38% similarity to Staphylococcus aureus AgrA (the response regulator of the accessory gene regulator system in the agr locus), FsrB shows 23% identity and 41% similarity to S. aureus AgrB, and FsrC shows 23% identity and 36% similarity to S. aureus AgrC (the sensor transducer of Agr system). Northern blot analysis suggested that gelE and sprE are cotranscribed and that fsrB and fsrC are also cotranscribed in OG1RF. Northern blot analysis of fsrA, fsrB, fsrC, gelE, and sprE insertion mutants showed that fsrB, fsrC, gelE, and sprE are not expressed in fsrA, fsrB, and fsrC mutants, while insertion in an open reading frame further upstream of fsrA did not effect the expression of these genes, suggesting that agr-like genes may be autoregulated and that they regulate gelE and sprE expression, as further confirmed by complementation of fsr gene mutations with a 6-kb fragment which contains all three fsr genes in the shuttle vector, pAT18. Testing of 95 other isolates of E. faecalis showed that 62% produced gelatinase (Gel(+)), while 91% (including all Gel(+) strains) hybridized to a gelE probe; 71% (including all Gel(+) strains) hybridized to an fsr probe, corroborating the conclusion that both gelE and fsr are necessary for gelatinase production. Testing of fsrA, fsrB, and sprE mutants in a mouse peritonitis model showed that sprE and agr-like gene mutants resulted in highly significantly prolonged survival compared to the parent strain OG1RF, a finding similar to what we had previously shown for a gelE mutant. These results suggest that sprE and agr-like genes contribute to the virulence of E. faecalis OG1RF in this model.

  14. Novel zinc protease gene isolated from Dictyostelium discoideum is structurally related to mammalian leukotriene A4 hydrolase.

    PubMed

    Fan, D; Hou, L S

    2015-12-09

    The allantoicase (allC) gene of Dictyostelium discoideum allC RNAi mutant strain was silenced using the RNA interference technique. The mutant strain is motile, aggregated, and could not undergo further morphological development. The growth rate is high and the cells show a shortened cell cycle comparing with wild-type D. discoideum. However, the mechanisms regarding these actions remain unclear. mRNA differential display was used in this study to identify genetic differences. A novel D. discoideum gene (GenBank accession number: KC759140) encoding a new zinc protease was cloned. The amino acid sequence of the novel gene exhibited a conserved zinc-binding domain (HEX2HX18E) that allowed its classification into the M1 family of metallopeptidases. The gene encoded a 345-amino acid protein with a theoretical molecular mass of 39.69 kDa and a theoretical pI of 6.05. This protein showed strong homology with leukotriene A4 (LTA4) hydrolase of Homo sapiens (41% identity and 60% similarity at the amino acid level). By analyzing quantitative reverse transcription-polymerase chain reaction data, this zinc protease gene was more highly expressed in D. discoideum allC RNAi mutant type than in wild-type KAx-3 cells during the trophophase. The novel zinc protease gene may function as an LTA4 hydrolase and contribute to the shortening of the allC RNAi mutant cell cycle.

  15. Gene trees reveal repeated instances of mitochondrial DNA introgression in orangethroat darters (percidae: etheostoma).

    PubMed

    Bossu, Christen M; Near, Thomas J

    2009-02-01

    Phylogenies of closely related animal species are often inferred using mitochondrial DNA (mtDNA) gene sequences. The accuracy of mtDNA gene trees is compromised through hybridization that leads to introgression of mitochondrial genomes. Using DNA sequences from 6 single-copy nuclear genes and 2 regions of the mitochondrial genome, we investigated the temporal and geographic signature of mitochondrial and nuclear introgression in the Etheostoma spectabile darter clade. Phylogenetic analyses of the nuclear genes result in the monophyly of the E. spectabile clade; however, with respect to sampled specimens of 5 species (Etheostoma fragi, Etheostoma uniporum, Etheostoma pulchellum, Etheostoma burri, and E. spectabile), the mitochondrial phylogeny is inconsistent with E. spectabile clade monophyly. Etheostoma uniporum and E. fragi are both fixed for heterospecific mitochondrial genomes. Limited nuclear introgression is restricted to E. uniporum. Our analyses show that the pattern of introgression is consistently asymmetric, with movement of heterospecific mitochondrial haplotypes and nuclear alleles into E. spectabile clade species; introgressive hybridization spans broad temporal scales; and introgression is restricted to species and populations in the Ozarks. The introgressed mitochondrial genome observed in E. fragi has an obscure phylogenetic placement among darters, an ancient age, and is possibly a mitochondrial fossil from an Etheostoma species that has subsequently gone extinct. These results indicate that introgression, both ancient and more contemporaneous, characterizes the history of diversification in the E. spectabile species clade and may be relatively common among clades comprising the species-rich North American freshwater fauna.

  16. Genes of the Mitochondrial Apoptotic Pathway in Mytilus galloprovincialis

    PubMed Central

    Figueras, Antonio; Novoa, Beatriz

    2013-01-01

    Bivalves play vital roles in marine, brackish, freshwater and terrestrial habitats. In recent years, these ecosystems have become affected through anthropogenic activities. The ecological success of marine bivalves is based on the ability to modify their physiological functions in response to environmental changes. One of the most important mechanisms involved in adaptive responses to environmental and biological stresses is apoptosis, which has been scarcely studied in mollusks, although the final consequence of this process, DNA fragmentation, has been frequently used for pollution monitoring. Environmental stressors induce apoptosis in molluscan cells via an intrinsic pathway. Many of the proteins involved in vertebrate apoptosis have been recognized in model invertebrates; however, this process might not be universally conserved. Mytilus galloprovincialis is presented here as a new model to study the linkage between molecular mechanisms that mediate apoptosis and marine bivalve ecological adaptations. Therefore, it is strictly necessary to identify the key elements involved in bivalve apoptosis. In the present study, six mitochondrial apoptotic-related genes were characterized, and their gene expression profiles following UV irradiation were evaluated. This is the first step for the development of potential biomarkers to assess the biological responses of marine organisms to stress. The results confirmed that apoptosis and, more specifically, the expression of the genes involved in this process can be used to assess the biological responses of marine organisms to stress. PMID:23626691

  17. Identification and Partial Characterization of Extracellular Aspartic Protease Genes from Metschnikowia pulcherrima IWBT Y1123 and Candida apicola IWBT Y1384

    PubMed Central

    Reid, Vernita J.; Theron, Louwrens W.; du Toit, Maret

    2012-01-01

    The extracellular acid proteases of non-Saccharomyces wine yeasts may fulfill a number of roles in winemaking, which include increasing the available nitrogen sources for the growth of fermentative microbes, affecting the aroma profile of the wine, and potentially reducing protein haze formation. These proteases, however, remain poorly characterized, especially at genetic level. In this study, two extracellular aspartic protease-encoding genes were identified and sequenced, from two yeast species of enological origin: one gene from Metschnikowia pulcherrima IWBT Y1123, named MpAPr1, and the other gene from Candida apicola IWBT Y1384, named CaAPr1. In silico analysis of these two genes revealed a number of features peculiar to aspartic protease genes, and both the MpAPr1 and CaAPr1 putative proteins showed homology to proteases of yeast genera. Heterologous expression of MpAPr1 in Saccharomyces cerevisiae YHUM272 confirmed that it encodes an aspartic protease. MpAPr1 production, which was shown to be constitutive, and secretion were confirmed in the presence of bovine serum albumin (BSA), casein, and grape juice proteins. The MpAPr1 gene was found to be present in 12 other M. pulcherrima strains; however, plate assays revealed that the intensity of protease activity was strain dependent and unrelated to the gene sequence. PMID:22820332

  18. Identification and partial characterization of extracellular aspartic protease genes from Metschnikowia pulcherrima IWBT Y1123 and Candida apicola IWBT Y1384.

    PubMed

    Reid, Vernita J; Theron, Louwrens W; du Toit, Maret; Divol, Benoit

    2012-10-01

    The extracellular acid proteases of non-Saccharomyces wine yeasts may fulfill a number of roles in winemaking, which include increasing the available nitrogen sources for the growth of fermentative microbes, affecting the aroma profile of the wine, and potentially reducing protein haze formation. These proteases, however, remain poorly characterized, especially at genetic level. In this study, two extracellular aspartic protease-encoding genes were identified and sequenced, from two yeast species of enological origin: one gene from Metschnikowia pulcherrima IWBT Y1123, named MpAPr1, and the other gene from Candida apicola IWBT Y1384, named CaAPr1. In silico analysis of these two genes revealed a number of features peculiar to aspartic protease genes, and both the MpAPr1 and CaAPr1 putative proteins showed homology to proteases of yeast genera. Heterologous expression of MpAPr1 in Saccharomyces cerevisiae YHUM272 confirmed that it encodes an aspartic protease. MpAPr1 production, which was shown to be constitutive, and secretion were confirmed in the presence of bovine serum albumin (BSA), casein, and grape juice proteins. The MpAPr1 gene was found to be present in 12 other M. pulcherrima strains; however, plate assays revealed that the intensity of protease activity was strain dependent and unrelated to the gene sequence.

  19. A novel mitochondrial ATP8 gene mutation in a patient with apical hypertrophic cardiomyopathy and neuropathy

    PubMed Central

    Jonckheere, An I; Hogeveen, Marije; Nijtmans, Leo; van den Brand, Mariel; Janssen, Antoon; Diepstra, Heleen; van den Brandt, Frans; van den Heuvel, Bert; Hol, Frans; Hofste, Tom; Kapusta, Livia; Dillmann, U; Shamdeen, M; Smeitink, J; Smeitink, J; Rodenburg, Richard

    2009-01-01

    To identify the biochemical and molecular genetic defect in a 16-year-old patient presenting with apical hypertrophic cardiomyopathy and neuropathy suspected for a mitochondrial disorder. Measurement of the mitochondrial energy-generating system (MEGS) capacity in muscle and enzyme analysis in muscle and fibroblasts were performed. Relevant parts of the mitochondrial DNA were analysed by sequencing. A homoplasmic nonsense mutation m.8529G→A (p.Trp55X) was found in the mitochondrial ATP8 gene in the patient’s fibroblasts and muscle tissue. Reduced complex V activity was measured in the patient’s fibroblasts and muscle tissue, and was confirmed in cybrid clones containing patient-derived mitochondrial DNA We describe the first pathogenic mutation in the mitochondrial ATP8 gene, resulting in an improper assembly and reduced activity of the complex V holoenzyme. PMID:21686774

  20. Mosaic-like organization of IgA protease genes in Neisseria gonorrhoeae generated by horizontal genetic exchange in vivo.

    PubMed Central

    Halter, R; Pohlner, J; Meyer, T F

    1989-01-01

    IgA protease is a putative virulence factor that exists in several allelic forms in Neisseria gonorrhoeae. However, extracellular secretion of these variant IgA proteases occurs by the same pathway involving three steps of autoproteolytic maturation from a large precursor. Two principal precursor types (H1 and H2) can be distinguished with respect to the location of autoproteolytic sites and the sizes of the mature products. By partial DNA sequence analysis, additional variations have been detected which are not unique to one particular gene; rather, otherwise unrelated iga genes often share homology, thus revealing a composite organization. In the context of other gonococcal features, this observation implies that recombination has occurred in vivo between iga genes of different strains, probably via the route of species-specific DNA transformation. This process may be of general significance for the modulation and the natural exchange of virulence properties among pathogenic Neisseriae. Images PMID:2511009

  1. Crystal structure of the caseinolytic protease gene regulator, a transcriptional activator in actinomycetes.

    PubMed

    Russo, Santina; Schweitzer, Jens-Eric; Polen, Tino; Bott, Michael; Pohl, Ehmke

    2009-02-20

    Human pathogens of the genera Corynebacterium and Mycobacterium possess the transcriptional activator ClgR (clp gene regulator) which in Corynebacterium glutamicum has been shown to regulate the expression of the ClpCP protease genes. ClgR specifically binds to pseudo-palindromic operator regions upstream of clpC and clpP1P2. Here, we present the first crystal structure of a ClgR protein from C. glutamicum. The structure was determined from two different crystal forms to resolutions of 1.75 and 2.05 A, respectively. ClgR folds into a five-helix bundle with a helix-turn-helix motif typical for DNA-binding proteins. Upon dimerization the two DNA-recognition helices are arranged opposite to each other at the protein surface in a distance of approximately 30 A, which suggests that they bind into two adjacent major grooves of B-DNA in an anti-parallel manner. A binding pocket is situated at a strategic position in the dimer interface and could possess a regulatory role altering the positions of the DNA-binding helices.

  2. A complete mitochondrial genome of wheat (Triticum aestivum cv. Chinese Yumai), and fast evolving mitochondrial genes in higher plants.

    PubMed

    Cui, Peng; Liu, Huitao; Lin, Qiang; Ding, Feng; Zhuo, Guoyin; Hu, Songnian; Liu, Dongcheng; Yang, Wenlong; Zhan, Kehui; Zhang, Aimin; Yu, Jun

    2009-12-01

    Plant mitochondrial genomes, encoding necessary proteins involved in the system of energy production, play an important role in the development and reproduction of the plant. They occupy a specific evolutionary pattern relative to their nuclear counterparts. Here, we determined the winter wheat (Triticum aestivum cv. Chinese Yumai) mitochondrial genome in a length of 452 and 526 bp by shotgun sequencing its BAC library. It contains 202 genes, including 35 known protein-coding genes, three rRNA and 17 tRNA genes, as well as 149 open reading frames (ORFs; greater than 300 bp in length). The sequence is almost identical to the previously reported sequence of the spring wheat (T. aestivum cv. Chinese Spring); we only identified seven SNPs (three transitions and four transversions) and 10 indels (insertions and deletions) between the two independently acquired sequences, and all variations were found in non-coding regions. This result confirmed the accuracy of the previously reported mitochondrial sequence of the Chinese Spring wheat. The nucleotide frequency and codon usage of wheat are common among the lineage of higher plant with a high AT-content of 58%. Molecular evolutionary analysis demonstrated that plant mitochondrial genomes evolved at different rates, which may correlate with substantial variations in metabolic rate and generation time among plant lineages. In addition, through the estimation of the ratio of non-synonymous to synonymous substitution rates between orthologous mitochondrion-encoded genes of higher plants, we found an accelerated evolutionary rate that seems to be the result of relaxed selection.

  3. The Aspergillus nidulans xprF gene encodes a hexokinase-like protein involved in the regulation of extracellular proteases.

    PubMed Central

    Katz, M E; Masoumi, A; Burrows, S R; Shirtliff, C G; Cheetham, B F

    2000-01-01

    The extracellular proteases of Aspergillus nidulans are produced in response to limitation of carbon, nitrogen, or sulfur, even in the absence of exogenous protein. Mutations in the A. nidulans xprF and xprG genes have been shown to result in elevated levels of extracellular protease in response to carbon limitation. The xprF gene was isolated and sequence analysis indicates that it encodes a 615-amino-acid protein, which represents a new type of fungal hexokinase or hexokinase-like protein. In addition to their catalytic role, hexokinases are thought to be involved in triggering carbon catabolite repression. Sequence analysis of the xprF1 and xprF2 alleles showed that both alleles contain nonsense mutations. No loss of glucose or fructose phosphorylating activity was detected in xprF1 or xprF2 mutants. There are two possible explanations for this observation: (1) the xprF gene may encode a minor hexokinase or (2) the xprF gene may encode a protein with no hexose phosphorylating activity. Genetic evidence suggests that the xprF and xprG genes are involved in the same regulatory pathway. Support for this hypothesis was provided by the identification of a new class of xprG(-) mutation that suppresses the xprF1 mutation and results in a protease-deficient phenotype. PMID:11102357

  4. Gene identification and molecular characterization of solvent stable protease from a moderately haloalkaliphilic bacterium, Geomicrobium sp. EMB2.

    PubMed

    Karan, Ram; Singh, Raj Kumar Mohan; Kapoor, Sanjay; Khare, S K

    2011-02-01

    Cloning and characterization of the gene encoding a solvent-tolerant protease from the haloalkaliphilic bacterium Geomicrobium sp. EMB2 are described. Primers designed based on the N-terminal amino acid sequence of the purified EMB2 protease helped in the amplification of a 1,505-bp open reading frame that had a coding potential of a 42.7-kDa polypeptide. The deduced EMB2 protein contained a 35.4-kDa mature protein of 311 residues, with a high proportion of acidic amino acid residues. Phylogenetic analysis placed the EMB2 gene close to a known serine protease from Bacillus clausii KSM-K16. Primary sequence analysis indicated a hydrophobic inclination of the protein; and the 3D structure modeling elucidated a relatively higher percentage of small (glycine, alanine, and valine) and borderline (serine and threonine) hydrophobic residues on its surface. The structure analysis also highlighted enrichment of acidic residues at the cost of basic residues. The study indicated that solvent and salt stabilities in Geomicrobium sp. protease may be accorded to different structural features; that is, the presence of a number of small hydrophobic amino acid residues on the surface and a higher content of acidic amino acid residues, respectively.

  5. Dietary fatty acids affect mitochondrial phospholipid compositions and mitochondrial gene expression of rainbow trout liver at different ages.

    PubMed

    Almaida-Pagán, P F; De Santis, C; Rubio-Mejía, O L; Tocher, D R

    2015-01-01

    Mitochondria are among the first responders to various stressors that challenge the homeostasis of cells and organisms. Mitochondrial decay is generally associated with impairment in the organelle bioenergetics function and increased oxidative stress, and it appears that deterioration of mitochondrial inner membrane phospholipids (PL), particularly cardiolipin (CL), and accumulation of mitochondrial DNA (mtDNA) mutations are among the main mechanisms involved in this process. In the present study, liver mitochondrial membrane PL compositions, lipid peroxidation, and mtDNA gene expression were analyzed in rainbow trout fed three diets with the same base formulation but with lipid supplied either by fish oil (FO), rapeseed oil (RO), or high DHA oil (DHA) during 6 weeks. Specifically, two feeding trials were performed using fish from the same population of two ages (1 and 3 years), and PL class compositions of liver mitochondria, fatty acid composition of individual PL classes, TBARS content, and mtDNA expression were determined. Dietary fatty acid composition strongly affected mitochondrial membrane composition from trout liver but observed changes did not fully reflect the diet, particularly when it contained high DHA. The changes were PL specific, CL being particularly resistant to changes in DHA. Some significant differences observed in expression of mtDNA with diet may suggest long-term dietary effects in mitochondrial gene expression which could affect electron transport chain function. All the changes were influenced by fish age, which could be related to the different growth rates observed between 1- and 3-year-old trout but that could also indicate age-related changes in the ability to maintain structural homeostasis of mitochondrial membranes.

  6. Restoration of Mitochondrial Gene Expression Using a Cloned Human Gene in Chinese Hamster Lung Cell Mutant

    PubMed Central

    Sherif, Zaki A; Broome, Carolyn W

    2015-01-01

    Background Gal−32 is a Chinese hamster lung cell nuclear mutant that is unable to grow in galactose due to a defect in mitochondrial protein synthesis. Since the product of the Gal−32 gene was unknown, it was imperative to use phenotypic complementation to clone a human gene that corrected the Gal−32 mutation. Results Recessive Gal−32 cells were co-transformed with pSV2-neo plasmid DNA and recombinant DNA from a human genomic library containing the dominant human Gal+ gene and a chloramphenicol-resistance (camr) gene present in the pSV13 vector. Primary transformants were selected by growth in galactose and the neomycin analog G418. In order to rescue the human Gal+ gene, a genomic library was constructed with primary transformant DNA and the pCV108 cosmid vector. The camr gene was used to identify clones with the nearby human sequences. DNA from two camr, Alu-hybridizing clones was able to transform the recessive Gal−32 cells to the Gal+ phenotype and to restore mitochondrial protein synthesis. Conclusion These data demonstrate the isolation of two pCV108-transformant recombinant clones containing a human gene that complements the Chinese hamster Gal−32 mutation and restores galactose metabolism. PMID:26052559

  7. Type II Transmembrane Serine Protease Gene Variants Associate with Breast Cancer

    PubMed Central

    Luostari, Kaisa; Hartikainen, Jaana M.; Tengström, Maria; Palvimo, Jorma J.; Kataja, Vesa

    2014-01-01

    Type II transmembrane serine proteases (TTSPs) are related to tumor growth, invasion, and metastasis in cancer. Genetic variants in these genes may alter their function, leading to cancer onset and progression, and affect patient outcome. Here, 464 breast cancer cases and 370 controls were genotyped for 82 single-nucleotide polymorphisms covering eight genes. Association of the genotypes was estimated against breast cancer risk, breast cancer–specific survival, and survival in different treatment groups, and clinicopathological variables. SNPs in TMPRSS3 (rs3814903 and rs11203200), TMPRSS7 (rs1844925), and HGF (rs5745752) associated significantly with breast cancer risk (Ptrend = 0.008–0.042). SNPs in TMPRSS1 (rs12151195 and rs12461158), TMPRSS2 (rs2276205), TMPRSS3 (rs3814903), and TMPRSS7 (rs2399403) associated with prognosis (P = 0.004–0.046). When estimating the combined effect of the variants, the risk of breast cancer was higher with 4–5 alleles present compared to 0–2 alleles (P = 0.0001; OR, 2.34; 95% CI, 1.39–3.94). Women with 6–8 survival-associating alleles had a 3.3 times higher risk of dying of breast cancer compared to women with 1–3 alleles (P = 0.001; HR, 3.30; 95% CI, 1.58–6.88). The results demonstrate the combined effect of variants in TTSPs and their related genes in breast cancer risk and patient outcome. Functional analysis of these variants will lead to further understanding of this gene family, which may improve individualized risk estimation and development of new strategies for treatment of breast cancer. PMID:25029565

  8. Rapidly Evolving Mitochondrial Genome and Directional Selection in Mitochondrial Genes in the Parasitic Wasp Nasonia (Hymenoptera: Pteromalidae)

    PubMed Central

    Raychoudhury, Rhitoban; Lavrov, Dennis V.; Werren, John H.

    2008-01-01

    We sequenced the nearly complete mtDNA of 3 species of parasitic wasps, Nasonia vitripennis (2 strains), Nasonia giraulti, and Nasonia longicornis, including all 13 protein-coding genes and the 2 rRNAs, and found unusual patterns of mitochondrial evolution. The Nasonia mtDNA has a unique gene order compared with other insect mtDNAs due to multiple rearrangements. The mtDNAs of these wasps also show nucleotide substitution rates over 30 times faster than nuclear protein-coding genes, indicating among the highest substitution rates found in animal mitochondria (normally <10 times faster). A McDonald and Kreitman test shows that the between-species frequency of fixed replacement sites relative to silent sites is significantly higher compared with within-species polymorphisms in 2 mitochondrial genes of Nasonia, atp6 and atp8, indicating directional selection. Consistent with this interpretation, the Ka/Ks (nonsynonymous/synonymous substitution rates) ratios are higher between species than within species. In contrast, cox1 shows a signature of purifying selection for amino acid sequence conservation, although rates of amino acid substitutions are still higher than for comparable insects. The mitochondrial-encoded polypeptides atp6 and atp8 both occur in F0F1ATP synthase of the electron transport chain. Because malfunction in this fundamental protein severely affects fitness, we suggest that the accelerated accumulation of replacements is due to beneficial mutations necessary to compensate mild-deleterious mutations fixed by random genetic drift or Wolbachia sweeps in the fast evolving mitochondria of Nasonia. We further propose that relatively high rates of amino acid substitution in some mitochondrial genes can be driven by a “Compensation-Draft Feedback”; increased fixation of mildly deleterious mutations results in selection for compensatory mutations, which lead to fixation of additional deleterious mutations in nonrecombining mitochondrial genomes, thus

  9. Rapidly evolving mitochondrial genome and directional selection in mitochondrial genes in the parasitic wasp nasonia (hymenoptera: pteromalidae).

    PubMed

    Oliveira, Deodoro C S G; Raychoudhury, Rhitoban; Lavrov, Dennis V; Werren, John H

    2008-10-01

    We sequenced the nearly complete mtDNA of 3 species of parasitic wasps, Nasonia vitripennis (2 strains), Nasonia giraulti, and Nasonia longicornis, including all 13 protein-coding genes and the 2 rRNAs, and found unusual patterns of mitochondrial evolution. The Nasonia mtDNA has a unique gene order compared with other insect mtDNAs due to multiple rearrangements. The mtDNAs of these wasps also show nucleotide substitution rates over 30 times faster than nuclear protein-coding genes, indicating among the highest substitution rates found in animal mitochondria (normally <10 times faster). A McDonald and Kreitman test shows that the between-species frequency of fixed replacement sites relative to silent sites is significantly higher compared with within-species polymorphisms in 2 mitochondrial genes of Nasonia, atp6 and atp8, indicating directional selection. Consistent with this interpretation, the Ka/Ks (nonsynonymous/synonymous substitution rates) ratios are higher between species than within species. In contrast, cox1 shows a signature of purifying selection for amino acid sequence conservation, although rates of amino acid substitutions are still higher than for comparable insects. The mitochondrial-encoded polypeptides atp6 and atp8 both occur in F0F1ATP synthase of the electron transport chain. Because malfunction in this fundamental protein severely affects fitness, we suggest that the accelerated accumulation of replacements is due to beneficial mutations necessary to compensate mild-deleterious mutations fixed by random genetic drift or Wolbachia sweeps in the fast evolving mitochondria of Nasonia. We further propose that relatively high rates of amino acid substitution in some mitochondrial genes can be driven by a "Compensation-Draft Feedback"; increased fixation of mildly deleterious mutations results in selection for compensatory mutations, which lead to fixation of additional deleterious mutations in nonrecombining mitochondrial genomes, thus

  10. Gene characterization of two digestive serine proteases in orange blossom wheat midge (Sitodiplosis mosellana)

    USDA-ARS?s Scientific Manuscript database

    Two full length cDNA sequences, encoding digestive serine proteases (designated as SmPROT-1 and SmPROT-2), were recovered from the midgut of the wheat midge, Sitodiplosis mosellana in an ongoing EST project. The deduced amino acid sequences shared homology with digestive serine proteases from insect...

  11. The mitochondrial genome of the onychophoran Opisthopatus cinctipes (Peripatopsidae) reflects the ancestral mitochondrial gene arrangement of Panarthropoda and Ecdysozoa.

    PubMed

    Braband, Anke; Cameron, Stephen L; Podsiadlowski, Lars; Daniels, Savel R; Mayer, Georg

    2010-10-01

    The ancestral genome composition in Onychophora (velvet worms) is unknown since only a single species of Peripatidae has been studied thus far, which shows a highly derived gene order with numerous translocated genes. Due to this lack of information from Onychophora, it is difficult to infer the ancestral mitochondrial gene arrangement patterns for Panarthropoda and Ecdysozoa. Hence, we analyzed the complete mitochondrial genome of the onychophoran Opisthopatus cinctipes, a representative of Peripatopsidae. Our data show that O. cinctipes possesses a highly conserved gene order, similar to that found in various arthropods. By comparing our results to those from different outgroups, we reconstruct the ancestral gene arrangement in Panarthropoda and Ecdysozoa. Our phylogenetic analysis of protein-coding gene sequences from 60 protostome species (including outgroups) provides some support for the sister group relationship of Onychophora and Arthropoda, which was not recovered by using a single species of Peripatidae, Epiperipatus biolleyi, in a previous study. A comparison of the strand-specific bias between onychophorans, arthropods, and a priapulid suggests that the peripatid E. biolleyi is less suitable for phylogenetic analyses of Ecdysozoa using mitochondrial genomic data than the peripatopsid O. cinctipes.

  12. Activation of the human mitochondrial transcription factor A gene by nuclear respiratory factors: a potential regulatory link between nuclear and mitochondrial gene expression in organelle biogenesis.

    PubMed Central

    Virbasius, J V; Scarpulla, R C

    1994-01-01

    Mitochondrial transcription factor A (mtTFA), the product of a nuclear gene, stimulates transcription from the two divergent mitochondrial promoters and is likely the principal activator of mitochondrial gene expression in vertebrates. Here we establish that the proximal promoter of the human mtTFA gene is highly dependent upon recognition sites for the nuclear respiratory factors, NRF-1 and NRF-2, for activity. These factors have been previously implicated in the activation of numerous nuclear genes that contribute to mitochondrial respiratory function. The affinity-purified factors from HeLa cells specifically bind to the mtTFA NRF-1 and NRF-2 sites through guanine nucleotide contacts that are characteristic for each site. Mutations in these contacts eliminate NRF-1 and NRF-2 binding and also dramatically reduce promoter activity in transfected cells. Although both factors contribute, NRF-1 binding appears to be the major determinant of promoter function. This dependence on NRF-1 activation is confirmed by in vitro transcription using highly purified recombinant proteins that display the same binding specificities as the HeLa cell factors. The activation of the mtTFA promoter by both NRF-1 and NRF-2 therefore provides a link between the expression of nuclear and mitochondrial genes and suggests a mechanism for their coordinate regulation during organelle biogenesis. Images PMID:8108407

  13. Extensive mitochondrial gene rearrangement in a genus of plant parasitic nematodes

    USDA-ARS?s Scientific Manuscript database

    The nematodes Globodera pallida and G. rostochiensis are two of the only animals known to have multipartite mitochondrial genomes. In such genomes, mitochondrial genes are distributed on multiple circles. The entire sequence of a nematode (Radopholus similis) that belongs to the same superfamily (...

  14. Evolution of the mitochondrial genome in snakes: Gene rearrangements and phylogenetic relationships

    PubMed Central

    Yan, Jie; Li, Hongdan; Zhou, Kaiya

    2008-01-01

    Background Snakes as a major reptile group display a variety of morphological characteristics pertaining to their diverse behaviours. Despite abundant analyses of morphological characters, molecular studies using mitochondrial and nuclear genes are limited. As a result, the phylogeny of snakes remains controversial. Previous studies on mitochondrial genomes of snakes have demonstrated duplication of the control region and translocation of trnL to be two notable features of the alethinophidian (all serpents except blindsnakes and threadsnakes) mtDNAs. Our purpose is to further investigate the gene organizations, evolution of the snake mitochondrial genome, and phylogenetic relationships among several major snake families. Results The mitochondrial genomes were sequenced for four taxa representing four different families, and each had a different gene arrangement. Comparative analyses with other snake mitochondrial genomes allowed us to summarize six types of mitochondrial gene arrangement in snakes. Phylogenetic reconstruction with commonly used methods of phylogenetic inference (BI, ML, MP, NJ) arrived at a similar topology, which was used to reconstruct the evolution of mitochondrial gene arrangements in snakes. Conclusion The phylogenetic relationships among the major families of snakes are in accordance with the mitochondrial genomes in terms of gene arrangements. The gene arrangement in Ramphotyphlops braminus mtDNA is inferred to be ancestral for snakes. After the divergence of the early Ramphotyphlops lineage, three types of rearrangements occurred. These changes involve translocations within the IQM tRNA gene cluster and the duplication of the CR. All phylogenetic methods support the placement of Enhydris plumbea outside of the (Colubridae + Elapidae) cluster, providing mitochondrial genomic evidence for the familial rank of Homalopsidae. PMID:19038056

  15. Functional analysis of five trypsin-like protease genes in the oriental fruit fly, Bactrocera dorsalis (Diptera: Tephritidae).

    PubMed

    Li, Ya-Li; Hou, Ming-Zhe; Shen, Guang-Mao; Lu, Xue-Ping; Wang, Zhe; Jia, Fu-Xian; Wang, Jin-Jun; Dou, Wei

    2017-03-01

    Insect midgut proteases catalyze the release of free amino acids from dietary proteins and are essential for insect normal development. To date, digestive proteases as potential candidates have made great progress in pest control. To clarify the function of trypsin-like protease genes in the digestive system of Bactrocera dorsalis, a serious pest of a wide range of tropical and subtropical fruit and vegetable crops, five trypsin genes (BdTry1, BdTry2, BdTry3, BdTry4 and BdTry5) were identified from transcriptome dataset, and the effects of feeding condition on their expression levels were examined subsequently. RNA interference (RNAi) was applied to further explore their function on the growth of B. dorsalis. The results showed that all the BdTrys in starving midgut expressed at a minimal level but up-regulated upon feeding (except BdTry3). Besides, RNAi by feeding dsRNAs to larvae proved to be an effective method to cause gene silencing and the mixed dsRNAs of the five BdTrys slowed larvae growth of B. dorsalis. The current data suggest that trypsin genes are actively involved in digestion process of B. dorsalis larvae and thereafter play crucial roles in their development. Copyright © 2016 Elsevier Inc. All rights reserved.

  16. Extensive mitochondrial gene arrangements in coleoid Cephalopoda and their phylogenetic implications.

    PubMed

    Akasaki, Tetsuya; Nikaido, Masato; Tsuchiya, Kotaro; Segawa, Susumu; Hasegawa, Masami; Okada, Norihiro

    2006-03-01

    We determined the complete mitochondrial genomes of five cephalopods of the Subclass Coleoidea (Suborder Oegopsida: Watasenia scintillans, Todarodes pacificus, Suborder Myopsida: Sepioteuthis lessoniana, Order Sepiida: Sepia officinalis, and Order Octopoda: Octopus ocellatus) and used them to infer phylogenetic relationships. In our Maximum Likelihood (ML) tree, sepiids (cuttlefish) are at the most basal position of all decapodiformes, and oegopsids and myopsids form a monophyletic clade, thus supporting the traditional classification of the Order Teuthida. We detected extensive gene rearrangements in the mitochondrial genomes of broad cephalopod groups. It is likely that the arrangements of mitochondrial genes in Oegopsida and Sepiida were derived from those of Octopoda, which is thought to be the ancestral order, by entire gene duplication and random gene loss. Oegopsida in particular has undergone long-range gene duplications. We also found that the mitochondrial gene arrangement of Sepioteuthis lessoniana differs from that of Loligo bleekeri, although they belong to the same family. Analysis of both the phylogenetic tree and mitochondrial gene rearrangements of coleoid Cephalopoda suggests that each mitochondrial gene arrangement was acquired after the divergence of each lineage.

  17. Afrobatrachian mitochondrial genomes: genome reorganization, gene rearrangement mechanisms, and evolutionary trends of duplicated and rearranged genes

    PubMed Central

    2013-01-01

    Background Mitochondrial genomic (mitogenomic) reorganizations are rarely found in closely-related animals, yet drastic reorganizations have been found in the Ranoides frogs. The phylogenetic relationships of the three major ranoid taxa (Natatanura, Microhylidae, and Afrobatrachia) have been problematic, and mitogenomic information for afrobatrachians has not been available. Several molecular models for mitochondrial (mt) gene rearrangements have been proposed, but observational evidence has been insufficient to evaluate them. Furthermore, evolutionary trends in rearranged mt genes have not been well understood. To gain molecular and phylogenetic insights into these issues, we analyzed the mt genomes of four afrobatrachian species (Breviceps adspersus, Hemisus marmoratus, Hyperolius marmoratus, and Trichobatrachus robustus) and performed molecular phylogenetic analyses. Furthermore we searched for two evolutionary patterns expected in the rearranged mt genes of ranoids. Results Extensively reorganized mt genomes having many duplicated and rearranged genes were found in three of the four afrobatrachians analyzed. In fact, Breviceps has the largest known mt genome among vertebrates. Although the kinds of duplicated and rearranged genes differed among these species, a remarkable gene rearrangement pattern of non-tandemly copied genes situated within tandemly-copied regions was commonly found. Furthermore, the existence of concerted evolution was observed between non-neighboring copies of triplicated 12S and 16S ribosomal RNA regions. Conclusions Phylogenetic analyses based on mitogenomic data support a close relationship between Afrobatrachia and Microhylidae, with their estimated divergence 100 million years ago consistent with present-day endemism of afrobatrachians on the African continent. The afrobatrachian mt data supported the first tandem and second non-tandem duplication model for mt gene rearrangements and the recombination-based model for concerted

  18. Phylogenetics of advanced snakes (Caenophidia) based on four mitochondrial genes.

    PubMed

    Kelly, Christopher M R; Barker, Nigel P; Villet, Martin H

    2003-08-01

    Phylogenetic relationships among advanced snakes (Acrochordus + Colubroidea = Caenophidia) and the position of the genus Acrochordus relative to colubroid taxa are contentious. These concerns were investigated by phylogenetic analysis of fragments from four mitochondrial genes representing 62 caenophidian genera and 5 noncaenophidian taxa. Four methods of phylogeny reconstruction were applied: matrix representation with parsimony (MRP) supertree consensus, maximum parsimony, maximum likelihood, and Bayesian analysis. Because of incomplete sampling, extensive missing data were inherent in this study. Analyses of individual genes retrieved roughly the same clades, but branching order varied greatly between gene trees, and nodal support was poor. Trees generated from combined data sets using maximum parsimony, maximum likelihood, and Bayesian analysis had medium to low nodal support but were largely congruent with each other and with MRP supertrees. Conclusions about caenophidian relationships were based on these combined analyses. The Xenoderminae, Viperidae, Pareatinae, Psammophiinae, Pseudoxyrophiinae, Homalopsinae, Natricinae, Xenodontinae, and Colubrinae (redefined) emerged as monophyletic, whereas Lamprophiinae, Atractaspididae, and Elapidae were not in one or more topologies. A clade comprising Acrochordus and Xenoderminae branched closest to the root, and when Acrochordus was assessed in relation to a colubroid subsample and all five noncaenophidians, it remained associated with the Colubroidea. Thus, Acrochordus + Xenoderminae appears to be the sister group to the Colubroidea, and Xenoderminae should be excluded from Colubroidea. Within Colubroidea, Viperidae was the most basal clade. Other relationships appearing in all final topologies were (1) a clade comprising Psammophiinae, Lamprophiinae, Atractaspididae, Pseudoxyrophiinae, and Elapidae, within which the latter four taxa formed a subclade, and (2) a clade comprising Colubrinae, Natricinae, and

  19. Mitochondrial disease genetic diagnostics: optimized whole-exome analysis for all MitoCarta nuclear genes and the mitochondrial genome.

    PubMed

    Falk, Marni J; Pierce, Eric A; Consugar, Mark; Xie, Michael H; Guadalupe, Moraima; Hardy, Owen; Rappaport, Eric F; Wallace, Douglas C; LeProust, Emily; Gai, Xiaowu

    2012-12-01

    Discovering causative genetic variants in individual cases of suspected mitochondrial disease requires interrogation of both the mitochondrial (mtDNA) and nuclear genomes. Whole-exome sequencing can support simultaneous dual-genome analysis, although currently available capture kits do not target the mtDNA genome and provide insufficient capture for some nuclear-encoded mitochondrial genes. To optimize interrogation of nuclear and mtDNA genes relevant to mitochondrial biology and disease, a custom SureSelect "Mito-Plus" whole-exome library was formulated by blending RNA "baits" from three separate designs: (A) Agilent Technologies SureSelectXT 50 Mb All Exon PLUS Targeted Enrichment Kit, (B) 16-gene nuclear panel targeting sequences for known MitoCarta proteins not included in the 50 Mb All Exon design, and (C) sequences targeting the entire mtDNA genome. The final custom formulations consisted of a 1:1 ratio of nuclear baits to which a 1 to 1,000-fold diluted ratio of mtDNA genome baits were blended. Patient sample capture libraries were paired-end sequenced on an Illumina HiSeq 2000 system using v3.0 SBS chemistry. mtDNA genome coverage varied depending on the mtDNA:nuclear blend ratio, where a 1:100 ratio provided optimal dual-genome coverage with 10X coverage for over 97.5% of all targeted nuclear regions and 1,000X coverage for 99.8% of the mtDNA genome. mtDNA mutations were reliably detected to at least an 8% heteroplasmy level, as discriminated both from sequencing errors and potential contamination from nuclear mtDNA transcripts (Numts). The "1:100 Mito-Plus Whole-Exome" Agilent capture kit offers an optimized tool for whole-exome analysis of nuclear and mtDNA genes relevant to the diagnostic evaluation of mitochondrial disease.

  20. A novel aspartic acid protease gene from pineapple fruit (Ananas comosus): cloning, characterization and relation to postharvest chilling stress resistance.

    PubMed

    Raimbault, Astrid-Kim; Zuily-Fodil, Yasmine; Soler, Alain; Cruz de Carvalho, Maria H

    2013-11-15

    A full-length cDNA encoding a putative aspartic acid protease (AcAP1) was isolated for the first time from the flesh of pineapple (Ananas comosus) fruit. The deduced sequence of AcAP1 showed all the common features of a typical plant aspartic protease phytepsin precursor. Analysis of AcAP1 gene expression under postharvest chilling treatment in two pineapple varieties differing in their resistance to blackheart development revealed opposite trends. The resistant variety showed an up-regulation of AcAP1 precursor gene expression whereas the susceptible showed a down-regulation in response to postharvest chilling treatment. The same trend was observed regarding specific AP enzyme activity in both varieties. Taken together our results support the involvement of AcAP1 in postharvest chilling stress resistance in pineapple fruits. Copyright © 2013 Elsevier GmbH. All rights reserved.

  1. Accurate sampling and deep sequencing of the HIV-1 protease gene using a Primer ID.

    PubMed

    Jabara, Cassandra B; Jones, Corbin D; Roach, Jeffrey; Anderson, Jeffrey A; Swanstrom, Ronald

    2011-12-13

    Viruses can create complex genetic populations within a host, and deep sequencing technologies allow extensive sampling of these populations. Limitations of these technologies, however, potentially bias this sampling, particularly when a PCR step precedes the sequencing protocol. Typically, an unknown number of templates are used in initiating the PCR amplification, and this can lead to unrecognized sequence resampling creating apparent homogeneity; also, PCR-mediated recombination can disrupt linkage, and differential amplification can skew allele frequency. Finally, misincorporation of nucleotides during PCR and errors during the sequencing protocol can inflate diversity. We have solved these problems by including a random sequence tag in the initial primer such that each template receives a unique Primer ID. After sequencing, repeated identification of a Primer ID reveals sequence resampling. These resampled sequences are then used to create an accurate consensus sequence for each template, correcting for recombination, allelic skewing, and misincorporation/sequencing errors. The resulting population of consensus sequences directly represents the initial sampled templates. We applied this approach to the HIV-1 protease (pro) gene to view the distribution of sequence variation of a complex viral population within a host. We identified major and minor polymorphisms at coding and noncoding positions. In addition, we observed dynamic genetic changes within the population during intermittent drug exposure, including the emergence of multiple resistant alleles. These results provide an unprecedented view of a complex viral population in the absence of PCR resampling.

  2. Analyses of nuclearly encoded mitochondrial genes suggest gene duplication as a mechanism for resolving intralocus sexually antagonistic conflict in Drosophila.

    PubMed

    Gallach, Miguel; Chandrasekaran, Chitra; Betrán, Esther

    2010-01-01

    Gene duplication is probably the most important mechanism for generating new gene functions. However, gene duplication has been overlooked as a potentially effective way to resolve genetic conflicts. Here, we analyze the entire set of Drosophila melanogaster nuclearly encoded mitochondrial duplicate genes and show that both RNA- and DNA-mediated mitochondrial gene duplications exhibit an unexpectedly high rate of relocation (change in location between parental and duplicated gene) as well as an extreme tendency to avoid the X chromosome. These trends are likely related to our observation that relocated genes tend to have testis-specific expression. We also infer that these trends hold across the entire Drosophila genus. Importantly, analyses of gene ontology and functional interaction networks show that there is an overrepresentation of energy production-related functions in these mitochondrial duplicates. We discuss different hypotheses to explain our results and conclude that our findings substantiate the hypothesis that gene duplication for male germline function is likely a mechanism to resolve intralocus sexually antagonistic conflicts that we propose are common in testis. In the case of nuclearly encoded mitochondrial duplicates, our hypothesis is that past sexually antagonistic conflict related to mitochondrial energy function in Drosophila was resolved by gene duplication.

  3. A genetic locus closely linked to a protease inhibitor gene complex controls the level of multiple RNA transcripts.

    PubMed Central

    Hill, R E; Shaw, P H; Barth, R K; Hastie, N D

    1985-01-01

    The two major protease inhibitors in mouse plasma are alpha 1-protease inhibitor (alpha 1-PI), putative inhibitor of neutrophil elastase, and contrapsin, an inhibitor in vitro of trypsinlike proteases. We have shown by nucleotide sequence analysis that these two inhibitors are related (R. E. Hill, P. H. Shaw, P. A. Boyd, H. Baumann, and N. D. Hastie, Nature (London) 311:175-177, 1984). Here, we show that the contrapsin and alpha 1-PI genes are members of two different multigene families, each containing at least three genes in mice and rats. We established the chromosomal locations of these genes by analyzing the segregation of restriction fragment length polymorphisms in recombinant inbred mouse strains. These experiments show that the multiple genes in each family are clustered and that the two gene families are closely linked on chromosome 12. Thus the genes for contrapsin and alpha 1-PI are likely to have evolved by duplication of a common ancestral gene. The contrapsin multigene family codes for multiple mRNA transcripts in the liver. There is a genetic difference among inbred mouse strains in the regulation of two of these transcripts. In some inbred strains the transcripts are synthesized constitutively; in others they are induced by inflammation. We mapped in recombinant inbred strains the regulatory locus responsible for this genetic variation and found it is linked to the contrapsin multigene family, which suggests a cis-acting regulatory element. We also found that the contrapsin and the alpha 1-PI multigene families have acquired very different regulatory responses since the time of the gene duplication event. Images PMID:2427931

  4. Cloning, expression, and characterization of a milk-clotting aspartic protease gene (Po-Asp) from Pleurotus ostreatus.

    PubMed

    Yin, Chaomin; Zheng, Liesheng; Chen, Liguo; Tan, Qi; Shang, Xiaodong; Ma, Aimin

    2014-02-01

    An aspartic protease gene from Pleurotus ostreatus (Po-Asp) had been cloned based on the 3' portion of cDNA in our previous work. The Po-Asp cDNA contained 1,324 nucleotides with an open reading frame (ORF) of 1,212 bp encoding 403 amino acid residues. The putative amino acid sequence included a signal peptide, an activation peptide, two most possible N-glycosylation sites and two conserved catalytic active site. The mature polypeptide with 327 amino acid residues had a calculated molecular mass of 35.3 kDa and a theoretical isoelectric point of 4.57. Basic Local Alignment Search Tool analysis showed 68-80 % amino acid sequence identical to other basidiomycetous aspartic proteases. Sequence comparison and evolutionary analysis revealed that Po-Asp is a member of fungal aspartic protease family. The DNA sequence of Po-Asp is 1,525 bp in length without untranslated region, consisting of seven exons and six introns. The Po-Asp cDNA without signal sequence was expressed in Pichia pastoris and sodium dodecyl sulfate-polyacrylamide gel electrophoresis demonstrated the molecular mass of recombinant Po-Asp was about 43 kDa. The crude recombinant aspartic protease had milk-clotting activity.

  5. PhAP protease from Pseudoalteromonas haloplanktis TAC125: Gene cloning, recombinant production in E. coli and enzyme characterization

    NASA Astrophysics Data System (ADS)

    de Pascale, D.; Giuliani, M.; De Santi, C.; Bergamasco, N.; Amoresano, A.; Carpentieri, A.; Parrilli, E.; Tutino, M. L.

    2010-08-01

    Cold-adapted proteases have been found to be the dominant activity throughout the cold marine environment, indicating their importance in bacterial acquisition of nitrogen-rich complex organic compounds. However, few extracellular proteases from marine organisms have been characterized so far, and the mechanisms that enable their activity in situ are still largely unknown. Aside from their ecological importance and use as model enzyme for structure/function investigations, cold-active proteolytic enzymes offer great potential for biotechnological applications. Our studies on cold adapted proteases were performed on exo-enzyme produced by the Antarctic marine bacterium Pseudoalteromonas haloplanktis TAC125. By applying a proteomic approach, we identified several proteolytic activities from its culture supernatant. PhAP protease was selected for further investigations. The encoding gene was cloned and the protein was recombinantly produced in E. coli cells. The homogeneous product was biochemically characterised and it turned out that the enzyme is a Zn-dependent aminopeptidase, with an activity dependence from assay temperature typical of psychrophilic enzymes.

  6. Isolation and gene expression analysis of a papain-type cysteine protease in thermogenic skunk cabbage (Symplocarpus renifolius).

    PubMed

    Ito-Inaba, Yasuko; Masuko, Hiromi; Watanabe, Masao; Inaba, Takehito

    2012-01-01

    Skunk cabbage (Symplocarpus renifolius) spadices contain abundant transcripts for cysteine protease (CP). From thermogenic spadices, we isolated SrCPA, a highly expressed CP gene that encoded a papain-type CP. SrCPA is structurally similar to other plant CPs, including the senescence-associated CPs found in aroids. The expression of SrCPA increased during floral development, and was observed in all floral tissues except for the stamens.

  7. Comparative study of human mitochondrial proteome reveals extensive protein subcellular relocalization after gene duplications

    PubMed Central

    2009-01-01

    Background Gene and genome duplication is the principle creative force in evolution. Recently, protein subcellular relocalization, or neolocalization was proposed as one of the mechanisms responsible for the retention of duplicated genes. This hypothesis received support from the analysis of yeast genomes, but has not been tested thoroughly on animal genomes. In order to evaluate the importance of subcellular relocalizations for retention of duplicated genes in animal genomes, we systematically analyzed nuclear encoded mitochondrial proteins in the human genome by reconstructing phylogenies of mitochondrial multigene families. Results The 456 human mitochondrial proteins selected for this study were clustered into 305 gene families including 92 multigene families. Among the multigene families, 59 (64%) consisted of both mitochondrial and cytosolic (non-mitochondrial) proteins (mt-cy families) while the remaining 33 (36%) were composed of mitochondrial proteins (mt-mt families). Phylogenetic analyses of mt-cy families revealed three different scenarios of their neolocalization following gene duplication: 1) relocalization from mitochondria to cytosol, 2) from cytosol to mitochondria and 3) multiple subcellular relocalizations. The neolocalizations were most commonly enabled by the gain or loss of N-terminal mitochondrial targeting signals. The majority of detected subcellular relocalization events occurred early in animal evolution, preceding the evolution of tetrapods. Mt-mt protein families showed a somewhat different pattern, where gene duplication occurred more evenly in time. However, for both types of protein families, most duplication events appear to roughly coincide with two rounds of genome duplications early in vertebrate evolution. Finally, we evaluated the effects of inaccurate and incomplete annotation of mitochondrial proteins and found that our conclusion of the importance of subcellular relocalization after gene duplication on the genomic scale was

  8. Novel homoplasmic mutation in the mitochondrial tRNATyr gene associated with atypical mitochondrial cytopathy presenting with focal segmental glomerulosclerosis.

    PubMed

    Scaglia, Fernando; Vogel, Hannes; Hawkins, Edith P; Vladutiu, Georgirene D; Liu, Ling-Ling; Wong, Lee-Jun C

    2003-12-01

    We report a 9-year-old girl with a mitochondrial cytopathy preceded by steroid-resistant focal segmental glomerulosclerosis (FSGS). The proband presented at the age of 2 years with steroid-resistant nephrotic syndrome caused by FSGS. Her renal function progressively deteriorated and a dilated cardiomyopathy developed at the age of 7 years. A skeletal muscle biopsy showed a combined respiratory chain (RC) defect and a partial deficiency of coenzyme Q(10). A novel mutation in the evolutionary highly conserved region of the mitochondrial tRNA(Tyr) gene was found in homoplasmic state in skeletal muscle, blood, and renal tissue. The mutation was also found in homoplasmic state in her mildly symptomatic mother. No other maternal family members were available for testing. The present case of mitochondrial cytopathy initially presenting with steroid-resistant nephrotic syndrome, unusual biochemical and renal findings associated with a novel tRNA point mutation suggests that steroid-resistant FSGS can predate other features of mitochondrial disease for a prolonged period of time and that the progressive glomerulopathy associated with combined mitochondrial RC defects is genetically heterogeneous. Copyright 2003 Wiley-Liss, Inc.

  9. Mammalian mitochondrial ribosomal small subunit (MRPS) genes: A putative role in human disease.

    PubMed

    Gopisetty, Gopal; Thangarajan, Rajkumar

    2016-09-01

    Mitochondria are prominently understood as power houses producing ATP the primary energy currency of the cell. However, mitochondria are also known to play an important role in apoptosis and autophagy, and mitochondrial dysregulation can lead to pathological outcomes. Mitochondria are known to contain 1500 proteins of which only 13 are coded by mitochondrial DNA and the rest are coded by nuclear genes. Protein synthesis in mitochondria involves mitochondrial ribosomes which are 55-60S particles and are composed of small 28S and large 39S subunits. A feature of mammalian mitoribosome which differentiate it from bacterial ribosomes is the increased protein content. The human mitochondrial ribosomal protein (MRP) gene family comprises of 30 genes which code for mitochondrial ribosomal small subunit and 50 genes for the large subunit. The present review focuses on the mitochondrial ribosomal small subunit genes (MRPS), presents an overview of the literature and data gleaned from publicly available gene and protein expression databases. The survey revealed aberrations in MRPS gene expression patterns in varied human diseases indicating a putative role in their etiology.

  10. Regulation of skeletal muscle mitochondrial function: genes to proteins.

    PubMed

    Lanza, I R; Sreekumaran Nair, K

    2010-08-01

    The impact of ageing on mitochondrial function and the deterministic role of mitochondria on senescence continue to be topics of vigorous debate. Many studies report that skeletal muscle mitochondrial content and function are reduced with ageing and metabolic diseases associated with insulin resistance. However, an accumulating body of literature suggests that physical inactivity typical of ageing may be a more important determinant of mitochondrial function than chronological age, per se. Reports of age-related declines in mitochondrial function have spawned a vast body of literature devoted to understanding the underlying mechanisms. These mechanisms include decreased abundance of mtDNA, reduced mRNA levels, as well as decreased synthesis and expression of mitochondrial proteins, ultimately resulting in decreased function of the whole organelle. Effective therapies to prevent, reverse or delay the onset of the aforementioned mitochondrial changes, regardless of their inevitability or precise underlying causes, require an intimate understanding of the processes that regulate mitochondrial biogenesis, which necessitates the coordinated regulation of nuclear and mitochondrial genomes. Herein we review the current thinking on regulation of mitochondrial biogenesis by transcription factors and transcriptional co-activators and the role of hormones and exercise in initiating this process. We review how exercise may help preserve mitochondrial content and functionality across the lifespan, and how physical inactivity is emerging as a major determinant of many age-associated changes at the level of the mitochondrion. We also review evidence that some mitochondrial changes with ageing are independent of exercise or physical activity and appear to be inevitable consequences of old age.

  11. [MITO-Porter; a cutting-edge technology for mitochondrial gene therapy].

    PubMed

    Furukawa, Ryo; Yamada, Yuma; Harashima, Hideyoshi

    2012-01-01

    Gene therapy is an attractive strategy, for not only targeting nuclear genome, but the mitochondrial genome as well. Human mitochondrial DNA (mtDNA) encodes 13 subunits of the electron transport chain, 22 tRNAs, and 2 rRNAs and their mutations cause a wide range of mitochondrial diseases. Each cell contains hundreds to thousands of mtDNAs, and in the case of a diseased cell, the mitochondrion possesses both mutant mtDNA and wild-type mtDNA. It is generally accepted that the disease phenotype appears when the proportion of the pathogenic mutant mtDNA exceeds a certain threshold. Therefore, the suppression of mutant mtDNA or supplementing wild-type mtDNA will control the onset of mitochondrial disease. To achieve the transfection of an exogenous therapeutic gene to the mitochondrial matrix where mtDNA is transcribed and translated, it is necessary to transfer cargos through mitochondrial outer and inner membranes. Several methods have been examined for mitochondrial transfection, but a universal, wide-ranging transfection technique has yet not been established. We recently developed a mitochondrial targeting delivery system, namely the MITO-Porter. The MITO-Porter is liposomal nanocarrier with a mitochondrial fusogenic lipid composition. We reported that the MITO-Porter could deliver chemical compounds and proteins to the mitochondrial matrix via membrane fusion. In this review, we report (1) on the pharmacological enhancement of lecithinized superoxide dismutase (PC-SOD) using MITO-Porter, (2) the transcription activation of exogenous DNA by mitochondrial transcription factor A (TFAM), and (3) perspectives on a mitochondrial targeting device.

  12. Mitochondrial Genomes of Kinorhyncha: trnM Duplication and New Gene Orders within Animals

    PubMed Central

    Popova, Olga V.; Mikhailov, Kirill V.; Nikitin, Mikhail A.; Logacheva, Maria D.; Penin, Aleksey A.; Muntyan, Maria S.; Kedrova, Olga S.; Petrov, Nikolai B.; Panchin, Yuri V.

    2016-01-01

    Many features of mitochondrial genomes of animals, such as patterns of gene arrangement, nucleotide content and substitution rate variation are extensively used in evolutionary and phylogenetic studies. Nearly 6,000 mitochondrial genomes of animals have already been sequenced, covering the majority of animal phyla. One of the groups that escaped mitogenome sequencing is phylum Kinorhyncha—an isolated taxon of microscopic worm-like ecdysozoans. The kinorhynchs are thought to be one of the early-branching lineages of Ecdysozoa, and their mitochondrial genomes may be important for resolving evolutionary relations between major animal taxa. Here we present the results of sequencing and analysis of mitochondrial genomes from two members of Kinorhyncha, Echinoderes svetlanae (Cyclorhagida) and Pycnophyes kielensis (Allomalorhagida). Their mitochondrial genomes are circular molecules approximately 15 Kbp in size. The kinorhynch mitochondrial gene sequences are highly divergent, which precludes accurate phylogenetic inference. The mitogenomes of both species encode a typical metazoan complement of 37 genes, which are all positioned on the major strand, but the gene order is distinct and unique among Ecdysozoa or animals as a whole. We predict four types of start codons for protein-coding genes in E. svetlanae and five in P. kielensis with a consensus DTD in single letter code. The mitochondrial genomes of E. svetlanae and P. kielensis encode duplicated methionine tRNA genes that display compensatory nucleotide substitutions. Two distant species of Kinorhyncha demonstrate similar patterns of gene arrangements in their mitogenomes. Both genomes have duplicated methionine tRNA genes; the duplication predates the divergence of two species. The kinorhynchs share a few features pertaining to gene order that align them with Priapulida. Gene order analysis reveals that gene arrangement specific of Priapulida may be ancestral for Scalidophora, Ecdysozoa, and even Protostomia

  13. Mitochondrial Genomes of Kinorhyncha: trnM Duplication and New Gene Orders within Animals.

    PubMed

    Popova, Olga V; Mikhailov, Kirill V; Nikitin, Mikhail A; Logacheva, Maria D; Penin, Aleksey A; Muntyan, Maria S; Kedrova, Olga S; Petrov, Nikolai B; Panchin, Yuri V; Aleoshin, Vladimir V

    2016-01-01

    Many features of mitochondrial genomes of animals, such as patterns of gene arrangement, nucleotide content and substitution rate variation are extensively used in evolutionary and phylogenetic studies. Nearly 6,000 mitochondrial genomes of animals have already been sequenced, covering the majority of animal phyla. One of the groups that escaped mitogenome sequencing is phylum Kinorhyncha-an isolated taxon of microscopic worm-like ecdysozoans. The kinorhynchs are thought to be one of the early-branching lineages of Ecdysozoa, and their mitochondrial genomes may be important for resolving evolutionary relations between major animal taxa. Here we present the results of sequencing and analysis of mitochondrial genomes from two members of Kinorhyncha, Echinoderes svetlanae (Cyclorhagida) and Pycnophyes kielensis (Allomalorhagida). Their mitochondrial genomes are circular molecules approximately 15 Kbp in size. The kinorhynch mitochondrial gene sequences are highly divergent, which precludes accurate phylogenetic inference. The mitogenomes of both species encode a typical metazoan complement of 37 genes, which are all positioned on the major strand, but the gene order is distinct and unique among Ecdysozoa or animals as a whole. We predict four types of start codons for protein-coding genes in E. svetlanae and five in P. kielensis with a consensus DTD in single letter code. The mitochondrial genomes of E. svetlanae and P. kielensis encode duplicated methionine tRNA genes that display compensatory nucleotide substitutions. Two distant species of Kinorhyncha demonstrate similar patterns of gene arrangements in their mitogenomes. Both genomes have duplicated methionine tRNA genes; the duplication predates the divergence of two species. The kinorhynchs share a few features pertaining to gene order that align them with Priapulida. Gene order analysis reveals that gene arrangement specific of Priapulida may be ancestral for Scalidophora, Ecdysozoa, and even Protostomia.

  14. Independent replication of mitochondrial genes supports the transcriptional program in developing fiber cells of cotton (Gossypium hirsutum L.).

    USDA-ARS?s Scientific Manuscript database

    The mitochondrial genomes of flowering plants exist both as a "master circle" chromosome and as numerous subgenomic sublimons that are generated by intramolecular recombination. Differential stability or replication of these sublimons allows individual mitochondrial gene copy numbers to vary indepe...

  15. Mitochondrial respiratory gene expression is suppressed in many cancers

    PubMed Central

    Reznik, Ed; Wang, Qingguo; La, Konnor; Schultz, Nikolaus; Sander, Chris

    2017-01-01

    The fundamental metabolic decision of a cell, the balance between respiration and fermentation, rests in part on expression of the mitochondrial genome (mtDNA) and coordination with expression of the nuclear genome (nuDNA). Previously we described mtDNA copy number depletion across many solid tumor types (Reznik et al., 2016). Here, we use orthogonal RNA-sequencing data to quantify mtDNA expression (mtRNA), and report analogously lower expression of mtRNA in tumors (relative to normal tissue) across a majority of cancer types. Several cancers exhibit a trio of mutually consistent evidence suggesting a drop in respiratory activity: depletion of mtDNA copy number, decreases in mtRNA levels, and decreases in expression of nuDNA-encoded respiratory proteins. Intriguingly, a minority of cancer types exhibit a drop in mtDNA expression but an increase in nuDNA expression of respiratory proteins, with unknown implications for respiratory activity. Our results indicate suppression of respiratory gene expression across many cancer types. DOI: http://dx.doi.org/10.7554/eLife.21592.001 PMID:28099114

  16. Gene set of nuclear-encoded mitochondrial regulators is enriched for common inherited variation in obesity.

    PubMed

    Knoll, Nadja; Jarick, Ivonne; Volckmar, Anna-Lena; Klingenspor, Martin; Illig, Thomas; Grallert, Harald; Gieger, Christian; Wichmann, Heinz-Erich; Peters, Annette; Hebebrand, Johannes; Scherag, André; Hinney, Anke

    2013-01-01

    There are hints of an altered mitochondrial function in obesity. Nuclear-encoded genes are relevant for mitochondrial function (3 gene sets of known relevant pathways: (1) 16 nuclear regulators of mitochondrial genes, (2) 91 genes for oxidative phosphorylation and (3) 966 nuclear-encoded mitochondrial genes). Gene set enrichment analysis (GSEA) showed no association with type 2 diabetes mellitus in these gene sets. Here we performed a GSEA for the same gene sets for obesity. Genome wide association study (GWAS) data from a case-control approach on 453 extremely obese children and adolescents and 435 lean adult controls were used for GSEA. For independent confirmation, we analyzed 705 obesity GWAS trios (extremely obese child and both biological parents) and a population-based GWAS sample (KORA F4, n = 1,743). A meta-analysis was performed on all three samples. In each sample, the distribution of significance levels between the respective gene set and those of all genes was compared using the leading-edge-fraction-comparison test (cut-offs between the 50(th) and 95(th) percentile of the set of all gene-wise corrected p-values) as implemented in the MAGENTA software. In the case-control sample, significant enrichment of associations with obesity was observed above the 50(th) percentile for the set of the 16 nuclear regulators of mitochondrial genes (p(GSEA,50) = 0.0103). This finding was not confirmed in the trios (p(GSEA,50) = 0.5991), but in KORA (p(GSEA,50) = 0.0398). The meta-analysis again indicated a trend for enrichment (p(MAGENTA,50) = 0.1052, p(MAGENTA,75) = 0.0251). The GSEA revealed that weak association signals for obesity might be enriched in the gene set of 16 nuclear regulators of mitochondrial genes.

  17. A screen for nigericin-resistant yeast mutants revealed genes controlling mitochondrial volume and mitochondrial cation homeostasis.

    PubMed

    Kucejova, Blanka; Kucej, Martin; Petrezselyova, Silvia; Abelovska, Lenka; Tomaska, Lubomir

    2005-10-01

    Little is known about the regulation of ion transport across the inner mitochondrial membrane in Saccharomyces cerevisiae. To approach this problem, we devised a screening procedure for facilitating the identification of proteins involved in mitochondrial ion homeostasis. Taking advantage of the growth inhibition of yeast cells by electroneutral K(+)/H(+) ionophore nigericin, we screened for genetic mutations that would render cells tolerant to this drug when grown on a nonfermentable carbon source and identified several candidate genes including MDM31, MDM32, NDI1, YMR088C (VBA1), CSR2, RSA1, YLR024C, and YNL136W (EAF7). Direct examination of intact cells by electron microscopy indicated that mutants lacking MDM31 and/or MDM32 genes contain dramatically enlarged, spherical mitochondria and that these morphological abnormalities can be alleviated by nigericin. Mitochondria isolated from the Deltamdm31 and Deltamdm32 mutants exhibited limited swelling in an isotonic solution of potassium acetate even in the presence of an exogenous K(+)/H(+) antiport. In addition, growth of the mutants was inhibited on ethanol-containing media in the presence of high concentrations of salts (KCl, NaCl, or MgSO(4)) and their mitochondria exhibited two- (Deltamdm31 and Deltamdm32) to threefold (Deltamdm31Deltamdm32) elevation in magnesium content. Taken together, these data indicate that Mdm31p and Mdm32p control mitochondrial morphology through regulation of mitochondrial cation homeostasis and the maintenance of proper matrix osmolarity.

  18. PCR-based bioprospecting for homing endonucleases in fungal mitochondrial rRNA genes.

    PubMed

    Hafez, Mohamed; Guha, Tuhin Kumar; Shen, Chen; Sethuraman, Jyothi; Hausner, Georg

    2014-01-01

    Fungal mitochondrial genomes act as "reservoirs" for homing endonucleases. These enzymes with their DNA site-specific cleavage activities are attractive tools for genome editing and gene therapy applications. Bioprospecting and characterization of naturally occurring homing endonucleases offers an alternative to synthesizing artificial endonucleases. Here, we describe methods for PCR-based screening of fungal mitochondrial rRNA genes for homing endonuclease encoding sequences, and we also provide protocols for the purification and biochemical characterization of putative native homing endonucleases.

  19. A focused microarray to study human mitochondrial and nuclear gene expression.

    PubMed

    Voss, Joachim G; Raju, Raghavan; Logun, Carolea; Danner, Robert L; Munson, Peter J; Rangel, Zoila; Dalakas, Marinos C

    2008-04-01

    A focused microarray (huMITOchip) was developed to study alterations of human mitochondrial and nuclear gene expression in health and disease. The huMITOchip contains 4,774 probe sets identical to the Affymetrix U 133 plus 2.0 chip covering genes affecting mitochondrial, lipid, cytokine, apoptosis, and muscle function transcripts. Unlike other gene chips, the huMITOchip has 51 probe sets that interrogate 37 genes of the mitochondrial genome. The human mitochondrial gene chip was validated against the Affymetrix U133 plus 2.0 array using an in vitro system of CCL136 muscle cell line stimulated with or without interferon gamma (IFN-gamma). The 37 genes from the mtDNA demonstrated absolute gene expression levels ranging from 0.1 to 3,182. The comparison of the two gene chips yielded an excellent Pearson's correlation coefficient (r = 0.98). At least 17 probe sets were differentially expressed in response to IFN-gamma on both chips, with a high degree of concordance. This is the first report on the development of a focused oligonucleotide microarray containing genes of the mitochondrial genome.

  20. A Focused Microarray to Study Human Mitochondrial and Nuclear Gene Expression

    PubMed Central

    Voss, Joachim G.; Raju, Raghavan; Logun, Carolea; Danner, Robert L.; Munson, Peter J.; Rangel, Zoila; Dalakas, Marinos C.

    2016-01-01

    A focused microarray (huMITOchip) was developed to study alterations of human mitochondrial and nuclear gene expression in health and disease. The huMITOchip contains 4,774 probe sets identical to the Affymetrix U 133 plus 2.0 chip covering genes affecting mitochondrial, lipid, cytokine, apoptosis, and muscle function transcripts. Unlike other gene chips, the huMITOchip has 51 probe sets that interrogate 37 genes of the mitochondrial genome. The human mitochondrial gene chip was validated against the Affymetrix U133 plus 2.0 array using an in vitro system of CCL136 muscle cell line stimulated with or without interferon gamma (IFN-γ). The 37 genes from the mtDNA demonstrated absolute gene expression levels ranging from 0.1 to 3,182. The comparison of the two gene chips yielded an excellent Pearson’s correlation coefficient (r = 0.98). At least 17 probe sets were differentially expressed in response to IFN-γ on both chips, with a high degree of concordance. This is the first report on the development of a focused oligonucleotide microarray containing genes of the mitochondrial genome. PMID:18398222

  1. Control of gene expression and mitochondrial biogenesis in the muscular adaptation to endurance exercise.

    PubMed

    Joseph, Anna-Maria; Pilegaard, Henriette; Litvintsev, Anastassia; Leick, Lotte; Hood, David A

    2006-01-01

    Every time a bout of exercise is performed, a change in gene expression occurs within the contracting muscle. Over the course of many repeated bouts of exercise (i.e. training), the cumulative effects of these alterations lead to a change in muscle phenotype. One of the most prominent of these adaptations is an increase in mitochondrial content, which confers a greater resistance to muscle fatigue. This essay reviews current knowledge on the regulation of exercise-induced mitochondrial biogenesis at the molecular level. The major steps involved include, (i) transcriptional regulation of nuclear-encoded genes encoding mitochondrial proteins by the coactivator peroxisome-proliferator-activated receptor g coactivator-1, (ii) control of mitochondrial DNA gene expression by the transcription factor Tfam, (iii) mitochondrial fission and fusion mechanisms, and (iv) import of nuclear-derived gene products into the mitochondrion via the protein import machinery. It is now known that exercise can modify the rates of several of these steps, leading to mitochondrial biogenesis. An understanding of how exercise can produce this effect could help us decide whether exercise is beneficial for patients suffering from mitochondrial disorders, as well as a variety of metabolic diseases.

  2. The complete mitochondrial genome of Setaria digitata (Nematoda: Filarioidea): Mitochondrial gene content, arrangement and composition compared with other nematodes.

    PubMed

    Yatawara, Lalani; Wickramasinghe, Susiji; Rajapakse, R P V J; Agatsuma, Takeshi

    2010-09-01

    In the present study, we determined the complete mitochondrial (mt) genome sequence (13,839bp) of parasitic nematode Setaria digitata and its structure and organization compared with Onchocerca volvulus, Dirofilaria immitis and Brugia malayi. The mt genome of S. digitata is slightly larger than the mt genomes of other filarial nematodes. S. digitata mt genome contains 36 genes (12 protein-coding genes, 22 transfer RNAs and 2 ribosomal RNAs) that are typically found in metazoans. This genome contains a high A+T (75.1%) content and low G+C content (24.9%). The mt gene order for S. digitata is the same as those for O. volvulus, D. immitis and B. malayi but it is distinctly different from other nematodes compared. The start codons inferred in the mt genome of S. digitata are TTT, ATT, TTG, ATG, GTT and ATA. Interestingly, the initiation codon TTT is unique to S. digitata mt genome and four protein-coding genes use this codon as a translation initiation codon. Five protein-coding genes use TAG as a stop codon whereas three genes use TAA and four genes use T as a termination codon. Out of 64 possible codons, only 57 are used for mitochondrial protein-coding genes of S. digitata. T-rich codons such as TTT (18.9%), GTT (7.9%), TTG (7.8%), TAT (7%), ATT (5.7%), TCT (4.8%) and TTA (4.1%) are used more frequently. This pattern of codon usage reflects the strong bias for T in the mt genome of S. digitata. In conclusion, the present investigation provides new molecular data for future studies of the comparative mitochondrial genomics and systematic of parasitic nematodes of socio-economic importance. 2010 Elsevier B.V. All rights reserved.

  3. The gene expression landscape of thermogenic skunk cabbage suggests critical roles for mitochondrial and vacuolar metabolic pathways in the regulation of thermogenesis.

    PubMed

    Ito-Inaba, Yasuko; Hida, Yamato; Matsumura, Hideo; Masuko, Hiromi; Yazu, Fumiko; Terauchi, Ryohei; Watanabe, Masao; Inaba, Takehito

    2012-03-01

    Floral thermogenesis has been described in several plant species. Because of the lack of comprehensive gene expression profiles in thermogenic plants, the molecular mechanisms by which floral thermogenesis is regulated remain to be established. We examined the gene expression landscape of skunk cabbage (Symplocarpus renifolius) during thermogenic and post-thermogenic stages and identified expressed sequence tags from different developmental stages of the inflorescences using super serial analysis of gene expression (SuperSAGE). In-depth analysis suggested that cellular respiration and mitochondrial functions are significantly enhanced during the thermogenic stage. In contrast, genes involved in stress responses and protein degradation were significantly up-regulated during post-thermogenic stages. Quantitative comparisons indicated that the expression levels of genes involved in cellular respiration were higher in thermogenic spadices than in Arabidopsis inflorescences. Thermogenesis-associated genes seemed to be expressed abundantly in the peripheral tissues of the spadix. Our results suggest that cellular respiration and mitochondrial metabolism play key roles in heat production during floral thermogenesis. On the other hand, vacuolar cysteine protease and other degradative enzymes seem to accelerate senescence and terminate thermogenesis in the post-thermogenic stage.

  4. Dysfunctional chloroplasts up-regulate the expression of mitochondrial genes in Arabidopsis seedlings.

    PubMed

    Liao, Jo-Chien; Hsieh, Wei-Yu; Tseng, Ching-Chih; Hsieh, Ming-Hsiun

    2016-02-01

    Chloroplasts and mitochondria play important roles in maintaining metabolic and energy homeostasis in the plant cell. The interactions between these two organelles, especially photosynthesis and respiration, have been intensively studied. Still, little is known about the regulation of mitochondrial gene expression by chloroplasts and vice versa. The gene expression machineries in chloroplasts and mitochondria rely heavily on the nuclear genome. Thus, the interactions between nucleus and these organelles, including anterograde and retrograde regulation, have been actively investigated in the last two decades. Norflurazon (NF) and lincomycin (Lin) are two commonly used inhibitors to study chloroplast-to-nucleus retrograde signaling in plants. We used NF and Lin to block the development and functions of chloroplasts and examined their effects on mitochondrial gene expression, RNA editing and splicing. The editing of most mitochondrial transcripts was not affected, but the editing extents of nad4-107, nad6-103, and ccmFc-1172 decreased slightly in NF- and Lin-treated seedlings. While the splicing of mitochondrial transcripts was not significantly affected, steady-state mRNA levels of several mitochondrial genes increased significantly in NF- and Lin-treated seedlings. Moreover, Lin seemed to have more profound effects than NF on the expression of mitochondrial genes, indicating that signals derived from these two inhibitors might be distinct. NF and Lin also significantly induced the expression of nuclear genes encoding subunits of mitochondrial electron transport chain complexes. Thus, dysfunctional chloroplasts may coordinately up-regulate the expression of nuclear and mitochondrial genes encoding subunits of respiratory complexes.

  5. In vivo and in vitro maturation of rabbit oocytes differently affects the gene expression profile, mitochondrial distribution, apoptosis and early embryo development.

    PubMed

    Arias-Álvarez, M; García-García, R M; López-Tello, J; Rebollar, P G; Gutiérrez-Adán, A; Lorenzo, P L

    2016-09-28

    In vivo-matured cumulus-oocyte complexes are valuable models in which to assess potential biomarkers of rabbit oocyte quality that contribute to enhanced IVM systems. In the present study we compared some gene markers of oocytes and cumulus cells (CCs) from immature, in vivo-matured and IVM oocytes. Moreover, apoptosis in CCs, nuclear maturation, mitochondrial reallocation and the developmental potential of oocytes after IVF were assessed. In relation to cumulus expansion, gene expression of gap junction protein, alpha 1, 43 kDa (Gja1) and prostaglandin-endoperoxide synthase 2 (Ptgs2) was significantly lower in CCs after in vivo maturation than IVM. In addition, there were differences in gene expression after in vivo maturation versus IVM in both oocytes and CCs for genes related to cell cycle regulation and apoptosis (V-Akt murine thymoma viral oncogene homologue 1 (Akt1), tumour protein 53 (Tp53), caspase 3, apoptosis-related cysteine protease (Casp3)), oxidative response (superoxide dismutase 2, mitochondrial (Sod2)) and metabolism (glucose-6-phosphate dehydrogenase (G6pd), glyceraldehyde-3-phosphate dehydrogenase (Gapdh)). In vivo-matured CCs had a lower apoptosis rate than IVM and immature CCs. Meiotic progression, mitochondrial migration to the periphery and developmental competence were higher for in vivo-matured than IVM oocytes. In conclusion, differences in oocyte developmental capacity after IVM or in vivo maturation are accompanied by significant changes in transcript abundance in oocytes and their surrounding CCs, meiotic rate, mitochondrial distribution and apoptotic index. Some of the genes investigated, such as Gja1, could be potential biomarkers for oocyte developmental competence in the rabbit model, helping improve in vitro culture systems in these species.

  6. The human corticosteroid binding globulin gene is located on chromosome 14q31-q32.1 near two other serine protease inhibitor genes.

    PubMed

    Seralini, G E; Bérubé, D; Gagné, R; Hammond, G L

    1990-11-01

    Human corticosteroid binding globulin (CBG) cDNA fragments were radiolabeled and hybridized in situ to metaphase chromosome preparations. The results localized the CBG gene to the q31-q32.1 region of human chromosome 14. This location also contains the genes for two closely related serine protease inhibitors: alpha 1-proteinase inhibitor and alpha 1-antichymotrypsin. It is therefore likely that these genes evolved by duplication events, and it would appear that this region contains a series of functionally related genes.

  7. Mitochondrial DNA of Vitis vinifera and the issue of rampant horizontal gene transfer.

    PubMed

    Goremykin, Vadim V; Salamini, Francesco; Velasco, Riccardo; Viola, Roberto

    2009-01-01

    The mitochondrial genome of grape (Vitis vinifera), the largest organelle genome sequenced so far, is presented. The genome is 773,279 nt long and has the highest coding capacity among known angiosperm mitochondrial DNAs (mtDNAs). The proportion of promiscuous DNA of plastid origin in the genome is also the largest ever reported for an angiosperm mtDNA, both in absolute and relative terms. In all, 42.4% of chloroplast genome of Vitis has been incorporated into its mitochondrial genome. In order to test if horizontal gene transfer (HGT) has also contributed to the gene content of the grape mtDNA, we built phylogenetic trees with the coding sequences of mitochondrial genes of grape and their homologs from plant mitochondrial genomes. Many incongruent gene tree topologies were obtained. However, the extent of incongruence between these gene trees is not significantly greater than that observed among optimal trees for chloroplast genes, the common ancestry of which has never been in doubt. In both cases, we attribute this incongruence to artifacts of tree reconstruction, insufficient numbers of characters, and gene paralogy. This finding leads us to question the recent phylogenetic interpretation of Bergthorsson et al. (2003, 2004) and Richardson and Palmer (2007) that rampant HGT into the mtDNA of Amborella best explains phylogenetic incongruence between mitochondrial gene trees for angiosperms. The only evidence for HGT into the Vitis mtDNA found involves fragments of two coding sequences stemming from two closteroviruses that cause the leaf roll disease of this plant. We also report that analysis of sequences shared by both chloroplast and mitochondrial genomes provides evidence for a previously unknown gene transfer route from the mitochondrion to the chloroplast.

  8. A comprehensive analysis of mitochondrial genes variants and their association with antipsychotic-induced weight gain.

    PubMed

    Mittal, Kirti; Gonçalves, Vanessa F; Harripaul, Ricardo; Cuperfain, Ari B; Rollins, Brandi; Tiwari, Arun K; Zai, Clement C; Maciukiewicz, Malgorzata; Müller, Daniel J; Vawter, Marquis P; Kennedy, James L

    2017-09-01

    Antipsychotic Induced Weight Gain (AIWG) is a common and severe side effect of many antipsychotic medications. Mitochondria play a vital role for whole-body energy homeostasis and there is increasing evidence that antipsychotics modulate mitochondrial function. This study aimed to examine the role of variants in nuclear-encoded mitochondrial genes and the mitochondrial DNA (mtDNA) in conferring risk for AIWG. We selected 168 European-Caucasian individuals from the CATIE sample based upon meeting criteria of multiple weight measures while taking selected antipsychotics (risperidone, quetiapine or olanzapine). We tested the association of 670 nuclear-encoded mitochondrial genes with weight change (%) using MAGMA software. Thirty of these genes showed nominally significant P-values (<0.05). We were able to replicate the association of three genes, CLPB, PARL, and ACAD10, with weight change (%) in an independent prospectively assessed AIWG sample. We analyzed mtDNA variants in a subset of 74 of these individuals using next-generation sequencing. No common or rare mtDNA variants were found to be significantly associated with weight change (%) in our sample. Additionally, analysis of mitochondrial haplogroups showed no association with weight change (%). In conclusion, our findings suggest nuclear-encoded mitochondrial genes play a role in AIWG. Replication in larger sample is required to validate our initial report of mtDNA variants in AIWG. Copyright © 2017 Elsevier B.V. All rights reserved.

  9. Sessile snails, dynamic genomes: gene rearrangements within the mitochondrial genome of a family of caenogastropod molluscs.

    PubMed

    Rawlings, Timothy A; MacInnis, Martin J; Bieler, Rüdiger; Boore, Jeffrey L; Collins, Timothy M

    2010-07-19

    Widespread sampling of vertebrates, which comprise the majority of published animal mitochondrial genomes, has led to the view that mitochondrial gene rearrangements are relatively rare, and that gene orders are typically stable across major taxonomic groups. In contrast, more limited sampling within the Phylum Mollusca has revealed an unusually high number of gene order arrangements. Here we provide evidence that the lability of the molluscan mitochondrial genome extends to the family level by describing extensive gene order changes that have occurred within the Vermetidae, a family of sessile marine gastropods that radiated from a basal caenogastropod stock during the Cenozoic Era. Major mitochondrial gene rearrangements have occurred within this family at a scale unexpected for such an evolutionarily young group and unprecedented for any caenogastropod examined to date. We determined the complete mitochondrial genomes of four species (Dendropoma maximum, D. gregarium, Eualetes tulipa, and Thylacodes squamigerus) and the partial mitochondrial genomes of two others (Vermetus erectus and Thylaeodus sp.). Each of the six vermetid gastropods assayed possessed a unique gene order. In addition to the typical mitochondrial genome complement of 37 genes, additional tRNA genes were evident in D. gregarium (trnK) and Thylacodes squamigerus (trnV, trnLUUR). Three pseudogenes and additional tRNAs found within the genome of Thylacodes squamigerus provide evidence of a past duplication event in this taxon. Likewise, high sequence similarities between isoaccepting leucine tRNAs in Thylacodes, Eualetes, and Thylaeodus suggest that tRNA remolding has been rife within this family. While vermetids exhibit gene arrangements diagnostic of this family, they also share arrangements with littorinimorph caenogastropods, with which they have been linked based on sperm morphology and primary sequence-based phylogenies. We have uncovered major changes in gene order within a family of

  10. Sessile snails, dynamic genomes: gene rearrangements within the mitochondrial genome of a family of caenogastropod molluscs

    PubMed Central

    2010-01-01

    Background Widespread sampling of vertebrates, which comprise the majority of published animal mitochondrial genomes, has led to the view that mitochondrial gene rearrangements are relatively rare, and that gene orders are typically stable across major taxonomic groups. In contrast, more limited sampling within the Phylum Mollusca has revealed an unusually high number of gene order arrangements. Here we provide evidence that the lability of the molluscan mitochondrial genome extends to the family level by describing extensive gene order changes that have occurred within the Vermetidae, a family of sessile marine gastropods that radiated from a basal caenogastropod stock during the Cenozoic Era. Results Major mitochondrial gene rearrangements have occurred within this family at a scale unexpected for such an evolutionarily young group and unprecedented for any caenogastropod examined to date. We determined the complete mitochondrial genomes of four species (Dendropoma maximum, D. gregarium, Eualetes tulipa, and Thylacodes squamigerus) and the partial mitochondrial genomes of two others (Vermetus erectus and Thylaeodus sp.). Each of the six vermetid gastropods assayed possessed a unique gene order. In addition to the typical mitochondrial genome complement of 37 genes, additional tRNA genes were evident in D. gregarium (trnK) and Thylacodes squamigerus (trnV, trnLUUR). Three pseudogenes and additional tRNAs found within the genome of Thylacodes squamigerus provide evidence of a past duplication event in this taxon. Likewise, high sequence similarities between isoaccepting leucine tRNAs in Thylacodes, Eualetes, and Thylaeodus suggest that tRNA remolding has been rife within this family. While vermetids exhibit gene arrangements diagnostic of this family, they also share arrangements with littorinimorph caenogastropods, with which they have been linked based on sperm morphology and primary sequence-based phylogenies. Conclusions We have uncovered major changes in gene

  11. Extraordinary number of gene rearrangements in the mitochondrial genomes of lice (Phthiraptera: Insecta).

    PubMed

    Covacin, C; Shao, R; Cameron, S; Barker, S C

    2006-02-01

    The arrangement of genes in the mitochondrial (mt) genomes of most insects is the same, or near-identical, to that inferred to be ancestral for insects. We sequenced the entire mt genome of the small pigeon louse, Campanulotes bidentatus compar, and part of the mt genomes of nine other species of lice. These species were from six families and the three main suborders of the order Phthiraptera. There was no variation in gene arrangement among species within a family but there was much variation in gene arrangement among the three suborders of lice. There has been an extraordinary number of gene rearrangements in the mitochondrial genomes of lice!

  12. Establishment of mitochondrial pyruvate carrier 1 (MPC1) gene knockout mice with preliminary gene function analyses

    PubMed Central

    Li, Xiaoli; Li, Yaqing; Han, Gaoyang; Li, Xiaoran; Ji, Yasai; Fan, Zhirui; Zhong, Yali; Cao, Jing; Zhao, Jing; Mariusz, Goscinski; Zhang, Mingzhi; Wen, Jianguo; Nesland, Jahn M.; Suo, Zhenhe

    2016-01-01

    Pyruvate plays a critical role in the mitochondrial tricarboxylic acid (TCA) cycle, and it is the center product for the synthesis of amino acids, carbohydrates and fatty acids. Pyruvate transported across the inner mitochondrial membrane appears to be essential in anabolic and catabolic intermediary metabolism. The mitochondrial pyruvate carrier (MPC) mounted in the inner membrane of mitochondria serves as the channel to facilitate pyruvate permeating. In mammals, the MPC is formed by two paralogous subunits, MPC1 and MPC2. It is known that complete ablation of MPC2 in mice causes death on the 11th or 12th day of the embryonic period. However, MPC1 deletion and the knowledge of gene function in vivo are lacking. Using the new technology of gene manipulation known as Clustered Regularly Interspaced Short Palindromic Repeats/CRISPR-associated 9 (CRISPR/Cas9) systems, we gained stable MPC1 gene heterozygous mutation mice models, and the heterozygous mutations could be stably maintained in their offsprings. Only one line with homozygous 27 bases deletion in the first exon was established, but no offsprings could be obtained after four months of mating experiments, indicating infertility of the mice with such homozygous deletion. The other line of MPC1 knockout (KO) mice was only heterozygous, which mutated in the first exon with a terminator shortly afterwards. These two lines of MPC1 KO mice showed lower fertility and significantly higher bodyweight in the females. We concluded that heterozygous MPC1 KO weakens fertility and influences the metabolism of glucose and fatty acid and bodyweight in mice. PMID:27835892

  13. Computer prediction of peptide maps: assignment of polypeptides to human and mouse mitochondrial DNA genes by analysis of two-dimensional-proteolytic digest gels.

    PubMed Central

    Wallace, D C; Yang, J H; Ye, J H; Lott, M T; Oliver, N A; McCarthy, J

    1986-01-01

    We have prepared a computer program that predicts complete and partial peptide maps from amino acid sequences. The program fragments amino acid sequences at designated cleavage sites and calculates the molecular weight and relative labeling of each peptide. These data are graphed as log molecular weight of the original protein (X-axis) vs. log molecular weight of the component peptides (Y-axis). The program is interactive, permitting adjustment of a number of graphic parameters and alteration of the position of proteins in the first dimension to accommodate aberrations in protein mobility. The program has been used to predict the V8 protease peptide maps of the 13 open reading frames (ORFs) identified in the human and the mouse mitochondrial DNA (mtDNA) sequences. The results were compared to the V8 protease peptide maps obtained for mouse and human mitochondrially synthesized proteins by two-dimensional proteolytic digest gels. A high correlation was observed between the predicted and observed peptide maps. These results suggest the assignment of several proteins to mtDNA genes. Images Fig. 1 Fig. 2 Fig. 3 Fig. 4 PMID:3518425

  14. Weigh and wait: the prospect of mitochondrial gene replacement.

    PubMed

    Xu, Liang; Shi, Rui

    2016-12-01

    Mitochondrial DNA transfer has recently received attention from physicians. The transfer techniques place genetic material from the egg nucleus of a woman with a mitochondrial DNA mutation into a healthy donated egg from which the nuclear DNA was removed. This technology intends to reconstruct a mitochondria-competent egg to produce a baby. Three approaches: (1) pronuclear transfer; (2) metaphase II spindle transfer (ST); and (3) polar body (PB) transfer, have been proposed and applied in animal models with very low levels of heteroplasmy. Because there is no curative treatment for patients with mitochondrial dysfunction, the UK government has allowed the use of this pioneering technique to prevent the transmission of rare and devastating mitochondrial diseases. Despite general safety in the observation period, this technology involves germline modification, raising scientific and ethical questions in the public. In this review, we focus on this unprecedented technology and discuss its clinical application in the future.

  15. Molecular cloning, sequencing analysis, and chromosomal localization of the human protease inhibitor 4 (Kallistatin) gene (P14)

    SciTech Connect

    Chai, K.X.; Chao, J.; Chao, L.; Ward, D.C.

    1994-09-15

    The gene encoding human protease inhibitor 4 (kallistatin; gene symbol PI4), a novel serine proteinase inhibitor (serpin), has been isolated and completely sequenced. The kallistatin gene is 9618 bp in length and contains five exons and four introns. The structure and organization of the kallistatin gene are similar to those of the genes encoding {alpha}{sub 1}-antichymotrypsin. The kallistatin gene is also similar to the genes encoding rat and mouse kallikrein-binding proteins. The first exon of the kallistatin gene is a noncoding 89-bp fragment, as determined by primer extension. The fifth exon, which contains 308 bp of noncoding sequence, encodes the reactive center of kallistatin. In the 5`-flanking region of the kallistatin gene, 1125 bp have been sequenced and a consensus promoter segment with potential transcription regulatory sites, including CAAT and TATA boxes, an AP-2 binding site, a GC-rich region, a cAMP response element, and an AP-1 binding site, has been identified within this region. The kallistatin gene was localized by in situ hybridization to human chromosome 14q31-132.1, close to the serpin genes encoding {alpha}{sub 1}-antichymotrypsin, protein C inhibitor, {alpha}{sub 1}-antitrypsin, and corticosteroid-binding globulin. In a genomic DNA Southern blot, kallistatin-related genes were identified in monkey, mouse, rat, bovine, dog, cat, and a ground mole. The patterns of hybridization revealed clues of human serpin evolution. 34 refs., 6 figs.

  16. Proteins interacting with mitochondrial ATP-dependent Lon protease (MAP1) in Magnaporthe oryzae are involved in rice blast disease.

    PubMed

    Cui, Xiao; Wei, Yi; Wang, Yu-Han; Li, Jian; Wong, Fuk-Ling; Zheng, Ya-Jie; Yan, Hai; Liu, Shao-Shuai; Liu, Jin-Liang; Jia, Bao-Lei; Zhang, Shi-Hong

    2015-10-01

    The ATP-dependent Lon protease is involved in many physiological processes. In bacteria, Lon regulates pathogenesis and, in yeast, Lon protects mitochondia from oxidative damage. However, little is known about Lon in fungal phytopathogens. MAP1, a homologue of Lon in Magnaporthe oryzae, was recently identified to be important for stress resistance and pathogenesis. Here, we focus on a novel pathogenic pathway mediated by MAP1. Based on an interaction system between rice and a tandem affinity purification (TAP)-tagged MAP1 complementation strain, we identified 23 novel fungal proteins from infected leaves using a TAP approach with mass spectrometry, and confirmed that 14 of these proteins physically interact with MAP1 in vivo. Among these 14 proteins, 11 candidates, presumably localized to the mitochondria, were biochemically determined to be substrates of MAP1 hydrolysis. Deletion mutants were created and functionally analysed to further confirm the involvement of these proteins in pathogenesis. The results indicated that all mutants showed reduced conidiation and sensitivity to hydrogen peroxide. Appressorial formations were not affected, although conidia from certain mutants were morphologically altered. In addition, virulence was reduced in four mutants, enhanced (with lesions forming earlier) in two mutants and remained unchanged in one mutant. Together with the known virulence-related proteins alternative oxidase and enoyl-CoA hydratase, we propose that most of the Lon-interacting proteins are involved in the pathogenic regulation pathway mediated by MAP1 in M. oryzae. Perturbation of this pathway may represent an effective approach for the inhibition of rice blast disease. © 2015 BSPP AND JOHN WILEY & SONS LTD.

  17. Phylogenetic incongruence inferred with two mitochondrial genes in Mepraia spp. and Triatoma eratyrusiformis(Hemiptera, Reduviidae)

    PubMed Central

    Campos-Soto, Ricardo; Torres-Pérez, Fernando; Solari, Aldo

    2015-01-01

    Mitochondrial DNA (mtDNA) is widely used to clarify phylogenetic relationships among and within species, and to determine population structure. Due to the linked nature of mtDNA genes it is expected that different genes will show similar results. Phylogenetic incongruence using mtDNA genes may result from processes such as heteroplasmy, nuclear integration of mitochondrial genes, polymerase errors, contamination, and recombination. In this study we used sequences from two mitochondrial genes (cytochrome b and cytochrome oxidase subunit I) from the wild vectors of Chagas disease, Triatoma eratyrusiformis and Mepraia species to test for topological congruence. The results showed some cases of phylogenetic incongruence due to misplacement of four haplotypes of four individuals. We discuss the possible causes of such incongruence and suggest that the explanation is an intra-individual variation likely due to heteroplasmy. This phenomenon is an independent evidence of common ancestry between these taxa. PMID:26500444

  18. Loss of mitochondrial protease OMA1 alters processing of the GTPase OPA1 and causes obesity and defective thermogenesis in mice

    PubMed Central

    Quirós, Pedro M; Ramsay, Andrew J; Sala, David; Fernández-Vizarra, Erika; Rodríguez, Francisco; Peinado, Juan R; Fernández-García, Maria Soledad; Vega, José A; Enríquez, José A; Zorzano, Antonio; López-Otín, Carlos

    2012-01-01

    Mitochondria are dynamic subcellular organelles that convert nutrient intermediates into readily available energy equivalents. Optimal mitochondrial function is ensured by a highly evolved quality control system, coordinated by protein machinery that regulates a process of continual fusion and fission. In this work, we provide in vivo evidence that the ATP-independent metalloprotease OMA1 plays an essential role in the proteolytic inactivation of the dynamin-related GTPase OPA1 (optic atrophy 1). We also show that OMA1 deficiency causes a profound perturbation of the mitochondrial fusion–fission equilibrium that has important implications for metabolic homeostasis. Thus, ablation of OMA1 in mice results in marked transcriptional changes in genes of lipid and glucose metabolic pathways and substantial alterations in circulating blood parameters. Additionally, Oma1-mutant mice exhibit an increase in body weight due to increased adipose mass, hepatic steatosis, decreased energy expenditure and impaired thermogenenesis. These alterations are especially significant under metabolic stress conditions, indicating that an intact OMA1-OPA1 system is essential for developing the appropriate adaptive response to different metabolic stressors such as a high-fat diet or cold-shock. This study provides the first description of an unexpected role in energy metabolism for the metalloprotease OMA1 and reinforces the importance of mitochondrial quality control for normal metabolic function. PMID:22433842

  19. Loss of mitochondrial protease OMA1 alters processing of the GTPase OPA1 and causes obesity and defective thermogenesis in mice.

    PubMed

    Quirós, Pedro M; Ramsay, Andrew J; Sala, David; Fernández-Vizarra, Erika; Rodríguez, Francisco; Peinado, Juan R; Fernández-García, Maria Soledad; Vega, José A; Enríquez, José A; Zorzano, Antonio; López-Otín, Carlos

    2012-05-02

    Mitochondria are dynamic subcellular organelles that convert nutrient intermediates into readily available energy equivalents. Optimal mitochondrial function is ensured by a highly evolved quality control system, coordinated by protein machinery that regulates a process of continual fusion and fission. In this work, we provide in vivo evidence that the ATP-independent metalloprotease OMA1 plays an essential role in the proteolytic inactivation of the dynamin-related GTPase OPA1 (optic atrophy 1). We also show that OMA1 deficiency causes a profound perturbation of the mitochondrial fusion-fission equilibrium that has important implications for metabolic homeostasis. Thus, ablation of OMA1 in mice results in marked transcriptional changes in genes of lipid and glucose metabolic pathways and substantial alterations in circulating blood parameters. Additionally, Oma1-mutant mice exhibit an increase in body weight due to increased adipose mass, hepatic steatosis, decreased energy expenditure and impaired thermogenenesis. These alterations are especially significant under metabolic stress conditions, indicating that an intact OMA1-OPA1 system is essential for developing the appropriate adaptive response to different metabolic stressors such as a high-fat diet or cold-shock. This study provides the first description of an unexpected role in energy metabolism for the metalloprotease OMA1 and reinforces the importance of mitochondrial quality control for normal metabolic function.

  20. Classical and Novel TSPO Ligands for the Mitochondrial TSPO Can Modulate Nuclear Gene Expression: Implications for Mitochondrial Retrograde Signaling.

    PubMed

    Yasin, Nasra; Veenman, Leo; Singh, Sukhdev; Azrad, Maya; Bode, Julia; Vainshtein, Alex; Caballero, Beatriz; Marek, Ilan; Gavish, Moshe

    2017-04-07

    It is known that knockdown of the mitochondrial 18 kDa translocator protein (TSPO) as well as TSPO ligands modulate various functions, including functions related to cancer. To study the ability of TSPO to regulate gene expression regarding such functions, we applied microarray analysis of gene expression to U118MG glioblastoma cells. Within 15 min, the classical TSPO ligand PK 11195 induced changes in expression of immediate early genes and transcription factors. These changes also included gene products that are part of the canonical pathway serving to modulate general gene expression. These changes are in accord with real-time, reverse transcriptase (RT) PCR. At the time points of 15, 30, 45, and 60 min, as well as 3 and 24 h of PK 11195 exposure, the functions associated with the changes in gene expression in these glioblastoma cells covered well known TSPO functions. These functions included cell viability, proliferation, differentiation, adhesion, migration, tumorigenesis, and angiogenesis. This was corroborated microscopically for cell migration, cell accumulation, adhesion, and neuronal differentiation. Changes in gene expression at 24 h of PK 11195 exposure were related to downregulation of tumorigenesis and upregulation of programmed cell death. In the vehicle treated as well as PK 11195 exposed cell cultures, our triple labeling showed intense TSPO labeling in the mitochondria but no TSPO signal in the cell nuclei. Thus, mitochondrial TSPO appears to be part of the mitochondria-to-nucleus signaling pathway for modulation of nuclear gene expression. The novel TSPO ligand 2-Cl-MGV-1 appeared to be very specific regarding modulation of gene expression of immediate early genes and transcription factors.

  1. The natural killer cell serine protease gene Lmet1 maps to mouse chromosome 10

    SciTech Connect

    Thia, K.Y.T.; Smyth, M.J.; Jenkins, N.A.; Gilbert, D.J.; Copeland, N.G.

    1995-01-01

    Cytotoxic lymphocytes play a key role in immune responses against viruses and tumors. Lymphocyte-mediated cytolysis by both cytotoxic T lymphocytes (CTL) and natural killer (NK) cells is often associated with the formation of membrane lesions on target cells caused by exocytosis of cytoplasmic granule serine proteases and a pore-forming protein, perforin. A variety of granzymes have been found to reside within the cytoplasmic granules of cytotoxic lymphocytes, but unlike perforin, isolated serine proteases are not intrinsically lytic. However, a role for serine proteases in cellular cytotoxicity has been supported by the ability of protease inhibitors to completely abrogate lymphocyte cytotoxicity, and the demonstration that serine proteases can initiate DNA fragmentation in target cells transfected or pretreated with a sublytic concentration of perforin. Granzymes cloned in human, mouse, and rat encode four granzyme activities and all are expressed in either T cells, their thymic precursors, and/or NK cells. In particular, a rat granzyme that cleaves after methionine residues, but not phenylalanine residues and its human equivalent, human Met-ase 1, are unique granzymes with restricted expression in CD3-NK cells. 24 refs., 2 figs.

  2. Plasmodium vivax rhomboid-like protease 1 gene diversity in Thailand.

    PubMed

    Mataradchakul, Touchchapol; Uthaipibull, Chairat; Nosten, Francois; Vega-Rodriguez, Joel; Jacobs-Lorena, Marcelo; Lek-Uthai, Usa

    2017-10-01

    Plasmodium vivax infection remains a major public health problem, especially along the Thailand border regions. We examined the genetic diversity of this parasite by analyzing single-nucleotide polymorphisms (SNPs) of the P. vivax rhomboid-like protease 1 gene (Pvrom1) in parasites collected from western (Tak province, Thai-Myanmar border) and eastern (Chanthaburi province, Thai-Cambodia border) regions. Data were collected by a cross-sectional survey, consisting of 47 and 45 P. vivax-infected filter paper-spotted blood samples from the western and eastern regions of Thailand, respectively during September 2013 to May 2014. Extracted DNA was examined for presence of P. vivax using Plasmodium species-specific nested PCR. Pvrom1 gene was PCR amplified, sequenced and the SNP diversity was analyzed using F-STAT, DnaSP, MEGA and LIAN programs. Comparison of sequences of the 92 Pvrom1 831-base open reading frames with that of a reference sequence (GenBank acc. no. XM001615211) revealed 17 samples with a total of 8 polymorphic sites, consisting of singleton (exon 3, nt 645) and parsimony informative (exon 1, nt 22 and 39; exon 3, nt 336, 537 and 656; and exon 4, nt 719 and 748) sites, which resulted in six different deduced Pvrom1 variants. Non-synonymous to synonymous substitutions ratio estimated by the DnaSP program was 1.65 indicating positive selection, but the Z-tests of selection showed no significant deviations from neutrality for Pvrom1 samples from western region of Thailand. In addition McDonald Kreitman test (MK) showed not significant, and Fst values are not different between the two regions and the regions combined. Interestingly, only Pvrom1 exon 2 was the most conserved sequences among the four exons. The relatively high degree of Pvrom1 polymorphism suggests that the protein is important for parasite survival in face of changes in both insect vector and human populations. These polymorphisms could serve as a sensitive marker for studying plasmodial

  3. Extensive variation in synonymous substitution rates in mitochondrial genes of seed plants.

    PubMed

    Mower, Jeffrey P; Touzet, Pascal; Gummow, Julie S; Delph, Lynda F; Palmer, Jeffrey D

    2007-08-09

    It has long been known that rates of synonymous substitutions are unusually low in mitochondrial genes of flowering and other land plants. Although two dramatic exceptions to this pattern have recently been reported, it is unclear how often major increases in substitution rates occur during plant mitochondrial evolution and what the overall magnitude of substitution rate variation is across plants. A broad survey was undertaken to evaluate synonymous substitution rates in mitochondrial genes of angiosperms and gymnosperms. Although most taxa conform to the generality that plant mitochondrial sequences evolve slowly, additional cases of highly accelerated rates were found. We explore in detail one of these new cases, within the genus Silene. A roughly 100-fold increase in synonymous substitution rate is estimated to have taken place within the last 5 million years and involves only one of ten species of Silene sampled in this study. Examples of unusually slow sequence evolution were also identified. Comparison of the fastest and slowest lineages shows that synonymous substitution rates vary by four orders of magnitude across seed plants. In other words, some plant mitochondrial lineages accumulate more synonymous change in 10,000 years than do others in 100 million years. Several perplexing cases of gene-to-gene variation in sequence divergence within a plant were uncovered. Some of these probably reflect interesting biological phenomena, such as horizontal gene transfer, mitochondrial-to-nucleus transfer, and intragenomic variation in mitochondrial substitution rates, whereas others are likely the result of various kinds of errors. The extremes of synonymous substitution rates measured here constitute by far the largest known range of rate variation for any group of organisms. These results highlight the utility of examining absolute substitution rates in a phylogenetic context rather than by traditional pairwise methods. Why substitution rates are generally so low

  4. Analysis of nuclear and mitochondrial genes in patients with pseudoexfoliation glaucoma

    PubMed Central

    Morales, Jose

    2008-01-01

    Purpose Pseudoexfoliation glaucoma (PEG) is the most prevalent secondary open angle glaucoma occurring worldwide. The search for a genetic cause in PEG has been largely unsuccessful despite evidence of hereditary transmission. Methods The nuclear genes MYOC, OPTN, WDR36, CYP1B1, OPA1, and OPA3 were sequenced in patients with PEG. The entire mitochondrial DNA (mtDNA) coding region was also sequenced, relative mtDNA content was investigated, and mitochondrial respiration was assessed. Results No novel or previously reported mutations were present in the nuclear genes MYOC, OPTN, CYP1B1, WDR36, OPA1, or OPA3 in 29 PEG patients. Twenty-six patients (89.7%) had no pathological or potentially pathological mtDNA mutation(s); however, three patients (10.3%) had potentially pathologic mtDNA nucleotide changes not found in controls. PEG patients did not differ significantly from controls in relative mitochondrial content (p=0.98) or in mitochondrial respiratory activity (p=0.18). Conclusions These PEG patients had no mutations in nuclear genes associated with other types of glaucoma or other inherited optic neuropathies, and there was little evidence of mitochondrial abnormalities. These results imply that the nuclear genes and mitochondrial parameters evaluated here are less important determinants of PEG than other factors related to the presence of pseudoexfoliation material. PMID:18246027

  5. A high-fat diet coordinately downregulates genes required for mitochondrial oxidative phosphorylation in skeletal muscle.

    PubMed

    Sparks, Lauren M; Xie, Hui; Koza, Robert A; Mynatt, Randall; Hulver, Matthew W; Bray, George A; Smith, Steven R

    2005-07-01

    Obesity and type 2 diabetes have been associated with a high-fat diet (HFD) and reduced mitochondrial mass and function. We hypothesized a HFD may affect expression of genes involved in mitochondrial function and biogenesis. To test this hypothesis, we fed 10 insulin-sensitive males an isoenergetic HFD for 3 days with muscle biopsies before and after intervention. Oligonucleotide microarray analysis revealed 297 genes were differentially regulated by the HFD (Bonferonni adjusted P < 0.001). Six genes involved in oxidative phosphorylation (OXPHOS) decreased. Four were members of mitochondrial complex I: NDUFB3, NDUFB5, NDUFS1, and NDUFV1; one was SDHB in complex II and a mitochondrial carrier protein SLC25A12. Peroxisome proliferator-activated receptor gamma coactivator-1 (PGC1) alpha and PGC1beta mRNA were decreased by -20%, P < 0.01, and -25%, P < 0.01, respectively. In a separate experiment, we fed C57Bl/6J mice a HFD for 3 weeks and found that the same OXPHOS and PGC1 mRNAs were downregulated by approximately 90%, cytochrome C and PGC1alpha protein by approximately 40%. Combined, these results suggest a mechanism whereby HFD downregulates genes necessary for OXPHOS and mitochondrial biogenesis. These changes mimic those observed in diabetes and insulin resistance and, if sustained, may result in mitochondrial dysfunction in the prediabetic/insulin-resistant state.

  6. Sensitivity of hematopoietic stem cells to mitochondrial dysfunction by SdhD gene deletion

    PubMed Central

    Bejarano-García, José Antonio; Millán-Uclés, África; Rosado, Iván V; Sánchez-Abarca, Luís Ignacio; Caballero-Velázquez, Teresa; Durán-Galván, María José; Pérez-Simón, José Antonio; Piruat, José I

    2016-01-01

    It is established that hematopoietic stem cells (HSC) in the hypoxic bone marrow have adapted their metabolism to oxygen-limiting conditions. This adaptation includes suppression of mitochondrial activity, induction of anerobic glycolysis, and activation of hypoxia-inducible transcription factor 1α (Hif1α)-dependent gene expression. During progression of hematopoiesis, a metabolic switch towards mitochondrial oxidative phosphorylation is observed, making this organelle essential for determining cell fate choice in bone marrow. However, given that HSC metabolism is essentially oxygen-independent, it is still unclear whether functional mitochondria are absolutely required for their survival. To assess the actual dependency of these undifferentiated cells on mitochondrial function, we have performed an analysis of the hematopoiesis in a mouse mutant, named SDHD-ESR, with inducible deletion of the mitochondrial protein-encoding SdhD gene. This gene encodes one of the subunits of the mitochondrial complex II (MCII). In this study, we demonstrate that, in contrast to what has been previously established, survival of HSC, and also myeloid and B-lymphoid progenitors, depends on proper mitochondrial activity. In addition, gene expression analysis of these hematopoietic lineages in SDHD-ESR mutants calls into question the proposed activation of Hif1α in response to MCII dysfunction. PMID:27929539

  7. Complete mitochondrial genomes of Trisidos kiyoni and Potiarca pilula: Varied mitochondrial genome size and highly rearranged gene order in Arcidae

    PubMed Central

    Sun, Shao’e; Li, Qi; Kong, Lingfeng; Yu, Hong

    2016-01-01

    We present the complete mitochondrial genomes (mitogenomes) of Trisidos kiyoni and Potiarca pilula, both important species from the family Arcidae (Arcoida: Arcacea). Typical bivalve mtDNA features were described, such as the relatively conserved gene number (36 and 37), a high A + T content (62.73% and 61.16%), the preference for A + T-rich codons, and the evidence of non-optimal codon usage. The mitogenomes of Arcidae species are exceptional for their extraordinarily large and variable sizes and substantial gene rearrangements. The mitogenome of T. kiyoni (19,614 bp) and P. pilula (28,470 bp) are the two smallest Arcidae mitogenomes. The compact mitogenomes are weakly associated with gene number and primarily reflect shrinkage of the non-coding regions. The varied size in Arcidae mitogenomes reflect a dynamic history of expansion. A significant positive correlation is observed between mitogenome size and the combined length of cox1-3, the lengths of Cytb, and the combined length of rRNAs (rrnS and rrnL) (P < 0.001). Both protein coding genes (PCGs) and tRNA rearrangements is observed in P. pilula and T. kiyoni mitogenomes. This analysis imply that the complicated gene rearrangement in mitochondrial genome could be considered as one of key characters in inferring higher-level phylogenetic relationship of Arcidae. PMID:27653979

  8. Mitochondrial DNA haplotypes induce differential patterns of DNA methylation that result in differential chromosomal gene expression patterns

    PubMed Central

    Lee, William T; Sun, Xin; Tsai, Te-Sha; Johnson, Jacqueline L; Gould, Jodee A; Garama, Daniel J; Gough, Daniel J; McKenzie, Matthew; Trounce, Ian A; St. John, Justin C

    2017-01-01

    Mitochondrial DNA copy number is strictly regulated during development as naive cells differentiate into mature cells to ensure that specific cell types have sufficient copies of mitochondrial DNA to perform their specialised functions. Mitochondrial DNA haplotypes are defined as specific regions of mitochondrial DNA that cluster with other mitochondrial sequences to show the phylogenetic origins of maternal lineages. Mitochondrial DNA haplotypes are associated with a range of phenotypes and disease. To understand how mitochondrial DNA haplotypes induce these characteristics, we used four embryonic stem cell lines that have the same set of chromosomes but possess different mitochondrial DNA haplotypes. We show that mitochondrial DNA haplotypes influence changes in chromosomal gene expression and affinity for nuclear-encoded mitochondrial DNA replication factors to modulate mitochondrial DNA copy number, two events that act synchronously during differentiation. Global DNA methylation analysis showed that each haplotype induces distinct DNA methylation patterns, which, when modulated by DNA demethylation agents, resulted in skewed gene expression patterns that highlight the effectiveness of the new DNA methylation patterns established by each haplotype. The haplotypes differentially regulate α-ketoglutarate, a metabolite from the TCA cycle that modulates the TET family of proteins, which catalyse the transition from 5-methylcytosine, indicative of DNA methylation, to 5-hydroxymethylcytosine, indicative of DNA demethylation. Our outcomes show that mitochondrial DNA haplotypes differentially modulate chromosomal gene expression patterns of naive and differentiating cells by establishing mitochondrial DNA haplotype-specific DNA methylation patterns. PMID:28900542

  9. Global variability in gene expression and alternative splicing is modulated by mitochondrial content.

    PubMed

    Guantes, Raul; Rastrojo, Alberto; Neves, Ricardo; Lima, Ana; Aguado, Begoña; Iborra, Francisco J

    2015-05-01

    Noise in gene expression is a main determinant of phenotypic variability. Increasing experimental evidence suggests that genome-wide cellular constraints largely contribute to the heterogeneity observed in gene products. It is still unclear, however, which global factors affect gene expression noise and to what extent. Since eukaryotic gene expression is an energy demanding process, differences in the energy budget of each cell could determine gene expression differences. Here, we quantify the contribution of mitochondrial variability (a natural source of ATP variation) to global variability in gene expression. We find that changes in mitochondrial content can account for ∼50% of the variability observed in protein levels. This is the combined result of the effect of mitochondria dosage on transcription and translation apparatus content and activities. Moreover, we find that mitochondrial levels have a large impact on alternative splicing, thus modulating both the abundance and type of mRNAs. A simple mathematical model in which mitochondrial content simultaneously affects transcription rate and splicing site choice can explain the alternative splicing data. The results of this study show that mitochondrial content (and/or probably function) influences mRNA abundance, translation, and alternative splicing, which ultimately affects cellular phenotype.

  10. Global variability in gene expression and alternative splicing is modulated by mitochondrial content

    PubMed Central

    Guantes, Raul; Rastrojo, Alberto; Neves, Ricardo; Lima, Ana; Aguado, Begoña; Iborra, Francisco J.

    2015-01-01

    Noise in gene expression is a main determinant of phenotypic variability. Increasing experimental evidence suggests that genome-wide cellular constraints largely contribute to the heterogeneity observed in gene products. It is still unclear, however, which global factors affect gene expression noise and to what extent. Since eukaryotic gene expression is an energy demanding process, differences in the energy budget of each cell could determine gene expression differences. Here, we quantify the contribution of mitochondrial variability (a natural source of ATP variation) to global variability in gene expression. We find that changes in mitochondrial content can account for ∼50% of the variability observed in protein levels. This is the combined result of the effect of mitochondria dosage on transcription and translation apparatus content and activities. Moreover, we find that mitochondrial levels have a large impact on alternative splicing, thus modulating both the abundance and type of mRNAs. A simple mathematical model in which mitochondrial content simultaneously affects transcription rate and splicing site choice can explain the alternative splicing data. The results of this study show that mitochondrial content (and/or probably function) influences mRNA abundance, translation, and alternative splicing, which ultimately affects cellular phenotype. PMID:25800673

  11. The mitochondrial genome of the stramenopile alga Chrysodidymus synuroideus. Complete sequence, gene content and genome organization.

    PubMed

    Chesnick, J M; Goff, M; Graham, J; Ocampo, C; Lang, B F; Seif, E; Burger, G

    2000-07-01

    This is the first report of a complete mitochondrial genome sequence from a photosynthetic member of the stramenopiles, the chrysophyte alga Chrysodidymus synuroideus. The circular-mapping mitochondrial DNA (mtDNA) of 34 119 bp contains 58 densely packed genes (all without introns) and five unique open reading frames (ORFs). Protein genes code for components of respiratory chain complexes, ATP synthase and the mitoribosome, as well as one product of unknown function, encoded in many other protist mtDNAs (YMF16). In addition to small and large subunit ribosomal RNAs, 23 tRNAs are mtDNA-encoded, permitting translation of all codons present in protein-coding genes except ACN (Thr) and CGN (Arg). The missing tRNAs are assumed to be imported from the cytosol. Comparison of the C.SYNUROIDEUS: mtDNA with that of other stramenopiles allowed us to draw conclusions about mitochondrial genome organization, expression and evolution. First, we provide evidence that mitochondrial ORFs code for highly derived, unrecognizable versions of ribosomal or respiratory genes otherwise 'missing' in a particular mtDNA. Secondly, the observed constraints in mitochondrial genome rearrangements suggest operon-based, co-ordinated expression of genes functioning in common biological processes. Finally, stramenopile mtDNAs reveal an unexpectedly low variability in genome size and gene complement, testifying to substantial differences in the tempo of mtDNA evolution between major eukaryotic lineages.

  12. Brief Report: High Frequency of Biochemical Markers for Mitochondrial Dysfunction in Autism: No Association with the Mitochondrial Aspartate/Glutamate Carrier "SLC25A12" Gene

    ERIC Educational Resources Information Center

    Correia, Catarina; Coutinho, Ana M.; Diogo, Luisa; Grazina, Manuela; Marques, Carla; Miguel, Teresa; Ataide, Assuncao; Almeida, Joana; Borges, Luis; Oliveira, Catarina; Oliveira, Guiomar; Vicente, Astrid M.

    2006-01-01

    In the present study we confirm the previously reported high frequency of biochemical markers of mitochondrial dysfunction, namely hyperlactacidemia and increased lactate/pyruvate ratio, in a significant fraction of 210 autistic patients. We further examine the involvement of the mitochondrial aspartate/glutamate carrier gene ("SLC25A12") in…

  13. Brief Report: High Frequency of Biochemical Markers for Mitochondrial Dysfunction in Autism: No Association with the Mitochondrial Aspartate/Glutamate Carrier "SLC25A12" Gene

    ERIC Educational Resources Information Center

    Correia, Catarina; Coutinho, Ana M.; Diogo, Luisa; Grazina, Manuela; Marques, Carla; Miguel, Teresa; Ataide, Assuncao; Almeida, Joana; Borges, Luis; Oliveira, Catarina; Oliveira, Guiomar; Vicente, Astrid M.

    2006-01-01

    In the present study we confirm the previously reported high frequency of biochemical markers of mitochondrial dysfunction, namely hyperlactacidemia and increased lactate/pyruvate ratio, in a significant fraction of 210 autistic patients. We further examine the involvement of the mitochondrial aspartate/glutamate carrier gene ("SLC25A12") in…

  14. CRISPR/Cas9 and mitochondrial gene replacement therapy: promising techniques and ethical considerations

    PubMed Central

    Fogleman, Sarah; Santana, Casey; Bishop, Casey; Miller, Alyssa; Capco, David G

    2016-01-01

    Thousands of mothers are at risk of transmitting mitochondrial diseases to their offspring each year, with the most severe form of these diseases being fatal [1]. With no cure, transmission prevention is the only current hope for decreasing the disease incidence. Current methods of prevention rely on low mutant maternal mitochondrial DNA levels, while those with levels close to or above threshold (>60%) are still at a very high risk of transmission [2]. Two novel approaches may offer hope for preventing and treating mitochondrial disease: mitochondrial replacement therapy, and CRISPR/Cas9. Mitochondrial replacement therapy has emerged as a promising tool that has the potential to prevent transmission in patients with higher mutant mitochondrial loads. This method is the subject of many ethical concerns due its use of a donor embryo to transplant the patient’s nuclear DNA; however, it has ultimately been approved for use in the United Kingdom and was recently declared ethically permissible by the FDA. The leading-edge CRISPR/Cas9 technology exploits the principles of bacterial immune function to target and remove specific sequences of mutated DNA. This may have potential in treating individuals with disease caused by mutant mitochondrial DNA. As the technology progresses, it is important that the ethical considerations herein emerge and become more established. The purpose of this review is to discuss current research surrounding the procedure and efficacy of the techniques, compare the ethical concerns of each approach, and look into the future of mitochondrial gene replacement therapy. PMID:27725916

  15. CRISPR/Cas9 and mitochondrial gene replacement therapy: promising techniques and ethical considerations.

    PubMed

    Fogleman, Sarah; Santana, Casey; Bishop, Casey; Miller, Alyssa; Capco, David G

    2016-01-01

    Thousands of mothers are at risk of transmitting mitochondrial diseases to their offspring each year, with the most severe form of these diseases being fatal [1]. With no cure, transmission prevention is the only current hope for decreasing the disease incidence. Current methods of prevention rely on low mutant maternal mitochondrial DNA levels, while those with levels close to or above threshold (>60%) are still at a very high risk of transmission [2]. Two novel approaches may offer hope for preventing and treating mitochondrial disease: mitochondrial replacement therapy, and CRISPR/Cas9. Mitochondrial replacement therapy has emerged as a promising tool that has the potential to prevent transmission in patients with higher mutant mitochondrial loads. This method is the subject of many ethical concerns due its use of a donor embryo to transplant the patient's nuclear DNA; however, it has ultimately been approved for use in the United Kingdom and was recently declared ethically permissible by the FDA. The leading-edge CRISPR/Cas9 technology exploits the principles of bacterial immune function to target and remove specific sequences of mutated DNA. This may have potential in treating individuals with disease caused by mutant mitochondrial DNA. As the technology progresses, it is important that the ethical considerations herein emerge and become more established. The purpose of this review is to discuss current research surrounding the procedure and efficacy of the techniques, compare the ethical concerns of each approach, and look into the future of mitochondrial gene replacement therapy.

  16. Altered mitochondrial gene expression in the nonchromosomal stripe 2 mutant of maize

    PubMed Central

    Feiler, Heidi S.; Newton, Kathleen J.

    1987-01-01

    The genetic and molecular analyses of higher plant mitochondria can be facilitated by studying maternally-inherited mutations, such as the nonchromosomal stripe (NCS) mutants of maize, that have deleterious effects on plant growth. We have previously demonstrated a correlation between specific alterations in mitochondrial DNA and the expression of NCS phenotypes. In the present studies, the effects of the NCS2 mutation on mitochondrial gene expression are evaluated. Proteins synthesized by mitochondria isolated from NCS2 mutants and from related plants with normal growth have been compared. NCS2 mitochondria synthesize much reduced amounts of a single polypeptide. Probes corresponding to the mitochondrial DNA region altered in NCS2 hybridize to an aberrant set of transcripts in NCS2 mitochondria. Transcripts homologous to several previously characterized plant mitochondrial genes are similar in NCS2 and related non-mutant mitochondria. ImagesFig. 1.Fig. 2.Fig. 3.Fig. 4.Fig. 5. PMID:16453769

  17. Effects of dietary soybean stachyose and phytic acid on gene expressions of serine proteases in Japanese flounder ( Paralichthys olivaceus)

    NASA Astrophysics Data System (ADS)

    Mi, Haifeng; Mai, Kangsen; Zhang, Wenbing; Wu, Chenglong; Cai, Yinghua

    2011-09-01

    Soybean stachyose (SBS) and phytic acid (PA) are anti-nutritional factors (ANF) which have deleterious effects on the growth and digestibility in fish. The present research studied the effects of dietary SBS and PA on the expression of three serine protease genes in the liver of Japanese flounder ( Paralichthys olivaceus). These genes are trypsinogen 1 (poTRY), elastase 1 (poEL) and chymotrypsinogen 1 (poCTRY). Eight artificial diets with graded levels of supplemented ANFs were formulated to 4 levels of SBS (0.00, 0.40, 0.80 and 1.50%), 4 levels of PA (0.00, 0.20, 0.40 and 0.80), respectively. Japanese flounder (initial weight 2.45 g ± 0.01 g) were fed with these diets for 10 weeks with three replications per treatment. At the end of 10 weeks, supplementation of 0.40% of dietary SBS or PA significantly increased the gene expression of poTRY and poCTRY ( P<0.05). The same level of dietary SBS significantly decreased the gene expression of poEL. In comparison with the control group (ANF-free), dietary PA (0.2% and 0.8%) significantly decreased the gene expression of poTRY, poCTRY and poEL ( P<0.05). However, excessive supplement of dietary SBS (1.5%) has no significant effects on these gene expressions ( P>0.05). These results suggested that dietary SBS and dietary PA could directly affect the serine protease genes at the transcriptional level in Japanese flounder, and these genes' expression was more sensitive to dietary PA than to SBS under the current experimental conditions.

  18. Novel mutations in the TK2 gene associated with fatal mitochondrial DNA depletion myopathy.

    PubMed

    Blakely, Emma; He, Langping; Gardner, Julie L; Hudson, Gavin; Walter, John; Hughes, Imelda; Turnbull, Douglass M; Taylor, Robert W

    2008-07-01

    Mitochondrial DNA depletion syndromes are a heterogeneous group of childhood neurological disorders characterised by a quantitative abnormality of mitochondrial DNA. We describe two siblings who presented at 8 months and 14 months with myopathy, which rapidly progressed and resulted in death by respiratory failure at age 14 and 18 months, respectively. Muscle biopsy revealed marked respiratory chain defects, with real-time PCR confirming a dramatic depletion of mitochondrial DNA. Sequencing of the thymidine kinase 2 (TK2) gene revealed two, novel heterozygous mutations (p.Q87X and p.N100S) with parental DNA analysis confirming the transmission of mutated alleles.

  19. Uniparental Inheritance of Mitochondrial Genes in Yeast: Dependence on Input Bias of Mitochondrial DNA and Preliminary Investigations of the Mechanism

    PubMed Central

    Birky, C. William; Demko, Catherine A.; Perlman, Philip S.; Strausberg, Robert

    1978-01-01

    In Saccharomyces cerevisiae, previous studies on the inheritance of mitochondrial genes controlling antibiotic resistance have shown that some crosses produce a substantial number of uniparental zygotes , which transmit to their diploid progeny mitochondrial alleles from only one parent. In this paper, we show that uniparental zygotes are formed especially when one parent (majority parent) contributes substantially more mitochondrial DNA molecules to the zygote than does the other (minority) parent. Cellular contents of mitochondrial DNA (mtDNA) are increased in these experiments by treatment with cycloheximide, alpha-factor, or the uvsρ5 nuclear mutation. In such a biased cross, some zygotes are uniparental for mitochondrial alleles from the majority parent, and the frequency of such zygotes increases with increasing bias. In two- and three-factor crosses, the cap1, ery1, and oli1 loci behave coordinately, rather than independently; minority markers tend to be transmitted or lost as a unit, suggesting that the uniparental mechanism acts on entire mtDNA molecules rather than on individual loci. This rules out the possibility that uniparental inheritance can be explained by the conversion of minority markers to the majority alleles during recombination. Exceptions to the coordinate behavior of different loci can be explained by marker rescue via recombination. Uniparental inheritance is largely independent of the position of buds on the zygote. We conclude that it is due to the failure of minority markers to replicate in some zygotes, possibly involving the rapid enzymatic destruction of such markers. We have considered two general classes of mechanisms: (1) random selection of molecules for replication, as for example by competition for replicating sites on a membrane; and (2) differential marking of mtDNA molecules in the two parents, possibly by modification enzymes, followed by a mechanism that "counts" molecules and replicates only the majority type. These

  20. RNA sequencing reveals differential expression of mitochondrial and oxidation reduction genes in the long-lived naked mole-rat when compared to mice.

    PubMed

    Yu, Chuanfei; Li, Yang; Holmes, Andrew; Szafranski, Karol; Faulkes, Chris G; Coen, Clive W; Buffenstein, Rochelle; Platzer, Matthias; de Magalhães, João Pedro; Church, George M

    2011-01-01

    The naked mole-rat (Heterocephalus glaber) is a long-lived, cancer resistant rodent and there is a great interest in identifying the adaptations responsible for these and other of its unique traits. We employed RNA sequencing to compare liver gene expression profiles between naked mole-rats and wild-derived mice. Our results indicate that genes associated with oxidoreduction and mitochondria were expressed at higher relative levels in naked mole-rats. The largest effect is nearly 300-fold higher expression of epithelial cell adhesion molecule (Epcam), a tumour-associated protein. Also of interest are the protease inhibitor, alpha2-macroglobulin (A2m), and the mitochondrial complex II subunit Sdhc, both ageing-related genes found strongly over-expressed in the naked mole-rat. These results hint at possible candidates for specifying species differences in ageing and cancer, and in particular suggest complex alterations in mitochondrial and oxidation reduction pathways in the naked mole-rat. Our differential gene expression analysis obviated the need for a reference naked mole-rat genome by employing a combination of Illumina/Solexa and 454 platforms for transcriptome sequencing and assembling transcriptome contigs of the non-sequenced species. Overall, our work provides new research foci and methods for studying the naked mole-rat's fascinating characteristics.

  1. RNA Sequencing Reveals Differential Expression of Mitochondrial and Oxidation Reduction Genes in the Long-Lived Naked Mole-Rat When Compared to Mice

    PubMed Central

    Holmes, Andrew; Szafranski, Karol; Faulkes, Chris G.; Coen, Clive W.; Buffenstein, Rochelle; Platzer, Matthias; de Magalhães, João Pedro; Church, George M.

    2011-01-01

    The naked mole-rat (Heterocephalus glaber) is a long-lived, cancer resistant rodent and there is a great interest in identifying the adaptations responsible for these and other of its unique traits. We employed RNA sequencing to compare liver gene expression profiles between naked mole-rats and wild-derived mice. Our results indicate that genes associated with oxidoreduction and mitochondria were expressed at higher relative levels in naked mole-rats. The largest effect is nearly 300-fold higher expression of epithelial cell adhesion molecule (Epcam), a tumour-associated protein. Also of interest are the protease inhibitor, alpha2-macroglobulin (A2m), and the mitochondrial complex II subunit Sdhc, both ageing-related genes found strongly over-expressed in the naked mole-rat. These results hint at possible candidates for specifying species differences in ageing and cancer, and in particular suggest complex alterations in mitochondrial and oxidation reduction pathways in the naked mole-rat. Our differential gene expression analysis obviated the need for a reference naked mole-rat genome by employing a combination of Illumina/Solexa and 454 platforms for transcriptome sequencing and assembling transcriptome contigs of the non-sequenced species. Overall, our work provides new research foci and methods for studying the naked mole-rat's fascinating characteristics. PMID:22073188

  2. A Screen for Nigericin-Resistant Yeast Mutants Revealed Genes Controlling Mitochondrial Volume and Mitochondrial Cation Homeostasis

    PubMed Central

    Kucejova, Blanka; Kucej, Martin; Petrezselyova, Silvia; Abelovska, Lenka; Tomaska, Lubomir

    2005-01-01

    Little is known about the regulation of ion transport across the inner mitochondrial membrane in Saccharomyces cerevisiae. To approach this problem, we devised a screening procedure for facilitating the identification of proteins involved in mitochondrial ion homeostasis. Taking advantage of the growth inhibition of yeast cells by electroneutral K+/H+ ionophore nigericin, we screened for genetic mutations that would render cells tolerant to this drug when grown on a nonfermentable carbon source and identified several candidate genes including MDM31, MDM32, NDI1, YMR088C (VBA1), CSR2, RSA1, YLR024C, and YNL136W (EAF7). Direct examination of intact cells by electron microscopy indicated that mutants lacking MDM31 and/or MDM32 genes contain dramatically enlarged, spherical mitochondria and that these morphological abnormalities can be alleviated by nigericin. Mitochondria isolated from the Δmdm31 and Δmdm32 mutants exhibited limited swelling in an isotonic solution of potassium acetate even in the presence of an exogenous K+/H+ antiport. In addition, growth of the mutants was inhibited on ethanol-containing media in the presence of high concentrations of salts (KCl, NaCl, or MgSO4) and their mitochondria exhibited two- (Δmdm31 and Δmdm32) to threefold (Δmdm31Δmdm32) elevation in magnesium content. Taken together, these data indicate that Mdm31p and Mdm32p control mitochondrial morphology through regulation of mitochondrial cation homeostasis and the maintenance of proper matrix osmolarity. PMID:16020778

  3. Separate nuclear genes encode cytosolic and mitochondrial nucleoside diphosphate kinase in Dictyostelium discoideum.

    PubMed

    Troll, H; Winckler, T; Lascu, I; Müller, N; Saurin, W; Véron, M; Mutzel, R

    1993-12-05

    We have previously isolated cDNA clones for the gip17 gene encoding the cytosolic nucleoside diphosphate (NDP) kinase from Dictyostelium discoideum, and partial cDNAs for guk, a second member of the NDP kinase gene family (Wallet, V., Mutzel, R., Troll, H., Barzu, O., Wurster, B., Véron, M., and Lacombe, M. L. (1990) J. Natl. Cancer Inst. 80, 1199-1202). We now characterize genomic DNA clones for both NDP kinase genes, and we show that guk defines a nuclear-encoded mitochondrial NDP kinase. Isolated D. discoideum mitochondria contain 3% of the total cellular NDP kinase activity. Antibodies which specifically recognize and inhibit the activity of either cytosolic or mitochondrial NDP kinase unambiguously distinguish between these activities. The nascent mitochondrial NDP kinase contains a presequence of 57 amino acids that is removed during import into the organelle as shown by determination of the NH2 terminus of the mature protein from mitochondria. The genes for mitochondrial and cytosolic NDP kinases contain four and two introns, respectively. The positions of the of the introns in the gene for the cytosolic enzyme match exactly the positions of the second and fourth introns in the coding region of its mitochondrial homologue. From these results we conclude that the isozymes diverged from a common ancestor, and we discuss possible phylogenetic pathways for the evolution of cytosolic and organelle NDP kinases.

  4. Genome-wide identification, evolutuionary and expression analysis of aspartic proteases gene superfamily in grape

    USDA-ARS?s Scientific Manuscript database

    Aspartic proteases (APs) are a large family of proteolytic enzymes in vertebrates, plants, yeast, nematodes, parasites, fungi, and viruses. In plants, they are involved in many biological processes, such as plant senescence, stress response, programmed cell death, and reproduction. Prior to the pr...

  5. Insertion near the mitochondrial tyrosine tRNA gene in patients with mitochondrial diseases

    SciTech Connect

    Goto, Y.; Nonaka, I.; Horai, S.

    1994-09-01

    The 3243 mutation commonly found in patients with mitochondrial myopathy, encephalopathy, lactic acidosis, and stroke-like episodes (MELAS) has been occasionally detected in patients with chronic progressive external opthalmoplegia (CPEO). To elucidate the molecular mechanism underlying this phenomenon, an extensive mitochondrial (mt) DNA study was performed on such a patient (3243-CPEO). The newly discovered insertion was located in the noncoding region between cytrochrome c oxidase subunit 1 and tyrosine tRNA. The insertion was not found in 58 or 22 CPEO patients with or without mtDNA large-scale deletion but in another 3243-CPEO patient. In addition, the insertion was present in 1 of 116 normal Japanese, who had no 3243 mutation, and in 3 of 68 3243-MELAS patients. These results raise the possibility that the phenotypic expression of the 3243 mutation could be modulated or arranged by additional mtDNA mutations.

  6. Mutations in the mitochondrial 12S rRNA gene in elderly Chinese people.

    PubMed

    Zhu, Yuhua; Zhao, Jiandong; Feng, Bo; Su, Yu; Kang, Dongyang; Yuan, Huijun; Zhai, Suoqiang; Dai, Pu

    2015-01-01

    Our data indicate that the mitochondrial 12S rRNA gene, and particularly the A827G mutation, may be associated with susceptibility to age-related hearing loss. Hearing loss associated with aging is common among elderly persons. In all genetic backgrounds, mitochondrial DNA (mtDNA) mutations may be one of the most important factors contributing to aging and age-related hearing loss. The mitochondrial 12S rRNA is a hot spot for deafness-associated mutations in Chinese populations. The purpose of the present study was to elucidate the relationship of 12S rRNA gene polymorphisms and age-related hearing loss. The 12S rRNA gene polymorphisms were detected by direct sequencing. Statistical analyses were performed to assess the associations between age-related hearing loss and 12S rRNA gene variants. We report here a systematic mutational screening of the mitochondrial 12S rRNA gene in 662 elderly subjects from the general population with various hearing threshold levels (211 controls and 451 age-related hearing loss subjects). Mutational screening of the mitochondrial 12S rRNA gene identified 55 nucleotide changes, including 4 mutations localized at highly conserved sites and 51 known variants. Of the known deafness-associated mutations in the mitochondrial 12S rRNA gene, the incidence of the A1555G mutation was 0.15%, A827G was 4.38%, T1095C was 0.45%, and T1005C was 3.78%. The incidence of the other known variants was 0.15-99.85%. We found statistically significant differences in the proportions of subjects with the A827G mutation among the various age-related hearing loss groups and normal controls.

  7. Mitochondrial metagenomics: letting the genes out of the bottle.

    PubMed

    Crampton-Platt, Alex; Yu, Douglas W; Zhou, Xin; Vogler, Alfried P

    2016-01-01

    'Mitochondrial metagenomics' (MMG) is a methodology for shotgun sequencing of total DNA from specimen mixtures and subsequent bioinformatic extraction of mitochondrial sequences. The approach can be applied to phylogenetic analysis of taxonomically selected taxa, as an economical alternative to mitogenome sequencing from individual species, or to environmental samples of mixed specimens, such as from mass trapping of invertebrates. The routine generation of mitochondrial genome sequences has great potential both for systematics and community phylogenetics. Mapping of reads from low-coverage shotgun sequencing of environmental samples also makes it possible to obtain data on spatial and temporal turnover in whole-community phylogenetic and species composition, even in complex ecosystems where species-level taxonomy and biodiversity patterns are poorly known. In addition, read mapping can produce information on species biomass, and potentially allows quantification of within-species genetic variation. The success of MMG relies on the formation of numerous mitochondrial genome contigs, achievable with standard genome assemblers, but various challenges for the efficiency of assembly remain, particularly in the face of variable relative species abundance and intra-specific genetic variation. Nevertheless, several studies have demonstrated the power of mitogenomes from MMG for accurate phylogenetic placement, evolutionary analysis of species traits, biodiversity discovery and the establishment of species distribution patterns; it offers a promising avenue for unifying the ecological and evolutionary understanding of species diversity.

  8. Mitochondrial gene replacement in primate offspring and embryonic stem cells.

    PubMed

    Tachibana, Masahito; Sparman, Michelle; Sritanaudomchai, Hathaitip; Ma, Hong; Clepper, Lisa; Woodward, Joy; Li, Ying; Ramsey, Cathy; Kolotushkina, Olena; Mitalipov, Shoukhrat

    2009-09-17

    Mitochondria are found in all eukaryotic cells and contain their own genome (mitochondrial DNA or mtDNA). Unlike the nuclear genome, which is derived from both the egg and sperm at fertilization, the mtDNA in the embryo is derived almost exclusively from the egg; that is, it is of maternal origin. Mutations in mtDNA contribute to a diverse range of currently incurable human diseases and disorders. To establish preclinical models for new therapeutic approaches, we demonstrate here that the mitochondrial genome can be efficiently replaced in mature non-human primate oocytes (Macaca mulatta) by spindle-chromosomal complex transfer from one egg to an enucleated, mitochondrial-replete egg. The reconstructed oocytes with the mitochondrial replacement were capable of supporting normal fertilization, embryo development and produced healthy offspring. Genetic analysis confirmed that nuclear DNA in the three infants born so far originated from the spindle donors whereas mtDNA came from the cytoplast donors. No contribution of spindle donor mtDNA was detected in offspring. Spindle replacement is shown here as an efficient protocol replacing the full complement of mitochondria in newly generated embryonic stem cell lines. This approach may offer a reproductive option to prevent mtDNA disease transmission in affected families.

  9. Evidence for a novel mitochondrial promoter preceding the cox2 gene of perennial teosintes.

    PubMed Central

    Newton, K J; Winberg, B; Yamato, K; Lupold, S; Stern, D B

    1995-01-01

    We have characterized two promoters of the cytochrome oxidase subunit 2 (cox2) gene in Zea perennis mitochondria present in maize lines. Initiation at a site 907 bases upstream of the start codon results in the major approximately 1900 nt cox2 transcript. A sequence just upstream of this site conforms to the consensus described for maize mitochondrial promoters and its transcription is correctly initiated in a maize mitochondrial in vitro transcription extract. A second transcription initiation site (-347) is used only when the dominant allele of a nuclear gene, Mct, is present and its use results in an additional, shorter major transcript. Sequences flanking the Mct-dependent transcription initiation site, which we have termed the conditional promoter of cox2 (cpc), do not fit the maize mitochondrial promoter consensus and do not function in the maize in vitro transcription extract. The cpc region does not hybridize with mitochondrial, chloroplast or nuclear DNAs from most maize or teosinte lines. However, the cpc sequence is found in the same position upstream of the cox2 gene in Zea diploperennis mtDNA and it has striking similarity to the previously reported 'ORF of unknown origin' fused to the ATPase subunit 6 gene in maize CMS-C mitochondria. cpc appears to represent a new type of mitochondrial promoter. Further analysis of both conditional and constitutive promoters should help us to better understand the control of transcription in plant mitochondria. Images PMID:7859746

  10. The watermelon mitochondrial URF-1 gene: evidence for a complex structure.

    PubMed

    Stern, D B; Bang, A G; Thompson, W F

    1986-01-01

    We have cloned and sequenced a fragment of watermelon mitochondrial DNA (mtDNA) which contains a gene homologous to mitochondrial URF-1 (Unidentified Reading Frame-1) of vertebrates, Drosophila yakuba and Aspergillus nidulans. URF-1 is thought to encode a component of the respiratory chain NADH dehydrogenase. Two coding regions in the watermelon gene are separated by approximately 1,450 bp of untranslatable DNA. These two exons encode the central portions of URF-1, and are highly conserved. We postulate that three additional exons, selected by their map location and amino acid homology to other URF-1 sequences, encode the remainder of the polypeptide. This is the first description of a plant mitochondrial gene with multiple introns.

  11. Mitogenomic analyses propose positive selection in mitochondrial genes for high-altitude adaptation in galliform birds.

    PubMed

    Zhou, Taicheng; Shen, Xuejuan; Irwin, David M; Shen, Yongyi; Zhang, Yaping

    2014-09-01

    Galliform birds inhabit very diverse habitats, including plateaus that are above 3000 m in altitude. At high altitude, lower temperature and hypoxia are two important factors influencing survival. Mitochondria, as the ultimate oxygen transductor, play an important role in aerobic respiration through oxidative phosphorylation (OXPHOS). We analyzed the mitochondrial genomes of six high-altitude phasianidae birds and sixteen low-altitude relatives in an attempt to determine the role of mitochondrial genes in high-altitude adaptation. We reconstructed the phylogenetic relationships of these phasianidae birds and relatives and found at least four lineages that independently occupied this high-altitude habitat. Selective analyses revealed significant evidence for positive selection in the genes ND2, ND4, and ATP6 in three of the high-altitude lineages. This result strongly suggests that adaptive evolution of mitochondrial genes played a critical role during the independent acclimatization to high altitude by galliform birds.

  12. Gene organization and complete sequence of the mitochondrial genome of Linwu mallard.

    PubMed

    Tian, Ke-Xiong; Liu, Li-Li; Yu, Qi-Fang; He, Shao-Ping; He, Jian-Hua

    2016-01-01

    Linwu mallard is an excellent native breeds from Hunan province in China. This is the first study to determine the complete mitochondrial genome sequence of L. mallard using PCR-based amplification and Sanger sequencing. The characteristic of the entire mitochondrial genome was analyzed in detail, with the base composition of 29.19% A, 22.19% T, 32.83% C, 15.79% G in the L. mallard (16,605 bp in length). It contained 2 ribosomal RNA genes, 13 protein-coding genes, 22 transfer RNA genes and a major non-coding control region (D-loop region). The complete mitochondrial genome sequence of L. mallard will be useful for the phylogenetics of poultry, and be available as basic data for the genetics and breeding.

  13. Mitochondrial content is central to nuclear gene expression: Profound implications for human health.

    PubMed

    Muir, Rebecca; Diot, Alan; Poulton, Joanna

    2016-02-01

    We review a recent paper in Genome Research by Guantes et al. showing that nuclear gene expression is influenced by the bioenergetic status of the mitochondria. The amount of energy that mitochondria make available for gene expression varies considerably. It depends on: the energetic demands of the tissue; the mitochondrial DNA (mtDNA) mutant load; the number of mitochondria; stressors present in the cell. Hence, when failing mitochondria place the cell in energy crisis there are major effects on gene expression affecting the risk of degenerative diseases, cancer and ageing. In 2015 the UK parliament approved a change in the regulation of IVF techniques, allowing "Mitochondrial replacement therapy" to become a reproductive choice for women at risk of transmitting mitochondrial disease to their children. This is the first time that this technique will be available. Therefore understanding the interaction between mitochondria and the nucleus has never been more important.

  14. Gene clusters for ribosomal proteins in the mitochondrial genome of a liverwort, Marchantia polymorpha.

    PubMed Central

    Takemura, M; Oda, K; Yamato, K; Ohta, E; Nakamura, Y; Nozato, N; Akashi, K; Ohyama, K

    1992-01-01

    We detected 16 genes for ribosomal proteins in the complete sequence of the mitochondrial DNA from a liverwort, Marchantia polymorpha. The genes formed two major clusters, rps12-rps7 and rps10-rpl2-rps19-rps3-rpl16-rpl5- rps14-rps8- rpl6-rps13-rps11-rps1, very similar in organization to Escherichia coli ribosomal protein operons (str and S10-spc-alpha operons, respectively). In contrast, rps2 and rps4 genes were located separately in the liverwort mitochondrial genome (the latter was part of the alpha operon in E. coli). Furthermore, several ribosomal proteins encoded by the liverwort mitochondrial genome differed substantially in size from their counterparts in E. coli and liverwort chloroplast. PMID:1620617

  15. Mitochondrial content is central to nuclear gene expression: Profound implications for human health

    PubMed Central

    Muir, Rebecca; Diot, Alan

    2016-01-01

    We review a recent paper in Genome Research by Guantes et al. showing that nuclear gene expression is influenced by the bioenergetic status of the mitochondria. The amount of energy that mitochondria make available for gene expression varies considerably. It depends on: the energetic demands of the tissue; the mitochondrial DNA (mtDNA) mutant load; the number of mitochondria; stressors present in the cell. Hence, when failing mitochondria place the cell in energy crisis there are major effects on gene expression affecting the risk of degenerative diseases, cancer and ageing. In 2015 the UK parliament approved a change in the regulation of IVF techniques, allowing “Mitochondrial replacement therapy” to become a reproductive choice for women at risk of transmitting mitochondrial disease to their children. This is the first time that this technique will be available. Therefore understanding the interaction between mitochondria and the nucleus has never been more important. PMID:26725055

  16. Improved systematic tRNA gene annotation allows new insights into the evolution of mitochondrial tRNA structures and into the mechanisms of mitochondrial genome rearrangements

    PubMed Central

    Jühling, Frank; Pütz, Joern; Bernt, Matthias; Donath, Alexander; Middendorf, Martin; Florentz, Catherine; Stadler, Peter F.

    2012-01-01

    Transfer RNAs (tRNAs) are present in all types of cells as well as in organelles. tRNAs of animal mitochondria show a low level of primary sequence conservation and exhibit ‘bizarre’ secondary structures, lacking complete domains of the common cloverleaf. Such sequences are hard to detect and hence frequently missed in computational analyses and mitochondrial genome annotation. Here, we introduce an automatic annotation procedure for mitochondrial tRNA genes in Metazoa based on sequence and structural information in manually curated covariance models. The method, applied to re-annotate 1876 available metazoan mitochondrial RefSeq genomes, allows to distinguish between remaining functional genes and degrading ‘pseudogenes’, even at early stages of divergence. The subsequent analysis of a comprehensive set of mitochondrial tRNA genes gives new insights into the evolution of structures of mitochondrial tRNA sequences as well as into the mechanisms of genome rearrangements. We find frequent losses of tRNA genes concentrated in basal Metazoa, frequent independent losses of individual parts of tRNA genes, particularly in Arthropoda, and wide-spread conserved overlaps of tRNAs in opposite reading direction. Direct evidence for several recent Tandem Duplication-Random Loss events is gained, demonstrating that this mechanism has an impact on the appearance of new mitochondrial gene orders. PMID:22139921

  17. Biased introgression of mitochondrial and nuclear genes: a comparison of diploid and haplodiploid systems.

    PubMed

    Patten, Manus M; Carioscia, Sara A; Linnen, Catherine R

    2015-10-01

    Hybridization between recently diverged species, even if infrequent, can lead to the introgression of genes from one species into another. The rates of mitochondrial and nuclear introgression often differ, with some taxa showing biases for mitochondrial introgression and others for nuclear introgression. Several hypotheses exist to explain such biases, including adaptive introgression, sex differences in dispersal rates, sex-specific prezygotic isolation and sex-specific fitness of hybrids (e.g. Haldane's rule). We derive a simple population genetic model that permits an analysis of sex-specific demographic and fitness parameters and measures the relative rates of mitochondrial and nuclear introgression between hybridizing pairs. We do this separately for diploid and haplodiploid species. For diploid taxa, we recover results consistent with previous hypotheses: an excess of one sex among the hybridizing migrants or sex-specific prezygotic isolation causes a bias for one type of marker or the other; when Haldane's rule is obeyed, we find a mitochondrial bias in XY systems and a nuclear bias in ZW systems. For haplodiploid taxa, the model reveals that owing to their unique transmission genetics, they are seemingly assured of strong mitochondrial biases in introgression rates, unlike diploid taxa, where the relative fitness of male and female hybrids can tip the bias in either direction. This heretofore overlooked aspect of hybridization in haplodiploids provides what is perhaps the most likely explanation for differential introgression of mitochondrial and nuclear markers and raises concerns about the use of mitochondrial DNA barcodes for species delimitation in these taxa.

  18. The mitochondrial UPR - protecting organelle protein homeostasis.

    PubMed

    Haynes, Cole M; Ron, David

    2010-11-15

    Mitochondria are required for numerous essential metabolic processes including the regulation of apoptosis; therefore, proper maintenance of the mitochondrial proteome is crucial. The protein-folding environment in mitochondria is challenged by organelle architecture, the presence of reactive oxygen species and the difficulties associated with assembly of the electron transport chain, which consists of components encoded by both the mitochondrial and the nuclear genomes. Mitochondria have dedicated molecular chaperones and proteases that promote proper protein folding, complex assembly and quality control. Work in cultured mammalian cells and Caenorhabditis elegans has yielded clues to the mechanisms linking perturbations in the protein-folding environment in the mitochondrial matrix to the expression of nuclear genes encoding mitochondrial proteins. Here, we review the current knowledge of this mitochondrial unfolded protein response (UPR(mt)), compare it with the better understood UPR of the endoplasmic reticulum and highlight its potential impact on development and disease.

  19. Is Mitochondrial Donation Germ-Line Gene Therapy? Classifications and Ethical Implications.

    PubMed

    Newson, Ainsley J; Wrigley, Anthony

    2017-01-01

    The classification of techniques used in mitochondrial donation, including their role as purported germ-line gene therapies, is far from clear. These techniques exhibit characteristics typical of a variety of classifications that have been used in both scientific and bioethics scholarship. This raises two connected questions, which we address in this paper: (i) how should we classify mitochondrial donation techniques?; and (ii) what ethical implications surround such a classification? First, we outline how methods of genetic intervention, such as germ-line gene therapy, are typically defined or classified. We then consider whether techniques of mitochondrial donation fit into these, whether they might do so with some refinement of these categories, or whether they require some other approach to classification. To answer the second question, we discuss the relationship between classification and several key ethical issues arising from mitochondrial donation. We conclude that the properties characteristic of mitochondrial inheritance mean that most mitochondrial donation techniques belong to a new sub-class of genetic modification, which we call 'conditionally inheritable genomic modification' (CIGM).

  20. Deregulation of Genes Related to Iron and Mitochondrial Metabolism in Refractory Anemia with Ring Sideroblasts

    PubMed Central

    del Rey, Mónica; Benito, Rocío; Fontanillo, Celia; Campos-Laborie, Francisco J.; Janusz, Kamila; Velasco-Hernández, Talía; Abáigar, María; Hernández, María; Cuello, Rebeca; Borrego, Daniel; Martín-Zanca, Dionisio; De Las Rivas, Javier; Mills, Ken I.; Hernández-Rivas, Jesús M.

    2015-01-01

    The presence of SF3B1 gene mutations is a hallmark of refractory anemia with ring sideroblasts (RARS). However, the mechanisms responsible for iron accumulation that characterize the Myelodysplastic Syndrome with ring sideroblasts (MDS-RS) are not completely understood. In order to gain insight in the molecular basis of MDS-RS, an integrative study of the expression and mutational status of genes related to iron and mitochondrial metabolism was carried out. A total of 231 low-risk MDS patients and 81 controls were studied. Gene expression analysis revealed that iron metabolism and mitochondrial function had the highest number of genes deregulated in RARS patients compared to controls and the refractory cytopenias with unilineage dysplasia (RCUD). Thus mitochondrial transporters SLC25 (SLC25A37 and SLC25A38) and ALAD genes were over-expressed in RARS. Moreover, significant differences were observed between patients with SF3B1 mutations and patients without the mutations. The deregulation of genes involved in iron and mitochondrial metabolism provides new insights in our knowledge of MDS-RS. New variants that could be involved in the pathogenesis of these diseases have been identified. PMID:25955609

  1. Conservation of the structure and organization of lupin mitochondrial nad3 and rps12 genes.

    PubMed

    Rurek, M; Oczkowski, M; Augustyniak, H

    1998-01-01

    A high level of the nucleotide sequence conservation of mitochondrial nad3 and rps12 genes was found in four lupin species. The only differences concern three nucleotides in the Lupinus albus rps12 gene and three nucleotides insertion in the L. mutabilis spacer. Northern blot analysis as well as RT-PCR confirmed cotranscription of the L. luteus genes because the transcripts detected were long enough.

  2. Mitochondrial neurogastrointestinal encephalomyopathy: novel pathogenic mutations in thymidine phosphorylase gene in two Italian brothers.

    PubMed

    Libernini, Laura; Lupis, Chiara; Mastrangelo, Mario; Carrozzo, Rosalba; Santorelli, Filippo Maria; Inghilleri, Maurizio; Leuzzi, Vincenzo

    2012-08-01

    Mitochondrial neurogastrointestinal encephalomyopathy (MNGIE, MIM 603041) is an autosomal recessive multisystem disorder occurring due to mutations in a nuclear gene coding for the enzyme thymidine phosphorylase (TYMP). Clinical features of MNGIE include gastrointestinal dysmotility, cachexia, ptosis or ophthalmoparesis, peripheral neuropathy, diffuse leukoencephalopathy, and signs of mitochondrial dysfunction in tissues. We report the clinical and molecular findings in two brothers in whom novel TYMP gene mutations (c.215-13_215delinsGCGTGA; c.1159 + 2T > A) were associated with different clinical presentations and outcomes.

  3. Characterization of a juvenile hormone-regulated chymotrypsin-like serine protease gene in Aedes aegypti mosquito.

    PubMed

    Bian, Guowu; Raikhel, Alexander S; Zhu, Jinsong

    2008-02-01

    After female mosquitoes ingest blood from vertebrate hosts, exopeptidases and endopeptidases are required for digesting blood proteins in the midgut into amino acids, which female mosquitoes use to build yolk proteins. These proteases are not always present in the midgut, and their diverse expression patterns suggest that production of these enzymes is highly regulated in order to meet specific physiological demands at various stages. Here we report identification of a serine-type protease, JHA15, in the yellow fever mosquito Aedes aegypti. This protein shares high sequence homology with chymotrypsins, and indeed exhibits specific chymotrypsin enzymatic activity. The JHA15 gene is expressed primarily in the midgut of adult female mosquitoes. Our results indicate that its transcription is activated by juvenile hormone in the newly emerged female adults. Although its mRNA profile is similar to that of the early trypsin gene, we found that JHA15 proteins were readily detected in the midgut epithelium cells of both non-blood-fed and blood-fed mosquitoes. Analysis of polysomal RNA further substantiated that synthesis of JHA15 occurs before and shortly after blood feeding. Knocking down expression of JHA15 resulted in no evident phenotypic changes, implying that functional redundancy exists among those proteolytic enzymes.

  4. Identification, Characterization and Down-Regulation of Cysteine Protease Genes in Tobacco for Use in Recombinant Protein Production

    PubMed Central

    Duwadi, Kishor; Chen, Ling; Menassa, Rima; Dhaubhadel, Sangeeta

    2015-01-01

    Plants are an attractive host system for pharmaceutical protein production. Many therapeutic proteins have been produced and scaled up in plants at a low cost compared to the conventional microbial and animal-based systems. The main technical challenge during this process is to produce sufficient levels of recombinant proteins in plants. Low yield is generally caused by proteolytic degradation during expression and downstream processing of recombinant proteins. The yield of human therapeutic interleukin (IL)-10 produced in transgenic tobacco leaves was found to be below the critical level, and may be due to degradation by tobacco proteases. Here, we identified a total of 60 putative cysteine protease genes (CysP) in tobacco. Based on their predicted expression in leaf tissue, 10 candidate CysPs (CysP1-CysP10) were selected for further characterization. The effect of CysP gene silencing on IL-10 accumulation was examined in tobacco. It was found that the recombinant protein yield in tobacco could be increased by silencing CysP6. Transient expression of CysP6 silencing construct also showed an increase in IL-10 accumulation in comparison to the control. Moreover, CysP6 localizes to the endoplasmic reticulum (ER), suggesting that ER may be the site of IL-10 degradation. Overall results suggest that CysP6 is important in determining the yield of recombinant IL-10 in tobacco leaves. PMID:26148064

  5. Cloning and characteristic analysis of a novel aspartic protease gene Asp55 from Trichoderma asperellum ACCC30536.

    PubMed

    Dou, Kai; Wang, Zhiying; Zhang, Rongshu; Wang, Na; Fan, Haijuan; Diao, Guiping; Liu, Zhihua

    2014-12-01

    Proteases secreted by fungi belonging to the genus Trichoderma play important roles in biocontrol. In this study, the coding sequence and promoter region of the novel aspartic protease gene Asp55 were cloned from strain Trichoderma asperellum ACCC30536. Many cis-elements involved in phytopathogenic and environmental stress responses were identified in the Asp55 promoter region and may be recognized by MYB or WRKY transcription factors. The expression pattern of Asp55 under eight culture conditions was investigated by RT-qPCR. The expression level of Asp55 was up-regulated by poplar stem powder, Alternaria alternata cell wall fragments and A. alternata fermentation liquid, while it was down-regulated by carbon and nitrogen source starvation, and by powdered poplar leaves and roots. Additionally, the expression patterns of 15 genes encoding MYB transcription factors (Myb1 to Myb15) were also analyzed by RT-qPCR. Myb2 showed the most similar expression pattern with Asp55. The cDNA of Asp55 was expressed in Escherichia coli BL21, and recombinant ASP55 (rASP55) was purified. The purified rASP55 was evaluated for enzymatic activity and showed inhibitory effect on phytopathogenic A. alternata.

  6. Isolated respiratory chain enzyme deficiency in patients with a mitochondrial (encephalo-) myopathy: Sequence analysis of the mitochondrial complex and IV genes

    SciTech Connect

    Vries, D. de; Coo, I. de; Buddiger, P.

    1994-09-01

    The mitochondrial respiratory chain consists of four enzyme complexes. Deficiencies of complex I (NADH dehydrogenase) and complex IV (cytochrome c oxidase) are frequently found in muscle biopsies from patients with a mitochondrial (encephalo-)myopathy. Mutations in the mitochondrial-encoded subunits have been observed in a number of different mitochondrial (encephalo-)myophathies. We screened eight mitochondrial (encephalo-)myopathy patients with an isolated complex I deficiency for mutations in the ND genes by direct sequencing. No abnormality was detected. We also studied 9 mitochondrial (encephalo-)myopathy patients and an isolated complex IV deficiency. In the muscle biopsy of one patient a novel heteroplasmic mutation (T {r_arrow} C) at nucleotide position 6681 was found in the mitochondrial COX I gene. This mutation led to the substitution of a conserved Tyr for His. As this mutation changed the secondary structure of the protein and was not found in the healthy mother, we consider it likely that this mutation is pathological. In the other patients no abnormality was detected. Therefore, mutations in the mitochondrially-encoded subunits are not a frequent cause of isolated respiratory chain enzyme deficiency.

  7. Characterization of the entire cystatin gene family in barley and their target cathepsin L-like cysteine-proteases, partners in the hordein mobilization during seed germination.

    PubMed

    Martinez, Manuel; Cambra, Ines; Carrillo, Laura; Diaz-Mendoza, Mercedes; Diaz, Isabel

    2009-11-01

    Plant cystatins are inhibitors of cysteine-proteases of the papain C1A and legumain C13 families. Cystatin data from multiple plant species have suggested that these inhibitors act as defense proteins against pests and pathogens and as regulators of protein turnover. In this study, we characterize the entire cystatin gene family from barley (Hordeum vulgare), which contain 13 nonredundant genes, and identify and characterize their target enzymes, the barley cathepsin L-like proteases. Cystatins and proteases were expressed and purified from Escherichia coli cultures. Each cystatin was found to have different inhibitory capability against barley cysteine-proteases in in vitro inhibitory assays using specific substrates. Real-time reverse transcription-polymerase chain reaction revealed that inhibitors and enzymes present a wide variation in their messenger RNA expression patterns. Their transcripts were mainly detected in developing and germinating seeds, and some of them were also expressed in leaves and roots. Subcellular localization of cystatins and cathepsin L-like proteases fused to green fluorescent protein demonstrated the presence of both protein families throughout the endoplasmic reticulum and the Golgi complex. Proteases and cystatins not only colocalized but also interacted in vivo in the plant cell, as revealed by bimolecular fluorescence complementation. The functional relationship between cystatins and cathepsin L-like proteases was inferred from their common implication as counterparts of mobilization of storage proteins upon barley seed germination. The opposite pattern of transcription expression in gibberellin-treated aleurones presented by inhibitors and enzymes allowed proteases to specifically degrade B, C, and D hordeins stored in the endosperm of barley seeds.

  8. Hypothalamic and amygdalar cell lines differ markedly in mitochondrial rather than nuclear encoded gene expression

    PubMed Central

    2013-01-01

    Background Corticotropin-releasing hormone (CRH) plays an important role in regulating the mammalian stress response. Two of the most extensively studied neuronal populations that express CRH are in the hypothalamus and amygdala. Both regions are involved in the stress response, but the amygdala is also involved in mediating response to fear and anxiety. Given that both hypothalamus and amygdala have overlapping functions, but their CRH-expressing neurons may respond differently to a given perturbation, we sought to identify differentially expressed genes between two neuronal cell types, amygdalar AR-5 and hypothalamic IVB cells. Thus, we performed a microarray analysis. Our hypothesis was that we would identify differentially expressed transcription factors, coregulators and chromatin-modifying enzymes. Results A total of 31,042 genes were analyzed, 10,572 of which were consistently expressed in both cell lines at a 95% confidence level. Of the 10,572 genes, 2,320 genes in AR-5 were expressed at ≥ 2-fold relative to IVBs, 1,104 genes were expressed at ≥2-fold in IVB relative to AR-5 and 7,148 genes were expressed at similar levels between the two cell lines. The greatest difference was in six mitochondrial DNA-encoded genes, which were highly abundant in AR-5 relative to IVB cells. The relative abundance of these genes ranged from 413 to 885-fold according to the microarray results. Differential expression of these genes was verified by RTqPCR. The differentially expressed mitochondrial genes were cytochrome b (MT-CYB), cytochrome c oxidase subunit 1 and 2 (MT-CO1 and MT-CO2) and NADH-ubiquinone oxidoreductase chain 1, 2, and 3 (MT-ND1, MT-ND2, MT-ND3). Conclusion As expected, the array revealed differential expression of transcription factors and coregulators; however the greatest difference between the two cell lines was in genes encoded by the mitochondrial genome. These genes were abundant in AR-5 relative to IVBs. At present, the reason for the marked

  9. Cloning and targeted disruption, via Agrobacterium tumefaciens-mediated transformation, of a trypsin protease gene from the vascular wilt fungus Verticillium dahliae.

    PubMed

    Dobinson, Katherine F; Grant, Sandra J; Kang, Seogchan

    2004-02-01

    A gene encoding a trypsin protease was isolated from a tomato isolate of Verticillium dahliae. The gene, designated VTP1, contains two introns and is predicted to encode a protein of 256 amino acids. The gene is present in V. dahliae isolates from different host plants and in V. albo-atrum; weakly hybridizing sequences are present in V. tricorpus. VTP1 cDNA sequences were identified in a sequence tag analysis of genes expressed under growth conditions that promote microsclerotia development. Replacement of the gene, by Agrobacterium tumefaciens-mediated transformation (ATMT), with a mutant allele construct did not noticeably alter either pathogenicity or growth in culture. Searches of expressed sequence tag databases showed that, in addition to the VTP1 gene, V. dahliae contains two genes encoding subtilisin-like proteases similar to those produced by pathogenic Aspergillus spp. This is the first description of the application of ATMT to the molecular analysis of phytopathogenic Verticillium spp.

  10. ATAD3 gene cluster deletions cause cerebellar dysfunction associated with altered mitochondrial DNA and cholesterol metabolism

    PubMed Central

    Desai, Radha; Frazier, Ann E.; Durigon, Romina; Patel, Harshil; Jones, Aleck W.; Dalla Rosa, Ilaria; Lake, Nicole J.; Compton, Alison G.; Mountford, Hayley S.; Tucker, Elena J.; Mitchell, Alice L. R.; Jackson, Deborah; Sesay, Abdul; Di Re, Miriam; van den Heuvel, Lambert P.; Burke, Derek; Lunke, Sebastian; McGillivray, George; Mandelstam, Simone; Mochel, Fanny; Keren, Boris; Jardel, Claude; Turner, Anne M.; Ian Andrews, P.; Smeitink, Jan; Spelbrink, Johannes N.; Heales, Simon J.; Kohda, Masakazu; Ohtake, Akira; Murayama, Kei; Okazaki, Yasushi; Lombès, Anne; Holt, Ian J.; Thorburn, David R.; Spinazzola, Antonella

    2017-01-01

    Abstract Although mitochondrial disorders are clinically heterogeneous, they frequently involve the central nervous system and are among the most common neurogenetic disorders. Identifying the causal genes has benefited enormously from advances in high-throughput sequencing technologies; however, once the defect is known, researchers face the challenge of deciphering the underlying disease mechanism. Here we characterize large biallelic deletions in the region encoding the ATAD3C, ATAD3B and ATAD3A genes. Although high homology complicates genomic analysis of the ATAD3 defects, they can be identified by targeted analysis of standard single nucleotide polymorphism array and whole exome sequencing data. We report deletions that generate chimeric ATAD3B/ATAD3A fusion genes in individuals from four unrelated families with fatal congenital pontocerebellar hypoplasia, whereas a case with genomic rearrangements affecting the ATAD3C/ATAD3B genes on one allele and ATAD3B/ATAD3A genes on the other displays later-onset encephalopathy with cerebellar atrophy, ataxia and dystonia. Fibroblasts from affected individuals display mitochondrial DNA abnormalities, associated with multiple indicators of altered cholesterol metabolism. Moreover, drug-induced perturbations of cholesterol homeostasis cause mitochondrial DNA disorganization in control cells, while mitochondrial DNA aggregation in the genetic cholesterol trafficking disorder Niemann-Pick type C disease further corroborates the interdependence of mitochondrial DNA organization and cholesterol. These data demonstrate the integration of mitochondria in cellular cholesterol homeostasis, in which ATAD3 plays a critical role. The dual problem of perturbed cholesterol metabolism and mitochondrial dysfunction could be widespread in neurological and neurodegenerative diseases. PMID:28549128

  11. A new point mutation in the ND1 mitochondrial gene identified in a type II diabetic patient

    SciTech Connect

    Kalinin, V.N.; Schmidt, W.; Olek, K.

    1995-08-01

    A novel mutation in a mitochondrial gene was identified in a patient with type II diabetes mellitus. G-to-A transition was localized at the nt3316 position of gene ND1 and resulted in alanine threonine replacement at position 4 of mitochondrial NAD-H-dehydrogenase. 6 refs., 2 figs.

  12. The yeast gene, MDM20, is necessary for mitochondrial inheritance and organization of the actin cytoskeleton.

    PubMed

    Hermann, G J; King, E J; Shaw, J M

    1997-04-07

    In Saccharomyces cerevisiae, the growing bud inherits a portion of the mitochondrial network from the mother cell soon after it emerges. Although this polarized transport of mitochondria is thought to require functions of the cytoskeleton, there are conflicting reports concerning the nature of the cytoskeletal element involved. Here we report the isolation of a yeast mutant, mdm20, in which both mitochondrial inheritance and actin cables (bundles of actin filaments) are disrupted. The MDM20 gene encodes a 93-kD polypeptide with no homology to other characterized proteins. Extra copies of TPM1, a gene encoding the actin filament-binding protein tropomyosin, suppress mitochondrial inheritance defects and partially restore actin cables in mdm20 delta cells. Synthetic lethality is also observed between mdm20 and tpm1 mutant strains. Overexpression of a second yeast tropomyosin, Tpm2p, rescues mutant phenotypes in the mdm20 strain to a lesser extent. Together, these results provide compelling evidence that mitochondrial inheritance in yeast is an actin-mediated process. MDM20 and TPM1 also exhibit the same pattern of genetic interactions; mutations in MDM20 are synthetically lethal with mutations in BEM2 and MYO2 but not SAC6. Although MDM20 and TPM1 are both required for the formation and/or stabilization of actin cables, mutations in these genes disrupt mitochondrial inheritance and nuclear segregation to different extents. Thus, Mdm20p and Tpm1p may act in vivo to establish molecular and functional heterogeneity of the actin cytoskeleton.

  13. Genetic architecture of metabolic rate: environment specific epistasis between mitochondrial and nuclear genes in an insect.

    PubMed

    Arnqvist, Göran; Dowling, Damian K; Eady, Paul; Gay, Laurene; Tregenza, Tom; Tuda, Midori; Hosken, David J

    2010-12-01

    The extent to which mitochondrial DNA (mtDNA) variation is involved in adaptive evolutionary change is currently being reevaluated. In particular, emerging evidence suggests that mtDNA genes coevolve with the nuclear genes with which they interact to form the energy producing enzyme complexes in the mitochondria. This suggests that intergenomic epistasis between mitochondrial and nuclear genes may affect whole-organism metabolic phenotypes. Here, we use crossed combinations of mitochondrial and nuclear lineages of the seed beetle Callosobruchus maculatus and assay metabolic rate under two different temperature regimes. Metabolic rate was affected by an interaction between the mitochondrial and nuclear lineages and the temperature regime. Sequence data suggests that mitochondrial genetic variation has a role in determining the outcome of this interaction. Our genetic dissection of metabolic rate reveals a high level of complexity, encompassing genetic interactions over two genomes, and genotype × genotype × environment interactions. The evolutionary implications of these results are twofold. First, because metabolic rate is at the root of life histories, our results provide insights into the complexity of life-history evolution in general, and thermal adaptation in particular. Second, our results suggest a mechanism that could contribute to the maintenance of nonneutral mtDNA polymorphism. © 2010 The Author(s). Evolution© 2010 The Society for the Study of Evolution.

  14. Adult-onset obesity is triggered by impaired mitochondrial gene expression

    PubMed Central

    Perks, Kara L.; Ferreira, Nicola; Richman, Tara R.; Ermer, Judith A.; Kuznetsova, Irina; Shearwood, Anne-Marie J.; Lee, Richard G.; Viola, Helena M.; Johnstone, Victoria P. A.; Matthews, Vance; Hool, Livia C.; Rackham, Oliver; Filipovska, Aleksandra

    2017-01-01

    Mitochondrial gene expression is essential for energy production; however, an understanding of how it can influence physiology and metabolism is lacking. Several proteins from the pentatricopeptide repeat (PPR) family are essential for the regulation of mitochondrial gene expression, but the functions of the remaining members of this family are poorly understood. We created knockout mice to investigate the role of the PPR domain 1 (PTCD1) protein and show that loss of PTCD1 is embryonic lethal, whereas haploinsufficient, heterozygous mice develop age-induced obesity. The molecular defects and metabolic consequences of mitochondrial protein haploinsufficiency in vivo have not been investigated previously. We show that PTCD1 haploinsufficiency results in increased RNA metabolism, in response to decreased protein synthesis and impaired RNA processing that affect the biogenesis of the respiratory chain, causing mild uncoupling and changes in mitochondrial morphology. We demonstrate that with age, these effects lead to adult-onset obesity that results in liver steatosis and cardiac hypertrophy in response to tissue-specific differential regulation of the mammalian target of rapamycin pathways. Our findings indicate that changes in mitochondrial gene expression have long-term consequences on energy metabolism, providing evidence that haploinsufficiency of PTCD1 can be a major predisposing factor for the development of metabolic syndrome. PMID:28835921

  15. Adult-onset obesity is triggered by impaired mitochondrial gene expression.

    PubMed

    Perks, Kara L; Ferreira, Nicola; Richman, Tara R; Ermer, Judith A; Kuznetsova, Irina; Shearwood, Anne-Marie J; Lee, Richard G; Viola, Helena M; Johnstone, Victoria P A; Matthews, Vance; Hool, Livia C; Rackham, Oliver; Filipovska, Aleksandra

    2017-08-01

    Mitochondrial gene expression is essential for energy production; however, an understanding of how it can influence physiology and metabolism is lacking. Several proteins from the pentatricopeptide repeat (PPR) family are essential for the regulation of mitochondrial gene expression, but the functions of the remaining members of this family are poorly understood. We created knockout mice to investigate the role of the PPR domain 1 (PTCD1) protein and show that loss of PTCD1 is embryonic lethal, whereas haploinsufficient, heterozygous mice develop age-induced obesity. The molecular defects and metabolic consequences of mitochondrial protein haploinsufficiency in vivo have not been investigated previously. We show that PTCD1 haploinsufficiency results in increased RNA metabolism, in response to decreased protein synthesis and impaired RNA processing that affect the biogenesis of the respiratory chain, causing mild uncoupling and changes in mitochondrial morphology. We demonstrate that with age, these effects lead to adult-onset obesity that results in liver steatosis and cardiac hypertrophy in response to tissue-specific differential regulation of the mammalian target of rapamycin pathways. Our findings indicate that changes in mitochondrial gene expression have long-term consequences on energy metabolism, providing evidence that haploinsufficiency of PTCD1 can be a major predisposing factor for the development of metabolic syndrome.

  16. The plant mitochondrial mat-r gene/nad1 gene complex

    SciTech Connect

    Wolstenhome, D.R.

    1996-12-31

    We have completed sequencing segments of the maize mitochondrial (mt) DNA that contains all five of the exons (A-E) of the gene (nad1) for subunit I of the respiratory chain NADH dehydrogenase. Analysis of these sequences indicates that exons B and C are joined by a continuous group II intron, but the remaining exons are associated with partial group II introns and are encoded at widely separated locations in the maize mtDNA molecule. We have shown that mature transcripts of the maize nad1 gene contain 23 edited nucleotides, and that transcripts of maize and soybean mat-r genes contain 15 and 14 edits, respectively. The majority of edits in nad1 transcripts result in amino acid replacements that increase similarity between the maize NAD1 protein and NAD1 proteins of other plant species and of animal species. We found that the intron between exons b and c is not edited. From data obtained using PCR and sequencing we have shown that transcripts containing all possible exon combinations exist in maize mitochondria.

  17. Mitochondrial electron transport regulation of nuclear gene expression. Studies with the alternative oxidase gene of tobacco.

    PubMed Central

    Vanlerberghe, G C; McIntosh, L

    1994-01-01

    We have isolated a cDNA representing the tobacco (Nicotiana tabacum L. cv Bright Yellow) nuclear gene Aox1, which encodes the alternative oxidase of plant mitochondria. The clone contains the complete coding region (1059 base pairs) of a precursor protein of 353 amino acids with a calculated molecular mass of 39.8 kD. A putative transit peptide contains common signals believed to be important for import and processing of mitochondrially localized proteins. We have studied changes in Aox1 gene expression in tobacco in response to changes in cytochrome pathway activity. Inhibition of the cytochrome pathway by antimycin A resulted in a rapid and dramatic accumulation of Aox1 mRNA, whereas the level of mRNAs encoding two proteins of the cytochrome pathway did not change appreciably. This was accompanied by a dramatic increase in alternative pathway capacity and engagement in whole cells. Respiration under these conditions was unaffected by the uncoupler p-trifluoromethoxycarbonylcyanide (FCCP). When inhibition of the cytochrome pathway was relieved, levels of Aox1 mRNA returned to control levels, alternative pathway capacity and engagement declined, and respiration could once again be stimulated by FCCP. The results show that a mechanism involving changes in Aox1 gene expression exists whereby the capacity of the alternative pathway can be adjusted in response to changes in the activity of the cytochrome pathway. PMID:8058837

  18. Two genes encoding the bovine mitochondrial ATP synthase proteolipid specify precursors with different import sequences and are expressed in a tissue-specific manner.

    PubMed Central

    Gay, N J; Walker, J E

    1985-01-01

    Two cDNAs encoding different precursor proteins of the same mature proteolipid subunit of mitochondrial ATP synthase have been cloned from a bovine cDNA library. The hybridisation probe was a mixture of 17-mer oligonucleotides containing 256 discrete sequences. The coding sequences of the two cDNAs differ in 25 silent positions of codons and the 3' non-coding sequences are only weakly related. The precursor sequences, which direct the import of the proteolipid into the mitochondrion, are 61 and 68 amino acids long. They are related to each other in regions which probably are recognition signals for the processing protease. The corresponding genes are expressed differently in various tissues in a way that reflects their embryonic origin. Images Fig. 3. Fig. 6. Fig. 7. PMID:2868890

  19. Phylogeny of the Asparagales based on three plastid and two mitochondrial genes.

    PubMed

    Seberg, Ole; Petersen, Gitte; Davis, Jerrold I; Pires, J Chris; Stevenson, Dennis W; Chase, Mark W; Fay, Michael F; Devey, Dion S; Jørgensen, Tina; Sytsma, Kenneth J; Pillon, Yohan

    2012-05-01

    The Asparagales, with ca. 40% of all monocotyledons, include a host of commercially important ornamentals in families such as Orchidaceae, Alliaceae, and Iridaceae, and several important crop species in genera such as Allium, Aloe, Asparagus, Crocus, and Vanilla. Though the order is well defined, the number of recognized families, their circumscription, and relationships are somewhat controversial. Phylogenetic analyses of Asparagales were based on parsimony and maximum likelihood using nucleotide sequence variation in three plastid genes (matK, ndhF, and rbcL) and two mitochondrial genes (atp1 and cob). Branch support was assessed using both jackknife analysis implementing strict-consensus (SC) and bootstrap analysis implementing frequency-within-replicates (FWR). The contribution of edited sites in the mitochondrial genes to topology and branch support was investigated. The topologies recovered largely agree with previous results, though some clades remain poorly resolved (e.g., Ruscaceae). When the edited sites were included in the analysis, the plastid and mitochondrial genes were highly incongruent. However, when the edited sites were removed, the two partitions became congruent. Some deeper nodes in the Asparagales tree remain poorly resolved or unresolved as do the relationships of certain monogeneric families (e.g., Aphyllanthaceae, Ixioliriaceae, Doryanthaceae), whereas support for many families increases. However, the increased support is dominated by plastid data, and the potential influence of mitochondrial and biparentially inherited single or low-copy nuclear genes should be investigated.

  20. Gene arrangement convergence, diverse intron content, and genetic code modifications in mitochondrial genomes of sphaeropleales (chlorophyta).

    PubMed

    Fučíková, Karolina; Lewis, Paul O; González-Halphen, Diego; Lewis, Louise A

    2014-08-08

    The majority of our knowledge about mitochondrial genomes of Viridiplantae comes from land plants, but much less is known about their green algal relatives. In the green algal order Sphaeropleales (Chlorophyta), only one representative mitochondrial genome is currently available-that of Acutodesmus obliquus. Our study adds nine completely sequenced and three partially sequenced mitochondrial genomes spanning the phylogenetic diversity of Sphaeropleales. We show not only a size range of 25-53 kb and variation in intron content (0-11) and gene order but also conservation of 13 core respiratory genes and fragmented ribosomal RNA genes. We also report an unusual case of gene arrangement convergence in Neochloris aquatica, where the two rns fragments were secondarily placed in close proximity. Finally, we report the unprecedented usage of UCG as stop codon in Pseudomuriella schumacherensis. In addition, phylogenetic analyses of the mitochondrial protein-coding genes yield a fully resolved, well-supported phylogeny, showing promise for addressing systematic challenges in green algae. © The Author(s) 2014. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  1. Mitochondrial genome dynamics in plants and animals: convergent gene fusions of a MutS homologue.

    PubMed

    Abdelnoor, Ricardo V; Christensen, Alan C; Mohammed, Saleem; Munoz-Castillo, Bryan; Moriyama, Hideaki; Mackenzie, Sally A

    2006-08-01

    Mitochondrial processes influence a broad spectrum of physiological and developmental events in higher eukaryotes, and their aberrant function can lead to several familiar disease phenotypes in mammals. In plants, mitochondrial genes directly influence pollen development and the occurrence of male sterility in natural plant populations. Likewise, in animal systems evidence accumulates to suggest important mitochondrial functions in spermatogenesis and reproduction. Here we present evidence for a convergent gene fusion involving a MutS-homologous gene functioning within the mitochondrion and designated Msh1. In only plants and soft corals, the MutS homologue has fused with a homing endonuclease sequence at the carboxy terminus of the protein. However, the endonuclease domains in the plants and the soft corals are members of different groups. In plants, Msh1 can influence mitochondrial genome organization and male sterility expression. Based on parallels in Msh1 gene structure shared by plants and corals, and their similarities in reproductive behavior, we postulate that this convergent gene fusion might have occurred in response to coincident adaptive pressures on reproduction.

  2. Metazoan mitochondrial gene sequence reference datasets for taxonomic assignment of environmental samples

    PubMed Central

    Machida, Ryuji J.; Leray, Matthieu; Ho, Shian-Lei; Knowlton, Nancy

    2017-01-01

    Mitochondrial-encoded genes are increasingly targeted in studies using high-throughput sequencing approaches for characterizing metazoan communities from environmental samples (e.g., plankton, meiofauna, filtered water). Yet, unlike nuclear ribosomal RNA markers, there is to date no high-quality reference dataset available for taxonomic assignments. Here, we retrieved all metazoan mitochondrial gene sequences from GenBank, and then quality filtered and formatted the datasets for taxonomic assignments using taxonomic assignment tools. The reference datasets—‘Midori references’—are available for download at www.reference-midori.info. Two versions are provided: (I) Midori-UNIQUE that contains all unique haplotypes associated with each species and (II) Midori-LONGEST that contains a single sequence, the longest, for each species. Overall, the mitochondrial Cytochrome oxidase subunit I gene was the most sequence-rich gene. However, sequences of the mitochondrial large ribosomal subunit RNA and Cytochrome b apoenzyme genes were observed for a large number of species in some phyla. The Midori reference is compatible with some taxonomic assignment software. Therefore, automated high-throughput sequence taxonomic assignments can be particularly effective using these datasets. PMID:28291235

  3. Gene Arrangement Convergence, Diverse Intron Content, and Genetic Code Modifications in Mitochondrial Genomes of Sphaeropleales (Chlorophyta)

    PubMed Central

    Fučíková, Karolina; Lewis, Paul O.; González-Halphen, Diego; Lewis, Louise A.

    2014-01-01

    The majority of our knowledge about mitochondrial genomes of Viridiplantae comes from land plants, but much less is known about their green algal relatives. In the green algal order Sphaeropleales (Chlorophyta), only one representative mitochondrial genome is currently available—that of Acutodesmus obliquus. Our study adds nine completely sequenced and three partially sequenced mitochondrial genomes spanning the phylogenetic diversity of Sphaeropleales. We show not only a size range of 25–53 kb and variation in intron content (0–11) and gene order but also conservation of 13 core respiratory genes and fragmented ribosomal RNA genes. We also report an unusual case of gene arrangement convergence in Neochloris aquatica, where the two rns fragments were secondarily placed in close proximity. Finally, we report the unprecedented usage of UCG as stop codon in Pseudomuriella schumacherensis. In addition, phylogenetic analyses of the mitochondrial protein-coding genes yield a fully resolved, well-supported phylogeny, showing promise for addressing systematic challenges in green algae. PMID:25106621

  4. Caenorhabditis elegans, a pluricellular model organism to screen new genes involved in mitochondrial genome maintenance.

    PubMed

    Addo, Matthew Glover; Cossard, Raynald; Pichard, Damien; Obiri-Danso, Kwasi; Rötig, Agnès; Delahodde, Agnès

    2010-09-01

    The inheritance of functional mitochondria depends on faithful replication and transmission of mitochondrial DNA (mtDNA). A large and heterogeneous group of human disorders is associated with mitochondrial genome quantitative and qualitative anomalies. Several nuclear genes have been shown to account for these severe OXPHOS disorders. However, in several cases, the disease-causing mutations still remain unknown. Caenorhabditis elegans has been largely used for studying various biological functions because this multicellular organism has short life cycle and is easy to grow in the laboratory. Mitochondrial functions are relatively well conserved between human and C.elegans, and heteroplasmy exists in this organism as in human. C. elegans therefore represents a useful tool for studying mtDNA maintenance. Suppression by RNA interference of genes involved in mtDNA replication such as polg-1, encoding the mitochondrial DNA polymerase, results in reduced mtDNA copy number but in a normal phenotype of the F1 worms. By combining RNAi of genes involved in mtDNA maintenance and EtBr exposure, we were able to reveal a strong and specific phenotype (developmental larval arrest) associated to a severe decrease of mtDNA copy number. Moreover, we tested and validated the screen efficiency for human orthologous genes encoding mitochondrial nucleoid proteins. This allowed us to identify several genes that seem to be closely related to mtDNA maintenance in C. elegans. This work reports a first step in the further development of a large-scale screening in C. elegans that should allow to identify new genes of mtDNA maintenance whose human orthologs will obviously constitute new candidate genes for patients with quantitative or qualitative mtDNA anomalies.

  5. Peripheral neuropathy predicts nuclear gene defect in patients with mitochondrial ophthalmoplegia

    PubMed Central

    Pitceathly, Robert D. S.; Blake, Julian C.; Woodward, Catherine E.; Zapater, Pedro; Fratter, Carl; Mudanohwo, Ese E.; Plant, Gordon T.; Houlden, Henry; Sweeney, Mary G.; Hanna, Michael G.; Reilly, Mary M.

    2014-01-01

    Progressive external ophthalmoplegia is a common clinical feature in mitochondrial disease caused by nuclear DNA defects and single, large-scale mitochondrial DNA deletions and is less frequently associated with point mutations of mitochondrial DNA. Peripheral neuropathy is also a frequent manifestation of mitochondrial disease, although its prevalence and characteristics varies considerably among the different syndromes and genetic aetiologies. Based on clinical observations, we systematically investigated whether the presence of peripheral neuropathy could predict the underlying genetic defect in patients with progressive external ophthalmoplegia. We analysed detailed demographic, clinical and neurophysiological data from 116 patients with genetically-defined mitochondrial disease and progressive external ophthalmoplegia. Seventy-eight patients (67%) had a single mitochondrial DNA deletion, 12 (10%) had a point mutation of mitochondrial DNA and 26 (22%) had mutations in either POLG, C10orf2 or RRM2B, or had multiple mitochondrial DNA deletions in muscle without an identified nuclear gene defect. Seventy-seven patients had neurophysiological studies; of these, 16 patients (21%) had a large-fibre peripheral neuropathy. The prevalence of peripheral neuropathy was significantly lower in patients with a single mitochondrial DNA deletion (2%) as compared to those with a point mutation of mitochondrial DNA or with a nuclear DNA defect (44% and 52%, respectively; P < 0.001). Univariate analyses revealed significant differences in the distribution of other clinical features between genotypes, including age at disease onset, gender, family history, progressive external ophthalmoplegia at clinical presentation, hearing loss, pigmentary retinopathy and extrapyramidal features. However, binomial logistic regression analysis identified peripheral neuropathy as the only independent predictor associated with a nuclear DNA defect (P = 0.002; odds ratio 8.43, 95% confidence

  6. Peripheral neuropathy predicts nuclear gene defect in patients with mitochondrial ophthalmoplegia.

    PubMed

    Horga, Alejandro; Pitceathly, Robert D S; Blake, Julian C; Woodward, Catherine E; Zapater, Pedro; Fratter, Carl; Mudanohwo, Ese E; Plant, Gordon T; Houlden, Henry; Sweeney, Mary G; Hanna, Michael G; Reilly, Mary M

    2014-12-01

    Progressive external ophthalmoplegia is a common clinical feature in mitochondrial disease caused by nuclear DNA defects and single, large-scale mitochondrial DNA deletions and is less frequently associated with point mutations of mitochondrial DNA. Peripheral neuropathy is also a frequent manifestation of mitochondrial disease, although its prevalence and characteristics varies considerably among the different syndromes and genetic aetiologies. Based on clinical observations, we systematically investigated whether the presence of peripheral neuropathy could predict the underlying genetic defect in patients with progressive external ophthalmoplegia. We analysed detailed demographic, clinical and neurophysiological data from 116 patients with genetically-defined mitochondrial disease and progressive external ophthalmoplegia. Seventy-eight patients (67%) had a single mitochondrial DNA deletion, 12 (10%) had a point mutation of mitochondrial DNA and 26 (22%) had mutations in either POLG, C10orf2 or RRM2B, or had multiple mitochondrial DNA deletions in muscle without an identified nuclear gene defect. Seventy-seven patients had neurophysiological studies; of these, 16 patients (21%) had a large-fibre peripheral neuropathy. The prevalence of peripheral neuropathy was significantly lower in patients with a single mitochondrial DNA deletion (2%) as compared to those with a point mutation of mitochondrial DNA or with a nuclear DNA defect (44% and 52%, respectively; P<0.001). Univariate analyses revealed significant differences in the distribution of other clinical features between genotypes, including age at disease onset, gender, family history, progressive external ophthalmoplegia at clinical presentation, hearing loss, pigmentary retinopathy and extrapyramidal features. However, binomial logistic regression analysis identified peripheral neuropathy as the only independent predictor associated with a nuclear DNA defect (P=0.002; odds ratio 8.43, 95% confidence interval 2

  7. Octocoral mitochondrial genomes provide insights into the phylogenetic history of gene order rearrangements, order reversals, and cnidarian phylogenetics.

    PubMed

    Figueroa, Diego F; Baco, Amy R

    2014-12-24

    We use full mitochondrial genomes to test the robustness of the phylogeny of the Octocorallia, to determine the evolutionary pathway for the five known mitochondrial gene rearrangements in octocorals, and to test the suitability of using mitochondrial genomes for higher taxonomic-level phylogenetic reconstructions. Our phylogeny supports three major divisions within the Octocorallia and show that Paragorgiidae is paraphyletic, with Sibogagorgia forming a sister branch to the Coralliidae. Furthermore, Sibogagorgia cauliflora has what is presumed to be the ancestral gene order in octocorals, but the presence of a pair of inverted repeat sequences suggest that this gene order was not conserved but rather evolved back to this apparent ancestral state. Based on this we recommend the resurrection of the family Sibogagorgiidae to fix the paraphyly of the Paragorgiidae. This is the first study to show that in the Octocorallia, mitochondrial gene orders have evolved back to an ancestral state after going through a gene rearrangement, with at least one of the gene orders evolving independently in different lineages. A number of studies have used gene boundaries to determine the type of mitochondrial gene arrangement present. However, our findings suggest that this method known as gene junction screening may miss evolutionary reversals. Additionally, substitution saturation analysis demonstrates that while whole mitochondrial genomes can be used effectively for phylogenetic analyses within Octocorallia, their utility at higher taxonomic levels within Cnidaria is inadequate. Therefore for phylogenetic reconstruction at taxonomic levels higher than subclass within the Cnidaria, nuclear genes will be required, even when whole mitochondrial genomes are available.

  8. Enhanced heterologous protein display on bacterial magnetic particles using a lon protease gene deletion mutant in Magnetospirillum magneticum AMB-1.

    PubMed

    Kanetsuki, Yuka; Tanaka, Tsuyoshi; Matsunaga, Tadashi; Yoshino, Tomoko

    2013-07-01

    Bacterial magnetic particles (BacMPs) produced by the magnetotactic bacterium Magnetospirillum magneticum AMB-1, are used as magnetic supports or carriers for a variety of biomedical and environmental applications. Although protein expression systems on BacMPs have been established in previous studies, the expression efficiency was dependent on the introduced protein sequences. Recombinant human proteins are often poorly expressed on BacMPs because of proteolytic degradation by endogenous proteases. We constructed a lon protease gene deletion mutant strain (Δlon) of M. magneticum AMB-1 by homologous recombination to increase the efficiency of functional protein display on BacMPs using Δlon host cells. Wild-type and Δlon-M. magneticum AMB-1 cells were transformed using expression plasmids for human proteins, thyroid-stimulating hormone receptor (TSHR) and the class II major histocompatibility complex (MHC II) molecules onto BacMPs. Although mRNA expression of both TSHR and MHC II was the same level in the wild-type and Δlon transformants, the protein expression levels in Δlon transformants were significantly increased versus wild-type cells. Furthermore, the amounts of two different human proteins on BacMPs were successfully improved. This phenomenon could be due to the reduction of the degradation of target proteins in the Δlon strain. This is the first report to construct a protease deletion mutant in magnetotactic bacteria. The Δlon strain is a useful host to provide BacMPs displaying target proteins for various experimental, and ultimately, clinical applications. Copyright © 2013 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

  9. Potential impact of human mitochondrial replacement on global policy regarding germline gene modification.

    PubMed

    Ishii, Tetsuya

    2014-08-01

    Previous discussions regarding human germline gene modification led to a global consensus that no germline should undergo genetic modification. However, the UK Human Fertilisation and Embryology Authority, having conducted at the UK Government's request a scientific review and a wide public consultation, provided advice to the Government on the pros and cons of Parliament's lifting a ban on altering mitochondrial DNA content of human oocytes and embryos, so as to permit the prevention of maternal transmission of mitochondrial diseases. In this commentary, relevant ethical and biomedical issues are examined and requirements for proceeding with this novel procedure are suggested. Additionally, potentially significant impacts of the UK legalization on global policy concerning germline gene modification are discussed in the context of recent advances in genome-editing technology. It is concluded that international harmonization is needed, as well as further ethical and practical consideration, prior to the legalization of human mitochondrial replacement.

  10. Gene cloning, molecular modeling, and phylogenetics of serine protease P32 and serine carboxypeptidase SCP1 from nematophagous fungi Pochonia rubescens and Pochonia chlamydosporia.

    PubMed

    Larriba, Eduardo; Martín-Nieto, José; Lopez-Llorca, Luis Vicente

    2012-07-01

    The fungi Pochonia chlamydosporia and Pochonia rubescens are parasites of nematode eggs and thus are biocontrol agents of nematodes. Proteolytic enzymes such as the S8 proteases VCP1 and P32, secreted during the pathogenesis of nematode eggs, are major virulence factors in these fungi. Recently, expression of these enzymes and of SCP1, a new putative S10 carboxypeptidase, was detected during endophytic colonization of barley roots by these fungi. In our study, we cloned the genomic and mRNA sequences encoding P32 from P. rubescens and SCP1 from P. chlamydosporia. P32 showed a high homology with the serine proteases Pr1A from the entomopathogenic fungus Metarhizium anisopliae and VCP1 from P. chlamydosporia (86% and 76% identity, respectively). However, the catalytic pocket of P32 showed differences in the amino acids of the substrate-recognition sites compared with the catalytic pockets of Pr1A and VCP1 proteases. Phylogenetic analysis of P32 suggests a common ancestor with protease Pr1A. SCP1 displays the characteristic features of a member of the S10 family of serine proteases. Phylogenetic comparisons show that SCP1 and other carboxypeptidases from filamentous fungi have an origin different from that of yeast vacuolar serine carboxypeptidases. Understanding protease genes from nematophagous fungi is crucial for enhancing the biocontrol potential of these organisms.

  11. RNA editing of 10 Didymium iridis mitochondrial genes and comparison with the homologous genes in Physarum polycephalum

    PubMed Central

    Traphagen, Stephen J.; Dimarco, Michael J.; Silliker, Margaret E.

    2010-01-01

    Regions of the Didymium iridis mitochondrial genome were identified with similarity to typical mitochondrial genes; however, these regions contained numerous stop codons. We used RT-PCR and DNA sequencing to determine whether, through RNA editing, these regions were transcribed into mRNAs that could encode functional proteins. Ten putative gene regions were examined: atp1, atp6, atp8, atp9, cox1, cox2, cytb, nad4L, nad6, and nad7. The cDNA sequences of each gene could encode a functional mitochondrial protein that was highly conserved compared with homologous genes. The type of editing events and editing sequence features were very similar to those observed in the homologous genes of Physarum polycephalum, though the actual editing locations showed a variable degree of conservation. Edited sites were compared with encoded sites in D. iridis and P. polycephalum for all 10 genes. Edited sequence for a portion of the cox1 gene was available for six myxomycetes, which, when compared, showed a high degree of conservation at the protein level. Different types of editing events showed varying degrees of site conservation with C-to-U base changes being the least conserved. Several aspects of single C insertion editing events led to the preferential creation of hydrophobic amino acid codons that may help to minimize adverse effects on the resulting protein structure. PMID:20159952

  12. RNA editing of 10 Didymium iridis mitochondrial genes and comparison with the homologous genes in Physarum polycephalum.

    PubMed

    Traphagen, Stephen J; Dimarco, Michael J; Silliker, Margaret E

    2010-04-01

    Regions of the Didymium iridis mitochondrial genome were identified with similarity to typical mitochondrial genes; however, these regions contained numerous stop codons. We used RT-PCR and DNA sequencing to determine whether, through RNA editing, these regions were transcribed into mRNAs that could encode functional proteins. Ten putative gene regions were examined: atp1, atp6, atp8, atp9, cox1, cox2, cytb, nad4L, nad6, and nad7. The cDNA sequences of each gene could encode a functional mitochondrial protein that was highly conserved compared with homologous genes. The type of editing events and editing sequence features were very similar to those observed in the homologous genes of Physarum polycephalum, though the actual editing locations showed a variable degree of conservation. Edited sites were compared with encoded sites in D. iridis and P. polycephalum for all 10 genes. Edited sequence for a portion of the cox1 gene was available for six myxomycetes, which, when compared, showed a high degree of conservation at the protein level. Different types of editing events showed varying degrees of site conservation with C-to-U base changes being the least conserved. Several aspects of single C insertion editing events led to the preferential creation of hydrophobic amino acid codons that may help to minimize adverse effects on the resulting protein structure.

  13. Importance of mitochondrial dysfunction in oxidative stress response: A comparative study of gene expression profiles.

    PubMed

    Shibanuma, Motoko; Inoue, Anna; Ushida, Kyota; Uchida, Tetsu; Ishikawa, Fumihiro; Mori, Kazunori; Nose, Kiyoshi

    2011-06-01

    Mitochondria are considered to play an important role in oxidative stress response since they are a source of reactive oxygen species and are also targeted by these species. This study examined the mitochondrial conditions in cells of epithelial origin that were exposed to H(2)O(2) and found a decline in the membrane potential along with a specific loss of UQCRC1, a sub-unit of complex III, suggesting that mitochondrial dysfunction occurs upon exposure to oxidative stress. This observation led to the hypothesis that certain cellular responses to oxidative stress occurred because of mitochondrial dysfunction. When mitochondria-less (pseudo ρ0) cells were examined as a model of mitochondrial dysfunction, striking similarities were found in their cellular responses compared with those found in cells exposed to oxidative stress, including changes in gene expression and gelatinolytic enzyme activities, thus suggesting that cellular responses to oxidative stress were partly mediated by mitochondrial dysfunction. This possibility was further validated by microarray analysis, which suggested that almost one-fourth of the cellular responses to oxidative stress were mediated by mitochondrial dysfunction that accompanies oxidative stress, thereby warranting a therapeutic strategy that targets mitochondria for the treatment of oxidative stress-associated diseases.

  14. Deleterious mutation in FDX1L gene is associated with a novel mitochondrial muscle myopathy.

    PubMed

    Spiegel, Ronen; Saada, Ann; Halvardson, Jonatan; Soiferman, Devorah; Shaag, Avraham; Edvardson, Simon; Horovitz, Yoseph; Khayat, Morad; Shalev, Stavit A; Feuk, Lars; Elpeleg, Orly

    2014-07-01

    Isolated metabolic myopathies encompass a heterogeneous group of disorders, with mitochondrial myopathies being a subgroup, with depleted skeletal muscle energy production manifesting either by recurrent episodes of myoglobinuria or progressive muscle weakness. In this study, we investigated the genetic cause of a patient from a consanguineous family who presented with adolescent onset autosomal recessive mitochondrial myopathy. Analysis of enzyme activities of the five respiratory chain complexes in our patients' skeletal muscle showed severely impaired activities of iron sulfur (Fe-S)-dependent complexes I, II and III and mitochondrial aconitase. We employed exome sequencing combined with homozygosity mapping to identify a homozygous mutation, c.1A>T, in the FDX1L gene, which encodes the mitochondrial ferredoxin 2 (Fdx2) protein. The mutation disrupts the ATG initiation translation site resulting in severe reduction of Fdx2 content in the patient muscle and fibroblasts mitochondria. Fdx2 is the second component of the Fe-S cluster biogenesis machinery, the first being IscU that is associated with isolated mitochondrial myopathy. We suggest adding genetic analysis of FDX1L in cases of mitochondrial myopathy especially when associated with reduced activity of the respiratory chain complexes I, II and III.

  15. Unparalleled replacement of native mitochondrial genes by foreign homologs in a holoparasitic plant.

    PubMed

    Sanchez-Puerta, M Virginia; García, Laura E; Wohlfeiler, Josefina; Ceriotti, Luis F

    2017-04-01

    Horizontal gene transfer (HGT) among flowering plant mitochondria occurs frequently and, in most cases, leads to nonfunctional transgenes in the recipient genome. Parasitic plants are particularly prone to this phenomenon, but their mitochondrial genomes (mtDNA) have been largely unexplored. We undertook a large-scale mitochondrial genomic study of the holoparasitic plant Lophophytum mirabile (Balanophoraceae). Comprehensive phylogenetic analyses were performed to address the frequency, origin, and impact of HGT. The sequencing of the complete mtDNA of L. mirabile revealed the unprecedented acquisition of host-derived mitochondrial genes, representing 80% of the protein-coding gene content. All but two of these foreign genes replaced the native homologs and are probably functional in energy metabolism. The genome consists of 54 circular-mapping chromosomes, 25 of which carry no intact genes. The likely functional replacement of up to 26 genes in L. mirabile represents a stunning example of the potential effect of rampant HGT on plant mitochondria. The use of host-derived genes may have a positive effect on the host-parasite relationship, but could also be the result of nonadaptive forces.

  16. Host mitochondrial association evolved in the human parasite Toxoplasma gondii via neofunctionalization of a gene duplicate

    USDA-ARS?s Scientific Manuscript database

    In Toxoplasma gondii, an intracellular parasite of humans and other warm-blooded animals, the ability to associate with host mitochondria (HMA) is driven by a locally expanded gene family that encodes multiple mitochondrial association factor 1 (MAF1) proteins. The importance of copy number in the e...

  17. Evolutionary Inference across Eukaryotes Identifies Specific Pressures Favoring Mitochondrial Gene Retention.

    PubMed

    Johnston, Iain G; Williams, Ben P

    2016-02-24

    Since their endosymbiotic origin, mitochondria have lost most of their genes. Although many selective mechanisms underlying the evolution of mitochondrial genomes have been proposed, a data-driven exploration of these hypotheses is lacking, and a quantitatively supported consensus remains absent. We developed HyperTraPS, a methodology coupling stochastic modeling with Bayesian inference, to identify the ordering of evolutionary events and suggest their causes. Using 2015 complete mitochondrial genomes, we inferred evolutionary trajectories of mtDNA gene loss across the eukaryotic tree of life. We find that proteins comprising the structural cores of the electron transport chain are preferentially encoded within mitochondrial genomes across eukaryotes. A combination of high GC content and high protein hydrophobicity is required to explain patterns of mtDNA gene retention; a model that accounts for these selective pressures can also predict the success of artificial gene transfer experiments in vivo. This work provides a general method for data-driven inference of the ordering of evolutionary and progressive events, here identifying the distinct features shaping mitochondrial genomes of present-day species.

  18. Detection and quantification of Pfiesteria piscicida by using the mitochondrial cytochrome b gene.

    PubMed

    Zhang, Huan; Lin, Senjie

    2002-02-01

    Mitochondrial cytochrome b was isolated from the dinoflagellate Pfiesteria piscicida, and the utility of the gene for species identification was examined. One of the primer sets designed was shown to be highly specific for P. piscicida. A time step PCR protocol was used to demonstrate the potential of this primer set for quantification of this species.

  19. A novel mutation in the mitochondrial DNA cytochrome b gene (MTCYB) in a patient with Prader Willi syndrome.

    PubMed

    Yiş, Uluç; Ezgü, Fatih Süheyl; Karakaya, Pakize; Polat, İpek; Arslan, Nur; Çankaya, Tufan; Bozkaya, Özlem Giray; Kurul, Semra Hız

    2015-03-01

    In recent years, it has been suggested that defects in energy metabolism may accompany Prader Willi syndrome. Mutations in the mitochondrial cytochrome b gene have been commonly associated isolated mitochondrial myopathy and exercise intolerance, rarely with multisystem disorders. The authors describe a novel mutation (mt. 15209T>C) in mitochondrial cytochrome b gene in a 2-year-old girl with Prader-Willi syndrome with a clinical history of lactic acidosis attacks, renal sodium loss, hepatopathy, progressive cerebral atrophy, and sudden death. The authors suggest that atypical clinical findings in patients with Prader-Willi syndrome should direct the physician to search for a mitochondrial disease.

  20. A nodule-specific gene encoding a subtilisin-like protease is expressed in early stages of actinorhizal nodule development.

    PubMed Central

    Ribeiro, A; Akkermans, A D; van Kammen, A; Bisseling, T; Pawlowski, K

    1995-01-01

    To identify genes specifically expressed during early stages of actinorhizal nodule development, a cDNA library made from poly(A) RNA from root nodules of Alnus glutinosa was screened differentially with nodule and root cDNA, respectively. Seven nodule-enhanced and four nodule-specific cDNA clones were isolated. By using in situ hybridization, two of the nodule-specific cDNAs were shown to be expressed at the highest levels in infected cells before the onset of nitrogen fixation; one of them, ag12 (A. glutinosa), was examined in detail. Sequencing showed that ag12 codes for a serine protease of the subtilisin (EC 3.4.21.14) family. Subtilisins previously appeared to be limited to microorganisms. However, subtilisin-like serine proteases have recently been found in archaebacteria, fungi, and yeasts as well as in mammals; a plant subtilisin has also been sequenced. In yeast and mammals, subtilases are responsible for processing peptide hormones. A homolog of ag12, ara12, was identified in Arabidopsis; it was expressed in all organs, and its expression levels were highest during silique development. Hence, our study shows that subtilases are also involved in both symbiotic and nonsymbiotic processes in plant development. PMID:7647567

  1. A nodule-specific gene encoding a subtilisin-like protease is expressed in early stages of actinorhizal nodule development.

    PubMed

    Ribeiro, A; Akkermans, A D; van Kammen, A; Bisseling, T; Pawlowski, K

    1995-06-01

    To identify genes specifically expressed during early stages of actinorhizal nodule development, a cDNA library made from poly(A) RNA from root nodules of Alnus glutinosa was screened differentially with nodule and root cDNA, respectively. Seven nodule-enhanced and four nodule-specific cDNA clones were isolated. By using in situ hybridization, two of the nodule-specific cDNAs were shown to be expressed at the highest levels in infected cells before the onset of nitrogen fixation; one of them, ag12 (A. glutinosa), was examined in detail. Sequencing showed that ag12 codes for a serine protease of the subtilisin (EC 3.4.21.14) family. Subtilisins previously appeared to be limited to microorganisms. However, subtilisin-like serine proteases have recently been found in archaebacteria, fungi, and yeasts as well as in mammals; a plant subtilisin has also been sequenced. In yeast and mammals, subtilases are responsible for processing peptide hormones. A homolog of ag12, ara12, was identified in Arabidopsis; it was expressed in all organs, and its expression levels were highest during silique development. Hence, our study shows that subtilases are also involved in both symbiotic and nonsymbiotic processes in plant development.

  2. Isolation and characterization of the hyperthermostable serine protease, pyrolysin, and its gene from the hyperthermophilic archaeon Pyrococcus furiosus.

    PubMed

    Voorhorst, W G; Eggen, R I; Geerling, A C; Platteeuw, C; Siezen, R J; Vos, W M

    1996-08-23

    The hyperthermostable serine protease pyrolysin from the hyperthermophilic archaeon Pyrococcus furiosus was purified from membrane fractions. Two proteolytically active fractions were obtained, designated high (HMW) and low (LMW) molecular weight pyrolysin, that showed immunological cross-reaction and identical NH2-terminal sequences in which the third residue could be glycosylated. The HMW pyrolysin showed a subunit mass of 150 kDa after acid denaturation. Incubation of HMW pyrolysin at 95 degrees C resulted in the formation of LMW pyrolysin, probably as a consequence of COOH-terminal autoproteolysis. The 4194-base pair pls gene encoding pyrolysin was isolated and characterized, and its transcription initiation site was identified. The deduced pyrolysin sequence indicated a prepro-enzyme organization, with a 1249-residue mature protein composed of an NH2-terminal catalytic domain with considerable homology to subtilisin-like serine proteases and a COOH-terminal domain that contained most of the 32 possible N-glycosylation sites. The archaeal pyrolysin showed highest homology with eucaryal tripeptidyl peptidases II on the amino acid level but a different cleavage specificity as shown by its endopeptidase activity toward caseins, casein fragments including alphaS1-casein and synthetic peptides.

  3. Mitochondrial impairment increases FL-PINK1 levels by calcium-dependent gene expression.

    PubMed

    Gómez-Sánchez, Rubén; Gegg, Matthew E; Bravo-San Pedro, José M; Niso-Santano, Mireia; Alvarez-Erviti, Lydia; Pizarro-Estrella, Elisa; Gutiérrez-Martín, Yolanda; Alvarez-Barrientos, Alberto; Fuentes, José M; González-Polo, Rosa Ana; Schapira, Anthony H V

    2014-02-01

    Mutations of the PTEN-induced kinase 1 (PINK1) gene are a cause of autosomal recessive Parkinson's disease (PD). This gene encodes a mitochondrial serine/threonine kinase, which is partly localized to mitochondria, and has been shown to play a role in protecting neuronal cells from oxidative stress and cell death, perhaps related to its role in mitochondrial dynamics and mitophagy. In this study, we report that increased mitochondrial PINK1 levels observed in human neuroblastoma SH-SY5Y cells after carbonyl cyanide m-chlorophelyhydrazone (CCCP) treatment were due to de novo protein synthesis, and not just increased stabilization of full length PINK1 (FL-PINK1). PINK1 mRNA levels were significantly increased by 4-fold after 24h. FL-PINK1 protein levels at this time point were significantly higher than vehicle-treated, or cells treated with CCCP for 3h, despite mitochondrial content being decreased by 29%. We have also shown that CCCP dissipated the mitochondrial membrane potential (Δψm) and induced entry of extracellular calcium through L/N-type calcium channels. The calcium chelating agent BAPTA-AM impaired the CCCP-induced PINK1 mRNA and protein expression. Furthermore, CCCP treatment activated the transcription factor c-Fos in a calcium-dependent manner. These data indicate that PINK1 expression is significantly increased upon CCCP-induced mitophagy in a calcium-dependent manner. This increase in expression continues after peak Parkin mitochondrial translocation, suggesting a role for PINK1 in mitophagy that is downstream of ubiquitination of mitochondrial substrates. This sensitivity to intracellular calcium levels supports the hypothesis that PINK1 may also play a role in cellular calcium homeostasis and neuroprotection.

  4. Mitochondrial impairment increases FL-PINK1 levels by calcium-dependent gene expression☆

    PubMed Central

    Gómez-Sánchez, Rubén; Gegg, Matthew E.; Bravo-San Pedro, José M.; Niso-Santano, Mireia; Alvarez-Erviti, Lydia; Pizarro-Estrella, Elisa; Gutiérrez-Martín, Yolanda; Alvarez-Barrientos, Alberto; Fuentes, José M.; González-Polo, Rosa Ana; Schapira, Anthony H.V.

    2014-01-01

    Mutations of the PTEN-induced kinase 1 (PINK1) gene are a cause of autosomal recessive Parkinson's disease (PD). This gene encodes a mitochondrial serine/threonine kinase, which is partly localized to mitochondria, and has been shown to play a role in protecting neuronal cells from oxidative stress and cell death, perhaps related to its role in mitochondrial dynamics and mitophagy. In this study, we report that increased mitochondrial PINK1 levels observed in human neuroblastoma SH-SY5Y cells after carbonyl cyanide m-chlorophelyhydrazone (CCCP) treatment were due to de novo protein synthesis, and not just increased stabilization of full length PINK1 (FL-PINK1). PINK1 mRNA levels were significantly increased by 4-fold after 24 h. FL-PINK1 protein levels at this time point were significantly higher than vehicle-treated, or cells treated with CCCP for 3 h, despite mitochondrial content being decreased by 29%. We have also shown that CCCP dissipated the mitochondrial membrane potential (Δψm) and induced entry of extracellular calcium through L/N-type calcium channels. The calcium chelating agent BAPTA-AM impaired the CCCP-induced PINK1 mRNA and protein expression. Furthermore, CCCP treatment activated the transcription factor c-Fos in a calcium-dependent manner. These data indicate that PINK1 expression is significantly increased upon CCCP-induced mitophagy in a calcium-dependent manner. This increase in expression continues after peak Parkin mitochondrial translocation, suggesting a role for PINK1 in mitophagy that is downstream of ubiquitination of mitochondrial substrates. This sensitivity to intracellular calcium levels supports the hypothesis that PINK1 may also play a role in cellular calcium homeostasis and neuroprotection. PMID:24184327

  5. Molecular characterization of a gene encoding extracellular serine protease isolated from a subtilisin inhibitor-deficient mutant of Streptomyces albogriseolus S-3253.

    PubMed Central

    Taguchi, S; Odaka, A; Watanabe, Y; Momose, H

    1995-01-01

    An extracellular serine protease produced by a mutant, M1, derived from Streptomyces albogriseolus S-3253 that no longer produces a protease inhibitor (Streptomyces subtilisin inhibitor [SSI]) was isolated. A 20-kDa protein was purified by its affinity for SSI and designated SAM-P20. The amino acid sequence of the amino-terminal region of SAM-P20 revealed high homology with the sequences of Streptomyces griseus proteases A and B, and the gene sequence confirmed the relationships. The sequence also revealed a putative amino acid signal sequence for SAM-P20 that apparently functioned to allow secretion of SAM-P20 from Escherichia coli carrying the recombinant gene. SAM-P20 produced by E. coli cells was shown to be sensitive to SSI inhibition. PMID:7887600

  6. The yeast VAS1 gene encodes both mitochondrial and cytoplasmic valyl-tRNA synthetases.

    PubMed

    Chatton, B; Walter, P; Ebel, J P; Lacroute, F; Fasiolo, F

    1988-01-05

    S1 mapping on the VAS1 structural gene indicates the existence of two classes of transcripts initiating at distinct in-frame translation start codons. The longer class of VAS1 transcripts initiates upstream of both ATG codons located 138 base pairs away and the shorter class downstream of the first ATG. A mutation that destroys the first AUG on the long message results in respiratory deficiency but does not affect viability. Mutation of the ATG at position 139 leads to lethality because the initiating methionine codon of the essential cytoplasmic valyl-tRNA synthetase has been destroyed. N-terminal protein sequence data further confirm translation initiation at ATG-139 for the cytoplasmic valyl-tRNA synthetase. From these results, we conclude that the VAS1 single gene encodes both mitochondrial and cytoplasmic valyl-tRNA synthetases. The presequence of the mitochondrial valyl-tRNA synthetase shows amino acid composition but not the amphiphilic character of imported mitochondrial proteins. From mutagenesis of the ATG-139 we conclude that the presequence specifically targets the cytoplasmically synthesized mitochondrial valyl-tRNA synthetase to the mitochondrial outer membrane and prevents binding of the enzyme core to cytoplasmic tRNAVal.

  7. A Novel MitoTimer Reporter Gene for Mitochondrial Content, Structure, Stress, and Damage in Vivo*

    PubMed Central

    Laker, Rhianna C.; Xu, Peng; Ryall, Karen A.; Sujkowski, Alyson; Kenwood, Brandon M.; Chain, Kristopher H.; Zhang, Mei; Royal, Mary A.; Hoehn, Kyle L.; Driscoll, Monica; Adler, Paul N.; Wessells, Robert J.; Saucerman, Jeffrey J.; Yan, Zhen

    2014-01-01

    Mitochondrial dysfunction plays important roles in many diseases, but there is no satisfactory method to assess mitochondrial health in vivo. Here, we engineered a MitoTimer reporter gene from the existing Timer reporter gene. MitoTimer encodes a mitochondria-targeted green fluorescent protein when newly synthesized, which shifts irreversibly to red fluorescence when oxidized. Confocal microscopy confirmed targeting of the MitoTimer protein to mitochondria in cultured cells, Caenorhabditis elegans touch receptor neurons, Drosophila melanogaster heart and indirect flight muscle, and mouse skeletal muscle. A ratiometric algorithm revealed that conditions that cause mitochondrial stress led to a significant shift toward red fluorescence as well as accumulation of pure red fluorescent puncta of damaged mitochondria targeted for mitophagy. Long term voluntary exercise resulted in a significant fluorescence shift toward green, in mice and D. melanogaster, as well as significantly improved structure and increased content in mouse FDB muscle. In contrast, high-fat feeding in mice resulted in a significant shift toward red fluorescence and accumulation of pure red puncta in skeletal muscle, which were completely ameliorated by voluntary wheel running. Hence, MitoTimer allows for robust analysis of multiple parameters of mitochondrial health under both physiological and pathological conditions and will be highly useful for future research of mitochondrial health in multiple disciplines in vivo. PMID:24644293

  8. A mutation in the inner mitochondrial membrane peptidase 2-like gene (Immp2l) affects mitochondrial function and impairs fertility in mice.

    PubMed

    Lu, Baisong; Poirier, Christophe; Gaspar, Tamas; Gratzke, Christian; Harrison, Wilbur; Busija, David; Matzuk, Martin M; Andersson, Karl-Erik; Overbeek, Paul A; Bishop, Colin E

    2008-04-01

    The mitochondrion is involved in energy generation, apoptosis regulation, and calcium homeostasis. Mutations in genes involved in mitochondrial processes often result in a severe phenotype or embryonic lethality, making the study of mitochondrial involvement in aging, neurodegeneration, or reproduction challenging. Using a transgenic insertional mutagenesis strategy, we generated a mouse mutant, Immp2lTg(Tyr)979Ove, with a mutation in the inner mitochondrial membrane peptidase 2-like (Immp2l) gene. The mutation affected the signal peptide sequence processing of mitochondrial proteins cytochrome c1 and glycerol phosphate dehydrogenase 2. The inefficient processing of mitochondrial membrane proteins perturbed mitochondrial function so that mitochondria from mutant mice manifested hyperpolarization, higher than normal superoxide ion generation, and higher levels of ATP. Homozygous Immp2lTg(Tyr)979Ove females were infertile due to defects in folliculogenesis and ovulation, whereas mutant males were severely subfertile due to erectile dysfunction. The data suggest that the high superoxide ion levels lead to a decrease in the bioavailability of nitric oxide and an increase in reactive oxygen species stress, which underlies these reproductive defects. The results provide a novel link between mitochondrial dysfunction and infertility and suggest that superoxide ion targeting agents may prove useful for treating infertility in a subpopulation of infertile patients.

  9. Reduced expression of Paternally Expressed Gene-3 enhances somatic cell reprogramming through mitochondrial activity perturbation.

    PubMed

    Theka, Ilda; Sottile, Francesco; Aulicino, Francesco; Garcia, Alvaro Castells; Cosma, Maria Pia

    2017-08-29

    Imprinted genes control several cellular and metabolic processes in embryonic and adult tissues. In particular, paternally expressed gene-3 (Peg3) is active in the adult stem cell population and during muscle and neuronal lineage development. Here we have investigated the role of Peg3 in mouse embryonic stem cells (ESCs) and during the process of somatic cell reprogramming towards pluripotency. Our data show that Peg3 knockdown increases expression of pluripotency genes in ESCs and enhances reprogramming efficiency of both mouse embryonic fibroblasts and neural stem cells. Interestingly, we observed that altered activity of Peg3 correlates with major perturbations of mitochondrial gene expression and mitochondrial function, which drive metabolic changes during somatic cell reprogramming. Overall, our study shows that Peg3 is a regulator of pluripotent stem cells and somatic cell reprogramming.

  10. Mitochondrial gene rearrangements confirm the parallel evolution of the crab-like form.

    PubMed

    Morrison, C L; Harvey, A W; Lavery, S; Tieu, K; Huang, Y; Cunningham, C W

    2002-02-22

    The repeated appearance of strikingly similar crab-like forms in independent decapod crustacean lineages represents a remarkable case of parallel evolution. Uncertainty surrounding the phylogenetic relationships among crab-like lineages has hampered evolutionary studies. As is often the case, aligned DNA sequences by themselves were unable to fully resolve these relationships. Four nested mitochondrial gene rearrangements--including one of the few reported movements of an arthropod protein-coding gene--are congruent with the DNA phylogeny and help to resolve a crucial node. A phylogenetic analysis of DNA sequences, and gene rearrangements, supported five independent origins of the crab-like form, and suggests that the evolution of the crab-like form may be irreversible. This result supports the utility of mitochondrial gene rearrangements in phylogenetic reconstruction.

  11. Complete sequence and gene organization of the mitochondrial genome of the land snail Albinaria coerulea.

    PubMed

    Hatzoglou, E; Rodakis, G C; Lecanidou, R

    1995-08-01

    The complete sequence (14,130 bp) of the mitochondrial DNA (mtDNA) of the land snail Albinaria coerulea was determined. It contains 13 protein, two rRNA and 22 tRNA genes. Twenty-four of these genes are encoded by one and 13 genes by the other strand. The gene arrangement shares almost no similarities with that of two other molluscs for which the complete gene content and arrangement are known, the bivalve Mytilus edulis and the chiton Katharina tunicata; the protein and rRNA gene order is similar to that of another terrestrial gastropod, Cepaea nemoralis. Unusual features include the following: (1) the absence of lengthy noncoding regions (there are only 141 intergenic nucleotides interspersed at different gene borders, the longest intergenic sequence being 42 nucleotides) (2) the presence of several overlapping genes (mostly tRNAs), (3) the presence of tRNA-like structures and other stem and loop structures within genes. An RNA editing system acting on tRNAs must necessarily be invoked for posttranscriptional extension of the overlapping tRNAs. Due to these features, and also because of the small size of its genes (e.g., it contains the smallest rRNA genes among the known coelomates), it is one of the most compact mitochondrial genomes known to date.

  12. Complete Sequence and Gene Organization of the Mitochondrial Genome of the Land Snail Albinaria Coerulea

    PubMed Central

    Hatzoglou, E.; Rodakis, G. C.; Lecanidou, R.

    1995-01-01

    The complete sequence (14,130 bp) of the mitochondrial DNA (mtDNA) of the land snail Albinaria coerulea was determined. It contains 13 protein, two rRNA and 22 tRNA genes. Twenty-four of these genes are encoded by one and 13 genes by the other strand. The gene arrangement shares almost no similarities with that of two other molluscs for which the complete gene content and arrangement are known, the bivalve Mytilus edulis and the chiton Katharina tunicata; the protein and rRNA gene order is similar to that of another terrestrial gastropod, Cepaea nemoralis. Unusual features include the following: (1) the absence of lengthy noncoding regions (there are only 141 intergenic nucleotides interspersed at different gene borders, the longest intergenic sequence being 42 nucleotides), (2) the presence of several overlapping genes (mostly tRNAs), (3) the presence of tRNA-like structures and other stem and loop structures within genes. An RNA editing system acting on tRNAs must necessarily be invoked for posttranscriptional extension of the overlapping tRNAs. Due to these features, and also because of the small size of its genes (e.g., it contains the smallest rRNA genes among the known coelomates), it is one of the most compact mitochondrial genomes known to date. PMID:7498775

  13. Prevalence of mitochondrial gene mutations among hearing impaired patients

    PubMed Central

    Usami, S.; Abe, S.; Akita, J.; Namba, A.; Shinkawa, H.; Ishii, M.; Iwasaki, S.; Hoshino, T.; Ito, J.; Doi, K.; Kubo, T.; Nakagawa, T.; Komiyama, S.; Tono, T.; Komune, S.

    2000-01-01

    The frequency of three mitochondrial point mutations, 1555A→G, 3243A→G, and 7445A→G, known to be associated with hearing impairment, was examined using restriction fragment length polymorphism (RFLP) analysis in two Japanese groups: (1) 319 unrelated SNHL outpatients (including 21 with aminoglycoside antibiotic injection history), and (2) 140 cochlear implantation patients (including 22 with aminoglycoside induced hearing loss). Approximately 3% of the outpatients and 10% of the cochlear implantation patients had the 1555A→G mutation. The frequency was higher in the patients with a history of aminoglycoside injection (outpatient group 33%, cochlear implantation group 59%). One outpatient (0.314%) had the 3243A→G mutation, but no outpatients had the 7445A→G mutation and neither were found in the cochlear implantation group. The significance of the 1555A→G mutation, the most prevalent mitochondrial mutation found in this study of a hearing impaired population in Japan, among subjects with specific backgrounds, such as aminoglycoside induced hearing loss, is evident.


Keywords: mitochondria; point mutation; hearing impairment; frequencies PMID:10633132

  14. The mitochondrial genome of Iberobaenia (Coleoptera: Iberobaeniidae): first rearrangement of protein-coding genes in the beetles.

    PubMed

    Andujar, Carmelo; Arribas, Paula; Linard, Benjamin; Kundrata, Robin; Bocak, Ladislav; Vogler, Alfried P

    2017-03-01

    The complete mitochondrial genome of the recently discovered beetle family Iberobaeniidae is described and compared with known coleopteran mitogenomes. The mitochondrial sequence was obtained by shotgun metagenomic sequencing using the Illumina Miseq technology and resulted in an average coverage of 130 × and a minimum coverage of 35×. The mitochondrial genome of Iberobaeniidae includes 13 protein-coding genes, 2 rRNAs, 22 tRNAs genes, and 1 putative control region, and showed a unique rearrangement of protein-coding genes. This is the first rearrangement affecting the relative position of protein-coding and ribosomal genes reported for the order Coleoptera.

  15. Complete mitochondrial genome of Tubulipora flabellaris (Bryozoa: Stenolaemata): the first representative from the class Stenolaemata with unique gene order.

    PubMed

    Sun, Ming'an; Shen, Xin; Liu, Huilian; Liu, Xixing; Wu, Zhigang; Liu, Bin

    2011-09-01

    Mitochondrial genomes play a significant role in the reconstruction of phylogenetic relationships within metazoans. There are still many controversies concerning the phylogenetic position of the phylum Bryozoa. In this research, we have finished the complete mitochondrial genome of one bryozoan (Tubulipora flabellaris), which is the first representative from the class Stenolaemata. The complete mitochondrial genome of T. flabellaris is 13,763bp in length and contains 36 genes, which lacks the atp8 gene in contrast to the typical metazoan mitochondrial genomes. Gene arrangement comparisons indicate that the mitochondrial genome of T. flabellaris has unique gene order when compared with other metazoans. The four known bryozoans complete mitochondrial genomes also have very different gene arrangements, indicates that bryozoan mitochondrial genomes have experienced drastic rearrangements. To investigate the phylogenetic relationship of Bryozoa, phylogenetic analyses based on amino acid sequences of 11 protein coding genes (excluding atp6 and atp8) from 26 metazoan complete mitochondrial genomes were made utilizing Maximum Likelihood (ML) and Bayesian methods, respectively. The results indicate the monopoly of Lophotrochozoa and a close relationship between Chaetognatha and Bryozoa. However, more evidences are needed to clarify the relationship between two groups. Lophophorate appeared to be polyphyletic according to our analyses. Meanwhile, neither analysis supports close relationship between Branchiopod and Phoronida. Four bryozoans form a clade and the relationship among them is T. flabellaris+(F. hispida+(B. neritina+W. subtorquata)), which is in coincidence with traditional classification system. Copyright © 2011 Elsevier B.V. All rights reserved.

  16. Increased mitochondrial ROS formation by acetaminophen in human hepatic cells is associated with gene expression changes suggesting disruption of the mitochondrial electron transport chain.

    PubMed

    Jiang, Jian; Briedé, Jacob J; Jennen, Danyel G J; Van Summeren, Anke; Saritas-Brauers, Karen; Schaart, Gert; Kleinjans, Jos C S; de Kok, Theo M C M

    2015-04-16

    Acetaminophen (APAP) overdosage results in hepatotoxicity, but the underlying molecular mechanisms are still not completely understood. In the current study, we focused on mitochondrial-specific oxidative liver injury induced by APAP exposure. Owning to genetic polymorphisms in the CYP2E1 gene or varying inducibility by xenobiotics, the CYP2E1 mRNA level and protein activity vary extensively among individuals. As CYP2E1 is a known ROS generating enzyme, we chose HepG2 to minimize CYP2E1-induced ROS formation, which will help us better understand the APAP induced mitochondrial-specific hepatotoxicity in a subpopulation with low CYP2E1 activity. HepG2 cells were exposed to a low and toxic dose (0.5 and 10mM) of APAP and analyzed at four time points for genome-wide gene expression. Mitochondria were isolated and electron spin resonance spectroscopy was performed to measure the formation of mitochondrial ROS. The yield of ATP was measured to confirm the impact of the toxic dose of APAP on cellular energy production. Our results indicate that 10mM APAP significantly influences the expression of mitochondrial protein-encoding genes in association with an increase in mitochondrial ROS formation. Additionally, 10mM APAP affects the expression of genes encoding the subunits of electron transport chain (ETC) complexes, which may alter normal mitochondrial functions by disrupting the assembly, stability, and structural integrity of ETC complexes, leading to a measurable depletion of ATP, and cell death. The expression of mitochondrium-specific antioxidant enzyme, SOD2, is reduced which may limit the ROS scavenging ability and cause imbalance of the mitochondrial ROS homeostasis. Overall, transcriptome analysis reveals the molecular processes involved in the observed APAP-induced increase of mitochondrial ROS formation and the associated APAP-induced oxidative stress.

  17. Effects of different dietary conditions on the expression of trypsin- and chymotrypsin-like protease genes in the digestive system of the migratory locust, Locusta migratoria.

    PubMed

    Spit, Jornt; Zels, Sven; Dillen, Senne; Holtof, Michiel; Wynant, Niels; Vanden Broeck, Jozef

    2014-05-01

    While technological advancements have recently led to a steep increase in genomic and transcriptomic data, and large numbers of protease sequences are being discovered in diverse insect species, little information is available about the expression of digestive enzymes in Orthoptera. Here we describe the identification of Locusta migratoria serine protease transcripts (cDNAs) involved in digestion, which might serve as possible targets for pest control management. A total of 5 putative trypsin and 15 putative chymotrypsin gene sequences were characterized. Phylogenetic analysis revealed that these are distributed among 3 evolutionary conserved clusters. In addition, we have determined the relative gene expression levels of representative members in the gut under different feeding conditions. This study demonstrated that the transcript levels for all measured serine proteases were strongly reduced after starvation. On the other hand, larvae of L. migratoria displayed compensatory effects to the presence of Soybean Bowman Birk (SBBI) and Soybean Trypsin (SBTI) inhibitors in their diet by differential upregulation of multiple proteases. A rapid initial upregulation was observed for all tested serine protease transcripts, while only for members belonging to class I, the transcript levels remained elevated after prolonged exposure. In full agreement with these results, we also observed an increase in proteolytic activity in midgut secretions of locusts that were accustomed to the presence of protease inhibitors in their diet, while no change in sensitivity to these inhibitors was observed. Taken together, this paper is the first comprehensive study on dietary dependent transcript levels of proteolytic enzymes in Orthoptera. Our data suggest that compensatory response mechanisms to protease inhibitor ingestion may have appeared early in insect evolution.

  18. Reducing Amyloid Plaque Burden via Ex Vivo Gene Delivery of an Aβ-Degrading Protease: A Novel Therapeutic Approach to Alzheimer Disease

    PubMed Central

    Hemming, Matthew L; Patterson, Michaela; Reske-Nielsen, Casper; Lin, Ling; Isacson, Ole; Selkoe, Dennis J

    2007-01-01

    Background Understanding the mechanisms of amyloid-β protein (Aβ) production and clearance in the brain has been essential to elucidating the etiology of Alzheimer disease (AD). Chronically decreasing brain Aβ levels is an emerging therapeutic approach for AD, but no such disease-modifying agents have achieved clinical validation. Certain proteases are responsible for the catabolism of brain Aβ in vivo, and some experimental evidence suggests they could be used as therapeutic tools to reduce Aβ levels in AD. The objective of this study was to determine if enhancing the clearance of Aβ in the brain by ex vivo gene delivery of an Aβ-degrading protease can reduce amyloid plaque burden. Methods and Findings We generated a secreted form of the Aβ-degrading protease neprilysin, which significantly lowers the levels of naturally secreted Aβ in cell culture. We then used an ex vivo gene delivery approach utilizing primary fibroblasts to introduce this soluble protease into the brains of β-amyloid precursor protein (APP) transgenic mice with advanced plaque deposition. Brain examination after cell implantation revealed robust clearance of plaques at the site of engraftment (72% reduction, p = 0.0269), as well as significant reductions in plaque burden in both the medial and lateral hippocampus distal to the implantation site (34% reduction, p = 0.0020; and 55% reduction, p = 0.0081, respectively). Conclusions Ex vivo gene delivery of an Aβ-degrading protease reduces amyloid plaque burden in transgenic mice expressing human APP. These results support the use of Aβ-degrading proteases as a means to therapeutically lower Aβ levels and encourage further exploration of ex vivo gene delivery for the treatment of Alzheimer disease. PMID:17760499

  19. Inherited Variants in Mitochondrial Biogenesis Genes May Influence Epithelial Ovarian Cancer Risk

    PubMed Central

    Permuth-Wey, Jennifer; Chen, Y. Ann; Tsai, Ya-Yu; Chen, Zhihua; Qu, Xiaotao; Lancaster, Johnathan M.; Stockwell, Heather; Dagne, Getachew; Iversen, Edwin; Risch, Harvey; Barnholtz-Sloan, Jill; Cunningham, Julie M.; Vierkant, Robert A.; Fridley, Brooke L.; Sutphen, Rebecca; McLaughlin, John; Narod, Steven A.; Goode, Ellen L.; Schildkraut, Joellen M.; Fenstermacher, David; Phelan, Catherine M.; Sellers, Thomas A.

    2011-01-01

    Background Mitochondria contribute to oxidative stress, a phenomenon implicated in ovarian carcinogenesis. We hypothesized that inherited variants in mitochondrial-related genes influence epithelial ovarian cancer (EOC) susceptibility. Methods Through a multi-center study of 1,815 Caucasian EOC cases and 1,900 controls, we investigated associations between EOC risk and 128 single nucleotide polymorphisms (SNPs) from 22 genes/regions within the mitochondrial genome (mtDNA) and 2,839 nuclear-encoded SNPs localized to 138 genes involved in mitochondrial biogenesis (BIO, n=35), steroid hormone metabolism (HOR, n=13), and oxidative phosphorylation (OXP, n=90) pathways. Unconditional logistic regression was used to estimate odds ratios (OR) and 95% confidence intervals (CI) between genotype and case status. Overall significance of each gene and pathway was evaluated using Fisher’s method to combine SNP-level evidence. At the SNP-level, we investigated whether lifetime ovulation, hormone replacement therapy (HRT), and cigarette smoking were confounders or modifiers of associations. Results Inter-individual variation involving BIO was most strongly associated with EOC risk (empirical P=0.050), especially for NRF1, MTERF, PPARGC1A, ESRRA, and CAMK2D. Several SNP-level associations strengthened after adjustment for non-genetic factors, particularly for MTERF. Statistical interactions with cigarette smoking and HRT use were observed with MTERF and CAMK2D SNPs, respectively. Overall variation within mtDNA, HOR, and OXP was not statistically significant (empirical P >0.10). Conclusion We provide novel evidence to suggest that variants in mitochondrial biogenesis genes may influence EOC susceptibility. Impact A deeper understanding of the complex mechanisms implicated in mitochondrial biogenesis and oxidative stress may aid in developing strategies to reduce morbidity and mortality from EOC. PMID:21447778

  20. Effects of TCDD on the expression of nuclear encoded mitochondrial genes

    SciTech Connect

    Forgacs, Agnes L.; Burgoon, Lyle D.; Lynn, Scott G.; LaPres, John J.; Zacharewski, Timothy

    2010-07-15

    Generation of mitochondrial reactive oxygen species (ROS) can be perturbed following exposure to environmental chemicals such as 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD). Reports indicate that the aryl hydrocarbon receptor (AhR) mediates TCDD-induced sustained hepatic oxidative stress by decreasing hepatic ATP levels and through hyperpolarization of the inner mitochondrial membrane. To further elucidate the effects of TCDD on the mitochondria, high-throughput quantitative real-time PCR (HTP-QRTPCR) was used to evaluate the expression of 90 nuclear genes encoding mitochondrial proteins involved in electron transport, oxidative phosphorylation, uncoupling, and associated chaperones. HTP-QRTPCR analysis of time course (30 {mu}g/kg TCDD at 2, 4, 8, 12, 18, 24, 72, and 168 h) liver samples obtained from orally gavaged immature, ovariectomized C57BL/6 mice identified 54 differentially expressed genes (|fold change| > 1.5 and P-value < 0.1). Of these, 8 exhibited a sigmoidal or exponential dose-response profile (0.03 to 300 {mu}g/kg TCDD) at 4, 24 or 72 h. Dose-responsive genes encoded proteins associated with electron transport chain (ETC) complexes I (NADH dehydrogenase), III (cytochrome c reductase), IV (cytochrome c oxidase), and V (ATP synthase) and could be generally categorized as having proton gradient, ATP synthesis, and chaperone activities. In contrast, transcript levels of ETC complex II, succinate dehydrogenase, remained unchanged. Putative dioxin response elements were computationally found in the promoter regions of all 8 dose-responsive genes. This high-throughput approach suggests that TCDD alters the expression of genes associated with mitochondrial function which may contribute to TCDD-elicited mitochondrial toxicity.

  1. The gene encoding DRAP (BACE2), a glycosylated transmembrane protein of the aspartic protease family, maps to the down critical region.

    PubMed

    Acquati, F; Accarino, M; Nucci, C; Fumagalli, P; Jovine, L; Ottolenghi, S; Taramelli, R

    2000-02-18

    We applied cDNA selection methods to a genomic clone (YAC 761B5) from chromosome 21 located in the so-called 'Down critical region' in 21q22.3. Starting from human fetal heart and brain mRNAs we obtained and sequenced several cDNA clones. One of these clones (Down region aspartic protease (DRAP), named also BACE2 according to the gene nomenclature) revealed a striking nucleotide and amino acid sequence identity with several motifs present in members of the aspartic protease family. In particular the amino acid sequences comprising the two catalytic sites found in all mammalian aspartic proteases are perfectly conserved. Interestingly, the predicted protein shows a typical membrane spanning region; this is at variance with most other known aspartic proteases, which are soluble molecules. We present preliminary evidence, on the basis of in vitro translation studies and cell transfection, that this gene encodes a glycosylated protein which localizes mainly intracellularly but to some extent also to the plasma membrane. Furthermore DRAP/BACE2 shares a high homology with a newly described beta-secretase enzyme (BACE-1) which is a transmembrane aspartic protease. The implications of this finding for Down syndrome are discussed.

  2. N-acetylcysteine inhibits the up-regulation of mitochondrial biogenesis genes in livers from rats fed ethanol chronically.

    PubMed

    Caro, Andres A; Bell, Matthew; Ejiofor, Shannon; Zurcher, Grant; Petersen, Dennis R; Ronis, Martin J J

    2014-12-01

    Chronic ethanol (EtOH) administration to experimental animals induces hepatic oxidative stress and up-regulates mitochondrial biogenesis. The mechanisms by which chronic EtOH up-regulates mitochondrial biogenesis have not been fully explored. In this work, we hypothesized that oxidative stress is a factor that triggers mitochondrial biogenesis after chronic EtOH feeding. If our hypothesis is correct, co-administration of antioxidants should prevent up-regulation of mitochondrial biogenesis genes. Rats were fed an EtOH-containing diet intragastrically by total enteral nutrition for 150 days, in the absence or presence of the antioxidant N-acetylcysteine (NAC) at 1.7 g/kg/d; control rats were administered isocaloric diets where carbohydrates substituted for EtOH calories. EtOH administration significantly increased hepatic oxidative stress, evidenced as decreased liver total glutathione and reduced glutathione/glutathione disulfide ratio. These effects were inhibited by co-administration of EtOH and NAC. Chronic EtOH increased the expression of mitochondrial biogenesis genes including peroxisome proliferator-activated receptor gamma-coactivator-1 alpha and mitochondrial transcription factor A, and mitochondrial DNA; co-administration of EtOH and NAC prevented these effects. Chronic EtOH administration was associated with decreased mitochondrial mass, inactivation and depletion of mitochondrial complex I and complex IV, and increased hepatic mitochondrial oxidative damage, effects that were not prevented by NAC. These results suggest that oxidative stress caused by chronic EtOH triggered the up-regulation of mitochondrial biogenesis genes in rat liver, because an antioxidant such as NAC prevented both effects. Because NAC did not prevent liver mitochondrial oxidative damage, extra-mitochondrial effects of reactive oxygen species may regulate mitochondrial biogenesis. In spite of the induction of hepatic mitochondrial biogenesis genes by chronic EtOH, mitochondrial

  3. Complete mitochondrial genome of the Japanese snapping shrimp Alpheus japonicus (Crustacea: Decapoda: Caridea): gene rearrangement and phylogeny within Caridea.

    PubMed

    Shen, Xin; Li, Xiao; Sha, Zhongli; Yan, Binlun; Xu, Qihua

    2012-07-01

    The complete sequence of the mitochondrial genome of the Japanese snapping shrimp Alpheus japonicus Miers (Crustacea: Decapoda: Caridea) is presented here. A comparative analysis based on the currently available mitochondrial genomic data revealed many previously unknown characteristics of the mitochondrial genomes of caridean shrimps. The A. japonicus mitochondrial genome is 16487 bp long and contains the typical set of 37 metazoan genes. The gene arrangements in the mitochondrial genomes of four previously studied carideans (Macrobrachium rosenbergii, M. nipponense, M. lanchesteri and Halocaridina rubra) were found to be identical to the pancrustacean ground pattern; thus, it was considered that gene rearrangements probably did not occur in the suborder Caridea. In the present study, a translocation of the trnE gene involving inversion was found in Alpheus mitochondrial genomes. This phenomenon has not been reported in any other crustacean mitochondrial genome that has been studied so far; however, the translocation of one transfer RNA gene (trnP or trnT) was reported in the mitochondrial genome of Exopalaemon carinicauda. When the ratios of the nonsynonymous and synonymous substitutions rates (Ka/Ks) for the 13 protein coding genes from two Alpheus species (A. japonicus and A. distinguendus) and three Macrobrachium species (M. rosenbergii, M. nipponense, M. lanchesteri) were calculated, the Ka/Ks values for all the protein coding genes in Alpheus and Macrobrachium mitochondrial genomes were found to be less than 1 (between 0.0048 and 0.2057), indicating that a strong purification selection had occurred. The phylogenetic tree that was constructed based on the mitochondrial protein coding genes in the genomes of nine related species indicated that Palaemonidae and Alpheidae formed a monophyly and shared a statistically significant relationship, (Palaemonidae+Alpheidae)+Atyidae, at the family level.

  4. 5-HT2 Receptor Regulation of Mitochondrial Genes: Unexpected Pharmacological Effects of Agonists and Antagonists.

    PubMed

    Harmon, Jennifer L; Wills, Lauren P; McOmish, Caitlin E; Demireva, Elena Y; Gingrich, Jay A; Beeson, Craig C; Schnellmann, Rick G

    2016-04-01

    In acute organ injuries, mitochondria are often dysfunctional, and recent research has revealed that recovery of mitochondrial and renal functions is accelerated by induction of mitochondrial biogenesis (MB). We previously reported that the nonselective 5-HT2 receptor agonist DOI [1-(4-iodo-2,5-dimethoxyphenyl)propan-2-amine] induced MB in renal proximal tubular cells (RPTCs). The goal of this study was to determine the role of 5-HT2 receptors in the regulation of mitochondrial genes and oxidative metabolism in the kidney. The 5-HT2C receptor agonist CP-809,101 [2-[(3-chlorophenyl)methoxy]-6-(1-piperazinyl)pyrazine] and antagonist SB-242,084 [6-chloro-2,3-dihydro-5-methyl-N-[6-[(2-methyl-3-pyridinyl)oxy]-3-pyridinyl]-1H-indole-1-carboxyamide dihydrochloride] were used to examine the induction of renal mitochondrial genes and oxidative metabolism in RPTCs and in mouse kidneys in the presence and absence of the 5-HT2C receptor. Unexpectedly, both CP-809,101 and SB-242,084 increased RPTC respiration and peroxisome proliferator-activated receptor γ coactivator-1α (PGC-1α) mRNA expression in RPTCs at 1-10 nM. In addition, CP-809,101 and SB-242,084 increased mRNA expression of PGC-1α and the mitochondrial proteins NADH dehydrogenase subunit 1 and NADH dehydrogenase (ubiquinone) β subcomplex 8 in mice. These compounds increased mitochondrial genes in RPTCs in which the 5-HT2C receptor was downregulated with small interfering RNA and in the renal cortex of mice lacking the 5-HT2C receptor. By contrast, the ability of these compounds to increase PGC-1α mRNA and respiration was blocked in RPTCs treated with 5-HT2A receptor small interfering RNA or the 5-HT2A receptor antagonist eplivanserin. In addition, the 5-HT2A receptor agonist NBOH-2C-CN [4-[2-[[(2-hydroxyphenyl)methyl]amino]ethyl]-2,5-dimethoxybenzonitrile] increased RPTC respiration at 1-100 nM. These results suggest that agonism of the 5-HT2A receptor induces MB and that the classic 5-HT2C receptor agonist CP

  5. Multi-focal control of mitochondrial gene expression by oncogenic MYC provides potential therapeutic targets in cancer

    PubMed Central

    Oran, Amanda R.; Adams, Clare M.; Zhang, Xiao-yong; Gennaro, Victoria J.; Pfeiffer, Harla K.; Mellert, Hestia S.; Seidel, Hans E.; Mascioli, Kirsten; Kaplan, Jordan; Gaballa, Mahmoud R.; Shen, Chen; Rigoutsos, Isidore; King, Michael P.; Cotney, Justin L.; Arnold, Jamie J.; Sharma, Suresh D.; Martinez, Ubaldo E.; Vakoc, Christopher R.; Chodosh, Lewis A.; Thompson, James E.; Bradner, James E.; Cameron, Craig E.; Shadel, Gerald S.; Eischen, Christine M.; McMahon, Steven B.

    2016-01-01

    Despite ubiquitous activation in human cancer, essential downstream effector pathways of the MYC transcription factor have been difficult to define and target. Using a structure/function-based approach, we identified the mitochondrial RNA polymerase (POLRMT) locus as a critical downstream target of MYC. The multifunctional POLRMT enzyme controls mitochondrial gene expression, a process required both for mitochondrial function and mitochondrial biogenesis. We further demonstrate that inhibition of this newly defined MYC effector pathway causes robust and selective tumor cell apoptosis, via an acute, checkpoint-like mechanism linked to aberrant electron transport chain complex assembly and mitochondrial reactive oxygen species (ROS) production. Fortuitously, MYC-dependent tumor cell death can be induced by inhibiting the mitochondrial gene expression pathway using a variety of strategies, including treatment with FDA-approved antibiotics. In vivo studies using a mouse model of Burkitt's Lymphoma provide pre-clinical evidence that these antibiotics can successfully block progression of MYC-dependent tumors. PMID:27590350

  6. Co segregation of the m.1555A>G mutation in the MT-RNR1 gene and mutations in MT-ATP6 gene in a family with dilated mitochondrial cardiomyopathy and hearing loss: A whole mitochondrial genome screening.

    PubMed

    Alila-Fersi, Olfa; Chamkha, Imen; Majdoub, Imen; Gargouri, Lamia; Mkaouar-Rebai, Emna; Tabebi, Mouna; Tlili, Abdelaziz; Keskes, Leila; Mahfoudh, Abdelmajid; Fakhfakh, Faiza

    2017-02-26

    Mitochondrial disease refers to a heterogeneous group of disorders resulting in defective cellular energy production due to dysfunction of the mitochondrial respiratory chain, which is responsible for the generation of most cellular energy. Because cardiac muscles are one of the high energy demanding tissues, mitochondrial cardiomyopathies is one of the most frequent mitochondria disorders. Mitochondrial cardiomyopathy has been associated with several point mutations of mtDNA in both genes encoded mitochondrial proteins and mitochondrial tRNA and rRNA. We reported here the first description of mutations in MT-ATP6 gene in two patients with clinical features of dilated mitochondrial cardiomyopathy. The mutational analysis of the whole mitochondrial DNA revealed the presence of m.1555A>G mutation in MT-RNR1 gene associated to the m.8527A>G (p.M>V) and the m.8392C>T (p.136P>S) variations in the mitochondrial MT-ATP6 gene in patient1 and his family members with variable phenotype including hearing impairment. The second patient with isolated mitochondrial cardiomyopathy presented the m.8605C>T (p.27P>S) mutation in the MT-ATP6 gene. The three mutations p.M1V, p.P27S and p.P136S detected in MT-ATP6 affected well conserved residues of the mitochondrial protein ATPase 6. In addition, the substitution of proline residue at position 27 and 136 effect hydrophobicity and structure flexibility conformation of the protein.

  7. Quality Control of Mitochondrial Proteostasis

    PubMed Central

    Baker, Michael J.; Tatsuta, Takashi; Langer, Thomas

    2011-01-01

    A decline in mitochondrial activity has been associated with aging and is a hallmark of many neurological diseases. Surveillance mechanisms acting at the molecular, organellar, and cellular level monitor mitochondrial integrity and ensure the maintenance of mitochondrial proteostasis. Here we will review the central role of mitochondrial chaperones and proteases, the cytosolic ubiquitin-proteasome system, and the mitochondrial unfolded response in this interconnected quality control network, highlighting the dual function of some proteases in protein quality control within the organelle and for the regulation of mitochondrial fusion and mitophagy. PMID:21628427

  8. Tomato transgenic plants expressing hairpin construct of a nematode protease gene conferred enhanced resistance to root-knot nematodes

    PubMed Central

    Dutta, Tushar K.; Papolu, Pradeep K.; Banakar, Prakash; Choudhary, Divya; Sirohi, Anil; Rao, Uma

    2015-01-01

    Root-knot nematodes (Meloidogyne incognita) cause substantial yield losses in vegetables worldwide, and are difficult to manage. Continuous withdrawal of environmentally-harmful nematicides from the global market warrants the need for novel nematode management strategies. Utility of host-delivered RNAi has been demonstrated in several plants (Arabidopsis, tobacco, and soybean) that exhibited resistance against root-knot and cyst nematodes. Herein, a M. incognita-specific protease gene, cathepsin L cysteine proteinase (Mi-cpl-1), was targeted to generate tomato transgenic lines to evaluate the genetically modified nematode resistance. In vitro knockdown of Mi-cpl-1 gene led to the reduced attraction and penetration of M. incognita in tomato, suggesting the involvement of Mi-cpl-1 in nematode parasitism. Transgenic expression of the RNAi construct of Mi-cpl-1 gene resulted in 60–80% reduction in infection and multiplication of M. incognita in tomato. Evidence for in vitro and in vivo silencing of Mi-cpl-1 was confirmed by expression analysis using quantitative PCR. Our study demonstrates that Mi-cpl-1 plays crucial role during plant-nematode interaction and plant-mediated downregulation of this gene elicits detrimental effect on M. incognita development, reinforcing the potential of RNAi technology for management of phytonematodes in crop plants. PMID:25883594

  9. Cardiolipin content in mitochondria from cultured skin fibroblasts harboring mutations in the mitochondrial ATP6 gene.

    PubMed

    El-Hafidi, Mohammed; Meschini, Maria Chiara; Rizza, Teresa; Santorelli, Filippo M; Bertini, Enrico; Carrozzo, Rosalba; Vázquez-Memije, Martha Elisa

    2011-12-01

    The role of phospholipids in normal assembly and organization of the membrane proteins has been well documented. Cardiolipin, a unique tetra-acyl phospholipid localized in the inner mitochondrial membrane, is implicated in the stability of many inner-membrane protein complexes. Loss of cardiolipin content, alterations in its acyl chain composition and/or cardiolipin peroxidation have been associated with dysfunction in multiple tissues in a variety of pathological conditions. The aim of this study was to analyze the phospholipid composition of the mitochondrial membrane in the four most frequent mutations in the ATP6 gene: L156R, L217R, L156P and L217P but, more importantly, to investigate the possible changes in the cardiolipin profile. Mitochondrial membranes from fibroblasts with mutations at codon 217 of the ATP6 gene, showed a different cardiolipin content compared to controls. Conversely, results similar to controls were obtained for mutations at codon 156. These findings may be attributed to differences in the biosynthesis and remodeling of cardiolipin at the level of the inner mitochondrial transmembrane related to some mutations of the ATP6 gene.

  10. Unusual organization of a developmentally regulated mitochondrial RNA polymerase (TBMTRNAP) gene in Trypanosoma brucei

    PubMed Central

    Clement, Sandra L.; Koslowsky, Donna J.

    2009-01-01

    We report here the characterization of a developmentally regulated mitochondrial RNA polymerase transcript in the parasitic protozoan, Trypanosoma brucei. The 3822 bp protein-coding region of the T. brucei mitochondrial RNA polymerase (TBMTRNAP) gene is predicted to encode a 1274 amino acid polypeptide, the carboxyl-terminal domain of which exhibits 29–37% identity with the mitochondrial RNA polymerases from other organisms in the molecular databases. Interestingly, the TBMTRNAP mRNA is one of several mature mRNA species post-transcriptionally processed from a stable, polycistronic precursor. Alternative polyadenylation of the TBMTRNAP mRNA produces two mature transcripts that differ by 500 nt and that show stage-specific differences in abundance during the T. brucei life cycle. This alternative polyadenylation event appears to be accompanied by the alternative splicing of a high abundance, non-coding downstream transcript of unknown function. Our finding that the TBMTRNAP gene is transcribed into two distinct mRNAs subject to differential regulation during the T. brucei life cycle suggests that mitochondrial differentiation might be achieved in part through the regulated expression of this gene. PMID:11470527

  11. Constitutive over-expression of rice chymotrypsin protease inhibitor gene OCPI2 results in enhanced growth, salinity and osmotic stress tolerance of the transgenic Arabidopsis plants.

    PubMed

    Tiwari, Lalit Dev; Mittal, Dheeraj; Chandra Mishra, Ratnesh; Grover, Anil

    2015-07-01

    Protease inhibitors are involved primarily in defense against pathogens. In recent years, these proteins have also been widely implicated in response of plants to diverse abiotic stresses. Rice chymotrypsin protease inhibitor gene OCPI2 is highly induced under salt and osmotic stresses. The construct containing the complete coding sequence of OCPI2 cloned downstream to CaMV35S promoter was transformed in Arabidopsis and single copy, homozygous transgenic lines were produced. The transgenic plants exhibited significantly enhanced tolerance to NaCl, PEG and mannitol stress as compared to wild type plants. Importantly, the vegetative and reproductive growth of transgenic plants under unstressed, control conditions was also enhanced: transgenic plants were more vigorous than wild type, resulting into higher yield in terms of silique number. The RWC values and membrane stability index of transgenic in comparison to wild type plants was higher. Higher proline content was observed in the AtOCPI2 lines, which was associated with higher transcript expression of pyrroline-5-carboxylate synthase and lowered levels of proline dehydrogenase genes. The chymotrypsin protease activities were lower in the transgenic as against wild type plants, under both unstressed, control as well as stressed conditions. It thus appears that rice chymotrypsin protease inhibitor gene OCPI2 is a useful candidate gene for genetic improvement of plants against salt and osmotic stress.

  12. Genome-wide identification and immune response analysis of serine protease inhibitor genes in the silkworm, Bombyx mori.

    PubMed

    Zhao, Ping; Dong, Zhaoming; Duan, Jun; Wang, Genhong; Wang, Lingyan; Li, Youshan; Xiang, Zhonghuai; Xia, Qingyou

    2012-01-01

    In most insect species, a variety of serine protease inhibitors (SPIs) have been found in multiple tissues, including integument, gonad, salivary gland, and hemolymph, and are required for preventing unwanted proteolysis. These SPIs belong to different families and have distinct inhibitory mechanisms. Herein, we predicted and characterized potential SPI genes based on the genome sequences of silkworm, Bombyx mori. As a result, a total of eighty SPI genes were identified in B. mori. These SPI genes contain 10 kinds of SPI domains, including serpin, Kunitz_BPTI, Kazal, TIL, amfpi, Bowman-Birk, Antistasin, WAP, Pacifastin, and alpha-macroglobulin. Sixty-three SPIs contain single SPI domain while the others have at least two inhibitor units. Some SPIs also contain non-inhibitor domains for protein-protein interactions, including EGF, ADAM_spacer, spondin_N, reeler, TSP_1 and other modules. Microarray analysis showed that fourteen SPI genes from lineage-specific TIL family and Group F of serpin family had enriched expression in the silk gland. The roles of SPIs in resisting pathogens were investigated in silkworms when they were infected by four pathogens. Microarray and qRT-PCR experiments revealed obvious up-regulation of 8, 4, 3 and 3 SPI genes after infection with Escherichia coli, Bacillus bombysepticus, Beauveria bassiana or B. mori nuclear polyhedrosis virus (BmNPV), respectively. On the contrary, 4, 11, 7 and 9 SPI genes were down-regulated after infection with E. coli, B. bombysepticus, B. bassiana or BmNPV, respectively. These results suggested that these SPI genes may be involved in resistance to pathogenic microorganisms. These findings may provide valuable information for further clarifying the roles of SPIs in the development, immune defence, and efficient synthesis of silk gland protein.

  13. Genome-Wide Identification and Immune Response Analysis of Serine Protease Inhibitor Genes in the Silkworm, Bombyx mori

    PubMed Central

    Duan, Jun; Wang, Genhong; Wang, Lingyan; Li, Youshan; Xiang, Zhonghuai; Xia, Qingyou

    2012-01-01

    In most insect species, a variety of serine protease inhibitors (SPIs) have been found in multiple tissues, including integument, gonad, salivary gland, and hemolymph, and are required for preventing unwanted proteolysis. These SPIs belong to different families and have distinct inhibitory mechanisms. Herein, we predicted and characterized potential SPI genes based on the genome sequences of silkworm, Bombyx mori. As a result, a total of eighty SPI genes were identified in B. mori. These SPI genes contain 10 kinds of SPI domains, including serpin, Kunitz_BPTI, Kazal, TIL, amfpi, Bowman-Birk, Antistasin, WAP, Pacifastin, and alpha-macroglobulin. Sixty-three SPIs contain single SPI domain while the others have at least two inhibitor units. Some SPIs also contain non-inhibitor domains for protein-protein interactions, including EGF, ADAM_spacer, spondin_N, reeler, TSP_1 and other modules. Microarray analysis showed that fourteen SPI genes from lineage-specific TIL family and Group F of serpin family had enriched expression in the silk gland. The roles of SPIs in resisting pathogens were investigated in silkworms when they were infected by four pathogens. Microarray and qRT-PCR experiments revealed obvious up-regulation of 8, 4, 3 and 3 SPI genes after infection with Escherichia coli, Bacillus bombysepticus, Beauveria bassiana or B. mori nuclear polyhedrosis virus (BmNPV), respectively. On the contrary, 4, 11, 7 and 9 SPI genes were down-regulated after infection with E. coli, B. bombysepticus, B. bassiana or BmNPV, respectively. These results suggested that these SPI genes may be involved in resistance to pathogenic microorganisms. These findings may provide valuable information for further clarifying the roles of SPIs in the development, immune defence, and efficient synthesis of silk gland protein. PMID:22348050

  14. Expression of genes related to mitochondrial function in Nellore cattle divergently ranked on residual feed intake.

    PubMed

    Fonseca, Larissa Fernanda Simielli; Gimenez, Daniele Fernanda Jovino; Mercadante, Maria Eugênia Zerlotti; Bonilha, Sarah Figueiredo Martins; Ferro, Jesus Aparecido; Baldi, Fernando; de Souza, Fábio Ricardo Pablos; de Albuquerque, Lucia Galvão

    2015-02-01

    Several measures have been proposed to investigate and improve feed efficiency in cattle. One of the most commonly used measure of feed efficiency is residual feed intake (RFI), which is estimated as the difference between actual feed intake and expected feed intake based on the animal's average live weight. This measure permits to identify and select the most efficient animals without selecting for higher mature weight. Mitochondrial function has been indicated as a major factor that influences RFI. The analysis of genes involved in mitochondrial function is therefore an alternative to identify molecular markers associated with higher feed efficiency. This study analyzed the expression of PGC1α, TFAM, UCP2 and UCP3 genes by quantitative real-time PCR in liver and muscle tissues of two groups of Nellore cattle divergently ranked on RFI values in order to evaluate the relationship of these genes with RFI. In liver tissue, higher expression of TFAM and UCP2 genes was observed in the negative RFI group. Expression of PGC1α gene did not differ significantly between the two groups, whereas UCP3 gene was not expressed in liver tissue. In muscle tissue, higher expression of TFAM gene was observed in the positive RFI group. Expression of PGC1α, UCP2 and UCP3 genes did not differ significantly between the two groups. These results suggest the use of TFAM and UCP2 as possible candidate gene markers in breeding programs designed to increase the feed efficiency of Nellore cattle.

  15. The complete mitochondrial genome of Sesarmops sinensis reveals gene rearrangements and phylogenetic relationships in Brachyura

    PubMed Central

    Liu, Yu; Zhang, Dai-Zhen; Wang, Zheng-Fei; Zhang, Hua-Bin; Chai, Xin-Yue; Zhou, Chun-Lin

    2017-01-01

    Mitochondrial genome (mitogenome) is very important to understand molecular evolution and phylogenetics. Herein, in this study, the complete mitogenome of Sesarmops sinensis was reported. The mitogenome was 15,905 bp in size, and contained 13 protein-coding genes (PCGs), two ribosomal RNA (rRNA) genes, 22 transfer RNA (tRNA) genes, and a control region (CR). The AT skew and the GC skew are both negative in the mitogenomes of S. sinensis. The nucleotide composition of the S. sinensis mitogenome was also biased toward A + T nucleotides (75.7%). All tRNA genes displayed a typical mitochondrial tRNA cloverleaf structure, except for the trnS1 gene, which lacked a dihydroxyuridine arm. S. sinensis exhibits a novel rearrangement compared with the Pancrustacean ground pattern and other Brachyura species. Based on the 13 PCGs, the phylogenetic analysis showed that S. sinensis and Sesarma neglectum were clustered on one branch with high nodal support values, indicating that S. sinensis and S. neglectum have a sister group relationship. The group (S. sinensis + S. neglectum) was sister to (Parasesarmops tripectinis + Metopaulias depressus), suggesting that S. sinensis belongs to Grapsoidea, Sesarmidae. Phylogenetic trees based on amino acid sequences and nucleotide sequences of mitochondrial 13 PCGs using BI and ML respectively indicate that section Eubrachyura consists of four groups clearly. The resulting phylogeny supports the establishment of a separate subsection Potamoida. These four groups correspond to four subsections of Raninoida, Heterotremata, Potamoida, and Thoracotremata. PMID:28622362

  16. Cloning and characterization of nuclear genes for two mitochondrial ribosomal proteins in Saccharomyces cerevisiae.

    PubMed Central

    Kitakawa, M; Grohmann, L; Graack, H R; Isono, K

    1990-01-01

    The genes for two large subunit proteins, YmL8 and YmL20, of the mitochondrial ribosome of Saccharomyces cerevisiae were cloned by hybridization with synthetic oligonucleotide mixtures corresponding to their N-terminal amino acid sequences. They were termed MRP-L8 and MRP-L20, respectively, and their nucleotide sequences were determined using a DNA sequencer. The MRP-L8 gene was found to encode a 26.8-kDa protein whose deduced amino acid sequence has a high degree of similarity to ribosomal protein L17 of Escherichia coli. The gene MRP-L20 was found to encode a 22.3-kDa protein with a presequence consisting of 18 amino acid residues. By Southern blot hybridization to the yeast chromosomes separated by field-inversion gel electrophoresis, the MRP-L8 and MRP-L20 genes were located on chromosomes X and XI, respectively. Gene disruption experiments indicate that their products, YmL8 and YmL20 proteins, are essential for the mitochondrial function and the absence of these proteins causes instability of the mitochondrial DNA. Images PMID:2183197

  17. Adaptive Evolution of Mitochondrial Energy Metabolism Genes Associated with Increased Energy Demand in Flying Insects

    PubMed Central

    Yang, Yunxia; Xu, Shixia; Xu, Junxiao; Guo, Yan; Yang, Guang

    2014-01-01

    Insects are unique among invertebrates for their ability to fly, which raises intriguing questions about how energy metabolism in insects evolved and changed along with flight. Although physiological studies indicated that energy consumption differs between flying and non-flying insects, the evolution of molecular energy metabolism mechanisms in insects remains largely unexplored. Considering that about 95% of adenosine triphosphate (ATP) is supplied by mitochondria via oxidative phosphorylation, we examined 13 mitochondrial protein-encoding genes to test whether adaptive evolution of energy metabolism-related genes occurred in insects. The analyses demonstrated that mitochondrial DNA protein-encoding genes are subject to positive selection from the last common ancestor of Pterygota, which evolved primitive flight ability. Positive selection was also found in insects with flight ability, whereas no significant sign of selection was found in flightless insects where the wings had degenerated. In addition, significant positive selection was also identified in the last common ancestor of Neoptera, which changed its flight mode from direct to indirect. Interestingly, detection of more positively selected genes in indirect flight rather than direct flight insects suggested a stronger selective pressure in insects having higher energy consumption. In conclusion, mitochondrial protein-encoding genes involved in energy metabolism were targets of adaptive evolution in response to increased energy demands that arose during the evolution of flight ability in insects. PMID:24918926

  18. Adaptive evolution of mitochondrial energy metabolism genes associated with increased energy demand in flying insects.

    PubMed

    Yang, Yunxia; Xu, Shixia; Xu, Junxiao; Guo, Yan; Yang, Guang

    2014-01-01

    Insects are unique among invertebrates for their ability to fly, which raises intriguing questions about how energy metabolism in insects evolved and changed along with flight. Although physiological studies indicated that energy consumption differs between flying and non-flying insects, the evolution of molecular energy metabolism mechanisms in insects remains largely unexplored. Considering that about 95% of adenosine triphosphate (ATP) is supplied by mitochondria via oxidative phosphorylation, we examined 13 mitochondrial protein-encoding genes to test whether adaptive evolution of energy metabolism-related genes occurred in insects. The analyses demonstrated that mitochondrial DNA protein-encoding genes are subject to positive selection from the last common ancestor of Pterygota, which evolved primitive flight ability. Positive selection was also found in insects with flight ability, whereas no significant sign of selection was found in flightless insects where the wings had degenerated. In addition, significant positive selection was also identified in the last common ancestor of Neoptera, which changed its flight mode from direct to indirect. Interestingly, detection of more positively selected genes in indirect flight rather than direct flight insects suggested a stronger selective pressure in insects having higher energy consumption. In conclusion, mitochondrial protein-encoding genes involved in energy metabolism were targets of adaptive evolution in response to increased energy demands that arose during the evolution of flight ability in insects.

  19. [Analysis of UQCRB gene mutation in a child with mitochondrial complex III deficiency].

    PubMed

    Zhang, Ting; Hong, Fang; Qian, Guling; Tong, Fan; Zhou, Xuelian; Huang, Xiaolei; Yang, Rulai; Huang, Xinwen

    2017-06-10

    To delineate the clinical, biochemical and genetic mutational characteristics of a child with mitochondrial complex III deficiency. Clinical information and results of auxiliary examination of the patient were analyzed. Next-generation sequencing of the mitochondrial genome and related nuclear genes was carried out. Suspected mutation was confirmed in both parents with Sanger sequencing. Heterozygous deletion was mapped with chromosomal microarray analysis and confirmed with real-time PCR. The patient presented with vomiting, polypnea, fever, metabolic acidosis, hyperlactatemia, hypoglycemia, dysfunction of coagulation and immune system, in addition with increased lactate dehydrogenase and creatine kinase isoenzyme. Elevation of blood alanine and acylcarnitines as well as urinary ketotic dicarboxylic acid were also noted. The patient also presented development delay, mental retardation and hypotonia. Sequence analysis revealed two mutations in the nuclear gene UQCRB, which included a previously reported frameshift mutation c.306_309delAAAA(p.Arg105Lysfs*22) and a novel large deletion encompassing the entire UQCRB gene. The clinical, biochemical and gene mutation characteristics of a child with mitochondrial complex III deficiency caused by mutations of the UQCRB gene have been delineated.

  20. Discovery of the rpl10 Gene in Diverse Plant Mitochondrial Genomes and Its Probable Replacement by the Nuclear Gene for Chloroplast RPL10 in Two Lineages of Angiosperms

    PubMed Central

    Kubo, Nakao; Arimura, Shin-ichi

    2010-01-01

    Mitochondrial genomes of plants are much larger than those of mammals and often contain conserved open reading frames (ORFs) of unknown function. Here, we show that one of these conserved ORFs is actually the gene for ribosomal protein L10 (rpl10) in plant. No rpl10 gene has heretofore been reported in any mitochondrial genome other than the exceptionally gene-rich genome of the protist Reclinomonas americana. Conserved ORFs corresponding to rpl10 are present in a wide diversity of land plant and green algal mitochondrial genomes. The mitochondrial rpl10 genes are transcribed in all nine land plants examined, with five seed plant genes subject to RNA editing. In addition, mitochondrial-rpl10-like cDNAs were identified in EST libraries from numerous land plants. In three lineages of angiosperms, rpl10 is either lost from the mitochondrial genome or a pseudogene. In two of them (Brassicaceae and monocots), no nuclear copy of mitochondrial rpl10 is identifiably present, and instead a second copy of nuclear-encoded chloroplast rpl10 is present. Transient assays using green fluorescent protein indicate that this duplicate gene is dual targeted to mitochondria and chloroplasts. We infer that mitochondrial rpl10 has been functionally replaced by duplicated chloroplast counterparts in Brassicaceae and monocots. PMID:19934175

  1. Discovery of the rpl10 gene in diverse plant mitochondrial genomes and its probable replacement by the nuclear gene for chloroplast RPL10 in two lineages of angiosperms.

    PubMed

    Kubo, Nakao; Arimura, Shin-ichi

    2010-02-01

    Mitochondrial genomes of plants are much larger than those of mammals and often contain conserved open reading frames (ORFs) of unknown function. Here, we show that one of these conserved ORFs is actually the gene for ribosomal protein L10 (rpl10) in plant. No rpl10 gene has heretofore been reported in any mitochondrial genome other than the exceptionally gene-rich genome of the protist Reclinomonas americana. Conserved ORFs corresponding to rpl10 are present in a wide diversity of land plant and green algal mitochondrial genomes. The mitochondrial rpl10 genes are transcribed in all nine land plants examined, with five seed plant genes subject to RNA editing. In addition, mitochondrial-rpl10-like cDNAs were identified in EST libraries from numerous land plants. In three lineages of angiosperms, rpl10 is either lost from the mitochondrial genome or a pseudogene. In two of them (Brassicaceae and monocots), no nuclear copy of mitochondrial rpl10 is identifiably present, and instead a second copy of nuclear-encoded chloroplast rpl10 is present. Transient assays using green fluorescent protein indicate that this duplicate gene is dual targeted to mitochondria and chloroplasts. We infer that mitochondrial rpl10 has been functionally replaced by duplicated chloroplast counterparts in Brassicaceae and monocots.

  2. The complete sequence and gene organization of the mitochondrial genome of the gadilid scaphopod Siphonondentalium lobatum (Mollusca).

    PubMed

    Dreyer, Hermann; Steiner, Gerhard

    2004-05-01

    Comparisons of mitochondrial gene sequences and gene arrangements can be informative for reconstructing high-level phylogenetic relationships. We determined the complete sequence of the mitochondrial genome of Siphonodentalium lobatum, (Mollusca, Scaphopoda). With only 13,932 bases, it is the shortest molluscan mitochondrial genome reported so far. The genome contains the usual 13 protein-coding genes, two rRNA and 22 tRNA genes. The ATPase subunit 8 gene is exceptionally short. Several transfer RNAs show truncated TpsiC arms or DHU arms. The gene arrangement of S. lobatum is markedly different from all other known molluscan mitochondrial genomes and shows low similarity even to an unpublished gene order of a dentaliid scaphopod. Phylogenetic analyses of all available complete molluscan mitochondrial genomes based on amino acid sequences of 11 protein-coding genes yield trees with low support for the basal branches. None of the traditionally accepted molluscan taxa and phylogenies are recovered in all analyses, except for the euthyneuran Gastropoda. S. lobatum appears as the sister taxon to two of the three bivalve species. We conclude that the deep molluscan phylogeny is probably beyond the resolution of mitochondrial protein sequences. Moreover, assessing the phylogenetic signal in gene order data requires a much larger taxon sample than is currently available, given the exceptional diversity of this character set in the Mollusca.

  3. The complete mitochondrial genome of Neobenedenia melleni (Platyhelminthes: Monogenea): mitochondrial gene content, arrangement and composition compared with two Benedenia species.

    PubMed

    Zhang, Juan; Wu, Xiangyun; Li, Yanwei; Zhao, Mengwei; Xie, Mingquan; Li, Anxing

    2014-10-01

    The complete mitochondrial (mt) genome sequences of Neobenedenia melleni were determined and compared with those of Benedenia seriolae and B. hoshinai. This circular genome comprises 13,270 bp and includes all 36 typical mt genes found in flatworms. Total AT content of N. melleni is 75.9 %. ATG is the most common start codon, while nad4L is initiated by GTG. All protein-coding genes are predicted to terminate with TAG and TAA. N. melleni has the trnR with a TCG anticodon, which is the same to B. seriolae but different from B. hoshinai (ACG). The mt gene arrangement of N. melleni is similar to that of B. seriolae and B. hoshinai with the exception of three translocations (trnF, trnT and trnG). The overlapped region between nad4L and nad4 was found in the N. melleni mt genome, which was also reported for the published Gyrodactylus species, but it was not found in those of B. seriolae and B. hoshinai, which are non-coding regions instead. The present study provides useful molecular characters for species or strain identification and systematic studies of this parasite.

  4. Strikingly Bacteria-Like and Gene-Rich Mitochondrial Genomes throughout Jakobid Protists

    PubMed Central

    Burger, Gertraud; Gray, Michael W.; Forget, Lise; Lang, B. Franz

    2013-01-01

    The most bacteria-like mitochondrial genome known is that of the jakobid flagellate Reclinomonas americana NZ. This genome also encodes the largest known gene set among mitochondrial DNAs (mtDNAs), including the RNA subunit of RNase P (transfer RNA processing), a reduced form of transfer–messenger RNA (translational control), and a four-subunit bacteria-like RNA polymerase, which in other eukaryotes is substituted by a nucleus-encoded, single-subunit, phage-like enzyme. Further, protein-coding genes are preceded by potential Shine–Dalgarno translation initiation motifs. Whether similarly ancestral mitochondrial characters also exist in relatives of R. americana NZ is unknown. Here, we report a comparative analysis of nine mtDNAs from five distant jakobid genera: Andalucia, Histiona, Jakoba, Reclinomonas, and Seculamonas. We find that Andalucia godoyi has an even larger mtDNA gene complement than R. americana NZ. The extra genes are rpl35 (a large subunit mitoribosomal protein) and cox15 (involved in cytochrome oxidase assembly), which are nucleus encoded throughout other eukaryotes. Andalucia cox15 is strikingly similar to its homolog in the free-living α-proteobacterium Tistrella mobilis. Similarly, a long, highly conserved gene cluster in jakobid mtDNAs, which is a clear vestige of prokaryotic operons, displays a gene order more closely resembling that in free-living α-proteobacteria than in Rickettsiales species. Although jakobid mtDNAs, overall, are characterized by bacteria-like features, they also display a few remarkably divergent characters, such as 3′-tRNA editing in Seculamonas ecuadoriensis and genome linearization in Jakoba libera. Phylogenetic analysis with mtDNA-encoded proteins strongly supports monophyly of jakobids with Andalucia as the deepest divergence. However, it remains unclear which α-proteobacterial group is the closest mitochondrial relative. PMID:23335123

  5. Differential Gene Expression Reveals Mitochondrial Dysfunction in an Imprinting Center Deletion Mouse Model of Prader–Willi Syndrome

    PubMed Central

    Yazdi, Puya G.; Su, Hailing; Ghimbovschi, Svetlana; Fan, Weiwei; Coskun, Pinar E.; Nalbandian, Angèle; Knoblach, Susan; Resnick, James L.; Hoffman, Eric; Wallace, Douglas C.

    2013-01-01

    Abstract Prader–Willi syndrome (PWS) is a genetic disorder caused by deficiency of imprinted gene expression from the paternal chromosome 15q11–15q13 and clinically characterized by neonatal hypotonia, short stature, cognitive impairment, hypogonadism, hyperphagia, morbid obesity, and diabetes. Previous clinical studies suggest that a defect in energy metabolism may be involved in the pathogenesis of PWS. We focused our attention on the genes associated with energy metabolism and found that there were 95 and 66 mitochondrial genes differentially expressed in PWS muscle and brain, respectively. Assessment of enzyme activities of mitochondrial oxidative phosphorylation complexes in the brain, heart, liver, and muscle were assessed. We found the enzyme activities of the cardiac mitochondrial complexes II‫III were up‐regulated in the PWS imprinting center deletion mice compared to the wild‐type littermates. These studies suggest that differential gene expression, especially of the mitochondrial genes may contribute to the pathophysiology of PWS. PMID:24127921

  6. Mitochondrial genomes of Clymenella torquata (Maldanidae) and Riftia pachyptila (Siboglinidae): evidence for conserved gene order in annelida.

    PubMed

    Jennings, Robert M; Halanych, Kenneth M

    2005-02-01

    Mitochondrial genomes are useful tools for inferring evolutionary history. However, many taxa are poorly represented by available data. Thus, to further understand the phylogenetic potential of complete mitochondrial genome sequence data in Annelida (segmented worms), we examined the complete mitochondrial sequence for Clymenella torquata (Maldanidae) and an estimated 80% of the sequence of Riftia pachyptila (Siboglinidae). These genomes have remarkably similar gene orders to previously published annelid genomes, suggesting that gene order is conserved across annelids. This result is interesting, given the high variation seen in the closely related Mollusca and Brachiopoda. Phylogenetic analyses of DNA sequence, amino acid sequence, and gene order all support the recent hypothesis that Sipuncula and Annelida are closely related. Our findings suggest that gene order data is of limited utility in annelids but that sequence data holds promise. Additionally, these genomes show AT bias (approximately 66%) and codon usage biases but have a typical gene complement for bilaterian mitochondrial genomes.

  7. Two complete mitochondrial genomes from Praticolella mexicana Perez, 2011 (Polygyridae) and gene order evolution in Helicoidea (Mollusca, Gastropoda)

    PubMed Central

    Minton, Russell L.; Cruz, Marco A. Martinez; Farman, Mark L.; Perez, Kathryn E.

    2016-01-01

    Abstract Helicoidea is a diverse group of land snails with a global distribution. While much is known regarding the relationships of helicoid taxa, comparatively little is known about the evolution of the mitochondrial genome in the superfamily. We sequenced two complete mitochondrial genomes from Praticolella mexicana Perez, 2011 representing the first such data from the helicoid family Polygyridae, and used them in an evolutionary analysis of mitogenomic gene order. We found the mitochondrial genome of Praticolella mexicana to be 14,008 bp in size, possessing the typical 37 metazoan genes. Multiple alternate stop codons are used, as are incomplete stop codons. Mitogenome size and nucleotide content is consistent with other helicoid species. Our analysis of gene order suggested that Helicoidea has undergone four mitochondrial rearrangements in the past. Two rearrangements were limited to tRNA genes only, and two involved protein coding genes. PMID:27833437

  8. RNA editing is absent in a single mitochondrial gene of Didymium iridis.

    PubMed

    Hendrickson, Peter G; Silliker, Margaret E

    2010-01-01

    An open reading frame (ORF) was found in the mitochondrial genome of the Pan2-16 strain of Didymium iridis that showed high similarity to the NADH dehydrogenase subunit 3 (nad3) gene in other organisms. So far all other typical mitochondrial genes identified in this organism require RNA editing to generate ORFs capable of directing protein synthesis. The D. iridis sequence was compared to the putative nad3 gene in the related myxomycete Physarum polycephalum, which would require editing. Based on this comparison, editing sites could be predicted for the P. polycelphalum gene that would result in the synthesis of a highly conserved ND3 protein between the two organisms. To determine the editing status of the nad3 gene in other D. iridis strains, PCR was used to amplify this region from eight other independent isolates of the A1 Central American interbreeding series. In each case a 378 base pair ORF was detected by PCR amplification and sequencing. Three patterns of sequence variation were observed; however all base substitutions were in the third codon position and silent with respect to the amino acids encoded. The distribution of the sequence variants was mapped geographically. The requirement for RNA editing in all other typical mitochondrial genes of D. iridis and P. polycephalum and the presence of RNA editing in the nad3 gene of P. polycephalum suggest that the D. iridis nad3 gene might have been edited at one time. We propose that the D. iridis nad3 gene may have lost the requirement for RNA editing by reverse transcription of an edited transcript that subsequently was inserted into the genome.

  9. Gene expression profiling in equine polysaccharide storage myopathy revealed inflammation, glycogenesis inhibition, hypoxia and mitochondrial dysfunctions

    PubMed Central

    Barrey, Eric; Mucher, Elodie; Jeansoule, Nicolas; Larcher, Thibaut; Guigand, Lydie; Herszberg, Bérénice; Chaffaux, Stéphane; Guérin, Gérard; Mata, Xavier; Benech, Philippe; Canale, Marielle; Alibert, Olivier; Maltere, Péguy; Gidrol, Xavier

    2009-01-01

    Background Several cases of myopathies have been observed in the horse Norman Cob breed. Muscle histology examinations revealed that some families suffer from a polysaccharide storage myopathy (PSSM). It is assumed that a gene expression signature related to PSSM should be observed at the transcriptional level because the glycogen storage disease could also be linked to other dysfunctions in gene regulation. Thus, the functional genomic approach could be conducted in order to provide new knowledge about the metabolic disorders related to PSSM. We propose exploring the PSSM muscle fiber metabolic disorders by measuring gene expression in relationship with the histological phenotype. Results Genotypying analysis of GYS1 mutation revealed 2 homozygous (AA) and 5 heterozygous (GA) PSSM horses. In the PSSM muscles, histological data revealed PAS positive amylase resistant abnormal polysaccharides, inflammation, necrosis, and lipomatosis and active regeneration of fibers. Ultrastructural evaluation revealed a decrease of mitochondrial number and structural disorders. Extensive accumulation of an abnormal polysaccharide displaced and partially replaced mitochondria and myofibrils. The severity of the disease was higher in the two homozygous PSSM horses. Gene expression analysis revealed 129 genes significantly modulated (p < 0.05). The following genes were up-regulated over 2 fold: IL18, CTSS, LUM, CD44, FN1, GST01. The most down-regulated genes were the following: mitochondrial tRNA, SLC2A2, PRKCα, VEGFα. Data mining analysis showed that protein synthesis, apoptosis, cellular movement, growth and proliferation were the main cellular functions significantly associated with the modulated genes (p < 0.05). Several up-regulated genes, especially IL18, revealed a severe muscular inflammation in PSSM muscles. The up-regulation of glycogen synthase kinase-3 (GSK3β) under its active form could be responsible for glycogen synthase (GYS1) inhibition and hypoxia-inducible factor

  10. Aging-induced alterations in gene transcripts and functional activity of mitochondrial oxidative phosphorylation complexes in the heart.

    PubMed

    Preston, Claudia C; Oberlin, Andrew S; Holmuhamedov, Ekhson L; Gupta, Anu; Sagar, Sandeep; Syed, Rashad H Khazi; Siddiqui, Sabeeh A; Raghavakaimal, Sreekumar; Terzic, Andre; Jahangir, Arshad

    2008-06-01

    Aging is associated with progressive decline in energetic reserves compromising cardiac performance and tolerance to injury. Although deviations in mitochondrial functions have been documented in senescent heart, the molecular bases for the decline in energy metabolism are only partially understood. Here, high-throughput transcription profiles of genes coding for mitochondrial proteins in ventricles from adult (6-months) and aged (24-months) rats were compared using microarrays. Out of 614 genes encoding for mitochondrial proteins, 94 were differentially expressed with 95% downregulated in the aged. The majority of changes affected genes coding for proteins involved in oxidative phosphorylation (39), substrate metabolism (14) and tricarboxylic acid cycle (6). Compared to adult, gene expression changes in aged hearts translated into a reduced mitochondrial functional capacity, with decreased NADH-dehydrogenase and F(0)F(1) ATPase complex activities and capacity for oxygen-utilization and ATP synthesis. Expression of genes coding for transcription co-activator factors involved in the regulation of mitochondrial metabolism and biogenesis were downregulated in aged ventricles without reduction in mitochondrial density. Thus, aging induces a selective decline in activities of oxidative phosphorylation complexes I and V within a broader transcriptional downregulation of mitochondrial genes, providing a substrate for reduced energetic efficiency associated with senescence.

  11. Aging-Induced Alterations in Gene Transcripts and Functional Activity of Mitochondrial Oxidative Phosphorylation Complexes in the Heart

    PubMed Central

    Preston, Claudia C.; Oberlin, Andrew S.; Holmuhamedov, Ekhson L.; Gupta, Anu; Sagar, Sandeep; Khazi Syed, Rashad H.; Siddiqui, Sabeeh; Raghavakaimal, Sreekumar; Terzic, Andre; Jahangir, Arshad

    2008-01-01

    Aging is associated with progressive decline in energetic reserves compromising cardiac performance and tolerance to injury. Although deviations in mitochondrial functions have been documented in senescent heart, the molecular bases for the decline in energy metabolism are only partially understood. Here, high-throughput transcription profiles of genes coding for mitochondrial proteins in ventricles from adult (6-months) and aged (24-months) rats were compared using microarrays. Out of 614 genes encoding for mitochondrial proteins, 94 were differentially expressed with 95% downregulated in the aged. The majority of changes affected genes coding for proteins involved in oxidative phosphorylation (39), substrate metabolism (14) and tricarboxylic acid cycle (6). Compared to adult, gene expression changes in aged hearts translated into a reduced mitochondrial functional capacity, with decreased NADH-dehydrogenase and F0F1-ATPase complex activities and capacity for oxygen-utilization and ATP synthesis. Expression of genes coding for transcription co-activator factors involved in the regulation of mitochondrial metabolism and biogenesis were downregulated in aged ventricles without reduction in mitochondrial density. Thus, aging induces a selective decline in activities of oxidative phosphorylation complexes I and V within a broader transcriptional downregulation of mitochondrial genes, providing a substrate for reduced energetic efficiency associated with senescence. PMID:18400259

  12. Photoperiod-sensitive cytoplasmic male sterility in wheat: nuclear-mitochondrial incompatibility results in differential processing of the mitochondrial orf25 gene.

    PubMed

    Ogihara, Y; Kurihara, Y; Futami, K; Tsuji, K; Murai, K

    1999-12-01

    An alloplasmic wheat line with the cytoplasm of Aegilops crassa expresses photoperiod-sensitive cytoplasmic male sterility (PCMS). Southern- and Northern-hybridization analyses showed that this line contains alterations in both the gene structure and transcription patterns of the mitochondrial gene orf25. In this study, the nucleotide sequence around the orf25 gene of Ae. crassa (CR-orf25) and common wheat (AE-orf25) was determined, and we found that the upstream region of CR-orf25 had been replaced by that of rps7 of common wheat (AE-rps7) through recombination. A novel open reading frame (orf48) is present upstream of CR-orf25. In these three genes, transcription was initiated from the consensus promoter motif of plant mitochondrial genes located in the upstream regions. Processing enzymes in Ae. crassa and common wheat cleave the respective precursor mRNAs, namely CR-orf25 and AE-rps7, at sites similar to that of the premature mitochondrial 26S rRNA. In contrast, the precursor mRNA is not effectively processed at the target sequence of CR-orf25 in the alloplasmic wheat line. Because major transcripts of the euplasmic CR-orf25 and AE-rps7 genes would result in a truncated orf48 product, one possibility is that the orf48 protein might disturb mitochondrial function at a specific stage and hence affect the expression of the PCMS trait.

  13. A One-Megabase Physical Map Provides Insights on Gene Organization in the Enormous Mitochondrial Genome of Cucumber

    USDA-ARS?s Scientific Manuscript database

    Cucumber has one of the largest mitochondrial genomes known among all eukaryotes, due in part to the accumulation of short repetitive-DNA motifs. Recombination among these repetitive DNAs produces rearrangements affecting organization and expression of mitochondrial genes. In order to more efficie...

  14. Rearrangement of mitochondrial tRNA genes in flat bugs (Hemiptera: Aradidae)

    PubMed Central

    Song, Fan; Li, Hu; Shao, Renfu; Shi, Aimin; Bai, Xiaoshuan; Zheng, Xiaorong; Heiss, Ernst; Cai, Wanzhi

    2016-01-01

    The typical insect mitochondrial (mt) genome organization, which contains a single chromosome with 37 genes, was found in the infraorder Pentatomomorpha (suborder Heteroptera). The arrangement of mt genes in these true bugs is usually the same as the ancestral mt gene arrangement of insects. Rearrangement of transfer RNA (tRNA) genes, however, has been found in two subfamilies of flat bugs (Mezirinae and Calisiinae, family Aradidae). In this study, we sequenced the complete mt genomes of four species from three other subfamilies (Aradinae, Carventinae and Aneurinae). We found tRNA gene rearrangement in all of these four species. All of the rearranged tRNA genes are located between the mitochondrial control region and cox1, indicating this region as a hotspot for gene rearrangement in flat bugs; the rearrangement is likely caused by events of tandem duplication and random deletion of genes. Furthermore, our phylogenetic and dating analyses indicated that the swap of positions between trnQ and trnI occurred ~162 million years ago (MYA) in the most recent common ancestor of the five subfamilies of flat bugs investigated to date, whereas the swap of positions between trnC and trnW occurred later in the lineage leading to Calisiinae, and the translocation of trnC and trnY occurred later than 134 MYA in the lineage leading to Aradinae. PMID:27180804

  15. Cloning and Characterization of TPE4A, a Thiol-Protease Gene Induced during Ovary Senescence and Seed Germination in Pea1

    PubMed Central

    Cercós, Manuel; Santamaría, Salvador; Carbonell, Juan

    1999-01-01

    A cDNA clone encoding a thiol-protease (TPE4A) was isolated from senescent ovaries of pea (Pisum sativum) by reverse transcriptase-polymerase chain reaction. The deduced amino acid sequence of TPE4A has the conserved catalytic amino acids of papain. It is very similar to VSCYSPROA, a thiol-protease induced during seed germination in common vetch. TPE4A mRNA levels increase during the senescence of unpollinated pea ovaries and are totally suppressed by treatment with gibberellic acid. In situ hybridization indicated that TPE4A mRNA distribution in senescent pea ovaries is different from that of previously reported thiol-proteases induced during senescence, suggesting the involvement of different proteases in the mobilization of proteins from senescent pea ovaries. TPE4A is also induced during the germination of pea seeds, indicating that a single protease gene can be induced during two different physiological processes, senescence and germination, both of which require protein mobilization. PMID:10198093

  16. Enhanced osteoclastogenesis by mitochondrial retrograde signaling through transcriptional activation of the cathepsin K gene.

    PubMed

    Guha, Manti; Srinivasan, Satish; Koenigstein, Alexander; Zaidi, Mone; Avadhani, Narayan G

    2016-01-01

    Mitochondrial dysfunction has emerged as an important factor in wide ranging human pathologies. We have previously defined a retrograde signaling pathway that originates from dysfunctional mitochondria (Mt-RS) and causes a global nuclear transcriptional reprograming as its end point. Mitochondrial dysfunction causing disruption of mitochondrial membrane potential and consequent increase in cytosolic calcium [Ca(2) ](c) activates calcineurin and the transcription factors NF-κB, NFAT, CREB, and C/EBPδ. In macrophages, this signaling complements receptor activator of nuclear factor kappa-B ligand (RANKL)-induced osteoclastic differentiation. Here, we show that the Mt-RS activated transcriptional coactivator heterogeneous ribonucleoprotein A2 (hnRNP A2) is induced by hypoxia in murine macrophages. We demonstrate that the cathepsin K gene (Ctsk), one of the key genes upregulated during osteoclast differentiation, is transcriptionally activated by Mt-RS factors. HnRNP A2 acts as a coactivator with nuclear transcription factors, cRel, and C/EBPδ for Ctsk promoter activation under hypoxic conditions. Notably, our study shows that hypoxia-induced activation of the stress target factors mediates effects similar to that of RANKL with regard to Ctsk activation. We therefore suggest that mitochondrial dysfunction and activation of Mt-RS, induced by various pathophysiologic conditions, is a potential risk factor for osteoclastogenesis and bone loss.

  17. Mitochondrial gene replacement in human pluripotent stem cell-derived neural progenitors.

    PubMed

    Iyer, S; Xiao, E; Alsayegh, K; Eroshenko, N; Riggs, M J; Bennett, J P; Rao, R R

    2012-05-01

    Human pluripotent stem cell-derived neural progenitor (hNP) cells are an excellent resource for understanding early neural development and neurodegenerative disorders. Given that many neurodegenerative disorders can be correlated with defects in the mitochondrial genome, optimal utilization of hNP cells requires an ability to manipulate and monitor changes in the mitochondria. Here, we describe a novel approach that uses recombinant human mitochondrial transcription factor A (rhTFAM) protein to transfect and express a pathogenic mitochondrial genome (mtDNA) carrying the G11778A mutation associated with Leber's hereditary optic neuropathy (LHON) disease, into dideoxycytidine (ddC)-treated hNPs. Treatment with ddC reduced endogenous mtDNA and gene expression, without loss of hNP phenotypic markers. Entry of G11778A mtDNA complexed with the rhTFAM was observed in mitochondria of ddC-hNPs. Expression of the pathogenic RNA was confirmed by restriction enzyme analysis of the SfaN1-digested cDNA. On the basis of the expression of neuron-specific class III beta-tubulin, neuronal differentiation occurred. Our results show for the first time that pathogenic mtDNA can be introduced and expressed into hNPs without loss of phenotype or neuronal differentiation potential. This mitochondrial gene replacement technology allows for creation of in vitro stem cell-based models useful for understanding neuronal development and treatment of neurodegenerative disorders.

  18. The Yeast Gene, MDM20, Is Necessary for Mitochondrial Inheritance and Organization of the Actin Cytoskeleton

    PubMed Central

    Hermann, Greg J.; King, Edward J.; Shaw, Janet M.

    1997-01-01

    In Saccharomyces cerevisiae, the growing bud inherits a portion of the mitochondrial network from the mother cell soon after it emerges. Although this polarized transport of mitochondria is thought to require functions of the cytoskeleton, there are conflicting reports concerning the nature of the cytoskeletal element involved. Here we report the isolation of a yeast mutant, mdm20, in which both mitochondrial inheritance and actin cables (bundles of actin filaments) are disrupted. The MDM20 gene encodes a 93-kD polypeptide with no homology to other characterized proteins. Extra copies of TPM1, a gene encoding the actin filament–binding protein tropomyosin, suppress mitochondrial inheritance defects and partially restore actin cables in mdm20Δ cells. Synthetic lethality is also observed between mdm20 and tpm1 mutant strains. Overexpression of a second yeast tropomyosin, Tpm2p, rescues mutant phenotypes in the mdm20 strain to a lesser extent. Together, these results provide compelling evidence that mitochondrial inheritance in yeast is an actin-mediated process. MDM20 and TPM1 also exhibit the same pattern of genetic interactions; mutations in MDM20 are synthetically lethal with mutations in BEM2 and MYO2 but not SAC6. Although MDM20 and TPM1 are both required for the formation and/or stabilization of actin cables, mutations in these genes disrupt mitochondrial inheritance and nuclear segregation to different extents. Thus, Mdm20p and Tpm1p may act in vivo to establish molecular and functional heterogeneity of the actin cytoskeleton. PMID:9105043

  19. Probable presence of an ubiquitous cryptic mitochondrial gene on the antisense strand of the cytochrome oxidase I gene

    PubMed Central

    2011-01-01

    Background Mitochondria mediate most of the energy production that occurs in the majority of eukaryotic organisms. These subcellular organelles contain a genome that differs from the nuclear genome and is referred to as mitochondrial DNA (mtDNA). Despite a disparity in gene content, all mtDNAs encode at least two components of the mitochondrial electron transport chain, including cytochrome c oxidase I (Cox1). Presentation of the hypothesis A positionally conserved ORF has been found on the complementary strand of the cox1 genes of both eukaryotic mitochondria (protist, plant, fungal and animal) and alpha-proteobacteria. This putative gene has been named gau for gene antisense ubiquitous in mtDNAs. The length of the deduced protein is approximately 100 amino acids. In vertebrates, several stop codons have been found in the mt gau region, and potentially functional gau regions have been found in nuclear genomes. However, a recent bioinformatics study showed that several hypothetical overlapping mt genes could be predicted, including gau; this involves the possible import of the cytosolic AGR tRNA into the mitochondria and/or the expression of mt antisense tRNAs with anticodons recognizing AGR codons according to an alternative genetic code that is induced by the presence of suppressor tRNAs. Despite an evolutionary distance of at least 1.5 to 2.0 billion years, the deduced Gau proteins share some conserved amino acid signatures and structure, which suggests a possible conserved function. Moreover, BLAST analysis identified rare, sense-oriented ESTs with poly(A) tails that include the entire gau region. Immunohistochemical analyses using an anti-Gau monoclonal antibody revealed strict co-localization of Gau proteins and a mitochondrial marker. Testing the hypothesis This hypothesis could be tested by purifying the gau gene product and determining its sequence. Cell biological experiments are needed to determine the physiological role of this protein. Implications of

  20. The "fossilized" mitochondrial genome of Liriodendron tulipifera: ancestral gene content and order, ancestral editing sites, and extraordinarily low mutation rate.

    PubMed

    Richardson, Aaron O; Rice, Danny W; Young, Gregory J; Alverson, Andrew J; Palmer, Jeffrey D

    2013-04-15

    The mitochondrial genomes of flowering plants vary greatly in size, gene content, gene order, mutation rate and level of RNA editing. However, the narrow phylogenetic breadth of available genomic data has limited our ability to reconstruct these traits in the ancestral flowering plant and, therefore, to infer subsequent patterns of evolution across angiosperms. We sequenced the mitochondrial genome of Liriodendron tulipifera, the first from outside the monocots or eudicots. This 553,721 bp mitochondrial genome has evolved remarkably slowly in virtually all respects, with an extraordinarily low genome-wide silent substitution rate, retention of genes frequently lost in other angiosperm lineages, and conservation of ancestral gene clusters. The mitochondrial protein genes in Liriodendron are the most heavily edited of any angiosperm characterized to date. Most of these sites are also edited in various other lineages, which allowed us to polarize losses of editing sites in other parts of the angiosperm phylogeny. Finally, we added comprehensive gene sequence data for two other magnoliids, Magnolia stellata and the more distantly related Calycanthus floridus, to measure rates of sequence evolution in Liriodendron with greater accuracy. The Magnolia genome has evolved at an even lower rate, revealing a roughly 5,000-fold range of synonymous-site divergence among angiosperms whose mitochondrial gene space has been comprehensively sequenced. Using Liriodendron as a guide, we estimate that the ancestral flowering plant mitochondrial genome contained 41 protein genes, 14 tRNA genes of mitochondrial origin, as many as 7 tRNA genes of chloroplast origin, >700 sites of RNA editing, and some 14 colinear gene clusters. Many of these gene clusters, genes and RNA editing sites have been variously lost in different lineages over the course of the ensuing ∽200 million years of angiosperm evolution.

  1. Mitochondrial genome sequence and gene order of Sipunculus nudus give additional support for an inclusion of Sipuncula into Annelida

    PubMed Central

    Mwinyi, Adina; Meyer, Achim; Bleidorn, Christoph; Lieb, Bernhard; Bartolomaeus, Thomas; Podsiadlowski, Lars

    2009-01-01

    Background Mitochondrial genomes are a valuable source of data for analysing phylogenetic relationships. Besides sequence information, mitochondrial gene order may add phylogenetically useful information, too. Sipuncula are unsegmented marine worms, traditionally placed in their own phylum. Recent molecular and morphological findings suggest a close affinity to the segmented Annelida. Results The first complete mitochondrial genome of a member of Sipuncula, Sipunculus nudus, is presented. All 37 genes characteristic for metazoan mtDNA were detected and are encoded on the same strand. The mitochondrial gene order (protein-coding and ribosomal RNA genes) resembles that of annelids, but shows several derivations so far found only in Sipuncula. Sequence based phylogenetic analysis of mitochondrial protein-coding genes results in significant bootstrap support for Annelida sensu lato, combining Annelida together with Sipuncula, Echiura, Pogonophora and Myzostomida. Conclusion The mitochondrial sequence data support a close relationship of Annelida and Sipuncula. Also the most parsimonious explanation of changes in gene order favours a derivation from the annelid gene order. These results complement findings from recent phylogenetic analyses of nuclear encoded genes as well as a report of a segmental neural patterning in Sipuncula. PMID:19149868

  2. Mitochondrial genome sequence and gene order of Sipunculus nudus give additional support for an inclusion of Sipuncula into Annelida.

    PubMed

    Mwinyi, Adina; Meyer, Achim; Bleidorn, Christoph; Lieb, Bernhard; Bartolomaeus, Thomas; Podsiadlowski, Lars

    2009-01-16

    Mitochondrial genomes are a valuable source of data for analysing phylogenetic relationships. Besides sequence information, mitochondrial gene order may add phylogenetically useful information, too. Sipuncula are unsegmented marine worms, traditionally placed in their own phylum. Recent molecular and morphological findings suggest a close affinity to the segmented Annelida. The first complete mitochondrial genome of a member of Sipuncula, Sipunculus nudus, is presented. All 37 genes characteristic for metazoan mtDNA were detected and are encoded on the same strand. The mitochondrial gene order (protein-coding and ribosomal RNA genes) resembles that of annelids, but shows several derivations so far found only in Sipuncula. Sequence based phylogenetic analysis of mitochondrial protein-coding genes results in significant bootstrap support for Annelida sensu lato, combining Annelida together with Sipuncula, Echiura, Pogonophora and Myzostomida. The mitochondrial sequence data support a close relationship of Annelida and Sipuncula. Also the most parsimonious explanation of changes in gene order favours a derivation from the annelid gene order. These results complement findings from recent phylogenetic analyses of nuclear encoded genes as well as a report of a segmental neural patterning in Sipuncula.

  3. The complete mitochondrial genome of the fire coral-inhabiting barnacle Megabalanus ajax (Sessilia: Balanidae): gene rearrangements and atypical gene content.

    PubMed

    Shen, Xin; Chu, Ka Hou; Chan, Benny Kwok Kan; Tsang, Ling Ming

    2016-01-01

    The complete mitochondrial genome of Megabalanus ajax Darwin, 1854 (Sessilia: Balanidae) is reported. Compared to typical gene content of metazoan mitochondrial genomes, duplication of one tRNA gene (trnL2) and absence of another tRNA gene (trnS1) are identified in M. ajax mitochondrial genome. There is a replacement of one tRNA (trnS1) by another tRNA (trnL2) in M. ajax mitochondrial genome compared to Megabalanus volcano mitochondrial genome. Inversion of a six-gene block (trnP-nd4L-nd4-trnH-nd5-trnF) is found between M. ajax/M. volcano and Tetraclita japonica mitochondrial genomes. With reference to the pancrustacean mitochondrial ground pattern, there is an inversion of a large gene block from the light strand to heavy strand in the two Megabalanus mitochondrial genomes, including three PCGs and two tRNAs (nd4L-nd4-trnH-nd5-trnF). Furthermore, four tRNAs (trnA, trnE, trnQ and trnC) exhibit translocation, while translocation and inversion occur in three tRNAs (trnP, trnY and trnK).

  4. Cadmium exposure affects mitochondrial bioenergetics and gene expression of key mitochondrial proteins in the eastern oyster Crassostrea virginica Gmelin (Bivalvia: Ostreidae).

    PubMed

    Sokolova, Inna M; Sokolov, Eugene P; Ponnappa, Kavita M

    2005-07-01

    Cadmium is a ubiquitous and extremely toxic metal, which strongly affects mitochondrial function of aquatic organisms in vitro; however, nothing is known about the in vivo effects of sublethal concentrations of this metal on mitochondrial bioenergetics. We have studied the effects of exposure to 0 (control) or 25 microg L-1 (Cd-exposed) Cd2+ on mitochondrial function and gene expression of key mitochondrial proteins in the eastern oyster Crassostrea virginica. Cadmium exposure in vivo resulted in considerable accumulation of cadmium in oyster mitochondria and in a significant decrease of ADP-stimulated respiration (state 3) by 30% indicating impaired capacity for ATP production. The decrease in state 3 respiration was similar to the level of inhibition expected from the direct effects of cadmium accumulated in oyster mitochondria. On the other hand, while no effect on proton leak was expected based on the mitochondrial accumulation of cadmium, Cd-exposed oysters in fact showed a significant decline of the proton leak rate (state 4+respiration) by 40%. This suggested a downregulation of proton leak, which correlated with a decrease in mRNA expression of a mitochondrial uncoupling protein UCP6 and two other potential uncouplers, mitochondrial substrate carriers MSC-1 and MSC-2. Expression of other key mitochondrial proteins including cytochrome c oxidase, adenine nucleotide transporter and voltage dependent anion channel was not affected by cadmium exposure. Adenylate energy charge (AEC) was significantly lower in Cd-exposed oysters; however, this was due to higher steady state ADP levels and not to the decrease in tissue ATP levels. Our data show that adjustment of the proton leak in cadmium-exposed oysters may be a compensatory mechanism, which allows them to maintain normal mitochondrial coupling and ATP levels despite the cadmium-induced inhibition of capacity for ATP production.

  5. The same Arabidopsis gene encodes both cytosolic and mitochondrial alanyl-tRNA synthetases.

    PubMed Central

    Mireau, H; Lancelin, D; Small, I D

    1996-01-01

    In plants, all aminoacyl-tRNA synthetases are nuclearly encoded, despite the fact that their activities are required in the three protein-synthesizing cell compartments (cytosol, mitochondria, and chloroplasts). To investigate targeting of these enzymes, we cloned cDNAs encoding alanyl-tRNA synthetase (AlaRS) and the corresponding nuclear gene, ALATS, from Arabidopsis by using degenerate polymerase chain reaction primers based on highly conserved regions shared between known AlaRSs from other organisms. Analysis of the transcription of the gene showed the presence of two potential translation initiation codons in some ALATS mRNAs. Translation from the upstream AUG would generate an N-terminal extension with features characteristic of mitochondrial targeting peptides. A polyclonal antibody raised against part of the Arabidopsis AlaRS revealed that the Arabidopsis cytosolic and mitochondrial AlaRSs are immunologically similar, suggesting that both isoforms are encoded by the ALATS gene. In vitro experiments confirmed that two polypeptides can be translated from AlATS transcripts, with most ribosomes initiating on the downstream AUG to give the shorter polypeptide corresponding in size to the cytosolic enzyme. The ability of the presequence encoded between the two initiation codons to direct polypeptides to mitochondria was demonstrated by expression of fusion proteins in tobacco protoplasts and in yeast. We conclude that the ALATS gene encodes both the cytosolic and the mitochondrial forms of AlaRS, depending on which of the two AUG codons is used to initiate translation. PMID:8672889

  6. A Mutation in the Mitochondrial Fission Gene Dnm1l Leads to Cardiomyopathy

    PubMed Central

    Ashrafian, Houman; Docherty, Louise; Leo, Vincenzo; Towlson, Christopher; Neilan, Monica; Steeples, Violetta; Lygate, Craig A.; Hough, Tertius; Townsend, Stuart; Williams, Debbie; Wells, Sara; Norris, Dominic; Glyn-Jones, Sarah; Land, John; Barbaric, Ivana; Lalanne, Zuzanne; Denny, Paul; Szumska, Dorota; Bhattacharya, Shoumo; Griffin, Julian L.; Hargreaves, Iain; Fernandez-Fuentes, Narcis; Cheeseman, Michael; Watkins, Hugh; Dear, T. Neil

    2010-01-01

    Mutations in a number of genes have been linked to inherited dilated cardiomyopathy (DCM). However, such mutations account for only a small proportion of the clinical cases emphasising the need for alternative discovery approaches to uncovering novel pathogenic mutations in hitherto unidentified pathways. Accordingly, as part of a large-scale N-ethyl-N-nitrosourea mutagenesis screen, we identified a mouse mutant, Python, which develops DCM. We demonstrate that the Python phenotype is attributable to a dominant fully penetrant mutation in the dynamin-1-like (Dnm1l) gene, which has been shown to be critical for mitochondrial fission. The C452F mutation is in a highly conserved region of the M domain of Dnm1l that alters protein interactions in a yeast two-hybrid system, suggesting that the mutation might alter intramolecular interactions within the Dnm1l monomer. Heterozygous Python fibroblasts exhibit abnormal mitochondria and peroxisomes. Homozygosity for the mutation results in the death of embryos midway though gestation. Heterozygous Python hearts show reduced levels of mitochondria enzyme complexes and suffer from cardiac ATP depletion. The resulting energy deficiency may contribute to cardiomyopathy. This is the first demonstration that a defect in a gene involved in mitochondrial remodelling can result in cardiomyopathy, showing that the function of this gene is needed for the maintenance of normal cellular function in a relatively tissue-specific manner. This disease model attests to the importance of mitochondrial remodelling in the heart; similar defects might underlie human heart muscle disease. PMID:20585624

  7. Clock-genes and mitochondrial respiratory activity: Evidence of a reciprocal interplay.

    PubMed

    Scrima, Rosella; Cela, Olga; Merla, Giuseppe; Augello, Bartolomeo; Rubino, Rosa; Quarato, Giovanni; Fugetto, Sabino; Menga, Marta; Fuhr, Luise; Relógio, Angela; Piccoli, Claudia; Mazzoccoli, Gianluigi; Capitanio, Nazzareno

    2016-08-01

    In the past few years mounting evidences have highlighted the tight correlation between circadian rhythms and metabolism. Although at the organismal level the central timekeeper is constituted by the hypothalamic suprachiasmatic nuclei practically all the peripheral tissues are equipped with autonomous oscillators made up by common molecular clockworks represented by circuits of gene expression that are organized in interconnected positive and negative feed-back loops. In this study we exploited a well-established in vitro synchronization model to investigate specifically the linkage between clock gene expression and the mitochondrial oxidative phosphorylation (OxPhos). Here we show that synchronized cells exhibit an autonomous ultradian mitochondrial respiratory activity which is abrogated by silencing the master clock gene ARNTL/BMAL1. Surprisingly, pharmacological inhibition of the mitochondrial OxPhos system resulted in dramatic deregulation of the rhythmic clock-gene expression and a similar result was attained with mtDNA depleted cells (Rho0). Our findings provide a novel level of complexity in the interlocked feedback loop controlling the interplay between cellular bioenergetics and the molecular clockwork. This article is part of a Special Issue entitled 'EBEC 2016: 19th European Bioenergetics Conference, Riva del Garda, Italy, July 2-6, 2016', edited by Prof. Paolo Bernardi.

  8. Maintenance and Integrity of the Mitochondrial Genome: a Plethora of Nuclear Genes in the Budding Yeast

    PubMed Central

    Contamine, Véronique; Picard, Marguerite

    2000-01-01

    Instability of the mitochondrial genome (mtDNA) is a general problem from yeasts to humans. However, its genetic control is not well documented except in the yeast Saccharomyces cerevisiae. From the discovery, 50 years ago, of the petite mutants by Ephrussi and his coworkers, it has been shown that more than 100 nuclear genes directly or indirectly influence the fate of the rho+ mtDNA. It is not surprising that mutations in genes involved in mtDNA metabolism (replication, repair, and recombination) can cause a complete loss of mtDNA (rho0 petites) and/or lead to truncated forms (rho−) of this genome. However, most loss-of-function mutations which increase yeast mtDNA instability act indirectly: they lie in genes controlling functions as diverse as mitochondrial translation, ATP synthase, iron homeostasis, fatty acid metabolism, mitochondrial morphology, and so on. In a few cases it has been shown that gene overexpression increases the levels of petite mutants. Mutations in other genes are lethal in the absence of a functional mtDNA and thus convert this petite-positive yeast into a petite-negative form: petite cells cannot be recovered in these genetic contexts. Most of the data are explained if one assumes that the maintenance of the rho+ genome depends on a centromere-like structure dispensable for the maintenance of rho− mtDNA and/or the function of mitochondrially encoded ATP synthase subunits, especially ATP6. In fact, the real challenge for the next 50 years will be to assemble the pieces of this puzzle by using yeast and to use complementary models, especially in strict aerobes. PMID:10839818

  9. Molecular cloning and regulatory analysis of the cuticle-degrading-protease structural gene from the entomopathogenic fungus Metarhizium anisopliae.

    PubMed

    St Leger, R J; Frank, D C; Roberts, D W; Staples, R C

    1992-03-15

    The proteinaceous insect cuticle is an effective barrier against most microbes, but entomopathogenic fungi can breach it using extracellular proteases. We report here the isolation and characterization of a cDNA clone of the cuticle-degrading protease (Pr1) of Metarhizium anisopliae. The cDNA sequence revealed that Pr1 is synthesized as a large precursor (40.3 kDa) containing a signal peptide, a propeptide and the mature protein predicted to have a molecular mass of 28.6 kDa. The primary structure of Pr1 has extensive similarity with enzymes of the subtilisin subclass of serine endopeptidases and the serine, histidine and aspartate components of the active site in subtilisins are preserved. Proteinase K demonstrated the closest sequence similarity to Pr1 (61%) but Pr1 was twofold more effective than proteinase K at degrading isolated cuticles of Manduca sexta and 33-fold more effective at degrading structural proteins bound to the cuticle by covalent bonds. We postulate that the additional positively charged residues on the surface of the Pr1 molecule, as determined using proteinase K, may facilitate electrostatic binding to cuticle proteins which is a prerequisite for activity. Northern-blot analysis of RNA and nuclear run-on assays demonstrated transcriptional control of the expression of Pr1 during nutrient deprivation and during the formation of infection structures. Southern-blot analysis demonstrated that genes with significant homologies to Metarhizium Pr1 were present in the entomopathogens Aspergillus flavus and Verticillium lecanii but not Zoophthora (= Erynia) radicans.

  10. Regulation of the nuclear genes encoding the cytoplasmic and mitochondrial leucyl-tRNA synthetases of Neurospora crassa.

    PubMed Central

    Chow, C M; Rajbhandary, U L

    1989-01-01

    We show that the nuclear genes for the cytoplasmic and mitochondrial leucyl-tRNA synthetase (LeuRS) of Neurospora crassa are distinct in their encoded proteins, codon usage, mRNA levels, and regulation. The 4.2-kilobase-pair region representing the structural gene for cytoplasmic LeuRS and flanking regions has been sequenced. The positions of the 5' and 3' ends of mRNA and of a single 62-base-pair intron have been mapped. The methionine-initiated open reading frame encoded a protein of 1,123 amino acids and displayed a strong codon bias. Although cytoplasmic LeuRS shares with mitochondrial LeuRS some general features common to most aminoacyl-tRNA synthetases, there is little amino acid sequence similarity between them, mRNA levels for cytoplasmic LeuRS were much higher than those for mitochondrial LeuRS. This observation and the strong codon bias in the cytoplasmic LeuRS gene may contribute to a greater abundance of cytoplasmic LeuRS than mitochondrial LeuRS. The genes for cytoplasmic and mitochondrial LeuRS are regulated independently. The cytoplasmic LeuRS gene is regulated by the cross-pathway control system in N. crassa, which is analogous to general amino acid control in Saccharomyces cerevisiae. The cytoplasmic LeuRS mRNA levels are induced by amino acid starvation resulting from the addition of aminotriazole. Part of this increase is due to utilization of new transcription start sites. In contrast, the mitochondrial LeuRS gene is not induced by amino acid limitation. However, the mitochondrial LeuRS mRNA levels did increase dramatically upon inhibition of mitochondrial protein synthesis by chloramphenicol or ethidium bromide or in the temperature-sensitive strain leu-5 carrying a mutation in the mitochondrial LeuRS structural gene. Images PMID:2532300

  11. Three-parent in vitro fertilization: gene replacement for the prevention of inherited mitochondrial diseases.

    PubMed

    Amato, Paula; Tachibana, Masahito; Sparman, Michelle; Mitalipov, Shoukhrat

    2014-01-01

    The exchange of nuclear genetic material between oocytes and embryos offers a novel reproductive option for the prevention of inherited mitochondrial diseases. Mitochondrial dysfunction has been recognized as a significant cause of a number of serious multiorgan diseases. Tissues with a high metabolic demand, such as brain, heart, muscle, and central nervous system, are often affected. Mitochondrial disease can be due to mutations in mitochondrial DNA or in nuclear genes involved in mitochondrial function. There is no curative treatment for patients with mitochondrial disease. Given the lack of treatments and the limitations of prenatal and preimplantation diagnosis, attention has focused on prevention of transmission of mitochondrial disease through germline gene replacement therapy. Because mitochondrial DNA is strictly maternally inherited, two approaches have been proposed. In the first, the nuclear genome from the pronuclear stage zygote of an affected woman is transferred to an enucleated donor zygote. A second technique involves transfer of the metaphase II spindle from the unfertilized oocyte of an affected woman to an enucleated donor oocyte. Our group recently reported successful spindle transfer between human oocytes, resulting in blastocyst development and embryonic stem cell derivation, with very low levels of heteroplasmy. In this review we summarize these novel assisted reproductive techniques and their use to prevent transmission of mitochondrial disorders. The promises and challenges are discussed, focusing on their potential clinical application.

  12. Molecular anatomy of tunicate senescence: reversible function of mitochondrial and nuclear genes associated with budding cycles.

    PubMed

    Kawamura, Kaz; Kitamura, Seigo; Sekida, Satoko; Tsuda, Masayuki; Sunanaga, Takeshi

    2012-11-01

    Zooids of the asexual strain of Polyandrocarpa misakiensis have a lifespan of 4-5 months; before dying, they produce many buds, enabling continuation of the strain. This study was designed to investigate the nature of gene inactivation and reactivation during this continuous process of senescence and budding. During senescence, the zooidal epidermis showed acid β-galactosidase activity, lost proliferating cell nuclear antigen immunoreactivity and became ultrastructurally worn, indicating that the epidermis is a major tissue affected by the ageing process. Semi-quantitative PCR analysis showed that the genes encoding mitochondrial respiratory chains (MRCs) engaged in decreased transcriptional activity in senescent adults compared with younger adults. The results of in situ hybridization showed that the epidermis dramatically attenuates MRC expression during ageing but restores gene activity when budding commences. During budding and ageing, the nuclear gene Eed (a polycomb group component) was activated and inactivated in a pattern similar to that observed in MRCs. In buds, RNA interference (RNAi) of Eed attenuated Eed transcripts but did not affect the gene expression of pre-activated MRCs. A tunicate humoral factor, TC14-3, could induce Eed, accompanying the reactivation of MRC in adult zooids. When RNAi of Eed and Eed induction were performed simultaneously, zooidal cells and tissues failed to engage in MRC reactivation, indicating the involvement of Eed in MRC activation. Results of this study provide evidence that the mitochondrial gene activities of Polyandrocarpa can be reversed during senescence and budding, suggesting that they are regulated by nuclear polycomb group genes.

  13. Drosophila Erect wing (Ewg) controls mitochondrial fusion during muscle growth and maintenance by regulation of the Opa1-like gene.

    PubMed

    Rai, Mamta; Katti, Prasanna; Nongthomba, Upendra

    2014-01-01

    Mitochondrial biogenesis and morphological changes are associated with tissue-specific functional demand, but the factors and pathways that regulate these processes have not been completely identified. A lack of mitochondrial fusion has been implicated in various developmental and pathological defects. The spatiotemporal regulation of mitochondrial fusion in a tissue such as muscle is not well understood. Here, we show in Drosophila indirect flight muscles (IFMs) that the nuclear-encoded mitochondrial inner membrane fusion gene, Opa1-like, is regulated in a spatiotemporal fashion by the transcription factor/co-activator Erect wing (Ewg). In IFMs null for Ewg, mitochondria undergo mitophagy and/or autophagy accompanied by reduced mitochondrial functioning and muscle degeneration. By following the dynamics of mitochondrial growth and shape in IFMs, we found that mitochondria grow extensively and fuse during late pupal development to form the large tubular mitochondria. Our evidence shows that Ewg expression during early IFM development is sufficient to upregulate Opa1-like, which itself is a requisite for both late pupal mitochondrial fusion and muscle maintenance. Concomitantly, by knocking down Opa1-like during early muscle development, we show that it is important for mitochondrial fusion, muscle differentiation and muscle organization. However, knocking down Opa1-like, after the expression window of Ewg did not cause mitochondrial or muscle defects. This study identifies a mechanism by which mitochondrial fusion is regulated spatiotemporally by Ewg through Opa1-like during IFM differentiation and growth.

  14. Mitochondrial-related gene expression changes are sensitive to agonal-pH state: implications for brain disorders

    PubMed Central

    Vawter, MP; Tomita, H; Meng, F; Bolstad, B; Li, J; Evans, S; Choudary, P; Atz, M; Shao, L; Neal, C; Walsh, DM; Burmeister, M; Speed, T; Myers, R; Jones, EG; Watson, SJ; Akil, H; Bunney, WE

    2010-01-01

    Mitochondrial defects in gene expression have been implicated in the pathophysiology of bipolar disorder and schizophrenia. We have now contrasted control brains with low pH versus high pH and showed that 28% of genes in mitochondrial-related pathways meet criteria for differential expression. A majority of genes in the mitochondrial, chaperone and proteasome pathways of nuclear DNA-encoded gene expression were decreased with decreased brain pH, whereas a majority of genes in the apoptotic and reactive oxygen stress pathways showed an increased gene expression with a decreased brain pH. There was a significant increase in mitochondrial DNA copy number and mitochondrial DNA gene expression with increased agonal duration. To minimize effects of agonal-pH state on mood disorder comparisons, two classic approaches were used, removing all subjects with low pH and agonal factors from analysis, or grouping low and high pH as a separate variable. Three groups of potential candidate genes emerged that may be mood disorder related: (a) genes that showed no sensitivity to pH but were differentially expressed in bipolar disorder or major depressive disorder; (b) genes that were altered by agonal-pH in one direction but altered in mood disorder in the opposite direction to agonal-pH and (c) genes with agonal-pH sensitivity that displayed the same direction of changes in mood disorder. Genes from these categories such as NR4A1 and HSPA2 were confirmed with Q-PCR. The interpretation of postmortem brain studies involving broad mitochondrial gene expression and related pathway alterations must be monitored against the strong effect of agonal-pH state. Genes with the least sensitivity to agonal-pH could present a starting point for candidate gene search in neuropsychiatric disorders. PMID:16636682

  15. Resolution of the African hominoid trichotomy by use of a mitochondrial gene sequence

    SciTech Connect

    Ruvolo, M.; Disotell, T.R.; Allard, M.W. ); Brown, W.M. ); Honeycutt, R.L. )

    1991-02-15

    Mitochondrial DNA sequences encoding the cytochrome oxidase subunit II gene have been determined for five primate species, siamang (Hylobates syndactylus), lowland gorilla (Gorilla gorilla), pygmy chimpanzee (Pan paniscus), crab-eating macaque (Macaca fascicularis), and green monkey (Cercopithecus aethiops), and compared with published sequences of other primate and nonprimate species. Comparisons of cytochrome oxidase subunit II gene sequences provide clear-cut evidence from the mitochondrial genome for the separation of the African ape trichotomy into two evolutionary lineages, one leading to gorillas and the other to humans and chimpanzees. Several different tree-building methods support this same phylogenetic tree topology. The comparisons also yield trees in which a substantial length separates the divergence point of gorillas from that of humans and chimpanzees, suggesting that the lineage most immediately ancestral to humans and chimpanzees may have been in existence for a relatively long time.

  16. Parkinson's disease in relation to pesticide exposure and nuclear encoded mitochondrial complex I gene variants.

    PubMed

    Corder, Elizabeth H; Mellick, George D

    2006-01-01

    Parkinson's disease (PD) is a common age-related neurodegenerative disorder thought to result from the integrated effects of genetic background and exposure to neuronal toxins. Certain individual nuclear-encoded mitochondrial complex I gene polymorphisms were found to be associated with approximately 2-fold risk variation in an Australian case-control sample. We further characterized this sample of 306 cases and 321 controls to determine the mutual information contained in the 22 SNPs and, additionally, level of pesticide exposure: five distinct risk sets were identified using grade-of-membership analysis. Of these, one was robust to pesticide exposure (I), three were vulnerable (II, III, IV), and another (V) denoted low risk for unexposed persons. Risk for individual subjects varied > 16-fold according to level of membership in the vulnerable groups. We conclude that inherited variation in mitochondrial complex I genes and pesticide exposure together modulate risk for PD.

  17. MitoNuc: a database of nuclear genes coding for mitochondrial proteins. Update 2002.

    PubMed

    Attimonelli, Marcella; Catalano, Domenico; Gissi, Carmela; Grillo, Giorgio; Licciulli, Flavio; Liuni, Sabino; Santamaria, Monica; Pesole, Graziano; Saccone, Cecilia

    2002-01-01

    Mitochondria, besides their central role in energy metabolism, have recently been found to be involved in a number of basic processes of cell life and to contribute to the pathogenesis of many degenerative diseases. All functions of mitochondria depend on the interaction of nuclear and organelle genomes. Mitochondrial genomes have been extensively sequenced and analysed and data have been collected in several specialised databases. In order to collect information on nuclear coded mitochondrial proteins we developed MitoNuc, a database containing detailed information on sequenced nuclear genes coding for mitochondrial proteins in Metazoa. The MitoNuc database can be retrieved through SRS and is available via the web site http://bighost.area.ba.cnr.it/mitochondriome where other mitochondrial databases developed by our group, the complete list of the sequenced mitochondrial genomes, links to other mitochondrial sites and related information, are available. The MitoAln database, related to MitoNuc in the previous release, reporting the multiple alignments of the relevant homologous protein coding regions, is no longer supported in the present release. In order to keep the links among entries in MitoNuc from homologous proteins, a new field in the database has been defined: the cluster identifier, an alpha numeric code used to identify each cluster of homologous proteins. A comment field derived from the corresponding SWISS-PROT entry has been introduced; this reports clinical data related to dysfunction of the protein. The logic scheme of MitoNuc database has been implemented in the ORACLE DBMS. This will allow the end-users to retrieve data through a friendly interface that will be soon implemented.

  18. Complete female mitochondrial genome of Anodonta anatina (Mollusca: Unionidae): confirmation of a novel protein-coding gene (F ORF).

    PubMed

    Soroka, Marianna; Burzyński, Artur

    2015-04-01

    Freshwater mussels are among animals having two different, gender-specific mitochondrial genomes. We sequenced complete female mitochondrial genomes from five individuals of Anodonta anatina, a bivalve species common in palearctic ecozone. The length of the genome was variable: 15,637-15,653 bp. This variation was almost entirely confined to the non-coding parts, which constituted approximately 5% of the genome. Nucleotide diversity was moderate, at 0.3%. Nucleotide composition was typically biased towards AT (66.0%). All genes normally seen in animal mtDNA were identified, as well as the ORF characteristic for unionid mitochondrial genomes, bringing the total number of genes present to 38. If this additional ORF does encode a protein, it must evolve under a very relaxed selection since all substitutions within this gene were non-synonymous. The gene order and structure of the genome were identical to those of all female mitochondrial genomes described in unionid bivalves except the Gonideini.

  19. Massively convergent evolution for ribosomal protein gene content in plastid and mitochondrial genomes.

    PubMed

    Maier, Uwe-G; Zauner, Stefan; Woehle, Christian; Bolte, Kathrin; Hempel, Franziska; Allen, John F; Martin, William F

    2013-01-01

    Plastid and mitochondrial genomes have undergone parallel evolution to encode the same functional set of genes. These encode conserved protein components of the electron transport chain in their respective bioenergetic membranes and genes for the ribosomes that express them. This highly convergent aspect of organelle genome evolution is partly explained by the redox regulation hypothesis, which predicts a separate plastid or mitochondrial location for genes encoding bioenergetic membrane proteins of either photosynthesis or respiration. Here we show that convergence in organelle genome evolution is far stronger than previously recognized, because the same set of genes for ribosomal proteins is independently retained by both plastid and mitochondrial genomes. A hitherto unrecognized selective pressure retains genes for the same ribosomal proteins in both organelles. On the Escherichia coli ribosome assembly map, the retained proteins are implicated in 30S and 50S ribosomal subunit assembly and initial rRNA binding. We suggest that ribosomal assembly imposes functional constraints that govern the retention of ribosomal protein coding genes in organelles. These constraints are subordinate to redox regulation for electron transport chain components, which anchor the ribosome to the organelle genome in the first place. As organelle genomes undergo reduction, the rRNAs also become smaller. Below size thresholds of approximately 1,300 nucleotides (16S rRNA) and 2,100 nucleotides (26S rRNA), all ribosomal protein coding genes are lost from organelles, while electron transport chain components remain organelle encoded as long as the organelles use redox chemistry to generate a proton motive force.

  20. Massively Convergent Evolution for Ribosomal Protein Gene Content in Plastid and Mitochondrial Genomes

    PubMed Central

    Maier, Uwe-G; Zauner, Stefan; Woehle, Christian; Bolte, Kathrin; Hempel, Franziska; Allen, John F.; Martin, William F.

    2013-01-01

    Plastid and mitochondrial genomes have undergone parallel evolution to encode the same functional set of genes. These encode conserved protein components of the electron transport chain in their respective bioenergetic membranes and genes for the ribosomes that express them. This highly convergent aspect of organelle genome evolution is partly explained by the redox regulation hypothesis, which predicts a separate plastid or mitochondrial location for genes encoding bioenergetic membrane proteins of either photosynthesis or respiration. Here we show that convergence in organelle genome evolution is far stronger than previously recognized, because the same set of genes for ribosomal proteins is independently retained by both plastid and mitochondrial genomes. A hitherto unrecognized selective pressure retains genes for the same ribosomal proteins in both organelles. On the Escherichia coli ribosome assembly map, the retained proteins are implicated in 30S and 50S ribosomal subunit assembly and initial rRNA binding. We suggest that ribosomal assembly imposes functional constraints that govern the retention of ribosomal protein coding genes in organelles. These constraints are subordinate to redox regulation for electron transport chain components, which anchor the ribosome to the organelle genome in the first place. As organelle genomes undergo reduction, the rRNAs also become smaller. Below size thresholds of approximately 1,300 nucleotides (16S rRNA) and 2,100 nucleotides (26S rRNA), all ribosomal protein coding genes are lost from organelles, while electron transport chain components remain organelle encoded as long as the organelles use redox chemistry to generate a proton motive force. PMID:24259312

  1. Excess amino acid polymorphism in mitochondrial DNA: contrasts among genes from Drosophila, mice, and humans.

    PubMed

    Rand, D M; Kann, L M

    1996-07-01

    Recent studies of mitochondrial DNA (mtDNA) variation in mammals and Drosophila have shown an excess of amino acid variation within species (replacement polymorphism) relative to the number of silent and replacement differences fixed between species. To examine further this pattern of nonneutral mtDNA evolution, we present sequence data for the ND3 and ND5 genes from 59 lines of Drosophila melanogaster and 29 lines of D. simulans. Of interest are the frequency spectra of silent and replacement polymorphisms, and potential variation among genes and taxa in the departures from neutral expectations. The Drosophila ND3 and ND5 data show no significant excess of replacement polymorphism using the McDonald-Kreitman test. These data are in contrast to significant departures from neutrality for the ND3 gene in mammals and other genes in Drosophila mtDNA (cytochrome b and ATPase 6). Pooled across genes, however, both Drosophila and human mtDNA show very significant excesses of amino acid polymorphism. Silent polymorphisms at ND5 show a significantly higher variance in frequency than replacement polymorphisms, and the latter show a significant skew toward low frequencies (Tajima's D = -1.954). These patterns are interpreted in light of the nearly neutral theory where mildly deleterious amino acid haplotypes are observed as ephemeral variants within species but do not contribute to divergence. The patterns of polymorphism and divergence at charge-altering amino acid sites are presented for the Drosophila ND5 gene to examine the evolution of functionally distinct mutations. Excess charge-altering polymorphism is observed at the carboxyl terminal and excess charge-altering divergence is detected at the amino terminal. While the mildly deleterious model fits as a net effect in the evolution of nonrecombining mitochondrial genomes, these data suggest that opposing evolutionary pressures may act on different regions of mitochondrial genes and genomes.

  2. Modulation of mitochondrial gene expression in pulmonary epithelial cells exposed to oxidants.

    PubMed Central

    Janssen, Y M; Driscoll, K E; Timblin, C R; Hassenbein, D; Mossman, B T

    1998-01-01

    Oxidants are important in the regulation of signal transduction and gene expression. Multiple classes of genes are transcriptionally activated by oxidants and are implicated in different phenotypic responses. In the present study, we performed differential mRNA display to elucidate genes that are induced or repressed after exposure of rat lung epithelial (RLE) cells to H2O2 or crocidolite asbestos, a pathogenic mineral that generates oxidants. After 8 or 24 hr of exposure, RNA was extracted, reverse transcribed, and amplified by polymerase chain reaction with degenerate primers to visualize alterations in gene expression. The seven clones obtained were sequenced and encoded the mitochondrial genes, NADH dehydrogenase subunits ND5 and ND6, and 16S ribosomal RNA. Evaluation of their expression by Northern blot analysis revealed increased expression of 16S rRNA after 1 or 2 hr of exposure to H2O2. At later time periods (4 and 24 hr), mRNA levels of 16S rRNA and NADH dehydrogenase were decreased in H2O2-treated RLE cells when compared to sham controls. Crocidolite asbestos caused increases in 16S rRNA levels after 8 hr of exposure, whereas after 24 hr of exposure to asbestos, 16S rRNA levels were decreased in comparison to sham controls. In addition to these oxidants, the nitric oxide generator spermine NONOate caused similar decreases in NADH dehydrogenase mRNA levels after 4 hr of exposure. The present data and previous studies demonstrated that all oxidants examined resulted in apoptosis in RLE cells during the time frame where alterations of mitochondrial gene expression were observed. As the mitochondrion is a major organelle that controls apoptosis, alterations in expression of mitochondrial genes may be involved in the regulation of apoptosis. Images Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 PMID:9788897

  3. Use of a cloned multidrug resistance gene for coamplification and overproduction of major excreted protein, a transformation-regulated secreted acid protease

    SciTech Connect

    Kane, S.E.; Troen, B.R.; Gal, S.; Ueda, K.; Pastan, I.; Gottesman, M.M.

    1988-08-01

    Malignantly transformed mouse fibroblasts synthesize and secrete large amounts of major excreted protein (MEP), a 39,000-dalton precursor to an acid protease (cathepsin L). To evaluate the possible role of this protease in the transformed phenotype, the authors transfected cloned genes for mouse or human MEP into mouse MIH 3T3 cells with an expression vector for the dominant, selectable human multidrug resistance (MDR1) gene. The cotransfected MEP sequences were efficiently coamplified and transcribed during stepwise selection for multidrug resistance in colchicine. The transfected NIH 3T3 cell lines containing amplified MEP sequences synthesized as much MEP as did Kirsten sarcoma virus-transformed NIH 3T3 cells. The MEP synthesized by cells transfected with the cloned mouse and human MEP genes were also secreted. Elevated synthesis and secretion of MEP by NIH 3T3 cells did not change the nontransformed phenotype of these cells.

  4. Timing major conflict between mitochondrial and nuclear genes in species relationships of Polygonia butterflies (Nymphalidae: Nymphalini)

    PubMed Central

    Wahlberg, Niklas; Weingartner, Elisabet; Warren, Andrew D; Nylin, Sören

    2009-01-01

    Background Major conflict between mitochondrial and nuclear genes in estimating species relationships is an increasingly common finding in animals. Usually this is attributed to incomplete lineage sorting, but recently the possibility has been raised that hybridization is important in generating such phylogenetic patterns. Just how widespread ancient and/or recent hybridization is in animals and how it affects estimates of species relationships is still not well-known. Results We investigate the species relationships and their evolutionary history over time in the genus Polygonia using DNA sequences from two mitochondrial gene regions (COI and ND1, total 1931 bp) and four nuclear gene regions (EF-1α, wingless, GAPDH and RpS5, total 2948 bp). We found clear, strongly supported conflict between mitochondrial and nuclear DNA sequences in estimating species relationships in the genus Polygonia. Nodes at which there was no conflict tended to have diverged at the same time when analyzed separately, while nodes at which conflict was present diverged at different times. We find that two species create most of the conflict, and attribute the conflict found in Polygonia satyrus to ancient hybridization and conflict found in Polygonia oreas to recent or ongoing hybridization. In both examples, the nuclear gene regions tended to give the phylogenetic relationships of the species supported by morphology and biology. Conclusion Studies inferring species-level relationships using molecular data should never be based on a single locus. Here we show that the phylogenetic hypothesis generated using mitochondrial DNA gives a very different interpretation of the evolutionary history of Polygonia species compared to that generated from nuclear DNA. We show that possible cases of hybridization in Polygonia are not limited to sister species, but may be inferred further back in time. Furthermore, we provide more evidence that Haldane's effect might not be as strong a process in

  5. Phylogenetic relationship between Dermanyssus gallinae populations in European countries based on mitochondrial COI gene sequences.

    PubMed

    Marangi, M; de Luna, C J; Cafiero, M A; Camarda, A; le Bouquin, S; Huonnic, D; Giangaspero, A; Sparagano, O A E

    2009-06-01

    Phylogenetic analysis of Dermanyssus gallinae mites originating from UK, France and Italy was performed using partial amplification of the mitochondrial COI gene. Results showed that UK samples reveal the greatest variation and diversity and are linked to one of the French populations highlighting North-South genetic transitions in European red mite populations. Intra-farm variations between mite samples highlighted the diversity between national populations and possibly its origin from the different chemical strategies used in each country.

  6. Assessing the Association of Mitochondrial Genetic Variation With Primary Open-Angle Glaucoma Using Gene-Set Analyses

    PubMed Central

    Khawaja, Anthony P.; Cooke Bailey, Jessica N.; Kang, Jae Hee; Allingham, R. Rand; Hauser, Michael A.; Brilliant, Murray; Budenz, Donald L.; Christen, William G.; Fingert, John; Gaasterland, Douglas; Gaasterland, Terry; Kraft, Peter; Lee, Richard K.; Lichter, Paul R.; Liu, Yutao; Medeiros, Felipe; Moroi, Syoko E.; Richards, Julia E.; Realini, Tony; Ritch, Robert; Schuman, Joel S.; Scott, William K.; Singh, Kuldev; Sit, Arthur J.; Vollrath, Douglas; Wollstein, Gadi; Zack, Donald J.; Zhang, Kang; Pericak-Vance, Margaret; Weinreb, Robert N.; Haines, Jonathan L.; Pasquale, Louis R.; Wiggs, Janey L.

    2016-01-01

    Purpose Recent studies indicate that mitochondrial proteins may contribute to the pathogenesis of primary open-angle glaucoma (POAG). In this study, we examined the association between POAG and common variations in gene-encoding mitochondrial proteins. Methods We examined genetic data from 3430 POAG cases and 3108 controls derived from the combination of the GLAUGEN and NEIGHBOR studies. We constructed biological-system coherent mitochondrial nuclear-encoded protein gene-sets by intersecting the MitoCarta database with the Kyoto Encyclopedia of Genes and Genomes (KEGG) database. We examined the mitochondrial gene-sets for association with POAG and with normal-tension glaucoma (NTG) and high-tension glaucoma (HTG) subsets using Pathway Analysis by Randomization Incorporating Structure. Results We identified 22 KEGG pathways with significant mitochondrial protein-encoding gene enrichment, belonging to six general biological classes. Among the pathway classes, mitochondrial lipid metabolism was associated with POAG overall (P = 0.013) and with NTG (P = 0.0006), and mitochondrial carbohydrate metabolism was associated with NTG (P = 0.030). Examining the individual KEGG pathway mitochondrial gene-sets, fatty acid elongation and synthesis and degradation of ketone bodies, both lipid metabolism pathways, were significantly associated with POAG (P = 0.005 and P = 0.002, respectively) and NTG (P = 0.0004 and P < 0.0001, respectively). Butanoate metabolism, a carbohydrate metabolism pathway, was significantly associated with POAG (P = 0.004), NTG (P = 0.001), and HTG (P = 0.010). Conclusions We present an effective approach for assessing the contributions of mitochondrial genetic variation to open-angle glaucoma. Our findings support a role for mitochondria in POAG pathogenesis and specifically point to lipid and carbohydrate metabolism pathways as being important. PMID:27661856

  7. Assessing the Association of Mitochondrial Genetic Variation With Primary Open-Angle Glaucoma Using Gene-Set Analyses.

    PubMed

    Khawaja, Anthony P; Cooke Bailey, Jessica N; Kang, Jae Hee; Allingham, R Rand; Hauser, Michael A; Brilliant, Murray; Budenz, Donald L; Christen, William G; Fingert, John; Gaasterland, Douglas; Gaasterland, Terry; Kraft, Peter; Lee, Richard K; Lichter, Paul R; Liu, Yutao; Medeiros, Felipe; Moroi, Syoko E; Richards, Julia E; Realini, Tony; Ritch, Robert; Schuman, Joel S; Scott, William K; Singh, Kuldev; Sit, Arthur J; Vollrath, Douglas; Wollstein, Gadi; Zack, Donald J; Zhang, Kang; Pericak-Vance, Margaret; Weinreb, Robert N; Haines, Jonathan L; Pasquale, Louis R; Wiggs, Janey L

    2016-09-01

    Recent studies indicate that mitochondrial proteins may contribute to the pathogenesis of primary open-angle glaucoma (POAG). In this study, we examined the association between POAG and common variations in gene-encoding mitochondrial proteins. We examined genetic data from 3430 POAG cases and 3108 controls derived from the combination of the GLAUGEN and NEIGHBOR studies. We constructed biological-system coherent mitochondrial nuclear-encoded protein gene-sets by intersecting the MitoCarta database with the Kyoto Encyclopedia of Genes and Genomes (KEGG) database. We examined the mitochondrial gene-sets for association with POAG and with normal-tension glaucoma (NTG) and high-tension glaucoma (HTG) subsets using Pathway Analysis by Randomization Incorporating Structure. We identified 22 KEGG pathways with significant mitochondrial protein-encoding gene enrichment, belonging to six general biological classes. Among the pathway classes, mitochondrial lipid metabolism was associated with POAG overall (P = 0.013) and with NTG (P = 0.0006), and mitochondrial carbohydrate metabolism was associated with NTG (P = 0.030). Examining the individual KEGG pathway mitochondrial gene-sets, fatty acid elongation and synthesis and degradation of ketone bodies, both lipid metabolism pathways, were significantly associated with POAG (P = 0.005 and P = 0.002, respectively) and NTG (P = 0.0004 and P < 0.0001, respectively). Butanoate metabolism, a carbohydrate metabolism pathway, was significantly associated with POAG (P = 0.004), NTG (P = 0.001), and HTG (P = 0.010). We present an effective approach for assessing the contributions of mitochondrial genetic variation to open-angle glaucoma. Our findings support a role for mitochondria in POAG pathogenesis and specifically point to lipid and carbohydrate metabolism pathways as being important.

  8. Prorenin processing enzyme (PPE) produced by Baculovirus-infected Sf-9 insect cells: PPE is the cysteine protease encoded in the acMNPV gene.

    PubMed

    Gotoh, Takeshi; Awa, Hirono; Kikuchi, Ken-Ichi; Nirasawa, Satoru; Takahashi, Saori

    2010-01-01

    In infection cultures of Spodoptera frugiperda (Sf-9) insect cells with a recombinant baculovirus, vhpR, carrying human preprorenin cDNA in the polyhedrin locus of Autographa californica multiple nuclear polyhedrosis virus (AcMNPV), the expressed inactive recombinant human (rh)-prorenin is reported to be proteolytically processed to yield active rh-renin in the very late phase of culture (Takahashi et al., Biosci. Biotechnol. Biochem., 71, 2610-2613 (2007)). To identify the enzyme that catalyzes the processing of rh-prorenin, referred to as prorenin processing enzyme (PPE), we purified potential PPE from virus-infected Sf-9 culture supernatant by the use of an internally quenched fluorescent (IQF) substrate for PPE. The 32-kDa protein band agreed well with PPE activity on the final Mono Q FPLC. By N-terminal amino acid sequence analysis, the protein was revealed to be a cysteine protease encoded by the AcMNPV gene. Enzyme activity was inhibited by cysteine protease inhibitors but not by other protease inhibitors. When the purified rh-prorenin was incubated with the 32-kDa protein, renin activity appeared concomitant with the disappearance of rh-prorenin. The N-terminal amino acid sequence of the activated product was identical to that of the rh-renin that had accumulated in the infection cultures. These results indicate that the 32-kDa cysteine protease derived from the AcMNPV gene is the enzyme PPE of virus-infected Sf-9 cells.

  9. RNAi-Mediated Knockdown of Serine Protease Inhibitor Genes Increases the Mortality of Plutella xylostella Challenged by Destruxin A

    PubMed Central

    Han, Pengfei; Fan, Jiqiao; Liu, Yu; Cuthbertson, Andrew G. S.; Yan, Shaoqiao; Qiu, Bao-Li; Ren, Shunxiang

    2014-01-01

    Destruxin A is a mycotoxin that is secreted by entomopathogenic fungi which has a broad-spectrum insecticidal effect. Previous transcript and protein profiling analysis showed that destruxin A has significant effects on the expression of serine protease inhibitor genes (serpin-2, 4, 5) in the larvae of Plutella xylostella. In the current study, we aimed to understand the role of serpins under application of destruxin A. We obtained two full-length cDNA sequences of P. xylostella serpins, named serpin-4 and serpin-5, and cloned the serpin-2 gene whose full-length has already been published. Phylogenetic analysis indicated that these two serpin genes were highly clustered with other serpins associated with the immune response in other insects. The temporal and spatial expression of serpin-2, serpin-4 and serpin-5 were determined to be the highest in the fat body and hemolymph of 4th larval stage using qRT-PCR and western blot detection techniques. RNA interference (RNAi) mediated knockdown of P. xylostella serpin genes was carried out by microinjection of double-stranded RNA (dsRNA). The expression levels of serpins decreased significantly after RNAi. Results showed that the depletion of serpins induced cecropins expression, increased phenoloxidase (PO) activity, body melanization and mortality in the larvae of P. xylostella under the same lethal concentration of destruxin A. The superimposed effects of serpins RNAi were similar with the destruxin A treatment upon mortality of P. xylostella larvae. We discovered for the first time that serpins play indispensable role in P. xylostella when challenged by destruxin A and deduced the possible function mechanism of destruxin A. Our findings are conducive to fully understanding the potential insecticidal mechanism of destruxin A and constitute a well-defined potential molecular target for novel insecticides. PMID:24837592

  10. RNAi-mediated knockdown of serine protease inhibitor genes increases the mortality of Plutella xylostella challenged by destruxin A.

    PubMed

    Han, Pengfei; Fan, Jiqiao; Liu, Yu; Cuthbertson, Andrew G S; Yan, Shaoqiao; Qiu, Bao-Li; Ren, Shunxiang

    2014-01-01

    Destruxin A is a mycotoxin that is secreted by entomopathogenic fungi which has a broad-spectrum insecticidal effect. Previous transcript and protein profiling analysis showed that destruxin A has significant effects on the expression of serine protease inhibitor genes (serpin-2, 4, 5) in the larvae of Plutella xylostella. In the current study, we aimed to understand the role of serpins under application of destruxin A. We obtained two full-length cDNA sequences of P. xylostella serpins, named serpin-4 and serpin-5, and cloned the serpin-2 gene whose full-length has already been published. Phylogenetic analysis indicated that these two serpin genes were highly clustered with other serpins associated with the immune response in other insects. The temporal and spatial expression of serpin-2, serpin-4 and serpin-5 were determined to be the highest in the fat body and hemolymph of 4th larval stage using qRT-PCR and western blot detection techniques. RNA interference (RNAi) mediated knockdown of P. xylostella serpin genes was carried out by microinjection of double-stranded RNA (dsRNA). The expression levels of serpins decreased significantly after RNAi. Results showed that the depletion of serpins induced cecropins expression, increased phenoloxidase (PO) activity, body melanization and mortality in the larvae of P. xylostella under the same lethal concentration of destruxin A. The superimposed effects of serpins RNAi were similar with the destruxin A treatment upon mortality of P. xylostella larvae. We discovered for the first time that serpins play indispensable role in P. xylostella when challenged by destruxin A and deduced the possible function mechanism of destruxin A. Our findings are conducive to fully understanding the potential insecticidal mechanism of destruxin A and constitute a well-defined potential molecular target for novel insecticides.

  11. Expression characterization, genomic structure and function analysis of fish ubiquitin-specific protease 18 (USP18) genes.

    PubMed

    Chen, Chen; Zhang, Yi-Bing; Gui, Jian-Fang

    2015-10-01

    In mammals, USP18 (ubiquitin-specific protease 18) is an interferon (IFN) inducible protein and plays a role in regulation of IFN response upon viral infection. In this study, we first cloned a USP18 homologous gene from virally-infected crucian carp (Carassius auratus) blastula embryonic (CAB) cells, and later found in other fish species including zebrafish. All fish USP18 genes have 10 exons and 9 introns comparable to 11 exons and 10 introns in non-fish vertebrates. Expression analysis revealed that fish USP18 was significantly induced in vitro and in vivo by IFN and IFN stimuli. Using promoter-driven luciferase reporter assay system to explore the molecular mechanism underlying fish USP18 expression, fish USP18 was identified as a typical interferon (IFN)-stimulated gene (ISG). Intracellular poly(I:C)-triggered zebrafish USP18 expression was regulated through RLR-IFN pathway, which was consistent with the fact that fish USP18 gene promoter contained two typical IFN-stimulated response elements (ISREs). Further mutation assays revealed that the distant ISRE motif primarily contributed to the induction of zebrafish USP18 by fish IFN and IFN stimuli. Functionally, fish USP18 inhibited poly(I:C)- and IFN-triggered activation of a common ISRE-containing promoter, and attenuated transcriptional expression of some ISGs including Stat1 and PKZ by recombinant IFN. Finally, we found that fish USP18 protein was expressed in cytoplasm and exhibited an ability to interact with ISG15. These results indicate that fish USP18 likely exerts its function similar to mammalian homologs. Copyright © 2015 Elsevier Ltd. All rights reserved.

  12. Identification of Sphaeroma terebrans via morphology and the mitochondrial cytochrome c oxidase subunit I (COI) gene

    PubMed Central

    LI, Xiu-Feng; HAN, Chong; ZHONG, Cai-Rong; XU, Jun-Qiu; HUANG, Jian-Rong

    2016-01-01

    Sphaeroma terebrans, a wood-boring isopoda, is distributed worldwide in tropical and subtropical mangroves. The taxonomy of S. terebrans is usually based on morphological characteristics, with its molecular identification still poorly understood. The number of teeth on the uropodal exopod and the length of the propodus of the seventh pereopod are considered as the major morphological characteristics in S. terebrans, which can cause difficulty in regards to accurate identification. In this study, we identified S. terebrans via molecular and morphological data. Furthermore, the validity of the mitochondrial cytochrome c oxidase subunit I (COI) gene as a DNA barcode for the identification of genus Sphaeroma, including species S. terebrans, S. retrolaeve, and S. serratum, was examined. The mitochondrial COI gene sequences of all specimens were sequenced and analysed. The interspecific Kimura 2-parameter distances were higher than intraspecific distances and no intraspecific-interspecific distance overlaps were observed. In addition, genetic distance and nucleotide diversity (π) exhibited no differences within S. terebrans. Our results revealed that the mitochondrial COI gene can serve as a valid DNA barcode for the identification of S. terebrans. Furthermore, the number of teeth on the uropodal exopod and the length of the propodus of the seventh pereopod were found to be unreliable taxonomic characteristics for S. terebrans. PMID:27686791

  13. Mitochondrial genomes of praying mantises (Dictyoptera, Mantodea): rearrangement, duplication, and reassignment of tRNA genes

    PubMed Central

    Ye, Fei; Lan, Xu-e; Zhu, Wen-bo; You, Ping

    2016-01-01

    Insect mitochondrial genomes (mitogenomes) contain a conserved set of 37 genes for an extensive diversity of lineages. Previously reported dictyopteran mitogenomes share this conserved mitochondrial gene arrangement, although surprisingly little is known about the mitogenome of Mantodea. We sequenced eight mantodean mitogenomes including the first representatives of two families: Hymenopodidae and Liturgusidae. Only two of these genomes retain the typical insect gene arrangement. In three Liturgusidae species, the trnM genes have translocated. Four species of mantis (Creobroter gemmata, Mantis religiosa, Statilia sp., and Theopompa sp.-HN) have multiple identical tandem duplication of trnR, and Statilia sp. additionally includes five extra duplicate trnW. These extra trnR and trnW in Statilia sp. are erratically arranged and form another novel gene order. Interestingly, the extra trnW is converted from trnR by the process of point mutation at anticodon, which is the first case of tRNA reassignment for an insect. Furthermore, no significant differences were observed amongst mantodean mitogenomes with variable copies of tRNA according to comparative analysis of codon usage. Combined with phylogenetic analysis, the characteristics of tRNA only possess limited phylogenetic information in this research. Nevertheless, these features of gene rearrangement, duplication, and reassignment provide valuable information toward understanding mitogenome evolution in insects. PMID:27157299

  14. Genetic Fingerprinting of Wheat and Its Progenitors by Mitochondrial Gene orf256

    PubMed Central

    El-Shehawi, Ahmed M.; Fahmi, Abdelmeguid I.; Sayed, Samy M.; Elseehy, Mona M.

    2012-01-01

    orf256 is a wheat mitochondrial gene associated with cytoplasmic male sterility (CMS) that has different organization in various species. This study exploited the orf256 gene as a mitochondrial DNA marker to study the genetic fingerprint of Triticum and Aegilops species. PCR followed by sequencing of common parts of the orf256 gene were employed to determine the fingerprint and molecular evolution of Triticum and Aegilops species. Although many primer pairs were used, two pairs of orf256 specific primers (5:-94/C: 482, 5:253/C: 482), amplified DNA fragments of 576 bp and 230 bp respectively in all species were tested. A common 500 bp of nine species of Triticum and Aegilops were aligned and showed consistent results with that obtained from other similar chloroplast or nuclear genes. Base alignment showed that there were various numbers of base substitutions in all species compared to S. cereal (Sc) (the outgroup species). Phylogenetic relationship revealed similar locations and proximity on phylogenetic trees established using plastid and nuclear genes. The results of this study open a good route to use unknown function genes of mitochondria in studying the molecular relationships and evolution of wheat and complex plant genomes. PMID:24970134

  15. A cytoplasmic male sterility-associated mitochondrial peptide in common bean is post-translationally regulated.

    PubMed Central

    Sarria, R; Lyznik, A; Vallejos, C E; Mackenzie, S A

    1998-01-01

    Cytoplasmic male sterility in the common bean plant is associated with a dominant mitochondrial mutation designated pvs-or f 239 (for Phaseolus vulgaris sterility sequence open reading frame 239). The sequence is transcribed in both vegetative and reproductive tissues, but the translation product, ORF239, is present only in reproductive tissues. We present evidence to support a model of post-translational regulation of ORF239 expression based on the following observations. In organello translation experiments using purified mitochondria from young seedlings demonstrated accumulation of ORF239 only when a protease inhibitor was included. Proteolytic activity against ORF239 was observed in mitochondrial extracts fractionating with the mitochondrial inner membrane. The DNA sequence encoding a serine-type protease, similar to the lon protease gene of Escherichia coli, was cloned from the Arabidopsis genome. The expression product of this sequence demonstrated proteolytic activity against ORF239 in vitro, with features resembling the activity detected in mitochondrial inner membrane preparations. Antibodies generated against the overexpressed Lon homolog reduced proteolytic activity against ORF239 when added to mitochondrial extracts. Our data suggest that ORF239 was undetected in vegetative tissue due to rapid turnover by at least one mitochondrial protease that acts against ORF239 post-translationally. PMID:9668139

  16. Unequal and genotype-dependent expression of mitochondrial genes in larvae of the pacific oyster Crassostrea gigas.

    PubMed

    Curole, Jason P; Meyer, Eli; Manahan, Donal T; Hedgecock, Dennis

    2010-04-01

    Mitochondria are essential for regulation of energy metabolism, but little is known about patterns of mitochondrial genome expression in invertebrates. To explore the association of mitochondrial expression with differential growth of Crassostrea gigas, the Pacific oyster, we crossed two inbred lines to produce inbred and hybrid larvae, which grew at different rates under the same environmental conditions. Using high-throughput cloning and sequencing methods, we identified 1.1 million expressed sequence tags from the mitochondrial genome, 96.7% of which were perfect matches to genes targeted by the method. Expression varied significantly among genes, ranging over nearly four orders of magnitude, from mt:lRNA, which constituted 21% of all transcripts, to mt:CoII, which constituted less than 0.02% of all transcripts. Variable expression of genes coding for subunits of macromolecular complexes (e.g., mt:CoI and mt:CoII) implies that stoichiometry in these complexes must be regulated post-transcriptionally. Surprisingly, the mitochondrial transcriptome contained non-coding transcripts, which may play a role in the regulation of mitochondrial function. Finally, mitochondrial expression depended strongly on maternal factors and nuclear-cytoplasmic interactions, which may explain previously observed growth differences between reciprocal hybrids. Differences in mitochondrial gene expression could provide a biochemical index for the metabolic basis of genetically determined differences in larval growth.

  17. Disruption of a nuclear gene encoding a mitochondrial gamma carbonic anhydrase reduces complex I and supercomplex I + III2 levels and alters mitochondrial physiology in Arabidopsis.

    PubMed

    Perales, Mariano; Eubel, Holger; Heinemeyer, Jesco; Colaneri, Alejandro; Zabaleta, Eduardo; Braun, Hans-Peter

    2005-07-08

    Mitochondrial NADH dehydrogenase (complex I) of plants includes quite a number of plant-specific subunits, some of which exhibit sequence similarity to bacterial gamma-carbonic anhydrases. A homozygous Arabidopsis knockout mutant carrying a T-DNA insertion in a gene encoding one of these subunits (At1g47260) was generated to investigate its physiological role. Isolation of mitochondria and separation of mitochondrial protein complexes by Blue-native polyacrylamide gel electrophoresis or sucrose gradient ultracentrifugation revealed drastically reduced complex I levels. Furthermore, the mitochondrial I + III2 supercomplex was very much reduced in mutant plants. Remaining complex I had normal molecular mass, suggesting substitution of the At1g47260 protein by one or several of the structurally related subunits of this respiratory protein complex. Immune-blotting experiments using polyclonal antibodies directed against the At1g47260 protein indicated its presence within complex I, the I + III2 supercomplex and smaller protein complexes, which possibly represent subcomplexes of complex I. Changes within the mitochondrial proteome of mutant cells were systematically monitored by fluorescence difference gel electrophoresis using 2D Blue-native/SDS and 2D isoelectric focussing/SDS polyacrylamide gel electrophoresis. Complex I subunits are largely absent within the mitochondrial proteome. Further mitochondrial proteins are reduced in mutant plants, like mitochondrial ferredoxin, others are increased, like formate dehydrogenase. Development of mutant plants was normal under standard growth conditions. However, a suspension cell culture generated from mutant plants exhibited clearly reduced growth rates and respiration. In summary, At1g47260 is important for complex I assembly in plant mitochondria and respiration. A role of At1g47260 in mitochondrial one-carbon metabolism is supported by micro-array analyses.

  18. Octocoral Mitochondrial Genomes Provide Insights into the Phylogenetic History of Gene Order Rearrangements, Order Reversals, and Cnidarian Phylogenetics

    PubMed Central

    Figueroa, Diego F.; Baco, Amy R.

    2015-01-01

    We use full mitochondrial genomes to test the robustness of the phylogeny of the Octocorallia, to determine the evolutionary pathway for the five known mitochondrial gene rearrangements in octocorals, and to test the suitability of using mitochondrial genomes for higher taxonomic-level phylogenetic reconstructions. Our phylogeny supports three major divisions within the Octocorallia and show that Paragorgiidae is paraphyletic, with Sibogagorgia forming a sister branch to the Coralliidae. Furthermore, Sibogagorgia cauliflora has what is presumed to be the ancestral gene order in octocorals, but the presence of a pair of inverted repeat sequences suggest that this gene order was not conserved but rather evolved back to this apparent ancestral state. Based on this we recommend the resurrection of the family Sibogagorgiidae to fix the paraphyly of the Paragorgiidae. This is the first study to show that in the Octocorallia, mitochondrial gene orders have evolved back to an ancestral state after going through a gene rearrangement, with at least one of the gene orders evolving independently in different lineages. A number of studies have used gene boundaries to determine the type of mitochondrial gene arrangement present. However, our findings suggest that this method known as gene junction screening may miss evolutionary reversals. Additionally, substitution saturation analysis demonstrates that while whole mitochondrial genomes can be used effectively for phylogenetic analyses within Octocorallia, their utility at higher taxonomic levels within Cnidaria is inadequate. Therefore for phylogenetic reconstruction at taxonomic levels higher than subclass within the Cnidaria, nuclear genes will be required, even when whole mitochondrial genomes are available. PMID:25539723

  19. Mitochondrial myopathy, lactic acidosis, and sideroblastic anemia (MLASA) plus associated with a novel de novo mutation (m.8969G>A) in the mitochondrial encoded ATP6 gene.

    PubMed

    Burrage, Lindsay C; Tang, Sha; Wang, Jing; Donti, Taraka R; Walkiewicz, Magdalena; Luchak, J Michael; Chen, Li-Chieh; Schmitt, Eric S; Niu, Zhiyv; Erana, Rodrigo; Hunter, Jill V; Graham, Brett H; Wong, Lee-Jun; Scaglia, Fernando

    2014-11-01

    Mitochondrial myopathy, lactic acidosis and sideroblastic anemia (MLASA) is a rare mitochondrial disorder that has previously been associated with mutations in PUS1 and YARS2. In the present report, we describe a 6-year old male with an MLASA plus phenotype. This patient had features of MLASA in the setting of developmental delay, sensorineural hearing loss, epilepsy, agenesis of the corpus callosum, failure to thrive, and stroke-like episodes. Sequencing of the mitochondrial genome identified a novel de novo, heteroplasmic mutation in the mitochondrial DNA (mtDNA) encoded ATP6 gene (m.8969G>A, p.S148N). Whole exome sequencing did not identify mutations or variants in PUS1 or YARS2 or any known nuclear genes that could affect mitochondrial function and explain this phenotype. Studies of fibroblasts derived from the patient revealed a decrease in oligomycin-sensitive respiration, a finding which is consistent with a complex V defect. Thus, this mutation in MT-ATP6 may represent the first mtDNA point mutation associated with the MLASA phenotype.

  20. The role of SIGMAR1 gene mutation and mitochondrial dysfunction in amyotrophic lateral sclerosis.

    PubMed

    Fukunaga, Kohji; Shinoda, Yasuharu; Tagashira, Hideaki

    2015-01-01

    Amyotrophic lateral sclerosis (ALS) patients exhibit diverse pathologies such as endoplasmic reticulum (ER) stress and mitochondrial dysfunction in motor neurons. Five to ten percent of patients have familial ALS, a form of the disease caused by mutations in ALS-related genes, while sporadic forms of the disease occur in 90-95% of patients. Recently, it was reported that familial ALS patients exhibit a missense mutation in SIGMAR1 (c.304G > C), which encodes sigma-1 receptor (Sig-1R), substituting glutamine for glutamic acid at amino acid residue 102 (p.E102Q). Expression of that mutant Sig-1R(E102Q) protein reduces mitochondrial ATP production, inhibits proteasome activity and causes mitochondrial injury, aggravating ER stress-induced neuronal death in neuro2A cells. In this issue, we discuss mechanisms underlying mitochondrial impairment seen in ALS motor neurons and propose that therapies that protect mitochondria might improve the quality of life (QOL) of ALS patients and should be considered for clinical trials. Copyright © 2015 Japanese Pharmacological Society. Production and hosting by Elsevier B.V. All rights reserved.

  1. Interactions between nuclear genes and a foreign mitochondrial genome in the redbelly dace Chrosomus eos.

    PubMed

    Deremiens, Léo; Schwartz, Logan; Angers, Annie; Glémet, Hélène; Angers, Bernard

    2015-11-01

    Given the coevolution process occurring between nuclear and mitochondrial genomes, the effects of introgressive hybridization remain puzzling. In this study, we take advantage of the natural co-occurrence of two biotypes bearing a similar nuclear genome (Chrosomus eos) but harbouring mitochondria from different species (wild type: C. eos; cybrids: Chrosomus neogaeus) to determine the extent of phenotype changes linked to divergence in the mitochondrial genome. Changes were assessed through differences in gene expression, enzymatic activity, proteomic and swimming activity. Our data demonstrate that complex IV activity was significantly higher in cybrids compared to wild type. This difference could result from one variable amino acid on the COX3 mitochondrial subunit and/or from a tremendous change in the proteome. We also show that cybrids present a higher swimming performance than wild type. Ultimately, our results demonstrate that the absence of coevolution for a period of almost ten million years between nuclear and mitochondrial genomes does not appear to be necessarily deleterious but could even have beneficial effects. Indeed, the capture of foreign mitochondria could be an efficient way to circumvent the selection process of genomic coevolution, allowing the rapid accumulation of new mutations in C. eos cybrids. Copyright © 2015 Elsevier Inc. All rights reserved.

  2. Three genes expressing Kunitz domains in the epididymis are related to genes of WFDC-type protease inhibitors and semen coagulum proteins in spite of lacking similarity between their protein products

    PubMed Central

    2011-01-01

    Background We have previously identified a locus on human chromosome 20q13.1, encompassing related genes of postulated WFDC-type protease inhibitors and semen coagulum proteins. Three of the genes with WFDC motif also coded for the Kunitz-type protease inhibitor motif. In this report, we have reinvestigated the locus for homologous genes encoding Kunitz motif only. The identified genes have been analyzed with respect to structure, expression and function. Results We identified three novel genes; SPINT3, SPINT4 and SPINT5, and the structure of their transcripts were determined by sequencing of DNA generated by rapid amplification of cDNA ends. Each gene encodes a Kunitz domain preceded by a typical signal peptide sequence, which indicates that the proteins of 7.6, 8.7, and 9.7 kDa are secreted. Analysis of transcripts in 26 tissues showed that the genes predominantly are expressed in the epididymis. The recombinantly produced proteins could not inhibit the amidolytic activity of trypsin, chymotrypsin, plasmin, thrombin, coagulation factor Xa, elastase, urokinase and prostate specific antigen, whereas similarly made bovine pancreatic trypsin inhibitor (BPTI) had the same bioactivity as the protein isolated from bovine pancreas. Conclusions The similar organization, chromosomal location and site of expression, suggests that the novel genes are homologous with the genes of WFDC-type protease inhibitors and semen coagulum proteins, despite the lack of similarity in primary structure of their protein products. Their restricted expression to the epididymis suggests that they could be importan