Creating Coherent Incidental Learning Journeys on Smartphones Using Feedback and Progress Indicators: The SCAMP Framework

ERIC Educational Resources Information Center

Jones, Ann; Gaved, Mark; Kukulska-Hulme, Agnes; Scanlon, Eileen; Pearson, Charlie; Lameras, Petros; Dunwell, Ian; Jones, Jan

2014-01-01

Although the motivating role of feedback and progress indicators is understood in formal learning, their role in supporting incidental mobile learning is less well understood. In this paper we argue that well-designed feedback and progress indicators (FPIs) offer guidance and structure that may encourage mobile app users to move from fragmented…

Development of 2, 7-Diamino-1, 8-Naphthyridine (DANP) Anchored Hairpin Primers for RT-PCR Detection of Chikungunya Virus Infection

PubMed Central

Chen, Huixin; Parimelalagan, Mariya; Takei, Fumie; Hapuarachchi, Hapuarachchige Chanditha; Koay, Evelyn Siew-Chuan; Ng, Lee Ching; Ho, Phui San; Nakatani, Kazuhiko; Chu, Justin Jang Hann

2016-01-01

A molecular diagnostic platform with DANP-anchored hairpin primer was developed and evaluated for the rapid and cost-effective detection of Chikungunya virus (CHIKV) with high sensitivity and specificity. The molecule 2, 7-diamino-1, 8-naphthyridine (DANP) binds to a cytosine-bulge and emits fluorescence at 450 nm when it is excited by 400 nm light. Thus, by measuring the decline in fluorescence emitted from DANP—primer complexes after PCR reaction, we could monitor the PCR progress. By adapting this property of DANP, we have previously developed the first generation DANP-coupled hairpin RT-PCR assay. In the current study, we improved the assay performance by conjugating the DANP molecule covalently onto the hairpin primer to fix the DANP/primer ratio at 1:1; and adjusting the excitation emission wavelength to 365/430 nm to minimize the background signal and a ‘turn-on’ system is achieved. After optimizing the PCR cycle number to 30, we not only shortened the total assay turnaround time to 60 minutes, but also further reduced the background fluorescence. The detection limit of our assay was 0.001 PFU per reaction. The DANP-anchored hairpin primer, targeting nsP2 gene of CHIKV genome, is highly specific to CHIKV, having no cross-reactivity to a panel of other RNA viruses tested. In conclusion, we report here a molecular diagnostic assay that is sensitive, specific, rapid and cost effective for CHIKV detection and can be performed where no real time PCR instrumentation is required. Our results from patient samples indicated 93.62% sensitivity and 100% specificity of this method, ensuring that it can be a useful tool for rapid detection of CHIKV for outbreaks in many parts of the world. PMID:27571201

Development of 2, 7-Diamino-1, 8-Naphthyridine (DANP) Anchored Hairpin Primers for RT-PCR Detection of Chikungunya Virus Infection.

PubMed

Chen, Huixin; Parimelalagan, Mariya; Takei, Fumie; Hapuarachchi, Hapuarachchige Chanditha; Koay, Evelyn Siew-Chuan; Ng, Lee Ching; Ho, Phui San; Nakatani, Kazuhiko; Chu, Justin Jang Hann

2016-08-01

A molecular diagnostic platform with DANP-anchored hairpin primer was developed and evaluated for the rapid and cost-effective detection of Chikungunya virus (CHIKV) with high sensitivity and specificity. The molecule 2, 7-diamino-1, 8-naphthyridine (DANP) binds to a cytosine-bulge and emits fluorescence at 450 nm when it is excited by 400 nm light. Thus, by measuring the decline in fluorescence emitted from DANP-primer complexes after PCR reaction, we could monitor the PCR progress. By adapting this property of DANP, we have previously developed the first generation DANP-coupled hairpin RT-PCR assay. In the current study, we improved the assay performance by conjugating the DANP molecule covalently onto the hairpin primer to fix the DANP/primer ratio at 1:1; and adjusting the excitation emission wavelength to 365/430 nm to minimize the background signal and a 'turn-on' system is achieved. After optimizing the PCR cycle number to 30, we not only shortened the total assay turnaround time to 60 minutes, but also further reduced the background fluorescence. The detection limit of our assay was 0.001 PFU per reaction. The DANP-anchored hairpin primer, targeting nsP2 gene of CHIKV genome, is highly specific to CHIKV, having no cross-reactivity to a panel of other RNA viruses tested. In conclusion, we report here a molecular diagnostic assay that is sensitive, specific, rapid and cost effective for CHIKV detection and can be performed where no real time PCR instrumentation is required. Our results from patient samples indicated 93.62% sensitivity and 100% specificity of this method, ensuring that it can be a useful tool for rapid detection of CHIKV for outbreaks in many parts of the world.

Rasch Analysis: A Primer for School Psychology Researchers and Practitioners

ERIC Educational Resources Information Center

Boone, William J.; Noltemeyer, Amity

2017-01-01

In order to progress as a field, school psychology research must be informed by effective measurement techniques. One approach to address the need for careful measurement is Rasch analysis. This technique can (a) facilitate the development of instruments that provide useful data, (b) provide data that can be used confidently for both descriptive…

High School Graduation, Completion, and Dropout (GCD) Indicators: A Primer and Catalog

ERIC Educational Resources Information Center

Swanson, Christopher B.

2004-01-01

This catalog is concerned with the measurement of certain high school outcomes; specifically the progression of students through high school and the way in which students terminate their participation with the secondary education system. The catalog provides a basic inventory of the various methods for estimating high school graduation,…

A Primer-Test Centered Equating Method for Setting Cut-Off Scores

ERIC Educational Resources Information Center

Zhu, Weimo; Plowman, Sharon Ann; Park, Youngsik

2010-01-01

This study evaluated the use of a new primary field test method based on test equating to address inconsistent classification among field tests. We analyzed students' information on the Progressive Aerobic Cardiovascular Endurance Run (PACER), mile run (MR), and VO[subscript 2]max from three data sets (college: n = 94; middle school: n = 39;…

"It's Going to Kill Us!" and Other Myths about the Future of Artificial Intelligence

ERIC Educational Resources Information Center

Atkinson, Robert D.

2016-01-01

Given the promise that artificial intelligence (AI) holds for economic growth and societal advancement, it is critical that policymakers not only avoid retarding the progress of AI innovation, but also actively support its further development and use. This report provides a primer on artificial intelligence and debunks five prevailing myths that,…

The progression of disability among older adults in Mexico.

PubMed

Díaz-Venegas, Carlos; Reistetter, Timothy A; Wang, Ching-Yi; Wong, Rebeca

2016-10-01

This paper seeks to document the progression of disability in a developing country and to examine gender differences in this process. The data come from the Mexican Health and Aging Study (MHAS), a nationally representative sample of older adults. An ordinal logistic regression (n = 3283) is used to measure the progression of disability that considers: (1) no disability, (2) mobility problems, (3) mobility problems with IADLs limitations, (4) mobility problems with ADLs limitations, (5) combinations of the latter three and (6) death. Approximately 43% of the sample remained in the same level of disability after 2 years. The patterns of progression with two disabilities differ for men and women. Our model reflects the importance of separating ADLs and IADLs in the study of disability progression in Mexico. Varying risk profiles and cultural differences might influence the divergent disability paths followed by each gender. Implications for Rehabilitation The disablement process involving transitions from mobility impairments to IADL and ADL limitations seen in developed countries differs for older adults in Mexico. Cultural differences may influence the progression from non-disabled to becoming disabled in different ways for females in developing countries like Mexico. One-fifth of individuals showed greater function and independence over time, suggesting that the disablement process is reversible. This finding highlights the need to focus on improving mobility, ADL, and IADL skills to facilitate successful aging. Although disability is often conceptualised as a combination of ADL and IADL limitations, gender differences seen in Mexico indicate the need to separate ADL and IADL when developing approaches to prevent or ameliorate disability.

AirLab: a cloud-based platform to manage and share antibody-based single-cell research.

PubMed

Catena, Raúl; Özcan, Alaz; Jacobs, Andrea; Chevrier, Stephane; Bodenmiller, Bernd

2016-06-29

Single-cell analysis technologies are essential tools in research and clinical diagnostics. These methods include flow cytometry, mass cytometry, and other microfluidics-based technologies. Most laboratories that employ these methods maintain large repositories of antibodies. These ever-growing collections of antibodies, their multiple conjugates, and the large amounts of data generated in assays using specific antibodies and conditions makes a dedicated software solution necessary. We have developed AirLab, a cloud-based tool with web and mobile interfaces, for the organization of these data. AirLab streamlines the processes of antibody purchase, organization, and storage, antibody panel creation, results logging, and antibody validation data sharing and distribution. Furthermore, AirLab enables inventory of other laboratory stocks, such as primers or clinical samples, through user-controlled customization. Thus, AirLab is a mobile-powered and flexible tool that harnesses the capabilities of mobile tools and cloud-based technology to facilitate inventory and sharing of antibody and sample collections and associated validation data.

Safety and Feasibility of a Neuroscience Critical Care Program to Mobilize Patients With Primary Intracerebral Hemorrhage.

PubMed

Bahouth, Mona N; Power, Melinda C; Zink, Elizabeth K; Kozeniewski, Kate; Kumble, Sowmya; Deluzio, Sandra; Urrutia, Victor C; Stevens, Robert D

2018-06-01

To measure the impact of a progressive mobility program on patients admitted to a neurocritical critical care unit (NCCU) with intracerebral hemorrhage (ICH). The early mobilization of critically ill patients with spontaneous ICH is a challenge owing to the potential for neurologic deterioration and hemodynamic lability in the acute phase of injury. Patients admitted to the intensive care unit have been excluded from randomized trials of early mobilization after stroke. An interdisciplinary working group developed a formalized NCCU Mobility Algorithm that allocates patients to incremental passive or active mobilization pathways on the basis of level of consciousness and motor function. In a quasi-experimental consecutive group comparison, patients with ICH admitted to the NCCU were analyzed in two 6-month epochs, before and after rollout of the algorithm. Mobilization and safety endpoints were compared between epochs. NCCU in an urban, academic hospital. Adult patients admitted to the NCCU with primary intracerebral hemorrhage. Progressive mobilization after stroke using a formalized mobility algorithm. Time to first mobilization. The 2 groups of patients with ICH (pre-algorithm rolllout, n=28; post-algorithm rollout, n=29) were similar on baseline characteristics. Patients in the postintervention group were significantly more likely to undergo mobilization within the first 7 days after admission (odds ratio 8.7, 95% confidence interval 2.1, 36.6; P=.003). No neurologic deterioration, hypotension, falls, or line dislodgments were reported in association with mobilization. A nonsignificant difference in mortality was noted before and after rollout of the algorithm (4% vs 24%, respectively, P=.12). The implementation of a progressive mobility algorithm was safe and associated with a higher likelihood of mobilization in the first week after spontaneous ICH. Research is needed to investigate methods and the timing for the first mobilization in critically ill stroke patients. Copyright © 2018 American Congress of Rehabilitation Medicine. Published by Elsevier Inc. All rights reserved.

Information Operations Primer

DTIC Science & Technology

2011-11-01

Intelligence Community (IC). All contracts to support human -derived information gathering activities shall have proper USG oversight and undergo a policy...later in subsequent assignments. This booklet begins with an overview of Information Operations, Strategic Communication and Cyberspace Operations. At... communication related websites. Readers will note that many of the concepts, documents, and organizations are "works in progress" as DoD and the

A Primer on Vibrational Ball Bearing Feature Generation for Prognostics and Diagnostics Algorithms

DTIC Science & Technology

2015-03-01

Atlas -Marks (Cone-Shaped Kernel) ........................................................36 8.7.7 Hilbert-Huang Transform...bearing surface and eventually progress to the surface where the material will separate. Also known as pitting, spalling, or flaking. • Wear ...normal degradation caused by dirt and foreign particles causing abrasion of the contact surfaces over time resulting in alterations in the raceway and

NAVAIR Progress in Assessing, Validating and Implementing Non-Chromate Primers (Briefing charts)

DTIC Science & Technology

2011-02-09

logistics for any new coating or coating system NAVAIR Application Areas for Hexavalent Chromium Alternatives: Status Components/ Structure... Hexavalent chromium alternatives Sacrificial Coating Post Treatment MIL-A-8625 Anodize Avionics/ Electronics Magnesium/Titanium Conversion Aluminum Anodizing...Aluminum Pretreatment Type IC Seal Type IIB Seal Type II Seal Phosphating Rinse (Aluminum)Rinse (Steel) Cadmium Zinc-Nickel Aluminum Bonding Chrome

[Comparison of efficacy of tests for differentiation of typical and atypical strains of Yersinia pestis and Yersinia pseudotuberculosis].

PubMed

Arsen'eva, T E; Lebedeva, S A; Trukhachev, A L; Vasil'eva, E A; Ivanova, V S; Bozhko, N V

2010-01-01

To characterize species specificity of officially recommended tests for differentiation of Yersiniapestis and Yersinia pseudotuberculosis and propose additional tests allowing for more accurate identification. Natural, laboratory and typical strains oftwo Yersinia species were studied using microbiological, molecular and biochemical methods. For PCR species-specific primers complementary to certain fragments of chromosomal DNA of each species as well as to several plasmid genes of Y. pestis were used. It was shown that such attributes of Y. pestis as form of colonies, fermentation ofrhamnose, melibiose and urea, susceptibility to diagnostic phages, nutritional requirements could be lost in pestis bacterial species or detected in pseudotuberculosis species. Such attribute as mobility as well as positive result of CoA-reaction on fraction V antigen are more reliable. Guaranteed differentiation of typical and changed according to differential tests strains is provided only by PCR-analysis with primers vlml2for/ISrev216 and JS respectively, which are homologous to certain chromosome fragments of one of two Yersinia species.

Characterization of a nucleocapsid-like region and of two distinct primer tRNALys,2 binding sites in the endogenous retrovirus Gypsy.

PubMed

Gabus, Caroline; Ivanyi-Nagy, Roland; Depollier, Julien; Bucheton, Alain; Pelisson, Alain; Darlix, Jean-Luc

2006-01-01

Mobile LTR-retroelements comprising retroviruses and LTR-retrotransposons form a large part of eukaryotic genomes. Their mode of replication and abundance favour the notion that they are major actors in eukaryote evolution. The Gypsy retroelement can spread in the germ line of the fruit fly Drosophila melanogaster via both env-independent and env-dependent processes. Thus, Gypsy is both an active retrotransposon and an infectious retrovirus resembling the gammaretrovirus MuLV. However, unlike gammaretroviruses, the Gypsy Gag structural precursor is not processed into Matrix, Capsid and Nucleocapsid (NC) proteins. In contrast, it has features in common with Gag of the ancient yeast TY1 retroelement. These characteristics of Gypsy make it a very interesting model to study replication of a retroelement at the frontier between ancient retrotransposons and retroviruses. We investigated Gypsy replication using an in vitro model system and transfection of insect cells. Results show that an unstructured domain of Gypsy Gag has all the properties of a retroviral NC. This NC-like peptide forms ribonucleoparticle-like complexes upon binding Gypsy RNA and directs the annealing of primer tRNA(Lys,2) to two distinct primer binding sites (PBS) at the genome 5' and 3' ends. Only the 5' PBS is indispensable for cDNA synthesis in vitro and in Drosophila cells.

Characterization of a nucleocapsid-like region and of two distinct primer tRNALys,2 binding sites in the endogenous retrovirus Gypsy

PubMed Central

Gabus, Caroline; Ivanyi-Nagy, Roland; Depollier, Julien; Bucheton, Alain; Pelisson, Alain; Darlix, Jean-Luc

2006-01-01

Mobile LTR-retroelements comprising retroviruses and LTR-retrotransposons form a large part of eukaryotic genomes. Their mode of replication and abundance favour the notion that they are major actors in eukaryote evolution. The Gypsy retroelement can spread in the germ line of the fruit fly Drosophila melanogaster via both env-independent and env-dependent processes. Thus, Gypsy is both an active retrotransposon and an infectious retrovirus resembling the gammaretrovirus MuLV. However, unlike gammaretroviruses, the Gypsy Gag structural precursor is not processed into Matrix, Capsid and Nucleocapsid (NC) proteins. In contrast, it has features in common with Gag of the ancient yeast TY1 retroelement. These characteristics of Gypsy make it a very interesting model to study replication of a retroelement at the frontier between ancient retrotransposons and retroviruses. We investigated Gypsy replication using an in vitro model system and transfection of insect cells. Results show that an unstructured domain of Gypsy Gag has all the properties of a retroviral NC. This NC-like peptide forms ribonucleoparticle-like complexes upon binding Gypsy RNA and directs the annealing of primer tRNALys,2 to two distinct primer binding sites (PBS) at the genome 5′ and 3′ ends. Only the 5′ PBS is indispensable for cDNA synthesis in vitro and in Drosophila cells. PMID:17040893

Evaluation of a Progressive Mobility Protocol in Postoperative Cardiothoracic Surgical Patients.

PubMed

Floyd, Shawn; Craig, Sarah W; Topley, Darla; Tullmann, Dorothy

2016-01-01

Cardiothoracic surgical patients are at high risk for complications related to immobility, such as increased intensive care and hospital length of stay, intensive care unit readmission, pressure ulcer development, and deep vein thrombosis/pulmonary embolus. A progressive mobility protocol was started in the thoracic cardiovascular intensive care unit in a rural academic medical center. The purpose of the progressive mobility protocol was to increase mobilization of postoperative patients and decrease complications related to immobility in this unique patient population. A matched-pairs design was used to compare a randomly selected sample of the preintervention group (n = 30) to a matched postintervention group (n = 30). The analysis compared outcomes including intensive care unit and hospital length of stay, intensive care unit readmission occurrence, pressure ulcer prevalence, and deep vein thrombosis/pulmonary embolism prevalence between the 2 groups. Although this comparison does not achieve statistical significance (P < .05) for any of the outcomes measured, it does show clinical significance in a reduction in hospital length of stay, intensive care unit days, in intensive care unit readmission rate, and a decline in pressure ulcer prevalence, which is the overall goal of progressive mobility. This study has implications for nursing, hospital administration, and therapy services with regard to staffing and cost savings related to fewer complications of immobility. Future studies with a larger sample size and other populations are warranted.

Competitor internal standards for quantitative detection of mycoplasma DNA.

PubMed

Sidhu, M K; Rashidbaigi, A; Testa, D; Liao, M J

1995-05-01

Homologous internal controls were used as competitor DNA in the polymerase chain reaction for the quantitative detection of mycoplasma DNA. PCR primer sets were designed on the basis of the most conserved nucleotide sequences of the 16S rRNA gene of mycoplasma species. Amplification of this gene was examined in five different mycoplasma species: Mycoplasma orale, M. hyorhinus, M. synoviae, M. gallisepticum and M. pneumoniae. To evaluate the primers, a number of different cell lines were assayed for the detection of mycoplasma infections. All positive cell lines showed a distinct product on agarose gels while uninfected cells showed no DNA amplification. Neither bacterial nor eukaryotic DNA produced any cross-reaction with the primers used, thus confirming their specificity. Internal control DNA to be used for quantitation was constructed by modifying the sizes of the wild-type amplified products and cloning them in plasmid vectors. These controls used the same primer binding sites as the wild-type and the amplified products were differentiated by a size difference. The detection limits for all the mycoplasma species by competitive quantitative PCR were estimated to range from 4 to 60 genome copies per assay as determined by ethidium bromide-stained agarose gels. These internal standards also serve as positive controls in PCR-based detection of mycoplasma DNA, and therefore accidental contamination of test samples with wild-type positive controls can be eliminated. The quantitative PCR method developed will be useful in monitoring the progression and significance of mycoplasma in the disease process.

SciDAC-3: Searching for Physics Beyond the Standard Model, University of Arizona component, Year 2 progress report

DOE Office of Scientific and Technical Information (OSTI.GOV)

Toussaint, Doug

2014-03-21

The Arizona component of the SciDAC-3 Lattice Gauge Theory program consisted of partial support for a postdoctoral position. In the original budget this covered three fourths of a postdoc, but the University of Arizona changed its ERE rate for postdoctoral positions from 4.3% to 21%, so the support level was closer to two-thirds of a postdoc. The grant covered the work of postdoc Thomas Primer. Dr. Primer's first task was an urgent one, although it was not forseen in our proposed work. It turned out that on the large lattices used in some of our current computations the gauge fixingmore » code was not working as expected, and this revealed itself in inconsistent results in the correlators needed to compute the semileptonic form factors for K and D decays. Dr. Primer participated in the effort to understand this problem and to modify our codes to deal with the large lattices we are now generating (as large as 144 3 x 288). Corrected code was incorporated in our standard codes, and workarounds that allow us to use the correlators already computed with the unexpected gauge fixing were been implemented.« less

Current advances in molecular methods for detection of nitrite-dependent anaerobic methane oxidizing bacteria in natural environments.

PubMed

Chen, Jing; Dick, Richard; Lin, Jih-Gaw; Gu, Ji-Dong

2016-12-01

Nitrite-dependent anaerobic methane oxidation (n-damo) process uniquely links microbial nitrogen and carbon cycles. Research on n-damo bacteria progresses quickly with experimental evidences through enrichment cultures. Polymerase chain reaction (PCR)-based methods for detecting them in various natural ecosystems and engineered systems play a very important role in the discovery of their distribution, abundance, and biodiversity in the ecosystems. Important characteristics of n-damo enrichments were obtained and their key significance in microbial nitrogen and carbon cycles was investigated. The molecular methods currently used in detecting n-damo bacteria were comprehensively reviewed and discussed for their strengths and limitations in applications with a wide range of samples. The pmoA gene-based PCR primers for n-damo bacterial detection were evaluated and, in particular, several incorrectly stated PCR primer nucleotide sequences in the published papers were also pointed out to allow correct applications of the PCR primers in current and future investigations. Furthermore, this review also offers the future perspectives of n-damo bacteria based on current information and methods available for a better acquisition of new knowledge about this group of bacteria.

Mobile Usability in Educational Contexts: What Have We Learnt?

ERIC Educational Resources Information Center

Kukulska-Hulme, Agnes

2007-01-01

The successful development of mobile learning is dependent on human factors in the use of new mobile and wireless technologies. The majority of mobile learning activity continues to take place on devices that were not designed with educational applications in mind, and usability issues are often reported. The paper reflects on progress in…

Use of optokinetics based OKCSIB protocol in restoring mobility in primary progressive MS.

PubMed

Chitambira, Benjamin; McConaghy, Ciara

2017-10-04

The case is of a mid-40s patient who developed progressive muscle weakness and loss of mobility over 6 weeks due to primary progressive multiple sclerosis. 2.5 days before admission, she became bed bound with weakness of 1/5 on the Oxford scale. She normally rested for a couple of days after similar periods of worsening symptoms and then got back on her feet although with worse balance. She was treated with optokinetic chart stimulation and sensory interaction for balance (OKCSIB) protocol. Within 2 days of intervention, she was mobile with a delta frame and supervision of one. By the end of a week, she was independently mobile with her delta frame. It is recommended that instead of just practising function, the OKCSIB protocol be used to regain antigravity extensor control loss of which leads to deteriorating function in neurological conditions. © BMJ Publishing Group Ltd (unless otherwise stated in the text of the article) 2017. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

Learning to Fish with Genetics: A Primer on the Vertebrate Model Danio rerio

PubMed Central

Holtzman, Nathalia G.; Iovine, M. Kathryn; Liang, Jennifer O.; Morris, Jacqueline

2016-01-01

In the last 30 years, the zebrafish has become a widely used model organism for research on vertebrate development and disease. Through a powerful combination of genetics and experimental embryology, significant inroads have been made into the regulation of embryonic axis formation, organogenesis, and the development of neural networks. Research with this model has also expanded into other areas, including the genetic regulation of aging, regeneration, and animal behavior. Zebrafish are a popular model because of the ease with which they can be maintained, their small size and low cost, the ability to obtain hundreds of embryos on a daily basis, and the accessibility, translucency, and rapidity of early developmental stages. This primer describes the swift progress of genetic approaches in zebrafish and highlights recent advances that have led to new insights into vertebrate biology. PMID:27384027

A primer on the molecular virology of hepatitis C.

PubMed

Moradpour, Darius; Blum, Hubert E

2004-12-01

Exciting advances have recently been made in the understanding of the molecular virology of hepatitis C. Powerful model systems have been developed that allow to systematically dissect important steps of the hepatitis C virus (HCV) life cycle. These include new systems for functional analyses of the HCV glycoproteins, providing insights into possible HCV receptors and cell entry mechanisms, and the replicon system, which has revolutionized investigation of HCV RNA replication and has facilitated drug discovery efforts. The largest gaps remain in the understanding of the virion structure and the processes that lead to the assembly, packaging and release of virions. However, given the pace of current HCV research, progress in these directions may be expected in the near future. Here, we provide a primer on the molecular virology of hepatitis C, with particular reference to novel antiviral targets and therapeutic strategies.

A Sharing Mind Map-Oriented Approach to Enhance Collaborative Mobile Learning with Digital Archiving Systems

ERIC Educational Resources Information Center

Chang, Jui-Hung; Chiu, Po-Sheng; Huang, Yueh-Min

2018-01-01

With the advances in mobile network technology, the use of portable devices and mobile networks for learning is not limited by time and space. Such use, in combination with appropriate learning strategies, can achieve a better effect. Despite the effectiveness of mobile learning, students' learning direction, progress, and achievement may differ.…

Influence of muscle strength on early mobility in critically ill adult patients: Systematic literature review.

PubMed

Roberson, Audrey R; Starkweather, Angela; Grossman, Catherine; Acevedo, Edmund; Salyer, Jeanne

Muscle strength may be one indicator of readiness to mobilize that can be used to guide decisions regarding early mobility efforts and to progressively advance mobilization. To provide a synthesis of current measures of muscle strength in the assessment of early mobilization in critically ill adult patients who are receiving MV therapy. Research studies conducted between 2000-2015 were identified using PubMed, CINHAL, MEDLINE, and the Cochrane Database of Systematic Reviews databases using the search terms "muscle strength", "intensive care", "mechanical ventilation" and "muscle weakness". Nine articles used manual muscle testing, the Medical Research Council scale and/or hand-held dynamometer to provide objective measures for assessing muscle strength in the critically ill adult patient population. Further research is needed to examine the application of standardized measures of muscle strength for guiding decisions regarding early and progressive advancement of mobility goals in adult ICU patients on MV. Copyright © 2017 Elsevier Inc. All rights reserved.

The Impact of the Rate and Variety of Uses of Fixed and Mobile Broadband on the Progress of CPE: A Chartered Accountant's Perspective

ERIC Educational Resources Information Center

Rawashdeh, Awni; Al-namlah, Lamia

2015-01-01

To examine the impact of the usage of fixed and mobile broadband on the progress of continuing professional education (CPE) from the perspective of chartered accountants in Saudi Arabia, an e-mail survey was conducted. A random sampling of chartered accountants in Saudi Arabia was investigated. This research was aimed to identify any correlation…

Defective human T-cell lymphotropic virus type I (HTLV-I) provirus in seronegative tropical spastic paraparesis/HTLV-I-associated myelopathy (TSP/HAM) patients.

PubMed

Ramirez, E; Fernandez, J; Cartier, L; Villota, C; Rios, M

2003-02-01

Infection with human T-cell lymphotropic virus type I (HTLV-I) have been associated with the development of the tropical spastic paraparesis/HTLV-I-associated myelopathy (TSP/HAM). We studied the presence of HTLV-I provirus in peripheral blood mononuclear cells (PBMC) from 72 Chilean patients with progressive spastic paraparesis by polymerase chain reaction: 32 seropositive and 40 seronegative cases. We amplified different genomic regions of HTLV-I using primers of 5' ltr, tax, env/tax, pX, pol and env genes. These genes were detected from all seropositive patients. The seronegative patients were negative with 5' ltr, pol, env, and pX primers. However, amplified product of tax and env/tax genes was detected from 16 and four seronegative patients, respectively. Three of them were positive with both genetic regions. The results of this study show that the complete HTLV-I provirus is found in 100% of seropositive cases. In seronegative cases, clinically very similar of seropositive cases, was found only tax gene in 42.5% (17/40) of patients. These results suggest the presence of a defective HTLV-I provirus in some seronegative patients with progressive spastic paraparesis, and suggest a pathogenic role of this truncate provirus for a group of TSP/HAM.

The Social Mobility Index: Further Information

ERIC Educational Resources Information Center

Sutton Trust, 2015

2015-01-01

The "Social Mobility Index" ranks all 533 parliamentary constituencies in England according to five measures of social mobility through education: (1) Performance of disadvantaged pupils in early years test; (2) Performance of disadvantaged pupils in Key Stage 2 tests; (3) Performance of disadvantaged pupils at GCSE; (4) Progress of…

Learners on the Move: Mobile Modalities in Development Studies

ERIC Educational Resources Information Center

Beckmann, Elizabeth A.

2010-01-01

Many careers involve mobile lifestyles, yet require specialised postgraduate qualifications for career progression. Mobile technologies offer new opportunities by providing more choice in when, where, and how students learn. Experiences in an Australian postgraduate development studies program illustrate the choices. Three key issues are explored:…

The replisome uses mRNA as a primer after colliding with RNA polymerase.

PubMed

Pomerantz, Richard T; O'Donnell, Mike

2008-12-11

Replication forks are impeded by DNA damage and protein-nucleic acid complexes such as transcribing RNA polymerase. For example, head-on collision of the replisome with RNA polymerase results in replication fork arrest. However, co-directional collision of the replisome with RNA polymerase has little or no effect on fork progression. Here we examine co-directional collisions between a replisome and RNA polymerase in vitro. We show that the Escherichia coli replisome uses the RNA transcript as a primer to continue leading-strand synthesis after the collision with RNA polymerase that is displaced from the DNA. This action results in a discontinuity in the leading strand, yet the replisome remains intact and bound to DNA during the entire process. These findings underscore the notable plasticity by which the replisome operates to circumvent obstacles in its path and may explain why the leading strand is synthesized discontinuously in vivo.

Empowering Learners with Mobile Open-Access Learning Initiatives

ERIC Educational Resources Information Center

Mills, Michael, Ed.; Wake, Donna, Ed.

2017-01-01

Education has been progressing at a rapid pace ever since educators have been able to harness the power of mobile technology. Open-access learning techniques provide more students with the opportunity to engage in educational opportunities that may have been previously restricted. "Empowering Learners with Mobile Open-Access Learning…

40 CFR 52.473 - Conditional approval.

Code of Federal Regulations, 2010 CFR

2010-07-01

...-progress plan to provide MOBILE6-based mobile source emission budgets and adopted measures sufficient to... threshold to 25 tons per year. (9) Revises Reasonably Available Control Technology (RACT) rules to include...

The influence of direct mobile phone radiation on sperm quality.

PubMed

Gorpinchenko, Igor; Nikitin, Oleg; Banyra, Oleg; Shulyak, Alexander

2014-01-01

It is impossible to imagine a modern socially-active man who does not use mobile devices and/or computers with Wi-Fi function. The effect of mobile phone radiation on male fertility is the subject of recent interest and investigations. The aim of this study was to investigate the direct in vitro influence of mobile phone radiation on sperm DNA fragmentation and motility parameters in healthy subjects with normozoospermia. 32 healthy men with normal semen parameters were selected for the study. Each sperm sample was divided into two equal portions (A and B). Portions A of all involved men were placed for 5 hours in a thermostat, and portions B were placed into a second thermostat for the same period of time, where a mobile phone in standby/talk mode was placed. After 5 hours of incubation the sperm samples from both thermostats were re-evaluated regarding basic motility parameters. The presence of DNA fragmentation in both A and B portions of each sample was determined each hour using a standard sperm chromatin dispersion test. The number of spermatozoa with progressive movement in the group, influenced by electromagnetic radiation, is statistically lower than the number of spermatozoa with progressive movement in the group under no effect of the mobile phone. The number of non-progressive movement spermatozoa was significantly higher in the group, which was influenced by cell phone radiation. The DNA fragmentation was also significantly higher in this group. A correlation exists between mobile phone radiation exposure, DNA-fragmentation level and decreased sperm motility.

The influence of direct mobile phone radiation on sperm quality

PubMed Central

Gorpinchenko, Igor; Nikitin, Oleg; Shulyak, Alexander

2014-01-01

Introduction It is impossible to imagine a modern socially–active man who does not use mobile devices and/or computers with Wi–Fi function. The effect of mobile phone radiation on male fertility is the subject of recent interest and investigations. The aim of this study was to investigate the direct in vitro influence of mobile phone radiation on sperm DNA fragmentation and motility parameters in healthy subjects with normozoospermia. Material and methods 32 healthy men with normal semen parameters were selected for the study. Each sperm sample was divided into two equal portions (A and B). Portions A of all involved men were placed for 5 hours in a thermostat, and portions B were placed into a second thermostat for the same period of time, where a mobile phone in standby/talk mode was placed. After 5 hours of incubation the sperm samples from both thermostats were re–evaluated regarding basic motility parameters. The presence of DNA fragmentation in both A and B portions of each sample was determined each hour using a standard sperm chromatin dispersion test. Results The number of spermatozoa with progressive movement in the group, influenced by electromagnetic radiation, is statistically lower than the number of spermatozoa with progressive movement in the group under no effect of the mobile phone. The number of non–progressive movement spermatozoa was significantly higher in the group, which was influenced by cell phone radiation. The DNA fragmentation was also significantly higher in this group. Conclusions A correlation exists between mobile phone radiation exposure, DNA–fragmentation level and decreased sperm motility. PMID:24982785

Characterization of Aspergillus flavus strains from Brazilian Brazil nuts and cashew by RAPD and ribosomal DNA analysis.

PubMed

Midorikawa, G E O; Pinheiro, M R R; Vidigal, B S; Arruda, M C; Costa, F F; Pappas, G J; Ribeiro, S G; Freire, F; Miller, R N G

2008-07-01

The aim of this study was to determine the genetic variability in Aspergillus flavus populations from Brazil nut and cashew and develop a polymerase chain reaction (PCR) detection method. Chomatography analysis of 48 isolates identified 36 as aflatoxigenic (75%). One hundred and forty-one DNA bands were generated with 11 random amplified polymorphic DNA (RAPD) primers and analysed via unweighted pair group analysis, using arithmetic means (UPGMA). Isolates grouped according to host, with differentiation of those from A. occidentale also according to geographical origin. Aspergillus flavus-specific PCR primers ASPITSF2 and ASPITSR3 were designed from ribosomal DNA internal transcribed spacers (ITS 1 and 2), and an internal amplification control was developed, to prevent false negative results. Specificity to only A. flavus was confirmed against DNA from additional aspergilli and other fungi. RAPD-based characterization differentiated isolates according to plant host. The PCR primer pair developed showed specificity to A. flavus, with a detection limit of 10 fg. Genetic variability observed in A. flavus isolates from two Brazilian agroecosystems suggested reproductive isolation. The PCR detection method developed for A. flavus represents progress towards multiplex PCR detection of aflatoxigenic and nonaflatoxigenic strains in Hazard Analysis Critical Control Point systems.

Is It Aulua or Education Dressed up in "Kastom"? A Report on the Ongoing Negotiation of Literacy and Identity in a Ni Vanuatu Community

ERIC Educational Resources Information Center

Paviour-Smith, Martin

2005-01-01

This paper reports on two critical incidents in the progress towards implementing a vernacular language programme in the village school at Aulua, Malakula, in Vanuatu. In stage one of the fieldwork, (2000-1) an orthography was created by a committee. An element of the second stage of the project (2004-5) was a workshop to create the primers and…

Does Using Mobile Device Applications Lead to Learning?

ERIC Educational Resources Information Center

Vogel, Doug; Kennedy, David; Kwok, Ron Chi-Wai

2009-01-01

Assessing the impact on learning of the use of mobile devices and associated applications is a complex challenge. This article reports on progress to date in a longitudinal study using a design research approach with three cohorts of 800 students each. Results are encouraging in terms of learning enhancement through select mobile application by a…

The Relationship between School Mobility and the Acquisition of Early Literacy Skills

ERIC Educational Resources Information Center

Franco, Amy C.

2013-01-01

The relationship between frequent mobility and student achievement is complex. While studies have shown that frequent mobility may have a detrimental effect on student achievement, the suggestion that poverty is an underlying cause for poor academic progress has been proposed (Buerkle & Christenson, 1999; United States GAO Report, 2010). The…

Exploring Students' Progression in an Inquiry Science Curriculum Enabled by Mobile Learning

ERIC Educational Resources Information Center

Looi, Chee-Kit; Sun, Daner; Xie, Wenting

2015-01-01

The research literature reports on designs of ubiquitous and seamless learning environments enabled by the integration of mobile technology into learning. However, the lack of good pedagogical designs that provide for sustainability and the inadequate investigation of learning outcomes remain major gaps in the current studies on mobile learning.…

Mobile Multicast in Hierarchical Proxy Mobile IPV6

NASA Astrophysics Data System (ADS)

Hafizah Mohd Aman, Azana; Hashim, Aisha Hassan A.; Mustafa, Amin; Abdullah, Khaizuran

2013-12-01

Mobile Internet Protocol Version 6 (MIPv6) environments have been developing very rapidly. Many challenges arise with the fast progress of MIPv6 technologies and its environment. Therefore the importance of improving the existing architecture and operations increases. One of the many challenges which need to be addressed is the need for performance improvement to support mobile multicast. Numerous approaches have been proposed to improve mobile multicast performance. This includes Context Transfer Protocol (CXTP), Hierarchical Mobile IPv6 (HMIPv6), Fast Mobile IPv6 (FMIPv6) and Proxy Mobile IPv6 (PMIPv6). This document describes multicast context transfer in hierarchical proxy mobile IPv6 (H-PMIPv6) to provide better multicasting performance in PMIPv6 domain.

The Economic and Clinical Impact of Sustained Use of a Progressive Mobility Program in a Neuro-ICU.

PubMed

Hester, Jeannette M; Guin, Peggy R; Danek, Gale D; Thomas, Jaime R; Titsworth, William L; Reed, Richard K; Vasilopoulos, Terrie; Fahy, Brenda G

2017-06-01

To investigate a progressive mobility program in a neurocritical care population with the hypothesis that the benefits and outcomes of the program (e.g., decreased length of stay) would have a significant positive economic impact. Retrospective analysis of economic and clinical outcome data before, immediately following, and 2 years after implementation of the Progressive Upright Mobility Protocol Plus program (UF Health Shands Hospital, Gainesville, FL) involving a series of planned movements in a sequential manner with an additional six levels of rehabilitation in the neuro-ICU at UF Health Shands Hospital. Thirty-bed neuro-ICU in an academic medical center. Adult neurologic and neurosurgical patients: 1,118 patients in the pre period, 731 patients in the post period, and 796 patients in the sustained period. Implementation of Progressive Upright Mobility Protocol Plus. ICU length of stay decreased from 6.5 to 5.8 days in the immediate post period and 5.9 days in the sustained period (F(2,2641) = 3.1; p = 0.045). Hospital length of stay was reduced from 11.3 ± 14.1 days to 8.6 ± 8.8 post days and 8.8 ± 9.3 days sustained (F(2,2641) = 13.0; p < 0.001). The impact of the study intervention on ICU length of stay (p = 0.031) and hospital length of stay (p < 0.001) remained after adjustment for age, sex, diagnoses, sedation, and ventilation. Hospital-acquired infections were reduced by 50%. Average total cost per patient after adjusting for inflation was significantly reduced by 16% (post period) and 11% (sustained period) when compared with preintervention (F(2,2641) = 3.1; p = 0.045). Overall, these differences translated to an approximately $12.0 million reduction in direct costs from February 2011 through the end of 2013. An ongoing progressive mobility program in the neurocritical care population has clinical and financial benefits associated with its implementation and should be considered.

Security Issues for Mobile Medical Imaging: A Primer.

PubMed

Choudhri, Asim F; Chatterjee, Arindam R; Javan, Ramin; Radvany, Martin G; Shih, George

2015-10-01

The end-user of mobile device apps in the practice of clinical radiology should be aware of security measures that prevent unauthorized use of the device, including passcode policies, methods for dealing with failed login attempts, network manager-controllable passcode enforcement, and passcode enforcement for the protection of the mobile device itself. Protection of patient data must be in place that complies with the Health Insurance Portability and Accountability Act and U.S. Federal Information Processing Standards. Device security measures for data protection include methods for locally stored data encryption, hardware encryption, and the ability to locally and remotely clear data from the device. As these devices transfer information over both local wireless networks and public cell phone networks, wireless network security protocols, including wired equivalent privacy and Wi-Fi protected access, are important components in the chain of security. Specific virtual private network protocols, Secure Sockets Layer and related protocols (especially in the setting of hypertext transfer protocols), native apps, virtual desktops, and nonmedical commercial off-the-shelf apps require consideration in the transmission of medical data over both private and public networks. Enterprise security and management of both personal and enterprise mobile devices are discussed. Finally, specific standards for hardware and software platform security, including prevention of hardware tampering, protection from malicious software, and application authentication methods, are vital components in establishing a secure platform for the use of mobile devices in the medical field. © RSNA, 2015.

The Impact of Aerobic Exercise on Fronto-Parietal Network Connectivity and Its Relation to Mobility: An Exploratory Analysis of a 6-Month Randomized Controlled Trial.

PubMed

Hsu, Chun L; Best, John R; Wang, Shirley; Voss, Michelle W; Hsiung, Robin G Y; Munkacsy, Michelle; Cheung, Winnie; Handy, Todd C; Liu-Ambrose, Teresa

2017-01-01

Impaired mobility is a major concern for older adults and has significant consequences. While the widely accepted belief is that improved physical function underlies the effectiveness of targeted exercise training in improving mobility and reducing falls, recent evidence suggests cognitive and neural benefits gained through exercise may also play an important role in promoting mobility. However, the underlying neural mechanisms of this relationship are currently unclear. Thus, we hypothesize that 6 months of progressive aerobic exercise training would alter frontoparietal network (FPN) connectivity during a motor task among older adults with mild subcortical ischemic vascular cognitive impairment (SIVCI)-and exercise-induced changes in FPN connectivity would correlate with changes in mobility. We focused on the FPN as it is involved in top-down attentional control as well as motor planning and motor execution. Participants were randomized either to usual-care (CON), which included monthly educational materials about VCI and healthy diet; or thrice-weekly aerobic training (AT), which was walking outdoors with progressive intensity. Functional magnetic resonance imaging was acquired at baseline and trial completion, where the participants were instructed to perform bilateral finger tapping task. At trial completion, compared with AT, CON showed significantly increased FPN connectivity strength during right finger tapping ( p < 0.05). Across the participants, reduced FPN connectivity was associated with greater cardiovascular capacity ( p = 0.05). In the AT group, reduced FPN connectivity was significantly associated with improved mobility performance, as measured by the Timed-Up-and-Go test ( r = 0.67, p = 0.02). These results suggest progressive AT may improve mobility in older adults with SIVCI via maintaining intra-network connectivity of the FPN.

Pupil Mobility, Attainment, and Progress during Key Stage 1: A Study in Cautious Interpretation.

ERIC Educational Resources Information Center

Strand, Steve

2002-01-01

Explores association between pupil mobility and attainment in national end of Key Stage 1 tests for 6000+ pupils in an English urban education authority. Indicates pupil mobility during the early years is associated with significantly lower levels of pupil attainment in reading, writing, and mathematics tests at age seven. (BT)

Teachers and Students Poised to Use Mobile Phones in the Classroom

ERIC Educational Resources Information Center

O'Bannon, B. W.; Waters, S.; Lubke, J.; Cady, J.; Rearden, K.

2017-01-01

This study examined the perceptions of 15 teachers and 103 middle school students at a progressive private school located in Mumbai, India to determine their support for the use of mobile phones in the classroom, their perceptions of the mobile phone features that are beneficial for school-related work, and the instructional benefits and barriers…

Mobile Devices and Mobile Learning: Shifting the Mindset of Teachers and Learners

ERIC Educational Resources Information Center

Smith, Philippa K.; Grant, Lynn; Conway, Clare; Narayan, Vickel

2016-01-01

Incorporating new media technologies that enable mobile learning to be part of educational practice poses challenges to those used to teaching in a traditional classroom environment. In this article three lecturers and a learning advisor from a New Zealand university reflect on their experiences in the progressive redesign of a Bachelor of Arts…

Pupil Mobility, Attainment and Progress in Primary School

ERIC Educational Resources Information Center

Strand, Steve; Demie, Feyisa

2006-01-01

This article presents an analysis of the association between pupil mobility and educational attainment in the 2002 national end of Key Stage 2 (KS2) tests for 11-year-old pupils in an inner London education authority. The results show that pupil mobility is strongly associated with low attainment in the end of key stage tests. However, the…

Seamless Connection between Learning and Assessment--Applying Progressive Learning Tasks in Mobile Ecology Inquiry

ERIC Educational Resources Information Center

Hung, Pi-Hsia; Hwang, Gwo-Jen; Lin, Yu-Fen; Wu, Tsung-Hsun; Su, I-Hsiang

2013-01-01

Mobile learning has been recommended for motivating students on field trips; nevertheless, owing to the complexity and the richness of the learning resources from both the real-world and the digital-world environments, information overload remains one of the major concerns. Most mobile learning designs provide feedback only for multiple choice…

Primer-BLAST: A tool to design target-specific primers for polymerase chain reaction

PubMed Central

2012-01-01

Background Choosing appropriate primers is probably the single most important factor affecting the polymerase chain reaction (PCR). Specific amplification of the intended target requires that primers do not have matches to other targets in certain orientations and within certain distances that allow undesired amplification. The process of designing specific primers typically involves two stages. First, the primers flanking regions of interest are generated either manually or using software tools; then they are searched against an appropriate nucleotide sequence database using tools such as BLAST to examine the potential targets. However, the latter is not an easy process as one needs to examine many details between primers and targets, such as the number and the positions of matched bases, the primer orientations and distance between forward and reverse primers. The complexity of such analysis usually makes this a time-consuming and very difficult task for users, especially when the primers have a large number of hits. Furthermore, although the BLAST program has been widely used for primer target detection, it is in fact not an ideal tool for this purpose as BLAST is a local alignment algorithm and does not necessarily return complete match information over the entire primer range. Results We present a new software tool called Primer-BLAST to alleviate the difficulty in designing target-specific primers. This tool combines BLAST with a global alignment algorithm to ensure a full primer-target alignment and is sensitive enough to detect targets that have a significant number of mismatches to primers. Primer-BLAST allows users to design new target-specific primers in one step as well as to check the specificity of pre-existing primers. Primer-BLAST also supports placing primers based on exon/intron locations and excluding single nucleotide polymorphism (SNP) sites in primers. Conclusions We describe a robust and fully implemented general purpose primer design tool that designs target-specific PCR primers. Primer-BLAST offers flexible options to adjust the specificity threshold and other primer properties. This tool is publicly available at http://www.ncbi.nlm.nih.gov/tools/primer-blast. PMID:22708584

Matematicas Para El Primer Ciclo Secundario, Volumen II (Parte 2). Traduccion Preliminar de la Edicion en Ingles Revisada. (Mathematics for Junior High School, Volume II, Part 2. Preliminary Translation of the Revised English Edition).

ERIC Educational Resources Information Center

Anderson, R. D.; And Others

This is part two of a two-part SMSG mathematics text for junior high school students. Key ideas emphasized are structure of arithmetic from an algebraic viewpoint, the real number system as a progressing development, and metric and non-metric relations in geometry. Chapter topics include real numbers, similar triangles, variation, polyhedrons,…

Diabetic kidney disease.

PubMed

Thomas, Merlin C; Brownlee, Michael; Susztak, Katalin; Sharma, Kumar; Jandeleit-Dahm, Karin A M; Zoungas, Sophia; Rossing, Peter; Groop, Per-Henrik; Cooper, Mark E

2015-07-30

The kidney is arguably the most important target of microvascular damage in diabetes. A substantial proportion of individuals with diabetes will develop kidney disease owing to their disease and/or other co-morbidity, including hypertension and ageing-related nephron loss. The presence and severity of chronic kidney disease (CKD) identify individuals who are at increased risk of adverse health outcomes and premature mortality. Consequently, preventing and managing CKD in patients with diabetes is now a key aim of their overall management. Intensive management of patients with diabetes includes controlling blood glucose levels and blood pressure as well as blockade of the renin-angiotensin-aldosterone system; these approaches will reduce the incidence of diabetic kidney disease and slow its progression. Indeed, the major decline in the incidence of diabetic kidney disease (DKD) over the past 30 years and improved patient prognosis are largely attributable to improved diabetes care. However, there remains an unmet need for innovative treatment strategies to prevent, arrest, treat and reverse DKD. In this Primer, we summarize what is now known about the molecular pathogenesis of CKD in patients with diabetes and the key pathways and targets implicated in its progression. In addition, we discuss the current evidence for the prevention and management of DKD as well as the many controversies. Finally, we explore the opportunities to develop new interventions through urgently needed investment in dedicated and focused research. For an illustrated summary of this Primer, visit: http://go.nature.com/NKHDzg.

[Progress in research of mobile health intervention].

PubMed

Huang, Z; Ning, P S; Cheng, P X; Hu, G Q

2016-10-10

With the rapid development of mobile communication technology and the growing popularity of smartphones worldwide, mobile health has become an extension of e-Health and Tele-Health, and is of value in the research and practice of public health. In this paper, we systematically assessed research literature of mobile health' s application on disease prevention and control as well as health promotion. Based on the characteristics of current literature, this paper focused on the application of mobile health in maternal health promotion, chronic disease management, and communicable disease prevention and control to provide reference for the mobile health intervention research in China.

PrimerDesign-M: A multiple-alignment based multiple-primer design tool for walking across variable genomes

DOE PAGES

Yoon, Hyejin; Leitner, Thomas

2014-12-17

Analyses of entire viral genomes or mtDNA requires comprehensive design of many primers across their genomes. In addition, simultaneous optimization of several DNA primer design criteria may improve overall experimental efficiency and downstream bioinformatic processing. To achieve these goals, we developed PrimerDesign-M. It includes several options for multiple-primer design, allowing researchers to efficiently design walking primers that cover long DNA targets, such as entire HIV-1 genomes, and that optimizes primers simultaneously informed by genetic diversity in multiple alignments and experimental design constraints given by the user. PrimerDesign-M can also design primers that include DNA barcodes and minimize primer dimerization. PrimerDesign-Mmore » finds optimal primers for highly variable DNA targets and facilitates design flexibility by suggesting alternative designs to adapt to experimental conditions.« less

FY2017 Energy Efficient Mobility Systems Annual Progress Report

DOE Office of Scientific and Technical Information (OSTI.GOV)

None

During fiscal year 2017 (FY 2017), the U.S. Department of Energy (DOE) Vehicle Technologies Office (VTO) created the Energy Efficient Mobility Systems (EEMS) Program to understand the range of mobility futures that could result from these disruptive technologies and services, and to create solutions that improve mobility energy productivity, or the value derived from the transportation system per unit of energy consumed. Increases in mobility energy productivity result from improvements in the quality or output of the transportation system, and/or reductions in the energy used for transportation.

Recent progress in high-mobility thin-film transistors based on multilayer 2D materials

NASA Astrophysics Data System (ADS)

Hong, Young Ki; Liu, Na; Yin, Demin; Hong, Seongin; Kim, Dong Hak; Kim, Sunkook; Choi, Woong; Yoon, Youngki

2017-04-01

Two-dimensional (2D) layered semiconductors are emerging as promising candidates for next-generation thin-film electronics because of their high mobility, relatively large bandgap, low-power switching, and the availability of large-area growth methods. Thin-film transistors (TFTs) based on multilayer transition metal dichalcogenides or black phosphorus offer unique opportunities for next-generation electronic and optoelectronic devices. Here, we review recent progress in high-mobility transistors based on multilayer 2D semiconductors. We describe the theoretical background on characterizing methods of TFT performance and material properties, followed by their applications in flexible, transparent, and optoelectronic devices. Finally, we highlight some of the methods used in metal-semiconductor contacts, hybrid structures, heterostructures, and chemical doping to improve device performance.

RExPrimer: an integrated primer designing tool increases PCR effectiveness by avoiding 3' SNP-in-primer and mis-priming from structural variation

PubMed Central

2009-01-01

Background Polymerase chain reaction (PCR) is very useful in many areas of molecular biology research. It is commonly observed that PCR success is critically dependent on design of an effective primer pair. Current tools for primer design do not adequately address the problem of PCR failure due to mis-priming on target-related sequences and structural variations in the genome. Methods We have developed an integrated graphical web-based application for primer design, called RExPrimer, which was written in Python language. The software uses Primer3 as the primer designing core algorithm. Locally stored sequence information and genomic variant information were hosted on MySQLv5.0 and were incorporated into RExPrimer. Results RExPrimer provides many functionalities for improved PCR primer design. Several databases, namely annotated human SNP databases, insertion/deletion (indel) polymorphisms database, pseudogene database, and structural genomic variation databases were integrated into RExPrimer, enabling an effective without-leaving-the-website validation of the resulting primers. By incorporating these databases, the primers reported by RExPrimer avoid mis-priming to related sequences (e.g. pseudogene, segmental duplication) as well as possible PCR failure because of structural polymorphisms (SNP, indel, and copy number variation (CNV)). To prevent mismatching caused by unexpected SNPs in the designed primers, in particular the 3' end (SNP-in-Primer), several SNP databases covering the broad range of population-specific SNP information are utilized to report SNPs present in the primer sequences. Population-specific SNP information also helps customize primer design for a specific population. Furthermore, RExPrimer offers a graphical user-friendly interface through the use of scalable vector graphic image that intuitively presents resulting primers along with the corresponding gene structure. In this study, we demonstrated the program effectiveness in successfully generating primers for strong homologous sequences. Conclusion The improvements for primer design incorporated into RExPrimer were demonstrated to be effective in designing primers for challenging PCR experiments. Integration of SNP and structural variation databases allows for robust primer design for a variety of PCR applications, irrespective of the sequence complexity in the region of interest. This software is freely available at http://www4a.biotec.or.th/rexprimer. PMID:19958502

MCMC-ODPR: primer design optimization using Markov Chain Monte Carlo sampling.

PubMed

Kitchen, James L; Moore, Jonathan D; Palmer, Sarah A; Allaby, Robin G

2012-11-05

Next generation sequencing technologies often require numerous primer designs that require good target coverage that can be financially costly. We aimed to develop a system that would implement primer reuse to design degenerate primers that could be designed around SNPs, thus find the fewest necessary primers and the lowest cost whilst maintaining an acceptable coverage and provide a cost effective solution. We have implemented Metropolis-Hastings Markov Chain Monte Carlo for optimizing primer reuse. We call it the Markov Chain Monte Carlo Optimized Degenerate Primer Reuse (MCMC-ODPR) algorithm. After repeating the program 1020 times to assess the variance, an average of 17.14% fewer primers were found to be necessary using MCMC-ODPR for an equivalent coverage without implementing primer reuse. The algorithm was able to reuse primers up to five times. We compared MCMC-ODPR with single sequence primer design programs Primer3 and Primer-BLAST and achieved a lower primer cost per amplicon base covered of 0.21 and 0.19 and 0.18 primer nucleotides on three separate gene sequences, respectively. With multiple sequences, MCMC-ODPR achieved a lower cost per base covered of 0.19 than programs BatchPrimer3 and PAMPS, which achieved 0.25 and 0.64 primer nucleotides, respectively. MCMC-ODPR is a useful tool for designing primers at various melting temperatures at good target coverage. By combining degeneracy with optimal primer reuse the user may increase coverage of sequences amplified by the designed primers at significantly lower costs. Our analyses showed that overall MCMC-ODPR outperformed the other primer-design programs in our study in terms of cost per covered base.

MCMC-ODPR: Primer design optimization using Markov Chain Monte Carlo sampling

PubMed Central

2012-01-01

Background Next generation sequencing technologies often require numerous primer designs that require good target coverage that can be financially costly. We aimed to develop a system that would implement primer reuse to design degenerate primers that could be designed around SNPs, thus find the fewest necessary primers and the lowest cost whilst maintaining an acceptable coverage and provide a cost effective solution. We have implemented Metropolis-Hastings Markov Chain Monte Carlo for optimizing primer reuse. We call it the Markov Chain Monte Carlo Optimized Degenerate Primer Reuse (MCMC-ODPR) algorithm. Results After repeating the program 1020 times to assess the variance, an average of 17.14% fewer primers were found to be necessary using MCMC-ODPR for an equivalent coverage without implementing primer reuse. The algorithm was able to reuse primers up to five times. We compared MCMC-ODPR with single sequence primer design programs Primer3 and Primer-BLAST and achieved a lower primer cost per amplicon base covered of 0.21 and 0.19 and 0.18 primer nucleotides on three separate gene sequences, respectively. With multiple sequences, MCMC-ODPR achieved a lower cost per base covered of 0.19 than programs BatchPrimer3 and PAMPS, which achieved 0.25 and 0.64 primer nucleotides, respectively. Conclusions MCMC-ODPR is a useful tool for designing primers at various melting temperatures at good target coverage. By combining degeneracy with optimal primer reuse the user may increase coverage of sequences amplified by the designed primers at significantly lower costs. Our analyses showed that overall MCMC-ODPR outperformed the other primer-design programs in our study in terms of cost per covered base. PMID:23126469

Inventing Orientation and Mobility Techniques and Teaching Methods: A Conversation with Russell Williams (Part 2)

ERIC Educational Resources Information Center

Welsh, Rachard L.

2005-01-01

This is the final part of the adaptation from my on-stage conversation with Russell Williams at the 1998 International Mobility conference in Atlanta, GA, which attempted to highlight Williams's contributions to the progression of orientation and mobility from the Army's immediate response to the service men and women who lost their sight during…

Intergenerational Mobility in the Post-1965 Immigration Era: Estimates By An Immigrant Generation Cohort Method

PubMed Central

PARK, JULIE; MYERS, DOWELL

2010-01-01

The new second generation of the post-1965 immigration era is observed as children with their parents in 1980 and again as adults 25 years later. Intergenerational mobility is assessed for both men and women in four major racial/ethnic groups, both in regard to children’s status attainment relative to parents and with regard to the rising societal standards proxied by native-born non-Hispanic whites. A profile of intergenerational mobility is prepared using multiple indicators of status attainment: high school and college completion, upper white-collar occupation, poverty, and homeownership. The immigrant generation cohort method we introduce accounts for four distinct temporal dimensions of immigrant progress, clarifying inconsistencies in the literature and highlighting differences in mobility between racial/ethnic groups and with respect to different outcome measures. The immigrant generation cohort method consistently finds greater intergenerational mobility than suggested by alternative approaches. Our analysis also shows that the intergenerational progress of women is greater than that of men and provides a more complete record of immigrant mobility overall. Findings for individual racial/ethnic groups accord with some expectations in the literature and contradict others. PMID:20608102

PrimerZ: streamlined primer design for promoters, exons and human SNPs.

PubMed

Tsai, Ming-Fang; Lin, Yi-Jung; Cheng, Yu-Chang; Lee, Kuo-Hsi; Huang, Cheng-Chih; Chen, Yuan-Tsong; Yao, Adam

2007-07-01

PrimerZ (http://genepipe.ngc.sinica.edu.tw/primerz/) is a web application dedicated primarily to primer design for genes and human SNPs. PrimerZ accepts genes by gene name or Ensembl accession code, and SNPs by dbSNP rs or AFFY_Probe IDs. The promoter and exon sequence information of all gene transcripts fetched from the Ensembl database (http://www.ensembl.org) are processed before being passed on to Primer3 (http://frodo.wi.mit.edu/cgi-bin/primer3/primer3_www.cgi) for individual primer design. All results returned from Primer 3 are organized and integrated in a specially designed web page for easy browsing. Besides the web page presentation, csv text file export is also provided for enhanced user convenience. PrimerZ automates highly standard but tedious gene primer design to improve the success rate of PCR experiments. More than 2000 primers have been designed with PrimerZ at our institute since 2004 and the success rate is over 70%. The addition of several new features has made PrimerZ even more useful to the research community in facilitating primer design for promoters, exons and SNPs.

PrimerStation: a highly specific multiplex genomic PCR primer design server for the human genome

PubMed Central

Yamada, Tomoyuki; Soma, Haruhiko; Morishita, Shinichi

2006-01-01

PrimerStation () is a web service that calculates primer sets guaranteeing high specificity against the entire human genome. To achieve high accuracy, we used the hybridization ratio of primers in liquid solution. Calculating the status of sequence hybridization in terms of the stringent hybridization ratio is computationally costly, and no web service checks the entire human genome and returns a highly specific primer set calculated using a precise physicochemical model. To shorten the response time, we precomputed candidates for specific primers using a massively parallel computer with 100 CPUs (SunFire 15 K) about 3 months in advance. This enables PrimerStation to search and output qualified primers interactively. PrimerStation can select highly specific primers suitable for multiplex PCR by seeking a wider temperature range that minimizes the possibility of cross-reaction. It also allows users to add heuristic rules to the primer design, e.g. the exclusion of single nucleotide polymorphisms (SNPs) in primers, the avoidance of poly(A) and CA-repeats in the PCR products, and the elimination of defective primers using the secondary structure prediction. We performed several tests to verify the PCR amplification of randomly selected primers for ChrX, and we confirmed that the primers amplify specific PCR products perfectly. PMID:16845094

Estrogen receptor mRNA in mineralized tissues of rainbow trout: calcium mobilization by estrogen.

PubMed

Armour, K J; Lehane, D B; Pakdel, F; Valotaire, Y; Graham, R; Russell, R G; Henderson, I W

1997-07-07

RT-PCR was undertaken on total RNA extracts from bone and scales of the rainbow trout, Oncorhynchus mykiss. The rainbow trout estrogen receptor (ER)-specific primers used amplified a single product of expected size from each tissue which, using Southern blotting, strongly hybridized with a 32P-labelled rtER probe under stringent conditions. These data provide the first in vivo evidence of ER mRNA in bone and scale tissues of rainbow trout and suggest that the effects of estrogen observed in this study (increased bone mineral and decreased scale mineral contents, respectively) may be mediated directly through ER.

Matematicas Para El Primer Ciclo Secundario, Volumen II (Parte 1). Traduccion Preliminar de la Edicion en Ingles Revisada. (Mathematics for Junior High School, Volume II, Part 1. Preliminary Translation of the Revised English Edition).

ERIC Educational Resources Information Center

Anderson, R. D.; And Others

This is part one of a two-part SMSG mathematics text for junior high school students. Key ideas emphasized are structure of arithmetic from an algebraic viewpoint, the real number system as a progressing development, and metric and non-metric relations in geometry. Chapter topics include number line and coordinates, equations, scientific notation,…

Primer3_masker: integrating masking of template sequence with primer design software.

PubMed

Kõressaar, Triinu; Lepamets, Maarja; Kaplinski, Lauris; Raime, Kairi; Andreson, Reidar; Remm, Maido

2018-06-01

Designing PCR primers for amplifying regions of eukaryotic genomes is a complicated task because the genomes contain a large number of repeat sequences and other regions unsuitable for amplification by PCR. We have developed a novel k-mer based masking method that uses a statistical model to detect and mask failure-prone regions on the DNA template prior to primer design. We implemented the software as a standalone software primer3_masker and integrated it into the primer design program Primer3. The standalone version of primer3_masker is implemented in C. The source code is freely available at https://github.com/bioinfo-ut/primer3_masker/ (standalone version for Linux and macOS) and at https://github.com/primer3-org/primer3/ (integrated version). Primer3 web application that allows masking sequences of 196 animal and plant genomes is available at http://primer3.ut.ee/. maido.remm@ut.ee. Supplementary data are available at Bioinformatics online.

Development of mobile laboratory for viral haemorrhagic fever detection in Africa.

PubMed

Weidmann, Manfred; Faye, Ousmane; Faye, Oumar; Abd El Wahed, Ahmed; Patel, Pranav; Batejat, Christophe; Manugerra, Jean Claude; Adjami, Aimee; Niedrig, Matthias; Hufert, Frank T; Sall, Amadou A

2018-06-15

In order to enable local response to viral haemorrhagic fever outbreaks a mobile laboratory transportable on commercial flights was developed. The development progressed from use of mobile real time RT-PCR to mobile Recombinase Polymerase Amplification (RT-RPA). The various stages of the mobile laboratory development are described. A brief overview of its deployments, which culminated in the first on site detection of Ebola virus disease (EVD) in March 2014 and a successful use in a campaign to roll back EVD cases in Conakry in the West-Africa Ebola virus outbreak are described. The developed mobile laboratory successfully enabled local teams to perform rapid viral haemorrhagic fever disgnostics.

Efficient Mobility Management Signalling in Network Mobility Supported PMIPV6

PubMed Central

Jebaseeli Samuelraj, Ananthi; Jayapal, Sundararajan

2015-01-01

Proxy Mobile IPV6 (PMIPV6) is a network based mobility management protocol which supports node's mobility without the contribution from the respective mobile node. PMIPV6 is initially designed to support individual node mobility and it should be enhanced to support mobile network movement. NEMO-BSP is an existing protocol to support network mobility (NEMO) in PMIPV6 network. Due to the underlying differences in basic protocols, NEMO-BSP cannot be directly applied to PMIPV6 network. Mobility management signaling and data structures used for individual node's mobility should be modified to support group nodes' mobility management efficiently. Though a lot of research work is in progress to implement mobile network movement in PMIPV6, it is not yet standardized and each suffers with different shortcomings. This research work proposes modifications in NEMO-BSP and PMIPV6 to achieve NEMO support in PMIPV6. It mainly concentrates on optimizing the number and size of mobility signaling exchanged while mobile network or mobile network node changes its access point. PMID:26366431

Efficient Mobility Management Signalling in Network Mobility Supported PMIPV6.

PubMed

Samuelraj, Ananthi Jebaseeli; Jayapal, Sundararajan

2015-01-01

Proxy Mobile IPV6 (PMIPV6) is a network based mobility management protocol which supports node's mobility without the contribution from the respective mobile node. PMIPV6 is initially designed to support individual node mobility and it should be enhanced to support mobile network movement. NEMO-BSP is an existing protocol to support network mobility (NEMO) in PMIPV6 network. Due to the underlying differences in basic protocols, NEMO-BSP cannot be directly applied to PMIPV6 network. Mobility management signaling and data structures used for individual node's mobility should be modified to support group nodes' mobility management efficiently. Though a lot of research work is in progress to implement mobile network movement in PMIPV6, it is not yet standardized and each suffers with different shortcomings. This research work proposes modifications in NEMO-BSP and PMIPV6 to achieve NEMO support in PMIPV6. It mainly concentrates on optimizing the number and size of mobility signaling exchanged while mobile network or mobile network node changes its access point.

PrimerSuite: A High-Throughput Web-Based Primer Design Program for Multiplex Bisulfite PCR.

PubMed

Lu, Jennifer; Johnston, Andrew; Berichon, Philippe; Ru, Ke-Lin; Korbie, Darren; Trau, Matt

2017-01-24

The analysis of DNA methylation at CpG dinucleotides has become a major research focus due to its regulatory role in numerous biological processes, but the requisite need for assays which amplify bisulfite-converted DNA represents a major bottleneck due to the unique design constraints imposed on bisulfite-PCR primers. Moreover, a review of the literature indicated no available software solutions which accommodated both high-throughput primer design, support for multiplex amplification assays, and primer-dimer prediction. In response, the tri-modular software package PrimerSuite was developed to support bisulfite multiplex PCR applications. This software was constructed to (i) design bisulfite primers against multiple regions simultaneously (PrimerSuite), (ii) screen for primer-primer dimerizing artefacts (PrimerDimer), and (iii) support multiplex PCR assays (PrimerPlex). Moreover, a major focus in the development of this software package was the emphasis on extensive empirical validation, and over 1300 unique primer pairs have been successfully designed and screened, with over 94% of them producing amplicons of the expected size, and an average mapping efficiency of 93% when screened using bisulfite multiplex resequencing. The potential use of the software in other bisulfite-based applications such as methylation-specific PCR is under consideration for future updates. This resource is freely available for use at PrimerSuite website (www.primer-suite.com).

Deconstructing the Polymerase Chain Reaction: Understanding and Correcting Bias Associated with Primer Degeneracies and Primer-Template Mismatches

PubMed Central

Green, Stefan J.; Venkatramanan, Raghavee; Naqib, Ankur

2015-01-01

The polymerase chain reaction (PCR) is sensitive to mismatches between primer and template, and mismatches can lead to inefficient amplification of targeted regions of DNA template. In PCRs in which a degenerate primer pool is employed, each primer can behave differently. Therefore, inefficiencies due to different primer melting temperatures within a degenerate primer pool, in addition to mismatches between primer binding sites and primers, can lead to a distortion of the true relative abundance of targets in the original DNA pool. A theoretical analysis indicated that a combination of primer-template and primer-amplicon interactions during PCR cycles 3–12 is potentially responsible for this distortion. To test this hypothesis, we developed a novel amplification strategy, entitled “Polymerase-exonuclease (PEX) PCR”, in which primer-template interactions and primer-amplicon interactions are separated. The PEX PCR method substantially and significantly improved the evenness of recovery of sequences from a mock community of known composition, and allowed for amplification of templates with introduced mismatches near the 3’ end of the primer annealing sites. When the PEX PCR method was applied to genomic DNA extracted from complex environmental samples, a significant shift in the observed microbial community was detected. Furthermore, the PEX PCR method provides a mechanism to identify which primers in a primer pool are annealing to target gDNA. Primer utilization patterns revealed that at high annealing temperatures in the PEX PCR method, perfect match annealing predominates, while at lower annealing temperatures, primers with up to four mismatches with templates can contribute substantially to amplification. The PEX PCR method is simple to perform, is limited to PCR mixes and a single exonuclease step which can be performed without reaction cleanup, and is recommended for reactions in which degenerate primer pools are used or when mismatches between primers and template are possible. PMID:25996930

miPrimer: an empirical-based qPCR primer design method for small noncoding microRNA

PubMed Central

Kang, Shih-Ting; Hsieh, Yi-Shan; Feng, Chi-Ting; Chen, Yu-Ting; Yang, Pok Eric; Chen, Wei-Ming

2018-01-01

MicroRNAs (miRNAs) are 18–25 nucleotides (nt) of highly conserved, noncoding RNAs involved in gene regulation. Because of miRNAs’ short length, the design of miRNA primers for PCR amplification remains a significant challenge. Adding to the challenge are miRNAs similar in sequence and miRNA family members that often only differ in sequences by 1 nt. Here, we describe a novel empirical-based method, miPrimer, which greatly reduces primer dimerization and increases primer specificity by factoring various intrinsic primer properties and employing four primer design strategies. The resulting primer pairs displayed an acceptable qPCR efficiency of between 90% and 110%. When tested on miRNA families, miPrimer-designed primers are capable of discriminating among members of miRNA families, as validated by qPCR assays using Quark Biosciences’ platform. Of the 120 miRNA primer pairs tested, 95.6% and 93.3% were successful in amplifying specifically non-family and family miRNA members, respectively, after only one design trial. In summary, miPrimer provides a cost-effective and valuable tool for designing miRNA primers. PMID:29208706

MethPrimer: designing primers for methylation PCRs.

PubMed

Li, Long-Cheng; Dahiya, Rajvir

2002-11-01

DNA methylation is an epigenetic mechanism of gene regulation. Bisulfite- conversion-based PCR methods, such as bisulfite sequencing PCR (BSP) and methylation specific PCR (MSP), remain the most commonly used techniques for methylation mapping. Existing primer design programs developed for standard PCR cannot handle primer design for bisulfite-conversion-based PCRs due to changes in DNA sequence context caused by bisulfite treatment and many special constraints both on the primers and the region to be amplified for such experiments. Therefore, the present study was designed to develop a program for such applications. MethPrimer, based on Primer 3, is a program for designing PCR primers for methylation mapping. It first takes a DNA sequence as its input and searches the sequence for potential CpG islands. Primers are then picked around the predicted CpG islands or around regions specified by users. MethPrimer can design primers for BSP and MSP. Results of primer selection are delivered through a web browser in text and in graphic view.

40 CFR 52.2450 - Conditional approval.

Code of Federal Regulations, 2010 CFR

2010-07-01

... reasonably available control technology (RACT) for the Manufacturing Center located in Richmond, Virginia is...) Revises the 1999-2005 portion of the severe area rate-of-progress plan to provide MOBILE6-based mobile...) Revises Reasonably Available Control Technology (RACT) rules to include the lower major source...

A GIS-BASED MODAL MODEL OF AUTOMOBILE EXHAUST EMISSIONS

EPA Science Inventory

The report presents progress toward the development of a computer tool called MEASURE, the Mobile Emission Assessment System for Urban and Regional Evaluation. The tool works toward a goal of providing researchers and planners with a way to assess new mobile emission mitigation s...

Longitudinal patient-reported mobility assessment in fibrodysplasia ossificans progressiva (FOP).

PubMed

Kaplan, Frederick S; Al Mukaddam, Mona; Pignolo, Robert J

2018-04-01

Fibrodysplasia ossificans progressiva (FOP) is a rare, disabling genetic disorder characterized by episodic soft tissue swelling (flare-ups) that leads to progressive heterotopic ossification and restricted joint mobility. Here we present the first longitudinal patient-reported mobility assessment (PRMA) in FOP based on a simple evaluation tool. At initial presentation and follow-up (1-11year span; median: 6 year span), 64 patients (36 females; 28 males) with classic FOP completed a questionnaire designed to rapidly assess mobility at 15 sites (three axial; six upper limb, and six lower limb). In order to validate this instrument, twenty-one of 64 patients (33%) underwent a cumulative analogue joint involvement scale (CAJIS) evaluation by two physicians within six months of their second self-assessment. We found that: 1) mobility changes were episodic and regional, occurring first in the neck and trunk, followed by the upper limbs and finally the lower limbs; 2) interval improvements in mobility did occur, most notably in the lower limbs (18%), and less so in the upper limbs (12%) and trunk (3%), and 3) patient-reported mobility assessments correlate highly (R 2 =0.81) with physician-reported CAJIS evaluations. This is the first longitudinal PRMA in FOP and provides a simple and valid tool that can be used in the design and evaluation of clinical trials in this progressively disabling disease. Copyright © 2017 Elsevier Inc. All rights reserved.

The effectiveness of Robot-Assisted Gait Training versus conventional therapy on mobility in severely disabled progressIve MultiplE sclerosis patients (RAGTIME): study protocol for a randomized controlled trial.

PubMed

Straudi, Sofia; Manfredini, Fabio; Lamberti, Nicola; Zamboni, Paolo; Bernardi, Francesco; Marchetti, Giovanna; Pinton, Paolo; Bonora, Massimo; Secchiero, Paola; Tisato, Veronica; Volpato, Stefano; Basaglia, Nino

2017-02-27

Gait and mobility impairments affect the quality of life (QoL) of patients with progressive multiple sclerosis (MS). Robot-assisted gait training (RAGT) is an effective rehabilitative treatment but evidence of its superiority compared to other options is lacking. Furthermore, the response to rehabilitation is multidimensional, person-specific and possibly involves functional reorganization processes. The aims of this study are: (1) to test the effectiveness on gait speed, mobility, balance, fatigue and QoL of RAGT compared to conventional therapy (CT) in progressive MS and (2) to explore changes of clinical and circulating biomarkers of neural plasticity. This will be a parallel-group, randomized controlled trial design with the assessor blinded to the group allocation of participants. Ninety-eight (49 per arm) progressive MS patients (EDSS scale 6-7) will be randomly assigned to receive twelve 2-h training sessions over a 4-week period (three sessions/week) of either: (1) RAGT intervention on a robotic-driven gait orthosis (Lokomat, Hocoma, Switzerland). The training parameters (torque of the knee and hip drives, treadmill speed, body weight support) are set during the first session and progressively adjusted during training progression or (2) individual conventional physiotherapy focusing on over-ground walking training performed with the habitual walking device. The same assessors will perform outcome measurements at four time points: baseline (before the first intervention session); intermediate (after six training sessions); end of treatment (after the completion of 12 sessions); and follow-up (after 3 months from the end of the training program). The primary outcome is gait speed, assessed by the Timed 25-Foot Walk Test. We will also assess walking endurance, balance, depression, fatigue and QoL as well as instrumental laboratory markers (muscle metabolism, cerebral venous hemodynamics, cortical activation) and circulating laboratory markers (rare circulating cell populations pro and anti-inflammatory cytokines/chemokines, growth factors, neurotrophic factors, coagulation factors, other plasma proteins suggested by transcriptomic analysis and metabolic parameters). The RAGT training is expected to improve mobility compared to the active control intervention in progressive MS. Unique to this study is the analysis of various potential markers of plasticity in relation with clinical outcomes. ClinicalTrials.gov, identifier: NCT02421731 . Registered on 19 January 2015 (retrospectively registered).

PrimerMapper: high throughput primer design and graphical assembly for PCR and SNP detection

PubMed Central

O’Halloran, Damien M.

2016-01-01

Primer design represents a widely employed gambit in diverse molecular applications including PCR, sequencing, and probe hybridization. Variations of PCR, including primer walking, allele-specific PCR, and nested PCR provide specialized validation and detection protocols for molecular analyses that often require screening large numbers of DNA fragments. In these cases, automated sequence retrieval and processing become important features, and furthermore, a graphic that provides the user with a visual guide to the distribution of designed primers across targets is most helpful in quickly ascertaining primer coverage. To this end, I describe here, PrimerMapper, which provides a comprehensive graphical user interface that designs robust primers from any number of inputted sequences while providing the user with both, graphical maps of primer distribution for each inputted sequence, and also a global assembled map of all inputted sequences with designed primers. PrimerMapper also enables the visualization of graphical maps within a browser and allows the user to draw new primers directly onto the webpage. Other features of PrimerMapper include allele-specific design features for SNP genotyping, a remote BLAST window to NCBI databases, and remote sequence retrieval from GenBank and dbSNP. PrimerMapper is hosted at GitHub and freely available without restriction. PMID:26853558

Circumventing the Glass Ceiling: Women Executives in American State Governments.

ERIC Educational Resources Information Center

Bullard, Angela M.; Wright, Deil S.

1993-01-01

Data from 1984 (n=489) and 1988 (n=658) surveys show that female executives in state government have progressed in top positions in certain types of agencies, but much progress has occurred by avoiding, not breaking, the glass ceiling. Most notable male-female differences are in party affiliation, age, interagency mobility, career progress, and…

Improved Efficiency and Robustness in qPCR and Multiplex End-Point PCR by Twisted Intercalating Nucleic Acid Modified Primers

PubMed Central

Schneider, Uffe Vest; Mikkelsen, Nikolaj Dam; Lindqvist, Anja; Okkels, Limei Meng; Jøhnk, Nina; Lisby, Gorm

2012-01-01

We introduce quantitative polymerase chain reaction (qPCR) primers and multiplex end-point PCR primers modified by the addition of a single ortho-Twisted Intercalating Nucleic Acid (o-TINA) molecule at the 5′-end. In qPCR, the 5′-o-TINA modified primers allow for a qPCR efficiency of 100% at significantly stressed reaction conditions, increasing the robustness of qPCR assays compared to unmodified primers. In samples spiked with genomic DNA, 5′-o-TINA modified primers improve the robustness by increased sensitivity and specificity compared to unmodified DNA primers. In unspiked samples, replacement of unmodified DNA primers with 5′-o-TINA modified primers permits an increased qPCR stringency. Compared to unmodified DNA primers, this allows for a qPCR efficiency of 100% at lowered primer concentrations and at increased annealing temperatures with unaltered cross-reactivity for primers with single nucleobase mismatches. In a previously published octaplex end-point PCR targeting diarrheagenic Escherichia coli, application of 5′-o-TINA modified primers allows for a further reduction (>45% or approximately one hour) in overall PCR program length, while sustaining the amplification and analytical sensitivity for all targets in crude bacterial lysates. For all crude bacterial lysates, 5′-o-TINA modified primers permit a substantial increase in PCR stringency in terms of lower primer concentrations and higher annealing temperatures for all eight targets. Additionally, crude bacterial lysates spiked with human genomic DNA show lesser formation of non-target amplicons implying increased robustness. Thus, 5′-o-TINA modified primers are advantageous in PCR assays, where one or more primer pairs are required to perform at stressed reaction conditions. PMID:22701644

Early mobilization in the critical care unit: A review of adult and pediatric literature.

PubMed

Cameron, Saoirse; Ball, Ian; Cepinskas, Gediminas; Choong, Karen; Doherty, Timothy J; Ellis, Christopher G; Martin, Claudio M; Mele, Tina S; Sharpe, Michael; Shoemaker, J Kevin; Fraser, Douglas D

2015-08-01

Early mobilization of critically ill patients is beneficial, suggesting that it should be incorporated into daily clinical practice. Early passive, active, and combined progressive mobilizations can be safely initiated in intensive care units (ICUs). Adult patients receiving early mobilization have fewer ventilator-dependent days, shorter ICU and hospital stays, and better functional outcomes. Pediatric ICU data are limited, but recent studies also suggest that early mobilization is achievable without increasing patient risk. In this review, we provide a current and comprehensive appraisal of ICU mobilization techniques in both adult and pediatric critically ill patients. Contraindications and perceived barriers to early mobilization, including cost and health care provider views, are identified. Methods of overcoming barriers to early mobilization and enhancing sustainability of mobilization programs are discussed. Optimization of patient outcomes will require further studies on mobilization timing and intensity, particularly within specific ICU populations. Copyright © 2015 Elsevier Inc. All rights reserved.

Reduced volatile organic compound (VOC) ammunition coatings. Progress report, October 1994-September 1995

DOE Office of Scientific and Technical Information (OSTI.GOV)

Duncan, J.L.

1996-05-01

Production requirements and film thickness limitations typically require that ammunition coating systems consist of a single film. This single film must provide the corrosion resistance of a primer plus such properties as color, gloss, and solvent resistance that are required of a topcoat, a compromise at best. Federal and local regulations resulting from the Clean Air Act and its amendments restrict the amount of VOC emitted during the application of protective coatings, and regulations on worker safety restrict exposure to hazardous materials such as chromates. These materials also generate hazardous wastes and the associated high disposal costs. This report summarizesmore » progress in developing ammunition coatings that perform as well as or better than current systems, but at reduced VOC levels with chromate-free pigmentation.« less

A Tale of Tails: Dissecting the Enhancing Effect of Tailed Primers in Real-Time PCR

PubMed Central

Vandenbussche, Frank; Mathijs, Elisabeth; Lefebvre, David; De Clercq, Kris; Van Borm, Steven

2016-01-01

Non-specific tail sequences are often added to the 5’-terminus of primers to improve the robustness and overall performance of diagnostic assays. Despite the widespread use of tailed primers, the underlying working mechanism is not well understood. To address this problem, we conducted a detailed in vitro and in silico analysis of the enhancing effect of primer tailing on 2 well-established foot-and-mouth disease virus (FMDV) RT-qPCR assays using an FMDV reference panel. Tailing of the panFMDV-5UTR primers mainly affected the shape of the amplification curves. Modelling of the raw fluorescence data suggested a reduction of the amplification efficiency due to the accumulation of inhibitors. In depth analysis of PCR products indeed revealed the rapid accumulation of forward-primer derived artefacts. More importantly, tailing of the forward primer delayed artefacts formation and concomitantly restored the sigmoidal shape of the amplification curves. Our analysis also showed that primer tailing can alter utilisation patterns of degenerate primers and increase the number of primer variants that are able to participate in the reaction. The impact of tailed primers was less pronounced in the panFMDV-3D assay with only 5 out of 50 isolates showing a clear shift in Cq values. Sequence analysis of the target region of these 5 isolates revealed several mutations in the inter-primer region that extend an existing hairpin structure immediately downstream of the forward primer binding site. Stabilisation of the forward primer with either a tail sequence or cationic spermine units restored the sensitivity of the assay, which suggests that the enhancing effect in the panFMDV-3D assay is due to a more efficient extension of the forward primer. ur results show that primer tailing can alter amplification through various mechanisms that are determined by both the assay and target region. These findings expand our understanding of primer tailing and should enable a more targeted and efficient use of tailed primers. PMID:27723800

Progress in utilization of a mobile laboratory for making storm electricity measurements

NASA Technical Reports Server (NTRS)

Rust, W. David

1988-01-01

A mobile atmospheric science laboratory has been used to intercept and track storms on the Great Plains region of the U.S., with the intention of combining the data obtained with those from Doppler and conventional radars, NASA U-2 aircraft overflights, balloon soundings, and fixed-base storm electricity measurements. The mobile lab has proven to be valuable in the gathering of ground truth verifications for the two commercially operated lightning ground-strike locating systems. Data acquisition has recently been expanded by means of mobile ballooning before and during storms.

PrecisePrimer: an easy-to-use web server for designing PCR primers for DNA library cloning and DNA shuffling.

PubMed

Pauthenier, Cyrille; Faulon, Jean-Loup

2014-07-01

PrecisePrimer is a web-based primer design software made to assist experimentalists in any repetitive primer design task such as preparing, cloning and shuffling DNA libraries. Unlike other popular primer design tools, it is conceived to generate primer libraries with popular PCR polymerase buffers proposed as pre-set options. PrecisePrimer is also meant to design primers in batches, such as for DNA libraries creation of DNA shuffling experiments and to have the simplest interface possible. It integrates the most up-to-date melting temperature algorithms validated with experimental data, and cross validated with other computational tools. We generated a library of primers for the extraction and cloning of 61 genes from yeast DNA genomic extract using default parameters. All primer pairs efficiently amplified their target without any optimization of the PCR conditions. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

Precambrian perspectives.

PubMed

Goodwin, A M

1981-07-03

The Precambrian record is interpreted in terms of an evolutionary progression that moves in the direction of increasing continental stability. An early, highly mobile microplate tectonics phase progressed through a more stable, largely intracratonic, ensialic, mobile belt phase to the modern macroplate tectonics phase that involves large, rigid lithospheric plates. Various phases are characterized by distinctive crustal associations. Three controls-bulk earth heat production, crustal fractionation and cratonization, and atmospheric oxygen accumulation-are viewed as the cumulative cause of the trends and events that characterize the crust at different stages of development, from its inception approximately 4.6 billion years ago to the present.

Aquaculture changes the profile of antibiotic resistance and mobile genetic element associated genes in Baltic Sea sediments.

PubMed

Muziasari, Windi I; Pärnänen, Katariina; Johnson, Timothy A; Lyra, Christina; Karkman, Antti; Stedtfeld, Robert D; Tamminen, Manu; Tiedje, James M; Virta, Marko

2016-04-01

Antibiotics are commonly used in aquaculture and they can change the environmental resistome by increasing antibiotic resistance genes (ARGs). Sediment samples were collected from two fish farms located in the Northern Baltic Sea, Finland, and from a site outside the farms (control). The sediment resistome was assessed by using a highly parallel qPCR array containing 295 primer sets to detect ARGs, mobile genetic elements and the 16S rRNA gene. The fish farm resistomes were enriched in transposon and integron associated genes and in ARGs encoding resistance to antibiotics which had been used to treat fish at the farms. Aminoglycoside resistance genes were also enriched in the farm sediments despite the farms not having used aminoglycosides. In contrast, the total relative abundance values of ARGs were higher in the control sediment resistome and they were mainly genes encoding efflux pumps followed by beta-lactam resistance genes, which are found intrinsically in many bacteria. This suggests that there is a natural Baltic sediment resistome. The resistome associated with fish farms can be from native ARGs enriched by antibiotic use at the farms and/or from ARGs and mobile elements that have been introduced by fish farming. © FEMS 2016. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Microbial transformations of arsenic: Mobilization from glauconitic sediments to water

USGS Publications Warehouse

Mumford, Adam C.; Barringer, Julia L.; Benzel, William M.; Reilly, Pamela A.; Young, L.Y.

2012-01-01

In the Inner Coastal Plain of New Jersey, arsenic (As) is released from glauconitic sediment to carbon- and nutrient-rich shallow groundwater. This As-rich groundwater discharges to a major area stream. We hypothesize that microbes play an active role in the mobilization of As from glauconitic subsurface sediments into groundwater in the Inner Coastal Plain of New Jersey. We have examined the potential impact of microbial activity on the mobilization of arsenic from subsurface sediments into the groundwater at a site on Crosswicks Creek in southern New Jersey. The As contents of sediments 33–90 cm below the streambed were found to range from 15 to 26.4 mg/kg, with siderite forming at depth. Groundwater beneath the streambed contains As at concentrations up to 89 μg/L. Microcosms developed from site sediments released 23 μg/L of As, and active microbial reduction of As(V) was observed in microcosms developed from site groundwater. DNA extracted from site sediments was amplified with primers for the 16S rRNA gene and the arsenate respiratory reductase gene, arrA, and indicated the presence of a diverse anaerobic microbial community, as well as the presence of potential arsenic-reducing bacteria. In addition, high iron (Fe) concentrations in groundwater and the presence of iron-reducing microbial genera suggests that Fe reduction in minerals may provide an additional mechanism for release of associated As, while arsenic-reducing microorganisms may serve to enhance the mobility of As in groundwater at this site.

Progress on field study with precision mobile drip irrigation technologly

USDA-ARS?s Scientific Manuscript database

Precision mobile drip irrigation (PMDI) is a technology that was developed in the 1970s that converts drop hoses on moving irrigation systems to dripline. Although this technology was developed more than 40 years ago, it was not widely implemented and few studies reported on its performance. Recentl...

Investigation of Using Analytics in Promoting Mobile Learning Support

ERIC Educational Resources Information Center

Visali, Videhi; Swami, Niraj

2013-01-01

Learning analytics can promote pedagogically informed use of learner data, which can steer the progress of technology mediated learning across several learning contexts. This paper presents the application of analytics to a mobile learning solution and demonstrates how a pedagogical sense was inferred from the data. Further, this inference was…

Measuring the post-adoption customer perception of mobile banking services.

PubMed

Yu, Tai-Kuei; Fang, Kwoting

2009-02-01

With liberalization and internalization in the financial market and progress in information technology, banks face dual competitive pressures to provide service quality and administrative efficiency. That these recent developments are fueled by technology might misleadingly suggest that the adoption of mobile banking is largely based on technological criteria. The purpose of this study is to establish a better measurement model for postadoption user perception of mobile banking services. Based on 458 valid responses of mobile banking users, the results show that the instrument, consisting of 21 items and 6 factors, is a reliable, valid, and useful measurement for assessing the postadoption perception of mobile banking.

Primers-4-Yeast: a comprehensive web tool for planning primers for Saccharomyces cerevisiae.

PubMed

Yofe, Ido; Schuldiner, Maya

2014-02-01

The budding yeast Saccharomyces cerevisiae is a key model organism of functional genomics, due to its ease and speed of genetic manipulations. In fact, in this yeast, the requirement for homologous sequences for recombination purposes is so small that 40 base pairs (bp) are sufficient. Hence, an enormous variety of genetic manipulations can be performed by simply planning primers with the correct homology, using a defined set of transformation plasmids. Although designing primers for yeast transformations and for the verification of their correct insertion is a common task in all yeast laboratories, primer planning is usually done manually and a tool that would enable easy, automated primer planning for the yeast research community is still lacking. Here we introduce Primers-4-Yeast, a web tool that allows primers to be designed in batches for S. cerevisiae gene-targeting transformations, and for the validation of correct insertions. This novel tool enables fast, automated, accurate primer planning for large sets of genes, introduces consistency in primer planning and is therefore suggested to serve as a standard in yeast research. Primers-4-Yeast is available at: http://www.weizmann.ac.il/Primers-4-Yeast Copyright © 2013 John Wiley & Sons, Ltd.

VizPrimer: a web server for visualized PCR primer design based on known gene structure.

PubMed

Zhou, Yang; Qu, Wubin; Lu, Yiming; Zhang, Yanchun; Wang, Xiaolei; Zhao, Dongsheng; Yang, Yi; Zhang, Chenggang

2011-12-15

The visualization of gene structure plays an important role in polymerase chain reaction (PCR) primer design, especially for eukaryotic genes with a number of splice variants that users need to distinguish between via PCR. Here, we describe a visualized web server for primer design named VizPrimer. It utilizes the new information technology (IT) tools, HTML5 to display gene structure and JavaScript to interact with the users. In VizPrimer, the users can focus their attention on the gene structure and primer design strategy, without wasting time calculating the exon positions of splice variants or manually configuring complicated parameters. In addition, VizPrimer is also suitable for the design of PCR primers for amplifying open reading frames and detecting single nucleotide polymorphisms (SNPs). VizPrimer is freely available at http://biocompute.bmi.ac.cn/CZlab/VizPrimer/. The web server supported browsers: Chrome (≥5.0), Firefox (≥3.0), Safari (≥4.0) and Opera (≥10.0). zhangcg@bmi.ac.cn; yangyi528@vip.sina.com.

Comparison and Validation of Some ITS Primer Pairs Useful for Fungal Metabarcoding Studies

PubMed Central

Op De Beeck, Michiel; Lievens, Bart; Busschaert, Pieter; Declerck, Stéphan; Vangronsveld, Jaco; Colpaert, Jan V.

2014-01-01

Current metabarcoding studies aiming to characterize microbial communities generally rely on the amplification and sequencing of relatively short DNA regions. For fungi, the internal transcribed spacer (ITS) region in the ribosomal RNA (rRNA) operon has been accepted as the formal fungal barcode. Despite an increasing number of fungal metabarcoding studies, the amplification efficiency of primers is generally not tested prior to their application in metabarcoding studies. Some of the challenges that metabarcoding primers should overcome efficiently are the amplification of target DNA strands in samples rich in non-target DNA and environmental pollutants, such as humic acids, that may have been co-extracted with DNA. In the current study, three selected primer pairs were tested for their suitability as fungal metabarcoding primers. The selected primer pairs include two primer pairs that have been frequently used in fungal metabarcoding studies (ITS1F/ITS2 and ITS3/ITS4) and a primer pair (ITS86F/ITS4) that has been shown to efficiently amplify the ITS2 region of a broad range of fungal taxa in environmental soil samples. The selected primer pairs were evaluated in a 454 amplicon pyrosequencing experiment, real-time PCR (qPCR) experiments and in silico analyses. Results indicate that experimental evaluation of primers provides valuable information that could aid in the selection of suitable primers for fungal metabarcoding studies. Furthermore, we show that the ITS86F/ITS4 primer pair outperforms other primer pairs tested in terms of in silico primer efficiency, PCR efficiency, coverage, number of reads and number of species-level operational taxonomic units (OTUs) obtained. These traits push the ITS86F/ITS4 primer pair forward as highly suitable for studying fungal diversity and community structures using DNA metabarcoding. PMID:24933453

Shear bond strength between autopolymerizing acrylic resin and Co-Cr alloy using different primers.

PubMed

Sanohkan, Sasiwimol; Urapepon, Somchai; Harnirattisai, Choltacha; Sirisinha, Chakrit; Sunintaboon, Panya

2012-01-01

This study aimed to examine the shear bond strength between cobalt chromium alloy and autopolymerizing acrylic resin using experimental primers containing 5, 10, and 15 wt% of 4-methacryloxyethyl trimellitic anhydride or 1, 2, and 3 wt% of 3-methacryloxypropyl-trimethoxysilane comparison to 5 commercial primers (ML primers, Alloy primer, Metal/Zirconia primer, Monobond S, and Monobond plus). Sixty alloy specimens were sandblasted and treated with each primer before bonded with an acrylic resin. The control group was not primed. The shear bond strengths were tested and statistically compared. Specimens treated with commercial primers significantly increased the shear bond strength of acrylic resin to cobalt chromium alloy (p<0.05). The highest shear bond strength was found in the Alloy primer group. Among experimental group, using 10 wt% of 4-methacryloxyethyl trimellitic anhydride -or 2 wt% of 3-methacryloxypropyltrimethoxysilane enhanced highest shear bond strength. The experimental and commercial primers in this study all improved bonding of acrylic resin to cobalt chromium alloy.

Neuraminidase Subtyping of Avian Influenza Viruses with PrimerHunter-Designed Primers and Quadruplicate Primer Pools

PubMed Central

Huang, Yanyan; Khan, Mazhar; Măndoiu, Ion I.

2013-01-01

We have previously developed a software package called PrimerHunter to design primers for PCR-based virus subtyping. In this study, 9 pairs of primers were designed with PrimerHunter and successfully used to differentiate the 9 neuraminidase (NA) genes of avian influenza viruses (AIVs) in multiple PCR-based assays. Furthermore, primer pools were designed and successfully used to decrease the number of reactions needed for NA subtyping from 9 to 4. The quadruplicate primer-pool method is cost-saving, and was shown to be suitable for the NA subtyping of both cultured AIVs and uncultured AIV swab samples. The primers selected for this study showed excellent sensitivity and specificity in NA subtyping by RT-PCR, SYBR green-based Real-time PCR and Real-time RT-PCR methods. AIV RNA of 2 to 200 copies (varied by NA subtypes) could be detected by these reactions. No unspecific amplification was displayed when detecting RNAs of other avian infectious viruses such as Infectious bronchitis virus, Infectious bursal disease virus and Newcastle disease virus. In summary, this study introduced several sensitive and specific PCR-based assays for NA subtyping of AIVs and also validated again the effectiveness of the PrimerHunter tool for the design of subtyping primers. PMID:24312367

The effect of intrathecal baclofen treatment on activities of daily life in children and young adults with cerebral palsy and progressive neurological disorders.

PubMed

Bonouvrié, Laura; Becher, Jules; Soudant, Dan; Buizer, Annemieke; van Ouwerkerk, Willem; Vles, Georges; Vermeulen, R Jeroen

2016-07-01

Intrathecal baclofen (ITB) treatment is applied in patients with spastic cerebral palsy (SCP), dystonic cerebral palsy (DCP) and progressive neurological disease (PND). Our aim was to investigate whether ITB treatment has a different effect on activities of daily life (ADL) in these groups. A retrospective and cross-sectional survey was conducted using a questionnaire to assess the qualitative effect of ITB (Likert scale) on different domains of functioning (mobility, personal care, communication, comfort) and satisfaction with the results. Groups were compared using non-parametric statistics. Questionnaires were completed for 68 patients (39 SCP, 13 DCP, 16 PND). Satisfaction scores were relatively high in all groups (7-8) and the positive effect on personal care and communication was similar in all groups. The PND group had the shortest follow-up and scored significantly less favourably for the effect on mobility and comfort. This is the first study to show that ITB treatment has similar effects on personal care and communication in stable and progressive neurological disease. The decrease in mobility in the PND group is likely due to the progressive nature of the disease. The different effect on comfort between groups is mainly due to the smaller effect on startles in the PND group. Copyright © 2016 European Paediatric Neurology Society. Published by Elsevier Ltd. All rights reserved.

Chapter 17. Extension of endogenous primers as a tool to detect micro-RNA targets.

PubMed

Vatolin, Sergei; Weil, Robert J

2008-01-01

Mammalian cells express a large number of small, noncoding RNAs, including micro-RNAs (miRNAs), that can regulate both the level of a target mRNA and the protein produced by the target mRNA. Recognition of miRNA targets is a complicated process, as a single target mRNA may be regulated by several miRNAs. The potential for combinatorial miRNA-mediated regulation of miRNA targets complicates diagnostic and therapeutic applications of miRNAs. Despite significant progress in understanding the biology of miRNAs and advances in computational predictions of miRNA targets, methods that permit direct physical identification of miRNA-mRNA complexes in eukaryotic cells are still required. Several groups have utilized coimmunoprecipitation of RNA associated with a protein(s) that is part of the RNA silencing macromolecular complex. This chapter describes a detailed but straightforward strategy that identifies miRNA targets based on the assumption that small RNAs base paired with a complementary target mRNA can be used as a primer to synthesize cDNA that may be used for cloning, identification, and functional analysis.

ATLAS: An advanced PCR-method for routine visualization of telomere length in Saccharomyces cerevisiae.

PubMed

Zubko, Elena I; Shackleton, Jennifer L; Zubko, Mikhajlo K

2016-12-01

Measuring telomere length is essential in telomere biology. Southern blot hybridization is the predominant method for measuring telomere length in the genetic model Saccharomyces cerevisiae. We have further developed and refined a telomere PCR approach, which was rarely used previously (mainly in specific telomeric projects), into a robust method allowing direct visualisation of telomere length differences in routine experiments with S. cerevisiae, and showing a strong correlation of results with data obtained by Southern blot hybridization. In this expanded method denoted as ATLAS (A-dvanced T-elomere L-ength A-nalysis in S. cerevisiae), we have introduced: 1) set of new primers annealing with high specificity to telomeric regions on five different chromosomes; 2) new approach for designing reverse telomere primers that is based on the ligation of an adaptor of a fixed size to telomeric ends. ATLAS can be used at the scale of individual assays and high-throughput approaches. This simple, time/cost-effective and reproducible methodology will complement Southern blot hybridization and facilitate further progress in telomere research. Copyright © 2016 Elsevier B.V. All rights reserved.

Framework for Understanding Balance Dysfunction in Parkinson’s Disease

PubMed Central

Schoneburg, Bernadette; Mancini, Martina; Horak, Fay; Nutt, John G.

2013-01-01

People with Parkinson’s disease (PD) suffer from progressive impairment in their mobility. Locomotor and balance dysfunction that impairs mobility in PD is an important cause of physical and psychosocial disability. The recognition and evaluation of balance dysfunction by the clinician is an essential component of managing PD. In this review, we describe a framework for understanding balance dysfunction in PD to help clinicians recognize patients that are at risk for falling and impaired mobility. PMID:23925954

Connecting Research on Retinitis Pigmentosa to the Practice of Orientation and Mobility.

ERIC Educational Resources Information Center

Geruschat, Duane R.; Turano, Kathleen A.

2002-01-01

Retinitis pigmentosa (RP) causes restriction of the visual field, progressive vision loss, and night blindness. This article presents an overview of the most common problems in orientation and mobility (O&M) for individuals with RP, appropriate interventions, vision science discoveries related to RP, and the impact of RP on functional visual…

The Pathways to Enterprise Mobile Readiness: Analysis of Perceptions, Pressures, Preparedness, and Progression

ERIC Educational Resources Information Center

Johnson, James Nathaniel

2013-01-01

Ubiquitous computing is a near reality in both the private and public arena. Business and personal spaces are seeing a proliferation of mobile computing devices and pervasive computing technologies. This phenomenon is creating a unique set of challenges for organizational IT professionals, specifically in the numerous spillover effects of having…

Mobile Technology in Hospital Schools: What Are Hospital Teachers' Professional Learning Needs?

ERIC Educational Resources Information Center

McCarthy, Aidan; Maor, Dorit; McConney, Andrew

2017-01-01

The aim of this study was to identify hospital teachers' professional learning needs to enable effective use of mobile technology in hospital schools. Hospitalized students cannot attend their regular schools and as a result their educational progress and development can suffer. In an attempt to address this, hospital schools provide learning…

Specialized Intervention Using Tablet Devices for Communication Deficits in Children with Autism Spectrum Disorders

ERIC Educational Resources Information Center

Cabielles-Hernandez, David; Pérez-Pérez, Juan-Ramón; Paule-Ruiz, MPuerto; Fernández-Fernández, Samuel

2017-01-01

New possibilities offered by mobile devices for special education students have led to the design of skill acquisition software applications. Advances in mobile technologies development have made progress possible in helping teachers with autistic students modelling and evaluation. "Chain of Words" theoretical basis is the autism…

Sex Stereotyping in Mexican Reading Primers.

ERIC Educational Resources Information Center

Heathcote, Olivia

A study was conducted comparing the sex stereotypes present in selected Mexican reading primers published in 1960 with those present in primers published in 1972 to determine whether any significant changes in sex stereotyping were reflected in the 1972 primers. Comparisons were made between four primers published in 1960 for grades one through…

Computational intelligence-based polymerase chain reaction primer selection based on a novel teaching-learning-based optimisation.

PubMed

Cheng, Yu-Huei

2014-12-01

Specific primers play an important role in polymerase chain reaction (PCR) experiments, and therefore it is essential to find specific primers of outstanding quality. Unfortunately, many PCR constraints must be simultaneously inspected which makes specific primer selection difficult and time-consuming. This paper introduces a novel computational intelligence-based method, Teaching-Learning-Based Optimisation, to select the specific and feasible primers. The specified PCR product lengths of 150-300 bp and 500-800 bp with three melting temperature formulae of Wallace's formula, Bolton and McCarthy's formula and SantaLucia's formula were performed. The authors calculate optimal frequency to estimate the quality of primer selection based on a total of 500 runs for 50 random nucleotide sequences of 'Homo species' retrieved from the National Center for Biotechnology Information. The method was then fairly compared with the genetic algorithm (GA) and memetic algorithm (MA) for primer selection in the literature. The results show that the method easily found suitable primers corresponding with the setting primer constraints and had preferable performance than the GA and the MA. Furthermore, the method was also compared with the common method Primer3 according to their method type, primers presentation, parameters setting, speed and memory usage. In conclusion, it is an interesting primer selection method and a valuable tool for automatic high-throughput analysis. In the future, the usage of the primers in the wet lab needs to be validated carefully to increase the reliability of the method.

Mobile Transcripts and Intercellular Communication in Plants.

PubMed

Saplaoura, E; Kragler, F

2016-01-01

Phloem serves as a highway for mobile signals in plants. Apart from sugars and hormones, proteins and RNAs are transported via the phloem and contribute to the intercellular communication coordinating growth and development. Different classes of RNAs have been found mobile and in the phloem exudate such as viral RNAs, small interfering RNAs (siRNAs), microRNAs, transfer RNAs, and messenger RNAs (mRNAs). Their transport is considered to be mediated via ribonucleoprotein complexes formed between phloem RNA-binding proteins and mobile RNA molecules. Recent advances in the analysis of the mobile transcriptome indicate that thousands of transcripts move along the plant axis. Although potential RNA mobility motifs were identified, research is still in progress on the factors triggering siRNA and mRNA mobility. In this review, we discuss the approaches used to identify putative mobile mRNAs, the transport mechanism, and the significance of mRNA trafficking. © 2016 Elsevier Inc. All rights reserved.

Delayed Induction of Human NTE (PNPLA6) Rescues Neurodegeneration and Mobility Defects of Drosophila swiss cheese (sws) Mutants.

PubMed

Sujkowski, Alyson; Rainier, Shirley; Fink, John K; Wessells, Robert J

2015-01-01

Human PNPLA6 gene encodes Neuropathy Target Esterase protein (NTE). PNPLA6 gene mutations cause hereditary spastic paraplegia (SPG39 HSP), Gordon-Holmes syndrome, Boucher-Neuhäuser syndromes, Laurence-Moon syndrome, and Oliver-McFarlane syndrome. Mutations in the Drosophila NTE homolog swiss cheese (sws) cause early-onset, progressive behavioral defects and neurodegeneration characterized by vacuole formation. We investigated sws5 flies and show for the first time that this allele causes progressive vacuolar formation in the brain and progressive deterioration of negative geotaxis speed and endurance. We demonstrate that inducible, neuron-specific expression of full-length human wildtype NTE reduces vacuole formation and substantially rescues mobility. Indeed, neuron-specific expression of wildtype human NTE is capable of rescuing mobility defects after 10 days of adult life at 29°C, when significant degeneration has already occurred, and significantly extends longevity of mutants at 25°C. These results raise the exciting possibility that late induction of NTE function may reduce or ameliorate neurodegeneration in humans even after symptoms begin. In addition, these results highlight the utility of negative geotaxis endurance as a new assay for longitudinal tracking of degenerative phenotypes in Drosophila.

PRISE2: software for designing sequence-selective PCR primers and probes.

PubMed

Huang, Yu-Ting; Yang, Jiue-in; Chrobak, Marek; Borneman, James

2014-09-25

PRISE2 is a new software tool for designing sequence-selective PCR primers and probes. To achieve high level of selectivity, PRISE2 allows the user to specify a collection of target sequences that the primers are supposed to amplify, as well as non-target sequences that should not be amplified. The program emphasizes primer selectivity on the 3' end, which is crucial for selective amplification of conserved sequences such as rRNA genes. In PRISE2, users can specify desired properties of primers, including length, GC content, and others. They can interactively manipulate the list of candidate primers, to choose primer pairs that are best suited for their needs. A similar process is used to add probes to selected primer pairs. More advanced features include, for example, the capability to define a custom mismatch penalty function. PRISE2 is equipped with a graphical, user-friendly interface, and it runs on Windows, Macintosh or Linux machines. PRISE2 has been tested on two very similar strains of the fungus Dactylella oviparasitica, and it was able to create highly selective primers and probes for each of them, demonstrating the ability to create useful sequence-selective assays. PRISE2 is a user-friendly, interactive software package that can be used to design high-quality selective primers for PCR experiments. In addition to choosing primers, users have an option to add a probe to any selected primer pair, enabling design of Taqman and other primer-probe based assays. PRISE2 can also be used to design probes for FISH and other hybridization-based assays.

Improved group-specific primers based on the full SILVA 16S rRNA gene reference database.

PubMed

Pfeiffer, Stefan; Pastar, Milica; Mitter, Birgit; Lippert, Kathrin; Hackl, Evelyn; Lojan, Paul; Oswald, Andreas; Sessitsch, Angela

2014-08-01

Quantitative PCR (qPCR) and community fingerprinting methods, such as the Terminal Restriction Fragment Length Polymorphism (T-RFLP) analysis,are well-suited techniques for the examination of microbial community structures. The use of phylum and class-specific primers can provide enhanced sensitivity and phylogenetic resolution as compared with domain-specific primers. To date, several phylum- and class-specific primers targeting the 16S ribosomal RNA gene have been published. However, many of these primers exhibit low discriminatory power against non-target bacteria in PCR. In this study, we evaluated the precision of certain published primers in silico and via specific PCR. We designed new qPCR and T-RFLP primer pairs (for the classes Alphaproteobacteria and Betaproteobacteria, and the phyla Bacteroidetes, Firmicutes and Actinobacteria) by combining the sequence information from a public dataset (SILVA SSU Ref 102 NR) with manual primer design. We evaluated the primer pairs via PCR using isolates of the above-mentioned groups and via screening of clone libraries from environmental soil samples and human faecal samples. As observed through theoretical and practical evaluation, the primers developed in this study showed a higher level of precision than previously published primers, thus allowing a deeper insight into microbial community dynamics.

MRPrimer: a MapReduce-based method for the thorough design of valid and ranked primers for PCR

PubMed Central

Kim, Hyerin; Kang, NaNa; Chon, Kang-Wook; Kim, Seonho; Lee, NaHye; Koo, JaeHyung; Kim, Min-Soo

2015-01-01

Primer design is a fundamental technique that is widely used for polymerase chain reaction (PCR). Although many methods have been proposed for primer design, they require a great deal of manual effort to generate feasible and valid primers, including homology tests on off-target sequences using BLAST-like tools. That approach is inconvenient for many target sequences of quantitative PCR (qPCR) due to considering the same stringent and allele-invariant constraints. To address this issue, we propose an entirely new method called MRPrimer that can design all feasible and valid primer pairs existing in a DNA database at once, while simultaneously checking a multitude of filtering constraints and validating primer specificity. Furthermore, MRPrimer suggests the best primer pair for each target sequence, based on a ranking method. Through qPCR analysis using 343 primer pairs and the corresponding sequencing and comparative analyses, we showed that the primer pairs designed by MRPrimer are very stable and effective for qPCR. In addition, MRPrimer is computationally efficient and scalable and therefore useful for quickly constructing an entire collection of feasible and valid primers for frequently updated databases like RefSeq. Furthermore, we suggest that MRPrimer can be utilized conveniently for experiments requiring primer design, especially real-time qPCR. PMID:26109350

SSRPrimer and SSR Taxonomy Tree: Biome SSR discovery

PubMed Central

Jewell, Erica; Robinson, Andrew; Savage, David; Erwin, Tim; Love, Christopher G.; Lim, Geraldine A. C.; Li, Xi; Batley, Jacqueline; Spangenberg, German C.; Edwards, David

2006-01-01

Simple sequence repeat (SSR) molecular genetic markers have become important tools for a broad range of applications such as genome mapping and genetic diversity studies. SSRs are readily identified within DNA sequence data and PCR primers can be designed for their amplification. These PCR primers frequently cross amplify within related species. We report a web-based tool, SSR Primer, that integrates SPUTNIK, an SSR repeat finder, with Primer3, a primer design program, within one pipeline. On submission of multiple FASTA formatted sequences, the script screens each sequence for SSRs using SPUTNIK. Results are then parsed to Primer3 for locus specific primer design. We have applied this tool for the discovery of SSRs within the complete GenBank database, and have designed PCR amplification primers for over 13 million SSRs. The SSR Taxonomy Tree server provides web-based searching and browsing of species and taxa for the visualisation and download of these SSR amplification primers. These tools are available at . PMID:16845092

SSRPrimer and SSR Taxonomy Tree: Biome SSR discovery.

PubMed

Jewell, Erica; Robinson, Andrew; Savage, David; Erwin, Tim; Love, Christopher G; Lim, Geraldine A C; Li, Xi; Batley, Jacqueline; Spangenberg, German C; Edwards, David

2006-07-01

Simple sequence repeat (SSR) molecular genetic markers have become important tools for a broad range of applications such as genome mapping and genetic diversity studies. SSRs are readily identified within DNA sequence data and PCR primers can be designed for their amplification. These PCR primers frequently cross amplify within related species. We report a web-based tool, SSR Primer, that integrates SPUTNIK, an SSR repeat finder, with Primer3, a primer design program, within one pipeline. On submission of multiple FASTA formatted sequences, the script screens each sequence for SSRs using SPUTNIK. Results are then parsed to Primer3 for locus specific primer design. We have applied this tool for the discovery of SSRs within the complete GenBank database, and have designed PCR amplification primers for over 13 million SSRs. The SSR Taxonomy Tree server provides web-based searching and browsing of species and taxa for the visualisation and download of these SSR amplification primers. These tools are available at http://bioinformatics.pbcbasc.latrobe.edu.au/ssrdiscovery.html.

A PCR primer bank for quantitative gene expression analysis.

PubMed

Wang, Xiaowei; Seed, Brian

2003-12-15

Although gene expression profiling by microarray analysis is a useful tool for assessing global levels of transcriptional activity, variability associated with the data sets usually requires that observed differences be validated by some other method, such as real-time quantitative polymerase chain reaction (real-time PCR). However, non-specific amplification of non-target genes is frequently observed in the latter, confounding the analysis in approximately 40% of real-time PCR attempts when primer-specific labels are not used. Here we present an experimentally validated algorithm for the identification of transcript-specific PCR primers on a genomic scale that can be applied to real-time PCR with sequence-independent detection methods. An online database, PrimerBank, has been created for researchers to retrieve primer information for their genes of interest. PrimerBank currently contains 147 404 primers encompassing most known human and mouse genes. The primer design algorithm has been tested by conventional and real-time PCR for a subset of 112 primer pairs with a success rate of 98.2%.

Teachers' Attitudes toward the Usage of Mobile Devices in EFL Classroom

ERIC Educational Resources Information Center

Dogan, Ali; Akbarov, Azamat

2016-01-01

Nowadays, technology is developing in a geometrically progressive manner. Its usage in different social areas is an imperative, rather than a choice. As expected, digital devices are applicable in the educational context, as well. Hence, the scope of the present study is to examine attitudes toward mobile learning among English teachers. For this…

English-Language Learning at Their Fingertips: How Can Teachers Use Tablets to Teach EFL Children?

ERIC Educational Resources Information Center

Alhinty, Mona

2015-01-01

The emergence of multi-touch screen tablets has increased the opportunities for mobile learning, as the unique capabilities and affordances of these devices give them an educational advantage over other mobile technologies. Tablets are progressively finding their way into classrooms and transforming modes of learning and teaching. However,…

Mathvision: A Mobile Video Application for Math Teacher Noticing of Learning Progressions

ERIC Educational Resources Information Center

Lewis, Stephen T.; Chao, Theodore; Battista, Michael

2017-01-01

We report on the development and evaluation of MathVision, a mobile-application designed to develop Virtual Professional Learning Communities through asynchronous discussion about 2nd, 3rd, 4th, and 5th grade students' mathematical thinking. MathVision allows teachers to upload videos of problems solving sessions using Cognition Based Assessment…

Parental Perception of Mobile Device Usage in Children and Social Competency

ERIC Educational Resources Information Center

Topper, Christin

2017-01-01

Parents in the 21st century are concerned with the ubiquity of mobile devices and their effects on the progression of social development. A review of the literature indicated that although digital interaction has become more prominent, limited empirical data existed on whether children who spend more time interacting in the digital realm would…

Comparison among amoA Primers Suited for Quantification and Diversity Analyses of Ammonia-Oxidizing Bacteria in Soil

PubMed Central

Shimomura, Yumi; Morimoto, Sho; Hoshino, Yuko Takada; Uchida, Yoshitaka; Akiyama, Hiroko; Hayatsu, Masahito

2012-01-01

Ammonia monooxygenase subunit A gene (amoA) is frequently used as a functional gene marker for diversity analysis of ammonia-oxidizing bacteria (AOB). To select a suitable amoA primer for real-time PCR and PCR-denaturing gradient gel electrophoresis (DGGE), three reverse primers (degenerate primer amoA-2R; non-degenerate primers amoA-2R-GG and amoA-2IR) were examined. No significant differences were observed among the three primers in terms of quantitative values of amoA from environmental samples using real-time PCR. We found that PCR-DGGE analysis with the amoA-2IR primer gave the best results in this studied soil. These results indicate that amoA-2IR is a suitable primer for community analysis of AOB in the environment. PMID:22075625

Characterization and modification of phage T7 DNA polymerase for use in DNA sequencing; Progress report, June 1, 1990--May 31, 1993

DOE Office of Scientific and Technical Information (OSTI.GOV)

Richardson, C.C.

1993-12-31

This project focuses on the DNA polymerase (gene 5 protein) of phage T7 for use in DNA sequence analysis. Gene 5 protein interacts with accessory proteins to acquire properties essential for DNA replication. One goal is to understand these interactions in order to modify the proteins for use in DNA sequencing. E. coli thioredoxin, binds to gene 5 protein and clamps it to a primer-template. They have analyzed the binding of gene 5 protein-thioredoxin to primer-templates and have defined the optimal conditions to form an extremely stable complex with a dNTP in the polymerase catalytic site. The spatial proximity ofmore » these components has been determined using fluorescence emission anisotropy. The T7 DNA binding protein, the gene 2.5 protein, interacts with gene 5 protein and gene 4 protein to increase processivity and primer synthesis, respectively. Mutant gene 2.5 proteins have been isolated that do not interact with T7 DNA polymerase and can not support T7 growth. The nucleotide binding site of the T7 helicase has been identified and mutations affecting the site provide information on how the hydrolysis of NTPs fuel its unidirectional translocation. The sequence, GTC, has been shown to be necessary and sufficient for recognition by the T7 primase. The T7 gene 5.5 protein interacts with the E. coli nucleoid protein, H-NS, and also overcomes the phage {lambda} rex restriction system.« less

Polymerase cross-linking spiral reaction (PCLSR) for detection of African swine fever virus (ASFV) in pigs and wild boars

PubMed Central

Woźniakowski, Grzegorz; Frączyk, Magdalena; Kowalczyk, Andrzej; Pomorska-Mól, Małgorzata; Niemczuk, Krzysztof; Pejsak, Zygmunt

2017-01-01

The study reports the development of a polymerase cross-linking spiral reaction (PCLSR) for the detection of African swine fever virus (ASFV) DNA in blood collected from infected pigs and wild boars. The method uses 3 specifically designed primers. Two outer-spiral primers comprising of 3′ sequences complementary to ASFV p72 gene sequence and 5′end sequences complementary to exogenous gene of black widow alpha-latrotoxin as well as additional ASFV specific cross-linking primer. The method is specific exclusively to ASFV DNA without cross-reactions with cDNA of classical swine fever virus (CSFV), porcine reproductive respiratory syndrome (PRRSV) or porcine epidemic diarrhea virus (PEDV). The sensitivity of this technique reached 7.2 × 102 copies per μl−1 of plasmid containing p72 gene. The PCLSR was conducted at 65 °C creating cross-linked complex structures. The results of PCLSR were visualized using SYBR Green I dye, gel electrophoresis while the reaction progress was traced using real-time PCR system that resulted in registration of fluorescent curves and melting peaks at 85.3 °C. The developed PCLSR was examined using blood or tissue samples collected from selected 17 ASF cases from infected wild boars and 3 outbreaks in pigs. Further tests have been also conducted using 55 tissue samples from 23 outbreaks and 22 cases. These results showed that PCLSR might be further used for preliminary and cost-effective detection and surveillance of ASFV. PMID:28198455

Polymerase cross-linking spiral reaction (PCLSR) for detection of African swine fever virus (ASFV) in pigs and wild boars.

PubMed

Woźniakowski, Grzegorz; Frączyk, Magdalena; Kowalczyk, Andrzej; Pomorska-Mól, Małgorzata; Niemczuk, Krzysztof; Pejsak, Zygmunt

2017-02-15

The study reports the development of a polymerase cross-linking spiral reaction (PCLSR) for the detection of African swine fever virus (ASFV) DNA in blood collected from infected pigs and wild boars. The method uses 3 specifically designed primers. Two outer-spiral primers comprising of 3' sequences complementary to ASFV p72 gene sequence and 5'end sequences complementary to exogenous gene of black widow alpha-latrotoxin as well as additional ASFV specific cross-linking primer. The method is specific exclusively to ASFV DNA without cross-reactions with cDNA of classical swine fever virus (CSFV), porcine reproductive respiratory syndrome (PRRSV) or porcine epidemic diarrhea virus (PEDV). The sensitivity of this technique reached 7.2 × 10 2 copies per μl -1 of plasmid containing p72 gene. The PCLSR was conducted at 65 °C creating cross-linked complex structures. The results of PCLSR were visualized using SYBR Green I dye, gel electrophoresis while the reaction progress was traced using real-time PCR system that resulted in registration of fluorescent curves and melting peaks at 85.3 °C. The developed PCLSR was examined using blood or tissue samples collected from selected 17 ASF cases from infected wild boars and 3 outbreaks in pigs. Further tests have been also conducted using 55 tissue samples from 23 outbreaks and 22 cases. These results showed that PCLSR might be further used for preliminary and cost-effective detection and surveillance of ASFV.

40 CFR 63.3092 - How must I control emissions from my electrodeposition primer system if I want to comply with the...

Code of Federal Regulations, 2011 CFR

2011-07-01

... electrodeposition primer system if I want to comply with the combined primer-surfacer, topcoat, final repair, glass bonding primer, and glass bonding adhesive emission limit? 63.3092 Section 63.3092 Protection of...-surfacer, topcoat, final repair, glass bonding primer, and glass bonding adhesive emission limit? If your...

40 CFR 63.3092 - How must I control emissions from my electrodeposition primer system if I want to comply with the...

Code of Federal Regulations, 2010 CFR

2010-07-01

... electrodeposition primer system if I want to comply with the combined primer-surfacer, topcoat, final repair, glass bonding primer, and glass bonding adhesive emission limit? 63.3092 Section 63.3092 Protection of...-surfacer, topcoat, final repair, glass bonding primer, and glass bonding adhesive emission limit? If your...

Phylum- and Class-Specific PCR Primers for General Microbial Community Analysis

PubMed Central

Blackwood, Christopher B.; Oaks, Adam; Buyer, Jeffrey S.

2005-01-01

Amplification of a particular DNA fragment from a mixture of organisms by PCR is a common first step in methods of examining microbial community structure. The use of group-specific primers in community DNA profiling applications can provide enhanced sensitivity and phylogenetic detail compared to domain-specific primers. Other uses for group-specific primers include quantitative PCR and library screening. The purpose of the present study was to develop several primer sets targeting commonly occurring and important groups. Primers specific for the 16S ribosomal sequences of Alphaproteobacteria, Betaproteobacteria, Bacilli, Actinobacteria, and Planctomycetes and for parts of both the 18S ribosomal sequence and the internal transcribed spacer region of Basidiomycota were examined. Primers were tested by comparison to sequences in the ARB 2003 database, and chosen primers were further tested by cloning and sequencing from soil community DNA. Eighty-five to 100% of the sequences obtained from clone libraries were found to be placed with the groups intended as targets, demonstrating the specificity of the primers under field conditions. It will be important to reevaluate primers over time because of the continual growth of sequence databases and revision of microbial taxonomy. PMID:16204538

Effects of three silane primers and five adhesive agents on the bond strength of composite material for a computer-aided design and manufacturing system.

PubMed

Shinohara, Ayano; Taira, Yohsuke; Sakihara, Michino; Sawase, Takashi

2018-01-01

Objective The objective of this study was to evaluate the effects of combinations of silane primers and adhesive agents on the bond strength of a composite block for a computer-aided design and manufacturing system. Material and Methods Three silane primers [Clearfil Ceramic Primer (CP), Super-Bond PZ Primer (PZ), and GC Ceramic Primer II (GP)] were used in conjunction with five adhesive agents [G-Premio Bond (P-Bond), Repair Adhe Adhesive (R-Adhesive), Super-Bond D-Liner Dual (SB-Dual), Super-Bond C&B (SB-Self), and SB-Dual without tributylborane derivative (SB-Light)]. The surface of a composite block (Gradia Block) was ground with silicon carbide paper. After treatment with a silane primer, a adhesive agent was applied to each testing specimen. The specimens were then bonded with a light-curing resin composite. After 24 h, the shear bond strength values were determined and compared using a post hoc test (α=0.05, n=8/group). We also prepared control specimens without primer (No primer) and/or without adhesive agent (No adhesive). Results PZ/SB-Dual and GP/SB-Dual presented the highest bond strength, followed by GP/P-Bond, CP/SB-Dual, CP/R-Adhesive, No primer/SB-Dual, GP/R-Adhesive, CP/P-Bond, No primer/R-Adhesive, PZ/R-Adhesive, CP/SB-Self, PZ/P-Bond, PZ/SB-Self, and GP/SB-Self in descending order of bond strength. No primer/P-Bond, No primer/SB-Self, and all specimens in the SB-Light and No adhesive groups presented the lowest bond strengths. Conclusion A dual-curing adhesive agent (SB-Dual) containing a tributylborane derivative in combination with a silane primer (GP or PZ) presents a greater bond strength between the composite block and the repairing resin composite than the comparators used in the study.

Effects of three silane primers and five adhesive agents on the bond strength of composite material for a computer-aided design and manufacturing system

PubMed Central

2018-01-01

Abstract Objective The objective of this study was to evaluate the effects of combinations of silane primers and adhesive agents on the bond strength of a composite block for a computer-aided design and manufacturing system. Material and Methods Three silane primers [Clearfil Ceramic Primer (CP), Super-Bond PZ Primer (PZ), and GC Ceramic Primer II (GP)] were used in conjunction with five adhesive agents [G-Premio Bond (P-Bond), Repair Adhe Adhesive (R-Adhesive), Super-Bond D-Liner Dual (SB-Dual), Super-Bond C&B (SB-Self), and SB-Dual without tributylborane derivative (SB-Light)]. The surface of a composite block (Gradia Block) was ground with silicon carbide paper. After treatment with a silane primer, a adhesive agent was applied to each testing specimen. The specimens were then bonded with a light-curing resin composite. After 24 h, the shear bond strength values were determined and compared using a post hoc test (α=0.05, n=8/group). We also prepared control specimens without primer (No primer) and/or without adhesive agent (No adhesive). Results PZ/SB-Dual and GP/SB-Dual presented the highest bond strength, followed by GP/P-Bond, CP/SB-Dual, CP/R-Adhesive, No primer/SB-Dual, GP/R-Adhesive, CP/P-Bond, No primer/R-Adhesive, PZ/R-Adhesive, CP/SB-Self, PZ/P-Bond, PZ/SB-Self, and GP/SB-Self in descending order of bond strength. No primer/P-Bond, No primer/SB-Self, and all specimens in the SB-Light and No adhesive groups presented the lowest bond strengths. Conclusion A dual-curing adhesive agent (SB-Dual) containing a tributylborane derivative in combination with a silane primer (GP or PZ) presents a greater bond strength between the composite block and the repairing resin composite than the comparators used in the study. PMID:29742254

MRPrimerW: a tool for rapid design of valid high-quality primers for multiple target qPCR experiments

PubMed Central

Kim, Hyerin; Kang, NaNa; An, KyuHyeon; Koo, JaeHyung; Kim, Min-Soo

2016-01-01

Design of high-quality primers for multiple target sequences is essential for qPCR experiments, but is challenging due to the need to consider both homology tests on off-target sequences and the same stringent filtering constraints on the primers. Existing web servers for primer design have major drawbacks, including requiring the use of BLAST-like tools for homology tests, lack of support for ranking of primers, TaqMan probes and simultaneous design of primers against multiple targets. Due to the large-scale computational overhead, the few web servers supporting homology tests use heuristic approaches or perform homology tests within a limited scope. Here, we describe the MRPrimerW, which performs complete homology testing, supports batch design of primers for multi-target qPCR experiments, supports design of TaqMan probes and ranks the resulting primers to return the top-1 best primers to the user. To ensure high accuracy, we adopted the core algorithm of a previously reported MapReduce-based method, MRPrimer, but completely redesigned it to allow users to receive query results quickly in a web interface, without requiring a MapReduce cluster or a long computation. MRPrimerW provides primer design services and a complete set of 341 963 135 in silico validated primers covering 99% of human and mouse genes. Free access: http://MRPrimerW.com. PMID:27154272

MRPrimer: a MapReduce-based method for the thorough design of valid and ranked primers for PCR.

PubMed

Kim, Hyerin; Kang, NaNa; Chon, Kang-Wook; Kim, Seonho; Lee, NaHye; Koo, JaeHyung; Kim, Min-Soo

2015-11-16

Primer design is a fundamental technique that is widely used for polymerase chain reaction (PCR). Although many methods have been proposed for primer design, they require a great deal of manual effort to generate feasible and valid primers, including homology tests on off-target sequences using BLAST-like tools. That approach is inconvenient for many target sequences of quantitative PCR (qPCR) due to considering the same stringent and allele-invariant constraints. To address this issue, we propose an entirely new method called MRPrimer that can design all feasible and valid primer pairs existing in a DNA database at once, while simultaneously checking a multitude of filtering constraints and validating primer specificity. Furthermore, MRPrimer suggests the best primer pair for each target sequence, based on a ranking method. Through qPCR analysis using 343 primer pairs and the corresponding sequencing and comparative analyses, we showed that the primer pairs designed by MRPrimer are very stable and effective for qPCR. In addition, MRPrimer is computationally efficient and scalable and therefore useful for quickly constructing an entire collection of feasible and valid primers for frequently updated databases like RefSeq. Furthermore, we suggest that MRPrimer can be utilized conveniently for experiments requiring primer design, especially real-time qPCR. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

A 22-mer primer enhances discriminatory power of AP-PCR fingerprinting technique in characterization of leptospires.

PubMed

Roy, Subarna; Biswas, Debabrata; Vijayachari, P; Sugunan, A P; Sehgal, Subhash C

2004-11-01

To evaluate the discriminatory power and usefulness of arbitrarily primed-polymerase chain reaction (AP-PCR) characterization of leptospires with M16 primer. AP-PCR fingerprints of 20 reference strains of Leptospira representing 20 different serovars belonging to seven genospecies (Leptospira interrogans, 11; L. noguchii, 2; L. borgpetersenii, 1; L. santarosai, 2; L. biflexa, 2; L. kirschneri, 1; L. weilii, 1) were generated by employing M16 primer. Fingerprints generated with this primer were compared with those generated with two other commonly used primers PB1, and L10. An attempt was also made to type 20 leptospiral isolates with the M16 primer. Fingerprints with M16 primer could not only differentiate between strains of different genospecies, but also between strains of the same genospecies belonging to different serovars. While two commonly used primers (PB1 and L10) failed to discriminate between some of the different serovars belonging to the same genospecies, this primer was able to generate discriminatory fingerprints for all strains tested. All 20 Leptospira isolates, recovered from patients in Andaman Islands, could also be typed by fingerprints generated with the M16 primer. The discriminatory power of M16 primer adds more specificity to the rapidity of this system of characterization and can be used as an excellent tool in epidemiological studies on Leptospira.

Association between advanced glycation end-products and functional performance in Alzheimer's disease and mixed dementia.

PubMed

Drenth, Hans; Zuidema, Sytse U; Krijnen, Wim P; Bautmans, Ivan; van der Schans, Cees; Hobbelen, Hans

2017-09-01

People with Alzheimer's disease (AD) experience, in addition to the progressive loss of cognitive functions, a decline in functional performance such as mobility impairment and disability in activities of daily living (ADL). Functional decline in dementia is mainly linked to the progressive brain pathology. Peripheral biomechanical changes by advanced glycation end-products (AGEs) have been suggested but have yet to be thoroughly studied. A multi-center, longitudinal, one-year follow-up cohort study was conducted in 144 people with early stage AD or mixed Alzheimer's/Vascular dementia. Linear mixed model analyses was used to study associations between AGE-levels (AGE reader) and mobility (Timed Up and Go), and ADL (Groningen Activity Restriction Scale and Barthel index), respectively. A significant association between AGE levels and mobility (β = 3.57, 95%CI: 1.43-5.73) was revealed; however, no significant association between AGE levels and ADL was found. Over a one-year time span, mean AGE levels significantly increased, and mobility and ADL performance decreased. Change in AGE levels was not significantly correlated with change in mobility. This study indicates that high AGE levels could be a contributing factor to impaired mobility but lacks evidence for an association with ADL decline in people with early stage AD or mixed dementia. Future research is necessary on the reduction of functional decline in dementia regarding the effectiveness of interventions such as physical activity programs and dietary advice possibly in combination with pharmacologic strategies targeting AGE accumulation.

Output testing of small-arms primers

NASA Technical Reports Server (NTRS)

Bement, Laurence J.; Doris, Thomas A.; Schimmel, Morry L.

1991-01-01

The performance of two standard primers for initiating small-caliber ammunition are compared to that of a primer for initiating aircraft escape-system components. Three testing methods are employed including: (1) firing the primer to measure total energy delivered; (2) monitoring output in terms of gaseous product-mass flow rate and pressure as a function of time; and (3) firing the primer onto ignition material to study gas pressure produced during ignition and burning as a function of time. The results of the test demonstrate differences in the ignitability factors of the standard primers and time peak pressures of less than 100 microseconds. One unexpected result is that two percussion primers (the FA-41 and the M42C1) developed for different applications have the same ignitability. The ignitability test method is shown to yield the most useful data and can be used to specify percussion primers and optimize their performance.

Transferability of retrotransposon primers derived from Persimmon (Diospyros kaki Thunb.) across other plant species.

PubMed

Du, X Y; Hu, Q N; Zhang, Q L; Wang, Y B; Luo, Z R

2013-06-06

Retrotransposon-based molecular markers are powerful molecular tools. However, these markers are not readily available due to the difficulty in obtaining species-specific retrotransposon primers. Although recent techniques enabling the rapid isolation of retrotransposon sequences have facilitated primer development, this process nonetheless remains time-consuming and costly. Therefore, research into the transferability of retrotransposon primers developed from one plant species onto others would be of great value. The present study investigated the transferability of retrotransposon primers derived from 'Luotian-tianshi' persimmon (Diospyros kaki Thunb.) across other fruit crops, as well as within the genus using inter-retrotransposon amplified polymorphism molecular marker. Fourteen of the 26 retrotransposon primers tested (53.85%) produced robust and reproducible amplification products across all fruit crops tested, indicating their applicability across plant species. Four of the 13 fruit crops showed the best transferability performances: persimmon, grape, citrus, and peach. Furthermore, similarity coefficients and UPGMA clustering indicated that these primers could further offer a potential tool for germplasm differentiation, parentage identification, genetic diversity assessment, classification, and phylogenetic studies across a variety of plant species. Transferability was further confirmed by examining published primers derived from Rosaceae, Gramineae, and Solanaceae. This study is one of the few currently available studies concerning the transferability of retrotransposon primers across plant species in general, and is the first successful study of the transferability of retrotransposon primers derived from persimmon. The primers presented here will help reduce costs for future retrotransposon primer development and therefore contribute to the popularization of retrotransposon molecular markers.

Value for money assessment for public-private partnerships : a primer.

DOT National Transportation Integrated Search

2015-01-01

This primer addresses Value for Money Assessment for public-private partnerships (P3s). Companion primers on Financial Assessment and Risk Assessment for P3s are also available as part of this series of primers.

Phytoplasma-specific PCR primers based on sequences of the 16S-23S rRNA spacer region.

PubMed Central

Smart, C D; Schneider, B; Blomquist, C L; Guerra, L J; Harrison, N A; Ahrens, U; Lorenz, K H; Seemüller, E; Kirkpatrick, B C

1996-01-01

In order to develop a diagnostic tool to identify phytoplasmas and classify them according to their phylogenetic group, we took advantage of the sequence diversity of the 16S-23S intergenic spacer regions (SRs) of phytoplasmas. Ten PCR primers were developed from the SR sequences and were shown to amplify in a group-specific fashion. For some groups of phytoplasmas, such as elm yellows, ash yellows, and pear decline, the SR primer was paired with a specific primer from within the 16S rRNA gene. Each of these primer pairs was specific for a specific phytoplasma group, and they did not produce PCR products of the correct size from any other phytoplasma group. One primer was designed to anneal within the conserved tRNA(Ile) and, when paired with a universal primer, amplified all phytoplasmas tested. None of the primers produced PCR amplification products of the correct size from healthy plant DNA. These primers can serve as effective tools for identifying particular phytoplasmas in field samples. PMID:8702291

A multiple-alignment based primer design algorithm for genetically highly variable DNA targets

PubMed Central

2013-01-01

Background Primer design for highly variable DNA sequences is difficult, and experimental success requires attention to many interacting constraints. The advent of next-generation sequencing methods allows the investigation of rare variants otherwise hidden deep in large populations, but requires attention to population diversity and primer localization in relatively conserved regions, in addition to recognized constraints typically considered in primer design. Results Design constraints include degenerate sites to maximize population coverage, matching of melting temperatures, optimizing de novo sequence length, finding optimal bio-barcodes to allow efficient downstream analyses, and minimizing risk of dimerization. To facilitate primer design addressing these and other constraints, we created a novel computer program (PrimerDesign) that automates this complex procedure. We show its powers and limitations and give examples of successful designs for the analysis of HIV-1 populations. Conclusions PrimerDesign is useful for researchers who want to design DNA primers and probes for analyzing highly variable DNA populations. It can be used to design primers for PCR, RT-PCR, Sanger sequencing, next-generation sequencing, and other experimental protocols targeting highly variable DNA samples. PMID:23965160

Detection of Prostate Cancer Progression by Serum DNA Integrity

DTIC Science & Technology

2009-04-01

DNA was assayed for AI of 6 genome microsatellites. We assessed meth- ylation of RASSF1, RARB2, and GSTP1 using a methylation-specific PCR assay and...microsatellites. The epigenetic biomarkers evaluated were 3 tumor suppressor genes that are frequently hypermethylated in PCa: GSTP1 (glutathione S...8p22, D8S262 at 8p23, D9S171 at 9p21, D10S591 at 10p15, and D18S70 at 18q23. Forward primer sets were labeled with WellRed 8 Human genes: GSTP1

Status Report on Speech Research. A Report on the Status and Progress of Studies on the Nature of Speech, Instrumentation for Its Investigation, and Practical Applications.

DTIC Science & Technology

1986-01-01

1984). La segmentacion fonologica y silabica en ninos de preescolar y primer grado. Lectura y Vida, 5, 4-13. "-:" " Marcel, A. (1980). Phonological...vaibe (L i rtuin A-li prue r xrse Figuent fo. B ilabial sks:tA. tok sacen th.Cld ie dimninflpaentue ( LA )arabe (LP lip protrusion, LAP) Lip aperture...beutioen (7) copetans alontan selip yaicpraees, and gi rtuinb h orinthe movements for the bitabiar-onstridction og the dimesions loe lips prur ( LA ) ande lip

New Homes, New Neighborhoods, New Schools: A Progress Report on the Baltimore Housing Mobility Program

ERIC Educational Resources Information Center

Engdahl, Lora

2009-01-01

In the Baltimore region, a successful housing mobility program is providing families living in very disadvantaged inner city communities with a new home and a chance for a new life. Minority voucher holders in the federal Housing Choice Voucher Program (formerly titled Section 8) have often been limited to living in "voucher submarkets"…

Mentoring into Higher Education: A Useful Addition to the Landscape of Widening Access to Higher Education?

ERIC Educational Resources Information Center

Wilson, Alistair; Hunter, Katie; Spohrer, Konstanze; Bruner, Richard; Beasley, Anna

2014-01-01

Alan Milburn, the Chair of the Government's Social Mobility and Child Poverty Commission recently highlighted the role of education in progressing social mobility in Scotland; "In my view it's a grave social injustice that only one in forty pupils from Scotland's most deprived households…got three As in their Highers in 2011, compared to one…

Inventing Orientation and Mobility Techniques and Teaching Methods: A Conversation with Russell Williams

ERIC Educational Resources Information Center

Welsh, Richard L.

2005-01-01

Russell C. Williams was a key figure in the progression of orientation and mobility from the Army's immediate response to the servicemen and women who lost their sight during World War II to a recognized profession delivering individualized instruction to visually impaired people throughout the world. Blinded in combat while serving in the U.S.…

State of the Art of Language Learning Design Using Mobile Technology: Sample Apps and Some Critical Reflection

ERIC Educational Resources Information Center

Bárcena, Elena; Read, Timothy; Underwood, Joshua; Obari, Hiroyuki; Cojocnean, Diana; Koyama, Toshiko; Pareja-Lora, Antonio; Calle, Cristina; Pomposo, Lourdes; Talaván, Noa; Ávila-Cabrera, José; Ibañez, Ana; Vermeulen, Anna; Jordano, María; Arús-Hita, Jorge; Rodríguez, Pilar; Castrillo, María Dolores; Kétyi, Andras; Selwood, Jaime; Gaved, Mark; Kukulska-Hulme, Agnes

2015-01-01

In this paper, experiences from different research groups illustrate the state-of-the-art of Mobile Assisted Language Learning (henceforth, MALL) in formal and non-formal education. These research samples represent recent and on-going progress made in the field of MALL at an international level and offer encouragement for practitioners who are…

PD_Manager: an mHealth platform for Parkinson's disease patient management.

PubMed

Tsiouris, Kostas M; Gatsios, Dimitrios; Rigas, George; Miljkovic, Dragana; Koroušić Seljak, Barbara; Bohanec, Marko; Arredondo, Maria T; Antonini, Angelo; Konitsiotis, Spyros; Koutsouris, Dimitrios D; Fotiadis, Dimitrios I

2017-06-01

PD_Manager is a mobile health platform designed to cover most of the aspects regarding the management of Parkinson's disease (PD) in a holistic approach. Patients are unobtrusively monitored using commercial wrist and insole sensors paired with a smartphone, to automatically estimate the severity of most of the PD motor symptoms. Besides motor symptoms monitoring, the patient's mobile application also provides various non-motor self-evaluation tests for assessing cognition, mood and nutrition to motivate them in becoming more active in managing their disease. All data from the mobile application and the sensors is transferred to a cloud infrastructure to allow easy access for clinicians and further processing. Clinicians can access this information using a separate mobile application that is specifically designed for their respective needs to provide faster and more accurate assessment of PD symptoms that facilitate patient evaluation. Machine learning techniques are used to estimate symptoms and disease progression trends to further enhance the provided information. The platform is also complemented with a decision support system (DSS) that notifies clinicians for the detection of new symptoms or the worsening of existing ones. As patient's symptoms are progressing, the DSS can also provide specific suggestions regarding appropriate medication changes.

PD_Manager: an mHealth platform for Parkinson's disease patient management

PubMed Central

Gatsios, Dimitrios; Rigas, George; Miljkovic, Dragana; Koroušić Seljak, Barbara; Bohanec, Marko; Arredondo, Maria T.; Antonini, Angelo; Konitsiotis, Spyros; Koutsouris, Dimitrios D.

2017-01-01

PD_Manager is a mobile health platform designed to cover most of the aspects regarding the management of Parkinson's disease (PD) in a holistic approach. Patients are unobtrusively monitored using commercial wrist and insole sensors paired with a smartphone, to automatically estimate the severity of most of the PD motor symptoms. Besides motor symptoms monitoring, the patient's mobile application also provides various non-motor self-evaluation tests for assessing cognition, mood and nutrition to motivate them in becoming more active in managing their disease. All data from the mobile application and the sensors is transferred to a cloud infrastructure to allow easy access for clinicians and further processing. Clinicians can access this information using a separate mobile application that is specifically designed for their respective needs to provide faster and more accurate assessment of PD symptoms that facilitate patient evaluation. Machine learning techniques are used to estimate symptoms and disease progression trends to further enhance the provided information. The platform is also complemented with a decision support system (DSS) that notifies clinicians for the detection of new symptoms or the worsening of existing ones. As patient's symptoms are progressing, the DSS can also provide specific suggestions regarding appropriate medication changes. PMID:28706727

Mobile phones and head tumours. The discrepancies in cause-effect relationships in the epidemiological studies - how do they arise?

PubMed

Levis, Angelo G; Minicuci, Nadia; Ricci, Paolo; Gennaro, Valerio; Garbisa, Spiridione

2011-06-17

Whether or not there is a relationship between use of mobile phones (analogue and digital cellulars, and cordless) and head tumour risk (brain tumours, acoustic neuromas, and salivary gland tumours) is still a matter of debate; progress requires a critical analysis of the methodological elements necessary for an impartial evaluation of contradictory studies. A close examination of the protocols and results from all case-control and cohort studies, pooled- and meta-analyses on head tumour risk for mobile phone users was carried out, and for each study the elements necessary for evaluating its reliability were identified. In addition, new meta-analyses of the literature data were undertaken. These were limited to subjects with mobile phone latency time compatible with the progression of the examined tumours, and with analysis of the laterality of head tumour localisation corresponding to the habitual laterality of mobile phone use. Blind protocols, free from errors, bias, and financial conditioning factors, give positive results that reveal a cause-effect relationship between long-term mobile phone use or latency and statistically significant increase of ipsilateral head tumour risk, with biological plausibility. Non-blind protocols, which instead are affected by errors, bias, and financial conditioning factors, give negative results with systematic underestimate of such risk. However, also in these studies a statistically significant increase in risk of ipsilateral head tumours is quite common after more than 10 years of mobile phone use or latency. The meta-analyses, our included, examining only data on ipsilateral tumours in subjects using mobile phones since or for at least 10 years, show large and statistically significant increases in risk of ipsilateral brain gliomas and acoustic neuromas. Our analysis of the literature studies and of the results from meta-analyses of the significant data alone shows an almost doubling of the risk of head tumours induced by long-term mobile phone use or latency.

Mobile phones and head tumours. The discrepancies in cause-effect relationships in the epidemiological studies - how do they arise?

PubMed Central

2011-01-01

Background Whether or not there is a relationship between use of mobile phones (analogue and digital cellulars, and cordless) and head tumour risk (brain tumours, acoustic neuromas, and salivary gland tumours) is still a matter of debate; progress requires a critical analysis of the methodological elements necessary for an impartial evaluation of contradictory studies. Methods A close examination of the protocols and results from all case-control and cohort studies, pooled- and meta-analyses on head tumour risk for mobile phone users was carried out, and for each study the elements necessary for evaluating its reliability were identified. In addition, new meta-analyses of the literature data were undertaken. These were limited to subjects with mobile phone latency time compatible with the progression of the examined tumours, and with analysis of the laterality of head tumour localisation corresponding to the habitual laterality of mobile phone use. Results Blind protocols, free from errors, bias, and financial conditioning factors, give positive results that reveal a cause-effect relationship between long-term mobile phone use or latency and statistically significant increase of ipsilateral head tumour risk, with biological plausibility. Non-blind protocols, which instead are affected by errors, bias, and financial conditioning factors, give negative results with systematic underestimate of such risk. However, also in these studies a statistically significant increase in risk of ipsilateral head tumours is quite common after more than 10 years of mobile phone use or latency. The meta-analyses, our included, examining only data on ipsilateral tumours in subjects using mobile phones since or for at least 10 years, show large and statistically significant increases in risk of ipsilateral brain gliomas and acoustic neuromas. Conclusions Our analysis of the literature studies and of the results from meta-analyses of the significant data alone shows an almost doubling of the risk of head tumours induced by long-term mobile phone use or latency. PMID:21679472

Dental caries.

PubMed

Pitts, Nigel B; Zero, Domenick T; Marsh, Phil D; Ekstrand, Kim; Weintraub, Jane A; Ramos-Gomez, Francisco; Tagami, Junji; Twetman, Svante; Tsakos, Georgios; Ismail, Amid

2017-05-25

Dental caries is a biofilm-mediated, sugar-driven, multifactorial, dynamic disease that results in the phasic demineralization and remineralization of dental hard tissues. Caries can occur throughout life, both in primary and permanent dentitions, and can damage the tooth crown and, in later life, exposed root surfaces. The balance between pathological and protective factors influences the initiation and progression of caries. This interplay between factors underpins the classification of individuals and groups into caries risk categories, allowing an increasingly tailored approach to care. Dental caries is an unevenly distributed, preventable disease with considerable economic and quality-of-life burdens. The daily use of fluoride toothpaste is seen as the main reason for the overall decline of caries worldwide over recent decades. This Primer aims to provide a global overview of caries, acknowledging the historical era dominated by restoration of tooth decay by surgical means, but focuses on current, progressive and more holistic long-term, patient-centred, tooth-preserving preventive care.

MRPrimerW: a tool for rapid design of valid high-quality primers for multiple target qPCR experiments.

PubMed

Kim, Hyerin; Kang, NaNa; An, KyuHyeon; Koo, JaeHyung; Kim, Min-Soo

2016-07-08

Design of high-quality primers for multiple target sequences is essential for qPCR experiments, but is challenging due to the need to consider both homology tests on off-target sequences and the same stringent filtering constraints on the primers. Existing web servers for primer design have major drawbacks, including requiring the use of BLAST-like tools for homology tests, lack of support for ranking of primers, TaqMan probes and simultaneous design of primers against multiple targets. Due to the large-scale computational overhead, the few web servers supporting homology tests use heuristic approaches or perform homology tests within a limited scope. Here, we describe the MRPrimerW, which performs complete homology testing, supports batch design of primers for multi-target qPCR experiments, supports design of TaqMan probes and ranks the resulting primers to return the top-1 best primers to the user. To ensure high accuracy, we adopted the core algorithm of a previously reported MapReduce-based method, MRPrimer, but completely redesigned it to allow users to receive query results quickly in a web interface, without requiring a MapReduce cluster or a long computation. MRPrimerW provides primer design services and a complete set of 341 963 135 in silico validated primers covering 99% of human and mouse genes. Free access: http://MRPrimerW.com. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

Microsatellite markers for Vellozia gigantea (Velloziaceae), a narrowly endemic species to the Brazilian campos rupestres.

PubMed

Martins, Ana Paula V; Proite, Karina; Kalapothakis, Evanguedes; Santos, Fabrício R; Chaves, Anderson V; Borba, Eduardo L

2012-07-01

Microsatellite primers were developed for the first time in Velloziaceae, in the endangered species Vellozia gigantea. Using two different protocols, seven primer sets were characterized in three populations of V. gigantea. The primers amplified di- and trinucleotide repeats with six to 12 alleles per locus. These revealed high levels of genetic variation, presenting an average observed heterozygosity of 0.508 in V. gigantea. The seven primers were tested for cross-amplification in three Vellozia species. All primers successfully amplified in V. auriculata. Six primers amplified in V. compacta and three in V. hirsuta. The new marker set described here will be useful for studies of population genetics of V. gigantea. The cross-amplification results indicate the utility of primers for studies in other Vellozia species.

Low Earth Orbit satellite/terrestrial mobile service compatibility

NASA Technical Reports Server (NTRS)

Sheriff, Ray E.; Gardiner, John G.

1993-01-01

Currently the geostationary type of satellite is the only one used to provide commercial mobile-satellite communication services. Low earth orbit (LEO) satellite systems are now being proposed as a future alternative. By the implementation of LEO satellite systems, predicted at between 5 and 8 years time, mobile space/terrestrial technology will have progressed to the third generation stage of development. This paper considers the system issues that will need to be addressed when developing a dual mode terminal, enabling access to both terrestrial and LEO satellite systems.

FlyPrimerBank: An Online Database for Drosophila melanogaster Gene Expression Analysis and Knockdown Evaluation of RNAi Reagents

PubMed Central

Hu, Yanhui; Sopko, Richelle; Foos, Marianna; Kelley, Colleen; Flockhart, Ian; Ammeux, Noemie; Wang, Xiaowei; Perkins, Lizabeth; Perrimon, Norbert; Mohr, Stephanie E.

2013-01-01

The evaluation of specific endogenous transcript levels is important for understanding transcriptional regulation. More specifically, it is useful for independent confirmation of results obtained by the use of microarray analysis or RNA-seq and for evaluating RNA interference (RNAi)-mediated gene knockdown. Designing specific and effective primers for high-quality, moderate-throughput evaluation of transcript levels, i.e., quantitative, real-time PCR (qPCR), is nontrivial. To meet community needs, predefined qPCR primer pairs for mammalian genes have been designed and sequences made available, e.g., via PrimerBank. In this work, we adapted and refined the algorithms used for the mammalian PrimerBank to design 45,417 primer pairs for 13,860 Drosophila melanogaster genes, with three or more primer pairs per gene. We experimentally validated primer pairs for ~300 randomly selected genes expressed in early Drosophila embryos, using SYBR Green-based qPCR and sequence analysis of products derived from conventional PCR. All relevant information, including primer sequences, isoform specificity, spatial transcript targeting, and any available validation results and/or user feedback, is available from an online database (www.flyrnai.org/flyprimerbank). At FlyPrimerBank, researchers can retrieve primer information for fly genes either one gene at a time or in batch mode. Importantly, we included the overlap of each predicted amplified sequence with RNAi reagents from several public resources, making it possible for researchers to choose primers suitable for knockdown evaluation of RNAi reagents (i.e., to avoid amplification of the RNAi reagent itself). We demonstrate the utility of this resource for validation of RNAi reagents in vivo. PMID:23893746

A tool for design of primers for microRNA-specific quantitative RT-qPCR.

PubMed

Busk, Peter K

2014-01-28

MicroRNAs are small but biologically important RNA molecules. Although different methods can be used for quantification of microRNAs, quantitative PCR is regarded as the reference that is used to validate other methods. Several commercial qPCR assays are available but they often come at a high price and the sequences of the primers are not disclosed. An alternative to commercial assays is to manually design primers but this work is tedious and, hence, not practical for the design of primers for a larger number of targets. I have developed the software miRprimer for automatic design of primers for the method miR-specific RT-qPCR, which is one of the best performing microRNA qPCR methods available. The algorithm is based on an implementation of the previously published rules for manual design of miR-specific primers with the additional feature of evaluating the propensity of formation of secondary structures and primer dimers. Testing of the primers showed that 76 out of 79 primers (96%) worked for quantification of microRNAs by miR-specific RT-qPCR of mammalian RNA samples. This success rate corresponds to the success rate of manual primer design. Furthermore, primers designed by this method have been distributed to several labs and used successfully in published studies. The software miRprimer is an automatic and easy method for design of functional primers for miR-specific RT-qPCR. The application is available as stand-alone software that will work on the MS Windows platform and in a developer version written in the Ruby programming language.

URPD: a specific product primer design tool

PubMed Central

2012-01-01

Background Polymerase chain reaction (PCR) plays an important role in molecular biology. Primer design fundamentally determines its results. Here, we present a currently available software that is not located in analyzing large sequence but used for a rather straight-forward way of visualizing the primer design process for infrequent users. Findings URPD (yoUR Primer Design), a web-based specific product primer design tool, combines the NCBI Reference Sequences (RefSeq), UCSC In-Silico PCR, memetic algorithm (MA) and genetic algorithm (GA) primer design methods to obtain specific primer sets. A friendly user interface is accomplished by built-in parameter settings. The incorporated smooth pipeline operations effectively guide both occasional and advanced users. URPD contains an automated process, which produces feasible primer pairs that satisfy the specific needs of the experimental design with practical PCR amplifications. Visual virtual gel electrophoresis and in silico PCR provide a simulated PCR environment. The comparison of Practical gel electrophoresis comparison to virtual gel electrophoresis facilitates and verifies the PCR experiment. Wet-laboratory validation proved that the system provides feasible primers. Conclusions URPD is a user-friendly tool that provides specific primer design results. The pipeline design path makes it easy to operate for beginners. URPD also provides a high throughput primer design function. Moreover, the advanced parameter settings assist sophisticated researchers in performing experiential PCR. Several novel functions, such as a nucleotide accession number template sequence input, local and global specificity estimation, primer pair redesign, user-interactive sequence scale selection, and virtual and practical PCR gel electrophoresis discrepancies have been developed and integrated into URPD. The URPD program is implemented in JAVA and freely available at http://bio.kuas.edu.tw/urpd/. PMID:22713312

The removal of RNA primers from DNA synthesized by the reverse transcriptase of the retrotransposon Tf1 is stimulated by Tf1 integrase.

PubMed

Herzig, Eytan; Voronin, Nickolay; Hizi, Amnon

2012-06-01

The Tf1 retrotransposon represents a group of long terminal repeat retroelements that use an RNA self-primer for initiating reverse transcription while synthesizing the minus-sense DNA strand. Tf1 reverse transcriptase (RT) was found earlier to generate the self-primer in vitro. Here, we show that this RT can remove from the synthesized cDNA the entire self-primer as well as the complete polypurine tract (PPT) sequence (serving as a second primer for cDNA synthesis). However, these primer removals, mediated by the RNase H activity of Tf1 RT, are quite inefficient. Interestingly, the integrase of Tf1 stimulated the specific Tf1 RT-directed cleavage of both the self-primer and PPT, although there was no general enhancement of the RT's RNase H activity (and the integrase by itself is devoid of any primer cleavage). The RTs of two prototype retroviruses, murine leukemia virus and human immunodeficiency virus, showed only a partial and nonspecific cleavage of both Tf1-associated primers with no stimulation by Tf1 integrase. Mutagenesis of Tf1 integrase revealed that the complete Tf1 integrase protein (excluding its chromodomain) is required for stimulating the Tf1 RT primer removal activity. Nonetheless, a double mutant integrase that has lost its integration functions can still stimulate the RT's activity, though heat-inactivated integrase cannot enhance primer removals. These findings suggest that the enzymatic activity of Tf1 integrase is not essential for stimulating the RT-mediated primer removal, while the proper folding of this protein is obligatory for this function. These results highlight possible new functions of Tf1 integrase in the retrotransposon's reverse transcription process.

The Removal of RNA Primers from DNA Synthesized by the Reverse Transcriptase of the Retrotransposon Tf1 Is Stimulated by Tf1 Integrase

PubMed Central

Herzig, Eytan; Voronin, Nickolay

2012-01-01

The Tf1 retrotransposon represents a group of long terminal repeat retroelements that use an RNA self-primer for initiating reverse transcription while synthesizing the minus-sense DNA strand. Tf1 reverse transcriptase (RT) was found earlier to generate the self-primer in vitro. Here, we show that this RT can remove from the synthesized cDNA the entire self-primer as well as the complete polypurine tract (PPT) sequence (serving as a second primer for cDNA synthesis). However, these primer removals, mediated by the RNase H activity of Tf1 RT, are quite inefficient. Interestingly, the integrase of Tf1 stimulated the specific Tf1 RT-directed cleavage of both the self-primer and PPT, although there was no general enhancement of the RT's RNase H activity (and the integrase by itself is devoid of any primer cleavage). The RTs of two prototype retroviruses, murine leukemia virus and human immunodeficiency virus, showed only a partial and nonspecific cleavage of both Tf1-associated primers with no stimulation by Tf1 integrase. Mutagenesis of Tf1 integrase revealed that the complete Tf1 integrase protein (excluding its chromodomain) is required for stimulating the Tf1 RT primer removal activity. Nonetheless, a double mutant integrase that has lost its integration functions can still stimulate the RT's activity, though heat-inactivated integrase cannot enhance primer removals. These findings suggest that the enzymatic activity of Tf1 integrase is not essential for stimulating the RT-mediated primer removal, while the proper folding of this protein is obligatory for this function. These results highlight possible new functions of Tf1 integrase in the retrotransposon's reverse transcription process. PMID:22491446

URPD: a specific product primer design tool.

PubMed

Chuang, Li-Yeh; Cheng, Yu-Huei; Yang, Cheng-Hong

2012-06-19

Polymerase chain reaction (PCR) plays an important role in molecular biology. Primer design fundamentally determines its results. Here, we present a currently available software that is not located in analyzing large sequence but used for a rather straight-forward way of visualizing the primer design process for infrequent users. URPD (yoUR Primer Design), a web-based specific product primer design tool, combines the NCBI Reference Sequences (RefSeq), UCSC In-Silico PCR, memetic algorithm (MA) and genetic algorithm (GA) primer design methods to obtain specific primer sets. A friendly user interface is accomplished by built-in parameter settings. The incorporated smooth pipeline operations effectively guide both occasional and advanced users. URPD contains an automated process, which produces feasible primer pairs that satisfy the specific needs of the experimental design with practical PCR amplifications. Visual virtual gel electrophoresis and in silico PCR provide a simulated PCR environment. The comparison of Practical gel electrophoresis comparison to virtual gel electrophoresis facilitates and verifies the PCR experiment. Wet-laboratory validation proved that the system provides feasible primers. URPD is a user-friendly tool that provides specific primer design results. The pipeline design path makes it easy to operate for beginners. URPD also provides a high throughput primer design function. Moreover, the advanced parameter settings assist sophisticated researchers in performing experiential PCR. Several novel functions, such as a nucleotide accession number template sequence input, local and global specificity estimation, primer pair redesign, user-interactive sequence scale selection, and virtual and practical PCR gel electrophoresis discrepancies have been developed and integrated into URPD. The URPD program is implemented in JAVA and freely available at http://bio.kuas.edu.tw/urpd/.

Hybrid Materials for Thermal Management in Thin Films and Bulk Composites

DTIC Science & Technology

2012-02-01

enamel  that  cures  via  oxidative...polymerization   in   air  ( Enamel ),  a  waterborne  flat   latex  that  cures  by  coalescing  while  air  drying  (Flat...Wood   Bare   Primer   Primer   +  KPF6     Bare   Primer   Primer   +  KPF6     Bare   Primer   Enamel  

Progressive friction mobilization and enhanced Janssen's screening in confined granular rafts

NASA Astrophysics Data System (ADS)

Saavedra V., Oscar; Elettro, Hervé; Melo, Francisco

2018-04-01

Confined two-dimensional assemblies of floating particles, known as granular rafts, are prone to develop a highly nonlinear response under compression. Here we investigate the transition to the friction-dominated jammed state and map the gradual development of the internal stress profile with flexible pressure sensors distributed along the raft surface. Surprisingly, we observe that the surface stress screening builds up much more slowly than previously thought and that the typical screening distance later dramatically decreases. We explain this behavior in terms of progressive friction mobilization, where the full amplitude of the frictional forces is only reached after a macroscopic local displacement. At further stages of compression, rafts of large length-to-width aspect ratio experience much stronger screenings than the full mobilization limit described by the Janssen's model. We solve this paradox using a simple mathematical analysis and show that such enhanced screening can be attributed to a localized compaction front, essentially shielding the far field from compressive stresses.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Walters, William; Hyde, Embriette R.; Berg-Lyons, Donna

ABSTRACT Designing primers for PCR-based taxonomic surveys that amplify a broad range of phylotypes in varied community samples is a difficult challenge, and the comparability of data sets amplified with varied primers requires attention. Here, we examined the performance of modified 16S rRNA gene and internal transcribed spacer (ITS) primers for archaea/bacteria and fungi, respectively, with nonaquatic samples. We moved primer bar codes to the 5′ end, allowing for a range of different 3′ primer pairings, such as the 515f/926r primer pair, which amplifies variable regions 4 and 5 of the 16S rRNA gene. We additionally demonstrated that modifications tomore » the 515f/806r (variable region 4) 16S primer pair, which improves detection ofThaumarchaeotaand clade SAR11 in marine samples, do not degrade performance on taxa already amplified effectively by the original primer set. Alterations to the fungal ITS primers did result in differential but overall improved performance compared to the original primers. In both cases, the improved primers should be widely adopted for amplicon studies. ImportanceWe continue to uncover a wealth of information connecting microbes in important ways to human and environmental ecology. As our scientific knowledge and technical abilities improve, the tools used for microbiome surveys can be modified to improve the accuracy of our techniques, ensuring that we can continue to identify groundbreaking connections between microbes and the ecosystems they populate, from ice caps to the human body. It is important to confirm that modifications to these tools do not cause new, detrimental biases that would inhibit the field rather than continue to move it forward. We therefore demonstrated that two recently modified primer pairs that target taxonomically discriminatory regions of bacterial and fungal genomic DNA do not introduce new biases when used on a variety of sample types, from soil to human skin. This confirms the utility of these primers for maintaining currently recommended microbiome research techniques as the state of the art.« less

Improved PCR primers for the detection and identification of arbuscular mycorrhizal fungi.

PubMed

Lee, Jaikoo; Lee, Sangsun; Young, J Peter W

2008-08-01

A set of PCR primers that should amplify all subgroups of arbuscular mycorrhizal fungi (AMF, Glomeromycota), but exclude sequences from other organisms, was designed to facilitate rapid detection and identification directly from field-grown plant roots. The small subunit rRNA gene was targeted for the new primers (AML1 and AML2) because phylogenetic relationships among the Glomeromycota are well understood for this gene. Sequence comparisons indicate that the new primers should amplify all published AMF sequences except those from Archaeospora trappei. The specificity of the new primers was tested using 23 different AMF spore morphotypes from trap cultures and Miscanthus sinensis, Glycine max and Panax ginseng roots sampled from the field. Non-AMF DNA of 14 plants, 14 Basidiomycota and 18 Ascomycota was also tested as negative controls. Sequences amplified from roots using the new primers were compared with those obtained using the established NS31 and AM1 primer combination. The new primers have much better specificity and coverage of all known AMF groups.

WASP: a Web-based Allele-Specific PCR assay designing tool for detecting SNPs and mutations

PubMed Central

Wangkumhang, Pongsakorn; Chaichoompu, Kridsadakorn; Ngamphiw, Chumpol; Ruangrit, Uttapong; Chanprasert, Juntima; Assawamakin, Anunchai; Tongsima, Sissades

2007-01-01

Background Allele-specific (AS) Polymerase Chain Reaction is a convenient and inexpensive method for genotyping Single Nucleotide Polymorphisms (SNPs) and mutations. It is applied in many recent studies including population genetics, molecular genetics and pharmacogenomics. Using known AS primer design tools to create primers leads to cumbersome process to inexperience users since information about SNP/mutation must be acquired from public databases prior to the design. Furthermore, most of these tools do not offer the mismatch enhancement to designed primers. The available web applications do not provide user-friendly graphical input interface and intuitive visualization of their primer results. Results This work presents a web-based AS primer design application called WASP. This tool can efficiently design AS primers for human SNPs as well as mutations. To assist scientists with collecting necessary information about target polymorphisms, this tool provides a local SNP database containing over 10 million SNPs of various populations from public domain databases, namely NCBI dbSNP, HapMap and JSNP respectively. This database is tightly integrated with the tool so that users can perform the design for existing SNPs without going off the site. To guarantee specificity of AS primers, the proposed system incorporates a primer specificity enhancement technique widely used in experiment protocol. In particular, WASP makes use of different destabilizing effects by introducing one deliberate 'mismatch' at the penultimate (second to last of the 3'-end) base of AS primers to improve the resulting AS primers. Furthermore, WASP offers graphical user interface through scalable vector graphic (SVG) draw that allow users to select SNPs and graphically visualize designed primers and their conditions. Conclusion WASP offers a tool for designing AS primers for both SNPs and mutations. By integrating the database for known SNPs (using gene ID or rs number), this tool facilitates the awkward process of getting flanking sequences and other related information from public SNP databases. It takes into account the underlying destabilizing effect to ensure the effectiveness of designed primers. With user-friendly SVG interface, WASP intuitively presents resulting designed primers, which assist users to export or to make further adjustment to the design. This software can be freely accessed at . PMID:17697334

30 CFR 56.6304 - Primer protection.

Code of Federal Regulations, 2010 CFR

2010-07-01

... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Primer protection. 56.6304 Section 56.6304 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR METAL AND NONMETAL MINE... Primer protection. (a) Tamping shall not be done directly on a primer. (b) Rigid cartridges of explosives...

Antimicrobial and physical characteristics of orthodontic primers containing antimicrobial agents.

PubMed

Chung, Shin-Hye; Cho, Soha; Kim, Kyungsun; Lim, Bum-Soon; Ahn, Sug-Joon

2017-03-01

To compare the antimicrobial and physical properties of experimental primers containing chlorhexidine (CHX) or ursolic acid (UA) with a commercial primer. Two antibacterial agents, 3 mg each of CHX and UA were incorporated respectively into 1 ml of Transbond XT primer (TX) to form antibacterial primers, TX-CHX and TX-UA. The antimicrobial activity of the three primers (TX, TX-CHX, and TX-UA) against Streptococcus mutans in both planktonic and biofilm phases was analyzed by determining minimum inhibitory and bactericidal concentrations and by performing growth and biofilm assays. Growth and biofilm assays were performed in both the absence and presence of thermocycling in a water tank to analyze the effects of water aging on the antimicrobial activities of primers. After bonding brackets onto bovine incisors using the primers, shear bond strength and mode of fracture were analyzed to compare physical properties. TX-CHX had stronger antimicrobial activity against S. mutans in the planktonic and biofilm phases than did TX or TX-UA. When applied, TX-CHX completely inhibited the growth and biofilm formation of S. mutans . In addition, the antimicrobial activity of TX-CHX was maintained after thermocycling. However, TX-UA did not show significant antimicrobial activity compared with TX. There was no significant difference in either shear bond strength or bond failure interface among the primers. Incorporation of CHX into an orthodontic primer may help prevent enamel demineralization around surfaces without compromising its physical properties.

The Corrosion Protection of 2219-T87 Aluminum by Organic and Inorganic Zinc-Rich Primers

NASA Technical Reports Server (NTRS)

Danford, M. D.; Mendrek, M. J.; Walsh, D. W.

1995-01-01

The behavior of zinc-rich primer-coated 2219-T87 aluminum in a 3.5-percent Na-Cl was investigated using electrochemical techniques. The alternating current (ac) method of electrochemical impedance spectroscopy (EIS), in the frequency range of 0.001 to 40,000 Hz, and the direct current (dc) method of polarization resistance (PR) were used to evaluate the characteristics of an organic, epoxy zinc-rich primer and an inorganic, ethyl silicate zinc-rich primer. A dc electrochemical galvanic corrosion test was also used to determine the corrosion current of each zinc-rich primer anode coupled to a 2219-T87 aluminum cathode. Duration of the EIS/PR and galvanic testing was 21 days and 24 h, respectively. The galvanic test results demonstrated a very high galvanic current between the aluminum cathode and both zinc-rich primer anodes (37.9 pA/CM2 and 23.7 pA/CM2 for the organic and inorganic primers, respectively). The PR results demonstrated a much higher corrosion rate of the zinc in the inorganic primer than in the organic primer, due primarily to the higher porosity in the former. Based on this investigation, the inorganic zinc-rich primer appears to provide superior galvanic protection and is recommended for additional study for application in the solid rocket booster aft skirt.

Impact of primer dimers and self-amplifying hairpins on reverse transcription loop-mediated isothermal amplification detection of viral RNA

DOE PAGES

Meagher, Robert J.; Priye, Aashish; Light, Yooli K.; ...

2018-03-27

Loop-mediated isothermal amplification (LAMP), coupled with reverse transcription (RT), has become a popular technique for detection of viral RNA due to several desirable characteristics for use in point-of-care or low-resource settings. The large number of primers in LAMP (six per target) leads to an increased likelihood of primer-dimer interactions, and the inner primers in particular are prone to formation of stable hairpin structures due to their length (typically 40-45 bases). Although primer-dimers and hairpin structures are known features to avoid in nucleic acid amplification techniques, there is little quantitative information in literature regarding the impact of these structures on LAMPmore » or RT-LAMP assays. In this study, we examine the impact of primer-dimers and hairpins on previously-published primer sets for dengue virus and yellow fever virus. We demonstrate that minor changes to the primers to eliminate amplifiable primer dimers and hairpins improves the performance of the assays when monitored in real time with intercalating dyes, and when monitoring a fluorescent endpoint using the QUASR technique. We also discuss the thermodynamic implications of these minor changes on the overall stability of amplifiable secondary structures, and we present a single thermodynamic parameter to predict the probability of non-specific amplification associated with LAMP primers.« less

Impact of primer dimers and self-amplifying hairpins on reverse transcription loop-mediated isothermal amplification detection of viral RNA

DOE Office of Scientific and Technical Information (OSTI.GOV)

Meagher, Robert J.; Priye, Aashish; Light, Yooli K.

Loop-mediated isothermal amplification (LAMP), coupled with reverse transcription (RT), has become a popular technique for detection of viral RNA due to several desirable characteristics for use in point-of-care or low-resource settings. The large number of primers in LAMP (six per target) leads to an increased likelihood of primer-dimer interactions, and the inner primers in particular are prone to formation of stable hairpin structures due to their length (typically 40-45 bases). Although primer-dimers and hairpin structures are known features to avoid in nucleic acid amplification techniques, there is little quantitative information in literature regarding the impact of these structures on LAMPmore » or RT-LAMP assays. In this study, we examine the impact of primer-dimers and hairpins on previously-published primer sets for dengue virus and yellow fever virus. We demonstrate that minor changes to the primers to eliminate amplifiable primer dimers and hairpins improves the performance of the assays when monitored in real time with intercalating dyes, and when monitoring a fluorescent endpoint using the QUASR technique. We also discuss the thermodynamic implications of these minor changes on the overall stability of amplifiable secondary structures, and we present a single thermodynamic parameter to predict the probability of non-specific amplification associated with LAMP primers.« less

The corrosion protection of 2219-T87 aluminum by organic and inorganic zinc-rich primers

NASA Technical Reports Server (NTRS)

Danford, M. D.; Mendrek, M. J.; Walsh, D. W.

1995-01-01

The behavior of zinc-rich primer-coated 2219-T87 aluminum in a 3.5-percent Na-Cl was investigated using electrochemical techniques. The alternating current (ac) method of electro-chemical impedance spectroscopy (EIS), in the frequency range of 0.001 to 40,000 Hz, and the direct current (dc) method of polarization resistance (PR) were used to evaluate the characteristics of an organic, epoxy zinc-rich primer and an inorganic, ethyl silicate zinc-rich primer. A dc electrochemical galvanic corrosion test was also used to determine the corrosion current of each zinc-rich primer anode coupled to a 2219-T87 aluminum cathode. Duration of the EIS/PR and galvanic testing was 21 days and 24 h, respectively. the galvanic test results demonstrated a very high galvanic current between the aluminum cathode and both zinc-rich primer anodes (37.9 micro A/cm(exp 2) and 23.7 micro A/cm(exp 2) for the organic and inorganic primers, respectively). The PR results demonstrated a much higher corrosion rate of the zinc in the inorganic primer than in the organic primer, due primarily to the higher porosity in the former. Based on this investigation, the inorganic zinc-rich primer appears to provide superior galvanic protection and is recommended for additional study for application in the solid rocket booster aft skirt.

COMplementary Primer ASymmetric PCR (COMPAS-PCR) Applied to the Identification of Salmo salar, Salmo trutta and Their Hybrids

PubMed Central

2016-01-01

Avoiding complementarity between primers when designing a PCR assay constitutes a central rule strongly anchored in the mind of the molecular scientist. 3’-complementarity will extend the primers during PCR elongation using one another as template, consequently disabling further possible involvement in traditional target amplification. However, a 5’-complementarity will leave the primers unchanged during PCR cycles, albeit sequestered to one another, therefore also suppressing target amplification. We show that 5’-complementarity between primers may be exploited in a new PCR method called COMplementary-Primer-Asymmetric (COMPAS)-PCR, using asymmetric primer concentrations to achieve target PCR amplification. Moreover, such a design may paradoxically reduce spurious non-target amplification by actively sequestering the limiting primer. The general principles were demonstrated using 5S rDNA direct repeats as target sequences to design a species-specific assay for identifying Salmo salar and Salmo trutta using almost fully complementary primers overlapping the same target sequence. Specificity was enhanced by using 3’-penultimate point mutations and the assay was further developed to enable identification of S. salar x S. trutta hybrids by High Resolution Melt analysis in a 35 min one-tube assay. This small paradigm shift, using highly complementary primers for PCR, should help develop robust assays that previously would not be considered. PMID:27783658

The corrosion protection of AISI(TM) 1010 steel by organic and inorganic zinc-rich primers

NASA Technical Reports Server (NTRS)

Danford, M. D.; Mendrek, M. J.

1995-01-01

The behavior of zinc-rich primer-coated AISI 1010 steel in 3.5-percent Na-Cl was investigated using electrochemical techniques. The alternating current (ac) method of electrochemical impedance spectroscopy (EIS), in the frequency range of 0.001 to 40,000 Hz, and the direct current (dc) method of polarization resistance (PR), were used to evaluate the characteristics of an organic, epoxy zinc-rich primer and an inorganic, ethyl silicate zinc-rich primer. A dc electromechanical galvanic corrosion test was also used to determine the corrosion current of each zinc-rich primer anode coupled to a 1010 steel cathode. Duration of the EIS/PR and galvanic testing was 21 days and 24 h, respectively. The galvanic test results demonstrated a very high current between the steel cathode and both zinc-rich primer anodes (38.8 and 135.2 microns A/sq cm for the organic and inorganic primers, respectively). The results of corrosion rate determinations demonstrated a much higher corrosion rate of the zinc in the inorganic primer than in the organic primer, due primarily to the higher porosity in the former. EIS equivalent circuit parameters confirmed this conclusion. Based on this investigation, the inorganic zinc-rich primer appears to provide superior galvanic protection and is recommended for additional study for application on solid rocket booster steel hardware.

Limited-life cartridge primers

DOEpatents

Makowiecki, Daniel M.; Rosen, Robert S.

1998-01-01

A cartridge primer which utilizes an explosive that can be designed to become inactive in a predetermined period of time: a limited-life primer. The explosive or combustible material of the primer is an inorganic reactive multilayer (RML). The reaction products of the RML are sub-micron grains of non-corrosive inorganic compounds that would have no harmful effects on firearms or cartridge cases. Unlike use of primers containing lead components, primers utilizing RML's would not present a hazard to the environment. The sensitivity of an RML is determined by the physical structure and the stored interfacial energy. The sensitivity lowers with time due to a decrease in interfacial energy resulting from interdiffusion of the elemental layers. Time-dependent interdiffusion is predictable, thereby enabling the functional lifetime of an RML primer to be predetermined by the initial thickness and materials selection of the reacting layers.

Limited-life cartridge primers

DOEpatents

Makowiecki, Daniel M.; Rosen, Robert S.

2005-04-19

A cartridge primer which utilizes an explosive that can be designed to become inactive in a predetermined period of time: a limited-life primer. The explosive or combustible material of the primer is an inorganic reactive multilayer (RML). The reaction products of the RML are sub-micron grains of non-corrosive inorganic compounds that would have no harmful effects on firearms or cartridge cases. Unlike use of primers containing lead components, primers utilizing RML's would not present a hazard to the environment. The sensitivity of an RML is determined by the physical structure and the stored interfacial energy. The sensitivity lowers with time due to a decrease in interfacial energy resulting from interdiffusion of the elemental layers. Time-dependent interdiffusion is predictable, thereby enabling the functional lifetime of an RML primer to be predetermined by the initial thickness and materials selection of the reacting layers.

SP-Designer: a user-friendly program for designing species-specific primer pairs from DNA sequence alignments.

PubMed

Villard, Pierre; Malausa, Thibaut

2013-07-01

SP-Designer is an open-source program providing a user-friendly tool for the design of specific PCR primer pairs from a DNA sequence alignment containing sequences from various taxa. SP-Designer selects PCR primer pairs for the amplification of DNA from a target species on the basis of several criteria: (i) primer specificity, as assessed by interspecific sequence polymorphism in the annealing regions, (ii) the biochemical characteristics of the primers and (iii) the intended PCR conditions. SP-Designer generates tables, detailing the primer pair and PCR characteristics, and a FASTA file locating the primer sequences in the original sequence alignment. SP-Designer is Windows-compatible and freely available from http://www2.sophia.inra.fr/urih/sophia_mart/sp_designer/info_sp_designer.php. © 2013 John Wiley & Sons Ltd.

Dye shift: a neglected source of genotyping error in molecular ecology.

PubMed

Sutton, Jolene T; Robertson, Bruce C; Jamieson, Ian G

2011-05-01

Molecular ecologists must be vigilant in detecting and accounting for genotyping error, yet potential errors stemming from dye-induced mobility shift (dye shift) may be frequently neglected and largely unknown to researchers who employ 3-primer systems with automated genotyping. When left uncorrected, dye shift can lead to mis-scoring alleles and even to falsely calling new alleles if different dyes are used to genotype the same locus in subsequent reactions. When we used four different fluorophore labels from a standard dye set to genotype the same set of loci, differences in the resulting size estimates for a single allele ranged from 2.07 bp to 3.68 bp. The strongest effects were associated with the fluorophore PET, and relative degree of dye shift was inversely related to locus size. We found little evidence in the literature that dye shift is regularly accounted for in 3-primer studies, despite knowledge of this phenomenon existing for over a decade. However, we did find some references to erroneous standard correction factors for the same set of dyes that we tested. We thus reiterate the need for strict quality control when attempting to reduce possible sources of genotyping error, and in cases where different dyes are applied to a single locus, perhaps mistakenly, we strongly discourage researchers from assuming generic correction patterns. © 2011 Blackwell Publishing Ltd.

Loss of heterozygosity assay for molecular detection of cancer using energy-transfer primers and capillary array electrophoresis.

PubMed

Medintz, I L; Lee, C C; Wong, W W; Pirkola, K; Sidransky, D; Mathies, R A

2000-08-01

Microsatellite DNA loci are useful markers for the detection of loss of heterozygosity (LOH) and microsatellite instability (MI) associated with primary cancers. To carry out large-scale studies of LOH and MI in cancer progression, high-throughput instrumentation and assays with high accuracy and sensitivity need to be validated. DNA was extracted from 26 renal tumor and paired lymphocyte samples and amplified with two-color energy-transfer (ET) fluorescent primers specific for loci associated with cancer-induced chromosomal changes. PCR amplicons were separated on the MegaBACE-1000 96 capillary array electrophoresis (CAE) instrument and analyzed with MegaBACE Genetic Profiler v.1.0 software. Ninety-six separations were achieved in parallel in 75 minutes. Loss of heterozygosity was easily detected in tumor samples as was the gain/loss of microsatellite core repeats. Allelic ratios were determined with a precision of +/- 10% or better. Prior analysis of these samples with slab gel electrophoresis and radioisotope labeling had not detected these changes with as much sensitivity or precision. This study establishes the validity of this assay and the MegaBACE instrument for large-scale, high-throughput studies of the molecular genetic changes associated with cancer.

Direct role for the RNA polymerase domain of T7 primase in primer delivery

PubMed Central

Zhu, Bin; Lee, Seung-Joo; Richardson, Charles C.

2010-01-01

Gene 4 protein (gp4) encoded by bacteriophage T7 contains a C-terminal helicase and an N-terminal primase domain. After synthesis of tetraribonucleotides, gp4 must transfer them to the polymerase for use as primers to initiate DNA synthesis. In vivo gp4 exists in two molecular weight forms, a 56-kDa form and the full-length 63-kDa form. The 56-kDa gp4 lacks the N-terminal Cys4 zinc-binding motif important in the recognition of primase sites in DNA. The 56-kDa gp4 is defective in primer synthesis but delivers a wider range of primers to initiate DNA synthesis compared to the 63-kDa gp4. Suppressors exist that enable the 56-kDa gp4 to support the growth of T7 phage lacking gene 4 (T7Δ4). We have identified 56-kDa DNA primases defective in primer delivery by screening for their ability to support growth of T7Δ4 phage in the presence of this suppressor. Trp69 is critical for primer delivery. Replacement of Trp69 with lysine in either the 56- or 63-kDa gp4 results in defective primer delivery with other functions unaffected. DNA primase harboring lysine at position 69 fails to stabilize the primer on DNA. Thus, a primase subdomain not directly involved in primer synthesis is involved in primer delivery. The stabilization of the primer by DNA primase is necessary for DNA polymerase to initiate synthesis. PMID:20439755

A mobility program for an inpatient acute care medical unit.

PubMed

Wood, Winnie; Tschannen, Dana; Trotsky, Alyssa; Grunawalt, Julie; Adams, Danyell; Chang, Robert; Kendziora, Sandra; Diccion-MacDonald, Stephanie

2014-10-01

For many patients, hospitalization brings prolonged periods of bed rest, which are associated with such adverse health outcomes as increased length of stay, increased risk of falls, functional decline, and extended-care facility placement. Most studies of progressive or early mobility protocols designed to minimize these adverse effects have been geared toward specific patient populations and conducted by multidisciplinary teams in either ICUs or surgical units. Very few mobility programs have been developed for and implemented on acute care medical units. This evidence-based quality improvement project describes how a mobility program, devised for and put to use on a general medical unit in a large Midwestern academic health care system, improved patient outcomes.

The state of ergonomics for mobile computing technology.

PubMed

Dennerlein, Jack T

2015-01-01

Because mobile computing technologies, such as notebook computers, smart mobile phones, and tablet computers afford users many different configurations through their intended mobility, there is concern about their effects on musculoskeletal pain and a need for usage recommendations. Therefore the main goal of this paper to determine which best practices surrounding the use of mobile computing devices can be gleaned from current field and laboratory studies of mobile computing devices. An expert review was completed. Field studies have documented various user configurations, which often include non-neutral postures, that users adopt when using mobile technology, along with some evidence suggesting that longer duration of use is associated with more discomfort. It is therefore prudent for users to take advantage of their mobility and not get stuck in any given posture for too long. The use of accessories such as appropriate cases or riser stands, as well as external keyboards and pointing devices, can also improve postures and comfort. Overall, the state of ergonomics for mobile technology is a work in progress and there are more research questions to be addressed.

Annual Technical Progress Report for Emergency School Assistance Program, Title 45, 1970-71.

ERIC Educational Resources Information Center

Lindsey, Randall B.

This paper presents a technical progress report of two programs conducted with funds provided under the Emergency School Assistance Program. One, the Mobile Learning Unit, said to have been designed to measure changes in fourth and fifth grade students' self-concept in a reorganized desegregated school environment, focuses on whether a positive…

Autonomous Learning in Mobile Cognitive Machines

DTIC Science & Technology

2017-11-25

2016). [18] Liu, Wei, et al. "Ssd: Single shot multibox detector." European conference on computer vision. Springer, Cham, 2016. [19] Vinyals, Oriol...the brain being evolved to support its mobility has been raised. In fact, as the project progressed, the researchers discovered that if one of the...deductive, relies on rule-based programming, and can solve complex problems, however, faces difficulties in learning and adaptability. The latter

Prevalence of the integration status for human papillomavirus 16 in esophageal carcinoma samples.

PubMed

Li, Shuying; Shen, Haie; Li, Ji; Hou, Xiaoli; Zhang, Ke; Li, Jintao

2018-03-01

To investigate the etiology of esophageal cancer (EC) related with human papillomavirus (HPV) infection. Fresh surgically resected tissue samples and clinical information were obtained from 189 patients. Genomic DNA was extracted, and HPV was detected using polymerase chain reaction (PCR) with HPV L1 gene primers of MY09/11; HPV16 was detected using HPV16 E6 type-specific primer sets. Copies of HPV16 E2, E6, and the human housekeeping gene β-actin were tested using quantitative PCR to analyze the relationship between HPV16 integration and esophageal squamous cell carcinoma and the relationship between the HPV16 integration status and clinical information of patients. Of the 189 samples, 168 HPV-positive samples were detected, of which 76 were HPV16 positive. Among the HPV16 positive samples, 2 cases (E2/E6 ratio>1) were 2.6% (2/76) purely episomal, 65 (E2/E6 ratio between 0 and 1) were 85.6% (65/76) mixture of integrated and episomal, and 9 (E2/E6 ratio=0) were 11.8% (9/76) purely integrated. The results indicate that integration of HPV16 was more common in the host genome than in the episome genome. The prevalence rate of HPV16 integration is increasing with the pathological stage progression of esophageal carcinoma (EC). A high prevalence of HPV16 suggested that HPV16 has an etiological effect on the progress of EC. Integration of HPV16 is more common than episome genome in the host cells, indicating that continuous HPV infection is the key to esophageal epithelial cell malignant conversion and canceration.

Mobility (Parkinson's Disease)

MedlinePlus

... risk of complications and have better quality of life. Learn More Research Research We Fund Parkinson's Outcomes Project Grant Opportunities Science News & Progress Patient Engagement Research Our research has ...

Development of a molecular diagnostic system to discriminate Dreissena polymorpha (zebra mussel) and Dreissena bugensis (quagga mussel)

USGS Publications Warehouse

Hoy, M.S.; Kelly, K.; Rodriguez, R.J.

2010-01-01

A 3-primer PCR system was developed to discriminate invasive zebra (Dreissena polymorpha) and quagga (Dreissena bugensis) mussel. The system is based on: 1) universal primers that amplifies a region of the nuclear 28s rDNA gene from both species and 2) a species-specific primer complementary to either zebra or quagga mussel. The species-specific primers bind to sequences between the binding sites for the universal primers resulting in the amplification of two products from the target species and one product from the nontarget species. Therefore, nontarget products are positive amplification controls. The 3-primer system accurately discriminated zebra and quagga mussels from seven geographically distinct populations.

Why Do Medial Unicompartmental Knee Arthroplasties Fail Today?

PubMed

van der List, Jelle P; Zuiderbaan, Hendrik A; Pearle, Andrew D

2016-05-01

Failure rates are higher in medial unicompartmental knee arthroplasty (UKA) than total knee arthroplasty. To improve these failure rates, it is important to understand why medial UKA fail. Because individual studies lack power to show failure modes, a systematic review was performed to assess medial UKA failure modes. Furthermore, we compared cohort studies with registry-based studies, early with midterm and late failures and fixed-bearing with mobile-bearing implants. Databases of PubMed, EMBASE, and Cochrane and annual registries were searched for medial UKA failures. Studies were included when they reported >25 failures or when they reported early (<5 years), midterm (5-10 years), or late failures (>10 years). Thirty-seven cohort studies (4 level II studies and 33 level III studies) and 2 registry-based studies were included. A total of 3967 overall failures, 388 time-dependent failures, and 1305 implant design failures were identified. Aseptic loosening (36%) and osteoarthritis (OA) progression (20%) were the most common failure modes. Aseptic loosening (26%) was most common early failure mode, whereas OA progression was more commonly seen in midterm and late failures (38% and 40%, respectively). Polyethylene wear (12%) and instability (12%) were more common in fixed-bearing implants, whereas pain (14%) and bearing dislocation (11%) were more common in mobile-bearing implants. This level III systematic review identified aseptic loosening and OA progression as the major failure modes. Aseptic loosening was the main failure mode in early years and mobile-bearing implants, whereas OA progression caused most failures in late years and fixed-bearing implants. Copyright © 2016 Elsevier Inc. All rights reserved.

RESIF national datacentre : new features and forthcoming evolutions

NASA Astrophysics Data System (ADS)

Pequegnat, C.; Volcke, P.; le Tanou, J.; Wolyniec, D.; Lecointre, A.; Guéguen, P.

2013-12-01

RESIF is a nationwide french project aimed at building an high quality system to observe and understand the inner earth. The goal is to create a network throughout mainland France comprising 750 seismometers and geodetic measurement instruments, 250 of which will be mobile, to enable the observation network to be focussed on specific investigation subjects and geographic locations. The RESIF data distribution centre, which is a part of the global project, is operated by the Université Joseph Fourier (Grenoble, France) and is being implemented for two years. Data from french broadband permanent network, strong motion permanent network, and mobile seismological antenna are freely accessible as realtime streams and continuous validated data, along with instrumental metadata, delivered using widely known formats and requests tools. New features of the datacentre are : - new modern distribution tools : two FDSN WEBservices has been implemented and deliver data and metadata. - new data and datasets : the number of permanent stations rose by over 40 % percent in one year and the RESIF archive now includes past data (down to 1995) and data from new networks. Moreover, data from mobile experiments prior to 2011 is progressively released, and data from new mobile experiments in the Alps and in the Pyrenean mountains is progressively integrated. - new infrastructures : (1) the RESIF databank is about to be connected to the grid storage of the University High Performance Computing (HPC) centre. As a scientific use case of this datacenter facility, a focus is made on intensive exploitation of combined data from permanent and mobile networks (2) the RESIF databank will be progressively hosted on a new shared storage facility operated by the Université Joseph Fourier. This infrastructure offers high availability data storage (both in blocks and files modes) as well as backup and long term archival capabilities, and will be fully operational at the beginning of 2014.

Occult hepatitis B virus infection is not associated with disease progression of chronic hepatitis C virus infection.

PubMed

Cho, Junhyeon; Lee, Sang Soo; Choi, Yun Suk; Jeon, Yejoo; Chung, Jung Wha; Baeg, Joo Yeong; Si, Won Keun; Jang, Eun Sun; Kim, Jin-Wook; Jeong, Sook-Hyang

2016-11-14

To clarify the prevalence of occult hepatitis B virus (HBV) infection (OBI) and the association between OBI and liver disease progression, defined as development of liver cirrhosis or hepatocellular carcinoma (HCC), worsening of Child-Pugh class, or mortality in cases of chronic hepatitis C virus (HCV) infection. This prospective cohort study enrolled 174 patients with chronic HCV infection (chronic hepatitis, n = 83; cirrhosis, n = 47; HCC, n = 44), and evaluated disease progression during a mean follow-up of 38.7 mo. OBI was defined as HBV DNA positivity in 2 or more different viral genomic regions by nested polymerase chain reaction using 4 sets of primers in the S, C, P and X open reading frame of the HBV genome. The overall OBI prevalence in chronic HCV patients at enrollment was 18.4%, with 16.9%, 25.5% and 13.6% in the chronic hepatitis C, liver cirrhosis and HCC groups, respectively ( P = 0.845). During follow-up, 52 patients showed disease progression, which was independently associated with aspartate aminotransferase > 40 IU/L, Child-Pugh score and sustained virologic response (SVR), but not with OBI positivity. In 136 patients who were not in the SVR state during the study period, OBI positivity was associated with neither disease progression, nor HCC development. The prevalence of OBI in chronic HCV patients was 18.4%, and OBI was not associated with disease progression in South Koreans.

Limited-life cartridge primers

DOEpatents

Makowiecki, D.M.; Rosen, R.S.

1998-06-30

A cartridge primer is described which utilizes an explosive that can be designed to become inactive in a predetermined period of time: a limited-life primer. The explosive or combustible material of the primer is an inorganic reactive multilayer (RML). The reaction products of the RML are sub-micron grains of non-corrosive inorganic compounds that would have no harmful effects on firearms or cartridge cases. Unlike use of primers containing lead components, primers utilizing RML`s would not present a hazard to the environment. The sensitivity of an RML is determined by the physical structure and the stored interfacial energy. The sensitivity lowers with time due to a decrease in interfacial energy resulting from interdiffusion of the elemental layers. Time-dependent interdiffusion is predictable, thereby enabling the functional lifetime of an RML primer to be predetermined by the initial thickness and materials selection of the reacting layers. 10 figs.

Plastid primers for angiosperm phylogenetics and phylogeography.

PubMed

Prince, Linda M

2015-06-01

PCR primers are available for virtually every region of the plastid genome. Selection of which primer pairs to use is second only to selection of the genic region. This is particularly true for research at the species/population interface. Primer pairs for 130 regions of the chloroplast genome were evaluated in 12 species distributed across the angiosperms. Likelihood of amplification success was inferred based upon number and location of mismatches to target sequence. Intraspecific sequence variability was evaluated under three different criteria in four species. Many published primer pairs should work across all taxa sampled, with the exception of failure due to genomic reorganization events. Universal barcoding primers were the least likely to work (65% success). The list of most variable regions for use within species has little in common with the lists identified in prior studies. Published primer sequences should amplify a diversity of flowering plant DNAs, even those designed for specific taxonomic groups. "Universal" primers may have extremely limited utility. There was little consistency in likelihood of amplification success for any given publication across lineages or within lineage across publications.

Next-Generation DNA Sequencing of VH/VL Repertoires: A Primer and Guide to Applications in Single-Domain Antibody Discovery.

PubMed

Henry, Kevin A

2018-01-01

Immunogenetic analyses of expressed antibody repertoires are becoming increasingly common experimental investigations and are critical to furthering our understanding of autoimmunity, infectious disease, and cancer. Next-generation DNA sequencing (NGS) technologies have now made it possible to interrogate antibody repertoires to unprecedented depths, typically by sequencing of cDNAs encoding immunoglobulin variable domains. In this chapter, we describe simple, fast, and reliable methods for producing and sequencing multiplex PCR amplicons derived from the variable regions (V H , V H H or V L ) of rearranged immunoglobulin heavy and light chain genes using the Illumina MiSeq platform. We include complete protocols and primer sets for amplicon sequencing of V H /V H H/V L repertoires directly from human, mouse, and llama lymphocytes as well as from phage-displayed V H /V H H/V L libraries; these can be easily be adapted to other types of amplicons with little modification. The resulting amplicons are diverse and representative, even using as few as 10 3 input B cells, and their generation is relatively inexpensive, requiring no special equipment and only a limited set of primers. In the absence of heavy-light chain pairing, single-domain antibodies are uniquely amenable to NGS analyses. We present a number of applications of NGS technology useful in discovery of single-domain antibodies from phage display libraries, including: (i) assessment of library functionality; (ii) confirmation of desired library randomization; (iii) estimation of library diversity; and (iv) monitoring the progress of panning experiments. While the case studies presented here are of phage-displayed single-domain antibody libraries, the principles extend to other types of in vitro display libraries.

Genes tagging and molecular diversity of red rot susceptible/tolerant sugarcane hybrids using c-DNA and unigene derived markers.

PubMed

Singh, R K; Singh, R B; Singh, S P; Sharma, M L

2012-04-01

Sugarcane is an important international commodity as a valuable agricultural crop especially in tropical and subtropical countries. Two bulked DNA used to screen polymorphic primers from commercial hybrids (varieties) with moderately resistant and highly susceptible to red rot disease. Among 145 simple sequence repeat and unigene primers screened, 37 (25%) were found to be highly robust and polymorphic with Polymorphism Information Content values ranging from 0.50 to 1.00 with the mean value of 0.82. Among these microsatellites, twenty one were used in the study of genetic relationships and marker identification in sugarcane varieties for red rot resistance. A total of 105 polymorphic DNA bands were identified, with their fragment size ranging from 54 to 1,280 bp. Jaccard's similarity coefficient value recorded between closely related hybrids was 0.986 while lowest coefficient value of 0.341 was detected with distantly related hybrids. The average similarity coefficient among these hybrids was 0.663. Cluster analysis resulted in a dendrogram with two major clusters separating the moderately resistant varieties from highly susceptible varieties. Three group specific fragments amplified by unigene Saccharum microsatellite primers viz; two markers UGSM316(850) and UGSM316(60) were closely associated with moderately resistant varieties by appearing bands in this region but the bands were absent in highly susceptible varieties. Similarly UGSM316(400) marker was tightly linked with highly susceptible varieties by amplifying uniformly in sugarcane varieties showing highly susceptible reaction to red rot but it was absent in moderately resistant varietal groups. Validation of red rot resistance/susceptibility associated markers on a group of different mapping populations for red rot resistant/susceptible traits is in progress.

Evaluation of Different Oligonucleotide Base Substitutions at CpG Binding sites in Multiplex Bisulfite-PCR sequencing.

PubMed

Lu, Jennifer; Ru, Kelin; Candiloro, Ida; Dobrovic, Alexander; Korbie, Darren; Trau, Matt

2017-03-22

Multiplex bisulfite-PCR sequencing is a convenient and scalable method for the quantitative determination of the methylation state of target DNA regions. A challenge of this application is the presence of CpGs in the same region where primers are being placed. A common solution to the presence of CpGs within a primer-binding region is to substitute a base degeneracy at the cytosine position. However, the efficacy of different substitutions and the extent to which bias towards methylated or unmethylated templates may occur has never been evaluated in bisulfite multiplex sequencing applications. In response, we examined the performance of four different primer substitutions at the cytosine position of CpG's contained within the PCR primers. In this study, deoxyinosine-, 5-nitroindole-, mixed-base primers and primers with an abasic site were evaluated across a series of methylated controls. Primers that contained mixed- or deoxyinosine- base modifications performed most robustly. Mixed-base primers were further selected to determine the conditions that induce bias towards methylated templates. This identified an optimized set of conditions where the methylated state of bisulfite DNA templates can be accurately assessed using mixed-base primers, and expands the scope of bisulfite resequencing assays when working with challenging templates.

Improved Selection of Internal Transcribed Spacer-Specific Primers Enables Quantitative, Ultra-High-Throughput Profiling of Fungal Communities

PubMed Central

Bokulich, Nicholas A.

2013-01-01

Ultra-high-throughput sequencing (HTS) of fungal communities has been restricted by short read lengths and primer amplification bias, slowing the adoption of newer sequencing technologies to fungal community profiling. To address these issues, we evaluated the performance of several common internal transcribed spacer (ITS) primers and designed a novel primer set and work flow for simultaneous quantification and species-level interrogation of fungal consortia. Primer comparison and validation were predicted in silico and by sequencing a “mock community” of mixed yeast species to explore the challenges of amplicon length and amplification bias for reconstructing defined yeast community structures. The amplicon size and distribution of this primer set are smaller than for all preexisting ITS primer sets, maximizing sequencing coverage of hypervariable ITS domains by very-short-amplicon, high-throughput sequencing platforms. This feature also enables the optional integration of quantitative PCR (qPCR) directly into the HTS preparatory work flow by substituting qPCR with these primers for standard PCR, yielding quantification of individual community members. The complete work flow described here, utilizing any of the qualified primer sets evaluated, can rapidly profile mixed fungal communities and capably reconstructed well-characterized beer and wine fermentation fungal communities. PMID:23377949

Invading stacking primer: A trigger for high-efficiency isothermal amplification reaction with superior selectivity for detecting microRNA variants.

PubMed

Liu, Weipeng; Zhu, Minjun; Liu, Hongxing; Wei, Jitao; Zhou, Xiaoming; Xing, Da

2016-07-15

Searching for a strategy to enhance the efficiency of nucleic acid amplification and achieve exquisite discrimination of nucleic acids at the single-base level for biological detection has become an exciting research direction in recent years. Here, we have developed a simple and universal primer design strategy which produces a fascinating effect on isothermal strand displacement amplification (iSDA). We refer to the resultant primer as "invading stacking primer (IS-Primer)" which is based on contiguous stacking hybridization and toehold-mediated exchange reaction and function by merely changing the hybridization location of the primer. Using the IS-Primer, the sensitivity in detecting the target miR-21 is improved approximately five fold compared with the traditional iSDA reaction. It was further demonstrated that the IS-Primer acts as an invading strand to initiate branch migration which can increase the efficiency of the untwisting of the hairpin probe. This effect is equivalent to reducing the free energy of the stem, and the technique shows superior selectivity for single-base mismatches. By demonstrating the enhanced effect of the IS-Primer in the iSDA reaction, this work may provide a potentially new avenue for developing more sensitive and selective nucleic acids assays. Copyright © 2016 Elsevier B.V. All rights reserved.

Improved Performance of Loop-Mediated Isothermal Amplification Assays via Swarm Priming.

PubMed

Martineau, Rhett L; Murray, Sarah A; Ci, Shufang; Gao, Weimin; Chao, Shih-Hui; Meldrum, Deirdre R

2017-01-03

This work describes an enhancement to the loop-mediated isothermal amplification (LAMP) reaction which results in improved performance. Enhancement is achieved by adding a new set of primers to conventional LAMP reactions. These primers are termed "swarm primers" based on their relatively high concentration and their ability to create new amplicons despite the theoretical lack of single-stranded annealing sites. The primers target a region upstream of the FIP/BIP primer recognition sequences on opposite strands, substantially overlapping F1/B1 sites. Thus, despite the addition of a new primer set to an already complex assay, no significant increase in assay complexity is incurred. Swarm priming is presented for three DNA templates: Lambda phage, Synechocystis sp. PCC 6803 rbcL gene, and human HFE. The results of adding swarm primers to conventional LAMP reactions include increased amplification speed, increased indicator contrast, and increased reaction products. For at least one template, minor improvements in assay repeatability are also shown. In addition, swarm priming is shown to be effective at increasing the reaction speed for RNA amplification via RT-LAMP. Collectively, these results suggest that the addition of swarm primers will likely benefit most if not all existing LAMP assays based on state-of-the-art, six-primer reactions.

Bond strength of self-etch adhesives after saliva contamination at different application steps.

PubMed

Cobanoglu, N; Unlu, N; Ozer, F F; Blatz, M B

2013-01-01

This study evaluated and compared the effect of saliva contamination and possible decontamination methods on bond strengths of two self-etching adhesive systems (Clearfil SE Bond [CSE], Optibond Solo Plus SE [OSE]). Flat occlusal dentin surfaces were created on 180 extracted human molar teeth. The two bonding systems and corresponding composite resins (Clearfil AP-X, Kerr Point 4) were bonded to the dentin under six surface conditions (n=15/group): group 1 (control): primer/bonding/composite; group 2: saliva/drying/primer/bonding/composite; group 3: primer/saliva/rinsing/drying/primer/bonding/composite; group 4: primer/saliva/rinsing/drying/bonding/composite; group 5: primer/bonding (cured)/saliva/rinsing/drying/primer/bonding/composite; group 6: primer/bonding (cured)/saliva/removing contaminated layer with a bur/rinsing/drying/primer/bonding/composite. Shear bond strength was tested after specimens were stored in distilled water at 37°C for 24 hours. One-way analysis of variance and Tukey post hoc tests were used for statistical analyses. For CSE, groups 2, 3, and 4 and for OSE, groups 6, 2, and 4 showed significantly lower bond strengths than the control group (p<0.05). CSE groups 5 and 6 and OSE groups 3 and 5 revealed bond strengths similar to the control. When saliva contamination occurred after light polymerization of the bonding agent, repeating the bonding procedure recovered the bonding capacity of both self-etch adhesives. However, saliva contamination before or after primer application negatively affected their bond strength.

Primer selection impacts specific population abundances but not community dynamics in a monthly time-series 16S rRNA gene amplicon analysis of coastal marine bacterioplankton.

PubMed

Wear, Emma K; Wilbanks, Elizabeth G; Nelson, Craig E; Carlson, Craig A

2018-03-09

Primers targeting the 16S small subunit ribosomal RNA marker gene, used to characterize bacterial and archaeal communities, have recently been re-evaluated for marine planktonic habitats. To investigate whether primer selection affects the ecological interpretation of bacterioplankton populations and community dynamics, amplicon sequencing with four primer sets targeting several hypervariable regions of the 16S rRNA gene was conducted on both mock communities constructed from cloned 16S rRNA genes and a time-series of DNA samples from the temperate coastal Santa Barbara Channel. Ecological interpretations of community structure (delineation of depth and seasonality, correlations with environmental factors) were similar across primer sets, while population dynamics varied. We observed substantial differences in relative abundances of taxa known to be poorly resolved by some primer sets, such as Thaumarchaeota and SAR11, and unexpected taxa including Roseobacter clades. Though the magnitude of relative abundances of common OTUs differed between primer sets, the relative abundances of the OTUs were nonetheless strongly correlated. We do not endorse one primer set but rather enumerate strengths and weaknesses to facilitate selection appropriate to a system or experimental goal. While 16S rRNA gene primer bias suggests caution in assessing quantitative population dynamics, community dynamics appear robust across studies using different primers. © 2018 The Authors. Environmental Microbiology published by Society for Applied Microbiology and John Wiley & Sons Ltd.

Optimal pcr primers for rapid and accurate detection of Aspergillus flavus isolates.

PubMed

Al-Shuhaib, Mohammed Baqur S; Albakri, Ali H; Alwan, Sabah H; Almandil, Noor B; AbdulAzeez, Sayed; Borgio, J Francis

2018-03-01

Aspergillus flavus is among the most devastating opportunistic pathogens of several food crops including rice, due to its high production of carcinogenic aflatoxins. The presence of these organisms in economically important rice strip farming is a serious food safety concern. Several polymerase chain reaction (PCR) primers have been designed to detect this species; however, a comparative assessment of their accuracy has not been conducted. This study aims to identify the optimal diagnostic PCR primers for the identification of A. flavus, among widely available primers. We isolated 122 A. flavus native isolates from randomly collected rice strips (N = 300). We identified 109 isolates to the genus level using universal fungal PCR primer pairs. Nine pairs of primers were examined for their PCR diagnostic specificity on the 109 isolates. FLA PCR was found to be the optimal PCR primer pair for specific identification of the native isolates, over aflP(1), aflM, aflA, aflD, aflP(3), aflP(2), and aflR. The PEP primer pair was found to be the most unsuitable for A. flavus identification. In conclusion, the present study indicates the powerful specificity of the FLA PCR primer over other commonly available diagnostic primers for accurate, rapid, and large-scale identification of A. flavus native isolates. This study provides the first simple, practical comparative guide to PCR-based screening of A. flavus infection in rice strips. Copyright © 2018 Elsevier Ltd. All rights reserved.

Bond Strength of Resin Cements to Zirconia Ceramic Using Adhesive Primers.

PubMed

Stefani, Ariovaldo; Brito, Rui Barbosa; Kina, Sidney; Andrade, Oswaldo Scopin; Ambrosano, Gláucia Maria Bovi; Carvalho, Andreia Assis; Giannini, Marcelo

2016-07-01

To evaluate the influence of adhesive primers on the microshear bond strength of resin cements to zirconia ceramic. Fifty zirconia plates (12 mm × 5 mm × 1.5 mm thick) of a commercially available zirconium oxide ceramic (ZirCad) were sintered, sandblasted with aluminum oxide particles, and cleaned ultrasonically before bonding. The plates were randomly divided into five groups of 10. Three resin cements were selected (RelyX ARC, Multilink Automix, Clearfil SA Cement self-adhesive resin cement), along with two primers (Metal-Zirconia Primer, Alloy Primer) and one control group. The primers and resin cements were used according to manufacturers' recommendations. The control group comprised the conventional resin cement (RelyX ARC) without adhesive primer. Test cylinders (0.75 mm diameter × 1 mm high) were formed on zirconia surfaces by filling cylindrical Tygon tube molds with resin cement. The specimens were stored in distilled water for 24 hours at 37°C, then tested for shear strength on a Shimadzu EZ Test testing machine at 0.5 mm/min. Bond strength data were analyzed statistically by two-way ANOVA and Dunnett's test (5%). The bond strength means in MPa (± s.d.) were: RelyX ARC: 28.1 (6.6); Multilink Automix: 37.6 (4.5); Multilink Automix + Metal-Zirconia Primer: 55.7 (4.0); Clearfil SA Cement: 46.2 (3.3); and Clearfil SA Cement + Alloy Primer: 47.0 (4.1). Metal-Zirconia Primer increased the bond strength of Multilink Automix resin cement to zirconia, but no effect was observed for Alloy Primer using Clearfil SA Cement. RelyX ARC showed the lowest bond strength to zirconia. © 2015 by the American College of Prosthodontists.

Specific primer design of mitochondrial 12S rRNA for species identification in raw meats

NASA Astrophysics Data System (ADS)

Cahyadi, M.; Puruhita; Barido, F. H.; Hertanto, B. S.

2018-01-01

Polymerase chain reaction (PCR) is a molecular technique that widely used in agriculture area including species identification in animal-based products for halalness and food safety reasons. Amplification of DNA using PCR needs a primer pair (forward and reverse primers) to isolate specific DNA fragment in the genome. This objective of this study was to design specific primer from mitochondrial 12S rRNA region for species identification in raw beef, pork and chicken meat. Three published sequences, HQ184045, JN601075, and KT626857, were downloaded from National Center for Biotechnology Information (NCBI) website. Furthermore, those reference sequences were used to design specific primer for bovine, pig, and chicken species using primer3 v.0.4.0. A total of 15 primer pairs were picked up from primer3 software. Of these, an universal forward primer and three reverse primers which are specific for bovine, pig, and chicken species were selected to be optimized using multiplex-PCR technique. The selected primers were namely UNIF (5’-ACC GCG GTC ATA CGA TTA AC-3’), SPR (5’-AGT GCG TCG GCT ATT GTA GG-3’), BBR (5’-GAA TTG GCA AGG GTT GGT AA-3’), and AR (5’-CGG TAT GTA CGT GCC TCA GA-3’). In addition, the PCR products were visualized using 2% agarose gels under the UV light and sequenced to be aligned with reference sequences using Clustal Omega. The result showed that those primers were specifically amplified mitochondrial 12S rRNA regions from bovine, pig, and chicken using PCR. It was indicated by the existence of 155, 357, and 611 bp of DNA bands for bovine, pig, and chicken species, respectively. Moreover, sequence analysis revealed that our sequences were identically similar with reference sequences. It can be concluded that mitochondrial 12S rRNA may be used as a genetic marker for species identification in meat products.

Clinical Decision-Making Tool for Safe and Effective Prescription of Exercise in Acute Exacerbations of Chronic Obstructive Pulmonary Disease: Results From an Interdisciplinary Delphi Survey and Focus Groups.

PubMed

Camp, Pat G; Reid, W Darlene; Chung, Frank; Kirkham, Ashley; Brooks, Dina; Goodridge, Donna; Marciniuk, Darcy D; Hoens, Alison M

2015-10-01

Exercise is recommended for people with an acute exacerbation of chronic obstructive pulmonary disease (AECOPD), yet there is little information to guide safe and effective mobilization and exercise for these patients. The purpose of this study was to develop a clinical decision-making tool to guide health care professionals in the assessment, prescription, monitoring, and progression of mobilization and therapeutic exercise for patients with AECOPD. A 3-round interdisciplinary Delphi panel identified and selected items based on a preselected consensus of 80%. These items were summarized in a paper-based tool titled Mobilization in Acute Exacerbations of Chronic Obstructive Pulmonary Disease (AECOPD-Mob). Focus groups and questionnaires were subsequently used to conduct a sensibility evaluation of the tool. Nine researchers, 13 clinicians, and 7 individuals with COPD identified and approved 110 parameters for safe and effective exercise in AECOPD. These parameters were grouped into 5 categories: (1) "What to Assess Prior to Mobilization," (2) "When to Consider Not Mobilizing or to Discontinue Mobilization," (3) "What to Monitor During Mobilization for Patient Safety," (4) "How to Progress Mobilization to Enhance Effectiveness," and (5) "What to Confirm Prior to Discharge." The tool was evaluated in 4 focus groups of 18 health care professionals, 90% of whom reported the tool was easy to use, was concise, and would guide a health care professional who is new to the acute care setting and working with patients with AECOPD. The tool was developed based on published evidence and expert opinion, so the applicability of the items to patients in all settings cannot be guaranteed. The Delphi panel consisted of health care professionals from Canada, so items may not be generalizable to other jurisdictions. The AECOPD-Mob provides practical and concise information on safe and effective exercise for the AECOPD population for use by the new graduate or novice acute care practitioner. © 2015 American Physical Therapy Association.

Isolation, Characterization, and Transfer of Cryptic Gene-Mobilizing Plasmids in the Wheat Rhizosphere

PubMed Central

van Elsas, Jan Dirk; McSpadden Gardener, Brian B.; Wolters, Anneke C.; Smit, Eric

1998-01-01

A set of self-transmissible plasmids with IncQ plasmid-mobilizing capacity was isolated by triparental exogenous isolation from the wheat rhizosphere with an Escherichia coli IncQ plasmid host and a Ralstonia eutropha recipient. Three plasmids of 38 to 45 kb, denoted pIPO1, pIPO2, and pIPO3, were selected for further study. No selectable traits (antibiotic or heavy-metal resistance) were identified in these plasmids. The plasmids were characterized by replicon typing via PCR and hybridization with replicon-specific probes and other hybridizations. pIPO1 and pIPO3 were similar to each other, whereas pIPO2 was different. None of these plasmids belonged to any known incompatibility group. pIPO2 was selected for further work, and a mini-Tn5-tet transposon was inserted to confer selectability. Plasmid pIPO2 had a broad IncQ plasmid mobilization and self-transfer range among the alpha, beta, and gamma subclasses of the Proteobacteria but did not show productive transfer to gram-positive bacteria. Plasmid pIPO2 mobilized IncQ plasmid pIE723 from Pseudomonas fluorescens to diverse indigenous proteobacteria in the rhizosphere of field-grown wheat. Transfer of pIE723 to indigenous bacteria was not observed in the absence of added pIPO2. A specific PCR primer system and a probe were developed for the detection of pIPO2-type plasmids in soil and rhizosphere. Analysis of soil DNA provided evidence for the presence of pIPO2 in inoculated wheat rhizosphere soil in the field study, as well as in the rhizosphere of uninoculated wheat plants growing in soil microcosms. The system failed to identify major reservoirs of pIPO2 in a variety of other soils. PMID:9501428

MSP-HTPrimer: a high-throughput primer design tool to improve assay design for DNA methylation analysis in epigenetics.

PubMed

Pandey, Ram Vinay; Pulverer, Walter; Kallmeyer, Rainer; Beikircher, Gabriel; Pabinger, Stephan; Kriegner, Albert; Weinhäusel, Andreas

2016-01-01

Bisulfite (BS) conversion-based and methylation-sensitive restriction enzyme (MSRE)-based PCR methods have been the most commonly used techniques for locus-specific DNA methylation analysis. However, both methods have advantages and limitations. Thus, an integrated approach would be extremely useful to quantify the DNA methylation status successfully with great sensitivity and specificity. Designing specific and optimized primers for target regions is the most critical and challenging step in obtaining the adequate DNA methylation results using PCR-based methods. Currently, no integrated, optimized, and high-throughput methylation-specific primer design software methods are available for both BS- and MSRE-based methods. Therefore an integrated, powerful, and easy-to-use methylation-specific primer design pipeline with great accuracy and success rate will be very useful. We have developed a new web-based pipeline, called MSP-HTPrimer, to design primers pairs for MSP, BSP, pyrosequencing, COBRA, and MSRE assays on both genomic strands. First, our pipeline converts all target sequences into bisulfite-treated templates for both forward and reverse strand and designs all possible primer pairs, followed by filtering for single nucleotide polymorphisms (SNPs) and known repeat regions. Next, each primer pairs are annotated with the upstream and downstream RefSeq genes, CpG island, and cut sites (for COBRA and MSRE). Finally, MSP-HTPrimer selects specific primers from both strands based on custom and user-defined hierarchical selection criteria. MSP-HTPrimer produces a primer pair summary output table in TXT and HTML format for display and UCSC custom tracks for resulting primer pairs in GTF format. MSP-HTPrimer is an integrated, web-based, and high-throughput pipeline and has no limitation on the number and size of target sequences and designs MSP, BSP, pyrosequencing, COBRA, and MSRE assays. It is the only pipeline, which automatically designs primers on both genomic strands to increase the success rate. It is a standalone web-based pipeline, which is fully configured within a virtual machine and thus can be readily used without any configuration. We have experimentally validated primer pairs designed by our pipeline and shown a very high success rate of primer pairs: out of 66 BSP primer pairs, 63 were successfully validated without any further optimization step and using the same qPCR conditions. The MSP-HTPrimer pipeline is freely available from http://sourceforge.net/p/msp-htprimer.

Novel ITS1 Fungal Primers for Characterization of the Mycobiome

PubMed Central

Usyk, Mykhaylo; Zolnik, Christine P.; Patel, Hitesh; Levi, Michael H.

2017-01-01

ABSTRACT Studies of the human microbiome frequently omit characterization of fungal communities (the mycobiome), which limits our ability to investigate how fungal communities influence human health. The internal transcribed spacer 1 (ITS1) region of the eukaryotic ribosomal cluster has features allowing for wide taxonomic coverage and has been recognized as a suitable barcode region for species-level identification of fungal organisms. We developed custom ITS1 primer sets using iterative alignment refinement. Primer performance was evaluated using in silico testing and experimental testing of fungal cultures and human samples. Using an expanded novel reference database, SIS (18S-ITS1-5.8S), the newly designed primers showed an average in silico taxonomic coverage of 79.9% ± 7.1% compared to a coverage of 44.6% ± 13.2% using previously published primers (P = 0.05). The newly described primer sets recovered an average of 21,830 ± 225 fungal reads from fungal isolate culture samples, whereas the previously published primers had an average of 3,305 ± 1,621 reads (P = 0.03). Of note was an increase in the taxonomic coverage of the Candida genus, which went from a mean coverage of 59.5% ± 13% to 100.0% ± 0.0% (P = 0.0015) comparing the previously described primers to the new primers, respectively. The newly developed ITS1 primer sets significantly improve general taxonomic coverage of fungal communities infecting humans and increased read depth by an order of magnitude over the best-performing published primer set tested. The overall best-performing primer pair in terms of taxonomic coverage and read recovery, ITS1-30F/ITS1-217R, will aid in advancing research in the area of the human mycobiome. IMPORTANCE The mycobiome constitutes all the fungal organisms within an environment or biological niche. The fungi are eukaryotes, are extremely heterogeneous, and include yeasts and molds that colonize humans as part of the microbiome. In addition, fungi can also infect humans and cause disease. Characterization of the bacterial component of the microbiome was revolutionized by 16S rRNA gene fragment amplification, next-generation sequencing technologies, and bioinformatics pipelines. Characterization of the mycobiome has often not been included in microbiome studies because of limitations in amplification systems. This report revisited the selection of PCR primers that amplify the fungal ITS1 region. We have identified primers with superior identification of fungi present in the database. We have compared the new primer sets against those previously used in the literature and show a significant improvement in read count and taxon identification. These primers should facilitate the study of fungi in human physiology and disease states. PMID:29242834

Progress toward a full scale mobile satellite system for Canada

NASA Astrophysics Data System (ADS)

Roscoe, Orest S.

The MSAT satellite, planned for launch in early 1994, will provide full scale, satellite based, mobile voice and data communication services to Canada. The MSAT system will provide mobile telephone, mobile radio and mobile data services to customers on the move in any part of North America. The Telesat Mobile Inc. (TMI) satellite will be backed up by a similar satellite to be operated by the American Mobile Satellite Corporation (AMSC) in the United States. An early entry mobile data service was inaugurated in the second quarter of 1990 using channels leased from INMARSAT on Marisat or Marecs-B. The baseline TMI system is described, beginning with the MSAT satellite under contract. The network architecture and the control system that are under development to support the mobile services are discussed. Since it is clearly desirable to have a North American system, such that customers may buy a mobile earth terminal (MET) from a number of qualified suppliers and be able to use it either in Canada or the U.S., TMI and AMSC are cooperating closely in the development of the space and ground segments of the system. The time scale for the procurement of all the elements of the systems is discussed.

Chocolate HILIC phases: development and characterization of novel saccharide-based stationary phases by applying non-enzymatic browning (Maillard reaction) on amino-modified silica surfaces.

PubMed

Schuster, Georg; Lindner, Wolfgang

2011-06-01

Novel saccharide-based stationary phases were developed by applying non-enzymatic browning (Maillard Reaction) on aminopropyl silica material. During this process, the reducing sugars glucose, lactose, maltose, and cellobiose served as "ligand primers". The reaction cascade using cellobiose resulted in an efficient chromatographic material which further served as our model Chocolate HILIC column. (Chocolate refers to the fact that these phases are brownish.) In this way, an amine backbone was introduced to facilitate convenient manipulation of selectivity by additional attractive or repulsive ionic solute-ligand interactions in addition to the typical HILIC retention mechanism. In total, six different test sets and five different mobile phase compositions were investigated, allowing a comprehensive evaluation of the new polar column. It became evident that, besides the so-called HILIC retention mechanism based on partition phenomena, additional adsorption mechanisms, including ionic interactions, take place. Thus, the new column is another example of a HILIC-type column characterized by mixed-modal retention increments. The glucose-modified materials exhibited the relative highest overall hydrophobicity of all grafted Chocolate HILIC columns which enabled retention of lipophilic analytes with high water content mobile phases.

Chemical and mechanical aspects of HMR primer in relationship to wood bonding

Treesearch

Alfred W. Christiansen

2005-01-01

The mechanism by which hydroxymethylated resorcinol (HMR) primer improves the durability of various adhesives to wood has been hypothesized as covalent chemical links between the adhesive and primer and possibly between the primer and wood. The present work presents experiments to test this hypothesis. In the first test, some resorcinol was displaced by 2- methylres-...

Polyacid macromolecule primers

DOEpatents

Sugama, Toshifumi

1989-01-01

Hydrophylic polyacids, such as macromolecules of polyitaconic acid and polyacrylic acid, where such macromolecules have molecular weights >50,000 as primers between a polymeric top coating, such as polyurethane, and an oxidized aluminum or aluminum alloy. A near monolayer of primer is used in polymeric adhesive/oxidized aluminum adhered joint systems in 0.05% primer concentration to give superior results in standard peel tests.

NeuroMind: Past, present, and future.

PubMed

Kubben, Pieter L

2017-01-01

This narrative report describes the underlying rationale and technical developments of NeuroMind, a mobile clinical decision support system for neurosurgery. From the perspective of a neurosurgeon - (app) developer it explains how technical progress has shaped the world's "most rated and highest rated" neurosurgical mobile application, with particular attention for operating system diversity on mobile hardware, cookbook medicine, regulatory affairs (in particular regarding software as a medical device), and new developments in the field of clinical data science, machine learning, and predictive analytics. Finally, the concept of "computational neurosurgery" is introduced as a vehicle to reach new horizons in neurosurgery.

NeuroMind: Past, present, and future

PubMed Central

Kubben, Pieter L.

2017-01-01

This narrative report describes the underlying rationale and technical developments of NeuroMind, a mobile clinical decision support system for neurosurgery. From the perspective of a neurosurgeon – (app) developer it explains how technical progress has shaped the world's “most rated and highest rated” neurosurgical mobile application, with particular attention for operating system diversity on mobile hardware, cookbook medicine, regulatory affairs (in particular regarding software as a medical device), and new developments in the field of clinical data science, machine learning, and predictive analytics. Finally, the concept of “computational neurosurgery” is introduced as a vehicle to reach new horizons in neurosurgery. PMID:28966822

Mobile Health Advances in Physical Activity, Fitness, and Atrial Fibrillation: Moving Hearts.

PubMed

McConnell, Michael V; Turakhia, Mintu P; Harrington, Robert A; King, Abby C; Ashley, Euan A

2018-06-12

The growing recognition that "health" takes place outside of the hospital and clinic, plus recent advances in mobile and wearable devices, have propelled the field of mobile health (mHealth). Cardiovascular disease and prevention are major opportunities for mHealth, as mobile devices can monitor key physiological signals (e.g., physical activity, heart rate and rhythm) for promoting healthy behaviors, detecting disease, and aid in ongoing care. In this review, the authors provide an update on cardiovascular mHealth by highlighting recent progress and challenges with mobile and wearable devices for assessing and promoting physical activity and fitness, and for monitoring heart rate and rhythm for the detection and management of atrial fibrillation. Copyright © 2018 American College of Cardiology Foundation. Published by Elsevier Inc. All rights reserved.

Comparison of Alignment Correction Angles Between Fixed-Bearing and Mobile-Bearing UKA.

PubMed

Inoue, Atsuo; Arai, Yuji; Nakagawa, Shuji; Inoue, Hiroaki; Yamazoe, Shoichi; Kubo, Toshikazu

2016-01-01

Good outcomes have been reported with both fixed-bearing and mobile-bearing unicompartmental knee arthroplasty (UKA). However, overcorrected alignment could induce the progression of arthritis on the non-arthroplasty side. Changes of limb alignment after UKA with both types of bearings (fixed bearing: 24 knees, mobile bearing: 28 knees) were investigated. The mean difference between the preoperative standing femoral-tibial angle (FTA) and postoperative standing FTA was significantly larger in mobile bearing UKA group. In fixed-bearing UKA, there must be some laxity in MCL tension so that a 2-mm tension gauge can be inserted. In mobile-bearing UKA, appropriate MCL tension is needed to prevent bearing dislocation. This difference in MCL tension may have caused the difference in the correction angle between the groups. Copyright © 2016 Elsevier Inc. All rights reserved.

Sensitivity to change of mobility measures in musculoskeletal conditions on lower extremities in outpatient rehabilitation settings.

PubMed

Navarro-Pujalte, Esther; Gacto-Sánchez, Mariano; Montilla-Herrador, Joaquina; Escolar-Reina, Pilar; Ángeles Franco-Sierra, María; Medina-Mirapeix, Francesc

2018-01-12

Prospective longitudinal study. To examine the sensitivity of the Mobility Activities Measure for lower extremities and to compare it to the sensitivity of the Physical Functioning Scale (PF-10) and the Patient-Specific Functional Scale (PSFS) at week 4 and week 8 post-hospitalization in outpatient rehabilitation settings. Mobility Activities Measure is a set of short mobility measures to track outpatient rehabilitation progress: its scales have shown good properties but its sensitivity to change has not been reported. Patients with musculoskeletal conditions were recruited at admission in three outpatient rehabilitation settings in Spain. Data were collected at admission, week 4 and week 8 from an initial sample of 236 patients (mean age ± SD = 36.7 ± 11.1). Mobility Activities Measure scales for lower extremity; PF-10; and PSFS. All the Mobility Activities Measure scales were sensitive to both positive and negative changes (the Standardized Response Means (SRMs) ranged between 1.05 and 1.53 at week 4, and between 0.63 and 1.47 at week 8). The summary measure encompassing the three Mobility Activities Measure scales detected a higher proportion of participants who had improved beyond the minimal detectable change (MDC) than detected by the PSFS and the PF-10 both at week 4 (86.64% vs. 69.81% and 42.23%, respectively) and week 8 (71.14% vs. 55.65% and 60.81%, respectively). The three Mobility Activities Measure scales assessing the lower extremity can be used across outpatient rehabilitation settings to provide consistent and sensitive measures of changes in patients' mobility. Implications for rehabilitation All the scales of the Mobility Activities Measure for the lower extremity were sensitive to both positive and negative change across the follow-up periods. Overall, the summary measure encompassing the three Mobility Activities Measure scales for the lower extremity appeared more sensitive to positive changes than the Physical Functioning Scale, especially during the first four weeks of treatment. The summary measure also detected a higher percentage of participants with positive change that exceeded the minimal detectable change than the Patient-Specific Functional Scale and the Physical Functioning Scale at the first follow-up period. By demonstrating their consistency and sensitivity to change, the three Mobility Activities Measures scales can now be considered in order to track patients' functional progress. Mobility Activities Measure can be therefore used in patients with musculoskeletal conditions across outpatient rehabilitation settings to provide estimates of change in mobility activities focusing on the lower extremity.

An Investigation to Improve Quality Evaluations of Primers and Propellant for 20mm Munitions

NASA Technical Reports Server (NTRS)

Bement, L. J.; Holmes, C.; McGrory, J.; Schimmel, M. L.

1997-01-01

To reduce the frequency of electrically initiated, 20mm munition hangfires (delayed ignitions), a joint Army/NASA investigation was conducted to recommend quality evaluation improvements for acceptance of both primers and gun propellant. This effort focused only on evaluating ignition and combustion performance as potential causes of hangfires: poor electrical initiation of the primer, low output performance of the primer, low ignition sensitivity of the gun propellant, and the effects of cold temperature. The goal was to determine the "best" of the Army and NASA test methods to assess the functional performance of primers and gun propellants. The approach was to evaluate the performance of both high-quality and deliberately defective primers to challenge the sensitivity of test methods. In addition, the ignition sensitivity of different manufacturing batches of gun propellants was evaluated. The results of the investigation revealed that improvements can be made in functional evaluations that can assist in identifying and reducing ignition and performance variations. The "best" functional evaluation of primers and propellant is achieved through a combination of both Army and NASA test methods. Incorporating the recommendations offered in this report may provide for considerable savings in reducing the number of cartridge firings, while significantly lowering the rejection rate of primer, propellant and cartridge lots. The most probable causes for ignition and combustion-related hangfires were the lack of calcium silicide in the primer mix, a low output performance of primers, and finally, poor ignition sensitivity of gun propellant. Cold temperatures further reduce propellant ignition sensitivity, as well as reducing burn rate and chamber pressures.

[Identification of Clonorchis sinensis metacercariae based on PCR targeting ribosomal DNA ITS regions and COX1 gene].

PubMed

Yang, Qing-Li; Shen, Ji-Qing; Jiang, Zhi-Hua; Yang, Yi-Chao; Li, Hong-Mei; Chen, Ying-Dan; Zhou, Xiao-Nong

2014-06-01

To identify Clonorchis sinensis metacercariae using PCR targeting ribosomal DNA ITS region and COX1 gene. Pseudorasbora parva were collected from Hengxian County of Guangxi at the end of May 2013. Single metacercaria of C. sinensis and other trematodes were separated from muscle tissue of P. parva by digestion method. Primers targeting ribosomal DNA ITS region and COX1 gene of C. sinensis were designed for PCR and the universal primers were used as control. The sensitivity and specificity of the PCR detection were analyzed. C. sinensis metacercariae at different stages were identified by PCR. DNA from single C. sinensis metacercaria was detected by PCR targeting ribosomal DNA ITS region and COX1 gene. The specific amplicans have sizes of 437/549, 156/249 and 195/166 bp, respectively. The ratio of the two positive numbers in PCR with universal primers and specific primers targeting C. sinensis ribosomal DNA ITS1 and ITS2 regions was 0.905 and 0.952, respectively. The target gene fragments were amplified by PCR using COX1 gene-specific primers. The PCR with specific primers did not show any non-specific amplification. However, the PCR with universal primers targeting ribosomal DNA ITS regions performed serious non-specific amplification. C. sinensis metacercariae at different stages are identified by morphological observation and PCR method. Species-specific primers targeting ribosomal DNA ITS region show higher sensitivity and specificity than the universal primers. PCR targeting COX1 gene shows similar sensitivity and specificity to PCR with specific primers targeting ribosomal DNA ITS regions.

Detection of N2O-producing fungi in environment using nitrite reductase gene (nirK)-targeting primers.

PubMed

Chen, Huaihai; Yu, Fangbo; Shi, Wei

2016-12-01

Fungal denitrification has been increasingly investigated, but its community ecology is poorly understood due to the lack of culture-independent tools. In this work, four pairs of nirK-targeting primers were designed and evaluated for primer specificity and efficiency using thirty N 2 O-producing fungal cultures and an agricultural soil. All primers amplified nirK from fungi and soil, but their efficiency and specificity were different. A primer set, FnirK_F3/R2 amplified ∼80 % of tested fungi, including Aspergillus, Fusarium, Penicillium, and Trichoderma, as compared to ∼40-70 % for other three primers. The nirK fragments of fungal and soil DNA amplified by FnirK_F3/R2 were phylogenetically related to denitrifying fungi in the orders Eurotiales, Hypocreales, and Sordariales; and clone sequences were also distributed in the clusters of Chaetomium, Metarhizium, and Myceliophthora that were uncultured from soil in our previous work. This proved the wide-range capability of primers for amplifying diverse denitrifying fungi from environment. However, our primers and recently-developed other primers amplified bacterial nirK from soil and this co-amplification of fungal and bacterial nirK was theoretically discussed. The FnirK_F3/R2 was further compared with published primers; results from clone libraries demonstrated that FnirK_F3/R2 was more specifically targeted on fungi and had broader taxonomical coverage than some others. Copyright © 2016 British Mycological Society. Published by Elsevier Ltd. All rights reserved.

Comparison of PCR primer-based strategies for characterization of ammonia oxidizer communities in environmental samples.

PubMed

Mahmood, Shahid; Freitag, Thomas E; Prosser, James I

2006-06-01

PCR-based techniques are commonly used to characterize microbial communities, but are subject to bias that is difficult to assess. This study aimed to evaluate bias of several PCR primer-based strategies used to study diversity of autotrophic ammonia oxidizers. 16S rRNA genes from soil- or sediment-DNA were amplified using primers considered either selective or specific for betaproteobacterial ammonia oxidizers. Five approaches were assessed: (a) amplification with primers betaAMO143f-betaAMO1315r; (b) amplification with primers CTO189f-CTO654r; (c) nested amplification with betaAMO143f-betaAMO1315r followed by CTO189f-CTO654r primers; (d) nested amplification with betaAMO143f-betaAMO1315r and CTO189f-Pf1053r primers; (e) nested amplification with 27f-1492r and CTO189f-CTO654r primers. Amplification products were characterized by denaturing gradient gel electrophoresis (DGGE) analysis after further amplification with 357f-GC-518r primers. DGGE profiles of soil communities were heterogeneous and depended on the approach followed. Ammonia oxidizer diversity was higher using approaches (b), (c) and (e) than using (a) and (d), where sequences of the most prominent bands showed similarities to nonammonia oxidizers. Profiles from marine sediments were more consistent, regardless of the approach adopted, and sequence analysis of excised bands indicated that these consisted of ammonia oxidizers only. The study demonstrates the importance of choice of primer, of screening for sequences of nontarget organisms and use of several approaches when characterizing microbial communities in natural environments.

GETPrime: a gene- or transcript-specific primer database for quantitative real-time PCR.

PubMed

Gubelmann, Carine; Gattiker, Alexandre; Massouras, Andreas; Hens, Korneel; David, Fabrice; Decouttere, Frederik; Rougemont, Jacques; Deplancke, Bart

2011-01-01

The vast majority of genes in humans and other organisms undergo alternative splicing, yet the biological function of splice variants is still very poorly understood in large part because of the lack of simple tools that can map the expression profiles and patterns of these variants with high sensitivity. High-throughput quantitative real-time polymerase chain reaction (qPCR) is an ideal technique to accurately quantify nucleic acid sequences including splice variants. However, currently available primer design programs do not distinguish between splice variants and also differ substantially in overall quality, functionality or throughput mode. Here, we present GETPrime, a primer database supported by a novel platform that uniquely combines and automates several features critical for optimal qPCR primer design. These include the consideration of all gene splice variants to enable either gene-specific (covering the majority of splice variants) or transcript-specific (covering one splice variant) expression profiling, primer specificity validation, automated best primer pair selection according to strict criteria and graphical visualization of the latter primer pairs within their genomic context. GETPrime primers have been extensively validated experimentally, demonstrating high transcript specificity in complex samples. Thus, the free-access, user-friendly GETPrime database allows fast primer retrieval and visualization for genes or groups of genes of most common model organisms, and is available at http://updepla1srv1.epfl.ch/getprime/. Database URL: http://deplanckelab.epfl.ch.

GETPrime: a gene- or transcript-specific primer database for quantitative real-time PCR

PubMed Central

Gubelmann, Carine; Gattiker, Alexandre; Massouras, Andreas; Hens, Korneel; David, Fabrice; Decouttere, Frederik; Rougemont, Jacques; Deplancke, Bart

2011-01-01

The vast majority of genes in humans and other organisms undergo alternative splicing, yet the biological function of splice variants is still very poorly understood in large part because of the lack of simple tools that can map the expression profiles and patterns of these variants with high sensitivity. High-throughput quantitative real-time polymerase chain reaction (qPCR) is an ideal technique to accurately quantify nucleic acid sequences including splice variants. However, currently available primer design programs do not distinguish between splice variants and also differ substantially in overall quality, functionality or throughput mode. Here, we present GETPrime, a primer database supported by a novel platform that uniquely combines and automates several features critical for optimal qPCR primer design. These include the consideration of all gene splice variants to enable either gene-specific (covering the majority of splice variants) or transcript-specific (covering one splice variant) expression profiling, primer specificity validation, automated best primer pair selection according to strict criteria and graphical visualization of the latter primer pairs within their genomic context. GETPrime primers have been extensively validated experimentally, demonstrating high transcript specificity in complex samples. Thus, the free-access, user-friendly GETPrime database allows fast primer retrieval and visualization for genes or groups of genes of most common model organisms, and is available at http://updepla1srv1.epfl.ch/getprime/. Database URL: http://deplanckelab.epfl.ch. PMID:21917859

Employment of Near Full-Length Ribosome Gene TA-Cloning and Primer-Blast to Detect Multiple Species in a Natural Complex Microbial Community Using Species-Specific Primers Designed with Their Genome Sequences.

PubMed

Zhang, Huimin; He, Hongkui; Yu, Xiujuan; Xu, Zhaohui; Zhang, Zhizhou

2016-11-01

It remains an unsolved problem to quantify a natural microbial community by rapidly and conveniently measuring multiple species with functional significance. Most widely used high throughput next-generation sequencing methods can only generate information mainly for genus-level taxonomic identification and quantification, and detection of multiple species in a complex microbial community is still heavily dependent on approaches based on near full-length ribosome RNA gene or genome sequence information. In this study, we used near full-length rRNA gene library sequencing plus Primer-Blast to design species-specific primers based on whole microbial genome sequences. The primers were intended to be specific at the species level within relevant microbial communities, i.e., a defined genomics background. The primers were tested with samples collected from the Daqu (also called fermentation starters) and pit mud of a traditional Chinese liquor production plant. Sixteen pairs of primers were found to be suitable for identification of individual species. Among them, seven pairs were chosen to measure the abundance of microbial species through quantitative PCR. The combination of near full-length ribosome RNA gene library sequencing and Primer-Blast may represent a broadly useful protocol to quantify multiple species in complex microbial population samples with species-specific primers.

Cross-kingdom amplification using bacteria-specific primers: complications for studies of coral microbial ecology.

PubMed

Galkiewicz, Julia P; Kellogg, Christina A

2008-12-01

PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem.

Cross-Kingdom Amplification Using Bacteria-Specific Primers: Complications for Studies of Coral Microbial Ecology▿

PubMed Central

Galkiewicz, Julia P.; Kellogg, Christina A.

2008-01-01

PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem. PMID:18931299

Polyacid macromolecule primers

DOEpatents

Sugama, Toshifumi.

1989-12-26

Hydrophilic polyacids are described, such as macromolecules of polyitaconic acid and polyacrylic acid, where such macromolecules have molecular weights >50,000 as primers between a polymeric top coating, such as polyurethane, and an oxidized aluminum or aluminum alloy. A near monolayer of primer is used in polymeric adhesive/oxidized aluminum adhered joint systems in 0.05% primer concentration to give superior results in standard peel tests. 2 figs.

Effect of surface preparation on service life of top-coats applied to weathered primer paint

Treesearch

R. Sam Williams; Mark Knaebe; Peter Sotos

2008-01-01

Paint companies usually recommend that topcoats be applied to primer paint within two weeks. Unfortunately, this is not always possible. For example, onset of winter weather shortly after applying primer may delay topcoat application until spring. Scuff sanding or repriming are often recommended remedial methods for preparing a weathered primer for topcoats, but there...

Simple sequence repeat marker loci discovery using SSR primer.

PubMed

Robinson, Andrew J; Love, Christopher G; Batley, Jacqueline; Barker, Gary; Edwards, David

2004-06-12

Simple sequence repeats (SSRs) have become important molecular markers for a broad range of applications, such as genome mapping and characterization, phenotype mapping, marker assisted selection of crop plants and a range of molecular ecology and diversity studies. With the increase in the availability of DNA sequence information, an automated process to identify and design PCR primers for amplification of SSR loci would be a useful tool in plant breeding programs. We report an application that integrates SPUTNIK, an SSR repeat finder, with Primer3, a PCR primer design program, into one pipeline tool, SSR Primer. On submission of multiple FASTA formatted sequences, the script screens each sequence for SSRs using SPUTNIK. The results are parsed to Primer3 for locus-specific primer design. The script makes use of a Web-based interface, enabling remote use. This program has been written in PERL and is freely available for non-commercial users by request from the authors. The Web-based version may be accessed at http://hornbill.cspp.latrobe.edu.au/

Nucleic acid amplification using modular branched primers

DOEpatents

Ulanovsky, Levy; Raja, Mugasimangalam C.

2001-01-01

Methods and compositions expand the options for making primers for use in amplifying nucleic acid segments. The invention eliminates the step of custom synthesis of primers for Polymerase Chain Reactions (PCR). Instead of being custom-synthesized, a primer is replaced by a combination of several oligonucleotide modules selected from a pre-synthesized library. A modular combination of just a few oligonucleotides essentially mimics the performance of a conventional, custom-made primer by matching the sequence of the priming site in the template. Each oligonucleotide module has a segment that matches one of the stretches within the priming site.

Rising Intragenerational Occupational Mobility in the United States, 1969 to 2011

PubMed Central

Jarvis, Benjamin F.; Song, Xi

2017-01-01

Despite the theoretical importance of intragenerational mobility and its connection to intergenerational mobility, no study since the 1970s has documented trends in intragenerational occupational mobility. The present article fills this intellectual gap by presenting evidence of an increasing trend in intragenerational mobility in the United States from 1969 to 2011. We decompose the trend using a nested occupational classification scheme that distinguishes between disaggregated micro-classes and progressively more aggregated meso-classes, macro-classes, and manual and nonmanual sectors. Log-linear analysis reveals that mobility increased across the occupational structure at nearly all levels of aggregation, especially after the early 1990s. Controlling for structural changes in occupational distributions modifies, but does not substantially alter, these findings. Trends are qualitatively similar for men and women. We connect increasing mobility to other macro-economic trends dating back to the 1970s, including changing labor force composition, technologies, employment relations, and industrial structures. We reassert the sociological significance of intragenerational mobility and discuss how increasing variability in occupational transitions within careers may counteract or mask trends in intergenerational mobility, across occupations and across more broadly construed social classes. PMID:28966346

Unusual course of infective endocarditis: acute renal failure progressing to chronic renal failure.

PubMed

Sevinc, Alper; Davutoglu, Vedat; Barutcu, Irfan; Kocoglu, M Esra

2006-04-01

Infective endocarditis is an infection of the endocardium that usually involves the valves and adjacent structures. The classical fever of unknown origin presentation represents a minority of infective endocarditis. The presented case was a 21-yearold young lady presenting with acute renal failure and fever to the emergency room. Cardiac auscultation revealed a soft S1 and 4/6 apical holosystolic murmur extended to axilla. Echocardiography showed mobile fresh vegetation under the mitral posterior leaflet. She was diagnosed as having infective endocarditis. Hemodialysis was started with antimicrobial therapy. However, because of the presence of severe mitral regurgitation with left ventricle dilatation and large mobile vegetation, mitral prosthetic mechanical valve replacement was performed. Although treated with antibiotics combined with surgery, renal functions were deteriorated and progressed to chronic renal failure.

Design factors that influence PCR amplification success of cross-species primers among 1147 mammalian primer pairs

PubMed Central

Housley, Donna JE; Zalewski, Zachary A; Beckett, Stephanie E; Venta, Patrick J

2006-01-01

Background Cross-species primers have been used with moderate success to address a variety of questions concerning genome structure, evolution, and gene function. However, the factors affecting their success have never been adequately addressed, particularly with respect to producing a consistent method to achieve high throughput. Using 1,147 mammalian cross-species primer pairs (1089 not previously reported), we tested several factors to determine their influence on the probability that a given target will amplify in a given species under a single amplification condition. These factors included: number of mismatches between the two species (the index species) used to identify conserved regions to which the primers were designed, GC-content of the gene and amplified region, CpG dinucleotides in the primer region, degree of encoded protein conservation, length of the primers, and the degree of evolutionary distance between the target species and the two index species. Results The amplification success rate for the cross-species primers was significantly influenced by the number of mismatches between the two index species (6–8% decrease per mismatch in a primer pair), the GC-content within the amplified region (for the dog, GC ≥ 50%, 56.9% amplified; GC<50%, 74.2% amplified), the degree of protein conservation (R2 = 0.14) and the relatedness of the target species to the index species. For the dog, 598 products of 930 primer pairs (64.3%) (excluding primers in which dog was an index species) were sequenced and shown to be the expected product, with an additional three percent producing the incorrect sequence. When hamster DNA was used with the single amplification condition in a microtiter plate-based format, 510 of 1087 primer pairs (46.9%) produced amplified products. The primer pairs are spaced at an average distance of 2.3 Mb in the human genome and may be used to produce up to several hundred thousand bp of species-specific sequence. Conclusion The most important factors influencing the proportion of successful amplifications are the number of index species mismatches, GC-richness of the target amplimer, and the relatedness of the target species to the index species, at least under the single PCR condition used. The 1147 cross-species primer pairs can be used in a high throughput manner to generate data for studies on the genetics and genomics of non-sequenced mammalian genomes. PMID:17029642

A comparison of orthodontic bracket shear bond strength on enamel deproteinized by 5.25% sodium hypochlorite using total etch and self-etch primer

NASA Astrophysics Data System (ADS)

Ongkowidjaja, F.; Soegiharto, B. M.; Purbiati, M.

2017-08-01

The shear bond strength (SBS) can be increased by removing protein pellicles from the enamel surface by deproteinization using 5.25% sodium hypochlorite (NaOCl). The SBS of a self-etch primer is lower than that of a total etch primer; nonetheless, it prevents white spot lesions. This study aimed to assess the SBS of the Anyetch (AE) total etch primer and FL-Bond II Shofu (FL) self-etch primer after enamel deproteinization using 5.25% NaOCl. Forty eight human maxillary first premolars were extracted, cleaned, and divided into four groups. In group A, brackets were bonded to the enamel without deproteinization before etching (A1: 10 teeth using total etch primer (AE); A2: 10 teeth using self-etch primer (FL)). In group B, brackets were bonded to the enamel after deproteinization with 5.25% NaOCl before etching (B1: 10 teeth using total etch primer (AE); B2: 10 teeth using self-etch primer (FL)). Brackets were bonded using Transbond XT, stored in artificial saliva for 24 h at 37°C, mounted on acrylic cylinders, and debonded using a Shimadzu AG-5000 universal testing machine. There were no significant differences in SBS between the total etch (AE) groups (p > 0.05) and between the self-etch (FL) groups (p > 0.05). There were significant differences in SBS between groups A and B. The mean SBS for groups A1, A2, B1, and B2 was 12.91±3.99, 4.46±2.47, 13.06±3.66, and 3.62±2.36 MPa, respectively. Deproteinization using NaOCl did not affect the SBS of the total etch primer (AE) group; it reduced the SBS of the self-etch primer (FL) group, but not with a statistically significant difference.

Genic and Intergenic SSR Database Generation, SNPs Determination and Pathway Annotations, in Date Palm (Phoenix dactylifera L.).

PubMed

Mokhtar, Morad M; Adawy, Sami S; El-Assal, Salah El-Din S; Hussein, Ebtissam H A

2016-01-01

The present investigation was carried out aiming to use the bioinformatics tools in order to identify and characterize, simple sequence repeats within the third Version of the date palm genome and develop a new SSR primers database. In addition single nucleotide polymorphisms (SNPs) that are located within the SSR flanking regions were recognized. Moreover, the pathways for the sequences assigned by SSR primers, the biological functions and gene interaction were determined. A total of 172,075 SSR motifs was identified on date palm genome sequence with a frequency of 450.97 SSRs per Mb. Out of these, 130,014 SSRs (75.6%) were located within the intergenic regions with a frequency of 499 SSRs per Mb. While, only 42,061 SSRs (24.4%) were located within the genic regions with a frequency of 347.5 SSRs per Mb. A total of 111,403 of SSR primer pairs were designed, that represents 291.9 SSR primers per Mb. Out of the 111,403, only 31,380 SSR primers were in the genic regions, while 80,023 primers were in the intergenic regions. A number of 250,507 SNPs were recognized in 84,172 SSR flanking regions, which represents 75.55% of the total SSR flanking regions. Out of 12,274 genes only 463 genes comprising 896 SSR primers were mapped onto 111 pathways using KEGG data base. The most abundant enzymes were identified in the pathway related to the biosynthesis of antibiotics. We tested 1031 SSR primers using both publicly available date palm genome sequences as templates in the in silico PCR reactions. Concerning in vitro validation, 31 SSR primers among those used in the in silico PCR were synthesized and tested for their ability to detect polymorphism among six Egyptian date palm cultivars. All tested primers have successfully amplified products, but only 18 primers detected polymorphic amplicons among the studied date palm cultivars.

Effectiveness of the standard and an alternative set of Streptococcus pneumoniae multi locus sequence typing primers.

PubMed

Adamiak, Paul; Vanderkooi, Otto G; Kellner, James D; Schryvers, Anthony B; Bettinger, Julie A; Alcantara, Joenel

2014-06-03

Multi-locus sequence typing (MLST) is a portable, broadly applicable method for classifying bacterial isolates at an intra-species level. This methodology provides clinical and scientific investigators with a standardized means of monitoring evolution within bacterial populations. MLST uses the DNA sequences from a set of genes such that each unique combination of sequences defines an isolate's sequence type. In order to reliably determine the sequence of a typing gene, matching sequence reads for both strands of the gene must be obtained. This study assesses the ability of both the standard, and an alternative set of, Streptococcus pneumoniae MLST primers to completely sequence, in both directions, the required typing alleles. The results demonstrated that for five (aroE, recP, spi, xpt, ddl) of the seven S. pneumoniae typing alleles, the standard primers were unable to obtain the complete forward and reverse sequences. This is due to the standard primers annealing too closely to the target regions, and current sequencing technology failing to sequence the bases that are too close to the primer. The alternative primer set described here, which includes a combination of primers proposed by the CDC and several designed as part of this study, addresses this limitation by annealing to highly conserved segments further from the target region. This primer set was subsequently employed to sequence type 105 S. pneumoniae isolates collected by the Canadian Immunization Monitoring Program ACTive (IMPACT) over a period of 18 years. The inability of several of the standard S. pneumoniae MLST primers to fully sequence the required region was consistently observed and is the result of a shift in sequencing technology occurring after the original primers were designed. The results presented here introduce clear documentation describing this phenomenon into the literature, and provide additional guidance, through the introduction of a widely validated set of alternative primers, to research groups seeking to undertake S. pneumoniae MLST based studies.

A novel photoinduced electron transfer (PET) primer technique for rapid real-time PCR detection of Cryptosporidium spp

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jothikumar, N., E-mail: jin2@cdc.gov; Hill, Vincent R.

Highlights: •Uses a single-labeled fluorescent primer for real-time PCR. •The detection sensitivity of PET PCR was comparable to TaqMan PCR. •Melt curve analysis can be performed to confirm target amplicon production. •Conventional PCR primers can be converted to PET PCR primers. -- Abstract: We report the development of a fluorescently labeled oligonucleotide primer that can be used to monitor real-time PCR. The primer has two parts, the 3′-end of the primer is complimentary to the target and a universal 17-mer stem loop at the 5′-end forms a hairpin structure. A fluorescent dye is attached to 5′-end of either the forwardmore » or reverse primer. The presence of guanosine residues at the first and second position of the 3′ dangling end effectively quenches the fluorescence due to the photo electron transfer (PET) mechanism. During the synthesis of nucleic acid, the hairpin structure is linearized and the fluorescence of the incorporated primer increases several-fold due to release of the fluorescently labeled tail and the absence of guanosine quenching. As amplicons are synthesized during nucleic acid amplification, the fluorescence increase in the reaction mixture can be measured with commercially available real-time PCR instruments. In addition, a melting procedure can be performed to denature the double-stranded amplicons, thereby generating fluorescence peaks that can differentiate primer dimers and other non-specific amplicons if formed during the reaction. We demonstrated the application of PET-PCR for the rapid detection and quantification of Cryptosporidium parvum DNA. Comparison with a previously published TaqMan® assay demonstrated that the two real-time PCR assays exhibited similar sensitivity for a dynamic range of detection of 6000–0.6 oocysts per reaction. PET PCR primers are simple to design and less-expensive than dual-labeled probe PCR methods, and should be of interest for use by laboratories operating in resource-limited environments.« less

Solution characterization of [methyl-13C]methionine HIV-1 reverse transcriptase by NMR spectroscopy☆

PubMed Central

Zheng, Xunhai; Mueller, Geoffrey A.; DeRose, Eugene F.; London, Robert E.

2013-01-01

HIV reverse transcriptase (RT) is a primary target for drug intervention in the treatment of AIDS. Wereport the first solution NMR studies of [methyl-13 C]methionine HIV-1 RT, aimed at better understanding the conformational and dynamic characteristics of RT, both in the presence and absence of the non-nucleoside RT inhibitor (NNRTI) nevirapine. The selection of methionine as a structural probe was based both on its favorable NMR characteristics, and on the presence of two important active site methionine residues, M18466 and M23066. Observation of the M184 resonance is subunit dependent; in the p66 subunit the solvent-exposed residue produces a readily observed signal with a characteristic resonance shift, while in the globular p51 subunit, the M18451 resonance is shifted and broadened as M184 becomes buried in the protein interior. In contrast, although structural data indicates that the environment of M230 is also strongly subunit dependent, the M230 resonances from both subunits have very similar shift and relaxation characteristics. A comparison of chemical shift and intensity data with model-based predictions gives reasonable agreement for M18466, while M23066, located on the β-hairpin “primer grip”, is more mobile and solvent-exposed than suggested by crystal structures of the apo enzyme which have a “closed” fingers-thumb conformation. This mobility of the primer grip is presumably important for binding of non-nucleoside RT inhibitors (NNRTIs), since the NNRTI binding pocket is not observed in the absence of the inhibitors, requiring instead that the binding pocket be dynamically accessible. In the presence of the nevirapine, both the M18466 and M23066 resonances are significantly perturbed, while none of the methionine resonances in the p51 subunit is sensitive to this inhibitor. Site-directed mutagenesis indicates that both M16 and M357 produce two resonances in each subunit, and for both residues, the intensity ratio of the component peaks is strongly subunit dependent. Conformational features that might explain the multiple peaks are discussed. PMID:19665484

Photoaffinity labeling of the primer binding domain in murine leukemia virus reverse transcriptase.

PubMed

Tirumalai, R S; Modak, M J

1991-07-02

We have labeled the primer binding domain of murine leukemia virus reverse transcriptase (MuLV RT) by covalently cross-linking 5' end labeled d(T)8 to MuLV RT, using ultraviolet light energy. The specificity and the functional significance of the primer cross-linking reaction were demonstrated by the fact that (i) other oligomeric primers, tRNAs, and also template-primers readily compete with radiolabeled d(T)8 for the cross-linking reaction, (ii) under similar conditions, the competing primers and template-primer also inhibit the DNA polymerase activity of MuLV RT to a similar extent, (iii) substrate deoxynucleotides have no effect, and (iv) the reaction is sensitive to high ionic strength. In order to identify the primer binding domains/sites in MuLV RT; tryptic digests prepared from the covalently cross-linked MuLV RT and [32P]d(T)8 complexes were resolved on C-18 columns by reverse-phase HPLC. Three distinct radiolabeled peptides were found to contain the majority of the bound primer. Of these, peptide I contained approximately 65% radioactivity, while the remainder was associated with peptides II and III. Amino acid composition and sequence analyses of the individual peptides revealed that peptide I spans amino acid residues 72-80 in the primary amino acid sequence of MuLV RT and is located in the polymerase domain. The primer cross-linking site appears to be at or near Pro-76. Peptides II and III span amino acid residues 602-609 and 615-622, respectively, and are located in the RNase H domain. The probable cross-linking sites in peptides II and III are suggested to be at or near Leu-604 and Leu-618, respectively.

Development of internal COI primers to improve and extend barcoding of fruit flies (Diptera: Tephritidae: Dacini).

PubMed

Krosch, Matt N; Strutt, Francesca; Blacket, Mark J; Batovska, Jana; Starkie, Melissa; Clarke, Anthony R; Cameron, Stephen L; Schutze, Mark K

2018-06-06

Accurate species-level identifications underpin many aspects of basic and applied biology; however, identifications can be hampered by a lack of discriminating morphological characters, taxonomic expertise or time. Molecular approaches, such as DNA 'barcoding' of the cytochrome c oxidase (COI) gene, are argued to overcome these issues. However, nuclear encoding of mitochondrial genes (numts) and poor amplification success of suboptimally preserved specimens can lead to erroneous identifications. One insect group for which these molecular and morphological problems are significant are the dacine fruit flies (Diptera: Tephritidae: Dacini). We addressed these issues associated with COI barcoding in the dacines by first assessing several 'universal' COI primers against public mitochondrial genome and numt sequences for dacine taxa. We then modified a set of four primers that more closely matched true dacine COI sequence and amplified two overlapping portions of the COI barcode region. Our new primers were tested alongside universal primers on a selection of dacine species, including both fresh preserved and decades-old dry specimens. Additionally, Bactrocera tryoni mitochondrial and nuclear genomes were compared to identify putative numts. Four numt clades were identified, three of which were amplified using existing universal primers. In contrast, our new primers preferentially amplified the 'true' mitochondrial COI barcode in all dacine species tested. The new primers also successfully amplified partial barcodes from dry specimens for which full length barcodes were unobtainable. Thus we recommend these new primers be incorporated into the suites of primers used by diagnosticians and quarantine labs for the accurate identification of dacine species. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

Linkage analysis with multiplexed short tandem repeat polymorphisms using infrared fluorescence and M13 tailed primers

DOE Office of Scientific and Technical Information (OSTI.GOV)

Oetting, W.S.; Lee, H.K.; Flanders, D.J.

The use of short tandem repeat polymorphisms (STRPs) as marker loci for linkage analysis is becoming increasingly important due to their large numbers in the human genome and their high degree of polymorphism. Fluorescence-based detection of the STRP pattern with an automated DNA sequencer has improved the efficiency of this technique by eliminating the need for radioactivity and producing a digitized autoradiogram-like image that can be used for computer analysis. In an effort to simplify the procedure and to reduce the cost of fluorescence STRP analysis, we have developed a technique known as multiplexing STRPs with tailed primers (MSTP) usingmore » primers that have a 19-bp extension, identical to the sequence of an M13 sequencing primer, on the 5{prime} end of the forward primer in conjunction with multiplexing several primer pairs in a single polymerase chain reaction (PCR) amplification. The banding pattern is detected with the addition of the M13 primer-dye conjugate as the sole primer conjugated to the fluorescent dye, eliminating the need for direct conjugation of the infrared fluorescent dye to the STRP primers. The use of MSTP for linkage analysis greatly reduces the number of PCR reactions. Up to five primer pairs can be multiplexed together in the same reaction. At present, a set of 148 STRP markers spaced at an average genetic distance of 28 cM throughout the autosomal genome can be analyzed in 37 sets of multiplexed amplification reactions. We have automated the analysis of these patterns for linkage using software that both detects the STRP banding pattern and determines their sizes. This information can then be exported in a user-defined format from a database manager for linkage analysis. 15 refs., 2 figs., 4 tabs.« less

Evaluation of different primers for PCR-DGGE analysis of cheese-associated enterococci.

PubMed

Lorbeg, Petra Mohar; Majhenic, Andreja Canzek; Rogelj, Irena

2009-08-01

Enterococci represent an important part of bacterial microbiota in different types of artisanal cheeses, made from either raw or pasteurized milk. Polymerase chain reaction denaturing gradient gel electrophoresis (PCR-DGGE) of ribosomal DNA is currently one of the most frequently used fingerprinting method to study diversity and dynamics of microbial communities and also a tool for microbial identification. Among several primer pairs for DGGE analysis published so far, six primer pairs amplifying different variable regions of 16S rDNA were selected and applied in our DGGE analysis of 12 species belonging to genus Enterococcus and eight other bacterial species often found in cheeses (seven lactobacilli and one Lactoccocus lactis). When DGGE procedures were optimized, the same set of primers was used for DGGE analysis of five cheese samples. Our study demonstrates that the use of different primer pairs generate significant differences in DGGE analysis of enterococcal population, consequently, appropriate primers regarding the purpose of analysis can be selected. For differentiation and identification of pure enterococcal isolates, primer pair P1V1/P2V1 showed the most promising results since all 12 enterococcal isolates gave distinctive DGGE fingerprints, but with multiple bands patterns; therefore, these primers do not seem to be appropriate for identification of enterococcal species in mixed cultures. Use of primer pairs HDA1/HDA2 and V3f/V3r amplifying V3 region showed better potential for detection and identification of enterococci in mixed communities, but since some bacterial species showed the same fingerprint, for clear identification combination of DGGE and some other method (e.g. species specific PCR) or combined DGGE analysis using two primer pairs generating distinctive results should be used.

Project Fire Model: Summary Progress Report, Period November 1, 1958 to April 30, 1960

Treesearch

W.L. Fons; H.D. Bruce; W.Y. Pong; S.S. Richards

1960-01-01

This report summarizes progress from November 1, 1958, to April 30, 1960, in a study conducted by the Pacific Southwest Forest and Range Experiment Station of the Forest Service in cooperation with the Office of Civil and Defense Mobilization. Called PROJECT FIRE MODEL for convenience, the project sought to develop and study a laboratory-scale fire which would...

Following the Mobile Student: Can We Develop the Capacity for a Comprehensive Database To Assess Student Progression? Research Report.

ERIC Educational Resources Information Center

Ewell, Peter T.; Schild, Paula R.; Paulson, Karen

A major problem in measuring student success in postsecondary education is the difficulty in tracking students' progress as they transfer from one institution to another. National studies have shown that more than half of students attend more than one institution in their pursuit of a bachelor's degree. This study examined existing state-level…

Effects of different orthodontic primers on enamel demineralization around orthodontic brackets.

PubMed

Baysal, Asli; Yasa, Asli; Sogut, Ozlem; Ozturk, Mehmet Ali; Uysal, Tancan

2015-09-01

The purpose of this work is to evaluate the effectiveness of one self-etching and two filled orthodontic primers on enamel demineralization around orthodontic brackets. Brackets were bonded to 84 bovine teeth and the vestibular enamel surfaces covered with acid-resistant nail varnish exposing 1 mm of space on each side of the bracket base. The teeth were allocated to four groups, using either Transbond XT conventional primer on etched enamel (group 1), Transbond Plus Self-Etching Primer on untreated enamel (group 2), Pro Seal filled resin primer on etched enamel (group 3), or Opal Seal filled resin primer on etched enamel (group 4). Each tooth was subjected to 15,000 strokes of brushing followed by exposure to an acid challenge. Calcium-ion release from each sample was calculated using atomic absorption spectrophotometry. Data were analyzed using one-way ANOVA and a post hoc Tukey test. Differences were considered statistically significant at p ≤ 0.05. Statistically significant differences were observed between the four groups (p < 0.001). No significant difference was found between the controls (group 1) and the Opal Seal group. Higher calcium release was observed in the Pro Seal group and the self-etching primer group compared to the controls. The highest calcium release was recorded in the self-etching primer group. Filled sealants may not have a protective effect against enamel demineralization. Transbond Plus Self-Etching Primer should be used cautiously, considering the risk of demineralization involved in its application.

[Effect of a chemical primer on the bond strength of a zirconia ceramic with self-adhesive resin cement].

PubMed

Zhang, Hong; Jing, Ye; Nie, Rongrong; Meng, Xiangfeng

2015-10-01

To evaluate the bond strength and durability of a self-adhesive resin cement with a zirconia ceramic pretreated by a zirconia primer. Zirconia ceramic (Vita Inceram YZ) plates with a thickness of 2.5 mm were fired, polished, and then cleaned. Half of the polished ceramic plates were sandblasted with 50 μm alumina particles at 0.3 MPa for 20 s. The surface compound weight ratios were measured via X-ray fluorescence microscopy. The polished and sandblasted ceramic plates were directly bonded with self-adhesive resin cement (Biscem) or were pretreated by a zirconia primer (Z Primer Plus) before bonding with Biscem. The specimens of each test group were divided into two subgroups (n=10) and subjected to the shear test after 0 and 10,000 thermal cycles. The data were analyzed via three-way ANOVA. After air abrasion, 8.27% weight ratio of alumina attached to the zirconia surface. Compared with air abrasion, primer treatment more significantly improved the primary resin bond strength of the zirconia ceramic. The primary resin bond strength of the zirconia ceramic with no primer treatment was not affected by thermocycling (P>0.05). However, the primary resin bond strength of the zirconia ceramic with primer treatment was significantly decreased by thermocycling (P<0.05). Primer treatment can improve the primary resin bond strengths of zirconia ceramics. However, the bond interface of the primer is not stable and rapidly degraded during thermocycling.

Analysis of short tandem repeat polymorphisms using infrared fluorescence with M18 tailed primers

DOE Office of Scientific and Technical Information (OSTI.GOV)

Oetting, W.S.; Wiesner, G.; Laken, S.

The use of short tandem repeat polymorphisms (STRPs) are becoming increasingly important as markers for linkage analysis due to their large numbers of the human genome and their high degree of polymorphism. Fluorescence based detection of the STRP pattern using the LI-COR model 4000S automated DNA sequencer eliminates the need for radioactivity and produces a digitized image that can be used for the analysis of the polymorphisms. In an effort to reduce the cost of STRP analysis, we have synthesized primers with a 19 bp extension complementary to the sequence of the M13 primer on the 5{prime} end of onemore » of the two primers used in the amplification of the STRP instead of using primers with direct conjugation of the infrared fluorescent dye. Up to 5 primer pairs can be multiplexed together with the M13 primer-dye conjugate as the sole primer conjugated to the fluorescent dye. Comparisons between primers that have been directly conjugated to the fluor with those having the M13 sequence extension show no difference in the ability to determine the STRP pattern. At present, the entire Weber 4A set of STRP markers is available with the M13 5{prime} extension. We are currently using this technique for linkage analysis of familial breast cancer and asthma. The combination of STRP analysis using fluorescence detection will allow this technique to be fully automated for allele scoring and linkage analysis.« less

Contributions of mobile technologies to addiction research.

PubMed

Swendsen, Joel

2016-06-01

Mobile technologies are revolutionizing the field of mental health, and particular progress has been made in their application to addiction research and treatment. The use of smartphones and other mobile devices has been shown to be feasible with individuals addicted to any of a wide range of substances, with few biases being observed concerning the repeated monitoring of daily life experiences, craving, or substance use. From a methodological point of view, the use of mobile technologies overcomes longstanding limitations of traditional clinical research protocols, including the more accurate assessment of temporal relationships among variables, as well as the reduction in both contextual constraints and discipline-specific methodological isolation. The present article presents a conceptual review of these advances while using illustrations of research applications that are capable of overcoming specific methodological barriers. Finally, a brief review of both the benefits and risks of mobile technology use for the treatment of patients will be addressed.

A review of privacy and usability issues in mobile health systems: Role of external factors.

PubMed

Katusiime, Jane; Pinkwart, Niels

2017-10-01

The increased penetration of mobile devices has created opportunities in the health sector and led to emerging of mobile health systems. As much as the mobile health systems have registered tremendous progress, they have been faced with privacy and usability issues. Due to the sensitivity of health information, there is an ethical need to equip mobile health systems with adequate privacy measures. However, these systems should also be useable by the intended users. Even though many researchers are working on solutions, the issues still persist. External factors such as cultural differences have also contributed to the issues, yet they have been under researched. In this article, we conduct a systematic literature review of 22 articles, categorize and present privacy and usability issues and possible solutions. We then discuss the relevance and implications of external factors to the findings on privacy and usability. We end with recommendations to address these external factors.

Catching up? The educational mobility of migrants’ and natives’ children in Europe

PubMed Central

Oberdabernig, Doris; Schneebaum, Alyssa

2017-01-01

ABSTRACT Migrants into European countries are often less educated than European natives. We analyse whether migrants’ children are more or less likely than natives’ children to achieve upward educational mobility across generations, and study differences in the factors, which contribute to differences in mobility for the two groups. We find that migrants’ descendants are more often upwardly mobile (and less often downwardly mobile) than their native peers in the majority of countries studied, and show that the main factor contributing to these patterns is the education level of parents. Although a lower parental education means that their children are less likely to access the same amount of human, social and financial capital as children of more highly educated parents, migrants’ descendants over the last two generations were able to make significant progress in reducing education gaps with natives. PMID:28620245

Contributions of mobile technologies to addiction research

PubMed Central

Swendsen, Joel

2016-01-01

Mobile technologies are revolutionizing the field of mental health, and particular progress has been made in their application to addiction research and treatment. The use of smartphones and other mobile devices has been shown to be feasible with individuals addicted to any of a wide range of substances, with few biases being observed concerning the repeated monitoring of daily life experiences, craving, or substance use. From a methodological point of view, the use of mobile technologies overcomes longstanding limitations of traditional clinical research protocols, including the more accurate assessment of temporal relationships among variables, as well as the reduction in both contextual constraints and discipline-specific methodological isolation. The present article presents a conceptual review of these advances while using illustrations of research applications that are capable of overcoming specific methodological barriers. Finally, a brief review of both the benefits and risks of mobile technology use for the treatment of patients will be addressed. PMID:27489461

In the Palm of Your Hand - Normalizing the Use of Mobile Technology for Nurse Practitioner Education and Clinical Practice.

PubMed

Lamarche, Kimberley; Park, Caroline; Fraser, Shawn; Rich, Mariann; MacKenzie, Susan

2016-01-01

The use of mobile devices by nurse practitioners (NPs) to meet an evolving technological landscape is expanding rapidly. A longitudinal study of the ways NP students "normalize" the use of mobile devices in clinical education was completed. This study used researcher-designed survey tools, including sociodemographic questions, and the numerical picture was augmented and interpreted in light of the textual data in the form of selected interviews. Data indicate that mobile technology is normalized in the social realm but still developing in the clinical realm. Progress is hindered by non-modelling by faculty, inconsistent healthcare policy and lack of understanding of the affordances available through this technology. Overall, mobile technology is utilized and normalized in practice; this in turn has influenced their ability to prepare students for practice. Data presented can assist educators and clinicians alike in developing a more fulsome understanding on how to appropriately incorporate mobile technology into education and practice.

Cross-kingdom amplification using Bacteria-specific primers: Complications for studies of coral microbial ecology

USGS Publications Warehouse

Galkiewicz, J.P.; Kellogg, C.A.

2008-01-01

PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem. Copyright ?? 2008, American Society for Microbiology. All Rights Reserved.

Multiplex Degenerate Primer Design for Targeted Whole Genome Amplification of Many Viral Genomes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gardner, Shea N.; Jaing, Crystal J.; Elsheikh, Maher M.

Background . Targeted enrichment improves coverage of highly mutable viruses at low concentration in complex samples. Degenerate primers that anneal to conserved regions can facilitate amplification of divergent, low concentration variants, even when the strain present is unknown. Results . A tool for designing multiplex sets of degenerate sequencing primers to tile overlapping amplicons across multiple whole genomes is described. The new script, run_tiled_primers, is part of the PriMux software. Primers were designed for each segment of South American hemorrhagic fever viruses, tick-borne encephalitis, Henipaviruses, Arenaviruses, Filoviruses, Crimean-Congo hemorrhagic fever virus, Rift Valley fever virus, and Japanese encephalitis virus. Eachmore » group is highly diverse with as little as 5% genome consensus. Primer sets were computationally checked for nontarget cross reactions against the NCBI nucleotide sequence database. Primers for murine hepatitis virus were demonstrated in the lab to specifically amplify selected genes from a laboratory cultured strain that had undergone extensive passage in vitro and in vivo. Conclusions . This software should help researchers design multiplex sets of primers for targeted whole genome enrichment prior to sequencing to obtain better coverage of low titer, divergent viruses. Applications include viral discovery from a complex background and improved sensitivity and coverage of rapidly evolving strains or variants in a gene family.« less

De-MetaST-BLAST: A Tool for the Validation of Degenerate Primer Sets and Data Mining of Publicly Available Metagenomes

PubMed Central

Gulvik, Christopher A.; Effler, T. Chad; Wilhelm, Steven W.; Buchan, Alison

2012-01-01

Development and use of primer sets to amplify nucleic acid sequences of interest is fundamental to studies spanning many life science disciplines. As such, the validation of primer sets is essential. Several computer programs have been created to aid in the initial selection of primer sequences that may or may not require multiple nucleotide combinations (i.e., degeneracies). Conversely, validation of primer specificity has remained largely unchanged for several decades, and there are currently few available programs that allows for an evaluation of primers containing degenerate nucleotide bases. To alleviate this gap, we developed the program De-MetaST that performs an in silico amplification using user defined nucleotide sequence dataset(s) and primer sequences that may contain degenerate bases. The program returns an output file that contains the in silico amplicons. When De-MetaST is paired with NCBI’s BLAST (De-MetaST-BLAST), the program also returns the top 10 nr NCBI database hits for each recovered in silico amplicon. While the original motivation for development of this search tool was degenerate primer validation using the wealth of nucleotide sequences available in environmental metagenome and metatranscriptome databases, this search tool has potential utility in many data mining applications. PMID:23189198

Multiplex real-time PCR using temperature sensitive primer-supplying hydrogel particles and its application for malaria species identification

PubMed Central

Byoun, Mun Sub; Yoo, Changhoon; Sim, Sang Jun; Lim, Chae Seung; Kim, Sung Woo

2018-01-01

Real-time PCR, also called quantitative PCR (qPCR), has been powerful analytical tool for detection of nucleic acids since it developed. Not only for biological research but also for diagnostic needs, qPCR technique requires capacity to detect multiple genes in recent years. Solid phase PCR (SP-PCR) where one or two directional primers are immobilized on solid substrates could analyze multiplex genetic targets. However, conventional SP-PCR was subjected to restriction of application for lack of PCR efficiency and quantitative resolution. Here we introduce an advanced qPCR with primer-incorporated network (PIN). One directional primers are immobilized in the porous hydrogel particle by covalent bond and the other direction of primers are temporarily immobilized at so-called 'Supplimers'. Supplimers released the primers to aqueous phase in the hydrogel at the thermal cycling of PCR. It induced the high PCR efficiency over 92% with high reliability. It reduced the formation of primer dimers and improved the selectivity of qPCR thanks to the strategy of 'right primers supplied to right place only'. By conducting a six-plex qPCR of 30 minutes, we analyzed DNA samples originated from malaria patients and successfully identified malaria species in a single reaction. PMID:29293604

MRPrimerV: a database of PCR primers for RNA virus detection

PubMed Central

Kim, Hyerin; Kang, NaNa; An, KyuHyeon; Kim, Doyun; Koo, JaeHyung; Kim, Min-Soo

2017-01-01

Many infectious diseases are caused by viral infections, and in particular by RNA viruses such as MERS, Ebola and Zika. To understand viral disease, detection and identification of these viruses are essential. Although PCR is widely used for rapid virus identification due to its low cost and high sensitivity and specificity, very few online database resources have compiled PCR primers for RNA viruses. To effectively detect viruses, the MRPrimerV database (http://MRPrimerV.com) contains 152 380 247 PCR primer pairs for detection of 1818 viruses, covering 7144 coding sequences (CDSs), representing 100% of the RNA viruses in the most up-to-date NCBI RefSeq database. Due to rigorous similarity testing against all human and viral sequences, every primer in MRPrimerV is highly target-specific. Because MRPrimerV ranks CDSs by the penalty scores of their best primer, users need only use the first primer pair for a single-phase PCR or the first two primer pairs for two-phase PCR. Moreover, MRPrimerV provides the list of genome neighbors that can be detected using each primer pair, covering 22 192 variants of 532 RefSeq RNA viruses. We believe that the public availability of MRPrimerV will facilitate viral metagenomics studies aimed at evaluating the variability of viruses, as well as other scientific tasks. PMID:27899620

Evaluation of revised polymerase chain reaction primers for more inclusive quantification of ammonia-oxidizing archaea and bacteria.

PubMed

Meinhardt, Kelley A; Bertagnolli, Anthony; Pannu, Manmeet W; Strand, Stuart E; Brown, Sally L; Stahl, David A

2015-04-01

Ammonia-oxidizing archaea (AOA) and bacteria (AOB) fill key roles in the nitrogen cycle. Thus, well-vetted methods for characterizing their distribution are essential for framing studies of their significance in natural and managed systems. Quantification of the gene coding for one subunit of the ammonia monooxygenase (amoA) by polymerase chain reaction is frequently employed to enumerate the two groups. However, variable amplification of sequence variants comprising this conserved genetic marker for ammonia oxidizers potentially compromises within- and between-system comparisons. We compared the performance of newly designed non-degenerate quantitative polymerase chain reaction primer sets to existing primer sets commonly used to quantify the amoA of AOA and AOB using a collection of plasmids and soil DNA samples. The new AOA primer set provided improved quantification of model mixtures of different amoA sequence variants and increased detection of amoA in DNA recovered from soils. Although both primer sets for the AOB provided similar results for many comparisons, the new primers demonstrated increased detection in environmental application. Thus, the new primer sets should provide a useful complement to primers now commonly used to characterize the environmental distribution of AOA and AOB. © 2014 Society for Applied Microbiology and John Wiley & Sons Ltd.

Identification of the gene encoding the major capsid protein of fish lymphocystis disease virus.

PubMed

Schnitzler, P; Darai, G

1993-10-01

The gene encoding the major capsid protein (MCP) of fish lymphocystis disease virus (flounder isolate; FLCDV-f) has been identified by PCR using oligonucleotide primers corresponding to different regions of the MCP of Tipula iridescent virus (TIV), iridescent virus 22 (IV22) and Chilo iridescent virus (CIV). DNA fragments of 0.4 kbp, 0.5 kbp and 0.27 kbp in size were amplified using oligonucleotide primers corresponding to amino acids (aa) 146 to 153 (primer 1) and 274 to 268 (primer 6), or aa 146 to 153 (primer 1) and 313 to 304 (primer 8), or aa 304 to 312 (primer 7) and 385 to 381 (primer 9) of the MCP of TIV, respectively. The PCR products were used as hybridization probes for screening the gene library of FLCDV-f. The MCP gene of FLCDV-f(1377 bp; 459 aa; 51.4K) was identified within the DNA sequence of the EcoRI FLCDV-f DNA fragment C (11.2 kbp; 0.611 to 0.718 map units). A high degree of aa sequence identity/similarity was detected between the MCP of FLCDV-f and TIV (50.3%/33.8%), IV22 (49.1%/34.2%). CIV (53%/29.5%) and African swine fever virus (16%/38.1%).

Multiplex Degenerate Primer Design for Targeted Whole Genome Amplification of Many Viral Genomes

DOE PAGES

Gardner, Shea N.; Jaing, Crystal J.; Elsheikh, Maher M.; ...

2014-01-01

Background . Targeted enrichment improves coverage of highly mutable viruses at low concentration in complex samples. Degenerate primers that anneal to conserved regions can facilitate amplification of divergent, low concentration variants, even when the strain present is unknown. Results . A tool for designing multiplex sets of degenerate sequencing primers to tile overlapping amplicons across multiple whole genomes is described. The new script, run_tiled_primers, is part of the PriMux software. Primers were designed for each segment of South American hemorrhagic fever viruses, tick-borne encephalitis, Henipaviruses, Arenaviruses, Filoviruses, Crimean-Congo hemorrhagic fever virus, Rift Valley fever virus, and Japanese encephalitis virus. Eachmore » group is highly diverse with as little as 5% genome consensus. Primer sets were computationally checked for nontarget cross reactions against the NCBI nucleotide sequence database. Primers for murine hepatitis virus were demonstrated in the lab to specifically amplify selected genes from a laboratory cultured strain that had undergone extensive passage in vitro and in vivo. Conclusions . This software should help researchers design multiplex sets of primers for targeted whole genome enrichment prior to sequencing to obtain better coverage of low titer, divergent viruses. Applications include viral discovery from a complex background and improved sensitivity and coverage of rapidly evolving strains or variants in a gene family.« less

Early mobilization in critically ill patients: patients' mobilization level depends on health care provider's profession.

PubMed

Garzon-Serrano, Jaime; Ryan, Cheryl; Waak, Karen; Hirschberg, Ronald; Tully, Susan; Bittner, Edward A; Chipman, Daniel W; Schmidt, Ulrich; Kasotakis, Georgios; Benjamin, John; Zafonte, Ross; Eikermann, Matthias

2011-04-01

To evaluate whether the level of mobilization achieved and the barriers for progressing to the next mobilization level differ between nurses and physical therapists. Prospective, observational study. Twenty-bed surgical intensive care unit (SICU) of the Massachusetts General Hospital. Sixty-three critically ill patients. Physical therapists and nurses performed 179 mobilization therapies with 63 patients. Mobilization was defined as the process of enhancing mobility in the SICU, including bed mobility, edge of bed activities, transfers out of bed to a chair, and gait training; the mobilization level was measured on the SICU optimal mobilization scale, a 5-point (0-4) numerical rating scale. Patients' level of mobilization achieved by physical therapists was significantly higher compared with that achieved by nurses (2.3 ± 1.2 mean ± SD versus 1.2 ± 1.2, respectively P < .0001). Different barriers for mobilization were identified by physical therapists and nurses: hemodynamic instability (26% versus 12%, P = .03) and renal replacement therapy (12% versus 1%, P = .03) were barriers rated higher by nurses, whereas neurologic impairment was rated higher by physical therapists providers (18% versus 38%, P = .002). No mobilization-associated adverse events were observed in this study. This study showed that physical therapists mobilize their critically ill patients to higher levels compared with nurses. Nurse and physical therapists identify different barriers for mobilization. Routine involvement of physical therapists in directing mobilization treatment may promote early mobilization of critically ill patients. Copyright © 2011 American Academy of Physical Medicine and Rehabilitation. Published by Elsevier Inc. All rights reserved.

An Optimal Mobile Service for Telecare Data Synchronization using a Role-based Access Control Model and Mobile Peer-to-Peer Technology.

PubMed

Ke, Chih-Kun; Lin, Zheng-Hua

2015-09-01

The progress of information and communication technologies (ICT) has promoted the development of healthcare which has enabled the exchange of resources and services between organizations. Organizations want to integrate mobile devices into their hospital information systems (HIS) due to the convenience to employees who are then able to perform specific healthcare processes from any location. The collection and merage of healthcare data from discrete mobile devices are worth exploring possible ways for further use, especially in remote districts without public data network (PDN) to connect the HIS. In this study, we propose an optimal mobile service which automatically synchronizes the telecare file resources among discrete mobile devices. The proposed service enforces some technical methods. The role-based access control model defines the telecare file resources accessing mechanism; the symmetric data encryption method protects telecare file resources transmitted over a mobile peer-to-peer network. The multi-criteria decision analysis method, ELECTRE (Elimination Et Choice Translating Reality), evaluates multiple criteria of the candidates' mobile devices to determine a ranking order. This optimizes the synchronization of telecare file resources among discrete mobile devices. A prototype system is implemented to examine the proposed mobile service. The results of the experiment show that the proposed mobile service can automatically and effectively synchronize telecare file resources among discrete mobile devices. The contribution of this experiment is to provide an optimal mobile service that enhances the security of telecare file resource synchronization and strengthens an organization's mobility.

Delaying Mobility Disability in People With Parkinson Disease Using a Sensorimotor Agility Exercise Program

PubMed Central

King, Laurie A; Horak, Fay B

2009-01-01

This article introduces a new framework for therapists to develop an exercise program to delay mobility disability in people with Parkinson disease (PD). Mobility, or the ability to efficiently navigate and function in a variety of environments, requires balance, agility, and flexibility, all of which are affected by PD. This article summarizes recent research identifying how constraints on mobility specific to PD, such as rigidity, bradykinesia, freezing, poor sensory integration, inflexible program selection, and impaired cognitive processing, limit mobility in people with PD. Based on these constraints, a conceptual framework for exercises to maintain and improve mobility is presented. An example of a constraint-focused agility exercise program, incorporating movement principles from tai chi, kayaking, boxing, lunges, agility training, and Pilates exercises, is presented. This new constraint-focused agility exercise program is based on a strong scientific framework and includes progressive levels of sensorimotor, resistance, and coordination challenges that can be customized for each patient while maintaining fidelity. Principles for improving mobility presented here can be incorporated into an ongoing or long-term exercise program for people with PD. PMID:19228832

Delaying mobility disability in people with Parkinson disease using a sensorimotor agility exercise program.

PubMed

King, Laurie A; Horak, Fay B

2009-04-01

This article introduces a new framework for therapists to develop an exercise program to delay mobility disability in people with Parkinson disease (PD). Mobility, or the ability to efficiently navigate and function in a variety of environments, requires balance, agility, and flexibility, all of which are affected by PD. This article summarizes recent research identifying how constraints on mobility specific to PD, such as rigidity, bradykinesia, freezing, poor sensory integration, inflexible program selection, and impaired cognitive processing, limit mobility in people with PD. Based on these constraints, a conceptual framework for exercises to maintain and improve mobility is presented. An example of a constraint-focused agility exercise program, incorporating movement principles from tai chi, kayaking, boxing, lunges, agility training, and Pilates exercises, is presented. This new constraint-focused agility exercise program is based on a strong scientific framework and includes progressive levels of sensorimotor, resistance, and coordination challenges that can be customized for each patient while maintaining fidelity. Principles for improving mobility presented here can be incorporated into an ongoing or long-term exercise program for people with PD.

CRISPR Primer Designer: Design primers for knockout and chromosome imaging CRISPR-Cas system.

PubMed

Yan, Meng; Zhou, Shi-Rong; Xue, Hong-Wei

2015-07-01

The clustered regularly interspaced short palindromic repeats (CRISPR)-associated system enables biologists to edit genomes precisely and provides a powerful tool for perturbing endogenous gene regulation, modulation of epigenetic markers, and genome architecture. However, there are concerns about the specificity of the system, especially the usages of knocking out a gene. Previous designing tools either were mostly built-in websites or ran as command-line programs, and none of them ran locally and acquired a user-friendly interface. In addition, with the development of CRISPR-derived systems, such as chromosome imaging, there were still no tools helping users to generate specific end-user spacers. We herein present CRISPR Primer Designer for researchers to design primers for CRISPR applications. The program has a user-friendly interface, can analyze the BLAST results by using multiple parameters, score for each candidate spacer, and generate the primers when using a certain plasmid. In addition, CRISPR Primer Designer runs locally and can be used to search spacer clusters, and exports primers for the CRISPR-Cas system-based chromosome imaging system. © 2014 Institute of Botany, Chinese Academy of Sciences.

Immunological properties of the primer-independent glucosyltransferase of Streptococcus mutans serotypes d and g.

PubMed

Yamashita, Y; Shigeoka, T; Hanada, N; Takehara, T

1988-05-01

Streptococcus mutans serotype g secretes at least three kinds of glucosyltransferase with different enzymological and immunological properties. One of them is a primer-independent enzyme and seems to be the source of primer for the others, both of which are primer-dependent enzymes. Recently, we purified the primer-independent enzyme, the third glucosyltransferase in this group from S. mutans strain AHT-k serotype g. In the present study, we examined the specificity of the antiserum against the primer-independent glucosyltransferase using extracellular culture-conditioned fluids of many strains of the various serotypes of S. mutans. The antiserum cross-reacted with the extracellular culture fluids from strains of serotypes d and a, in addition to serotype g, but not with those of other serotypes, indicating that the primer-independent glucosyltransferase is secreted by the S. sobrinus and S. cricetus, but not by S. mutans and S. rattus. The antiserum did not completely inhibit the activity of the enzyme, even at more than twofold antibody excess, determined by indirect precipitation with immobilized staphylococcal protein A.

Sensitivity of different Trypanosoma vivax specific primers for the diagnosis of livestock trypanosomosis using different DNA extraction methods.

PubMed

Gonzales, J L; Loza, A; Chacon, E

2006-03-15

There are several T. vivax specific primers developed for PCR diagnosis. Most of these primers were validated under different DNA extraction methods and study designs leading to heterogeneity of results. The objective of the present study was to validate PCR as a diagnostic test for T. vivax trypanosomosis by means of determining the test sensitivity of different published specific primers with different sample preparations. Four different DNA extraction methods were used to test the sensitivity of PCR with four different primer sets. DNA was extracted directly from whole blood samples, blood dried on filter papers or blood dried on FTA cards. The results showed that the sensitivity of PCR with each primer set was highly dependant of the sample preparation and DNA extraction method. The highest sensitivities for all the primers tested were determined using DNA extracted from whole blood samples, while the lowest sensitivities were obtained when DNA was extracted from filter paper preparations. To conclude, the obtained results are discussed and a protocol for diagnosis and surveillance for T. vivax trypanosomosis is recommended.

CODEHOP (COnsensus-DEgenerate Hybrid Oligonucleotide Primer) PCR primer design

PubMed Central

Rose, Timothy M.; Henikoff, Jorja G.; Henikoff, Steven

2003-01-01

We have developed a new primer design strategy for PCR amplification of distantly related gene sequences based on consensus-degenerate hybrid oligonucleotide primers (CODEHOPs). An interactive program has been written to design CODEHOP PCR primers from conserved blocks of amino acids within multiply-aligned protein sequences. Each CODEHOP consists of a pool of related primers containing all possible nucleotide sequences encoding 3–4 highly conserved amino acids within a 3′ degenerate core. A longer 5′ non-degenerate clamp region contains the most probable nucleotide predicted for each flanking codon. CODEHOPs are used in PCR amplification to isolate distantly related sequences encoding the conserved amino acid sequence. The primer design software and the CODEHOP PCR strategy have been utilized for the identification and characterization of new gene orthologs and paralogs in different plant, animal and bacterial species. In addition, this approach has been successful in identifying new pathogen species. The CODEHOP designer (http://blocks.fhcrc.org/codehop.html) is linked to BlockMaker and the Multiple Alignment Processor within the Blocks Database World Wide Web (http://blocks.fhcrc.org). PMID:12824413

UniPrime2: a web service providing easier Universal Primer design.

PubMed

Boutros, Robin; Stokes, Nicola; Bekaert, Michaël; Teeling, Emma C

2009-07-01

The UniPrime2 web server is a publicly available online resource which automatically designs large sets of universal primers when given a gene reference ID or Fasta sequence input by a user. UniPrime2 works by automatically retrieving and aligning homologous sequences from GenBank, identifying regions of conservation within the alignment, and generating suitable primers that can be used to amplify variable genomic regions. In essence, UniPrime2 is a suite of publicly available software packages (Blastn, T-Coffee, GramAlign, Primer3), which reduces the laborious process of primer design, by integrating these programs into a single software pipeline. Hence, UniPrime2 differs from previous primer design web services in that all steps are automated, linked, saved and phylogenetically delimited, only requiring a single user-defined gene reference ID or input sequence. We provide an overview of the web service and wet-laboratory validation of the primers generated. The system is freely accessible at: http://uniprime.batlab.eu. UniPrime2 is licenced under a Creative Commons Attribution Noncommercial-Share Alike 3.0 Licence.

Primer synthesis by a eukaryotic-like archaeal primase is independent of its Fe-S cluster.

PubMed

Holzer, Sandro; Yan, Jiangyu; Kilkenny, Mairi L; Bell, Stephen D; Pellegrini, Luca

2017-11-23

DNA replication depends on primase, the specialised polymerase responsible for synthesis of the RNA primers that are elongated by the replicative DNA polymerases. In eukaryotic and archaeal replication, primase is a heterodimer of two subunits, PriS and PriL. Recently, a third primase subunit named PriX was identified in the archaeon Sulfolobus solfataricus. PriX is essential for primer synthesis and is structurally related to the Fe-S cluster domain of eukaryotic PriL. Here we show that PriX contains a nucleotide-binding site required for primer synthesis, and demonstrate equivalence of nucleotide-binding residues in PriX with eukaryotic PriL residues that are known to be important for primer synthesis. A primase chimera, where PriX is fused to a truncated version of PriL lacking the Fe-S cluster domain retains wild-type levels of primer synthesis. Our evidence shows that PriX has replaced PriL as the subunit that endows primase with the unique ability to initiate nucleic acid synthesis. Importantly, our findings reveal that the Fe-S cluster is not required for primer synthesis.

25th anniversary article: key points for high-mobility organic field-effect transistors.

PubMed

Dong, Huanli; Fu, Xiaolong; Liu, Jie; Wang, Zongrui; Hu, Wenping

2013-11-20

Remarkable progress has been made in developing high performance organic field-effect transistors (OFETs) and the mobility of OFETs has been approaching the values of polycrystalline silicon, meeting the requirements of various electronic applications from electronic papers to integrated circuits. In this review, the key points for development of high mobility OFETs are highlighted from aspects of molecular engineering, process engineering and interface engineering. The importance of other factors, such as impurities and testing conditions is also addressed. Finally, the current challenges in this field for practical applications of OFETs are further discussed. © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

SINEs of progress: Mobile element applications to molecular ecology.

PubMed

Ray, David A

2007-01-01

Mobile elements represent a unique and under-utilized set of tools for molecular ecologists. They are essentially homoplasy-free characters with the ability to be genotyped in a simple and efficient manner. Interpretation of the data generated using mobile elements can be simple compared to other genetic markers. They exist in a wide variety of taxa and are useful over a wide selection of temporal ranges within those taxa. Furthermore, their mode of evolution instills them with another advantage over other types of multilocus genotype data: the ability to determine loci applicable to a range of time spans in the history of a taxon. In this review, I discuss the application of mobile element markers, especially short interspersed elements (SINEs), to phylogenetic and population data, with an emphasis on potential applications to molecular ecology.

Ultrahigh-mobility graphene devices from chemical vapor deposition on reusable copper

PubMed Central

Banszerus, Luca; Schmitz, Michael; Engels, Stephan; Dauber, Jan; Oellers, Martin; Haupt, Federica; Watanabe, Kenji; Taniguchi, Takashi; Beschoten, Bernd; Stampfer, Christoph

2015-01-01

Graphene research has prospered impressively in the past few years, and promising applications such as high-frequency transistors, magnetic field sensors, and flexible optoelectronics are just waiting for a scalable and cost-efficient fabrication technology to produce high-mobility graphene. Although significant progress has been made in chemical vapor deposition (CVD) and epitaxial growth of graphene, the carrier mobility obtained with these techniques is still significantly lower than what is achieved using exfoliated graphene. We show that the quality of CVD-grown graphene depends critically on the used transfer process, and we report on an advanced transfer technique that allows both reusing the copper substrate of the CVD growth and making devices with mobilities as high as 350,000 cm2 V–1 s–1, thus rivaling exfoliated graphene. PMID:26601221

White primer permits a corrosion-resistant coating of minimum weight

NASA Technical Reports Server (NTRS)

Albrecht, R. H.; Jensen, D. P.; Schnake, P.

1966-01-01

White primer for coating 2219 aluminum alloy supplies a base for a top coating of enamel. A formulation of pigments and vehicle results in a primer with high corrosion resistance and minimum film thickness.

Economics : pricing, demand, and economic efficiency : a primer.

DOT National Transportation Integrated Search

2008-11-01

The Congestion Pricing Primer Series is part of : FHWAs outreach efforts to introduce the various : aspects of congestion pricing to decision-makers and : transportation professionals in the United States. The : primers are intended to lay out the...

Failure to detect genomic material of HTLV-I or HTLV-II in mononuclear cells of Italian patients with multiple sclerosis and chronic progressive myelopathy.

PubMed

Merelli, E; Sola, P; Marasca, R; Salati, R; Torelli, G

1993-01-01

To contribute to the undecided question if a retrovirus of the human T-cell lymphotropic virus (HTLV) family may be involved in the development of multiple sclerosis (MS), we investigated by the polymerase chain reaction (PCR) the presence of HTLV-I and HTLV-II sequences in the peripheral blood mononuclear cell DNAs from 30 patients affected by MS and 15 by chronic progressive myelopathy. Moreover a control group of 14 blood donors was examined. All these patients were devoid of anti-HTLV-I antibody in the serum and cerebrospinal fluid at ELISA. For the PCR, primers and probes specific for the tax region common to HTLV-I and HTLV-II, for the pol region of HTLV-I, and for the pol region of HTLV-II were used. In spite of the high sensitivity of the technique used, the three groups of subjects were negative for HTLV-I and HTLV-II genomic sequences.

Species specific identification of spore-producing microbes using the gene sequence of small acid-soluble spore coat proteins for amplification based diagnostics

DOEpatents

McKinney, Nancy

2002-01-01

PCR (polymerase chain reaction) primers for the detection of certain Bacillus species, such as Bacillus anthracis. The primers specifically amplify only DNA found in the target species and can distinguish closely related species. Species-specific PCR primers for Bacillus anthracis, Bacillus globigii and Clostridium perfringens are disclosed. The primers are directed to unique sequences within sasp (small acid soluble protein) genes.

Uncoupling primer and releaser responses to pheromone in honey bees

NASA Astrophysics Data System (ADS)

Grozinger, Christina M.; Fischer, Patrick; Hampton, Jacob E.

2007-05-01

Pheromones produce dramatic behavioral and physiological responses in a wide variety of species. Releaser pheromones elicit rapid responses within seconds or minutes, while primer pheromones produce long-term changes which may take days to manifest. Honeybee queen mandibular pheromone (QMP) elicits multiple distinct behavioral and physiological responses in worker bees, as both a releaser and primer, and thus produces responses on vastly different time scales. In this study, we demonstrate that releaser and primer responses to QMP can be uncoupled. First, treatment with the juvenile hormone analog methoprene leaves a releaser response (attraction to QMP) intact, but modulates QMP’s primer effects on sucrose responsiveness. Secondly, two components of QMP (9-ODA and 9-HDA) do not elicit a releaser response (attraction) but are as effective as QMP at modulating a primer response, downregulation of foraging-related brain gene expression. These results suggest that different responses to a single pheromone may be produced via distinct pathways.

Strategies to Improve Efficiency and Specificity of Degenerate Primers in PCR.

PubMed

Campos, Maria Jorge; Quesada, Alberto

2017-01-01

PCR with degenerate primers can be used to identify the coding sequence of an unknown protein or to detect a genetic variant within a gene family. These primers, which are complex mixtures of slightly different oligonucleotide sequences, can be optimized to increase the efficiency and/or specificity of PCR in the amplification of a sequence of interest by the introduction of mismatches with the target sequence and balancing their position toward the primers 5'- or 3'-ends. In this work, we explain in detail examples of rational design of primers in two different applications, including the use of specific determinants at the 3'-end, to: (1) improve PCR efficiency with coding sequences for members of a protein family by fully degeneration at a core box of conserved genetic information, with the reduction of degeneration at the 5'-end, and (2) optimize specificity of allelic discrimination of closely related orthologous by 5'-end degenerate primers.

Comparative study on the use of specific and heterologous microsatellite primers in the stingless bees Melipona rufiventris and M. mondury (Hymenoptera, Apidae)

PubMed Central

2010-01-01

Due to their high degree of polymorphism, microsatellites are considered useful tools for studying population genetics. Nevertheless, studies of genetic diversity in stingless bees by means of these primers have revealed a low level of polymorphism, possibly the consequence of the heterologous primers used, since in most cases these were not specifically designed for the species under consideration. Herein we compared the number of polymorphic loci and alleles per locus, as well as observed heterozygosity in Melipona rufiventris and M. mondury populations, using specific and heterologous primers. The use of specific primers placed in evidence the greater frequency of polymorphic loci and alleles per locus, besides an expressive increase in observed heterozygosity in M. rufiventris and M. mondury, thereby reinforcing the idea that populational studies should be undertaken by preferably using species-specific microsatellite primers. PMID:21637499

Comparative study on the use of specific and heterologous microsatellite primers in the stingless bees Melipona rufiventris and M. mondury (Hymenoptera, Apidae).

PubMed

Lopes, Denilce Meneses; de Oliveira Campos, Lúcio Antônio; Salomão, Tânia Maria Fernandes; Tavares, Mara Garcia

2010-04-01

Due to their high degree of polymorphism, microsatellites are considered useful tools for studying population genetics. Nevertheless, studies of genetic diversity in stingless bees by means of these primers have revealed a low level of polymorphism, possibly the consequence of the heterologous primers used, since in most cases these were not specifically designed for the species under consideration. Herein we compared the number of polymorphic loci and alleles per locus, as well as observed heterozygosity in Melipona rufiventris and M. mondury populations, using specific and heterologous primers. The use of specific primers placed in evidence the greater frequency of polymorphic loci and alleles per locus, besides an expressive increase in observed heterozygosity in M. rufiventris and M. mondury, thereby reinforcing the idea that populational studies should be undertaken by preferably using species-specific microsatellite primers.

Molecular method for determining sex of walruses

USGS Publications Warehouse

Fischbach, Anthony S.; Jay, C.V.; Jackson, J.V.; Andersen, L.W.; Sage, G.K.; Talbot, S.L.

2008-01-01

We evaluated the ability of a set of published trans-species molecular sexing primers and a set of walrus-specific primers, which we developed, to accurately identify sex of 235 Pacific walruses (Odobenus rosmarus divergens). The trans-species primers were developed for mammals and targeted the X- and Y-gametologs of the zinc finger protein genes (ZFX, ZFY). We extended this method by using these primers to obtain sequence from Pacific and Atlantic walrus (0. r. rosmarus) ZFX and ZFY genes to develop new walrus-specific primers, which yield polymerase chain reaction products of distinct lengths (327 and 288 base pairs from the X- and Y-chromosome, respectively), allowing them to be used for sex determination. Both methods yielded a determination of sex in all but 1-2% of samples with an accuracy of 99.6-100%. Our walrus-specific primers offer the advantage of small fragment size and facile application to automated electrophoresis and visualization.

Oligonucleotides complementary to a promoter over the region -8...+2 as transcription primers for E. coli RNA polymerase.

PubMed Central

Grachev, M A; Zaychikov, E F; Ivanova, E M; Komarova, N I; Kutyavin, I V; Sidelnikova, N P; Frolova, I P

1984-01-01

Primer-dependent transcription by E. coli RNA polymerase on T7 promoter A2 has been studied. Synthetic deoxyribonucleotides complementary to the promoter over the region -8...+2 were taken as primers. A ribonucleoside residue was present at the 3'-end of some of these oligonucleotides. The octanucleotide complementary to the region -8...-1 appeared to be an active primer. Oligonucleotides having lengths from 3 to 6 nucleotide residues complementary to the promoter over the region -4...+2 also exhibited primer activity. The latter was some 5-10 times greater in the case of oligonucleotides having a ribonucleoside residue at the 3'-end. Oligonucleotides which on complementary binding do not reach the center of phosphodiester bond synthesis, as well as the decanucleotides (-8...+2) and octanucleotides (-6...+2) of both the ribo- and deoxyribo-series were inactive as primers. Images PMID:6390344

Genotyping of K-ras codons 12 and 13 mutations in colorectal cancer by capillary electrophoresis.

PubMed

Chen, Yen-Ling; Chang, Ya-Sian; Chang, Jan-Gowth; Wu, Shou-Mei

2009-06-26

Point mutations of the K-ras gene located in codons 12 and 13 cause poor responses to the anti-epidermal growth factor receptor (anti-EGFR) therapy of colorectal cancer (CRC) patients. Besides, mutations of K-ras gene have also been proven to play an important role in human tumor progression. We established a simple and effective capillary electrophoresis (CE) method for simultaneous point mutation detection in codons 12 and 13 of K-ras gene. We combined one universal fluorescence-based nonhuman-sequence primer and two fragment-oriented primers in one tube, and performed this two-in-one polymerase chain reaction (PCR). PCR fragments included wild type and seven point mutations at codons 12 and 13 of K-ras gene. The amplicons were analyzed by single-strand conformation polymorphism (SSCP)-CE method. The CE analysis was performed by using a 1x Tris-borate-EDTA (TBE) buffer containing 1.5% (w/v) hydroxyethylcellulose (HEC) (MW 250,000) under reverse polarity with 15 degrees C and 30 degrees C. Ninety colorectal cancer patients were blindly genotyped using this developed method. The results showed good agreement with those of DNA sequencing method. The SSCP-CE was feasible for mutation screening of K-ras gene in populations.

The prevalence and usage of mobile health applications among mental health patients in Saudi Arabia.

PubMed

Atallah, Nora; Khalifa, Mohamed; El Metwally, Ashraf; Househ, Mowafa

2018-03-01

Mobile health (mHealth) applications provide new methods of engagement with patients and can help patients manage their mental health condition. The main objective of this study is to explore the prevalence of the use of mobile health applications for mental health patients in Saudi Arabia. A total of 376 participants with depression and/or anxiety completed an online survey distributed by social networks which asked questions relating to mobile phone ownership, uses of health applications, and utilization patterns to track mental health related issues. Approximately, 46% of the participants reported running one or two healthcare related applications on their mobile phones. In all age groups, 64% of the participants used their mobile phones to access information related to their own health. Also, 64% of the participants expressed interest in using their own mobile phones to track and follow the progression of their depression and/or anxiety. Developing mobile health applications for Saudi mental health patients is needed since it can offer opportunities for patients, researchers, caregivers, and legislators to work together to improve the state of mental health care in Saudi Arabia. Copyright © 2017 Elsevier B.V. All rights reserved.

MIPE: A metagenome-based community structure explorer and SSU primer evaluation tool

PubMed Central

Zhou, Quan

2017-01-01

An understanding of microbial community structure is an important issue in the field of molecular ecology. The traditional molecular method involves amplification of small subunit ribosomal RNA (SSU rRNA) genes by polymerase chain reaction (PCR). However, PCR-based amplicon approaches are affected by primer bias and chimeras. With the development of high-throughput sequencing technology, unbiased SSU rRNA gene sequences can be mined from shotgun sequencing-based metagenomic or metatranscriptomic datasets to obtain a reflection of the microbial community structure in specific types of environment and to evaluate SSU primers. However, the use of short reads obtained through next-generation sequencing for primer evaluation has not been well resolved. The software MIPE (MIcrobiota metagenome Primer Explorer) was developed to adapt numerous short reads from metagenomes and metatranscriptomes. Using metagenomic or metatranscriptomic datasets as input, MIPE extracts and aligns rRNA to reveal detailed information on microbial composition and evaluate SSU rRNA primers. A mock dataset, a real Metagenomics Rapid Annotation using Subsystem Technology (MG-RAST) test dataset, two PrimerProspector test datasets and a real metatranscriptomic dataset were used to validate MIPE. The software calls Mothur (v1.33.3) and the SILVA database (v119) for the alignment and classification of rRNA genes from a metagenome or metatranscriptome. MIPE can effectively extract shotgun rRNA reads from a metagenome or metatranscriptome and is capable of classifying these sequences and exhibiting sensitivity to different SSU rRNA PCR primers. Therefore, MIPE can be used to guide primer design for specific environmental samples. PMID:28350876

Comparison of shear bond strength of orthodontic brackets using various zirconia primers.

PubMed

Lee, Ji-Yeon; Kim, Jin-Seok; Hwang, Chung-Ju

2015-07-01

The aim of this study was to compare the shear bond strength (SBS) of orthodontic brackets bonded to zirconia surfaces using three different zirconia primers and one silane primer, and subjected to thermocycling. We designed 10 experimental groups following the surface treatment and thermocycling. The surface was treated with one of the following method: no-primer (NP), Porcelain Conditioner (PC), Z-PRIME Plus (ZP), Monobond Plus (MP) and Zirconia Liner Premium (ZL) (n=20). Then each group was subdivided to non-thermocycled and thermocycled groups (NPT, PC, ZPT, MPT, ZLT) (n=10). Orthodontic brackets were bonded to the specimens using Transbond™ XT Paste and light cured for 15 s at 1,100 mW/cm(2). The SBS was measured at a 1 mm/min crosshead speed. The failure mode was assessed by examination with a stereomicroscope and the amount of bonding resin remaining on the zirconia surface was scored using the modified adhesive remnant index (ARI). The SBS of all experimental groups decreased after thermocycling. Before thermocycling, the SBS was ZL, ZP ≥ MP ≥ PC > NP but after thermocycling, the SBS was ZLT ≥ MPT ≥ ZPT > PCT = NPT (p > 0.05). For the ARI score, both of the groups lacking primer (NP and NPT) displayed adhesive failure modes, but the groups with zirconia primers (ZP, ZPT, MP, MPT, ZL, and ZLT) were associated with mixed failure modes. Surface treatment with a zirconia primer increases the SBS relative to no-primer or silane primer application between orthodontic brackets and zirconia prostheses.

The effects of lumbar extensor strength on disability and mobility in patients with persistent low back pain.

PubMed

Helmhout, Pieter H; Witjes, Marloes; Nijhuis-VAN DER Sanden, Ria W; Bron, Carel; van Aalst, Michiel; Staal, J Bart

2017-04-01

It is assumed that low back pain patients who use pain-avoiding immobilizing strategies may benefit from specific back flexion and extension exercises aimed at reducing sagittal lumbar hypomobility. The aim of this study was to test this potential working mechanism in chronic low back pain patients undergoing lumbar extensor strengthening training. A single-group prospective cohort design was used in this study. Patients with persistent low back complaints for at least 2 years were recruited at a specialized physical therapy clinics center. They participated in a progressive 11-week lumbar extensor strength training program, once a week. At baseline, sagittal lumbar mobility in flexion and extension was measured with a computer-assisted inclinometer. Self-rated pain intensity was measured using a visual analogue scale, back-specific functional status was assessed with the Quebec Back Pain Disability Scale and the Patient Specific Complains questionnaire. Statistically significant improvements were found in pain (28% decrease) and functional disability (23% to 36% decrease). Most progress was seen in the first 5 treatment weeks. Lumbar mobility in flexion showed non-significant increases over time (+12%). Pre-post treatment changes in flexion and extension mobility did not contribute significantly to the models. The retained factors together explained 15% to 48% of the variation in outcome. Specific lumbar strengthening showed clinically relevant improvements in pain and disability in patients with persistent chronic low back pain. These improvements did not necessarily relate to improvements in lumbar mobility. Parameters representing other domains of adaptations to exercise may be needed to evaluate the effects of back pain management.

Low-copy nuclear primers and ycf1 primers in Cactaceae.

PubMed

Franck, Alan R; Cochrane, Bruce J; Garey, James R

2012-10-01

To increase the number of variable regions available for phylogenetic study in the Cactaceae, primers were developed for a portion of the plastid ycf1 gene and intron-spanning regions of two low-copy nuclear genes (isi1, nhx1). • Primers were tested on several families within Caryophyllales, focusing on the Cactaceae. Gel electrophoresis indicated positive amplification in most samples. Sequences of these three regions (isi1, nhx1, ycf1) from Harrisia exhibited variation similar to or greater than two plastid regions (atpB-rbcL intergenic spacer and rpl16 intron). • The isi, nhx, and ycf1 primers amplify phylogenetically useful information applicable to the Cactaceae and other families in the Caryophyllales.

Electro-Deposited Primer Development and Low-Polluting Primer Evaluation

DTIC Science & Technology

1989-08-01

in the use of spray-applied primers are nonuniform corrosion protection, poor control of primer thickness, and variable strength of the adhesive bond...AL=)r- U’) LA C) .LAV) . L" () - C:’. L L :0 3c’. ) %D r- LAIr - LA I r-.%D ’D( o oD𔃺t- LA Ln DLI m to r- 0 0l- I cn M - in C.0 CD I (n m~ : c) = I V

Design of a Percussion and Electric Primer Gun Firing Power Supply

DTIC Science & Technology

2014-07-01

solenoid failure. As new instrumentation techniques such as high-speed video and laser interferometry have been introduced into our gun testing...to drive a solenoid into a percussion primer or ignite the M52A3B1 electric primer. To reduce power requirements, it uses charged capacitor banks to...drive the solenoid or ignite the primer. This report details the design and construction of the power supplies. 15. SUBJECT TERMS power supply

ITS fungal barcoding primers versus 18S AMF-specific primers reveal similar AMF-based diversity patterns in roots and soils of three mountain vineyards.

PubMed

Berruti, Andrea; Desirò, Alessandro; Visentin, Stefano; Zecca, Odoardo; Bonfante, Paola

2017-10-01

ITS primers commonly used to describe soil fungi are flawed for AMF although it is unknown the extent to which they distort the interpretation of community patterns. Here, we focus on how the use of a specific ITS2 fungal barcoding primer pair biased for AMF changes the interpretation of AMF community patterns from three mountain vineyards compared to a novel AMF-specific approach on the 18S. We found that although discrepancies were present in the taxonomic composition of the two resulting datasets, the estimation of diversity patterns among AMF communities was similar and resulted in both primer systems being able to correctly assess the community-structuring effect of location, compartment (root vs. soil) and environment. Both methodologies made it possible to detect the same alpha-diversity trend among the locations under study but not between root and soil transects. We show that the ITS2 primer system for fungal barcoding provides a good estimate of both AMF community structure and relation to environmental variables. However, this primer system does not fit in with cross-compartment surveys (roots vs. soil) as it can underestimate AMF diversity in soil samples. When specifically focusing on AMF, the 18S primer system resulted in wide coverage and marginal non-target amplification. © 2017 Society for Applied Microbiology and John Wiley & Sons Ltd.

Generation of sequence signatures from DNA amplification fingerprints with mini-hairpin and microsatellite primers.

PubMed

Caetano-Anollés, G; Gresshoff, P M

1996-06-01

DNA amplification fingerprinting (DAF) with mini-hairpins harboring arbitrary "core" sequences at their 3' termini were used to fingerprint a variety of templates, including PCR products and whole genomes, to establish genetic relationships between plant tax at the interspecific and intraspecific level, and to identify closely related fungal isolates and plant accessions. No correlation was observed between the sequence of the arbitrary core, the stability of the mini-hairpin structure and DAF efficiency. Mini-hairpin primers with short arbitrary cores and primers complementary to simple sequence repeats present in microsatellites were also used to generate arbitrary signatures from amplification profiles (ASAP). The ASAP strategy is a dual-step amplification procedure that uses at least one primer in each fingerprinting stage. ASAP was able to reproducibly amplify DAF products (representing about 10-15 kb of sequence) following careful optimization of amplification parameters such as primer and template concentration. Avoidance of primer sequences partially complementary to DAF product termini was necessary in order to produce distinct fingerprints. This allowed the combinatorial use of oligomers in nucleic acid screening, with numerous ASAP fingerprinting reactions based on a limited number of primer sequences. Mini-hairpin primers and ASAP analysis significantly increased detection of polymorphic DNA, separating closely related bermudagrass (Cynodon) cultivars and detecting putatively linked markers in bulked segregant analysis of the soybean (Glycine max) supernodulation (nitrate-tolerant symbiosis) locus.

Aluminum Rich Epoxy Primer for Ground and Air Vehicles

DTIC Science & Technology

2017-03-01

UNCLASSIFIED DOCUMENT Aluminum Rich Epoxy Primer for Ground and Air Vehicles Monthly Technical Report for the Period: January 20, 2017...Objective: To further develop the Aluminum Rich Epoxy Primer systems for Air and Ground Vehicles while addressing the objective requirements

A primer on safety performance measures for the transportation planning process

DOT National Transportation Integrated Search

2009-09-01

This Primer is a tool to help State and local practitioners, transportation planners, and decision-makers identify, select, and use safety performance measures as a part of the transportation planning process. The Primer draws from current literature...

Primer on consumer marketing research : procedures, methods, and tools

DOT National Transportation Integrated Search

1994-03-01

The Volpe Center developed a marketing research primer which provides a guide to the approach, procedures, and research tools used by private industry in predicting consumer response. The final two chapters of the primer focus on the challenges of do...

Antibacterial Effect and Tensile Bond Strength of Self-etching Adhesive Resins with and without Methacryloyloxydodecylpyridinium Bromide: An in vitro Study.

PubMed

Krishnamurthy, Madhuram; Kumar, V Naveen; Leburu, Ashok; Dhanavel, Chakravarthy; Selvendran, Kasiswamy E; Praveen, Nehrudhas

2018-04-01

Aim: The aim of the present study was to compare the antibacterial activity of a self-etching primer containing antibacterial monomer methacryloyloxydodecylpyridinium bromide (MDPB) (Clearfil protect bond) with a conventional self-etching primer without MDPB (Clearfil SE bond) against Streptococcus mutans and the effect of incorporation of MDPB on the tensile bond strength of the experimental self-etching primer (Clearfil protect bond). Materials and methods: The antibacterial activity of the self-etching primers was assessed using agar disk diffusion method and the diameters of the zones of inhibition were measured and ranked. For tensile bond strength testing, 20 noncarious human molars were selected and randomly divided into two groups comprising 10 teeth in each group. Group I specimens were treated with Clearfil SE bond (without MDPB). Group II specimens were treated with Clearfil protect bond (with MDPB). Composite material was placed incrementally and cured for 40 seconds in all the specimens. Tensile bond strength was estimated using the Instron Universal testing machine at a crosshead speed of 1 mm/min. Results: The addition of MDPB into a self-etching primer exerts potential antibacterial effect against S. mutans. The tensile bond strength of MDPB containing self-etching primer was slightly lower than that of the conventional self-etching Clearfil protect bond primer, but the difference was not statistically significant. Conclusion: Thus, a self-etching primer containing MDPB will be a boon to adhesive dentistry as it has bactericidal property with adequate tensile bond strength. Clinical significance: The concept of prevention of extension in adhesive dentistry would result in micro/nanoleakage due to the presence of residual bacteria in the cavity. Self-etching primers with MDPB would improve the longevity of such restorations by providing adequate antibacterial activity without compromising the bond strength. Keywords: Antibacterial property, Methacryloyloxydodecy-lpyridinium bromide, Self-etching primers, Tensile bond strength.

Evaluation of new gyrB-based real-time PCR system for the detection of B. fragilis as an indicator of human-specific fecal contamination.

PubMed

Lee, Chang Soo; Lee, Jiyoung

2010-09-01

A rapid and specific gyrB-based real-time PCR system has been developed for detecting Bacteroides fragilis as a human-specific marker of fecal contamination. Its specificity and sensitivity was evaluated by comparison with other 16S rRNA gene-based primers using closely related Bacteroides and Prevotella. Many studies have used 16S rRNA gene-based method targeting Bacteroides because this genus is relatively abundant in human feces and is useful for microbial source tracking. However, 16S rRNA gene-based primers are evolutionarily too conserved among taxa to discriminate between human-specific species of Bacteroides and other closely related genera, such as Prevotella. Recently, one of the housekeeping genes, gyrB, has been used as an alternative target in multilocus sequence analysis (MLSA) to provide greater phylogenetic resolution. In this study, a new B. fragilis-specific primer set (Bf904F/Bf958R) was designed by alignments of 322 gyrB genes and was compared with the performance of the 16S rRNA gene-based primers in the presence of B. fragilis, Bacteroides ovatus and Prevotella melaninogenica. Amplicons were sequenced and a phylogenetic tree was constructed to confirm the specificity of the primers to B. fragilis. The gyrB-based primers successfully discriminated B. fragilis from B. ovatus and P. melaninogenica. Real-time PCR results showed that the gyrB primer set had a comparable sensitivity in the detection of B. fragilis when compared with the 16S rRNA primer set. The host-specificity of our gyrB-based primer set was validated with human, pig, cow, and dog fecal samples. The gyrB primer system had superior human-specificity. The gyrB-based system can rapidly detect human-specific fecal source and can be used for improved source tracking of human contamination. (c) 2010 Elsevier B.V. All rights reserved.

PCR Primers for Metazoan Nuclear 18S and 28S Ribosomal DNA Sequences

PubMed Central

Machida, Ryuji J.; Knowlton, Nancy

2012-01-01

Background Metagenetic analyses, which amplify and sequence target marker DNA regions from environmental samples, are increasingly employed to assess the biodiversity of communities of small organisms. Using this approach, our understanding of microbial diversity has expanded greatly. In contrast, only a few studies using this approach to characterize metazoan diversity have been reported, despite the fact that many metazoan species are small and difficult to identify or are undescribed. One of the reasons for this discrepancy is the availability of universal primers for the target taxa. In microbial studies, analysis of the 16S ribosomal DNA is standard. In contrast, the best gene for metazoan metagenetics is less clear. In the present study, we have designed primers that amplify the nuclear 18S and 28S ribosomal DNA sequences of most metazoan species with the goal of providing effective approaches for metagenetic analyses of metazoan diversity in environmental samples, with a particular emphasis on marine biodiversity. Methodology/Principal Findings Conserved regions suitable for designing PCR primers were identified using 14,503 and 1,072 metazoan sequences of the nuclear 18S and 28S rDNA regions, respectively. The sequence similarity of both these newly designed and the previously reported primers to the target regions of these primers were compared for each phylum to determine the expected amplification efficacy. The nucleotide diversity of the flanking regions of the primers was also estimated for genera or higher taxonomic groups of 11 phyla to determine the variable regions within the genes. Conclusions/Significance The identified nuclear ribosomal DNA primers (five primer pairs for 18S and eleven for 28S) and the results of the nucleotide diversity analyses provide options for primer combinations for metazoan metagenetic analyses. Additionally, advantages and disadvantages of not only the 18S and 28S ribosomal DNA, but also other marker regions as targets for metazoan metagenetic analyses, are discussed. PMID:23049971

Primer design for a prokaryotic differential display RT-PCR.

PubMed Central

Fislage, R; Berceanu, M; Humboldt, Y; Wendt, M; Oberender, H

1997-01-01

We have developed a primer set for a prokaryotic differential display of mRNA in the Enterobacteriaceae group. Each combination of ten 10mer and ten 11mer primers generates up to 85 bands from total Escherichia coli RNA, thus covering expressed sequences of a complete bacterial genome. Due to the lack of polyadenylation in prokaryotic RNA the type T11VN anchored oligonucleotides for the reverse transcriptase reaction had to be replaced with respect to the original method described by Liang and Pardee [ Science , 257, 967-971 (1992)]. Therefore, the sequences of both the 10mer and the new 11mer oligonucleotides were determined by a statistical evaluation of species-specific coding regions extracted from the EMBL database. The 11mer primers used for reverse transcription were selected for localization in the 3'-region of the bacterial RNA. The 10mer primers preferentially bind to the 5'-end of the RNA. None of the primers show homology to rRNA or other abundant small RNA species. Randomly sampled cDNA bands were checked for their bacterial origin either by re-amplification, cloning and sequencing or by re-amplification and direct sequencing with 10mer and 11mer primers after asymmetric PCR. PMID:9108168

Primer design for a prokaryotic differential display RT-PCR.

PubMed

Fislage, R; Berceanu, M; Humboldt, Y; Wendt, M; Oberender, H

1997-05-01

We have developed a primer set for a prokaryotic differential display of mRNA in the Enterobacteriaceae group. Each combination of ten 10mer and ten 11mer primers generates up to 85 bands from total Escherichia coli RNA, thus covering expressed sequences of a complete bacterial genome. Due to the lack of polyadenylation in prokaryotic RNA the type T11VN anchored oligonucleotides for the reverse transcriptase reaction had to be replaced with respect to the original method described by Liang and Pardee [ Science , 257, 967-971 (1992)]. Therefore, the sequences of both the 10mer and the new 11mer oligonucleotides were determined by a statistical evaluation of species-specific coding regions extracted from the EMBL database. The 11mer primers used for reverse transcription were selected for localization in the 3'-region of the bacterial RNA. The 10mer primers preferentially bind to the 5'-end of the RNA. None of the primers show homology to rRNA or other abundant small RNA species. Randomly sampled cDNA bands were checked for their bacterial origin either by re-amplification, cloning and sequencing or by re-amplification and direct sequencing with 10mer and 11mer primers after asymmetric PCR.

Primer and platform effects on 16S rRNA tag sequencing

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tremblay, Julien; Singh, Kanwar; Fern, Alison

Sequencing of 16S rRNA gene tags is a popular method for profiling and comparing microbial communities. The protocols and methods used, however, vary considerably with regard to amplification primers, sequencing primers, sequencing technologies; as well as quality filtering and clustering. How results are affected by these choices, and whether data produced with different protocols can be meaningfully compared, is often unknown. Here we compare results obtained using three different amplification primer sets (targeting V4, V6–V8, and V7–V8) and two sequencing technologies (454 pyrosequencing and Illumina MiSeq) using DNA from a mock community containing a known number of species as wellmore » as complex environmental samples whose PCR-independent profiles were estimated using shotgun sequencing. We find that paired-end MiSeq reads produce higher quality data and enabled the use of more aggressive quality control parameters over 454, resulting in a higher retention rate of high quality reads for downstream data analysis. While primer choice considerably influences quantitative abundance estimations, sequencing platform has relatively minor effects when matched primers are used. In conclusion, beta diversity metrics are surprisingly robust to both primer and sequencing platform biases.« less

Primer and platform effects on 16S rRNA tag sequencing

DOE PAGES

Tremblay, Julien; Singh, Kanwar; Fern, Alison; ...

2015-08-04

Sequencing of 16S rRNA gene tags is a popular method for profiling and comparing microbial communities. The protocols and methods used, however, vary considerably with regard to amplification primers, sequencing primers, sequencing technologies; as well as quality filtering and clustering. How results are affected by these choices, and whether data produced with different protocols can be meaningfully compared, is often unknown. Here we compare results obtained using three different amplification primer sets (targeting V4, V6–V8, and V7–V8) and two sequencing technologies (454 pyrosequencing and Illumina MiSeq) using DNA from a mock community containing a known number of species as wellmore » as complex environmental samples whose PCR-independent profiles were estimated using shotgun sequencing. We find that paired-end MiSeq reads produce higher quality data and enabled the use of more aggressive quality control parameters over 454, resulting in a higher retention rate of high quality reads for downstream data analysis. While primer choice considerably influences quantitative abundance estimations, sequencing platform has relatively minor effects when matched primers are used. In conclusion, beta diversity metrics are surprisingly robust to both primer and sequencing platform biases.« less

Validation of a PCR-based method for the detection of various rendered materials in feedstuffs using a forensic DNA extraction kit.

PubMed

Myers, Michael J; Yancy, Haile F; Araneta, Michael; Armour, Jennifer; Derr, Janice; Hoostelaere, Lawrence A D; Farmer, Doris; Jackson, Falana; Kiessling, William M; Koch, Henry; Lin, Huahua; Liu, Yan; Mowlds, Gabrielle; Pinero, David; Riter, Ken L; Sedwick, John; Shen, Yuelian; Wetherington, June; Younkins, Ronsha

2006-01-01

A method trial was initiated to validate the use of a commercial DNA forensic kit to extract DNA from animal feed as part of a PCR-based method. Four different PCR primer pairs (one bovine pair, one porcine pair, one ovine primer pair, and one multispecies pair) were also evaluated. Each laboratory was required to analyze a total of 120 dairy feed samples either not fortified (control, true negative) or fortified with bovine meat and bone meal, porcine meat and bone meal (PMBM), or lamb meal. Feeds were fortified with the animal meals at a concentration of 0.1% (wt/wt). Ten laboratories participated in this trial, and each laboratory was required to evaluate two different primer pairs, i.e., each PCR primer pair was evaluated by five different laboratories. The method was considered to be validated for a given animal source when three or more laboratories achieved at least 97% accuracy (29 correct of 30 samples for 96.7% accuracy, rounded up to 97%) in detecting the fortified samples for that source. Using this criterion, the method was validated for the bovine primer because three laboratories met the criterion, with an average accuracy of 98.9%. The average false-positive rate was 3.0% in these laboratories. A fourth laboratory was 80% accurate in identifying the samples fortified with bovine meat and bone meal. A fifth laboratory was not able to consistently extract the DNA from the feed samples and did not achieve the criterion for accuracy for either the bovine or multispecies PCR primers. For the porcine primers, the method was validated, with four laboratories meeting the criterion for accuracy with an average accuracy of 99.2%. The fifth laboratory had a 93.3% accuracy outcome for the porcine primer. Collectively, these five laboratories had a 1.3% false-positive rate for the porcine primer. No laboratory was able to meet the criterion for accuracy with the ovine primers, most likely because of problems with the synthesis of the primer pair; none of the positive control DNA samples could be detected with the ovine primers. The multispecies primer pair was validated in three laboratories for use with bovine meat and bone meal and lamb meal but not with PMBM. The three laboratories had an average accuracy of 98.9% for bovine meat and bone meal, 97.8% for lamb meal, and 63.3% for PMBM. When examined on an individual laboratory basis, one of these four laboratories could not identify a single feed sample containing PMBM by using the multispecies primer, whereas the other laboratory identified only one PMBM-fortified sample, suggesting that the limit of detection for PMBM with this primer pair is around 0.1% (wt/wt). The results of this study demonstrated that the DNA forensic kit can be used to extract DNA from animal feed, which can then be used for PCR analysis to detect animal-derived protein present in the feed sample.

Kinetic characterisation of primer mismatches in allele-specific PCR: a quantitative assessment.

PubMed

Waterfall, Christy M; Eisenthal, Robert; Cobb, Benjamin D

2002-12-20

A novel method of estimating the kinetic parameters of Taq DNA polymerase during rapid cycle PCR is presented. A model was constructed using a simplified sigmoid function to represent substrate accumulation during PCR in combination with the general equation describing high substrate inhibition for Michaelis-Menten enzymes. The PCR progress curve was viewed as a series of independent reactions where initial rates were accurately measured for each cycle. Kinetic parameters were obtained for allele-specific PCR (AS-PCR) amplification to examine the effect of mismatches on amplification. A high degree of correlation was obtained providing evidence of substrate inhibition as a major cause of the plateau phase that occurs in the later cycles of PCR.

Considerations for high occupancy vehicle (HOV) to high occupancy toll (HOT) lanes conversions primer.

DOT National Transportation Integrated Search

2007-09-01

This primer presents key issues and challenges related to the conversion of high occupancy vehicle (HOV) lanes to high occupancy toll (HOT) lanes. The primer is intended for community leaders, administrators, : the public, and other stakeholders resp...

Development of acceptance criteria for batches of silane primer for external tank thermal protection system bonding applications

NASA Technical Reports Server (NTRS)

Mikes, F.; Mowrey, C.; Reis, E.

1985-01-01

Results of lap shear tests of various silane primers are presented in graphs and tables. The OH-absorption of these primers (FTIR area values) are correlated with the lap shear tests of coated panels.

Comparison of Primer Sets for Use in Automated Ribosomal Intergenic Spacer Analysis of Aquatic Bacterial Communities: an Ecological Perspective▿

PubMed Central

Jones, Stuart E.; Shade, Ashley L.; McMahon, Katherine D.; Kent, Angela D.

2007-01-01

Two primer sets for automated ribosomal intergenic spacer analysis (ARISA) were used to assess the bacterial community composition (BCC) in Lake Mendota, Wisconsin, over 3 years. Correspondence analysis revealed differences in community profiles generated by different primer sets, but overall ecological patterns were conserved in each case. ARISA is a powerful tool for evaluating BCC change through space and time, regardless of the specific primer set used. PMID:17122397

A method for predicting service life of zinc rich primers on carbon steel

NASA Technical Reports Server (NTRS)

Hoppesch, C. W.

1986-01-01

The service life of zinc rich primers on carbon steel can be estimated by immersing a primer coated glass slide into an aqueous copper sulfate solution and measuring the amount of zinc that reacts with the copper in 15 minutes. This zinc availability test was used to evaluate eleven primers currently available for which marine beach exposure data was available from previous programs. Results were evaluated and a correlation between zinc availability and ASTM rust grade was shown.

The effect of zoledronate-containing primer on dentin bonding of a universal adhesive.

PubMed

Zenobi, Walter; Feitosa, Victor Pinheiro; Moura, Maria Elisa Martins; D'arcangelo, Camillo; Rodrigues, Lidiany Karla de Azevedo; Sauro, Salvatore

2018-01-01

To evaluate the bonding ability and nanoleakage of a universal adhesive applied to dentin pre-treated using a zoledronate-containing primer (zol-primer) before and after mechanical load cycling. Flat dentin surfaces obtained from human molars were assigned to one of the following adhesion procedures (n=6): 1-Single Bond Universal (SBU) applied in etch-and-rinse mode; 2- SBU applied as etch-and-rinse after the application of zol-primer; 3- SBU applied in self-etch strategy; 4- SBU applied as self-etch after the use of zol-primer. Half of the specimens were processed for microtensile bond strength test after 24h, while the other half part was submitted to 200,000 mechanical cycles. Further specimens were silver-impregnated and assessed for interface nanoleakage by SEM. Data were analyzed with two-way ANOVA and Tukey's test (p<0.05). At 24h evaluation, the four groups presented similar bond strengths, whilst both groups bonded with etch-and-rinse technique showed significant bond strength reduction after mechanical load (p<0.05), with the highest drop in bond strength for the specimens pre-treated with the zol-primer. No negative effects were found for self-etch strategy (p>0.05) in microtensile test. Lower nanoleakage expression was observed for etch-and-rinse specimens treated with zol-primer. However, noteworthy reduction of adhesive layer thickness was observed when combining the zol-primer with the self-etch bonding approach. It can be concluded that zol-primer should not be used along with a universal adhesive in etch-and-rinse mode, but its application before self-etch application may provide less degradation of the resin-dentin interface. Copyright © 2017 Elsevier Ltd. All rights reserved.

Development of a Prokaryotic Universal Primer for Simultaneous Analysis of Bacteria and Archaea Using Next-Generation Sequencing

PubMed Central

Takahashi, Shunsuke; Tomita, Junko; Nishioka, Kaori; Hisada, Takayoshi; Nishijima, Miyuki

2014-01-01

For the analysis of microbial community structure based on 16S rDNA sequence diversity, sensitive and robust PCR amplification of 16S rDNA is a critical step. To obtain accurate microbial composition data, PCR amplification must be free of bias; however, amplifying all 16S rDNA species with equal efficiency from a sample containing a large variety of microorganisms remains challenging. Here, we designed a universal primer based on the V3-V4 hypervariable region of prokaryotic 16S rDNA for the simultaneous detection of Bacteria and Archaea in fecal samples from crossbred pigs (Landrace×Large white×Duroc) using an Illumina MiSeq next-generation sequencer. In-silico analysis showed that the newly designed universal prokaryotic primers matched approximately 98.0% of Bacteria and 94.6% of Archaea rRNA gene sequences in the Ribosomal Database Project database. For each sequencing reaction performed with the prokaryotic universal primer, an average of 69,330 (±20,482) reads were obtained, of which archaeal rRNA genes comprised approximately 1.2% to 3.2% of all prokaryotic reads. In addition, the detection frequency of Bacteria belonging to the phylum Verrucomicrobia, including members of the classes Verrucomicrobiae and Opitutae, was higher in the NGS analysis using the prokaryotic universal primer than that performed with the bacterial universal primer. Importantly, this new prokaryotic universal primer set had markedly lower bias than that of most previously designed universal primers. Our findings demonstrate that the prokaryotic universal primer set designed in the present study will permit the simultaneous detection of Bacteria and Archaea, and will therefore allow for a more comprehensive understanding of microbial community structures in environmental samples. PMID:25144201

Simultaneous identification and DNA barcoding of six Eimeria species infecting turkeys using PCR primers targeting the mitochondrial cytochrome c oxidase subunit I (mtCOI) locus.

PubMed

Hafeez, Mian A; Shivaramaiah, Srichaitanya; Dorsey, Kristi Moore; Ogedengbe, Mosun E; El-Sherry, Shiem; Whale, Julia; Cobean, Julie; Barta, John R

2015-05-01

Species-specific PCR primers targeting the mitochondrial cytochrome c oxidase subunit I (mtCOI) locus were generated that allow for the specific identification of the most common Eimeria species infecting turkeys (i.e., Eimeria adenoeides, Eimeria meleagrimitis, Eimeria gallopavonis, Eimeria meleagridis, Eimeria dispersa, and Eimeria innocua). PCR reaction chemistries were optimized with respect to divalent cation (MgCl2) and dNTP concentrations, as well as PCR cycling conditions (particularly anneal temperature for primers). Genomic DNA samples from single oocyst-derived lines of six Eimeria species were tested to establish specificity and sensitivity of these newly designed primer pairs. A mixed 60-ng total DNA sample containing 10 ng of each of the six Eimeria species was used as DNA template to demonstrate specific amplification of the correct product using each of the species-specific primer pairs. Ten nanograms of each of the five non-target Eimeria species was pooled to provide a non-target, control DNA sample suitable to test the specificity of each primer pair. The amplifications of the COI region with species-specific primer pairs from pooled samples yielded products of expected sizes (209 to 1,012 bp) and no amplification of non-target Eimeria sp. DNA was detected using the non-target, control DNA samples. These primer pairs specific for Eimeria spp. of turkeys did not amplify any of the seven Eimeria species infecting chickens. The newly developed PCR primers can be used as a diagnostic tool capable of specifically identifying six turkey Eimeria species; additionally, sequencing of the PCR amplification products yields sequence-based genotyping data suitable for identification and molecular phylogenetics.

Microsatellite primers in the white proteas (Protea section Exsertae, Proteaceae), a rapidly radiating lineage.

PubMed

Prunier, Rachel; Latimer, Andrew

2010-01-01

Microsatellite primers were developed in the South African sclerophyllous shrub Protea punctata to investigate the degree of population differentiation within and between P. punctata and closely related species. • 10 primer pairs were identified from three individuals of Protea punctata. The primers amplified di- and tri-nucleotide repeats. Across all P. punctata samples, the loci have 8-49 alleles. All primers also amplified in Protea section Exsertae (P. aurea, P. aurea subsp. potbergensis, P. mundii, P. venusta, P. lacticolor, and P. subvestita). The loci had 14-69 alleles across the subgenus. • These results show the broad utility of microsatellite loci for future studies of population genetics in the white proteas and their potential utility across the entire genus.

The self primer of the long terminal repeat retrotransposon Tf1 is not removed during reverse transcription.

PubMed

Atwood-Moore, Angela; Yan, Kenneth; Judson, Robert L; Levin, Henry L

2006-08-01

The long terminal repeat retrotransposon Tf1 of Schizosaccharomyces pombe uses a unique mechanism of self priming to initiate reverse transcription. Instead of using a tRNA, Tf1 primes minus-strand synthesis with an 11-nucleotide RNA removed from the 5' end of its own transcript. We tested whether the self primer of Tf1 was similar to tRNA primers in being removed from the cDNA by RNase H. Our analysis of Tf1 cDNA extracted from virus-like particles revealed the surprising observation that the dominant species of cDNA retained the self primer. This suggests that integration of the cDNA relies on mechanisms other than reverse transcription to remove the primer.

Initialization of Formation Flying Using Primer Vector Theory

NASA Technical Reports Server (NTRS)

Mailhe, Laurie; Schiff, Conrad; Folta, David

2002-01-01

In this paper, we extend primer vector analysis to formation flying. Optimization of the classical rendezvous or free-time transfer problem between two orbits using primer vector theory has been extensively studied for one spacecraft. However, an increasing number of missions are now considering flying a set of spacecraft in close formation. Missions such as the Magnetospheric MultiScale (MMS) and Leonardo-BRDF (Bidirectional Reflectance Distribution Function) need to determine strategies to transfer each spacecraft from the common launch orbit to their respective operational orbit. In addition, all the spacecraft must synchronize their states so that they achieve the same desired formation geometry over each orbit. This periodicity requirement imposes constraints on the boundary conditions that can be used for the primer vector algorithm. In this work we explore the impact of the periodicity requirement in optimizing each spacecraft transfer trajectory using primer vector theory. We first present our adaptation of primer vector theory to formation flying. Using this method, we then compute the AV budget for each spacecraft subject to different formation endpoint constraints.

Java web tools for PCR, in silico PCR, and oligonucleotide assembly and analysis.

PubMed

Kalendar, Ruslan; Lee, David; Schulman, Alan H

2011-08-01

The polymerase chain reaction is fundamental to molecular biology and is the most important practical molecular technique for the research laboratory. We have developed and tested efficient tools for PCR primer and probe design, which also predict oligonucleotide properties based on experimental studies of PCR efficiency. The tools provide comprehensive facilities for designing primers for most PCR applications and their combinations, including standard, multiplex, long-distance, inverse, real-time, unique, group-specific, bisulphite modification assays, Overlap-Extension PCR Multi-Fragment Assembly, as well as a programme to design oligonucleotide sets for long sequence assembly by ligase chain reaction. The in silico PCR primer or probe search includes comprehensive analyses of individual primers and primer pairs. It calculates the melting temperature for standard and degenerate oligonucleotides including LNA and other modifications, provides analyses for a set of primers with prediction of oligonucleotide properties, dimer and G-quadruplex detection, linguistic complexity, and provides a dilution and resuspension calculator. Copyright © 2011 Elsevier Inc. All rights reserved.

Genus-specific PCR Primers Targeting Intracellular Parasite Euduboscquella (Dinoflagellata: Syndinea)

NASA Astrophysics Data System (ADS)

Jung, Jae-Ho; Choi, Jung Min; Kim, Young-Ok

2018-03-01

We designed a genus-specific primer pair targeting the intracellular parasite Euduboscquella. To increase target specificity and inhibit untargeted PCR, two nucleotides were added at the 3' end of the reverse primer, one being a complementary nucleotide to the Euduboscquella-specific SNP (single-nucleotide polymorphism) and the other a deliberately mismatched nucleotide. Target specificity of the primer set was verified experimentally using PCR of two Euduboscquella species (positive controls) and 15 related species (negative controls composed of ciliates, diatoms and dinoflagellates), and analytical comparison with SILVA SSU rRNA gene database (release 119) in silico. In addition, we applied the Euduboscquella-specific primer set to four environmental samples previously determined by cytological staining to be either positive or negative for Euduboscquella. As expected, only positive controls and environmental samples known to contain Euduboscquella were successfully amplified by the primer set. An inferred SSU rRNA gene phylogeny placed environmental samples containing aloricate ciliates infected by Euduboscquella in a cluster discrete from Euduboscquella groups a-d previously reported from loricate, tintinnid ciliates.

Multiplex primer prediction software for divergent targets

PubMed Central

Gardner, Shea N.; Hiddessen, Amy L.; Williams, Peter L.; Hara, Christine; Wagner, Mark C.; Colston, Bill W.

2009-01-01

We describe a Multiplex Primer Prediction (MPP) algorithm to build multiplex compatible primer sets to amplify all members of large, diverse and unalignable sets of target sequences. The MPP algorithm is scalable to larger target sets than other available software, and it does not require a multiple sequence alignment. We applied it to questions in viral detection, and demonstrated that there are no universally conserved priming sequences among viruses and that it could require an unfeasibly large number of primers (∼3700 18-mers or ∼2000 10-mers) to generate amplicons from all sequenced viruses. We then designed primer sets separately for each viral family, and for several diverse species such as foot-and-mouth disease virus (FMDV), hemagglutinin (HA) and neuraminidase (NA) segments of influenza A virus, Norwalk virus, and HIV-1. We empirically demonstrated the application of the software with a multiplex set of 16 short (10 nt) primers designed to amplify the Poxviridae family to produce a specific amplicon from vaccinia virus. PMID:19759213

Primer sets for cloning the human repertoire of T cell Receptor Variable regions.

PubMed

Boria, Ilenia; Cotella, Diego; Dianzani, Irma; Santoro, Claudio; Sblattero, Daniele

2008-08-29

Amplification and cloning of naïve T cell Receptor (TR) repertoires or antigen-specific TR is crucial to shape immune response and to develop immuno-based therapies. TR variable (V) regions are encoded by several genes that recombine during T cell development. The cloning of expressed genes as large diverse libraries from natural sources relies upon the availability of primers able to amplify as many V genes as possible. Here, we present a list of primers computationally designed on all functional TR V and J genes listed in the IMGT, the ImMunoGeneTics information system. The list consists of unambiguous or degenerate primers suitable to theoretically amplify and clone the entire TR repertoire. We show that it is possible to selectively amplify and clone expressed TR V genes in one single RT-PCR step and from as little as 1000 cells. This new primer set will facilitate the creation of more diverse TR libraries than has been possible using currently available primer sets.

Shear bond strengths of an indirect composite layering material to a tribochemically silica-coated zirconia framework material.

PubMed

Iwasaki, Taro; Komine, Futoshi; Fushiki, Ryosuke; Kubochi, Kei; Shinohara, Mitsuyo; Matsumura, Hideo

2016-01-01

This study evaluated shear bond strengths of a layering indirect composite material to a zirconia framework material treated with tribochemical silica coating. Zirconia disks were divided into two groups: ZR-PRE (airborne-particle abrasion) and ZR-PLU (tribochemical silica coating). Indirect composite was bonded to zirconia treated with one of the following primers: Clearfil Ceramic Primer (CCP), Clearfil Mega Bond Primer with Clearfil Porcelain Bond Activator (MGP+Act), ESPE-Sil (SIL), Estenia Opaque Primer, MR. Bond, Super-Bond PZ Primer Liquid A with Liquid B (PZA+PZB), and Super-Bond PZ Primer Liquid B (PZB), or no treatment. Shear bond testing was performed at 0 and 20,000 thermocycles. Post-thermocycling shear bond strengths of ZR-PLU were higher than those of ZR-PRE in CCP, MGP+Act, SIL, PZA+PZB, and PZB groups. Application of silane yielded better durable bond strengths of a layering indirect composite material to a tribochemically silica-coated zirconia framework material.

Clinical applicability of nursing outcomes in the evolution of orthopedic patients with Impaired Physical Mobility.

PubMed

da Silva, Marcos Barragan; Almeida, Miriam de Abreu; Panato, Bruna Paulsen; Siqueira, Ana Paula de Oliveira; da Silva, Mariana Palma; Reisderfer, Letícia

2015-01-01

to evaluate the clinical applicability of outcomes, according to the Nursing Outcomes Classification (NOC) in the evolution of orthopedic patients with Impaired Physical Mobility longitudinal study conducted in 2012 in a university hospital, with 21 patients undergoing Total Hip Arthroplasty, evaluated daily by pairs of trained data collectors. Data were collected using an instrument containing five Nursing Outcomes, 16 clinical indicators and a five point Likert scale, and statistically analyzed. The outcomes Body Positioning: self-initiated, Mobility, Knowledge: prescribed activity, and Fall Prevention Behavior presented significant increases in mean scores when comparing the first and final evaluations (p<0.001) and (p=0.035). the use of the NOC outcomes makes it possible to demonstrate the clinical progression of orthopedic patients with Impaired Physical Mobility, as well as its applicability in this context.

Do we need primer for orthodontic bonding? A randomized controlled trial.

PubMed

Nandhra, Sarabjit Singh; Littlewood, Simon J; Houghton, Nadine; Luther, Friedy; Prabhu, Jagadish; Munyombwe, Theresa; Wood, Simon R

2015-04-01

To evaluate the clinical performance of APC™II Victory Series™ (3M Unitek) brackets in direct orthodontic bonding with and without the use of primer. A single-operator, two-centre prospective, non-inferiority randomized controlled clinical trial. The Orthodontic departments at the Leeds Dental Institute and St Luke's Hospital, Bradford, UK. Ethical approval was granted by Leeds (East) Research Ethics Committee on 18th of December 2009 (Reference 09/H1306/102). The protocol was not published prior to trial commencement. Ninety-two patients requiring orthodontic treatment with fixed appliances were randomly allocated to the control (bonded with primer) or test groups (bonded without primer). Patients were randomly allocated to either the control or experimental group. This was performed by preparing opaque numbered sealed envelopes in advance using a random numbers table generated by a computer by an independent third party . Once the envelopes were opened, blinding of the operator and the patient was no longer possible due to the nature of the intervention. Patients were approached for inclusion in the trial if they qualified for NHS orthodontic treatment requiring fixed appliances and had no previous orthodontic treatment. Number of bracket failures, time to bond-up appliances, and the adhesive remnant index (ARI) when bracket failure occurred, over a 12-month period Failure rate with primer was 11.1 per cent and without primer was 15.8 per cent. Bonding without primer was shown statistically to be non-inferior to bonding with primer odds ratio 0.95-2.25 (P = 0.08). Mean difference in bond-up time per bracket was 0.068 minutes (4 seconds), which was not statistically significant (P = 0.402). There was a statistically significant difference in the Adhesive Remnant Index - ARI 0 with primer 49.4 per cent, no primer 76.5 per cent, (P < 0.0001). As the study was only performed by one operator, the results can therefore only be truly be applied to their practice. Also this study was powered to ascertain if there was no difference between the 2 groups up to 5%, however orthodontists may consider a change in the bracket failure rate of 2% to be clinically significant. When bonding with APC™II Victory Series™ brackets without primer was shown statistically to be non-inferior to bonding with primer (P =0.08). There was no significant difference in bond-up times. Bond failure was more likely to happen at the composite-enamel interface when bonded without a primer. No conflict of interest for all authors. No funding sources were used. Study was not registered on external databases. © The Author 2014. Published by Oxford University Press on behalf of the European Orthodontic Society. All rights reserved. For permissions, please email: journals.permissions@oup.com.

The Evolution of the Advanced Attack Helicopter

DTIC Science & Technology

1975-06-06

p. 18. C. V. Glines (LTC, USA), "De Bothezat’s Flying Octopus ," Airman, Vol VI, No. I (January, 1962), 43. 29Ross, p. 58. 20 in his own right, being...AIR MOBILE OPIRATIONS, A Report for the Blue Ribbon Defense Panel by COL Jay D. Vanderpool, USA, Ret. (February 1970), 29. F. IY 70A Observation...not produce significant quantitative progress. -Attack Helicopters The Key to Army Air Mobile Operations, A Report for the Blue Ribbon Defense Panel by

Multiple scales in metapopulations of public goods producers

NASA Astrophysics Data System (ADS)

Bauer, Marianne; Frey, Erwin

2018-04-01

Multiple scales in metapopulations can give rise to paradoxical behavior: in a conceptual model for a public goods game, the species associated with a fitness cost due to the public good production can be stabilized in the well-mixed limit due to the mere existence of these scales. The scales in this model involve a length scale corresponding to separate patches, coupled by mobility, and separate time scales for reproduction and interaction with a local environment. Contrary to the well-mixed high mobility limit, we find that for low mobilities, the interaction rate progressively stabilizes this species due to stochastic effects, and that the formation of spatial patterns is not crucial for this stabilization.

A graphics to scalable vector graphics adaptation framework for progressive remote line rendering on mobile devices

NASA Astrophysics Data System (ADS)

Le, Minh Tuan; Nguyen, Congdu; Yoon, Dae-Il; Jung, Eun Ku; Kim, Hae-Kwang

2007-12-01

In this paper, we introduce a graphics to Scalable Vector Graphics (SVG) adaptation framework with a mechanism of vector graphics transmission to overcome the shortcoming of real-time representation and interaction experiences of 3D graphics application running on mobile devices. We therefore develop an interactive 3D visualization system based on the proposed framework for rapidly representing a 3D scene on mobile devices without having to download it from the server. Our system scenario is composed of a client viewer and a graphic to SVG adaptation server. The client viewer offers the user to access to the same 3D contents with different devices according to consumer interactions.

Career mobility: equipping nurses for health care beyond the year 2000.

PubMed

Doswell, W M

1996-01-01

Nurses are faced with uncertain employment in today's rapidly changing work place. The key to survival in this environment is to provide innovative, cost-effective, yet outcome-oriented methods of patient care delivery. Professional nurses and nursing students should make career mobility their watchword. Career mobility defines a planned trajectory which is flexible, role-expandable, and capable of adjusting to the sudden changes in direction which arise as nurses progress through their professional career. Nursing students must carefully examine the educational program they chose, and, once graduated, should use an innovative approach to the health care job market, with emphasis on professional nursing careers outside the traditional employment roles.

Optimization of nested polymerase chain reaction assays for identification of Aeromonas salmonicida, Yersinia ruckeri and Flavobacterium psychrophilum

USGS Publications Warehouse

Taylor, P.W.; Winton, J.R.

2002-01-01

Nested polymerase chain reaction (PCR) assays were developed using first-round primers complementary to highly conserved regions within the bacterial 16S ribosomal RNA (rRNA) gene (universal eubacterial primers) and second-round primers specific for sequences within the 16S rRNA genes of Aeromonas salmonicida, Yersinia ruckeri, andFlavobacterium psychrophilum. Following optimization of the MgCl2 concentration and primer annealing temperature, PCR employing the universal eubacterial primers was used to amplify a 1,500-base-pair (bp) product visible in agarose gels stained with ethidium bromide. The calculated detection limit of this single-round assay was less than 1.4 × 104 colony-forming units (CFU) per reaction for all bacterial species tested. Single-round PCR using primer sets specific for A. salmonicida, Y. ruckeri, and F. psychrophilumamplified bands of 271, 575, and 1,100 bp, respectively, with detection limits of less than 1.4 × 104, 1.4 × 105, and 1.4 × 105 CFU per reaction. Using the universal eubacterial primers in the first round and the species-specific primer sets in the second round of nested PCR assays improved the detection ability by approximately four orders of magnitude to fewer than 14 CFU per sample for each of the three bacterial species. Such nested assays could be adapted to a wide variety of bacterial fish pathogens for which 16S sequences are available.

Innovations in bonding to zirconia-based materials. Part II: Focusing on chemical interactions.

PubMed

Aboushelib, Moustafa N; Mirmohamadi, Hesam; Matinlinna, Jukka P; Kukk, Edwin; Ounsi, Hani F; Salameh, Ziad

2009-08-01

The zirconia-resin bond strength was enhanced using novel engineered zirconia primers in combination with selective infiltration etching as a surface pre-treatment. The aim of this study was to evaluate the effect of artificial aging on the chemical stability of the established bond and to understand the activation mechanism of the used primers. Selective infiltration etched zirconia discs (Procera; NobelBiocare) were coated with one of four novel engineered zirconia primers containing reactive monomers and were bonded to resin-composite discs (Panavia F2.0). Fourier transform infrared spectroscopy (FT-IR) was carried out to examine the chemical activation of zirconia primers from mixing time and up to 60min. The bilayered specimens were cut into microbars (1mm(2) in cross-section area) and zirconia-resin microtensile bond strength (MTBS) was evaluated immediately and after 90 days of water storage at 37 degrees C. Scanning electron microscopy (SEM) was used to analyze the fracture surface. There was a significant drop in MTBS values after 90 days of water storage for all tested zirconia primers from ca. 28-41MPa to ca. 15-18MPa after completion of artificial aging. SEM revealed increase in percentage of interfacial failure after water storage. FTIR spectra suggested adequate activation of the experimental zirconia primers within 1h of mixing time. The novel engineered zirconia primers produced initially high bond strength values which were significantly reduced after water storage. Long-term bond stability requires developing more stable primers.

PD5: a general purpose library for primer design software.

PubMed

Riley, Michael C; Aubrey, Wayne; Young, Michael; Clare, Amanda

2013-01-01

Complex PCR applications for large genome-scale projects require fast, reliable and often highly sophisticated primer design software applications. Presently, such applications use pipelining methods to utilise many third party applications and this involves file parsing, interfacing and data conversion, which is slow and prone to error. A fully integrated suite of software tools for primer design would considerably improve the development time, the processing speed, and the reliability of bespoke primer design software applications. The PD5 software library is an open-source collection of classes and utilities, providing a complete collection of software building blocks for primer design and analysis. It is written in object-oriented C(++) with an emphasis on classes suitable for efficient and rapid development of bespoke primer design programs. The modular design of the software library simplifies the development of specific applications and also integration with existing third party software where necessary. We demonstrate several applications created using this software library that have already proved to be effective, but we view the project as a dynamic environment for building primer design software and it is open for future development by the bioinformatics community. Therefore, the PD5 software library is published under the terms of the GNU General Public License, which guarantee access to source-code and allow redistribution and modification. The PD5 software library is downloadable from Google Code and the accompanying Wiki includes instructions and examples: http://code.google.com/p/primer-design.

Shop primer as part of the corrosion protective coating for submerged steel structures

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bjordal, M.; Steinsmo, U.

In Norwegian workshops the standard pre-treatment procedures for steel structures intended for sub-sea use, normally include removal of shop primer by blast cleaning to Sa 2 1/2 before application of corrosion protective coatings. This is also stated in the Norwegian offshore standard NORSOK. Omitting this stage in fabrication will represent large reductions in both time consumption and costs, and reduce the volume of waste from the blast cleaning. This report presents results from investigations of how a shop primer will influence on the coating properties. The aim of the investigation was to test whether the systems are good enough ifmore » the shop primer is left on the surface. Two different zinc silicate shop primers have been included in the investigation. As protective coatings the authors have used three different epoxy mastic systems with Al pigments. In addition to panels with original shop primer, they have also tested shop primed panels pre-treated in various ways, such as heated, corroded and blast cleaned to various degrees before coating. The coatings have been tested in the ASTM-G8 121 test and in a long term test in sea water polarized with a Zn anode. They have found that coatings including the zinc silicate shop primer are more susceptible to cathodic disbonding than the coating applied directly on blast cleaned steel. It is however possible to meet the NORSOK criteria with a zinc silicate shop primer as first coat.« less

Active and reactive behaviour in human mobility: the influence of attraction points on pedestrians

NASA Astrophysics Data System (ADS)

Gutiérrez-Roig, M.; Sagarra, O.; Oltra, A.; Palmer, J. R. B.; Bartumeus, F.; Díaz-Guilera, A.; Perelló, J.

2016-07-01

Human mobility is becoming an accessible field of study, thanks to the progress and availability of tracking technologies as a common feature of smart phones. We describe an example of a scalable experiment exploiting these circumstances at a public, outdoor fair in Barcelona (Spain). Participants were tracked while wandering through an open space with activity stands attracting their attention. We develop a general modelling framework based on Langevin dynamics, which allows us to test the influence of two distinct types of ingredients on mobility: reactive or context-dependent factors, modelled by means of a force field generated by attraction points in a given spatial configuration and active or inherent factors, modelled from intrinsic movement patterns of the subjects. The additive and constructive framework model accounts for some observed features. Starting with the simplest model (purely random walkers) as a reference, we progressively introduce different ingredients such as persistence, memory and perceptual landscape, aiming to untangle active and reactive contributions and quantify their respective relevance. The proposed approach may help in anticipating the spatial distribution of citizens in alternative scenarios and in improving the design of public events based on a facts-based approach.

Active and reactive behaviour in human mobility: the influence of attraction points on pedestrians

PubMed Central

Sagarra, O.; Oltra, A.; Palmer, J. R. B.; Bartumeus, F.; Díaz-Guilera, A.; Perelló, J.

2016-01-01

Human mobility is becoming an accessible field of study, thanks to the progress and availability of tracking technologies as a common feature of smart phones. We describe an example of a scalable experiment exploiting these circumstances at a public, outdoor fair in Barcelona (Spain). Participants were tracked while wandering through an open space with activity stands attracting their attention. We develop a general modelling framework based on Langevin dynamics, which allows us to test the influence of two distinct types of ingredients on mobility: reactive or context-dependent factors, modelled by means of a force field generated by attraction points in a given spatial configuration and active or inherent factors, modelled from intrinsic movement patterns of the subjects. The additive and constructive framework model accounts for some observed features. Starting with the simplest model (purely random walkers) as a reference, we progressively introduce different ingredients such as persistence, memory and perceptual landscape, aiming to untangle active and reactive contributions and quantify their respective relevance. The proposed approach may help in anticipating the spatial distribution of citizens in alternative scenarios and in improving the design of public events based on a facts-based approach. PMID:27493774

40 CFR 63.3120 - What reports must I submit?

Code of Federal Regulations, 2013 CFR

2013-07-01

... deviation. (8) Deviations: separate electrodeposition primer bake oven capture and control limitations. If you used the separate electrodeposition primer bake oven capture and control limitations in § 63.3092... dates of each month during which there was a deviation from the separate electrodeposition primer bake...

40 CFR 63.3120 - What reports must I submit?

Code of Federal Regulations, 2012 CFR

2012-07-01

... deviation. (8) Deviations: separate electrodeposition primer bake oven capture and control limitations. If you used the separate electrodeposition primer bake oven capture and control limitations in § 63.3092... dates of each month during which there was a deviation from the separate electrodeposition primer bake...

40 CFR 63.3120 - What reports must I submit?

Code of Federal Regulations, 2011 CFR

2011-07-01

... deviation. (8) Deviations: separate electrodeposition primer bake oven capture and control limitations. If you used the separate electrodeposition primer bake oven capture and control limitations in § 63.3092... dates of each month during which there was a deviation from the separate electrodeposition primer bake...

40 CFR 63.3120 - What reports must I submit?

Code of Federal Regulations, 2014 CFR

2014-07-01

... deviation. (8) Deviations: separate electrodeposition primer bake oven capture and control limitations. If you used the separate electrodeposition primer bake oven capture and control limitations in § 63.3092... dates of each month during which there was a deviation from the separate electrodeposition primer bake...

40 CFR 63.3120 - What reports must I submit?

Code of Federal Regulations, 2010 CFR

2010-07-01

... deviation. (8) Deviations: separate electrodeposition primer bake oven capture and control limitations. If you used the separate electrodeposition primer bake oven capture and control limitations in § 63.3092... dates of each month during which there was a deviation from the separate electrodeposition primer bake...

Outcome of Unicompartmental Knee Arthroplasty: A Systematic Review of Comparative Studies between Fixed and Mobile Bearings Focusing on Complications

PubMed Central

Ko, Young-Bong; Gujarathi, Manan Ramesh

2015-01-01

The purpose of this systematic review is to collate results of studies comparing fixed and mobile bearing unicompartmental knee arthroplasty (UKA), focusing on complications and timing for reoperations. Out of 723 results derived from PubMed, EMBASE and Cochrane database search engines on bearings in arthroplasty, 10 studies comparing clinical results of fixed bearings to mobile bearings in UKA were found eligible for analysis. The reoperation rate was calculated using a novel method such as reoperations per hundred component years, and the causes of specific reoperations were investigated. The overall reoperation rate per hundred component years was similar between the mobile bearings (1.392) and fixed bearings (1.377); however, mobile bearings were more susceptible to reoperations in cases with aseptic loosening (0.393>0.255), progression of arthritis (0.428>0.357) and implant dislocation (0.286>0). The overall incidence of complications is similar for fixed and mobile bearing designs in UKA. The discussion on complications presented above may assist surgeons in their choice of bearing design. PMID:26389066

Terrain Perception for DEMO III

NASA Technical Reports Server (NTRS)

Manduchi, R.; Bellutta, P.; Matthies, L.; Owens, K.; Rankin, A.

2000-01-01

The Demo III program has as its primary focus the development of autonomous mobility for a small rugged cross country vehicle. In this paper we report recent progress on both stereo-based obstacle detection and terrain cover color-based classification.

Reconfigurable robots for all terrain exploration

NASA Technical Reports Server (NTRS)

Schenker, P. S.; Pirjanian, P.; Balaram, B.; Ali, K. S.; Trebi-Ollennu, A.; Huntsberger, T. L.; Aghazarian, H.; Kennedy, B. A.; Baumgartner, E. T.; Iagnemma, K.;

47 CFR 22.313 - Station identification.

Code of Federal Regulations, 2014 CFR

2014-10-01

... Telecommunication FEDERAL COMMUNICATIONS COMMISSION (CONTINUED) COMMON CARRIER SERVICES PUBLIC MOBILE SERVICES... delayed to avoid interrupting the continuity of any public communication in progress, provided that station identification is transmitted at the conclusion of that public communication. (c) Station...

47 CFR 22.313 - Station identification.

Code of Federal Regulations, 2012 CFR

2012-10-01

... Telecommunication FEDERAL COMMUNICATIONS COMMISSION (CONTINUED) COMMON CARRIER SERVICES PUBLIC MOBILE SERVICES... delayed to avoid interrupting the continuity of any public communication in progress, provided that station identification is transmitted at the conclusion of that public communication. (c) Station...

47 CFR 22.313 - Station identification.

Code of Federal Regulations, 2010 CFR

2010-10-01

... Telecommunication FEDERAL COMMUNICATIONS COMMISSION (CONTINUED) COMMON CARRIER SERVICES PUBLIC MOBILE SERVICES... delayed to avoid interrupting the continuity of any public communication in progress, provided that station identification is transmitted at the conclusion of that public communication. (c) Station...

47 CFR 22.313 - Station identification.

Code of Federal Regulations, 2013 CFR

2013-10-01

... Telecommunication FEDERAL COMMUNICATIONS COMMISSION (CONTINUED) COMMON CARRIER SERVICES PUBLIC MOBILE SERVICES... delayed to avoid interrupting the continuity of any public communication in progress, provided that station identification is transmitted at the conclusion of that public communication. (c) Station...

47 CFR 22.313 - Station identification.

Code of Federal Regulations, 2011 CFR

2011-10-01

... Telecommunication FEDERAL COMMUNICATIONS COMMISSION (CONTINUED) COMMON CARRIER SERVICES PUBLIC MOBILE SERVICES... delayed to avoid interrupting the continuity of any public communication in progress, provided that station identification is transmitted at the conclusion of that public communication. (c) Station...

Primer for identifying cold-water refuges to protect and restore thermal diversity in riverine landscapes

EPA Science Inventory

EPA recently released a primer that provides guidance to Region 10 Tribes, States, and local watershed community groups to support the identification, protection, and restoration of critical cold water refuges for the protection of salmonids. This primer will assist these entiti...

A Primer on Sampling for Statewide Assessment.

ERIC Educational Resources Information Center

Jaeger, Richard M.

This paper is a primer on sampling procedures for statewide assessment. The careful reader should gain substantial knowledge about the promises and pitfalls of sampling for assessment. The primer has three basic objectives: (1) to define terms and concepts basic to sampling theory and its application, including population, sampling unit, sampling…

GSP: A web-based platform for designing genome-specific primers in polyploids

USDA-ARS?s Scientific Manuscript database

The sequences among subgenomes in a polyploid species have high similarity. This makes difficult to design genome-specific primers for sequence analysis. We present a web-based platform named GSP for designing genome-specific primers to distinguish subgenome sequences in the polyploid genome backgr...

30 CFR 57.6304 - Primer protection.

Code of Federal Regulations, 2010 CFR

2010-07-01

... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Primer protection. 57.6304 Section 57.6304 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR METAL AND NONMETAL MINE... Transportation-Surface and Underground § 57.6304 Primer protection. (a) Tamping shall not be done directly on a...

PCR Amplicon Prediction from Multiplex Degenerate Primer and Probe Sets

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gardner, S. N.

2013-08-08

Assessing primer specificity and predicting both desired and off-target amplification products is an essential step for robust PCR assay design. Code is described to predict potential polymerase chain reaction (PCR) amplicons in a large sequence database such as NCBI nt from either singleplex or a large multiplexed set of primers, allowing degenerate primer and probe bases, with target mismatch annotates amplicons with gene information automatically downloaded from NCBI, and optionally it can predict whether there are also TaqMan/Luminex probe matches within predicted amplicons.

Development of acceptance criteria for batches of silane primer for external tank thermal protection system bonding applications

NASA Technical Reports Server (NTRS)

Mikes, F.

1985-01-01

Fourier transform infrared spectroscopy is currently the best technique for observing hydrolytic changes in DC 1200 silane the primers caused by moisture in the atmosphere. To further prove that FTIR can be used as a criterion test for acceptance of silane primer lots, intensities of the FTIR OH- band are being compared with primer adhesive bond strength using a mechanical test suggested by NASA. Results of tests for shear strength and Oh-absorption are tabulated and compared with FTIR absorption intensities in the OH-region.

Specific Primers for Rapid Detection of Microsporum audouinii by PCR in Clinical Samples▿

PubMed Central

Roque, H. D.; Vieira, R.; Rato, S.; Luz-Martins, M.

2006-01-01

This report describes application of PCR fingerprinting to identify common species of dermatophytes using the microsatellite primers M13, (GACA)4, and (GTG)5. The initial PCR analysis rendered a specific DNA fragment for Microsporum audouinii, which was cloned and sequenced. Based on the sequencing data of this fragment, forward (MA_1F) and reverse (MA_1R) primers were designed and verified by PCR to establish their reliability in the diagnosis of M. audouinii. These primers produced a singular PCR band of 431 bp specific only to strains and isolates of M. audouinii, based on a global test of 182 strains/isolates belonging to 11 species of dermatophytes. These findings indicate these primers are reliable for diagnostic purposes, and we recommend their use in laboratory analysis. PMID:17005755

The Self Primer of the Long Terminal Repeat Retrotransposon Tf1 Is Not Removed during Reverse Transcription

PubMed Central

Atwood-Moore, Angela; Yan, Kenneth; Judson, Robert L.; Levin, Henry L.

2006-01-01

The long terminal repeat retrotransposon Tf1 of Schizosaccharomyces pombe uses a unique mechanism of self priming to initiate reverse transcription. Instead of using a tRNA, Tf1 primes minus-strand synthesis with an 11-nucleotide RNA removed from the 5′ end of its own transcript. We tested whether the self primer of Tf1 was similar to tRNA primers in being removed from the cDNA by RNase H. Our analysis of Tf1 cDNA extracted from virus-like particles revealed the surprising observation that the dominant species of cDNA retained the self primer. This suggests that integration of the cDNA relies on mechanisms other than reverse transcription to remove the primer. PMID:16873283

Specific primers for rapid detection of Microsporum audouinii by PCR in clinical samples.

PubMed

Roque, H D; Vieira, R; Rato, S; Luz-Martins, M

2006-12-01

This report describes application of PCR fingerprinting to identify common species of dermatophytes using the microsatellite primers M13, (GACA)4, and (GTG)5. The initial PCR analysis rendered a specific DNA fragment for Microsporum audouinii, which was cloned and sequenced. Based on the sequencing data of this fragment, forward (MA_1F) and reverse (MA_1R) primers were designed and verified by PCR to establish their reliability in the diagnosis of M. audouinii. These primers produced a singular PCR band of 431 bp specific only to strains and isolates of M. audouinii, based on a global test of 182 strains/isolates belonging to 11 species of dermatophytes. These findings indicate these primers are reliable for diagnostic purposes, and we recommend their use in laboratory analysis.

Application of microsatellite primers developed for Polistes in the independent-founding wasp Polists satan Bequaert (Hymenoptera: Vespidae).

PubMed

Komatsu, K; Mateus, S; Zucchi, R; Nascimento, F; Kudô, K

2012-06-01

Microsatellite primers developed for a given species are sometimes useful for another in the same genus and in other genera within the same family, making possible to search for pre-existing suitable primers in the databanks such as GenBank. We examined whether existing primers developed for Polistes could be used for Polistes satan Bequaert. We tested 50 microsatellite primers from three Polistes species and found that six microsatellite loci show polymorphism in size in P. satan. These six loci were highly polymorphic, having four to 15 alleles in P. satan with an expected heterozygosity of 0.525-0.832. These loci can be used to study parameters concerning genetic relatedness such as social interactions in colonies and genetic conflicts of interest among nestmate individuals.

Multiplexing Short Primers for Viral Family PCR

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gardner, S N; Hiddessen, A L; Hara, C A

We describe a Multiplex Primer Prediction (MPP) algorithm to build multiplex compatible primer sets for large, diverse, and unalignable sets of target sequences. The MPP algorithm is scalable to larger target sets than other available software, and it does not require a multiple sequence alignment. We applied it to questions in viral detection, and demonstrated that there are no universally conserved priming sequences among viruses and that it could require an unfeasibly large number of primers ({approx}3700 18-mers or {approx}2000 10-mers) to generate amplicons from all sequenced viruses. We then designed primer sets separately for each viral family, and formore » several diverse species such as foot-and-mouth disease virus, hemagglutinin and neuraminidase segments of influenza A virus, Norwalk virus, and HIV-1.« less

A novel MALDI–TOF based methodology for genotyping single nucleotide polymorphisms

PubMed Central

Blondal, Thorarinn; Waage, Benedikt G.; Smarason, Sigurdur V.; Jonsson, Frosti; Fjalldal, Sigridur B.; Stefansson, Kari; Gulcher, Jeffery; Smith, Albert V.

2003-01-01

A new MALDI–TOF based detection assay was developed for analysis of single nucleotide polymorphisms (SNPs). It is a significant modification on the classic three-step minisequencing method, which includes a polymerase chain reaction (PCR), removal of excess nucleotides and primers, followed by primer extension in the presence of dideoxynucleotides using modified thermostable DNA polymerase. The key feature of this novel assay is reliance upon deoxynucleotide mixes, lacking one of the nucleotides at the polymorphic position. During primer extension in the presence of depleted nucleotide mixes, standard thermostable DNA polymerases dissociate from the template at positions requiring a depleted nucleotide; this principal was harnessed to create a genotyping assay. The assay design requires a primer- extension primer having its 3′-end one nucleotide upstream from the interrogated site. The assay further utilizes the same DNA polymerase in both PCR and the primer extension step. This not only simplifies the assay but also greatly reduces the cost per genotype compared to minisequencing methodology. We demonstrate accurate genotyping using this methodology for two SNPs run in both singleplex and duplex reactions. We term this assay nucleotide depletion genotyping (NUDGE). Nucleotide depletion genotyping could be extended to other genotyping assays based on primer extension such as detection by gel or capillary electrophoresis. PMID:14654708

swga: a primer design toolkit for selective whole genome amplification.

PubMed

Clarke, Erik L; Sundararaman, Sesh A; Seifert, Stephanie N; Bushman, Frederic D; Hahn, Beatrice H; Brisson, Dustin

2017-07-15

Population genomic analyses are often hindered by difficulties in obtaining sufficient numbers of genomes for analysis by DNA sequencing. Selective whole-genome amplification (SWGA) provides an efficient approach to amplify microbial genomes from complex backgrounds for sequence acquisition. However, the process of designing sets of primers for this method has many degrees of freedom and would benefit from an automated process to evaluate the vast number of potential primer sets. Here, we present swga , a program that identifies primer sets for SWGA and evaluates them for efficiency and selectivity. We used swga to design and test primer sets for the selective amplification of Wolbachia pipientis genomic DNA from infected Drosophila melanogaster and Mycobacterium tuberculosis from human blood. We identify primer sets that successfully amplify each against their backgrounds and describe a general method for using swga for arbitrary targets. In addition, we describe characteristics of primer sets that correlate with successful amplification, and present guidelines for implementation of SWGA to detect new targets. Source code and documentation are freely available on https://www.github.com/eclarke/swga . The program is implemented in Python and C and licensed under the GNU Public License. ecl@mail.med.upenn.edu. Supplementary data are available at Bioinformatics online. © The Author(s) 2017. Published by Oxford University Press.

Evaluation of highly conserved hsp65-specific nested PCR primers for diagnosing Mycobacterium tuberculosis.

PubMed

Priyadarshini, P; Tiwari, K; Das, A; Kumar, D; Mishra, M N; Desikan, P; Nath, G

2017-02-01

To evaluate the sensitivity and specificity of a new nested set of primers designed for the detection of Mycobacterium tuberculosis complex targeting a highly conserved heat shock protein gene (hsp65). The nested primers were designed using multiple sequence alignment assuming the nucleotide sequence of the M. tuberculosis H37Rv hsp65 genome as base. Multidrug-resistant Mycobacterium species along with other non-mycobacterial and fungal species were included to evaluate the specificity of M. tuberculosis hsp65 gene-specific primers. The sensitivity of the primers was determined using serial 10-fold dilutions, and was 100% as shown by the bands in the case of M. tuberculosis complex. None of the other non M. tuberculosis complex bacterial and fungal species yielded any band on nested polymerase chain reaction (PCR). The first round of amplification could amplify 0.3 ng of the template DNA, while nested PCR could detect 0.3 pg. The present hsp65-specific primers have been observed to be sensitive, specific and cost-effective, without requiring interpretation of biochemical tests, real-time PCR, sequencing or high-performance liquid chromatography. These primer sets do not have the drawbacks associated with those protocols that target insertion sequence 6110, 16S rDNA, rpoB, recA and MPT 64.

Assessment of primer/template mismatch effects on real-time PCR amplification of target taxa for GMO quantification.

PubMed

Ghedira, Rim; Papazova, Nina; Vuylsteke, Marnik; Ruttink, Tom; Taverniers, Isabel; De Loose, Marc

2009-10-28

GMO quantification, based on real-time PCR, relies on the amplification of an event-specific transgene assay and a species-specific reference assay. The uniformity of the nucleotide sequences targeted by both assays across various transgenic varieties is an important prerequisite for correct quantification. Single nucleotide polymorphisms (SNPs) frequently occur in the maize genome and might lead to nucleotide variation in regions used to design primers and probes for reference assays. Further, they may affect the annealing of the primer to the template and reduce the efficiency of DNA amplification. We assessed the effect of a minor DNA template modification, such as a single base pair mismatch in the primer attachment site, on real-time PCR quantification. A model system was used based on the introduction of artificial mismatches between the forward primer and the DNA template in the reference assay targeting the maize starch synthase (SSIIb) gene. The results show that the presence of a mismatch between the primer and the DNA template causes partial to complete failure of the amplification of the initial DNA template depending on the type and location of the nucleotide mismatch. With this study, we show that the presence of a primer/template mismatch affects the estimated total DNA quantity to a varying degree.

Molecular Tools for the Detection of Nitrogen Cycling Archaea

PubMed Central

Rusch, Antje

2013-01-01

Archaea are widespread in extreme and temperate environments, and cultured representatives cover a broad spectrum of metabolic capacities, which sets them up for potentially major roles in the biogeochemistry of their ecosystems. The detection, characterization, and quantification of archaeal functions in mixed communities require Archaea-specific primers or probes for the corresponding metabolic genes. Five pairs of degenerate primers were designed to target archaeal genes encoding key enzymes of nitrogen cycling: nitrite reductases NirA and NirB, nitrous oxide reductase (NosZ), nitrogenase reductase (NifH), and nitrate reductases NapA/NarG. Sensitivity towards their archaeal target gene, phylogenetic specificity, and gene specificity were evaluated in silico and in vitro. Owing to their moderate sensitivity/coverage, the novel nirB-targeted primers are suitable for pure culture studies only. The nirA-targeted primers showed sufficient sensitivity and phylogenetic specificity, but poor gene specificity. The primers designed for amplification of archaeal nosZ performed well in all 3 criteria; their discrimination against bacterial homologs appears to be weakened when Archaea are strongly outnumbered by bacteria in a mixed community. The novel nifH-targeted primers showed high sensitivity and gene specificity, but failed to discriminate against bacterial homologs. Despite limitations, 4 of the new primer pairs are suitable tools in several molecular methods applied in archaeal ecology. PMID:23365509

Comparison of the antibacterial activity of different self-etching primers and adhesives.

PubMed

Korkmaz, Yonca; Ozalp, Meral; Attar, Nuray

2008-11-01

The aim of this study was to evaluate the antibacterial effects of different one-step and two-step self-etching primer/adhesives on Streptococcus mutans (S. mutans), Lactobacillus casei (L. casei), and Lactobacillus acidophilus (L. acidophilus). The antibacterial effects of Clearfil Protect Bond Primer and Bonding agent; AdheSE Primer and Bonding agent; Adper Prompt L-Pop; Futurabond NR; Clearfil Tri S Bond; and Cervitec (positive control, 1% chlorhexidine varnish) were tested against standard strains of S. mutans, L. Casei, and L. acidophilus using the disk diffusion method. Standard filter paper disks (n=5) impregnated with 20 microL of each material were prepared. After incubation at 37 masculineC for 48 hours in a 5-10% CO2 atmosphere, the diameter of inhibition zones were measured in millimeters. Data were analyzed using one way analysis of variance (ANOVA) and multivariate analysis of variance (MANOVA). Duncan's Multiple Range Test was used for pairwise comparison. The size of inhibition zones produced by primer/adhesives varied among the brands. AdheSE Primer: S. mutans (20.6+/-1.51); L. casei (14.8+/-1.78); L. acidophilus (11.4+/-0.54). Adper Prompt L-Pop: S. mutans (19.6+/-1.51); L. casei (13.8+/-1.64); L. acidophilus (13.8+/-1.09). Cervitec: S. mutans (23+/-0.00); L. casei (27+/-0.70); L. acidophilus (22.4+/-0.54). Clearfil Protect Bond Primer: S. mutans (17+/-0.00); L. casei (17.6+/-0.54); L. acidophilus (22.4+/-0.54). Futurabond NR was found effective only against S. mutans (14.6+/-1.67). Of all the materials tested, AdheSE Bonding agent, Clearfil Protect Bond Bonding agent, and Clearfil Tri S Bond exhibited no inhibition zone (-) for all bacteria tested. Among the adhesives tested Clearafil Protect Bond Primer based upon monomer methacryloyloxydodecylpyridiniium bromide (MDPB) was found to be the most potent material against L. acidophilus and L. casei. AdheSE Primer and Adper Prompt L-Pop are highly effective against S. mutans. Compared with other adhesive systems, Clearfil Protect Bond Primer (containing MDPB) showed a high antibacterial effect against all microorganizms tested. Two-step, self-etching primer/adhesive system Clearfil Protect Bond might be a suitable choice under minimally invasive restorations. The recently developed one-step, self-etching system Clearfil Tri S Bond showed no antibacterial effect against microorgazims tested.

Bonding to new CAD/CAM resin composites: influence of air abrasion and conditioning agents as pretreatment strategy.

PubMed

Reymus, Marcel; Roos, Malgorzata; Eichberger, Marlis; Edelhoff, Daniel; Hickel, Reinhard; Stawarczyk, Bogna

2018-04-27

Because of their industrially standardized process of manufacturing, CAD/CAM resin composites show a high degree of conversion, making a reliable bond difficult to achieve. The purpose of this experiment was to investigate the tensile bond strength (TBS) of luting composite to CAD/CAM resin composite materials as influenced by air abrasion and pretreatment strategies. The treatment factors of the present study were (1) brand of the CAD/CAM resin composite (Brilliant Crios [Coltene/Whaledent], Cerasmart [GC Europe], Shofu Block HC [Shofu], and Lava Ultimate [3M]); (2) air abrasion vs. no air abrasion; and (3) pretreatment using a silane primer (Clearfil Ceramic Primer, Kuraray) vs. a resin primer (One Coat 7 Universal, Coltene/Whaledent). Subsequently, luting composite (DuoCem, Coltene/Whaledent) was polymerized onto the substrate surface using a mold. For each combination of the levels of the three treatment factors (4 (materials) × 2 (air abrasion vs. no air abrasion; resin) × 2 (primer vs. silane primer)), n = 15, specimens were prepared. After 24 h of water storage at 37 °C and 5000 thermo-cycles (5/55 °C), TBS was measured and failure types were examined. The resulting data was analyzed using Kaplan-Meier estimates of the cumulative failure distribution function with Breslow-Gehan tests and non-parametric ANOVA (Kruskal-Wallis test) followed by the multiple pairwise Mann-Whitney U test with α-error adjustment using the Benjamini-Hochberg procedure and chi-square test (p < 0.05). The additional air abrasion step increased TBS values and lowered failure rates. Specimens pretreated using a resin primer showed significantly higher TBS and lower failure rates than those pretreated using a silane primer. The highest failure rates were observed for groups pretreated with a silane primer. Within the Shofu Block HC group, all specimens without air abrasion and pretreatment with a silane primer debonded during the aging procedure. Before fixation of CAD/CAM resin composites, the restorations should be air abraded and pretreated using a resin primer containing methyl-methacrylate to successfully bond to the luting composite. The pretreatment of the CAD/CAM resin composite using merely a silane primer results in deficient adhesion. For a reliable bond of CAD/CAM resin composites to the luting composite, air abrasion and a special pretreatment strategy are necessary in order to achieve promising long-term results.

KENO-VI Primer: A Primer for Criticality Calculations with SCALE/KENO-VI Using GeeWiz

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bowman, Stephen M

2008-09-01

The SCALE (Standardized Computer Analyses for Licensing Evaluation) computer software system developed at Oak Ridge National Laboratory is widely used and accepted around the world for criticality safety analyses. The well-known KENO-VI three-dimensional Monte Carlo criticality computer code is one of the primary criticality safety analysis tools in SCALE. The KENO-VI primer is designed to help a new user understand and use the SCALE/KENO-VI Monte Carlo code for nuclear criticality safety analyses. It assumes that the user has a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with SCALE/KENO-VImore » in particular. The primer is designed to teach by example, with each example illustrating two or three features of SCALE/KENO-VI that are useful in criticality analyses. The primer is based on SCALE 6, which includes the Graphically Enhanced Editing Wizard (GeeWiz) Windows user interface. Each example uses GeeWiz to provide the framework for preparing input data and viewing output results. Starting with a Quickstart section, the primer gives an overview of the basic requirements for SCALE/KENO-VI input and allows the user to quickly run a simple criticality problem with SCALE/KENO-VI. The sections that follow Quickstart include a list of basic objectives at the beginning that identifies the goal of the section and the individual SCALE/KENO-VI features that are covered in detail in the sample problems in that section. Upon completion of the primer, a new user should be comfortable using GeeWiz to set up criticality problems in SCALE/KENO-VI. The primer provides a starting point for the criticality safety analyst who uses SCALE/KENO-VI. Complete descriptions are provided in the SCALE/KENO-VI manual. Although the primer is self-contained, it is intended as a companion volume to the SCALE/KENO-VI documentation. (The SCALE manual is provided on the SCALE installation DVD.) The primer provides specific examples of using SCALE/KENO-VI for criticality analyses; the SCALE/KENO-VI manual provides information on the use of SCALE/KENO-VI and all its modules. The primer also contains an appendix with sample input files.« less

Low-temperature magnetotransport in Si/SiGe heterostructures on 300 mm Si wafers

NASA Astrophysics Data System (ADS)

Scappucci, Giordano; Yeoh, L.; Sabbagh, D.; Sammak, A.; Boter, J.; Droulers, G.; Kalhor, N.; Brousse, D.; Veldhorst, M.; Vandersypen, L. M. K.; Thomas, N.; Roberts, J.; Pillarisetty, R.; Amin, P.; George, H. C.; Singh, K. J.; Clarke, J. S.

Undoped Si/SiGe heterostructures are a promising material stack for the development of spin qubits in silicon. To deploy a qubit into high volume manufacturing in a quantum computer requires stringent control over substrate uniformity and quality. Electron mobility and valley splitting are two key electrical metrics of substrate quality relevant for qubits. Here we present low-temperature magnetotransport measurements of strained Si quantum wells with mobilities in excess of 100000 cm2/Vs fabricated on 300 mm wafers within the framework of advanced semiconductor manufacturing. These results are benchmarked against the results obtained in Si quantum wells deposited on 100 mm Si wafers in an academic research environment. To ensure rapid progress in quantum wells quality we have implemented fast feedback loops from materials growth, to heterostructure FET fabrication, and low temperature characterisation. On this topic we will present recent progress in developing a cryogenic platform for high-throughput magnetotransport measurements.

Thermodynamically balanced inside-out (TBIO) PCR-based gene synthesis: a novel method of primer design for high-fidelity assembly of longer gene sequences

PubMed Central

Gao, Xinxin; Yo, Peggy; Keith, Andrew; Ragan, Timothy J.; Harris, Thomas K.

2003-01-01

A novel thermodynamically-balanced inside-out (TBIO) method of primer design was developed and compared with a thermodynamically-balanced conventional (TBC) method of primer design for PCR-based gene synthesis of codon-optimized gene sequences for the human protein kinase B-2 (PKB2; 1494 bp), p70 ribosomal S6 subunit protein kinase-1 (S6K1; 1622 bp) and phosphoinositide-dependent protein kinase-1 (PDK1; 1712 bp). Each of the 60mer TBIO primers coded for identical nucleotide regions that the 60mer TBC primers covered, except that half of the TBIO primers were reverse complement sequences. In addition, the TBIO and TBC primers contained identical regions of temperature- optimized primer overlaps. The TBC method was optimized to generate sequential overlapping fragments (∼0.4–0.5 kb) for each of the gene sequences, and simultaneous and sequential combinations of overlapping fragments were tested for their ability to be assembled under an array of PCR conditions. However, no fully synthesized gene sequences could be obtained by this approach. In contrast, the TBIO method generated an initial central fragment (∼0.4–0.5 kb), which could be gel purified and used for further inside-out bidirectional elongation by additional increments of 0.4–0.5 kb. By using the newly developed TBIO method of PCR-based gene synthesis, error-free synthetic genes for the human protein kinases PKB2, S6K1 and PDK1 were obtained with little or no corrective mutagenesis. PMID:14602936

Use of natural gas, methanol, and ethanol fuel emulsions as environmentally friendly energy carriers for mobile heat power plants

NASA Astrophysics Data System (ADS)

Likhanov, V. A.; Lopatin, O. P.

2017-12-01

The need for using environmentally friendly energy carriers for mobile heat power plants (HPPs) is grounded. Ecologically friendly sources of energy, such as natural gas as well as renewable methyl and ethyl alcohols, are investigated. In order to develop, determine, and optimize the composition of environmentally friendly energy carriers for an HPP, the latter has been tested when working on diesel fuel (DF), compressed natural gas (CNG), and methanol and ethanol fuel emulsions (MFE, EFE). It has been experimentally established that, for the application of environmentally friendly energy carriers for a 4Ch 11.0/12.5 diesel engine of a mobile fuel and power plant, it is necessary to maintain the following ratio of components when working on CNG: 80% gas and 20% DF primer portion. When working on an alcohol mixture, emulsions of the following composition were used: 25% alcohol (methanol or ethanol), 0.5% detergent-dispersant additive succinimide C-5A, 7% water, and 67.5% DF. When this diesel passed from oil DF to environmentally friendly energy sources, it allowed for the reduction of the content of exhaust gases (EG) (1) when working on CNG with recirculation of exhaust gases (EGR) (recirculation was used to eliminate the increased amount of nitric oxides by using CNG): carbon black by 5.8 times, carbon dioxide by 45.9%, and carbon monoxide by 23.8%; (2) when working on MFE: carbon black by 6.4 times, nitrogen oxides by 29.6%, carbon dioxide by 10.1%, and carbon oxide by 47.6%; (3) when working on EFE: carbon black by 4.8 times; nitrogen oxides by 40.3%, carbon dioxide by 26.6%, and carbon monoxide by 28.6%. The prospects of use of environmentally friendly energy carriers in diesels of mobile HPPs, such as natural gas, ethanol, and methanol, has been determined.

Primer for identifying cold-water refuges to protect and restore thermal diversity in riverine landscapes - EPA 910-C-12-001

EPA Science Inventory

This primer provides guidance to Region 10 Tribes, States, and local watershed community groups to support the identification, protection, and restoration of critical cold water refuges for the protection of salmonids. This primer will assist these entities in implementing the E...

Charter School Primer. Peter Lang Primer. Volume 34

ERIC Educational Resources Information Center

Tryjankowski, Anne Marie

2012-01-01

The "Charter School Primer" presents an overview of public charter schools in the United States. The book discusses what charter schools are; the history of public charter school choice in the United States; the role of teachers, parents, boards, and unions in the charter school movement; and gives examples of innovations in education made…

Reading Assessment: A Primer for Teachers and Tutors.

ERIC Educational Resources Information Center

Caldwell, JoAnne Schudt

This primer provides the basic information that teachers and tutors need to get started on the complex process of reading assessment. Designed for maximum utility in today's standards-driven classroom, the primer presents simple, practical assessment strategies that are based on theory and research. It takes teachers step by step through learning…

Novel primers for detection of genetically diverse virulent Agrobacterium tumefaciens bv1 strains

USDA-ARS?s Scientific Manuscript database

Novel primers were developed to amplify a 243 bp fragment of an intergenic region between gene5 and tms2 on the T-DNA of Agrobacterium tumefaciens. These primers exhibit 100% positive correlation with strain virulence, 100% negative correlation with avirulence and did not generate extraneous bands,...

40 CFR 63.3091 - What emission limits must I meet for an existing affected source?

Code of Federal Regulations, 2010 CFR

2010-07-01

... bonding primer, and glass bonding adhesive operations plus all coatings and thinners, except for deadener materials and for adhesive and sealer materials that are not components of glass bonding systems, used in... from primer-surfacer, topcoat, final repair, glass bonding primer, and glass bonding adhesive...

Murrinh Nganki (Our Language), 1.

ERIC Educational Resources Information Center

Street, Chester; And Others

This primer is the first in a series of four trial primers intended to teach the speakers of the Murrinh-patha language to read and write in their mother tongue. The approach and method of this primer is eclectic, based on principles developed by Dr. Sarah Gudschinsky. It has been designed to teach the vowels…

A Primer on Brain Imaging in Developmental Psychopathology: What Is It Good For?

ERIC Educational Resources Information Center

Pine, Daniel S.

2006-01-01

This primer introduces a Special Section on brain imaging, which includes a commentary and 10 data papers presenting applications of brain imaging to questions on developmental psychopathology. This primer serves two purposes. First, the article summarizes the strength and weaknesses of various brain-imaging techniques typically employed in…

Integrating PCR theory and bioinformatics into a research-oriented primer design exercise.

PubMed

Robertson, Amber L; Phillips, Allison R

2008-01-01

Polymerase chain reaction (PCR) is a conceptually difficult technique that embodies many fundamental biological processes. Traditionally, students have struggled to analyze PCR results due to an incomplete understanding of the biological concepts (theory) of DNA replication and strand complementarity. Here we describe the design of a novel research-oriented exercise that prepares students to design DNA primers for PCR. Our exercise design includes broad and specific learning goals and assessments of student performance and perceptions. We developed this interactive Primer Design Exercise using the principles of scientific teaching to enhance student understanding of the theory behind PCR and provide practice in designing PCR primers to amplify DNA. In the end, the students were more poised to troubleshoot problems that arose in real experiments using PCR. In addition, students had the opportunity to utilize several bioinformatics tools to gain an increased understanding of primer quality, directionality, and specificity. In the course of this study many misconceptions about DNA replication during PCR and the need for primer specificity were identified and addressed. Students were receptive to the new materials and the majority achieved the learning goals.

A Novel Universal Primer-Multiplex-PCR Method with Sequencing Gel Electrophoresis Analysis

PubMed Central

Huang, Kunlun; Zhang, Nan; Yuan, Yanfang; Shang, Ying; Luo, Yunbo

2012-01-01

In this study, a novel universal primer-multiplex-PCR (UP-M-PCR) method adding a universal primer (UP) in the multiplex PCR reaction system was described. A universal adapter was designed in the 5′-end of each specific primer pairs which matched with the specific DNA sequences for each template and also used as the universal primer (UP). PCR products were analyzed on sequencing gel electrophoresis (SGE) which had the advantage of exhibiting extraordinary resolution. This method overcame the disadvantages rooted deeply in conventional multiplex PCR such as complex manipulation, lower sensitivity, self-inhibition and amplification disparity resulting from different primers, and it got a high specificity and had a low detection limit of 0.1 ng for single kind of crops when screening the presence of genetically modified (GM) crops in mixture samples. The novel developed multiplex PCR assay with sequencing gel electrophoresis analysis will be useful in many fields, such as verifying the GM status of a sample irrespective of the crop and GM trait and so on. PMID:22272223

Real-time PCR (qPCR) primer design using free online software.

PubMed

Thornton, Brenda; Basu, Chhandak

2011-01-01

Real-time PCR (quantitative PCR or qPCR) has become the preferred method for validating results obtained from assays which measure gene expression profiles. The process uses reverse transcription polymerase chain reaction (RT-PCR), coupled with fluorescent chemistry, to measure variations in transcriptome levels between samples. The four most commonly used fluorescent chemistries are SYBR® Green dyes and TaqMan®, Molecular Beacon or Scorpion probes. SYBR® Green is very simple to use and cost efficient. As SYBR® Green dye binds to any double-stranded DNA product, its success depends greatly on proper primer design. Many types of online primer design software are available, which can be used free of charge to design desirable SYBR® Green-based qPCR primers. This laboratory exercise is intended for those who have a fundamental background in PCR. It addresses the basic fluorescent chemistries of real-time PCR, the basic rules and pitfalls of primer design, and provides a step-by-step protocol for designing SYBR® Green-based primers with free, online software. Copyright © 2010 Wiley Periodicals, Inc.

Identification of cultivars and validation of genetic relationships in Mangifera indica L. using RAPD markers.

PubMed

Schnell, R J; Ronning, C M; Knight, R J

1995-02-01

Twenty-five accessions of mango were examined for random amplified polymorphic DNA (RAPD) genetic markers with 80 10-mer random primers. Of the 80 primers screened, 33 did not amplify, 19 were monomorphic, and 28 gave reproducible, polymorphic DNA amplification patterns. Eleven primers were selected from the 28 for the study. The number of bands generated was primer- and genotype-dependent, and ranged from 1 to 10. No primer gave unique banding patterns for each of the 25 accessions; however, ten different combinations of 2 primer banding patterns produced unique fingerprints for each accession. A maternal half-sib (MHS) family was included among the 25 accessions to see if genetic relationships could be detected. RAPD data were used to generate simple matching coefficients, which were analyzed phenetically and by means of principal coordinate analysis (PCA). The MHS clustered together in both the phenetic and the PCA while the randomly selected accessions were scattered with no apparent pattern. The uses of RAPD analysis for Mangifera germ plasm classification and clonal identification are discussed.

Molecular Properties of Poliovirus Isolates: Nucleotide Sequence Analysis, Typing by PCR and Real-Time RT-PCR.

PubMed

Burns, Cara C; Kilpatrick, David R; Iber, Jane C; Chen, Qi; Kew, Olen M

2016-01-01

Virologic surveillance is essential to the success of the World Health Organization initiative to eradicate poliomyelitis. Molecular methods have been used to detect polioviruses in tissue culture isolates derived from stool samples obtained through surveillance for acute flaccid paralysis. This chapter describes the use of realtime PCR assays to identify and serotype polioviruses. In particular, a degenerate, inosine-containing, panpoliovirus (panPV) PCR primer set is used to distinguish polioviruses from NPEVs. The high degree of nucleotide sequence diversity among polioviruses presents a challenge to the systematic design of nucleic acid-based reagents. To accommodate the wide variability and rapid evolution of poliovirus genomes, degenerate codon positions on the template were matched to mixed-base or deoxyinosine residues on both the primers and the TaqMan™ probes. Additional assays distinguish between Sabin vaccine strains and non-Sabin strains. This chapter also describes the use of generic poliovirus specific primers, along with degenerate and inosine-containing primers, for routine VP1 sequencing of poliovirus isolates. These primers, along with nondegenerate serotype-specific Sabin primers, can also be used to sequence individual polioviruses in mixtures.

Novel Primer Sets for Next Generation Sequencing-Based Analyses of Water Quality

PubMed Central

Lee, Elvina; Khurana, Maninder S.; Whiteley, Andrew S.; Monis, Paul T.; Bath, Andrew; Gordon, Cameron; Ryan, Una M.; Paparini, Andrea

2017-01-01

Next generation sequencing (NGS) has rapidly become an invaluable tool for the detection, identification and relative quantification of environmental microorganisms. Here, we demonstrate two new 16S rDNA primer sets, which are compatible with NGS approaches and are primarily for use in water quality studies. Compared to 16S rRNA gene based universal primers, in silico and experimental analyses demonstrated that the new primers showed increased specificity for the Cyanobacteria and Proteobacteria phyla, allowing increased sensitivity for the detection, identification and relative quantification of toxic bloom-forming microalgae, microbial water quality bioindicators and common pathogens. Significantly, Cyanobacterial and Proteobacterial sequences accounted for ca. 95% of all sequences obtained within NGS runs (when compared to ca. 50% with standard universal NGS primers), providing higher sensitivity and greater phylogenetic resolution of key water quality microbial groups. The increased selectivity of the new primers allow the parallel sequencing of more samples through reduced sequence retrieval levels required to detect target groups, potentially reducing NGS costs by 50% but still guaranteeing optimal coverage and species discrimination. PMID:28118368

Rapid identification of red-flesh loquat cultivars using EST-SSR markers based on manual cultivar identification diagram strategy.

PubMed

Li, X Y; Xu, H X; Chen, J W

2014-04-29

Manual cultivar identification diagram is a new strategy for plant cultivar identification based on DNA markers, providing information to efficiently separate cultivars. We tested 25 pairs of apple EST-SSR primers for amplification of PCR products from loquat cultivars. These EST-SSR primers provided clear amplification products from the loquat cultivars, with a relatively high transferability rate of 84% to loquat; 11 pairs of primers amplified polymorphic products. After analysis of 24 red-fleshed loquat accessions, we found that only 7 pairs of primers could clearly separate all of them. A cultivar identification diagram of the 24 cultivars was constructed using polymorphic bands from the DNA fingerprints and EST-SSR primers. Any two of the 24 cultivars could be rapidly separated from each other, according to the polymorphic bands from the cultivars; the corresponding primers were marked in the correct position on the cultivar identification diagram. This red-flesh loquat cultivar identification diagram can separate the 24 red-flesh loquat cultivars, which is of benefit for loquat cultivar identification for germplasm management and breeding programs.

Primer sets for cloning the human repertoire of T cell Receptor Variable regions

PubMed Central

Boria, Ilenia; Cotella, Diego; Dianzani, Irma; Santoro, Claudio; Sblattero, Daniele

2008-01-01

Background Amplification and cloning of naïve T cell Receptor (TR) repertoires or antigen-specific TR is crucial to shape immune response and to develop immuno-based therapies. TR variable (V) regions are encoded by several genes that recombine during T cell development. The cloning of expressed genes as large diverse libraries from natural sources relies upon the availability of primers able to amplify as many V genes as possible. Results Here, we present a list of primers computationally designed on all functional TR V and J genes listed in the IMGT®, the ImMunoGeneTics information system®. The list consists of unambiguous or degenerate primers suitable to theoretically amplify and clone the entire TR repertoire. We show that it is possible to selectively amplify and clone expressed TR V genes in one single RT-PCR step and from as little as 1000 cells. Conclusion This new primer set will facilitate the creation of more diverse TR libraries than has been possible using currently available primer sets. PMID:18759974

Effect of thione primers on adhesive bonding between an indirect composite material and Ag-Pd-Cu-Au alloy.

PubMed

Imai, Hideyuki; Koizumi, Hiroyasu; Shimoe, Saiji; Hirata, Isao; Matsumura, Hideo; Nikawa, Hiroki

2014-01-01

The current study evaluated the effect of primers on the shear bond strength of an indirect composite material joined to a silverpalladium-copper-gold (Ag-Pd-Cu-Au) alloy (Castwell). Disk specimens were cast from the alloy and were air-abraded with alumina. Eight metal primers were applied to the alloy surface. A light-polymerized indirect composite material (Solidex) was bonded to the alloy. Shear bond strength was determined both before and after the application of thermocycling. Two groups primed with Metaltite (thione) and M. L. Primer (sulfide) showed the greatest post-thermocycling bond strength (8.8 and 6.5 MPa). The results of the X-ray photoelectron spectroscopic (XPS) analysis suggested that the thione monomer (MTU-6) in the Metaltite primer was strongly adsorbed onto the Ag-Pd-Cu-Au alloy surface even after repeated cleaning with acetone. The application of either the thione (MTU-6) or sulfide primer is effective for enhancing the bonding between a composite material and Ag-Pd-Cu-Au alloy.

Comparison of the Chromium Distribution in New Super Koropon Primer to 30 Year Old Super Koropon Using Focused Ion Beam/Scanning Electron Microscopy

NASA Technical Reports Server (NTRS)

Lomness, Janice K.; Calle, Luz Marina

2006-01-01

Super Koropon primer (MB0125-055) plays a significant role in the corrosion protection of areas throughout the Orbiter. Because the Shuttle Program relies so heavily upon the performance of the Koropon primer, it is necessary to fully understand all aspects of the behavior of the coating. One area where little understanding of the Koropon primer still exists is the level of risk associated with age related degradation. Recently, efforts were undertaken to better understand the age life of the Koropon primer and to gain some insight into the aging process of this coating. In that study, an aluminum access panel from the Orbiter Enterprise was used to investigate the performance of the old Koropon film. A control panel was also used to study the performance of new Koropon coating. Preliminary investigations into the performance of aged Super Koropon primer indicated a significant decrease in corrosion protection. This investigation serves as an example of how Focused Ion Beam/Scanning Microscopy can be used to characterize the changes that occur as coatings age.

Got black swimming dots in your cell culture? Identification of Achromobacter as a novel cell culture contaminant

PubMed Central

Gray, Jennifer Sue; Birmingham, Janette Marie; Fenton, Jenifer Imig

2009-01-01

ARTICLE SUMMARY Cell culture model systems are utilized for their ease of use, relative inexpensiveness, and potentially limitless sample size. Reliable results cannot be obtained, however, when cultures contain contamination. This report discusses the observation and identification of mobile black specks observed in multiple cell lines. Cultures of the contamination were grown, and DNA was purified from isolated colonies. The 16S rDNA gene was PCR amplified using primers that will amplify the gene from many genera, and then sequenced. Sequencing results matched the members of the genus Achromobacter, bacteria common in the environment. Achromobacter species have been shown to be resistant to multiple antibiotics. Attempts to decontaminate the eukaryotic cell culture used multiple antibiotics at different concentrations. The contaminating Achromobacter was eventually eliminated, without permanently harming the eukaryotic cells, using a combination of the antibiotics ciprofloxacin and piperacillin. PMID:19926304

Developing the Medication Reminder Mobile Application "Seeb".

PubMed

Saghaeiannejad-Isfahani, Sakineh; Ehteshami, Asghar; Savari, Ebtesam; Samimi, Ali

2017-06-01

Today, the structure of comprehensive health care emphasizes self-care more than therapy. Medication therapy is a strong instrument for therapy received through the health setting, especially in medication area. Error in medication administration has produced different problems and they cost billions of dollars every year. Regarding mobile phone extensions, we developed a local medication reminder mobile application called "Seeb" as a suitable solution for decreasing medication errors for Iranians. We conducted a mixed methods study in three Phases: 1) Comparative study of existing mobile applications; 2) developed its object-oriented model; 3) Developed the initial version of "Seeb" that was approved for production. This application was designed for the appropriate medication administration including time and dosages through: recording patient and medication data; scheduling patients' medication; and reporting medication administration on progress. "Seeb" has been designed in compliance with Iranian health information technologists and pharmacists requirements. It is expected to reduce medication error and improve patient adherence to medical prescriptions.

Precise observation of C. elegans dynamic behaviours under controlled thermal stimulus using a mobile phone-based microscope.

PubMed

Yoon, T; Shin, D-M; Kim, S; Lee, S; Lee, T G; Kim, K

2017-04-01

We investigated the temperature-dependent locomotion of Caenorhabditis elegans by using the mobile phone-based microscope. We developed the customized imaging system with mini incubator and smartphone to effectively control the thermal stimulation for precisely observing the temperature-dependent locomotory behaviours of C. elegans. Using the mobile phone-based microscope, we successfully followed the long-term progress of specimens of C. elegans in real time as they hatched and explored their temperature-dependent locomotory behaviour. We are convinced that the mobile phone-based microscope is a useful device for real time and long-term observations of biological samples during incubation, and can make it possible to carry out live observations via wireless communications regardless of location. In addition, this microscope has the potential for widespread use owing to its low cost and compact design. © 2017 The Authors Journal of Microscopy © 2017 Royal Microscopical Society.

Clinical applicability of nursing outcomes in the evolution of orthopedic patients with Impaired Physical Mobility 1

PubMed Central

da Silva, Marcos Barragan; Almeida, Miriam de Abreu; Panato, Bruna Paulsen; Siqueira, Ana Paula de Oliveira; da Silva, Mariana Palma; Reisderfer, Letícia

2015-01-01

AIM: to evaluate the clinical applicability of outcomes, according to the Nursing Outcomes Classification (NOC) in the evolution of orthopedic patients with Impaired Physical Mobility METHOD: longitudinal study conducted in 2012 in a university hospital, with 21 patients undergoing Total Hip Arthroplasty, evaluated daily by pairs of trained data collectors. Data were collected using an instrument containing five Nursing Outcomes, 16 clinical indicators and a five point Likert scale, and statistically analyzed. RESULTS: The outcomes Body Positioning: self-initiated, Mobility, Knowledge: prescribed activity, and Fall Prevention Behavior presented significant increases in mean scores when comparing the first and final evaluations (p<0.001) and (p=0.035). CONCLUSION: the use of the NOC outcomes makes it possible to demonstrate the clinical progression of orthopedic patients with Impaired Physical Mobility, as well as its applicability in this context. PMID:25806631

The Digital Divide: A Global View

NASA Astrophysics Data System (ADS)

Ntoko, Alexander

2011-04-01

Huge progress was made in bridging the digital divide in first decade of 21^st century. This was largely due to the explosive growth of mobile, which saw numbers rise from under 500 million to over five billion mobile cellular subscriptions in just ten years. With household mobile penetration rates of over 50% even in rural areas of developing countries, we have achieved the dream of bringing all the world's people within reach of communications technology. We must now, however, replicate the mobile miracle for the Internet, and especially broadband, if we are to avoid creating a new broadband breach to replace the digital divide. Three things need to happen for this to be achieved: firstly, broadband needs to be brought to the top of the development agenda; secondly, broadband needs to become much more affordable and thirdly, security needs to be part of the strategy.

Quantifying functional mobility progress for chronic disease management.

PubMed

Boyle, Justin; Karunanithi, Mohan; Wark, Tim; Chan, Wilbur; Colavitti, Christine

2006-01-01

A method for quantifying improvements in functional mobility is presented based on patient-worn accelerometer devices. For patients with cardiovascular, respiratory, or other chronic disease, increasing the amount of functional mobility is a large component of rehabilitation programs. We have conducted an observational trial on the use of accelerometers for quantifying mobility improvements in a small group of chronic disease patients (n=15, 48 - 86 yrs). Cognitive impairments precluded complex instrumentation of patients, and movement data was obtained from a single 2-axis accelerometer device worn at the hip. In our trial, movement data collected from accelerometer devices was classified into Lying vs Sitting/Standing vs Walking/Activity movements. This classification enabled the amount of walking to be quantified and graphically presented to clinicians and carers for feedback on exercise efficacy. Presenting long term trends in this data to patients also provides valuable feedback for self managed care and assisting with compliance.

Use of tannin anticorrosive reaction primer to improve traditional coating systems

DOE Office of Scientific and Technical Information (OSTI.GOV)

Matamala, G.; Droguett, G.; Smeltzer, W.

1994-04-01

Different anticorrosive schemes applied over plain or previously shot-blasted surfaces of AISI 1010 (UNS G10100) steel plates were compared. Plates were painted with alkydic, vinylic, and epoxy anticorrosive schemes over metal treated previously with pine tannin reaction primer and over its own schemes without previous primer treatment. Anticorrosive tests were conducted in a salt fog chamber according to ASTM B 117-73. Rusting, blistering, and adhesion were assessed over time. The survey was complemented with potentiodynamic scanning tests in sodium chloride (NaCl) solution with a concentration equivalent to seawater. Corrosion currents were determined using Tafel and polarization resistance techniques. Results showedmore » the reaction primer inhibited corrosion by improving adherence. Advantages over traditional conversion primers formulated in a base of zinc chromate in phosphoric medium were evident.« less

The Choice of PCR Primers Has Great Impact on Assessments of Bacterial Community Diversity and Dynamics in a Wastewater Treatment Plant

PubMed Central

Fredriksson, Nils Johan; Hermansson, Malte; Wilén, Britt-Marie

2013-01-01

Assessments of bacterial community diversity and dynamics are fundamental for the understanding of microbial ecology as well as biotechnological applications. We show that the choice of PCR primers has great impact on the results of analyses of diversity and dynamics using gene libraries and DNA fingerprinting. Two universal primer pairs targeting the 16S rRNA gene, 27F&1492R and 63F&M1387R, were compared and evaluated by analyzing the bacterial community in the activated sludge of a large-scale wastewater treatment plant. The two primer pairs targeted distinct parts of the bacterial community, none encompassing the other, both with similar richness. Had only one primer pair been used, very different conclusions had been drawn regarding dominant phylogenetic and putative functional groups. With 27F&1492R, Betaproteobacteria would have been determined to be the dominating taxa while 63F&M1387R would have described Alphaproteobacteria as the most common taxa. Microscopy and fluorescence in situ hybridization analysis showed that both Alphaproteobacteria and Betaproteobacteria were abundant in the activated sludge, confirming that the two primer pairs target two different fractions of the bacterial community. Furthermore, terminal restriction fragment polymorphism analyses of a series of four activated sludge samples showed that the two primer pairs would have resulted in different conclusions about community stability and the factors contributing to changes in community composition. In conclusion, different PCR primer pairs, although considered universal, target different ranges of bacteria and will thus show the diversity and dynamics of different fractions of the bacterial community in the analyzed sample. We also show that while a database search can serve as an indicator of how universal a primer pair is, an experimental assessment is necessary to evaluate the suitability for a specific environmental sample. PMID:24098498

Evaluation of six primer pairs targeting the nuclear rRNA operon for characterization of arbuscular mycorrhizal fungal (AMF) communities using 454 pyrosequencing.

PubMed

Van Geel, Maarten; Busschaert, Pieter; Honnay, Olivier; Lievens, Bart

2014-11-01

In the last few years, 454 pyrosequencing-based analysis of arbuscular mycorrhizal fungal (AMF; Glomeromycota) communities has tremendously increased our knowledge of the distribution and diversity of AMF. Nonetheless, comparing results between different studies is difficult, as different target genes (or regions thereof) and primer combinations, with potentially dissimilar specificities and efficacies, are being utilized. In this study we evaluated six primer pairs that have previously been used in AMF studies (NS31-AM1, AMV4.5NF-AMDGR, AML1-AML2, NS31-AML2, FLR3-LSUmBr and Glo454-NDL22) for their use in 454 pyrosequencing based on both an in silico approach and 454 pyrosequencing of AMF communities from apple tree roots. Primers were evaluated in terms of (i) in silico coverage of Glomeromycota fungi, (ii) the number of high-quality sequences obtained, (iii) selectivity for AMF species, (iv) reproducibility and (v) ability to accurately describe AMF communities. We show that primer pairs AMV4.5NF-AMDGR, AML1-AML2 and NS31-AML2 outperformed the other tested primer pairs in terms of number of Glomeromycota reads (AMF specificity and coverage). Additionally, these primer pairs were found to have no or only few mismatches to AMF sequences and were able to consistently describe AMF communities from apple roots. However, whereas most high-quality AMF sequences were obtained for AMV4.5NF-AMDGR, our results also suggest that this primer pair favored amplification of Glomeraceae sequences at the expense of Ambisporaceae, Claroideoglomeraceae and Paraglomeraceae sequences. Furthermore, we demonstrate the complementary specificity of AMV4.5NF-AMDGR with AML1-AML2, and of AMV4.5NF-AMDGR with NS31-AML2, making these primer combinations highly suitable for tandem use in covering the diversity of AMF communities. Copyright © 2014 Elsevier B.V. All rights reserved.

DNA polymerase preference determines PCR priming efficiency.

PubMed

Pan, Wenjing; Byrne-Steele, Miranda; Wang, Chunlin; Lu, Stanley; Clemmons, Scott; Zahorchak, Robert J; Han, Jian

2014-01-30

Polymerase chain reaction (PCR) is one of the most important developments in modern biotechnology. However, PCR is known to introduce biases, especially during multiplex reactions. Recent studies have implicated the DNA polymerase as the primary source of bias, particularly initiation of polymerization on the template strand. In our study, amplification from a synthetic library containing a 12 nucleotide random portion was used to provide an in-depth characterization of DNA polymerase priming bias. The synthetic library was amplified with three commercially available DNA polymerases using an anchored primer with a random 3' hexamer end. After normalization, the next generation sequencing (NGS) results of the amplified libraries were directly compared to the unamplified synthetic library. Here, high throughput sequencing was used to systematically demonstrate and characterize DNA polymerase priming bias. We demonstrate that certain sequence motifs are preferred over others as primers where the six nucleotide sequences at the 3' end of the primer, as well as the sequences four base pairs downstream of the priming site, may influence priming efficiencies. DNA polymerases in the same family from two different commercial vendors prefer similar motifs, while another commercially available enzyme from a different DNA polymerase family prefers different motifs. Furthermore, the preferred priming motifs are GC-rich. The DNA polymerase preference for certain sequence motifs was verified by amplification from single-primer templates. We incorporated the observed DNA polymerase preference into a primer-design program that guides the placement of the primer to an optimal location on the template. DNA polymerase priming bias was characterized using a synthetic library amplification system and NGS. The characterization of DNA polymerase priming bias was then utilized to guide the primer-design process and demonstrate varying amplification efficiencies among three commercially available DNA polymerases. The results suggest that the interaction of the DNA polymerase with the primer:template junction during the initiation of DNA polymerization is very important in terms of overall amplification bias and has broader implications for both the primer design process and multiplex PCR.

A Nested-Splicing by Overlap Extension PCR Improves Specificity of this Standard Method.

PubMed

Karkhane, Ali Asghar; Yakhchali, Bagher; Rastgar Jazii, Ferdous; Bambai, Bijan; Aminzadeh, Saeed; Rahimi, Fatemeh

2015-06-01

Splicing by overlap extension (SOE) PCR is used to create mutation in the coding sequence of an enzyme in order to study the role of specific residues in protein's structure and function. We introduced a nested-SOE-PCR (N -SOE-PCR) in order to increase the specificity and generating mutations in a gene by SOE-PCR. Genomic DNA from Bacillus thermocatenulatus was extracted. Nested PCR was used to amplify B. thermocatenulatus lipase gene variants, namely wild type and mutant, using gene specific and mutagenic specific primers, followed by cloning in a suitable vector. Briefly in N-SOE-PCR method, instead of two pairs of primers, three pairs of primers are used to amplify a mutagenic fragment. Moreover, the first and second PCR products are slightly longer than PCR products in a conventional SOE. PCR products obtained from the first round of PCR are used for the second PCR by applying the nested and mutated primers. Following to the purification of the amplified fragments, they will be subject of the further purification and will be used as template to perform the third round of PCR using gene specific primers. In the end, the products will be cloned into a suitable vector for subsequent application. In comparison to the conventional SOE-PCR, the improved method (i.e. N-SOE-PCR) increases the yield and specificity of the products. In addition, the proposed method shows a large reduction in the non-specific products. By applying two more primers in the conventional SOE, the specificity of the method will be improved. This would be in part due to annealing of the primers further inside the amplicon that increases both the efficiency and a better attachment of the primers. Positioning of the primer far from both ends of an amplicon leads to an enhanced binding as well as increased affinity in the third round of amplification in SOE.

Possible roles of HIV-1 nucleocapsid protein in the specificity of proviral DNA synthesis and in its variability.

PubMed

Lapadat-Tapolsky, M; Gabus, C; Rau, M; Darlix, J L

1997-05-02

Retroviral nucleocapsid (NC) protein is an integral part of the virion nucleocapsid where it coats the dimeric RNA genome. Due to its nucleic acid binding and annealing activities, NC protein directs the annealing of the tRNA primer to the primer binding site and greatly facilitates minus strand DNA elongation and transfer while protecting the nucleic acids against nuclease degradation. To understand the role of NCp7 in viral DNA synthesis, we examined the influence of NCp7 on self-primed versus primer-specific reverse transcription. The results show that HIV-1 NCp7 can extensively inhibit self-primed reverse transcription of viral and cellular RNAs while promoting primer-specific synthesis of proviral DNA. The role of NCp7 vis-a-vis the presence of mutations in the viral DNA during minus strand elongation was examined. NCp7 maximized the annealing between a cDNA(-) primer containing one to five consecutive errors and an RNA representing the 3' end of the genome. The ability of reverse transcriptase (RT) in the presence of NCp7 to subsequently extend the mutated primers depended upon the position of the mismatch within the primer:template complex. When the mutations were at the polymerisation site, primer extension by RT in the presence of NCp7 was very high, about 40% for one mismatch and 3% for five consecutive mismatches. Mutations within the DNA primer or at its 5' end had little effect on the extension of viral DNA by RT. Taken together these results indicate that NCp7 plays major roles in proviral DNA synthesis within the virion core due to its ability to promote prime-specific proviral DNA synthesis while concurrently inhibiting non-specific reverse transcription of viral and cellular RNAs. Moreover, the observation that NCp7 enhances the incorporation of mutations during minus strand DNA elongation favours the notion that NCp7 is a factor contributing to the high mutation rate of HIV-1.

One fungus, which genes? Development and assessment of universal primers for potential secondary fungal DNA barcodes.

PubMed

Stielow, J B; Lévesque, C A; Seifert, K A; Meyer, W; Iriny, L; Smits, D; Renfurm, R; Verkley, G J M; Groenewald, M; Chaduli, D; Lomascolo, A; Welti, S; Lesage-Meessen, L; Favel, A; Al-Hatmi, A M S; Damm, U; Yilmaz, N; Houbraken, J; Lombard, L; Quaedvlieg, W; Binder, M; Vaas, L A I; Vu, D; Yurkov, A; Begerow, D; Roehl, O; Guerreiro, M; Fonseca, A; Samerpitak, K; van Diepeningen, A D; Dolatabadi, S; Moreno, L F; Casaregola, S; Mallet, S; Jacques, N; Roscini, L; Egidi, E; Bizet, C; Garcia-Hermoso, D; Martín, M P; Deng, S; Groenewald, J Z; Boekhout, T; de Beer, Z W; Barnes, I; Duong, T A; Wingfield, M J; de Hoog, G S; Crous, P W; Lewis, C T; Hambleton, S; Moussa, T A A; Al-Zahrani, H S; Almaghrabi, O A; Louis-Seize, G; Assabgui, R; McCormick, W; Omer, G; Dukik, K; Cardinali, G; Eberhardt, U; de Vries, M; Robert, V

2015-12-01

The aim of this study was to assess potential candidate gene regions and corresponding universal primer pairs as secondary DNA barcodes for the fungal kingdom, additional to ITS rDNA as primary barcode. Amplification efficiencies of 14 (partially) universal primer pairs targeting eight genetic markers were tested across > 1 500 species (1 931 strains or specimens) and the outcomes of almost twenty thousand (19 577) polymerase chain reactions were evaluated. We tested several well-known primer pairs that amplify: i) sections of the nuclear ribosomal RNA gene large subunit (D1-D2 domains of 26/28S); ii) the complete internal transcribed spacer region (ITS1/2); iii) partial β -tubulin II (TUB2); iv) γ-actin (ACT); v) translation elongation factor 1-α (TEF1α); and vi) the second largest subunit of RNA-polymerase II (partial RPB2, section 5-6). Their PCR efficiencies were compared with novel candidate primers corresponding to: i) the fungal-specific translation elongation factor 3 (TEF3); ii) a small ribosomal protein necessary for t-RNA docking; iii) the 60S L10 (L1) RP; iv) DNA topoisomerase I (TOPI); v) phosphoglycerate kinase (PGK); vi) hypothetical protein LNS2; and vii) alternative sections of TEF1α. Results showed that several gene sections are accessible to universal primers (or primers universal for phyla) yielding a single PCR-product. Barcode gap and multi-dimensional scaling analyses revealed that some of the tested candidate markers have universal properties providing adequate infra- and inter-specific variation that make them attractive barcodes for species identification. Among these gene sections, a novel high fidelity primer pair for TEF1α, already widely used as a phylogenetic marker in mycology, has potential as a supplementary DNA barcode with superior resolution to ITS. Both TOPI and PGK show promise for the Ascomycota, while TOPI and LNS2 are attractive for the Pucciniomycotina, for which universal primers for ribosomal subunits often fail.

A Primer on Electric Utilities, Deregulation, and Restructuring of U.S. Electricity Markets

DOE Office of Scientific and Technical Information (OSTI.GOV)

Warwick, William M.

2002-06-03

This primer is offered as an introduction to utility restructuring to better prepare readers for ongoing changes in public utilities and associated energy markets. It is written for use by individuals with responsibility for the management of facilities that use energy, including energy managers, procurement staff, and managers with responsibility for facility operations and budgets. The primer was prepared by the Pacific Northwest National Laboratory under sponsorship from the U.S. Department of Energy?s Federal Energy Management Program. The impetus for this primer originally came from the Government Services Administration who supported its initial development.

A genomic library-based amplification approach (GL-PCR) for the mapping of multiple IS6110 insertion sites and strain differentiation of Mycobacterium tuberculosis.

PubMed

Namouchi, Amine; Mardassi, Helmi

2006-11-01

Evidence suggests that insertion of the IS6110 element is not without consequence to the biology of Mycobacterium tuberculosis complex strains. Thus, mapping of multiple IS6110 insertion sites in the genome of biomedically relevant clinical isolates would result in a better understanding of the role of this mobile element, particularly with regard to transmission, adaptability and virulence. In the present paper, we describe a versatile strategy, referred to as GL-PCR, that amplifies IS6110-flanking sequences based on the construction of a genomic library. M. tuberculosis chromosomal DNA is fully digested with HincII and then ligated into a plasmid vector between T7 and T3 promoter sequences. The ligation reaction product is transformed into Escherichia coli and selective PCR amplification targeting both 5' and 3' IS6110-flanking sequences are performed on the plasmid library DNA. For this purpose, four separate PCR reactions are performed, each combining an outward primer specific for one IS6110 end with either T7 or T3 primer. Determination of the nucleotide sequence of the PCR products generated from a single ligation reaction allowed mapping of 21 out of the 24 IS6110 copies of two 12 banded M. tuberculosis strains, yielding an overall sensitivity of 87,5%. Furthermore, by simply comparing the migration pattern of GL-PCR-generated products, the strategy proved to be as valuable as IS6110 RFLP for molecular typing of M. tuberculosis complex strains. Importantly, GL-PCR was able to discriminate between strains differing by a single IS6110 band.

Partial nucleotide sequences, and routine typing by polymerase chain reaction-restriction fragment length polymorphism, of the brown trout (Salmo trutta) lactate dehydrogenase, LDH-C1*90 and *100 alleles.

PubMed

McMeel, O M; Hoey, E M; Ferguson, A

2001-01-01

The cDNA nucleotide sequences of the lactate dehydrogenase alleles LDH-C1*90 and *100 of brown trout (Salmo trutta) were found to differ at position 308 where an A is present in the *100 allele but a G is present in the *90 allele. This base substitution results in an amino acid change from aspartic acid at position 82 in the LDH-C1 100 allozyme to a glycine in the 90 allozyme. Since aspartic acid has a net negative charge whilst glycine is uncharged, this is consistent with the electrophoretic observation that the LDH-C1 100 allozyme has a more anodal mobility relative to the LDH-C1 90 allozyme. Based on alignment of the cDNA sequence with the mouse genomic sequence, a local primer set was designed, incorporating the variable position, and was found to give very good amplification with brown trout genomic DNA. Sequencing of this fragment confirmed the difference in both homozygous and heterozygous individuals. Digestion of the polymerase chain reaction products with BslI, a restriction enzyme specific for the site difference, gave one, two and three fragments for the two homozygotes and the heterozygote, respectively, following electrophoretic separation. This provides a DNA-based means of routine screening of the highly informative LDH-C1* polymorphism in brown trout population genetic studies. Primer sets presented could be used to sequence cDNA of other LDH* genes of brown trout and other species.

Effect of clearfil protect bond and transbond plus self-etch primer on shear bond strength of orthodontic brackets

PubMed Central

Raji, S. Hamid; Ghorbanipour, Reza; Majdzade, Fateme

2011-01-01

Background: The aim of this study was to evaluate the shear bond strength of an antimicrobial and fluoride-releasing self-etch primer (clearfil protect bond) and compare it with transbond plus self-etch primer and conventional acid etching and priming system. Materials and Methods: Forty-eight extracted human premolars were divided randomly to three groups. In group 1, the teeth were bonded with conventional acid etching and priming method. In group 2, the teeth were bonded with clearfil protect bond self-etch primer, and transbond plus self-etch primer was used to bond the teeth in group 3. The samples were stored in 37°C distilled water and thermocycled. Then, the SBS of the sample was evaluated with Zwick testing machine. Descriptive statistics and the analysis of variances (ANOVA) and Tukey's test and Kruskal-Wallis were used to analyze the data. Results: The results of the ANOVA showed that the mean of group 3 was significantly lower than that of other groups. Most of the sample showed a pattern of failure within the adhesive resin. Conclusion: The shear bond strength of clearfil protect bond and transbond plus self-etch primer was enough for bonding the orthodontic brackets. The mode of failure of bonded brackets with these two self-etch primers is safe for enamel. PMID:23372605

Record surface state mobility and quantum Hall effect in topological insulator thin films via interface engineering

DOE PAGES

Koirala, Nikesh; Han, Myung -Geun; Brahlek, Matthew; ...

2015-11-19

Material defects remain as the main bottleneck to the progress of topological insulators (TIs). In particular, efforts to achieve thin TI samples with dominant surface transport have always led to increased defects and degraded mobilities, thus making it difficult to probe the quantum regime of the topological surface states. Here, by utilizing a novel buffer layer scheme composed of an In 2Se 3/(Bi 0.5In 0.5) 2Se 3 heterostructure, we introduce a quantum generation of Bi 2Se 3 films with an order of magnitude enhanced mobilities than before. Furthermore, this scheme has led to the first observation of the quantum Hallmore » effect in Bi 2Se 3.« less

Analysis of particles produced during airbag deployment by scanning electron microscopy with energy dispersive x-ray spectroscopy and their deposition on surrounding surfaces: a mid-research summary

NASA Astrophysics Data System (ADS)

Wyatt, J. Matney

2011-06-01

Airbags can be encountered in forensic work when investigating a car crash and are typically constructed with primerlike material to begin the deployment apparatus. The mechanisms of airbag deployment can produce particles ideal for scanning electron microscopy with energy dispersive X-ray spectroscopy (SEM/EDS) analysis. A recent study published by Berk studied airbags with vents and showed that it is possible for particles generated from the deployment of these airbags to deposit on surfaces in the vehicle as the airbags deflate.1 Another paper published by Berk reported particles similar in morphology and composition to primer gunshot residue (GSR) are produced by side impact airbags.2 This paper's aim will be to show mid-point results of a study still in progress in which non-vented airbags were analyzed to determine if they exhibited the same particle depositing features as their vented airbag counterparts. Further investigation in this study is being performed to find more airbags which produce primer gunshot residue-like particles containing lead, barium, and antimony from airbag deployment. To date, the study has resulted in (1) non-vented airbags exhibiting deposition of particles suitable for SEM/EDS analysis and (2) no gunshot residue-like particles being detected from the airbag residues studied thus far.

Quantitative Analysis of Diverse Lactobacillus Species Present in Advanced Dental Caries

PubMed Central

Byun, Roy; Nadkarni, Mangala A.; Chhour, Kim-Ly; Martin, F. Elizabeth; Jacques, Nicholas A.; Hunter, Neil

2004-01-01

Our previous analysis of 65 advanced dental caries lesions by traditional culture techniques indicated that lactobacilli were numerous in the advancing front of the progressive lesion. Production of organic acids by lactobacilli is considered to be important in causing decalcification of the dentinal matrix. The present study was undertaken to define more precisely the diversity of lactobacilli found in this environment and to quantify the major species and phylotypes relative to total load of lactobacilli by real-time PCR. Pooled DNA was amplified by PCR with Lactobacillus genus-specific primers for subsequent cloning, sequencing, and phylogenetic analysis. Based on 16S ribosomal DNA sequence comparisons, 18 different phylotypes of lactobacilli were detected, including strong representation of both novel and gastrointestinal phylotypes. Specific PCR primers were designed for nine prominent species, including Lactobacillus gasseri, L. ultunensis, L. salivarius, L. rhamnosus, L. casei, L. crispatus, L. delbrueckii, L. fermentum, and L. gallinarum. More than three different species were identified as being present in most of the dentine samples, confirming the widespread distribution and numerical importance of various Lactobacillus spp. in carious dentine. Quantification by real-time PCR revealed various proportions of the nine species colonizing carious dentine, with higher mean loads of L. gasseri and L. ultunensis than of the other prevalent species. The findings provide a basis for further characterization of the pathogenicity of Lactobacillus spp. in the context of extension of the carious lesion. PMID:15243071

Quantitative analysis of diverse Lactobacillus species present in advanced dental caries.

PubMed

Byun, Roy; Nadkarni, Mangala A; Chhour, Kim-Ly; Martin, F Elizabeth; Jacques, Nicholas A; Hunter, Neil

2004-07-01

Our previous analysis of 65 advanced dental caries lesions by traditional culture techniques indicated that lactobacilli were numerous in the advancing front of the progressive lesion. Production of organic acids by lactobacilli is considered to be important in causing decalcification of the dentinal matrix. The present study was undertaken to define more precisely the diversity of lactobacilli found in this environment and to quantify the major species and phylotypes relative to total load of lactobacilli by real-time PCR. Pooled DNA was amplified by PCR with Lactobacillus genus-specific primers for subsequent cloning, sequencing, and phylogenetic analysis. Based on 16S ribosomal DNA sequence comparisons, 18 different phylotypes of lactobacilli were detected, including strong representation of both novel and gastrointestinal phylotypes. Specific PCR primers were designed for nine prominent species, including Lactobacillus gasseri, L. ultunensis, L. salivarius, L. rhamnosus, L. casei, L. crispatus, L. delbrueckii, L. fermentum, and L. gallinarum. More than three different species were identified as being present in most of the dentine samples, confirming the widespread distribution and numerical importance of various Lactobacillus spp. in carious dentine. Quantification by real-time PCR revealed various proportions of the nine species colonizing carious dentine, with higher mean loads of L. gasseri and L. ultunensis than of the other prevalent species. The findings provide a basis for further characterization of the pathogenicity of Lactobacillus spp. in the context of extension of the carious lesion.

MELCOR computer code manuals: Primer and user`s guides, Version 1.8.3 September 1994. Volume 1

DOE Office of Scientific and Technical Information (OSTI.GOV)

Summers, R.M.; Cole, R.K. Jr.; Smith, R.C.

1995-03-01

MELCOR is a fully integrated, engineering-level computer code that models the progression of severe accidents in light water reactor nuclear power plants. MELCOR is being developed at Sandia National Laboratories for the US Nuclear Regulatory Commission as a second-generation plant risk assessment tool and the successor to the Source Term Code Package. A broad spectrum of severe accident phenomena in both boiling and pressurized water reactors is treated in MELCOR in a unified framework. These include: thermal-hydraulic response in the reactor coolant system, reactor cavity, containment, and confinement buildings; core heatup, degradation, and relocation; core-concrete attack; hydrogen production, transport, andmore » combustion; fission product release and transport; and the impact of engineered safety features on thermal-hydraulic and radionuclide behavior. Current uses of MELCOR include estimation of severe accident source terms and their sensitivities and uncertainties in a variety of applications. This publication of the MELCOR computer code manuals corresponds to MELCOR 1.8.3, released to users in August, 1994. Volume 1 contains a primer that describes MELCOR`s phenomenological scope, organization (by package), and documentation. The remainder of Volume 1 contains the MELCOR Users` Guides, which provide the input instructions and guidelines for each package. Volume 2 contains the MELCOR Reference Manuals, which describe the phenomenological models that have been implemented in each package.« less

An electronic laboratory notebook based on HTML forms

DOE Office of Scientific and Technical Information (OSTI.GOV)

Marstaller, J.E.; Zorn, M.D.

The electronic notebook records information that has traditionally been kept in handwritten laboratory notebooks. It keeps detailed information about the progress of the research , such as the optimization of primers, the screening of the primers and, finally, the mapping of the probes. The notebook provides two areas of services: Data entry, and reviewing of data in all stages. The World wide Web browsers, with HTML based forms provide a fast and easy mechanism to create forms-based user interfaces. The computer scientist can sit down with the biologist and rapidly make changes in response to the user`s comments. Furthermore themore » HTML forms work equally well on a number of different hardware platforms; thus the biologists may continue using their Macintosh computers and find a familiar interface if they have to work on a Unix workstation. The web browser can be run from any machine connected to the Internet: thus the users are free to enter or view information even away from their labs at home or while on travel. Access can be restricted by password and other means to secure the confidentiality of the data. A bonus that is hard to implement otherwise is the facile connection to outside resources. Linking local information to data in public databases is only a hypertext link away with little or no additional programming efforts.« less

Large-scale microsatellite development in grasspea (Lathyrus sativus L.), an orphan legume of the arid areas

PubMed Central

2014-01-01

Background Grasspea (Lathyrus sativus L., 2n = 14), a member of the family Leguminosae, holds great agronomic potential as grain and forage legume crop in the arid areas for its superb resilience to abiotic stresses such as drought, flood and salinity. The crop could not make much progress through conventional breeding in the past, and there are hardly any detailed molecular biology studies due to paucity of reliable molecular markers representative of the entire genome. Results Using the 454 FLX Titanium pyrosequencing technique, 651,827 simple sequence repeat (SSR) loci were identified and 50,144 nonredundant primer pairs were successfully designed, of which 288 were randomly selected for validation among 23 L. sativus and one L. cicera accessions of diverse provenance. 74 were polymorphic, 70 monomorphic, and 144 with no PCR product. The number of observed alleles ranged from two to five, the observed heterozygosity from 0 to 0.9545, and Shannon’s information index ranged from 0.1013 to 1.0980, respectively. The dendrogram constructed by using unweighted pair group method with arithmetic mean (UPGMA) based on Nei's genetic distance, showed obvious distinctions and understandable relationships among the 24 accessions. Conclusions The large number of SSR primer pairs developed in this study would make a significant contribution to genomics enabled improvement of grasspea. PMID:24635905

Leishmania infections: Molecular targets and diagnosis.

PubMed

Akhoundi, Mohammad; Downing, Tim; Votýpka, Jan; Kuhls, Katrin; Lukeš, Julius; Cannet, Arnaud; Ravel, Christophe; Marty, Pierre; Delaunay, Pascal; Kasbari, Mohamed; Granouillac, Bruno; Gradoni, Luigi; Sereno, Denis

2017-10-01

Progress in the diagnosis of leishmaniases depends on the development of effective methods and the discovery of suitable biomarkers. We propose firstly an update classification of Leishmania species and their synonymies. We demonstrate a global map highlighting the geography of known endemic Leishmania species pathogenic to humans. We summarize a complete list of techniques currently in use and discuss their advantages and limitations. The available data highlights the benefits of molecular markers in terms of their sensitivity and specificity to quantify variation from the subgeneric level to species complexes, (sub) species within complexes, and individual populations and infection foci. Each DNA-based detection method is supplied with a comprehensive description of markers and primers and proposal for a classification based on the role of each target and primer in the detection, identification and quantification of leishmaniasis infection. We outline a genome-wide map of genes informative for diagnosis that have been used for Leishmania genotyping. Furthermore, we propose a classification method based on the suitability of well-studied molecular markers for typing the 21 known Leishmania species pathogenic to humans. This can be applied to newly discovered species and to hybrid strains originating from inter-species crosses. Developing more effective and sensitive diagnostic methods and biomarkers is vital for enhancing Leishmania infection control programs. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.

Vygotsky on Education Primer. Peter Lang Primer. Volume 30

ERIC Educational Resources Information Center

Lake, Robert

2012-01-01

The "Vygotsky on Education Primer" serves as an introduction to the life and work of the Russian psychologist Lev Vygotsky. Even though he died almost eighty years ago, his life's work remains both relevant and significant to the field of education today. This book examines Vygotsky's emphasis on the role of cultural and historical context in…

The Fluid Reading Primer: Animated Decoding Support for Emergent Readers.

ERIC Educational Resources Information Center

Zellweger, Polle T.; Mackinlay, Jock D.

A prototype application called the Fluid Reading Primer was developed to help emergent readers with the process of decoding written words into their spoken forms. The Fluid Reading Primer is part of a larger research project called Fluid Documents, which is exploring the use of interactive animation of typography to show additional information in…

Nanotechnology: A Policy Primer

DTIC Science & Technology

2010-03-12

clean water. Nanotechnology water desalination and filtration systems may offer affordable, scalable, and portable water filtration...CRS Report for Congress Prepared for Members and Committees of Congress Nanotechnology : A Policy Primer John F. Sargent Jr. Specialist...DATES COVERED 00-00-2010 to 00-00-2010 4. TITLE AND SUBTITLE Nanotechnology : A Policy Primer 5a. CONTRACT NUMBER 5b. GRANT NUMBER 5c

Nanotechnology: A Policy Primer

DTIC Science & Technology

2010-01-04

clean water. Nanotechnology water desalination and filtration systems may offer affordable, scalable, and portable water filtration...CRS Report for Congress Prepared for Members and Committees of Congress Nanotechnology : A Policy Primer John F. Sargent Jr. Specialist...DATES COVERED 00-00-2010 to 00-00-2010 4. TITLE AND SUBTITLE Nanotechnology : A Policy Primer 5a. CONTRACT NUMBER 5b. GRANT NUMBER 5c

Protective Coats For Zinc-Rich Primers

NASA Technical Reports Server (NTRS)

Macdowell, Louis G, III

1993-01-01

Report describes tests of topcoats for inorganic zinc-rich primers on carbon steel. Topcoats intended to provide additional protection against corrosion in acidic, salty seacoast-air/rocket-engine-exhaust environment of Space Shuttle launch site. Tests focused on polyurethane topcoats on epoxy tie coats on primers. Part of study involved comparison between "high-build" coating materials and thin-film coating materials.

Sediment transport primer: estimating bed-material transport in gravel-bed rivers

Treesearch

Peter Wilcock; John Pitlick; Yantao Cui

2009-01-01

This primer accompanies the release of BAGS, software developed to calculate sediment transport rate in gravel-bed rivers. BAGS and other programs facilitate calculation and can reduce some errors, but cannot ensure that calculations are accurate or relevant. This primer was written to help the software user define relevant and tractable problems, select appropriate...

Newly developed primers for complete YCF1 amplification in Pinus (Pinaceae) chloroplasts with possible family-wide utility

Treesearch

Matthew Parks; Aaron Liston; Rich Cronn

2011-01-01

Primers were designed to amplify the highly variable locus ycf1 from all 11 subsections of Pinus to facilitate plastome assemblies based on short sequence reads as well as future phylogenetic and population genetic analyses. Primer design was based on alignment of 33 Pinus and four Pinaceae plastomes with...

The Household Detective Primer: Protecting Your Children from Toxins in the Home. CHEC's Guide to Environmental Childproofing.

ERIC Educational Resources Information Center

Schubert, Sandra; Zelinsky, Benjamin

Designed for parents, this primer presents information on threats to children's health that can be found in every American home, including disinfectants, art supplies, pesticides, and toxins in food and drinking water. The primer also provides practical information on safe and environmentally friendly household cleaners and disinfectants, outlines…

Primer ID Validates Template Sampling Depth and Greatly Reduces the Error Rate of Next-Generation Sequencing of HIV-1 Genomic RNA Populations

PubMed Central

Zhou, Shuntai; Jones, Corbin; Mieczkowski, Piotr

2015-01-01

ABSTRACT Validating the sampling depth and reducing sequencing errors are critical for studies of viral populations using next-generation sequencing (NGS). We previously described the use of Primer ID to tag each viral RNA template with a block of degenerate nucleotides in the cDNA primer. We now show that low-abundance Primer IDs (offspring Primer IDs) are generated due to PCR/sequencing errors. These artifactual Primer IDs can be removed using a cutoff model for the number of reads required to make a template consensus sequence. We have modeled the fraction of sequences lost due to Primer ID resampling. For a typical sequencing run, less than 10% of the raw reads are lost to offspring Primer ID filtering and resampling. The remaining raw reads are used to correct for PCR resampling and sequencing errors. We also demonstrate that Primer ID reveals bias intrinsic to PCR, especially at low template input or utilization. cDNA synthesis and PCR convert ca. 20% of RNA templates into recoverable sequences, and 30-fold sequence coverage recovers most of these template sequences. We have directly measured the residual error rate to be around 1 in 10,000 nucleotides. We use this error rate and the Poisson distribution to define the cutoff to identify preexisting drug resistance mutations at low abundance in an HIV-infected subject. Collectively, these studies show that >90% of the raw sequence reads can be used to validate template sampling depth and to dramatically reduce the error rate in assessing a genetically diverse viral population using NGS. IMPORTANCE Although next-generation sequencing (NGS) has revolutionized sequencing strategies, it suffers from serious limitations in defining sequence heterogeneity in a genetically diverse population, such as HIV-1 due to PCR resampling and PCR/sequencing errors. The Primer ID approach reveals the true sampling depth and greatly reduces errors. Knowing the sampling depth allows the construction of a model of how to maximize the recovery of sequences from input templates and to reduce resampling of the Primer ID so that appropriate multiplexing can be included in the experimental design. With the defined sampling depth and measured error rate, we are able to assign cutoffs for the accurate detection of minority variants in viral populations. This approach allows the power of NGS to be realized without having to guess about sampling depth or to ignore the problem of PCR resampling, while also being able to correct most of the errors in the data set. PMID:26041299

Mechanics of biological networks: from the cell cytoskeleton to connective tissue.

PubMed

Pritchard, Robyn H; Huang, Yan Yan Shery; Terentjev, Eugene M

2014-03-28

From the cell cytoskeleton to connective tissues, fibrous networks are ubiquitous in metazoan life as the key promoters of mechanical strength, support and integrity. In recent decades, the application of physics to biological systems has made substantial strides in elucidating the striking mechanical phenomena observed in such networks, explaining strain stiffening, power law rheology and cytoskeletal fluidisation - all key to the biological function of individual cells and tissues. In this review we focus on the current progress in the field, with a primer into the basic physics of individual filaments and the networks they form. This is followed by a discussion of biological networks in the context of a broad spread of recent in vitro and in vivo experiments.

Investigation of test methods, material properties, and processes for solar cell encapsulants

NASA Technical Reports Server (NTRS)

Willis, P. B.

1985-01-01

Progress in solar energy technology is reported in the following areas: aging and life prediction methodology and devices for solar cell encapsulation; the function of adhesion chemistry, primers, and a new diagnostic technique for estimations of bond durability; a study of fire retardant formulations for decreasing the potential flammability of solar modules; initial studies of the electrical insulating properties of encapsulation materials and measurement of the intrinsic dielectric strength; antisoiling compounds for the prevention of soil build-up on the outer surface of the module; and low temperature processing encapsulants that permit module fabrication at temperatures less than 100 C. Another area of study has been added to determine the degree to which formulation and processes affect the module quality and manufacturing yield.

Effects of dual antibacterial agents MDPB and nano-silver in primer on microcosm biofilm, cytotoxicity and dentin bond properties

PubMed Central

Zhang, Ke; Cheng, Lei; Imazato, Satoshi; Antonucci, Joseph M.; Lin, Nancy J.; Lin-Gibson, Sheng; Bai, Yuxing; Xu, Hockin H. K.

2013-01-01

Objectives The objective of this study was to investigate the effects of dentin primer containing dual antibacterial agents, namely, 12-methacryloyloxydodecylpyridinium bromide (MDPB) and nanoparticles of silver (NAg), on dentin bond strength, dental plaque microcosm biofilm response, and fibroblast cytotoxicity for the first time. Methods Scotchbond Multi-Purpose (SBMP) was used as the parent bonding agent. Four primers were tested: SBMP primer control (referred to as “P”), P+5%MDPB, P+0.05%NAg, and P+5%MDPB+0.05%NAg. Dentin shear bond strengths were measured using extracted human teeth. Biofilms from the mixed saliva of 10 donors were cultured to investigate metabolic activity, colony-forming units (CFU), and lactic acid production. Human fibroblast cytotoxicity of the four primers was tested in vitro. Results Incorporating MDPB and NAg into primer did not reduce dentin bond strength compared to control (p>0.1). SEM revealed well-bonded adhesive-dentin interfaces with numerous resin tags. MDPB or NAg each greatly reduced biofilm viability and acid production, compared to control. Dual agents MDPB+NAg had a much stronger effect than either agent alone (p<0.05), increasing inhibition zone size and reducing metabolic activity, CFU and lactic acid by an order of magnitude, compared to control. There was no difference in cytotoxicity between commercial control and antibacterial primers (p>0.1). Conclusions The method of using dual agents MDPB+NAg in the primer yielded potent antibacterial properties. Hence, this method may be promising to combat residual bacteria in tooth cavity and invading bacteria at the margins. The dual agents MDPB+NAg may have wide applicability to other adhesives, composites, sealants and cements to inhibit biofilms and caries. PMID:23402889

Dental primer and adhesive containing a new antibacterial quaternary ammonium monomer dimethylaminododecyl methacrylate

PubMed Central

Cheng, Lei; Weir, Michael D.; Zhang, Ke; Arola, Dwayne D.; Zhou, Xuedong; Xu, Hockin H. K.

2013-01-01

Objectives The main reason for restoration failure is secondary caries caused by biofilm acids. Replacing the failed restorations accounts for 50–70% of all operative work. The objectives of this study were to incorporate a new quaternary ammonium monomer (dimethylaminododecyl methacrylate, DMADDM) and nanoparticles of silver (NAg) into a primer and an adhesive, and to investigate their effects on antibacterial and dentin bonding properties. Methods Scotchbond Multi-Purpose (SBMP) served as control. DMADDM was synthesized and incorporated with NAg into primer/adhesive. A dental plaque microcosm biofilm model with human saliva was used to investigate metabolic activity, colony-forming units (CFU), and lactic acid. Dentin shear bond strengths were measured. Results Minimum inhibitory concentration (MIC) and minimum bactericidal concentration (MBC) of the new DMADDM were orders of magnitude lower than those of a previous quaternary ammonium dimethacrylate (QADM). Uncured primer with DMADDM had much larger inhibition zones than QADM (p<0.05). Cured primer/adhesive with DMADDM-NAg greatly reduced biofilm metabolic activity (p<0.05). Combining DMADDM with NAg in primer/adhesive resulted in less CFU than DMADDM alone (p<0.05). Lactic acid production by biofilms was reduced by 20-fold via DMADDM-NAg, compared to control. Incorporation of DMADDM and NAg into primer/adhesive did not adversely affect dentin bond strength. Conclusions A new antibacterial monomer DMADDM was synthesized and incorporated into primer/adhesive for the first time. The bonding agents are promising to combat residual bacteria in tooth cavity and invading bacteria at tooth-restoration margins to inhibit caries. DMADDM and NAg are promising for use into a wide range of dental adhesive systems and restoratives. PMID:23353068

Application of Locked Nucleic Acid (LNA) Primer and PCR Clamping by LNA Oligonucleotide to Enhance the Amplification of Internal Transcribed Spacer (ITS) Regions in Investigating the Community Structures of Plant-Associated Fungi.

PubMed

Ikenaga, Makoto; Tabuchi, Masakazu; Kawauchi, Tomohiro; Sakai, Masao

2016-09-29

The simultaneous extraction of host plant DNA severely limits investigations of the community structures of plant-associated fungi due to the similar homologies of sequences in primer-annealing positions between fungi and host plants. Although fungal-specific primers have been designed, plant DNA continues to be excessively amplified by PCR, resulting in the underestimation of community structures. In order to overcome this limitation, locked nucleic acid (LNA) primers and PCR clamping by LNA oligonucleotides have been applied to enhance the amplification of fungal internal transcribed spacer (ITS) regions. LNA primers were designed by converting DNA into LNA, which is specific to fungi, at the forward primer side. LNA oligonucleotides, the sequences of which are complementary to the host plants, were designed by overlapping a few bases with the annealing position of the reverse primer. Plant-specific DNA was then converted into LNA at the shifted position from the 3' end of the primer-binding position. PCR using the LNA technique enhanced the amplification of fungal ITS regions, whereas those of the host plants were more likely to be amplified without the LNA technique. A denaturing gradient gel electrophoresis (DGGE) analysis displayed patterns that reached an acceptable level for investigating the community structures of plant-associated fungi using the LNA technique. The sequences of the bands detected using the LNA technique were mostly affiliated with known isolates. However, some sequences showed low similarities, indicating the potential to identify novel fungi. Thus, the application of the LNA technique is considered effective for widening the scope of community analyses of plant-associated fungi.

Optimization of β-glucan synthase gene primers for molecular DNA fingerprinting in Pleurotus pulmonarious

NASA Astrophysics Data System (ADS)

Kadir, Zaiton Abdul; Daud, Fauzi; Mohamad, Azhar; Senafi, Sahidan; Jamaludin, Ferlynda Fazleen

2015-09-01

Pleurotus pulmonarius is an edible mushroom in Malaysia and commonly known as Oyster mushroom. The species are important not only for nutritional values but also for pharmaceutical importance related to bioactive compounds in polysaccharides such as β glucan. Hence, β-glucan synthase gene (BGS) pathways which are related to the production of the β-glucan might be useful as marker for molecular DNA fingerprinting in P. pulmonarius. Conserved regions of β-glucan gene were mined from public database and aligned. Consensus from the alignment was used to design the primers by using Primer 3 software. Eight primers were designed and a single primer pair (BGF3: 5' TCTTGGCGAGTTCGAAGAAT 3'; BGR3: 5' TTCCGATCTTGGTCTGGAAG 3') was optimized at Ta (annealing temperature) 57.1°C to produce PCR product ranging from 400-500 bp. Optimum components for PCR reactions were 5.0 µl of 10× PCR buffer, 1.5 µl of 25 mM MgCl2, 1 µl of 10 mM dNTP, 1 µl of β-glucan primers, 0.1 µl of 5 units/ml Taq polymerase and 2 µl DNA template. PCR program was set at 34 PCR cycles by using Bio-Rad T100 Thermal Cycler. Initial denaturation was set at 94°C for 2 min, denaturation at 94°C for 1 minute, primer annealing at 45°C to 60°C (gradient temperature) for 50 seconds, followed by elongation at 72°C for 1 minute and further extension 5 minutes for last cycle PCR prior to end the program cycle. Thus, this information revealed that the primer of β-glucan gene designed could be used as targeted markers in screening population strains of P. pulmonarius.

Enhanced sensitivity of CpG island search and primer design based on predicted CpG island position.

PubMed

Park, Hyun-Chul; Ahn, Eu-Ree; Jung, Ju Yeon; Park, Ji-Hye; Lee, Jee Won; Lim, Si-Keun; Kim, Won

2018-05-01

DNA methylation has important biological roles, such as gene expression regulation, as well as practical applications in forensics, such as in body fluid identification and age estimation. DNA methylation often occurs in the CpG site, and methylation within the CpG islands affects various cellular functions and is related to tissue-specific identification. Several programs have been developed to identify CpG islands; however, the size, location, and number of predicted CpG islands are not identical due to different search algorithms. In addition, they only provide structural information for predicted CpG islands without experimental information, such as primer design. We developed an analysis pipeline package, CpGPNP, to integrate CpG island prediction and primer design. CpGPNP predicts CpG islands more accurately and sensitively than other programs, and designs primers easily based on the predicted CpG island locations. The primer design function included standard, bisulfite, and methylation-specific PCR to identify the methylation of particular CpG sites. In this study, we performed CpG island prediction on all chromosomes and compared CpG island search performance of CpGPNP with other CpG island prediction programs. In addition, we compared the position of primers designed for a specific region within the predicted CpG island using other bisulfite PCR primer programs. The primers designed by CpGPNP were used to experimentally verify the amplification of the target region of markers for body fluid identification and age estimation. CpGPNP is freely available at http://forensicdna.kr/cpgpnp/. Copyright © 2018 Elsevier B.V. All rights reserved.

Beam shaping for laser initiated optical primers

NASA Astrophysics Data System (ADS)

Lizotte, Todd E.

2008-08-01

Remington was one of the first firearm manufacturing companies to file a patent for laser initiated firearms, in 1969. Nearly 40 years later, the development of laser initiated firearms has not become a mainstream technology in the civilian market. Requiring a battery is definitely a short coming, so it is easy to see how such a concept would be problematic. Having a firearm operate reliably and the delivery of laser energy in an efficient manner to ignite the shock-sensitive explosive primer mixtures is a tall task indeed. There has been considerable research on optical element based methods of transferring or compressing laser energy to ignite primer charges, including windows, laser chip primers and various lens shaped windows to focus the laser energy. The focusing of laser light needs to achieve igniting temperatures upwards of >400°C. Many of the patent filings covering this type of technology discuss simple approaches where a single point of light might be sufficient to perform this task. Alternatively a multi-point method might provide better performance, especially for mission critical applications, such as precision military firearms. This paper covers initial design and performance test of the laser beam shaping optics to create simultaneous multiple point ignition locations and a circumferential intense ring for igniting primer charge compounds. A simple initial test of the ring beam shaping technique was evaluated on a standard large caliber primer to determine its effectiveness on igniting the primer material. Several tests were conducted to gauge the feasibility of laser beam shaping, including optic fabrication and mounting on a cartridge, optic durability and functional ignition performance. Initial data will be presented, including testing of optically elements and empirical primer ignition / burn analysis.

An Efficient Approach for the Development of Locus Specific Primers in Bread Wheat (Triticum aestivum L.) and Its Application to Re-Sequencing of Genes Involved in Frost Tolerance

PubMed Central

Babben, Steve; Perovic, Dragan; Koch, Michael; Ordon, Frank

2015-01-01

Recent declines in costs accelerated sequencing of many species with large genomes, including hexaploid wheat (Triticum aestivum L.). Although the draft sequence of bread wheat is known, it is still one of the major challenges to developlocus specific primers suitable to be used in marker assisted selection procedures, due to the high homology of the three genomes. In this study we describe an efficient approach for the development of locus specific primers comprising four steps, i.e. (i) identification of genomic and coding sequences (CDS) of candidate genes, (ii) intron- and exon-structure reconstruction, (iii) identification of wheat A, B and D sub-genome sequences and primer development based on sequence differences between the three sub-genomes, and (iv); testing of primers for functionality, correct size and localisation. This approach was applied to single, low and high copy genes involved in frost tolerance in wheat. In summary for 27 of these genes for which sequences were derived from Triticum aestivum, Triticum monococcum and Hordeum vulgare, a set of 119 primer pairs was developed and after testing on Nulli-tetrasomic (NT) lines, a set of 65 primer pairs (54.6%), corresponding to 19 candidate genes, turned out to be specific. Out of these a set of 35 fragments was selected for validation via Sanger's amplicon re-sequencing. All fragments, with the exception of one, could be assigned to the original reference sequence. The approach presented here showed a much higher specificity in primer development in comparison to techniques used so far in bread wheat and can be applied to other polyploid species with a known draft sequence. PMID:26565976

Genetic diversity of Palestine landraces of faba bean (Vicia faba) based on RAPD markers.

PubMed

Basheer-Salimia, R; Shtaya, M; Awad, M; Abdallah, J; Hamdan, Y

2013-09-03

Until now, neither phenotypic nor molecular approaches have been used to characterize the landraces of Palestine faba beans (Vicia faba). We used PCR-based RAPD markers to determine the genetic diversity and relatedness among 26 Palestinian faba bean landraces (traditional farmers' varieties) from 8 localities in the West Bank, Palestine. In tests with 37 primers, 14 generated no polymorphic bands, 12 exhibited weak and unclear products, and 11 primers produced good amplification products with high intensity and pattern stability. Ninety-four DNA fragments (loci) were detected, with an average of 8.54 loci per primer and size ranging from 160 to 1370 bp. A minimum of 4 and a maximum of 14 DNA fragments were obtained using (OPA-05 and OPA-09) and (BC-261) primers, respectively. The maximum percentage of polymorphic markers was 71.4 (BC-298) and the minimum was 50.0 (OPA-05, -09, -16). The 11 primers exhibited relatively high collective resolving power (Rp) values of 26.316, and varied from 0.154 for the OPA-09 primer to 5.236 for the BC-261, with an overall mean of 2.392. The primers BC-261, -322, and -298 were found to be the most useful RAPD primers to assess the genetic diversity of Palestinian faba beans, as they revealed relatively high Rp rates (5.236, 3.618, and 3.150, respectively). Based on the Jaccard coefficient, the genetic distance ranged from 0.358 to 0.069, with a mean of 0.213. We conclude that the RAPD technique is useful for determining genetic diversity and for developing suitable fingerprints for faba bean landraces grown in Palestine.

47 CFR 90.403 - General operating requirements.

Code of Federal Regulations, 2010 CFR

2010-10-01

... communications in progress and such other measures as may be necessary to minimize the potential for causing... 90.403 Telecommunication FEDERAL COMMUNICATIONS COMMISSION (CONTINUED) SAFETY AND SPECIAL RADIO SERVICES PRIVATE LAND MOBILE RADIO SERVICES Operating Requirements § 90.403 General operating requirements...

Oligonucleotide primers, probes and molecular methods for the environmental monitoring of methanogenic archaea

PubMed Central

Narihiro, Takashi; Sekiguchi, Yuji

2011-01-01

Summary For the identification and quantification of methanogenic archaea (methanogens) in environmental samples, various oligonucleotide probes/primers targeting phylogenetic markers of methanogens, such as 16S rRNA, 16S rRNA gene and the gene for the α‐subunit of methyl coenzyme M reductase (mcrA), have been extensively developed and characterized experimentally. These oligonucleotides were designed to resolve different groups of methanogens at different taxonomic levels, and have been widely used as hybridization probes or polymerase chain reaction primers for membrane hybridization, fluorescence in situ hybridization, rRNA cleavage method, gene cloning, DNA microarray and quantitative polymerase chain reaction for studies in environmental and determinative microbiology. In this review, we present a comprehensive list of such oligonucleotide probes/primers, which enable us to determine methanogen populations in an environment quantitatively and hierarchically, with examples of the practical applications of the probes and primers. PMID:21375721

Detection and identification of Brettanomyces/Dekkera sp. yeasts with a loop-mediated isothermal amplification method.

PubMed

Hayashi, Nobuyuki; Arai, Ritsuko; Tada, Setsuzo; Taguchi, Hiroshi; Ogawa, Yutaka

2007-01-01

Primer sets for a loop-mediated isothermal amplification (LAMP) method were developed to specifically identify each of the four Brettanomyces/Dekkera species, Dekkera anomala, Dekkera bruxellensis, Dekkera custersiana and Brettanomyces naardenensis. Each primer set was designed with target sequences in the ITS region of the four species and could specifically amplify the target DNA of isolates from beer, wine and soft drinks. Furthermore, the primer sets differentiated strains of the target species from strains belonging to other species, even within the genus Brettanomyces/Dekkera. Moreover, the LAMP method with these primer sets could detect about 1 x 10(1) cfu/ml of Brettanomyces/Dekkera yeasts from suspensions in distilled water, wine and beer. This LAMP method with primer sets for the identification of Brettanomyces/Dekkera yeasts is advantageous in terms of specificity, sensitivity and ease of operation compared with standard PCR methods.

Information theory-based algorithm for in silico prediction of PCR products with whole genomic sequences as templates.

PubMed

Cao, Youfang; Wang, Lianjie; Xu, Kexue; Kou, Chunhai; Zhang, Yulei; Wei, Guifang; He, Junjian; Wang, Yunfang; Zhao, Liping

2005-07-26

A new algorithm for assessing similarity between primer and template has been developed based on the hypothesis that annealing of primer to template is an information transfer process. Primer sequence is converted to a vector of the full potential hydrogen numbers (3 for G or C, 2 for A or T), while template sequence is converted to a vector of the actual hydrogen bond numbers formed after primer annealing. The former is considered as source information and the latter destination information. An information coefficient is calculated as a measure for fidelity of this information transfer process and thus a measure of similarity between primer and potential annealing site on template. Successful prediction of PCR products from whole genomic sequences with a computer program based on the algorithm demonstrated the potential of this new algorithm in areas like in silico PCR and gene finding.

Hexavalent Chromium IV-Free Primer Development

NASA Technical Reports Server (NTRS)

Alldredge, Michael J.; Buck, Amy L.

2015-01-01

Primer materials provide corrosion protection for metal parts as well as an increased adhesion between metallic substrates and thermal protection systems (TPSs). Current primers for use in cryogenic applications contain hexavalent chromium. This hexavalent chromium provides excellent corrosion protection even in a cryogenic environment, but it is a carcinogen that requires special equipment and waste control procedures to use. The hazardous nature of hexavalent chromium makes it an obsolescence risk in the future. This study included two phases of evaluation. Thirteen primers were initially identified as candidates and twelve of those primers were tested in phase 1. Four of the best performing candidates from phase 1 continued into phase 2 testing. Phase 1 testing consisted mostly of liquid constituent and physical property testing. Cryoflex and salt fog testing were included in phase 1 because of their importance to the overall success of a candidate material. Phase 2 consisted of physical, thermal, and mechanical properties for nominally processed and fabricated specimens.

Detection of giardine gene in local isolates of Giardia duodenalis by polymerase chain reaction (PCR).

PubMed

Latifah, I; Teoh, K Y; Wan, K L; Rahmah, M; Normaznah, Y; Rohani, A

2005-12-01

Giardia duodenalis is an intestinal parasite that causes diarrhoea and malabsorption in children. The parasite also infects AIDS patients with a weak immune system. A study was carried out on six local isolates of Giardia duodenalis (110, 7304, 6304, M007, 2002 and 6307) from faeces of Orang Asli patients admitted to the Gombak Hospital. WB, a reference pathogenic strain from human and G. muris from a wild mouse, were commercially obtained from the American Type Culture Collection (ATCC). All the isolates were cultured axenically in TYI-S-33 medium. Two sets of primers were used for the techniques: primers LP1 and RP1 and primers LP2 and RP2. The sets of primers amplified giardine gene of 171 bp and 218 bp in sizes respectively. The study showed that the two sets of primers could detect G. duodenalis to the genus and species level specifically.

Development of Primer Pairs from Molecular Typing of Rabies Virus Variants Present in Mexico

PubMed Central

Ramírez-Hernández, Dolores G.; Lara-Padilla, Eleazar; Zárate-Segura, Paola

2016-01-01

Nucleoprotein (N) gene from rabies virus (RABV) is a useful sequence target for variant studies. Several specific RABV variants have been characterized in different mammalian hosts such as skunk, dog, and bats by using anti-nucleocapsid monoclonal antibodies (MAbs) via indirect fluorescent antibody (IFA) test, a technique not available in many laboratories in Mexico. In the present study, a total of 158 sequences of N gene from RABV were used to design eight pairs of primers (four external and four internal primers), for typing four different RABV variants (dog, skunk, vampire bat, and nonhematophagous bat) which are most common in Mexico. The results indicate that the primer and the typing variant from the brain samples, submitted to nested and/or real-time PCR, are in agreement in all four singleplex reactions, and the designed primer pairs are an alternative for use in specific variant RABV typing. PMID:27563666

Development of Primer Pairs from Molecular Typing of Rabies Virus Variants Present in Mexico.

PubMed

Bastida-González, Fernando; Ramírez-Hernández, Dolores G; Chavira-Suárez, Erika; Lara-Padilla, Eleazar; Zárate-Segura, Paola

2016-01-01

Nucleoprotein (N) gene from rabies virus (RABV) is a useful sequence target for variant studies. Several specific RABV variants have been characterized in different mammalian hosts such as skunk, dog, and bats by using anti-nucleocapsid monoclonal antibodies (MAbs) via indirect fluorescent antibody (IFA) test, a technique not available in many laboratories in Mexico. In the present study, a total of 158 sequences of N gene from RABV were used to design eight pairs of primers (four external and four internal primers), for typing four different RABV variants (dog, skunk, vampire bat, and nonhematophagous bat) which are most common in Mexico. The results indicate that the primer and the typing variant from the brain samples, submitted to nested and/or real-time PCR, are in agreement in all four singleplex reactions, and the designed primer pairs are an alternative for use in specific variant RABV typing.

In vitro cytotoxicity of orthodontic primers.

PubMed

D'Antò, Vincenzo; Spagnuolo, Gianrico; Polito, Ilaria; Paduano, Sergio; Ambrosio, Luigi; Valletta, Rosa

2009-01-01

The aim of this study was to evaluate the cytotoxicity of four orthodontic primers: Transbond XT and Transbond MIP (3M, USA), Eagle Fluorsure (American Orthodontics, USA) and Ortho Solo (Ormco, USA). Balb 3T3 cells were exposed to different concentrations of primers (0-0.25 mg/ml). Mitochondrial dehydrogenase activity was evaluated by MTT assay and cell necrosis was measured by flow cytometry (propidium iodide staining). All the materials decreased cell viability in a dose related manner. Cytotoxicity of orthodontic primers based on concentrations which caused a 50% decrease of mitochondrial activity was ranked as follows: Transbond XT (45.57 mg/ml) > Eagle Fluorsure (49.27 mg/ml) > Transbond MIP (64.35 mg/ml) > Ortho solo (70.09 mg/ml). Our results suggest that the cytotoxic potencies demonstrated by orthodontic primers might be of clinical relevance since they disturbed cell metabolism and induced cell death in monolayer cultures.

Progress Towards Microwave Ignition of Explosives

NASA Astrophysics Data System (ADS)

Curling, Mark; Collins, Adam; Dima, Gabriel; Proud, William

2009-06-01

Microwaves could provide a method of propellant ignition that does away with a traditional primer, making ammunition safer and suitable for Insensitive Munitions (IM) applications. By embedding a suitable material inside a propellant, it is postulated that microwaves could be used to stimulate hotspots, through direct heating or electrostatic discharge (arcing) across the energetic material. This paper reports on progress in finding these suitable materials. Graphite rod, magnetite cubes and powders of graphite, aluminium, copper oxide, and iron were irradiated in a conventional microwave oven. Temperature measurements were made using a shielded thermocouple and thermal paints. Only graphite rod and magnetite showed significant heating upon microwave exposure. The light output from arcing of iron, steel, iron pyrite, magnetite and graphite was measured in the same microwave oven as above. Sample mass and shape were correlated with arcing intensity. A strategy is proposed to create a homogeneous igniter material by embedding arcing materials within an insulator, Polymethylpentene (TPX). External discharges were transmitted through TPX, however no embedded samples were successful in generating an electrical breakdown suitable for propellant ignition.

Challenges and progress in making DNA-based AIS early ...

EPA Pesticide Factsheets

The ability of DNA barcoding to find additional species in hard-to-sample locations or hard-to-identify samples is well established. Nevertheless, adoption of DNA barcoding into regular monitoring programs has been slow, in part due to issues of standardization and interpretation that need resolving. In this presentation, we describe our progress towards incorporating DNA-based identification into broad-spectrum aquatic invasive species early-detection monitoring in the Laurentian Great Lakes. Our work uses community biodiversity information as the basis for evaluating survey performance for various taxonomic groups. Issues we are tackling in bringing DNA-based data to bear on AIS monitoring design include: 1) Standardizing methodology and work flow from field collection and sample handling through bioinformatics post-processing; 2) Determining detection sensitivity and accounting for inter-species differences in DNA amplification and primer affinity; 3) Differentiating sequencing and barcoding errors from legitimate new finds when range and natural history information is limited; and 4) Accounting for the different nature of morphology- vs. DNA-based biodiversity information in subsequent analysis (e.g., via species accumulation curves, multi-metric indices). not applicable

Genetic disorders with heterotopic ossificans

PubMed Central

Sankar, Ruthiramurthy; Gowrishankar, Kalpana; Viswanathan, Saraswati

2015-01-01

Fibrodysplasia ossificans progressiva (FOP) and progressive ossific heteroplasia (POH) are rare genetic disorders characterized by heterotopic bone formation leading to progressive loss of mobility and function. We report three cases of these rare disorders (two cases of FOP and one case of POH), which were clinically diagnosed and underwent genetic analysis. The aim of this report is to highlight the clinical features and the differences between these two conditions. We would also like to emphasize on the morbidity that can arise from unnecessary invasive investigations for diagnostic purposes. PMID:26015640

The Resistome of Farmed Fish Feces Contributes to the Enrichment of Antibiotic Resistance Genes in Sediments below Baltic Sea Fish Farms

PubMed Central

Muziasari, Windi I.; Pitkänen, Leena K.; Sørum, Henning; Stedtfeld, Robert D.; Tiedje, James M.; Virta, Marko

2017-01-01

Our previous studies showed that particular antibiotic resistance genes (ARGs) were enriched locally in sediments below fish farms in the Northern Baltic Sea, Finland, even when the selection pressure from antibiotics was negligible. We assumed that a constant influx of farmed fish feces could be the plausible source of the ARGs enriched in the farm sediments. In the present study, we analyzed the composition of the antibiotic resistome from the intestinal contents of 20 fish from the Baltic Sea farms. We used a high-throughput method, WaferGen qPCR array with 364 primer sets to detect and quantify ARGs, mobile genetic elements (MGE), and the 16S rRNA gene. Despite a considerably wide selection of qPCR primer sets, only 28 genes were detected in the intestinal contents. The detected genes were ARGs encoding resistance to sulfonamide (sul1), trimethoprim (dfrA1), tetracycline [tet(32), tetM, tetO, tetW], aminoglycoside (aadA1, aadA2), chloramphenicol (catA1), and efflux-pumps resistance genes (emrB, matA, mefA, msrA). The detected genes also included class 1 integron-associated genes (intI1, qacEΔ1) and transposases (tnpA). Importantly, most of the detected genes were the same genes enriched in the farm sediments. This preliminary study suggests that feces from farmed fish contribute to the ARG enrichment in farm sediments despite the lack of contemporaneous antibiotic treatments at the farms. We observed that the intestinal contents of individual farmed fish had their own resistome compositions. Our result also showed that the total relative abundances of transposases and tet genes were significantly correlated (p = 0.001, R2 = 0.71). In addition, we analyzed the mucosal skin and gill filament resistomes of the farmed fish but only one multidrug-efflux resistance gene (emrB) was detected. To our knowledge, this is the first study reporting the resistome of farmed fish using a culture-independent method. Determining the possible sources of ARGs, especially mobilized ARGs, is essential for controlling the occurrence and spread of ARGs at fish farming facilities and for lowering the risk of ARG spread from the farms to surrounding environments. PMID:28111573

The Resistome of Farmed Fish Feces Contributes to the Enrichment of Antibiotic Resistance Genes in Sediments below Baltic Sea Fish Farms.

PubMed

Muziasari, Windi I; Pitkänen, Leena K; Sørum, Henning; Stedtfeld, Robert D; Tiedje, James M; Virta, Marko

2016-01-01

Our previous studies showed that particular antibiotic resistance genes (ARGs) were enriched locally in sediments below fish farms in the Northern Baltic Sea, Finland, even when the selection pressure from antibiotics was negligible. We assumed that a constant influx of farmed fish feces could be the plausible source of the ARGs enriched in the farm sediments. In the present study, we analyzed the composition of the antibiotic resistome from the intestinal contents of 20 fish from the Baltic Sea farms. We used a high-throughput method, WaferGen qPCR array with 364 primer sets to detect and quantify ARGs, mobile genetic elements (MGE), and the 16S rRNA gene. Despite a considerably wide selection of qPCR primer sets, only 28 genes were detected in the intestinal contents. The detected genes were ARGs encoding resistance to sulfonamide ( sul1 ), trimethoprim ( dfrA1 ), tetracycline [ tet(32), tetM, tetO, tetW ], aminoglycoside ( aadA1, aadA2 ), chloramphenicol ( catA1 ), and efflux-pumps resistance genes ( emrB, matA, mefA, msrA ). The detected genes also included class 1 integron-associated genes ( intI1, qacE Δ 1 ) and transposases ( tnpA ). Importantly, most of the detected genes were the same genes enriched in the farm sediments. This preliminary study suggests that feces from farmed fish contribute to the ARG enrichment in farm sediments despite the lack of contemporaneous antibiotic treatments at the farms. We observed that the intestinal contents of individual farmed fish had their own resistome compositions. Our result also showed that the total relative abundances of transposases and tet genes were significantly correlated ( p = 0.001, R 2 = 0.71). In addition, we analyzed the mucosal skin and gill filament resistomes of the farmed fish but only one multidrug-efflux resistance gene ( emrB ) was detected. To our knowledge, this is the first study reporting the resistome of farmed fish using a culture-independent method. Determining the possible sources of ARGs, especially mobilized ARGs, is essential for controlling the occurrence and spread of ARGs at fish farming facilities and for lowering the risk of ARG spread from the farms to surrounding environments.

Summary of the Impact of the Inclusion of Mobile Phone Numbers into the NSW Population Health Survey in 2012.

PubMed

Barr, Margo; Ferguson, Raymond; van Ritten, Jason; Hughes, Phil; Steel, David

2015-01-01

Although it was estimated that 20% of the population in Australia were mobile-only phone users in 2010, the inclusion of mobile numbers into computer-assisted telephone interviews (CATI) behavioural risk factor surveys did not occur until 2012. Three papers have been published describing the methods, weighting strategy and the impact in detail of including mobile numbers into the NSW Population Health Survey (NSWPHS). This paper identifies the important components of those papers and summarises them for a broader audience. In the 2012 NSWPHS, 15,214 (15,149 with weights) interviews were completed (64% landline frame; 36% mobile frame). Response, cooperation and contact rates were 37%, 65% and 69% respectively. The inclusion of mobile phone numbers resulted in a sample that was closer to the NSW population profile and impacted on the time series of estimates for alcohol drinking, recommended fruit consumption, current smoking, and overweight or obesity. The papers found that including mobile phone numbers into NSWPHS did not impact negatively on response rates or data collection, but it did cost more and affect the time series for some behavioural risk factors, in that it corrected the estimates that had been produced from a sample frame that was progressively getting less representative of the population.

Change in physical mobility over 10 years in post-polio syndrome.

PubMed

Bickerstaffe, A; Beelen, A; Nollet, F

2015-03-01

Post-polio syndrome is characterised by progressive muscle weakness and other symptoms which can limit physical mobility. We assessed the rate of decline in mobility over 10 years in relation to strength decline; and investigated potential predictors for the rate of decline of walking capacity, a measure of mobility, in 48 patients with post-polio syndrome and proven quadriceps dysfunction at baseline. Average walking capacity and self-reported physical mobility declined over 10 years, by 6 and 14%, respectively. Concomitantly people lost an average of 15% of isometric quadriceps strength. Significantly more people used walking aids offering greater support at follow-up. Notably, there was much individual variation, with 18% of participants losing a substantial amount of walking capacity (27% decline) and concomitant self-reported physical mobility (38% decline). Loss of quadriceps strength only explained a small proportion of the variance of the decline in walking capacity (R = 11%) and the rate of decline could not be predicted from baseline values for strength, walking capacity, self-reported physical mobility or basic demographics. The individual variability, yet lack of predictive factors, underscores the need for personally tailored care based on actual functional decline in patients with post-polio syndrome. Copyright © 2014. Published by Elsevier B.V.

Public Use of Mobile Medical Applications: A Case Study on Cloud-Based Medical Service of Taiwan.

PubMed

Lu, Chen-Luan; Yan, Yu-Hua

2016-01-01

The use of smart mobile devices has been getting increasingly popular. The focus of this study is an attempt to explore the development of mobile medical App by medical centers and regional hospitals of Taiwan and the function of the App for comparison. The results show indicated that many hospitals developed Apps for the public for mobile medical service, of which 26 medical centers (100%) and 72 regional hospitals (84.7%) availed appointment making service via Apps. The result indicated variance at significant level (p < 0.01). There are 23 medical centers (88.5%) and 74 regional hospitals (87.1%) availed Apps for checking service progress. The result indicated insignificant variance level (p > 0.01). We can see that mobile medical service is gradually emerging as a vital issue. Yet, this is a new domain in medical service. With the mushrooming of medical applications in smart mobile devices, the medical service system is expected to be installed in these devices to enhance interactive mode of operation and inquiry services, such as medication and inquiries into physical examination results. By then, people can learn the status of their health with this system.

Fostering learners' interaction with content: A learner-centered mobile device interface

NASA Astrophysics Data System (ADS)

Abdous, M.

2015-12-01

With the ever-increasing omnipresence of mobile devices in student life, leveraging smart devices to foster students' interaction with course content is critical. Following a learner-centered design iterative approach, we designed a mobile interface that may enable learners to access and interact with online course content efficiently and intuitively. Our design process leveraged recent technologies, such as bootstrap, Google's Material Design, HTML5, and JavaScript to design an intuitive, efficient, and portable mobile interface with a variety of built-in features, including context sensitive bookmarking, searching, progress tracking, captioning, and transcript display. The mobile interface also offers students the ability to ask context-related questions and to complete self-checks as they watch audio/video presentations. Our design process involved ongoing iterative feedback from learners, allowing us to refine and tweak the interface to provide learners with a unified experience across platforms and devices. The innovative combination of technologies built around well-structured and well-designed content seems to provide an effective learning experience to mobile learners. Early feedback indicates a high level of satisfaction with the interface's efficiency, intuitiveness, and robustness from both students and faculty.

Defense Primer: A Guide for New Members

DTIC Science & Technology

2017-03-03

1 President’s Constitutional Authority with Regard to the Armed Forces ................................... 1 The Department of Defense ...primers to give Members of Congress an overview of key aspects of the Department of Defense and how Congress exercises authority over it. A consolidated...for New Members Congressional Research Service 2 The Department of Defense CRS In Focus IF10543, Defense Primer: The Department of Defense , by

Genome-wide characterization and selection of expressed sequence tag simple sequence repeat primers for optimized marker distribution and reliability in peach

USDA-ARS?s Scientific Manuscript database

Expressed sequence tag (EST) simple sequence repeats (SSRs) in Prunus were mined, and flanking primers designed and used for genome-wide characterization and selection of primers to optimize marker distribution and reliability. A total of 12,618 contigs were assembled from 84,727 ESTs, along with 34...

Primers for polymerase chain reaction to detect genomic DNA of Toxocara canis and T. cati.

PubMed

Wu, Z; Nagano, I; Xu, D; Takahashi, Y

1997-03-01

Primers for polymerase chain reaction to amplify genomic DNA of both Toxocara canis and T. cati were constructed by adapting cloning and sequencing random amplified polymorphic DNA. The primers are expected to detect eggs and/or larvae of T. canis and T. cati, both of which are known to cause toxocariasis in humans.

40 CFR 63.5749 - How do I calculate the organic HAP content of aluminum wipedown solvents?

Code of Federal Regulations, 2013 CFR

2013-07-01

... solvents, kilograms of HAP per liter of total coating solids from aluminum primers, top coats, and clear... = volume of aluminum primer, top coat, or clear coat i used in the past 12 months, liters. Solidsi= solids content aluminum primer, top coat, or clear coat i, liter solids per liter of coating. (b) Compliance is...

40 CFR 63.5749 - How do I calculate the organic HAP content of aluminum wipedown solvents?

Code of Federal Regulations, 2012 CFR

2012-07-01

... solvents, kilograms of HAP per liter of total coating solids from aluminum primers, top coats, and clear... = volume of aluminum primer, top coat, or clear coat i used in the past 12 months, liters. Solidsi= solids content aluminum primer, top coat, or clear coat i, liter solids per liter of coating. (b) Compliance is...

40 CFR 63.5749 - How do I calculate the organic HAP content of aluminum wipedown solvents?

Code of Federal Regulations, 2014 CFR

2014-07-01

... solvents, kilograms of HAP per liter of total coating solids from aluminum primers, top coats, and clear... = volume of aluminum primer, top coat, or clear coat i used in the past 12 months, liters. Solidsi = solids content aluminum primer, top coat, or clear coat i, liter solids per liter of coating. (b) Compliance is...

Metastable Intermolecular Composites (MIC) Primers for Small Caliber Cartridges and Cartridge Actuated Devices

DTIC Science & Technology

2009-07-01

24 iii ACRONYMS AND ABBREVIATIONS ATF Armaments Technology Facility ATK Alliant Techsystems, Inc. ARDEC Armament Research...Technology Facility ( ATF ) firings there, and was instrumental in producing the primers and loading the cartridges needed for the supplemental...and CADs known as the percussion primer. The novel properties associated with nanostructure materials have resulted in the development of thermite

A Dozen Primers on Important Information Standards

ERIC Educational Resources Information Center

Dempsey, Kathy, Comp.

2007-01-01

This is a compilation of 12 primers on important information standards and protocols. These primers are: (1) Atom; (2) COinS; (3) MADS; (4) MARC 21/MARCXML; (5) MIX; (6) MXG; (7) OpenSearch; (8) PREMIS; (9) RESTful HTTP; (10) unAPI; (11) XMPP (aka Jabber); and (12) ZeeRex. The Atom Syndication Format defines a new XML-based syndication format for…

Molecular Genetic Studies of Bone Mechanical Strain and of Pedigrees with Very High Bone Density

DTIC Science & Technology

2009-11-01

mice. We used Cre-recombinase primer (F- TTA GCA CCA CGG CAG CAG GAG GTT and R-CAG GCC AGA TCT CCT GTG CAG CAT) and loxp primer (Primer 1, AGT GAT...Leprdb heterozygotes during breeding. Three types of littermates are produced from breeding these heterozygotes: the misty gray homozygote (m +/m +), the

BchY-based degenerate primers target all types of anoxygenic photosynthetic bacteria in a single PCR.

PubMed

Yutin, Natalya; Suzuki, Marcelino T; Rosenberg, Mira; Rotem, Denisse; Madigan, Michael T; Süling, Jörg; Imhoff, Johannes F; Béjà, Oded

2009-12-01

To detect anoxygenic bacteria containing either type 1 or type 2 photosynthetic reaction centers in a single PCR, we designed a degenerate primer set based on the bchY gene. The new primers were validated in silico using the GenBank nucleotide database as well as by PCR on pure strains and environmental DNA.

Electrocoat Process for Non-Chromate Primers in DoD Manufacturing

DTIC Science & Technology

2011-02-01

requirements are uniquely  suited for aerospace  aluminum. ↑ O2 ↑ H2 Anode (+) Cathode (-) Deposited Film Alkaline  clean Rinse ElectrocoatSurface...Objectives ● Demonstration and validation of a novel, non‐chromated,  environmentally friendly,  electrodeposited  primer. ● The primers will be

Universal primers for amplification of the complete mitochondrial control region in marine fish species.

PubMed

Cheng, Y Z; Xu, T J; Jin, X X; Tang, D; Wei, T; Sun, Y Y; Meng, F Q; Shi, G; Wang, R X

2012-01-01

Through multiple alignment analysis of mitochondrial tRNA-Thr and tRNA-Phe sequences from 161 fishes, new universal primers specially targeting the entire mitochondrial control region were designed. This new primer set successfully amplified the expected PCR products from various kinds of marine fish species, belonging to various families, and the amplified segments were confirmed to be the control region by sequencing. These primers provide a useful tool to study the control region diversity in economically important fish species, the possible mechanism of control region evolution, and the functions of the conserved motifs in the control region.

FUNGAL BIOGEOGRAPHY. Response to Comment on "Global diversity and geography of soil fungi".

PubMed

Tedersoo, Leho; Bahram, Mohammad; Põlme, Sergei; Anslan, Sten; Riit, Taavi; Kõljalg, Urmas; Nilsson, R Henrik; Hildebrand, Falk; Abarenkov, Kessy

2015-08-28

Schadt and Rosling (Technical Comment, 26 June 2015, p. 1438) argue that primer-template mismatches neglected the fungal class Archaeorhizomycetes in a global soil survey. Amplicon-based metabarcoding of nine barcode-primer pair combinations and polymerase chain reaction (PCR)-free shotgun metagenomics revealed that barcode and primer choice and PCR bias drive the diversity and composition of microorganisms in general, but the Archaeorhizomycetes were little affected in the global study. We urge that careful choice of DNA markers and primers is essential for ecological studies using high-throughput sequencing for identification. Copyright © 2015, American Association for the Advancement of Science.

Primer on spontaneous heating and pyrophoricity

DOE Office of Scientific and Technical Information (OSTI.GOV)

Not Available

1994-12-01

This primer was prepared as an information resource for personnel responsible for operation of DOE nuclear facilities. It has sections on combustion principles, spontaneous heating/ignition of hydrocarbons and organics, pyrophoric gases and liquids, pyrophoric nonmetallic solids, pyrophoric metals (including Pu and U), and accident case studies. Although the information in this primer is not all-encompassing, it should provide the reader with a fundamental knowledge level sufficient to recognize most spontaneous combustion hazards and how to prevent ignition and widespread fires. This primer is provided as an information resource only, and is not intended to replace any fire protection or hazardousmore » material training.« less

A physicists guide to The Los Alamos Primer

NASA Astrophysics Data System (ADS)

Reed, B. Cameron

2016-11-01

In April 1943, a group of scientists at the newly established Los Alamos Laboratory were given a series of lectures by Robert Serber on what was then known of the physics and engineering issues involved in developing fission bombs. Serber’s lectures were recorded in a 24 page report titled The Los Alamos Primer, which was subsequently declassified and published in book form. This paper describes the background to the Primer and analyzes the physics contained in its 22 sections. The motivation for this paper is to provide a firm foundation of the background and contents of the Primer for physicists interested in the Manhattan Project and nuclear weapons.

Cytochrome c oxidase I primers for corbiculate bees: DNA barcode and mini-barcode.

PubMed

Françoso, E; Arias, M C

2013-09-01

Bees (Apidae), of which there are more than 19 900 species, are extremely important for ecosystem services and economic purposes, so taxon identity is a major concern. The goal of this study was to optimize the DNA barcode technique based on the Cytochrome c oxidase (COI) mitochondrial gene region. This approach has previously been shown to be useful in resolving taxonomic inconsistencies and for species identification when morphological data are poor. Specifically, we designed and tested new primers and standardized PCR conditions to amplify the barcode region for bees, focusing on the corbiculate Apids. In addition, primers were designed to amplify small COI amplicons and tested with pinned specimens. Short barcode sequences were easily obtained for some Bombus century-old museum specimens and shown to be useful as mini-barcodes. The new primers and PCR conditions established in this study proved to be successful for the amplification of the barcode region for all species tested, regardless of the conditions of tissue preservation. We saw no evidence of Wolbachia or numts amplification by these primers, and so we suggest that these new primers are of broad value for corbiculate bee identification through DNA barcode. © 2013 John Wiley & Sons Ltd.

Design and Evaluation of PCR Primers for Analysis of Bacterial Populations in Wine by Denaturing Gradient Gel Electrophoresis

PubMed Central

Lopez, Isabel; Ruiz-Larrea, Fernanda; Cocolin, Luca; Orr, Erica; Phister, Trevor; Marshall, Megan; VanderGheynst, Jean; Mills, David A.

2003-01-01

Denaturing gradient gel electrophoresis (DGGE) of PCR-amplified ribosomal DNA (rDNA) is routinely used to compare levels of diversity of microbial communities and to monitor population dynamics. While using PCR-DGGE to examine the bacteria in wine fermentations, we noted that several commonly used PCR primers for amplifying bacterial 16S rDNA also coamplified yeast, fungal, or plant DNA present in samples. Unfortunately, amplification of nonbacterial DNA can result in a masking of bacterial populations in DGGE profiles. To surmount this problem, we developed two new primer sets for specific amplification of bacterial 16S rDNA in wine fermentation samples without amplification of eukaryotic DNA. One primer set, termed WLAB1 and WLAB2, amplified lactic acid bacteria, while another, termed WBAC1 and WBAC2, amplified both lactic acid bacterial and acetic acid bacterial populations found in wine. Primer specificity and efficacy were examined with DNA isolated from numerous bacterial, yeast, and fungal species commonly found in wine and must samples. Importantly, both primer sets effectively distinguished bacterial species in wine containing mixtures of yeast and bacteria. PMID:14602643

Characterization of highly informative cross-species microsatellite panels for the Australian dugong (Dugong dugon) and Florida manatee (Trichechus manatus latirostris) including five novel primers

USGS Publications Warehouse

Hunter, Margaret Kellogg; Broderick, Damien; Ovenden, Jennifer R.; Tucker, Kimberly Pause; Bonde, Robert K.; McGuire, Peter M.; Lanyon, Janet M.

2010-01-01

The Australian dugong (Dugong dugon) and Florida manatee (Trichechus manatus latirostris) are threatened species of aquatic mammals in the order Sirenia. Sirenian conservation and management actions would benefit from a more complete understanding of genetic diversity and population structure. Generally, species-specific microsatellite markers are employed in conservation genetic studies; however, robust markers can be difficult and costly to isolate. To increase the number of available markers, dugong and manatee microsatellite primers were evaluated for cross-species amplification. Furthermore, one manatee and four dugong novel primers are reported. After polymerase chain reaction optimization, 23 (92%) manatee primers successfully amplified dugong DNA, of which 11 (48%) were polymorphic. Of the 32 dugong primers tested, 27 (84%) yielded product in the manatee, of which 17 (63%) were polymorphic. Dugong and manatee primers were compared and the most informative markers were selected to create robust and informative marker-panels for each species. These crossspecies microsatellite marker-panels can be employed to assess other sirenian populations and can provide beneficial information for the protection and management of these unique mammals.

DNA-based species level detection of Glomeromycota: one PCR primer set for all arbuscular mycorrhizal fungi.

PubMed

Krüger, Manuela; Stockinger, Herbert; Krüger, Claudia; Schüssler, Arthur

2009-01-01

* At present, molecular ecological studies of arbuscular mycorrhizal fungi (AMF) are only possible above species level when targeting entire communities. To improve molecular species characterization and to allow species level community analyses in the field, a set of newly designed AMF specific PCR primers was successfully tested. * Nuclear rDNA fragments from diverse phylogenetic AMF lineages were sequenced and analysed to design four primer mixtures, each targeting one binding site in the small subunit (SSU) or large subunit (LSU) rDNA. To allow species resolution, they span a fragment covering the partial SSU, whole internal transcribed spacer (ITS) rDNA region and partial LSU. * The new primers are suitable for specifically amplifying AMF rDNA from material that may be contaminated by other organisms (e.g., samples from pot cultures or the field), characterizing the diversity of AMF species from field samples, and amplifying a SSU-ITS-LSU fragment that allows phylogenetic analyses with species level resolution. * The PCR primers can be used to monitor entire AMF field communities, based on a single rDNA marker region. Their application will improve the base for deep sequencing approaches; moreover, they can be efficiently used as DNA barcoding primers.

Genetic diversity analysis of tree peony germplasm using iPBS markers.

PubMed

Duan, Y B; Guo, D L; Guo, L L; Wei, D F; Hou, X G

2015-07-06

We examined the genetic diversity of 10 wild species (populations) and 55 varieties of tree peony using inter-primer binding site (iPBS) markers. From a total of 36 iPBS primers, 16 were selected based on polymorphic amplification. The number of bands amplified by each primer ranged from 9 to 19, with an average of 12.88 bands per primer. The length of bands ranged from 100 to 2000 bp, concentrated at 200 to 1800 bp. Sixteen primers amplified 206 bands in total, of which 173 bands were polymorphic with a polymorphism ratio of 83.98%. Each primer amplified 10.81 polymorphic bands on average. The data were then used to construct a phylogenetic tree using unweighted pair group method with arithmetic mean methods. Clustering analysis showed that the genetic relationships among the varieties were not only related to the genetic background or geographic origin, but also to the flowering phase, flower color, and flower type. Our data also indicated that iPBS markers were useful tools for classifying tree peony germplasms and for tree peony breeding, and the specific bands were helpful for molecular identification of tree peony varieties.

A flexible and economical barcoding approach for highly multiplexed amplicon sequencing of diverse target genes

PubMed Central

Herbold, Craig W.; Pelikan, Claus; Kuzyk, Orest; Hausmann, Bela; Angel, Roey; Berry, David; Loy, Alexander

2015-01-01

High throughput sequencing of phylogenetic and functional gene amplicons provides tremendous insight into the structure and functional potential of complex microbial communities. Here, we introduce a highly adaptable and economical PCR approach to barcoding and pooling libraries of numerous target genes. In this approach, we replace gene- and sequencing platform-specific fusion primers with general, interchangeable barcoding primers, enabling nearly limitless customized barcode-primer combinations. Compared to barcoding with long fusion primers, our multiple-target gene approach is more economical because it overall requires lower number of primers and is based on short primers with generally lower synthesis and purification costs. To highlight our approach, we pooled over 900 different small-subunit rRNA and functional gene amplicon libraries obtained from various environmental or host-associated microbial community samples into a single, paired-end Illumina MiSeq run. Although the amplicon regions ranged in size from approximately 290 to 720 bp, we found no significant systematic sequencing bias related to amplicon length or gene target. Our results indicate that this flexible multiplexing approach produces large, diverse, and high quality sets of amplicon sequence data for modern studies in microbial ecology. PMID:26236305

Colorimetric molecular diagnosis of the HIV gag gene using DNAzyme and a complementary DNA-extended primer.

PubMed

Kim, Seong U; Batule, Bhagwan S; Mun, Hyoyoung; Byun, Ju-Young; Shim, Won-Bo; Kim, Min-Gon

2018-02-07

We have developed a novel strategy for the colorimetric detection of PCR products by utilizing a target-specific primer modified at the 5'-end with an anti-DNAzyme sequence. A single-stranded DNAzyme sequence folds into a G-quadruplex structure with hemin and shows strong peroxidase activity. When the complementary strand binds to the DNAzyme sequence, it blocks the formation of the G-quadraduplex structure and loses its peroxidase activity. In the presence of the target gene, PCR amplification proceeds, and anti-DNAzyme sequence modified primers present in the reaction mixture form a double strand through primer extension. Therefore, it does not block the DNAzyme sequence. Further, a colorimetric signal is generated by the addition of 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonate) (ABTS) and H 2 O 2 at the end of the reaction. We have successfully detected a single copy of the HIV type 1 gag gene in buffer and 10 copies in human serum. The strategy developed could be used to detect DNA and RNA in complex biological samples by simple primer designing that includes DNAzyme and a DNA extended primer.

Comparison of the Performances of Five Primer Sets for the Detection and Quantification of Plasmodium in Anopheline Vectors by Real-Time PCR.

PubMed

Chaumeau, V; Andolina, C; Fustec, B; Tuikue Ndam, N; Brengues, C; Herder, S; Cerqueira, D; Chareonviriyaphap, T; Nosten, F; Corbel, V

2016-01-01

Quantitative real-time polymerase chain reaction (qrtPCR) has made a significant improvement for the detection of Plasmodium in anopheline vectors. A wide variety of primers has been used in different assays, mostly adapted from molecular diagnosis of malaria in human. However, such an adaptation can impact the sensitivity of the PCR. Therefore we compared the sensitivity of five primer sets with different molecular targets on blood stages, sporozoites and oocysts standards of Plasmodium falciparum (Pf) and P. vivax (Pv). Dilution series of standard DNA were used to discriminate between methods at low concentrations of parasite and to generate standard curves suitable for the absolute quantification of Plasmodium sporozoites. Our results showed that the best primers to detect blood stages were not necessarily the best ones to detect sporozoites. Absolute detection threshold of our qrtPCR assay varied between 3.6 and 360 Pv sporozoites and between 6 and 600 Pf sporozoites per mosquito according to the primer set used in the reaction mix. In this paper, we discuss the general performance of each primer set and highlight the need to use efficient detection methods for transmission studies.

Comparison of the Performances of Five Primer Sets for the Detection and Quantification of Plasmodium in Anopheline Vectors by Real-Time PCR

PubMed Central

Chaumeau, V.; Andolina, C.; Fustec, B.; Tuikue Ndam, N.; Brengues, C.; Herder, S.; Cerqueira, D.; Chareonviriyaphap, T.; Nosten, F.; Corbel, V.

2016-01-01

Quantitative real-time polymerase chain reaction (qrtPCR) has made a significant improvement for the detection of Plasmodium in anopheline vectors. A wide variety of primers has been used in different assays, mostly adapted from molecular diagnosis of malaria in human. However, such an adaptation can impact the sensitivity of the PCR. Therefore we compared the sensitivity of five primer sets with different molecular targets on blood stages, sporozoites and oocysts standards of Plasmodium falciparum (Pf) and P. vivax (Pv). Dilution series of standard DNA were used to discriminate between methods at low concentrations of parasite and to generate standard curves suitable for the absolute quantification of Plasmodium sporozoites. Our results showed that the best primers to detect blood stages were not necessarily the best ones to detect sporozoites. Absolute detection threshold of our qrtPCR assay varied between 3.6 and 360 Pv sporozoites and between 6 and 600 Pf sporozoites per mosquito according to the primer set used in the reaction mix. In this paper, we discuss the general performance of each primer set and highlight the need to use efficient detection methods for transmission studies. PMID:27441839

A PCR-based method for detecting the mycelia of stipitate hydnoid fungi in soil.

PubMed

van der Linde, Sietse; Alexander, Ian; Anderson, Ian C

2008-09-01

To reduce the reliance on sporocarp records for conservation efforts, information on the below-ground distribution of specific fungal species, such as stipitate hydnoid fungi, is required. Species-specific primers were developed within the internal transcribed spacer (ITS1 and ITS2) regions for 12 hydnoid fungal species including Bankera fuligineoalba, Hydnellum aurantiacum, H. caeruleum, H. concrescens, H. ferrugineum, H. peckii, Phellodon confluens, P. melaleucus, P. niger, P. tomentosus, Sarcodon glaucopus and S. squamosus. The specificity of the primer pairs was tested using BLAST searches and PCR amplifications. All primers amplified DNA only of the target species with the exception of those designed for P. melaleucus. In order to assess the ability of the primers to detect DNA from mycelium in soil, DNA extracted from soil samples taken from around solitary H. peckii sporocarps was amplified with the H. peckii primer 1peck and ITS2. H. peckii DNA was detected in 70% of all soil samples and up to 40 cm away from the base of individual sporocarps. The development of these species-specific primers provides a below-ground alternative for monitoring the distribution of these rare fungi.

Formulation and Assessment of a Wash-Primer Containing Lanthanum "Tannate" for Steel Temporary Protection

NASA Astrophysics Data System (ADS)

D'Alessandro, Oriana; Selmi, Gonzalo J.; Deyá, Cecilia; Di Sarli, Alejandro; Romagnoli, Roberto

2018-02-01

Tannins are polyphenols synthesized by plants and useful for the coating industry as corrosion inhibitors. In addition, lanthanum salts have a great inhibitory effect on steel corrosion. The aim of this study was to obtain lanthanum "tannate" with adequate solubility to be incorporated as the corrosion inhibitor in a wash-primer. The "tannate" was obtained from commercial "Quebracho" tannin and 0.1 M La(NO3)3. The soluble tannin was determined by the Folin-Denis reagent, while the concentration of Lanthanum was obtained by a gravimetric procedure. The protective action of "tannate" on SAE 1010 steel was evaluated by linear polarization curves and corrosion potential measurements. Lanthanum "tannate" was incorporated in a wash-primer formulation and tested by corrosion potential and ionic resistance measurements. The corrosion rate was also determined by the polarization resistance technique. Besides, the primer was incorporated in an alkyd paint system and its anticorrosion performance assessed in the salt spray cabinet and by electrochemical impedance spectroscopy. Results showed that lanthanum "tannate" primer inhibits the development of deleterious iron oxyhydroxides on the steel substrate and incorporated into a paint system had a similar behavior to the primer formulated with zinc tetroxychromate.

A New Primer to Amplify pmoA Gene From NC10 Bacteria in the Sediments of Dongchang Lake and Dongping Lake.

PubMed

Wang, Shenghui; Liu, Yanjun; Liu, Guofu; Huang, Yaru; Zhou, Yu

2017-08-01

Nitrite-dependent anaerobic methane oxidation (n-damo) is catalyzed by the NC10 phylum bacterium "Candidatus Methylomirabilis oxyfera" (M. oxyfera). Generally, the pmoA gene is applied as a functional marker to test and identify NC10-like bacteria. However, it is difficult to detect the NC10 bacteria from sediments of freshwater lake (Dongchang Lake and Dongping Lake) with the previous pmoA gene primer sets. In this work, a new primer cmo208 was designed and used to amplify pmoA gene of NC10-like bacteria. A newly nested PCR approach was performed using the new primer cmo208 and the previous primers cmo182, cmo682, and cmo568 to detect the NC10 bacteria. The obtained pmoA gene sequences exhibited 85-92% nucleotide identity and 95-97% amino acid sequence identity to pmoA gene of M. oxyfera. The obtained diversity of pmoA gene sequences coincided well with the diversity of 16S rRNA sequences. These results indicated that the newly designed pmoA primer cmo208 could give one more option to detect NC10 bacteria from different environmental samples.

Characterization of Novel Di-, Tri-, and Tetranucleotide Microsatellite Primers Suitable for Genotyping Various Plant Pathogenic Fungi with Special Emphasis on Fusaria and Mycospherella graminicola

PubMed Central

Bahkali, Ali H.; Abd-Elsalam, Kamel A.; Guo, Jian-Rong; Khiyami, Mohamed A.; Verreet, Joseph-Alexander

2012-01-01

The goals of this investigation were to identify and evaluate the use of polymorphic microsatellite marker (PMM) analysis for molecular typing of seventeen plant pathogenic fungi. Primers for di-, tri-, and tetranucleotide loci were designed directly from the recently published genomic sequence of Mycospherlla graminicola and Fusarium graminearum. A total of 20 new microsatellite primers as easy-to-score markers were developed. Microsatellite primer PCR (MP-PCR) yielded highly reproducible and complex genomic fingerprints, with several bands ranging in size from 200 to 3000 bp. Of the 20 primers tested, only (TAGG)4, (TCC)5 and (CA)7T produced a high number of polymorphic bands from either F. graminearum or F. culmorum. (ATG)5 led to successful amplifications in M. graminicola isolates collected from Germany. Percentage of polymorphic bands among Fusarium species ranged from 9 to 100%. Cluster analysis of banding patterns of the isolates corresponded well to the established species delineations based on morphology and other methods of phylogenetic analysis. The current research demonstrates that the newly designed microsatellite primers are reliable, sensitive and technically simple tools for assaying genetic variability in plant pathogenic fungi. PMID:22489135

Novel priming and crosslinking systems for use with isocyanatomethacrylate dental adhesives.

PubMed

Chappelow, C C; Power, M D; Bowles, C Q; Miller, R G; Pinzino, C S; Eick, J D

2000-11-01

(a) to design, formulate and evaluate prototype primers and a crosslinking agent for use with isocyanatomethacrylate-based comonomer adhesives and (b) to establish correlations between bond strength and solubility parameter differences between the adhesives and etched dentin, and the permeability coefficients of the adhesives. Equimolar mixtures of 2-isocyanatoethyl methacrylate (IEM) and a methacrylate comonomer were formulated with tri-n-butyl borane oxide (TBBO) as the free radical initiator to have cure times of 6-10 min. Shear bond strengths to dentin were determined for each adhesive mixture (n = 7) using standard testing protocols. Shear bond strengths for the three systems were also determined after application of "reactive primers" to the dentin surface. The "reactive primers" contained 10-20 parts by weight of the respective comonomer mixture and 3.5 parts by weight TBBO in acetone. Solubility parameters difference values (delta delta) and permeability coefficients (P) were approximated for each adhesive system and correlated with shear bond strength values. Additionally, a crosslinking agent was prepared by bulk reaction of an equimolar mixture containing IEM and a methacrylate comonomer. The effects of crosslinker addition on: (a) the setting time of IEM; and (b) the setting times and initiator requirements of selected IEM/comonomer mixtures were determined. Shear bond strength values (MPa): IEM/HEMA 13.6 +/- 2.0 (no primer), 20.1 +/- 2.0 (with primer); IEM/HETMA 9.3 +/- 3.3 (no primer), 20.8 +/- 8.1 (with primer); IEM/AAEMA 13.6 +/- 1.9 (no primer), 17.3 +/- 3.2 (with primer). Also, approximated permeability coefficients showed a significant correlation (r = +0.867, p < 0.001) with shear bond strength values. Crosslinker addition studies with IEM/4-META: (a) at 5-9 mol% reduced the setting time of IEM polymerization by 79%; and (b) at 6 mol% reduced initiator level requirements 60-70% to achieve a comparable setting time, and decreased setting times by ca. 75% for a given initiator level with selected IEM/methacrylate adhesive systems. The shear bond strengths of isocyanatomethacrylate-based dental adhesives can be enhanced by using reactive primers; their setting times and initiator requirements can be improved using a dimethacrylate crosslinker. Approximated permeability coefficients may be useful as indicators of bonding performance for dentin adhesive systems.

Long distance PCR in detection of inversion mutations of F8C gene in hemophilia A patients.

PubMed

Poláková, H; Zmetáková, I; Kádasi, L'

2003-06-01

In the present paper, the experience with detection of intron 22 inversion of F8C gene in severe hemophilia A patients using a recently described long-distance PCR (LD-PCR) method was reported. To test the sensitivity and the specifity of the LD-PCR, analysis of 46 DNA samples of patients and their family members, previously tested by Southern hybridization, was performed. In addition, 16 DNA samples of severe hemophilia A patients in which causative mutation was unknown, were included in analysis. Four-primers, P, Q, A&B, which are able to differentiate between the affected males with or without the inversion, and in female carriers, were used in LD-PCR. Two primers, P&Q, are located within the F8C gene flanking int22h1. Two further primers, A&B, flank int22h2 and int22h3, extragene homologs of int22h1. Nine combinations of four primers were used to identify the optimal one. Four-primers (P, Q, A&B), three-primers (P,Q & B;P, A & B; A, B & Q;P, Q & A) and two-primers (A & B; P & Q; A & Q; P & B) PCR amplifications were performed in the hemophilia A patients as well as in obligate carriers DNA samples. Successful amplification required introduction of some modifications of the original protocol. The most reproducible and uniform results were obtained using two-primers PCR, performed in four single reactions. Thus, a total of 46 DNA samples, 22 were hemizygous for inversion, 6 without the inversion, 14 carriers and 4 non-carriers of inversion. Perfect correlation between genotypes determined using Southern hybridization and LD-PCR was achieved. The optimalized two-primers LD-PCR protocol was used for analysis of 16 DNA samples of severe hemophilia A patients with unknown mutation. Ten cases of inversions and six cases without them were detected. Thus in additional 10 severe hemophilic patients DNA diagnosis was completed. The most successful and reproducible results were obtained performing four single LD-PCR reactions with combinations of two-primers A & B; P & Q; A&Q, and P&B in each DNA sample and this approach is recommended for routine using in clinical practice.

Wearable motion sensors to continuously measure real-world physical activities.

PubMed

Dobkin, Bruce H

2013-12-01

Rehabilitation for sensorimotor impairments aims to improve daily activities, walking, exercise, and motor skills. Monitoring of practice and measuring outcomes, however, is usually restricted to laboratory-based procedures and self-reports. Mobile health devices may reverse these confounders of daily care and research trials. Wearable, wireless motion sensor data, analyzed by activity pattern-recognition algorithms, can describe the type, quantity, and quality of mobility-related activities in the community. Data transmission from the sensors to a cell phone and the Internet enable continuous monitoring. Remote access to laboratory quality data about walking speed, duration and distance, gait asymmetry and smoothness of movements, as well as cycling, exercise, and skills practice, opens new opportunities to engage patients in progressive, personalized therapies with feedback about the performance. Clinical trial designs will be able to include remote verification of the integrity of complex physical interventions and compliance with practice, as well as capture repeated, ecologically sound, ratio scale outcome measures. Given the progressively falling cost of miniaturized wearable gyroscopes, accelerometers, and other physiologic sensors, as well as inexpensive data transmission, sensing systems may become as ubiquitous as cell phones for healthcare. Neurorehabilitation can develop these mobile health platforms for daily care and clinical trials to improve exercise and fitness, skills learning, and physical functioning.

Effective PCR-based detection of Naegleria fowleri from cultured sample and PAM-developed mouse.

PubMed

Kang, Heekyoung; Seong, Gi-Sang; Sohn, Hae-Jin; Kim, Jong-Hyun; Lee, Sang-Eun; Park, Mi Yeoun; Lee, Won-Ja; Shin, Ho-Joon

2015-10-01

Increasing numbers of Primary Amoebic Meningoencephalitis (PAM) cases due to Naegleria fowleri are becoming a serious issue in subtropical and tropical countries as a Neglected Tropical Disease (NTD). To establish a rapid and effective diagnostic tool, a PCR-based detection technique was developed based on previous PCR methods. Four kinds of primer pairs, Nfa1, Nae3, Nf-ITS, and Naegl, were employed in the cultured amoebic trophozoites and a mouse with PAM experimentally developed by N. fowleri inoculation (PAM-mouse). For the extraction of genomic DNA from N. fowleri trophozoites (1×10(6)), simple boiling with 10μl of PBS (pH 7.4) at 100°C for 30min was found to be the most rapid and efficient procedure, allowing amplification of 2.5×10(2) trophozoites using the Nfa-1 primer. The primers Nfa1 and Nae3 amplified only N. fowleri DNA, whereas the ITS primer detected N. fowleri and N. gruberi DNA. Using the PAM-mouse brain tissue, the Nfa1 primer was able to amplify the N. fowleri DNA 4 days post infection with 1ng/μl of genomic DNA being detectable. Using the PAM-mouse CSF, amplification of the N. fowleri DNA with the Nae3 primer was possible 5 days post infection showing a better performance than the Nfa1 primer at day 6. Copyright © 2015 Elsevier GmbH. All rights reserved.

The effect of increased mobility on morbidity in the neurointensive care unit.

PubMed

Titsworth, W Lee; Hester, Jeannette; Correia, Tom; Reed, Richard; Guin, Peggy; Archibald, Lennox; Layon, A Joseph; Mocco, J

2012-06-01

The detrimental effects of immobility on intensive care unit (ICU) patients are well established. Limited studies involving medical ICUs have demonstrated the safety and benefit of mobility protocols. Currently no study has investigated the role of increased mobility in the neurointensive care unit population. This study was a single-institution prospective intervention trial to investigate the effectiveness of increased mobility among neurointensive care unit patients. All patients admitted to the neurointensive care unit of a tertiary care center over a 16-month period (April 2010 through July 2011) were evaluated. The study consisted of a 10-month (8025 patient days) preintervention observation period followed by a 6-month (4455 patient days) postintervention period. The intervention was a comprehensive mobility initiative utilizing the Progressive Upright Mobility Protocol (PUMP) Plus. Implementation of the PUMP Plus increased mobility among neurointensive care unit patients by 300% (p < 0.0001). Initiation of this protocol also correlated with a reduction in neurointensive care unit length of stay (LOS; p < 0.004), hospital LOS (p < 0.004), hospital-acquired infections (p < 0.05), and ventilator-associated pneumonias (p < 0.001), and decreased the number of patient days in restraints (p < 0.05). Additionally, increased mobility did not lead to increases in adverse events as measured by falls or inadvertent line disconnections. Among neurointensive care unit patients, increased mobility can be achieved quickly and safely with associated reductions in LOS and hospital-acquired infections using the PUMP Plus program.

MICROBIAL MOBILIZATION OF ARSENIC FROM SEDIMENTS OF THE ABERJONA WATERSHED. (R823222)

EPA Science Inventory

The perspectives, information and conclusions conveyed in research project abstracts, progress reports, final reports, journal abstracts and journal publications convey the viewpoints of the principal investigator and may not represent the views and policies of ORD and EPA. Concl...

Transportation research : The Department of Transportation has made progress in coordinating and reviewing its research activities

DOT National Transportation Integrated Search

2009-02-12

Research, development, and technology (RD&T) activities are vital to meeting the Department of Transportation's (DOT) priorities, such as increasing safety, enhancing mobility, and supporting the nation's economic growth. In fiscal year 2008, the dep...

Bioinspired Intelligent Algorithm and Its Applications for Mobile Robot Control: A Survey.

PubMed

Ni, Jianjun; Wu, Liuying; Fan, Xinnan; Yang, Simon X

2016-01-01

Bioinspired intelligent algorithm (BIA) is a kind of intelligent computing method, which is with a more lifelike biological working mechanism than other types. BIAs have made significant progress in both understanding of the neuroscience and biological systems and applying to various fields. Mobile robot control is one of the main application fields of BIAs which has attracted more and more attention, because mobile robots can be used widely and general artificial intelligent algorithms meet a development bottleneck in this field, such as complex computing and the dependence on high-precision sensors. This paper presents a survey of recent research in BIAs, which focuses on the research in the realization of various BIAs based on different working mechanisms and the applications for mobile robot control, to help in understanding BIAs comprehensively and clearly. The survey has four primary parts: a classification of BIAs from the biomimetic mechanism, a summary of several typical BIAs from different levels, an overview of current applications of BIAs in mobile robot control, and a description of some possible future directions for research.

Balance and mobility dysfunction and falls risk in older people with mild to moderate Alzheimer disease.

PubMed

Suttanon, Plaiwan; Hill, Keith D; Said, Catherine M; Logiudice, Dina; Lautenschlager, Nicola T; Dodd, Karen J

2012-01-01

This study aimed to identify the magnitude and type of balance and mobility impairments in people with Alzheimer disease by comparing their performance with that of older people without cognitive impairment. Twenty-five community-dwelling people with mild to moderate Alzheimer disease and a comparison group of 25 cognitively intact age- and sex-matched people completed a comprehensive balance and mobility assessment. This included computerized posturography measures of static and dynamic balance under various conditions, clinical balance, and mobility measures, and measures of falls and falls risk. The level of falls risk was higher in people with Alzheimer disease. Standing balance in people with Alzheimer disease was significantly impaired across a range of static and dynamic balance conditions. Activity level, gait, and mobility measures were also impaired, particularly turning and dual tasks. The findings of the study highlight the value of including balance screening as a routine component of early dementia assessment. This would allow for the early detection of balance dysfunction and the introduction of balance retraining before impairments progress to more advanced levels.

Bioinspired Intelligent Algorithm and Its Applications for Mobile Robot Control: A Survey

PubMed Central

Ni, Jianjun; Wu, Liuying; Fan, Xinnan; Yang, Simon X.

2016-01-01

Bioinspired intelligent algorithm (BIA) is a kind of intelligent computing method, which is with a more lifelike biological working mechanism than other types. BIAs have made significant progress in both understanding of the neuroscience and biological systems and applying to various fields. Mobile robot control is one of the main application fields of BIAs which has attracted more and more attention, because mobile robots can be used widely and general artificial intelligent algorithms meet a development bottleneck in this field, such as complex computing and the dependence on high-precision sensors. This paper presents a survey of recent research in BIAs, which focuses on the research in the realization of various BIAs based on different working mechanisms and the applications for mobile robot control, to help in understanding BIAs comprehensively and clearly. The survey has four primary parts: a classification of BIAs from the biomimetic mechanism, a summary of several typical BIAs from different levels, an overview of current applications of BIAs in mobile robot control, and a description of some possible future directions for research. PMID:26819582

Nanotechnology: A Policy Primer

DTIC Science & Technology

2010-06-02

States of 24 million barrels of oil.3 • Universal access to clean water. Nanotechnology water desalination and filtration systems may offer...CRS Report for Congress Prepared for Members and Committees of Congress Nanotechnology : A Policy Primer John F. Sargent Jr. Specialist...00-00-2010 to 00-00-2010 4. TITLE AND SUBTITLE Nanotechnology : A Policy Primer 5a. CONTRACT NUMBER 5b. GRANT NUMBER 5c. PROGRAM ELEMENT

Nanotechnology: A Policy Primer

DTIC Science & Technology

2008-05-20

of oil.3 ! Universal access to clean water. Nanotechnology water desalination and filtration systems may offer affordable, scalable, and portable...Order Code RL34511 Nanotechnology : A Policy Primer May 20, 2008 John F. Sargent Specialist in Science and Technology Policy Resources, Science, and...REPORT DATE 20 MAY 2008 2. REPORT TYPE 3. DATES COVERED 00-00-2008 to 00-00-2008 4. TITLE AND SUBTITLE Nanotechnology : A Policy Primer 5a