Homing endonucleases from mobile group I introns: discovery to genome engineering

PubMed Central

2014-01-01

Homing endonucleases are highly specific DNA cleaving enzymes that are encoded within genomes of all forms of microbial life including phage and eukaryotic organelles. These proteins drive the mobility and persistence of their own reading frames. The genes that encode homing endonucleases are often embedded within self-splicing elements such as group I introns, group II introns and inteins. This combination of molecular functions is mutually advantageous: the endonuclease activity allows surrounding introns and inteins to act as invasive DNA elements, while the splicing activity allows the endonuclease gene to invade a coding sequence without disrupting its product. Crystallographic analyses of representatives from all known homing endonuclease families have illustrated both their mechanisms of action and their evolutionary relationships to a wide range of host proteins. Several homing endonucleases have been completely redesigned and used for a variety of genome engineering applications. Recent efforts to augment homing endonucleases with auxiliary DNA recognition elements and/or nucleic acid processing factors has further accelerated their use for applications that demand exceptionally high specificity and activity. PMID:24589358

Mobile small RNAs regulate genome-wide DNA methylation.

PubMed

Lewsey, Mathew G; Hardcastle, Thomas J; Melnyk, Charles W; Molnar, Attila; Valli, Adrián; Urich, Mark A; Nery, Joseph R; Baulcombe, David C; Ecker, Joseph R

2016-02-09

RNA silencing at the transcriptional and posttranscriptional levels regulates endogenous gene expression, controls invading transposable elements (TEs), and protects the cell against viruses. Key components of the mechanism are small RNAs (sRNAs) of 21-24 nt that guide the silencing machinery to their nucleic acid targets in a nucleotide sequence-specific manner. Transcriptional gene silencing is associated with 24-nt sRNAs and RNA-directed DNA methylation (RdDM) at cytosine residues in three DNA sequence contexts (CG, CHG, and CHH). We previously demonstrated that 24-nt sRNAs are mobile from shoot to root in Arabidopsis thaliana and confirmed that they mediate DNA methylation at three sites in recipient cells. In this study, we extend this finding by demonstrating that RdDM of thousands of loci in root tissues is dependent upon mobile sRNAs from the shoot and that mobile sRNA-dependent DNA methylation occurs predominantly in non-CG contexts. Mobile sRNA-dependent non-CG methylation is largely dependent on the DOMAINS REARRANGED METHYLTRANSFERASES 1/2 (DRM1/DRM2) RdDM pathway but is independent of the CHROMOMETHYLASE (CMT)2/3 DNA methyltransferases. Specific superfamilies of TEs, including those typically found in gene-rich euchromatic regions, lose DNA methylation in a mutant lacking 22- to 24-nt sRNAs (dicer-like 2, 3, 4 triple mutant). Transcriptome analyses identified a small number of genes whose expression in roots is associated with mobile sRNAs and connected to DNA methylation directly or indirectly. Finally, we demonstrate that sRNAs from shoots of one accession move across a graft union and target DNA methylation de novo at normally unmethylated sites in the genomes of root cells from a different accession.

Meeting report for mobile DNA 2010.

PubMed

Chaconas, George; Craig, Nancy; Curcio, M Joan; Deininger, Prescott; Feschotte, Cedric; Levin, Henry; Rice, Phoebe A; Voytas, Daniel F

2010-08-24

An international conference on mobile DNA was held 24-28 April 2010 in Montreal, Canada. Sponsored by the American Society for Microbiology, the conference's goal was to bring together researchers from around the world who study transposition in diverse organisms using multiple experimental approaches. The meeting drew over 190 attendees and most contributed through poster presentations, invited talks and short talks selected from poster abstracts. The talks were organized into eight scientific sessions, which ranged in topic from the evolutionary dynamics of mobile genetic elements to transposition reaction mechanisms. Here we present highlights from the platform sessions with a focus on talks presented by the invited speakers.

Behavior of restriction–modification systems as selfish mobile elements and their impact on genome evolution

PubMed Central

Kobayashi, Ichizo

2001-01-01

Restriction–modification (RM) systems are composed of genes that encode a restriction enzyme and a modification methylase. RM systems sometimes behave as discrete units of life, like viruses and transposons. RM complexes attack invading DNA that has not been properly modified and thus may serve as a tool of defense for bacterial cells. However, any threat to their maintenance, such as a challenge by a competing genetic element (an incompatible plasmid or an allelic homologous stretch of DNA, for example) can lead to cell death through restriction breakage in the genome. This post-segregational or post-disturbance cell killing may provide the RM complexes (and any DNA linked with them) with a competitive advantage. There is evidence that they have undergone extensive horizontal transfer between genomes, as inferred from their sequence homology, codon usage bias and GC content difference. They are often linked with mobile genetic elements such as plasmids, viruses, transposons and integrons. The comparison of closely related bacterial genomes also suggests that, at times, RM genes themselves behave as mobile elements and cause genome rearrangements. Indeed some bacterial genomes that survived post-disturbance attack by an RM gene complex in the laboratory have experienced genome rearrangements. The avoidance of some restriction sites by bacterial genomes may result from selection by past restriction attacks. Both bacteriophages and bacteria also appear to use homologous recombination to cope with the selfish behavior of RM systems. RM systems compete with each other in several ways. One is competition for recognition sequences in post-segregational killing. Another is super-infection exclusion, that is, the killing of the cell carrying an RM system when it is infected with another RM system of the same regulatory specificity but of a different sequence specificity. The capacity of RM systems to act as selfish, mobile genetic elements may underlie the structure and function of RM enzymes. PMID:11557807

Behavior of restriction-modification systems as selfish mobile elements and their impact on genome evolution.

PubMed

Kobayashi, I

2001-09-15

Restriction-modification (RM) systems are composed of genes that encode a restriction enzyme and a modification methylase. RM systems sometimes behave as discrete units of life, like viruses and transposons. RM complexes attack invading DNA that has not been properly modified and thus may serve as a tool of defense for bacterial cells. However, any threat to their maintenance, such as a challenge by a competing genetic element (an incompatible plasmid or an allelic homologous stretch of DNA, for example) can lead to cell death through restriction breakage in the genome. This post-segregational or post-disturbance cell killing may provide the RM complexes (and any DNA linked with them) with a competitive advantage. There is evidence that they have undergone extensive horizontal transfer between genomes, as inferred from their sequence homology, codon usage bias and GC content difference. They are often linked with mobile genetic elements such as plasmids, viruses, transposons and integrons. The comparison of closely related bacterial genomes also suggests that, at times, RM genes themselves behave as mobile elements and cause genome rearrangements. Indeed some bacterial genomes that survived post-disturbance attack by an RM gene complex in the laboratory have experienced genome rearrangements. The avoidance of some restriction sites by bacterial genomes may result from selection by past restriction attacks. Both bacteriophages and bacteria also appear to use homologous recombination to cope with the selfish behavior of RM systems. RM systems compete with each other in several ways. One is competition for recognition sequences in post-segregational killing. Another is super-infection exclusion, that is, the killing of the cell carrying an RM system when it is infected with another RM system of the same regulatory specificity but of a different sequence specificity. The capacity of RM systems to act as selfish, mobile genetic elements may underlie the structure and function of RM enzymes.

DNA transposon-based gene vehicles - scenes from an evolutionary drive

PubMed Central

2013-01-01

DNA transposons are primitive genetic elements which have colonized living organisms from plants to bacteria and mammals. Through evolution such parasitic elements have shaped their host genomes by replicating and relocating between chromosomal loci in processes catalyzed by the transposase proteins encoded by the elements themselves. DNA transposable elements are constantly adapting to life in the genome, and self-suppressive regulation as well as defensive host mechanisms may assist in buffering ‘cut-and-paste’ DNA mobilization until accumulating mutations will eventually restrict events of transposition. With the reconstructed Sleeping Beauty DNA transposon as a powerful engine, a growing list of transposable elements with activity in human cells have moved into biomedical experimentation and preclinical therapy as versatile vehicles for delivery and genomic insertion of transgenes. In this review, we aim to link the mechanisms that drive transposon evolution with the realities and potential challenges we are facing when adapting DNA transposons for gene transfer. We argue that DNA transposon-derived vectors may carry inherent, and potentially limiting, traits of their mother elements. By understanding in detail the evolutionary journey of transposons, from host colonization to element multiplication and inactivation, we may better exploit the potential of distinct transposable elements. Hence, parallel efforts to investigate and develop distinct, but potent, transposon-based vector systems will benefit the broad applications of gene transfer. Insight and clever optimization have shaped new DNA transposon vectors, which recently debuted in the first DNA transposon-based clinical trial. Learning from an evolutionary drive may help us create gene vehicles that are safer, more efficient, and less prone for suppression and inactivation. PMID:24320156

Systematic prediction of control proteins and their DNA binding sites

PubMed Central

Sorokin, Valeriy; Severinov, Konstantin; Gelfand, Mikhail S.

2009-01-01

We present here the results of a systematic bioinformatics analysis of control (C) proteins, a class of DNA-binding regulators that control time-delayed transcription of their own genes as well as restriction endonuclease genes in many type II restriction-modification systems. More than 290 C protein homologs were identified and DNA-binding sites for ∼70% of new and previously known C proteins were predicted by a combination of phylogenetic footprinting and motif searches in DNA upstream of C protein genes. Additional analysis revealed that a large proportion of C protein genes are translated from leaderless RNA, which may contribute to time-delayed nature of genetic switches operated by these proteins. Analysis of genetic contexts of newly identified C protein genes revealed that they are not exclusively associated with restriction-modification genes; numerous instances of associations with genes originating from mobile genetic elements were observed. These instances might be vestiges of ancient horizontal transfers and indicate that during evolution ancestral restriction-modification system genes were the sites of mobile elements insertions. PMID:19056824

A Mobile Element in mutS Drives Hypermutation in a Marine Vibrio

PubMed Central

Chu, Nathaniel D.; Clarke, Sean A.; Timberlake, Sonia; Polz, Martin F.; Grossman, Alan D.

2017-01-01

ABSTRACT Bacteria face a trade-off between genetic fidelity, which reduces deleterious mistakes in the genome, and genetic innovation, which allows organisms to adapt. Evidence suggests that many bacteria balance this trade-off by modulating their mutation rates, but few mechanisms have been described for such modulation. Following experimental evolution and whole-genome resequencing of the marine bacterium Vibrio splendidus 12B01, we discovered one such mechanism, which allows this bacterium to switch to an elevated mutation rate. This switch is driven by the excision of a mobile element residing in mutS, which encodes a DNA mismatch repair protein. When integrated within the bacterial genome, the mobile element provides independent promoter and translation start sequences for mutS—different from the bacterium’s original mutS promoter region—which allow the bacterium to make a functional mutS gene product. Excision of this mobile element rejoins the mutS gene with host promoter and translation start sequences but leaves a 2-bp deletion in the mutS sequence, resulting in a frameshift and a hypermutator phenotype. We further identified hundreds of clinical and environmental bacteria across Betaproteobacteria and Gammaproteobacteria that possess putative mobile elements within the same amino acid motif in mutS. In a subset of these bacteria, we detected excision of the element but not a frameshift mutation; the mobile elements leave an intact mutS coding sequence after excision. Our findings reveal a novel mechanism by which one bacterium alters its mutation rate and hint at a possible evolutionary role for mobile elements within mutS in other bacteria. PMID:28174306

Reconstructing the complex evolutionary history of mobile plasmids in red algal genomes

PubMed Central

Lee, JunMo; Kim, Kyeong Mi; Yang, Eun Chan; Miller, Kathy Ann; Boo, Sung Min; Bhattacharya, Debashish; Yoon, Hwan Su

2016-01-01

The integration of foreign DNA into algal and plant plastid genomes is a rare event, with only a few known examples of horizontal gene transfer (HGT). Plasmids, which are well-studied drivers of HGT in prokaryotes, have been reported previously in red algae (Rhodophyta). However, the distribution of these mobile DNA elements and their sites of integration into the plastid (ptDNA), mitochondrial (mtDNA), and nuclear genomes of Rhodophyta remain unknown. Here we reconstructed the complex evolutionary history of plasmid-derived DNAs in red algae. Comparative analysis of 21 rhodophyte ptDNAs, including new genome data for 5 species, turned up 22 plasmid-derived open reading frames (ORFs) that showed syntenic and copy number variation among species, but were conserved within different individuals in three lineages. Several plasmid-derived homologs were found not only in ptDNA but also in mtDNA and in the nuclear genome of green plants, stramenopiles, and rhizarians. Phylogenetic and plasmid-derived ORF analyses showed that the majority of plasmid DNAs originated within red algae, whereas others were derived from cyanobacteria, other bacteria, and viruses. Our results elucidate the evolution of plasmid DNAs in red algae and suggest that they spread as parasitic genetic elements. This hypothesis is consistent with their sporadic distribution within Rhodophyta. PMID:27030297

Transposable elements in Drosophila.

PubMed

McCullers, Tabitha J; Steiniger, Mindy

2017-01-01

Transposable elements (TEs) are mobile genetic elements that can mobilize within host genomes. As TEs comprise more than 40% of the human genome and are linked to numerous diseases, understanding their mechanisms of mobilization and regulation is important. Drosophila melanogaster is an ideal model organism for the study of eukaryotic TEs as its genome contains a diverse array of active TEs. TEs universally impact host genome size via transposition and deletion events, but may also adopt unique functional roles in host organisms. There are 2 main classes of TEs: DNA transposons and retrotransposons. These classes are further divided into subgroups of TEs with unique structural and functional characteristics, demonstrating the significant variability among these elements. Despite this variability, D. melanogaster and other eukaryotic organisms utilize conserved mechanisms to regulate TEs. This review focuses on the transposition mechanisms and regulatory pathways of TEs, and their functional roles in D. melanogaster .

Transposable elements in Drosophila

PubMed Central

McCullers, Tabitha J.; Steiniger, Mindy

2017-01-01

ABSTRACT Transposable elements (TEs) are mobile genetic elements that can mobilize within host genomes. As TEs comprise more than 40% of the human genome and are linked to numerous diseases, understanding their mechanisms of mobilization and regulation is important. Drosophila melanogaster is an ideal model organism for the study of eukaryotic TEs as its genome contains a diverse array of active TEs. TEs universally impact host genome size via transposition and deletion events, but may also adopt unique functional roles in host organisms. There are 2 main classes of TEs: DNA transposons and retrotransposons. These classes are further divided into subgroups of TEs with unique structural and functional characteristics, demonstrating the significant variability among these elements. Despite this variability, D. melanogaster and other eukaryotic organisms utilize conserved mechanisms to regulate TEs. This review focuses on the transposition mechanisms and regulatory pathways of TEs, and their functional roles in D. melanogaster. PMID:28580197

LINE-1 Elements in Structural Variation and Disease

PubMed Central

Beck, Christine R.; Garcia-Perez, José Luis; Badge, Richard M.; Moran, John V.

2014-01-01

The completion of the human genome reference sequence ushered in a new era for the study and discovery of human transposable elements. It now is undeniable that transposable elements, historically dismissed as junk DNA, have had an instrumental role in sculpting the structure and function of our genomes. In particular, long interspersed element-1 (LINE-1 or L1) and short interspersed elements (SINEs) continue to affect our genome, and their movement can lead to sporadic cases of disease. Here, we briefly review the types of transposable elements present in the human genome and their mechanisms of mobility. We next highlight how advances in DNA sequencing and genomic technologies have enabled the discovery of novel retrotransposons in individual genomes. Finally, we discuss how L1-mediated retrotransposition events impact human genomes. PMID:21801021

Novel Structure of Ty3 Reverse Transcriptase | Center for Cancer Research

Cancer.gov

Retrotransposons are mobile genetic elements that self amplify via a single-stranded RNA intermediate, which is converted to double-stranded DNA by an encoded reverse transcriptase (RT) with both DNA polymerase (pol) and ribonuclease H (RNase) activities. Categorized by whether they contain flanking long terminal repeat (LTR) sequences, retrotransposons play a critical role in

Stability of non-Watson-Crick G-A/A-G base pair in synthetic DNA and RNA oligonucleotides.

PubMed

Ito, Yuko; Sone, Yumiko; Mizutani, Takaharu

2004-03-01

A non-Watson-Crick G-A/A-G base pair is found in SECIS (selenocysteine-insertion sequence) element in the 3'-untranslated region of Se-protein mRNAs and in the functional site of the hammerhead ribozyme. We studied the stability of G-A/A-G base pair (bold) in 17mer GT(U)GACGGAAACCGGAAC synthetic DNA and RNA oligonucleotides by thermal melting experiments and gel electrophoresis. The measured Tm value of DNA oligonucleotide having G-A/A-G pair showed an intermediate value (58 degrees C) between that of Watson-Crick G-C/C-G base pair (75 degrees C) and that of G-G/A-A of non-base-pair (40 degrees C). Similar thermal melting patterns were obtained with RNA oligonucleotides. This result indicates that the secondary structure of oligonucleotide having G-A/A-G base pair is looser than that of the G-C type Watson-Crick base pair. In the comparison between RNA and DNA having G-A/A-G base pair, the Tm value of the RNA oligonucleotide was 11 degrees C lower than that of DNA, indicating that DNA has a more rigid structure than RNA. The stained pattern of oligonucleotide on polyacrylamide gel clarified that the mobility of the DNA oligonucleotide G-A/A-G base pair changed according to the urea concentration from the rigid state (near the mobility of G-C/C-G oligonucleotide) in the absence of urea to the random state (near the mobility of G-G/A-A oligonucleotide) in 7 M urea. However, the RNA oligonucleotide with G-A/A-G pair moved at an intermediate mobility between that of oligonucleotide with G-C/C-G and of the oligonucleotide with G-G/A-A, and the mobility pattern did not depend on urea concentration. Thus, DNA and RNA oligonucleotides with the G-A/A-G base pair showed a pattern indicating an intermediate structure between the rigid Watson-Crick base pair and the random structure of non-base pair. RNA with G-A/A-G base pair has the intermediate structure not influenced by urea concentration. Finally, this study indicated that the intermediate rigidity imparted by Non-Watson-Crick base pair in SECIS element plays an important role in the selenocysteine expression by UGA codon.

A mobile element in mutS drives hypermutation in a marine Vibrio

DOE PAGES

Chu, Nathaniel D.; Clarke, Sean A.; Timberlake, Sonia; ...

2017-02-07

Bacteria face a trade-off between genetic fidelity, which reduces deleterious mistakes in the genome, and genetic innovation, which allows organisms to adapt. Evidence suggests that many bacteria balance this trade-off by modulating their mutation rates, but few mechanisms have been described for such modulation. Following experimental evolution and whole-genome resequencing of the marine bacterium Vibrio splendidus 12B01, we discovered one such mechanism, which allows this bacterium to switch to an elevated mutation rate. This switch is driven by the excision of a mobile element residing in mutS, which encodes a DNA mismatch repair protein. When integrated within the bacterial genome,more » the mobile element provides independent promoter and translation start sequences for mutS—different from the bacterium’s original mutS promoter region—which allow the bacterium to make a functional mutS gene product. Excision of this mobile element rejoins the mutS gene with host promoter and translation start sequences but leaves a 2-bp deletion in the mutS sequence, resulting in a frameshift and a hypermutator phenotype. We further identified hundreds of clinical and environmental bacteria across Betaproteobacteria and Gammaproteobacteria that possess putative mobile elements within the same amino acid motif in mutS. In a subset of these bacteria, we detected excision of the element but not a frameshift mutation; the mobile elements leave an intact mutS coding sequence after excision. Finally, our findings reveal a novel mechanism by which one bacterium alters its mutation rate and hint at a possible evolutionary role for mobile elements within mutS in other bacteria.« less

A mobile element in mutS drives hypermutation in a marine Vibrio

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chu, Nathaniel D.; Clarke, Sean A.; Timberlake, Sonia

Bacteria face a trade-off between genetic fidelity, which reduces deleterious mistakes in the genome, and genetic innovation, which allows organisms to adapt. Evidence suggests that many bacteria balance this trade-off by modulating their mutation rates, but few mechanisms have been described for such modulation. Following experimental evolution and whole-genome resequencing of the marine bacterium Vibrio splendidus 12B01, we discovered one such mechanism, which allows this bacterium to switch to an elevated mutation rate. This switch is driven by the excision of a mobile element residing in mutS, which encodes a DNA mismatch repair protein. When integrated within the bacterial genome,more » the mobile element provides independent promoter and translation start sequences for mutS—different from the bacterium’s original mutS promoter region—which allow the bacterium to make a functional mutS gene product. Excision of this mobile element rejoins the mutS gene with host promoter and translation start sequences but leaves a 2-bp deletion in the mutS sequence, resulting in a frameshift and a hypermutator phenotype. We further identified hundreds of clinical and environmental bacteria across Betaproteobacteria and Gammaproteobacteria that possess putative mobile elements within the same amino acid motif in mutS. In a subset of these bacteria, we detected excision of the element but not a frameshift mutation; the mobile elements leave an intact mutS coding sequence after excision. Finally, our findings reveal a novel mechanism by which one bacterium alters its mutation rate and hint at a possible evolutionary role for mobile elements within mutS in other bacteria.« less

Antibiotic Resistance Genes in the Bacteriophage DNA Fraction of Environmental Samples

PubMed Central

Colomer-Lluch, Marta; Jofre, Juan; Muniesa, Maite

2011-01-01

Antibiotic resistance is an increasing global problem resulting from the pressure of antibiotic usage, greater mobility of the population, and industrialization. Many antibiotic resistance genes are believed to have originated in microorganisms in the environment, and to have been transferred to other bacteria through mobile genetic elements. Among others, β-lactam antibiotics show clinical efficacy and low toxicity, and they are thus widely used as antimicrobials. Resistance to β-lactam antibiotics is conferred by β-lactamase genes and penicillin-binding proteins, which are chromosomal- or plasmid-encoded, although there is little information available on the contribution of other mobile genetic elements, such as phages. This study is focused on three genes that confer resistance to β-lactam antibiotics, namely two β-lactamase genes (blaTEM and blaCTX-M9) and one encoding a penicillin-binding protein (mecA) in bacteriophage DNA isolated from environmental water samples. The three genes were quantified in the DNA isolated from bacteriophages collected from 30 urban sewage and river water samples, using quantitative PCR amplification. All three genes were detected in the DNA of phages from all the samples tested, in some cases reaching 104 gene copies (GC) of blaTEM or 102 GC of blaCTX-M and mecA. These values are consistent with the amount of fecal pollution in the sample, except for mecA, which showed a higher number of copies in river water samples than in urban sewage. The bla genes from phage DNA were transferred by electroporation to sensitive host bacteria, which became resistant to ampicillin. blaTEM and blaCTX were detected in the DNA of the resistant clones after transfection. This study indicates that phages are reservoirs of resistance genes in the environment. PMID:21390233

FARME DB: a functional antibiotic resistance element database

PubMed Central

Wallace, James C.; Port, Jesse A.; Smith, Marissa N.; Faustman, Elaine M.

2017-01-01

Antibiotic resistance (AR) is a major global public health threat but few resources exist that catalog AR genes outside of a clinical context. Current AR sequence databases are assembled almost exclusively from genomic sequences derived from clinical bacterial isolates and thus do not include many microbial sequences derived from environmental samples that confer resistance in functional metagenomic studies. These environmental metagenomic sequences often show little or no similarity to AR sequences from clinical isolates using standard classification criteria. In addition, existing AR databases provide no information about flanking sequences containing regulatory or mobile genetic elements. To help address this issue, we created an annotated database of DNA and protein sequences derived exclusively from environmental metagenomic sequences showing AR in laboratory experiments. Our Functional Antibiotic Resistant Metagenomic Element (FARME) database is a compilation of publically available DNA sequences and predicted protein sequences conferring AR as well as regulatory elements, mobile genetic elements and predicted proteins flanking antibiotic resistant genes. FARME is the first database to focus on functional metagenomic AR gene elements and provides a resource to better understand AR in the 99% of bacteria which cannot be cultured and the relationship between environmental AR sequences and antibiotic resistant genes derived from cultured isolates. Database URL: http://staff.washington.edu/jwallace/farme PMID:28077567

Alpha3, a transposable element that promotes host sexual reproduction.

PubMed

Barsoum, Emad; Martinez, Paula; Aström, Stefan U

2010-01-01

Theoretical models predict that selfish DNA elements require host sex to persist in a population. Therefore, a transposon that induces sex would strongly favor its own spread. We demonstrate that a protein homologous to transposases, called alpha3, was essential for mating type switch in Kluyveromyces lactis. Mutational analysis showed that amino acids conserved among transposases were essential for its function. During switching, sequences in the 5' and 3' flanking regions of the alpha3 gene were joined, forming a DNA circle, showing that alpha3 mobilized from the genome. The sequences encompassing the alpha3 gene circle junctions in the mating type alpha (MATalpha) locus were essential for switching from MATalpha to MATa, suggesting that alpha3 mobilization was a coupled event. Switching also required a DNA-binding protein, Mating type switch 1 (Mts1), whose binding sites in MATalpha were important. Expression of Mts1 was repressed in MATa/MATalpha diploids and by nutrients, limiting switching to haploids in low-nutrient conditions. A hairpin-capped DNA double-strand break (DSB) was observed in the MATa locus in mre11 mutant strains, indicating that mating type switch was induced by MAT-specific DSBs. This study provides empirical evidence for selfish DNA promoting host sexual reproduction by mediating mating type switch.

Functional impact of the human mobilome.

PubMed

Babatz, Timothy D; Burns, Kathleen H

2013-06-01

The human genome is replete with interspersed repetitive sequences derived from the propagation of mobile DNA elements. Three families of human retrotransposons remain active today: LINE1, Alu, and SVA elements. Since 1988, de novo insertions at previously recognized disease loci have been shown to generate highly penetrant alleles in Mendelian disorders. Only recently has the extent of germline-transmitted retrotransposon insertion polymorphism (RIP) in human populations been fully realized. Also exciting are recent studies of somatic retrotransposition in human tissues and reports of tumor-specific insertions, suggesting roles in tissue heterogeneity and tumorigenesis. Here we discuss mobile elements in human disease with an emphasis on exciting developments from the last several years. Copyright © 2013 Elsevier Ltd. All rights reserved.

Schizosaccharomyces pombe Retrotransposon Tf2 Mobilizes Primarily through Homologous cDNA Recombination

PubMed Central

Hoff, Eleanor F.; Levin, Henry L.; Boeke, Jef D.

1998-01-01

The Tf2 retrotransposon, found in the fission yeast Schizosaccharomyces pombe, is nearly identical to its sister element, Tf1, in its reverse transcriptase-RNase H and integrase domains but is very divergent in the gag domain, the protease, the 5′ untranslated region, and the U3 domain of the long terminal repeats. It has now been demonstrated that a neo-marked copy of Tf2 overexpressed from a heterologous promoter can mobilize into the S. pombe genome and produce true transposition events. However, the Tf2-neo mobilization frequency is 10- to 20-fold lower than that of Tf1-neo, and 70% of the Tf2-neo events are homologous recombination events generated independently of a functional Tf2 integrase. Thus, the Tf2 element is primarily dependent on homologous recombination with preexisting copies of Tf2 for its propagation. Finally, production of Tf2-neo proteins and cDNA was also analyzed; surprisingly, Tf2 was found to produce its reverse transcriptase as a single species in which it is fused to protease, unlike all other retroviruses and retrotransposons. PMID:9774697

The high mobility group protein 1 enhances binding of the estrogen receptor DNA binding domain to the estrogen response element.

PubMed

Romine, L E; Wood, J R; Lamia, L A; Prendergast, P; Edwards, D P; Nardulli, A M

1998-05-01

We have examined the ability of the high-mobility group protein 1 (HMG1) to alter binding of the estrogen receptor DNA-binding domain (DBD) to the estrogen response element (ERE). HMG1 dramatically enhanced binding of purified, bacterially expressed DBD to the consensus vitellogenin A2 ERE in a dose-dependent manner. The ability of HMG1 to stabilize the DBD-ERE complex resulted in part from a decrease in the dissociation rate of the DBD from the ERE. Antibody supershift experiments demonstrated that HMG1 was also capable of forming a ternary complex with the ERE-bound DBD in the presence of HMG1-specific antibody. HMG1 did not substantially affect DBD-ERE contacts as assessed by methylation interference assays, nor did it alter the ability of the DBD to induce distortion in ERE-containing DNA fragments. Because HMG1 dramatically enhanced estrogen receptor DBD binding to the ERE, and the DBD is the most highly conserved region among the nuclear receptor superfamily members, HMG1 may function to enhance binding of other nuclear receptors to their respective response elements and act in concert with coactivator proteins to regulate expression of hormone-responsive genes.

Transcriptional activation of short interspersed elements by DNA-damaging agents.

PubMed

Rudin, C M; Thompson, C B

2001-01-01

Short interspersed elements (SINEs), typified by the human Alu repeat, are RNA polymerase III (pol III)-transcribed sequences that replicate within the genome through an RNA intermediate. Replication of SINEs has been extensive in mammalian evolution: an estimated 5% of the human genome consists of Alu repeats. The mechanisms regulating transcription, reverse transcription, and reinsertion of SINE elements in genomic DNA are poorly understood. Here we report that expression of murine SINE transcripts of both the B1 and B2 classes is strongly upregulated after prolonged exposure to cisplatin, etoposide, or gamma radiation. A similar induction of Alu transcripts in human cells occurs under these conditions. This induction is not due to a general upregulation of pol III activity in either species. Genotoxic treatment of murine cells containing an exogenous human Alu element induced Alu transcription. Concomitant with the increased expression of SINEs, an increase in cellular reverse transcriptase was observed after exposure to these same DNA-damaging agents. These findings suggest that genomic damage may be an important activator of SINEs, and that SINE mobility may contribute to secondary malignancy after exposure to DNA-damaging chemotherapy.

Functional characterization of piggyBat from the bat Myotis lucifugus unveils an active mammalian DNA transposon.

PubMed

Mitra, Rupak; Li, Xianghong; Kapusta, Aurélie; Mayhew, David; Mitra, Robi D; Feschotte, Cédric; Craig, Nancy L

2013-01-02

A revelation of the genomic age has been the contributions of the mobile DNA segments called transposable elements to chromosome structure, function, and evolution in virtually all organisms. Substantial fractions of vertebrate genomes derive from transposable elements, being dominated by retroelements that move via RNA intermediates. Although many of these elements have been inactivated by mutation, several active retroelements remain. Vertebrate genomes also contain substantial quantities and a high diversity of cut-and-paste DNA transposons, but no active representative of this class has been identified in mammals. Here we show that a cut-and-paste element called piggyBat, which has recently invaded the genome of the little brown bat (Myotis lucifugus) and is a member of the piggyBac superfamily, is active in its native form in transposition assays in bat and human cultured cells, as well as in the yeast Saccharomyces cerevisiae. Our study suggests that some DNA transposons are still actively shaping some mammalian genomes and reveals an unprecedented opportunity to study the mechanism, regulation, and genomic impact of cut-and-paste transposition in a natural mammalian host.

Hsmar1 Transposition Is Sensitive to the Topology of the Transposon Donor and the Target

PubMed Central

Claeys Bouuaert, Corentin; Chalmers, Ronald

2013-01-01

Hsmar1 is a member of the Tc1-mariner superfamily of DNA transposons. These elements mobilize within the genome of their host by a cut-and-paste mechanism. We have exploited the in vitro reaction provided by Hsmar1 to investigate the effect of DNA supercoiling on transposon integration. We found that the topology of both the transposon and the target affect integration. Relaxed transposons have an integration defect that can be partially restored in the presence of elevated levels of negatively supercoiled target DNA. Negatively supercoiled DNA is a better target than nicked or positively supercoiled DNA, suggesting that underwinding of the DNA helix promotes target interactions. Like other Tc1-mariner elements, Hsmar1 integrates into 5′-TA dinucleotides. The direct vicinity of the target TA provides little sequence specificity for target interactions. However, transposition within a plasmid substrate was not random and some TA dinucleotides were targeted preferentially. The distribution of intramolecular target sites was not affected by DNA topology. PMID:23341977

A Helitron-like Transposon Superfamily from Lepidoptera Disrupts (GAAA)n Microsatellites and is Responsible for Flanking Sequence Similarity within a Microsatellite Family

USDA-ARS?s Scientific Manuscript database

Transposable elements (TEs) are mobile DNA regions that alter host genome structure and gene expression. A novel 588 bp non-autonomous high copy number TE in the Ostrinia nubilalis genome has features in common with miniature inverted-repeat transposable elements (MITEs): high A+T content (62.3%),...

Chromosome size in diploid eukaryotic species centers on the average length with a conserved boundary

USDA-ARS?s Scientific Manuscript database

Understanding genome and chromosome evolution is important for understanding genetic inheritance and evolution. Universal events comprising DNA replication, transcription, repair, mobile genetic element transposition, chromosome rearrangements, mitosis, and meiosis underlie inheritance and variation...

Transfer of scarlet fever-associated elements into the group A Streptococcus M1T1 clone.

PubMed

Ben Zakour, Nouri L; Davies, Mark R; You, Yuanhai; Chen, Jonathan H K; Forde, Brian M; Stanton-Cook, Mitchell; Yang, Ruifu; Cui, Yujun; Barnett, Timothy C; Venturini, Carola; Ong, Cheryl-lynn Y; Tse, Herman; Dougan, Gordon; Zhang, Jianzhong; Yuen, Kwok-Yung; Beatson, Scott A; Walker, Mark J

2015-11-02

The group A Streptococcus (GAS) M1T1 clone emerged in the 1980s as a leading cause of epidemic invasive infections worldwide, including necrotizing fasciitis and toxic shock syndrome. Horizontal transfer of mobile genetic elements has played a central role in the evolution of the M1T1 clone, with bacteriophage-encoded determinants DNase Sda1 and superantigen SpeA2 contributing to enhanced virulence and colonization respectively. Outbreaks of scarlet fever in Hong Kong and China in 2011, caused primarily by emm12 GAS, led to our investigation of the next most common cause of scarlet fever, emm1 GAS. Genomic analysis of 18 emm1 isolates from Hong Kong and 16 emm1 isolates from mainland China revealed the presence of mobile genetic elements associated with the expansion of emm12 scarlet fever clones in the M1T1 genomic background. These mobile genetic elements confer expression of superantigens SSA and SpeC, and resistance to tetracycline, erythromycin and clindamycin. Horizontal transfer of mobile DNA conferring multi-drug resistance and expression of a new superantigen repertoire in the M1T1 clone should trigger heightened public health awareness for the global dissemination of these genetic elements.

Transfer of scarlet fever-associated elements into the group A Streptococcus M1T1 clone

PubMed Central

Ben Zakour, Nouri L.; Davies, Mark R.; You, Yuanhai; Chen, Jonathan H. K.; Forde, Brian M.; Stanton-Cook, Mitchell; Yang, Ruifu; Cui, Yujun; Barnett, Timothy C.; Venturini, Carola; Ong, Cheryl-lynn Y.; Tse, Herman; Dougan, Gordon; Zhang, Jianzhong; Yuen, Kwok-Yung; Beatson, Scott A.; Walker, Mark J.

2015-01-01

The group A Streptococcus (GAS) M1T1 clone emerged in the 1980s as a leading cause of epidemic invasive infections worldwide, including necrotizing fasciitis and toxic shock syndrome123. Horizontal transfer of mobile genetic elements has played a central role in the evolution of the M1T1 clone45, with bacteriophage-encoded determinants DNase Sda16 and superantigen SpeA27 contributing to enhanced virulence and colonization respectively. Outbreaks of scarlet fever in Hong Kong and China in 2011, caused primarily by emm12 GAS8910, led to our investigation of the next most common cause of scarlet fever, emm1 GAS89. Genomic analysis of 18 emm1 isolates from Hong Kong and 16 emm1 isolates from mainland China revealed the presence of mobile genetic elements associated with the expansion of emm12 scarlet fever clones1011 in the M1T1 genomic background. These mobile genetic elements confer expression of superantigens SSA and SpeC, and resistance to tetracycline, erythromycin and clindamycin. Horizontal transfer of mobile DNA conferring multi-drug resistance and expression of a new superantigen repertoire in the M1T1 clone should trigger heightened public health awareness for the global dissemination of these genetic elements. PMID:26522788

Experimental mapping of DNA duplex shape enabled by global lineshape analyses of a nucleotide-independent nitroxide probe

PubMed Central

Ding, Yuan; Zhang, Xiaojun; Tham, Kenneth W.; Qin, Peter Z.

2014-01-01

Sequence-dependent variation in structure and dynamics of a DNA duplex, collectively referred to as ‘DNA shape’, critically impacts interactions between DNA and proteins. Here, a method based on the technique of site-directed spin labeling was developed to experimentally map shapes of two DNA duplexes that contain response elements of the p53 tumor suppressor. An R5a nitroxide spin label, which was covalently attached at a specific phosphate group, was scanned consecutively through the DNA duplex. X-band continuous-wave electron paramagnetic resonance spectroscopy was used to monitor rotational motions of R5a, which report on DNA structure and dynamics at the labeling site. An approach based on Pearson's coefficient analysis was developed to collectively examine the degree of similarity among the ensemble of R5a spectra. The resulting Pearson's coefficients were used to generate maps representing variation of R5a mobility along the DNA duplex. The R5a mobility maps were found to correlate with maps of certain DNA helical parameters, and were capable of revealing similarity and deviation in the shape of the two closely related DNA duplexes. Collectively, the R5a probe and the Pearson's coefficient-based lineshape analysis scheme yielded a generalizable method for examining sequence-dependent DNA shapes. PMID:25092920

Repeated extragenic sequences in prokaryotic genomes: a proposal for the origin and dynamics of the RUP element in Streptococcus pneumoniae.

PubMed

Oggioni, M R; Claverys, J P

1999-10-01

A survey of all Streptococcus pneumoniae GenBank/EMBL DNA sequence entries and of the public domain sequence (representing more than 90% of the genome) of an S. pneumoniae type 4 strain allowed identification of 108 copies of a 107-bp-long highly repeated intergenic element called RUP (for repeat unit of pneumococcus). Several features of the element, revealed in this study, led to the proposal that RUP is an insertion sequence (IS)-derivative that could still be mobile. Among these features are: (1) a highly significant homology between the terminal inverted repeats (IRs) of RUPs and of IS630-Spn1, a new putative IS of S. pneumoniae; and (2) insertion at a TA dinucleotide, a characteristic target of several members of the IS630 family. Trans-mobilization of RUP is therefore proposed to be mediated by the transposase of IS630-Spn1. To account for the observation that RUPs are distributed among four subtypes which exhibit different degrees of sequence homogeneity, a scenario is invoked based on successive stages of RUP mobility and non-mobility, depending on whether an active transposase is present or absent. In the latter situation, an active transposase could be reintroduced into the species through natural transformation. Examination of sequences flanking RUP revealed a preferential association with ISs. It also provided evidence that RUPs promote sequence rearrangements, thereby contributing to genome flexibility. The possibility that RUP preferentially targets transforming DNA of foreign origin and subsequently favours disruption/rearrangement of exogenous sequences is discussed.

Cut-and-Paste Transposons in Fungi with Diverse Lifestyles

PubMed Central

Steczkiewicz, Kamil; Ginalski, Krzysztof

2017-01-01

Abstract Transposable elements (TEs) shape genomes via recombination and transposition, lead to chromosomal rearrangements, create new gene neighborhoods, and alter gene expression. They play key roles in adaptation either to symbiosis in Amanita genus or to pathogenicity in Pyrenophora tritici-repentis. Despite growing evidence of their importance, the abundance and distribution of mobile elements replicating in a “cut-and-paste” fashion is barely described so far. In order to improve our knowledge on this old and ubiquitous class of transposable elements, 1,730 fungal genomes were scanned using both de novo and homology-based approaches. DNA TEs have been identified across the whole data set and display uneven distribution from both DNA TE classification and fungal taxonomy perspectives. DNA TE content correlates with genome size, which confirms that many transposon families proliferate simultaneously. In contrast, it is independent from intron density, average gene distance and GC content. TE count is associated with species’ lifestyle and tends to be elevated in plant symbionts and decreased in animal parasites. Lastly, we found that fungi with both RIP and RNAi systems have more total DNA TE sequences but less elements retaining a functional transposase, what reflects stringent control over transposition. PMID:29228286

Novel Structure of Ty3 Reverse Transcriptase | Center for Cancer Research

Cancer.gov

Retrotransposons are mobile genetic elements that self amplify via a single-stranded RNA intermediate, which is converted to double-stranded DNA by an encoded reverse transcriptase (RT) with both DNA polymerase (pol) and ribonuclease H (RNase) activities. Categorized by whether they contain flanking long terminal repeat (LTR) sequences, retrotransposons play a critical role in the architecture of eukaryotic genomes and are the evolutionary origin of retroviruses, including human immunodeficiency virus (HIV).

Mitochondrial genome rearrangements in glomus species triggered by homologous recombination between distinct mtDNA haplotypes.

PubMed

Beaudet, Denis; Terrat, Yves; Halary, Sébastien; de la Providencia, Ivan Enrique; Hijri, Mohamed

2013-01-01

Comparative mitochondrial genomics of arbuscular mycorrhizal fungi (AMF) provide new avenues to overcome long-lasting obstacles that have hampered studies aimed at understanding the community structure, diversity, and evolution of these multinucleated and genetically polymorphic organisms.AMF mitochondrial (mt) genomes are homogeneous within isolates, and their intergenic regions harbor numerous mobile elements that have rapidly diverged, including homing endonuclease genes, small inverted repeats, and plasmid-related DNA polymerase genes (dpo), making them suitable targets for the development of reliable strain-specific markers. However, these elements may also lead to genome rearrangements through homologous recombination, although this has never previously been reported in this group of obligate symbiotic fungi. To investigate whether such rearrangements are present and caused by mobile elements in AMF, the mitochondrial genomes from two Glomeraceae members (i.e., Glomus cerebriforme and Glomus sp.) with substantial mtDNA synteny divergence,were sequenced and compared with available glomeromycotan mitochondrial genomes. We used an extensive nucleotide/protein similarity network-based approach to investigated podiversity in AMF as well as in other organisms for which sequences are publicly available. We provide strong evidence of dpo-induced inter-haplotype recombination, leading to a reshuffled mitochondrial genome in Glomus sp. These findings raise questions as to whether AMF single spore cultivations artificially underestimate mtDNA genetic diversity.We assessed potential dpo dispersal mechanisms in AMF and inferred a robust phylogenetic relationship with plant mitochondrial plasmids. Along with other indirect evidence, our analyses indicate that members of the Glomeromycota phylum are potential donors of mitochondrial plasmids to plants.

Mitochondrial Genome Rearrangements in Glomus Species Triggered by Homologous Recombination between Distinct mtDNA Haplotypes

PubMed Central

Beaudet, Denis; Terrat, Yves; Halary, Sébastien; de la Providencia, Ivan Enrique; Hijri, Mohamed

2013-01-01

Comparative mitochondrial genomics of arbuscular mycorrhizal fungi (AMF) provide new avenues to overcome long-lasting obstacles that have hampered studies aimed at understanding the community structure, diversity, and evolution of these multinucleated and genetically polymorphic organisms. AMF mitochondrial (mt) genomes are homogeneous within isolates, and their intergenic regions harbor numerous mobile elements that have rapidly diverged, including homing endonuclease genes, small inverted repeats, and plasmid-related DNA polymerase genes (dpo), making them suitable targets for the development of reliable strain-specific markers. However, these elements may also lead to genome rearrangements through homologous recombination, although this has never previously been reported in this group of obligate symbiotic fungi. To investigate whether such rearrangements are present and caused by mobile elements in AMF, the mitochondrial genomes from two Glomeraceae members (i.e., Glomus cerebriforme and Glomus sp.) with substantial mtDNA synteny divergence, were sequenced and compared with available glomeromycotan mitochondrial genomes. We used an extensive nucleotide/protein similarity network-based approach to investigate dpo diversity in AMF as well as in other organisms for which sequences are publicly available. We provide strong evidence of dpo-induced inter-haplotype recombination, leading to a reshuffled mitochondrial genome in Glomus sp. These findings raise questions as to whether AMF single spore cultivations artificially underestimate mtDNA genetic diversity. We assessed potential dpo dispersal mechanisms in AMF and inferred a robust phylogenetic relationship with plant mitochondrial plasmids. Along with other indirect evidence, our analyses indicate that members of the Glomeromycota phylum are potential donors of mitochondrial plasmids to plants. PMID:23925788

DNA transposon activity is associated with increased mutation rates in genes of rice and other grasses

PubMed Central

Wicker, Thomas; Yu, Yeisoo; Haberer, Georg; Mayer, Klaus F. X.; Marri, Pradeep Reddy; Rounsley, Steve; Chen, Mingsheng; Zuccolo, Andrea; Panaud, Olivier; Wing, Rod A.; Roffler, Stefan

2016-01-01

DNA (class 2) transposons are mobile genetic elements which move within their ‘host' genome through excising and re-inserting elsewhere. Although the rice genome contains tens of thousands of such elements, their actual role in evolution is still unclear. Analysing over 650 transposon polymorphisms in the rice species Oryza sativa and Oryza glaberrima, we find that DNA repair following transposon excisions is associated with an increased number of mutations in the sequences neighbouring the transposon. Indeed, the 3,000 bp flanking the excised transposons can contain over 10 times more mutations than the genome-wide average. Since DNA transposons preferably insert near genes, this is correlated with increases in mutation rates in coding sequences and regulatory regions. Most importantly, we find this phenomenon also in maize, wheat and barley. Thus, these findings suggest that DNA transposon activity is a major evolutionary force in grasses which provide the basis of most food consumed by humankind. PMID:27599761

Mechanisms Used for Genomic Proliferation by Thermophilic Group II Introns

PubMed Central

Mohr, Georg; Ghanem, Eman; Lambowitz, Alan M.

2010-01-01

Mobile group II introns, which are found in bacterial and organellar genomes, are site-specific retroelments hypothesized to be evolutionary ancestors of spliceosomal introns and retrotransposons in higher organisms. Most bacteria, however, contain no more than one or a few group II introns, making it unclear how introns could have proliferated to higher copy numbers in eukaryotic genomes. An exception is the thermophilic cyanobacterium Thermosynechococcus elongatus, which contains 28 closely related copies of a group II intron, constituting ∼1.3% of the genome. Here, by using a combination of bioinformatics and mobility assays at different temperatures, we identified mechanisms that contribute to the proliferation of T. elongatus group II introns. These mechanisms include divergence of DNA target specificity to avoid target site saturation; adaptation of some intron-encoded reverse transcriptases to splice and mobilize multiple degenerate introns that do not encode reverse transcriptases, leading to a common splicing apparatus; and preferential insertion within other mobile introns or insertion elements, which provide new unoccupied sites in expanding non-essential DNA regions. Additionally, unlike mesophilic group II introns, the thermophilic T. elongatus introns rely on elevated temperatures to help promote DNA strand separation, enabling access to a larger number of DNA target sites by base pairing of the intron RNA, with minimal constraint from the reverse transcriptase. Our results provide insight into group II intron proliferation mechanisms and show that higher temperatures, which are thought to have prevailed on Earth during the emergence of eukaryotes, favor intron proliferation by increasing the accessibility of DNA target sites. We also identify actively mobile thermophilic introns, which may be useful for structural studies, gene targeting in thermophiles, and as a source of thermostable reverse transcriptases. PMID:20543989

Friends-enemies: endogenous retroviruses are major transcriptional regulators of human DNA

NASA Astrophysics Data System (ADS)

Buzdin, Anton A.; Prassolov, Vladimir; Garazha, Andrew V.

2017-06-01

Endogenous retroviruses are mobile genetic elements hardly distinguishable from infectious, or “exogenous”, retroviruses at the time of insertion in the host DNA. Human endogenous retroviruses (HERVs) are not rare. They gave rise to multiple families of closely related mobile elements that occupy 8% of the human genome. Together, they shape genomic regulatory landscape by providing at least 320,000 human transcription factor binding sites (TFBS) located on 110,000 individual HERV elements. The HERVs host as many as 155,000 mapped DNaseI hypersensitivity sites, which denote loci active in the regulation of gene expression or chromatin structure. The contemporary view of the HERVs evolutionary dynamics suggests that at the early stages after insertion, the HERV is treated by the host cells as a foreign genetic element, and is likely to be suppressed by the targeted methylation and mutations. However, at the later stages, when significant number of mutations has been already accumulated and when the retroviral genes are broken, the regulatory potential of a HERV may be released and recruited to modify the genomic balance of transcription factor binding sites. This process goes together with further accumulation and selection of mutations, which reshape the regulatory landscape of the human DNA. However, developmental reprogramming, stress or pathological conditions like cancer, inflammation and infectious diseases, can remove the blocks limiting expression and HERV-mediated host gene regulation. This, in turn, can dramatically alter the gene expression equilibrium and shift it to a newer state, thus further amplifying instability and exacerbating the stressful situation.

Mobility and generation of mosaic non-autonomous transposons by Tn3-derived inverted-repeat miniature elements (TIMEs).

PubMed

Szuplewska, Magdalena; Ludwiczak, Marta; Lyzwa, Katarzyna; Czarnecki, Jakub; Bartosik, Dariusz

2014-01-01

Functional transposable elements (TEs) of several Pseudomonas spp. strains isolated from black shale ore of Lubin mine and from post-flotation tailings of Zelazny Most in Poland, were identified using a positive selection trap plasmid strategy. This approach led to the capture and characterization of (i) 13 insertion sequences from 5 IS families (IS3, IS5, ISL3, IS30 and IS1380), (ii) isoforms of two Tn3-family transposons--Tn5563a and Tn4662a (the latter contains a toxin-antitoxin system), as well as (iii) non-autonomous TEs of diverse structure, ranging in size from 262 to 3892 bp. The non-autonomous elements transposed into AT-rich DNA regions and generated 5- or 6-bp sequence duplications at the target site of transposition. Although these TEs lack a transposase gene, they contain homologous 38-bp-long terminal inverted repeat sequences (IRs), highly conserved in Tn5563a and many other Tn3-family transposons. The simplest elements of this type, designated TIMEs (Tn3 family-derived Inverted-repeat Miniature Elements) (262 bp), were identified within two natural plasmids (pZM1P1 and pLM8P2) of Pseudomonas spp. It was demonstrated that TIMEs are able to mobilize segments of plasmid DNA for transposition, which results in the generation of more complex non-autonomous elements, resembling IS-driven composite transposons in structure. Such transposon-like elements may contain different functional genetic modules in their core regions, including plasmid replication systems. Another non-autonomous element "captured" with a trap plasmid was a TIME derivative containing a predicted resolvase gene and a res site typical for many Tn3-family transposons. The identification of a portable site-specific recombination system is another intriguing example confirming the important role of non-autonomous TEs of the TIME family in shuffling genetic information in bacterial genomes. Transposition of such mosaic elements may have a significant impact on diversity and evolution, not only of transposons and plasmids, but also of other types of mobile genetic elements.

Sequencing the extrachromosomal circular mobilome reveals retrotransposon activity in plants

PubMed Central

Llauro, Christel; Jobet, Edouard; Robakowska-Hyzorek, Dagmara; Lasserre, Eric; Ghesquière, Alain; Panaud, Olivier

2017-01-01

Retrotransposons are mobile genetic elements abundant in plant and animal genomes. While efficiently silenced by the epigenetic machinery, they can be reactivated upon stress or during development. Their level of transcription not reflecting their transposition ability, it is thus difficult to evaluate their contribution to the active mobilome. Here we applied a simple methodology based on the high throughput sequencing of extrachromosomal circular DNA (eccDNA) forms of active retrotransposons to characterize the repertoire of mobile retrotransposons in plants. This method successfully identified known active retrotransposons in both Arabidopsis and rice material where the epigenome is destabilized. When applying mobilome-seq to developmental stages in wild type rice, we identified PopRice as a highly active retrotransposon producing eccDNA forms in the wild type endosperm. The mobilome-seq strategy opens new routes for the characterization of a yet unexplored fraction of plant genomes. PMID:28212378

Sequencing the extrachromosomal circular mobilome reveals retrotransposon activity in plants.

PubMed

Lanciano, Sophie; Carpentier, Marie-Christine; Llauro, Christel; Jobet, Edouard; Robakowska-Hyzorek, Dagmara; Lasserre, Eric; Ghesquière, Alain; Panaud, Olivier; Mirouze, Marie

2017-02-01

Retrotransposons are mobile genetic elements abundant in plant and animal genomes. While efficiently silenced by the epigenetic machinery, they can be reactivated upon stress or during development. Their level of transcription not reflecting their transposition ability, it is thus difficult to evaluate their contribution to the active mobilome. Here we applied a simple methodology based on the high throughput sequencing of extrachromosomal circular DNA (eccDNA) forms of active retrotransposons to characterize the repertoire of mobile retrotransposons in plants. This method successfully identified known active retrotransposons in both Arabidopsis and rice material where the epigenome is destabilized. When applying mobilome-seq to developmental stages in wild type rice, we identified PopRice as a highly active retrotransposon producing eccDNA forms in the wild type endosperm. The mobilome-seq strategy opens new routes for the characterization of a yet unexplored fraction of plant genomes.

A Locus Encoding Variable Defense Systems against Invading DNA Identified in Streptococcus suis

PubMed Central

Okura, Masatoshi; Nozawa, Takashi; Watanabe, Takayasu; Murase, Kazunori; Nakagawa, Ichiro; Takamatsu, Daisuke; Osaki, Makoto; Sekizaki, Tsutomu; Gottschalk, Marcelo; Hamada, Shigeyuki

2017-01-01

Streptococcus suis, an important zoonotic pathogen, is known to have an open pan-genome and to develop a competent state. In S. suis, limited genetic lineages are suggested to be associated with zoonosis. However, little is known about the evolution of diversified lineages and their respective phenotypic or ecological characteristics. In this study, we performed comparative genome analyses of S. suis, with a focus on the competence genes, mobile genetic elements, and genetic elements related to various defense systems against exogenous DNAs (defense elements) that are associated with gene gain/loss/exchange mediated by horizontal DNA movements and their restrictions. Our genome analyses revealed a conserved competence-inducing peptide type (pherotype) of the competence system and large-scale genome rearrangements in certain clusters based on the genome phylogeny of 58 S. suis strains. Moreover, the profiles of the defense elements were similar or identical to each other among the strains belonging to the same genomic clusters. Our findings suggest that these genetic characteristics of each cluster might exert specific effects on the phenotypic or ecological differences between the clusters. We also found certain loci that shift several types of defense elements in S. suis. Of note, one of these loci is a previously unrecognized variable region in bacteria, at which strains of distinct clusters code for different and various defense elements. This locus might represent a novel defense mechanism that has evolved through an arms race between bacteria and invading DNAs, mediated by mobile genetic elements and genetic competence. PMID:28379509

Tyrosine Recombinase Retrotransposons and Transposons.

PubMed

Poulter, Russell T M; Butler, Margi I

2015-04-01

Retrotransposons carrying tyrosine recombinases (YR) are widespread in eukaryotes. The first described tyrosine recombinase mobile element, DIRS1, is a retroelement from the slime mold Dictyostelium discoideum. The YR elements are bordered by terminal repeats related to their replication via free circular dsDNA intermediates. Site-specific recombination is believed to integrate the circle without creating duplications of the target sites. Recently a large number of YR retrotransposons have been described, including elements from fungi (mucorales and basidiomycetes), plants (green algae) and a wide range of animals including nematodes, insects, sea urchins, fish, amphibia and reptiles. YR retrotransposons can be divided into three major groups: the DIRS elements, PAT-like and the Ngaro elements. The three groups form distinct clades on phylogenetic trees based on alignments of reverse transcriptase/ribonuclease H (RT/RH) and YR sequences, and also having some structural distinctions. A group of eukaryote DNA transposons, cryptons, also carry tyrosine recombinases. These DNA transposons do not encode a reverse transcriptase. They have been detected in several pathogenic fungi and oomycetes. Sequence comparisons suggest that the crypton YRs are related to those of the YR retrotransposons. We suggest that the YR retrotransposons arose from the combination of a crypton-like YR DNA transposon and the RT/RH encoding sequence of a retrotransposon. This acquisition must have occurred at a very early point in the evolution of eukaryotes.

Recent mobility of plastid encoded group II introns and twintrons in five strains of the unicellular red alga Porphyridium

PubMed Central

Perrineau, Marie-Mathilde; Price, Dana C.; Mohr, Georg

2015-01-01

Group II introns are closely linked to eukaryote evolution because nuclear spliceosomal introns and the small RNAs associated with the spliceosome are thought to trace their ancient origins to these mobile elements. Therefore, elucidating how group II introns move, and how they lose mobility can potentially shed light on fundamental aspects of eukaryote biology. To this end, we studied five strains of the unicellular red alga Porphyridium purpureum that surprisingly contain 42 group II introns in their plastid genomes. We focused on a subset of these introns that encode mobility-conferring intron-encoded proteins (IEPs) and found them to be distributed among the strains in a lineage-specific manner. The reverse transcriptase and maturase domains were present in all lineages but the DNA endonuclease domain was deleted in vertically inherited introns, demonstrating a key step in the loss of mobility. P. purpureum plastid intron RNAs had a classic group IIB secondary structure despite variability in the DIII and DVI domains. We report for the first time the presence of twintrons (introns-within-introns, derived from the same mobile element) in Rhodophyta. The P. purpureum IEPs and their mobile introns provide a valuable model for the study of mobile retroelements in eukaryotes and offer promise for biotechnological applications. PMID:26157604

oriTfinder: a web-based tool for the identification of origin of transfers in DNA sequences of bacterial mobile genetic elements.

PubMed

Li, Xiaobin; Xie, Yingzhou; Liu, Meng; Tai, Cui; Sun, Jingyong; Deng, Zixin; Ou, Hong-Yu

2018-05-04

oriTfinder is a web server that facilitates the rapid identification of the origin of transfer site (oriT) of a conjugative plasmid or chromosome-borne integrative and conjugative element. The utilized back-end database oriTDB was built upon more than one thousand known oriT regions of bacterial mobile genetic elements (MGEs) as well as the known MGE-encoding relaxases and type IV coupling proteins (T4CP). With a combination of similarity searches for the oriTDB-archived oriT nucleotide sequences and the co-localization of the flanking relaxase homologous genes, the oriTfinder can predict the oriT region with high accuracy in the DNA sequence of a bacterial plasmid or chromosome in minutes. The server also detects the other transfer-related modules, including the potential relaxase gene, T4CP gene and the type IV secretion system gene cluster, and the putative genes coding for virulence factors and acquired antibiotic resistance determinants. oriTfinder may contribute to meeting the increasing demands of re-annotations for bacterial conjugative, mobilizable or non-transferable elements and aid in the rapid risk accession of disease-relevant trait dissemination in pathogenic bacteria of interest. oriTfinder is freely available to all users without any login requirement at http://bioinfo-mml.sjtu.edu.cn/oriTfinder.

MD simulations of papillomavirus DNA-E2 protein complexes hints at a protein structural code for DNA deformation.

PubMed

Falconi, M; Oteri, F; Eliseo, T; Cicero, D O; Desideri, A

2008-08-01

The structural dynamics of the DNA binding domains of the human papillomavirus strain 16 and the bovine papillomavirus strain 1, complexed with their DNA targets, has been investigated by modeling, molecular dynamics simulations, and nuclear magnetic resonance analysis. The simulations underline different dynamical features of the protein scaffolds and a different mechanical interaction of the two proteins with DNA. The two protein structures, although very similar, show differences in the relative mobility of secondary structure elements. Protein structural analyses, principal component analysis, and geometrical and energetic DNA analyses indicate that the two transcription factors utilize a different strategy in DNA recognition and deformation. Results show that the protein indirect DNA readout is not only addressable to the DNA molecule flexibility but it is finely tuned by the mechanical and dynamical properties of the protein scaffold involved in the interaction.

Analysis of Two Cosmid Clones from Chromosome 4 of Drosophila melanogaster Reveals Two New Genes Amid an Unusual Arrangement of Repeated Sequences

PubMed Central

Locke, John; Podemski, Lynn; Roy, Ken; Pilgrim, David; Hodgetts, Ross

1999-01-01

Chromosome 4 from Drosophila melanogaster has several unusual features that distinguish it from the other chromosomes. These include a diffuse appearance in salivary gland polytene chromosomes, an absence of recombination, and the variegated expression of P-element transgenes. As part of a larger project to understand these properties, we are assembling a physical map of this chromosome. Here we report the sequence of two cosmids representing ∼5% of the polytenized region. Both cosmid clones contain numerous repeated DNA sequences, as identified by cross hybridization with labeled genomic DNA, BLAST searches, and dot matrix analysis, which are positioned between and within the transcribed sequences. The repetitive sequences include three copies of the mobile element Hoppel, one copy of the mobile element HB, and 18 DINE repeats. DINE is a novel, short repeated sequence dispersed throughout both cosmid sequences. One cosmid includes the previously described cubitus interruptus (ci) gene and two new genes: that a gene with a predicted amino acid sequence similar to ribosomal protein S3a which is consistent with the Minute(4)101 locus thought to be in the region, and a novel member of the protein family that includes plexin and met–hepatocyte growth factor receptor. The other cosmid contains only the two short 5′-most exons from the zinc-finger-homolog-2 (zfh-2) gene. This is the first extensive sequence analysis of noncoding DNA from chromosome 4. The distribution of the various repeats suggests its organization is similar to the β-heterochromatic regions near the base of the major chromosome arms. Such a pattern may account for the diffuse banding of the polytene chromosome 4 and the variegation of many P-element transgenes on the chromosome. PMID:10022978

Occurrence of antibiotic resistance genes and mobile genetic elements in enterococci and genomic DNA during anaerobic digestion of pharmaceutical waste sludge with different pretreatments.

PubMed

Tong, Juan; Lu, XueTing; Zhang, JunYa; Sui, Qianwen; Wang, Rui; Chen, Meixue; Wei, Yuansong

2017-07-01

Pharmaceutical waste sludge harbors large amounts of antibiotic resistance genes (ARGs) and mobile genetic elements (MGEs), and it is necessary to study the reduction of ARGs and MGEs during sludge treatment. Therefore, the antibiotic resistance phenotypes and genotypes of enterococci, and the ARGs and MGEs in genomic DNA were investigated during anaerobic digestion (AD) with microwave (MW), thermal hydrolysis (TH) and ozone pretreatment. Results showed that sludge pretreatment increased the occurrence of the resistance phenotypes and genotypes of enterococci. During AD, the resistance of enterococci to macrolides decreased, except for in the MW-pretreated sludge. Horizontal gene transfer and co-occurrence of ermB and tetM in enterococci resulted in increased tetracycline resistance of enterococci throughout the sludge treatment. MGEs such as intI1, ISCR1 and Tn916/1545 had a significant effect on the distribution of ARGs. AD with pretreatment, especially TH pretreatment, resulted in greater ARGs and MGEs reduction and improved methane production. Copyright © 2017. Published by Elsevier Ltd.

Natural mutagenesis of human genomes by endogenous retrotransposons.

PubMed

Iskow, Rebecca C; McCabe, Michael T; Mills, Ryan E; Torene, Spencer; Pittard, W Stephen; Neuwald, Andrew F; Van Meir, Erwin G; Vertino, Paula M; Devine, Scott E

2010-06-25

Two abundant classes of mobile elements, namely Alu and L1 elements, continue to generate new retrotransposon insertions in human genomes. Estimates suggest that these elements have generated millions of new germline insertions in individual human genomes worldwide. Unfortunately, current technologies are not capable of detecting most of these young insertions, and the true extent of germline mutagenesis by endogenous human retrotransposons has been difficult to examine. Here, we describe technologies for detecting these young retrotransposon insertions and demonstrate that such insertions indeed are abundant in human populations. We also found that new somatic L1 insertions occur at high frequencies in human lung cancer genomes. Genome-wide analysis suggests that altered DNA methylation may be responsible for the high levels of L1 mobilization observed in these tumors. Our data indicate that transposon-mediated mutagenesis is extensive in human genomes and is likely to have a major impact on human biology and diseases.

Mobile Phone Radiation Induces Reactive Oxygen Species Production and DNA Damage in Human Spermatozoa In Vitro

PubMed Central

De Iuliis, Geoffry N.; Newey, Rhiannon J.; King, Bruce V.; Aitken, R. John

2009-01-01

Background In recent times there has been some controversy over the impact of electromagnetic radiation on human health. The significance of mobile phone radiation on male reproduction is a key element of this debate since several studies have suggested a relationship between mobile phone use and semen quality. The potential mechanisms involved have not been established, however, human spermatozoa are known to be particularly vulnerable to oxidative stress by virtue of the abundant availability of substrates for free radical attack and the lack of cytoplasmic space to accommodate antioxidant enzymes. Moreover, the induction of oxidative stress in these cells not only perturbs their capacity for fertilization but also contributes to sperm DNA damage. The latter has, in turn, been linked with poor fertility, an increased incidence of miscarriage and morbidity in the offspring, including childhood cancer. In light of these associations, we have analyzed the influence of RF-EMR on the cell biology of human spermatozoa in vitro. Principal Findings Purified human spermatozoa were exposed to radio-frequency electromagnetic radiation (RF-EMR) tuned to 1.8 GHz and covering a range of specific absorption rates (SAR) from 0.4 W/kg to 27.5 W/kg. In step with increasing SAR, motility and vitality were significantly reduced after RF-EMR exposure, while the mitochondrial generation of reactive oxygen species and DNA fragmentation were significantly elevated (P<0.001). Furthermore, we also observed highly significant relationships between SAR, the oxidative DNA damage bio-marker, 8-OH-dG, and DNA fragmentation after RF-EMR exposure. Conclusions RF-EMR in both the power density and frequency range of mobile phones enhances mitochondrial reactive oxygen species generation by human spermatozoa, decreasing the motility and vitality of these cells while stimulating DNA base adduct formation and, ultimately DNA fragmentation. These findings have clear implications for the safety of extensive mobile phone use by males of reproductive age, potentially affecting both their fertility and the health and wellbeing of their offspring. PMID:19649291

The orphan receptor hepatic nuclear factor 4 functions as a transcriptional activator for tissue-specific and hypoxia-specific erythropoietin gene expression and is antagonized by EAR3/COUP-TF1.

PubMed

Galson, D L; Tsuchiya, T; Tendler, D S; Huang, L E; Ren, Y; Ogura, T; Bunn, H F

1995-04-01

The erythropoietin (Epo) gene is regulated by hypoxia-inducible cis-acting elements in the promoter and in a 3' enhancer, both of which contain consensus hexanucleotide hormone receptor response elements which are important for function. A group of 11 orphan nuclear receptors, transcribed and translated in vitro, were screened by the electrophoretic mobility shift assay. Of these, hepatic nuclear factor 4 (HNF-4), TR2-11, ROR alpha 1, and EAR3/COUP-TF1 bound specifically to the response elements in the Epo promoter and enhancer and, except for ROR alpha 1, formed DNA-protein complexes that had mobilities similar to those observed in nuclear extracts of the Epo-producing cell line Hep3B. Moreover, both anti-HNF-4 and anti-COUP antibodies were able to supershift complexes in Hep3B nuclear extracts. Like Epo, HNF-4 is expressed in kidney, liver, and Hep3B cells but not in HeLa cells. Transfection of a plasmid expressing HNF-4 into HeLa cells enabled an eightfold increase in the hypoxic induction of a luciferase reporter construct which contains the minimal Epo enhancer and Epo promoter, provided that the nuclear hormone receptor consensus DNA elements in both the promoter and the enhancer were intact. The augmentation by HNF-4 in HeLa cells could be abrogated by cotransfection with HNF-4 delta C, which retains the DNA binding domain of HNF-4 but lacks the C-terminal activation domain. Moreover, the hypoxia-induced expression of the endogenous Epo gene was significantly inhibited in Hep3B cells stably transfected with HNF-4 delta C. On the other hand, cotransfection of EAR3/COUP-TF1 and the Epo reporter either with HNF-4 into HeLa cells or alone into Hep3B cells suppressed the hypoxia induction of the Epo reporter. These electrophoretic mobility shift assay and functional experiments indicate that HNF-4 plays a critical positive role in the tissue-specific and hypoxia-inducible expression of the Epo gene, whereas the COUP family has a negative modulatory role.

Electrophoretic mobility shift scanning using an automated infrared DNA sequencer.

PubMed

Sano, M; Ohyama, A; Takase, K; Yamamoto, M; Machida, M

2001-11-01

Electrophoretic mobility shift assay (EMSA) is widely used in the study of sequence-specific DNA-binding proteins, including transcription factors and mismatch binding proteins. We have established a non-radioisotope-based protocol for EMSA that features an automated DNA sequencer with an infrared fluorescent dye (IRDye) detection unit. Our modification of the elec- trophoresis unit, which includes cooling the gel plates with a reduced well-to-read length, has made it possible to detect shifted bands within 1 h. Further, we have developed a rapid ligation-based method for generating IRDye-labeled probes with an approximately 60% cost reduction. This method has the advantages of real-time scanning, stability of labeled probes, and better safety associated with nonradioactive methods of detection. Analysis of a promoter from an industrially important filamentous fungus, Aspergillus oryzae, in a prototype experiment revealed that the method we describe has potential for use in systematic scanning and identification of the functionally important elements to which cellular factors bind in a sequence-specific manner.

Dynamics of water around the complex structures formed between the KH domains of far upstream element binding protein and single-stranded DNA molecules

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chakraborty, Kaushik; Bandyopadhyay, Sanjoy, E-mail: sanjoy@chem.iitkgp.ernet.in

2015-07-28

Single-stranded DNA (ss-DNA) binding proteins specifically bind to the single-stranded regions of the DNA and protect it from premature annealing, thereby stabilizing the DNA structure. We have carried out atomistic molecular dynamics simulations of the aqueous solutions of two DNA binding K homology (KH) domains (KH3 and KH4) of the far upstream element binding protein complexed with two short ss-DNA segments. Attempts have been made to explore the influence of the formation of such complex structures on the microscopic dynamics and hydrogen bond properties of the interfacial water molecules. It is found that the water molecules involved in bridging themore » ss-DNA segments and the protein domains form a highly constrained thin layer with extremely retarded mobility. These water molecules play important roles in freezing the conformational oscillations of the ss-DNA oligomers and thereby forming rigid complex structures. Further, it is demonstrated that the effect of complexation on the slow long-time relaxations of hydrogen bonds at the interface is correlated with hindered motions of the surrounding water molecules. Importantly, it is observed that the highly restricted motions of the water molecules bridging the protein and the DNA components in the complexed forms originate from more frequent hydrogen bond reformations.« less

The genome biology of phytoplasma: modulators of plants and insects.

PubMed

Sugio, Akiko; Hogenhout, Saskia A

2012-06-01

Phytoplasmas are bacterial pathogens of plants that are transmitted by insects. These bacteria uniquely multiply intracellularly in both plants (Plantae) and insects (Animalia). Similarly to bacterial endosymbionts, phytoplasmas have reduced genomes with limited metabolic capabilities. Nonetheless, the chromosomes of many phytoplasmas are rich in repeated DNA consisting of mobile elements. Phytoplasmas produce an arsenal of effectors most of which are encoded on these mobile elements and on plasmids. These effectors target conserved plant transcription factors resulting in witches' broom and leafy flower symptoms and suppression of plant defense to insect vectors that transmit the phytoplasmas. Future studies of these fascinating microbes will generate a wealth of new knowledge about forces that shape genomes and microbial interactions with multicellular hosts. Copyright © 2012 Elsevier Ltd. All rights reserved.

RNAi drives nonreciprocal translocations at eroding chromosome ends to establish telomere-free linear chromosomes.

PubMed

Begnis, Martina; Apte, Manasi S; Masuda, Hirohisa; Jain, Devanshi; Wheeler, David Lee; Cooper, Julia Promisel

2018-04-01

The identification of telomerase-negative HAATI (heterochromatin amplification-mediated and telomerase-independent) cells, in which telomeres are superseded by nontelomeric heterochromatin tracts, challenged the idea that canonical telomeres are essential for chromosome linearity and raised crucial questions as to how such tracts translocate to eroding chromosome ends and confer end protection. Here we show that HAATI arises when telomere loss triggers a newly recognized illegitimate translocation pathway that requires RNAi factors. While RNAi is necessary for the translocation events that mobilize ribosomal DNA (rDNA) tracts to all chromosome ends (forming "HAATI rDNA " chromosomes), it is dispensable for HAATI rDNA maintenance. Surprisingly, Dicer (Dcr1) plays a separate, RNAi-independent role in preventing formation of the rare HAATI subtype in which a different repetitive element (the subtelomeric element) replaces telomeres. Using genetics and fusions between shelterin components and rDNA-binding proteins, we mapped the mechanism by which rDNA loci engage crucial end protection factors-despite the absence of telomere repeats-and secure end protection. Sequence analysis of HAATI rDNA genomes allowed us to propose RNA and DNA polymerase template-switching models for the mechanism of RNAi-triggered rDNA translocations. Collectively, our results reveal unforeseen roles for noncoding RNAs (ncRNAs) in assembling a telomere-free chromosome end protection device. © 2018 Begnis et al.; Published by Cold Spring Harbor Laboratory Press.

Effects of mobile phone radiation on reproduction and development in Drosophila melanogaster.

PubMed

Weisbrot, David; Lin, Hana; Ye, Lin; Blank, Martin; Goodman, Reba

2003-05-01

In this report we examined the effects of a discontinuous radio frequency (RF) signal produced by a GSM multiband mobile phone (900/1,900 MHz; SAR approximately 1.4 W/kg) on Drosophila melanogaster, during the 10-day developmental period from egg laying through pupation. As found earlier with low frequency exposures, the non-thermal radiation from the GSM mobile phone increased numbers of offspring, elevated hsp70 levels, increased serum response element (SRE) DNA-binding and induced the phosphorylation of the nuclear transcription factor, ELK-1. The rapid induction of hsp70 within minutes, by a non-thermal stress, together with identified components of signal transduction pathways, provide sensitive and reliable biomarkers that could serve as the basis for realistic mobile phone safety guidelines. Copyright 2003 Wiley-Liss, Inc.

E2F mediates induction of the Sp1-controlled promoter of the human DNA polymerase ɛ B-subunit gene POLE2

PubMed Central

Huang, Deqi; Jokela, Maarit; Tuusa, Jussi; Skog, Sven; Poikonen, Kari; Syväoja, Juhani E.

2001-01-01

The B-subunits of replicative DNA polymerases from Archaea to humans belong to the same protein family, suggesting that they share a common fundamental function. We report here the gene structure for the B-subunit of human DNA polymerase ɛ (POLE2), whose expression and transcriptional regulation is typical for replication proteins with some unique features. The 75 bp core promoter region, located within exon 1, contains an Sp1 element that is a critical determinant of promoter activity as shown by the luciferase reporter, electrophoretic mobility shift and DNase I footprinting assays. Two overlapping E2F elements adjacent to the Sp1 element are essential for full promoter activity and serum response. Binding sites for E2F1 and NF-1 reside immediately downstream from the core promoter region. Our results suggest that human POLE2 is regulated by two E2F–pocket protein complexes, one associated with Sp1 and the other with NF-1. So far, only one replicative DNA polymerase B-subunit gene promoter, POLA2 encoding the B-subunit of DNA polymerase α, has been characterized. Mitogenic activation of the POLE2 promoter by an E2F-mediated mechanism resembles that of POLA2, but the regulation of basal promoter activity is different between these two genes. PMID:11433027

Ribosomal DNA Organization Before and After Magnification in Drosophila melanogaster

PubMed Central

Bianciardi, Alessio; Boschi, Manuela; Swanson, Ellen E.; Belloni, Massimo; Robbins, Leonard G.

2012-01-01

In all eukaryotes, the ribosomal RNA genes are stably inherited redundant elements. In Drosophila melanogaster, the presence of a Ybb− chromosome in males, or the maternal presence of the Ribosomal exchange (Rex) element, induces magnification: a heritable increase of rDNA copy number. To date, several alternative classes of mechanisms have been proposed for magnification: in situ replication or extra-chromosomal replication, either of which might act on short or extended strings of rDNA units, or unequal sister chromatid exchange. To eliminate some of these hypotheses, none of which has been clearly proven, we examined molecular-variant composition and compared genetic maps of the rDNA in the bb2 mutant and in some magnified bb+ alleles. The genetic markers used are molecular-length variants of IGS sequences and of R1 and R2 mobile elements present in many 28S sequences. Direct comparison of PCR products does not reveal any particularly intensified electrophoretic bands in magnified alleles compared to the nonmagnified bb2 allele. Hence, the increase of rDNA copy number is diluted among multiple variants. We can therefore reject mechanisms of magnification based on multiple rounds of replication of short strings. Moreover, we find no changes of marker order when pre- and postmagnification maps are compared. Thus, we can further restrict the possible mechanisms to two: replication in situ of an extended string of rDNA units or unequal exchange between sister chromatids. PMID:22505623

The contribution of alu elements to mutagenic DNA double-strand break repair.

PubMed

Morales, Maria E; White, Travis B; Streva, Vincent A; DeFreece, Cecily B; Hedges, Dale J; Deininger, Prescott L

2015-03-01

Alu elements make up the largest family of human mobile elements, numbering 1.1 million copies and comprising 11% of the human genome. As a consequence of evolution and genetic drift, Alu elements of various sequence divergence exist throughout the human genome. Alu/Alu recombination has been shown to cause approximately 0.5% of new human genetic diseases and contribute to extensive genomic structural variation. To begin understanding the molecular mechanisms leading to these rearrangements in mammalian cells, we constructed Alu/Alu recombination reporter cell lines containing Alu elements ranging in sequence divergence from 0%-30% that allow detection of both Alu/Alu recombination and large non-homologous end joining (NHEJ) deletions that range from 1.0 to 1.9 kb in size. Introduction of as little as 0.7% sequence divergence between Alu elements resulted in a significant reduction in recombination, which indicates even small degrees of sequence divergence reduce the efficiency of homology-directed DNA double-strand break (DSB) repair. Further reduction in recombination was observed in a sequence divergence-dependent manner for diverged Alu/Alu recombination constructs with up to 10% sequence divergence. With greater levels of sequence divergence (15%-30%), we observed a significant increase in DSB repair due to a shift from Alu/Alu recombination to variable-length NHEJ which removes sequence between the two Alu elements. This increase in NHEJ deletions depends on the presence of Alu sequence homeology (similar but not identical sequences). Analysis of recombination products revealed that Alu/Alu recombination junctions occur more frequently in the first 100 bp of the Alu element within our reporter assay, just as they do in genomic Alu/Alu recombination events. This is the first extensive study characterizing the influence of Alu element sequence divergence on DNA repair, which will inform predictions regarding the effect of Alu element sequence divergence on both the rate and nature of DNA repair events.

In vitro selection of DNA elements highly responsive to the human T-cell lymphotropic virus type I transcriptional activator, Tax.

PubMed

Paca-Uccaralertkun, S; Zhao, L J; Adya, N; Cross, J V; Cullen, B R; Boros, I M; Giam, C Z

1994-01-01

The human T-cell lymphotropic virus type I (HTLV-I) transactivator, Tax, the ubiquitous transcriptional factor cyclic AMP (cAMP) response element-binding protein (CREB protein), and the 21-bp repeats in the HTLV-I transcriptional enhancer form a ternary nucleoprotein complex (L. J. Zhao and C. Z. Giam, Proc. Natl. Acad. Sci. USA 89:7070-7074, 1992). Using an antibody directed against the COOH-terminal region of Tax along with purified Tax and CREB proteins, we selected DNA elements bound specifically by the Tax-CREB complex in vitro. Two distinct but related groups of sequences containing the cAMP response element (CRE) flanked by long runs of G and C residues in the 5' and 3' regions, respectively, were preferentially recognized by Tax-CREB. In contrast, CREB alone binds only to CRE motifs (GNTGACG[T/C]) without neighboring G- or C-rich sequences. The Tax-CREB-selected sequences bear a striking resemblance to the 5' or 3' two-thirds of the HTLV-I 21-bp repeats and are highly inducible by Tax. Gel electrophoretic mobility shift assays, DNA transfection, and DNase I footprinting analyses indicated that the G- and C-rich sequences flanking the CRE motif are crucial for Tax-CREB-DNA ternary complex assembly and Tax transactivation but are not in direct contact with the Tax-CREB complex. These data show that Tax recruits CREB to form a multiprotein complex that specifically recognizes the viral 21-bp repeats. The expanded DNA binding specificity of Tax-CREB and the obligatory role the ternary Tax-CREB-DNA complex plays in transactivation reveal a novel mechanism for regulating the transcriptional activity of leucine zipper proteins like CREB.

Germ line insertion of mtDNA at the breakpoint junction of a reciprocal constitutional translocation.

PubMed

Willett-Brozick, J E; Savul, S A; Richey, L E; Baysal, B E

2001-08-01

Constitutional chromosomal translocations are relatively common causes of human morbidity, yet the DNA double-strand break (DSB) repair mechanisms that generate them are incompletely understood. We cloned, sequenced and analyzed the breakpoint junctions of a familial constitutional reciprocal translocation t(9;11)(p24;q23). Within the 10-kb region flanking the breakpoints, chromosome 11 had 25% repeat elements, whereas chromosome 9 had 98% repeats, 95% of which were L1-type LINE elements. The breakpoints occurred within an L1-type repeat element at 9p24 and at the 3'-end of an Alu sequence at 11q23. At the breakpoint junction of derivative chromosome 9, we discovered an unusually large 41-bp insertion, which showed 100% identity to 12S mitochondrial DNA (mtDNA) between nucleotides 896 and 936 of the mtDNA sequence. Analysis of the human genome failed to show the preexistence of the inserted sequence at normal chromosomes 9 and 11 breakpoint junctions or elsewhere in the genome, strongly suggesting that the insertion was derived from human mtDNA and captured into the junction during the DSB repair process. To our knowledge, these findings represent the first observation of spontaneous germ line insertion of modern human mtDNA sequences and suggest that DSB repair may play a role in inter-organellar gene transfer in vivo. Our findings also provide evidence for a previously unrecognized insertional mechanism in human, by which non-mobile extra-chromosomal fragments can be inserted into the genome at DSB repair junctions.

Junk DNA-Encoded Antigens in Ovarian Cancer

DTIC Science & Technology

2014-10-01

4 2. Keywords……………………………………………………………. 4 3. Accomplishments………..…………………………………………... 5 4. Impact …………………………...…………………………………… 8 5...active mobile DNAs are retrotransposons, known as ‘copy-and- paste’ transposons . These propagate through a process known as retrotransposition, which...retrotransposons; LINE, Long INterspersed Element; DNA, DNA transposon . (2) LINE-1 protein detection in human tumors. During the first year of this pilot, we

Genome expansion and gene loss in powdery mildew fungi reveal functional tradeoffs in extreme parasitism

USDA-ARS?s Scientific Manuscript database

Eukaryotic genomes vary in size over five orders of magnitude ranging from microsporidia (~2.9Mb) to the lung-fish (~1.2Tb). This extraordinary variation is largely a result of the proliferation of mobile DNA elements also referred to as “genomic parasites.” The constraints on genome size may be imp...

Living Organisms Author Their Read-Write Genomes in Evolution

PubMed Central

2017-01-01

Evolutionary variations generating phenotypic adaptations and novel taxa resulted from complex cellular activities altering genome content and expression: (i) Symbiogenetic cell mergers producing the mitochondrion-bearing ancestor of eukaryotes and chloroplast-bearing ancestors of photosynthetic eukaryotes; (ii) interspecific hybridizations and genome doublings generating new species and adaptive radiations of higher plants and animals; and, (iii) interspecific horizontal DNA transfer encoding virtually all of the cellular functions between organisms and their viruses in all domains of life. Consequently, assuming that evolutionary processes occur in isolated genomes of individual species has become an unrealistic abstraction. Adaptive variations also involved natural genetic engineering of mobile DNA elements to rewire regulatory networks. In the most highly evolved organisms, biological complexity scales with “non-coding” DNA content more closely than with protein-coding capacity. Coincidentally, we have learned how so-called “non-coding” RNAs that are rich in repetitive mobile DNA sequences are key regulators of complex phenotypes. Both biotic and abiotic ecological challenges serve as triggers for episodes of elevated genome change. The intersections of cell activities, biosphere interactions, horizontal DNA transfers, and non-random Read-Write genome modifications by natural genetic engineering provide a rich molecular and biological foundation for understanding how ecological disruptions can stimulate productive, often abrupt, evolutionary transformations. PMID:29211049

Living Organisms Author Their Read-Write Genomes in Evolution.

PubMed

Shapiro, James A

2017-12-06

Evolutionary variations generating phenotypic adaptations and novel taxa resulted from complex cellular activities altering genome content and expression: (i) Symbiogenetic cell mergers producing the mitochondrion-bearing ancestor of eukaryotes and chloroplast-bearing ancestors of photosynthetic eukaryotes; (ii) interspecific hybridizations and genome doublings generating new species and adaptive radiations of higher plants and animals; and, (iii) interspecific horizontal DNA transfer encoding virtually all of the cellular functions between organisms and their viruses in all domains of life. Consequently, assuming that evolutionary processes occur in isolated genomes of individual species has become an unrealistic abstraction. Adaptive variations also involved natural genetic engineering of mobile DNA elements to rewire regulatory networks. In the most highly evolved organisms, biological complexity scales with "non-coding" DNA content more closely than with protein-coding capacity. Coincidentally, we have learned how so-called "non-coding" RNAs that are rich in repetitive mobile DNA sequences are key regulators of complex phenotypes. Both biotic and abiotic ecological challenges serve as triggers for episodes of elevated genome change. The intersections of cell activities, biosphere interactions, horizontal DNA transfers, and non-random Read-Write genome modifications by natural genetic engineering provide a rich molecular and biological foundation for understanding how ecological disruptions can stimulate productive, often abrupt, evolutionary transformations.

Tetris Is a Foldback Transposon that Provided the Building Blocks for an Emerging Satellite DNA of Drosophila virilis

PubMed Central

Dias, Guilherme B.; Svartman, Marta; Delprat, Alejandra; Ruiz, Alfredo; Kuhn, Gustavo C.S.

2014-01-01

Transposable elements (TEs) and satellite DNAs (satDNAs) are abundant components of most eukaryotic genomes studied so far and their impact on evolution has been the focus of several studies. A number of studies linked TEs with satDNAs, but the nature of their evolutionary relationships remains unclear. During in silico analyses of the Drosophila virilis assembled genome, we found a novel DNA transposon we named Tetris based on its modular structure and diversity of rearranged forms. We aimed to characterize Tetris and investigate its role in generating satDNAs. Data mining and sequence analysis showed that Tetris is apparently nonautonomous, with a structure similar to foldback elements, and present in D. virilis and D. americana. Herein, we show that Tetris shares the final portions of its terminal inverted repeats (TIRs) with DAIBAM, a previously described miniature inverted transposable element implicated in the generation of chromosome inversions. Both elements are likely to be mobilized by the same autonomous TE. Tetris TIRs contain approximately 220-bp internal tandem repeats that we have named TIR-220. We also found TIR-220 repeats making up longer (kb-size) satDNA-like arrays. Using bioinformatic, phylogenetic and cytogenomic tools, we demonstrated that Tetris has contributed to shaping the genomes of D. virilis and D. americana, providing internal tandem repeats that served as building blocks for the amplification of satDNA arrays. The β-heterochromatic genomic environment seemed to have favored such amplification. Our results imply for the first time a role for foldback elements in generating satDNAs. PMID:24858539

Functional Characterization of the Human Mariner Transposon Hsmar2

PubMed Central

Gil, Estel; Bosch, Assumpcio; Lampe, David; Lizcano, Jose M.; Perales, Jose C.; Danos, Olivier; Chillon, Miguel

2013-01-01

DNA transposons are mobile elements with the ability to mobilize and transport genetic information between different chromosomal loci. Unfortunately, most transposons copies are currently inactivated, little is known about mariner elements in humans despite their role in the evolution of the human genome, even though the Hsmar2 transposon is associated to hotspots for homologous recombination involved in human genetic disorders as Charcot–Marie–Tooth, Prader-Willi/Angelman, and Williams syndromes. This manuscript describes the functional characterization of the human HSMAR2 transposase generated from fossil sequences and shows that the native HSMAR2 is active in human cells, but also in bacteria, with an efficiency similar to other mariner elements. We observe that the sub-cellular localization of HSMAR2 is dependent on the host cell type, and is cytotoxic when overexpressed in HeLa cells. Finally, we also demonstrate that the binding of HSMAR2 to its own ITRs is specific, and that the excision reaction leaves non-canonical footprints both in bacteria and eukaryotic cells. PMID:24039890

Staphylococcal SCCmec elements encode an active MCM-like helicase and thus may be replicative

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mir-Sanchis, Ignacio; Roman, Christina A.; Misiura, Agnieszka

2016-08-29

Methicillin-resistant Staphylococcus aureus (MRSA) is a public-health threat worldwide. Although the mobile genomic island responsible for this phenotype, staphylococcal cassette chromosome (SCC), has been thought to be nonreplicative, we predicted DNA-replication-related functions for some of the conserved proteins encoded by SCC. We show that one of these, Cch, is homologous to the self-loading initiator helicases of an unrelated family of genomic islands, that it is an active 3'-to-5' helicase and that the adjacent ORF encodes a single-stranded DNA–binding protein. Our 2.9-Å crystal structure of intact Cch shows that it forms a hexameric ring. Cch, like the archaeal and eukaryotic MCM-familymore » replicative helicases, belongs to the pre–sensor II insert clade of AAA+ ATPases. Additionally, we found that SCC elements are part of a broader family of mobile elements, all of which encode a replication initiator upstream of their recombinases. Replication after excision would enhance the efficiency of horizontal gene transfer.« less

Mavericks, a novel class of giant transposable elements widespread in eukaryotes and related to DNA viruses.

PubMed

Pritham, Ellen J; Putliwala, Tasneem; Feschotte, Cédric

2007-04-01

We previously identified a group of atypical mobile elements designated Mavericks from the nematodes Caenorhabditis elegans and C. briggsae and the zebrafish Danio rerio. Here we present the results of comprehensive database searches of the genome sequences available, which reveal that Mavericks are widespread in invertebrates and non-mammalian vertebrates but show a patchy distribution in non-animal species, being present in the fungi Glomus intraradices and Phakopsora pachyrhizi and in several single-celled eukaryotes such as the ciliate Tetrahymena thermophila, the stramenopile Phytophthora infestans and the trichomonad Trichomonas vaginalis, but not detectable in plants. This distribution, together with comparative and phylogenetic analyses of Maverick-encoded proteins, is suggestive of an ancient origin of these elements in eukaryotes followed by lineage-specific losses and/or recurrent episodes of horizontal transmission. In addition, we report that Maverick elements have amplified recently to high copy numbers in T. vaginalis where they now occupy as much as 30% of the genome. Sequence analysis confirms that most Mavericks encode a retroviral-like integrase, but lack other open reading frames typically found in retroelements. Nevertheless, the length and conservation of the target site duplication created upon Maverick insertion (5- or 6-bp) is consistent with a role of the integrase-like protein in the integration of a double-stranded DNA transposition intermediate. Mavericks also display long terminal-inverted repeats but do not contain ORFs similar to proteins encoded by DNA transposons. Instead, Mavericks encode a conserved set of 5 to 9 genes (in addition to the integrase) that are predicted to encode proteins with homology to replication and packaging proteins of some bacteriophages and diverse eukaryotic double-stranded DNA viruses, including a DNA polymerase B homolog and putative capsid proteins. Based on these and other structural similarities, we speculate that Mavericks represent an evolutionary missing link between seemingly disparate invasive DNA elements that include bacteriophages, adenoviruses and eukaryotic linear plasmids.

Selfish DNA in protein-coding genes of Rickettsia.

PubMed

Ogata, H; Audic, S; Barbe, V; Artiguenave, F; Fournier, P E; Raoult, D; Claverie, J M

2000-10-13

Rickettsia conorii, the aetiological agent of Mediterranean spotted fever, is an intracellular bacterium transmitted by ticks. Preliminary analyses of the nearly complete genome sequence of R. conorii have revealed 44 occurrences of a previously undescribed palindromic repeat (150 base pairs long) throughout the genome. Unexpectedly, this repeat was found inserted in-frame within 19 different R. conorii open reading frames likely to encode functional proteins. We found the same repeat in proteins of other Rickettsia species. The finding of a mobile element inserted in many unrelated genes suggests the potential role of selfish DNA in the creation of new protein sequences.

Spy: a new group of eukaryotic DNA transposons without target site duplications.

PubMed

Han, Min-Jin; Xu, Hong-En; Zhang, Hua-Hao; Feschotte, Cédric; Zhang, Ze

2014-06-24

Class 2 or DNA transposons populate the genomes of most eukaryotes and like other mobile genetic elements have a profound impact on genome evolution. Most DNA transposons belong to the cut-and-paste types, which are relatively simple elements characterized by terminal-inverted repeats (TIRs) flanking a single gene encoding a transposase. All eukaryotic cut-and-paste transposons so far described are also characterized by target site duplications (TSDs) of host DNA generated upon chromosomal insertion. Here, we report a new group of evolutionarily related DNA transposons called Spy, which also include TIRs and DDE motif-containing transposase but surprisingly do not create TSDs upon insertion. Instead, Spy transposons appear to transpose precisely between 5'-AAA and TTT-3' host nucleotides, without duplication or modification of the AAATTT target sites. Spy transposons were identified in the genomes of diverse invertebrate species based on transposase homology searches and structure-based approaches. Phylogenetic analyses indicate that Spy transposases are distantly related to IS5, ISL2EU, and PIF/Harbinger transposases. However, Spy transposons are distinct from these and other DNA transposon superfamilies by their lack of TSD and their target site preference. Our findings expand the known diversity of DNA transposons and reveal a new group of eukaryotic DDE transposases with unusual catalytic properties. © The Author(s) 2014. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

Regulatory motifs for CREB-binding protein and Nfe2l2 transcription factors in the upstream enhancer of the mitochondrial uncoupling protein 1 gene.

PubMed

Rim, Jong S; Kozak, Leslie P

2002-09-13

Thermogenesis against cold exposure in mammals occurs in brown adipose tissue (BAT) through mitochondrial uncoupling protein (UCP1). Expression of the Ucp1 gene is unique in brown adipocytes and is regulated tightly. The 5'-flanking region of the mouse Ucp1 gene contains cis-acting elements including PPRE, TRE, and four half-site cAMP-responsive elements (CRE) with BAT-specific enhancer elements. In the course of analyzing how these half-site CREs are involved in Ucp1 expression, we found that a DNA regulatory element for NF-E2 overlaps CRE2. Electrophoretic mobility shift assay and competition assays with the CRE2 element indicates that nuclear proteins from BAT, inguinal fat, and retroperitoneal fat tissue interact with the CRE2 motif (CGTCA) in a specific manner. A supershift assay using an antibody against the CRE-binding protein (CREB) shows specific affinity to the complex from CRE2 and nuclear extract of BAT. Additionally, Western blot analysis for phospho-CREB/ATF1 shows an increase in phosphorylation of CREB/ATF1 in HIB-1B cells after norepinephrine treatment. Transient transfection assay using luciferase reporter constructs also indicates that the two half-site CREs are involved in transcriptional regulation of Ucp1 in response to norepinephrine and cAMP. We also show that a second DNA regulatory element for NF-E2 is located upstream of the CRE2 region. This element, which is found in a similar location in the 5'-flanking region of the human and rodent Ucp1 genes, shows specific binding to rat and human NF-E2 by electrophoretic mobility shift assay with nuclear extracts from brown fat. Co-transfections with an Nfe2l2 expression vector and a luciferase reporter construct of the Ucp1 enhancer region provide additional evidence that Nfe2l2 is involved in the regulation of Ucp1 by cAMP-mediated signaling.

Mobile elements reveal small population size in the ancient ancestors of Homo sapiens.

PubMed

Huff, Chad D; Xing, Jinchuan; Rogers, Alan R; Witherspoon, David; Jorde, Lynn B

2010-02-02

The genealogies of different genetic loci vary in depth. The deeper the genealogy, the greater the chance that it will include a rare event, such as the insertion of a mobile element. Therefore, the genealogy of a region that contains a mobile element is on average older than that of the rest of the genome. In a simple demographic model, the expected time to most recent common ancestor (TMRCA) is doubled if a rare insertion is present. We test this expectation by examining single nucleotide polymorphisms around polymorphic Alu insertions from two completely sequenced human genomes. The estimated TMRCA for regions containing a polymorphic insertion is two times larger than the genomic average (P < <10(-30)), as predicted. Because genealogies that contain polymorphic mobile elements are old, they are shaped largely by the forces of ancient population history and are insensitive to recent demographic events, such as bottlenecks and expansions. Remarkably, the information in just two human DNA sequences provides substantial information about ancient human population size. By comparing the likelihood of various demographic models, we estimate that the effective population size of human ancestors living before 1.2 million years ago was 18,500, and we can reject all models where the ancient effective population size was larger than 26,000. This result implies an unusually small population for a species spread across the entire Old World, particularly in light of the effective population sizes of chimpanzees (21,000) and gorillas (25,000), which each inhabit only one part of a single continent.

Two new miniature inverted-repeat transposable elements in the genome of the clam Donax trunculus.

PubMed

Šatović, Eva; Plohl, Miroslav

2017-10-01

Repetitive sequences are important components of eukaryotic genomes that drive their evolution. Among them are different types of mobile elements that share the ability to spread throughout the genome and form interspersed repeats. To broaden the generally scarce knowledge on bivalves at the genome level, in the clam Donax trunculus we described two new non-autonomous DNA transposons, miniature inverted-repeat transposable elements (MITEs), named DTC M1 and DTC M2. Like other MITEs, they are characterized by their small size, their A + T richness, and the presence of terminal inverted repeats (TIRs). DTC M1 and DTC M2 are 261 and 286 bp long, respectively, and in addition to TIRs, both of them contain a long imperfect palindrome sequence in their central parts. These elements are present in complete and truncated versions within the genome of the clam D. trunculus. The two new MITEs share only structural similarity, but lack any nucleotide sequence similarity to each other. In a search for related elements in databases, blast search revealed within the Crassostrea gigas genome a larger element sharing sequence similarity only to DTC M1 in its TIR sequences. The lack of sequence similarity with any previously published mobile elements indicates that DTC M1 and DTC M2 elements may be unique to D. trunculus.

Transposition of the maize transposable element Ac in barley (Hordeum vulgare L.).

PubMed

Scholz, S; Lörz, H; Lütticke, S

2001-01-01

Transposition of the maize autonomous element Ac (Activator) was investigated in barley (Hordeum vulgare L.) with the aim of developing a transposon tagging system for the latter. The Ac element was introduced into meristematic tissue of barley by microprojectile bombardment. Transposon activity was then examined in the resulting transgenic plants. Multiple excision events were detected in leaf tissue of all plant lines. The mobile elements generated empty donor sites with small DNA sequence alterations, similar to those found in maize. Reintegration of Ac at independent genomic loci in somatic tissue was demonstrated by isolation of new element-flanking regions by AIMS-PCR (amplification of insertion-mutagenized sites). In addition, transmission of transposed Ac elements to progeny plants was confirmed. The results indicate that the introduced Ac element is able to transpose in barley. This is a first step towards the establishment of a transposon tagging system in this economically important crop.

Mobile genetic elements of Staphylococcus aureus.

PubMed

Malachowa, Natalia; DeLeo, Frank R

2010-09-01

Bacteria such as Staphylococcus aureus are successful as commensal organisms or pathogens in part because they adapt rapidly to selective pressures imparted by the human host. Mobile genetic elements (MGEs) play a central role in this adaptation process and are a means to transfer genetic information (DNA) among and within bacterial species. Importantly, MGEs encode putative virulence factors and molecules that confer resistance to antibiotics, including the gene that confers resistance to beta-lactam antibiotics in methicillin-resistant S. aureus (MRSA). Inasmuch as MRSA infections are a significant problem worldwide and continue to emerge in epidemic waves, there has been significant effort to improve diagnostic assays and to develop new antimicrobial agents for treatment of disease. Our understanding of S. aureus MGEs and the molecules they encode has played an important role toward these ends and has provided detailed insight into the evolution of antimicrobial resistance mechanisms and virulence.

Identification of a Recently Active Mammalian SINE Derived from Ribosomal RNA

PubMed Central

Longo, Mark S.; Brown, Judy D.; Zhang, Chu; O’Neill, Michael J.; O’Neill, Rachel J.

2015-01-01

Complex eukaryotic genomes are riddled with repeated sequences whose derivation does not coincide with phylogenetic history and thus is often unknown. Among such sequences, the capacity for transcriptional activity coupled with the adaptive use of reverse transcription can lead to a diverse group of genomic elements across taxa, otherwise known as selfish elements or mobile elements. Short interspersed nuclear elements (SINEs) are nonautonomous mobile elements found in eukaryotic genomes, typically derived from cellular RNAs such as tRNAs, 7SL or 5S rRNA. Here, we identify and characterize a previously unknown SINE derived from the 3′-end of the large ribosomal subunit (LSU or 28S rDNA) and transcribed via RNA polymerase III. This new element, SINE28, is represented in low-copy numbers in the human reference genome assembly, wherein we have identified 27 discrete loci. Phylogenetic analysis indicates these elements have been transpositionally active within primate lineages as recently as 6 MYA while modern humans still carry transcriptionally active copies. Moreover, we have identified SINE28s in all currently available assembled mammalian genome sequences. Phylogenetic comparisons indicate that these elements are frequently rederived from the highly conserved LSU rRNA sequences in a lineage-specific manner. We propose that this element has not been previously recognized as a SINE given its high identity to the canonical LSU, and that SINE28 likely represents one of possibly many unidentified, active transposable elements within mammalian genomes. PMID:25637222

Tetris is a foldback transposon that provided the building blocks for an emerging satellite DNA of Drosophila virilis.

PubMed

Dias, Guilherme B; Svartman, Marta; Delprat, Alejandra; Ruiz, Alfredo; Kuhn, Gustavo C S

2014-05-24

Transposable elements (TEs) and satellite DNAs (satDNAs) are abundant components of most eukaryotic genomes studied so far and their impact on evolution has been the focus of several studies. A number of studies linked TEs with satDNAs, but the nature of their evolutionary relationships remains unclear. During in silico analyses of the Drosophila virilis assembled genome, we found a novel DNA transposon we named Tetris based on its modular structure and diversity of rearranged forms. We aimed to characterize Tetris and investigate its role in generating satDNAs. Data mining and sequence analysis showed that Tetris is apparently nonautonomous, with a structure similar to foldback elements, and present in D. virilis and D. americana. Herein, we show that Tetris shares the final portions of its terminal inverted repeats (TIRs) with DAIBAM, a previously described miniature inverted transposable element implicated in the generation of chromosome inversions. Both elements are likely to be mobilized by the same autonomous TE. Tetris TIRs contain approximately 220-bp internal tandem repeats that we have named TIR-220. We also found TIR-220 repeats making up longer (kb-size) satDNA-like arrays. Using bioinformatic, phylogenetic and cytogenomic tools, we demonstrated that Tetris has contributed to shaping the genomes of D. virilis and D. americana, providing internal tandem repeats that served as building blocks for the amplification of satDNA arrays. The β-heterochromatic genomic environment seemed to have favored such amplification. Our results imply for the first time a role for foldback elements in generating satDNAs. © The Author(s) 2014. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

TE-Tracker: systematic identification of transposition events through whole-genome resequencing.

PubMed

Gilly, Arthur; Etcheverry, Mathilde; Madoui, Mohammed-Amin; Guy, Julie; Quadrana, Leandro; Alberti, Adriana; Martin, Antoine; Heitkam, Tony; Engelen, Stefan; Labadie, Karine; Le Pen, Jeremie; Wincker, Patrick; Colot, Vincent; Aury, Jean-Marc

2014-11-19

Transposable elements (TEs) are DNA sequences that are able to move from their location in the genome by cutting or copying themselves to another locus. As such, they are increasingly recognized as impacting all aspects of genome function. With the dramatic reduction in cost of DNA sequencing, it is now possible to resequence whole genomes in order to systematically characterize novel TE mobilization in a particular individual. However, this task is made difficult by the inherently repetitive nature of TE sequences, which in some eukaryotes compose over half of the genome sequence. Currently, only a few software tools dedicated to the detection of TE mobilization using next-generation-sequencing are described in the literature. They often target specific TEs for which annotation is available, and are only able to identify families of closely related TEs, rather than individual elements. We present TE-Tracker, a general and accurate computational method for the de-novo detection of germ line TE mobilization from re-sequenced genomes, as well as the identification of both their source and destination sequences. We compare our method with the two classes of existing software: specialized TE-detection tools and generic structural variant (SV) detection tools. We show that TE-Tracker, while working independently of any prior annotation, bridges the gap between these two approaches in terms of detection power. Indeed, its positive predictive value (PPV) is comparable to that of dedicated TE software while its sensitivity is typical of a generic SV detection tool. TE-Tracker demonstrates the benefit of adopting an annotation-independent, de novo approach for the detection of TE mobilization events. We use TE-Tracker to provide a comprehensive view of transposition events induced by loss of DNA methylation in Arabidopsis. TE-Tracker is freely available at http://www.genoscope.cns.fr/TE-Tracker . We show that TE-Tracker accurately detects both the source and destination of novel transposition events in re-sequenced genomes. Moreover, TE-Tracker is able to detect all potential donor sequences for a given insertion, and can identify the correct one among them. Furthermore, TE-Tracker produces significantly fewer false positives than common SV detection programs, thus greatly facilitating the detection and analysis of TE mobilization events.

Bacterial Genome Instability

PubMed Central

Darmon, Elise

2014-01-01

SUMMARY Bacterial genomes are remarkably stable from one generation to the next but are plastic on an evolutionary time scale, substantially shaped by horizontal gene transfer, genome rearrangement, and the activities of mobile DNA elements. This implies the existence of a delicate balance between the maintenance of genome stability and the tolerance of genome instability. In this review, we describe the specialized genetic elements and the endogenous processes that contribute to genome instability. We then discuss the consequences of genome instability at the physiological level, where cells have harnessed instability to mediate phase and antigenic variation, and at the evolutionary level, where horizontal gene transfer has played an important role. Indeed, this ability to share DNA sequences has played a major part in the evolution of life on Earth. The evolutionary plasticity of bacterial genomes, coupled with the vast numbers of bacteria on the planet, substantially limits our ability to control disease. PMID:24600039

Intramolecular transposition by a synthetic IS50 (Tn5) derivative

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tomcsanyi, T.; Phadnis, S.H.; Berg, D.E.

1990-11-01

We report the formation of deletions and inversions by intramolecular transposition of Tn5-derived mobile elements. The synthetic transposons used contained the IS50 O and I end segments and the transposase gene, a contraselectable gene encoding sucrose sensitivity (sacB), antibiotic resistance genes, and a plasmid replication origin. Both deletions and inversions were associated with loss of a 300-bp segment that is designated the vector because it is outside of the transposon. Deletions were severalfold more frequent than inversions, perhaps reflecting constraints on DNA twisting or abortive transposition. Restriction and DNA sequence analyses showed that both types of rearrangements extended from onemore » transposon end to many different sites in target DNA. In the case of inversions, transposition generated 9-bp direct repeats of target sequences.« less

The Influence of LINE-1 and SINE Retrotransposons on Mammalian Genomes.

PubMed

Richardson, Sandra R; Doucet, Aurélien J; Kopera, Huira C; Moldovan, John B; Garcia-Perez, José Luis; Moran, John V

2015-04-01

Transposable elements have had a profound impact on the structure and function of mammalian genomes. The retrotransposon Long INterspersed Element-1 (LINE-1 or L1), by virtue of its replicative mobilization mechanism, comprises ∼17% of the human genome. Although the vast majority of human LINE-1 sequences are inactive molecular fossils, an estimated 80-100 copies per individual retain the ability to mobilize by a process termed retrotransposition. Indeed, LINE-1 is the only active, autonomous retrotransposon in humans and its retrotransposition continues to generate both intra-individual and inter-individual genetic diversity. Here, we briefly review the types of transposable elements that reside in mammalian genomes. We will focus our discussion on LINE-1 retrotransposons and the non-autonomous Short INterspersed Elements (SINEs) that rely on the proteins encoded by LINE-1 for their mobilization. We review cases where LINE-1-mediated retrotransposition events have resulted in genetic disease and discuss how the characterization of these mutagenic insertions led to the identification of retrotransposition-competent LINE-1s in the human and mouse genomes. We then discuss how the integration of molecular genetic, biochemical, and modern genomic technologies have yielded insight into the mechanism of LINE-1 retrotransposition, the impact of LINE-1-mediated retrotransposition events on mammalian genomes, and the host cellular mechanisms that protect the genome from unabated LINE-1-mediated retrotransposition events. Throughout this review, we highlight unanswered questions in LINE-1 biology that provide exciting opportunities for future research. Clearly, much has been learned about LINE-1 and SINE biology since the publication of Mobile DNA II thirteen years ago. Future studies should continue to yield exciting discoveries about how these retrotransposons contribute to genetic diversity in mammalian genomes.

Structural, functional and evolutionary relationships between homing endonucleases and proteins from their host organisms

PubMed Central

Taylor, Gregory K.; Stoddard, Barry L.

2012-01-01

Homing endonucleases (HEs) are highly specific DNA-cleaving enzymes that are encoded by invasive DNA elements (usually mobile introns or inteins) within the genomes of phage, bacteria, archea, protista and eukaryotic organelles. Six unique structural HE families, that collectively span four distinct nuclease catalytic motifs, have been characterized to date. Members of each family display structural homology and functional relationships to a wide variety of proteins from various organisms. The biological functions of those proteins are highly disparate and include non-specific DNA-degradation enzymes, restriction endonucleases, DNA-repair enzymes, resolvases, intron splicing factors and transcription factors. These relationships suggest that modern day HEs share common ancestors with proteins involved in genome fidelity, maintenance and gene expression. This review summarizes the results of structural studies of HEs and corresponding proteins from host organisms that have illustrated the manner in which these factors are related. PMID:22406833

Extensive Mobilome-Driven Genome Diversification in Mouse Gut-Associated Bacteroides vulgatus mpk

PubMed Central

Lange, Anna; Beier, Sina; Steimle, Alex; Autenrieth, Ingo B.; Huson, Daniel H.; Frick, Julia-Stefanie

2016-01-01

Like many other Bacteroides species, Bacteroides vulgatus strain mpk, a mouse fecal isolate which was shown to promote intestinal homeostasis, utilizes a variety of mobile elements for genome evolution. Based on sequences collected by Pacific Biosciences SMRT sequencing technology, we discuss the challenges of assembling and studying a bacterial genome of high plasticity. Additionally, we conducted comparative genomics comparing this commensal strain with the B. vulgatus type strain ATCC 8482 as well as multiple other Bacteroides and Parabacteroides strains to reveal the most important differences and identify the unique features of B. vulgatus mpk. The genome of B. vulgatus mpk harbors a large and diverse set of mobile element proteins compared with other sequenced Bacteroides strains. We found evidence of a number of different horizontal gene transfer events and a genome landscape that has been extensively altered by different mobilization events. A CRISPR/Cas system could be identified that provides a possible mechanism for preventing the integration of invading external DNA. We propose that the high genome plasticity and the introduced genome instabilities of B. vulgatus mpk arising from the various mobilization events might play an important role not only in its adaptation to the challenging intestinal environment in general, but also in its ability to interact with the gut microbiota. PMID:27071651

Exposure to non-ionizing electromagnetic fields emitted from mobile phones induced DNA damage in human ear canal hair follicle cells.

PubMed

Akdag, Mehmet; Dasdag, Suleyman; Canturk, Fazile; Akdag, Mehmet Zulkuf

2018-01-01

The aim of this study was to investigate effect of radiofrequency radiation (RFR) emitted from mobile phones on DNA damage in follicle cells of hair in the ear canal. The study was carried out on 56 men (age range: 30-60 years old)in four treatment groups with n = 14 in each group. The groups were defined as follows: people who did not use a mobile phone (Control), people use mobile phones for 0-30 min/day (second group), people use mobile phones for 30-60 min/day (third group) and people use mobile phones for more than 60 min/day (fourth group). Ear canal hair follicle cells taken from the subjects were analyzed by the Comet Assay to determine DNA damages. The Comet Assay parameters measured were head length, tail length, comet length, percentage of head DNA, tail DNA percentage, tail moment, and Olive tail moment. Results of the study showed that DNA damage indicators were higher in the RFR exposure groups than in the control subjects. In addition, DNA damage increased with the daily duration of exposure. In conclusion, RFR emitted from mobile phones has a potential to produce DNA damage in follicle cells of hair in the ear canal. Therefore, mobile phone users have to pay more attention when using wireless phones.

The annotation of repetitive elements in the genome of channel catfish (Ictalurus punctatus).

PubMed

Yuan, Zihao; Zhou, Tao; Bao, Lisui; Liu, Shikai; Shi, Huitong; Yang, Yujia; Gao, Dongya; Dunham, Rex; Waldbieser, Geoff; Liu, Zhanjiang

2018-01-01

Channel catfish (Ictalurus punctatus) is a highly adaptive species and has been used as a research model for comparative immunology, physiology, and toxicology among ectothermic vertebrates. It is also economically important for aquaculture. As such, its reference genome was generated and annotated with protein coding genes. However, the repetitive elements in the catfish genome are less well understood. In this study, over 417.8 Megabase (MB) of repetitive elements were identified and characterized in the channel catfish genome. Among them, the DNA/TcMar-Tc1 transposons are the most abundant type, making up ~20% of the total repetitive elements, followed by the microsatellites (14%). The prevalence of repetitive elements, especially the mobile elements, may have provided a driving force for the evolution of the catfish genome. A number of catfish-specific repetitive elements were identified including the previously reported Xba elements whose divergence rate was relatively low, slower than that in untranslated regions of genes but faster than the protein coding sequences, suggesting its evolutionary restrictions.

The annotation of repetitive elements in the genome of channel catfish (Ictalurus punctatus)

PubMed Central

Yuan, Zihao; Zhou, Tao; Bao, Lisui; Liu, Shikai; Shi, Huitong; Yang, Yujia; Gao, Dongya; Dunham, Rex; Waldbieser, Geoff

2018-01-01

Channel catfish (Ictalurus punctatus) is a highly adaptive species and has been used as a research model for comparative immunology, physiology, and toxicology among ectothermic vertebrates. It is also economically important for aquaculture. As such, its reference genome was generated and annotated with protein coding genes. However, the repetitive elements in the catfish genome are less well understood. In this study, over 417.8 Megabase (MB) of repetitive elements were identified and characterized in the channel catfish genome. Among them, the DNA/TcMar-Tc1 transposons are the most abundant type, making up ~20% of the total repetitive elements, followed by the microsatellites (14%). The prevalence of repetitive elements, especially the mobile elements, may have provided a driving force for the evolution of the catfish genome. A number of catfish-specific repetitive elements were identified including the previously reported Xba elements whose divergence rate was relatively low, slower than that in untranslated regions of genes but faster than the protein coding sequences, suggesting its evolutionary restrictions. PMID:29763462

Repetitive DNA in the pea (Pisum sativum L.) genome: comprehensive characterization using 454 sequencing and comparison to soybean and Medicago truncatula

PubMed Central

Macas, Jiří; Neumann, Pavel; Navrátilová, Alice

2007-01-01

Background Extraordinary size variation of higher plant nuclear genomes is in large part caused by differences in accumulation of repetitive DNA. This makes repetitive DNA of great interest for studying the molecular mechanisms shaping architecture and function of complex plant genomes. However, due to methodological constraints of conventional cloning and sequencing, a global description of repeat composition is available for only a very limited number of higher plants. In order to provide further data required for investigating evolutionary patterns of repeated DNA within and between species, we used a novel approach based on massive parallel sequencing which allowed a comprehensive repeat characterization in our model species, garden pea (Pisum sativum). Results Analysis of 33.3 Mb sequence data resulted in quantification and partial sequence reconstruction of major repeat families occurring in the pea genome with at least thousands of copies. Our results showed that the pea genome is dominated by LTR-retrotransposons, estimated at 140,000 copies/1C. Ty3/gypsy elements are less diverse and accumulated to higher copy numbers than Ty1/copia. This is in part due to a large population of Ogre-like retrotransposons which alone make up over 20% of the genome. In addition to numerous types of mobile elements, we have discovered a set of novel satellite repeats and two additional variants of telomeric sequences. Comparative genome analysis revealed that there are only a few repeat sequences conserved between pea and soybean genomes. On the other hand, all major families of pea mobile elements are well represented in M. truncatula. Conclusion We have demonstrated that even in a species with a relatively large genome like pea, where a single 454-sequencing run provided only 0.77% coverage, the generated sequences were sufficient to reconstruct and analyze major repeat families corresponding to a total of 35–48% of the genome. These data provide a starting point for further investigations of legume plant genomes based on their global comparative analysis and for the development of more sophisticated approaches for data mining. PMID:18031571

The impact of horizontal gene transfer on the biology of Clostridium difficile.

PubMed

Roberts, Adam P; Allan, Elaine; Mullany, Peter

2014-01-01

Clostridium difficile infection (CDI) is now recognised as the main cause of healthcare associated diarrhoea. Over the recent years there has been a change in the epidemiology of CDI with certain related strains dominating infection. These strains have been termed hyper-virulent and have successfully spread across the globe. Many C. difficile strains have had their genomes completely sequenced allowing researchers to build up a very detailed picture of the contribution of horizontal gene transfer to the adaptive potential, through the acquisition of mobile DNA, of this organism. Here, we review and discuss the contribution of mobile genetic elements to the biology of this clinically important pathogen. © 2014 Elsevier Ltd All rights reserved.

Functional Role of Extranucleosomal DNA and the Entry Site of the Nucleosome in Chromatin Remodeling by ISW2

PubMed Central

Zofall, Martin; Persinger, Jim; Bartholomew, Blaine

2004-01-01

A minimal amount of extranucleosomal DNA was required for nucleosome mobilization by ISW2 as shown by using a photochemical histone mapping approach to analyze nucleosome movement on a set of nucleosomes with varied lengths of extranucleosomal DNA. ISW2 was ineffective in repositioning or mobilizing nucleosomes with ≤20 bp of extranucleosomal DNA. In addition, ISW2 was able to slide nucleosomes to within only 10 to 13 bp of the edge of DNA fragments. The nucleosome mobilization was promoted by extranucleosomal single-stranded DNA with modest strand preference. Gaps (10 bp) just inside the nucleosome and in the extranucleosomal DNA showed that the transfer of torsional strain (twist) into the nucleosomal DNA region was not required for mobilizing nucleosomes. However, indications are that the extranucleosomal DNA immediately adjacent to the nucleosome has an important role in the initial stage of nucleosome movement by ISW2. PMID:15509805

[Blocking 1800 MHz mobile phone radiation-induced reactive oxygen species production and DNA damage in lens epithelial cells by noise magnetic fields].

PubMed

Wu, Wei; Yao, Ke; Wang, Kai-jun; Lu, De-qiang; He, Ji-liang; Xu, Li-hong; Sun, Wen-jun

2008-01-01

To investigate whether the exposure to the electromagnetic noise can block reactive oxygen species (ROS) production and DNA damage of lens epithelial cells induced by 1800 MHz mobile phone radiation. The DCFH-DA method and comet assay were used respectively to detect the intracellular ROS and DNA damage of cultured human lens epithelial cells induced by 4 W/kg 1800 MHz mobile phone radiation or/and 2 muT electromagnetic noise for 24 h intermittently. 1800 MHz mobile phone radiation at 4 W/kg for 24 h increased intracellular ROS and DNA damage significantly (P<0.05). However, the ROS level and DNA damage of mobile phone radiation plus noise group were not significant enhanced (P>0.05) as compared to sham exposure group. Electromagnetic noise can block intracellular ROS production and DNA damage of human lens epithelial cells induced by 1800 MHz mobile phone radiation.

The Nucleotide Excision Repair Pathway Limits L1 Retrotransposition

PubMed Central

Servant, Geraldine; Streva, Vincent A.; Derbes, Rebecca S.; Wijetunge, Madushani I.; Neeland, Marc; White, Travis B.; Belancio, Victoria P.; Roy-Engel, Astrid M.; Deininger, Prescott L.

2017-01-01

Long interspersed elements 1 (L1) are active mobile elements that constitute almost 17% of the human genome. They amplify through a “copy-and-paste” mechanism termed retrotransposition, and de novo insertions related to these elements have been reported to cause 0.2% of genetic diseases. Our previous data demonstrated that the endonuclease complex ERCC1-XPF, which cleaves a 3′ DNA flap structure, limits L1 retrotransposition. Although the ERCC1-XPF endonuclease participates in several different DNA repair pathways, such as single-strand annealing, or in telomere maintenance, its recruitment to DNA lesions is best characterized in the nucleotide excision repair (NER) pathway. To determine if the NER pathway prevents the insertion of retroelements in the genome, we monitored the retrotransposition efficiencies of engineered L1 elements in NER-deficient cells and in their complemented versions. Core proteins of the NER pathway, XPD and XPA, and the lesion binding protein, XPC, are involved in limiting L1 retrotransposition. In addition, sequence analysis of recovered de novo L1 inserts and their genomic locations in NER-deficient cells demonstrated the presence of abnormally large duplications at the site of insertion, suggesting that NER proteins may also play a role in the normal L1 insertion process. Here, we propose new functions for the NER pathway in the maintenance of genome integrity: limitation of insertional mutations caused by retrotransposons and the prevention of potentially mutagenic large genomic duplications at the site of retrotransposon insertion events. PMID:28049704

Reduced Mutation Rate and Increased Transformability of Transposon-Free Acinetobacter baylyi ADP1-ISx

PubMed Central

Suárez, Gabriel A.; Renda, Brian A.; Dasgupta, Aurko

2017-01-01

ABSTRACT The genomes of most bacteria contain mobile DNA elements that can contribute to undesirable genetic instability in engineered cells. In particular, transposable insertion sequence (IS) elements can rapidly inactivate genes that are important for a designed function. We deleted all six copies of IS1236 from the genome of the naturally transformable bacterium Acinetobacter baylyi ADP1. The natural competence of ADP1 made it possible to rapidly repair deleterious point mutations that arose during strain construction. In the resulting ADP1-ISx strain, the rates of mutations inactivating a reporter gene were reduced by 7- to 21-fold. This reduction was higher than expected from the incidence of new IS1236 insertions found during a 300-day mutation accumulation experiment with wild-type ADP1 that was used to estimate spontaneous mutation rates in the strain. The extra improvement appears to be due in part to eliminating large deletions caused by IS1236 activity, as the point mutation rate was unchanged in ADP1-ISx. Deletion of an error-prone polymerase (dinP) and a DNA damage response regulator (umuDAb [the umuD gene of A. baylyi]) from the ADP1-ISx genome did not further reduce mutation rates. Surprisingly, ADP1-ISx exhibited increased transformability. This improvement may be due to less autolysis and aggregation of the engineered cells than of the wild type. Thus, deleting IS elements from the ADP1 genome led to a greater than expected increase in evolutionary reliability and unexpectedly enhanced other key strain properties, as has been observed for other clean-genome bacterial strains. ADP1-ISx is an improved chassis for metabolic engineering and other applications. IMPORTANCE Acinetobacter baylyi ADP1 has been proposed as a next-generation bacterial host for synthetic biology and genome engineering due to its ability to efficiently take up DNA from its environment during normal growth. We deleted transposable elements that are capable of copying themselves, inserting into other genes, and thereby inactivating them from the ADP1 genome. The resulting “clean-genome” ADP1-ISx strain exhibited larger reductions in the rates of inactivating mutations than expected from spontaneous mutation rates measured via whole-genome sequencing of lineages evolved under relaxed selection. Surprisingly, we also found that IS element activity reduces transformability and is a major cause of cell aggregation and death in wild-type ADP1 grown under normal laboratory conditions. More generally, our results demonstrate that domesticating a bacterial genome by removing mobile DNA elements that have accumulated during evolution in the wild can have unanticipated benefits. PMID:28667117

Reduced Mutation Rate and Increased Transformability of Transposon-Free Acinetobacter baylyi ADP1-ISx.

PubMed

Suárez, Gabriel A; Renda, Brian A; Dasgupta, Aurko; Barrick, Jeffrey E

2017-09-01

The genomes of most bacteria contain mobile DNA elements that can contribute to undesirable genetic instability in engineered cells. In particular, transposable insertion sequence (IS) elements can rapidly inactivate genes that are important for a designed function. We deleted all six copies of IS 1236 from the genome of the naturally transformable bacterium Acinetobacter baylyi ADP1. The natural competence of ADP1 made it possible to rapidly repair deleterious point mutations that arose during strain construction. In the resulting ADP1-ISx strain, the rates of mutations inactivating a reporter gene were reduced by 7- to 21-fold. This reduction was higher than expected from the incidence of new IS 1236 insertions found during a 300-day mutation accumulation experiment with wild-type ADP1 that was used to estimate spontaneous mutation rates in the strain. The extra improvement appears to be due in part to eliminating large deletions caused by IS 1236 activity, as the point mutation rate was unchanged in ADP1-ISx. Deletion of an error-prone polymerase ( dinP ) and a DNA damage response regulator ( umuD Ab [the umuD gene of A. baylyi ]) from the ADP1-ISx genome did not further reduce mutation rates. Surprisingly, ADP1-ISx exhibited increased transformability. This improvement may be due to less autolysis and aggregation of the engineered cells than of the wild type. Thus, deleting IS elements from the ADP1 genome led to a greater than expected increase in evolutionary reliability and unexpectedly enhanced other key strain properties, as has been observed for other clean-genome bacterial strains. ADP1-ISx is an improved chassis for metabolic engineering and other applications. IMPORTANCE Acinetobacter baylyi ADP1 has been proposed as a next-generation bacterial host for synthetic biology and genome engineering due to its ability to efficiently take up DNA from its environment during normal growth. We deleted transposable elements that are capable of copying themselves, inserting into other genes, and thereby inactivating them from the ADP1 genome. The resulting "clean-genome" ADP1-ISx strain exhibited larger reductions in the rates of inactivating mutations than expected from spontaneous mutation rates measured via whole-genome sequencing of lineages evolved under relaxed selection. Surprisingly, we also found that IS element activity reduces transformability and is a major cause of cell aggregation and death in wild-type ADP1 grown under normal laboratory conditions. More generally, our results demonstrate that domesticating a bacterial genome by removing mobile DNA elements that have accumulated during evolution in the wild can have unanticipated benefits. Copyright © 2017 American Society for Microbiology.

A genomic island integrated into recA of Vibrio cholerae contains a divergent recA and provides multi-pathway protection from DNA damage.

PubMed

Rapa, Rita A; Islam, Atiqul; Monahan, Leigh G; Mutreja, Ankur; Thomson, Nicholas; Charles, Ian G; Stokes, Harold W; Labbate, Maurizio

2015-04-01

Lateral gene transfer (LGT) has been crucial in the evolution of the cholera pathogen, Vibrio cholerae. The two major virulence factors are present on two different mobile genetic elements, a bacteriophage containing the cholera toxin genes and a genomic island (GI) containing the intestinal adhesin genes. Non-toxigenic V. cholerae in the aquatic environment are a major source of novel DNA that allows the pathogen to morph via LGT. In this study, we report a novel GI from a non-toxigenic V. cholerae strain containing multiple genes involved in DNA repair including the recombination repair gene recA that is 23% divergent from the indigenous recA and genes involved in the translesion synthesis pathway. This is the first report of a GI containing the critical gene recA and the first report of a GI that targets insertion into a specific site within recA. We show that possession of the island in Escherichia coli is protective against DNA damage induced by UV-irradiation and DNA targeting antibiotics. This study highlights the importance of genetic elements such as GIs in the evolution of V. cholerae and emphasizes the importance of environmental strains as a source of novel DNA that can influence the pathogenicity of toxigenic strains. © 2014 The Authors. Environmental Microbiology published by Society for Applied Microbiology and John Wiley & Sons Ltd.

Clustered regularly interspaced short palindromic repeats (CRISPRs): the hallmark of an ingenious antiviral defense mechanism in prokaryotes.

PubMed

Al-Attar, Sinan; Westra, Edze R; van der Oost, John; Brouns, Stan J J

2011-04-01

Many prokaryotes contain the recently discovered defense system against mobile genetic elements. This defense system contains a unique type of repetitive DNA stretches, termed Clustered Regularly Interspaced Short Palindromic Repeats (CRISPRs). CRISPRs consist of identical repeated DNA sequences (repeats), interspaced by highly variable sequences referred to as spacers. The spacers originate from either phages or plasmids and comprise the prokaryotes' 'immunological memory'. CRISPR-associated (cas) genes encode conserved proteins that together with CRISPRs make-up the CRISPR/Cas system, responsible for defending the prokaryotic cell against invaders. CRISPR-mediated resistance has been proposed to involve three stages: (i) CRISPR-Adaptation, the invader DNA is encountered by the CRISPR/Cas machinery and an invader-derived short DNA fragment is incorporated in the CRISPR array. (ii) CRISPR-Expression, the CRISPR array is transcribed and the transcript is processed by Cas proteins. (iii) CRISPR-Interference, the invaders' nucleic acid is recognized by complementarity to the crRNA and neutralized. An application of the CRISPR/Cas system is the immunization of industry-relevant prokaryotes (or eukaryotes) against mobile-genetic invasion. In addition, the high variability of the CRISPR spacer content can be exploited for phylogenetic and evolutionary studies. Despite impressive progress during the last couple of years, the elucidation of several fundamental details will be a major challenge in future research.

Triple helix-forming oligonucleotide corresponding to the polypyrimidine sequence in the rat alpha 1(I) collagen promoter specifically inhibits factor binding and transcription.

PubMed

Kovacs, A; Kandala, J C; Weber, K T; Guntaka, R V

1996-01-19

Type I and III fibrillar collagens are the major structural proteins of the extracellular matrix found in various organs including the myocardium. Abnormal and progressive accumulation of fibrillar type I collagen in the interstitial spaces compromises organ function and therefore, the study of transcriptional regulation of this gene and specific targeting of its expression is of major interest. Transient transfection of adult cardiac fibroblasts indicate that the polypurine-polypyrimidine sequence of alpha 1(I) collagen promoter between nucleotides - 200 and -140 represents an overall positive regulatory element. DNase I footprinting and electrophoretic mobility shift assays suggest that multiple factors bind to different elements of this promoter region. We further demonstrate that the unique polypyrimidine sequence between -172 and -138 of the promoter represents a suitable target for a single-stranded polypurine oligonucleotide (TFO) to form a triple helix DNA structure. Modified electrophoretic mobility shift assays show that this TFO specifically inhibits the protein-DNA interaction within the target region. In vitro transcription assays and transient transfection experiments demonstrate that the transcriptional activity of the promoter is inhibited by this oligonucleotide. We propose that TFOs represent a therapeutic potential to specifically influence the expression of alpha 1(I) collagen gene in various disease states where abnormal type I collagen accumulation is known to occur.

Evolution of Sphingomonad Gene Clusters Related to Pesticide Catabolism Revealed by Genome Sequence and Mobilomics of Sphingobium herbicidovorans MH

PubMed Central

Nielsen, Tue Kjærgaard; Rasmussen, Morten; Demanèche, Sandrine; Cecillon, Sébastien; Vogel, Timothy M.

2017-01-01

Abstract Bacterial degraders of chlorophenoxy herbicides have been isolated from various ecosystems, including pristine environments. Among these degraders, the sphingomonads constitute a prominent group that displays versatile xenobiotic-degradation capabilities. Four separate sequencing strategies were required to provide the complete sequence of the complex and plastic genome of the canonical chlorophenoxy herbicide-degrading Sphingobium herbicidovorans MH. The genome has an intricate organization of the chlorophenoxy-herbicide catabolic genes sdpA, rdpA, and cadABCD that encode the (R)- and (S)-enantiomer-specific 2,4-dichlorophenoxypropionate dioxygenases and four subunits of a Rieske non-heme iron oxygenase involved in 2-methyl-chlorophenoxyacetic acid degradation, respectively. Several major genomic rearrangements are proposed to help understand the evolution and mobility of these important genes and their genetic context. Single-strain mobilomic sequence analysis uncovered plasmids and insertion sequence-associated circular intermediates in this environmentally important bacterium and enabled the description of evolutionary models for pesticide degradation in strain MH and related organisms. The mobilome presented a complex mosaic of mobile genetic elements including four plasmids and several circular intermediate DNA molecules of insertion-sequence elements and transposons that are central to the evolution of xenobiotics degradation. Furthermore, two individual chromosomally integrated prophages were shown to excise and form free circular DNA molecules. This approach holds great potential for improving the understanding of genome plasticity, evolution, and microbial ecology. PMID:28961970

Recognition of the CDEI motif GTCACATG by mouse nuclear proteins and interference with the early development of the mouse embryo.

PubMed Central

Blangy, A; Léopold, P; Vidal, F; Rassoulzadegan, M; Cuzin, F

1991-01-01

We have reported previously (1) two unexpected consequences of the microinjection into fertilized mouse eggs of a recombinant plasmid designated p12B1, carrying a 343 bp insert of non-repetitive mouse DNA. Injected at very low concentrations, this plasmid could be established as an extrachromosomal genetic element. When injected in greater concentration, an early arrest of embryonic development resulted. In the present work, we have studied this toxic effect in more detail by microinjecting short synthetic oligonucleotides with sequences from the mouse insert. Lethality was associated with the nucleotide sequence GTCACATG, identical with the CDEl element of yeast centromeres. Development of injected embryos was arrested between the one-cell and the early morula stages, with abnormal structures and DNA contents. Electrophoretic mobility shift and DNAse foot-printing assays demonstrated the binding of mouse nuclear protein(s) to the CDEl-like box. Base changes within the CDEl sequence prevented both the toxic effects in embryos and the formation of protein complex in vitro, suggesting that protein binding at such sites in chromosomal DNA plays an important role in early development. Images PMID:1766880

Prespacer processing and specific integration in a Type I-A CRISPR system

PubMed Central

Rollie, Clare; Graham, Shirley; Rouillon, Christophe

2018-01-01

Abstract The CRISPR–Cas system for prokaryotic adaptive immunity provides RNA-mediated protection from viruses and mobile genetic elements. Adaptation is dependent on the Cas1 and Cas2 proteins along with varying accessory proteins. Here we analyse the process in Sulfolobus solfataricus, showing that while Cas1 and Cas2 catalyze spacer integration in vitro, host factors are required for specificity. Specific integration also requires at least 400 bp of the leader sequence, and is dependent on the presence of hydrolysable ATP, suggestive of an active process that may involve DNA remodelling. Specific spacer integration is associated with processing of prespacer 3′ ends in a PAM-dependent manner. This is reflected in PAM-dependent processing of prespacer 3′ ends in vitro in the presence of cell lysate or the Cas4 nuclease, in a reaction consistent with PAM-directed binding and protection of prespacer DNA. These results highlight the diverse interplay between CRISPR–Cas elements and host proteins across CRISPR types. PMID:29228332

A major insertion accounts for a significant proportion of mutations underlying human lipoprotein lipase deficiency

DOE Office of Scientific and Technical Information (OSTI.GOV)

Langlois, S.; Kastelein, J.J.; Hayden, M.R.

1989-02-01

Lipoprotein lipase is an important enzyme involved in triacylglycerol metabolism. Primary LPL deficiency is a genetic disorder that is usually manifested by a severe elevation in triacylglycerol levels. The authors have used a recently isolated LPL cDNA clone to study 15 probands from 11 families with this inherited disorder. Surprisingly, 7 of the probands from 4 families, of different ancestries, had a similar insertion in their LPL gene. In contrast to other human genetic disorders, where insertions are rare causes of mutation, this insertion accounts for a significant proportion of the alleles causing LPL deficiency. Detailed restriction mapping of themore » insertion revealed that it was unlikely to be a duplication of neighboring DNA and that it was not similar to the consensus sequence of human L1 repetitive elements. This suggests that there must be other mechanisms of insertional mutagenesis in human genetic disease besides transposition of mobile L1 repetitive elements.« less

The Alarmin Properties of DNA and DNA-associated Nuclear Proteins.

PubMed

Magna, Melinda; Pisetsky, David S

2016-05-01

The communication of cell injury and death is a critical element in host defense. Although immune cells can serve this function by elaborating cytokines and chemokines, somatic cells can repurpose nuclear macromolecules to function as damage-associated molecular patterns (DAMPs) or alarmins to exert similar activity. Among these molecules, DNA, high-mobility group box-1, and histone proteins can all act as DAMPs once they are in an extracellular location. This review describes current information on the role of the nuclear DAMPs, their translocation to the outside of cells, and pathways of activation after uptake into the inside of immune cells. MEDLINE and PubMed databases were searched for citations (1990-2016) in English related to the following terms: DAMPs, high-mobility group box-1, DNA, histones, cell death, danger, and immune activation. Selected articles with the most relevant studies were included for a more detailed consideration. Although nuclear molecules have important structural and genetic regulatory roles inside the cell nucleus, when released into the extracellular space during cell death, these molecules can acquire immune activity and serve as alarmins or DAMPs. Although apoptosis is generally considered the source of extracellular nuclear material, other cell death pathways such as necroptosis, NETosis, and pyroptosis can contribute to the release of nuclear molecules. Importantly, the release of nuclear DAMPs occurs with both soluble and particulate forms of these molecules. The activity of nuclear molecules may depend on posttranslational modifications, redox changes, and the binding of other molecules. Once in an extracellular location, nuclear DAMPs can engage the same pattern recognition receptors as do pathogen-associated molecular patterns. These interactions can activate immune cells and lead to cytokine and chemokine production. Among these receptors, internal receptors for DNA are key to the response to this molecule; the likely function of these internal sensors is the recognition of DNA from intracellular infection by bacteria or viruses. Activation of these receptors requires translocation of extracellular DNA into specialized compartments. In addition to nuclear DNA, mitochondrial DNA can also serve as a DAMP. The communication of cell injury and death is a critical element in host defense and involves the repurposing of nuclear molecules as immune triggers. As such, the presence of extracellular nuclear material can serve as novel biomarkers for conditions involving cell injury and death. Targeting of these molecules may also represent an important new approach to therapy. Published by Elsevier Inc.

Extensive Mobilome-Driven Genome Diversification in Mouse Gut-Associated Bacteroides vulgatus mpk.

PubMed

Lange, Anna; Beier, Sina; Steimle, Alex; Autenrieth, Ingo B; Huson, Daniel H; Frick, Julia-Stefanie

2016-04-25

Like many other Bacteroides species, Bacteroides vulgatus strain mpk, a mouse fecal isolate which was shown to promote intestinal homeostasis, utilizes a variety of mobile elements for genome evolution. Based on sequences collected by Pacific Biosciences SMRT sequencing technology, we discuss the challenges of assembling and studying a bacterial genome of high plasticity. Additionally, we conducted comparative genomics comparing this commensal strain with the B. vulgatus type strain ATCC 8482 as well as multiple other Bacteroides and Parabacteroides strains to reveal the most important differences and identify the unique features of B. vulgatus mpk. The genome of B. vulgatus mpk harbors a large and diverse set of mobile element proteins compared with other sequenced Bacteroides strains. We found evidence of a number of different horizontal gene transfer events and a genome landscape that has been extensively altered by different mobilization events. A CRISPR/Cas system could be identified that provides a possible mechanism for preventing the integration of invading external DNA. We propose that the high genome plasticity and the introduced genome instabilities of B. vulgatus mpk arising from the various mobilization events might play an important role not only in its adaptation to the challenging intestinal environment in general, but also in its ability to interact with the gut microbiota. © The Author(s) 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

Transposable element evolution in Heliconius suggests genome diversity within Lepidoptera

PubMed Central

2013-01-01

Background Transposable elements (TEs) have the potential to impact genome structure, function and evolution in profound ways. In order to understand the contribution of transposable elements (TEs) to Heliconius melpomene, we queried the H. melpomene draft sequence to identify repetitive sequences. Results We determined that TEs comprise ~25% of the genome. The predominant class of TEs (~12% of the genome) was the non-long terminal repeat (non-LTR) retrotransposons, including a novel SINE family. However, this was only slightly higher than content derived from DNA transposons, which are diverse, with several families having mobilized in the recent past. Compared to the only other well-studied lepidopteran genome, Bombyx mori, H. melpomene exhibits a higher DNA transposon content and a distinct repertoire of retrotransposons. We also found that H. melpomene exhibits a high rate of TE turnover with few older elements accumulating in the genome. Conclusions Our analysis represents the first complete, de novo characterization of TE content in a butterfly genome and suggests that, while TEs are able to invade and multiply, TEs have an overall deleterious effect and/or that maintaining a small genome is advantageous. Our results also hint that analysis of additional lepidopteran genomes will reveal substantial TE diversity within the group. PMID:24088337

Two CGTCA motifs and a GHF1/Pit1 binding site mediate cAMP-dependent protein kinase A regulation of human growth hormone gene expression in rat anterior pituitary GC cells.

PubMed

Shepard, A R; Zhang, W; Eberhardt, N L

1994-01-21

We established the cis-acting elements which mediate cAMP responsiveness of the human growth hormone (hGH) gene in transiently transfected rat anterior pituitary tumor GC cells. Analysis of the intact hGH gene or hGH 5'-flanking DNA (5'-FR) coupled to the hGh cDNA or chloramphenicol acetyltransferase or luciferase genes, indicated that cAMP primarily stimulated hGH promoter activity. Cotransfection of a protein kinase A inhibitory protein cDNA demonstrated that the cAMP response was mediated by protein kinase A. Mutational analysis of the hGH promoter identified two core cAMP response element motifs (CGTCA) located at nucleotides -187/-183 (distal cAMP response element; dCRE) and -99/-95 (proximal cAMP response element; pCRE) and a pituitary-specific transcription factor (GHF1/Pit1) binding site at nucleotides -123/-112 (dGHF1) which were required for cAMP responsiveness. GHF1 was not a limiting factor, since overexpression of GHF1 in cotransfections increased basal but not forskolin induction levels. Gel shift analyses indicated that similar, ubiquitous, thermostable protein(s) specifically bound the pCRE and dCRE motifs. The CGTCA motif-binding factors were cAMP response element binding protein (CREB)/activating transcription factor-1 (ATF-1)-related, since the DNA-protein complex was competed by unlabeled CREB consensus oligonucleotide, specifically supershifted by antisera to CREB and ATF-1 but not ATF-2, and was bound by purified CREB with the same relative binding affinity (pCRE < dCRE < CREB) and mobility as the GC nuclear extract. UV cross-linking and Southwestern blot analyses revealed multiple DNA-protein interactions of which approximately 100- and approximately 45-kDa proteins were predominant; the approximately 45-kDa protein may represent CREB. These results indicate that CREB/ATF-1-related factors act coordinately with the cell-specific factor GHF1 to mediate cAMP-dependent regulation of hGH-1 gene transcription in anterior pituitary somatotrophs.

Flipping chromosomes in deep-sea archaea

PubMed Central

Catchpole, Ryan; Gadelle, Danièle; Marguet, Evelyne; Barbe, Valérie; Forterre, Patrick

2017-01-01

One of the major mechanisms driving the evolution of all organisms is genomic rearrangement. In hyperthermophilic Archaea of the order Thermococcales, large chromosomal inversions occur so frequently that even closely related genomes are difficult to align. Clearly not resulting from the native homologous recombination machinery, the causative agent of these inversions has remained elusive. We present a model in which genomic inversions are catalyzed by the integrase enzyme encoded by a family of mobile genetic elements. We characterized the integrase from Thermococcus nautili plasmid pTN3 and showed that besides canonical site-specific reactions, it catalyzes low sequence specificity recombination reactions with the same outcome as homologous recombination events on DNA segments as short as 104bp both in vitro and in vivo, in contrast to other known tyrosine recombinases. Through serial culturing, we showed that the integrase-mediated divergence of T. nautili strains occurs at an astonishing rate, with at least four large-scale genomic inversions appearing within 60 generations. Our results and the ubiquitous distribution of pTN3-like integrated elements suggest that a major mechanism of evolution of an entire order of Archaea results from the activity of a selfish mobile genetic element. PMID:28628615

nanos-Driven expression of piggyBac transposase induces mobilization of a synthetic autonomous transposon in the malaria vector mosquito, Anopheles stephensi.

PubMed

Macias, Vanessa M; Jimenez, Alyssa J; Burini-Kojin, Bianca; Pledger, David; Jasinskiene, Nijole; Phong, Celine Hien; Chu, Karen; Fazekas, Aniko; Martin, Kelcie; Marinotti, Osvaldo; James, Anthony A

2017-08-01

Transposons are a class of selfish DNA elements that can mobilize within a genome. If mobilization is accompanied by an increase in copy number (replicative transposition), the transposon may sweep through a population until it is fixed in all of its interbreeding members. This introgression has been proposed as the basis for drive systems to move genes with desirable phenotypes into target species. One such application would be to use them to move a gene conferring resistance to malaria parasites throughout a population of vector mosquitos. We assessed the feasibility of using the piggyBac transposon as a gene-drive mechanism to distribute anti-malarial transgenes in populations of the malaria vector, Anopheles stephensi. We designed synthetic gene constructs that express the piggyBac transposase in the female germline using the control DNA of the An. stephensi nanos orthologous gene linked to marker genes to monitor inheritance. Two remobilization events were observed with a frequency of one every 23 generations, a rate far below what would be useful to drive anti-pathogen transgenes into wild mosquito populations. We discuss the possibility of optimizing this system and the impetus to do so. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.

Transposable elements at the center of the crossroads between embryogenesis, embryonic stem cells, reprogramming, and long non-coding RNAs.

PubMed

Hutchins, Andrew Paul; Pei, Duanqing

Transposable elements (TEs) are mobile genomic sequences of DNA capable of autonomous and non-autonomous duplication. TEs have been highly successful, and nearly half of the human genome now consists of various families of TEs. Originally thought to be non-functional, these elements have been co-opted by animal genomes to perform a variety of physiological functions ranging from TE-derived proteins acting directly in normal biological functions, to innovations in transcription factor logic and influence on epigenetic control of gene expression. During embryonic development, when the genome is epigenetically reprogrammed and DNA-demethylated, TEs are released from repression and show embryonic stage-specific expression, and in human and mouse embryos, intact TE-derived endogenous viral particles can even be detected. A similar process occurs during the reprogramming of somatic cells to pluripotent cells: When the somatic DNA is demethylated, TEs are released from repression. In embryonic stem cells (ESCs), where DNA is hypomethylated, an elaborate system of epigenetic control is employed to suppress TEs, a system that often overlaps with normal epigenetic control of ESC gene expression. Finally, many long non-coding RNAs (lncRNAs) involved in normal ESC function and those assisting or impairing reprogramming contain multiple TEs in their RNA. These TEs may act as regulatory units to recruit RNA-binding proteins and epigenetic modifiers. This review covers how TEs are interlinked with the epigenetic machinery and lncRNAs, and how these links influence each other to modulate aspects of ESCs, embryogenesis, and somatic cell reprogramming.

Aberrant methylation and associated transcriptional mobilization of Alu elements contributes to genomic instability in hypoxia.

PubMed

Pal, Arnab; Srivastava, Tapasya; Sharma, Manish K; Mehndiratta, Mohit; Das, Prerna; Sinha, Subrata; Chattopadhyay, Parthaprasad

2010-11-01

Hypoxia is an integral part of tumorigenesis and contributes extensively to the neoplastic phenotype including drug resistance and genomic instability. It has also been reported that hypoxia results in global demethylation. Because a majority of the cytosine-phosphate-guanine (CpG) islands are found within the repeat elements of DNA, and are usually methylated under normoxic conditions, we suggested that retrotransposable Alu or short interspersed nuclear elements (SINEs) which show altered methylation and associated changes of gene expression during hypoxia, could be associated with genomic instability. U87MG glioblastoma cells were cultured in 0.1% O₂ for 6 weeks and compared with cells cultured in 21% O₂ for the same duration. Real-time PCR analysis showed a significant increase in SINE and reverse transcriptase coding long interspersed nuclear element (LINE) transcripts during hypoxia. Sequencing of bisulphite treated DNA as well as the Combined Bisulfite Restriction Analysis (COBRA) assay showed that the SINE loci studied underwent significant hypomethylation though there was patchy hypermethylation at a few sites. The inter-alu PCR profile of DNA from cells cultured under 6-week hypoxia, its 4-week revert back to normoxia and 6-week normoxia showed several changes in the band pattern indicating increased alu mediated genomic alteration. Our results show that aberrant methylation leading to increased transcription of SINE and reverse transcriptase associated LINE elements could lead to increased genomic instability in hypoxia. This might be a cause of genetic heterogeneity in tumours especially in variegated hypoxic environment and lead to a development of foci of more aggressive tumour cells. © 2009 The Authors Journal compilation © 2010 Foundation for Cellular and Molecular Medicine/Blackwell Publishing Ltd.

Meeting Report: The Role of the Mobilome in Cancer

PubMed Central

Ardeljan, Daniel; Taylor, Martin S.; Burns, Kathleen H.; Boeke, Jef D.; Espey, Michael Graham; Woodhouse, Elisa C.; Howcroft, T. Kevin

2016-01-01

Approximately half of the human genome consists of repetitive sequence attributed to the activities of mobile DNAs, including DNA transposons, RNA transposons, and endogenous retroviruses. Of these, only Long INterspersed Elements (LINE-1 or L1) and sequences copied by LINE-1 remain mobile in our species today. Although cells restrict L1 activity by both transcriptional and post-transcriptional mechanisms, L1 de-repression occurs in developmental and pathologic contexts, including many types of cancers. However, we have limited knowledge of the extent and consequences of L1 expression in premalignancies and cancer. Participants in this NIH strategic workshop considered key questions to enhance our understanding of mechanisms and roles the mobilome may play in cancer biology. PMID:27527733

Analysis of the regulation of viral transcription.

PubMed

Gloss, Bernd; Kalantari, Mina; Bernard, Hans-Ulrich

2005-01-01

Despite the small genomes and number of genes of papillomaviruses, regulation of their transcription is very complex and governed by numerous transcription factors, cis-responsive elements, and epigenetic phenomena. This chapter describes the strategies of how one can approach a systematic analysis of these factors, elements, and mechanisms. From the numerous different techniques useful for studying transcription, we describe in detail three selected protocols of approaches that have been relevant in shaping our knowledge of human papillomavirus transcription. These are DNAse I protection ("footprinting") for location of transcription-factor binding sites, electrophoretic mobility shifts ("gelshifts") for analysis of bound transcription factors, and bisulfite sequencing for analysis of DNA methylation as a prerequisite for epigenetic transcriptional regulation.

HMG-D is an architecture-specific protein that preferentially binds to DNA containing the dinucleotide TG.

PubMed Central

Churchill, M E; Jones, D N; Glaser, T; Hefner, H; Searles, M A; Travers, A A

1995-01-01

The high mobility group (HMG) protein HMG-D from Drosophila melanogaster is a highly abundant chromosomal protein that is closely related to the vertebrate HMG domain proteins HMG1 and HMG2. In general, chromosomal HMG domain proteins lack sequence specificity. However, using both NMR spectroscopy and standard biochemical techniques we show that binding of HMG-D to a single DNA site is sequence selective. The preferred duplex DNA binding site comprises at least 5 bp and contains the deformable dinucleotide TG embedded in A/T-rich sequences. The TG motif constitutes a common core element in the binding sites of the well-characterized sequence-specific HMG domain proteins. We show that a conserved aromatic residue in helix 1 of the HMG domain may be involved in recognition of this core sequence. In common with other HMG domain proteins HMG-D binds preferentially to DNA sites that are stably bent and underwound, therefore HMG-D can be considered an architecture-specific protein. Finally, we show that HMG-D bends DNA and may confer a superhelical DNA conformation at a natural DNA binding site in the Drosophila fushi tarazu scaffold-associated region. Images PMID:7720717

Mechanisms of resistance to quinolones: target alterations, decreased accumulation and DNA gyrase protection.

PubMed

Ruiz, Joaquim

2003-05-01

Quinolones are broad-spectrum antibacterial agents, commonly used in both clinical and veterinary medicine. Their extensive use has resulted in bacteria rapidly developing resistance to these agents. Two mechanisms of quinolone resistance have been established to date: alterations in the targets of quinolones, and decreased accumulation due to impermeability of the membrane and/or an overexpression of efflux pump systems. Recently, mobile elements have also been described, carrying the qnr gene, which confers resistance to quinolones.

Stretching and Controlled Motion of Single-Stranded DNA in Locally-Heated Solid-State Nanopores

PubMed Central

Belkin, Maxim; Maffeo, Christopher; Wells, David B.

2013-01-01

Practical applications of solid-state nanopores for DNA detection and sequencing require the electrophoretic motion of DNA through the nanopores to be precisely controlled. Controlling the motion of single-stranded DNA presents a particular challenge, in part because of the multitude of conformations that a DNA strand can adopt in a nanopore. Through continuum, coarse-grained and atomistic modeling, we demonstrate that local heating of the nanopore volume can be used to alter the electrophoretic mobility and conformation of single-stranded DNA. In the nanopore systems considered, the temperature near the nanopore is modulated via a nanometer-size heater element that can be radiatively switched on and off. The local enhancement of temperature produces considerable stretching of the DNA fragment confined within the nanopore. Such stretching is reversible, so that the conformation of DNA can be toggled between compact (local heating is off) and extended (local heating is on) states. The effective thermophoretic force acting on single-stranded DNA in the vicinity of the nanopore is found to be sufficiently large (4–8 pN) to affect such changes in the DNA conformation. The local heating of the nanopore volume is observed to promote single-file translocation of DNA strands at transmembrane biases as low as 10 mV, which opens new avenues for using solid-state nanopores for detection and sequencing of DNA. PMID:23876013

High-Mobility Group Chromatin Proteins 1 and 2 Functionally Interact with Steroid Hormone Receptors To Enhance Their DNA Binding In Vitro and Transcriptional Activity in Mammalian Cells

PubMed Central

Boonyaratanakornkit, Viroj; Melvin, Vida; Prendergast, Paul; Altmann, Magda; Ronfani, Lorenza; Bianchi, Marco E.; Taraseviciene, Laima; Nordeen, Steven K.; Allegretto, Elizabeth A.; Edwards, Dean P.

1998-01-01

We previously reported that the chromatin high-mobility group protein 1 (HMG-1) enhances the sequence-specific DNA binding activity of progesterone receptor (PR) in vitro, thus providing the first evidence that HMG-1 may have a coregulatory role in steroid receptor-mediated gene transcription. Here we show that HMG-1 and the highly related HMG-2 stimulate DNA binding by other steroid receptors, including estrogen, androgen, and glucocorticoid receptors, but have no effect on DNA binding by several nonsteroid nuclear receptors, including retinoid acid receptor (RAR), retinoic X receptor (RXR), and vitamin D receptor (VDR). As highly purified recombinant full-length proteins, all steroid receptors tested exhibited weak binding affinity for their optimal palindromic hormone response elements (HREs), and the addition of purified HMG-1 or -2 substantially increased their affinity for HREs. Purified RAR, RXR, and VDR also exhibited little to no detectable binding to their cognate direct repeat HREs but, in contrast to results with steroid receptors, the addition of HMG-1 or HMG-2 had no stimulatory effect. Instead, the addition of purified RXR enhanced RAR and VDR DNA binding through a heterodimerization mechanism and HMG-1 or HMG-2 had no further effect on DNA binding by RXR-RAR or RXR-VDR heterodimers. HMG-1 and HMG-2 (HMG-1/-2) themselves do not bind to progesterone response elements, but in the presence of PR they were detected as part of an HMG-PR-DNA ternary complex. HMG-1/-2 can also interact transiently in vitro with PR in the absence of DNA; however, no direct protein interaction was detected with VDR. These results, taken together with the fact that PR can bend its target DNA and that HMG-1/-2 are non-sequence-specific DNA binding proteins that recognize DNA structure, suggest that HMG-1/-2 are recruited to the PR-DNA complex by the combined effect of transient protein interaction and DNA bending. In transient-transfection assays, coexpression of HMG-1 or HMG-2 increased PR-mediated transcription in mammalian cells by as much as 7- to 10-fold without altering the basal promoter activity of target reporter genes. This increase in PR-mediated gene activation by coexpression of HMG-1/-2 was observed in different cell types and with different target promoters, suggesting a generality to the functional interaction between HMG-1/-2 and PR in vivo. Cotransfection of HMG-1 also increased reporter gene activation mediated by other steroid receptors, including glucocorticoid and androgen receptors, but it had a minimal influence on VDR-dependent transcription in vivo. These results support the conclusion that HMG-1/-2 are coregulatory proteins that increase the DNA binding and transcriptional activity of the steroid hormone class of receptors but that do not functionally interact with certain nonsteroid classes of nuclear receptors. PMID:9671457

Mobile Bacterial Group II Introns at the Crux of Eukaryotic Evolution

PubMed Central

Lambowitz, Alan M.; Belfort, Marlene

2015-01-01

SUMMARY This review focuses on recent developments in our understanding of group II intron function, the relationships of these introns to retrotransposons and spliceosomes, and how their common features have informed thinking about bacterial group II introns as key elements in eukaryotic evolution. Reverse transcriptase-mediated and host factor-aided intron retrohoming pathways are considered along with retrotransposition mechanisms to novel sites in bacteria, where group II introns are thought to have originated. DNA target recognition and movement by target-primed reverse transcription infer an evolutionary relationship among group II introns, non-LTR retrotransposons, such as LINE elements, and telomerase. Additionally, group II introns are almost certainly the progenitors of spliceosomal introns. Their profound similarities include splicing chemistry extending to RNA catalysis, reaction stereochemistry, and the position of two divalent metals that perform catalysis at the RNA active site. There are also sequence and structural similarities between group II introns and the spliceosome’s small nuclear RNAs (snRNAs) and between a highly conserved core spliceosomal protein Prp8 and a group II intron-like reverse transcriptase. It has been proposed that group II introns entered eukaryotes during bacterial endosymbiosis or bacterial-archaeal fusion, proliferated within the nuclear genome, necessitating evolution of the nuclear envelope, and fragmented giving rise to spliceosomal introns. Thus, these bacterial self-splicing mobile elements have fundamentally impacted the composition of extant eukaryotic genomes, including the human genome, most of which is derived from close relatives of mobile group II introns. PMID:25878921

The impact of transposable elements on mammalian development

PubMed Central

Garcia-Perez, Jose L.; Widmann, Thomas J.; Adams, Ian R.

2018-01-01

Summary Despite often being classified as selfish or junk DNA, transposable elements (TEs) are a group of abundant genetic sequences that significantly impact on mammalian development and genome regulation. In recent years, our understanding of how pre-existing TEs affect genome architecture, gene regulatory networks and protein function during mammalian embryogenesis has dramatically expanded. In addition, the mobilization of active TEs in selected cell types has been shown to generate genetic variation during development and in fully differentiated tissues. Importantly, the ongoing domestication and evolution of TEs appears to provide a rich source of regulatory elements, functional modules and genetic variation that fuels the evolution of mammalian developmental processes. Here, we review the functional impact that TEs exert on mammalian developmental processes and how the somatic activity of TEs can influence gene regulatory networks. PMID:27875251

Mobile element biology – new possibilities with high-throughput sequencing

PubMed Central

Xing, Jinchuan; Witherspoon, David J.; Jorde, Lynn B.

2014-01-01

Mobile elements compose more than half of the human genome, but until recently their large-scale detection was time-consuming and challenging. With the development of new high-throughput sequencing technologies, the complete spectrum of mobile element variation in humans can now be identified and analyzed. Thousands of new mobile element insertions have been discovered, yielding new insights into mobile element biology, evolution, and genomic variation. We review several high-throughput methods, with an emphasis on techniques that specifically target mobile element insertions in humans, and we highlight recent applications of these methods in evolutionary studies and in the analysis of somatic alterations in human cancers. PMID:23312846

Mobile phone radiation induces mode-dependent DNA damage in a mouse spermatocyte-derived cell line: a protective role of melatonin.

PubMed

Liu, Chuan; Gao, Peng; Xu, Shang-Cheng; Wang, Yuan; Chen, Chun-Hai; He, Min-Di; Yu, Zheng-Ping; Zhang, Lei; Zhou, Zhou

2013-11-01

To evaluate whether exposure to mobile phone radiation (MPR) can induce DNA damage in male germ cells. A mouse spermatocyte-derived GC-2 cell line was exposed to a commercial mobile phone handset once every 20 min in standby, listen, dialed or dialing modes for 24 h. DNA damage was determined using an alkaline comet assay. The levels of DNA damage were significantly increased following exposure to MPR in the listen, dialed and dialing modes. Moreover, there were significantly higher increases in the dialed and dialing modes than in the listen mode. Interestingly, these results were consistent with the radiation intensities of these modes. However, the DNA damage effects of MPR in the dialing mode were efficiently attenuated by melatonin pretreatment. These results regarding mode-dependent DNA damage have important implications for the safety of inappropriate mobile phone use by males of reproductive age and also suggest a simple preventive measure: Keeping mobile phones as far away from our body as possible, not only during conversations but during 'dialed' and 'dialing' operation modes. Since the 'dialed' mode is actually part of the standby mode, mobile phones should be kept at a safe distance from our body even during standby operation. Furthermore, the protective role of melatonin suggests that it may be a promising pharmacological candidate for preventing mobile phone use-related reproductive impairments.

The interaction of E. coli integration host factor and lambda cos DNA: multiple complex formation and protein-induced bending.

PubMed Central

Kosturko, L D; Daub, E; Murialdo, H

1989-01-01

The interaction of E. coli's integration Host Factor (IHF) with fragments of lambda DNA containing the cos site has been studied by gel-mobility retardation and electron microscopy. The cos fragment used in the mobility assays is 398 bp and spans a region from 48,298 to 194 on the lambda chromosome. Several different complexes of IHF with this fragment can be distinguished by their differential mobility on polyacrylamide gels. Relative band intensities indicate that the formation of a complex between IHF and this DNA fragment has an equilibrium binding constant of the same magnitude as DNA fragments containing lambda's attP site. Gel-mobility retardation and electron microscopy have been employed to show that IHF sharply bends DNA near cos and to map the bending site. The protein-induced bend is near an intrinsic bend due to DNA sequence. The position of the bend suggests that IHF's role in lambda DNA packaging may be the enhancement of terminase binding/cos cutting by manipulating DNA structure. Images PMID:2521383

Gel shift analysis of the empA promoter region in Vibrio anguillarum.

PubMed

Denkin, Steven M; Sekaric, Pedja; Nelson, David R

2004-10-29

The induction of metalloprotease encoded by empA in Vibrio anguillarum occurs at high cell density in salmon intestinal mucus. Previously we have shown that there are significant differences in empA expression in two strains of V. anguillarum, M93Sm and NB10. It is hypothesized that differences in empA regulation are due to differences in binding of regulatory elements. Two strains of V. anguillarum, M93Sm and NB10, were examined and compared for the presence of DNA regulatory proteins that bind to and control the empA promoter region. Gel mobility shift assays, using a digoxigenin (DIG)-labeled oligomer containing a lux box-like element and the promoter for empA, were done to demonstrate the presence of a DNA-binding protein. Protein extracts from NB10 cells incubated in Luria Bertani broth + 2% NaCl (LB20), nine salts solution + 200 microg/ml mucus (NSSM), 3M (marine minimal medium), or NSS resulted in a gel mobility shift. No gel mobility shift was seen when protein extracts from either LB20- or NSSM-grown M93Sm cells were mixed with the DIG-labeled empA oligomer. The azocasein assay detected protease activity in all incubation conditions for NB10 culture supernatants. In contrast, protease activity was detected in M93Sm culture supernatants only when incubated in NSSM. Since the luxR homologue in V. anguillarum, vanT, has been cloned, sequenced, and shown to be required for protease activity, we wanted to determine if vanT mutants of NB10 exhibit the same gel shift observed in the wild-type. Site-directed mutagenesis was used to create vanT mutants in V. anguillarum M93Sm and NB10 to test whether VanT is involved with the gel mobility shift. Both vanT mutants, M02 and NB02, did not produce protease activity in any conditions. However, protein extracts from NB02 incubated in each condition still exhibited a gel shift when mixed with the DIG-labeled empA oligomer. The data demonstrate that protein extracts of V. anguillarum NB10 cells contain a protein that binds to a 50 bp oligomer containing the empA promoter-lux box-like region. NB10 cells express empA during stationary phase in all growth conditions. The DNA binding protein is not present in M93Sm extracts. M93Sm cells express protease activity only when incubated at high cell density in fish gastrointestinal mucus. The gel shift observed with NB10 cells is not due to VanT binding. The data also suggest that the DNA binding protein is responsible for the less restrictive expression of empA in NB10 compared to M93Sm.

Crowding Induces Complex Ergodic Diffusion and Dynamic Elongation of Large DNA Molecules

PubMed Central

Chapman, Cole D.; Gorczyca, Stephanie; Robertson-Anderson, Rae M.

2015-01-01

Despite the ubiquity of molecular crowding in living cells, the effects of crowding on the dynamics of genome-sized DNA are poorly understood. Here, we track single, fluorescent-labeled large DNA molecules (11, 115 kbp) diffusing in dextran solutions that mimic intracellular crowding conditions (0–40%), and determine the effects of crowding on both DNA mobility and conformation. Both DNAs exhibit ergodic Brownian motion and comparable mobility reduction in all conditions; however, crowder size (10 vs. 500 kDa) plays a critical role in the underlying diffusive mechanisms and dependence on crowder concentration. Surprisingly, in 10-kDa dextran, crowder influence saturates at ∼20% with an ∼5× drop in DNA diffusion, in stark contrast to exponentially retarded mobility, coupled to weak anomalous subdiffusion, with increasing concentration of 500-kDa dextran. Both DNAs elongate into lower-entropy states (compared to random coil conformations) when crowded, with elongation states that are gamma distributed and fluctuate in time. However, the broadness of the distribution of states and the time-dependence and length scale of elongation length fluctuations depend on both DNA and crowder size with concentration having surprisingly little impact. Results collectively show that mobility reduction and coil elongation of large crowded DNAs are due to a complex interplay between entropic effects and crowder mobility. Although elongation and initial mobility retardation are driven by depletion interactions, subdiffusive dynamics, and the drastic exponential slowing of DNA, up to ∼300×, arise from the reduced mobility of larger crowders. Our results elucidate the highly important and widely debated effects of cellular crowding on genome-sized DNA. PMID:25762333

Evolution of Sphingomonad Gene Clusters Related to Pesticide Catabolism Revealed by Genome Sequence and Mobilomics of Sphingobium herbicidovorans MH.

PubMed

Nielsen, Tue Kjærgaard; Rasmussen, Morten; Demanèche, Sandrine; Cecillon, Sébastien; Vogel, Timothy M; Hansen, Lars Hestbjerg

2017-09-01

Bacterial degraders of chlorophenoxy herbicides have been isolated from various ecosystems, including pristine environments. Among these degraders, the sphingomonads constitute a prominent group that displays versatile xenobiotic-degradation capabilities. Four separate sequencing strategies were required to provide the complete sequence of the complex and plastic genome of the canonical chlorophenoxy herbicide-degrading Sphingobium herbicidovorans MH. The genome has an intricate organization of the chlorophenoxy-herbicide catabolic genes sdpA, rdpA, and cadABCD that encode the (R)- and (S)-enantiomer-specific 2,4-dichlorophenoxypropionate dioxygenases and four subunits of a Rieske non-heme iron oxygenase involved in 2-methyl-chlorophenoxyacetic acid degradation, respectively. Several major genomic rearrangements are proposed to help understand the evolution and mobility of these important genes and their genetic context. Single-strain mobilomic sequence analysis uncovered plasmids and insertion sequence-associated circular intermediates in this environmentally important bacterium and enabled the description of evolutionary models for pesticide degradation in strain MH and related organisms. The mobilome presented a complex mosaic of mobile genetic elements including four plasmids and several circular intermediate DNA molecules of insertion-sequence elements and transposons that are central to the evolution of xenobiotics degradation. Furthermore, two individual chromosomally integrated prophages were shown to excise and form free circular DNA molecules. This approach holds great potential for improving the understanding of genome plasticity, evolution, and microbial ecology. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

Identifying structural variation in haploid microbial genomes from short-read resequencing data using breseq.

PubMed

Barrick, Jeffrey E; Colburn, Geoffrey; Deatherage, Daniel E; Traverse, Charles C; Strand, Matthew D; Borges, Jordan J; Knoester, David B; Reba, Aaron; Meyer, Austin G

2014-11-29

Mutations that alter chromosomal structure play critical roles in evolution and disease, including in the origin of new lifestyles and pathogenic traits in microbes. Large-scale rearrangements in genomes are often mediated by recombination events involving new or existing copies of mobile genetic elements, recently duplicated genes, or other repetitive sequences. Most current software programs for predicting structural variation from short-read DNA resequencing data are intended primarily for use on human genomes. They typically disregard information in reads mapping to repeat sequences, and significant post-processing and manual examination of their output is often required to rule out false-positive predictions and precisely describe mutational events. We have implemented an algorithm for identifying structural variation from DNA resequencing data as part of the breseq computational pipeline for predicting mutations in haploid microbial genomes. Our method evaluates the support for new sequence junctions present in a clonal sample from split-read alignments to a reference genome, including matches to repeat sequences. Then, it uses a statistical model of read coverage evenness to accept or reject these predictions. Finally, breseq combines predictions of new junctions and deleted chromosomal regions to output biologically relevant descriptions of mutations and their effects on genes. We demonstrate the performance of breseq on simulated Escherichia coli genomes with deletions generating unique breakpoint sequences, new insertions of mobile genetic elements, and deletions mediated by mobile elements. Then, we reanalyze data from an E. coli K-12 mutation accumulation evolution experiment in which structural variation was not previously identified. Transposon insertions and large-scale chromosomal changes detected by breseq account for ~25% of spontaneous mutations in this strain. In all cases, we find that breseq is able to reliably predict structural variation with modest read-depth coverage of the reference genome (>40-fold). Using breseq to predict structural variation should be useful for studies of microbial epidemiology, experimental evolution, synthetic biology, and genetics when a reference genome for a closely related strain is available. In these cases, breseq can discover mutations that may be responsible for important or unintended changes in genomes that might otherwise go undetected.

Miniature Transposable Sequences Are Frequently Mobilized in the Bacterial Plant Pathogen Pseudomonas syringae pv. phaseolicola

PubMed Central

Bardaji, Leire; Añorga, Maite; Jackson, Robert W.; Martínez-Bilbao, Alejandro; Yanguas-Casás, Natalia; Murillo, Jesús

2011-01-01

Mobile genetic elements are widespread in Pseudomonas syringae, and often associate with virulence genes. Genome reannotation of the model bean pathogen P. syringae pv. phaseolicola 1448A identified seventeen types of insertion sequences and two miniature inverted-repeat transposable elements (MITEs) with a biased distribution, representing 2.8% of the chromosome, 25.8% of the 132-kb virulence plasmid and 2.7% of the 52-kb plasmid. Employing an entrapment vector containing sacB, we estimated that transposition frequency oscillated between 2.6×10−5 and 1.1×10−6, depending on the clone, although it was stable for each clone after consecutive transfers in culture media. Transposition frequency was similar for bacteria grown in rich or minimal media, and from cells recovered from compatible and incompatible plant hosts, indicating that growth conditions do not influence transposition in strain 1448A. Most of the entrapped insertions contained a full-length IS801 element, with the remaining insertions corresponding to sequences smaller than any transposable element identified in strain 1448A, and collectively identified as miniature sequences. From these, fragments of 229, 360 and 679-nt of the right end of IS801 ended in a consensus tetranucleotide and likely resulted from one-ended transposition of IS801. An average 0.7% of the insertions analyzed consisted of IS801 carrying a fragment of variable size from gene PSPPH_0008/PSPPH_0017, showing that IS801 can mobilize DNA in vivo. Retrospective analysis of complete plasmids and genomes of P. syringae suggests, however, that most fragments of IS801 are likely the result of reorganizations rather than one-ended transpositions, and that this element might preferentially contribute to genome flexibility by generating homologous regions of recombination. A further miniature sequence previously found to affect host range specificity and virulence, designated MITEPsy1 (100-nt), represented an average 2.4% of the total number of insertions entrapped in sacB, demonstrating for the first time the mobilization of a MITE in bacteria. PMID:22016774

Miniature transposable sequences are frequently mobilized in the bacterial plant pathogen Pseudomonas syringae pv. phaseolicola.

PubMed

Bardaji, Leire; Añorga, Maite; Jackson, Robert W; Martínez-Bilbao, Alejandro; Yanguas-Casás, Natalia; Murillo, Jesús

2011-01-01

Mobile genetic elements are widespread in Pseudomonas syringae, and often associate with virulence genes. Genome reannotation of the model bean pathogen P. syringae pv. phaseolicola 1448A identified seventeen types of insertion sequences and two miniature inverted-repeat transposable elements (MITEs) with a biased distribution, representing 2.8% of the chromosome, 25.8% of the 132-kb virulence plasmid and 2.7% of the 52-kb plasmid. Employing an entrapment vector containing sacB, we estimated that transposition frequency oscillated between 2.6×10(-5) and 1.1×10(-6), depending on the clone, although it was stable for each clone after consecutive transfers in culture media. Transposition frequency was similar for bacteria grown in rich or minimal media, and from cells recovered from compatible and incompatible plant hosts, indicating that growth conditions do not influence transposition in strain 1448A. Most of the entrapped insertions contained a full-length IS801 element, with the remaining insertions corresponding to sequences smaller than any transposable element identified in strain 1448A, and collectively identified as miniature sequences. From these, fragments of 229, 360 and 679-nt of the right end of IS801 ended in a consensus tetranucleotide and likely resulted from one-ended transposition of IS801. An average 0.7% of the insertions analyzed consisted of IS801 carrying a fragment of variable size from gene PSPPH_0008/PSPPH_0017, showing that IS801 can mobilize DNA in vivo. Retrospective analysis of complete plasmids and genomes of P. syringae suggests, however, that most fragments of IS801 are likely the result of reorganizations rather than one-ended transpositions, and that this element might preferentially contribute to genome flexibility by generating homologous regions of recombination. A further miniature sequence previously found to affect host range specificity and virulence, designated MITEPsy1 (100-nt), represented an average 2.4% of the total number of insertions entrapped in sacB, demonstrating for the first time the mobilization of a MITE in bacteria.

Identification of Genetic Elements Associated with EPSPS Gene Amplification

PubMed Central

Gaines, Todd A.; Wright, Alice A.; Molin, William T.; Lorentz, Lothar; Riggins, Chance W.; Tranel, Patrick J.; Beffa, Roland; Westra, Philip; Powles, Stephen B.

2013-01-01

Weed populations can have high genetic plasticity and rapid responses to environmental selection pressures. For example, 100-fold amplification of the 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) gene evolved in the weed species Amaranthus palmeri to confer resistance to glyphosate, the world’s most important herbicide. However, the gene amplification mechanism is unknown. We sequenced the EPSPS gene and genomic regions flanking EPSPS loci in A. palmeri, and searched for mobile genetic elements or repetitive sequences. The EPSPS gene was 10,229 bp, containing 8 exons and 7 introns. The gene amplification likely proceeded through a DNA-mediated mechanism, as introns exist in the amplified gene copies and the entire amplified sequence is at least 30 kb in length. Our data support the presence of two EPSPS loci in susceptible (S) A. palmeri, and that only one of these was amplified in glyphosate-resistant (R) A. palmeri. The EPSPS gene amplification event likely occurred recently, as no sequence polymorphisms were found within introns of amplified EPSPS copies from R individuals. Sequences with homology to miniature inverted-repeat transposable elements (MITEs) were identified next to EPSPS gene copies only in R individuals. Additionally, a putative Activator (Ac) transposase and a repetitive sequence region were associated with amplified EPSPS genes. The mechanism controlling this DNA-mediated amplification remains unknown. Further investigation is necessary to determine if the gene amplification may have proceeded via DNA transposon-mediated replication, and/or unequal recombination between different genomic regions resulting in replication of the EPSPS gene. PMID:23762434

Transcriptional activation of transforming growth factor alpha by estradiol: requirement for both a GC-rich site and an estrogen response element half-site.

PubMed

Vyhlidal, C; Samudio, I; Kladde, M P; Safe, S

2000-06-01

17beta-Estradiol (E2) induces transforming growth factor alpha (TGFalpha) gene expression in MCF-7 cells and previous studies have identified a 53 bp (-252 to -200) sequence containing two imperfect estrogen responsive elements (EREs) that contribute to E2 responsiveness. Deletion analysis of the TGFalpha gene promoter in this study identified a second upstream region of the promoter (-623 to -549) that is also E2 responsive. This sequence contains three GC-rich sites and an imperfect ERE half-site, and the specific cis-elements and trans-acting factors were determined by promoter analysis in transient transfection experiments, gel mobility shift assays and in vitro DNA footprinting. The results are consistent with an estrogen receptor alpha (ERalpha)/Sp1 complex interacting with an Sp1(N)(30) ERE half-site ((1/2)) motif in which both ERalpha and Sp1 bind promoter DNA. The ER/Sp1-DNA complex is formed using nuclear extracts from MCF-7 cells but not with recombinant human ERalpha or Sp1 proteins, suggesting that other nuclear factor(s) are required for complex stabilization. The E2-responsive Sp1(N)(x)ERE(1/2) motif identified in the TGFalpha gene promoter has also been characterized in the cathepsin D and heat shock protein 27 gene promoters; however, in the latter two promoters the numbers of intervening nucleotides are 23 and 10 respectively.

Analysis of LexA binding sites and transcriptomics in response to genotoxic stress in Leptospira interrogans.

PubMed

Schons-Fonseca, Luciane; da Silva, Josefa B; Milanez, Juliana S; Domingos, Renan H; Smith, Janet L; Nakaya, Helder I; Grossman, Alan D; Ho, Paulo L; da Costa, Renata M A

2016-02-18

We determined the effects of DNA damage caused by ultraviolet radiation on gene expression in Leptospira interrogans using DNA microarrays. These data were integrated with DNA binding in vivo of LexA1, a regulator of the DNA damage response, assessed by chromatin immunoprecipitation and massively parallel DNA sequencing (ChIP-seq). In response to DNA damage, Leptospira induced expression of genes involved in DNA metabolism, in mobile genetic elements and defective prophages. The DNA repair genes involved in removal of photo-damage (e.g. nucleotide excision repair uvrABC, recombinases recBCD and resolvases ruvABC) were not induced. Genes involved in various metabolic pathways were down regulated, including genes involved in cell growth, RNA metabolism and the tricarboxylic acid cycle. From ChIP-seq data, we observed 24 LexA1 binding sites located throughout chromosome 1 and one binding site in chromosome 2. Expression of many, but not all, genes near those sites was increased following DNA damage. Binding sites were found as far as 550 bp upstream from the start codon, or 1 kb into the coding sequence. Our findings indicate that there is a shift in gene expression following DNA damage that represses genes involved in cell growth and virulence, and induces genes involved in mutagenesis and recombination. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

A unique mitigator sequence determines the species specificity of the major late promoter in adenovirus type 12 DNA.

PubMed Central

Zock, C; Iselt, A; Doerfler, W

1993-01-01

Human adenovirus type 12 (Ad12) cannot replicate in hamster cells, whereas human cells are permissive for Ad12. Ad12 DNA replication and late-gene and virus-associated RNA expression are blocked in hamster cells. Early Ad12 genes are transcribed, and the viral DNA can be integrated into the host genome. Ad12 DNA replication and late-gene transcription can be complemented in hamster cells by E1 functions of Ad2 or Ad5, for which hamster cells are fully permissive (for a review, see W. Doerfler, Adv. Virus Res. 39:89-128, 1991). We have previously demonstrated that a 33-nucleotide mitigator sequence, which is located in the downstream region of the major late promoter (MLP) of Ad12 DNA, is responsible for the inactivity of the Ad12 MLP in hamster cells (C. Zock and W. Doerfler, EMBO J. 9:1615-1623, 1990). A similar negative regulator has not been found in the MLP of Ad2 DNA. We have now studied the mechanism of action of this mitigator element. The results of nuclear run-on experiments document the absence of MLP transcripts in the nuclei of Ad12-infected BHK21 hamster cells. Surprisingly, the mitigator element cannot elicit its function in in vitro transcription experiments with nuclear extracts from both hamster BHK21 and human HeLa cells. Intact nuclear topology and/or tightly bound nuclear elements that cannot be eluted in nuclear extracts are somehow required for recognition of the Ad12 mitigator. Electrophoretic mobility shift assays have not revealed significant differences in the binding of proteins from human HeLa or hamster BHK21 cells to the mitigator sequence in the MLP of Ad12 DNA or to the corresponding sequence in Ad2 DNA. We have converted the sequence of the mitigator in the MLP of Ad12 DNA to the equivalent sequence in the MLP of Ad2 DNA by site-directed mutagenesis. This construct was not active in hamster cells. When the Ad12 mitigator, on the other hand, was inserted into the Ad2 MLP, the latter's function in hamster cells was not compromised. Deletions in the 5' upstream region of the Ad12 MLP have provided evidence for the existence of additional sequences that codetermine the deficiency of the Ad12 MLP in hamster cells. The amphifunctional YY1 protein from HeLa cells can bind specifically to the mitigator and to upstream elements of the MLP of Ad12 DNA.(ABSTRACT TRUNCATED AT 400 WORDS) Images PMID:8419643

Meeting Report: The Role of the Mobilome in Cancer.

PubMed

Ardeljan, Daniel; Taylor, Martin S; Burns, Kathleen H; Boeke, Jef D; Espey, Michael Graham; Woodhouse, Elisa C; Howcroft, Thomas Kevin

2016-08-01

Approximately half of the human genome consists of repetitive sequence attributed to the activities of mobile DNAs, including DNA transposons, RNA transposons, and endogenous retroviruses. Of these, only long interspersed elements (LINE-1 or L1) and sequences copied by LINE-1 remain mobile in our species today. Although cells restrict L1 activity by both transcriptional and posttranscriptional mechanisms, L1 derepression occurs in developmental and pathologic contexts, including many types of cancers. However, we have limited knowledge of the extent and consequences of L1 expression in premalignancies and cancer. Participants in this NIH strategic workshop considered key questions to enhance our understanding of mechanisms and roles the mobilome may play in cancer biology. Cancer Res; 76(15); 4316-9. ©2016 AACR. ©2016 American Association for Cancer Research.

Evolutionary genomics of miniature inverted-repeat transposable elements (MITEs) in Brassica.

PubMed

Nouroz, Faisal; Noreen, Shumaila; Heslop-Harrison, J S

2015-12-01

Miniature inverted-repeat transposable elements (MITEs) are truncated derivatives of autonomous DNA transposons, and are dispersed abundantly in most eukaryotic genomes. We aimed to characterize various MITEs families in Brassica in terms of their presence, sequence characteristics and evolutionary activity. Dot plot analyses involving comparison of homoeologous bacterial artificial chromosome (BAC) sequences allowed identification of 15 novel families of mobile MITEs. Of which, 5 were Stowaway-like with TA Target Site Duplications (TSDs), 4 Tourist-like with TAA/TTA TSDs, 5 Mutator-like with 9-10 bp TSDs and 1 novel MITE (BoXMITE1) flanked by 3 bp TSDs. Our data suggested that there are about 30,000 MITE-related sequences in Brassica rapa and B. oleracea genomes. In situ hybridization showed one abundant family was dispersed in the A-genome, while another was located near 45S rDNA sites. PCR analysis using primers flanking sequences of MITE elements detected MITE insertion polymorphisms between and within the three Brassica (AA, BB, CC) genomes, with many insertions being specific to single genomes and others showing evidence of more recent evolutionary insertions. Our BAC sequence comparison strategy enables identification of evolutionarily active MITEs with no prior knowledge of MITE sequences. The details of MITE families reported in Brassica enable their identification, characterization and annotation. Insertion polymorphisms of MITEs and their transposition activity indicated important mechanism of genome evolution and diversification. MITE families derived from known Mariner, Harbinger and Mutator DNA transposons were discovered, as well as some novel structures. The identification of Brassica MITEs will have broad applications in Brassica genomics, breeding, hybridization and phylogeny through their use as DNA markers.

Imaging and sizing of single DNA molecules on a mobile phone.

PubMed

Wei, Qingshan; Luo, Wei; Chiang, Samuel; Kappel, Tara; Mejia, Crystal; Tseng, Derek; Chan, Raymond Yan Lok; Yan, Eddie; Qi, Hangfei; Shabbir, Faizan; Ozkan, Haydar; Feng, Steve; Ozcan, Aydogan

2014-12-23

DNA imaging techniques using optical microscopy have found numerous applications in biology, chemistry and physics and are based on relatively expensive, bulky and complicated set-ups that limit their use to advanced laboratory settings. Here we demonstrate imaging and length quantification of single molecule DNA strands using a compact, lightweight and cost-effective fluorescence microscope installed on a mobile phone. In addition to an optomechanical attachment that creates a high contrast dark-field imaging setup using an external lens, thin-film interference filters, a miniature dovetail stage and a laser-diode for oblique-angle excitation, we also created a computational framework and a mobile phone application connected to a server back-end for measurement of the lengths of individual DNA molecules that are labeled and stretched using disposable chips. Using this mobile phone platform, we imaged single DNA molecules of various lengths to demonstrate a sizing accuracy of <1 kilobase-pairs (kbp) for 10 kbp and longer DNA samples imaged over a field-of-view of ∼2 mm2.

All y'all need to know 'bout retroelements in cancer.

PubMed

Belancio, Victoria P; Roy-Engel, Astrid M; Deininger, Prescott L

2010-08-01

Genetic instability is one of the principal hallmarks and causative factors in cancer. Human transposable elements (TE) have been reported to cause human diseases, including several types of cancer through insertional mutagenesis of genes critical for preventing or driving malignant transformation. In addition to retrotransposition-associated mutagenesis, TEs have been found to contribute even more genomic rearrangements through non-allelic homologous recombination. TEs also have the potential to generate a wide range of mutations derivation of which is difficult to directly trace to mobile elements, including double strand breaks that may trigger mutagenic genomic rearrangements. Genome-wide hypomethylation of TE promoters and significantly elevated TE expression in almost all human cancers often accompanied by the loss of critical DNA sensing and repair pathways suggests that the negative impact of mobile elements on genome stability should increase as human tumors evolve. The biological consequences of elevated retroelement expression, such as the rate of their amplification, in human cancers remain obscure, particularly, how this increase translates into disease-relevant mutations. This review is focused on the cellular mechanisms that control human TE-associated mutagenesis in cancer and summarizes the current understanding of TE contribution to genetic instability in human malignancies. Copyright © 2010 Elsevier Ltd. All rights reserved.

The impact of cHS4 insulators on DNA transposon vector mobilization and silencing in retinal pigment epithelium cells.

PubMed

Sharma, Nynne; Hollensen, Anne Kruse; Bak, Rasmus O; Staunstrup, Nicklas Heine; Schrøder, Lisbeth Dahl; Mikkelsen, Jacob Giehm

2012-01-01

DNA transposons have become important vectors for efficient non-viral integration of transgenes into genomic DNA. The Sleeping Beauty (SB), piggyBac (PB), and Tol2 transposable elements have distinct biological properties and currently represent the most promising transposon systems for animal transgenesis and gene therapy. A potential obstacle, however, for persistent function of integrating vectors is transcriptional repression of the element and its genetic cargo. In this study we analyze the insulating effect of the 1.2-kb 5'-HS4 chicken β-globin (cHS4) insulator element in the context of SB, PB, and Tol2 transposon vectors. By examining transgene expression from genomically inserted transposon vectors encoding a marker gene driven by a silencing-prone promoter, we detect variable levels of transcriptional silencing for the three transposon systems in retinal pigment epithelium cells. Notably, the PB system seems less vulnerable to silencing. Incorporation of cHS4 insulator sequences into the transposon vectors results in 2.2-fold and 1.5-fold increased transgene expression levels for insulated SB and PB vectors, respectively, but an improved persistency of expression was not obtained for insulated transgenes. Colony formation assays and quantitative excision assays unveil enhanced SB transposition efficiencies by the inclusion of the cHS4 element, resulting in a significant increase in the stable transfection rate for insulated SB transposon vectors in human cell lines. Our findings reveal a positive impact of cHS4 insulator inclusion for SB and PB vectors in terms of increased transgene expression levels and improved SB stable transfection rates, but also the lack of a long-term protective effect of the cHS4 insulator against progressive transgene silencing in retinal pigment epithelium cells.

The Impact of cHS4 Insulators on DNA Transposon Vector Mobilization and Silencing in Retinal Pigment Epithelium Cells

PubMed Central

Sharma, Nynne; Hollensen, Anne Kruse; Bak, Rasmus O.; Staunstrup, Nicklas Heine; Schrøder, Lisbeth Dahl; Mikkelsen, Jacob Giehm

2012-01-01

DNA transposons have become important vectors for efficient non-viral integration of transgenes into genomic DNA. The Sleeping Beauty (SB), piggyBac (PB), and Tol2 transposable elements have distinct biological properties and currently represent the most promising transposon systems for animal transgenesis and gene therapy. A potential obstacle, however, for persistent function of integrating vectors is transcriptional repression of the element and its genetic cargo. In this study we analyze the insulating effect of the 1.2-kb 5′-HS4 chicken β-globin (cHS4) insulator element in the context of SB, PB, and Tol2 transposon vectors. By examining transgene expression from genomically inserted transposon vectors encoding a marker gene driven by a silencing-prone promoter, we detect variable levels of transcriptional silencing for the three transposon systems in retinal pigment epithelium cells. Notably, the PB system seems less vulnerable to silencing. Incorporation of cHS4 insulator sequences into the transposon vectors results in 2.2-fold and 1.5-fold increased transgene expression levels for insulated SB and PB vectors, respectively, but an improved persistency of expression was not obtained for insulated transgenes. Colony formation assays and quantitative excision assays unveil enhanced SB transposition efficiencies by the inclusion of the cHS4 element, resulting in a significant increase in the stable transfection rate for insulated SB transposon vectors in human cell lines. Our findings reveal a positive impact of cHS4 insulator inclusion for SB and PB vectors in terms of increased transgene expression levels and improved SB stable transfection rates, but also the lack of a long-term protective effect of the cHS4 insulator against progressive transgene silencing in retinal pigment epithelium cells. PMID:23110238

The mitochondrial genome of the gymnosperm Cycas taitungensis contains a novel family of short interspersed elements, Bpu sequences, and abundant RNA editing sites.

PubMed

Chaw, Shu-Miaw; Shih, Arthur Chun-Chieh; Wang, Daryi; Wu, Yu-Wei; Liu, Shu-Mei; Chou, The-Yuan

2008-03-01

The mtDNA of Cycas taitungensis is a circular molecule of 414,903 bp, making it 2- to 6-fold larger than the known mtDNAs of charophytes and bryophytes, but similar to the average of 7 elucidated angiosperm mtDNAs. It is characterized by abundant RNA editing sites (1,084), more than twice the number found in the angiosperm mtDNAs. The A + T content of Cycas mtDNA is 53.1%, the lowest among known land plants. About 5% of the Cycas mtDNA is composed of a novel family of mobile elements, which we designated as "Bpu sequences." They share a consensus sequence of 36 bp with 2 terminal direct repeats (AAGG) and a recognition site for the Bpu 10I restriction endonuclease (CCTGAAGC). Comparison of the Cycas mtDNA with other plant mtDNAs revealed many new insights into the biology and evolution of land plant mtDNAs. For example, the noncoding sequences in mtDNAs have drastically expanded as land plants have evolved, with abrupt increases appearing in the bryophytes, and then in the seed plants. As a result, the genomic organizations of seed plant mtDNAs are much less compact than in other plants. Also, the Cycas mtDNA appears to have been exempted from the frequent gene loss observed in angiosperm mtDNAs. Similar to the angiosperms, the 3 Cycas genes nad1, nad2, and nad5 are disrupted by 5 group II intron squences, which have brought the genes into trans-splicing arrangements. The evolutionary origin and invasion/duplication mechanism of the Bpu sequences in Cycas mtDNA are hypothesized and discussed.

Structure and decoy-mediated inhibition of the SOX18/Prox1-DNA interaction

PubMed Central

Klaus, Miriam; Prokoph, Nina; Girbig, Mathias; Wang, Xuecong; Huang, Yong-Heng; Srivastava, Yogesh; Hou, Linlin; Narasimhan, Kamesh; Kolatkar, Prasanna R.; Francois, Mathias; Jauch, Ralf

2016-01-01

The transcription factor (TF) SOX18 drives lymphatic vessel development in both embryogenesis and tumour-induced neo-lymphangiogenesis. Genetic disruption of Sox18 in a mouse model protects from tumour metastasis and established the SOX18 protein as a molecular target. Here, we report the crystal structure of the SOX18 DNA binding high-mobility group (HMG) box bound to a DNA element regulating Prox1 transcription. The crystals diffracted to 1.75Å presenting the highest resolution structure of a SOX/DNA complex presently available revealing water structure, structural adjustments at the DNA contact interface and non-canonical conformations of the DNA backbone. To explore alternatives to challenging small molecule approaches for targeting the DNA-binding activity of SOX18, we designed a set of five decoys based on modified Prox1-DNA. Four decoys potently inhibited DNA binding of SOX18 in vitro and did not interact with non-SOX TFs. Serum stability, nuclease resistance and thermal denaturation assays demonstrated that a decoy circularized with a hexaethylene glycol linker and terminal phosphorothioate modifications is most stable. This SOX decoy also interfered with the expression of a luciferase reporter under control of a SOX18-dependent VCAM1 promoter in COS7 cells. Collectively, we propose SOX decoys as potential strategy for inhibiting SOX18 activity to disrupt tumour-induced neo-lymphangiogenesis. PMID:26939885

Eukaryotic gene regulation by targeted chromatin re-modeling at dispersed, middle-repetitive sequence elements.

PubMed

Hodgetts, Ross

2004-12-01

RNA interference might have evolved to minimize the deleterious impact of transposable elements and viruses on eukaryotic genomes, because mutations in genes within the RNAi pathway cause mobilization of transposons in nematodes and flies. Although the first examples of RNAi involved post-transcriptional gene silencing, recently the pathway has been shown to act at the transcriptional level. It does so by establishing a chromatin configuration on the target DNA that has many of the hallmarks of heterochromatin, thus preventing its transcription. Members of dispersed, repeated sequence families appear to have been utilized by the RNAi machinery to regulate nearby genes in yeast. The unusual genomic distribution of three repeated element families in the chicken, fruit-fly and nematode genomes prompts speculation that some of these repeats have been co-opted to control gene expression, either locally or over extended chromosomal domains.

The impact of transposable elements on mammalian development.

PubMed

Garcia-Perez, Jose L; Widmann, Thomas J; Adams, Ian R

2016-11-15

Despite often being classified as selfish or junk DNA, transposable elements (TEs) are a group of abundant genetic sequences that have a significant impact on mammalian development and genome regulation. In recent years, our understanding of how pre-existing TEs affect genome architecture, gene regulatory networks and protein function during mammalian embryogenesis has dramatically expanded. In addition, the mobilization of active TEs in selected cell types has been shown to generate genetic variation during development and in fully differentiated tissues. Importantly, the ongoing domestication and evolution of TEs appears to provide a rich source of regulatory elements, functional modules and genetic variation that fuels the evolution of mammalian developmental processes. Here, we review the functional impact that TEs exert on mammalian developmental processes and discuss how the somatic activity of TEs can influence gene regulatory networks. © 2016. Published by The Company of Biologists Ltd.

Inhibition Mechanism of an Anti-CRISPR Suppressor AcrIIA4 Targeting SpyCas9.

PubMed

Yang, Hui; Patel, Dinshaw J

2017-07-06

Prokaryotic CRISPR-Cas adaptive immune systems utilize sequence-specific RNA-guided endonucleases to defend against infection by viruses, bacteriophages, and mobile elements, while these foreign genetic elements evolve diverse anti-CRISPR proteins to overcome the CRISPR-Cas-mediated defense of the host. Recently, AcrIIA2 and AcrIIA4, encoded by Listeria monocytogene prophages, were shown to block the endonuclease activity of type II-A Streptococcus pyogene Cas9 (SpyCas9). We now report the crystal structure of AcrIIA4 in complex with single-guide RNA-bound SpyCas9, thereby establishing that AcrIIA4 preferentially targets critical residues essential for PAM duplex recognition, as well as blocks target DNA access to key catalytic residues lining the RuvC pocket. These structural insights, validated by biochemical assays on key mutants, demonstrate that AcrIIA4 competitively occupies both PAM-interacting and non-target DNA strand cleavage catalytic pockets. Our studies provide insights into anti-CRISPR-mediated suppression mechanisms for inactivating SpyCas9, thereby broadening the applicability of CRISPR-Cas regulatory tools for genome editing. Published by Elsevier Inc.

Estrogen receptor accessory proteins augment receptor-DNA interaction and DNA bending.

PubMed

Landel, C C; Potthoff, S J; Nardulli, A M; Kushner, P J; Greene, G L

1997-01-01

Increasing evidence suggests that accessory proteins play an important role in the ability of the estrogen receptor (ER) and other nuclear hormone receptors to modulate transcription when bound to cis-acting hormone response elements in target genes. We have previously shown that four proteins, hsp70, protein disulfide isomerase (PDI) and two unknown proteins (p48 and p45), copurify with ER that has been isolated by site-specific DNA chromatography (BERE) and influence the interaction of ER with DNA in vitro. To better define the nature of these effects, we used filter binding and electrophoretic mobility shift assays to study the ability of these proteins to alter the kinetics of ER-DNA interaction and to influence the ability of ER to bend DNA when bound to an estrogen response element (ERE). The results of both assays indicate that ERE-purified ER, with its four associated proteins (hsp70, PDI, p48, p45), has a greater ability to bind to the vitellogenin A2 ERE than ER purified by estradiol-Sepharose chromatography in the absence (ESeph) or presence (EATP) of ATP, in which p48, p45 (ESeph) and hsp70 (EATP) are removed. Surprisingly, the rates of association and dissociation of ER and ERE were essentially the same for all three mixtures, suggesting that one or more ER-associated proteins, especially p45 and p48, may be required for ER to attain maximum DNA binding activity. In addition, circular permutation and phasing analyses demonstrated that the same ER-associated proteins produced higher order ER-DNA complexes that significantly increased the magnitude of DNA distortion, but did not alter the direction of the ER-induced bend of ERE-containing DNA fragments, which was toward the major groove of the DNA helix. These results suggest that p45 and/or p48 and possibly hsp70, play an important role both in the specific DNA binding and bending activities of ER and thus contribute to the overall stimulation of transcription in target genes that contain cis-acting EREs.

Ancient, recurrent phage attacks and recombination shaped dynamic sequence-variable mosaics at the root of phytoplasma genome evolution.

PubMed

Wei, Wei; Davis, Robert E; Jomantiene, Rasa; Zhao, Yan

2008-08-19

Mobile genetic elements have impacted biological evolution across all studied organisms, but evidence for a role in evolutionary emergence of an entire phylogenetic clade has not been forthcoming. We suggest that mobile element predation played a formative role in emergence of the phytoplasma clade. Phytoplasmas are cell wall-less bacteria that cause numerous diseases in plants. Phylogenetic analyses indicate that these transkingdom parasites descended from Gram-positive walled bacteria, but events giving rise to the first phytoplasma have remained unknown. Previously we discovered a unique feature of phytoplasmal genome architecture, genes clustered in sequence-variable mosaics (SVMs), and suggested that such structures formed through recurrent, targeted attacks by mobile elements. In the present study, we discovered that cryptic prophage remnants, originating from phages in the order Caudovirales, formed SVMs and comprised exceptionally large percentages of the chromosomes of 'Candidatus Phytoplasma asteris'-related strains OYM and AYWB, occupying nearly all major nonsyntenic sections, and accounting for most of the size difference between the two genomes. The clustered phage remnants formed genomic islands exhibiting distinct DNA physical signatures, such as dinucleotide relative abundance and codon position GC values. Phytoplasma strain-specific genes identified as phage morons were located in hypervariable regions within individual SVMs, indicating that prophage remnants played important roles in generating phytoplasma genetic diversity. Because no SVM-like structures could be identified in genomes of ancestral relatives including Acholeplasma spp., we hypothesize that ancient phage attacks leading to SVM formation occurred after divergence of phytoplasmas from acholeplasmas, triggering evolution of the phytoplasma clade.

Genomic organization of the Neurospora crassa gsn gene: possible involvement of the STRE and HSE elements in the modulation of transcription during heat shock.

PubMed

Freitas, F Zanolli; Bertolini, M C

2004-12-01

Glycogen synthase, an enzyme involved in glycogen biosynthesis, is regulated by phosphorylation and by the allosteric ligand glucose-6-phosphate (G6P). In addition, enzyme levels can be regulated by changes in gene expression. We recently cloned a cDNA for glycogen synthase ( gsn) from Neurospora crassa, and showed that gsn transcription decreased when cells were exposed to heat shock (shifted from 30 degrees C to 45 degrees C). In order to understand the mechanisms that control gsn expression, we isolated the gene, including its 5' and 3' flanking regions, from the genome of N. crassa. An ORF of approximately 2.4 kb was identified, which is interrupted by four small introns (II-V). Intron I (482 bp) is located in the 5'UTR region. Three putative Transcription Initiation Sites (TISs) were mapped, one of which lies downstream of a canonical TATA-box sequence (5'-TGTATAAA-3'). Analysis of the 5'-flanking region revealed the presence of putative transcription factor-binding sites, including Heat Shock Elements (HSEs) and STress Responsive Elements (STREs). The possible involvement of these motifs in the negative regulation of gsn transcription was investigated using Electrophoretic Mobility Shift Assays (EMSA) with nuclear extracts of N. crassa mycelium obtained before and after heat shock, and DNA fragments encompassing HSE and STRE elements from the 5'-flanking region. While elements within the promoter region are involved in transcription under heat shock, elements in the 5'UTR intron may participate in transcription during vegetative growth. The results thus suggest that N. crassa possesses trans -acting elements that interact with the 5'-flanking region to regulate gsn transcription during heat shock and vegetative growth.

Mobility of P elements in drosophilids and nondrosophilids

USDA-ARS?s Scientific Manuscript database

The mobility properties of the Drosophila melanogaster P element in drosophilid and nondrosophilid species has been determined using a P-element mobility assay that is conducted transiently in insect embryos. P elements are mobilizable in all drosophilids tested, including species outside the genus ...

Transmission of the PabI family of restriction DNA glycosylase genes: mobility and long-term inheritance.

PubMed

Kojima, Kenji K; Kobayashi, Ichizo

2015-10-19

R.PabI is an exceptional restriction enzyme that functions as a DNA glycosylase. The enzyme excises an unmethylated base from its recognition sequence to generate apurinic/apyrimidinic (AP) sites, and also displays AP lyase activity, cleaving the DNA backbone at the AP site to generate the 3'-phospho alpha, beta-unsaturated aldehyde end in addition to the 5'-phosphate end. The resulting ends are difficult to religate with DNA ligase. The enzyme was originally isolated in Pyrococcus, a hyperthermophilic archaeon, and additional homologs subsequently identified in the epsilon class of the Gram-negative bacterial phylum Proteobacteria, such as Helicobacter pylori. Systematic analysis of R.PabI homologs and their neighboring genes in sequenced genomes revealed co-occurrence of R.PabI with M.PabI homolog methyltransferase genes. R.PabI and M.PabI homolog genes are occasionally found at corresponding (orthologous) loci in different species, such as Helicobacter pylori, Helicobacter acinonychis and Helicobacter cetorum, indicating long-term maintenance of the gene pair. One R.PabI and M.PabI homolog gene pair is observed immediately after the GMP synthase gene in both Campylobacter and Helicobacter, representing orthologs beyond genera. The mobility of the PabI family of restriction-modification (RM) system between genomes is evident upon comparison of genomes of sibling strains/species. Analysis of R.PabI and M.PabI homologs in H. pylori revealed an insertion of integrative and conjugative elements (ICE), and replacement with a gene of unknown function that may specify a membrane-associated toxin (hrgC). In view of the similarity of HrgC with toxins in type I toxin-antitoxin systems, we addressed the biological significance of this substitution. Our data indicate that replacement with hrgC occurred in the common ancestor of hspAmerind and hspEAsia. Subsequently, H. pylori with and without hrgC were intermixed at this locus, leading to complex distribution of hrgC in East Asia and the Americas. In Malaysia, hrgC was horizontally transferred from hspEAsia to hpAsia2 strains. The PabI family of RM system behaves as a mobile, selfish genetic element, similar to the other families of Type II RM systems. Our analysis additionally revealed some cases of long-term inheritance. The distribution of the hrgC gene replacing the PabI family in the subpopulations of H. pylori, hspAmerind, hspEAsia and hpAsia2, corresponds to the two human migration events, one from East Asia to Americas and the other from China to Malaysia.

Evolution of divergent DNA recognition specificities in VDE homing endonucleases from two yeast species

PubMed Central

Posey, Karen L.; Koufopanou, Vassiliki; Burt, Austin; Gimble, Frederick S.

2004-01-01

Homing endonuclease genes (HEGs) are mobile DNA elements that are thought to confer no benefit to their host. They encode site-specific DNA endonucleases that perpetuate the element within a species population by homing and disseminate it between species by horizontal transfer. Several yeast species contain the VMA1 HEG that encodes the intein-associated VMA1-derived endonuclease (VDE). The evolutionary state of VDEs from 12 species was assessed by assaying their endonuclease activities. Only two enzymes are active, PI-ZbaI from Zygosaccharomyces bailii and PI-ScaI from Saccharomyces cariocanus. PI-ZbaI cleaves the Z.bailii recognition sequence significantly faster than the Saccharomyces cerevisiae site, which differs at six nucleotide positions. A mutational analysis indicates that PI-ZbaI cleaves the S.cerevisiae substrate poorly due to the absence of a contact that is analogous to one made in PI-SceI between Gln-55 and nucleotides +9/+10. PI-ZbaI cleaves the Z.bailii substrate primarily due to a single base-pair substitution (A/T+5 → T/A+5). Structural modeling of the PI-ZbaI/DNA complex suggests that Arg-331, which is absent in PI-SceI, contacts T/A+5, and the reduced activity observed in a PI-ZbaI R331A mutant provides evidence for this interaction. These data illustrate that homing endonucleases evolve altered specificity as they adapt to recognize alternative target sites. PMID:15280510

Evolution of divergent DNA recognition specificities in VDE homing endonucleases from two yeast species.

PubMed

Posey, Karen L; Koufopanou, Vassiliki; Burt, Austin; Gimble, Frederick S

2004-01-01

Homing endonuclease genes (HEGs) are mobile DNA elements that are thought to confer no benefit to their host. They encode site-specific DNA endonucleases that perpetuate the element within a species population by homing and disseminate it between species by horizontal transfer. Several yeast species contain the VMA1 HEG that encodes the intein-associated VMA1-derived endonuclease (VDE). The evolutionary state of VDEs from 12 species was assessed by assaying their endonuclease activities. Only two enzymes are active, PI-ZbaI from Zygosaccharomyces bailii and PI-ScaI from Saccharomyces cariocanus. PI-ZbaI cleaves the Z.bailii recognition sequence significantly faster than the Saccharomyces cerevisiae site, which differs at six nucleotide positions. A mutational analysis indicates that PI-ZbaI cleaves the S.cerevisiae substrate poorly due to the absence of a contact that is analogous to one made in PI-SceI between Gln-55 and nucleotides +9/+10. PI-ZbaI cleaves the Z.bailii substrate primarily due to a single base-pair substitution (A/T+5 --> T/A+5). Structural modeling of the PI-ZbaI/DNA complex suggests that Arg-331, which is absent in PI-SceI, contacts T/A+5, and the reduced activity observed in a PI-ZbaI R331A mutant provides evidence for this interaction. These data illustrate that homing endonucleases evolve altered specificity as they adapt to recognize alternative target sites.

Development and validation of InnoQuant™, a sensitive human DNA quantitation and degradation assessment method for forensic samples using high copy number mobile elements Alu and SVA.

PubMed

Pineda, Gina M; Montgomery, Anne H; Thompson, Robyn; Indest, Brooke; Carroll, Marion; Sinha, Sudhir K

2014-11-01

There is a constant need in forensic casework laboratories for an improved way to increase the first-pass success rate of forensic samples. The recent advances in mini STR analysis, SNP, and Alu marker systems have now made it possible to analyze highly compromised samples, yet few tools are available that can simultaneously provide an assessment of quantity, inhibition, and degradation in a sample prior to genotyping. Currently there are several different approaches used for fluorescence-based quantification assays which provide a measure of quantity and inhibition. However, a system which can also assess the extent of degradation in a forensic sample will be a useful tool for DNA analysts. Possessing this information prior to genotyping will allow an analyst to more informatively make downstream decisions for the successful typing of a forensic sample without unnecessarily consuming DNA extract. Real-time PCR provides a reliable method for determining the amount and quality of amplifiable DNA in a biological sample. Alu are Short Interspersed Elements (SINE), approximately 300bp insertions which are distributed throughout the human genome in large copy number. The use of an internal primer to amplify a segment of an Alu element allows for human specificity as well as high sensitivity when compared to a single copy target. The advantage of an Alu system is the presence of a large number (>1000) of fixed insertions in every human genome, which minimizes the individual specific variation possible when using a multi-copy target quantification system. This study utilizes two independent retrotransposon genomic targets to obtain quantification of an 80bp "short" DNA fragment and a 207bp "long" DNA fragment in a degraded DNA sample in the multiplex system InnoQuant™. The ratio of the two quantitation values provides a "Degradation Index", or a qualitative measure of a sample's extent of degradation. The Degradation Index was found to be predictive of the observed loss of STR markers and alleles as degradation increases. Use of a synthetic target as an internal positive control (IPC) provides an additional assessment for the presence of PCR inhibitors in the test sample. In conclusion, a DNA based qualitative/quantitative/inhibition assessment system that accurately predicts the status of a biological sample, will be a valuable tool for deciding which DNA test kit to utilize and how much target DNA to use, when processing compromised forensic samples for DNA testing. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

Plant polyphenols mobilize nuclear copper in human peripheral lymphocytes leading to oxidatively generated DNA breakage: implications for an anticancer mechanism.

PubMed

Shamim, Uzma; Hanif, Sarmad; Ullah, M F; Azmi, Asfar S; Bhat, Showket H; Hadi, S M

2008-08-01

It was earlier proposed that an important anti-cancer mechanism of plant polyphenols may involve mobilization of endogenous copper ions, possibly chromatin-bound copper and the consequent pro-oxidant action. This paper shows that plant polyphenols are able to mobilize nuclear copper in human lymphocytes, leading to degradation of cellular DNA. A cellular system of lymphocytes isolated from human peripheral blood and comet assay was used for this purpose. Incubation of lymphocytes with neocuproine (a cell membrane permeable copper chelator) inhibited DNA degradation in intact lymphocytes. Bathocuproine, which is unable to permeate through the cell membrane, did not cause such inhibition. This study has further shown that polyphenols are able to degrade DNA in cell nuclei and that such DNA degradation is inhibited by neocuproine as well as bathocuproine (both of which are able to permeate the nuclear pore complex), suggesting that nuclear copper is mobilized in this reaction. Pre-incubation of lymphocyte nuclei with polyphenols indicates that it is capable of traversing the nuclear membrane. This study has also shown that polyphenols generate oxidative stress in lymphocyte nuclei which is inhibited by scavengers of reactive oxygen species (ROS) and neocuproine. These results indicate that the generation of ROS occurs through mobilization of nuclear copper resulting in oxidatively generated DNA breakage.

Structure of the germline genome of Tetrahymena thermophila and relationship to the massively rearranged somatic genome

PubMed Central

Hamilton, Eileen P; Kapusta, Aurélie; Huvos, Piroska E; Bidwell, Shelby L; Zafar, Nikhat; Tang, Haibao; Hadjithomas, Michalis; Krishnakumar, Vivek; Badger, Jonathan H; Caler, Elisabet V; Russ, Carsten; Zeng, Qiandong; Fan, Lin; Levin, Joshua Z; Shea, Terrance; Young, Sarah K; Hegarty, Ryan; Daza, Riza; Gujja, Sharvari; Wortman, Jennifer R; Birren, Bruce W; Nusbaum, Chad; Thomas, Jainy; Carey, Clayton M; Pritham, Ellen J; Feschotte, Cédric; Noto, Tomoko; Mochizuki, Kazufumi; Papazyan, Romeo; Taverna, Sean D; Dear, Paul H; Cassidy-Hanley, Donna M; Xiong, Jie; Miao, Wei; Orias, Eduardo; Coyne, Robert S

2016-01-01

The germline genome of the binucleated ciliate Tetrahymena thermophila undergoes programmed chromosome breakage and massive DNA elimination to generate the somatic genome. Here, we present a complete sequence assembly of the germline genome and analyze multiple features of its structure and its relationship to the somatic genome, shedding light on the mechanisms of genome rearrangement as well as the evolutionary history of this remarkable germline/soma differentiation. Our results strengthen the notion that a complex, dynamic, and ongoing interplay between mobile DNA elements and the host genome have shaped Tetrahymena chromosome structure, locally and globally. Non-standard outcomes of rearrangement events, including the generation of short-lived somatic chromosomes and excision of DNA interrupting protein-coding regions, may represent novel forms of developmental gene regulation. We also compare Tetrahymena’s germline/soma differentiation to that of other characterized ciliates, illustrating the wide diversity of adaptations that have occurred within this phylum. DOI: http://dx.doi.org/10.7554/eLife.19090.001 PMID:27892853

Methods for detecting the mobility of trace elements during medium-temperature pyrolysis

USGS Publications Warehouse

Shiley, R.H.; Konopka, K.L.; Cahill, R.A.; Hinckley, C.C.; Smith, Gerard V.; Twardowska, H.; Saporoschenko, Mykola

1983-01-01

The mobility (volatility) of trace elements in coal during pyrolysis has been studied for distances of up to 40 cm between the coal and the trace element collector, which was graphite or a baffled solvent trap. Nineteen elements not previously recorded as mobile were detected. ?? 1983.

Epigenetic Differentiation of Natural Populations of Lilium bosniacum Associated with Contrasting Habitat Conditions.

PubMed

Zoldoš, Vlatka; Biruš, Ivan; Muratovic, Edina; Šatovic, Zlatko; Vojta, Aleksandar; Robin, Odile; Pustahija, Fatima; Bogunic, Faruk; Vicic Bockor, Vedrana; Siljak-Yakovlev, Sonja

2018-01-01

Epigenetic variation in natural populations with contrasting habitats might be an important element, in addition to the genetic variation, in plant adaptation to environmental stress. Here, we assessed genetic, epigenetic, and cytogenetic structure of the three Lilium bosniacum populations growing on distinct habitats. One population was growing under habitual ecological conditions for this species and the other two were growing under stress associated with high altitude and serpentine soil. Amplified fragment length polymorphism and methylation-sensitive amplification polymorphism analyses revealed that the three populations did not differentiate genetically, but were clearly separated in three distinct clusters according to DNA methylation profiles. Principal coordinate analysis showed that overall epigenetic variation was closely related to habitat conditions. A new methylation-sensitive amplification polymorphism scoring approach allowed identification of mainly unmethylated (φST = 0.190) and fully CpG methylated (φST = 0.118) subepiloci playing a role in overall population differentiation, in comparison with hemimethylated sites (φST = 0.073). In addition, unusual rDNA repatterning and the presence of B chromosomes bearing 5S rDNA loci were recorded in the population growing on serpentine soil, suggesting dynamic chromosome rearrangements probably linked to global genome demethylation, which might have reactivated some mobile elements. We discuss our results considering our earlier data on morphology and leaf anatomy of several L. bosniacum populations, and suggest a possible role of epigenetics as a key element in population differentiation associated with environmental stress in these particular lily populations. © The Author(s) 2018. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

Characterization of the repetitive DNA elements in the genome of fish lymphocystis disease viruses.

PubMed

Schnitzler, P; Darai, G

1989-09-01

The complete DNA nucleotide sequence of the repetitive DNA elements in the genome of fish lymphocystis disease virus (FLDV) isolated from two different species (flounder and dab) was determined. The size of these repetitive DNA elements was found to be 1413 bp which corresponds to the DNA sequences of the 5' terminus of the EcoRI DNA fragment B (0.034 to 0.052 m.u.) and to the EcoRI DNA fragment M (0.718 to 0.736 m.u.) of the FLDV genome causing lymphocystis disease in flounder and plaice. The degree of DNA nucleotide homology between both regions was found to be 99%. The repetitive DNA element in the genome of FLDV isolated from other fish species (dab) was identified and is located within the EcoRI DNA fragment B and J of the viral genome. The DNA nucleotide sequence of one duplicate of this repetition (EcoRI DNA fragment J) was determined (1410 bp) and compared to the DNA nucleotide sequences of the repetitive DNA elements of the genome of FLDV isolated from flounder. It was found that the repetitive DNA elements of the genome of FLDV derived from two different fish species are highly conserved and possess a degree of DNA sequence homology of 94%. The DNA sequences of each strand of the individual repetitive element possess one open reading frame.

Gel shift analysis of the empA promoter region in Vibrio anguillarum

PubMed Central

Denkin, Steven M; Sekaric, Pedja; Nelson, David R

2004-01-01

Background The induction of metalloprotease encoded by empA in Vibrio anguillarum occurs at high cell density in salmon intestinal mucus. Previously we have shown that there are significant differences in empA expression in two strains of V. anguillarum, M93Sm and NB10. It is hypothesized that differences in empA regulation are due to differences in binding of regulatory elements. Results Two strains of V. anguillarum, M93Sm and NB10, were examined and compared for the presence of DNA regulatory proteins that bind to and control the empA promoter region. Gel mobility shift assays, using a digoxigenin (DIG)-labeled oligomer containing a lux box-like element and the promoter for empA, were done to demonstrate the presence of a DNA-binding protein. Protein extracts from NB10 cells incubated in Luria Bertani broth + 2% NaCl (LB20), nine salts solution + 200 μg/ml mucus (NSSM), 3M (marine minimal medium), or NSS resulted in a gel mobility shift. No gel mobility shift was seen when protein extracts from either LB20- or NSSM-grown M93Sm cells were mixed with the DIG-labeled empA oligomer. The azocasein assay detected protease activity in all incubation conditions for NB10 culture supernatants. In contrast, protease activity was detected in M93Sm culture supernatants only when incubated in NSSM. Since the luxR homologue in V. anguillarum, vanT, has been cloned, sequenced, and shown to be required for protease activity, we wanted to determine if vanT mutants of NB10 exhibit the same gel shift observed in the wild-type. Site-directed mutagenesis was used to create vanT mutants in V. anguillarum M93Sm and NB10 to test whether VanT is involved with the gel mobility shift. Both vanT mutants, M02 and NB02, did not produce protease activity in any conditions. However, protein extracts from NB02 incubated in each condition still exhibited a gel shift when mixed with the DIG-labeled empA oligomer. Conclusions The data demonstrate that protein extracts of V. anguillarum NB10 cells contain a protein that binds to a 50 bp oligomer containing the empA promoter-lux box-like region. NB10 cells express empA during stationary phase in all growth conditions. The DNA binding protein is not present in M93Sm extracts. M93Sm cells express protease activity only when incubated at high cell density in fish gastrointestinal mucus. The gel shift observed with NB10 cells is not due to VanT binding. The data also suggest that the DNA binding protein is responsible for the less restrictive expression of empA in NB10 compared to M93Sm. PMID:15516264

Yeast one-hybrid system used to identify the binding proteins for rat glutathione S-transferase P enhancer I.

PubMed

Liao, Ming-Xiang; Liu, Dong-Yuan; Zuo, Jin; Fang, Fu-De

2002-03-01

To detect the trans-factors specifically binding to the strong enhancer element (GPEI) in the upstream of rat glutathione S-transferase P (GST-P) gene. Yeast one-hybrid system was used to screen rat lung MATCHMAKER cDNA library to identify potential trans-factors that can interact with core sequence of GPEI(cGPEI). Electrophoresis mobility shift assay (EMSA) was used to analyze the binding of transfactors to cGPEI. cDNA fragments coding for the C-terminal part of the transcription factor c-Jun and rat adenine nucleotide translocator (ANT) were isolated. The binding of c-Jun and ANT to GPEI core sequence were confirmed. Rat c-jun transcriptional factor and ANT may interact with cGPEI. They could play an important role in the induced expression of GST-P gene.

Endonuclease-independent LINE-1 retrotransposition at mammalian telomeres.

PubMed

Morrish, Tammy A; Garcia-Perez, José Luis; Stamato, Thomas D; Taccioli, Guillermo E; Sekiguchi, JoAnn; Moran, John V

2007-03-08

Long interspersed element-1 (LINE-1 or L1) elements are abundant, non-long-terminal-repeat (non-LTR) retrotransposons that comprise approximately 17% of human DNA. The average human genome contains approximately 80-100 retrotransposition-competent L1s (ref. 2), and they mobilize by a process that uses both the L1 endonuclease and reverse transcriptase, termed target-site primed reverse transcription. We have previously reported an efficient, endonuclease-independent L1 retrotransposition pathway (EN(i)) in certain Chinese hamster ovary (CHO) cell lines that are defective in the non-homologous end-joining (NHEJ) pathway of DNA double-strand-break repair. Here we have characterized EN(i) retrotransposition events generated in V3 CHO cells, which are deficient in DNA-dependent protein kinase catalytic subunit (DNA-PKcs) activity and have both dysfunctional telomeres and an NHEJ defect. Notably, approximately 30% of EN(i) retrotransposition events insert in an orientation-specific manner adjacent to a perfect telomere repeat (5'-TTAGGG-3'). Similar insertions were not detected among EN(i) retrotransposition events generated in controls or in XR-1 CHO cells deficient for XRCC4, an NHEJ factor that is required for DNA ligation but has no known function in telomere maintenance. Furthermore, transient expression of a dominant-negative allele of human TRF2 (also called TERF2) in XRCC4-deficient XR-1 cells, which disrupts telomere capping, enables telomere-associated EN(i) retrotransposition events. These data indicate that L1s containing a disabled endonuclease can use dysfunctional telomeres as an integration substrate. The findings highlight similarities between the mechanism of EN(i) retrotransposition and the action of telomerase, because both processes can use a 3' OH for priming reverse transcription at either internal DNA lesions or chromosome ends. Thus, we propose that EN(i) retrotransposition is an ancestral mechanism of RNA-mediated DNA repair associated with non-LTR retrotransposons that may have been used before the acquisition of an endonuclease domain.

Location analysis for the estrogen receptor-α reveals binding to diverse ERE sequences and widespread binding within repetitive DNA elements

PubMed Central

Mason, Christopher E.; Shu, Feng-Jue; Wang, Cheng; Session, Ryan M.; Kallen, Roland G.; Sidell, Neil; Yu, Tianwei; Liu, Mei Hui; Cheung, Edwin; Kallen, Caleb B.

2010-01-01

Location analysis for estrogen receptor-α (ERα)-bound cis-regulatory elements was determined in MCF7 cells using chromatin immunoprecipitation (ChIP)-on-chip. Here, we present the estrogen response element (ERE) sequences that were identified at ERα-bound loci and quantify the incidence of ERE sequences under two stringencies of detection: <10% and 10–20% nucleotide deviation from the canonical ERE sequence. We demonstrate that ∼50% of all ERα-bound loci do not have a discernable ERE and show that most ERα-bound EREs are not perfect consensus EREs. Approximately one-third of all ERα-bound ERE sequences reside within repetitive DNA sequences, most commonly of the AluS family. In addition, the 3-bp spacer between the inverted ERE half-sites, rather than being random nucleotides, is C(A/T)G-enriched at bona fide receptor targets. Diverse ERα-bound loci were validated using electrophoretic mobility shift assay and ChIP-polymerase chain reaction (PCR). The functional significance of receptor-bound loci was demonstrated using luciferase reporter assays which proved that repetitive element ERE sequences contribute to enhancer function. ChIP-PCR demonstrated estrogen-dependent recruitment of the coactivator SRC3 to these loci in vivo. Our data demonstrate that ERα binds to widely variant EREs with less sequence specificity than had previously been suspected and that binding at repetitive and nonrepetitive genomic targets is favored by specific trinucleotide spacers. PMID:20047966

Location analysis for the estrogen receptor-alpha reveals binding to diverse ERE sequences and widespread binding within repetitive DNA elements.

PubMed

Mason, Christopher E; Shu, Feng-Jue; Wang, Cheng; Session, Ryan M; Kallen, Roland G; Sidell, Neil; Yu, Tianwei; Liu, Mei Hui; Cheung, Edwin; Kallen, Caleb B

2010-04-01

Location analysis for estrogen receptor-alpha (ERalpha)-bound cis-regulatory elements was determined in MCF7 cells using chromatin immunoprecipitation (ChIP)-on-chip. Here, we present the estrogen response element (ERE) sequences that were identified at ERalpha-bound loci and quantify the incidence of ERE sequences under two stringencies of detection: <10% and 10-20% nucleotide deviation from the canonical ERE sequence. We demonstrate that approximately 50% of all ERalpha-bound loci do not have a discernable ERE and show that most ERalpha-bound EREs are not perfect consensus EREs. Approximately one-third of all ERalpha-bound ERE sequences reside within repetitive DNA sequences, most commonly of the AluS family. In addition, the 3-bp spacer between the inverted ERE half-sites, rather than being random nucleotides, is C(A/T)G-enriched at bona fide receptor targets. Diverse ERalpha-bound loci were validated using electrophoretic mobility shift assay and ChIP-polymerase chain reaction (PCR). The functional significance of receptor-bound loci was demonstrated using luciferase reporter assays which proved that repetitive element ERE sequences contribute to enhancer function. ChIP-PCR demonstrated estrogen-dependent recruitment of the coactivator SRC3 to these loci in vivo. Our data demonstrate that ERalpha binds to widely variant EREs with less sequence specificity than had previously been suspected and that binding at repetitive and nonrepetitive genomic targets is favored by specific trinucleotide spacers.

Dual DNA binding property of ABA insensitive 3 like factors targeted to promoters responsive to ABA and auxin.

PubMed

Nag, Ronita; Maity, Manas Kanti; Dasgupta, Maitrayee

2005-11-01

The ABA responsive ABI3 and the auxin responsive ARF family of transcription factors bind the CATGCATG (Sph) and TGTCTC core motifs in ABA and auxin response elements (ABRE and AuxRE), respectively. Several evidences indicate ABI3s to act downstream to auxin too. Because DNA binding domain of ABI3s shows significant overlap with ARFs we enquired whether auxin responsiveness through ABI3s could be mediated by their binding to canonical AuxREs. Investigations were undertaken through in vitro gel mobility shift assays (GMSA) using the DNA binding domain B3 of PvAlf (Phaseolus vulgaris ABI3 like factor) and upstream regions of auxin responsive gene GH3 (-267 to -141) and ABA responsive gene Em (-316 to -146) harboring AuxRE and ABRE, respectively. We demonstrate that B3 domain of PvAlf could bind AuxRE only when B3 was associated with its flanking domain B2 (B2B3). Such strict requirement of B2 domain was not observed with ABRE, where B3 could bind with or without being associated with B2. This dual specificity in DNA binding of ABI3s was also demonstrated with nuclear extracts of cultured cells of Arachis hypogea. Supershift analysis of ABRE and AuxRE bound nuclear proteins with antibodies raised against B2B3 domains of PvAlf revealed that ABI3 associated complexes were detectable in association with both cis elements. Competition GMSA confirmed the same complexes to bind ABRE and AuxRE. This dual specificity of ABI3 like factors in DNA binding targeted to natural promoters responsive to ABA and auxin suggests them to have a potential role in conferring crosstalk between these two phytohormones.

High mobility organic field-effect transistor based on water-soluble deoxyribonucleic acid via spray coating

NASA Astrophysics Data System (ADS)

Shi, Wei; Han, Shijiao; Huang, Wei; Yu, Junsheng

2015-01-01

High mobility organic field-effect transistors (OFETs) by inserting water-soluble deoxyribonucleic acid (DNA) buffer layer between electrodes and pentacene film through spray coating process were fabricated. Compared with the OFETs incorporated with DNA in the conventional organic solvents of ethanol and methanol: water mixture, the water-soluble DNA based OFET exhibited an over four folds enhancement of field-effect mobility from 0.035 to 0.153 cm2/Vs. By characterizing the surface morphology and the crystalline structure of pentacene active layer through atomic force microscope and X-ray diffraction, it was found that the adoption of water solvent in DNA solution, which played a key role in enhancing the field-effect mobility, was ascribed to both the elimination of the irreversible organic solvent-induced bulk-like phase transition of pentacene film and the diminution of a majority of charge trapping at interfaces in OFETs.

Phyto (in)stabilization of elements.

PubMed

Jacob, Donna L; Otte, Marinus L; Hopkins, David G

2011-01-01

The effects of plants (corn, soybean, and sunflower) and fertilizer on mobility of more than 60 elements were assessed in a greenhouse experiment. Unplanted columns with the same soil served as controls. Half the columns received fertilizer and all columns were watered at the same rate. At the end of the experiment, the columns were watered to mimic a rainstorm event such that water drained from the bases of the columns, which was collected and analyzed for element content. Soil from between the roots of the plants was also collected and the water-extractable fraction determined. It was expected that (1) more mobile elements, as measured by water extraction, would be leached from the soils at a higher rate compared to less mobile elements, (2) plants would immobilize most elements, but that some would be immobilized, and (3) that this would depend on plant species. The results led to the following conclusions: plants cause metal mobility to vary over a wide range for a specific soil and do mobilize some elements (e.g., Th) while immobilizing others (e.g., U). The effects depended on plant species for some elements. Water-extractable fractions of elements do not predict mobility.

Gel electrophoresis of linear and star-branched DNA

NASA Astrophysics Data System (ADS)

Lau, Henry W.; Archer, Lynden A.

2011-12-01

The electrophoretic mobility of double-stranded DNA in polyacrylamide gel is investigated using an activated hopping model for the transport of a charged object within a heterogeneous medium. The model is premised upon a representation of the DNA path through the gel matrix as a series of traps with alternating large and small cross sections. Calculations of the trap dimensions from gel data show that the path imposes varying degrees of confinement upon migrating analytes, which retard their forward motion in a size-dependent manner. An expression derived for DNA mobility is shown to provide accurate predictions for the dynamics of linear DNA (67-622 bp) in gels of multiple concentrations. For star-branched DNA, the incorporation within the model of a length scale previously proposed to account for analyte architecture [Yuan , Anal. Chem.ANCHAM0003-270010.1021/ac060414w 78, 6179 (2006)] leads to mobility predictions that compare well with experimental results for a wide range of DNA shapes and molecular weights.

Highly conserved elements discovered in vertebrates are present in non-syntenic loci of tunicates, act as enhancers and can be transcribed during development

PubMed Central

Sanges, Remo; Hadzhiev, Yavor; Gueroult-Bellone, Marion; Roure, Agnes; Ferg, Marco; Meola, Nicola; Amore, Gabriele; Basu, Swaraj; Brown, Euan R.; De Simone, Marco; Petrera, Francesca; Licastro, Danilo; Strähle, Uwe; Banfi, Sandro; Lemaire, Patrick; Birney, Ewan; Müller, Ferenc; Stupka, Elia

2013-01-01

Co-option of cis-regulatory modules has been suggested as a mechanism for the evolution of expression sites during development. However, the extent and mechanisms involved in mobilization of cis-regulatory modules remains elusive. To trace the history of non-coding elements, which may represent candidate ancestral cis-regulatory modules affirmed during chordate evolution, we have searched for conserved elements in tunicate and vertebrate (Olfactores) genomes. We identified, for the first time, 183 non-coding sequences that are highly conserved between the two groups. Our results show that all but one element are conserved in non-syntenic regions between vertebrate and tunicate genomes, while being syntenic among vertebrates. Nevertheless, in all the groups, they are significantly associated with transcription factors showing specific functions fundamental to animal development, such as multicellular organism development and sequence-specific DNA binding. The majority of these regions map onto ultraconserved elements and we demonstrate that they can act as functional enhancers within the organism of origin, as well as in cross-transgenesis experiments, and that they are transcribed in extant species of Olfactores. We refer to the elements as ‘Olfactores conserved non-coding elements’. PMID:23393190

Inhibitory Effects of Bangladeshi Medicinal Plant Extracts on Interactions between Transcription Factors and Target DNA Sequences

PubMed Central

Lampronti, Ilaria; Khan, Mahmud T.H.; Borgatti, Monica; Bianchi, Nicoletta

2008-01-01

Several transcription factors (TFs) play crucial roles in governing the expression of different genes involved in the immune response, embryo or cell lineage development, cell apoptosis, cell cycle progression, oncogenesis, repair and fibrosis processes and inflammation. As far as inflammation, TFs playing pivotal roles are nuclear factor kappa B (NF-kB), activator protein (AP-1), signal transducer and activator of transcription (STATs), cAMP response element binding protein (CREB) and GATA-1 factors. All these TFs regulate the expression of pro-inflammatory cytokines and are involved in the pathogenesis of a number of human disorders, particularly those with an inflammatory component. Since several medicinal plants can be employed to produce extracts exhibiting biological effects and because alteration of gene transcription represents a very interesting approach to control the expression of selected genes, this study sought to verify the ability of several extracts derived from Bangladeshi medicinal plants in interfering with molecular interactions between different TFs and specific DNA sequences. We first analyzed the antiproliferative activity of 19 medicinal plants on different human cell lines, including erythroleukemia K562, B lymphoid Raji and T lymphoid Jurkat cell lines. Secondly, we employed the electrophoretic mobility shift assay as a suitable technique for a fast screening of plant extracts altering the binding between NF-kB, AP-1, GATA-1, STAT-3, CREB and the relative target DNA elements. PMID:18830455

Specific DNA binding of a potential transcriptional regulator, inosine 5'-monophosphate dehydrogenase-related protein VII, to the promoter region of a methyl coenzyme m reductase I-encoding operon retrieved from Methanothermobacter thermautotrophicus strain DeltaH.

PubMed

Shinzato, Naoya; Enoki, Miho; Sato, Hiroaki; Nakamura, Kohei; Matsui, Toru; Kamagata, Yoichi

2008-10-01

Two methyl coenzyme M reductases (MCRs) encoded by the mcr and mrt operons of the hydrogenotrophic methanogen Methanothermobacter thermautotrophicus DeltaH are expressed in response to H(2) availability. In the present study, cis elements and trans-acting factors responsible for the gene expression of MCRs were investigated by using electrophoretic mobility shift assay (EMSA) and affinity particle purification. A survey of their operator regions by EMSA with protein extracts from mrt-expressing cultures restricted them to 46- and 41-bp-long mcr and mrt upstream regions, respectively. Affinity particle purification of DNA-binding proteins conjugated with putative operator regions resulted in the retrieval of a protein attributed to IMP dehydrogenase-related protein VII (IMPDH VII). IMPDH VII is predicted to have a winged helix-turn-helix DNA-binding motif and two cystathionine beta-synthase domains, and it has been suspected to be an energy-sensing module. EMSA with oligonucleotide probes with unusual sequences showed that the binding site of IMPDH VII mostly overlaps the factor B-responsible element-TATA box of the mcr operon. The results presented here suggest that IMPDH VII encoded by MTH126 is a plausible candidate for the transcriptional regulator of the mcr operon in this methanogen.

Identification and characterization of TF1(phox), a DNA-binding protein that increases expression of gp91(phox) in PLB985 myeloid leukemia cells.

PubMed

Eklund, E A; Kakar, R

1997-04-04

The CYBB gene encodes gp91(phox), the heavy chain of the phagocyte-specific NADPH oxidase. CYBB is transcriptionally inactive until the promyelocyte stage of myelopoiesis, and in mature phagocytes, expression of gp91(phox) is further increased by interferon-gamma (IFN-gamma) and other inflammatory mediators. The CYBB promoter region contains several lineage-specific cis-elements involved in the IFN-gamma response. We screened a leukocyte cDNA expression library for proteins able to bind to one of these cis-elements (-214 to -262 base pairs) and identified TF1(phox), a protein with sequence-specific binding to the CYBB promoter. Electrophoretic mobility shift assay with nuclear proteins from a variety of cell lines demonstrated binding of a protein to the CYBB promoter that was cross-immunoreactive with TF1(phox). DNA binding of this protein was increased by IFN-gamma treatment in the myeloid cell line PLB985, but not in the non-myeloid cell line HeLa. Overexpression of recombinant TF1(phox) in PLB985 cells increased endogenous gp91(phox) message abundance, but did not lead to cellular differentiation. Overexpression of TF1(phox) in myeloid leukemia cell lines increased reporter gene expression from artificial promoter constructs containing CYBB promoter sequence. These data suggested that TF1(phox) increased expression of gp91(phox).

pTC Plasmids from Sulfolobus Species in the Geothermal Area of Tengchong, China: Genomic Conservation and Naturally-Occurring Variations as a Result of Transposition by Mobile Genetic Elements

PubMed Central

Xiang, Xiaoyu; Huang, Xiaoxing; Wang, Haina; Huang, Li

2015-01-01

Plasmids occur frequently in Archaea. A novel plasmid (denoted pTC1) containing typical conjugation functions has been isolated from Sulfolobus tengchongensis RT8-4, a strain obtained from a hot spring in Tengchong, China, and characterized. The plasmid is a circular double-stranded DNA molecule of 20,417 bp. Among a total of 26 predicted pTC1 ORFs, 23 have homologues in other known Sulfolobus conjugative plasmids (CPs). pTC1 resembles other Sulfolobus CPs in genome architecture, and is most highly conserved in the genomic region encoding conjugation functions. However, attempts to demonstrate experimentally the capacity of the plasmid for conjugational transfer were unsuccessful. A survey revealed that pTC1 and its closely related plasmid variants were widespread in the geothermal area of Tengchong. Variations of the plasmids at the target sites for transposition by an insertion sequence (IS) and a miniature inverted-repeat transposable element (MITE) were readily detected. The IS was efficiently inserted into the pTC1 genome, and the inserted sequence was inactivated and degraded more frequently in an imprecise manner than in a precise manner. These results suggest that the host organism has evolved a strategy to maintain a balance between the insertion and elimination of mobile genetic elements to permit genomic plasticity while inhibiting their fast spreading. PMID:25686154

pTC Plasmids from Sulfolobus Species in the Geothermal Area of Tengchong, China: Genomic Conservation and Naturally-Occurring Variations as a Result of Transposition by Mobile Genetic Elements.

PubMed

Xiang, Xiaoyu; Huang, Xiaoxing; Wang, Haina; Huang, Li

2015-02-12

Plasmids occur frequently in Archaea. A novel plasmid (denoted pTC1) containing typical conjugation functions has been isolated from Sulfolobus tengchongensis RT8-4, a strain obtained from a hot spring in Tengchong, China, and characterized. The plasmid is a circular double-stranded DNA molecule of 20,417 bp. Among a total of 26 predicted pTC1 ORFs, 23 have homologues in other known Sulfolobus conjugative plasmids (CPs). pTC1 resembles other Sulfolobus CPs in genome architecture, and is most highly conserved in the genomic region encoding conjugation functions. However, attempts to demonstrate experimentally the capacity of the plasmid for conjugational transfer were unsuccessful. A survey revealed that pTC1 and its closely related plasmid variants were widespread in the geothermal area of Tengchong. Variations of the plasmids at the target sites for transposition by an insertion sequence (IS) and a miniature inverted-repeat transposable element (MITE) were readily detected. The IS was efficiently inserted into the pTC1 genome, and the inserted sequence was inactivated and degraded more frequently in an imprecise manner than in a precise manner. These results suggest that the host organism has evolved a strategy to maintain a balance between the insertion and elimination of mobile genetic elements to permit genomic plasticity while inhibiting their fast spreading.

Electrophoresis of DNA in agarose gels, polyacrylamide gels and in free solution

PubMed Central

Stellwagen, Nancy C.

2009-01-01

This review describes the electrophoresis of curved and normal DNA molecules in agarose gels, polyacrylamide gels and in free solution. These studies were undertaken to clarify why curved DNA molecules migrate anomalously slowly in polyacrylamide gels but not in agarose gels. Two milestone papers are cited, in which Ferguson plots were used to estimate the effective pore size of agarose and polyacrylamide gels. Subsequent studies on the effect of the electric field on agarose and polyacrylamide gel matrices, DNA interactions with the two gel matrices, and the effect of curvature on the free solution mobility of DNA are also described. The combined results suggest that the anomalously slow mobilities observed for curved DNA molecules in polyacrylamide gels are due primarily to preferential interactions of curved DNAs with the polyacrylamide gel matrix; the restrictive pore size of the matrix is of lesser importance. In free solution, DNA mobilities increase with increasing molecular mass until leveling off at a plateau value of (3.17 ± 0.01) × 10-4 cm2/Vs in 40 mM Tris-acetate-EDTA buffer at 20°C. Curved DNA molecules migrate anomalously slowly in free solution as well as in polyacrylamide gels, explaining why the Ferguson plots of curved and normal DNAs containing the same number of base pairs extrapolate to different mobilities at zero gel concentration. PMID:19517510

Vector for IS element entrapment and functional characterization based on turning on expression of distal promoterless genes.

PubMed

Szeverényi, I; Hodel, A; Arber, W; Olasz, F

1996-09-26

We constructed and characterized a novel trap vector for rapid isolation of insertion sequences. The strategy used for the isolation of IS elements is based on the ability of many IS elements to turn on the expression of otherwise silent genes distal to some sites of insertion. The simple transposition of an IS element can sometimes cause the constitutive expression of promoterless antibiotic resistance genes resulting in selectable phenotypes. The trap vector pAW1326 is based on a pBR322 replicon, it carries ampicillin and streptomycin resistance genes, and also silenced genes that confer chloramphenicol and kanamycin resistance once activated. The trap vector pAW1326 proved to be efficient and 85 percent of all isolated mutations were insertions. The majority of IS elements resident in the studied Escherichia coli strains tested became trapped, namely IS2, IS3, IS5, IS150, IS186 and Tn1000. We also encountered an insertion sequence, called IS10L/R-2, which is a hybrid of the two IS variants IS10L and IS10R. IS10L/R-2 is absent from most E. coli strains, but it is detectable in some strains such as JM109 which had been submitted to Tn10 mutagenesis. The distribution of the insertion sequences within the trap region was not random. Rather, the integration of chromosomal mobile genetic elements into the offered target sequence occurred in element-specific clusters. This is explained both by the target specificity and by the specific requirements for the activation of gene transcription by the DNA rearrangement. The employed trap vector pAW1326 proved to be useful for the isolation of mobile genetic elements, for a demonstration of their transposition activity as well as for the further characterization of some of the functional parameters of transposition.

Using Electrophoretic Mobility Shift Assays to Measure Equilibrium Dissociation Constants: GAL4-p53 Binding DNA as a Model System

ERIC Educational Resources Information Center

Heffler, Michael A.; Walters, Ryan D.; Kugel, Jennifer F.

2012-01-01

An undergraduate biochemistry laboratory experiment is described that will teach students the practical and theoretical considerations for measuring the equilibrium dissociation constant (K[subscript D]) for a protein/DNA interaction using electrophoretic mobility shift assays (EMSAs). An EMSA monitors the migration of DNA through a native gel;…

Densely ionizing radiation affects DNA methylation of selective LINE-1 elements

DOE Office of Scientific and Technical Information (OSTI.GOV)

Prior, Sara; Miousse, Isabelle R.

Long Interspersed Nucleotide Element 1 (LINE-1) retrotransposons are heavily methylated and are the most abundant transposable elements in mammalian genomes. Here, we investigated the differential DNA methylation within the LINE-1 under normal conditions and in response to environmentally relevant doses of sparsely and densely ionizing radiation. We demonstrate that DNA methylation of LINE-1 elements in the lungs of C57BL6 mice is dependent on their evolutionary age, where the elder age of the element is associated with the lower extent of DNA methylation. Exposure to 5-aza-2′-deoxycytidine and methionine-deficient diet affected DNA methylation of selective LINE-1 elements in an age- and promotermore » type-dependent manner. Exposure to densely IR, but not sparsely IR, resulted in DNA hypermethylation of older LINE-1 elements, while the DNA methylation of evolutionary younger elements remained mostly unchanged. We also demonstrate that exposure to densely IR increased mRNA and protein levels of LINE-1 via the loss of the histone H3K9 dimethylation and an increase in the H3K4 trimethylation at the LINE-1 5′-untranslated region, independently of DNA methylation. Our findings suggest that DNA methylation is important for regulation of LINE-1 expression under normal conditions, but histone modifications may dictate the transcriptional activity of LINE-1 in response to exposure to densely IR. - Highlights: • DNA methylation of LINE-1 elements is dependent on their evolutionary age. • Densely ionizing radiation affects DNA methylation of selective LINE-1 elements. • Radiation-induced reactivation of LINE-1 is DNA methylation-independent. • Histone modifications dictate the transcriptional activity of LINE-1.« less

The Ty1 LTR-retrotransposon of budding yeast, Saccharomyces cerevisiae

PubMed Central

Curcio, M. Joan; Lutz, Sheila; Lesage, Pascale

2015-01-01

Summary Long-terminal repeat (LTR)-retrotransposons generate a copy of their DNA (cDNA) by reverse transcription of their RNA genome in cytoplasmic nucleocapsids. They are widespread in the eukaryotic kingdom and are the evolutionary progenitors of retroviruses [1]. The Ty1 element of the budding yeast Saccharomyces cerevisiae was the first LTR-retrotransposon demonstrated to mobilize through an RNA intermediate, and not surprisingly, is the best studied. The depth of our knowledge of Ty1 biology stems not only from the predominance of active Ty1 elements in the S. cerevisiae genome but also the ease and breadth of genomic, biochemical and cell biology approaches available to study cellular processes in yeast. This review describes the basic structure of Ty1 and its gene products, the replication cycle, the rapidly expanding compendium of host co-factors known to influence retrotransposition and the nature of Ty1's elaborate symbiosis with its host. Our goal is to illuminate the value of Ty1 as a paradigm to explore the biology of LTR-retrotransposons in multicellular organisms, where the low frequency of retrotransposition events presents a formidable barrier to investigations of retrotransposon biology. PMID:25893143

Oxidation of a critical methionine modulates DNA binding of the Drosophila melanogaster high mobility group protein, HMG-D.

PubMed

Dow, L K; Changela, A; Hefner, H E; Churchill, M E

1997-09-15

HMG-D is a major high mobility group chromosomal protein present during early embryogenesis in Drosophila melanogaster. During overexpression and purification of HMG-D from E. coli, a key DNA binding residue, methionine 13, undergoes oxidation to methionine sulfoxide. Oxidation of this critical residue decreases the affinity of HMG-D for DNA by three-fold, altering the structure of the HMG-D-DNA complex without affecting the structure of the free protein. This work shows that minor modification of DNA intercalating residues may be used to fine tune the DNA binding affinity of HMG domain proteins.

Interactions of trans-acting factor(s) with the estradiol response element and nuclear factor 1 of the vitellogenin II gene of Japanese quail.

PubMed

Gupta, S; Upadhayay, R; Kanungo, M S

1996-08-01

This study was directed at achieving an understanding of the mechanisms by which steroid hormones control the synthesis of vitellogenin (VTG) protein in the liver of the Japanese quail. Northern hybridization shows that administration of estradiol alone or with progesterone stimulates the synthesis of VTG mRNA. Gel mobility shift assay of DNA fragments containing the ERE and NF 1 shows that estradiol alone or with progesterone increases the levels of nuclear proteins that bind to these cis-acting elements of the promoter of the VTG gene. The cooperative effect of the two hormones seen at the level of expression of the VTG gene may be due to protein-protein interactions of trans-acting factors that bind to ERE and NF 1.

Mobile units of DNA in phytoplasma genomes.

PubMed

Dickinson, Matt

2010-09-01

Phytoplasmas are obligate symbionts of plants and insects that are responsible for significant yield losses in diverse crops. Genome sequencing has revealed that many phytoplasma genomes appear to contain repeated genes organized in units of approximately 20 kb. These 'potential mobile units' (PMUs) resemble composite replicative transposons. PMUs contain several genes for recombination and some also contain putative 'virulence genes'. Genome alignments suggest that PMUs are involved in phytoplasma genome instability and recombination. In this edition of Molecular Microbiology, Hogenhout and colleagues report that one PMU from the aster yellows phytoplasma strain Witches' Broom (AY-WB) can exist as both a linear PMU within the chromosome and as an extrachromosomal circular form. The copy number of the circular form is much higher in the insect vector compared with the plant, and expression levels of genes present on the PMU are also higher in the insect. These observations suggest not only that this PMU could be a mobile element, but that it could also be involved in a phase-variation mechanism that allows the phytoplasma to adapt to its different hosts.

Single DNA imaging and length quantification through a mobile phone microscope

NASA Astrophysics Data System (ADS)

Wei, Qingshan; Luo, Wei; Chiang, Samuel; Kappel, Tara; Mejia, Crystal; Tseng, Derek; Chan, Raymond Yan L.; Yan, Eddie; Qi, Hangfei; Shabbir, Faizan; Ozkan, Haydar; Feng, Steve; Ozcan, Aydogan

2016-03-01

The development of sensitive optical microscopy methods for the detection of single DNA molecules has become an active research area which cultivates various promising applications including point-of-care (POC) genetic testing and diagnostics. Direct visualization of individual DNA molecules usually relies on sophisticated optical microscopes that are mostly available in well-equipped laboratories. For POC DNA testing/detection, there is an increasing need for the development of new single DNA imaging and sensing methods that are field-portable, cost-effective, and accessible for diagnostic applications in resource-limited or field-settings. For this aim, we developed a mobile-phone integrated fluorescence microscopy platform that allows imaging and sizing of single DNA molecules that are stretched on a chip. This handheld device contains an opto-mechanical attachment integrated onto a smartphone camera module, which creates a high signal-to-noise ratio dark-field imaging condition by using an oblique illumination/excitation configuration. Using this device, we demonstrated imaging of individual linearly stretched λ DNA molecules (48 kilobase-pair, kbp) over 2 mm2 field-of-view. We further developed a robust computational algorithm and a smartphone app that allowed the users to quickly quantify the length of each DNA fragment imaged using this mobile interface. The cellphone based device was tested by five different DNA samples (5, 10, 20, 40, and 48 kbp), and a sizing accuracy of <1 kbp was demonstrated for DNA strands longer than 10 kbp. This mobile DNA imaging and sizing platform can be very useful for various diagnostic applications including the detection of disease-specific genes and quantification of copy-number-variations at POC settings.

Qualitative and Quantitative Assays of Transposition and Homologous Recombination of the Retrotransposon Tf1 in Schizosaccharomyces pombe.

PubMed

Sangesland, Maya; Atwood-Moore, Angela; Rai, Sudhir K; Levin, Henry L

2016-01-01

Transposition and homologous recombination assays are valuable genetic tools to measure the production and integration of cDNA from the long terminal repeat (LTR) retrotransposon Tf1 in the fission yeast (Schizosaccharomyces pombe). Here we describe two genetic assays, one that measures the transposition activity of Tf1 by monitoring the mobility of a drug resistance marked Tf1 element expressed from a multi-copy plasmid and another assay that measures homologous recombination between Tf1 cDNA and the expression plasmid. While the transposition assay measures insertion of full-length Tf1 cDNA mediated by the transposon integrase, the homologous recombination assay measures levels of cDNA present in the nucleus and is independent of integrase activity. Combined, these assays can be used to systematically screen large collections of strains to identify mutations that specifically inhibit the integration step in the retroelement life cycle. Such mutations can be identified because they reduce transposition activity but nevertheless have wild-type frequencies of homologous recombination. Qualitative assays of yeast patches on agar plates detect large defects in integration and recombination, while the quantitative approach provides a precise method of determining integration and recombination frequencies.

In and out of the rRNA genes: characterization of Pokey elements in the sequenced Daphnia genome

PubMed Central

2013-01-01

Background Only a few transposable elements are known to exhibit site-specific insertion patterns, including the well-studied R-element retrotransposons that insert into specific sites within the multigene rDNA. The only known rDNA-specific DNA transposon, Pokey (superfamily: piggyBac) is found in the freshwater microcrustacean, Daphnia pulex. Here, we present a genome-wide analysis of Pokey based on the recently completed whole genome sequencing project for D. pulex. Results Phylogenetic analysis of Pokey elements recovered from the genome sequence revealed the presence of four lineages corresponding to two divergent autonomous families and two related lineages of non-autonomous miniature inverted repeat transposable elements (MITEs). The MITEs are also found at the same 28S rRNA gene insertion site as the Pokey elements, and appear to have arisen as deletion derivatives of autonomous elements. Several copies of the full-length Pokey elements may be capable of producing an active transposase. Surprisingly, both families of Pokey possess a series of 200 bp repeats upstream of the transposase that is derived from the rDNA intergenic spacer (IGS). The IGS sequences within the Pokey elements appear to be evolving in concert with the rDNA units. Finally, analysis of the insertion sites of Pokey elements outside of rDNA showed a target preference for sites similar to the specific sequence that is targeted within rDNA. Conclusions Based on the target site preference of Pokey elements and the concerted evolution of a segment of the element with the rDNA unit, we propose an evolutionary path by which the ancestors of Pokey elements have invaded the rDNA niche. We discuss how specificity for the rDNA unit may have evolved and how this specificity has played a role in the long-term survival of these elements in the subgenus Daphnia. PMID:24059783

Combined effects of low-molecular-weight organic acids on mobilization of arsenic and lead from multi-contaminated soils.

PubMed

Onireti, Olaronke O; Lin, Chuxia; Qin, Junhao

2017-03-01

A batch experiment was conducted to examine the combined effects of three common low-molecular-weight organic acids (LMWOAs) on the mobilization of arsenic and lead in different types of multi-contaminated soils. The capacity of individual LMWOAs (at a same molar concentration) to mobilize soil-borne As and Pb varied significantly. The combination of the organic acids did not make a marked "additive" effect on the mobilization of the investigated three elements. An "antagonistic" effect on element mobilization was clear in the treatments involving oxalic acid for some soils. The acid strength of a LMWOA did not play an important role in controlling the mobilization of elements. While the mobilization of As and Pb was closely associated with the dissolution of soil-borne Fe, soil properties such as original soil pH, organic matter contents and the total amount of the element relative to the total Fe markedly complicated the mobility of that element. Aging led to continual consumption of proton introduced from addition of LMWOAs and consequently caused dramatic changes in solution-borne Fe, which in turn resulted in change in As and Pb in the soil solution though different elements behaved differently. Copyright © 2016 Elsevier Ltd. All rights reserved.

Drosophila I-R hybrid dysgenesis is associated with catastrophic meiosis and abnormal zygote formation.

PubMed

Orsi, Guillermo A; Joyce, Eric F; Couble, Pierre; McKim, Kim S; Loppin, Benjamin

2010-10-15

The Drosophila I-R type of hybrid dysgenesis is a sterility syndrome (SF sterility) associated with the mobilization of the I retrotransposon in female germ cells. SF sterility results from a maternal-effect embryonic lethality whose origin has remained unclear since its discovery about 40 years ago. Here, we show that meiotic divisions in SF oocytes are catastrophic and systematically fail to produce a functional female pronucleus at fertilization. As a consequence, most embryos from SF females rapidly arrest their development with aneuploid or damaged nuclei, whereas others develop as non-viable, androgenetic haploid embryos. Finally, we show that, in contrast to mutants affecting the biogenesis of piRNAs, SF egg chambers do not accumulate persistent DNA double-strand breaks, suggesting that I-element activity might perturb the functional organization of meiotic chromosomes without triggering an early DNA damage response.

Localization of a bacterial group II intron-encoded protein in human cells.

PubMed

Reinoso-Colacio, Mercedes; García-Rodríguez, Fernando Manuel; García-Cañadas, Marta; Amador-Cubero, Suyapa; García Pérez, José Luis; Toro, Nicolás

2015-08-05

Group II introns are mobile retroelements that self-splice from precursor RNAs to form ribonucleoparticles (RNP), which can invade new specific genomic DNA sites. This specificity can be reprogrammed, for insertion into any desired DNA site, making these introns useful tools for bacterial genetic engineering. However, previous studies have suggested that these elements may function inefficiently in eukaryotes. We investigated the subcellular distribution, in cultured human cells, of the protein encoded by the group II intron RmInt1 (IEP) and several mutants. We created fusions with yellow fluorescent protein (YFP) and with a FLAG epitope. We found that the IEP was localized in the nucleus and nucleolus of the cells. Remarkably, it also accumulated at the periphery of the nuclear matrix. We were also able to identify spliced lariat intron RNA, which co-immunoprecipitated with the IEP, suggesting that functional RmInt1 RNPs can be assembled in cultured human cells.

Localization of a bacterial group II intron-encoded protein in human cells

PubMed Central

Reinoso-Colacio, Mercedes; García-Rodríguez, Fernando Manuel; García-Cañadas, Marta; Amador-Cubero, Suyapa; Pérez, José Luis García; Toro, Nicolás

2015-01-01

Group II introns are mobile retroelements that self-splice from precursor RNAs to form ribonucleoparticles (RNP), which can invade new specific genomic DNA sites. This specificity can be reprogrammed, for insertion into any desired DNA site, making these introns useful tools for bacterial genetic engineering. However, previous studies have suggested that these elements may function inefficiently in eukaryotes. We investigated the subcellular distribution, in cultured human cells, of the protein encoded by the group II intron RmInt1 (IEP) and several mutants. We created fusions with yellow fluorescent protein (YFP) and with a FLAG epitope. We found that the IEP was localized in the nucleus and nucleolus of the cells. Remarkably, it also accumulated at the periphery of the nuclear matrix. We were also able to identify spliced lariat intron RNA, which co-immunoprecipitated with the IEP, suggesting that functional RmInt1 RNPs can be assembled in cultured human cells. PMID:26244523

The putative Agrobacterium transcriptional activator-like virulence protein VirD5 may target T-complex to prevent the degradation of coat proteins in the plant cell nucleus.

PubMed

Wang, Yafei; Peng, Wei; Zhou, Xu; Huang, Fei; Shao, Lingyun; Luo, Meizhong

2014-09-01

Agrobacterium exports at least five virulence proteins (VirE2, VirE3, VirF, VirD2, VirD5) into host cells and hijacks some host plant factors to facilitate its transformation process. Random DNA binding selection assays (RDSAs), electrophoretic mobility shift assays (EMSAs) and yeast one-hybrid systems were used to identify protein-bound DNA elements. Bimolecular fluorescence complementation, glutathione S-transferase pull-down and yeast two-hybrid assays were used to detect protein interactions. Protoplast transformation, coprecipitation, competitive binding and cell-free degradation assays were used to analyze the relationships among proteins. We found that Agrobacterium VirD5 exhibits transcriptional activation activity in yeast, is located in the plant cell nucleus, and forms homodimers. A specific VirD5-bound DNA element designated D5RE (VirD5 response element) was identified. VirD5 interacted directly with Arabidopsis VirE2 Interacting Protein 1 (AtVIP1). However, the ternary complex of VirD5-AtVIP1-VirE2 could be detected, whereas that of VirD5-AtVIP1-VBF (AtVIP1 Binding F-box protein) could not. We demonstrated that VirD5 competes with VBF for binding to AtVIP1 and stabilizes AtVIP1 and VirE2 in the cell-free degradation system. Our results indicated that VirD5 may act as both a transcriptional activator-like effector to regulate host gene expression and a protector preventing the coat proteins of the T-complex from being quickly degraded by the host's ubiquitin proteasome system (UPS). © 2014 The Authors. New Phytologist © 2014 New Phytologist Trust.

Mobile Genetic Elements and Evolution of CRISPR-Cas Systems: All the Way There and Back

PubMed Central

Makarova, Kira S.

2017-01-01

Abstract The Clustered Regularly Interspaced Palindromic Repeats (CRISPR)-CRISPR-associated proteins (Cas) systems of bacterial and archaeal adaptive immunity show multifaceted evolutionary relationships with at least five classes of mobile genetic elements (MGE). First, the adaptation module of CRISPR-Cas that is responsible for the formation of the immune memory apparently evolved from a Casposon, a self-synthesizing transposon that employs the Cas1 protein as the integrase and might have brought additional cas genes to the emerging immunity loci. Second, a large subset of type III CRISPR-Cas systems recruited a reverse transcriptase from a Group II intron, providing for spacer acquisition from RNA. Third, effector nucleases of Class 2 CRISPR-Cas systems that are responsible for the recognition and cleavage of the target DNA were derived from transposon-encoded TnpB nucleases, most likely, on several independent occasions. Fourth, accessory nucleases in some variants of types I and III toxin and type VI effectors RNases appear to be ultimately derived from toxin nucleases of microbial toxin–antitoxin modules. Fifth, the opposite direction of evolution is manifested in the recruitment of CRISPR-Cas systems by a distinct family of Tn7-like transposons that probably exploit the capacity of CRISPR-Cas to recognize unique DNA sites to facilitate transposition as well as by bacteriophages that employ them to cope with host defense. Additionally, individual Cas proteins, such as the Cas4 nuclease, were recruited by bacteriophages and transposons. The two-sided evolutionary connection between CRISPR-Cas and MGE fits the “guns for hire” paradigm whereby homologous enzymatic machineries, in particular nucleases, are shuttled between MGE and defense systems and are used alternately as means of offense or defense. PMID:28985291

DNA preservation in skeletal elements from the World Trade Center disaster: recommendations for mass fatality management.

PubMed

Mundorff, Amy Z; Bartelink, Eric J; Mar-Cash, Elaine

2009-07-01

The World Trade Center (WTC) victim identification effort highlights taphonomic influences on the degradation of DNA from victims of mass fatality incidents. This study uses a subset of the WTC-Human Remains Database to evaluate differential preservation of DNA by skeletal element. Recovery location, sex, and victim type (civilian, firefighter, or plane passenger) do not appear to influence DNA preservation. Results indicate that more intact elements, as well as elements encased in soft tissue, produced slightly higher identification rates than more fragmented remains. DNA identification rates by element type conform to previous findings, with higher rates generally found in denser, weight-bearing bones. However, smaller bones including patellae, metatarsals, and foot phalanges yielded rates comparable to both femora and tibiae. These elements can be easily sampled with a disposable scalpel, and thus reduce potential DNA contamination. These findings have implications for DNA sampling guidelines in future mass fatality incidents.

Genome-wide evidence for local DNA methylation spreading from small RNA-targeted sequences in Arabidopsis.

PubMed

Ahmed, Ikhlak; Sarazin, Alexis; Bowler, Chris; Colot, Vincent; Quesneville, Hadi

2011-09-01

Transposable elements (TEs) and their relics play major roles in genome evolution. However, mobilization of TEs is usually deleterious and strongly repressed. In plants and mammals, this repression is typically associated with DNA methylation, but the relationship between this epigenetic mark and TE sequences has not been investigated systematically. Here, we present an improved annotation of TE sequences and use it to analyze genome-wide DNA methylation maps obtained at single-nucleotide resolution in Arabidopsis. We show that although the majority of TE sequences are methylated, ∼26% are not. Moreover, a significant fraction of TE sequences densely methylated at CG, CHG and CHH sites (where H = A, T or C) have no or few matching small interfering RNA (siRNAs) and are therefore unlikely to be targeted by the RNA-directed DNA methylation (RdDM) machinery. We provide evidence that these TE sequences acquire DNA methylation through spreading from adjacent siRNA-targeted regions. Further, we show that although both methylated and unmethylated TE sequences located in euchromatin tend to be more abundant closer to genes, this trend is least pronounced for methylated, siRNA-targeted TE sequences located 5' to genes. Based on these and other findings, we propose that spreading of DNA methylation through promoter regions explains at least in part the negative impact of siRNA-targeted TE sequences on neighboring gene expression.

Multiple roles of genome-attached bacteriophage terminal proteins

DOE Office of Scientific and Technical Information (OSTI.GOV)

Redrejo-Rodríguez, Modesto; Salas, Margarita, E-mail: msalas@cbm.csic.es

2014-11-15

Protein-primed replication constitutes a generalized mechanism to initiate DNA or RNA synthesis in linear genomes, including viruses, gram-positive bacteria, linear plasmids and mobile elements. By this mechanism a specific amino acid primes replication and becomes covalently linked to the genome ends. Despite the fact that TPs lack sequence homology, they share a similar structural arrangement, with the priming residue in the C-terminal half of the protein and an accumulation of positively charged residues at the N-terminal end. In addition, various bacteriophage TPs have been shown to have DNA-binding capacity that targets TPs and their attached genomes to the host nucleoid.more » Furthermore, a number of bacteriophage TPs from different viral families and with diverse hosts also contain putative nuclear localization signals and localize in the eukaryotic nucleus, which could lead to the transport of the attached DNA. This suggests a possible role of bacteriophage TPs in prokaryote-to-eukaryote horizontal gene transfer. - Highlights: • Protein-primed genome replication constitutes a strategy to initiate DNA or RNA synthesis in linear genomes. • Bacteriophage terminal proteins (TPs) are covalently attached to viral genomes by their primary function priming DNA replication. • TPs are also DNA-binding proteins and target phage genomes to the host nucleoid. • TPs can also localize in the eukaryotic nucleus and may have a role in phage-mediated interkingdom gene transfer.« less

Mobile phone radiofrequency exposure has no effect on DNA double strand breaks (DSB) in human lymphocytes.

PubMed

Danese, Elisa; Lippi, Giuseppe; Buonocore, Ruggero; Benati, Marco; Bovo, Chiara; Bonaguri, Chiara; Salvagno, Gian Luca; Brocco, Giorgio; Roggenbuck, Dirk; Montagnana, Martina

2017-07-01

The use of mobile phones has been associated with an increased risk of developing certain type of cancer, especially in long term users. Therefore, this study was aimed to investigate the potential genotoxic effect of mobile phone radiofrequency exposure on human peripheral blood mononuclear cells in vitro. The study population consisted in 14 healthy volunteers. After collection of two whole blood samples, the former was placed in a plastic rack, 1 cm from the chassis of a commercial mobile phone (900 MHz carrier frequency), which was activated by a 30-min call. The second blood sample was instead maintained far from mobile phones or other RF sources. The influence of mobile phone RF on DNA integrity was assessed by analyzing γ-H2AX foci in lymphocytes using immunofluorescence staining kit on AKLIDES. No measure of γ-H2AX foci was significantly influenced by mobile phone RF exposure, nor mobile phone exposure was associated with significant risk of genetic damages in vitro (odds ratio comprised between 0.27 and 1.00). The results of this experimental study demonstrate that exposure of human lymphocytes to a conventional 900 MHz RF emitted by a commercial mobile phone for 30 min does not significantly impact DNA integrity.

CCAAT/enhancer-binding protein delta is a critical regulator of insulin-like growth factor-I gene transcription in osteoblasts

NASA Technical Reports Server (NTRS)

Umayahara, Y.; Billiard, J.; Ji, C.; Centrella, M.; McCarthy, T. L.; Rotwein, P.

1999-01-01

Insulin-like growth factor-I (IGF-I) plays a major role in promoting skeletal growth by stimulating bone cell replication and differentiation. Prostaglandin E2 and other agents that induce cAMP production enhance IGF-I gene transcription in cultured rat osteoblasts through a DNA element termed HS3D, located in the proximal part of the major rat IGF-I promoter. We previously determined that CCAAT/enhancer-binding protein delta (C/EBPdelta) is the key cAMP-stimulated regulator of IGF-I transcription in these cells and showed that it transactivates the rat IGF-I promoter through the HS3D site. We now have defined the physical-chemical properties and functional consequences of the interactions between C/EBPdelta and HS3D. C/EBPdelta, expressed in COS-7 cells or purified as a recombinant protein from Escherichia coli, bound to HS3D with an affinity at least equivalent to that of the albumin D-site, a known high affinity C/EBP binding sequence, and both DNA elements competed equally for C/EBPdelta. C/EBPdelta bound to HS3D as a dimer, with protein-DNA contact points located on guanine residues on both DNA strands within and just adjacent to the core C/EBP half-site, GCAAT, as determined by methylation interference footprinting. C/EBPdelta also formed protein-protein dimers in the absence of interactions with its DNA binding site, as indicated by results of glutaraldehyde cross-linking studies. As established by competition gel-mobility shift experiments, the conserved HS3D sequence from rat, human, and chicken also bound C/EBPdelta with similar affinity. We also found that prostaglandin E2-induced expression of reporter genes containing human IGF-I promoter 1 or four tandem copies of the human HS3D element fused to a minimal promoter and show that these effects were enhanced by a co-transfected C/EBPdelta expression plasmid. Taken together, our results provide evidence that C/EBPdelta is a critical activator of IGF-I gene transcription in osteoblasts and potentially in other cell types and species.

High mobility organic field-effect transistor based on water-soluble deoxyribonucleic acid via spray coating

DOE Office of Scientific and Technical Information (OSTI.GOV)

Shi, Wei; Han, Shijiao; Huang, Wei

High mobility organic field-effect transistors (OFETs) by inserting water-soluble deoxyribonucleic acid (DNA) buffer layer between electrodes and pentacene film through spray coating process were fabricated. Compared with the OFETs incorporated with DNA in the conventional organic solvents of ethanol and methanol: water mixture, the water-soluble DNA based OFET exhibited an over four folds enhancement of field-effect mobility from 0.035 to 0.153 cm{sup 2}/Vs. By characterizing the surface morphology and the crystalline structure of pentacene active layer through atomic force microscope and X-ray diffraction, it was found that the adoption of water solvent in DNA solution, which played a key role inmore » enhancing the field-effect mobility, was ascribed to both the elimination of the irreversible organic solvent-induced bulk-like phase transition of pentacene film and the diminution of a majority of charge trapping at interfaces in OFETs.« less

Cloning and functional analysis of 5'-upstream region of the Pokemon gene.

PubMed

Yang, Yutao; Zhou, Xiaowei; Zhu, Xudong; Zhang, Chuanfu; Yang, Zhixin; Xu, Long; Huang, Peitang

2008-04-01

Pokemon, the POK erythroid myeloid ontogenic factor, not only regulates the expression of many genes, but also plays an important role in cell tumorigenesis. To investigate the molecular mechanism regulating expression of the Pokemon gene in humans, its 5'-upstream region was cloned and analyzed. Transient analysis revealed that the Pokemon promoter is constitutive. Deletion analysis and a DNA decoy assay indicated that the NEG-U and NEG-D elements were involved in negative regulation of the Pokemon promoter, whereas the POS-D element was mainly responsible for its strong activity. Electrophoretic mobility shift assays suggested that the NEG-U, NEG-D and POS-D elements were specifically bound by the nuclear extract from A549 cells in vitro. Mutation analysis demonstrated that cooperation of the NEG-U and NEG-D elements led to negative regulation of the Pokemon promoter. Moreover, the NEG-U and NEG-D elements needed to be an appropriate distance apart in the Pokemon promoter in order to cooperate. Taken together, our results elucidate the mechanism underlying the regulation of Pokemon gene transcription, and also define a novel regulatory sequence that may be used to decrease expression of the Pokemon gene in cancer gene therapy.

Integrative and conjugative elements and their hosts: composition, distribution and organization

PubMed Central

Touchon, Marie; Rocha, Eduardo P. C.

2017-01-01

Abstract Conjugation of single-stranded DNA drives horizontal gene transfer between bacteria and was widely studied in conjugative plasmids. The organization and function of integrative and conjugative elements (ICE), even if they are more abundant, was only studied in a few model systems. Comparative genomics of ICE has been precluded by the difficulty in finding and delimiting these elements. Here, we present the results of a method that circumvents these problems by requiring only the identification of the conjugation genes and the species’ pan-genome. We delimited 200 ICEs and this allowed the first large-scale characterization of these elements. We quantified the presence in ICEs of a wide set of functions associated with the biology of mobile genetic elements, including some that are typically associated with plasmids, such as partition and replication. Protein sequence similarity networks and phylogenetic analyses revealed that ICEs are structured in functional modules. Integrases and conjugation systems have different evolutionary histories, even if the gene repertoires of ICEs can be grouped in function of conjugation types. Our characterization of the composition and organization of ICEs paves the way for future functional and evolutionary analyses of their cargo genes, composed of a majority of unknown function genes. PMID:28911112

What tangled web: barriers to rampant horizontal gene transfer.

PubMed

Kurland, Charles G

2005-07-01

Dawkins in his The Selfish Gene(1) quite aptly applies the term "selfish" to parasitic repetitive DNA sequences endemic to eukaryotic genomes, especially vertebrates. Doolittle and Sapienza(2) as well as Orgel and Crick(3) enlivened this notion of selfish DNA with the identification of such repetitive sequences as remnants of mobile elements such as transposons. In addition, Orgel and Crick(3) associated parasitic DNA with a potential to outgrow their host genomes by propagating both vertically via conventional genome replication as well as infectiously by horizontal gene transfer (HGT) to other genomes. Still later, Doolittle(4) speculated that unchecked HGT between unrelated genomes so complicates phylogeny that the conventional representation of a tree of life would have to be replaced by a thicket or a web of life.(4) In contrast, considerable data now show that reconstructions based on whole genome sequences are consistent with the conventional "tree of life".(5-10) Here, we identify natural barriers that protect modern genome populations from the inroads of rampant HGT. Copyright (c) 2005 Wiley Periodicals, Inc.

Cas4 Facilitates PAM-Compatible Spacer Selection during CRISPR Adaptation.

PubMed

Kieper, Sebastian N; Almendros, Cristóbal; Behler, Juliane; McKenzie, Rebecca E; Nobrega, Franklin L; Haagsma, Anna C; Vink, Jochem N A; Hess, Wolfgang R; Brouns, Stan J J

2018-03-27

CRISPR-Cas systems adapt their immunological memory against their invaders by integrating short DNA fragments into clustered regularly interspaced short palindromic repeat (CRISPR) loci. While Cas1 and Cas2 make up the core machinery of the CRISPR integration process, various class I and II CRISPR-Cas systems encode Cas4 proteins for which the role is unknown. Here, we introduced the CRISPR adaptation genes cas1, cas2, and cas4 from the type I-D CRISPR-Cas system of Synechocystis sp. 6803 into Escherichia coli and observed that cas4 is strictly required for the selection of targets with protospacer adjacent motifs (PAMs) conferring I-D CRISPR interference in the native host Synechocystis. We propose a model in which Cas4 assists the CRISPR adaptation complex Cas1-2 by providing DNA substrates tailored for the correct PAM. Introducing functional spacers that target DNA sequences with the correct PAM is key to successful CRISPR interference, providing a better chance of surviving infection by mobile genetic elements. Copyright © 2018 The Authors. Published by Elsevier Inc. All rights reserved.

Programmable RNA Cleavage and Recognition by a Natural CRISPR-Cas9 System from Neisseria meningitidis.

PubMed

Rousseau, Beth A; Hou, Zhonggang; Gramelspacher, Max J; Zhang, Yan

2018-03-01

The microbial CRISPR systems enable adaptive defense against mobile elements and also provide formidable tools for genome engineering. The Cas9 proteins are type II CRISPR-associated, RNA-guided DNA endonucleases that identify double-stranded DNA targets by sequence complementarity and protospacer adjacent motif (PAM) recognition. Here we report that the type II-C CRISPR-Cas9 from Neisseria meningitidis (Nme) is capable of programmable, RNA-guided, site-specific cleavage and recognition of single-stranded RNA targets and that this ribonuclease activity is independent of the PAM sequence. We define the mechanistic feature and specificity constraint for RNA cleavage by NmeCas9 and also show that nuclease null dNmeCas9 binds to RNA target complementary to CRISPR RNA. Finally, we demonstrate that NmeCas9-catalyzed RNA cleavage can be blocked by three families of type II-C anti-CRISPR proteins. These results fundamentally expand the targeting capacities of CRISPR-Cas9 and highlight the potential utility of NmeCas9 as a single platform to target both RNA and DNA. Copyright © 2018 Elsevier Inc. All rights reserved.

Identification of a p53-response element in the promoter of the proline oxidase gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Maxwell, Steve A.; Kochevar, Gerald J.

2008-05-02

Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significantmore » p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.« less

An ethylene-responsive enhancer element is involved in the senescence-related expression of the carnation glutathione-S-transferase (GST1) gene.

PubMed

Itzhaki, H; Maxson, J M; Woodson, W R

1994-09-13

The increased production of ethylene during carnation petal senescence regulates the transcription of the GST1 gene encoding a subunit of glutathione-S-transferase. We have investigated the molecular basis for this ethylene-responsive transcription by examining the cis elements and trans-acting factors involved in the expression of the GST1 gene. Transient expression assays following delivery of GST1 5' flanking DNA fused to a beta-glucuronidase receptor gene were used to functionally define sequences responsible for ethylene-responsive expression. Deletion analysis of the 5' flanking sequences of GST1 identified a single positive regulatory element of 197 bp between -667 and -470 necessary for ethylene-responsive expression. The sequences within this ethylene-responsive region were further localized to 126 bp between -596 and -470. The ethylene-responsive element (ERE) within this region conferred ethylene-regulated expression upon a minimal cauliflower mosaic virus-35S TATA-box promoter in an orientation-independent manner. Gel electrophoresis mobility-shift assays and DNase I footprinting were used to identify proteins that bind to sequences within the ERE. Nuclear proteins from carnation petals were shown to specifically interact with the 126-bp ERE and the presence and binding of these proteins were independent of ethylene or petal senescence. DNase I footprinting defined DNA sequences between -510 and -488 within the ERE specifically protected by bound protein. An 8-bp sequence (ATTTCAAA) within the protected region shares significant homology with promoter sequences required for ethylene responsiveness from the tomato fruit-ripening E4 gene.

Transfer RNA gene-targeted integration: an adaptation of retrotransposable elements to survive in the compact Dictyostelium discoideum genome.

PubMed

Winckler, T; Szafranski, K; Glöckner, G

2005-01-01

Almost every organism carries along a multitude of molecular parasites known as transposable elements (TEs). TEs influence their host genomes in many ways by expanding genome size and complexity, rearranging genomic DNA, mutagenizing host genes, and altering transcription levels of nearby genes. The eukaryotic microorganism Dictyostelium discoideum is attractive for the study of fundamental biological phenomena such as intercellular communication, formation of multicellularity, cell differentiation, and morphogenesis. D. discoideum has a highly compacted, haploid genome with less than 1 kb of genomic DNA separating coding regions. Nevertheless, the D. discoideum genome is loaded with 10% of TEs that managed to settle and survive in this inhospitable environment. In depth analysis of D. discoideum genome project data has provided intriguing insights into the evolutionary challenges that mobile elements face when they invade compact genomes. Two different mechanisms are used by D. discoideum TEs to avoid disruption of host genes upon retrotransposition. Several TEs have invented the specific targeting of tRNA gene-flanking regions as a means to avoid integration into coding regions. These elements have been dispersed on all chromosomes, closely following the distribution of tRNA genes. By contrast, TEs that lack bona fide integration specificities show a strong bias to nested integration, thus forming large TE clusters at certain chromosomal loci that are hardly resolved by bioinformatics approaches. We summarize our current view of D. discoideum TEs and present new data from the analysis of the complete sequences of D. discoideum chromosomes 1 and 2, which comprise more than one third of the total genome.

Characterization of Halomonas sp. ZM3 isolated from the Zelazny Most post-flotation waste reservoir, with a special focus on its mobile DNA

PubMed Central

2013-01-01

Background Halomonas sp. ZM3 was isolated from Zelazny Most post-flotation mineral waste repository (Poland), which is highly contaminated with heavy metals and various organic compounds. Mobile DNA of the strain (i.e. plasmids and transposons) were analyzed in order to identify genetic information enabling adaptation of the bacterium to the harsh environmental conditions. Results The analysis revealed that ZM3 carries plasmid pZM3H1 (31,370 bp), whose replication system may be considered as an archetype of a novel subgroup of IncU-like replicons. pZM3H1 is a narrow host range, mobilizable plasmid (encodes a relaxase of the MOBV family) containing mercury resistance operon (mer) and czcD genes (mediate resistance to zinc and cobalt), which are part of a large truncated Tn3 family transposon. Further analysis demonstrated that the phenotypes determined by the pZM3H1 resistance cassette are highly dependent on the host strain. In another strand of the study, the trap plasmid pMAT1 was employed to identify functional transposable elements of Halomonas sp. ZM3. Using the sacB positive selection strategy two insertion sequences were identified: ISHsp1 - representing IS5 group of IS5 family and ISHsp2 - a distinct member of the IS630 family. Conclusions This study provides the first detailed description of mobile DNA in a member of the family Halomonadaceae. The identified IncU plasmid pZM3H1 confers resistance phenotypes enabling adaptation of the host strain to the Zelazny Most environment. The extended comparative analysis has shed light on the distribution of related IncU plasmids among bacteria, which, in many cases, reflects the frequency and direction of horizontal gene transfer events. Our results also identify plasmid-encoded modules, which may form the basis of novel shuttle vectors, specific for this group of halophilic bacteria. PMID:23497212

Experimental single-strain mobilomics reveals events that shape pathogen emergence.

PubMed

Schoeniger, Joseph S; Hudson, Corey M; Bent, Zachary W; Sinha, Anupama; Williams, Kelly P

2016-08-19

Virulence genes on mobile DNAs such as genomic islands (GIs) and plasmids promote bacterial pathogen emergence. Excision is an early step in GI mobilization, producing a circular GI and a deletion site in the chromosome; circular forms are also known for some bacterial insertion sequences (ISs). The recombinant sequence at the junctions of such circles and deletions can be detected sensitively in high-throughput sequencing data, using new computational methods that enable empirical discovery of mobile DNAs. For the rich mobilome of a hospital Klebsiella pneumoniae strain, circularization junctions (CJs) were detected for six GIs and seven IS types. Our methods revealed differential biology of multiple mobile DNAs, imprecision of integrases and transposases, and differential activity among identical IS copies for IS26, ISKpn18 and ISKpn21 Using the resistance of circular dsDNA molecules to exonuclease, internally calibrated with the native plasmids, showed that not all molecules bearing GI CJs were circular. Transpositions were also detected, revealing replicon preference (ISKpn18 prefers a conjugative IncA/C2 plasmid), local action (IS26), regional preferences, selection (against capsule synthesis) and IS polarity inversion. Efficient discovery and global characterization of numerous mobile elements per experiment improves accounting for the new gene combinations that arise in emerging pathogens. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

Intron open reading frames as mobile elements and evolution of a group I intron.

PubMed

Sellem, C H; Belcour, L

1997-05-01

Group I introns are proposed to have become mobile following the acquisition of open reading frames (ORFs) that encode highly specific DNA endonucleases. This proposal implies that intron ORFs could behave as autonomously mobile entities. This was supported by abundant circumstantial evidence but no experiment of ORF transfer from an ORF-containing intron to its ORF-less counterpart has been described. In this paper we present such experiments, which demonstrate the efficient mobility of the mitochondrial nad1-i4-orf1 between two Podospora strains. The homing of this mobile ORF was accompanied by a bidirectional co-conversion that did not systematically involve the whole intron sequence. Orf1 acquisition would be the most recent step in the evolution of the nad1-i4 intron, which has resulted in many strains of Podospora having an intron with two ORFs (biorfic) and four splicing pathways. We show that two of the splicing events that operate in this biorfic intron, as evidenced by PCR experiments, are generated by a 5'-alternative splice site, which is most probably a remnant of the monoorfic ancestral form of the intron. We propose a sequential evolution model that is consistent with the four organizations of the corresponding nad1 locus that we found among various species of the Pyrenomycete family; these organizations consist of no intron, an intron alone, a monoorfic intron, and a biorfic intron.

A DNA-Inspired Encryption Methodology for Secure, Mobile Ad Hoc Networks

NASA Technical Reports Server (NTRS)

Shaw, Harry

2012-01-01

Users are pushing for greater physical mobility with their network and Internet access. Mobile ad hoc networks (MANET) can provide an efficient mobile network architecture, but security is a key concern. A figure summarizes differences in the state of network security for MANET and fixed networks. MANETs require the ability to distinguish trusted peers, and tolerate the ingress/egress of nodes on an unscheduled basis. Because the networks by their very nature are mobile and self-organizing, use of a Public Key Infra structure (PKI), X.509 certificates, RSA, and nonce ex changes becomes problematic if the ideal of MANET is to be achieved. Molecular biology models such as DNA evolution can provide a basis for a proprietary security architecture that achieves high degrees of diffusion and confusion, and resistance to cryptanalysis. A proprietary encryption mechanism was developed that uses the principles of DNA replication and steganography (hidden word cryptography) for confidentiality and authentication. The foundation of the approach includes organization of coded words and messages using base pairs organized into genes, an expandable genome consisting of DNA-based chromosome keys, and a DNA-based message encoding, replication, and evolution and fitness. In evolutionary computing, a fitness algorithm determines whether candidate solutions, in this case encrypted messages, are sufficiently encrypted to be transmitted. The technology provides a mechanism for confidential electronic traffic over a MANET without a PKI for authenticating users.

Micrometer-sized TPM emulsion droplets with surface-mobile binding groups

NASA Astrophysics Data System (ADS)

van der Wel, Casper; van de Stolpe, Guido L.; Verweij, Ruben W.; Kraft, Daniela J.

2018-03-01

Colloids coated with lipid membranes have been widely employed for fundamental studies of lipid membrane processes, biotechnological applications such as drug delivery and biosensing, and more recently, for self-assembly. The latter has been made possible by inserting DNA oligomers with covalently linked hydrophobic anchors into the membrane. The lateral mobility of the DNA linkers on micrometer-sized droplets and solid particles has opened the door to creating structures with unprecedented structural flexibility. Here, we investigate micro-emulsions of TPM (3-(trimethoxysilyl)propyl methacrylate) as a platform for lipid monolayers and further functionalization with proteins and DNA oligonucleotides. TPM droplets can be produced with a narrow size distribution and are polymerizable, thus providing supports for model lipid membranes with controlled size and curvature. With fluorescence recovery after photobleaching, we observed that droplet-attached lipids, NeutrAvidin proteins, as well as DNA oligonucleotides all show mobility on the surface. We explored the assembly of micron-sized particles on TPM-droplets by exploiting either avidin-biotin interactions or double-stranded DNA with complementary single-stranded end groups. While the single molecules are mobile, the particles that are attached to them are not. We propose that this is caused by the heterogeneous nature of emulsified TPM, which forms an oligomer network that limits the collective motion of linkers, but allows the surface mobility of individual molecules.

The structure of the KlcA and ArdB proteins reveals a novel fold and antirestriction activity against Type I DNA restriction systems in vivo but not in vitro

PubMed Central

Serfiotis-Mitsa, Dimitra; Herbert, Andrew P.; Roberts, Gareth A.; Soares, Dinesh C.; White, John H.; Blakely, Garry W.; Uhrín, Dušan; Dryden, David T. F.

2010-01-01

Plasmids, conjugative transposons and phage frequently encode anti-restriction proteins to enhance their chances of entering a new bacterial host that is highly likely to contain a Type I DNA restriction and modification (RM) system. The RM system usually destroys the invading DNA. Some of the anti-restriction proteins are DNA mimics and bind to the RM enzyme to prevent it binding to DNA. In this article, we characterize ArdB anti-restriction proteins and their close homologues, the KlcA proteins from a range of mobile genetic elements; including an ArdB encoded on a pathogenicity island from uropathogenic Escherichia coli and a KlcA from an IncP-1b plasmid, pBP136 isolated from Bordetella pertussis. We show that all the ArdB and KlcA act as anti-restriction proteins and inhibit the four main families of Type I RM systems in vivo, but fail to block the restriction endonuclease activity of the archetypal Type I RM enzyme, EcoKI, in vitro indicating that the action of ArdB is indirect and very different from that of the DNA mimics. We also present the structure determined by NMR spectroscopy of the pBP136 KlcA protein. The structure shows a novel protein fold and it is clearly not a DNA structural mimic. PMID:20007596

Vitamin D receptor displays DNA binding and transactivation as a heterodimer with the retinoid X receptor, but not with the thyroid hormone receptor.

PubMed

Thompson, P D; Hsieh, J C; Whitfield, G K; Haussler, C A; Jurutka, P W; Galligan, M A; Tillman, J B; Spindler, S R; Haussler, M R

1999-12-01

The vitamin D receptor (VDR) is a transcription factor believed to function as a heterodimer with the retinoid X receptor (RXR). However, it was reported [Schräder et al., 1994] that, on putative vitamin D response elements (VDREs) within the rat 9k and mouse 28k calcium binding protein genes (rCaBP 9k and mCaBP 28k), VDR and thyroid hormone receptor (TR) form heterodimers that transactivate in response to both 1,25-dihydroxyvitamin D(3) (1,25(OH)(2)D(3)) and triiodothyronine (T(3)). We, therefore, examined associations of these receptors on the putative rCaBP 9k and mCaBP 28k VDREs, as well as on established VDREs from the rat osteocalcin (rOC) and mouse osteopontin (mOP) genes, plus the thyroid hormone response element (TRE) from the rat myosin heavy chain (rMHC) gene. In gel mobility shift assays, we found no evidence for VDR-TR heterodimer interaction with any tested element. Further, employing these hormone response elements linked to reporter genes in transfected cells, VDR and TR mediated responses to their cognate ligands only from the rOC/mOP and rMHC elements, respectively, while the CaBP elements were unresponsive to any combination of ligand(s). Utilizing the rOC and mOP VDREs, two distinct repressive actions of TR on VDR-mediated signaling were demonstrated: a T(3)-independent action, presumably via direct TR-RXR competition for DNA binding, and a T(3)-dependent repression, likely by diversion of limiting RXR from VDR-RXR toward the formation of TR-RXR heterodimers. The relative importance of these two mechanisms differed in a response element-specific manner. These results may provide a partial explanation for the observed association between hyperthyroidism and bone demineralization/osteoporosis. Copyright 1999 Wiley-Liss, Inc.

Densely ionizing radiation affects DNA methylation of selective LINE-1 elements1

PubMed Central

Prior, Sara; Miousse, Isabelle R.; Nzabarushimana, Etienne; Pathak, Rupak; Skinner, Charles; Kutanzi, Kristy R.; Allen, Antiño R.; Raber, Jacob; Tackett, Alan J.; Hauer-Jensen, Martin; Nelson, Gregory A.; Koturbash, Igor

2016-01-01

Long Interspersed Nucleotide Element 1 (LINE-1) retrotransposons are heavily methylated and are the most abundant transposable elements in mammalian genomes. Here, we investigated the differential DNA methylation within the LINE-1 under normal conditions and in response to environmentally relevant doses of sparsely and densely ionizing radiation. We demonstrate that DNA methylation of LINE-1 elements in the lungs of C57BL6 mice is dependent on their evolutionary age, where the elder age of the element is associated with the lower extent of DNA methylation. Exposure to 5-aza-2′-deoxycytidine and methionine-deficient diet affected DNA methylation of selective LINE-1 elements in an age- and promoter type-dependent manner. Exposure to densely IR, but not sparsely IR, resulted in DNA hypermethylation of older LINE-1 elements, while the DNA methylation of evolutionary younger elements remained mostly unchanged. We also demonstrate that exposure to densely IR increased mRNA and protein levels of LINE-1 via the loss of the histone H3K9 dimethylation and an increase in the H3K4 trimethylation at the LINE-1 5′-untranslated region, independently of DNA methylation. Our findings suggest that DNA methylation is important for regulation of LINE-1 expression under normal conditions, but histone modifications may dictate the transcriptional activity of LINE-1 in response to exposure to densely IR. PMID:27419368

Mobilization of Carbapenemase-Mediated Resistance in Enterobacteriaceae.

PubMed

Mathers, Amy

2016-06-01

There has been a dramatic increase in the last decade in the number of carbapenem-resistant Enterobacteriaceae, often leaving patients and their providers with few treatment options and resultant poor outcomes when an infection develops. The majority of the carbapenem resistance is mediated by bacterial acquisition of one of three carbapenemases (Klebsiella pneumoniae carbapenemase [KPC], oxacillinase-48-like [OXA-48], and the New Delhi metallo-β-lactamase [NDM]). Each of these enzymes has a unique global epidemiology and microbiology. The genes which encode the most globally widespread carbapenemases are typically carried on mobile pieces of DNA which can be freely exchanged between bacterial strains and species via horizontal gene transfer. Unfortunately, most of the antimicrobial surveillance systems target specific strains or species and therefore are not well equipped for examining genes of drug resistance. Examination of not only the carbapenemase gene itself but also the genetic context which can predispose a gene to mobilize within a diversity of species and environments will likely be central to understanding the factors contributing to the global dissemination of carbapenem resistance. Using the three most prevalent carbapenemase genes as examples, this chapter highlights the potential impact the associated genetic mobile elements have on the epidemiology and microbiology for each carbapenemase. Understanding how a carbapenemase gene mobilizes through a bacterial population will be critical for detection methods and ultimately inform infection control practices. Understanding gene mobilization and tracking will require novel approaches to surveillance, which will be required to slow the spread of this emerging resistance.

DNA electrophoresis in agarose gels: effects of field and gel concentration on the exponential dependence of reciprocal mobility on DNA length.

PubMed

Rill, Randolph L; Beheshti, Afshin; Van Winkle, David H

2002-08-01

Electrophoretic mobilities of DNA molecules ranging in length from 200 to 48 502 base pairs (bp) were measured in agarose gels with concentrations T = 0.5% to 1.3% at electric fields from E = 0.71 to 5.0 V/cm. This broad data set determines a range of conditions over which the new interpolation equation nu(L) = (beta+alpha(1+exp(-L/gamma))(-1) can be used to relate mobility to length with high accuracy. Mobility data were fit with chi(2) > 0.999 for all gel concentrations and fields ranging from 2.5 to 5 V/cm, and for lower fields at low gel concentrations. Analyses using so-called reptation plots (Rousseau, J., Drouin, G., Slater, G. W., Phys. Rev. Lett. 1997, 79, 1945-1948) indicate that this simple exponential relation is obeyed well when there is a smooth transition from the Ogston sieving regime to the reptation regime with increasing DNA length. Deviations from this equation occur when DNA migration is hindered, apparently by entropic-trapping, which is favored at low fields and high gel concentrations in the ranges examined.

Theory of nucleosome corkscrew sliding in the presence of synthetic DNA ligands.

PubMed

Mohammad-Rafiee, Farshid; Kulić, Igor M; Schiessel, Helmut

2004-11-12

Histone octamers show a heat-induced mobility along DNA. Recent theoretical studies have established two mechanisms that are qualitatively and quantitatively compatible with in vitro experiments on nucleosome sliding: octamer repositioning through one-base-pair twist defects and through ten-base-pair bulge defects. A recent experiment demonstrated that the repositioning is strongly suppressed in the presence of minor-groove binding DNA ligands. In the present study, we give a quantitative theory for nucleosome repositioning in the presence of such ligands. We show that the experimentally observed octamer mobilities are consistent with the picture of bound ligands blocking the passage of twist defects through the nucleosome. This strongly supports the model of twist defects inducing a corkscrew motion of the nucleosome as the underlying mechanism of nucleosome sliding. We provide a theoretical estimate of the nucleosomal mobility without adjustable parameters, as a function of ligand concentration, binding affinity, binding site orientation, temperature and DNA anisotropy. Having this mobility in hand, we speculate on the interaction between a nucleosome and a transcribing RNA polymerase, and suggest a novel mechanism that might account for polymerase-induced nucleosome repositioning on short DNA templates.

Genomics Education in Practice: Evaluation of a Mobile Lab Design

ERIC Educational Resources Information Center

Van Mil, Marc H. W.; Boerwinkel, Dirk Jan; Buizer-Voskamp, Jacobine E.; Speksnijder, Annelies; Waarlo, Arend Jan

2010-01-01

Dutch genomics research centers have developed the "DNA labs on the road" to bridge the gap between modern genomics research practice and secondary-school curriculum in the Netherlands. These mobile DNA labs offer upper-secondary students the opportunity to experience genomics research through experiments with laboratory equipment that…

Burkholderia pseudomallei sequencing identifies genomic clades with distinct recombination, accessory, and epigenetic profiles

PubMed Central

Nandi, Tannistha; Holden, Matthew T.G.; Didelot, Xavier; Mehershahi, Kurosh; Boddey, Justin A.; Beacham, Ifor; Peak, Ian; Harting, John; Baybayan, Primo; Guo, Yan; Wang, Susana; How, Lee Chee; Sim, Bernice; Essex-Lopresti, Angela; Sarkar-Tyson, Mitali; Nelson, Michelle; Smither, Sophie; Ong, Catherine; Aw, Lay Tin; Hoon, Chua Hui; Michell, Stephen; Studholme, David J.; Titball, Richard; Chen, Swaine L.; Parkhill, Julian

2015-01-01

Burkholderia pseudomallei (Bp) is the causative agent of the infectious disease melioidosis. To investigate population diversity, recombination, and horizontal gene transfer in closely related Bp isolates, we performed whole-genome sequencing (WGS) on 106 clinical, animal, and environmental strains from a restricted Asian locale. Whole-genome phylogenies resolved multiple genomic clades of Bp, largely congruent with multilocus sequence typing (MLST). We discovered widespread recombination in the Bp core genome, involving hundreds of regions associated with multiple haplotypes. Highly recombinant regions exhibited functional enrichments that may contribute to virulence. We observed clade-specific patterns of recombination and accessory gene exchange, and provide evidence that this is likely due to ongoing recombination between clade members. Reciprocally, interclade exchanges were rarely observed, suggesting mechanisms restricting gene flow between clades. Interrogation of accessory elements revealed that each clade harbored a distinct complement of restriction-modification (RM) systems, predicted to cause clade-specific patterns of DNA methylation. Using methylome sequencing, we confirmed that representative strains from separate clades indeed exhibit distinct methylation profiles. Finally, using an E. coli system, we demonstrate that Bp RM systems can inhibit uptake of non-self DNA. Our data suggest that RM systems borne on mobile elements, besides preventing foreign DNA invasion, may also contribute to limiting exchanges of genetic material between individuals of the same species. Genomic clades may thus represent functional units of genetic isolation in Bp, modulating intraspecies genetic diversity. PMID:25236617

Update on Antimicrobial Resistance in Clostridium difficile: Resistance Mechanisms and Antimicrobial Susceptibility Testing

PubMed Central

Peng, Zhong; Kim, Hyeun Bum; Stratton, Charles W.; Wu, Bin

2017-01-01

ABSTRACT Oral antibiotics such as metronidazole, vancomycin and fidaxomicin are therapies of choice for Clostridium difficile infection. Several important mechanisms for C. difficile antibiotic resistance have been described, including the acquisition of antibiotic resistance genes via the transfer of mobile genetic elements, selective pressure in vivo resulting in gene mutations, altered expression of redox-active proteins, iron metabolism, and DNA repair, as well as via biofilm formation. This update summarizes new information published since 2010 on phenotypic and genotypic resistance mechanisms in C. difficile and addresses susceptibility test methods and other strategies to counter antibiotic resistance of C. difficile. PMID:28404671

Control of gene expression by CRISPR-Cas systems

PubMed Central

2013-01-01

Clustered regularly interspaced short palindromic repeats (CRISPR) loci and their associated cas (CRISPR-associated) genes provide adaptive immunity against viruses (phages) and other mobile genetic elements in bacteria and archaea. While most of the early work has largely been dominated by examples of CRISPR-Cas systems directing the cleavage of phage or plasmid DNA, recent studies have revealed a more complex landscape where CRISPR-Cas loci might be involved in gene regulation. In this review, we summarize the role of these loci in the regulation of gene expression as well as the recent development of synthetic gene regulation using engineered CRISPR-Cas systems. PMID:24273648

Solid-to-fluid – like DNA transition in viruses facilitates infection

DOE Office of Scientific and Technical Information (OSTI.GOV)

Liu, Ting; Sae-Ueng, Udom; Li, Dong

2014-10-14

Releasing the packaged viral DNA into the host cell is an essential process to initiate viral infection. In many double-stranded DNA bacterial viruses and herpesviruses, the tightly packaged genome is hexagonally ordered and stressed in the protein shell, called the capsid. DNA condensed in this state inside viral capsids has been shown to be trapped in a glassy state, with restricted molecular motion in vitro. This limited intracapsid DNA mobility is caused by the sliding friction between closely packaged DNA strands, as a result of the repulsive interactions between the negative charges on the DNA helices. It had been unclearmore » how this rigid crystalline structure of the viral genome rapidly ejects from the capsid, reaching rates of 60,000 bp/s. Through a combination of single- molecule and bulk techniques, we determined how the structure and energy of the encapsidated DNA in phage λ regulates the mobility required for its ejection. Our data show that packaged λ -DNA undergoes a solid-to-fluid – like disordering transition as a function of temperature, resultin g locally in less densely packed DNA, reducing DNA – DNA repulsions. This p rocess leads to a sig- nificant increase in genome mobility or fluidity, which facilitates genome release at temperatures close to that of viral infection (37 °C), suggesting a remarkab le physical adaptation of bac- terial viruses to the environment of Escherichia coli cells in a human host.« less

UV damage-specific DNA-binding protein in xeroderma pigmentosum complementation group E

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kataoka, H.; Fujiwara, Y.

1991-03-29

The gel mobility shift assay method revealed a specifically ultraviolet (UV) damage recognizing, DNA-binding protein in nuclear extracts of normal human cells. The resulted DNA/protein complexes caused the two retarded mobility shifts. Four xeroderma pigmentosum complementation group E (XPE) fibroblast strains derived from unrelated Japanese families were not deficient in such a DNA damage recognition/binding protein because of the normal complex formation and gel mobility shifts, although we confirmed the reported lack of the protein in the European XPE (XP2RO and XP3RO) cells. Thus, the absence of this binding protein is not always commonly observed in all the XPE strains,more » and the partially repair-deficient and intermediately UV-hypersensitive phenotype of XPE cells are much similar whether or not they lack the protein.« less

International Congress on Transposable Elements (ICTE) 2012 in Saint Malo and the sea of TE stories.

PubMed

Ainouche, Abdelkader; Bétermier, Mireille; Chandler, Mick; Cordaux, Richard; Cristofari, Gaël; Deragon, Jean-Marc; Lesage, Pascale; Panaud, Olivier; Quesneville, Hadi; Vaury, Chantal; Vieira, Cristina; Vitte, Clémentine

2012-10-30

An international conference on Transposable Elements (TEs) was held 21-24 April 2012 in Saint Malo, France. Organized by the French Transposition Community (GDR Elements Génétiques Mobiles et Génomes, CNRS) and the French Society of Genetics (SFG), the conference's goal was to bring together researchers from around the world who study transposition in diverse organisms using multiple experimental approaches. The meeting drew more than 217 attendees and most contributed through poster presentations (117), invited talks and short talks selected from poster abstracts (48 in total). The talks were organized into four scientific sessions, focused on: impact of TEs on genomes, control of transposition, evolution of TEs and mechanisms of transposition. Here, we present highlights from the talks given during the platform sessions. The conference was sponsored by Alliance pour les sciences de la vie et de la santé (Aviesan), Centre national de la recherche scientifique (CNRS), Institut national de la santé et de la recherche médicale (INSERM), Institut de recherche pour le développement (IRD), Institut national de la recherche agronomique (INRA), Université de Perpignan, Université de Rennes 1, Région Bretagne and Mobile DNA. CHAIR OF THE ORGANIZATION COMMITTEE: Jean-Marc Deragon ORGANIZERS: Abdelkader Ainouche, Mireille Bétermier, Mick Chandler, Richard Cordaux, Gaël Cristofari, Jean-Marc Deragon, Pascale Lesage, Didier Mazel, Olivier Panaud, Hadi Quesneville, Chantal Vaury, Cristina Vieira and Clémentine Vitte.

Interspecific hybridization as a genomic stressor inducing mobilization of transposable elements in Drosophila

PubMed Central

Guerreiro, Maria Pilar García

2014-01-01

Transposable elements (TEs) are DNA sequences able to be mobilized in host genomes. They are currently recognized as the major mutation inducers because of their insertion in the target, their effect on neighboring regions, or their ectopic recombination. A large number of factors including chemical and physical factors as well as intraspecific crosses have traditionally been identified as inducers of transposition. Besides environmental factors, interspecific crosses have also been proposed as promoters of transposition of particular TEs in plants and different animals. Our previous published work includes a genome-wide survey with the set of genomic TEs and shows that interspecific hybridization between the species Drosophila buzzatii and Drosophila koepferae induces genomic instability by transposition bursts. A high percentage of this instability corresponds to TEs belonging to classes I and II. The detailed study of three TEs (Osvaldo, Helena, and Galileo), representative of the different TE families, shows an increase of transposition in hybrids compared with parental species, that varies depending on the element. This study suggests ample variation in TE regulation mechanisms and the question is why this variation occurs. Interspecific hybridization is a genomic stressor that disrupts the stability of TEs probably contributing to a relaxation of the mechanisms controlling TEs in the Drosophila genome. In this commentary paper we will discuss these results and the molecular mechanisms that could explain these increases of transposition rates observed in interspecific Drosophila hybrids. PMID:25136509

Plasmid-Mediated Antimicrobial Resistance in Staphylococci and Other Firmicutes.

PubMed

Schwarz, Stefan; Shen, Jianzhong; Wendlandt, Sarah; Fessler, Andrea T; Wang, Yang; Kadlec, Kristina; Wu, Cong-Ming

2014-12-01

In staphylococci and other Firmicutes, resistance to numerous classes of antimicrobial agents, which are commonly used in human and veterinary medicine, is mediated by genes that are associated with mobile genetic elements. The gene products of some of these antimicrobial resistance genes confer resistance to only specific members of a certain class of antimicrobial agents, whereas others confer resistance to the entire class or even to members of different classes of antimicrobial agents. The resistance mechanisms specified by the resistance genes fall into any of three major categories: active efflux, enzymatic inactivation, and modification/replacement/protection of the target sites of the antimicrobial agents. Among the mobile genetic elements that carry such resistance genes, plasmids play an important role as carriers of primarily plasmid-borne resistance genes, but also as vectors for nonconjugative and conjugative transposons that harbor resistance genes. Plasmids can be exchanged by horizontal gene transfer between members of the same species but also between bacteria belonging to different species and genera. Plasmids are highly flexible elements, and various mechanisms exist by which plasmids can recombine, form cointegrates, or become integrated in part or in toto into the chromosomal DNA or into other plasmids. As such, plasmids play a key role in the dissemination of antimicrobial resistance genes within the gene pool to which staphylococci and other Firmicutes have access. This chapter is intended to provide an overview of the current knowledge of plasmid-mediated antimicrobial resistance in staphylococci and other Firmicutes.

A Field Guide to Pandemic, Epidemic and Sporadic Clones of Methicillin-Resistant Staphylococcus aureus

PubMed Central

Monecke, Stefan; Coombs, Geoffrey; Shore, Anna C.; Coleman, David C.; Akpaka, Patrick; Borg, Michael; Chow, Henry; Ip, Margaret; Jatzwauk, Lutz; Jonas, Daniel; Kadlec, Kristina; Kearns, Angela; Laurent, Frederic; O'Brien, Frances G.; Pearson, Julie; Ruppelt, Antje; Schwarz, Stefan; Scicluna, Elizabeth; Slickers, Peter; Tan, Hui-Leen; Weber, Stefan; Ehricht, Ralf

2011-01-01

In recent years, methicillin-resistant Staphylococcus aureus (MRSA) have become a truly global challenge. In addition to the long-known healthcare-associated clones, novel strains have also emerged outside of the hospital settings, in the community as well as in livestock. The emergence and spread of virulent clones expressing Panton-Valentine leukocidin (PVL) is an additional cause for concern. In order to provide an overview of pandemic, epidemic and sporadic strains, more than 3,000 clinical and veterinary isolates of MRSA mainly from Germany, the United Kingdom, Ireland, France, Malta, Abu Dhabi, Hong Kong, Australia, Trinidad & Tobago as well as some reference strains from the United States have been genotyped by DNA microarray analysis. This technique allowed the assignment of the MRSA isolates to 34 distinct lineages which can be clearly defined based on non-mobile genes. The results were in accordance with data from multilocus sequence typing. More than 100 different strains were distinguished based on affiliation to these lineages, SCCmec type and the presence or absence of PVL. These strains are described here mainly with regard to clinically relevant antimicrobial resistance- and virulence-associated markers, but also in relation to epidemiology and geographic distribution. The findings of the study show a high level of biodiversity among MRSA, especially among strains harbouring SCCmec IV and V elements. The data also indicate a high rate of genetic recombination in MRSA involving SCC elements, bacteriophages or other mobile genetic elements and large-scale chromosomal replacements. PMID:21494333

Mapping Fifteen Trace Elements in Human Seminal Plasma and Sperm DNA.

PubMed

Ali, Sazan; Chaspoul, Florence; Anderson, Loundou; Bergé-Lefranc, David; Achard, Vincent; Perrin, Jeanne; Gallice, Philippe; Guichaoua, Marie

2017-02-01

Studies suggest a relationship between semen quality and the concentration of trace elements in serum or seminal plasma. However, trace elements may be linked to DNA and capable of altering the gene expression patterns. Thus, trace element interactions with DNA may contribute to the mechanisms for a trans-generational reproductive effect. We developed an analytical method to determine the amount of trace elements bound to the sperm DNA, and to estimate their affinity for the sperm DNA by the ratio: R = Log [metal concentration in the sperm DNA/metal concentration in seminal plasma]. We then analyzed the concentrations of 15 trace elements (Al, Cd, Cr, Cu, Hg, Mn, Mo, Ni, Pb, Ti, V, Zn, As, Sb, and Se) in the seminal plasma and the sperm DNA in 64 normal and 30 abnormal semen specimens with Inductively Coupled Plasma/Mass Spectrometry (ICP-MS). This study showed all trace elements were detected in the seminal plasma and only metals were detected in the sperm DNA. There was no correlation between the metals' concentrations in the seminal plasma and the sperm DNA. Al had the highest affinity for DNA followed by Pb and Cd. This strong affinity is consistent with the known mutagenic effects of these metals. The lowest affinity was observed for Zn and Ti. We observed a significant increase of Al linked to the sperm DNA of patients with oligozoospermia and teratozoospermia. Al's reproductive toxicity might be due to Al linked to DNA, by altering spermatogenesis and expression patterns of genes involved in the function of reproduction.

Targeted DNA sequencing and in situ mutation analysis using mobile phone microscopy

NASA Astrophysics Data System (ADS)

Kühnemund, Malte; Wei, Qingshan; Darai, Evangelia; Wang, Yingjie; Hernández-Neuta, Iván; Yang, Zhao; Tseng, Derek; Ahlford, Annika; Mathot, Lucy; Sjöblom, Tobias; Ozcan, Aydogan; Nilsson, Mats

2017-01-01

Molecular diagnostics is typically outsourced to well-equipped centralized laboratories, often far from the patient. We developed molecular assays and portable optical imaging designs that permit on-site diagnostics with a cost-effective mobile-phone-based multimodal microscope. We demonstrate that targeted next-generation DNA sequencing reactions and in situ point mutation detection assays in preserved tumour samples can be imaged and analysed using mobile phone microscopy, achieving a new milestone for tele-medicine technologies.

Streptococcal group B integrative and mobilizable element IMESag-rpsI encodes a functional relaxase involved in its transfer

PubMed Central

Lorenzo-Diaz, Fabian; Fernández-Lopez, Cris; Douarre, Pierre-Emmanuel; Baez-Ortega, Adrian; Flores, Carlos; Glaser, Philippe

2016-01-01

Streptococcus agalactiae or Group B Streptococcus (GBS) are opportunistic bacteria that can cause lethal sepsis in children and immuno-compromised patients. Their genome is a reservoir of mobile genetic elements that can be horizontally transferred. Among them, integrative and conjugative elements (ICEs) and the smaller integrative and mobilizable elements (IMEs) primarily reside in the bacterial chromosome, yet have the ability to be transferred between cells by conjugation. ICEs and IMEs are therefore a source of genetic variability that participates in the spread of antibiotic resistance. Although IMEs seem to be the most prevalent class of elements transferable by conjugation, they are poorly known. Here, we have studied a GBS-IME, termed IMESag-rpsI, which is widely distributed in GBS despite not carrying any apparent virulence trait. Analyses of 240 whole genomes showed that IMESag-rpsI is present in approximately 47% of the genomes, has a roughly constant size (approx. 9 kb) and is always integrated at a single location, the 3′-end of the gene encoding the ribosomal protein S9 (rpsI). Based on their genetic variation, several IMESag-rpsI types were defined (A–J) and classified in clonal complexes (CCs). CC1 was the most populated by IMESag-rpsI (more than 95%), mostly of type-A (71%). One CC1 strain (S. agalactiae HRC) was deep-sequenced to understand the rationale underlying type-A IMESag-rpsI enrichment in GBS. Thirteen open reading frames were identified, one of them encoding a protein (MobSag) belonging to the broadly distributed family of relaxases MOBV1. Protein MobSag was purified and, by a newly developed method, shown to cleave DNA at a specific dinucleotide. The S. agalactiae HRC-IMESag-rpsI is able to excise from the chromosome, as shown by the presence of circular intermediates, and it harbours a fully functional mobilization module. Further, the mobSag gene encoded by this mobile element is able to promote plasmid transfer among pneumococcal strains, suggesting that MobSag facilitates the spread of IMESag-rpsI and that this spread would explain the presence of the same IMESag-rpsI type in GBS strains belonging to different CCs. PMID:27707895

Streptococcal group B integrative and mobilizable element IMESag-rpsI encodes a functional relaxase involved in its transfer.

PubMed

Lorenzo-Diaz, Fabian; Fernández-Lopez, Cris; Douarre, Pierre-Emmanuel; Baez-Ortega, Adrian; Flores, Carlos; Glaser, Philippe; Espinosa, Manuel

2016-10-01

Streptococcus agalactiae or Group B Streptococcus (GBS) are opportunistic bacteria that can cause lethal sepsis in children and immuno-compromised patients. Their genome is a reservoir of mobile genetic elements that can be horizontally transferred. Among them, integrative and conjugative elements (ICEs) and the smaller integrative and mobilizable elements (IMEs) primarily reside in the bacterial chromosome, yet have the ability to be transferred between cells by conjugation. ICEs and IMEs are therefore a source of genetic variability that participates in the spread of antibiotic resistance. Although IMEs seem to be the most prevalent class of elements transferable by conjugation, they are poorly known. Here, we have studied a GBS-IME, termed IMESag-rpsI, which is widely distributed in GBS despite not carrying any apparent virulence trait. Analyses of 240 whole genomes showed that IMESag-rpsI is present in approximately 47% of the genomes, has a roughly constant size (approx. 9 kb) and is always integrated at a single location, the 3'-end of the gene encoding the ribosomal protein S9 (rpsI). Based on their genetic variation, several IMESag-rpsI types were defined (A-J) and classified in clonal complexes (CCs). CC1 was the most populated by IMESag-rpsI (more than 95%), mostly of type-A (71%). One CC1 strain (S. agalactiae HRC) was deep-sequenced to understand the rationale underlying type-A IMESag-rpsI enrichment in GBS. Thirteen open reading frames were identified, one of them encoding a protein (MobSag) belonging to the broadly distributed family of relaxases MOB V1 Protein MobSag was purified and, by a newly developed method, shown to cleave DNA at a specific dinucleotide. The S. agalactiae HRC-IMESag-rpsI is able to excise from the chromosome, as shown by the presence of circular intermediates, and it harbours a fully functional mobilization module. Further, the mobSag gene encoded by this mobile element is able to promote plasmid transfer among pneumococcal strains, suggesting that MobSag facilitates the spread of IMESag-rpsI and that this spread would explain the presence of the same IMESag-rpsI type in GBS strains belonging to different CCs. © 2016 The Authors.

Recombinant SINEs are formed at high frequency during induced retrotransposition in vivo.

PubMed

Yadav, Vijay Pal; Mandal, Prabhat Kumar; Bhattacharya, Alok; Bhattacharya, Sudha

2012-05-22

Non-long terminal repeat Retrotransposons are referred to as long interspersed nuclear elements (LINEs) and their non-autonomous partners are short interspersed nuclear elements (SINEs). It is believed that an active SINE copy, upon retrotransposition, generates near identical copies of itself, which subsequently accumulate mutations resulting in sequence polymorphism. Here we show that when a retrotransposition-competent cell line of the parasitic protist Entamoeba histolytica, transfected with a marked SINE copy, is induced to retrotranspose, >20% of the newly retrotransposed copies are neither identical to the marked SINE nor to the mobilized resident SINEs. Rather they are recombinants of resident SINEs and the marked SINE. They are a consequence of retrotransposition and not DNA recombination, as they are absent in cells not expressing the retrotransposition functions. This high-frequency recombination provides a new explanation for the existence of mosaic SINEs, which may impact on genetic analysis of SINE lineages, and measurement of phylogenetic distances.

A new approach for annotation of transposable elements using small RNA mapping

PubMed Central

El Baidouri, Moaine; Kim, Kyung Do; Abernathy, Brian; Arikit, Siwaret; Maumus, Florian; Panaud, Olivier; Meyers, Blake C.; Jackson, Scott A.

2015-01-01

Transposable elements (TEs) are mobile genomic DNA sequences found in most organisms. They so densely populate the genomes of many eukaryotic species that they are often the major constituents. With the rapid generation of many plant genome sequencing projects over the past few decades, there is an urgent need for improved TE annotation as a prerequisite for genome-wide studies. Analogous to the use of RNA-seq for gene annotation, we propose a new method for de novo TE annotation that uses as a guide 24 nt-siRNAs that are a part of TE silencing pathways. We use this new approach, called TASR (for Transposon Annotation using Small RNAs), for de novo annotation of TEs in Arabidopsis, rice and soybean and demonstrate that this strategy can be successfully applied for de novo TE annotation in plants. Executable PERL is available for download from: http://tasr-pipeline.sourceforge.net/ PMID:25813049

Phage-inducible chromosomal islands are ubiquitous within the bacterial universe.

PubMed

Fillol-Salom, Alfred; Martínez-Rubio, Roser; Abdulrahman, Rezheen F; Chen, John; Davies, Robert; Penadés, José R

2018-06-06

Phage-inducible chromosomal islands (PICIs) are a recently discovered family of pathogenicity islands that contribute substantively to horizontal gene transfer, host adaptation and virulence in Gram-positive cocci. Here we report that similar elements also occur widely in Gram-negative bacteria. As with the PICIs from Gram-positive cocci, their uniqueness is defined by a constellation of features: unique and specific attachment sites, exclusive PICI genes, a phage-dependent mechanism of induction, conserved replication origin organization, convergent mechanisms of phage interference, and specific packaging of PICI DNA into phage-like infectious particles, resulting in very high transfer frequencies. We suggest that the PICIs represent two or more distinct lineages, have spread widely throughout the bacterial world, and have diverged much more slowly than their host organisms or their prophage cousins. Overall, these findings represent the discovery of a universal class of mobile genetic elements.

Stochastic Predator-Prey Dynamics of Transposons in the Human Genome

NASA Astrophysics Data System (ADS)

Xue, Chi; Goldenfeld, Nigel

2016-11-01

Transposable elements, or transposons, are DNA sequences that can jump from site to site in the genome during the life cycle of a cell, usually encoding the very enzymes which perform their excision. However, some transposons are parasitic, relying on the enzymes produced by the regular transposons. In this case, we show that a stochastic model, which takes into account the small copy numbers of the active transposons in a cell, predicts noise-induced predator-prey oscillations with a characteristic time scale that is much longer than the cell replication time, indicating that the state of the predator-prey oscillator is stored in the genome and transmitted to successive generations. Our work demonstrates the important role of the number fluctuations in the expression of mobile genetic elements, and shows explicitly how ecological concepts can be applied to the dynamics and fluctuations of living genomes.

Mobile glasses-free 3D using compact waveguide hologram

NASA Astrophysics Data System (ADS)

Pyun, K.; Choi, C.; Morozov, A.; Putilin, A.; Bovsunovskiy, I.; Kim, S.; Ahn, J.; Lee, H.-S.; Lee, S.

2013-02-01

The exploding mobile communication devices make 3D data available anywhere anytime. However, to record and reconstruct 3D, the huge number of optical components is often required, which makes overall device size bulky and image quality degraded due to the error-prone tuning. In addition, if additional glass is required, then user experience of 3D is exhausting and unpleasant. Holography is the ultimate 3D that users experience natural 3D in every direction. For mobile glasses-free 3D experience, it is critical to make holography device that can be as compact and integrated as possible. For reliable and economical mass production, integrated optics is needed as integrated circuits in semiconductor industry. Thus, we propose mobile glasses-free 3D using compact waveguide hologram in terms of overall device sizes, quantity of elements and combined functionality of each element. The main advantages of proposed solution are as follows: First, this solution utilizes various integral optical elements, where each of them is a united not adjustable optical element, replacing separate and adjustable optical elements with various forms and configurations. Second, geometrical form of integral elements provides small sizes of whole device. Third, geometrical form of integral elements allows creating flat device. And finally, absence of adjustable elements provide rigidly of whole device. The usage of integrated optical means based on waveguide holographic elements allows creating a new type of compact and high functional devices for mobile glasses-free 3D applications such as mobile medical 3D data visualization.

Identification of the cAMP response element that controls transcriptional activation of the insulin-like growth factor-I gene by prostaglandin E2 in osteoblasts

NASA Technical Reports Server (NTRS)

Thomas, M. J.; Umayahara, Y.; Shu, H.; Centrella, M.; Rotwein, P.; McCarthy, T. L.

1996-01-01

Insulin-like growth factor-I (IGF-I), a multifunctional growth factor, plays a key role in skeletal growth and can enhance bone cell replication and differentiation. We previously showed that prostaglandin E2 (PGE2) and other agents that increase cAMP activated IGF-I gene transcription in primary rat osteoblast cultures through promoter 1 (P1), the major IGF-I promoter, and found that transcriptional induction was mediated by protein kinase A. We now have identified a short segment of P1 that is essential for full hormonal regulation and have characterized inducible DNA-protein interactions involving this site. Transient transfections of IGF-I P1 reporter genes into primary rat osteoblasts showed that the 328-base pair untranslated region of exon 1 was required for a full 5.3-fold response to PGE2; mutation in a previously footprinted site, HS3D (base pairs +193 to +215), reduced induction by 65%. PGE2 stimulated nuclear protein binding to HS3D. Binding, as determined by gel mobility shift assay, was not seen in nuclear extracts from untreated osteoblast cultures, was detected within 2 h of PGE2 treatment, and was maximal by 4 h. This DNA-protein interaction was not observed in cytoplasmic extracts from PGE2-treated cultures, indicating nuclear localization of the protein kinase A-activated factor(s). Activation of this factor was not blocked by cycloheximide (Chx), and Chx did not impair stimulation of IGF-I gene expression by PGE2. In contrast, binding to a consensus cAMP response element (CRE; 5'-TGACGTCA-3') from the rat somatostatin gene was not modulated by PGE2 or Chx. Competition gel mobility shift analysis using mutated DNA probes identified 5'-CGCAATCG-3' as the minimal sequence needed for inducible binding. All modified IGF-I P1 promoterreporter genes with mutations within this CRE sequence also showed a diminished functional response to PGE2. These results identify the CRE within the 5'-untranslated region of IGF-I exon 1 that is required for hormonal activation of IGF-I gene transcription by cAMP in osteoblasts.

Carrier mobility in double-helix DNA and RNA: A quantum chemistry study with Marcus-Hush theory.

PubMed

Wu, Tao; Sun, Lei; Shi, Qi; Deng, Kaiming; Deng, Weiqiao; Lu, Ruifeng

2016-12-21

Charge mobilities of six DNAs and RNAs have been computed using quantum chemistry calculation combined with the Marcus-Hush theory. Based on this simulation model, we obtained quite reasonable results when compared with the experiment, and the obtained charge mobility strongly depends on the molecular reorganization and electronic coupling. Besides, we find that hole mobilities are larger than electron mobilities no matter in DNAs or in RNAs, and the hole mobility of 2L8I can reach 1.09 × 10 -1 cm 2 V -1 s -1 which can be applied in the molecular wire. The findings also show that our theoretical model can be regarded as a promising candidate for screening DNA- and RNA-based molecular electronic devices.

Carrier mobility in double-helix DNA and RNA: A quantum chemistry study with Marcus-Hush theory

NASA Astrophysics Data System (ADS)

Wu, Tao; Sun, Lei; Shi, Qi; Deng, Kaiming; Deng, Weiqiao; Lu, Ruifeng

2016-12-01

Charge mobilities of six DNAs and RNAs have been computed using quantum chemistry calculation combined with the Marcus-Hush theory. Based on this simulation model, we obtained quite reasonable results when compared with the experiment, and the obtained charge mobility strongly depends on the molecular reorganization and electronic coupling. Besides, we find that hole mobilities are larger than electron mobilities no matter in DNAs or in RNAs, and the hole mobility of 2L8I can reach 1.09 × 10-1 cm2 V-1 s-1 which can be applied in the molecular wire. The findings also show that our theoretical model can be regarded as a promising candidate for screening DNA- and RNA-based molecular electronic devices.

HiCoDG: a hierarchical data-gathering scheme using cooperative multiple mobile elements.

PubMed

Van Le, Duc; Oh, Hoon; Yoon, Seokhoon

2014-12-17

In this paper, we study mobile element (ME)-based data-gathering schemes in wireless sensor networks. Due to the physical speed limits of mobile elements, the existing data-gathering schemes that use mobile elements can suffer from high data-gathering latency. In order to address this problem, this paper proposes a new hierarchical and cooperative data-gathering (HiCoDG) scheme that enables multiple mobile elements to cooperate with each other to collect and relay data. In HiCoDG, two types of mobile elements are used: the mobile collector (MC) and the mobile relay (MR). MCs collect data from sensors and forward them to the MR, which will deliver them to the sink. In this work, we also formulated an integer linear programming (ILP) optimization problem to find the optimal trajectories for MCs and the MR, such that the traveling distance of MEs is minimized. Two variants of HiCoDG, intermediate station (IS)-based and cooperative movement scheduling (CMS)-based, are proposed to facilitate cooperative data forwarding from MCs to the MR. An analytical model for estimating the average data-gathering latency in HiCoDG was also designed. Simulations were performed to compare the performance of the IS and CMS variants, as well as a multiple traveling salesman problem (mTSP)-based approach. The simulation results show that HiCoDG outperforms mTSP in terms of latency. The results also show that CMS can achieve the lowest latency with low energy consumption.

HiCoDG: A Hierarchical Data-Gathering Scheme Using Cooperative Multiple Mobile Elements †

PubMed Central

Van Le, Duc; Oh, Hoon; Yoon, Seokhoon

2014-01-01

In this paper, we study mobile element (ME)-based data-gathering schemes in wireless sensor networks. Due to the physical speed limits of mobile elements, the existing data-gathering schemes that use mobile elements can suffer from high data-gathering latency. In order to address this problem, this paper proposes a new hierarchical and cooperative data-gathering (HiCoDG) scheme that enables multiple mobile elements to cooperate with each other to collect and relay data. In HiCoDG, two types of mobile elements are used: the mobile collector (MC) and the mobile relay (MR). MCs collect data from sensors and forward them to the MR, which will deliver them to the sink. In this work, we also formulated an integer linear programming (ILP) optimization problem to find the optimal trajectories for MCs and the MR, such that the traveling distance of MEs is minimized. Two variants of HiCoDG, intermediate station (IS)-based and cooperative movement scheduling (CMS)-based, are proposed to facilitate cooperative data forwarding from MCs to the MR. An analytical model for estimating the average data-gathering latency in HiCoDG was also designed. Simulations were performed to compare the performance of the IS and CMS variants, as well as a multiple traveling salesman problem (mTSP)-based approach. The simulation results show that HiCoDG outperforms mTSP in terms of latency. The results also show that CMS can achieve the lowest latency with low energy consumption. PMID:25526356

Diversity, Evolution, and Functionality of Clustered Regularly Interspaced Short Palindromic Repeat (CRISPR) Regions in the Fire Blight Pathogen Erwinia amylovora▿†

PubMed Central

Rezzonico, Fabio; Smits, Theo H. M.; Duffy, Brion

2011-01-01

The clustered regularly interspaced short palindromic repeat (CRISPR)/Cas system confers acquired heritable immunity against mobile nucleic acid elements in prokaryotes, limiting phage infection and horizontal gene transfer of plasmids. In CRISPR arrays, characteristic repeats are interspersed with similarly sized nonrepetitive spacers derived from transmissible genetic elements and acquired when the cell is challenged with foreign DNA. New spacers are added sequentially and the number and type of CRISPR units can differ among strains, providing a record of phage/plasmid exposure within a species and giving a valuable typing tool. The aim of this work was to investigate CRISPR diversity in the highly homogeneous species Erwinia amylovora, the causal agent of fire blight. A total of 18 CRISPR genotypes were defined within a collection of 37 cosmopolitan strains. Strains from Spiraeoideae plants clustered in three major groups: groups II and III were composed exclusively of bacteria originating from the United States, whereas group I generally contained strains of more recent dissemination obtained in Europe, New Zealand, and the Middle East. Strains from Rosoideae and Indian hawthorn (Rhaphiolepis indica) clustered separately and displayed a higher intrinsic diversity than that of isolates from Spiraeoideae plants. Reciprocal exclusion was generally observed between plasmid content and cognate spacer sequences, supporting the role of the CRISPR/Cas system in protecting against foreign DNA elements. However, in several group III strains, retention of plasmid pEU30 is inconsistent with a functional CRISPR/Cas system. PMID:21460108

Diversity, evolution, and functionality of clustered regularly interspaced short palindromic repeat (CRISPR) regions in the fire blight pathogen Erwinia amylovora.

PubMed

Rezzonico, Fabio; Smits, Theo H M; Duffy, Brion

2011-06-01

The clustered regularly interspaced short palindromic repeat (CRISPR)/Cas system confers acquired heritable immunity against mobile nucleic acid elements in prokaryotes, limiting phage infection and horizontal gene transfer of plasmids. In CRISPR arrays, characteristic repeats are interspersed with similarly sized nonrepetitive spacers derived from transmissible genetic elements and acquired when the cell is challenged with foreign DNA. New spacers are added sequentially and the number and type of CRISPR units can differ among strains, providing a record of phage/plasmid exposure within a species and giving a valuable typing tool. The aim of this work was to investigate CRISPR diversity in the highly homogeneous species Erwinia amylovora, the causal agent of fire blight. A total of 18 CRISPR genotypes were defined within a collection of 37 cosmopolitan strains. Strains from Spiraeoideae plants clustered in three major groups: groups II and III were composed exclusively of bacteria originating from the United States, whereas group I generally contained strains of more recent dissemination obtained in Europe, New Zealand, and the Middle East. Strains from Rosoideae and Indian hawthorn (Rhaphiolepis indica) clustered separately and displayed a higher intrinsic diversity than that of isolates from Spiraeoideae plants. Reciprocal exclusion was generally observed between plasmid content and cognate spacer sequences, supporting the role of the CRISPR/Cas system in protecting against foreign DNA elements. However, in several group III strains, retention of plasmid pEU30 is inconsistent with a functional CRISPR/Cas system.

Targeted DNA sequencing and in situ mutation analysis using mobile phone microscopy

PubMed Central

Kühnemund, Malte; Wei, Qingshan; Darai, Evangelia; Wang, Yingjie; Hernández-Neuta, Iván; Yang, Zhao; Tseng, Derek; Ahlford, Annika; Mathot, Lucy; Sjöblom, Tobias; Ozcan, Aydogan; Nilsson, Mats

2017-01-01

Molecular diagnostics is typically outsourced to well-equipped centralized laboratories, often far from the patient. We developed molecular assays and portable optical imaging designs that permit on-site diagnostics with a cost-effective mobile-phone-based multimodal microscope. We demonstrate that targeted next-generation DNA sequencing reactions and in situ point mutation detection assays in preserved tumour samples can be imaged and analysed using mobile phone microscopy, achieving a new milestone for tele-medicine technologies. PMID:28094784

Mobile Element Reservoir Mass Balance on Mars: New SIMS and EMP Data from Lonar and Mistastin Craters

NASA Technical Reports Server (NTRS)

Newsom, H. E.; Hagerty, J. J.; Shearer, C. W.

2002-01-01

New SIMS data for mobile elements in Lonar Crater clay minerals are remarkably similar to data for alteration material in the Lafayette Mars meteorite. This work strongly supports the use of terrestrial analogues for Mars, including a new mass balance model for mobile elements through time. Additional information is contained in the original extended abstract.

SINEs of progress: Mobile element applications to molecular ecology.

PubMed

Ray, David A

2007-01-01

Mobile elements represent a unique and under-utilized set of tools for molecular ecologists. They are essentially homoplasy-free characters with the ability to be genotyped in a simple and efficient manner. Interpretation of the data generated using mobile elements can be simple compared to other genetic markers. They exist in a wide variety of taxa and are useful over a wide selection of temporal ranges within those taxa. Furthermore, their mode of evolution instills them with another advantage over other types of multilocus genotype data: the ability to determine loci applicable to a range of time spans in the history of a taxon. In this review, I discuss the application of mobile element markers, especially short interspersed elements (SINEs), to phylogenetic and population data, with an emphasis on potential applications to molecular ecology.

The influence of direct mobile phone radiation on sperm quality.

PubMed

Gorpinchenko, Igor; Nikitin, Oleg; Banyra, Oleg; Shulyak, Alexander

2014-01-01

It is impossible to imagine a modern socially-active man who does not use mobile devices and/or computers with Wi-Fi function. The effect of mobile phone radiation on male fertility is the subject of recent interest and investigations. The aim of this study was to investigate the direct in vitro influence of mobile phone radiation on sperm DNA fragmentation and motility parameters in healthy subjects with normozoospermia. 32 healthy men with normal semen parameters were selected for the study. Each sperm sample was divided into two equal portions (A and B). Portions A of all involved men were placed for 5 hours in a thermostat, and portions B were placed into a second thermostat for the same period of time, where a mobile phone in standby/talk mode was placed. After 5 hours of incubation the sperm samples from both thermostats were re-evaluated regarding basic motility parameters. The presence of DNA fragmentation in both A and B portions of each sample was determined each hour using a standard sperm chromatin dispersion test. The number of spermatozoa with progressive movement in the group, influenced by electromagnetic radiation, is statistically lower than the number of spermatozoa with progressive movement in the group under no effect of the mobile phone. The number of non-progressive movement spermatozoa was significantly higher in the group, which was influenced by cell phone radiation. The DNA fragmentation was also significantly higher in this group. A correlation exists between mobile phone radiation exposure, DNA-fragmentation level and decreased sperm motility.

SXT/R391 Integrative and Conjugative Elements (ICEs) Encode a Novel 'Trap-Door' Strategy for Mobile Element Escape.

PubMed

Ryan, Michael P; Armshaw, Patricia; Pembroke, J Tony

2016-01-01

Integrative conjugative elements (ICEs) are a class of bacterial mobile elements that have the ability to mediate their own integration, excision, and transfer from one host genome to another by a mechanism of site-specific recombination, self-circularisation, and conjugative transfer. Members of the SXT/R391 ICE family of enterobacterial mobile genetic elements display an unusual UV-inducible sensitization function which results in stress induced killing of bacterial cells harboring the ICE. This sensitization has been shown to be associated with a stress induced overexpression of a mobile element encoded conjugative transfer gene, orf43, a traV homolog. This results in cell lysis and release of a circular form of the ICE. Induction of this novel system may allow transfer of an ICE, enhancing its survival potential under conditions not conducive to conjugative transfer.

Isotopic and trace element variability in altered and unaltered tuffs at Yucca Mountain, Nevada

USGS Publications Warehouse

Peterman, Z.E.; Spengler, R.W.; Singer, F.R.; Dickerson, R.P.

1993-01-01

Reference stratigraphic sections near Yucca Mountain, Nevada were established and sampled in outcrop areas where the volcanic rocks have been minimally altered. Isotopic and trace element analyses obtained for these reference sections are baseline data for assessing the degree and extent of element mobility attendant with past zonal alteration of the rock mass. In agreement with earlier studies, zeolitization is shown to have occurred under wholesale open-system conditions. Calcium was increased by two three times the baseline values and strontium up to twenty times. In contrast, barium displays less variability, and the high-field strength elements zirconium and titanium were the least mobile during zeolitization. The data reported here establish the usefulness of reference sections of assessing past elements mobility. The information gained will be helpful in predicting possible future element mobility induced by thermally activated fluids in the near field of a potential repository.

Recombination between Streptococcus suis ICESsu32457 and Streptococcus agalactiae ICESa2603 yields a hybrid ICE transferable to Streptococcus pyogenes.

PubMed

Marini, Emanuela; Palmieri, Claudio; Magi, Gloria; Facinelli, Bruna

2015-07-09

Integrative conjugative elements (ICEs) are mobile genetic elements that reside in the chromosome but retain the ability to undergo excision and to transfer by conjugation. Genes involved in drug resistance, virulence, or niche adaptation are often found among backbone genes as cargo DNA. We recently characterized in Streptococcus suis an ICE (ICESsu32457) carrying resistance genes [tet(O/W/32/O), tet(40), erm(B), aphA, and aadE] in the 15K unstable genetic element, which is flanked by two ∼1.3kb direct repeats. Remarkably, ∼1.3-kb sequences are conserved in ICESa2603 of Streptococcus agalactiae 2603V/R, which carry heavy metal resistance genes cadC/cadA and mer. In matings between S. suis 32457 (donor) and S. agalactiae 2603V/R (recipient), transconjugants were obtained. PCR experiments, PFGE, and sequence analysis of transconjugants demonstrated a tandem array between ICESsu32457 and ICESa2603. Matings between tandem array-containing S. agalactiae 2603V/R (donor) and Streptococcus pyogenes RF12 (recipient) yielded a single transconjugant containing a hybrid ICE, here named ICESa2603/ICESsu32457. The hybrid formed by recombination of the left ∼1.3-kb sequence of ICESsu32457 and the ∼1.3-kb sequence of ICESa2603. Interestingly, the hybrid ICE was transferable between S. pyogenes strains, thus demonstrating that it behaves as a conventional ICE. These findings suggest that both tandem arrays and hybrid ICEs may contribute to the evolution of antibiotic resistance in streptococci, creating novel mobile elements capable of disseminating new combinations of antibiotic resistance genes. Copyright © 2015 Elsevier B.V. All rights reserved.

Demonstrating Interactions of Transcription Factors with DNA by Electrophoretic Mobility Shift Assay.

PubMed

Yousaf, Nasim; Gould, David

2017-01-01

Confirming the binding of a transcription factor with a particular DNA sequence may be important in characterizing interactions with a synthetic promoter. Electrophoretic mobility shift assay is a powerful approach to demonstrate the specific DNA sequence that is bound by a transcription factor and also to confirm the specific transcription factor involved in the interaction. In this chapter we describe a method we have successfully used to demonstrate interactions of endogenous transcription factors with sequences derived from endogenous and synthetic promoters.

Coarse-grained model of conformation-dependent electrophoretic mobility and its influence on DNA dynamics

NASA Astrophysics Data System (ADS)

Pandey, Harsh; Underhill, Patrick T.

2015-11-01

The electrophoretic mobility of molecules such as λ -DNA depends on the conformation of the molecule. It has been shown that electrohydrodynamic interactions between parts of the molecule lead to a mobility that depends on conformation and can explain some experimental observations. We have developed a new coarse-grained model that incorporates these changes of mobility into a bead-spring chain model. Brownian dynamics simulations have been performed using this model. The model reproduces the cross-stream migration that occurs in capillary electrophoresis when pressure-driven flow is applied parallel or antiparallel to the electric field. The model also reproduces the change of mobility when the molecule is stretched significantly in an extensional field. We find that the conformation-dependent mobility can lead to a new type of unraveling of the molecule in strong fields. This occurs when different parts of the molecule have different mobilities and the electric field is large.

Heteroleptic Copper(I) Complexes of "Scorpionate" Bis-pyrazolyl Carboxylate Ligand with Auxiliary Phosphine as Potential Anticancer Agents: An Insight into Cytotoxic Mode.

PubMed

Khan, Rais Ahmad; Usman, Mohammad; Dhivya, Rajakumar; Balaji, Perumalsamy; Alsalme, Ali; AlLohedan, Hamad; Arjmand, Farukh; AlFarhan, Khalid; Akbarsha, Mohammad Abdulkader; Marchetti, Fabio; Pettinari, Claudio; Tabassum, Sartaj

2017-03-24

New copper(I) complexes [CuCl(PPh 3 )(L)] (1: L = L A  = 4-carboxyphenyl)bis(3,5-dimethylpyrazolyl)methane; (2: L = L B  = 3-carboxyphenyl)bis(3,5-dimethylpyrazolyl)methane) were prepared and characterised by elemental analysis and various spectroscopic techniques such as FT-IR, NMR, UV-Vis, and ESI-MS. The molecular structures of complexes 1 and 2 were analyzed by theoretical B3LYP/DFT method. Furthermore, in vitro DNA binding studies were carried out to check the ability of complexes 1 and 2 to interact with native calf thymus DNA (CT-DNA) using absorption titration, fluorescence quenching and circular dichroism, which is indicative of more avid binding of the complex 1. Moreover, DNA mobility assay was also conducted to study the concentration-dependent cleavage pattern of pBR322 DNA by complex 1, and the role of ROS species to have a mechanistic insight on the cleavage pattern, which ascertained substantial roles by both hydrolytic and oxidative pathways. Additionally, we analyzed the potential of the interaction of complex 1 with DNA and enzyme (Topo I and II) with the aid of molecular modeling. Furthermore, cytotoxic activity of complex 1 was tested against HepG2 cancer cell lines. Thus, the potential of the complex 1 is promising though further in vivo investigations may be required before subjecting it to clinical trials.

Birth and death of genes linked to chromosomal inversion

PubMed Central

Furuta, Yoshikazu; Kawai, Mikihiko; Yahara, Koji; Takahashi, Noriko; Handa, Naofumi; Tsuru, Takeshi; Oshima, Kenshiro; Yoshida, Masaru; Azuma, Takeshi; Hattori, Masahira; Uchiyama, Ikuo; Kobayashi, Ichizo

2011-01-01

The birth and death of genes is central to adaptive evolution, yet the underlying genome dynamics remain elusive. The availability of closely related complete genome sequences helps to follow changes in gene contents and clarify their relationship to overall genome organization. Helicobacter pylori, bacteria in our stomach, are known for their extreme genome plasticity through mutation and recombination and will make a good target for such an analysis. In comparing their complete genome sequences, we found that gain and loss of genes (loci) for outer membrane proteins, which mediate host interaction, occurred at breakpoints of chromosomal inversions. Sequence comparison there revealed a unique mechanism of DNA duplication: DNA duplication associated with inversion. In this process, a DNA segment at one chromosomal locus is copied and inserted, in an inverted orientation, into a distant locus on the same chromosome, while the entire region between these two loci is also inverted. Recognition of this and three more inversion modes, which occur through reciprocal recombination between long or short sequence similarity or adjacent to a mobile element, allowed reconstruction of synteny evolution through inversion events in this species. These results will guide the interpretation of extensive DNA sequencing results for understanding long- and short-term genome evolution in various organisms and in cancer cells. PMID:21212362

Hypoxia inducible factor-1 mediates the expression of the immune checkpoint HLA-G in glioma cells through hypoxia response element located in exon 2.

PubMed

Yaghi, Layale; Poras, Isabelle; Simoes, Renata T; Donadi, Eduardo A; Tost, Jörg; Daunay, Antoine; de Almeida, Bibiana Sgorla; Carosella, Edgardo D; Moreau, Philippe

2016-09-27

HLA-G is an immune checkpoint molecule with specific relevance in cancer immunotherapy. It was first identified in cytotrophoblasts, protecting the fetus from maternal rejection. HLA-G tissue expression is very restricted but induced in numerous malignant tumors such as glioblastoma, contributing to their immune escape. Hypoxia occurs during placenta and tumor development and was shown to activate HLA-G. We aimed to elucidate the mechanisms of HLA-G activation under conditions combining hypoxia-mimicking treatment and 5-aza-2'deoxycytidine, a DNA demethylating agent used in anti-cancer therapy which also induces HLA-G. Both treatments enhanced the amount of HLA-G mRNA and protein in HLA-G negative U251MG glioma cells. Electrophoretic Mobility Shift Assays and luciferase reporter gene assays revealed that HLA-G upregulation depends on Hypoxia Inducible Factor-1 (HIF-1) and a hypoxia responsive element (HRE) located in exon 2. A polymorphic HRE at -966 bp in the 5'UT region may modulate the magnitude of the response mediated by the exon 2 HRE. We suggest that therapeutic strategies should take into account that HLA-G expression in response to hypoxic tumor environment is dependent on HLA-G gene polymorphism and DNA methylation state at the HLA-G locus.

Interactions between the promoter and first intron are involved in transcriptional control of alpha 1(I) collagen gene expression.

PubMed Central

Bornstein, P; McKay, J; Liska, D J; Apone, S; Devarayalu, S

1988-01-01

The first intron of the human collagen alpha 1(I) gene contains several positively and negatively acting elements. We have studied the transcription of collagen-human growth hormone fusion genes, containing deletions and rearrangements of collagen intronic sequences, by transient transfection of chick tendon fibroblasts and NIH 3T3 cells. In chick tendon fibroblasts, but not in 3T3 cells, inversion of intronic sequences containing a previously studied 274-base-pair segment, A274, resulted in markedly reduced human growth hormone mRNA levels as determined by an RNase protection assay. This inhibitory effect was largely alleviated when deletions were introduced in the collagen promoter of plasmids containing negatively oriented intronic sequences. Evidence for interaction of the promoter with the intronic segment, A274, was obtained by gel mobility shift assays. We suggest that promoter-intron interactions, mediated by DNA-binding proteins, regulate collagen gene transcription. Inversion of intronic segments containing critical interactive elements might then lead to an altered geometry and reduced activity of a transcriptional complex in those cells with sufficiently high levels of appropriate transcription factors. We further suggest that the deleted promoter segment plays a key role in directing DNA interactions involved in transcriptional control. Images PMID:3211130

A fitness cost associated with the antibiotic resistance enzyme SME-1 beta-lactamase.

PubMed

Marciano, David C; Karkouti, Omid Y; Palzkill, Timothy

2007-08-01

The bla(TEM-1) beta-lactamase gene has become widespread due to the selective pressure of beta-lactam use and its stable maintenance on transferable DNA elements. In contrast, bla(SME-1) is rarely isolated and is confined to the chromosome of carbapenem-resistant Serratia marcescens strains. Dissemination of bla(SME-1) via transfer to a mobile DNA element could hinder the use of carbapenems. In this study, bla(SME-1) was determined to impart a fitness cost upon Escherichia coli in multiple genetic contexts and assays. Genetic screens and designed SME-1 mutants were utilized to identify the source of this fitness cost. These experiments established that the SME-1 protein was required for the fitness cost but also that the enzyme activity of SME-1 was not associated with the fitness cost. The genetic screens suggested that the SME-1 signal sequence was involved in the fitness cost. Consistent with these findings, exchange of the SME-1 signal sequence for the TEM-1 signal sequence alleviated the fitness cost while replacing the TEM-1 signal sequence with the SME-1 signal sequence imparted a fitness cost to TEM-1 beta-lactamase. Taken together, these results suggest that fitness costs associated with some beta-lactamases may limit their dissemination.

A Fitness Cost Associated With the Antibiotic Resistance Enzyme SME-1 β-Lactamase

PubMed Central

Marciano, David C.; Karkouti, Omid Y.; Palzkill, Timothy

2007-01-01

The blaTEM-1 β-lactamase gene has become widespread due to the selective pressure of β-lactam use and its stable maintenance on transferable DNA elements. In contrast, blaSME-1 is rarely isolated and is confined to the chromosome of carbapenem-resistant Serratia marcescens strains. Dissemination of blaSME-1 via transfer to a mobile DNA element could hinder the use of carbapenems. In this study, blaSME-1 was determined to impart a fitness cost upon Escherichia coli in multiple genetic contexts and assays. Genetic screens and designed SME-1 mutants were utilized to identify the source of this fitness cost. These experiments established that the SME-1 protein was required for the fitness cost but also that the enzyme activity of SME-1 was not associated with the fitness cost. The genetic screens suggested that the SME-1 signal sequence was involved in the fitness cost. Consistent with these findings, exchange of the SME-1 signal sequence for the TEM-1 signal sequence alleviated the fitness cost while replacing the TEM-1 signal sequence with the SME-1 signal sequence imparted a fitness cost to TEM-1 β-lactamase. Taken together, these results suggest that fitness costs associated with some β-lactamases may limit their dissemination. PMID:17565956

Using column experiments to examine transport of As and other trace elements released from poultry litter: Implications for trace element mobility in agricultural watersheds.

PubMed

Oyewumi, Oluyinka; Schreiber, Madeline E

2017-08-01

Trace elements are added to poultry feed to control infection and improve weight gain. However, the fate of these trace elements in poultry litter is poorly understood. Because poultry litter is applied as fertilizer in many agricultural regions, evaluation of the environmental processes that influence the mobility of litter-derived trace elements is critical for predicting if trace elements are retained in soil or released to water. This study examined the effect of dissolved organic carbon (DOC) in poultry litter leachate on the fate and transport of litter-derived elements (As, Cu, P and Zn) using laboratory column experiments with soil collected from the Delmarva Peninsula (Mid-Atlantic, USA), a region of intense poultry production. Results of the experiments showed that DOC enhanced the mobility of all of the studied elements. However, despite the increased mobility, 60-70% of Zn, As and P mass was retained within the soil. In contrast, almost all of the Cu was mobilized in the litter leachate experiments, with very little retention in soil. Overall, our results demonstrate that the mobility of As, Cu, Zn and P in soils which receive poultry litter application is strongly influenced by both litter leachate composition, specifically organic acids, and adsorption to soil. Results have implications for understanding fate and transport of trace elements released from litter application to soil water and groundwater, which can affect both human health and the environment. Copyright © 2017 Elsevier Ltd. All rights reserved.

Mobile genetic elements and antibiotic resistance in mine soil amended with organic wastes.

PubMed

Garbisu, Carlos; Garaiyurrebaso, Olatz; Lanzén, Anders; Álvarez-Rodríguez, Itxaso; Arana, Lide; Blanco, Fernando; Smalla, Kornelia; Grohmann, Elisabeth; Alkorta, Itziar

2018-04-15

Metal resistance has been associated with antibiotic resistance due to co- or cross-resistance mechanisms. Here, metal contaminated mine soil treated with organic wastes was screened for the presence of mobile genetic elements (MGEs). The occurrence of conjugative IncP-1 and mobilizable IncQ plasmids, as well as of class 1 integrons, was confirmed by PCR and Southern blot hybridization, suggesting that bacteria from these soils have gene-mobilizing capacity with implications for the dissemination of resistance factors. Moreover, exogenous isolation of MGEs from the soil bacterial community was attempted under antibiotic selection pressure by using Escherichia coli as recipient. Seventeen putative transconjugants were identified based on increased antibiotic resistance. Metabolic traits and metal resistance of putative transconjugants were investigated, and whole genome sequencing was carried out for two of them. Most putative transconjugants displayed a multi-resistant phenotype for a broad spectrum of antibiotics. They also displayed changes regarding the ability to metabolise different carbon sources, RNA: DNA ratio, growth rate and biofilm formation. Genome sequencing of putative transconjugants failed to detect genes acquired by horizontal gene transfer, but instead revealed a number of nonsense mutations, including in ubiH, whose inactivation was linked to the observed resistance to aminoglycosides. Our results confirm that mine soils contain MGEs encoding antibiotic resistance. Moreover, they point out the role of spontaneous mutations in achieving low-level antibiotic resistance in a short time, which was associated with a trade-off in the capability to metabolise specific carbon sources. Copyright © 2017. Published by Elsevier B.V.

Retroelements (LINEs and SINEs) in vole genomes: differential distribution in the constitutive heterochromatin.

PubMed

Acosta, M J; Marchal, J A; Fernández-Espartero, C H; Bullejos, M; Sánchez, A

2008-01-01

The chromosomal distribution of mobile genetic elements is scarcely known in Arvicolinae species, but could be of relevance to understand the origin and complex evolution of the sex chromosome heterochromatin. In this work we cloned two retrotransposon sequences, L1 and SINE-B1, from the genome of Chionomys nivalis and investigated their chromosomal distribution on several arvicoline species. Our results demonstrate first that both retroelements are the most abundant repeated DNA sequences in the genome of these species. L1 elements, in most species, are highly accumulated in the sex chromosomes compared to the autosomes. This favoured L1 insertion could have played an important role in the origin of the enlarged heterochromatic blocks existing in the sex chromosomes of some Microtus species. Also, we propose that L1 accumulation on the X heterochromatin could have been the consequence of different, independent and rapid amplification processes acting in each species. SINE elements, however, were completely lacking from the constitutive heterochromatin, either in autosomes or in the heterochromatic blocks of sex chromosomes. These data could indicate that some SINE elements are incompatible with the formation of heterochromatic complexes and hence are necessarily missing from the constitutive heterochromatin.

Optical mapping reveals a large genetic inversion between two methicillin-resistant Staphylococcus aureus strains.

PubMed

Shukla, Sanjay K; Kislow, Jennifer; Briska, Adam; Henkhaus, John; Dykes, Colin

2009-09-01

Staphylococcus aureus is a highly versatile and evolving bacterium of great clinical importance. S. aureus can evolve by acquiring single nucleotide polymorphisms and mobile genetic elements and by recombination events. Identification and location of novel genomic elements in a bacterial genome are not straightforward, unless the whole genome is sequenced. Optical mapping is a new tool that creates a high-resolution, in situ ordered restriction map of a bacterial genome. These maps can be used to determine genomic organization and perform comparative genomics to identify genomic rearrangements, such as insertions, deletions, duplications, and inversions, compared to an in silico (virtual) restriction map of a known genome sequence. Using this technology, we report here the identification, approximate location, and characterization of a genetic inversion of approximately 500 kb of a DNA element between the NRS387 (USA800) and FPR3757 (USA300) strains. The presence of the inversion and location of its junction sites were confirmed by site-specific PCR and sequencing. At both the left and right junction sites in NRS387, an IS1181 element and a 73-bp sequence were identified as inverted repeats, which could explain the possible mechanism of the inversion event.

Plasmid-mediated resistance to protein biosynthesis inhibitors in staphylococci.

PubMed

Schwarz, Stefan; Fessler, Andrea T; Hauschild, Tomasz; Kehrenberg, Corinna; Kadlec, Kristina

2011-12-01

Protein biosynthesis inhibitors (PBIs) represent powerful antimicrobial agents for the control of bacterial infections. In staphylococci, numerous resistance genes are known to be involved in resistance to PBIs, most of which mediate resistance to a specific class/subclass of PBIs, though a few genes do confer a multidrug resistance phenotype-up to five classes/subclasses of PBIs. Plasmids play a key role in the dissemination of PBI resistance among staphylococci, as they primarily carry plasmid-borne PBI resistance genes; however, plasmids also can be vectors for transposon-borne PBI resistance genes. Small plasmids that carry single PBI resistance genes are widespread among staphylococci of human and animal origin. Various mechanisms exist by which they can recombine, form cointegrates, or integrate into chromosomal DNA or larger plasmids. We provide an overview of the current knowledge of plasmid-mediated PBI resistance in staphylococci, with particular reference to the currently known PBI resistance genes, their association with mobile genetic elements, and the recombination/integration processes that control their mobility. © 2011 New York Academy of Sciences.

Nedd4 Family Interacting Protein 1 (Ndfip1) Is Required for Ubiquitination and Nuclear Trafficking of BRCA1-associated ATM Activator 1 (BRAT1) during the DNA Damage Response*

PubMed Central

Low, Ley-Hian; Chow, Yuh-Lit; Li, Yijia; Goh, Choo-Peng; Putz, Ulrich; Silke, John; Ouchi, Toru; Howitt, Jason; Tan, Seong-Seng

2015-01-01

During injury, cells are vulnerable to apoptosis from a variety of stress conditions including DNA damage causing double-stranded breaks. Without repair, these breaks lead to aberrations in DNA replication and transcription, leading to apoptosis. A major response to DNA damage is provided by the protein kinase ATM (ataxia telangiectasia mutated) that is capable of commanding a plethora of signaling networks for DNA repair, cell cycle arrest, and even apoptosis. A key element in the DNA damage response is the mobilization of activating proteins into the cell nucleus to repair damaged DNA. BRAT1 is one of these proteins, and it functions as an activator of ATM by maintaining its phosphorylated status while also keeping other phosphatases at bay. However, it is unknown how BRAT1 is trafficked into the cell nucleus to maintain ATM phosphorylation. Here we demonstrate that Ndfip1-mediated ubiquitination of BRAT1 leads to BRAT1 trafficking into the cell nucleus. Without Ndfip1, BRAT1 failed to translocate to the nucleus. Under genotoxic stress, cells showed increased expression of both Ndfip1 and phosphorylated ATM. Following brain injury, neurons show increased expression of Ndfip1 and nuclear translocation of BRAT1. These results point to Ndfip1 as a sensor protein during cell injury and Ndfip1 up-regulation as a cue for BRAT1 ubiquitination by Nedd4 E3 ligases, followed by nuclear translocation of BRAT1. PMID:25631046

Integrative and conjugative elements and their hosts: composition, distribution and organization.

PubMed

Cury, Jean; Touchon, Marie; Rocha, Eduardo P C

2017-09-06

Conjugation of single-stranded DNA drives horizontal gene transfer between bacteria and was widely studied in conjugative plasmids. The organization and function of integrative and conjugative elements (ICE), even if they are more abundant, was only studied in a few model systems. Comparative genomics of ICE has been precluded by the difficulty in finding and delimiting these elements. Here, we present the results of a method that circumvents these problems by requiring only the identification of the conjugation genes and the species' pan-genome. We delimited 200 ICEs and this allowed the first large-scale characterization of these elements. We quantified the presence in ICEs of a wide set of functions associated with the biology of mobile genetic elements, including some that are typically associated with plasmids, such as partition and replication. Protein sequence similarity networks and phylogenetic analyses revealed that ICEs are structured in functional modules. Integrases and conjugation systems have different evolutionary histories, even if the gene repertoires of ICEs can be grouped in function of conjugation types. Our characterization of the composition and organization of ICEs paves the way for future functional and evolutionary analyses of their cargo genes, composed of a majority of unknown function genes. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

Comparative Genome Analysis of “Candidatus Phytoplasma australiense” (Subgroup tuf-Australia I; rp-A) and “Ca. Phytoplasma asteris” Strains OY-M and AY-WB▿ †

PubMed Central

Tran-Nguyen, L. T. T.; Kube, M.; Schneider, B.; Reinhardt, R.; Gibb, K. S.

2008-01-01

The chromosome sequence of “Candidatus Phytoplasma australiense” (subgroup tuf-Australia I; rp-A), associated with dieback in papaya, Australian grapevine yellows in grapevine, and several other important plant diseases, was determined. The circular chromosome is represented by 879,324 nucleotides, a GC content of 27%, and 839 protein-coding genes. Five hundred two of these protein-coding genes were functionally assigned, while 337 genes were hypothetical proteins with unknown function. Potential mobile units (PMUs) containing clusters of DNA repeats comprised 12.1% of the genome. These PMUs encoded genes involved in DNA replication, repair, and recombination; nucleotide transport and metabolism; translation; and ribosomal structure. Elements with similarities to phage integrases found in these mobile units were difficult to classify, as they were similar to both insertion sequences and bacteriophages. Comparative analysis of “Ca. Phytoplasma australiense” with “Ca. Phytoplasma asteris” strains OY-M and AY-WB showed that the gene order was more conserved between the closely related “Ca. Phytoplasma asteris” strains than to “Ca. Phytoplasma australiense.” Differences observed between “Ca. Phytoplasma australiense” and “Ca. Phytoplasma asteris” strains included the chromosome size (18,693 bp larger than OY-M), a larger number of genes with assigned function, and hypothetical proteins with unknown function. PMID:18359806

Functional organization of DNA elements regulating SM30alpha, a spicule matrix gene of sea urchin embryos.

PubMed

Yamasu, K; Wilt, F H

1999-02-01

The SM30a gene encodes a protein in the embryonic endoskeleton of the sea urchin Strongylocentrotus purpuratus, and is specifically expressed in the skeletogenic primary mesenchyme cell lineage. To clarify the mechanism for the differentiation of this cell lineage, which proceeds rather autonomously in the embryo, regulation of the SM30alpha gene was investigated previously and it was shown that the distal DNA region upstream of this gene from - 1.6 to - 1.0 kb contained numerous negative regulatory elements that suppressed the ectopic expression of the gene in the gut. Here we study the influence of the proximal region from - 303 to + 104 bp. Analysis of the expression of reporter constructs indicated that a strong positive enhancer element existed in the region from -142 to -105bp. This element worked both in forward and reverse orientations and additively when placed tandemly upstream to the reporter gene. In addition, other weaker positive and negative regulatory sites were also detected throughout the proximal region. Electrophoretic gel mobility shift analyses showed that multiple nuclear proteins were bound to the putative strong enhancer region. One of the proteins binding to this region was present in ear y blastulae, a time when the SM30 gene was still silent, but it was not in prism embryos actively expressing the gene. The binding region for this blastula-specific protein was narrowed down to the region from - 132 to -122 bp, which included the consensus binding site for the mammalian proto-oncogene product, Ets. Two possible SpGCF1 binding sites were identified in the vicinity of the enhancer region. This information was used to make a comparison of the general regulatory architecture of genes that contribute to the formation of the skeletal spicule.

The Evolution of Mobile DNAs: When Will Transposons Create Phylogenies That Look As If There Is a Master Gene?

PubMed Central

Brookfield, John F. Y.; Johnson, Louise J.

2006-01-01

Some families of mammalian interspersed repetitive DNA, such as the Alu SINE sequence, appear to have evolved by the serial replacement of one active sequence with another, consistent with there being a single source of transposition: the “master gene.” Alternative models, in which multiple source sequences are simultaneously active, have been called “transposon models.” Transposon models differ in the proportion of elements that are active and in whether inactivation occurs at the moment of transposition or later. Here we examine the predictions of various types of transposon model regarding the patterns of sequence variation expected at an equilibrium between transposition, inactivation, and deletion. Under the master gene model, all bifurcations in the true tree of elements occur in a single lineage. We show that this property will also hold approximately for transposon models in which most elements are inactive and where at least some of the inactivation events occur after transposition. Such tree shapes are therefore not conclusive evidence for a single source of transposition. PMID:16790583

Long Chain DNA Separation in a Sparse Nanopost Array

NASA Astrophysics Data System (ADS)

Ou, Jia; Joswiak, Mark; Dorfman, Kevin

2010-11-01

Long chain DNA separation is a challenge for gel lectrophoresis. Our previous DNA separation experiments and simulations demonstrated that a sparse micro post array can separate large DNA. However, the smaller DNA are not well resolved. We hypothesized that smaller posts will increase the collision frequency of the smaller DNA and thus the resolution. We successfully fabricated a hexagonal array of 350 nm diameter posts with a 3 μm spacing using an oxygen plasma etching method. Under an electric field of 10 V/cm, the mobilities of different species ranging from 10-48.5 kilobasepair (kbp) were normalized by the mobility of λ DNA (48.5 kbp), which was included in all experiments as a standard to correct for day-to-day variations in electroosmotic flow. The resolution of these DNA is markedly improved when compared with a 1 μm diameter micropost array. We demonstrate the robustness of the device by using the calibration curve to identify the peaks in a separation of the λ DNA-Mono Cut mix.

Identification of transactivation-responsive DNA-binding protein 43 (TARDBP43; TDP-43) as a novel factor for TNF-α expression upon lipopolysaccharide stimulation in human monocytes.

PubMed

Murata, H; Hattori, T; Maeda, H; Takashiba, S; Takigawa, M; Kido, J; Nagata, T

2015-08-01

Tumor necrosis factor alpha (TNF-α) is a major cytokine implicated in various inflammatory diseases. The nature of the nuclear factors associated with human TNF-α gene regulation is not well elucidated. We previously identified a novel region located from -550 to -487 in human TNF-α promoter that did not contain the reported binding sites for nuclear factor kappa B (NF-κB) but showed lipopolysaccharide (LPS)-induced transcriptional activity. The purpose of this study is to identify novel factors that bind to the promoter region and regulate TNF-α expression. To identify DNA-binding proteins that bound to the target region of TNF-α promoter, a cDNA library from LPS-stimulated human monocytic cell line THP-1 was screened using a yeast one-hybrid system. Cellular localizations of the DNA-binding protein in the cells were examined by subcellular immunocytochemistry. Nuclear amounts of the protein in LPS-stimulated THP-1 cells were identified by western blot analysis. Expression of mRNA of the protein in the cells was quantified by real-time polymerase chain reaction. Electrophoretic mobility shift assays were performed to confirm the DNA-binding profile. Overexpression of the protein and knockdown of the gene were also performed to investigate the role for TNF-α expression. Several candidates were identified from the cDNA library and transactivation-responsive DNA-binding protein 43 (TARDBP43; TDP-43) was focused on. Western blot analysis revealed that nuclear TDP-43 protein was increased in the LPS-stimulated THP-1 cells. Expression of TDP-43 mRNA was already enhanced before TNF-α induction by LPS. Electrophoretic mobility shift assay analysis showed that nuclear extracts obtained by overexpressing FLAG-tagged TDP-43 bound to the -550 to -487 TNF-α promoter fragments. Overexpression of TDP-43 in THP-1 cells resulted in an increase of TNF-α expression. Knockdown of TDP-43 in THP-1 cells downregulated TNF-α expression. We identified TDP-43 as one of the novel TNF-α factors and found that it bound to the LPS-responsive element in the TNF-α promoter to increase TNF-α expression. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Mechanisms of Evolution in High-Consequence Drug Resistance Plasmids.

PubMed

He, Susu; Chandler, Michael; Varani, Alessandro M; Hickman, Alison B; Dekker, John P; Dyda, Fred

2016-12-06

The dissemination of resistance among bacteria has been facilitated by the fact that resistance genes are usually located on a diverse and evolving set of transmissible plasmids. However, the mechanisms generating diversity and enabling adaptation within highly successful resistance plasmids have remained obscure, despite their profound clinical significance. To understand these mechanisms, we have performed a detailed analysis of the mobilome (the entire mobile genetic element content) of a set of previously sequenced carbapenemase-producing Enterobacteriaceae (CPE) from the National Institutes of Health Clinical Center. This analysis revealed that plasmid reorganizations occurring in the natural context of colonization of human hosts were overwhelmingly driven by genetic rearrangements carried out by replicative transposons working in concert with the process of homologous recombination. A more complete understanding of the molecular mechanisms and evolutionary forces driving rearrangements in resistance plasmids may lead to fundamentally new strategies to address the problem of antibiotic resistance. The spread of antibiotic resistance among Gram-negative bacteria is a serious public health threat, as it can critically limit the types of drugs that can be used to treat infected patients. In particular, carbapenem-resistant members of the Enterobacteriaceae family are responsible for a significant and growing burden of morbidity and mortality. Here, we report on the mechanisms underlying the evolution of several plasmids carried by previously sequenced clinical Enterobacteriaceae isolates from the National Institutes of Health Clinical Center (NIH CC). Our ability to track genetic rearrangements that occurred within resistance plasmids was dependent on accurate annotation of the mobile genetic elements within the plasmids, which was greatly aided by access to long-read DNA sequencing data and knowledge of their mechanisms. Mobile genetic elements such as transposons and integrons have been strongly associated with the rapid spread of genes responsible for antibiotic resistance. Understanding the consequences of their actions allowed us to establish unambiguous evolutionary relationships between plasmids in the analysis set. Copyright © 2016 He et al.

Nucleosome mobilization by ISW2 requires the concerted action of the ATPase and SLIDE domains

PubMed Central

Hota, Swetansu K.; Bhardwaj, Saurabh K.; Deindl, Sebastian; Lin, Yuan-chi; Zhuang, Xiaowei; Bartholomew, Blaine

2013-01-01

The ISWI family of ATP-dependent chromatin remodelers represses transcription by changing nucleosome positioning. The interactions with extranucleosomal DNA and the requirement of a minimal length of extranucleosomal DNA by ISWI mediate the spacing of nucleosomes. ISW2 from Saccharomyces cerevisiae, a member of the ISWI family, has a conserved domain called SLIDE (SANT-like ISWI domain), whose binding to extranucleosomal DNA ~19 bp from the edge of nucleosomes is required for efficiently pushing DNA into nucleosomes and maintaining the unidirectional movement of nucleosomes, as reported here. Loss of SLIDE binding does not perturb ATPase domain binding to the SHL2 site of nucleosomes or its initial movement of DNA inside of nucleosomes. ISW2 has therefore two distinct roles in mobilizing nucleosomes, with the ATPase domain translocating and moving DNA inside nucleosomes, and the SLIDE domain facilitating the entry of linker DNA into nucleosomes. PMID:23334290

Modular structural elements in the replication origin region of Tetrahymena rDNA.

PubMed Central

Du, C; Sanzgiri, R P; Shaiu, W L; Choi, J K; Hou, Z; Benbow, R M; Dobbs, D L

1995-01-01

Computer analyses of the DNA replication origin region in the amplified rRNA genes of Tetrahymena thermophila identified a potential initiation zone in the 5'NTS [Dobbs, Shaiu and Benbow (1994), Nucleic Acids Res. 22, 2479-2489]. This region consists of a putative DNA unwinding element (DUE) aligned with predicted bent DNA segments, nuclear matrix or scaffold associated region (MAR/SAR) consensus sequences, and other common modular sequence elements previously shown to be clustered in eukaryotic chromosomal origin regions. In this study, two mung bean nuclease-hypersensitive sites in super-coiled plasmid DNA were localized within the major DUE-like element predicted by thermodynamic analyses. Three restriction fragments of the 5'NTS region predicted to contain bent DNA segments exhibited anomalous migration characteristic of bent DNA during electrophoresis on polyacrylamide gels. Restriction fragments containing the 5'NTS region bound Tetrahymena nuclear matrices in an in vitro binding assay, consistent with an association of the replication origin region with the nuclear matrix in vivo. The direct demonstration in a protozoan origin region of elements previously identified in Drosophila, chick and mammalian origin regions suggests that clusters of modular structural elements may be a conserved feature of eukaryotic chromosomal origins of replication. Images PMID:7784181

Localisation Microscopy of Breast Epithelial ErbB-2 Receptors and Gap Junctions: Trafficking after γ-Irradiation, Neuregulin-1β, and Trastuzumab Application

PubMed Central

Pilarczyk, Götz; Nesnidal, Ines; Gunkel, Manuel; Bach, Margund; Bestvater, Felix; Hausmann, Michael

2017-01-01

In cancer, vulnerable breast epithelium malignance tendency correlates with number and activation of ErbB receptor tyrosine kinases. In the presented work, we observe ErbB receptors activated by irradiation-induced DNA injury or neuregulin-1β application, or alternatively, attenuated by a therapeutic antibody using high resolution fluorescence localization microscopy. The gap junction turnover coinciding with ErbB receptor activation and co-transport is simultaneously recorded. DNA injury caused by 4 Gray of 6 MeV photon γ-irradiation or alternatively neuregulin-1β application mobilized ErbB receptors in a nucleograde fashion—a process attenuated by trastuzumab antibody application. This was accompanied by increased receptor density, indicating packing into transport units. Factors mobilizing ErbB receptors also mobilized plasma membrane resident gap junction channels. The time course of ErbB receptor activation and gap junction mobilization recapitulates the time course of non-homologous end-joining DNA repair. We explain our findings under terms of DNA injury-induced membrane receptor tyrosine kinase activation and retrograde trafficking. In addition, we interpret the phenomenon of retrograde co-trafficking of gap junction connexons stimulated by ErbB receptor activation. PMID:28208769

A Surrogate Approach to Study the Evolution of Noncoding DNA Elements That Organize Eukaryotic Genomes

PubMed Central

Vermaak, Danielle; Bayes, Joshua J.

2009-01-01

Comparative genomics provides a facile way to address issues of evolutionary constraint acting on different elements of the genome. However, several important DNA elements have not reaped the benefits of this new approach. Some have proved intractable to current day sequencing technology. These include centromeric and heterochromatic DNA, which are essential for chromosome segregation as well as gene regulation, but the highly repetitive nature of the DNA sequences in these regions make them difficult to assemble into longer contigs. Other sequences, like dosage compensation X chromosomal sites, origins of DNA replication, or heterochromatic sequences that encode piwi-associated RNAs, have proved difficult to study because they do not have recognizable DNA features that allow them to be described functionally or computationally. We have employed an alternate approach to the direct study of these DNA elements. By using proteins that specifically bind these noncoding DNAs as surrogates, we can indirectly assay the evolutionary constraints acting on these important DNA elements. We review the impact that such “surrogate strategies” have had on our understanding of the evolutionary constraints shaping centromeres, origins of DNA replication, and dosage compensation X chromosomal sites. These have begun to reveal that in contrast to the view that such structural DNA elements are either highly constrained (under purifying selection) or free to drift (under neutral evolution), some of them may instead be shaped by adaptive evolution and genetic conflicts (these are not mutually exclusive). These insights also help to explain why the same elements (e.g., centromeres and replication origins), which are so complex in some eukaryotic genomes, can be simple and well defined in other where similar conflicts do not exist. PMID:19635763

The expanding universe of transposon technologies for gene and cell engineering.

PubMed

Ivics, Zoltán; Izsvák, Zsuzsanna

2010-12-07

Transposable elements can be viewed as natural DNA transfer vehicles that, similar to integrating viruses, are capable of efficient genomic insertion. The mobility of class II transposable elements (DNA transposons) can be controlled by conditionally providing the transposase component of the transposition reaction. Thus, a DNA of interest (be it a fluorescent marker, a small hairpin (sh)RNA expression cassette, a mutagenic gene trap or a therapeutic gene construct) cloned between the inverted repeat sequences of a transposon-based vector can be used for stable genomic insertion in a regulated and highly efficient manner. This methodological paradigm opened up a number of avenues for genome manipulations in vertebrates, including transgenesis for the generation of transgenic cells in tissue culture, the production of germline transgenic animals for basic and applied research, forward genetic screens for functional gene annotation in model species, and therapy of genetic disorders in humans. Sleeping Beauty (SB) was the first transposon shown to be capable of gene transfer in vertebrate cells, and recent results confirm that SB supports a full spectrum of genetic engineering including transgenesis, insertional mutagenesis, and therapeutic somatic gene transfer both ex vivo and in vivo. The first clinical application of the SB system will help to validate both the safety and efficacy of this approach. In this review, we describe the major transposon systems currently available (with special emphasis on SB), discuss the various parameters and considerations pertinent to their experimental use, and highlight the state of the art in transposon technology in diverse genetic applications.

The Martian Soil as a Geochemical Sink for Hydrothermally Altered Crustal Rocks and Mobile Elements: Implications of Early MER Results

NASA Technical Reports Server (NTRS)

Newsom, H. E.; Nelson, M. J.; Shearer, C. K.; Draper, D. S.

2005-01-01

Hydrothermal and aqueous alteration can explain some of the exciting results from the MER team s analyses of the martian soil, including the major elements, mobile elements, and the nickel enrichment. Published results from the five lander missions lead to the following conclusions: 1) The soil appears to be globally mixed and basaltic with only small local variations in chemistry. Relative to martian basaltic meteorites and Gusev rocks the soils are depleted in the fluid-mobile element calcium, but only slightly enriched to somewhat depleted in iron oxide. 2) The presence of olivine in the soils based on M ssbauer data argues that the soil is only partly weathered and is more akin to a lunar regolith than a terrestrial soil. 3) The presence of bromine along with sulfur and chlorine in the soils is consistent with addition of a mobile element component to the soil.

Mariner transposons are sailing in the genome of the blood-sucking bug Rhodnius prolixus.

PubMed

Filée, Jonathan; Rouault, Jacques-Deric; Harry, Myriam; Hua-Van, Aurélie

2015-12-15

The Triatomine bug Rhodnius prolixus is a vector of Trypanosoma cruzi, which causes the Chagas disease in Latin America. R. prolixus can also transfer transposable elements horizontally across a wide range of species. We have taken advantage of the availability of the 700 Mbp complete genome sequence of R. prolixus to study the dynamics of invasion and persistence of transposable elements in this species. Using both library-based and de novo methods of transposon detection, we found less than 6 % of transposable elements in the R. prolixus genome, a relatively low percentage compared to other insect genomes with a similar genome size. DNA transposons are surprisingly abundant and elements belonging to the mariner family are by far the most preponderant components of the mobile part of this genome with 11,015 mariner transposons that could be clustered in 89 groups (75 % of the mobilome). Our analysis allowed the detection of a new mariner clade in the R. prolixus genome, that we called nosferatis. We demonstrated that a large diversity of mariner elements invaded the genome and expanded successfully over time via three main processes. (i) several families experienced recent and massive expansion, for example an explosive burst of a single mariner family led to the generation of more than 8000 copies. These recent expansion events explain the unusual prevalence of mariner transposons in the R. prolixus genome. Other families expanded via older bursts of transposition demonstrating the long lasting permissibility of mariner transposons in the R. prolixus genome. (ii) Many non-autonomous families generated by internal deletions were also identified. Interestingly, two non autonomous families were generated by atypical recombinations (5' part replacement with 3' part). (iii) at least 10 cases of horizontal transfers were found, supporting the idea that host/vector relationships played a pivotal role in the transmission and subsequent persistence of transposable elements in this genome. These data provide a new insight into the evolution of transposons in the genomes of hematophagous insects and bring additional evidences that lateral exchanges of mobile genetics elements occur frequently in the R. prolixus genome.

Reprogramming somatic cells into iPS cells activates LINE-1 retroelement mobility

PubMed Central

Wissing, Silke; Muñoz-Lopez, Martin; Macia, Angela; Yang, Zhiyuan; Montano, Mauricio; Collins, William; Garcia-Perez, Jose Luis; Moran, John V.; Greene, Warner C.

2012-01-01

Long interspersed element-1 (LINE-1 or L1) retrotransposons account for nearly 17% of human genomic DNA and represent a major evolutionary force that has reshaped the structure and function of the human genome. However, questions remain concerning both the frequency and the developmental timing of L1 retrotransposition in vivo and whether the mobility of these retroelements commonly results in insertional and post-insertional mechanisms of genomic injury. Cells exhibiting high rates of L1 retrotransposition might be especially at risk for such injury. We assessed L1 mRNA expression and L1 retrotransposition in two biologically relevant cell types, human embryonic stem cells (hESCs) and induced pluripotent stem cells (iPSCs), as well as in control parental human dermal fibroblasts (HDFs). Full-length L1 mRNA and the L1 open reading frame 1-encoded protein (ORF1p) were readily detected in hESCs and iPSCs, but not in HDFs. Sequencing analysis proved the expression of human-specific L1 element mRNAs in iPSCs. Bisulfite sequencing revealed that the increased L1 expression observed in iPSCs correlates with an overall decrease in CpG methylation in the L1 promoter region. Finally, retrotransposition of an engineered human L1 element was ∼10-fold more efficient in iPSCs than in parental HDFs. These findings indicate that somatic cell reprogramming is associated with marked increases in L1 expression and perhaps increases in endogenous L1 retrotransposition, which could potentially impact the genomic integrity of the resultant iPSCs. PMID:21989055

Mobile genetic elements and cancer. From mutations to gene therapy.

PubMed

Kozeretska, I A; Demydov, S V; Ostapchenko, L I

2011-12-01

In the present review, an association between cancer and the activity of the non-LTR retroelements L1, Alu, and SVA, as well as endogenous retroviruses, in the human genome, is analyzed. Data suggesting that transposons have been involved in embryogenesis and malignization processes, are presented. Events that lead to the activation of mobile elements in mammalian somatic cells, as well as the use of mobile elements in genetic screening and cancer gene therapy, are reviewed.

Pax6 localizes to chromatin-rich territories and displays a slow nuclear mobility altered by disease mutations.

PubMed

Elvenes, Julianne; Sjøttem, Eva; Holm, Turid; Bjørkøy, Geir; Johansen, Terje

2010-12-01

The transcription factor Pax6 is crucial for the embryogenesis of multiple organs, including the eyes, parts of the brain and the pancreas. Mutations in one allele of PAX6 lead to eye diseases including Peter's anomaly and aniridia. Here, we use fluorescence recovery after photobleaching to show that Pax6 and also other Pax family proteins display a strikingly low nuclear mobility compared to other transcriptional regulators. For Pax6, the slow mobility is largely due to the presence of two DNA-binding domains, but protein-protein interactions also contribute. Consistently, the subnuclear localization of Pax6 suggests that it interacts preferentially with chromatin-rich territories. Some aniridia-causing missense mutations in Pax6 have impaired DNA-binding affinity. Interestingly, when these mutants were analyzed by FRAP, they displayed a pronounced increased mobility compared to wild-type Pax6. Hence, our results support the conclusion that disease mutations result in proteins with impaired function because of altered DNA- and protein-interaction capabilities.

Validation of an entirely in vitro approach for rapid prototyping of DNA regulatory elements for synthetic biology

PubMed Central

Chappell, James; Jensen, Kirsten; Freemont, Paul S.

2013-01-01

A bottleneck in our capacity to rationally and predictably engineer biological systems is the limited number of well-characterized genetic elements from which to build. Current characterization methods are tied to measurements in living systems, the transformation and culturing of which are inherently time-consuming. To address this, we have validated a completely in vitro approach for the characterization of DNA regulatory elements using Escherichia coli extract cell-free systems. Importantly, we demonstrate that characterization in cell-free systems correlates and is reflective of performance in vivo for the most frequently used DNA regulatory elements. Moreover, we devise a rapid and completely in vitro method to generate DNA templates for cell-free systems, bypassing the need for DNA template generation and amplification from living cells. This in vitro approach is significantly quicker than current characterization methods and is amenable to high-throughput techniques, providing a valuable tool for rapidly prototyping libraries of DNA regulatory elements for synthetic biology. PMID:23371936

Effect of GSTM1 and GSTT1 Polymorphisms on Genetic Damage in Humans Populations Exposed to Radiation From Mobile Towers.

PubMed

Gulati, Sachin; Yadav, Anita; Kumar, Neeraj; Kanupriya; Aggarwal, Neeraj K; Kumar, Rajesh; Gupta, Ranjan

2016-04-01

All over the world, people have been debating about associated health risks due to radiation from mobile phones and mobile towers. The carcinogenicity of this nonionizing radiation has been the greatest health concern associated with mobile towers exposure until recently. The objective of our study was to evaluate the genetic damage caused by radiation from mobile towers and to find an association between genetic polymorphism of GSTM1 and GSTT1 genes and DNA damage. In our study, 116 persons exposed to radiation from mobile towers and 106 control subjects were genotyped for polymorphisms in the GSTM1 and GSTT1 genes by multiplex polymerase chain reaction method. DNA damage in peripheral blood lymphocytes was determined using alkaline comet assay in terms of tail moment (TM) value and micronucleus assay in buccal cells (BMN). There was a significant increase in BMN frequency and TM value in exposed subjects (3.65 ± 2.44 and 6.63 ± 2.32) compared with control subjects (1.23 ± 0.97 and 0.26 ± 0.27). However, there was no association of GSTM1 and GSTT1 polymorphisms with the level of DNA damage in both exposed and control groups.

Risk element immobilization/stabilization potential of fungal-transformed dry olive residue and arbuscular mycorrhizal fungi application in contaminated soils.

PubMed

García-Sánchez, Mercedes; Stejskalová, Tereza; García-Romera, Inmaculada; Száková, Jiřina; Tlustoš, Pavel

2017-10-01

The use of biotransformed dry olive residue (DOR) as organic soil amendment has recently been proposed due to its high contents of stabilized organic matter and nutrients. The potential of biotransformed DOR to immobilize risk elements in contaminated soils might qualify DOR as a potential risk element stabilization agent for in situ soil reclamation practices. In this experiment, the mobility of risk elements in response to Penicillium chrysogenum-10-transformed DOR, Funalia floccosa-transformed DOR, Bjerkandera adusta-transformed DOR, and Chondrostereum purpureum-transformed DOR as well as arbuscular mycorrhizal fungi (AMF), Funneliformis mosseae, inoculation was investigated. We evaluated the effect of these treatments on risk element uptake by wheat (Triticum aestivum L.) plants in a pot experiment with Cd, Pb, and Zn contaminated soil. The results showed a significant impact of the combined treatment (biotransformed DOR and AMF inoculation) on wheat plant growth and element mobility. The mobile proportions of elements in the treated soils were related to soil pH; with increasing pH levels, Cd, Cu, Fe, Mn, P, Pb, and Zn mobility decreased significantly (r values between -0.36 and -0.46), while Ca and Mg mobility increased (r = 0.63, and r = 0.51, respectively). The application of biotransformed DOR decreased risk element levels (Cd, Zn), and nutrient concentrations (Ca, Cu, Fe, Mg, Mn) in the aboveground biomass, where the elements were retained in the roots. Thus, biotransformed DOR in combination with AMF resulted in a higher capacity of wheat plants to grow under detrimental conditions, being able to accumulate high amounts of risk elements in the roots. However, risk element reduction was insufficient for safe crop production in the extremely contaminated soil. Copyright © 2017 Elsevier Ltd. All rights reserved.

High-mobility group (HMG) protein HMG-1 and TATA-binding protein-associated factor TAF(II)30 affect estrogen receptor-mediated transcriptional activation.

PubMed

Verrier, C S; Roodi, N; Yee, C J; Bailey, L R; Jensen, R A; Bustin, M; Parl, F F

1997-07-01

The estrogen receptor (ER) belongs to a family of ligand-inducible nuclear receptors that exert their effects by binding to cis-acting DNA elements in the regulatory region of target genes. The detailed mechanisms by which ER interacts with the estrogen response element (ERE) and affects transcription still remain to be elucidated. To study the ER-ERE interaction and transcription initiation, we employed purified recombinant ER expressed in both the baculovirus-Sf9 and his-tagged bacterial systems. The effect of high-mobility group (HMG) protein HMG-1 and purified recombinant TATA-binding protein-associated factor TAF(II)30 on ER-ERE binding and transcription initiation were assessed by electrophoretic mobility shift assay and in vitro transcription from an ERE-containing template (pERE2LovTATA), respectively. We find that purified, recombinant ER fails to bind to ERE in spite of high ligand-binding activity and electrophoretic and immunological properties identical to ER in MCF-7 breast cancer cells. HMG-1 interacts with ER and promotes ER-ERE binding in a concentration- and time-dependent manner. The effectiveness of HMG-1 to stimulate ER-ERE binding in the electrophoretic mobility shift assay depends on the sequence flanking the ERE consensus as well as the position of the latter in the oligonucleotide. We find that TAF(II)30 has no effect on ER-ERE binding either alone or in combination with ER and HMG-1. Although HMG-1 promotes ER-ERE binding, it fails to stimulate transcription initiation either in the presence or absence of hormone. In contrast, TAF(II)30, while not affecting ER-ERE binding, stimulates transcription initiation 20-fold in the presence of HMG-1. These results indicate that HMG-1 and TAF(II)30 act in sequence, the former acting to promote ER-ERE binding followed by the latter to stimulate transcription initiation.

SSB as an organizer/mobilizer of genome maintenance complexes

PubMed Central

Shereda, Robert D.; Kozlov, Alexander G.; Lohman, Timothy M.; Cox, Michael M.; Keck, James L.

2008-01-01

When duplex DNA is altered in almost any way (replicated, recombined, or repaired), single strands of DNA are usually intermediates, and single-stranded DNA binding (SSB) proteins are present. These proteins have often been described as inert, protective DNA coatings. Continuing research is demonstrating a far more complex role of SSB that includes the organization and/or mobilization of all aspects of DNA metabolism. Escherichia coli SSB is now known to interact with at least 14 other proteins that include key components of the elaborate systems involved in every aspect of DNA metabolism. Most, if not all, of these interactions are mediated by the amphipathic C-terminus of SSB. In this review, we summarize the extent of the eubacterial SSB interaction network, describe the energetics of interactions with SSB, and highlight the roles of SSB in the process of recombination. Similar themes to those highlighted in this review are evident in all biological systems. PMID:18937104

Quantifying the Number of Independent Organelle DNA Insertions in Genome Evolution and Human Health

PubMed Central

Martin, William F.

2017-01-01

Fragments of organelle genomes are often found as insertions in nuclear DNA. These fragments of mitochondrial DNA (numts) and plastid DNA (nupts) are ubiquitous components of eukaryotic genomes. They are, however, often edited out during the genome assembly process, leading to systematic underestimation of their frequency. Numts and nupts, once inserted, can become further fragmented through subsequent insertion of mobile elements or other recombinational events that disrupt the continuity of the inserted sequence relative to the genuine organelle DNA copy. Because numts and nupts are typically identified through sequence comparison tools such as BLAST, disruption of insertions into smaller fragments can lead to systematic overestimation of numt and nupt frequencies. Accurate identification of numts and nupts is important, however, both for better understanding of their role during evolution, and for monitoring their increasingly evident role in human disease. Human populations are polymorphic for 141 numt loci, five numts are causal to genetic disease, and cancer genomic studies are revealing an abundance of numts associated with tumor progression. Here, we report investigation of salient parameters involved in obtaining accurate estimates of numt and nupt numbers in genome sequence data. Numts and nupts from 44 sequenced eukaryotic genomes reveal lineage-specific differences in the number, relative age and frequency of insertional events as well as lineage-specific dynamics of their postinsertional fragmentation. Our findings outline the main technical parameters influencing accurate identification and frequency estimation of numts in genomic studies pertinent to both evolution and human health. PMID:28444372

DNA Data Visualization (DDV): Software for Generating Web-Based Interfaces Supporting Navigation and Analysis of DNA Sequence Data of Entire Genomes.

PubMed

Neugebauer, Tomasz; Bordeleau, Eric; Burrus, Vincent; Brzezinski, Ryszard

2015-01-01

Data visualization methods are necessary during the exploration and analysis activities of an increasingly data-intensive scientific process. There are few existing visualization methods for raw nucleotide sequences of a whole genome or chromosome. Software for data visualization should allow the researchers to create accessible data visualization interfaces that can be exported and shared with others on the web. Herein, novel software developed for generating DNA data visualization interfaces is described. The software converts DNA data sets into images that are further processed as multi-scale images to be accessed through a web-based interface that supports zooming, panning and sequence fragment selection. Nucleotide composition frequencies and GC skew of a selected sequence segment can be obtained through the interface. The software was used to generate DNA data visualization of human and bacterial chromosomes. Examples of visually detectable features such as short and long direct repeats, long terminal repeats, mobile genetic elements, heterochromatic segments in microbial and human chromosomes, are presented. The software and its source code are available for download and further development. The visualization interfaces generated with the software allow for the immediate identification and observation of several types of sequence patterns in genomes of various sizes and origins. The visualization interfaces generated with the software are readily accessible through a web browser. This software is a useful research and teaching tool for genetics and structural genomics.

Mobile Genetic Elements and Evolution of CRISPR-Cas Systems: All the Way There and Back.

PubMed

Koonin, Eugene V; Makarova, Kira S

2017-10-01

The Clustered Regularly Interspaced Palindromic Repeats (CRISPR)-CRISPR-associated proteins (Cas) systems of bacterial and archaeal adaptive immunity show multifaceted evolutionary relationships with at least five classes of mobile genetic elements (MGE). First, the adaptation module of CRISPR-Cas that is responsible for the formation of the immune memory apparently evolved from a Casposon, a self-synthesizing transposon that employs the Cas1 protein as the integrase and might have brought additional cas genes to the emerging immunity loci. Second, a large subset of type III CRISPR-Cas systems recruited a reverse transcriptase from a Group II intron, providing for spacer acquisition from RNA. Third, effector nucleases of Class 2 CRISPR-Cas systems that are responsible for the recognition and cleavage of the target DNA were derived from transposon-encoded TnpB nucleases, most likely, on several independent occasions. Fourth, accessory nucleases in some variants of types I and III toxin and type VI effectors RNases appear to be ultimately derived from toxin nucleases of microbial toxin-antitoxin modules. Fifth, the opposite direction of evolution is manifested in the recruitment of CRISPR-Cas systems by a distinct family of Tn7-like transposons that probably exploit the capacity of CRISPR-Cas to recognize unique DNA sites to facilitate transposition as well as by bacteriophages that employ them to cope with host defense. Additionally, individual Cas proteins, such as the Cas4 nuclease, were recruited by bacteriophages and transposons. The two-sided evolutionary connection between CRISPR-Cas and MGE fits the "guns for hire" paradigm whereby homologous enzymatic machineries, in particular nucleases, are shuttled between MGE and defense systems and are used alternately as means of offense or defense. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution 2017. This work is written by US Government employees and is in the public domain in the US.

Plasmodium falciparum Nucleosomes Exhibit Reduced Stability and Lost Sequence Dependent Nucleosome Positioning

PubMed Central

Silberhorn, Elisabeth; Schwartz, Uwe; Symelka, Anne; de Koning-Ward, Tania; Längst, Gernot

2016-01-01

The packaging and organization of genomic DNA into chromatin represents an additional regulatory layer of gene expression, with specific nucleosome positions that restrict the accessibility of regulatory DNA elements. The mechanisms that position nucleosomes in vivo are thought to depend on the biophysical properties of the histones, sequence patterns, like phased di-nucleotide repeats and the architecture of the histone octamer that folds DNA in 1.65 tight turns. Comparative studies of human and P. falciparum histones reveal that the latter have a strongly reduced ability to recognize internal sequence dependent nucleosome positioning signals. In contrast, the nucleosomes are positioned by AT-repeat sequences flanking nucleosomes in vivo and in vitro. Further, the strong sequence variations in the plasmodium histones, compared to other mammalian histones, do not present adaptations to its AT-rich genome. Human and parasite histones bind with higher affinity to GC-rich DNA and with lower affinity to AT-rich DNA. However, the plasmodium nucleosomes are overall less stable, with increased temperature induced mobility, decreased salt stability of the histones H2A and H2B and considerable reduced binding affinity to GC-rich DNA, as compared with the human nucleosomes. In addition, we show that plasmodium histone octamers form the shortest known nucleosome repeat length (155bp) in vitro and in vivo. Our data suggest that the biochemical properties of the parasite histones are distinct from the typical characteristics of other eukaryotic histones and these properties reflect the increased accessibility of the P. falciparum genome. PMID:28033404

The Double-Stranded DNA Virosphere as a Modular Hierarchical Network of Gene Sharing

PubMed Central

Iranzo, Jaime

2016-01-01

ABSTRACT Virus genomes are prone to extensive gene loss, gain, and exchange and share no universal genes. Therefore, in a broad-scale study of virus evolution, gene and genome network analyses can complement traditional phylogenetics. We performed an exhaustive comparative analysis of the genomes of double-stranded DNA (dsDNA) viruses by using the bipartite network approach and found a robust hierarchical modularity in the dsDNA virosphere. Bipartite networks consist of two classes of nodes, with nodes in one class, in this case genomes, being connected via nodes of the second class, in this case genes. Such a network can be partitioned into modules that combine nodes from both classes. The bipartite network of dsDNA viruses includes 19 modules that form 5 major and 3 minor supermodules. Of these modules, 11 include tailed bacteriophages, reflecting the diversity of this largest group of viruses. The module analysis quantitatively validates and refines previously proposed nontrivial evolutionary relationships. An expansive supermodule combines the large and giant viruses of the putative order “Megavirales” with diverse moderate-sized viruses and related mobile elements. All viruses in this supermodule share a distinct morphogenetic tool kit with a double jelly roll major capsid protein. Herpesviruses and tailed bacteriophages comprise another supermodule, held together by a distinct set of morphogenetic proteins centered on the HK97-like major capsid protein. Together, these two supermodules cover the great majority of currently known dsDNA viruses. We formally identify a set of 14 viral hallmark genes that comprise the hubs of the network and account for most of the intermodule connections. PMID:27486193

Contaminations of organic fertilizers with antibiotic residues, resistance genes, and mobile genetic elements mirroring antibiotic use in livestock?

PubMed

Wolters, Birgit; Widyasari-Mehta, Arum; Kreuzig, Robert; Smalla, Kornelia

2016-11-01

Pig manures are frequently used as fertilizer or co-substrate in biogas plants (BGPs) and typically contain antibiotic residues (ARs), as well as bacteria carrying resistance genes (RGs) and mobile genetic elements (MGEs). A survey of manures from eight pig fattening and six pig breeding farms and digestates from eight BGPs in Lower Saxony, Germany was conducted to evaluate the link between antibiotic usage and ARs to RGs and MGEs present in organic fertilizers. In total, 11 different antibiotics belonging to six substance classes were applied in the farms investigated. Residue analysis revealed concentrations of tetracycline up to 300 mg kg -1 dry weight (DW) in manures and of doxycycline up to 10.1 mg kg -1 DW in digestates indicating incomplete removal during anaerobic digestion. RGs (sul1, sul2, tet(A), tet(M), tet(X), qacE∆1) were detected in total community DNA of all samples by PCR-Southern blot hybridization. Broad-host range plasmids (IncP-1, IncQ, IncN, and IncW) and integron integrase genes (intI1, intI2) were found in most manure samples with IncN and IncW plasmids being more abundant in manure from pig breeding compared to pig fattening farms. IntI1, IncQ, and IncW plasmids were also detected in all digestates, while IncP-1, IncN, and LowGC plasmids were detected only sporadically. Our findings strongly reinforce the need for further research to identify mitigation strategies to reduce the level of contamination of organic fertilizers with ARs and transferable RGs that are applied to soil and that might influence the mobile resistome of the plant microbiome.

Concerted formation of macromolecular Suppressor–mutator transposition complexes

PubMed Central

Raina, Ramesh; Schläppi, Michael; Karunanandaa, Balasulojini; Elhofy, Adam; Fedoroff, Nina

1998-01-01

Transposition of the maize Suppressor–mutator (Spm) transposon requires two element-encoded proteins, TnpA and TnpD. Although there are multiple TnpA binding sites near each element end, binding of TnpA to DNA is not cooperative, and the binding affinity is not markedly affected by the number of binding sites per DNA fragment. However, intermolecular complexes form cooperatively between DNA fragments with three or more TnpA binding sites. TnpD, itself not a sequence-specific DNA-binding protein, binds to TnpA and stabilizes the TnpA–DNA complex. The high redundancy of TnpA binding sites at both element ends and the protein–protein interactions between DNA-bound TnpA complexes and between these and TnpD imply a concerted transition of the element from a linear to a protein crosslinked transposition complex within a very narrow protein concentration range. PMID:9671711

Useful DNA polymorphisms are identified by snapback, a midrepetitive element in Tribolium castaneum.

PubMed

Stuart, J J; De Gortari, M J; Hall, P S; Maxwell, M E; Mocelin, G; Brown, S J; Muir, W M

1996-06-01

The red flour bettle, Tribolium castaneum, is both a pest of stored grain products and an important experimental organism. To improve its facility as a genetic model, we are developing DNA fingerprinting methods for this insect. A Tribolium DNA fragment, snapback-1 (SBI), identified among sequences that reassociate before a Cot of 0.03 mol.s/L, was found to produce a banding pattern in restriction endonuclease digested genomic DNA that is characteristic of a midrepetitive element. DNA fingerprints of individual beetles demonstrated that unvarying inherited DNA polymorphism is revealed, and that polymorphism is inherited in a dominant Mendelian fashion. Linkage between bands was minimal. The sequence of SBI was determined, and hybridization experiments indicated that SBI is a fragment of a larger midrepetitive element. Fingerprinting individuals with known inbreeding coefficients indicated that SBI loci have relatively high mutation rates. The possibility that SBI is a fragment of a transposable element is discussed.

Motivating PAU Language Testing Candidates through Mobile Technology

ERIC Educational Resources Information Center

Gimenez Lopez, Jose Luis; Garcia Laborda, Jesus; Magal Royo, M. Teresa

2011-01-01

Mobile learning permits combining the most motivating elements of online learning. When becoming a supplement to face-to-face education, it is likely to become a most motivating achievement in e-learning. Up to now, little interest and work has been posed in proposing mobile learning as a supporting element for language testing. In this paper, we…

Mobile DNA and evolution in the 21st century

PubMed Central

2010-01-01

Scientific history has had a profound effect on the theories of evolution. At the beginning of the 21st century, molecular cell biology has revealed a dense structure of information-processing networks that use the genome as an interactive read-write (RW) memory system rather than an organism blueprint. Genome sequencing has documented the importance of mobile DNA activities and major genome restructuring events at key junctures in evolution: exon shuffling, changes in cis-regulatory sites, horizontal transfer, cell fusions and whole genome doublings (WGDs). The natural genetic engineering functions that mediate genome restructuring are activated by multiple stimuli, in particular by events similar to those found in the DNA record: microbial infection and interspecific hybridization leading to the formation of allotetraploids. These molecular genetic discoveries, plus a consideration of how mobile DNA rearrangements increase the efficiency of generating functional genomic novelties, make it possible to formulate a 21st century view of interactive evolutionary processes. This view integrates contemporary knowledge of the molecular basis of genetic change, major genome events in evolution, and stimuli that activate DNA restructuring with classical cytogenetic understanding about the role of hybridization in species diversification. PMID:20226073

MobB protein stimulates nicking at the R1162 origin of transfer by increasing the proportion of complexed plasmid DNA.

PubMed Central

Perwez, T; Meyer, R

1996-01-01

An essential early step in conjugal mobilization of R1162, nicking of the DNA strand that is subsequently transferred, is carried out in the relaxosome, a complex of two plasmid-encoded proteins and DNA at the origin of transfer (oriT). A third protein, MobB, is also required for efficient mobilization. We show that in the cell this protein increases the proportion of molecules specifically nicked at oriT, resulting in lower yields of covalently closed molecules after alkaline extraction. These nicked molecules largely remain supercoiled, with unwinding presumably constrained by the relaxosome. MobB enhances the sensitivity of the oriT DNA to oxidation by permanganate, indicating that the protein acts by increasing the fraction of complexed molecules. Mutations that significantly reduce the amount of complexed DNA in the cell were isolated. However, plasmids with these mutations were mobilized at nearly the normal frequency, were nicked at a commensurate level, and still required MobB. Our results indicate that the frequency of transfer is determined both by the amount of time each molecule is in the nicked form and by the proportion of complexed molecules in the total population. PMID:8824623

Cell Type-Specific Chromatin Signatures Underline Regulatory DNA Elements in Human Induced Pluripotent Stem Cells and Somatic Cells.

PubMed

Zhao, Ming-Tao; Shao, Ning-Yi; Hu, Shijun; Ma, Ning; Srinivasan, Rajini; Jahanbani, Fereshteh; Lee, Jaecheol; Zhang, Sophia L; Snyder, Michael P; Wu, Joseph C

2017-11-10

Regulatory DNA elements in the human genome play important roles in determining the transcriptional abundance and spatiotemporal gene expression during embryonic heart development and somatic cell reprogramming. It is not well known how chromatin marks in regulatory DNA elements are modulated to establish cell type-specific gene expression in the human heart. We aimed to decipher the cell type-specific epigenetic signatures in regulatory DNA elements and how they modulate heart-specific gene expression. We profiled genome-wide transcriptional activity and a variety of epigenetic marks in the regulatory DNA elements using massive RNA-seq (n=12) and ChIP-seq (chromatin immunoprecipitation combined with high-throughput sequencing; n=84) in human endothelial cells (CD31 + CD144 + ), cardiac progenitor cells (Sca-1 + ), fibroblasts (DDR2 + ), and their respective induced pluripotent stem cells. We uncovered 2 classes of regulatory DNA elements: class I was identified with ubiquitous enhancer (H3K4me1) and promoter (H3K4me3) marks in all cell types, whereas class II was enriched with H3K4me1 and H3K4me3 in a cell type-specific manner. Both class I and class II regulatory elements exhibited stimulatory roles in nearby gene expression in a given cell type. However, class I promoters displayed more dominant regulatory effects on transcriptional abundance regardless of distal enhancers. Transcription factor network analysis indicated that human induced pluripotent stem cells and somatic cells from the heart selected their preferential regulatory elements to maintain cell type-specific gene expression. In addition, we validated the function of these enhancer elements in transgenic mouse embryos and human cells and identified a few enhancers that could possibly regulate the cardiac-specific gene expression. Given that a large number of genetic variants associated with human diseases are located in regulatory DNA elements, our study provides valuable resources for deciphering the epigenetic modulation of regulatory DNA elements that fine-tune spatiotemporal gene expression in human cardiac development and diseases. © 2017 American Heart Association, Inc.

Target sites for the transposition of rat long interspersed repeated DNA elements (LINEs) are not random.

PubMed Central

Furano, A V; Somerville, C C; Tsichlis, P N; D'Ambrosio, E

1986-01-01

The long interspersed repeated DNA family of rats (LINE or L1Rn family) contains about 40,000 6.7-kilobase (kb) long members (1). LINE members may be currently mobile since their presence or absence causes allelic variation at three single copy loci (2, 3): insulin 1, Moloney leukemia virus integration 2 (Mlvi-2) (4), and immunoglobulin heavy chain (Igh). To characterize target sites for LINE insertion, we compared the DNA sequences of the unoccupied Mlvi-2 target site, its LINE-containing allele, and several other LINE-containing sites. Although not homologous overall, the target sites share three characteristics: First, depending on the site, they are from 68% to 86% (A+T) compared to 58% (A+T) for total rat DNA (5). Depending on the site, a 7- to 15-bp target site sequence becomes duplicated and flanks the inserted LINE member. The second is a version (0 or 1 mismatch) of the hexanucleotide, TACTCA, which is also present in the LINE member, in a highly conserved region located just before the A-rich right end of the LINE member. The third is a stretch of alternating purine/pyrimidine (PQ). The A-rich right ends of different LINE members vary in length and composition, and the sequence of a particularly long one suggests that it contains the A-rich target site from a previous transposition. PMID:3012480

Alu element insertion in PKLR gene as a novel cause of pyruvate kinase deficiency in Middle Eastern patients.

PubMed

Lesmana, Harry; Dyer, Lisa; Li, Xia; Denton, James; Griffiths, Jenna; Chonat, Satheesh; Seu, Katie G; Heeney, Matthew M; Zhang, Kejian; Hopkin, Robert J; Kalfa, Theodosia A

2018-03-01

Pyruvate kinase deficiency (PKD) is the most frequent red blood cell enzyme abnormality of the glycolytic pathway and the most common cause of hereditary nonspherocytic hemolytic anemia. Over 250 PKLR-gene mutations have been described, including missense/nonsense, splicing and regulatory mutations, small insertions, small and gross deletions, causing PKD and hemolytic anemia of variable severity. Alu retrotransposons are the most abundant mobile DNA sequences in the human genome, contributing to almost 11% of its mass. Alu insertions have been associated with a number of human diseases either by disrupting a coding region or a splice signal. Here, we report on two unrelated Middle Eastern patients, both born from consanguineous parents, with transfusion-dependent hemolytic anemia, where sequence analysis revealed a homozygous insertion of AluYb9 within exon 6 of the PKLR gene, causing precipitous decrease of PKLR RNA levels. This Alu element insertion consists a previously unrecognized mechanism underlying pathogenesis of PKD. © 2017 Wiley Periodicals, Inc.

Trace element mobility and transfer to vegetation within the Ethiopian Rift Valley lake areas.

PubMed

Kassaye, Yetneberk A; Skipperud, Lindis; Meland, Sondre; Dadebo, Elias; Einset, John; Salbu, Brit

2012-10-26

To evaluate critical trace element loads in native vegetation and calculate soil-to-plant transfer factors (TFs), 11 trace elements (Cr, Co, Ni, Cu, Zn, As, Se, Mo, Cd, Pb and Mn) have been determined in leaves of 9 taxonomically verified naturally growing terrestrial plant species as well as in soil samples collected around 3 Ethiopian Rift Valley lakes (Koka, Ziway and Awassa). The Cr concentration in leaves of all the plant species was higher than the "normal" range, with the highest level (8.4 mg per kg dw) being observed in Acacia tortilis from the Lake Koka area. Caper species (Capparis fascicularis) and Ethiopian dogstooth grass (Cynodon aethiopicus) from Koka also contained exceptionally high levels of Cd (1 mg per kg dw) and Mo (32.8 mg per kg dw), respectively. Pb, As and Cu concentrations were low in the plant leaves from all sites. The low Cu level in important fodder plant species (Cynodon aethiopicus, Acacia tortilis and Opuntia ficus-indicus) implies potential deficiency in grazing and browsing animals. Compared to the Canadian environmental quality guideline and maximum allowable concentration in agricultural soils, the total soil trace element concentrations at the studied sites are safe for agricultural crop production. Enrichment factor was high for Zn in soils around Lakes Ziway and Awassa, resulting in moderate to high transfer of Zn to the studied plants. A six step sequential extraction procedure on the soils revealed a relatively high mobility of Cd, Se and Mn. Strong association of most trace elements with the redox sensitive fraction and mineral lattice was also confirmed by partial redundancy analysis. TF (mg per kg dw plants/mg per kg dw soil) values based on the total (TF(total)) and mobile fractions (TF(mobile)) of soil trace element concentrations varied widely among elements and plant species, with the averaged TF(total) and TF(mobile) values ranging from 0.01-2 and 1-60, respectively. Considering the mobile fraction in soils should be available to plants, TF(mobile) values could reflect trace elements transfer to plants in the most realistic way. However, the present study indicates that TF(total) values also reflect the transfer of elements such as Mn, Cd and Se to plants more realistically than TF(mobile) values did.

Profiles of embryonic nuclear protein binding to the proximal promoter region of the soybean β-conglycinin α subunit gene.

PubMed

Yoshino, M; Tsutsumi, K; Kanazawa, A

2015-01-01

β-Conglycinin, a major component of seed storage protein in soybean, comprises three subunits: α, α' and β. The expression of genes for these subunits is strictly controlled during embryogenesis. The proximal promoter region up to 245 bp upstream of the transcription start site of the α subunit gene sufficiently confers spatial and temporal control of transcription in embryos. Here, the binding profile of nuclear proteins in the proximal promoter region of the α subunit gene was analysed. DNase I footprinting analysis indicated binding of proteins to the RY element and DNA regions including box I, a region conserved in cognate gene promoters. An electrophoretic mobility shift assay (EMSA) using different portions of box I as a probe revealed that multiple portions of box I bind to nuclear proteins. In addition, an EMSA using nuclear proteins extracted from embryos at different developmental stages indicated that the levels of major DNA-protein complexes on box I increased during embryo maturation. These results are consistent with the notion that box I is important for the transcriptional control of seed storage protein genes. Furthermore, the present data suggest that nuclear proteins bind to novel motifs in box I including 5'-TCAATT-3' rather than to predicted cis-regulatory elements. © 2014 German Botanical Society and The Royal Botanical Society of the Netherlands.

The CcpA regulon of Streptococcus suis reveals novel insights into the regulation of the streptococcal central carbon metabolism by binding of CcpA to two distinct binding motifs.

PubMed

Willenborg, Jörg; de Greeff, Astrid; Jarek, Michael; Valentin-Weigand, Peter; Goethe, Ralph

2014-04-01

Streptococcus suis (S. suis) is a neglected zoonotic streptococcus causing fatal diseases in humans and in pigs. The transcriptional regulator CcpA (catabolite control protein A) is involved in the metabolic adaptation to different carbohydrate sources and virulence of S. suis and other pathogenic streptococci. In this study, we determined the DNA binding characteristics of CcpA and identified the CcpA regulon during growth of S. suis. Electrophoretic mobility shift analyses showed promiscuous DNA binding of CcpA to cognate cre sites in vitro. In contrast, sequencing of immunoprecipitated chromatin revealed two specific consensus motifs, a pseudo-palindromic cre motif (WWGAAARCGYTTTCWW) and a novel cre2 motif (TTTTYHWDHHWWTTTY), within the regulatory elements of the genes directly controlled by CcpA. Via these elements CcpA regulates expression of genes involved in carbohydrate uptake and conversion, and in addition in important metabolic pathways of the central carbon metabolism, like glycolysis, mixed-acid fermentation, and the fragmentary TCA cycle. Furthermore, our analyses provide evidence that CcpA regulates the genes of the central carbon metabolism by binding either the pseudo-palindromic cre motif or the cre2 motif in a HPr(Ser)∼P independent conformation. © 2014 John Wiley & Sons Ltd.

Provirophages and transpovirons as the diverse mobilome of giant viruses.

PubMed

Desnues, Christelle; La Scola, Bernard; Yutin, Natalya; Fournous, Ghislain; Robert, Catherine; Azza, Saïd; Jardot, Priscilla; Monteil, Sonia; Campocasso, Angélique; Koonin, Eugene V; Raoult, Didier

2012-10-30

A distinct class of infectious agents, the virophages that infect giant viruses of the Mimiviridae family, has been recently described. Here we report the simultaneous discovery of a giant virus of Acanthamoeba polyphaga (Lentille virus) that contains an integrated genome of a virophage (Sputnik 2), and a member of a previously unknown class of mobile genetic elements, the transpovirons. The transpovirons are linear DNA elements of ~7 kb that encompass six to eight protein-coding genes, two of which are homologous to virophage genes. Fluorescence in situ hybridization showed that the free form of the transpoviron replicates within the giant virus factory and accumulates in high copy numbers inside giant virus particles, Sputnik 2 particles, and amoeba cytoplasm. Analysis of deep-sequencing data showed that the virophage and the transpoviron can integrate in nearly any place in the chromosome of the giant virus host and that, although less frequently, the transpoviron can also be linked to the virophage chromosome. In addition, integrated fragments of transpoviron DNA were detected in several giant virus and Sputnik genomes. Analysis of 19 Mimivirus strains revealed three distinct transpovirons associated with three subgroups of Mimiviruses. The virophage, the transpoviron, and the previously identified self-splicing introns and inteins constitute the complex, interconnected mobilome of the giant viruses and are likely to substantially contribute to interviral gene transfer.

Provirophages and transpovirons as the diverse mobilome of giant viruses

PubMed Central

Desnues, Christelle; La Scola, Bernard; Yutin, Natalya; Fournous, Ghislain; Robert, Catherine; Azza, Saïd; Jardot, Priscilla; Monteil, Sonia; Campocasso, Angélique; Koonin, Eugene V.; Raoult, Didier

2012-01-01

A distinct class of infectious agents, the virophages that infect giant viruses of the Mimiviridae family, has been recently described. Here we report the simultaneous discovery of a giant virus of Acanthamoeba polyphaga (Lentille virus) that contains an integrated genome of a virophage (Sputnik 2), and a member of a previously unknown class of mobile genetic elements, the transpovirons. The transpovirons are linear DNA elements of ∼7 kb that encompass six to eight protein-coding genes, two of which are homologous to virophage genes. Fluorescence in situ hybridization showed that the free form of the transpoviron replicates within the giant virus factory and accumulates in high copy numbers inside giant virus particles, Sputnik 2 particles, and amoeba cytoplasm. Analysis of deep-sequencing data showed that the virophage and the transpoviron can integrate in nearly any place in the chromosome of the giant virus host and that, although less frequently, the transpoviron can also be linked to the virophage chromosome. In addition, integrated fragments of transpoviron DNA were detected in several giant virus and Sputnik genomes. Analysis of 19 Mimivirus strains revealed three distinct transpovirons associated with three subgroups of Mimiviruses. The virophage, the transpoviron, and the previously identified self-splicing introns and inteins constitute the complex, interconnected mobilome of the giant viruses and are likely to substantially contribute to interviral gene transfer. PMID:23071316

Hypoxia inducible factor-1 mediates the expression of the immune checkpoint HLA-G in glioma cells through hypoxia response element located in exon 2

PubMed Central

Yaghi, Layale; Poras, Isabelle; Simoes, Renata T.; Donadi, Eduardo A.; Tost, Jörg; Daunay, Antoine; de Almeida, Bibiana Sgorla; Carosella, Edgardo D.; Moreau, Philippe

2016-01-01

HLA-G is an immune checkpoint molecule with specific relevance in cancer immunotherapy. It was first identified in cytotrophoblasts, protecting the fetus from maternal rejection. HLA-G tissue expression is very restricted but induced in numerous malignant tumors such as glioblastoma, contributing to their immune escape. Hypoxia occurs during placenta and tumor development and was shown to activate HLA-G. We aimed to elucidate the mechanisms of HLA-G activation under conditions combining hypoxia-mimicking treatment and 5-aza-2′deoxycytidine, a DNA demethylating agent used in anti-cancer therapy which also induces HLA-G. Both treatments enhanced the amount of HLA-G mRNA and protein in HLA-G negative U251MG glioma cells. Electrophoretic Mobility Shift Assays and luciferase reporter gene assays revealed that HLA-G upregulation depends on Hypoxia Inducible Factor-1 (HIF-1) and a hypoxia responsive element (HRE) located in exon 2. A polymorphic HRE at −966 bp in the 5′UT region may modulate the magnitude of the response mediated by the exon 2 HRE. We suggest that therapeutic strategies should take into account that HLA-G expression in response to hypoxic tumor environment is dependent on HLA-G gene polymorphism and DNA methylation state at the HLA-G locus. PMID:27577073

Experimental single-strain mobilomics reveals events that shape pathogen emergence

DOE PAGES

Schoeniger, Joseph S.; Hudson, Corey M.; Bent, Zachary W.; ...

2016-07-04

Virulence and resistance genes carried on mobile DNAs such as genomic islands (GIs) and plasmids promote bacterial pathogen emergence. An early step in the mobilization of GIs is their excision, which produces both a circular form of the GI and a deletion site in the chromosome; circular forms have also been described for some bacterial insertion sequences (ISs). We demonstrate that the recombinant sequence produced at the junction of such circles, and their corresponding deletion sites, can be detected sensitively in high throughput sequencing data, using new computational methods that enable empirical discovery of new mobile DNAs. Applied to themore » rich mobilome of a single strain (Kpn2146) of the emerging multidrug-resistant pathogen Klebsiella pneumoniae, our approach detected circular junctions for six GIs and seven IS types (several of the latter not previously known to circularize). Our methods further revealed differential biology of multiple mobile DNAs, imprecision of integrases and transposases, and differential activity among identical IS copies for IS26, ISKpn18 and ISKpn21. Exonuclease was used to enrich for circular dsDNA molecules, and internal calibration with the native Kpn2146 plasmids showed that not all molecules bearing GI and IS circular junctions were circular dsDNAs. Transposition events were also detected, revealing replicon preference (ISKpn18 preferring a conjugative IncA/C2 plasmid), local action (IS26), regional preferences, selection (against capsule synthesis), and left-right IS end swapping. Efficient discovery and global characterization of numerous mobile elements per experiment will allow detailed accounting of bacterial evolution, explaining the new gene combinations that arise in emerging pathogens.« less

DOE Office of Scientific and Technical Information (OSTI.GOV)

Schoeniger, Joseph S.; Hudson, Corey M.; Bent, Zachary W.

Virulence and resistance genes carried on mobile DNAs such as genomic islands (GIs) and plasmids promote bacterial pathogen emergence. An early step in the mobilization of GIs is their excision, which produces both a circular form of the GI and a deletion site in the chromosome; circular forms have also been described for some bacterial insertion sequences (ISs). We demonstrate that the recombinant sequence produced at the junction of such circles, and their corresponding deletion sites, can be detected sensitively in high throughput sequencing data, using new computational methods that enable empirical discovery of new mobile DNAs. Applied to themore » rich mobilome of a single strain (Kpn2146) of the emerging multidrug-resistant pathogen Klebsiella pneumoniae, our approach detected circular junctions for six GIs and seven IS types (several of the latter not previously known to circularize). Our methods further revealed differential biology of multiple mobile DNAs, imprecision of integrases and transposases, and differential activity among identical IS copies for IS26, ISKpn18 and ISKpn21. Exonuclease was used to enrich for circular dsDNA molecules, and internal calibration with the native Kpn2146 plasmids showed that not all molecules bearing GI and IS circular junctions were circular dsDNAs. Transposition events were also detected, revealing replicon preference (ISKpn18 preferring a conjugative IncA/C2 plasmid), local action (IS26), regional preferences, selection (against capsule synthesis), and left-right IS end swapping. Efficient discovery and global characterization of numerous mobile elements per experiment will allow detailed accounting of bacterial evolution, explaining the new gene combinations that arise in emerging pathogens.« less

Sequential induction of three recombination directionality factors directs assembly of tripartite integrative and conjugative elements.

PubMed

Haskett, Timothy L; Terpolilli, Jason J; Ramachandran, Vinoy K; Verdonk, Callum J; Poole, Phillip S; O'Hara, Graham W; Ramsay, Joshua P

2018-03-01

Tripartite integrative and conjugative elements (ICE3) are a novel form of ICE that exist as three separate DNA regions integrated within the genomes of Mesorhizobium spp. Prior to conjugative transfer the three ICE3 regions of M. ciceri WSM1271 ICEMcSym1271 combine and excise to form a single circular element. This assembly requires three coordinated recombination events involving three site-specific recombinases IntS, IntG and IntM. Here, we demonstrate that three excisionases-or recombination directionality factors-RdfS, RdfG and RdfM are required for ICE3 excision. Transcriptome sequencing revealed that expression of ICE3 transfer and conjugation genes was induced by quorum sensing. Quorum sensing activated expression of rdfS, and in turn RdfS stimulated transcription of both rdfG and rdfM. Therefore, RdfS acts as a "master controller" of ICE3 assembly and excision. The dependence of all three excisive reactions on RdfS ensures that ICE3 excision occurs via a stepwise sequence of recombination events that avoids splitting the chromosome into a non-viable configuration. These discoveries expose a surprisingly simple control system guiding molecular assembly of these novel and complex mobile genetic elements and highlight the diverse and critical functions of excisionase proteins in control of horizontal gene transfer.

Ionic switch controls the DNA state in phage λ

PubMed Central

Li, Dong; Liu, Ting; Zuo, Xiaobing; Li, Tao; Qiu, Xiangyun; Evilevitch, Alex

2015-01-01

We have recently found that DNA packaged in phage λ undergoes a disordering transition triggered by temperature, which results in increased genome mobility. This solid-to-fluid like DNA transition markedly increases the number of infectious λ particles facilitating infection. However, the structural transition strongly depends on temperature and ionic conditions in the surrounding medium. Using titration microcalorimetry combined with solution X-ray scattering, we mapped both energetic and structural changes associated with transition of the encapsidated λ-DNA. Packaged DNA needs to reach a critical stress level in order for transition to occur. We varied the stress on DNA in the capsid by changing the temperature, packaged DNA length and ionic conditions. We found striking evidence that the intracapsid DNA transition is ‘switched on’ at the ionic conditions mimicking those in vivo and also at the physiologic temperature of infection at 37°C. This ion regulated on-off switch of packaged DNA mobility in turn affects viral replication. These results suggest a remarkable adaptation of phage λ to the environment of its host bacteria in the human gut. The metastable DNA state in the capsid provides a new paradigm for the physical evolution of viruses. PMID:26092697

Ionic switch controls the DNA state in phage λ

DOE PAGES

Li, Dong; Liu, Ting; Zuo, Xiaobing; ...

2015-06-19

We have recently found that DNA packaged in phage λ undergoes a disordering transition triggered by temperature, which results in increased genome mobility. This solid-to-fluid like DNA transition markedly increases the number of infectious λ particles facilitating infection. However, the structural transition strongly depends on temperature and ionic conditions in the surrounding medium. Using titration microcalorimetry combined with solution X-ray scattering, we mapped both energetic and structural changes associated with transition of the encapsidated λ-DNA. Packaged DNA needs to reach a critical stress level in order for transition to occur. We varied the stress on DNA in the capsid bymore » changing the temperature, packaged DNA length and ionic conditions. We found striking evidence that the intracapsid DNA transition is ‘switched on’ at the ionic conditions mimicking those in vivo and also at the physiologic temperature of infection at 37°C. This ion regulated on-off switch of packaged DNA mobility in turn affects viral replication. The results suggest a remarkable adaptation of phage λ to the environment of its host bacteria in the human gut. The metastable DNA state in the capsid provides a new paradigm for the physical evolution of viruses.« less

Ionic switch controls the DNA state in phage λ

DOE Office of Scientific and Technical Information (OSTI.GOV)

Li, Dong; Liu, Ting; Zuo, Xiaobing

We have recently found that DNA packaged in phage λ undergoes a disordering transition triggered by temperature, which results in increased genome mobility. This solid-to-fluid like DNA transition markedly increases the number of infectious λ particles facilitating infection. However, the structural transition strongly depends on temperature and ionic conditions in the surrounding medium. Using titration microcalorimetry combined with solution X-ray scattering, we mapped both energetic and structural changes associated with transition of the encapsidated λ-DNA. Packaged DNA needs to reach a critical stress level in order for transition to occur. We varied the stress on DNA in the capsid bymore » changing the temperature, packaged DNA length and ionic conditions. We found striking evidence that the intracapsid DNA transition is ‘switched on’ at the ionic conditions mimicking those in vivo and also at the physiologic temperature of infection at 37°C. This ion regulated on-off switch of packaged DNA mobility in turn affects viral replication. The results suggest a remarkable adaptation of phage λ to the environment of its host bacteria in the human gut. The metastable DNA state in the capsid provides a new paradigm for the physical evolution of viruses.« less

Selfish DNA: a pharmaceutical perspective.

PubMed

Winckler, T

2013-07-01

Almost 25 years ago, Theo Dingermann published the discovery of a new mobile genetic element in the unicellular microbe Dictyostelium discoideum in the journal Science. An interesting property of this new molecular parasite, the Dictyostelium Repetitive Element (DRE), was that all integrations were found approximately 50 base pairs (bp) upstream of transfer RNA (tRNA) genes in the D. discoideum genome, thus implying an active targeting mechanism to avoid the disruption of host cell genes by the retrotransposition process. Since then, the facultative multicellular "social amoeba" D. discoideum has become a popular model for analyzing complex cellular functions such as cell movement, chemotaxis, phagocytosis, and cell differentiation, important areas of biomedical research that are often hard to investigate in cells from "higher organisms" including humans. Therefore, progress in the development of methods to study Dictyostelium biology has also provoked research on transposable elements in this organism. Early work on the DRE element suggested that studying its molecular mechanism of site-specific integration might promote human gene therapy technology through the design of integrating gene transfer vectors with low intrinsic genotoxic potential. In this review article, I will briefly review the original research performed on the DRE transposable element in the Dingermann lab and report on how the emergence of genomics technologies and the development of tools to analyze de novo retrotransposition events in D. discoideum cells will expand our knowledge of DRE biology in the future.

Element mobilization from Bakken shales as a function of water chemistry.

PubMed

Wang, Lin; Burns, Scott; Giammar, Daniel E; Fortner, John D

2016-04-01

Waters that return to the surface after injection of a hydraulic fracturing fluid for gas and oil production contain elements, including regulated metals and metalloids, which are mobilized through interactions between the fracturing fluid and the shale formation. The rate and extent of mobilization depends on the geochemistry of the formation and the chemical characteristics of the fracturing fluid. In this work, laboratory scale experiments investigated the influence of water chemistry on element mobilization from core samples taken from the Bakken formation, one of the most productive shale oil plays in the US. Fluid properties were systematically varied and evaluated with regard to pH, oxidant level, solid:water ratio, temperature, and chemical additives. Element mobilization strongly depended on solution pH and redox conditions and to a lesser extent on the temperature and solid:water ratio. The presence of oxygen and addition of hydrogen peroxide or ammonium persulfate led to pyrite oxidation, resulting in elevated sulfate concentrations. Further, depending on the mineral carbonates available to buffer the system pH, pyrite oxidation could lower the system pH and enhance the mobility of several metals and metalloids. Copyright © 2016 Elsevier Ltd. All rights reserved.

Synthesis, characterization, and anticancer activity of a series of ketone-N(4)-substituted thiosemicarbazones and their ruthenium(II) arene complexes.

PubMed

Su, Wei; Qian, Quanquan; Li, Peiyuan; Lei, Xiaolin; Xiao, Qi; Huang, Shan; Huang, Chusheng; Cui, Jianguo

2013-11-04

A series of ketone-N(4)-substituted thiosemicarbazone (TSC) compounds (L1-L9) and their corresponding [(η(6)-p-cymene)Ru(II)(TSC)Cl](+/0) complexes (1-9) were synthesized and characterized by NMR, IR, elemental analysis, and HR-ESI-mass spectrometry. The molecular structures of L4, L9, 1-6, and 9 were determined by single-crystal X-ray diffraction analysis. The compounds were further evaluated for their in vitro antiproliferative activities against the SGC-7901 human gastric cancer, BEL-7404 human liver cancer, and HEK-293T noncancerous cell lines. Furthermore, the interactions of the compounds with DNA were followed by electrophoretic mobility spectrometry studies.

Sequence analysis of the lactococcal plasmid pNP40: a mobile replicon for coping with environmental hazards.

PubMed

O'Driscoll, Jonathan; Glynn, Frances; Fitzgerald, Gerald F; van Sinderen, Douwe

2006-09-01

The conjugative lactococcal plasmid pNP40, identified in Lactococcus lactis subsp. diacetylactis DRC3, possesses a potent complement of bacteriophage resistance systems, which has stimulated its application as a fitness-improving, food-grade genetic element for industrial starter cultures. The complete sequence of this plasmid allowed the mapping of previously known functions including replication, conjugation, bacteriocin resistance, heavy metal tolerance, and bacteriophage resistance. In addition, functions for cold shock adaptation and DNA damage repair were identified, further confirming pNP40's contribution to environmental stress protection. A plasmid cointegration event appears to have been part of the evolution of pNP40, resulting in a "stockpiling" of bacteriophage resistance systems.

DNA-HMGB1 interaction: The nuclear aggregates of polyamine mediation.

PubMed

Iacomino, Giuseppe; Picariello, Gianluca; Sbrana, Francesca; Raiteri, Roberto; D'Agostino, Luciano

2016-10-01

Nuclear aggregates of polyamines (NAPs) are supramolecular compounds generated by the self-assembly of protonated nuclear polyamines (spermine, spermidine and putrescine) and phosphate ions. In the presence of genomic DNA, the hierarchical process of self-structuring ultimately produces nanotube-like polymers that envelop the double helix. Because of their modular nature and their aggregation-disaggregation dynamics, NAPs confer plasticity and flexibility to DNA. Through the disposition of charges, NAPs also enable a bidirectional stream of information between the genome and interacting moieties. High mobility group (HMG) B1 is a non-histone chromosomal protein that binds to DNA and that influences multiple nuclear processes. Because genomic DNA binds to either NAPs or HMGB1 protein, we explored the ability of in vitro self-assembled NAPs (ivNAPs) to mediate the DNA-HMGB1 interaction. To this end, we structured DNA-NAPs-HMGB1 and DNA-HMGB1-NAPs ternary complexes in vitro through opportune sequential incubations. Mobility shift electrophoresis and atomic force microscopy showed that the DNA-ivNAPs-HGMB1 complex had conformational assets supposedly more suitable those of the DNA-HGMB1-ivNAPs to comply with the physiological and functional requirements of DNA. Our findings indicated that ivNAPs act as mediators of the DNA-HMGB1 interaction. Copyright © 2016 Elsevier B.V. All rights reserved.

Structure, diversity, and mobility of the Salmonella pathogenicity island 7 family of integrative and conjugative elements within Enterobacteriaceae.

PubMed

Seth-Smith, Helena M B; Fookes, Maria C; Okoro, Chinyere K; Baker, Stephen; Harris, Simon R; Scott, Paul; Pickard, Derek; Quail, Michael A; Churcher, Carol; Sanders, Mandy; Harmse, Johan; Dougan, Gordon; Parkhill, Julian; Thomson, Nicholas R

2012-03-01

Integrative and conjugative elements (ICEs) are self-mobile genetic elements found in the genomes of some bacteria. These elements may confer a fitness advantage upon their host bacteria through the cargo genes that they carry. Salmonella pathogenicity island 7 (SPI-7), found within some pathogenic strains of Salmonella enterica, possesses features indicative of an ICE and carries genes implicated in virulence. We aimed to identify and fully analyze ICEs related to SPI-7 within the genus Salmonella and other Enterobacteriaceae. We report the sequence of two novel SPI-7-like elements, found within strains of Salmonella bongori, which share 97% nucleotide identity over conserved regions with SPI-7 and with each other. Although SPI-7 within Salmonella enterica serovar Typhi appears to be fixed within the chromosome, we present evidence that these novel elements are capable of excision and self-mobility. Phylogenetic analyses show that these Salmonella mobile elements share an ancestor which existed approximately 3.6 to 15.8 million years ago. Additionally, we identified more distantly related ICEs, with distinct cargo regions, within other strains of Salmonella as well as within Citrobacter, Erwinia, Escherichia, Photorhabdus, and Yersinia species. In total, we report on a collection of 17 SPI-7 related ICEs within enterobacterial species, of which six are novel. Using comparative and mutational studies, we have defined a core of 27 genes essential for conjugation. We present a growing family of SPI-7-related ICEs whose mobility, abundance, and cargo variability indicate that these elements may have had a large impact on the evolution of the Enterobacteriaceae.

Insertion sequences enrichment in extreme Red sea brine pool vent.

PubMed

Elbehery, Ali H A; Aziz, Ramy K; Siam, Rania

2017-03-01

Mobile genetic elements are major agents of genome diversification and evolution. Limited studies addressed their characteristics, including abundance, and role in extreme habitats. One of the rare natural habitats exposed to multiple-extreme conditions, including high temperature, salinity and concentration of heavy metals, are the Red Sea brine pools. We assessed the abundance and distribution of different mobile genetic elements in four Red Sea brine pools including the world's largest known multiple-extreme deep-sea environment, the Red Sea Atlantis II Deep. We report a gradient in the abundance of mobile genetic elements, dramatically increasing in the harshest environment of the pool. Additionally, we identified a strong association between the abundance of insertion sequences and extreme conditions, being highest in the harshest and deepest layer of the Red Sea Atlantis II Deep. Our comparative analyses of mobile genetic elements in secluded, extreme and relatively non-extreme environments, suggest that insertion sequences predominantly contribute to polyextremophiles genome plasticity.

Methods for separating particles and/or nucleic acids using isotachophoresis

DOEpatents

Jung, Byoungsok; Ness, Kevin; Rose, Klint A.

2016-03-15

According to one embodiment, a method includes co-feeding fluids comprising a leading electrolyte, a trailing electrolyte, and at least one of DNA and RNA to a channel, and applying an electric field to the fluids in a direction perpendicular to an axis of the channel for inducing transverse isotachophoresis. In another embodiment, a method includes co-feeding fluids to a channel. The fluids include a leading electrolyte, a trailing electrolyte, biological objects, at least one of DNA and RNA, and a spacer electrolyte having an electrophoretic mobility that is between an electrophoretic mobility of at least some of the biological objects and an electrophoretic mobility of the at least one of the DNA and the RNA. The method also includes applying an electric field to the fluids in a direction perpendicular to an axis of the channel for inducing transverse isotachophoresis. Other methods of isotachophoresis are disclosed in addition to these.

Mobile Genetic Elements: In Silico, In Vitro, In Vivo

PubMed Central

Arkhipova, Irina R.; Rice, Phoebe A.

2016-01-01

Mobile genetic elements (MGEs), also called transposable elements (TEs), represent universal components of most genomes and are intimately involved in nearly all aspects of genome organization, function, and evolution. However, there is currently a gap between fast-paced TE discovery in silico, stimulated by exponential growth of comparative genomic studies, and a limited number of experimental models amenable to more traditional in vitro and in vivo studies of structural, mechanistic, and regulatory properties of diverse MGEs. Experimental and computational scientists came together to bridge this gap at a recent conference, “Mobile Genetic Elements: in silico, in vitro, in vivo,” held at the Marine Biological Laboratory (MBL) in Woods Hole, MA, USA. PMID:26822117

Adsorption of bacterial plasmids in pure mineral mixtures

NASA Astrophysics Data System (ADS)

Zhang, L.; Cochran, J. P.; Seaman, J. C.; Parrott, B.

2017-12-01

Microorganisms play an important role in controlling the fate and transport of subsurface contaminants through the direct degradation of organic contaminants to the control of chemical redox conditions that impact the speciation and partitioning of inorganic contaminants. Genes that control these processes, including the relative tolerance associated with direct exposure to toxic contaminants, are found within the bacteria's chromosomal DNA and also within distinct, circular DNA elements called plasmids. Plasmids are mobile genetic elements that can be exchanged with other bacterial species through horizontal gene transfer (HGT). The frequency of HGT in soil is influenced by several factors, with the physicochemical characteristics of soil possibly being a primary factor. Thus, the objective for our research was to determine the movement and persistence of bacterial plasmids within soil. Our current study focuses on batch sorption experiments designed to evaluate the partitioning of bacterial plasmids in idealized mineral mixtures that represent the clay mineralogy of highly weathered soils of the Southeastern US. Specifically, we compared plasmid adsorption among pure goethite, kaolinite, and a mixture of goethite and kaolinite. We also determined the adsorption of plasmids on the above minerals over increasing pH (3 to 10). Our results show that adsorption decreased in the following order: goethite > kaolinite > mixture of goethite and kaolinite. We also found that plasmids adsorption was higher at lower pH levels, with pH 3 having the adsorption maximum. However, at pH 3, DNA denaturing may have occurred, leading to aggregation or precipitation of plasmids on the mineral surfaces. Our study was the first steps in determining the influence of soil properties on plasmid adsorption. Our future goals are to determine the adsorption in other pure minerals and in natural soils.

Genome-wide analysis of LTR-retrotransposon diversity and its impact on the evolution of the genus Helianthus (L.).

PubMed

Mascagni, Flavia; Giordani, Tommaso; Ceccarelli, Marilena; Cavallini, Andrea; Natali, Lucia

2017-08-18

Genome divergence by mobile elements activity and recombination is a continuous process that plays a key role in the evolution of species. Nevertheless, knowledge on retrotransposon-related variability among species belonging to the same genus is still limited. Considering the importance of the genus Helianthus, a model system for studying the ecological genetics of speciation and adaptation, we performed a comparative analysis of the repetitive genome fraction across ten species and one subspecies of sunflower, focusing on long terminal repeat retrotransposons at superfamily, lineage and sublineage levels. After determining the relative genome size of each species, genomic DNA was isolated and subjected to Illumina sequencing. Then, different assembling and clustering approaches allowed exploring the repetitive component of all genomes. On average, repetitive DNA in Helianthus species represented more than 75% of the genome, being composed mostly by long terminal repeat retrotransposons. Also, the prevalence of Gypsy over Copia superfamily was observed and, among lineages, Chromovirus was by far the most represented. Although nearly all the same sublineages are present in all species, we found considerable variability in the abundance of diverse retrotransposon lineages and sublineages, especially between annual and perennial species. This large variability should indicate that different events of amplification or loss related to these elements occurred following species separation and should have been involved in species differentiation. Our data allowed us inferring on the extent of interspecific repetitive DNA variation related to LTR-RE abundance, investigating the relationship between changes of LTR-RE abundance and the evolution of the genus, and determining the degree of coevolution of different LTR-RE lineages or sublineages between and within species. Moreover, the data suggested that LTR-RE abundance in a species was affected by the annual or perennial habit of that species.

Colloidal precipitates related to Acid Mine Drainage: bacterial diversity and micro fungi-heavy metal interactions

NASA Astrophysics Data System (ADS)

Lucchetti, G.; Carbone, C.; Consani, S.; Zotti, M.; Di Piazza, S.; Pozzolini, M.; Giovine, M.

2015-12-01

In Acid Mine Drainage (AMD) settings colloidal precipitates control the mobility of Potential Toxic Elements (PTEs). Mineral-contaminant relationships (i.e. adsorption, ion-exchange, desorption) are rarely pure abiotic processes. Microbes, mainly bacteria and microfungi, can catalyze several reactions modifying the element speciation, as well as the bioavailability of inorganic pollutants. Soil, sediments, and waters heavily polluted with PTEs through AMD processes are a potential reservoir of extremophile bacteria and fungi exploitable for biotechnological purposes. Two different AMD related colloids, an ochraceous precipitate (deposited in weakly acidic conditions, composed by nanocrystalline goethite) and a greenish-blue precipitate (deposited at near-neutral pH, composed by allophane + woodwardite) were sampled. The aims of this work were to a) characterize the mycobiota present in these colloidal minerals by evaluating the presence of alive fungal propagules and extracting bacteria DNA; b) verify the fungal strains tolerance, and bioaccumulation capability on greenish-blue and ZnSO4 enriched media; c) evaluate potential impact of bacteria in the system geochemistry. The preliminary results show an interesting and selected mycobiota able to survive under unfavourable environmental conditions. A significant number of fungal strains were isolated in pure culture. Among them, species belonging to Penicillium and Trichoderma genera were tested on both greenish-blue and ZnSO4 enriched media. The results show a significant tolerance and bioaccumulation capability to some PTEs. The same colloidal precipitates were processed to extract bacteria DNA by using a specific procedure developed for sediments. The results give a good yield of nucleic acids and a positive PCR amplification of 16S rDNA accomplished the first step for future metagenomic analyses.

Mobile monolithic polymer elements for flow control in microfluidic devices

DOEpatents

Hasselbrink, Jr., Ernest F.; Rehm, Jason E.; Shepodd, Timothy J.

2004-08-31

A cast-in-place and lithographically shaped mobile, monolithic polymer element for fluid flow control in microfluidic devices and method of manufacture. Microfluid flow control devices, or microvalves that provide for control of fluid or ionic current flow can be made incorporating a cast-in-place, mobile monolithic polymer element, disposed within a microchannel, and driven by either fluid or gas pressure against a retaining or sealing surface. The polymer elements are made by the application of lithographic methods to monomer mixtures formulated in such a way that the polymer will not bond to microchannel walls. The polymer elements can seal against pressures greater than 5000 psi, and have a response time on the order of milliseconds. By the use of energetic radiation it is possible to depolymerize selected regions of the polymer element to form shapes that cannot be produced by conventional lithographic patterning and would be impossible to machine.

Mobile Monolith Polymer Elements For Flow Control In Microfluidic Systems

DOEpatents

Hasselbrink, Jr., Ernest F.; Rehm, Jason E.; Shepodd, Timothy J.; Kirby, Brian J.

2006-01-24

A cast-in-place and lithographically shaped mobile, monolithic polymer element for fluid flow control in microfluidic devices and method of manufacture. Microfluid flow control devices, or microvalves that provide for control of fluid or ionic current flow can be made incorporating a cast-in-place, mobile monolithic polymer element, disposed within a microchannel, and driven by fluid pressure (either liquid or gas) against a retaining or sealing surface. The polymer elements are made by the application of lithographic methods to monomer mixtures formulated in such a way that the polymer will not bond to microchannel walls. The polymer elements can seal against pressures greater than 5000 psi, and have a response time on the order of milliseconds. By the use of energetic radiation it is possible to depolymerize selected regions of the polymer element to form shapes that cannot be produced by conventional lithographic patterning and would be impossible to machine.

Mobile monolithic polymer elements for flow control in microfluidic devices

DOEpatents

Hasselbrink, Jr., Ernest F.; Rehm, Jason E [Alameda, CA; Shepodd, Timothy J [Livermore, CA; Kirby, Brian J [San Francisco, CA

2005-11-11

A cast-in-place and lithographically shaped mobile, monolithic polymer element for fluid flow control in microfluidic devices and method of manufacture. Microfluid flow control devices, or microvalves that provide for control of fluid or ionic current flow can be made incorporating a cast-in-place, mobile monolithic polymer element, disposed within a microchannel, and driven by fluid pressure (either liquid or gas) against a retaining or sealing surface. The polymer elements are made by the application of lithographic methods to monomer mixtures formulated in such a way that the polymer will not bond to microchannel walls. The polymer elements can seal against pressures greater than 5000 psi, and have a response time on the order of milliseconds. By the use of energetic radiation it is possible to depolymerize selected regions of the polymer element to form shapes that cannot be produced by conventional lithographic patterning and would be impossible to machine.

Continuous-flow leaching in a rotating coiled column for studies on the mobility of toxic elements in dust samples collected near a metallurgic plant.

PubMed

Fedotov, Petr S; Ermolin, Mikhail S; Ivaneev, Alexandr I; Fedyunina, Natalia N; Karandashev, Vasily K; Tatsy, Yury G

2016-03-01

Continuous-flow (dynamic) leaching in a rotating coiled column has been applied to studies on the mobility of Zn, Cd, Cu, Pb, Ni, Sb, As, S, and other potentially toxic elements in atmospherically deposited dust samples collected near a large copper smelter (Chelyabinsk region, Russia). Water and simulated "acid rain" (pH 4) were used as eluents. The technique enables not only the fast and efficient leaching of elements but as well time-resolved studies on the mobilization of heavy metals, sulphur, and arsenic in environmentally relevant forms to be made. It is shown that up to 1.5, 4.1, 1.9, 11.1, and 46.1% of Pb, As, Cu, Zn, and S, correspondingly, can be easily mobilized by water. Taking into consideration that the total concentrations of these elements in the samples under investigation are surprisingly high and vary in the range from 2.7 g/kg (for arsenic) to 15.5 g/kg (for sulphur), the environmental impact of the dust may be dramatic. The simulated acid rain results in somewhat higher recoveries of elements, except Cu and Pb. The proposed approach and the data obtained can very useful for the risk assessment related to the mobility of potentially toxic elements and their inclusion in the biogeochemical cycle. Copyright © 2015 Elsevier Ltd. All rights reserved.

Two high-mobility group box domains act together to underwind and kink DNA

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sánchez-Giraldo, R.; Acosta-Reyes, F. J.; Malarkey, C. S.

The crystal structure of HMGB1 box A bound to an unmodified AT-rich DNA fragment is reported at a resolution of 2 Å. A new mode of DNA recognition for HMG box proteins is found in which two box A domains bind in an unusual configuration generating a highly kinked DNA structure. High-mobility group protein 1 (HMGB1) is an essential and ubiquitous DNA architectural factor that influences a myriad of cellular processes. HMGB1 contains two DNA-binding domains, box A and box B, which have little sequence specificity but have remarkable abilities to underwind and bend DNA. Although HMGB1 box A ismore » thought to be responsible for the majority of HMGB1–DNA interactions with pre-bent or kinked DNA, little is known about how it recognizes unmodified DNA. Here, the crystal structure of HMGB1 box A bound to an AT-rich DNA fragment is reported at a resolution of 2 Å. Two box A domains of HMGB1 collaborate in an unusual configuration in which the Phe37 residues of both domains stack together and intercalate the same CG base pair, generating highly kinked DNA. This represents a novel mode of DNA recognition for HMGB proteins and reveals a mechanism by which structure-specific HMG boxes kink linear DNA.« less

A minimal murine Msx-1 gene promoter. Organization of its cis-regulatory motifs and their role in transcriptional activation in cells in culture and in transgenic mice.

PubMed

Takahashi, T; Guron, C; Shetty, S; Matsui, H; Raghow, R

1997-09-05

To dissect the cis-regulatory elements of the murine Msx-1 promoter, which lacks a conventional TATA element, a putative Msx-1 promoter DNA fragment (from -1282 to +106 base pairs (bp)) or its congeners containing site-specific alterations were fused to luciferase reporter and introduced into NIH3T3 and C2C12 cells, and the expression of luciferase was assessed in transient expression assays. The functional consequences of the sequential 5' deletions of the promotor revealed that multiple positive and negative regulatory elements participate in regulating transcription of the Msx-1 gene. Surprisingly, however, the optimal expression of Msx-1 promoter in either NIH3T3 or C2C12 cells required only 165 bp of the upstream sequence to warrant detailed examination of its structure. Therefore, the functional consequences of site-specific deletions and point mutations of the cis-acting elements of the minimal Msx-1 promoter were systematically examined. Concomitantly, potential transcriptional factor(s) interacting with the cis-acting elements of the minimal promoter were also studied by gel electrophoretic mobility shift assays and DNase I footprinting. Combined analyses of the minimal promoter by DNase I footprinting, electrophoretic mobility shift assays, and super shift assays with specific antibodies revealed that 5'-flanking regions from -161 to -154 and from -26 to -13 of the Msx-1 promoter contains an authentic E box (proximal E box), capable of binding a protein immunologically related to the upstream stimulating factor 1 (USF-1) and a GC-rich sequence motif which can bind to Sp1 (proximal Sp1), respectively. Additionally, we observed that the promoter activation was seriously hampered if the proximal E box was removed or mutated, and the promoter activity was eliminated completely if the proximal Sp1 site was similarly altered. Absolute dependence of the Msx-1 minimal promoter on Sp1 could be demonstrated by transient expression assays in the Sp1-deficient Drosophila cell line cotransfected with Msx-1-luciferase and an Sp1 expression vector pPacSp1. The transgenic mice embryos containing -165/106-bp Msx-1 promoter-LacZ DNA in their genomes abundantly expressed beta-galactosidase in maxillae and mandibles and in the cellular primordia involved in the formation of the meninges and the bones of the skull. Thus, the truncated murine Msx-1 promoter can target expression of a heterologous gene in the craniofacial tissues of transgenic embryos known for high level of expression of the endogenous Msx-1 gene and found to be severely defective in the Msx-1 knock-out mice.

Wavefront measurement of plastic lenses for mobile-phone applications

NASA Astrophysics Data System (ADS)

Huang, Li-Ting; Cheng, Yuan-Chieh; Wang, Chung-Yen; Wang, Pei-Jen

2016-08-01

In camera lenses for mobile-phone applications, all lens elements have been designed with aspheric surfaces because of the requirements in minimal total track length of the lenses. Due to the diffraction-limited optics design with precision assembly procedures, element inspection and lens performance measurement have become cumbersome in the production of mobile-phone cameras. Recently, wavefront measurements based on Shack-Hartmann sensors have been successfully implemented on injection-molded plastic lens with aspheric surfaces. However, the applications of wavefront measurement on small-sized plastic lenses have yet to be studied both theoretically and experimentally. In this paper, both an in-house-built and a commercial wavefront measurement system configured on two optics structures have been investigated with measurement of wavefront aberrations on two lens elements from a mobile-phone camera. First, the wet-cell method has been employed for verifications of aberrations due to residual birefringence in an injection-molded lens. Then, two lens elements of a mobile-phone camera with large positive and negative power have been measured with aberrations expressed in Zernike polynomial to illustrate the effectiveness in wavefront measurement for troubleshooting defects in optical performance.

Solid-to-fluid DNA transition inside HSV-1 capsid close to the temperature of infection

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sae-Ueng, Udom; Li, Dong; Zuo, Xiaobing

2014-10-01

DNA in the human Herpes simplex virus type 1 (HSV-1) capsid is packaged to a tight density. This leads to tens of atmospheres of internal pressure responsible for the delivery of the herpes genome into the cell nucleus. In this study we show that, despite its liquid crystalline state inside the capsid, the DNA is fluid-like, which facilitates its ejection into the cell nucleus during infection. We found that the sliding friction between closely packaged DNA strands, caused by interstrand repulsive interactions, is reduced by the ionic environment of epithelial cells and neurons susceptible to herpes infection. However, variations inmore » the ionic conditions corresponding to neuronal activity can restrict DNA mobility in the capsid, making it more solid-like. This can inhibit intranuclear DNA release and interfere with viral replication. In addition, the temperature of the human host (37 °C) induces a disordering transition of the encapsidated herpes genome, which reduces interstrand interactions and provides genome mobility required for infection.« less

Transcription factor trapping by RNA in gene regulatory elements.

PubMed

Sigova, Alla A; Abraham, Brian J; Ji, Xiong; Molinie, Benoit; Hannett, Nancy M; Guo, Yang Eric; Jangi, Mohini; Giallourakis, Cosmas C; Sharp, Phillip A; Young, Richard A

2015-11-20

Transcription factors (TFs) bind specific sequences in promoter-proximal and -distal DNA elements to regulate gene transcription. RNA is transcribed from both of these DNA elements, and some DNA binding TFs bind RNA. Hence, RNA transcribed from regulatory elements may contribute to stable TF occupancy at these sites. We show that the ubiquitously expressed TF Yin-Yang 1 (YY1) binds to both gene regulatory elements and their associated RNA species across the entire genome. Reduced transcription of regulatory elements diminishes YY1 occupancy, whereas artificial tethering of RNA enhances YY1 occupancy at these elements. We propose that RNA makes a modest but important contribution to the maintenance of certain TFs at gene regulatory elements and suggest that transcription of regulatory elements produces a positive-feedback loop that contributes to the stability of gene expression programs. Copyright © 2015, American Association for the Advancement of Science.

Impact of radiofrequency radiation on DNA damage and antioxidants in peripheral blood lymphocytes of humans residing in the vicinity of mobile phone base stations.

PubMed

Zothansiama; Zosangzuali, Mary; Lalramdinpuii, Miriam; Jagetia, Ganesh Chandra

2017-01-01

Radiofrequency radiations (RFRs) emitted by mobile phone base stations have raised concerns on its adverse impact on humans residing in the vicinity of mobile phone base stations. Therefore, the present study was envisaged to evaluate the effect of RFR on the DNA damage and antioxidant status in cultured human peripheral blood lymphocytes (HPBLs) of individuals residing in the vicinity of mobile phone base stations and comparing it with healthy controls. The study groups matched for various demographic data including age, gender, dietary pattern, smoking habit, alcohol consumption, duration of mobile phone use and average daily mobile phone use. The RF power density of the exposed individuals was significantly higher (p < 0.0001) when compared to the control group. The HPBLs were cultured and the DNA damage was assessed by cytokinesis blocked micronucleus (MN) assay in the binucleate lymphocytes. The analyses of data from the exposed group (n = 40), residing within a perimeter of 80 m of mobile base stations, showed significantly (p < 0.0001) higher frequency of micronuclei when compared to the control group, residing 300 m away from the mobile base station/s. The analysis of various antioxidants in the plasma of exposed individuals revealed a significant attrition in glutathione (GSH) concentration (p < 0.01), activities of catalase (CAT) (p < 0.001) and superoxide dismutase (SOD) (p < 0.001) and rise in lipid peroxidation (LOO) when compared to controls. Multiple linear regression analyses revealed a significant association among reduced GSH concentration (p < 0.05), CAT (p < 0.001) and SOD (p < 0.001) activities and elevated MN frequency (p < 0.001) and LOO (p < 0.001) with increasing RF power density.

Phages and the Evolution of Bacterial Pathogens: from Genomic Rearrangements to Lysogenic Conversion

PubMed Central

Brüssow, Harald; Canchaya, Carlos; Hardt, Wolf-Dietrich

2004-01-01

Comparative genomics demonstrated that the chromosomes from bacteria and their viruses (bacteriophages) are coevolving. This process is most evident for bacterial pathogens where the majority contain prophages or phage remnants integrated into the bacterial DNA. Many prophages from bacterial pathogens encode virulence factors. Two situations can be distinguished: Vibrio cholerae, Shiga toxin-producing Escherichia coli, Corynebacterium diphtheriae, and Clostridium botulinum depend on a specific prophage-encoded toxin for causing a specific disease, whereas Staphylococcus aureus, Streptococcus pyogenes, and Salmonella enterica serovar Typhimurium harbor a multitude of prophages and each phage-encoded virulence or fitness factor makes an incremental contribution to the fitness of the lysogen. These prophages behave like “swarms” of related prophages. Prophage diversification seems to be fueled by the frequent transfer of phage material by recombination with superinfecting phages, resident prophages, or occasional acquisition of other mobile DNA elements or bacterial chromosomal genes. Prophages also contribute to the diversification of the bacterial genome architecture. In many cases, they actually represent a large fraction of the strain-specific DNA sequences. In addition, they can serve as anchoring points for genome inversions. The current review presents the available genomics and biological data on prophages from bacterial pathogens in an evolutionary framework. PMID:15353570

POZ domain transcription factor, FBI-1, represses transcription of ADH5/FDH by interacting with the zinc finger and interfering with DNA binding activity of Sp1.

PubMed

Lee, Dong-Kee; Suh, Dongchul; Edenberg, Howard J; Hur, Man-Wook

2002-07-26

The POZ domain is a protein-protein interaction motif that is found in many transcription factors, which are important for development, oncogenesis, apoptosis, and transcription repression. We cloned the POZ domain transcription factor, FBI-1, that recognizes the cis-element (bp -38 to -22) located just upstream of the core Sp1 binding sites (bp -22 to +22) of the ADH5/FDH minimal promoter (bp -38 to +61) in vitro and in vivo, as revealed by electrophoretic mobility shift assay and chromatin immunoprecipitation assay. The ADH5/FDH minimal promoter is potently repressed by the FBI-1. Glutathione S-transferase fusion protein pull-down showed that the POZ domains of FBI-1, Plzf, and Bcl-6 directly interact with the zinc finger DNA binding domain of Sp1. DNase I footprinting assays showed that the interaction prevents binding of Sp1 to the GC boxes of the ADH5/FDH promoter. Gal4-POZ domain fusions targeted proximal to the GC boxes repress transcription of the Gal4 upstream activator sequence-Sp1-adenovirus major late promoter. Our data suggest that POZ domain represses transcription by interacting with Sp1 zinc fingers and by interfering with the DNA binding activity of Sp1.

A super-family of transcriptional activators regulates bacteriophage packaging and lysis in Gram-positive bacteria

PubMed Central

Quiles-Puchalt, Nuria; Tormo-Más, María Ángeles; Campoy, Susana; Toledo-Arana, Alejandro; Monedero, Vicente; Lasa, Íñigo; Novick, Richard P.; Christie, Gail E.; Penadés, José R.

2013-01-01

The propagation of bacteriophages and other mobile genetic elements requires exploitation of the phage mechanisms involved in virion assembly and DNA packaging. Here, we identified and characterized four different families of phage-encoded proteins that function as activators required for transcription of the late operons (morphogenetic and lysis genes) in a large group of phages infecting Gram-positive bacteria. These regulators constitute a super-family of proteins, here named late transcriptional regulators (Ltr), which share common structural, biochemical and functional characteristics and are unique to this group of phages. They are all small basic proteins, encoded by genes present at the end of the early gene cluster in their respective phage genomes and expressed under cI repressor control. To control expression of the late operon, the Ltr proteins bind to a DNA repeat region situated upstream of the terS gene, activating its transcription. This involves the C-terminal part of the Ltr proteins, which control specificity for the DNA repeat region. Finally, we show that the Ltr proteins are the only phage-encoded proteins required for the activation of the packaging and lysis modules. In summary, we provide evidence that phage packaging and lysis is a conserved mechanism in Siphoviridae infecting a wide variety of Gram-positive bacteria. PMID:23771138

Micro faraday-element array detector for ion mobility spectroscopy

DOEpatents

Gresham, Christopher A [Albuquerque, NM; Rodacy, Phillip J [Albuquerque, NM; Denton, M Bonner [Tucson, AZ; Sperline, Roger [Tucson, AZ

2004-10-26

An ion mobility spectrometer includes a drift tube having a collecting surface covering a collecting area at one end of the tube. The surface comprises a plurality of closely spaced conductive elements on a non-conductive substrate, each conductive element being electrically insulated from each other element. A plurality of capacitive transimpedance amplifiers (CTIA) adjacent the collecting surface are electrically connected to the plurality of elements, so charge from an ion striking an element is transferred to the capacitor of the connected CTIA. A controller counts the charge on the capacitors over a period of time.

Genomic patterns associated with paternal/maternal distribution of transposable elements

NASA Astrophysics Data System (ADS)

Jurka, Jerzy

2003-03-01

Transposable elements (TEs) are specialized DNA or RNA fragments capable of surviving in intragenomic niches. They are commonly, perhaps unjustifiably referred to as "selfish" or "parasitic" elements. TEs can be divided in two major classes: retroelements and DNA transposons. The former include non-LTR retrotransposons and retrovirus-like elements, using reverse transriptase for their reproduction prior to integration into host DNA. The latter depend mostly on host DNA replication, with possible exception of rolling-circle transposons recently discovered by our team. I will review basic information on TEs, with emphasis on human Alu and L1 retroelements discussed in the context of genomic organization. TEs are non-randomly distributed in chromosomal DNA. In particular, human Alu elements tend to prefer GC-rich regions, whereas L1 accumulate in AT-rich regions. Current explanations of this phenomenon focus on the so called "target effects" and post-insertional selection. However, the proposed models appear to be unsatisfactory and alternative explanations invoking "channeling" to different chromosomal regions will be a major focus of my presentation. Transposable elements (TEs) can be expressed and integrated into host DNA in the male or female germlines, or both. Different models of expression and integration imply different proportions of TEs on sex chromosomes and autosomes. The density of recently retroposed human Alu elements is around three times higher on chromosome Y than on chromosome X, and over two times higher than the average density for all human autosomes. This implies Alu activity in paternal germlines. Analogous inter-chromosomal proportions for other repeat families should determine their compatibility with one of the three basic models describing the inheritance of TEs. Published evidence indicates that maternally and paternally imprinted genes roughly correspond to GC-rich and AT-rich DNA. This may explain the observed chromosomal distribution of Alu and L1 elements. Finally, paternal models of inheritance predict rapid accumulation of active TEs on chromosome Y. I will discuss potential implications of this phenomenon for evolution of chromosome Y and transposable elements.

The influence of direct mobile phone radiation on sperm quality

PubMed Central

Gorpinchenko, Igor; Nikitin, Oleg; Shulyak, Alexander

2014-01-01

Introduction It is impossible to imagine a modern socially–active man who does not use mobile devices and/or computers with Wi–Fi function. The effect of mobile phone radiation on male fertility is the subject of recent interest and investigations. The aim of this study was to investigate the direct in vitro influence of mobile phone radiation on sperm DNA fragmentation and motility parameters in healthy subjects with normozoospermia. Material and methods 32 healthy men with normal semen parameters were selected for the study. Each sperm sample was divided into two equal portions (A and B). Portions A of all involved men were placed for 5 hours in a thermostat, and portions B were placed into a second thermostat for the same period of time, where a mobile phone in standby/talk mode was placed. After 5 hours of incubation the sperm samples from both thermostats were re–evaluated regarding basic motility parameters. The presence of DNA fragmentation in both A and B portions of each sample was determined each hour using a standard sperm chromatin dispersion test. Results The number of spermatozoa with progressive movement in the group, influenced by electromagnetic radiation, is statistically lower than the number of spermatozoa with progressive movement in the group under no effect of the mobile phone. The number of non–progressive movement spermatozoa was significantly higher in the group, which was influenced by cell phone radiation. The DNA fragmentation was also significantly higher in this group. Conclusions A correlation exists between mobile phone radiation exposure, DNA–fragmentation level and decreased sperm motility. PMID:24982785

Agarose electrophoresis of DNA in discontinuous buffers, using a horizontal slab apparatus and a buffer system with improved properties.

PubMed

Zsolnai, A; Orbán, L; Chrambach, A

1993-03-01

Using a horizontal slab apparatus with a buffer in the reservoirs at the level of the gel ("sea-level electrophoresis"), the retrograde discontinuous buffer system reported by Wiltfang et al. for sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) of proteins was applied to DNA electrophoresis. This application yielded the advantages of an increased displacement rate of the moving boundary front and a decrease in the concentration of the counterion base in the resolving phase, which yielded reduced relative mobility values at equivalent gel concentrations and practicable low buffer concentrations. The change of relative mobilities (Rf) with a variation of field strength is decreased compared to that of the migration rate in the continuous Tris-boric-acid-EDTA (TBE) buffer and thus the robustness of the system is improved, as well as the efficiency of separation. The system of Wiltfang et al. has in common with previously described discontinuous DNA system, that it is able to stack DNA from dilute samples and is insensitive to sample components with lower net mobilities than DNA, such as acetate. However, the variance of Rf at constant current density in the discontinuous buffer system is not improved over that of the migration rate at constant field strength in the continuous TBE buffer.

Mobility of the maize suppressor-mutator element in transgenic tobacco cells.

PubMed Central

Masson, P; Fedoroff, N V

1989-01-01

Maize Suppressor-mutator (Spm) transposable elements have been introduced into tobacco cells and a visual assay for Spm activity has been developed using a bacterial beta-glucuronidase gene. The Spm element is mobile in tobacco and can trans-activate excision of a transposition-defective Spm (dSpm) element either from a different site on the same transforming Ti plasmid or from a second plasmid. An Spm element expressed from the stronger cauliflower mosaic virus 35S promoter trans-activates transposition of a dSpm element earlier after its introduction into tobacco cells than an element expressed from its own promoter. Images PMID:2538837

Transpositional reactivation of the Dart transposon family in rice lines derived from introgressive hybridization with Zizania latifolia.

PubMed

Wang, Ningning; Wang, Hongyan; Wang, Hui; Zhang, Di; Wu, Ying; Ou, Xiufang; Liu, Shuang; Dong, Zhenying; Liu, Bao

2010-08-26

It is widely recognized that interspecific hybridization may induce "genome shock", and lead to genetic and epigenetic instabilities in the resultant hybrids and/or backcrossed introgressants. A prominent component involved in the genome shock is reactivation of cryptic transposable elements (TEs) in the hybrid genome, which is often associated with alteration in the elements' epigenetic modifications like cytosine DNA methylation. We have previously reported that introgressants derived from hybridization between Oryza sativa (rice) and Zizania latifolia manifested substantial methylation re-patterning and rampant mobilization of two TEs, a copia retrotransposon Tos17 and a MITE mPing. It was not known however whether other types of TEs had also been transpositionally reactivated in these introgressants, their relevance to alteration in cytosine methylation, and their impact on expression of adjacent cellular genes. We document in this study that the Dart TE family was transpositionally reactivated followed by stabilization in all three studied introgressants (RZ1, RZ2 and RZ35) derived from introgressive hybridization between rice (cv. Matsumae) and Z. latifolia, while the TEs remained quiescent in the recipient rice genome. Transposon-display (TD) and sequencing verified the element's mobility and mapped the excisions and re-insertions to the rice chromosomes. Methylation-sensitive Southern blotting showed that the Dart TEs were heavily methylated along their entire length, and moderate alteration in cytosine methylation patterns occurred in the introgressants relative to their rice parental line. Real-time qRT-PCR quantification on the relative transcript abundance of six single-copy genes flanking the newly excised or inserted Dart-related TE copies indicated that whereas marked difference in the expression of all four genes in both tissues (leaf and root) were detected between the introgressants and their rice parental line under both normal and various stress conditions, the difference showed little association with the presence or absence of the newly mobilized Dart-related TEs. Introgressive hybridization has induced transpositional reactivation of the otherwise immobile Dart-related TEs in the parental rice line (cv. Matsumae), which was accompanied with a moderate alteration in the element's cytosine methylation. Significant difference in expression of the Dart-adjacent genes occurred between the introgressants and their rice parental line under both normal and various abiotic stress conditions, but the alteration in gene expression was not coupled with the TEs.

Effects of intercropping of oat (Avena sativa L.) with white lupin (Lupinus albus L.) on the mobility of target elements for phytoremediation and phytomining in soil solution.

PubMed

Wiche, Oliver; Székely, Balazs; Kummer, Nicolai-Alexeji; Moschner, Christin; Heilmeier, Hermann

2016-09-01

This study aims to investigate how intercropping of oat (Avena sativa L.) with white lupin (Lupinus albus L.) affects the mobile fractions of trace metals (Fe, Mn, Pb, Cd, Th, U, Sc, La, Nd, Ge) in soil solution. Oat and white lupin were cultivated in monocultures and mixed cultures with differing oat/white lupin ratios (11% and 33% lupin, respectively). Temporal variation of soil solution chemistry was compared with the mobilization of elements in the rhizosphere of white lupin and concentrations in plant tissues. Relative to the monocrops, intercropping of oat with 11% white lupin significantly increased the concentrations of Fe, Pb, Th, La and Nd in soil solution as well as the concentrations of Fe, Pb, Th, Sc, La and Nd in tissues of oat. Enhanced mobility of the mentioned elements corresponded to a depletion of elements in the rhizosphere soil of white lupin. In mixed cultures with 33% lupin, concentrations in soil solution only slightly increased. We conclude that intercropping with 11% white lupin might be a promising tool for phytoremediation and phytomining research enhancing mobility of essential trace metals as well as elements with relevance for phytoremediation (Pb, Th) and phytomining (La, Nd, Sc) in soil.

dndDB: a database focused on phosphorothioation of the DNA backbone.

PubMed

Ou, Hong-Yu; He, Xinyi; Shao, Yucheng; Tai, Cui; Rajakumar, Kumar; Deng, Zixin

2009-01-01

The Dnd DNA degradation phenotype was first observed during electrophoresis of genomic DNA from Streptomyces lividans more than 20 years ago. It was subsequently shown to be governed by the five-gene dnd cluster. Similar gene clusters have now been found to be widespread among many other distantly related bacteria. Recently the dnd cluster was shown to mediate the incorporation of sulphur into the DNA backbone via a sequence-selective, stereo-specific phosphorothioate modification in Escherichia coli B7A. Intriguingly, to date all identified dnd clusters lie within mobile genetic elements, the vast majority in laterally transferred genomic islands. We organized available data from experimental and bioinformatics analyses about the DNA phosphorothioation phenomenon and associated documentation as a dndDB database. It contains the following detailed information: (i) Dnd phenotype; (ii) dnd gene clusters; (iii) genomic islands harbouring dnd genes; (iv) Dnd proteins and conserved domains. As of 25 December 2008, dndDB contained data corresponding to 24 bacterial species exhibiting the Dnd phenotype reported in the scientific literature. In addition, via in silico analysis, dndDB identified 26 syntenic dnd clusters from 25 species of Eubacteria and Archaea, 25 dnd-bearing genomic islands and one dnd plasmid containing 114 dnd genes. A further 397 other genes coding for proteins with varying levels of similarity to Dnd proteins were also included in dndDB. A broad range of similarity search, sequence alignment and phylogenetic tools are readily accessible to allow for to individualized directions of research focused on dnd genes. dndDB can facilitate efficient investigation of a wide range of aspects relating to dnd DNA modification and other island-encoded functions in host organisms. dndDB version 1.0 is freely available at http://mml.sjtu.edu.cn/dndDB/.

Molecular cloning and characterization of SoxB2 gene from Zhikong scallop Chlamys farreri

NASA Astrophysics Data System (ADS)

He, Yan; Bao, Zhenmin; Guo, Huihui; Zhang, Yueyue; Zhang, Lingling; Wang, Shi; Hu, Jingjie; Hu, Xiaoli

2013-11-01

The Sox proteins play critical roles during the development of animals, including sex determination and central nervous system development. In this study, the SoxB2 gene was cloned from a mollusk, the Zhikong scallop ( Chlamys farreri), and characterized with respect to phylogeny and tissue distribution. The full-length cDNA and genomic DNA sequences of C. farreri SoxB2 ( Cf SoxB2) were obtained by rapid amplification of cDNA ends and genome walking, respectively, using a partial cDNA fragment from the highly conserved DNA-binding domain, i.e., the High Mobility Group (HMG) box. The full-length cDNA sequence of Cf SoxB2 was 2 048 bp and encoded 268 amino acids protein. The genomic sequence was 5 551 bp in length with only one exon. Several conserved elements, such as the TATA-box, GC-box, CAAT-box, GATA-box, and Sox/sry-sex/testis-determining and related HMG box factors, were found in the promoter region. Furthermore, real-time quantitative reverse transcription PCR assays were carried out to assess the mRNA expression of Cf SoxB 2 in different tissues. SoxB2 was highly expressed in the mantle, moderately in the digestive gland and gill, and weakly expressed in the gonad, kidney and adductor muscle. In male and female gonads at different developmental stages of reproduction, the expression levels of Cf SoxB2 were similar. Considering the specific expression and roles of SoxB 2 in other animals, in particular vertebrates, and the fact that there are many pallial nerves in the mantle, cerebral ganglia in the digestive gland and gill nerves in gill, we propose a possible essential role in nervous tissue function for Sox B 2 in C. farreri.

E622, a miniature, virulence-associated mobile element.

PubMed

Stavrinides, John; Kirzinger, Morgan W B; Beasley, Federico C; Guttman, David S

2012-01-01

Miniature inverted terminal repeat elements (MITEs) are nonautonomous mobile elements that have a significant impact on bacterial evolution. Here we characterize E622, a 611-bp virulence-associated MITE from Pseudomonas syringae, which contains no coding region but has almost perfect 168-bp inverted repeats. Using an antibiotic coupling assay, we show that E622 is transposable and can mobilize an antibiotic resistance gene contained between its borders. Its predicted parent element, designated TnE622, has a typical transposon structure with a three-gene operon, consisting of resolvase, integrase, and exeA-like genes, which is bounded by the same terminal inverted repeats as E622. A broader genome level survey of the E622/TnE622 inverted repeats identified homologs in Pseudomonas, Salmonella, Shewanella, Erwinia, Pantoea, and the cyanobacteria Nostoc and Cyanothece, many of which appear to encompass known virulence genes, including genes encoding toxins, enzymes, and type III secreted effectors. Its association with niche-specific genetic determinants, along with its persistence and evolutionary diversification, indicates that this mobile element family has played a prominent role in the evolution of many agriculturally and clinically relevant pathogenic bacteria.

Molecular interactions of orthologues of floral homeotic proteins from the gymnosperm Gnetum gnemon provide a clue to the evolutionary origin of 'floral quartets'.

PubMed

Wang, Yong-Qiang; Melzer, Rainer; Theissen, Günter

2010-10-01

Several lines of evidence suggest that the identity of floral organs in angiosperms is specified by multimeric transcription factor complexes composed of MADS-domain proteins. These bind to specific cis-regulatory elements ('CArG-boxes') of their target genes involving DNA-loop formation, thus constituting 'floral quartets'. Gymnosperms, angiosperms' closest relatives, contain orthologues of floral homeotic genes, but when and how the interactions constituting floral quartets were established during evolution has remained unknown. We have comprehensively studied the dimerization and DNA-binding of several classes of MADS-domain proteins from the gymnosperm Gnetum gnemon. Determination of protein-protein and protein-DNA interactions by yeast two-hybrid, in vitro pull-down and electrophoretic mobility shift assays revealed complex patterns of homo- and heterodimerization among orthologues of floral homeotic class B, class C and class E proteins and B(sister) proteins. Using DNase I footprint assays we demonstrate that both orthologues of class B with C proteins, and orthologues of class C proteins alone, but not orthologues of class B proteins alone can loop DNA in floral quartet-like complexes. This is in contrast to class B and class C proteins from angiosperms, which require other factors such as class E floral homeotic proteins to 'glue' them together in multimeric complexes. Our findings suggest that the evolutionary origin of floral quartet formation is based on the interaction of different DNA-bound homodimers, does not depend on class E proteins, and predates the origin of angiosperms. © 2010 The Authors. Journal compilation © 2010 Blackwell Publishing Ltd.

Quantifying the Number of Independent Organelle DNA Insertions in Genome Evolution and Human Health.

PubMed

Hazkani-Covo, Einat; Martin, William F

2017-05-01

Fragments of organelle genomes are often found as insertions in nuclear DNA. These fragments of mitochondrial DNA (numts) and plastid DNA (nupts) are ubiquitous components of eukaryotic genomes. They are, however, often edited out during the genome assembly process, leading to systematic underestimation of their frequency. Numts and nupts, once inserted, can become further fragmented through subsequent insertion of mobile elements or other recombinational events that disrupt the continuity of the inserted sequence relative to the genuine organelle DNA copy. Because numts and nupts are typically identified through sequence comparison tools such as BLAST, disruption of insertions into smaller fragments can lead to systematic overestimation of numt and nupt frequencies. Accurate identification of numts and nupts is important, however, both for better understanding of their role during evolution, and for monitoring their increasingly evident role in human disease. Human populations are polymorphic for 141 numt loci, five numts are causal to genetic disease, and cancer genomic studies are revealing an abundance of numts associated with tumor progression. Here, we report investigation of salient parameters involved in obtaining accurate estimates of numt and nupt numbers in genome sequence data. Numts and nupts from 44 sequenced eukaryotic genomes reveal lineage-specific differences in the number, relative age and frequency of insertional events as well as lineage-specific dynamics of their postinsertional fragmentation. Our findings outline the main technical parameters influencing accurate identification and frequency estimation of numts in genomic studies pertinent to both evolution and human health. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

Comparative Genomics in Drosophila.

PubMed

Oti, Martin; Pane, Attilio; Sammeth, Michael

2018-01-01

Since the pioneering studies of Thomas Hunt Morgan and coworkers at the dawn of the twentieth century, Drosophila melanogaster and its sister species have tremendously contributed to unveil the rules underlying animal genetics, development, behavior, evolution, and human disease. Recent advances in DNA sequencing technologies launched Drosophila into the post-genomic era and paved the way for unprecedented comparative genomics investigations. The complete sequencing and systematic comparison of the genomes from 12 Drosophila species represents a milestone achievement in modern biology, which allowed a plethora of different studies ranging from the annotation of known and novel genomic features to the evolution of chromosomes and, ultimately, of entire genomes. Despite the efforts of countless laboratories worldwide, the vast amount of data that were produced over the past 15 years is far from being fully explored.In this chapter, we will review some of the bioinformatic approaches that were developed to interrogate the genomes of the 12 Drosophila species. Setting off from alignments of the entire genomic sequences, the degree of conservation can be separately evaluated for every region of the genome, providing already first hints about elements that are under purifying selection and therefore likely functional. Furthermore, the careful analysis of repeated sequences sheds light on the evolutionary dynamics of transposons, an enigmatic and fascinating class of mobile elements housed in the genomes of animals and plants. Comparative genomics also aids in the computational identification of the transcriptionally active part of the genome, first and foremost of protein-coding loci, but also of transcribed nevertheless apparently noncoding regions, which were once considered "junk" DNA. Eventually, the synergy between functional and comparative genomics also facilitates in silico and in vivo studies on cis-acting regulatory elements, like transcription factor binding sites, that due to the high degree of sequence variability usually impose increased challenges for bioinformatics approaches.

Evolutionally dynamic L1 regulation in embryonic stem cells

PubMed Central

Castro-Diaz, Nathaly; Ecco, Gabriela; Coluccio, Andrea; Kapopoulou, Adamandia; Yazdanpanah, Benyamin; Friedli, Marc; Duc, Julien; Jang, Suk Min; Turelli, Priscilla; Trono, Didier

2014-01-01

Mobile elements are important evolutionary forces that challenge genomic integrity. Long interspersed element-1 (L1, also known as LINE-1) is the only autonomous transposon still active in the human genome. It displays an unusual pattern of evolution, with, at any given time, a single active L1 lineage amplifying to thousands of copies before getting replaced by a new lineage, likely under pressure of host restriction factors, which act notably by silencing L1 expression during early embryogenesis. Here, we demonstrate that in human embryonic stem (hES) cells, KAP1 (KRAB [Krüppel-associated box domain]-associated protein 1), the master cofactor of KRAB-containing zinc finger proteins (KRAB-ZFPs) previously implicated in the restriction of endogenous retroviruses, represses a discrete subset of L1 lineages predicted to have entered the ancestral genome between 26.8 million and 7.6 million years ago. In mice, we documented a similar chronologically conditioned pattern, albeit with a much contracted time scale. We could further identify an L1-binding KRAB-ZFP, suggesting that this rapidly evolving protein family is more globally responsible for L1 recognition. KAP1 knockdown in hES cells induced the expression of KAP1-bound L1 elements, but their younger, human-specific counterparts (L1Hs) were unaffected. Instead, they were stimulated by depleting DNA methyltransferases, consistent with recent evidence demonstrating that the PIWI–piRNA (PIWI-interacting RNA) pathway regulates L1Hs in hES cells. Altogether, these data indicate that the early embryonic control of L1 is an evolutionarily dynamic process and support a model in which newly emerged lineages are first suppressed by DNA methylation-inducing small RNA-based mechanisms before KAP1-recruiting protein repressors are selected. PMID:24939876

Facile Recovery of Individual High-Molecular-Weight, Low-Copy-Number Natural Plasmids for Genomic Sequencing

DOE Office of Scientific and Technical Information (OSTI.GOV)

Williams, L.E.; Detter, C,; Barrie, K.

2006-06-01

Sequencing of the large (>50 kb), low-copy-number (<5 per cell) plasmids that mediate horizontal gene transfer has been hindered by the difficulty and expense of isolating DNA from individual plasmids of this class. We report here that a kit method previously devised for purification of bacterial artificial chromosomes (BACs) can be adapted for effective preparation of individual plasmids up to 220 kb from wild gram-negative and gram-positive bacteria. Individual plasmid DNA recovered from less than 10 ml of Escherichia coli, Staphylococcus, and Corynebacterium cultures was of sufficient quantity and quality for construction of highcoverage libraries, as shown by sequencing fivemore » native plasmids ranging in size from 30 kb to 94 kb. We also report recommendations for vector screening to optimize plasmid sequence assembly, preliminary annotation of novel plasmid genomes, and insights on mobile genetic element biology derived from these sequences. Adaptation of this BAC method for large plasmid isolation removes one major technical hurdle to expanding our knowledge of the natural plasmid gene pool.« less

Shell alterations in limpets as putative biomarkers for multi-impacted coastal areas.

PubMed

Begliomini, Felipe Nincao; Maciel, Daniele Claudino; de Almeida, Sérgio Mendonça; Abessa, Denis Moledo; Maranho, Luciane Alves; Pereira, Camilo Seabra; Yogui, Gilvan Takeshi; Zanardi-Lamardo, Eliete; Castro, Ítalo Braga

2017-07-01

During the last years, shell alterations in gastropods have been proposed as tools to be used in monitoring programs. However, no studies were so far performed investigating the relationships among shell parameters and classical biomarkers of damage. The relationship between shell alterations (biometrics, shape and elemental composition) and biomarkers (LPO and DNA strand break) was evaluated in the limpet L. subrugosa sampled along a contamination gradient in a multi-impacted coastal zone from southeastern Brazil. Statistically significant differences were detected among sites under different pollution levels. The occurrence of shell malformations was consistent with environmental levels of several hazardous substances reported for the studied area and related to lipid peroxidation and DNA damage. In addition, considering the low mobility, wide geographic distribution, ease of collection and abundance of limpets in coastal zones, this putative tool may be a cost-effective alternative to traditional biomarkers. Thus, shell alterations in limpets seem to be good proxies for assessing biological adverse effects in multi-impacted coastal zones. Copyright © 2017 Elsevier Ltd. All rights reserved.

Sequence and analysis of chromosome 2 of the plant Arabidopsis thaliana.

PubMed

Lin, X; Kaul, S; Rounsley, S; Shea, T P; Benito, M I; Town, C D; Fujii, C Y; Mason, T; Bowman, C L; Barnstead, M; Feldblyum, T V; Buell, C R; Ketchum, K A; Lee, J; Ronning, C M; Koo, H L; Moffat, K S; Cronin, L A; Shen, M; Pai, G; Van Aken, S; Umayam, L; Tallon, L J; Gill, J E; Adams, M D; Carrera, A J; Creasy, T H; Goodman, H M; Somerville, C R; Copenhaver, G P; Preuss, D; Nierman, W C; White, O; Eisen, J A; Salzberg, S L; Fraser, C M; Venter, J C

1999-12-16

Arabidopsis thaliana (Arabidopsis) is unique among plant model organisms in having a small genome (130-140 Mb), excellent physical and genetic maps, and little repetitive DNA. Here we report the sequence of chromosome 2 from the Columbia ecotype in two gap-free assemblies (contigs) of 3.6 and 16 megabases (Mb). The latter represents the longest published stretch of uninterrupted DNA sequence assembled from any organism to date. Chromosome 2 represents 15% of the genome and encodes 4,037 genes, 49% of which have no predicted function. Roughly 250 tandem gene duplications were found in addition to large-scale duplications of about 0.5 and 4.5 Mb between chromosomes 2 and 1 and between chromosomes 2 and 4, respectively. Sequencing of nearly 2 Mb within the genetically defined centromere revealed a low density of recognizable genes, and a high density and diverse range of vestigial and presumably inactive mobile elements. More unexpected is what appears to be a recent insertion of a continuous stretch of 75% of the mitochondrial genome into chromosome 2.

An analysis of mobile genetic elements in three Plasmodium species and their potential impact on the nucleotide composition of the P. falciparum genome.

PubMed

Durand, Pierre M; Oelofse, Andries J; Coetzer, Theresa L

2006-11-04

The completed genome sequences of the malaria parasites P. falciparum, P. y. yoelii and P. vivax have revealed some unusual features. P. falciparum contains the most AT rich genome sequenced so far--over 90% in some regions. In comparison, P. y. yoelii is approximately 77% and P. vivax is approximately 55% AT rich. The evolutionary reasons for these findings are unknown. Mobile genetic elements have a considerable impact on genome evolution but a thorough investigation of these elements in Plasmodium has not been undertaken. We therefore performed a comprehensive genome analysis of these elements and their derivatives in the three Plasmodium species. Whole genome analysis was performed using bioinformatic methods. Forty potential protein encoding sequences with features of transposable elements were identified in P. vivax, eight in P. y. yoelii and only six in P. falciparum. Further investigation of the six open reading frames in P. falciparum revealed that only one is potentially an active mobile genetic element. Most of the open reading frames identified in all three species are hypothetical proteins. Some represent annotated host proteins such as the putative telomerase reverse transcriptase genes in P. y. yoelii and P. falciparum. One of the P. vivax open reading frames identified in this study demonstrates similarity to telomerase reverse transcriptase and we conclude it to be the orthologue of this gene. There is a divergence in the frequencies of mobile genetic elements in the three Plasmodium species investigated. Despite the limitations of whole genome analytical methods, it is tempting to speculate that mobile genetic elements might have been a driving force behind the compositional bias of the P. falciparum genome.

The potential leaching and mobilization of trace elements from FGD-gypsum of a coal-fired power plant under water re-circulation conditions.

PubMed

Córdoba, Patricia; Castro, Iria; Maroto-Valer, Mercedes; Querol, Xavier

2015-06-01

Experimental and geochemical modelling studies were carried out to identify mineral and solid phases containing major, minor, and trace elements and the mechanism of the retention of these elements in Flue Gas Desulphurisation (FGD)-gypsum samples from a coal-fired power plant under filtered water recirculation to the scrubber and forced oxidation conditions. The role of the pH and related environmental factors on the mobility of Li, Ni, Zn, As, Se, Mo, and U from FGD-gypsums for a comprehensive assessment of element leaching behaviour were also carried out. Results show that the extraction rate of the studied elements generally increases with decreasing the pH value of the FGD-gypsum leachates. The increase of the mobility of elements such as U, Se, and As in the FGD-gypsum entails the modification of their aqueous speciation in the leachates; UO2SO4, H2Se, and HAsO2 are the aqueous complexes with the highest activities under acidic conditions. The speciation of Zn, Li, and Ni is not affected in spite of pH changes; these elements occur as free cations and associated to SO4(2) in the FGD-gypsum leachates. The mobility of Cu and Mo decreases by decreasing the pH of the FGD-gypsum leachates, which might be associated to the precipitation of CuSe2 and MoSe2, respectively. Time-of-Flight mass spectrometry of the solid phase combined with geochemical modelling of the aqueous phase has proved useful in understanding the mobility and geochemical behaviour of elements and their partitioning into FGD-gypsum samples. Copyright © 2015. Published by Elsevier B.V.

The high mobility group protein Abf2p influences the level of yeast mitochondrial DNA recombination intermediates in vivo.

PubMed

MacAlpine, D M; Perlman, P S; Butow, R A

1998-06-09

Abf2p is a high mobility group (HMG) protein found in yeast mitochondria that is required for the maintenance of wild-type (rho+) mtDNA in cells grown on fermentable carbon sources, and for efficient recombination of mtDNA markers in crosses. Here, we show by two-dimensional gel electrophoresis that Abf2p promotes or stabilizes Holliday recombination junction intermediates in rho+ mtDNA in vivo but does not influence the high levels of recombination intermediates readily detected in the mtDNA of petite mutants (rho-). mtDNA recombination junctions are not observed in rho+ mtDNA of wild-type cells but are elevated to detectable levels in cells with a null allele of the MGT1 gene (Deltamgt1), which codes for a mitochondrial cruciform-cutting endonuclease. The level of recombination intermediates in rho+ mtDNA of Deltamgt1 cells is decreased about 10-fold if those cells contain a null allele of the ABF2 gene. Overproduction of Abf2p by >/= 10-fold in wild-type rho+ cells, which leads to mtDNA instability, results in a dramatic increase in mtDNA recombination intermediates. Specific mutations in the two Abf2p HMG boxes required for DNA binding diminishes these responses. We conclude that Abf2p functions in the recombination of rho+ mtDNA.

Transcriptional regulation of the cytosolic chaperonin theta subunit gene, Cctq, by Ets domain transcription factors Elk-1, Sap-1a, and Net in the absence of serum response factor.

PubMed

Yamazaki, Yuji; Kubota, Hiroshi; Nozaki, Masami; Nagata, Kazuhiro

2003-08-15

The chaperonin-containing t-complex polypeptide 1 (CCT) is a molecular chaperone that facilitates protein folding in eukaryotic cytosol, and the expression of CCT is highly dependent on cell growth. We show here that transcription of the gene encoding the theta subunit of mouse CCT, Cctq, is regulated by the ternary complex factors (TCFs), Elk-1, Sap-1a, and Net (Sap-2). Reporter gene assay using HeLa cells indicated that the Cctq gene promoter contains a cis-acting element of the CCGGAAGT sequence (CQE1) at -36 bp. The major CQE1-binding proteins in HeLa cell nuclear extract was recognized by anti-Elk-1 or anti-Sap-1a antibodies in electrophoretic mobility shift assay, and recombinant Elk-1, Sap-1a, or Net specifically recognized CQE1. The CQE1-dependent transcriptional activity in HeLa cells was virtually abolished by overexpression of the DNA binding domains of TCFs. Overexpression of full-length TCFs with Ras indicated that exogenous TCFs can regulate the CQE1-dependent transcription in a Ras-dependent manner. PD98059, an inhibitor of MAPK, significantly repressed the CQE1-dependent transcription. However, no serum response factor was detected by electrophoretic mobility shift assay using the CQE1 element. These results indicate that transcription of the Cctq gene is regulated by TCFs under the control of the Ras/MAPK pathway, probably independently of serum response factor.

Insights into the bovine rumen plasmidome

PubMed Central

Kav, Aya Brown; Sasson, Goor; Jami, Elie; Doron-Faigenboim, Adi; Benhar, Itai; Mizrahi, Itzhak

2012-01-01

Plasmids are self-replicating genetic elements capable of mobilization between different hosts. Plasmids often serve as mediators of lateral gene transfer, a process considered to be a strong and sculpting evolutionary force in microbial environments. Our aim was to characterize the overall plasmid population in the environment of the bovine rumen, which houses a complex and dense microbiota that holds enormous significance for humans. We developed a procedure for the isolation of total rumen plasmid DNA, termed rumen plasmidome, and subjected it to deep sequencing using the Illumina paired-end protocol and analysis using public and custom-made bioinformatics tools. A large number of plasmidome contigs aligned with plasmids of rumen bacteria isolated from different locations and at various time points, suggesting that not only the bacterial taxa, but also their plasmids, are defined by the ecological niche. The bacterial phylum distribution of the plasmidome was different from that of the rumen bacterial taxa. Nevertheless, both shared a dominance of the phyla Firmicutes, Bacteroidetes, and Proteobacteria. Evidently, the rumen plasmidome is of a highly mosaic nature that can cross phyla. Interestingly, when we compared the functional profile of the rumen plasmidome to two plasmid databases and two recently published rumen metagenomes, it became apparent that the rumen plasmidome codes for functions, which are enriched in the rumen ecological niche and could confer advantages to their hosts, suggesting that the functional profiles of mobile genetic elements are associated with their environment, as has been previously implied for viruses. PMID:22431592

The Replication Stress Response in Pancreatic Cancer

DTIC Science & Technology

2013-10-01

network that recognizes challenges to DNA replication and mobilizes diverse activities to maintain genome integrity. The RSR is critical for the...pancreatic cancer cells. We further validated positive hits be deconvolution of individual siRNAs and began work on determining their activities in DNA replication and DNA damage responses.

Nucleosome core particles containing a poly(dA.dT) sequence element exhibit a locally distorted DNA structure.

PubMed

Bao, Yunhe; White, Cindy L; Luger, Karolin

2006-08-25

Poly(dA.dT) DNA sequence elements are thought to promote transcription by either excluding nucleosomes or by altering their structural or dynamic properties. Here, the stability and structure of a defined nucleosome core particle containing a 16 base-pair poly(dA.dT) element (A16 NCP) was investigated. The A16 NCP requires a significantly higher temperature for histone octamer sliding in vitro compared to comparable nucleosomes that do not contain a poly(dA.dT) element. Fluorescence resonance energy transfer showed that the interactions between the nucleosomal DNA ends and the histone octamer were destabilized in A16 NCP. The crystal structure of A16 NCP was determined to a resolution of 3.2 A. The overall structure was maintained except for local deviations in DNA conformation. These results are consistent with previous in vivo and in vitro observations that poly(dA.dT) elements cause only modest changes in DNA accessibility and modest increases in steady-state transcription levels.

Mitochondrial Debris as a Discriminator Between Inflammatory and Infectious Complications of Blast Injuries: The Enemy Within

DTIC Science & Technology

2012-01-01

adult respiratory distress syndrome (ALI/ARDS) occur after fractures in a sporadic entity often termed ‘‘ fat embolism syndrome.’’ Fat embolism ...We then went on to evaluate the role of fracture injuries in mobilizing mtDNA from human tissue trauma. As proposed, we used discarded human samples...to show that long bone fractures (very common in combatants) and their repair by clinical reamed nailing operations mobilized huge amounts of mtDNA

Foldback intercoil DNA and the mechanism of DNA transposition.

PubMed

Kim, Byung-Dong

2014-09-01

Foldback intercoil (FBI) DNA is formed by the folding back at one point of a non-helical parallel track of double-stranded DNA at as sharp as 180° and the intertwining of two double helixes within each other's major groove to form an intercoil with a diameter of 2.2 nm. FBI DNA has been suggested to mediate intra-molecular homologous recombination of a deletion and inversion. Inter-molecular homologous recombination, known as site-specific insertion, on the other hand, is mediated by the direct perpendicular approach of the FBI DNA tip, as the attP site, onto the target DNA, as the attB site. Transposition of DNA transposons involves the pairing of terminal inverted repeats and 5-7-bp tandem target duplication. FBI DNA configuration effectively explains simple as well as replicative transposition, along with the involvement of an enhancer element. The majority of diverse retrotransposable elements that employ a target site duplication mechanism is also suggested to follow the FBI DNA-mediated perpendicular insertion of the paired intercoil ends by non-homologous end-joining, together with gap filling. A genome-wide perspective of transposable elements in light of FBI DNA is discussed.

Differences in unwinding of supercoiled DNA induced by the two enantiomers of anti-benzo[a]pyrene diol epoxide.

PubMed Central

Xu, R; Birke, S; Carberry, S E; Geacintov, N E; Swenberg, C E; Harvey, R G

1992-01-01

The unwinding of supercoiled phi X174 RFI DNA induced by the tumorigenic (+) and non-tumorigenic (-) enantiomers of trans-7,8-dihydroxy-anti-9,10-epoxy-7,8,9,10-tetrahydrobenzo[a]pyrene (BPDE) has been investigated by agarose slab-gel and ethidium titration tube gel electrophoresis. The differences in adduct conformations were verified by flow linear dichroism techniques. Both enantiomers cause a reversible unwinding by the formation of noncovalent intercalative complexes. The effects of covalently bound BPDE residues on the electrophoretic mobilities of the RF I DNA form in agarose gels were investigated in detail in the range of binding ratios rb approximately 0.0-0.06 (covalently bound BPDE residues/nucleotide). In this range of rb values, there is a striking difference in the mobilities of (+)-BPDE- and (-)-BPDE-adducted phi X174 DNA in agarose slab-gels, the covalently bound (+)-BPDE residues causing a significantly greater retardation than (-)-BPDE residues. Increasing the level of covalent adducts beyond rb approximately 0.06 in the case of the (+)-BPDE enantiomer, leads to further unwinding and a minimum in the mobilities (corresponding to comigration of the nicked form and the covalently closed relaxed modified form) at rb 0.10 +/- 0.01; at still higher rb values, rewinding of the modified DNA in the opposite sense is observed. From the minimum in the mobility, a mean unwinding angle (per BPDE residue) of theta = 12 +/- 1.5 degrees is determined, which is in good agreement the value of theta = 11 +/- 1.8 degrees obtained by the tube gel titration method. Using this latter method, values of theta = 6.8 +/- 1.7 degrees for (-)-BPDE-phi X174 adducts are observed. It is concluded that agarose slab gel techniques are not suitable for determining unwinding angles for (-)-BPDE-modified phi X174 DNA because the alterations in the tertiary structures for rb < 0.06 are too small to cause sufficiently large changes in the electrophoretic mobilities. The major trans (+)-BPDE-N2-guanosine covalent adduct is situated at external binding sites and the mechanisms of unwinding are therefore different from those relevant to noncovalent intercalative BPDE-DNA complexes or to classical intercalating drug molecules; a flexible hinge joint and a widening of the minor groove at the site of the lesion may account for the observed unwinding effects. The more heterogeneous (-)-BPDE-nucleoside adducts (involving cis and trans N2-guanosine, and adenosine adducts) are less effective in causing unwinding of supercoiled DNA for reasons which remain to be elucidated. Images PMID:1475180

Small RNA-Mediated trans-Nuclear and trans-Element Communications in Tetrahymena DNA Elimination.

PubMed

Noto, Tomoko; Mochizuki, Kazufumi

2018-06-18

Epigenetic inheritance of acquired traits is widespread among eukaryotes, but how and to what extent such information is transgenerationally inherited is still unclear. The patterns of programmed DNA elimination in ciliates are epigenetically and transgenerationally inherited, and it has been proposed that small RNAs, which shuttle between the germline and the soma, regulate this epigenetic inheritance. In this study, we test the existence and role of such small-RNA-mediated communication by epigenetically disturbing the pattern of DNA elimination in Tetrahymena. We show that the pattern of DNA elimination is, indeed, determined by the selective turnover of small RNAs, which is induced by the interaction between germline-derived small RNAs and the somatic genome. In addition, we show that DNA elimination of an element is regulated by small-RNA-mediated communication with other eliminated elements. By contrast, no evidence obtained thus far supports the notion that transfer of epigenetic information from the soma to the germline, if any, regulates DNA elimination. Our results indicate that small-RNA-mediated trans-nuclear and trans-element communication, in addition to unknown information in the germline genome, contributes to determining the pattern of DNA elimination. Copyright © 2018 Elsevier Ltd. All rights reserved.

Satellite DNA and Transposable Elements in Seabuckthorn (Hippophae rhamnoides), a Dioecious Plant with Small Y and Large X Chromosomes

PubMed Central

Puterova, Janka; Razumova, Olga; Martinek, Tomas; Alexandrov, Oleg; Divashuk, Mikhail; Kubat, Zdenek; Hobza, Roman; Karlov, Gennady

2017-01-01

Seabuckthorn (Hippophae rhamnoides) is a dioecious shrub commonly used in the pharmaceutical, cosmetic, and environmental industry as a source of oil, minerals and vitamins. In this study, we analyzed the transposable elements and satellites in its genome. We carried out Illumina DNA sequencing and reconstructed the main repetitive DNA sequences. For data analysis, we developed a new bioinformatics approach for advanced satellite DNA analysis and showed that about 25% of the genome consists of satellite DNA and about 24% is formed of transposable elements, dominated by Ty3/Gypsy and Ty1/Copia LTR retrotransposons. FISH mapping revealed X chromosome-accumulated, Y chromosome-specific or both sex chromosomes-accumulated satellites but most satellites were found on autosomes. Transposable elements were located mostly in the subtelomeres of all chromosomes. The 5S rDNA and 45S rDNA were localized on one autosomal locus each. Although we demonstrated the small size of the Y chromosome of the seabuckthorn and accumulated satellite DNA there, we were unable to estimate the age and extent of the Y chromosome degeneration. Analysis of dioecious relatives such as Shepherdia would shed more light on the evolution of these sex chromosomes. PMID:28057732

Continuous-Time Random Walk Models of DNA Electrophoresis in a Post Array: II. Mobility and Sources of Band Broadening

PubMed Central

Olson, Daniel W.; Dutta, Sarit; Laachi, Nabil; Tian, Mingwei; Dorfman, Kevin D.

2011-01-01

Using the two-state, continuous-time random walk model, we develop expressions for the mobility and the plate height during DNA electrophoresis in an ordered post array that delineate the contributions due to (i) the random distance between collisions and (ii) the random duration of a collision. These contributions are expressed in terms of the means and variances of the underlying stochastic processes, which we evaluate from a large ensemble of Brownian dynamics simulations performed using different electric fields and molecular weights in a hexagonal array of 1 μm posts with a 3 μm center-to-center distance. If we fix the molecular weight, we find that the collision frequency governs the mobility. In contrast, the average collision duration is the most important factor for predicting the mobility as a function of DNA size at constant Péclet number. The plate height is reasonably well-described by a single post rope-over-pulley model, provided that the extension of the molecule is small. Our results only account for dispersion inside the post array and thus represent a theoretical lower bound on the plate height in an actual device. PMID:21290387

Conserved DNA motifs in the type II-A CRISPR leader region.

PubMed

Van Orden, Mason J; Klein, Peter; Babu, Kesavan; Najar, Fares Z; Rajan, Rakhi

2017-01-01

The Clustered Regularly Interspaced Short Palindromic Repeats associated (CRISPR-Cas) systems consist of RNA-protein complexes that provide bacteria and archaea with sequence-specific immunity against bacteriophages, plasmids, and other mobile genetic elements. Bacteria and archaea become immune to phage or plasmid infections by inserting short pieces of the intruder DNA (spacer) site-specifically into the leader-repeat junction in a process called adaptation. Previous studies have shown that parts of the leader region, especially the 3' end of the leader, are indispensable for adaptation. However, a comprehensive analysis of leader ends remains absent. Here, we have analyzed the leader, repeat, and Cas proteins from 167 type II-A CRISPR loci. Our results indicate two distinct conserved DNA motifs at the 3' leader end: ATTTGAG (noted previously in the CRISPR1 locus of Streptococcus thermophilus DGCC7710) and a newly defined CTRCGAG, associated with the CRISPR3 locus of S. thermophilus DGCC7710. A third group with a very short CG DNA conservation at the 3' leader end is observed mostly in lactobacilli. Analysis of the repeats and Cas proteins revealed clustering of these CRISPR components that mirrors the leader motif clustering, in agreement with the coevolution of CRISPR-Cas components. Based on our analysis of the type II-A CRISPR loci, we implicate leader end sequences that could confer site-specificity for the adaptation-machinery in the different subsets of type II-A CRISPR loci.

Mixed ligand complexes of Cu(II)/Zn(II) ions containing (m-)/(p-) carboxylato phenyl azo pentane 2,4-dione and 2,2‧-bipyridine/1,10 phenanthroline: Synthesis, characterization, DNA binding, nuclease and topoisomerase I inhibitory activity

NASA Astrophysics Data System (ADS)

Hasan, Md. Amin; Kumari, Niraj; Singh, Kanhaiya; Singh, Kiran; Mishra, Lallan

2016-01-01

Metal complexes of type [Cu(L1H)2(bpy)] (1), [Zn(L1H)2(bpy)] (2), [Cu(L2H)2(bpy)] (3) and [Cu(L2H)2(Phen)] (4) (L1H2 = 3-[N‧-(1-acetyl-2-oxo-propylidene)-hydrazino]-benzoic acid, L2H2 = 4-[N‧-(1-acetyl-2-oxo-propylidene)-hydrazino]-benzoic acid, bpy = 2,2‧-bipyridine, Phen = 1,10 phenanthroline) are synthesized and characterized using spectroscopic techniques (FT-IR, 1H NMR, 13C NMR, electronic absorption and emission) and elemental analysis data. The assembly of the complexes involving intramolecular H-bonding is displayed using corresponding crystal structure. Binding of the complexes separately with Calf Thymus DNA is monitored using UV-vis spectral titrations. The displacement of ethidium bromide (EB) bound to DNA by the complexes, in phosphate buffer solution (pH ∼ 7.2) is monitored using fluorescence spectral titrations. Nuclease activity of the complexes follow the order 4 > 3 > 1 > 2. The gel electrophoretic mobility assay measurement in presence of minor groove binder 4‧,6-diamidino-2-phenylindole (DAPI), suggests that complexes preferably bind with the minor groove of DNA. Topoisomerase I inhibitory activity of the complexes 3 and 4 inhibit topoisomerase I activity with IC50 values of 112 and 87 μM respectively.

Conserved DNA motifs in the type II-A CRISPR leader region

PubMed Central

Babu, Kesavan; Najar, Fares Z.

2017-01-01

The Clustered Regularly Interspaced Short Palindromic Repeats associated (CRISPR-Cas) systems consist of RNA-protein complexes that provide bacteria and archaea with sequence-specific immunity against bacteriophages, plasmids, and other mobile genetic elements. Bacteria and archaea become immune to phage or plasmid infections by inserting short pieces of the intruder DNA (spacer) site-specifically into the leader-repeat junction in a process called adaptation. Previous studies have shown that parts of the leader region, especially the 3′ end of the leader, are indispensable for adaptation. However, a comprehensive analysis of leader ends remains absent. Here, we have analyzed the leader, repeat, and Cas proteins from 167 type II-A CRISPR loci. Our results indicate two distinct conserved DNA motifs at the 3′ leader end: ATTTGAG (noted previously in the CRISPR1 locus of Streptococcus thermophilus DGCC7710) and a newly defined CTRCGAG, associated with the CRISPR3 locus of S. thermophilus DGCC7710. A third group with a very short CG DNA conservation at the 3′ leader end is observed mostly in lactobacilli. Analysis of the repeats and Cas proteins revealed clustering of these CRISPR components that mirrors the leader motif clustering, in agreement with the coevolution of CRISPR-Cas components. Based on our analysis of the type II-A CRISPR loci, we implicate leader end sequences that could confer site-specificity for the adaptation-machinery in the different subsets of type II-A CRISPR loci. PMID:28392985

Understanding gas phase modifier interactions in rapid analysis by Differential Mobility-Tandem Mass Spectrometry

PubMed Central

Kafle, Amol; Coy, Stephen L.; Wong, Bryan M.; Fornace, Albert J.; Glick, James J.; Vouros, Paul

2014-01-01

A systematic study involving the use and optimization of gas phase modifiers in quantitative differential mobility- mass spectrometry (DMS-MS) analysis is presented using mucleoside-adduct biomarkers of DNA damage as an important reference point for analysis in complex matrices. Commonly used polar protic and polar aprotic modifiers have been screened for use against two deoxyguanosine adducts of DNA: N-(deoxyguanosin-8-yl)-4-aminobiphenyl (dG-C8-4-ABP) and N-(deoxyguanosin-8-y1)-2-amino-l-methyl-6-phenylimidazo[4,5-b]pyridine (dG-C8-PhIP). Particular attention was paid to compensation voltage (CoV) shifts, peak shapes and product ion signal intensities while optimizing the DMS-MS conditions. The optimized parameters were then applied to rapid quantitation of the DNA adducts in calf thymus DNA. After a protein precipitation step, adduct levels corresponding to less than one modification in 106 normal DNA bases were detected using the DMS-MS platform. Based on DMS fundamentals and ab-initio thermochemical results we interpret the complexity of DMS modifier responses in terms of thermal activation and the development of solvent shells. At very high bulk gas temperature, modifier dipole moment may be the most important factor in cluster formation and cluster geometry in mobility differences, but at lower temperatures multi-neutral clusters are important and less predictable. This work provides a useful protocol for targeted DNA adduct quantitation and a basis for future work on DMS modifier effects. PMID:24452298

Achieving Better Buying Power for Mobile Open Architecture Software Systems Through Diverse Acquisition Scenarios

DTIC Science & Technology

2016-04-30

software (OSS) and proprietary (CSS) software elements or remote services (Scacchi, 2002, 2010), eventually including recent efforts to support Web ...specific platforms, including those operating on secured Web /mobile devices.  Common Development Technology provides AC development tools and common...transition to OA systems and OSS software elements, specifically for Web and Mobile devices within the realm of C3CB. OA, Open APIs, OSS, and CSS OA

Restriction of Retrotransposon Mobilization in Schizosaccharomyces pombe by Transcriptional Silencing and Higher-Order Chromatin Organization

PubMed Central

Murton, Heather E.; Grady, Patrick J. R.; Chan, Tsun Ho; Cam, Hugh P.; Whitehall, Simon K.

2016-01-01

Uncontrolled propagation of retrotransposons is potentially detrimental to host genome integrity. Therefore, cells have evolved surveillance mechanisms to restrict the mobility of these elements. In Schizosaccharomyces pombe the Tf2 LTR retrotransposons are transcriptionally silenced and are also clustered in the nucleus into structures termed Tf bodies. Here we describe the impact of silencing and clustering on the mobility of an endogenous Tf2 element. Deletion of genes such as set1+ (histone H3 lysine 4 methyltransferase) or abp1+ (CENP-B homolog) that both alleviate silencing and clustering, result in a corresponding increase in mobilization. Furthermore, expression of constitutively active Sre1, a transcriptional activator of Tf2 elements, also alleviates clustering and induces mobilization. In contrast, clustering is not disrupted by loss of the HIRA histone chaperone, despite high levels of expression, and in this background, mobilization frequency is only marginally increased. Thus, mutations that compromise transcriptional silencing but not Tf bodies are insufficient to drive mobilization. Furthermore, analyses of mutant alleles that separate the transcriptional repression and clustering functions of Set1 are consistent with control of Tf2 propagation via a combination of silencing and spatial organization. Our results indicate that host surveillance mechanisms operate at multiple levels to restrict Tf2 retrotransposon mobilization. PMID:27343236

Identification of Bari Transposons in 23 Sequenced Drosophila Genomes Reveals Novel Structural Variants, MITEs and Horizontal Transfer.

PubMed

Palazzo, Antonio; Lovero, Domenica; D'Addabbo, Pietro; Caizzi, Ruggiero; Marsano, René Massimiliano

2016-01-01

Bari elements are members of the Tc1-mariner superfamily of DNA transposons, originally discovered in Drosophila melanogaster, and subsequently identified in silico in 11 sequenced Drosophila genomes and as experimentally isolated in four non-sequenced Drosophila species. Bari-like elements have been also studied for their mobility both in vivo and in vitro. We analyzed 23 Drosophila genomes and carried out a detailed characterization of the Bari elements identified, including those from the heterochromatic Bari1 cluster in D. melanogaster. We have annotated 401 copies of Bari elements classified either as putatively autonomous or inactive according to the structure of the terminal sequences and the presence of a complete transposase-coding region. Analyses of the integration sites revealed that Bari transposase prefers AT-rich sequences in which the TA target is cleaved and duplicated. Furthermore evaluation of transposon's co-occurrence near the integration sites of Bari elements showed a non-random distribution of other transposable elements. We also unveil the existence of a putatively autonomous Bari1 variant characterized by two identical long Terminal Inverted Repeats, in D. rhopaloa. In addition, we detected MITEs related to Bari transposons in 9 species. Phylogenetic analyses based on transposase gene and the terminal sequences confirmed that Bari-like elements are distributed into three subfamilies. A few inconsistencies in Bari phylogenetic tree with respect to the Drosophila species tree could be explained by the occurrence of horizontal transfer events as also suggested by the results of dS analyses. This study further clarifies the Bari transposon's evolutionary dynamics and increases our understanding on the Tc1-mariner elements' biology.

Genome-wide colonization of gene regulatory elements by G4 DNA motifs

PubMed Central

Du, Zhuo; Zhao, Yiqiang; Li, Ning

2009-01-01

G-quadruplex (or G4 DNA), a stable four-stranded structure found in guanine-rich regions, is implicated in the transcriptional regulation of genes involved in growth and development. Previous studies on the role of G4 DNA in gene regulation mostly focused on genomic regions proximal to transcription start sites (TSSs). To gain a more comprehensive understanding of the regulatory role of G4 DNA, we examined the landscape of potential G4 DNA (PG4Ms) motifs in the human genome and found that G4 motifs, not restricted to those found in the TSS-proximal regions, are bias toward gene-associated regions. Significantly, analyses of G4 motifs in seven types of well-known gene regulatory elements revealed a constitutive enrichment pattern and the clusters of G4 motifs tend to be colocalized with regulatory elements. Considering our analysis from a genome evolutionary perspective, we found evidence that the occurrence and accumulation of certain progenitors and canonical G4 DNA motifs within regulatory regions were progressively favored by natural selection. Our results suggest that G4 DNA motifs are ‘colonized’ in regulatory regions, supporting a likely genome-wide role of G4 DNA in gene regulation. We hypothesize that G4 DNA is a regulatory apparatus situated in regulatory elements, acting as a molecular switch that can modulate the role of the host functional regions, by transition in DNA structure. PMID:19759215

Rapid, Affordable, and Point-of-Care Water Monitoring Via a Microfluidic DNA Sensor and a Mobile Interface for Global Health

PubMed Central

Ghanbari, Sarah; Ravikumar, Anusha; Seubert, John; Figueira, Silvia

2013-01-01

Contaminated water is a serious concern in many developing countries with severe health consequences particularly for children. Current methods for monitoring waterborne pathogens are often time consuming, expensive, and labor intensive, making them not suitable for these regions. Electrochemical detection in a microfluidic platform offers many advantages such as portability, minimal use of instrumentation, and easy integration with electronics. In many parts of the world, however, the required equipment for pathogen detection through electrochemical sensors is either not available or insufficiently portable, and operators may not be trained to use these sensors and interpret results, ultimately preventing its wide adoption. Counterintuitively, these same regions often have an extensive mobile phone infrastructure, suggesting the possibility of integrating electrochemical detection of bacterial pathogens with a mobile platform. Toward a solution to water quality interventions, we demonstrate a microfluidic electrochemical sensor combined with a mobile interface that detects the sequences from bacterial pathogens, suitable for rapid, affordable, and point-of-care water monitoring. We employ the transduction of DNA hybridization into a readily detectable electric signal by means of a conformational change of DNA stem-loop structure. Using this platform, we successfully demonstrate the detection of as low as 100 nM E. coli sequences and the automatic interpretation and mapping of the detection results via a mobile application. PMID:27170858

Pathogenic mechanisms in systemic lupus erythematosus.

PubMed

Perl, Andras

2010-02-01

Systemic lupus erythematosus (SLE) is a chronic inflammatory disease characterized by the dysfunction of T cells, B cells, and dendritic cells and by the production of antinuclear autoantibodies. This editorial provides a synopsis of newly discovered genetic factors and signaling pathways in lupus pathogenesis that are documented in 11 state-of-the-art reviews and original articles. Mitochondrial hyperpolarization underlies mitochondrial dysfunction, depletion of ATP, oxidative stress, abnormal activation, and death signal processing in lupus T cells. The mammalian target of rapamycin, which is a sensor of the mitochondrial transmembrane potential, has been successfully targeted for treatment of SLE with rapamycin or sirolimus in both patients and animal models. Inhibition of oxidative stress, nitric oxide production, expression of endogenous retroviral and repetitive elements such as HRES-1, the long interspersed nuclear elements 1, Trex1, interferon alpha (IFN-alpha), toll-like receptors 7 and 9 (TLR-7/9), high-mobility group B1 protein, extracellular signal-regulated kinase, DNA methyl transferase 1, histone deacetylase, spleen tyrosine kinase, proteasome function, lysosome function, endosome recycling, actin cytoskeleton formation, the nuclear factor kappa B pathway, and activation of cytotoxic T cells showed efficacy in animal models of lupus. Although B cell depletion and blockade of anti-DNA antibodies and T-B cell interaction have shown success in animal models, human studies are currently ongoing to establish the value of several target molecules for treatment of patients with lupus. Ongoing oxidative stress and inflammation lead to accelerated atherosclerosis that emerged as a significant cause of mortality in SLE.

Bursts of retrotransposition reproduced in Arabidopsis.

PubMed

Tsukahara, Sayuri; Kobayashi, Akie; Kawabe, Akira; Mathieu, Olivier; Miura, Asuka; Kakutani, Tetsuji

2009-09-17

Retrotransposons, which proliferate by reverse transcription of RNA intermediates, comprise a major portion of plant genomes. Plants often change the genome size and organization during evolution by rapid proliferation and deletion of long terminal repeat (LTR) retrotransposons. Precise transposon sequences throughout the Arabidopsis thaliana genome and the trans-acting mutations affecting epigenetic states make it an ideal model organism with which to study transposon dynamics. Here we report the mobilization of various families of endogenous A. thaliana LTR retrotransposons identified through genetic and genomic approaches with high-resolution genomic tiling arrays and mutants in the chromatin-remodelling gene DDM1 (DECREASE IN DNA METHYLATION 1). Using multiple lines of self-pollinated ddm1 mutant, we detected an increase in copy number, and verified this for various retrotransposons in a gypsy family (ATGP3) and copia families (ATCOPIA13, ATCOPIA21, ATCOPIA93), and also for a DNA transposon of a Mutator family, VANDAL21. A burst of retrotransposition occurred stochastically and independently for each element, suggesting an additional autocatalytic process. Furthermore, comparison of the identified LTR retrotransposons in related Arabidopsis species revealed that a lineage-specific burst of retrotransposition of these elements did indeed occur in natural Arabidopsis populations. The recent burst of retrotransposition in natural population is targeted to centromeric repeats, which is presumably less harmful than insertion into genes. The ddm1-induced retrotransposon proliferations and genome rearrangements mimic the transposon-mediated genome dynamics during evolution and provide experimental systems with which to investigate the controlling molecular factors directly.

Maize DRE-binding proteins DBF1 and DBF2 are involved in rab17 regulation through the drought-responsive element in an ABA-dependent pathway.

PubMed

Kizis, Dimosthenis; Pagès, Montserrat

2002-06-01

The abscisic acid-responsive gene rab17 of maize is expressed during late embryogenesis, and is induced by ABA and desiccation in embryo and vegetative tissues. ABRE and DRE cis-elements are involved in regulation of the gene by ABA and drought. Using yeast one-hybrid screening, we isolated two cDNAs encoding two new DRE-binding proteins, designated DBF1 and DBF2, that are members of the AP2/EREBP transcription factor family. Analysis of mRNA accumulation profiles showed that DBF1 is induced during maize embryogenesis and after desiccation, NaCl and ABA treatments in plant seedlings, whereas the DBF2 mRNA is not induced. DNA-binding preferences of DBFs were analysed by electrophoretic mobility shift assays, and showed that both DBF1 and DBF2 bound to the wild-type DRE2 element, but not to the DRE2 mutant or to the DRE1 element which differs only in a single nucleotide. Transactivation activity using particle bombardment showed that DBF1 functioned as activator of DRE2-dependent transcription of rab17 promoter by ABA, whereas DBF2 overexpression had a repression action downregulating not only the basal promoter activity, but also the ABA effect. These results show that ABA plays a role in the regulation of DBF activity, and suggests the existence of an ABA-dependent pathway for the regulation of genes through the C-repeat/DRE element.

Copy and paste: the impact of a new non-L1 retroposon on the gonosomal heterochromatin of Microtus agrestis.

PubMed

Neitzel, H; Kalscheuer, V; Singh, A P; Henschel, S; Sperling, K

2002-01-01

Mobile elements are most abundant in the mammalian genome, comprising at least 40-50% of the DNA. They are differentiated into two most prominent families: the LINE elements, which are preferentially located in the G-bands, and SINES, which are clustered in the R-bands. We report here a novel mammalian non-L1-retroposon, which invaded the genome of Microtus agrestis in a very short time from an evolutionary viewpoint. No relevant sequence homology could be demonstrated to known sequences in the NCBI database. However, cross-hybridizing sequences exist in the genomes of all other Microtus species analyzed, but not in Mus musculus, indicating the recent evolutionary origin of this element. This retroposon is enriched in the entire heterochromatin of the X and Y chromosomes, but is also interspersed in autosomal locations in euchromatic portions of the genome. We show that the retroposon is heavily transcribed from the heterochromatin during female meiosis prerequisite for the subsequent retrotransposition. The estimated rate of retrotransposition is at least 1-2 x 10(-2) per generation, which is hundred-fold higher than that of the majority of invertebrate retroposons and also higher than the transposition rate of a murine L1 element, which was calculated to be 3 x 10(-3) per generation. Copyright 2002 S. Karger AG, Basel

Regulation of the yeast RAD2 gene: DNA damage-dependent induction correlates with protein binding to regulatory sequences and their deletion influences survival.

PubMed

Siede, W; Friedberg, E C

1992-03-01

In the yeast Saccharomyces cerevisiae the RAD2 gene is absolutely required for damage-specific incision of DNA during nucleotide excision repair and is inducible by DNA-damaging agents. In the present study we correlated sensitivity to killing by DNA-damaging agents with the deletion of previously defined specific promoter elements. Deletion of the element DRE2 increased the UV sensitivity of cells in both the G1/early S and S/G2 phases of the cell cycle as well as in stationary phase. On the other hand, increased UV sensitivity associated with deletion of the sequence-related element DRE1 was restricted to cells irradiated in G1/S. Specific binding of protein(s) to the promoter elements DRE1 and DRE2 was observed under non-inducing conditions using gel retardation assays. Exposure of cells to DNA-damaging agents resulted in increased protein binding that was dependent on de novo protein synthesis.

Effect of DGPS failures on dynamic positioning of mobile drilling units in the North Sea.

PubMed

Chen, Haibo; Moan, Torgeir; Verhoeven, Harry

2009-11-01

Basic features of differential global positioning system (DGPS), and its operational configuration on dynamically positioned (DP) mobile offshore drilling units in the North Sea are described. Generic failure modes of DGPS are discussed, and a critical DGPS failure which has the potential to cause drive-off for mobile drilling units is identified. It is the simultaneous erroneous position data from two DGPS's. Barrier method is used to analyze this critical DGPS failure. Barrier elements to prevent this failure are identified. Deficiencies of each barrier element are revealed based on the incidents and operational experiences in the North Sea. Recommendations to strengthen these barrier elements, i.e. to prevent erroneous position data from DGPS, are proposed. These recommendations contribute to the safety of DP operations of mobile offshore drilling units.

Systems and Methods of Coordination Control for Robot Manipulation

NASA Technical Reports Server (NTRS)

Chang, Chu-Yin (Inventor); English, James (Inventor); Tardella, Neil (Inventor); Bacon, James (Inventor)

2013-01-01

Disclosed herein are systems and methods for controlling robotic apparatus having several movable elements or segments coupled by joints. At least one of the movable elements can include one or more mobile bases, while the others can form one or more manipulators. One of the movable elements can be treated as an end effector for which a certain motion is desired. The end effector may include a tool, for example, or represent a robotic hand (or a point thereon), or one or more of the one or more mobile bases. In accordance with the systems and methods disclosed herein, movement of the manipulator and the mobile base can be controlled and coordinated to effect a desired motion for the end effector. In many cases, the motion can include simultaneously moving the manipulator and the mobile base.

Separation of a chemically modified DNA oligomer bound by the carcinogen 2-Amino-1-methy-6-phenylimidazo [4,5-{beta}]pyridine using capillary gel electrophoresis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nguyen, T.N.

1994-05-06

We have optimized the reaction conditions under which unactivated metabolite of the food borne carcinogen 2-amino-1-methyl-6-phenylimidazo [4,5-{beta}]pyridine (PhIP) is covalently bound to the oligodeoxynucleotide d(CCTACGCATCC). Capillary electrophoresis (CE) was used to separate and characterize this DNA oligomer bound by PhIP. We observed 2 major and several minor PhIP adduct species. The 2 major adducts had different absorbance maxima; the major adduct eluates with faster and slower mobilities had absorbance maxima of 360 and 340 nm, respectively. One of the two major PhIP adduct species was resolvable but the peak was broad. Using detection at 260 nm, the other major PhIPmore » adduct with fastest electrophoretic mobility was not resolvable, but coelute with the huge broad unmodified DNA oligomer peak. However, at higher wavelengths (>320 nm) where DNA does not absorb, electropherograms generated by detection at these higher wavelengths showed very heterogeneous binding by PhIP to the DNA oligomer with no interfering absorbance by the DNA.« less

Mobile satellite service for Canada

NASA Technical Reports Server (NTRS)

Sward, David

1988-01-01

The Mobile Satellite (MSAT) system and a special program designed to provide interim mobile satellite services (IMSS) during the construction phase of MSAT are described. A mobile satellite system is a key element in extending voice and and data telecommunications to all Canadians.

The hobo transposable element has transposase-dependent and -independent excision activity in drosophilid species

USDA-ARS?s Scientific Manuscript database

Mobility of the hobo transposable element was determined for several strains of Drosophila melanogaster and several Drosophila species. Mobility was assessed by use of an in vivo transient assay in the soma of developing embryos, which monitored hobo excision from injected indicator plasmids. Excisi...

Dramatic genotypic difference in, and effect of genetic crossing on, tissue culture-induced mobility of retrotransposon Tos17 in rice.

PubMed

Lin, Chunjing; Lin, Xiuyun; Hu, Lanjuan; Yang, Jingjing; Zhou, Tianqi; Long, Likun; Xu, Chunming; Xing, Shaochen; Qi, Bao; Dong, Yingshan; Liu, Bao

2012-11-01

KEY MESSAGE : We show for the first time that intraspecific crossing may impact mobility of the prominent endogenous retrotransposon Tos17 under tissue culture conditions in rice. Tos17, an endogenous copia retrotransposon of rice, is transpositionally active in tissue culture. To study whether there exists fundamental genotypic difference in the tissue culture-induced mobility of Tos17, and if so, whether the difference is under genetic and/or epigenetic control, we conducted this investigation. We show that dramatic difference in tissue culture-induced Tos17 mobility exists among different rice pure-line cultivars sharing the same maternal parent: of the three lines studied that harbor Tos17, two showed mobilization of Tos17, which accrued in proportion to subculture duration, while the third line showed total quiescence (immobility) of the element and the fourth line did not contain the element. In reciprocal F1 hybrids between Tos17-mobile and -immobile (or absence) parental lines, immobility was dominant over mobility. In reciprocal F1 hybrids between both Tos17-mobile parental lines, an additive or synergistic effect on mobility of the element was noticed. In both types of reciprocal F1 hybrids, clear difference in the extent of Tos17 mobility was noted between crossing directions. Given that all lines share the same maternal parent, this observation indicates the existence of epigenetic parent-of-origin effect. We conclude that the tissue culture-induced mobility of Tos17 in rice is under complex genetic and epigenetic control, which can be either enhanced or repressed by intraspecific genetic crossing.

Spontaneous germline excision of Tol1, a DNA-based transposable element naturally occurring in the medaka fish genome.

PubMed

Watanabe, Kohei; Koga, Hajime; Nakamura, Kodai; Fujita, Akiko; Hattori, Akimasa; Matsuda, Masaru; Koga, Akihiko

2014-04-01

DNA-based transposable elements are ubiquitous constituents of eukaryotic genomes. Vertebrates are, however, exceptional in that most of their DNA-based elements appear to be inactivated. The Tol1 element of the medaka fish, Oryzias latipes, is one of the few elements for which copies containing an undamaged gene have been found. Spontaneous transposition of this element in somatic cells has previously been demonstrated, but there is only indirect evidence for its germline transposition. Here, we show direct evidence of spontaneous excision in the germline. Tyrosinase is the key enzyme in melanin biosynthesis. In an albino laboratory strain of medaka fish, which is homozygous for a mutant tyrosinase gene in which a Tol1 copy is inserted, we identified de novo reversion mutations related to melanin pigmentation. The gamete-based reversion rate was as high as 0.4%. The revertant fish carried the tyrosinase gene from which the Tol1 copy had been excised. We previously reported the germline transposition of Tol2, another DNA-based element that is thought to be a recent invader of the medaka fish genome. Tol1 is an ancient resident of the genome. Our results indicate that even an old element can contribute to genetic variation in the host genome as a natural mutator.

Trace elements are associated with urinary 8-hydroxy-2'-deoxyguanosine level: a case study of college students in Guangzhou, China.

PubMed

Lu, Shaoyou; Ren, Lu; Fang, Jianzhang; Ji, Jiajia; Liu, Guihua; Zhang, Jianqing; Zhang, Huimin; Luo, Ruorong; Lin, Kai; Fan, Ruifang

2016-05-01

Many trace heavy elements are carcinogenic and increase the incidence of cancer. However, a comprehensive study of the correlation between multiple trace elements and DNA oxidative damage is still lacking. The aim of this study is to investigate the relationships between the body burden of multiple trace elements and DNA oxidative stress in college students in Guangzhou, China. Seventeen trace elements in urine samples were determined by inductively coupled plasma-mass spectrometry (ICP-MS). Urinary 8-hydroxy-2'-deoxyguanosine (8-OHdG), a biomarker of DNA oxidative stress, was also measured using liquid chromatography tandem mass spectrometer (LC-MS/MS). The concentrations of six essential elements including manganese (Mn), copper (Cu), nickel (Ni), selenium (Se), strontium (Sr), and molybdenum (Mo), and five non-essential elements including arsenic (As), cadmium (Cd), aluminum (Al), stibium (Sb), and thallium (Tl), were found to be significantly correlated with urinary 8-OHdG levels. Moreover, urinary levels of Ni, Se, Mo, As, Sr, and Tl were strongly significantly correlated with 8-OHdG (P < 0.01) concentration. Environmental exposure and dietary intake of these trace elements may play important roles in DNA oxidative damage in the population of Guangzhou, China.

Photoinduced Regeneration of an Aptamer-Based Electrochemical Sensor for Sensitively Detecting Adenosine Triphosphate.

PubMed

Zhang, Xiaoyu; Song, Chunxia; Yang, Ke; Hong, Wenwen; Lu, Ying; Yu, Ping; Mao, Lanqun

2018-04-17

Electrochemical aptasensors generally include three elements, that is, recognition element, signal-transformation element, and regeneration element. In this study, a new adenosine triphosphate (ATP) aptasensor is developed by combining three elements into one DNA oligonucleotide chain. In the DNA oligonucleotide chain, DNA aptamer is used as the recognition element, ferrocene group attached at the 3'-end of the aptamer is used as the signal-transformation element, and azobenzene moiety embedded into the DNA chain is used as the regeneration element. In addition to the similar analytical properties with the traditional ones, the aptasensor developed here is easily regenerated with UV-light irradiation. The current response recorded on the aptasensor increases with increasing the concentration of ATP in the incubation solution and is linear with the logarithm of ATP concentration in the range from 1 nM to 100 μM. The limit of detection is 0.5 nM (S/N = 3). The basal level of ATP in the rat brain cortex microdialysate is determined to be 21.33 ± 4.1 nM ( n = 3). After being challenged with ATP, the aptasensor could be readily regenerated by UV-light irradiation for more than seven cycles. The regeneration of the aptasensor is proposed to be regulated by conversing azobenzene from its trans to cis form under UV irradiation.

H-NS-like nucleoid-associated proteins, mobile genetic elements and horizontal gene transfer in bacteria.

PubMed

Dorman, Charles J

2014-09-01

Horizontal gene transfer plays an important role in the evolution of bacterial species, conferring new genetic traits on the recipient bacterium that extend its range of phenotypes and plasmids make important contributions to this process. However, the inappropriate expression of newly acquired genes may lead to a loss of competitive fitness, resulting in the elimination of the new gene-bacterium combination. It is thought that transcriptional silencing of horizontally acquired genes offers a route out of this dilemma and that nucleoid-associated proteins, especially those related to the H-NS protein, play a particularly important role in the silencing process. The discovery that many plasmids express orthologues of nucleoid-associated proteins adds an interesting dimension to current models of regulatory integration following lateral transfer of DNA. Other horizontally acquired genetic elements, such as genomic islands, also express nucleoid-associated proteins of their own. Here the interactions of H-NS-like nucleoid-associated proteins encoded by the core genome, genomic islands and plasmids are described. Copyright © 2014 Elsevier Inc. All rights reserved.

Movable Genetic Elements: Detection of Changes in Maize DNA at the Shrunken Locus Due to the Intervention of Ds Elements

DOE R&D Accomplishments Database

Burr, B.; Burr, F.A.

1980-05-28

This report describes our initial attempts at the molecular characterization of a maize controlling element. We have prepared a cDNA probe and used it to detect changes at a locus where Ds elements are found. Evidence of their presence are indicated by changes in the restriction patterns, but there is as yet no information on the physical nature of the controlling elements nor on the kinds of rearrangements they cause.

Evidence for the role of Mycobacterium tuberculosis RecG helicase in DNA repair and recombination.

PubMed

Thakur, Roshan S; Basavaraju, Shivakumar; Somyajit, Kumar; Jain, Akshatha; Subramanya, Shreelakshmi; Muniyappa, Kalappa; Nagaraju, Ganesh

2013-04-01

In order to survive and replicate in a variety of stressful conditions during its life cycle, Mycobacterium tuberculosis must possess mechanisms to safeguard the integrity of the genome. Although DNA repair and recombination related genes are thought to play key roles in the repair of damaged DNA in all organisms, so far only a few of them have been functionally characterized in the tubercle bacillus. In this study, we show that M. tuberculosis RecG (MtRecG) expression was induced in response to different genotoxic agents. Strikingly, expression of MtRecG in Escherichia coli ∆recG mutant strain provided protection against mitomycin C, methyl methane sulfonate and UV induced cell death. Purified MtRecG exhibited higher binding affinity for the Holliday junction (HJ) compared with a number of canonical recombinational DNA repair intermediates. Notably, although MtRecG binds at the core of the mobile and immobile HJs, and with higher binding affinity for the immobile HJ, branch migration was evident only in the case of the mobile HJ. Furthermore, immobile HJs stimulate MtRecG ATPase activity less efficiently than mobile HJs. In addition to HJ substrates, MtRecG exhibited binding affinity for a variety of branched DNA structures including three-way junctions, replication forks, flap structures, forked duplex and a D-loop structure, but demonstrated strong unwinding activity on replication fork and flap DNA structures. Together, these results support that MtRecG plays an important role in processes related to DNA metabolism under normal as well as stress conditions. © 2013 The Authors Journal compilation © 2013 FEBS.

A Literature Review: Website Design and User Engagement.

PubMed

Garett, Renee; Chiu, Jason; Zhang, Ly; Young, Sean D

2016-07-01

Proper design has become a critical element needed to engage website and mobile application users. However, little research has been conducted to define the specific elements used in effective website and mobile application design. We attempt to review and consolidate research on effective design and to define a short list of elements frequently used in research. The design elements mentioned most frequently in the reviewed literature were navigation, graphical representation, organization, content utility, purpose, simplicity, and readability. We discuss how previous studies define and evaluate these seven elements. This review and the resulting short list of design elements may be used to help designers and researchers to operationalize best practices for facilitating and predicting user engagement.

A Literature Review: Website Design and User Engagement

PubMed Central

Garett, Renee; Chiu, Jason; Zhang, Ly; Young, Sean D.

2015-01-01

Proper design has become a critical element needed to engage website and mobile application users. However, little research has been conducted to define the specific elements used in effective website and mobile application design. We attempt to review and consolidate research on effective design and to define a short list of elements frequently used in research. The design elements mentioned most frequently in the reviewed literature were navigation, graphical representation, organization, content utility, purpose, simplicity, and readability. We discuss how previous studies define and evaluate these seven elements. This review and the resulting short list of design elements may be used to help designers and researchers to operationalize best practices for facilitating and predicting user engagement. PMID:27499833

Satellite DNA and Transposable Elements in Seabuckthorn (Hippophae rhamnoides), a Dioecious Plant with Small Y and Large X Chromosomes.

PubMed

Puterova, Janka; Razumova, Olga; Martinek, Tomas; Alexandrov, Oleg; Divashuk, Mikhail; Kubat, Zdenek; Hobza, Roman; Karlov, Gennady; Kejnovsky, Eduard

2017-01-01

Seabuckthorn (Hippophae rhamnoides) is a dioecious shrub commonly used in the pharmaceutical, cosmetic, and environmental industry as a source of oil, minerals and vitamins. In this study, we analyzed the transposable elements and satellites in its genome. We carried out Illumina DNA sequencing and reconstructed the main repetitive DNA sequences. For data analysis, we developed a new bioinformatics approach for advanced satellite DNA analysis and showed that about 25% of the genome consists of satellite DNA and about 24% is formed of transposable elements, dominated by Ty3/Gypsy and Ty1/Copia LTR retrotransposons. FISH mapping revealed X chromosome-accumulated, Y chromosome-specific or both sex chromosomes-accumulated satellites but most satellites were found on autosomes. Transposable elements were located mostly in the subtelomeres of all chromosomes. The 5S rDNA and 45S rDNA were localized on one autosomal locus each. Although we demonstrated the small size of the Y chromosome of the seabuckthorn and accumulated satellite DNA there, we were unable to estimate the age and extent of the Y chromosome degeneration. Analysis of dioecious relatives such as Shepherdia would shed more light on the evolution of these sex chromosomes. © The Author(s) 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

Motion of Knots in DNA Stretched by Elongational Fields

NASA Astrophysics Data System (ADS)

Klotz, Alexander R.; Soh, Beatrice W.; Doyle, Patrick S.

2018-05-01

Knots in DNA occur in biological systems, serve as a model system for polymer entanglement, and affect the efficacy of modern genomics technologies. We study the motion of complex knots in DNA by stretching molecules with a divergent electric field that provides an elongational force. We demonstrate that the motion of knots is nonisotropic and driven towards the closest end of the molecule. We show for the first time experimentally that knots can go from a mobile to a jammed state by varying an applied strain rate, and that this jamming is reversible. We measure the mobility of knots as a function of strain rate, demonstrating the conditions under which knots can be driven towards the ends of the molecule and untied.

Gel Electrophoresis of Gold-DNA Nanoconjugates

DOE PAGES

Pellegrino, T.; Sperling, R. A.; Alivisatos, A. P.; ...

2007-01-01

Gold-DNA conjugates were investigated in detail by a comprehensive gel electrophoresis study based on 1200 gels. A controlled number of single-stranded DNA of different length was attached specifically via thiol-Au bonds to phosphine-stabilized colloidal gold nanoparticles. Alternatively, the surface of the gold particles was saturated with single stranded DNA of different length either specifically via thiol-Au bonds or by nonspecific adsorption. From the experimentally determined electrophoretic mobilities, estimates for the effective diameters of the gold-DNA conjugates were derived by applying two different data treatment approaches. The first method is based on making a calibration curve for the relation between effectivemore » diameters and mobilities with gold nanoparticles of known diameter. The second method is based on Ferguson analysis which uses gold nanoparticles of known diameter as reference database. Our study shows that effective diameters derived from gel electrophoresis measurements are affected with a high error bar as the determined values strongly depend on the method of evaluation, though relative changes in size upon binding of molecules can be detected with high precision. Furthermore, in this study, the specific attachment of DNA via gold-thiol bonds to Au nanoparticles is compared to nonspecific adsorption of DNA. Also, the maximum number of DNA molecules that can be bound per particle was determined.« less

RNA from the 5' end of the R2 retrotransposon controls R2 protein binding to and cleavage of its DNA target site.

PubMed

Christensen, Shawn M; Ye, Junqiang; Eickbush, Thomas H

2006-11-21

Non-LTR retrotransposons insert into eukaryotic genomes by target-primed reverse transcription (TPRT), a process in which cleaved DNA targets are used to prime reverse transcription of the element's RNA transcript. Many of the steps in the integration pathway of these elements can be characterized in vitro for the R2 element because of the rigid sequence specificity of R2 for both its DNA target and its RNA template. R2 retrotransposition involves identical subunits of the R2 protein bound to different DNA sequences upstream and downstream of the insertion site. The key determinant regulating which DNA-binding conformation the protein adopts was found to be a 320-nt RNA sequence from near the 5' end of the R2 element. In the absence of this 5' RNA the R2 protein binds DNA sequences upstream of the insertion site, cleaves the first DNA strand, and conducts TPRT when RNA containing the 3' untranslated region of the R2 transcript is present. In the presence of the 320-nt 5' RNA, the R2 protein binds DNA sequences downstream of the insertion site. Cleavage of the second DNA strand by the downstream subunit does not appear to occur until after the 5' RNA is removed from this subunit. We postulate that the removal of the 5' RNA normally occurs during reverse transcription, and thus provides a critical temporal link to first- and second-strand DNA cleavage in the R2 retrotransposition reaction.

Aconitase couples metabolic regulation to mitochondrial DNA maintenance.

PubMed

Chen, Xin Jie; Wang, Xiaowen; Kaufman, Brett A; Butow, Ronald A

2005-02-04

Mitochondrial DNA (mtDNA) is essential for cells to maintain respiratory competency and is inherited as a protein-DNA complex called the nucleoid. We have identified 22 mtDNA-associated proteins in yeast, among which is mitochondrial aconitase (Aco1p). We show that this Krebs-cycle enzyme is essential for mtDNA maintenance independent of its catalytic activity. Regulation of ACO1 expression by the HAP and retrograde metabolic signaling pathways directly affects mtDNA maintenance. When constitutively expressed, Aco1p can replace the mtDNA packaging function of the high-mobility-group protein Abf2p. Thus, Aco1p may integrate metabolic signals and mtDNA maintenance.

Vertical Transmission of the Retrotransposable Elements R1 and R2 during the Evolution of the Drosophila Melanogaster Species Subgroup

PubMed Central

Eickbush, D. G.; Eickbush, T. H.

1995-01-01

R1 and R2 are non-long-terminal repeat retrotransposable elements that insert into specific sequences of insect 28S ribosomal RNA genes. These elements have been extensively described in Drosophila melanogaster. To determine whether these elements have been horizontally or vertically transmitted, we characterized R1 and R2 elements from the seven other members of the melanogaster species subgroup by genomic blotting and nucleotide sequencing. Each species was found to have homogeneous families of R1 and R2 elements with the exception of erecta and orena, which have no R2 elements. The DNA sequences of multiple R1 and R2 copies from each species indicated nucleotide divergence within each species averaged only 0.48% for R1 and 0.35% for R2, well below the level of divergence among the species. Most copies of R1 and R2 (40 of 47) sequenced from the seven species were potentially functional, as indicated by the absence of premature termination codons or translational frameshifts that would destroy the open reading frame of the element. The sequence relationships of both the R1 and R2 elements from the various members of the melanogaster subgroup closely followed that of the species phylogeny, suggesting that R1 and R2 have been stably maintained by vertical transmission since the origin of this species subgroup 17-20 million years ago. The remarkable stability of R1 and R2, compared to what has been suggested for transposable elements that insert at multiple locations in these same species, may be due to their unique specificity for sites in the rRNA gene locus. Under low copy number conditions, when it is essential for any mobile element to transpose, the insertion specificities of R1 and R2 ensure uniform developmentally regulated target sites that can be occupied with little or no detrimental effect on the host. PMID:7713424

The cis-regulatory element CCACGTGG is involved in ABA and water-stress responses of the maize gene rab28.

PubMed

Pla, M; Vilardell, J; Guiltinan, M J; Marcotte, W R; Niogret, M F; Quatrano, R S; Pagès, M

1993-01-01

The maize gene rab28 has been identified as ABA-inducible in embryos and vegetative tissues. It is also induced by water stress in young leaves. The proximal promoter region contains the conserved cis-acting element CCACGTGG (ABRE) reported for ABA induction in other plant genes. Transient expression assays in rice protoplasts indicate that a 134 bp fragment (-194 to -60 containing the ABRE) fused to a truncated cauliflower mosaic virus promoter (35S) is sufficient to confer ABA-responsiveness upon the GUS reporter gene. Gel retardation experiments indicate that nuclear proteins from tissues in which the rab28 gene is expressed can interact specifically with this 134 bp DNA fragment. Nuclear protein extracts from embryo and water-stressed leaves generate specific complexes of different electrophoretic mobility which are stable in the presence of detergent and high salt. However, by DMS footprinting the same guanine-specific contacts with the ABRE in both the embryo and leaf binding activities were detected. These results indicate that the rab28 promoter sequence CCACGTGG is a functional ABA-responsive element, and suggest that distinct regulatory factors with apparent similar affinity for the ABRE sequence may be involved in the hormone action during embryo development and in vegetative tissues subjected to osmotic stress.

Identification and characterization of a silencer regulatory element in the 3'-flanking region of the murine CD46 gene.

PubMed Central

Nomura, M; Tsujimura, A; Begum, N A; Matsumoto, M; Wabiko, H; Toyoshima, K; Seya, T

2000-01-01

The murine membrane cofactor protein (CD46) gene is expressed exclusively in testis, in contrast to human CD46, which is expressed ubiquitously. To elucidate the mechanism of differential CD46 gene expression among species, we cloned entire murine CD46 genomic DNA and possible regulatory regions were placed in the flanking region of the luciferase reporter gene. The reporter gene assay revealed a silencing activity not in the promoter, but in the 3'-flanking region of the gene and the silencer-like element was identified within a 0.2-kb region between 0.6 and 0.8 kb downstream of the stop codon. This silencer-like element was highly similar to that of the pig MHC class-I gene. The introduction of a mutation into this putative silencer element of murine CD46 resulted in an abrogation of the silencing effect. Electrophoretic mobility-shift assay indicated the presence of the binding molecule(s) for this silencer sequence in murine cell lines and tissues. A size difference of the protein-silencer-element complex was observed depending upon the solubilizers used for preparation of the nuclear extracts. A mutated silencer sequence failed to interact with the binding molecules. The level of the binding factor was lower in the testicular germ cells compared with other organs. Thus the silencer element and its binding factor may play a role in transcriptional regulation of murine CD46 gene expression. These results imply that the effects of the CD46 silencer element encompass the innate immune and reproductive systems, and in mice may determine the testicular germ-cell-dominant expression of CD46. PMID:11023821

Combinatorial events of insertion sequences and ICE in Gram-negative bacteria.

PubMed

Toleman, Mark A; Walsh, Timothy R

2011-09-01

The emergence of antibiotic and antimicrobial resistance in Gram-negative bacteria is incremental and linked to genetic elements that function in a so-called 'one-ended transposition' manner, including ISEcp1, ISCR elements and Tn3-like transposons. The power of these elements lies in their inability to consistently recognize one of their own terminal sequences, while recognizing more genetically distant surrogate sequences. This has the effect of mobilizing the DNA sequence found adjacent to their initial location. In general, resistance in Gram-negatives is closely linked to a few one-off events. These include the capture of the class 1 integron by a Tn5090-like transposon; the formation of the 3' conserved segment (3'-CS); and the fusion of the ISCR1 element to the 3'-CS. The structures formed by these rare events have been massively amplified and disseminated in Gram-negative bacteria, but hitherto, are rarely found in Gram-positives. Such events dominate current resistance gene acquisition and are instrumental in the construction of large resistance gene islands on chromosomes and plasmids. Similar combinatorial events appear to have occurred between conjugative plasmids and phages constructing hybrid elements called integrative and conjugative elements or conjugative transposons. These elements are beginning to be closely linked to some of the more powerful resistance mechanisms such as the extended spectrum β-lactamases, metallo- and AmpC type β-lactamases. Antibiotic resistance in Gram-negative bacteria is dominated by unusual combinatorial mistakes of Insertion sequences and gene fusions which have been selected and amplified by antibiotic pressure enabling the formation of extended resistance islands. © 2011 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

Identification of Bari Transposons in 23 Sequenced Drosophila Genomes Reveals Novel Structural Variants, MITEs and Horizontal Transfer

PubMed Central

D’Addabbo, Pietro; Caizzi, Ruggiero

2016-01-01

Bari elements are members of the Tc1-mariner superfamily of DNA transposons, originally discovered in Drosophila melanogaster, and subsequently identified in silico in 11 sequenced Drosophila genomes and as experimentally isolated in four non-sequenced Drosophila species. Bari-like elements have been also studied for their mobility both in vivo and in vitro. We analyzed 23 Drosophila genomes and carried out a detailed characterization of the Bari elements identified, including those from the heterochromatic Bari1 cluster in D. melanogaster. We have annotated 401 copies of Bari elements classified either as putatively autonomous or inactive according to the structure of the terminal sequences and the presence of a complete transposase-coding region. Analyses of the integration sites revealed that Bari transposase prefers AT-rich sequences in which the TA target is cleaved and duplicated. Furthermore evaluation of transposon’s co-occurrence near the integration sites of Bari elements showed a non-random distribution of other transposable elements. We also unveil the existence of a putatively autonomous Bari1 variant characterized by two identical long Terminal Inverted Repeats, in D. rhopaloa. In addition, we detected MITEs related to Bari transposons in 9 species. Phylogenetic analyses based on transposase gene and the terminal sequences confirmed that Bari-like elements are distributed into three subfamilies. A few inconsistencies in Bari phylogenetic tree with respect to the Drosophila species tree could be explained by the occurrence of horizontal transfer events as also suggested by the results of dS analyses. This study further clarifies the Bari transposon’s evolutionary dynamics and increases our understanding on the Tc1-mariner elements’ biology. PMID:27213270

Deep-subwavelength Decoupling for MIMO Antennas in Mobile Handsets with Singular Medium.

PubMed

Xu, Su; Zhang, Ming; Wen, Huailin; Wang, Jun

2017-09-22

Decreasing the mutual coupling between Multi-input Multi-output (MIMO) antenna elements in a mobile handset and achieving a high data rate is a challenging topic as the 5 th -generation (5G) communication age is coming. Conventional decoupling components for MIMO antennas have to be re-designed when the geometries or frequencies of antennas have any adjustment. In this paper, we report a novel metamaterial-based decoupling strategy for MIMO antennas in mobile handsets with wide applicability. The decoupling component is made of subwavelength metal/air layers, which can be treated as singular medium over a broad frequency band. The flexible applicable property of the decoupling strategy is verified with different antennas over different frequency bands with the same metamaterial decoupling element. Finally, 1/100-wavelength 10-dB isolation is demonstrated for a 24-element MIMO antenna in mobile handsets over the frequency band from 4.55 to 4.75 GHz.

The long (LINEs) and the short (SINEs) of it: altered methylation as a precursor to toxicity.

PubMed

Carnell, Ammie N; Goodman, Jay I

2003-10-01

Although once thought of as "junk" DNA, the importance of interspersed elements in the genome has become increasingly appreciated in recent years. In a broad sense these are collectively referred to as transposable elements, which encompass both transposons and retrotransposons. The latter include long interspersed nuclear elements (LINEs) and short interspersed nuclear elements (SINEs). Expression of these elements leads to genetic instability. Therefore, it is important that they remain transcriptionally silenced, and DNA methylation plays a key role in this regard. A framework for understanding the possible interplay between altered DNA methylation, an epigenetic change, and mutational events is presented. A case is made as to how retrotransposable elements, specifically LINEs and SINEs, are likely to emerge as key players in furthering our understanding of mechanisms underlying a variety of toxicities, including carcinogenesis but not limited to this endpoint.

Characterization of mobile genetic elements in antibiotic resistant Salmonella enterica isolates from food animals

USDA-ARS?s Scientific Manuscript database

Antibiotic resistance (AR) is a major concern for the agricultural industry in the U.S. and globally. The problem of AR is further complicated by AR genes often being located on mobile genetic elements (MGEs) resulting in their spread among bacteria. In order to investigate the relationship between ...

The chromosomal organization of horizontal gene transfer in bacteria.

PubMed

Oliveira, Pedro H; Touchon, Marie; Cury, Jean; Rocha, Eduardo P C

2017-10-10

Bacterial adaptation is accelerated by the acquisition of novel traits through horizontal gene transfer, but the integration of these genes affects genome organization. We found that transferred genes are concentrated in only ~1% of the chromosomal regions (hotspots) in 80 bacterial species. This concentration increases with genome size and with the rate of transfer. Hotspots diversify by rapid gene turnover; their chromosomal distribution depends on local contexts (neighboring core genes), and content in mobile genetic elements. Hotspots concentrate most changes in gene repertoires, reduce the trade-off between genome diversification and organization, and should be treasure troves of strain-specific adaptive genes. Most mobile genetic elements and antibiotic resistance genes are in hotspots, but many hotspots lack recognizable mobile genetic elements and exhibit frequent homologous recombination at flanking core genes. Overrepresentation of hotspots with fewer mobile genetic elements in naturally transformable bacteria suggests that homologous recombination and horizontal gene transfer are tightly linked in genome evolution.Horizontal gene transfer (HGT) is an important mechanism for genome evolution and adaptation in bacteria. Here, Oliveira and colleagues find HGT hotspots comprising  ~ 1% of the chromosomal regions in 80 bacterial species.

Conserved Elements Vaccine for HIV | NCI Technology Transfer Center | TTC

Cancer.gov

Researchers at the National Cancer Institute (NCI) developed a DNA vaccine using conserved elements of HIV-1 Gag, administered in a prime-boost vaccination protocol. Two of the HIV Gag CE DNA vectors have been tested in a rhesus macaque model. Priming with the Gag CE vaccine and boosting with full length Gag DNA showed increased immune responses when compared to vaccination with Gag alone. Researchers seek licensing and/or co-development research collaborations for development this DNA vaccine.

Interactions between the R2R3-MYB Transcription Factor, AtMYB61, and Target DNA Binding Sites

PubMed Central

Prouse, Michael B.; Campbell, Malcolm M.

2013-01-01

Despite the prominent roles played by R2R3-MYB transcription factors in the regulation of plant gene expression, little is known about the details of how these proteins interact with their DNA targets. For example, while Arabidopsis thaliana R2R3-MYB protein AtMYB61 is known to alter transcript abundance of a specific set of target genes, little is known about the specific DNA sequences to which AtMYB61 binds. To address this gap in knowledge, DNA sequences bound by AtMYB61 were identified using cyclic amplification and selection of targets (CASTing). The DNA targets identified using this approach corresponded to AC elements, sequences enriched in adenosine and cytosine nucleotides. The preferred target sequence that bound with the greatest affinity to AtMYB61 recombinant protein was ACCTAC, the AC-I element. Mutational analyses based on the AC-I element showed that ACC nucleotides in the AC-I element served as the core recognition motif, critical for AtMYB61 binding. Molecular modelling predicted interactions between AtMYB61 amino acid residues and corresponding nucleotides in the DNA targets. The affinity between AtMYB61 and specific target DNA sequences did not correlate with AtMYB61-driven transcriptional activation with each of the target sequences. CASTing-selected motifs were found in the regulatory regions of genes previously shown to be regulated by AtMYB61. Taken together, these findings are consistent with the hypothesis that AtMYB61 regulates transcription from specific cis-acting AC elements in vivo. The results shed light on the specifics of DNA binding by an important family of plant-specific transcriptional regulators. PMID:23741471

Carbohydrate linked organotin(IV) complexes as human topoisomerase Iα inhibitor and their antiproliferative effects against the human carcinoma cell line.

PubMed

Khan, Rais Ahmad; Yadav, Shipra; Hussain, Zahid; Arjmand, Farukh; Tabassum, Sartaj

2014-02-14

Dimethyltin(IV) complexes with ethanolamine (1) and biologically significant N-glycosides (2 and 3) were designed and synthesized. The structural elucidation of complexes 1-3 was done using elemental and spectroscopic methods; in addition, complex 1 was studied by single crystal X-ray diffraction studies. The in vitro DNA binding profile of complexes 2 and 3 was carried out by employing different biophysical methods to ascertain the feasibility of glycosylated complexes. Further, the cleaving ability of 2 and 3 was investigated by the agarose gel electrophoretic mobility assay with supercoiled pBR322 DNA, and demonstrated significantly good nuclease activity. Furthermore, both the complexes exhibited significant inhibitory effects on the catalytic activity of human Topo I at lower concentration than standard drugs. Computer-aided molecular docking techniques were used to ascertain the mode and mechanism of action towards the molecular target DNA and Topo I. The cytotoxicity of 2 and 3 against human hepatoma cancer cells (Huh7) was evaluated, which revealed significant regression in cancerous cells as compared with the standard drug. The antiproliferative activities of 2 and 3 were tested against human hepatoma cancer cells (Huh7), and results showed significantly good activity. Additionally, to validate the remarkable antiproliferative activity of complexes 2 and 3, specific regulatory gene expression (MMP-2 and TGF-β) was obtained by real time PCR.

Alignment of Gold Nanoparticle-Decorated DNA Origami Nanotubes: Substrate Prepatterning versus Molecular Combing.

PubMed

Teschome, Bezu; Facsko, Stefan; Gothelf, Kurt V; Keller, Adrian

2015-11-24

DNA origami has become an established technique for designing well-defined nanostructures with any desired shape and for the controlled arrangement of functional nanostructures with few nanometer resolution. These unique features make DNA origami nanostructures promising candidates for use as scaffolds in nanoelectronics and nanophotonics device fabrication. Consequently, a number of studies have shown the precise organization of metallic nanoparticles on various DNA origami shapes. In this work, we fabricated large arrays of aligned DNA origami decorated with a high density of gold nanoparticles (AuNPs). To this end, we first demonstrate the high-yield assembly of high-density AuNP arrangements on DNA origami adsorbed to Si surfaces with few unbound background nanoparticles by carefully controlling the concentrations of MgCl2 and AuNPs in the hybridization buffer and the hybridization time. Then, we evaluate two methods, i.e., hybridization to prealigned DNA origami and molecular combing in a receding meniscus, with respect to their potential to yield large arrays of aligned AuNP-decorated DNA origami nanotubes. Because of the comparatively low MgCl2 concentration required for the efficient immobilization of the AuNPs, the prealigned DNA origami become mobile and displaced from their original positions, thereby decreasing the alignment yield. This increased mobility, on the other hand, makes the adsorbed origami susceptible to molecular combing, and a total alignment yield of 86% is obtained in this way.

Extended HSR/CARD domain mediates AIRE binding to DNA

DOE Office of Scientific and Technical Information (OSTI.GOV)

Maslovskaja, Julia, E-mail: julia.maslovskaja@ut.ee; Saare, Mario; Liiv, Ingrid

Autoimmune regulator (AIRE) activates the transcription of many genes in an unusual promiscuous and stochastic manner. The mechanism by which AIRE binds to the chromatin and DNA is not fully understood, and the regulatory elements that AIRE target genes possess are not delineated. In the current study, we demonstrate that AIRE activates the expression of transiently transfected luciferase reporters that lack defined promoter regions, as well as intron and poly(A) signal sequences. Our protein-DNA interaction experiments with mutated AIRE reveal that the intact homogeneously staining region/caspase recruitment domain (HSR/CARD) and amino acids R113 and K114 are key elements involved inmore » AIRE binding to DNA. - Highlights: • Promoter and mRNA processing elements are not important for AIRE to activate gene expression from reporter plasmids. • AIRE protein fragment aa 1–138 mediates direct binding to DNA. • Integrity of the HSR/CARD domain is needed for AIRE binding to DNA.« less

Interplay between DNA methylation, histone modification and chromatin remodeling in stem cells and during development.

PubMed

Ikegami, Kohta; Ohgane, Jun; Tanaka, Satoshi; Yagi, Shintaro; Shiota, Kunio

2009-01-01

Genes constitute only a small proportion of the mammalian genome, the majority of which is composed of non-genic repetitive elements including interspersed repeats and satellites. A unique feature of the mammalian genome is that there are numerous tissue-dependent, differentially methylated regions (T-DMRs) in the non-repetitive sequences, which include genes and their regulatory elements. The epigenetic status of T-DMRs varies from that of repetitive elements and constitutes the DNA methylation profile genome-wide. Since the DNA methylation profile is specific to each cell and tissue type, much like a fingerprint, it can be used as a means of identification. The formation of DNA methylation profiles is the basis for cell differentiation and development in mammals. The epigenetic status of each T-DMR is regulated by the interplay between DNA methyltransferases, histone modification enzymes, histone subtypes, non-histone nuclear proteins and non-coding RNAs. In this review, we will discuss how these epigenetic factors cooperate to establish cell- and tissue-specific DNA methylation profiles.

Origin and evolution of SINEs in eukaryotic genomes.

PubMed

Kramerov, D A; Vassetzky, N S

2011-12-01

Short interspersed elements (SINEs) are one of the two most prolific mobile genomic elements in most of the higher eukaryotes. Although their biology is still not thoroughly understood, unusual life cycle of these simple elements amplified as genomic parasites makes their evolution unique in many ways. In contrast to most genetic elements including other transposons, SINEs emerged de novo many times in evolution from available molecules (for example, tRNA). The involvement of reverse transcription in their amplification cycle, huge number of genomic copies and modular structure allow variation mechanisms in SINEs uncommon or rare in other genetic elements (module exchange between SINE families, dimerization, and so on.). Overall, SINE evolution includes their emergence, progressive optimization and counteraction to the cell's defense against mobile genetic elements.

Stepwise evolution of pandrug-resistance in Klebsiella pneumoniae

PubMed Central

Zowawi, Hosam M.; Forde, Brian M.; Alfaresi, Mubarak; Alzarouni, Abdulqadir; Farahat, Yasser; Chong, Teik-Min; Yin, Wai-Fong; Chan, Kok-Gan; Li, Jian; Schembri, Mark A.; Beatson, Scott A.; Paterson, David L.

2015-01-01

Carbapenem resistant Enterobacteriaceae (CRE) pose an urgent risk to global human health. CRE that are non-susceptible to all commercially available antibiotics threaten to return us to the pre-antibiotic era. Using Single Molecule Real Time (SMRT) sequencing we determined the complete genome of a pandrug-resistant Klebsiella pneumoniae isolate, representing the first complete genome sequence of CRE resistant to all commercially available antibiotics. The precise location of acquired antibiotic resistance elements, including mobile elements carrying genes for the OXA-181 carbapenemase, were defined. Intriguingly, we identified three chromosomal copies of an ISEcp1-blaOXA-181 mobile element, one of which has disrupted the mgrB regulatory gene, accounting for resistance to colistin. Our findings provide the first description of pandrug-resistant CRE at the genomic level, and reveal the critical role of mobile resistance elements in accelerating the emergence of resistance to other last resort antibiotics. PMID:26478520

Chemical studies of H chondrites. I - Mobile trace elements and gas retention ages

NASA Technical Reports Server (NTRS)

Lingner, David W.; Huston, Ted J.; Hutson, Melinda; Lipschutz, Michael E.

1987-01-01

Trends for 16 trace elements (Ag, As, Au, Bi, Cd, Co, Cs, Ga, In, K, Rb, Sb, Se, Te, Tl, and Zn), chosen to span a broad geochemical and thermal response range, in 44 H4-6 chondrites, differ widely from those in L4-6 chondrites. In particular, H chondrites classified as heavily shocked petrologically do not necessarily exhibit Ar-40 loss and vice versa. The clear-cut causal relationship between siderophile and mobile element loss with increasing late shock seen in L chondrites is not generally evident in the H group. H chondrite parent material experienced an early high temperature genetic episode that mobilized a substantial proportion of these trace elements so that later thermal episodes resulted in more subtle, collateral fractionations. Mildly shocked L chondrites escaped this early high temperature event, indicating that the two most numerous meteorite groups differ fundamentally in genetic history.

Whole DNA methylome profiling in mice exposed to secondhand smoke.

PubMed

Tommasi, Stella; Zheng, Albert; Yoon, Jae-In; Li, Arthur Xuejun; Wu, Xiwei; Besaratinia, Ahmad

2012-11-01

Aberration of DNA methylation is a prime epigenetic mechanism of carcinogenesis. Aberrant DNA methylation occurs frequently in lung cancer, with exposure to secondhand smoke (SHS) being an established risk factor. The causal role of SHS in the genesis of lung cancer, however, remains elusive. To investigate whether SHS can cause aberrant DNA methylation in vivo, we have constructed the whole DNA methylome in mice exposed to SHS for a duration of 4 mo, both after the termination of exposure and at ensuing intervals post-exposure (up to 10 mo). Our genome-wide and gene-specific profiling of DNA methylation in the lung of SHS-exposed mice revealed that all groups of SHS-exposed mice and controls share a similar pattern of DNA methylation. Furthermore, the methylation status of major repetitive DNA elements, including long-interspersed nuclear elements (LINE L1), intracisternal A particle long-terminal repeat retrotransposons (IAP-LTR), and short-interspersed nuclear elements (SINE B1), in the lung of all groups of SHS-exposed mice and controls remains comparable. The absence of locus-specific gain of DNA methylation and global loss of DNA methylation in the lung of SHS-exposed mice within a timeframe that precedes neoplastic-lesion formation underscore the challenges of lung cancer biomarker development. Identifying the initiating events that cause aberrant DNA methylation in lung carcinogenesis may help improve future strategies for prevention, early detection and treatment of this highly lethal disease.

FAIRE (Formaldehyde-Assisted Isolation of Regulatory Elements) isolates active regulatory elements from human chromatin

PubMed Central

Giresi, Paul G.; Kim, Jonghwan; McDaniell, Ryan M.; Iyer, Vishwanath R.; Lieb, Jason D.

2007-01-01

DNA segments that actively regulate transcription in vivo are typically characterized by eviction of nucleosomes from chromatin and are experimentally identified by their hypersensitivity to nucleases. Here we demonstrate a simple procedure for the isolation of nucleosome-depleted DNA from human chromatin, termed FAIRE (Formaldehyde-Assisted Isolation of Regulatory Elements). To perform FAIRE, chromatin is crosslinked with formaldehyde in vivo, sheared by sonication, and phenol-chloroform extracted. The DNA recovered in the aqueous phase is fluorescently labeled and hybridized to a DNA microarray. FAIRE performed in human cells strongly enriches DNA coincident with the location of DNaseI hypersensitive sites, transcriptional start sites, and active promoters. Evidence for cell-type–specific patterns of FAIRE enrichment is also presented. FAIRE has utility as a positive selection for genomic regions associated with regulatory activity, including regions traditionally detected by nuclease hypersensitivity assays. PMID:17179217

Natural Hot Spots for Gain of Multiple Resistances: Arsenic and Antibiotic Resistances in Heterotrophic, Aerobic Bacteria from Marine Hydrothermal Vent Fields

PubMed Central

Farias, Pedro; Espírito Santo, Christophe; Branco, Rita; Francisco, Romeu; Santos, Susana; Hansen, Lars; Sorensen, Soren

2015-01-01

Microorganisms are responsible for multiple antibiotic resistances that have been associated with resistance/tolerance to heavy metals, with consequences to public health. Many genes conferring these resistances are located on mobile genetic elements, easily exchanged among phylogenetically distant bacteria. The objective of the present work was to isolate arsenic-, antimonite-, and antibiotic-resistant strains and to determine the existence of plasmids harboring antibiotic/arsenic/antimonite resistance traits in phenotypically resistant strains, in a nonanthropogenically impacted environment. The hydrothermal Lucky Strike field in the Azores archipelago (North Atlantic, between 11°N and 38°N), at the Mid-Atlantic Ridge, protected under the OSPAR Convention, was sampled as a metal-rich pristine environment. A total of 35 strains from 8 different species were isolated in the presence of arsenate, arsenite, and antimonite. ACR3 and arsB genes were amplified from the sediment's total DNA, and 4 isolates also carried ACR3 genes. Phenotypic multiple resistances were found in all strains, and 7 strains had recoverable plasmids. Purified plasmids were sequenced by Illumina and assembled by EDENA V3, and contig annotation was performed using the “Rapid Annotation using the Subsystems Technology” server. Determinants of resistance to copper, zinc, cadmium, cobalt, and chromium as well as to the antibiotics β-lactams and fluoroquinolones were found in the 3 sequenced plasmids. Genes coding for heavy metal resistance and antibiotic resistance in the same mobile element were found, suggesting the possibility of horizontal gene transfer and distribution of theses resistances in the bacterial population. PMID:25636836

Stiff Filamentous Viruses Probe the Mobility of Counterions During Nanopore Translocations

NASA Astrophysics Data System (ADS)

McMullen, Angus; Tang, Jay; Stein, Derek

2015-03-01

We study the electrophoresis of two different filamentous viruses and double-stranded DNA through solid-state nanopores. The two viruses we examine, fd and M13, are both 880 nm in length, 6.6 nm in diameter, very stiff, and monodisperse. They only differ in their linear charge density, which is 30 % lower for M13 than for fd. Filamentous viruses are therefore ideal for testing transport models and for comparisons with DNA dynamics. We find that the mean translocation speed of fd virus is related to the nanopore diameter, D, and the virus diameter, d, as ln(D / d) - 1 , in agreement with the conventional electrokinetic model of translocations. In order to obtain quantitative agreement between that electrokinetic model and the measured translocation dynamics, however, one must conclude that the mobility of counterions within a few Angstroms of the polymer surface is strongly reduced from the bulk value. Similar reductions in counterion mobility near fd, M13, and dsDNA explain their dynamics over a wide range of ionic strengths. This work was supported by NSF Grant CBET0846505, NSF Grant PHYS1058375 and Oxford Nanopore Technologies.

Sequence-specific DNA binding by MYC/MAX to low-affinity non-E-box motifs.

PubMed

Allevato, Michael; Bolotin, Eugene; Grossman, Mark; Mane-Padros, Daniel; Sladek, Frances M; Martinez, Ernest

2017-01-01

The MYC oncoprotein regulates transcription of a large fraction of the genome as an obligatory heterodimer with the transcription factor MAX. The MYC:MAX heterodimer and MAX:MAX homodimer (hereafter MYC/MAX) bind Enhancer box (E-box) DNA elements (CANNTG) and have the greatest affinity for the canonical MYC E-box (CME) CACGTG. However, MYC:MAX also recognizes E-box variants and was reported to bind DNA in a "non-specific" fashion in vitro and in vivo. Here, in order to identify potential additional non-canonical binding sites for MYC/MAX, we employed high throughput in vitro protein-binding microarrays, along with electrophoretic mobility-shift assays and bioinformatic analyses of MYC-bound genomic loci in vivo. We identified all hexameric motifs preferentially bound by MYC/MAX in vitro, which include the low-affinity non-E-box sequence AACGTT, and found that the vast majority (87%) of MYC-bound genomic sites in a human B cell line contain at least one of the top 21 motifs bound by MYC:MAX in vitro. We further show that high MYC/MAX concentrations are needed for specific binding to the low-affinity sequence AACGTT in vitro and that elevated MYC levels in vivo more markedly increase the occupancy of AACGTT sites relative to CME sites, especially at distal intergenic and intragenic loci. Hence, MYC binds diverse DNA motifs with a broad range of affinities in a sequence-specific and dose-dependent manner, suggesting that MYC overexpression has more selective effects on the tumor transcriptome than previously thought.

An Attenuated CRISPR-Cas System in Enterococcus faecalis Permits DNA Acquisition

PubMed Central

Hullahalli, Karthik; Rodrigues, Marinelle; Nguyen, Uyen Thy

2018-01-01

ABSTRACT Antibiotic-resistant bacteria are critical public health concerns. Among the prime causative factors for the spread of antibiotic resistance is horizontal gene transfer (HGT). A useful model organism for investigating the relationship between HGT and antibiotic resistance is the opportunistic pathogen Enterococcus faecalis, since the species possesses highly conjugative plasmids that readily disseminate antibiotic resistance genes and virulence factors in nature. Unlike many commensal E. faecalis strains, the genomes of multidrug-resistant (MDR) E. faecalis clinical isolates are enriched for mobile genetic elements (MGEs) and lack clustered regularly interspaced short palindromic repeats (CRISPR) and CRISPR-associated protein (Cas) genome defense systems. CRISPR-Cas systems cleave foreign DNA in a programmable, sequence-specific manner and are disadvantageous for MGE-derived genome expansion. An unexplored facet of CRISPR biology in E. faecalis is that MGEs that are targeted by native CRISPR-Cas systems can be maintained transiently. Here, we investigate the basis for this “CRISPR tolerance.” We observe that E. faecalis can maintain self-targeting constructs that direct Cas9 to cleave the chromosome, but at a fitness cost. Interestingly, DNA repair genes were not upregulated during self-targeting, but integrated prophages were strongly induced. We determined that low cas9 expression contributes to this transient nonlethality and used this knowledge to develop a robust CRISPR-assisted genome-editing scheme. Our results suggest that E. faecalis has maximized the potential for DNA acquisition by attenuating its CRISPR machinery, thereby facilitating the acquisition of potentially beneficial MGEs that may otherwise be restricted by genome defense. PMID:29717009

Ion mobility based on column leaching of South African gold tailings dam with chemometric evaluation.

PubMed

Cukrowska, Ewa M; Govender, Koovila; Viljoen, Morris

2004-07-01

New column leaching experiments were designed and used as an alternative rapid screening approach to element mobility assessment. In these experiments, field-moist material was treated with an extracting solution to assess the effects of acidification on element mobility in mine tailings. The main advantage of this version of column leaching experiments with partitioned segments is that they give quick information on current element mobility in conditions closely simulating field conditions to compare with common unrepresentative air-dried, sieved samples used for column leaching experiments. Layers from the tailings dump material were sampled and packed into columns. The design of columns allows extracting leachates from each layer. The extracting solutions used were natural (pH 6.8) and acidified (pH 4.2) rainwater. Metals and anions were determined in the leachates. The concentrations of metals (Ca, Mg, Fe, Mn, Al, Cr, Ni, Co, Zn, and Cu) in sample leachates were determined using ICP OES. The most important anions (NO3-, Cl-, and SO4(2)-) were determined using the closed system izotacophoresis ITP analyser. The chemical analytical data from tailings leaching and physico-chemical data from field measurements (including pH, conductivity, redox potential, temperature) were used for chemometric evaluation of element mobility. Principal factor analysis (PFA) was used to evaluate ions mobility from different layers of tailings dump arising from varied pH and redox conditions. It was found that the results from the partitioned column leaching illustrate much better complex processes of metals mobility from tailings dump than the total column. The chemometric data analysis (PFA) proofed the differences in the various layers leachability that are arising from physico-chemical processes due to chemical composition of tailings dump deposit. Copyright 2004 Elsevier Ltd.

Copia and Gypsy retrotransposons activity in sunflower (Helianthus annuus L.)

PubMed Central

2009-01-01

Background Retrotransposons are heterogeneous sequences, widespread in eukaryotic genomes, which refer to the so-called mobile DNA. They resemble retroviruses, both in their structure and for their ability to transpose within the host genome, of which they make up a considerable portion. Copia- and Gypsy-like retrotransposons are the two main classes of retroelements shown to be ubiquitous in plant genomes. Ideally, the retrotransposons life cycle results in the synthesis of a messenger RNA and then self-encoded proteins to process retrotransposon mRNA in double stranded extra-chromosomal cDNA copies which may integrate in new chromosomal locations. Results The RT-PCR and IRAP protocol were applied to detect the presence of Copia and Gypsy retrotransposon transcripts and of new events of integration in unstressed plants of a sunflower (Helianthus annuus L.) selfed line. Results show that in sunflower retrotransposons transcription occurs in all analyzed organs (embryos, leaves, roots, and flowers). In one out of sixty-four individuals analyzed, retrotransposons transcription resulted in the integration of a new element into the genome. Conclusion These results indicate that the retrotransposon life cycle is firmly controlled at a post transcriptional level. A possible silencing mechanism is discussed. PMID:20030800

Leptin rapidly activates PPARs in C2C12 muscle cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bendinelli, Paola; Piccoletti, Roberta; Maroni, Paola

2005-07-08

Experimental evidence suggests that leptin operates on the tissues, including skeletal muscle, also by modulating gene expression. Using electrophoretic mobility shift assays, we have shown that physiological doses of leptin promptly increase the binding of C2C12 cell nuclear extracts to peroxisome proliferator-activated receptor (PPAR) response elements in oligonucleotide probes and that all three PPAR isoforms participate in DNA-binding complexes. We pre-treated C2C12 cells with AACOCF{sub 3}, a specific inhibitor of cytosolic phospholipase A{sub 2} (cPLA{sub 2}), an enzyme that supplies ligands to PPARs, and found that it abrogates leptin-induced PPAR DNA-binding activity. Leptin treatment significantly increased cPLA{sub 2} activity, evaluatedmore » as the release of [{sup 3}H]arachidonic acid from pre-labelled C2C12 cells, as well as phosphorylation. Further, using MEK1 inhibitor PD-98059 we showed that leptin activates cPLA{sub 2} through ERK induction. These results support a direct effect of leptin on skeletal muscle cells, and suggest that the hormone may modulate muscle transcription also by precocious activation of PPARs through ERK-cPLA{sub 2} pathway.« less

Genomic study of the Type IVC secretion system in Clostridium difficile: understanding C. difficile evolution via horizontal gene transfer.

PubMed

Zhang, Wen; Cheng, Ying; Du, Pengcheng; Zhang, Yuanyuan; Jia, Hongbing; Li, Xianping; Wang, Jing; Han, Na; Qiang, Yujun; Chen, Chen; Lu, Jinxing

2017-01-01

Clostridium difficile, the etiological agent of Clostridium difficile infection (CDI), is a gram-positive, spore-forming bacillus that is responsible for ∼20% of antibiotic-related cases of diarrhea and nearly all cases of pseudomembranous colitis. Previous data have shown that a substantial proportion (11%) of the C. difficile genome consists of mobile genetic elements, including seven conjugative transposons. However, the mechanism underlying the formation of a mosaic genome in C. difficile is unknown. The type-IV secretion system (T4SS) is the only secretion system known to transfer DNA segments among bacteria. We searched genome databases to identify a candidate T4SS in C. difficile that could transfer DNA among different C. difficile strains. All T4SS gene clusters in C. difficile are located within genomic islands (GIs), which have variable lengths and structures and are all conjugative transposons. During the horizontal-transfer process of T4SS GIs within the C. difficile population, the excision sites were altered, resulting in different short-tandem repeat sequences among the T4SS GIs, as well as different chromosomal insertion sites and additional regions in the GIs.

Isolation of active regulatory elements from eukaryotic chromatin using FAIRE (Formaldehyde Assisted Isolation of Regulatory Elements)

PubMed Central

Giresi, Paul G.; Lieb, Jason D.

2009-01-01

The binding of sequence-specific regulatory factors and the recruitment of chromatin remodeling activities cause nucleosomes to be evicted from chromatin in eukaryotic cells. Traditionally, these active sites have been identified experimentally through their sensitivity to nucleases. Here we describe the details of a simple procedure for the genome-wide isolation of nucleosome-depleted DNA from human chromatin, termed FAIRE (Formaldehyde Assisted Isolation of Regulatory Elements). We also provide protocols for different methods of detecting FAIRE-enriched DNA, including use of PCR, DNA microarrays, and next-generation sequencing. FAIRE works on all eukaryotic chromatin tested to date. To perform FAIRE, chromatin is crosslinked with formaldehyde, sheared by sonication, and phenol-chloroform extracted. Most genomic DNA is crosslinked to nucleosomes and is sequestered to the interphase, whereas DNA recovered in the aqueous phase corresponds to nucleosome-depleted regions of the genome. The isolated regions are largely coincident with the location of DNaseI hypersensitive sites, transcriptional start sites, enhancers, insulators, and active promoters. Given its speed and simplicity, FAIRE has utility in establishing chromatin profiles of diverse cell types in health and disease, isolating DNA regulatory elements en masse for further characterization, and as a screening assay for the effects of small molecules on chromatin organization. PMID:19303047

Exposure to 1800 MHz radiofrequency electromagnetic radiation induces oxidative DNA base damage in a mouse spermatocyte-derived cell line.

PubMed

Liu, Chuan; Duan, Weixia; Xu, Shangcheng; Chen, Chunhai; He, Mindi; Zhang, Lei; Yu, Zhengping; Zhou, Zhou

2013-03-27

Whether exposure to radiofrequency electromagnetic radiation (RF-EMR) emitted from mobile phones can induce DNA damage in male germ cells remains unclear. In this study, we conducted a 24h intermittent exposure (5 min on and 10 min off) of a mouse spermatocyte-derived GC-2 cell line to 1800 MHz Global System for Mobile Communication (GSM) signals in GSM-Talk mode at specific absorption rates (SAR) of 1 W/kg, 2 W/kg or 4 W/kg. Subsequently, through the use of formamidopyrimidine DNA glycosylase (FPG) in a modified comet assay, we determined that the extent of DNA migration was significantly increased at a SAR of 4 W/kg. Flow cytometry analysis demonstrated that levels of the DNA adduct 8-oxoguanine (8-oxoG) were also increased at a SAR of 4 W/kg. These increases were concomitant with similar increases in the generation of reactive oxygen species (ROS); these phenomena were mitigated by co-treatment with the antioxidant α-tocopherol. However, no detectable DNA strand breakage was observed by the alkaline comet assay. Taking together, these findings may imply the novel possibility that RF-EMR with insufficient energy for the direct induction of DNA strand breaks may produce genotoxicity through oxidative DNA base damage in male germ cells. Crown Copyright © 2013. Published by Elsevier Ireland Ltd. All rights reserved.

Quantitative Experimental Determination of Primer-Dimer Formation Risk by Free-Solution Conjugate Electrophoresis

PubMed Central

Desmarais, Samantha M.; Leitner, Thomas; Barron, Annelise E.

2012-01-01

DNA barcodes are short, unique ssDNA primers that “mark” individual biomolecules. To gain better understanding of biophysical parameters constraining primer-dimer formation between primers that incorporate barcode sequences, we have developed a capillary electrophoresis method that utilizes drag-tag-DNA conjugates to quantify dimerization risk between primer-barcode pairs. Results obtained with this unique free-solution conjugate electrophoresis (FSCE) approach are useful as quantitatively precise input data to parameterize computation models of dimerization risk. A set of fluorescently labeled, model primer-barcode conjugates were designed with complementary regions of differing lengths to quantify heterodimerization as a function of temperature. Primer-dimer cases comprised two 30-mer primers, one of which was covalently conjugated to a lab-made, chemically synthesized poly-N-methoxyethylglycine drag-tag, which reduced electrophoretic mobility of ssDNA to distinguish it from ds primer-dimers. The drag-tags also provided a shift in mobility for the dsDNA species, which allowed us to quantitate primer-dimer formation. In the experimental studies, pairs of oligonucleotide primer-barcodes with fully or partially complementary sequences were annealed, and then separated by free-solution conjugate CE at different temperatures, to assess effects on primer-dimer formation. When less than 30 out of 30 basepairs were bonded, dimerization was inversely correlated to temperature. Dimerization occurred when more than 15 consecutive basepairs formed, yet non-consecutive basepairs did not create stable dimers even when 20 out of 30 possible basepairs bonded. The use of free-solution electrophoresis in combination with a peptoid drag-tag and different fluorophores enabled precise separation of short DNA fragments to establish a new mobility shift assay for detection of primer-dimer formation. PMID:22331820

Primary analysis of repeat elements of the Asian seabass (Lates calcarifer) transcriptome and genome

PubMed Central

Kuznetsova, Inna S.; Thevasagayam, Natascha M.; Sridatta, Prakki S. R.; Komissarov, Aleksey S.; Saju, Jolly M.; Ngoh, Si Y.; Jiang, Junhui; Shen, Xueyan; Orbán, László

2014-01-01

As part of our Asian seabass genome project, we are generating an inventory of repeat elements in the genome and transcriptome. The karyotype showed a diploid number of 2n = 24 chromosomes with a variable number of B-chromosomes. The transcriptome and genome of Asian seabass were searched for repetitive elements with experimental and bioinformatics tools. Six different types of repeats constituting 8–14% of the genome were characterized. Repetitive elements were clustered in the pericentromeric heterochromatin of all chromosomes, but some of them were preferentially accumulated in pretelomeric and pericentromeric regions of several chromosomes pairs and have chromosomes specific arrangement. From the dispersed class of fish-specific non-LTR retrotransposon elements Rex1 and MAUI-like repeats were analyzed. They were wide-spread both in the genome and transcriptome, accumulated on the pericentromeric and peritelomeric areas of all chromosomes. Every analyzed repeat was represented in the Asian seabass transcriptome, some showed differential expression between the gonads. The other group of repeats analyzed belongs to the rRNA multigene family. FISH signal for 5S rDNA was located on a single pair of chromosomes, whereas that for 18S rDNA was found on two pairs. A BAC-derived contig containing rDNA was sequenced and assembled into a scaffold containing incomplete fragments of 18S rDNA. Their assembly and chromosomal position revealed that this part of Asian seabass genome is extremely rich in repeats containing evolutionarily conserved and novel sequences. In summary, transcriptome assemblies and cDNA data are suitable for the identification of repetitive DNA from unknown genomes and for comparative investigation of conserved elements between teleosts and other vertebrates. PMID:25120555

Evolved Populations of Shigella flexneri Phage Sf6 Acquire Large Deletions, Altered Genomic Architecture, and Faster Life Cycles.

PubMed

Dover, John A; Burmeister, Alita R; Molineux, Ian J; Parent, Kristin N

2016-09-19

Genomic architecture is the framework within which genes and regulatory elements evolve and where specific constructs may constrain or potentiate particular adaptations. One such construct is evident in phages that use a headful packaging strategy that results in progeny phage heads packaged with DNA until full rather than encapsidating a simple unit-length genome. Here, we investigate the evolution of the headful packaging phage Sf6 in response to barriers that impede efficient phage adsorption to the host cell. Ten replicate populations evolved faster Sf6 life cycles by parallel mutations found in a phage lysis gene and/or by large, 1.2- to 4.0-kb deletions that remove a mobile genetic IS911 element present in the ancestral phage genome. The fastest life cycles were found in phages that acquired both mutations. No mutations were found in genes encoding phage structural proteins, which were a priori expected from the experimental design that imposed a challenge for phage adsorption by using a Shigella flexneri host lacking receptors preferred by Sf6. We used DNA sequencing, molecular approaches, and physiological experiments on 82 clonal isolates taken from all 10 populations to reveal the genetic basis of the faster Sf6 life cycle. The majority of our isolates acquired deletions in the phage genome. Our results suggest that deletions are adaptive and can influence the duration of the phage life cycle while acting in conjunction with other lysis time-determining point mutations. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

Comparative genotyping of Clostridium thermocellum strains isolated from biogas plants: genetic markers and characterization of cellulolytic potential.

PubMed

Koeck, Daniela E; Zverlov, Vladimir V; Liebl, Wolfgang; Schwarz, Wolfgang H

2014-07-01

Clostridium thermocellum is among the most prevalent of known anaerobic cellulolytic bacteria. In this study, genetic and phenotypic variations among C. thermocellum strains isolated from different biogas plants were determined and different genotyping methods were evaluated on these isolates. At least two C. thermocellum strains were isolated independently from each of nine different biogas plants via enrichment on cellulose. Various DNA-based genotyping methods such as ribotyping, RAPD (Random Amplified Polymorphic DNA) and VNTR (Variable Number of Tandem Repeats) were applied to these isolates. One novel approach - the amplification of unknown target sequences between copies of a previously discovered Random Inserted Mobile Element (RIME) - was also tested. The genotyping method with the highest discriminatory power was found to be the amplification of the sequences between the insertion elements, where isolates from each biogas plant yielded a different band pattern. Cellulolytic potentials, optimal growth conditions and substrate spectra of all isolates were characterized to help identify phenotypic variations. Irrespective of the genotyping method used, the isolates from each individual biogas plant always exhibited identical patterns. This is suggestive of a single C. thermocellum strain exhibiting dominance in each biogas plant. The genotypic groups reflect the results of the physiological characterization of the isolates like substrate diversity and cellulase activity. Conversely, strains isolated across a range of biogas plants differed in their genotyping results and physiological properties. Both strains isolated from one biogas plant had the best specific cellulose-degrading properties and might therefore achieve superior substrate utilization yields in biogas fermenters. Copyright © 2014 Elsevier GmbH. All rights reserved.

A genomic library-based amplification approach (GL-PCR) for the mapping of multiple IS6110 insertion sites and strain differentiation of Mycobacterium tuberculosis.

PubMed

Namouchi, Amine; Mardassi, Helmi

2006-11-01

Evidence suggests that insertion of the IS6110 element is not without consequence to the biology of Mycobacterium tuberculosis complex strains. Thus, mapping of multiple IS6110 insertion sites in the genome of biomedically relevant clinical isolates would result in a better understanding of the role of this mobile element, particularly with regard to transmission, adaptability and virulence. In the present paper, we describe a versatile strategy, referred to as GL-PCR, that amplifies IS6110-flanking sequences based on the construction of a genomic library. M. tuberculosis chromosomal DNA is fully digested with HincII and then ligated into a plasmid vector between T7 and T3 promoter sequences. The ligation reaction product is transformed into Escherichia coli and selective PCR amplification targeting both 5' and 3' IS6110-flanking sequences are performed on the plasmid library DNA. For this purpose, four separate PCR reactions are performed, each combining an outward primer specific for one IS6110 end with either T7 or T3 primer. Determination of the nucleotide sequence of the PCR products generated from a single ligation reaction allowed mapping of 21 out of the 24 IS6110 copies of two 12 banded M. tuberculosis strains, yielding an overall sensitivity of 87,5%. Furthermore, by simply comparing the migration pattern of GL-PCR-generated products, the strategy proved to be as valuable as IS6110 RFLP for molecular typing of M. tuberculosis complex strains. Importantly, GL-PCR was able to discriminate between strains differing by a single IS6110 band.

Mariner and the ITm Superfamily of Transposons.

PubMed

Tellier, Michael; Bouuaert, Corentin Claeys; Chalmers, Ronald

2015-04-01

The IS630-Tc1-mariner (ITm) family of transposons is one of the most widespread in nature. The phylogenetic distribution of its members shows that they do not persist for long in a given lineage, but rely on frequent horizontal transfer to new hosts. Although they are primarily selfish genomic-parasites, ITm transposons contribute to the evolution of their hosts because they generate variation and contribute protein domains and regulatory regions. Here we review the molecular mechanism of ITm transposition and its regulation. We focus mostly on the mariner elements, which are understood in the greatest detail owing to in vitro reconstitution and structural analysis. Nevertheless, the most important characteristics are probably shared across the grouping. Members of the ITm family are mobilized by a cut-and-paste mechanism and integrate at 5'-TA dinucleotide target sites. The elements encode a single transposase protein with an N-terminal DNA-binding domain and a C-terminal catalytic domain. The phosphoryl-transferase reactions during the DNA-strand breaking and joining reactions are performed by the two metal-ion mechanism. The metal ions are coordinated by three or four acidic amino acid residues located within an RNase H-like structural fold. Although all of the strand breaking and joining events at a given transposon end are performed by a single molecule of transposase, the reaction is coordinated by close communication between transpososome components. During transpososome assembly, transposase dimers compete for free transposon ends. This helps to protect the host by dampening an otherwise exponential increase in the rate of transposition as the copy number increases.

Structure of genes and an insertion element in the methane producing archaebacterium Methanobrevibacter smithii.

PubMed

Hamilton, P T; Reeve, J N

1985-01-01

DNA fragments cloned from the methanogenic archaebacterium Methanobrevibacter smithii which complement mutations in the purE and proC genes of E. coli have been sequenced. Sequence analyses, transposon mutagenesis and expression in E. coli minicells indicate that purE and proC complementations result from the synthesis of M. smithii polypeptides with molecular weights of 36,697 and 27,836 respectively. The encoding genes appear to be located in operons. The M. smithii genome contains 69% A/T basepairs (bp) which is reflected in unusual codon usages and intergenic regions containing approximately 85% A/T bp. An insertion element, designated ISM1, was found within the cloned M. smithii DNA located adjacent to the proC complementing region. ISM1 is 1381 bp in length, has 29 bp terminal inverted repeat sequences and contains one major ORF encoded in 87% of the ISM1 sequence. ISM1 is mobile, present in approximately 10 copies per genome and integration duplicates 8 bp at the site of insertion. The duplicated sequences show homology with sequences within the 29 bp terminal repeat sequence of ISM1. Comparison of our data with sequences from halophilic archaebacteria suggests that 5'GAANTTTCA and 5'TTTTAATATAAA may be consensus promoter sequences for archaebacteria. These sequences closely resemble the consensus sequences which precede Drosophila heat-shock genes (Pelham 1982; Davidson et al. 1983). Methanogens appear to employ the eubacterial system of mRNA: 16SrRNA hybridization to ensure initiation of translation; the consensus ribosome binding sequence is 5'AGGTGA.

Fractionation of trace elements and human health risk of submicron particulate matter (PM1) collected in the surroundings of coking plants.

PubMed

Zajusz-Zubek, Elwira; Radko, Tomasz; Mainka, Anna

2017-08-01

Samples of PM1 were collected in the surroundings of coking plants located in southern Poland. Chemical fractionation provided information on the contents of trace elements As, Cd, Co, Cr, Hg, Mn, Ni, Pb, Sb and Se in all mobile (F1-F3) and not mobile (F4) fractions of PM1 in the vicinity of large sources of emissions related to energochemical processing of coal during the summer. The determined enrichment factors indicate the influence of anthropogenic sources on the concentration of the examined elements contained in PM1 in the areas subjected to investigation. The analysis of health risk for the assumed scenario of inhabitant exposure to the toxic effect of elements, based on the values of the hazard index, revealed that the absorption of the examined elements contained in the most mobile fractions of particulate matter via inhalation by children and adults can be considered potentially harmless to the health of people inhabiting the surroundings of coking plants during the summer (HI < 1). It has been estimated that due to the inhalation exposure to carcinogenic elements, i.e., As, Cd, Co, Cr, Ni and Pb, contained in the most mobile fractions (F1 + F2) of PM1, approximately four adults and one child out of one million people living in the vicinity of the coking plants may develop cancer.

Propagation Modeling and Defending of a Mobile Sensor Worm in Wireless Sensor and Actuator Networks.

PubMed

Wang, Tian; Wu, Qun; Wen, Sheng; Cai, Yiqiao; Tian, Hui; Chen, Yonghong; Wang, Baowei

2017-01-13

WSANs (Wireless Sensor and Actuator Networks) are derived from traditional wireless sensor networks by introducing mobile actuator elements. Previous studies indicated that mobile actuators can improve network performance in terms of data collection, energy supplementation, etc. However, according to our experimental simulations, the actuator's mobility also causes the sensor worm to spread faster if an attacker launches worm attacks on an actuator and compromises it successfully. Traditional worm propagation models and defense strategies did not consider the diffusion with a mobile worm carrier. To address this new problem, we first propose a microscopic mathematical model to describe the propagation dynamics of the sensor worm. Then, a two-step local defending strategy (LDS) with a mobile patcher (a mobile element which can distribute patches) is designed to recover the network. In LDS, all recovering operations are only taken in a restricted region to minimize the cost. Extensive experimental results demonstrate that our model estimations are rather accurate and consistent with the actual spreading scenario of the mobile sensor worm. Moreover, on average, the LDS outperforms other algorithms by approximately 50% in terms of the cost.

A plasmid containing the human metallothionein II gene can function as an antibody-assisted electrophoretic biosensor for heavy metals.

PubMed

Wooten, Dennis C; Starr, Clarise R; Lyon, Wanda J

2016-01-01

Different forms of heavy metals affect biochemical systems in characteristic ways that cannot be detected with typical metal analysis methods like atomic absorption spectrometry. Further, using living systems to analyze interaction of heavy metals with biochemical systems can be laborious and unreliable. To generate a reliable easy-to-use biologically-based biosensor system, the entire human metallothionein-II (MT-II) gene was incorporated into a plasmid (pUC57-MT) easily replicated in Escherichia coli. In this system, a commercial polyclonal antibody raised against human metal-responsive transcription factor-1 protein (MTF-1 protein) could modify the electrophoretic migration patterns (i.e. cause specific decreases in agarose gel electrophoretic mobility) of the plasmid in the presence or absence of heavy metals other than zinc (Zn). In the study here, heavy metals, MTF-1 protein, and polyclonal anti-MTF-1 antibody were used to assess pUC57-MT plasmid antibody-assisted electrophoretic mobility. Anti-MTF-1 antibody bound both MTF-1 protein and pUC57-MT plasmid in a non-competitive fashion such that it could be used to differentiate specific heavy metal binding. The results showed that antibody-inhibited plasmid migration was heavy metal level-dependent. Zinc caused a unique mobility shift pattern opposite to that of other metals tested, i.e. Zn blocked the antibody ability to inhibit plasmid migration, despite a greatly increased affinity for DNA by the antibody when Zn was present. The Zn effect was reversed/modified by adding MTF-1 protein. Additionally, antibody inhibition of plasmid mobility was resistant to heat pre-treatment and trypsinization, indicating absence of residual DNA extraction-resistant bacterial DNA binding proteins. DNA binding by anti-DNA antibodies may be commonly enhanced by xenobiotic heavy metals and elevated levels of Zn, thus making them potentially effective tools for assessment of heavy metal bioavailability in aqueous solutions and fluid obtained from metal implant sites.

Uncoupling of sgRNAs from their associated barcodes during PCR amplification of combinatorial CRISPR screens

PubMed Central

2018-01-01

Many implementations of pooled screens in mammalian cells rely on linking an element of interest to a barcode, with the latter subsequently quantitated by next generation sequencing. However, substantial uncoupling between these paired elements during lentiviral production has been reported, especially as the distance between elements increases. We detail that PCR amplification is another major source of uncoupling, and becomes more pronounced with increased amounts of DNA template molecules and PCR cycles. To lessen uncoupling in systems that use paired elements for detection, we recommend minimizing the distance between elements, using low and equal template DNA inputs for plasmid and genomic DNA during PCR, and minimizing the number of PCR cycles. We also present a vector design for conducting combinatorial CRISPR screens that enables accurate barcode-based detection with a single short sequencing read and minimal uncoupling. PMID:29799876

Staphylococci on ICE: Overlooked agents of horizontal gene transfer.

PubMed

Sansevere, Emily A; Robinson, D Ashley

2017-01-01

Horizontal gene transfer plays a significant role in spreading antimicrobial resistance and virulence genes throughout the genus Staphylococcus , which includes species of clinical relevance to humans and animals. While phages and plasmids are the most well-studied agents of horizontal gene transfer in staphylococci, the contribution of integrative conjugative elements (ICEs) has been mostly overlooked. Experimental work demonstrating the activity of ICEs in staphylococci remained frozen for years after initial work in the 1980s that showed Tn 916 was capable of transfer from Enterococcus to Staphylococcus . However, recent work has begun to thaw this field. To date, 2 families of ICEs have been identified among staphylococci - Tn 916 that includes the Tn 5801 subfamily, and ICE 6013 that includes at least 7 subfamilies. Both Tn 5801 and ICE 6013 commonly occur in clinical strains of S. aureus . Tn 5801 is the most studied of the Tn 916 family elements in staphylococci and encodes tetracycline resistance and a protein that, when expressed in Escherichia coli , inhibits restriction barriers to incoming DNA. ICE 6013 is among the shortest known ICEs, but it still includes many uncharacterized open reading frames. This element uses an IS 30 -like transposase as its recombinase, providing some versatility in integration sites. ICE 6013 also conjugatively transfers among receptive S. aureus strains at relatively higher frequency than Tn 5801 . Continued study of these mobile genetic elements may reveal the full extent to which ICEs impact horizontal gene transfer and the evolution of staphylococci.

DPTEdb, an integrative database of transposable elements in dioecious plants.

PubMed

Li, Shu-Fen; Zhang, Guo-Jun; Zhang, Xue-Jin; Yuan, Jin-Hong; Deng, Chuan-Liang; Gu, Lian-Feng; Gao, Wu-Jun

2016-01-01

Dioecious plants usually harbor 'young' sex chromosomes, providing an opportunity to study the early stages of sex chromosome evolution. Transposable elements (TEs) are mobile DNA elements frequently found in plants and are suggested to play important roles in plant sex chromosome evolution. The genomes of several dioecious plants have been sequenced, offering an opportunity to annotate and mine the TE data. However, comprehensive and unified annotation of TEs in these dioecious plants is still lacking. In this study, we constructed a dioecious plant transposable element database (DPTEdb). DPTEdb is a specific, comprehensive and unified relational database and web interface. We used a combination of de novo, structure-based and homology-based approaches to identify TEs from the genome assemblies of previously published data, as well as our own. The database currently integrates eight dioecious plant species and a total of 31 340 TEs along with classification information. DPTEdb provides user-friendly web interfaces to browse, search and download the TE sequences in the database. Users can also use tools, including BLAST, GetORF, HMMER, Cut sequence and JBrowse, to analyze TE data. Given the role of TEs in plant sex chromosome evolution, the database will contribute to the investigation of TEs in structural, functional and evolutionary dynamics of the genome of dioecious plants. In addition, the database will supplement the research of sex diversification and sex chromosome evolution of dioecious plants.Database URL: http://genedenovoweb.ticp.net:81/DPTEdb/index.php. © The Author(s) 2016. Published by Oxford University Press.

Origin and evolution of SINEs in eukaryotic genomes

PubMed Central

Kramerov, D A; Vassetzky, N S

2011-01-01

Short interspersed elements (SINEs) are one of the two most prolific mobile genomic elements in most of the higher eukaryotes. Although their biology is still not thoroughly understood, unusual life cycle of these simple elements amplified as genomic parasites makes their evolution unique in many ways. In contrast to most genetic elements including other transposons, SINEs emerged de novo many times in evolution from available molecules (for example, tRNA). The involvement of reverse transcription in their amplification cycle, huge number of genomic copies and modular structure allow variation mechanisms in SINEs uncommon or rare in other genetic elements (module exchange between SINE families, dimerization, and so on.). Overall, SINE evolution includes their emergence, progressive optimization and counteraction to the cell's defense against mobile genetic elements. PMID:21673742

History in Your Hand: Design Elements to Enhance Adoption of a Mobile Multimedia Historical Tour

ERIC Educational Resources Information Center

Mallchok, Malia M.

2017-01-01

The purpose of this qualitative design case study was to determine the design elements that can lead to technology acceptance of a mobile multimedia tour at an informal historical site. Using rapid prototyping, a tour prototype was developed using a low-cost Website building platform. The tour was then tested with thirteen participants in two…

Trace Elements Speciation of Submicron Particulate Matter (PM1) Collected in the Surroundings of Power Plants.

PubMed

Zajusz-Zubek, Elwira; Kaczmarek, Konrad; Mainka, Anna

2015-10-16

This study reports the concentrations of PM1 trace elements (As, Cd, Co, Cr, Hg, Mn, Ni, Pb, Sb and Se) content in highly mobile (F1), mobile (F2), less mobile (F3) and not mobile (F4) fractions in samples that were collected in the surroundings of power plants in southern Poland. It also reports source identification by enrichment factors (EF) and a principal component analysis (PCA). There is limited availability of scientific data concerning the chemical composition of dust, including fractionation analyses of trace elements, in the surroundings of power plants. The present study offers important results in order to fill this data gap. The data collected in this study can be utilized to validate air quality models in this rapidly developing area. They are also crucial for comparisons with datasets from similar areas all over the world. Moreover, the identification of the bioavailability of selected carcinogenic and toxic elements in the future might be used as output data for potential biological and population research on risk assessment. This is important in the context of air pollution being hazardous to human health.

Dissemination of Novel Antimicrobial Resistance Mechanisms through the Insertion Sequence Mediated Spread of Metabolic Genes

PubMed Central

Furi, Leonardo; Haigh, Richard; Al Jabri, Zaaima J. H.; Morrissey, Ian; Ou, Hong-Yu; León-Sampedro, Ricardo; Martinez, Jose L.; Coque, Teresa M.; Oggioni, Marco R.

2016-01-01

The widely used biocide triclosan selectively targets FabI, the NADH-dependent trans-2-enoyl-acyl carrier protein (ACP) reductase, which is also an important target for the development of narrow spectrum antibiotics. The analysis of triclosan resistant Staphylococcus aureus isolates had previously shown that in about half of the strains, the mechanism of triclosan resistance consists on the heterologous duplication of the triclosan target gene due to the acquisition of an additional fabI allele derived from Staphylococcus haemolyticus (sh-fabI). In the current work, the genomic sequencing of 10 of these strains allowed the characterization of two novel composite transposons TnSha1 and TnSha2 involved in the spread of sh-fabI. TnSha1 harbors one copy of IS1272, whereas TnSha2 is a 11.7 kb plasmid carrying TnSha1 present either as plasmid or in an integrated form generally flanked by two IS1272 elements. The target and mechanism of integration for IS1272 and TnSha1 are novel and include targeting of DNA secondary structures, generation of blunt-end deletions of the stem-loop and absence of target duplication. Database analyses showed widespread occurrence of these two elements in chromosomes and plasmids, with TnSha1 mainly in S. aureus and with TnSha2 mainly in S. haemolyticus and S. epidermidis. The acquisition of resistance by means of an insertion sequence-based mobilization and consequent duplication of drug-target metabolic genes, as observed here for sh-fabI, is highly reminiscent of the situation with the ileS2 gene conferring mupirocin resistance, and the dfrA and dfrG genes conferring trimethoprim resistance both of which are mobilized by IS257. These three examples, which show similar mechanisms and levels of spread of metabolic genes linked to IS elements, highlight the importance of this genetic strategy for recruitment and rapid distribution of novel resistance mechanisms in staphylococci. PMID:27446047

PCNA appears in two populations of slow and fast diffusion with a constant ratio throughout S-phase in replicating mammalian cells.

PubMed

Zessin, Patrick J M; Sporbert, Anje; Heilemann, Mike

2016-01-13

DNA replication is a fundamental cellular process that precedes cell division. Proliferating cell nuclear antigen (PCNA) is a central scaffold protein that orchestrates DNA replication by recruiting many factors essential for the replication machinery. We studied the mobility of PCNA in live mammalian cells using single-particle tracking in combination with photoactivated-localization microscopy (sptPALM) and found two populations. The first population which is only present in cells with active DNA replication, showed slow diffusion and was found to be located in replication foci. The second population showed fast diffusion, and represents the nucleoplasmic pool of unbound PCNA not involved in DNA replication. The ratio of these two populations remained constant throughout different stages of S-phase. A fraction of molecules in both populations showed spatially constrained mobility. We determined an exploration radius of ~100 nm for 13% of the slow-diffusing PCNA molecules, and of ~600 nm for 46% of the fast-diffusing PCNA molecules.

Insights into the history of a bacterial group II intron remnant from the genomes of the nitrogen-fixing symbionts Sinorhizobium meliloti and Sinorhizobium medicae.

PubMed

Toro, N; Martínez-Rodríguez, L; Martínez-Abarca, F

2014-10-01

Group II introns are self-splicing catalytic RNAs that act as mobile retroelements. In bacteria, they are thought to be tolerated to some extent because they self-splice and home preferentially to sites outside of functional genes, generally within intergenic regions or in other mobile genetic elements, by mechanisms including the divergence of DNA target specificity to prevent target site saturation. RmInt1 is a mobile group II intron that is widespread in natural populations of Sinorhizobium meliloti and was first described in the GR4 strain. Like other bacterial group II introns, RmInt1 tends to evolve toward an inactive form by fragmentation, with loss of the 3' terminus. We identified genomic evidence of a fragmented intron closely related to RmInt1 buried in the genome of the extant S. meliloti/S. medicae species. By studying this intron, we obtained evidence for the occurrence of intron insertion before the divergence of ancient rhizobial species. This fragmented group II intron has thus existed for a long time and has provided sequence variation, on which selection can act, contributing to diverse genetic rearrangements, and to generate pan-genome divergence after strain differentiation. The data presented here suggest that fragmented group II introns within intergenic regions closed to functionally important neighboring genes may have been microevolutionary forces driving adaptive evolution of these rhizobial species.

Insights into the history of a bacterial group II intron remnant from the genomes of the nitrogen-fixing symbionts Sinorhizobium meliloti and Sinorhizobium medicae

PubMed Central

Toro, N; Martínez-Rodríguez, L; Martínez-Abarca, F

2014-01-01

Group II introns are self-splicing catalytic RNAs that act as mobile retroelements. In bacteria, they are thought to be tolerated to some extent because they self-splice and home preferentially to sites outside of functional genes, generally within intergenic regions or in other mobile genetic elements, by mechanisms including the divergence of DNA target specificity to prevent target site saturation. RmInt1 is a mobile group II intron that is widespread in natural populations of Sinorhizobium meliloti and was first described in the GR4 strain. Like other bacterial group II introns, RmInt1 tends to evolve toward an inactive form by fragmentation, with loss of the 3′ terminus. We identified genomic evidence of a fragmented intron closely related to RmInt1 buried in the genome of the extant S. meliloti/S. medicae species. By studying this intron, we obtained evidence for the occurrence of intron insertion before the divergence of ancient rhizobial species. This fragmented group II intron has thus existed for a long time and has provided sequence variation, on which selection can act, contributing to diverse genetic rearrangements, and to generate pan-genome divergence after strain differentiation. The data presented here suggest that fragmented group II introns within intergenic regions closed to functionally important neighboring genes may have been microevolutionary forces driving adaptive evolution of these rhizobial species. PMID:24736785

Whole DNA methylome profiling in mice exposed to secondhand smoke

PubMed Central

Tommasi, Stella; Zheng, Albert; Yoon, Jae-In; Li, Arthur Xuejun; Wu, Xiwei; Besaratinia, Ahmad

2012-01-01

Aberration of DNA methylation is a prime epigenetic mechanism of carcinogenesis. Aberrant DNA methylation occurs frequently in lung cancer, with exposure to secondhand smoke (SHS) being an established risk factor. The causal role of SHS in the genesis of lung cancer, however, remains elusive. To investigate whether SHS can cause aberrant DNA methylation in vivo, we have constructed the whole DNA methylome in mice exposed to SHS for a duration of 4 mo, both after the termination of exposure and at ensuing intervals post-exposure (up to 10 mo). Our genome-wide and gene-specific profiling of DNA methylation in the lung of SHS-exposed mice revealed that all groups of SHS-exposed mice and controls share a similar pattern of DNA methylation. Furthermore, the methylation status of major repetitive DNA elements, including long-interspersed nuclear elements (LINE L1), intracisternal A particle long-terminal repeat retrotransposons (IAP-LTR), and short-interspersed nuclear elements (SINE B1), in the lung of all groups of SHS-exposed mice and controls remains comparable. The absence of locus-specific gain of DNA methylation and global loss of DNA methylation in the lung of SHS-exposed mice within a timeframe that precedes neoplastic-lesion formation underscore the challenges of lung cancer biomarker development. Identifying the initiating events that cause aberrant DNA methylation in lung carcinogenesis may help improve future strategies for prevention, early detection and treatment of this highly lethal disease. PMID:23051858

Structure and conformational dynamics of scaffolded DNA origami nanoparticles

DTIC Science & Technology

2017-05-08

all-atom molecular dynamics and coarse-grained finite element modeling to DX-based nanoparticles to elucidate their fine-scale and global conforma... finite element (FE) modeling approach CanDo is also routinely used to predict the 3D equilibrium conformation of programmed DNA assemblies based on a...model with both experimental cryo-electron microscopy (cryo-EM) data and all-atom modeling. MATERIALS AND METHODS Lattice-free finite element model

Rapid and Simple Detection of Hot Spot Point Mutations of Epidermal Growth Factor Receptor, BRAF, and NRAS in Cancers Using the Loop-Hybrid Mobility Shift Assay

PubMed Central

Matsukuma, Shoichi; Yoshihara, Mitsuyo; Kasai, Fumio; Kato, Akinori; Yoshida, Akira; Akaike, Makoto; Kobayashi, Osamu; Nakayama, Haruhiko; Sakuma, Yuji; Yoshida, Tsutomu; Kameda, Yoichi; Tsuchiya, Eiju; Miyagi, Yohei

2006-01-01

A simple and rapid method to detect the epidermal growth factor receptor hot spot mutation L858R in lung adenocarcinoma was developed based on principles similar to the universal heteroduplex generator technology. A single-stranded oligonucleotide with an internal deletion was used to generate heteroduplexes (loop-hybrids) bearing a loop in the complementary strand derived from the polymerase chain reaction product of the normal or mutant allele. By placing deletion in the oligonucleotide adjacent to the mutational site, difference in electrophoretic mobility between loop-hybrids with normal and mutated DNA was distinguishable in a native polyacrylamide gel. The method was also modified to detect in-frame deletion mutations of epidermal growth factor receptor in lung adenocarcinomas. In addition, the method was adapted to detect hot spot mutations in the B-type Raf kinase (BRAF) at V600 and in a Ras-oncogene (NRAS) at Q61, the mutations commonly found in thyroid carcinomas. Our mutation detection system, designated the loop-hybrid mobility shift assay was sensitive enough to detect mutant DNA comprising 7.5% of the total DNA. As a simple and straightforward mutation detection technique, loop-hybrid mobility shift assay may be useful for the molecular diagnosis of certain types of clinical cancers. Other applications are also discussed. PMID:16931592

DEPPDB - DNA electrostatic potential properties database. Electrostatic properties of genome DNA elements.

PubMed

Osypov, Alexander A; Krutinin, Gleb G; Krutinina, Eugenia A; Kamzolova, Svetlana G

2012-04-01

Electrostatic properties of genome DNA are important to its interactions with different proteins, in particular, related to transcription. DEPPDB - DNA Electrostatic Potential (and other Physical) Properties Database - provides information on the electrostatic and other physical properties of genome DNA combined with its sequence and annotation of biological and structural properties of genomes and their elements. Genomes are organized on taxonomical basis, supporting comparative and evolutionary studies. Currently, DEPPDB contains all completely sequenced bacterial, viral, mitochondrial, and plastids genomes according to the NCBI RefSeq, and some model eukaryotic genomes. Data for promoters, regulation sites, binding proteins, etc., are incorporated from established DBs and literature. The database is complemented by analytical tools. User sequences calculations are available. Case studies discovered electrostatics complementing DNA bending in E.coli plasmid BNT2 promoter functioning, possibly affecting host-environment metabolic switch. Transcription factors binding sites gravitate to high potential regions, confirming the electrostatics universal importance in protein-DNA interactions beyond the classical promoter-RNA polymerase recognition and regulation. Other genome elements, such as terminators, also show electrostatic peculiarities. Most intriguing are gene starts, exhibiting taxonomic correlations. The necessity of the genome electrostatic properties studies is discussed.

Promoter selection in human mitochondria involves binding of a transcription factor to orientation-independent upstream regulatory elements.

PubMed

Fisher, R P; Topper, J N; Clayton, D A

1987-07-17

Selective transcription of human mitochondrial DNA requires a transcription factor (mtTF) in addition to an essentially nonselective RNA polymerase. Partially purified mtTF is able to sequester promoter-containing DNA in preinitiation complexes in the absence of mitochondrial RNA polymerase, suggesting a DNA-binding mechanism for factor activity. Functional domains, required for positive transcriptional regulation by mtTF, are identified within both major promoters of human mtDNA through transcription of mutant promoter templates in a reconstituted in vitro system. These domains are essentially coextensive with DNA sequences protected from nuclease digestion by mtTF-binding. Comparison of the sequences of the two mtTF-responsive elements reveals significant homology only when one sequence is inverted; the binding sites are in opposite orientations with respect to the predominant direction of transcription. Thus mtTF may function bidirectionally, requiring additional protein-DNA interactions to dictate transcriptional polarity. The mtTF-responsive elements are arrayed as direct repeats, separated by approximately 80 bp within the displacement-loop region of human mitochondrial DNA; this arrangement may reflect duplication of an ancestral bidirectional promoter, giving rise to separate, unidirectional promoters for each strand.

A comprehensive list of cloned human DNA sequences

PubMed Central

Schmidtke, Jörg; Cooper, David N.

1987-01-01

A list of DNA sequences cloned from the human genome is presented. Intended as a guide to clone availability, this list includes published reports of cDNA, genomic and synthetic clones comprising gene and pseudogene sequences, uncharacterised DNA segments and repetitive DNA elements. PMID:3575113

A comprehensive list of cloned human DNA sequences

PubMed Central

Schmidtke, Jörg; Cooper, David N.

1990-01-01

A list of DNA sequences cloned from the human genome is presented. Intended as a guide to clone availability, this list includes published reports of cDNA, genomic and synthetic clones comprising gene and pseudogene sequences, uncharacterised DNA segments and repetitive DNA elements. PMID:2333227

A comprehensive list of cloned human DNA sequences

PubMed Central

Schmidtke, Jörg; Cooper, David N.

1988-01-01

A list of DNA sequences cloned from the human genome is presented. Intended as a guide to clone availability, this list includes published reports of cDNA, genomic and synthetic clones comprising gene and pseudogene sequences, uncharacterised DNA segments and repetitive DNA elements. PMID:3368330

A comprehensive list of cloned human DNA sequences

PubMed Central

Schmidtke, Jörg; Cooper, David N.

1989-01-01

A list of DNA sequences cloned from the human genome is presented. Intended as a guide to clone availability, this list includes published reports of cDNA, genomic and synthetic clones comprising gene and pseudogene sequences, uncharacterised DNA segments and repetitive DNA elements. PMID:2654889

Characterisation of cytoplasmic DNA complementary to non-retroviral RNA viruses in human cells

PubMed Central

Shimizu, Akira; Nakatani, Yoko; Nakamura, Takako; Jinno-Oue, Atsushi; Ishikawa, Osamu; Boeke, Jef D.; Takeuchi, Yasuhiro; Hoshino, Hiroo

2014-01-01

The synthesis and subsequent genomic integration of DNA that is complementary to the genomes of non-retroviral RNA viruses are rarely observed. However, upon infection of various human cell lines and primary fibroblasts with the vesicular stomatitis virus (VSV), we detected DNA complementary to the VSV RNA. The VSV DNA was detected in the cytoplasm as single-stranded DNA fully complementary to the viral mRNA from the poly(A) region to the 7-methyl guanosine cap. The formation of this DNA was cell-dependent. Experimentally, we found that the transduction of cells that do not produce VSV DNA with the long interspersed nuclear element 1 and their infection with VSV could lead to the formation of VSV DNA. Viral DNA complementary to other RNA viruses was also detected in the respective infected human cells. Thus, the genetic information of the non-retroviral RNA virus genome can flow into the DNA of mammalian cells expressing LINE-1-like elements. PMID:24875540

On the Adsorption of DNA Origami Nanostructures in Nanohole Arrays.

PubMed

Brassat, Katharina; Ramakrishnan, Saminathan; Bürger, Julius; Hanke, Marcel; Doostdar, Mahnaz; Lindner, Jörg K N; Grundmeier, Guido; Keller, Adrian

2018-05-22

DNA origami nanostructures are versatile substrates for the controlled arrangement of molecular capture sites with nanometer precision and thus have many promising applications in single-molecule bioanalysis. Here, we investigate the adsorption of DNA origami nanostructures in nanohole arrays which represent an important class of biosensors and may benefit from the incorporation of DNA origami-based molecular probes. Nanoholes with well-defined diameter that enable the adsorption of single DNA origami triangles are fabricated in Au films on Si wafers by nanosphere lithography. The efficiency of directed DNA origami adsorption on the exposed SiO 2 areas at the bottoms of the nanoholes is evaluated in dependence of various parameters, i.e., Mg 2+ and DNA origami concentrations, buffer strength, adsorption time, and nanohole diameter. We observe that the buffer strength has a surprisingly strong effect on DNA origami adsorption in the nanoholes and that multiple DNA origami triangles with 120 nm edge length can adsorb in nanoholes as small as 120 nm in diameter. We attribute the latter observation to the low lateral mobility of once adsorbed DNA origami on the SiO 2 surface, in combination with parasitic adsorption to the Au film. Although parasitic adsorption can be suppressed by modifying the Au film with a hydrophobic self-assembled monolayer, the limited surface mobility of the adsorbed DNA origami still leads to poor localization accuracy in the nanoholes and results in many DNA origami crossing the boundary to the Au film even under optimized conditions. We discuss possible ways to minimize this effect by varying the composition of the adsorption buffer, employing different fabrication conditions, or using other substrate materials for nanohole array fabrication.

Structural changes induced by binding of the high-mobility group I protein to a mouse satellite DNA sequence.

PubMed Central

Slama-Schwok, A; Zakrzewska, K; Léger, G; Leroux, Y; Takahashi, M; Käs, E; Debey, P

2000-01-01

Using spectroscopic methods, we have studied the structural changes induced in both protein and DNA upon binding of the High-Mobility Group I (HMG-I) protein to a 21-bp sequence derived from mouse satellite DNA. We show that these structural changes depend on the stoichiometry of the protein/DNA complexes formed, as determined by Job plots derived from experiments using pyrene-labeled duplexes. Circular dichroism and melting temperature experiments extended in the far ultraviolet range show that while native HMG-I is mainly random coiled in solution, it adopts a beta-turn conformation upon forming a 1:1 complex in which the protein first binds to one of two dA.dT stretches present in the duplex. HMG-I structure in the 1:1 complex is dependent on the sequence of its DNA target. A 3:1 HMG-I/DNA complex can also form and is characterized by a small increase in the DNA natural bend and/or compaction coupled to a change in the protein conformation, as determined from fluorescence resonance energy transfer (FRET) experiments. In addition, a peptide corresponding to an extended DNA-binding domain of HMG-I induces an ordered condensation of DNA duplexes. Based on the constraints derived from pyrene excimer measurements, we present a model of these nucleated structures. Our results illustrate an extreme case of protein structure induced by DNA conformation that may bear on the evolutionary conservation of the DNA-binding motifs of HMG-I. We discuss the functional relevance of the structural flexibility of HMG-I associated with the nature of its DNA targets and the implications of the binding stoichiometry for several aspects of chromatin structure and gene regulation. PMID:10777751

Eight-Element Antenna Array for LTE 3.4-3.8 GHz Mobile Handset Applications

NASA Astrophysics Data System (ADS)

Yang, Lingsheng; Ji, Ming; Cheng, Biyu; Ni, Bo

2017-05-01

In this letter, an eight-element Multiple-input multiple-output (MIMO) antenna system for LTE mobile handset applications is proposed. The antenna array consists of eight 3D inverted F-shaped antennas (3D-IFA), and the measured -10 dB impedance bandwidth is 3.2-3.9 GHz which can cover the LTE bands 42 and 43 (3.4-3.8 GHz). By controlling the rotation of the antenna elements, no less than 10 dB isolation between antenna elements can be obtained. After using the specially designed meandered slots on the ground as decoupling structures, the measured isolation can be further improved to higher than 13 dB between the antenna elements at the whole operating band.

Mycobacterium smegmatis strain for detection of Mycobacterium tuberculosis by PCR used as internal control for inhibition of amplification and for quantification of bacteria.

PubMed Central

Kolk, A H; Noordhoek, G T; de Leeuw, O; Kuijper, S; van Embden, J D

1994-01-01

For the detection of Mycobacterium tuberculosis by PCR, the IS6110 sequence was used. A modified target was constructed by insertion of 56 nucleotides in the IS6110 insertion element of Mycobacterium bovis BCG. This modified insertion sequence was integrated into the genome of Mycobacterium smegmatis, a mycobacterium species which does not contain the IS6110 element. When DNA from the modified M. smegmatis 1008 strain was amplified with IS6110-specific primers INS1 and INS2, a band of 301 bp was seen on agarose gel, whereas the PCR product of M. tuberculosis complex DNA was a 245-bp fragment with these primers. The addition of a small number of M. smegmatis 1008 cells to clinical samples before DNA purification enables the detection of problems which may be due to the loss of DNA in the isolation procedure or to the presence of inhibitors. The presence of inhibitors of the amplification reaction can be confirmed by the addition of M. smegmatis 1008 DNA after the DNA isolation procedure. Furthermore, competition between the different target DNAs of M. smegmatis 1008 DNA and M. tuberculosis complex DNA enables the estimation of the number of IS6110 elements in the clinical sample. Images PMID:8051267

Major and Trace Element Variations in Impact Crater Clay from Chicxulub, Lonar, and Mistastin, Implications for the Martian Soil

NASA Technical Reports Server (NTRS)

Newsom, H. E.; Nelson, M. J.; Shearer, C. K.; Rietmeijer, F. J. M.; Gakin, R.; Lee, K.

2004-01-01

The catastrophic Chicxulub event should have generated a large hydrothermal system with volatile element mobilization, producing interesting alteration materials and clays. The Yaxcopoil-1 (YAX) drill hole is located in the annular trough, about 70 km southwest of the crater center, in an area where the impactite layers are relatively thin (approx. 100 m thick). We have analyzed samples from the YAX drill core and from other impact craters including Mistastin and Lonar to determine the nature of alteration and trace element mobilization.

VEZF1 Elements Mediate Protection from DNA Methylation

PubMed Central

Strogantsev, Ruslan; Gaszner, Miklos; Hair, Alan; Felsenfeld, Gary; West, Adam G.

2010-01-01

There is growing consensus that genome organization and long-range gene regulation involves partitioning of the genome into domains of distinct epigenetic chromatin states. Chromatin insulator or barrier elements are key components of these processes as they can establish boundaries between chromatin states. The ability of elements such as the paradigm β-globin HS4 insulator to block the range of enhancers or the spread of repressive histone modifications is well established. Here we have addressed the hypothesis that a barrier element in vertebrates should be capable of defending a gene from silencing by DNA methylation. Using an established stable reporter gene system, we find that HS4 acts specifically to protect a gene promoter from de novo DNA methylation. Notably, protection from methylation can occur in the absence of histone acetylation or transcription. There is a division of labor at HS4; the sequences that mediate protection from methylation are separable from those that mediate CTCF-dependent enhancer blocking and USF-dependent histone modification recruitment. The zinc finger protein VEZF1 was purified as the factor that specifically interacts with the methylation protection elements. VEZF1 is a candidate CpG island protection factor as the G-rich sequences bound by VEZF1 are frequently found at CpG island promoters. Indeed, we show that VEZF1 elements are sufficient to mediate demethylation and protection of the APRT CpG island promoter from DNA methylation. We propose that many barrier elements in vertebrates will prevent DNA methylation in addition to blocking the propagation of repressive histone modifications, as either process is sufficient to direct the establishment of an epigenetically stable silent chromatin state. PMID:20062523

Fueling and Stabilizing a Biomolecular Motor-Powered Biosensor for Remote Detection Scenarios

DTIC Science & Technology

2007-10-01

streptavidin, cyclodextrin host - guest 0 , malachite green - aptamer", DNA - DNA12, and antibody - antigen . Using functionalized microtubules gliding on...3), 646-648 (2005). 11 Hirabayashi, M. et al. Malachite green-conjugated microtubules as mobile bioprobes selective for malachite green aptamers with

AP1 Keeps Chromatin Poised for Action | Center for Cancer Research

Cancer.gov

The human genome harbors gene-encoding DNA, the blueprint for building proteins that regulate cellular function. Embedded across the genome, in non-coding regions, are DNA elements to which regulatory factors bind. The interaction of regulatory factors with DNA at these sites modifies gene expression to modulate cell activity. In cells, DNA exists in a complex with proteins called chromatin that compacts the DNA in the nucleus, strongly restricting access to DNA sequences. As a result, regulatory factors only interact with a small subset of their potential binding elements in a given cell to regulate genes. How factors recognize and select sites in chromatin across the genome is not well understood -- but several discoveries in CCR’s Laboratory of Receptor Biology and Gene Expression (LRBGE) have shed light on the mechanisms that direct factors to DNA.

DNA methylation induced changes in chromatin conformation of the promoter of the vitellogenin II gene of Japanese quail during aging.

PubMed

Gupta, Sanjay; Pathak, Rashmi U; Kanungo, Madhu S

2006-08-01

One approach to the understanding of the molecular basis of aging in higher organisms may be to use genes whose timing and rate of expression during the life span run parallel with specific functions that can be monitored. The genes for egg proteins, such as vitellogenin (VTG), which is expressed in the liver, and ovalbumin, lysozyme etc. that are expressed in the oviduct of birds, meet these requirements. Egg laying function is dependent on the production of these proteins, which, in turn, depends on the expression of their genes. In this communication we present the age-related studies on the VTG II gene of the bird, Japanese quail. The gene is expressed only in the liver and its expression is considerably lower in old birds that do not lay eggs. Comparison of the promoter region of the gene carrying the two important cis-acting elements, estrogen responsive element (ERE) and progesterone responsive element (PRE), shows it to be 100% homologous to the corresponding region of the chicken VTG II gene. Methylation of DNA and conformation of chromatin of this region were studied, as they are known to be important for regulation of expression of genes. Our studies show that in the liver of adult female quails which lay eggs, a -CCGG- sequence located in this region is hypomethylated, and the chromatin encompassing this region of the gene is relaxed. In the old, the -CCGG- sequence is hypermethylated and the chromatin is compact. This is correlated with a decrease in the expression of the gene and decrease in egg production. Further, electrophoretic mobility shift assay (EMSA) shows that the levels/affinity of specific trans-acting factors that bind to ERE and PRE present in the region, are not different in adult and old birds. Hence the methylation status of the -CCGG- sequence that is located in-between the ERE and the PRE may be crucial for the conformation of chromatin and availability of these two important cis-acting elements for the binding of the trans-acting factors. This, in turn, may downregulate the expression of the gene in old birds.

The CRISPR Spacer Space Is Dominated by Sequences from Species-Specific Mobilomes.

PubMed

Shmakov, Sergey A; Sitnik, Vassilii; Makarova, Kira S; Wolf, Yuri I; Severinov, Konstantin V; Koonin, Eugene V

2017-09-19

Clustered regularly interspaced short palindromic repeats and CRISPR-associated protein (CRISPR-Cas) systems store the memory of past encounters with foreign DNA in unique spacers that are inserted between direct repeats in CRISPR arrays. For only a small fraction of the spacers, homologous sequences, called protospacers, are detectable in viral, plasmid, and microbial genomes. The rest of the spacers remain the CRISPR "dark matter." We performed a comprehensive analysis of the spacers from all CRISPR- cas loci identified in bacterial and archaeal genomes, and we found that, depending on the CRISPR-Cas subtype and the prokaryotic phylum, protospacers were detectable for 1% to about 19% of the spacers (~7% global average). Among the detected protospacers, the majority, typically 80 to 90%, originated from viral genomes, including proviruses, and among the rest, the most common source was genes that are integrated into microbial chromosomes but are involved in plasmid conjugation or replication. Thus, almost all spacers with identifiable protospacers target mobile genetic elements (MGE). The GC content, as well as dinucleotide and tetranucleotide compositions, of microbial genomes, their spacer complements, and the cognate viral genomes showed a nearly perfect correlation and were almost identical. Given the near absence of self-targeting spacers, these findings are most compatible with the possibility that the spacers, including the dark matter, are derived almost completely from the species-specific microbial mobilomes. IMPORTANCE The principal function of CRISPR-Cas systems is thought to be protection of bacteria and archaea against viruses and other parasitic genetic elements. The CRISPR defense function is mediated by sequences from parasitic elements, known as spacers, that are inserted into CRISPR arrays and then transcribed and employed as guides to identify and inactivate the cognate parasitic genomes. However, only a small fraction of the CRISPR spacers match any sequences in the current databases, and of these, only a minority correspond to known parasitic elements. We show that nearly all spacers with matches originate from viral or plasmid genomes that are either free or have been integrated into the host genome. We further demonstrate that spacers with no matches have the same properties as those of identifiable origins, strongly suggesting that all spacers originate from mobile elements.

The twilight zone of cis element alignments.

PubMed

Sebastian, Alvaro; Contreras-Moreira, Bruno

2013-02-01

Sequence alignment of proteins and nucleic acids is a routine task in bioinformatics. Although the comparison of complete peptides, genes or genomes can be undertaken with a great variety of tools, the alignment of short DNA sequences and motifs entails pitfalls that have not been fully addressed yet. Here we confront the structural superposition of transcription factors with the sequence alignment of their recognized cis elements. Our goals are (i) to test TFcompare (http://floresta.eead.csic.es/tfcompare), a structural alignment method for protein-DNA complexes; (ii) to benchmark the pairwise alignment of regulatory elements; (iii) to define the confidence limits and the twilight zone of such alignments and (iv) to evaluate the relevance of these thresholds with elements obtained experimentally. We find that the structure of cis elements and protein-DNA interfaces is significantly more conserved than their sequence and measures how this correlates with alignment errors when only sequence information is considered. Our results confirm that DNA motifs in the form of matrices produce better alignments than individual sequences. Finally, we report that empirical and theoretically derived twilight thresholds are useful for estimating the natural plasticity of regulatory sequences, and hence for filtering out unreliable alignments.

The twilight zone of cis element alignments

PubMed Central

Sebastian, Alvaro; Contreras-Moreira, Bruno

2013-01-01

Sequence alignment of proteins and nucleic acids is a routine task in bioinformatics. Although the comparison of complete peptides, genes or genomes can be undertaken with a great variety of tools, the alignment of short DNA sequences and motifs entails pitfalls that have not been fully addressed yet. Here we confront the structural superposition of transcription factors with the sequence alignment of their recognized cis elements. Our goals are (i) to test TFcompare (http://floresta.eead.csic.es/tfcompare), a structural alignment method for protein–DNA complexes; (ii) to benchmark the pairwise alignment of regulatory elements; (iii) to define the confidence limits and the twilight zone of such alignments and (iv) to evaluate the relevance of these thresholds with elements obtained experimentally. We find that the structure of cis elements and protein–DNA interfaces is significantly more conserved than their sequence and measures how this correlates with alignment errors when only sequence information is considered. Our results confirm that DNA motifs in the form of matrices produce better alignments than individual sequences. Finally, we report that empirical and theoretically derived twilight thresholds are useful for estimating the natural plasticity of regulatory sequences, and hence for filtering out unreliable alignments. PMID:23268451

Comparative Genomics of Oral Isolates of Streptococcus mutans by in silico Genome Subtraction Does Not Reveal Accessory DNA Associated with Severe Early Childhood Caries

PubMed Central

Argimón, Silvia; Konganti, Kranti; Chen, Hao; Alekseyenko, Alexander V.; Brown, Stuart; Caufield, Page W.

2014-01-01

Comparative genomics is a popular method for the identification of microbial virulence determinants, especially since the sequencing of a large number of whole bacterial genomes from pathogenic and non-pathogenic strains has become relatively inexpensive. The bioinformatics pipelines for comparative genomics usually include gene prediction and annotation and can require significant computer power. To circumvent this, we developed a rapid method for genome-scale in silico subtractive hybridization, based on blastn and independent of feature identification and annotation. Whole genome comparisons by in silico genome subtraction were performed to identify genetic loci specific to Streptococcus mutans strains associated with severe early childhood caries (S-ECC), compared to strains isolated from caries-free (CF) children. The genome similarity of the 20 S. mutans strains included in this study, calculated by Simrank k-mer sharing, ranged from 79.5 to 90.9%, confirming this is a genetically heterogeneous group of strains. We identified strain-specific genetic elements in 19 strains, with sizes ranging from 200 bp to 39 kb. These elements contained protein-coding regions with functions mostly associated with mobile DNA. We did not, however, identify any genetic loci consistently associated with dental caries, i.e., shared by all the S-ECC strains and absent in the CF strains. Conversely, we did not identify any genetic loci specific with the healthy group. Comparison of previously published genomes from pathogenic and carriage strains of Neisseria meningitidis with our in silico genome subtraction yielded the same set of genes specific to the pathogenic strains, thus validating our method. Our results suggest that S. mutans strains derived from caries active or caries free dentitions cannot be differentiated based on the presence or absence of specific genetic elements. Our in silico genome subtraction method is available as the Microbial Genome Comparison (MGC) tool, with a user-friendly JAVA graphical interface. PMID:24291226

Comparison of biomechanical function at ideal and varied surgical placement for two lumbar artificial disc implant designs: mobile-core versus fixed-core.

PubMed

Moumene, Missoum; Geisler, Fred H

2007-08-01

Finite element model. To estimate the effect of lumbar mobile-core and fixed-core artificial disc design and placement on the loading of the facet joints, and stresses on the polyethylene core. Although both mobile-core and fixed-core lumbar artificial disc designs have been used clinically, the effect of their design and the effect of placement within the disc space on the structural element loading, and in particular the facets and the implant itself, have not been investigated. A 3D nonlinear finite element model of an intact ligamentous L4-L5 motion segment was developed and validated in all 6 df based on previous experiments conducted on human cadavers. Facet loading of a mobile-core TDR and a fixed-core TDR were estimated with 4 different prosthesis placements for 3 different ranges of motion. Placing the mobile-core TDR anywhere within the disc space reduced facet loading by more than 50%, while the fixed-core TDR increased facet loading by more than 10% when compared with the intact disc in axial rotation. For central (ideal) placement, the mobile- and fixed-core implants were subjected to compressive stresses on the order of 3 MPa and 24 MPa, respectively. The mobile-core stresses were not affected by implant placement, while the fixed-core stresses increased by up to 40%. A mobile-core artificial disc design is less sensitive to placement, and unloads the facet joints, compared with a fixed-core design. The decreased core stress may result in a reduced potential for wear in a mobile-core prosthesis compared with a fixed-core prosthesis, which may increase the functional longevity of the device.

Evolutionary dynamics of selfish DNA explains the abundance distribution of genomic subsequences

PubMed Central

Sheinman, Michael; Ramisch, Anna; Massip, Florian; Arndt, Peter F.

2016-01-01

Since the sequencing of large genomes, many statistical features of their sequences have been found. One intriguing feature is that certain subsequences are much more abundant than others. In fact, abundances of subsequences of a given length are distributed with a scale-free power-law tail, resembling properties of human texts, such as Zipf’s law. Despite recent efforts, the understanding of this phenomenon is still lacking. Here we find that selfish DNA elements, such as those belonging to the Alu family of repeats, dominate the power-law tail. Interestingly, for the Alu elements the power-law exponent increases with the length of the considered subsequences. Motivated by these observations, we develop a model of selfish DNA expansion. The predictions of this model qualitatively and quantitatively agree with the empirical observations. This allows us to estimate parameters for the process of selfish DNA spreading in a genome during its evolution. The obtained results shed light on how evolution of selfish DNA elements shapes non-trivial statistical properties of genomes. PMID:27488939

DNA capture elements for rapid detection and identification of biological agents

NASA Astrophysics Data System (ADS)

Kiel, Johnathan L.; Parker, Jill E.; Holwitt, Eric A.; Vivekananda, Jeeva

2004-08-01

DNA capture elements (DCEs; aptamers) are artificial DNA sequences, from a random pool of sequences, selected for their specific binding to potential biological warfare agents. These sequences were selected by an affinity method using filters to which the target agent was attached and the DNA isolated and amplified by polymerase chain reaction (PCR) in an iterative, increasingly stringent, process. Reporter molecules were attached to the finished sequences. To date, we have made DCEs to Bacillus anthracis spores, Shiga toxin, Venezuelan Equine Encephalitis (VEE) virus, and Francisella tularensis. These DCEs have demonstrated specificity and sensitivity equal to or better than antibody.

A Novel aadA Aminoglycoside Resistance Gene in Bovine and Porcine Pathogens.

PubMed

Cameron, Andrew; Klima, Cassidy L; Ha, Reuben; Gruninger, Robert J; Zaheer, Rahat; McAllister, Tim A

2018-01-01

A novel variant of the AAD(3″) class of aminoglycoside-modifying enzymes was discovered in fatal bovine respiratory disease-associated pathogens Pasteurella multocida and Histophilus somni . The aadA31 gene encodes a spectinomycin/streptomycin adenylyltransferase and was located in a variant of the integrative and conjugative element ICE Mh1 , a mobile genetic element transmissible among members of the family Pasteurellaceae . The gene was also detected in Mannheimia haemolytica from a case of porcine pneumonia and in Moraxella bovoculi from a case of keratoconjunctivitis. IMPORTANCE Aminoglycosides are important antimicrobials used worldwide for prophylaxis and/or therapy in multiple production animal species. The emergence of new resistance genes jeopardizes current pathogen detection and treatment methods. The risk of resistance gene transfer to other animal and human pathogens is elevated when resistance genes are carried by mobile genetic elements. This study identified a new variant of a spectinomycin/streptomycin resistance gene harbored in a self-transmissible mobile element. The gene was also present in four different bovine pathogen species.

A Novel aadA Aminoglycoside Resistance Gene in Bovine and Porcine Pathogens

PubMed Central

Cameron, Andrew; Klima, Cassidy L.; Ha, Reuben; Gruninger, Robert J.; Zaheer, Rahat

2018-01-01

ABSTRACT A novel variant of the AAD(3″) class of aminoglycoside-modifying enzymes was discovered in fatal bovine respiratory disease-associated pathogens Pasteurella multocida and Histophilus somni. The aadA31 gene encodes a spectinomycin/streptomycin adenylyltransferase and was located in a variant of the integrative and conjugative element ICEMh1, a mobile genetic element transmissible among members of the family Pasteurellaceae. The gene was also detected in Mannheimia haemolytica from a case of porcine pneumonia and in Moraxella bovoculi from a case of keratoconjunctivitis. IMPORTANCE Aminoglycosides are important antimicrobials used worldwide for prophylaxis and/or therapy in multiple production animal species. The emergence of new resistance genes jeopardizes current pathogen detection and treatment methods. The risk of resistance gene transfer to other animal and human pathogens is elevated when resistance genes are carried by mobile genetic elements. This study identified a new variant of a spectinomycin/streptomycin resistance gene harbored in a self-transmissible mobile element. The gene was also present in four different bovine pathogen species. PMID:29507894

Challenges with Deploying and Integrating Environmental Control and Life Support Functions in a Lunar Architecture with High Degrees of Mobility

NASA Technical Reports Server (NTRS)

Bagdigian, Robert M.

2009-01-01

Visions of lunar outposts often depict a collection of fixed elements such as pressurized habitats, in and around which human inhabitants spend the large majority of their surface stay time. In such an outpost, an efficient deployment of environmental control and life support equipment can be achieved by centralizing certain functions within one or a minimum number of habitable elements and relying on the exchange of gases and liquids between elements via atmosphere ventilation and plumbed interfaces. However, a rigidly fixed outpost can constrain the degree to which the total lunar landscape can be explored. The capability to enable widespread access across the landscape makes a lunar architecture with a high degree of surface mobility attractive. Such mobility presents unique challenges to the efficient deployment of environmental control and life support functions in multiple elements that may for long periods of time be operated independently. This paper describes some of those anticipated challenges.

DNA methylation dynamics during early plant life.

PubMed

Bouyer, Daniel; Kramdi, Amira; Kassam, Mohamed; Heese, Maren; Schnittger, Arp; Roudier, François; Colot, Vincent

2017-09-25

Cytosine methylation is crucial for gene regulation and silencing of transposable elements in mammals and plants. While this epigenetic mark is extensively reprogrammed in the germline and early embryos of mammals, the extent to which DNA methylation is reset between generations in plants remains largely unknown. Using Arabidopsis as a model, we uncovered distinct DNA methylation dynamics over transposable element sequences during the early stages of plant development. Specifically, transposable elements and their relics show invariably high methylation at CG sites but increasing methylation at CHG and CHH sites. This non-CG methylation culminates in mature embryos, where it reaches saturation for a large fraction of methylated CHH sites, compared to the typical 10-20% methylation level observed in seedlings or adult plants. Moreover, the increase in CHH methylation during embryogenesis matches the hypomethylated state in the early endosperm. Finally, we show that interfering with the embryo-to-seedling transition results in the persistence of high CHH methylation levels after germination, specifically over sequences that are targeted by the RNA-directed DNA methylation (RdDM) machinery. Our findings indicate the absence of extensive resetting of DNA methylation patterns during early plant life and point instead to an important role of RdDM in reinforcing DNA methylation of transposable element sequences in every cell of the mature embryo. Furthermore, we provide evidence that this elevated RdDM activity is a specific property of embryogenesis.

Mobility of radionuclides and trace elements in soil from legacy NORM and undisturbed naturally 232Th-rich sites.

PubMed

Mrdakovic Popic, Jelena; Meland, Sondre; Salbu, Brit; Skipperud, Lindis

2014-05-01

Investigation of radionuclides (232Th and 238U) and trace elements (Cr, As and Pb) in soil from two legacy NORM (former mining sites) and one undisturbed naturally 232Th-rich site was conducted as a part of the ongoing environmental impact assessment in the Fen Complex area (Norway). The major objectives were to determine the radionuclide and trace element distribution and mobility in soils as well as to analyze possible differences between legacy NORM and surrounding undisturbed naturally 232Th-rich soils. Inhomogeneous soil distribution of radionuclides and trace elements was observed for each of the investigated sites. The concentration of 232Th was high (up to 1685 mg kg(-1), i.e., ∼7000 Bq kg(-1)) and exceeded the screening value for the radioactive waste material in Norway (1 Bq g(-1)). Based on the sequential extraction results, the majority of 232Th and trace elements were rather inert, irreversibly bound to soil. Uranium was found to be potentially more mobile, as it was associated with pH-sensitive soil phases, redox-sensitive amorphous soil phases and soil organic compounds. Comparison of the sequential extraction datasets from the three investigated sites revealed increased mobility of all analyzed elements at the legacy NORM sites in comparison with the undisturbed 232Th-rich site. Similarly, the distribution coefficients Kd (232Th) and Kd (238U) suggested elevated dissolution, mobility and transportation at the legacy NORM sites, especially at the decommissioned Nb-mining site (346 and 100 L kg(-1) for 232Th and 238U, respectively), while the higher sorption of radionuclides was demonstrated at the undisturbed 232Th-rich site (10,672 and 506 L kg(-1) for 232Th and 238U, respectively). In general, although the concentration ranges of radionuclides and trace elements were similarly wide both at the legacy NORM and at the undisturbed 232Th-rich sites, the results of soil sequential extractions together with Kd values supported the expected differences between sites as the consequences of previous mining operations. Hence, mobility and possible elevated bioavailability at the legacy NORM site could be expected and further risk assessment should take this into account when decisions about the possible intervention measures are made.

Cytotoxicity, genotoxicity and oxidative stress of malachite green on the kidney and gill cell lines of freshwater air breathing fish Channa striata.

PubMed

Majeed, S Abdul; Nambi, K S N; Taju, G; Vimal, S; Venkatesan, C; Hameed, A S Sahul

2014-12-01

The cytotoxicity, genotoxicity and oxidative stress of malachite green (MG) was investigated using the fish Channa striata kidney (CSK) and Channa striata gill (CSG) cell lines. Five concentrations ranging from 0.001 to 10 μg mL(-1) were tested in three independent experiments. Cytotoxicity was assessed by 3-(4, 5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay, Rhodamine 123 and Alamar Blue. The mitochondrial changes and apoptosis of MG-exposed cells were observed by Rhodamine 123 and acridine orange/ethidium bromide (AO/EB) staining, respectively. In vitro potential DNA damaging effect of MG was tested using comet assay. Mitochondrial damage, apoptosis and DNA fragmentation increased in a concentration-dependent manner. Additionally, DNA electrophoretic mobility experiments were carried out to study the binding effect of MG to double-stranded DNA (dsDNA) of cells. DNA shift mobility experiments showed that MG is capable of strongly binding to linear dsDNA causing its degradation. Biochemical parameters such as lipid peroxidation (MDA), catalase (CAT) activity and reduced glutathione (GSH) levels were evaluated after exposure to MG. In CSK and CSG cell lines exposed to MG for 48 h, a significant increase in lipid peroxidation, which might be associated with decreased levels of reduced glutathione and catalase activity in these cell lines (p < 0.001), was observed.

Diepoxybutane Interstrand Cross-Links Induce DNA Bending

PubMed Central

Millard, Julie T.; McGowan, Erin E.; Bradley, Sharonda Q.

2011-01-01

The bifunctional alkylating agent 1,2,3,4-diepoxybutane (DEB) is thought to be a major contributor to the carcinogenicity of 1,3-butadiene, from which it is derived in vivo. DEB forms DNA interstrand cross-links primarily between distal deoxyguanosine residues at the duplex sequence 5’-GNC. In order for the short butanediol tether to span this distance, distortion of the DNA target has been postulated. We determined that the electrophoretic mobility of ligated DNA oligomers containing DEB cross-links was retarded in comparison with control, uncross-linked DNA. Our data are consistent with DNA bending of ~34° per lesion towards the major groove. PMID:21839139

NMR and enzymology of modified DNA/protein interactions

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kennedy, M.A.

1994-12-31

We have found distinct DNA structure and base dynamics precisely at the TpA cleavage site in the TTTAAA AHA III endonuclease restriction sequence. Hence, the unusual base stacking and mobility found in this sequence may be important to the mechanism of enzymatic cleavage of the phophodiester bond.

Divergent genome evolution caused by regional variation in DNA gain and loss between human and mouse

PubMed Central

Kortschak, R. Daniel

2018-01-01

The forces driving the accumulation and removal of non-coding DNA and ultimately the evolution of genome size in complex organisms are intimately linked to genome structure and organisation. Our analysis provides a novel method for capturing the regional variation of lineage-specific DNA gain and loss events in their respective genomic contexts. To further understand this connection we used comparative genomics to identify genome-wide individual DNA gain and loss events in the human and mouse genomes. Focusing on the distribution of DNA gains and losses, relationships to important structural features and potential impact on biological processes, we found that in autosomes, DNA gains and losses both followed separate lineage-specific accumulation patterns. However, in both species chromosome X was particularly enriched for DNA gain, consistent with its high L1 retrotransposon content required for X inactivation. We found that DNA loss was associated with gene-rich open chromatin regions and DNA gain events with gene-poor closed chromatin regions. Additionally, we found that DNA loss events tended to be smaller than DNA gain events suggesting that they were able to accumulate in gene-rich open chromatin regions due to their reduced capacity to interrupt gene regulatory architecture. GO term enrichment showed that mouse loss hotspots were strongly enriched for terms related to developmental processes. However, these genes were also located in regions with a high density of conserved elements, suggesting that despite high levels of DNA loss, gene regulatory architecture remained conserved. This is consistent with a model in which DNA gain and loss results in turnover or “churning” in regulatory element dense regions of open chromatin, where interruption of regulatory elements is selected against. PMID:29677183

Horizontal transfer of OC1 transposons in the Tasmanian devil.

PubMed

Gilbert, Clement; Waters, Paul; Feschotte, Cedric; Schaack, Sarah

2013-02-27

There is growing recognition that horizontal DNA transfer, a process known to be common in prokaryotes, is also a significant source of genomic variation in eukaryotes. Horizontal transfer of transposable elements (HTT) may be especially prevalent in eukaryotes given the inherent mobility, widespread occurrence, and prolific abundance of these elements in many eukaryotic genomes. Here, we provide evidence for a new case of HTT of the transposon family OposCharlie1 (OC1) in the Tasmanian devil, Sarcophilus harrisii. Bioinformatic analyses of OC1 sequences in the Tasmanian devil genome suggest that this transposon infiltrated the common ancestor of the Dasyuridae family ~17 million years ago. This estimate is corroborated by a PCR-based screen for the presence/absence of this family in Tasmanian devils and closely-related species. This case of HTT is the first to be reported in dasyurids. It brings the number of animal lineages independently invaded by OC1 to 12, and adds a fourth continent to the pandemic-like pattern of invasion of this transposon. In the context of these data, we discuss the evolutionary history of this transposon family and its potential impact on the diversification of marsupials.