Sample records for mobilis cloning sequencing

  1. Cloning and sequencing of the alcohol dehydrogenase II gene from Zymomonas mobilis


    Ingram, Lonnie O.; Conway, Tyrrell


    The alcohol dehydrogenase II gene from Zymomonas mobilis has been cloned and sequenced. This gene can be expressed at high levels in other organisms to produce acetaldehyde or to convert acetaldehyde to ethanol.

  2. Nucleotide sequence of the pyruvate decarboxylase gene from Zymomonas mobilis.


    Neale, A D; Scopes, R K; Wettenhall, R E; Hoogenraad, N J


    Pyruvate decarboxylase (EC, the penultimate enzyme in the alcoholic fermentation pathway of Zymomonas mobilis, converts pyruvate to acetaldehyde and carbon dioxide. The complete nucleotide sequence of the structural gene encoding pyruvate decarboxylase from Zymomonas mobilis has been determined. The coding region is 1704 nucleotides long and encodes a polypeptide of 567 amino acids with a calculated subunit mass of 60,790 daltons. The amino acid sequence was confirmed by comparison with the amino acid sequence of a selection of tryptic fragments of the enzyme. The amino acid composition obtained from the nucleotide sequence is in good agreement with that obtained experimentally.

  3. Genome Sequence of the Ethanol-Producing Zymomonas mobilis subsp. mobilis Lectotype Strain ATCC 10988 ▿

    PubMed Central

    Pappas, Katherine M.; Kouvelis, Vassili N.; Saunders, Elizabeth; Brettin, Thomas S.; Bruce, David; Detter, Chris; Balakireva, Mariya; Han, Cliff S.; Savvakis, Giannis; Kyrpides, Nikos C.; Typas, Milton A.


    Zymomonas mobilis ATCC 10988 is the type strain of the Z. mobilis subsp. mobilis taxon, members of which are some of the most rigorous ethanol-producing bacteria. Isolated from Agave cactus fermentations in Mexico, ATCC 10988 is one of the first Z. mobilis strains to be described and studied. Its robustness in sucrose-substrate fermentations, physiological characteristics, large number of plasmids, and overall genomic plasticity render this strain important to the study of the species. Here we report the finishing and annotation of the ATCC 10988 chromosomal and plasmid genome. PMID:21725006

  4. Sequence and genetic organization of a Zymomonas mobilis gene cluster that encodes several enzymes of glucose metabolism

    SciTech Connect

    Barnell, W.O.; Kyung Cheol Yi; Conway, T. )


    The Zymomonas mobilis genes that encode glucose-6-phosphate dehydrogenase (zwf), 6-phosphogluconate dehydratase (edd), and glucokinase (glk) were cloned independently by genetic complementation of specific defects in Escherichia coli metabolism. The identify of these cloned genes was confirmed by various biochemical means. Nucleotide sequence analysis established that these three genes are clustered on the genome and revealed an additional open reading frame in this region that has significant amino acid identity to the E.coli xylose-proton symporter and the human glucose transporter. On the basis of this evidence and structural analysis of the deduced primary amino acid sequence, this gene is believed to encode the Z. mobilis glucose-facilitated diffusion protein, glf. The four genes in the 6-kb cluster are organized in the order glf, zwf, edd, glk. The glf and zwf genes are separated by 146 bp. The zwf and edd genes overlap by 8 bp, and their expression may be translationally coupled. The edd and glk genes are separated by 203 bp. The glk gene is followed by tandem transcriptional terminators. The four genes appear to be organized in an operon. Such an arrangement of the genes that govern glucose uptake and the first three steps of the Entner-Doudoroff glycolytic pathway provides the organism with a mechanism for carefully regulating the levels of the enzymes that control carbon flux into the pathway.

  5. Permanent draft genome sequence of Desulfurococcus mobilis type strain DSM 2161, a thermoacidophilic sulfur-reducing crenarchaeon isolated from acidic hot springs of Hveravellir, Iceland

    SciTech Connect

    Susanti, Dwi; Johnson, Eric F.; Lapidus, Alla; Han, James; Reddy, T. B. K.; Pilay, Manoj; Ivanova, Natalia N.; Markowitz, Victor M.; Woyke, Tanja; Kyrpides, Nikos C.; Mukhopadhyay, Biswarup


    Our report presents the permanent draft genome sequence of Desulfurococcus mobilis type strain DSM 2161, an obligate anaerobic hyperthermophilic crenarchaeon that was isolated from acidic hot springs in Hveravellir, Iceland. D. mobilis utilizes peptides as carbon and energy sources and reduces elemental sulfur to H2S. A metabolic construction derived from the draft genome identified putative pathways for peptide degradation and sulfur respiration in this archaeon. Existence of several hydrogenase genes in the genome supported previous findings that H2 is produced during the growth of D. mobilis in the absence of sulfur. Interestingly, genes encoding glucose transport and utilization systems also exist in the D. mobilis genome though this archaeon does not utilize carbohydrate for growth. The draft genome of D. mobilis provides an additional mean for comparative genomic analysis of desulfurococci. In addition, our analysis on the Average Nucleotide Identity between D. mobilis and Desulfurococcus mucosus suggested that these two desulfurococci are two different strains of the same species.

  6. Permanent draft genome sequence of Desulfurococcus mobilis type strain DSM 2161, a thermoacidophilic sulfur-reducing crenarchaeon isolated from acidic hot springs of Hveravellir, Iceland


    Susanti, Dwi; Johnson, Eric F.; Lapidus, Alla; ...


    Our report presents the permanent draft genome sequence of Desulfurococcus mobilis type strain DSM 2161, an obligate anaerobic hyperthermophilic crenarchaeon that was isolated from acidic hot springs in Hveravellir, Iceland. D. mobilis utilizes peptides as carbon and energy sources and reduces elemental sulfur to H2S. A metabolic construction derived from the draft genome identified putative pathways for peptide degradation and sulfur respiration in this archaeon. Existence of several hydrogenase genes in the genome supported previous findings that H2 is produced during the growth of D. mobilis in the absence of sulfur. Interestingly, genes encoding glucose transport and utilization systems alsomore » exist in the D. mobilis genome though this archaeon does not utilize carbohydrate for growth. The draft genome of D. mobilis provides an additional mean for comparative genomic analysis of desulfurococci. In addition, our analysis on the Average Nucleotide Identity between D. mobilis and Desulfurococcus mucosus suggested that these two desulfurococci are two different strains of the same species.« less

  7. From deep sequencing to actual clones.


    D'Angelo, Sara; Kumar, Sandeep; Naranjo, Leslie; Ferrara, Fortunato; Kiss, Csaba; Bradbury, Andrew R M


    The application of deep sequencing to in vitro display technologies has been invaluable for the straightforward analysis of enriched clones. After sequencing in vitro selected populations, clones are binned into identical or similar groups and ordered by abundance, allowing identification of those that are most enriched. However, the greatest strength of deep sequencing is also its greatest weakness: clones are easily identified by their DNA sequences, but are not physically available for testing without a laborious multistep process involving several rounds of polymerization chain reaction (PCR), assembly and cloning. Here, using the isolation of antibody genes from a phage and yeast display selection as an example, we show the power of a rapid and simple inverse PCR-based method to easily isolate clones identified by deep sequencing. Once primers have been received, clone isolation can be carried out in a single day, rather than two days. Furthermore the reduced number of PCRs required will reduce PCR mutations correspondingly. We have observed a 100% success rate in amplifying clones with an abundance as low as 0.5% in a polyclonal population. This approach allows us to obtain full-length clones even when an incomplete sequence is available, and greatly simplifies the subcloning process. Moreover, rarer, but functional clones missed by traditional screening can be easily isolated using this method, and the approach can be extended to any selected library (scFv, cDNA, libraries based on scaffold proteins) where a unique sequence signature for the desired clones of interest is available.

  8. Physiology and genetics of metabolic flux control in Zymomonas mobilis

    SciTech Connect

    Conway, T.


    This work seeks to understand the role of gene expression in regulating glycolytic enzyme synthesis in a balance that allows proper glycoltic flux control. The seven genes targeted for study in this laboratory have been cloned and sequenced, and molecular details of regulation have been investigated. Clear that glycolytic enzyme synthesis is coordinated to prevent the build up of toxic metabolic intermediates. The genetic mechanisms responsible for regulating balanced expression of the EntnerDoudoroff and glycolytic genes in Z. mobilis are beginning to be understood. Several layers of genetic control, perhaps in a hierarchal arrangement act in concert to determine the relative abundance of the glycolytic enzymes. These genetic controls involve differential translational efficiency, highly conserved promoter sequences, transcription factors, differential mRNA stabilities, and nucleolytic mRNA processing. The serendipitous cloning of the glucose facilitator, glf, as a result of linkage to several other genes of interest will have a significant impact on the study of Z. mobilis metabolism. The glucose facilitator is being characterized in a genetically reconstituted system in E. coli. Molecular genetic studies indicate that the ratio of glf expression to that of glk, zmf, and edd is carefully regulated, and suggests a critical role in metabolic control. Regulation of glycolytic gene expression is now sufficiently well understood to allow use of the glycolytic genes as tools to manipulate specified enzyme levels for the purpose of analyzing metabolic flux control. The critical genes have been subcloned for stable expression in Z. mobilis and placed under control of a regulated promoter system involving the tac promoter, the lacI repressor, and gene induction in by IPTG. HPLC methods have been developed that allow quantitation of virtually all of the metabolic intermediates in the cell pool.

  9. A comprehensive list of cloned human DNA sequences

    PubMed Central

    Schmidtke, Jörg; Cooper, David N.


    A list of DNA sequences cloned from the human genome is presented. Intended as a guide to clone availability, this list includes published reports of cDNA, genomic and synthetic clones comprising gene and pseudogene sequences, uncharacterised DNA segments and repetitive DNA elements. PMID:3575113

  10. A comprehensive list of cloned human DNA sequences

    PubMed Central

    Schmidtke, Jörg; Cooper, David N.


    A list of DNA sequences cloned from the human genome is presented. Intended as a guide to clone availability, this list includes published reports of cDNA, genomic and synthetic clones comprising gene and pseudogene sequences, uncharacterised DNA segments and repetitive DNA elements. PMID:2654889

  11. A comprehensive list of cloned human DNA sequences

    PubMed Central

    Schmidtke, Jörg; Cooper, David N.


    A list of DNA sequences cloned from the human genome is presented. Intended as a guide to clone availability, this list includes published reports of cDNA, genomic and synthetic clones comprising gene and pseudogene sequences, uncharacterised DNA segments and repetitive DNA elements. PMID:3368330

  12. A comprehensive list of cloned human DNA sequences

    PubMed Central

    Schmidtke, Jörg; Cooper, David N.


    A list of DNA sequences cloned from the human genome is presented. Intended as a guide to clone availability, this list includes published reports of cDNA, genomic and synthetic clones comprising gene and pseudogene sequences, uncharacterised DNA segments and repetitive DNA elements. PMID:2333227

  13. Cloning and Sequencing the First HLA Gene

    PubMed Central

    Jordan, Bertrand R.


    This Perspectives article recounts the isolation and sequencing of the first human histocompatibility gene (HLA) in 1980–1981. At the time, general knowledge of the molecules of the immune system was already fairly extensive, and gene rearrangements in the immunoglobulin complex (discovered in 1976) had generated much excitement: HLA was quite obviously the next frontier. The author was able to use a homologous murine H-2 cDNA to identify putative human HLA genomic clones in a λ-phage library and thus to isolate and sequence the first human histocompatibility gene. This personal account relates the steps that led to this result, describes the highly competitive international environment, and highlights the role of location, connections, and sheer luck in such an achievement. It also puts this work in perspective with a short description of the current knowledge of histocompatibility genes and, finally, presents some reflections on the meaning of “discovery.” PMID:20457890

  14. (Physiology and genetics of metabolic flux control in Zymomonas mobilis)

    SciTech Connect

    Conway, T.


    The funded research deals with the physiology and genetics of glycolytic flux control in Zymomonas mobilis. Two fundamental biological questions are begin addressed: First, how do the enzymes of glycolytic pathways act in concert to regulate metabolic flux Second, what is the role of gene expression in regulating high level synthesis of the glycolytic enzymes in a balance that allows proper glycolytic flux control The specific objectives of the grant are as follows: 1. To clone the structural and regulatory regions of the Z. mobilis genes encoding glucose-6-phosphate dehydrogenase, phosphoglucose isomerase, enolase, 6-phosphogluconate dehydratase, 2- keto-3-deoxy- 6-phosphogluconate aldolase, glucokinase and fructokinase. 2. To characterize the structure of these genes with respect to nucleotide sequence, transcriptional initiation sites promoter location, evolutionary relatedness to similar genes from other organisms, and organization of these genes on the genome. 3. To investigate the effects of genetically engineered alterations in the levels of the cloned enzymes on metabolic flux and cell growth. 4. To study transcriptional and post-transcriptional regulation of the genes encoding the enzymes of the Entner-Doudoroff pathway. The first two specific objectives have now been fully completed. Significant progress has been made on the fourth objective and work on the third objective is well underway.

  15. Recombinant L-Asparaginase from Zymomonas mobilis: A Potential New Antileukemic Agent Produced in Escherichia coli

    PubMed Central

    Pereira, Juliana Christina Castanheira Vicente; Costa-Amaral, Isabele Campos; da Costa, Elaine Sobral; Ribeiro, Maria Cecília Menks; Land, Marcelo Gerardin Poirot; Alves, Tito Lívio Moitinho; Larentis, Ariane Leites; Almeida, Rodrigo Volcan


    L-asparaginase is an enzyme used as a chemotherapeutic agent, mainly for treating acute lymphoblastic leukemia. In this study, the gene of L-asparaginase from Zymomonas mobilis was cloned in pET vectors, fused to a histidine tag, and had its codons optimized. The L-asparaginase was expressed extracellularly and intracellularly (cytoplasmically) in Escherichia coli in far larger quantities than obtained from the microorganism of origin, and sufficient for initial cytotoxicity tests on leukemic cells. The in silico analysis of the protein from Z. mobilis indicated the presence of a signal peptide in the sequence, as well as high identity to other sequences of L-asparaginases with antileukemic activity. The protein was expressed in a bioreactor with a complex culture medium, yielding 0.13 IU/mL extracellular L-asparaginase and 3.6 IU/mL intracellular L-asparaginase after 4 h of induction with IPTG. The cytotoxicity results suggest that recombinant L-asparaginase from Z. mobilis expressed extracellularly in E.coli has a cytotoxic and cytostatic effect on leukemic cells. PMID:27253887

  16. Recombinant L-Asparaginase from Zymomonas mobilis: A Potential New Antileukemic Agent Produced in Escherichia coli.


    Einsfeldt, Karen; Baptista, Isis Cavalcante; Pereira, Juliana Christina Castanheira Vicente; Costa-Amaral, Isabele Campos; Costa, Elaine Sobral da; Ribeiro, Maria Cecília Menks; Land, Marcelo Gerardin Poirot; Alves, Tito Lívio Moitinho; Larentis, Ariane Leites; Almeida, Rodrigo Volcan


    L-asparaginase is an enzyme used as a chemotherapeutic agent, mainly for treating acute lymphoblastic leukemia. In this study, the gene of L-asparaginase from Zymomonas mobilis was cloned in pET vectors, fused to a histidine tag, and had its codons optimized. The L-asparaginase was expressed extracellularly and intracellularly (cytoplasmically) in Escherichia coli in far larger quantities than obtained from the microorganism of origin, and sufficient for initial cytotoxicity tests on leukemic cells. The in silico analysis of the protein from Z. mobilis indicated the presence of a signal peptide in the sequence, as well as high identity to other sequences of L-asparaginases with antileukemic activity. The protein was expressed in a bioreactor with a complex culture medium, yielding 0.13 IU/mL extracellular L-asparaginase and 3.6 IU/mL intracellular L-asparaginase after 4 h of induction with IPTG. The cytotoxicity results suggest that recombinant L-asparaginase from Z. mobilis expressed extracellularly in E.coli has a cytotoxic and cytostatic effect on leukemic cells.

  17. Ethanologenic enzymes of Zymomonas mobilis: Progress report

    SciTech Connect

    Ingram, L.O.


    In this study, we have proposed to investigate the regulatory mechanisms which permit the high level expression of the ethanologenic enzymes from Zymomonas mobilis (PDC, ADHI, ADHII). This research is continuing essentially as proposed in the original grant except that the scope is being expanded to include the glycolytic enzymes which are also highly expressed. Several enzymes which are expressed only at moderate levels are being examined for comparison (tryptophan biosynthesis, acid phosphatase). Studies of highly expressed genes involve enzyme purification and the production of antibodies, investigations of the effects of growth conditions on expression, cloning and characterization of structural genes, construction of hybrid genes, mutation of alcohol dehydrogenases, and investigation of transcriptional and translational regulation. In addition, we are investigating the feasibility of replacing the NAD regeneration systems of other bacteria with an artificial operon containing the Z. mobilis genes (PDC and ADHII) for the production of ethanol, the ''PET'' operon. 30 refs.

  18. To Clone or Not To Clone: Method Analysis for Retrieving Consensus Sequences In Ancient DNA Samples

    PubMed Central

    Winters, Misa; Barta, Jodi Lynn; Monroe, Cara; Kemp, Brian M.


    The challenges associated with the retrieval and authentication of ancient DNA (aDNA) evidence are principally due to post-mortem damage which makes ancient samples particularly prone to contamination from “modern” DNA sources. The necessity for authentication of results has led many aDNA researchers to adopt methods considered to be “gold standards” in the field, including cloning aDNA amplicons as opposed to directly sequencing them. However, no standardized protocol has emerged regarding the necessary number of clones to sequence, how a consensus sequence is most appropriately derived, or how results should be reported in the literature. In addition, there has been no systematic demonstration of the degree to which direct sequences are affected by damage or whether direct sequencing would provide disparate results from a consensus of clones. To address this issue, a comparative study was designed to examine both cloned and direct sequences amplified from ∼3,500 year-old ancient northern fur seal DNA extracts. Majority rules and the Consensus Confidence Program were used to generate consensus sequences for each individual from the cloned sequences, which exhibited damage at 31 of 139 base pairs across all clones. In no instance did the consensus of clones differ from the direct sequence. This study demonstrates that, when appropriate, cloning need not be the default method, but instead, should be used as a measure of authentication on a case-by-case basis, especially when this practice adds time and cost to studies where it may be superfluous. PMID:21738625

  19. Characteristics of cloned repeated DNA sequences in the barley genome

    SciTech Connect

    Anan'ev, E.V.; Bochkanov, S.S.; Ryzhik, M.V.; Sonina, N.V.; Chernyshev, A.I.; Shchipkova, N.I.; Yakovleva, E.Yu.


    A partial clone library of barley DNA fragments based on plasmid pBR325 was created. The cloned EcoRI-fragments of chromosomal DNA are from 2 to 14 kbp in length. More than 95% of the barley DNA inserts comprise repeated sequences of different complexity and copy number. Certain of these DNA sequences are from families comprising at least 1% of the barley genome. A significant proportion of the clones hybridize with numerous sets of restriction fragments of genome DNA and they are dispersed throughout the barley chromosomes.

  20. Physiology and genetics of metabolic flux control in Zymomonas mobilis. Progress report

    SciTech Connect

    Conway, T.


    This work seeks to understand the role of gene expression in regulating glycolytic enzyme synthesis in a balance that allows proper glycoltic flux control. The seven genes targeted for study in this laboratory have been cloned and sequenced, and molecular details of regulation have been investigated. Clear that glycolytic enzyme synthesis is coordinated to prevent the build up of toxic metabolic intermediates. The genetic mechanisms responsible for regulating balanced expression of the EntnerDoudoroff and glycolytic genes in Z. mobilis are beginning to be understood. Several layers of genetic control, perhaps in a hierarchal arrangement act in concert to determine the relative abundance of the glycolytic enzymes. These genetic controls involve differential translational efficiency, highly conserved promoter sequences, transcription factors, differential mRNA stabilities, and nucleolytic mRNA processing. The serendipitous cloning of the glucose facilitator, glf, as a result of linkage to several other genes of interest will have a significant impact on the study of Z. mobilis metabolism. The glucose facilitator is being characterized in a genetically reconstituted system in E. coli. Molecular genetic studies indicate that the ratio of glf expression to that of glk, zmf, and edd is carefully regulated, and suggests a critical role in metabolic control. Regulation of glycolytic gene expression is now sufficiently well understood to allow use of the glycolytic genes as tools to manipulate specified enzyme levels for the purpose of analyzing metabolic flux control. The critical genes have been subcloned for stable expression in Z. mobilis and placed under control of a regulated promoter system involving the tac promoter, the lacI repressor, and gene induction in by IPTG. HPLC methods have been developed that allow quantitation of virtually all of the metabolic intermediates in the cell pool.

  1. Cloning and characterization of a highly repetitive fish nucleotide sequence.


    Datta, U; Dutta, P; Mandal, R K


    We have cloned and sequenced a highly repetitive HindIII fragment of DNA from the common carp Cyprinus carpio. It represents a tandemly repeated sequence with a monomeric unit of 245 bp and comprises 8% of the fish genome. Higher units of this monomer appear as a ladder in Southern blots. The monomeric unit has been sequenced; it is A + T-rich with some direct and some inverse-repeat nucleotide clusters.

  2. Sequence structure of Lowary/Widom clones forming strong nucleosomes.


    Trifonov, Edward N


    Lowary and Widom selected from random sequences those which form exceptionally stable nucleosomes, including clone 601, the current champion of strong nucleosome (SN) sequences. This unique sequence database (LW sequences) carries sequence elements which confer stability on the nucleosomes formed on the sequences, and, thus, may serve as source of information on the structure of "ideal" or close to ideal nucleosome DNA sequence. An important clue is also provided by crystallographic study of Vasudevan and coauthors on clone 601 nucleosomes. It demonstrated that YR·YR dinucleotide stacks (primarily TA·TA) follow one another at distances 10 or 11 bases or multiples thereof, such that they all are located on the interface between DNA and histone octamer. Combining this important information with alignment of the YR-containing 10-mers and 11-mers from LW sequences, the bendability matrices of the stable nucleosome DNA are derived. The matrices suggest that the periodically repeated TA (YR), RR, and YY dinucleotides are the main sequence features of the SNs. This consensus coincides with the one for recently discovered SNs with visibly periodic DNA sequences. Thus, the experimentally observed stable LW nucleosomes and SNs derived computationally appear to represent the same entity - exceptionally stable SNs.

  3. cDNA cloning and sequencing of tarantula hemocyanin subunits.


    Voit, R; Feldmaier-Fuchs, G


    Tarantula heart cDNA libraries were screened with synthetic oligonucleotide probes deduced from the highly conserved amino acid sequences of the two copper-binding sites, copper A and copper B, found in chelicerate hemocyanins. Positive cDNA clones could be obtained and four different cDNA types were characterized.

  4. [Physiology and genetics of metabolic flux control in Zymomonas mobilis]. Progress report

    SciTech Connect

    Conway, T.


    The funded research deals with the physiology and genetics of glycolytic flux control in Zymomonas mobilis. Two fundamental biological questions are begin addressed: First, how do the enzymes of glycolytic pathways act in concert to regulate metabolic flux? Second, what is the role of gene expression in regulating high level synthesis of the glycolytic enzymes in a balance that allows proper glycolytic flux control? The specific objectives of the grant are as follows: 1. To clone the structural and regulatory regions of the Z. mobilis genes encoding glucose-6-phosphate dehydrogenase, phosphoglucose isomerase, enolase, 6-phosphogluconate dehydratase, 2- keto-3-deoxy- 6-phosphogluconate aldolase, glucokinase and fructokinase. 2. To characterize the structure of these genes with respect to nucleotide sequence, transcriptional initiation sites promoter location, evolutionary relatedness to similar genes from other organisms, and organization of these genes on the genome. 3. To investigate the effects of genetically engineered alterations in the levels of the cloned enzymes on metabolic flux and cell growth. 4. To study transcriptional and post-transcriptional regulation of the genes encoding the enzymes of the Entner-Doudoroff pathway. The first two specific objectives have now been fully completed. Significant progress has been made on the fourth objective and work on the third objective is well underway.

  5. Molecular cloning and amino acid sequence of human 5-lipoxygenase

    SciTech Connect

    Matsumoto, T.; Funk, C.D.; Radmark, O.; Hoeoeg, J.O.; Joernvall, H.; Samuelsson, B.


    5-Lipoxygenase (EC, a Ca/sup 2 +/- and ATP-requiring enzyme, catalyzes the first two steps in the biosynthesis of the peptidoleukotrienes and the chemotactic factor leukotriene B/sub 4/. A cDNA clone corresponding to 5-lipoxygenase was isolated from a human lung lambda gt11 expression library by immunoscreening with a polyclonal antibody. Additional clones from a human placenta lambda gt11 cDNA library were obtained by plaque hybridization with the /sup 32/P-labeled lung cDNA clone. Sequence data obtained from several overlapping clones indicate that the composite DNAs contain the complete coding region for the enzyme. From the deduced primary structure, 5-lipoxygenase encodes a 673 amino acid protein with a calculated molecular weight of 77,839. Direct analysis of the native protein and its proteolytic fragments confirmed the deduced composition, the amino-terminal amino acid sequence, and the structure of many internal segments. 5-Lipoxygenase has no apparent sequence homology with leukotriene A/sub 4/ hydrolase or Ca/sup 2 +/-binding proteins. RNA blot analysis indicated substantial amounts of an mRNA species of approx. = 2700 nucleotides in leukocytes, lung, and placenta.

  6. Evaluation of a Pooled Strategy for High-Throughput Sequencing of Cosmid Clones from Metagenomic Libraries

    PubMed Central

    Lam, Kathy N.; Hall, Michael W.; Engel, Katja; Vey, Gregory; Cheng, Jiujun; Neufeld, Josh D.; Charles, Trevor C.


    High-throughput sequencing methods have been instrumental in the growing field of metagenomics, with technological improvements enabling greater throughput at decreased costs. Nonetheless, the economy of high-throughput sequencing cannot be fully leveraged in the subdiscipline of functional metagenomics. In this area of research, environmental DNA is typically cloned to generate large-insert libraries from which individual clones are isolated, based on specific activities of interest. Sequence data are required for complete characterization of such clones, but the sequencing of a large set of clones requires individual barcode-based sample preparation; this can become costly, as the cost of clone barcoding scales linearly with the number of clones processed, and thus sequencing a large number of metagenomic clones often remains cost-prohibitive. We investigated a hybrid Sanger/Illumina pooled sequencing strategy that omits barcoding altogether, and we evaluated this strategy by comparing the pooled sequencing results to reference sequence data obtained from traditional barcode-based sequencing of the same set of clones. Using identity and coverage metrics in our evaluation, we show that pooled sequencing can generate high-quality sequence data, without producing problematic chimeras. Though caveats of a pooled strategy exist and further optimization of the method is required to improve recovery of complete clone sequences and to avoid circumstances that generate unrecoverable clone sequences, our results demonstrate that pooled sequencing represents an effective and low-cost alternative for sequencing large sets of metagenomic clones. PMID:24911009

  7. Evaluation of a pooled strategy for high-throughput sequencing of cosmid clones from metagenomic libraries.


    Lam, Kathy N; Hall, Michael W; Engel, Katja; Vey, Gregory; Cheng, Jiujun; Neufeld, Josh D; Charles, Trevor C


    High-throughput sequencing methods have been instrumental in the growing field of metagenomics, with technological improvements enabling greater throughput at decreased costs. Nonetheless, the economy of high-throughput sequencing cannot be fully leveraged in the subdiscipline of functional metagenomics. In this area of research, environmental DNA is typically cloned to generate large-insert libraries from which individual clones are isolated, based on specific activities of interest. Sequence data are required for complete characterization of such clones, but the sequencing of a large set of clones requires individual barcode-based sample preparation; this can become costly, as the cost of clone barcoding scales linearly with the number of clones processed, and thus sequencing a large number of metagenomic clones often remains cost-prohibitive. We investigated a hybrid Sanger/Illumina pooled sequencing strategy that omits barcoding altogether, and we evaluated this strategy by comparing the pooled sequencing results to reference sequence data obtained from traditional barcode-based sequencing of the same set of clones. Using identity and coverage metrics in our evaluation, we show that pooled sequencing can generate high-quality sequence data, without producing problematic chimeras. Though caveats of a pooled strategy exist and further optimization of the method is required to improve recovery of complete clone sequences and to avoid circumstances that generate unrecoverable clone sequences, our results demonstrate that pooled sequencing represents an effective and low-cost alternative for sequencing large sets of metagenomic clones.

  8. Cloning and sequence analysis of an actin gene in aloe.


    Wen, S S; He, D W; Liao, C M; Li, J; Wen, G Q; Liu, X H


    Aloe (Aloe spp), containing abundant polysaccharides and numerous bioactive ingredients, has remarkable medical, ornamental, calleidic, and edible values. In the present study, the total RNA was extracted from aloe leaf tissue. The isolated high-quality RNA was further used to clone actin gene by using reverse transcription-polymerase chain reaction (RT-PCR). The result of sequence analysis for the amplified fragment revealed that the cloned actin gene was 1012 bp in length (GenBank accession No. KC751541.1) and contained a 924-bp coding region and encoded a protein consisting of 307 amino acids. Homologous alignment showed that it shared over 80 and 96% identity with the nucleotide and amino acid sequences of actin from other plants, respectively. In addition, the cloned gene was used for phylogenetic analyses based on the deduced amino acid sequences, and the results suggested that the actin gene is highly conserved in evolution. The findings of this study will be useful for investigating the expression patterns of other genes in Aloe.

  9. Cloning and sequence analysis of myostatin promoter in sheep.


    Du, Rong; Chen, Yong-Fu; An, Xiao-Rong; Yang, Xing-Yuan; Ma, Yi; Zhang, Lei; Yuan, Xiao-Li; Chen, Li-Mei; Qin, Jian


    To better understand the structure and function of the myostatin's gene promoter region in sheep, we cloned and sequenced a 1.517 kb fragment containing the 5'-regulatory region of the sheep myostatin gene (GenBank accession number is AY918121). The promoter sequence consists of three TATA boxes, one CAAT box, and eight putative E-boxes. Some putative muscle growth response elements for Octamer-binding factor 1(Octamer), Activator protein 1(AP1), Growth factor independence 1 zinc finger protein (Gfi-1B), Myocyte enhancer factor 2 (MEF2), Muscle-specific Mt binding site (MTBF), Glucocorticoid response elements (GRE) and Progesterone receptor binding site (PRE) were detected. Some of the motifs are conserved as compared to with that in the goat, bovine and porcine myostatin promoters. However, some differences were also found.

  10. Genomic libraries: II. Subcloning, sequencing, and assembling large-insert genomic DNA clones.


    Quail, Mike A; Matthews, Lucy; Sims, Sarah; Lloyd, Christine; Beasley, Helen; Baxter, Simon W


    Sequencing large insert clones to completion is useful for characterizing specific genomic regions, identifying haplotypes, and closing gaps in whole genome sequencing projects. Despite being a standard technique in molecular laboratories, DNA sequencing using the Sanger method can be highly problematic when complex secondary structures or sequence repeats are encountered in genomic clones. Here, we describe methods to isolate DNA from a large insert clone (fosmid or BAC), subclone the sample, and sequence the region to the highest industry standard. Troubleshooting solutions for sequencing difficult templates are discussed.

  11. Ethanologenic Enzymes of Zymomonas mobilis

    SciTech Connect

    Ingram, Lonnie O'Neal


    Zymomonas mobilis is a unique microorganism in being both obligately fermentative and utilizing a Entner-Doudoroff pathway for glycolysis. Glycolytic flux in this organism is readily measured as evolved carbon dioxide, ethanol, or glucose consumed and exceeds 1 {micro}mole glucose/min per mg cell protein. To support this rapid glycolysis, approximately 50% of cytoplasmic protein is devoted to the 13 glycolytic and fermentative enzymes which constitute this central catabolic pathway. Only 1 ATP (net) is produced from each glucose metabolized. During the past grant period, we have completed the characterization of 11 of the 13 glycolytic genes from Z. mobilis together with complementary but separate DOE-fimded research by a former post-dot and collaborator, Dr. Tyrrell Conway. Research funded in my lab by DOE, Division of Energy Biosciences can be divided into three sections: A. Fundamental studies; B. Applied studies and utility; and C. Miscellaneous investigations.

  12. Cloning and Sequence Analysis of Two Pseudomonas Flavoprotein Xenobiotic Reductases

    PubMed Central

    Blehert, David S.; Fox, Brian G.; Chambliss, Glenn H.


    The genes encoding flavin mononucleotide-containing oxidoreductases, designated xenobiotic reductases, from Pseudomonas putida II-B and P. fluorescens I-C that removed nitrite from nitroglycerin (NG) by cleavage of the nitroester bond were cloned, sequenced, and characterized. The P. putida gene, xenA, encodes a 39,702-Da monomeric, NAD(P)H-dependent flavoprotein that removes either the terminal or central nitro groups from NG and that reduces 2-cyclohexen-1-one but did not readily reduce 2,4,6-trinitrotoluene (TNT). The P. fluorescens gene, xenB, encodes a 37,441-Da monomeric, NAD(P)H-dependent flavoprotein that exhibits fivefold regioselectivity for removal of the central nitro group from NG and that transforms TNT but did not readily react with 2-cyclohexen-1-one. Heterologous expression of xenA and xenB was demonstrated in Escherichia coli DH5α. The transcription initiation sites of both xenA and xenB were identified by primer extension analysis. BLAST analyses conducted with the P. putida xenA and the P. fluorescens xenB sequences demonstrated that these genes are similar to several other bacterial genes that encode broad-specificity flavoprotein reductases. The prokaryotic flavoprotein reductases described herein likely shared a common ancestor with old yellow enzyme of yeast, a broad-specificity enzyme which may serve a detoxification role in antioxidant defense systems. PMID:10515912

  13. Full genome sequencing of the Newcastle disease viruses VS/GA and clone 5

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The complete genome sequence of the Villegas-Glisson/University of Georgia (VG/GA) strain of Newcastle disease virus (NDV) and of a plaque purified clone (clone 5) exhibiting a different phenotype were sequenced and analyzed. The VG/GA strain, isolated from the intestine of healthy turkeys replicat...

  14. ABO genotyping by PCR-RFLP and cloning and sequencing.


    Haak, Wolfgang; Burger, Joachim; Alt, Kurt Werner


    A refined PCR-RFLP based method was established to genotype ABO blood groups. The main objective of this study was to make the techniques also suitable for working with degraded DNA. Specific primer design was carried out to choose fragments shorter than 200 bp as necessary in forensic and archaeological applications. Four fragments of exon 6 and 7 of the ABO gene were amplified and digested by in total 7 restriction endonucleases. Particular attention was paid to the base changes at nucleotide positions 261(delG), 297, 526, 703, 721, 771, 796 and 1060(delC) in order to distinguish the six common alleles A101, A201, B, O01, O02 and O03. Furthermore, this method also enables determination of seven of the less frequent alleles: A104, A204, Ax02, Ax03, O05, O06 and O07. The method was applied successfully to a series of blood samples with known phenotypes and genotypes as well as DNA extracted from a thirty year old blood stain and an ancient tooth sample. However, working with ancient DNA requires additional cloning and sequencing of the RFLP-typing results due to DNA post mortem damages such as deaminations, which could lead to false typing results.

  15. Cloning


    Cloning describes the processes used to create an exact genetic replica of another cell, tissue or organism. ... named Dolly. There are three different types of cloning: Gene cloning, which creates copies of genes or ...

  16. Giant panda ribosomal protein S14: cDNA, genomic sequence cloning, sequence analysis, and overexpression.


    Wu, G-F; Hou, Y-L; Hou, W-R; Song, Y; Zhang, T


    RPS14 is a component of the 40S ribosomal subunit encoded by the RPS14 gene and is required for its maturation. The cDNA and the genomic sequence of RPS14 were cloned successfully from the giant panda (Ailuropoda melanoleuca) using RT-PCR technology and touchdown-PCR, respectively; they were both sequenced and analyzed. The length of the cloned cDNA fragment was 492 bp; it contained an open-reading frame of 456 bp, encoding 151 amino acids. The length of the genomic sequence is 3421 bp; it contains four exons and three introns. Alignment analysis indicates that the nucleotide sequence shares a high degree of homology with those of Homo sapiens, Bos taurus, Mus musculus, Rattus norvegicus, Gallus gallus, Xenopus laevis, and Danio rerio (93.64, 83.37, 92.54, 91.89, 87.28, 84.21, and 84.87%, respectively). Comparison of the deduced amino acid sequences of the giant panda with those of these other species revealed that the RPS14 of giant panda is highly homologous with those of B. taurus, R. norvegicus and D. rerio (85.99, 99.34 and 99.34%, respectively), and is 100% identical with the others. This degree of conservation of RPS14 suggests evolutionary selection. Topology prediction shows that there are two N-glycosylation sites, three protein kinase C phosphorylation sites, two casein kinase II phosphorylation sites, four N-myristoylation sites, two amidation sites, and one ribosomal protein S11 signature in the RPS14 protein of the giant panda. The RPS14 gene can be readily expressed in Escherichia coli. When it was fused with the N-terminally His-tagged protein, it gave rise to accumulation of an expected 22-kDa polypeptide, in good agreement with the predicted molecular weight. The expression product obtained can be purified for studies of its function.

  17. A first generation physical map of the medaka genome in BACs essential for positional cloning and clone-by-clone based genomic sequencing.


    Khorasani, Maryam Zadeh; Hennig, Steffen; Imre, Gabriele; Asakawa, Shuichi; Palczewski, Stefanie; Berger, Anja; Hori, Hiroshi; Naruse, Kiyoshi; Mitani, Hiroshi; Shima, Akihiro; Lehrach, Hans; Wittbrodt, Jochen; Kondoh, Hisato; Shimizu, Nobuyoshi; Himmelbauer, Heinz


    In order to realize the full potential of the medaka as a model system for developmental biology and genetics, characterized genomic resources need to be established, culminating in the sequence of the medaka genome. To facilitate the map-based cloning of genes underlying induced mutations and to provide templates for clone-based genomic sequencing, we have created a first-generation physical map of the medaka genome in bacterial artificial chromosome (BAC) clones. In particular, we exploited the synteny to the closely related genome of the pufferfish, Takifugu rubripes, by marker content mapping. As a first step, we clustered 103,144 public medaka EST sequences to obtain a set of 21,121 non-redundant sequence entities. Avoiding oversampling of gene-dense regions, 11,254 of EST clusters were successfully matched against the draft sequence of the fugu genome, and 2363 genes were selected for the BAC map project. We designed 35mer oligonucleotide probes from the selected genes and hybridized them against 64,500 BAC clones of strains Cab and Hd-rR, representing 14-fold coverage of the medaka genome. Our data set is further supplemented with 437 results generated from PCR-amplified inserts of medaka cDNA clones and BAC end-fragment markers. Our current, edited, first generation medaka BAC map consists of 902 map segments that cover about 74% of the medaka genome. The map contains 2721 markers. Of these, 2534 are from expressed sequences, equivalent to a non-redundant set of 2328 loci. The 934 markers (724 different) are anchored to the medaka genetic map. Thus, genetic map assignments provide immediate access to underlying clones and contigs, simplifying molecular access to candidate gene regions and their characterization.

  18. Cloning and sequencing of the gene encoding cytochrome c sub 553 from Desulfovibrio vulgaris Hildenborough

    SciTech Connect

    van Rooijen, G.J.H.; Voordouw, G. ); Bruschi, M. )


    The gene encoding cytochrome c{sub 553} from Desulfovibrio vulgaris Hildenborough was cloned by using two synthetic deoxyoligonucleotide probes. The amino acid sequence derived from the sequence of the gene differs from that reported by Bruschi and LeGall. Renewed protein sequencing confirmed the correctness of the DNA-derived sequence. The gene sequence indicates cytochrome c{sub 553} to be synthesized as a precursor protein with an NH{sub 2}-terminal signal sequence of 24 residues.

  19. Molecular cloning and sequences of lignin peroxidase genes of Phanerochaete chrysosporium.

    PubMed Central

    Schalch, H; Gaskell, J; Smith, T L; Cullen, D


    The genomic clones encoding lignin peroxidase isozyme H8 and two closely related genes were isolated from Phanerochaete chrysosporium BKM-1767, and their nucleotide sequences were determined. The positions and approximate lengths of introns were found to be highly conserved in all three clones. Analysis of homokaryotic derivatives indicated that the three clones are not alleles of the same gene(s). Images PMID:2761543

  20. Molecular cloning of mRNA sequences encoding rat lens crystallins.

    PubMed Central

    Dodemont, H J; Andreoli, P M; Moormann, R J; Ramaekers, F C; Schoenmakers, J G; Bloemendal, H


    To provide access to crystallin-specific DNA sequences, we have constructed plasmid clones bearing duplex DNA sequences complementary to crystallin mRNAs isolated from rat lens. Optimization of the cDNA reaction conditions enabled us to fractionate three double-stranded (ds) cDNA groups. Molecular cloning of dC-tailed ds cDNAs into the Pst I site of dG-tailed pBR322 yielded crystallin-specific clones of each group. By means of positive hybridization selection and translation, recombinant plasmids containing cDNA sequences coding for rat lens polypeptides from alpha-, beta-, and gamma-crystallins could be identified. The established cDNA clones have been used for a blot-hybridization analysis to map the crystallin mRNAs from which they originated. Both procedures revealed a high degree of homology between the gamma-crystallin sequences. From the beta-crystallin class, the beta H-specific cDNA coding for the beta B1a polypeptide was obtained. The alpha A-chain clone did not show any cross-hybridization to the alpha B-chain mRNA despite the existence of 60% homology between the corresponding gene products. As this clone hybridized to both alpha A2 and alpha AIns mRNAs, sequence analysis was applied for further characterization. The results showed that the cloned cDNA corresponds to the alpha A2 sequence exclusively. Images PMID:6946472

  1. Molecular Cloning and Sequencing of Hemoglobin-Beta Gene of Channel Catfish, Ictalurus Punctatus Rafinesque

    Technology Transfer Automated Retrieval System (TEKTRAN)

    : Hemoglobin-y gene of channel catfish , lctalurus punctatus, was cloned and sequenced . Total RNA from head kidneys was isolated, reverse transcribed and amplified . The sequence of the channel catfish hemoglobin-y gene consists of 600 nucleotides . Analysis of the nucleotide sequence reveals one o...

  2. Nucleotide sequence of a cloned woodchuck hepatitis virus genome: comparison with the hepatitis B virus sequence.

    PubMed Central

    Galibert, F; Chen, T N; Mandart, E


    The complete nucleotide sequence of a woodchuck hepatitis virus genome cloned in Escherichia coli was determined by the method of Maxam and Gilbert. This sequence was found to be 3,308 nucleotides long. Potential ATG initiator triplets and nonsense codons were identified and used to locate regions with a substantial coding capacity. A striking similarity was observed between the organization of human hepatitis B virus and woodchuck hepatitis virus. Nucleotide sequences of these open regions in the woodchuck virus were compared with corresponding regions present in hepatitis B virus. This allowed the location of four viral genes on the L strand and indicated the absence of protein coded by the S strand. Evolution rates of the various parts of the genome as well as of the four different proteins coded by hepatitis B virus and woodchuck hepatitis virus were compared. These results indicated that: (i) the core protein has evolved slightly less rapidly than the other proteins; and (ii) when a region of DNA codes for two different proteins, there is less freedom for the DNA to evolve and, moreover, one of the proteins can evolve more rapidly than the other. A hairpin structure, very well conserved in the two genomes, was located in the only region devoid of coding function, suggesting the location of the origin of replication of the viral DNA. Images PMID:7086958

  3. Cloning and sequencing of the allophycocyanin genes from Spirulina maxima (Cyanophyta)

    NASA Astrophysics Data System (ADS)

    Qin, Song; Hiroyuki, Kojima; Yoshikazu, Kawata; Shin-Ichi, Yano; Zeng, Cheng-Kui


    The genes coding for the α-and β-subunit of allophycocyanin ( apcA and apcB) from the cyanophyte Spirulina maxima were cloned and sequenced. The results revealed 44.4% of nucleotide sequence similarity and 30.4% of similarity of deduced amino acid sequence between them. The amino acid sequence identities between S. maxima and S. platensis are 99.4% for α subunit and 100% for β subunit.

  4. Cloning and sequence of DNA encoding structural proteins of the autonomous parvovirus feline panleukopenia virus.

    PubMed Central

    Carlson, J; Rushlow, K; Maxwell, I; Maxwell, F; Winston, S; Hahn, W


    Approximately 80% of the genome of feline panleukopenia virus was cloned into pBR322. This DNA included the transcription unit for the major viral mRNA species. The nucleotide sequence of the cloned portion of the genome was determined. Comparison of the feline panleukopenia virus sequence with the sequences of the parvoviruses minute virus of mice and H-1 revealed considerable homology between the three viruses on both the nucleic acid and protein levels. Based on this homology, a model for the generation of the two size classes of viral structural proteins (VP1 and VP2') is proposed. Images PMID:2991581

  5. Cloning, sequencing and characterization of lipase genes from a polyhydroxyalkanoate- (PHA-) synthesizing Pseudomonas resinovorans

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Lipase (lip) and lipase-specific foldase (lif) genes of a biodegradable polyhydroxyalkanoate- (PHA-) synthesizing Pseudomonas resinovorans NRRL B-2649 were cloned using primers based on consensus sequences, followed by PCR-based genome walking. Sequence analyses showed a putative Lip gene-product (...

  6. Cloning and sequence analysis of banana streak virus DNA.


    Harper, G; Hull, R


    Banana streak virus (BSV), a member of the Badnavirus group of plant viruses, causes severe problems in banana cultivation, reducing fruit yield and restricting plant breeding and the movement of germplasm. Current detection methods are relatively insensitive. In order to develop a PCR-based diagnostic method that is both reliable and sensitive, the genome of a Nigerian isolate of BSV has been sequenced and shown to comprise 7389 bp and to be organized in a manner characteristic of badnaviruses. Comparison of this sequence with those of other badnaviruses showed that BSV is a distinct virus. PCR with primers based on sequence data indicated that BSV sequences are present in the banana genome.

  7. Cloning and sequence analysis of a cDNA clone coding for the mouse GM2 activator protein.

    PubMed Central

    Bellachioma, G; Stirling, J L; Orlacchio, A; Beccari, T


    A cDNA (1.1 kb) containing the complete coding sequence for the mouse GM2 activator protein was isolated from a mouse macrophage library using a cDNA for the human protein as a probe. There was a single ATG located 12 bp from the 5' end of the cDNA clone followed by an open reading frame of 579 bp. Northern blot analysis of mouse macrophage RNA showed that there was a single band with a mobility corresponding to a size of 2.3 kb. We deduce from this that the mouse mRNA, in common with the mRNA for the human GM2 activator protein, has a long 3' untranslated sequence of approx. 1.7 kb. Alignment of the mouse and human deduced amino acid sequences showed 68% identity overall and 75% identity for the sequence on the C-terminal side of the first 31 residues, which in the human GM2 activator protein contains the signal peptide. Hydropathicity plots showed great similarity between the mouse and human sequences even in regions of low sequence similarity. There is a single N-glycosylation site in the mouse GM2 activator protein sequence (Asn151-Phe-Thr) which differs in its location from the single site reported in the human GM2 activator protein sequence (Asn63-Val-Thr). Images Figure 1 PMID:7689829

  8. Using the CRISPR/Cas9 system to eliminate native plasmids of Zymomonas mobilis ZM4.


    Cao, Qing-Hua; Shao, Huan-Huan; Qiu, Hui; Li, Tao; Zhang, Yi-Zheng; Tan, Xue-Mei


    The CRISPR/Cas system can be used to simply and efficiently edit the genomes of various species, including animals, plants, and microbes. Zymomonas mobilis ZM4 is a highly efficient, ethanol-producing bacterium that contains five native plasmids. Here, we constructed the pSUZM2a-Cas9 plasmid and a single-guide RNA expression plasmid. The pSUZM2a-Cas9 plasmid was used to express the Cas9 gene cloned from Streptococcus pyogenes CICC 10464. The single-guide RNA expression plasmid pUC-T7sgRNA, with a T7 promoter, can be used for the in vitro synthesis of single-guide RNAs. This system was successfully employed to knockout the upp gene of Escherichia coli and the replicase genes of native Z. mobilis plasmids. This is the first study to apply the CRISPR/Cas9 system of S. pyogenes to eliminate native plasmids in Z. mobilis. It provides a new method for plasmid curing and paves the way for the genomic engineering of Z. mobilis.

  9. [cDNA cloning and sequence analysis of pluripotency genes in tree shrews (Tupaia belangeri)].


    Wang, Cai-Yun; Ma, Yun-Han; He, Da-Jian; Yang, Shi-Hua


    In this paper, partial sequences of the tree shrew (Tupaia belangeri) Klf4, Sox2, and c-Myc genes were cloned and sequenced, which were 382, 612, and 485 bp in length and encoded 127, 204, and 161 amino acids, respectively. Whereas, their cDNA sequence identities with those of human were 89%, 98%, and 89%, respectively. Their phylogenetic tree results indicated different topologies and suggested individual evolutional pathways. These results can facilitate further functional studies.

  10. Linking the human cytogenetic map with nucleotide sequence: the CCAP clone set.


    Jang, Wonhee; Yonescu, Raluca; Knutsen, Turid; Brown, Theresa; Reppert, Tricia; Sirotkin, Karl; Schuler, Gregory D; Ried, Thomas; Kirsch, Ilan R


    We present the completed dataset and clone repository of the Cancer Chromosome Aberration Project (CCAP), an initiative developed and funded through the intramural program of the U.S. National Cancer Institute, to provide seamless linkage of human cytogenetic markers with the primary nucleotide sequence of the human genome. Spaced at 1-2 Mb intervals across the human genome, 1,339 bacterial artificial chromosome (BAC) clones have been localized to chromosomal bands through high-resolution fluorescence in situ hybridization (FISH) mapping. Of these clones, 99.8% can be positioned on the primary human genome sequence and 95% are placed at or close to their precise nucleotide starts and stops. This dataset can be studied and manipulated within generally available public Web sites. The clones are available from a commercial repository. The CCAP BAC clone set provides anchors for the interrogation of gene and sequence involvement in oncogenic and developmental disorders when the starting point is the recognition of a structural, numerical, or interstitial chromosomal aberration. This dataset also provides a current view of the quality and coherence of the available genome sequence and insight into the nucleotide and three-dimensional structures that manifest as Giemsa light and dark chromosomal banding patterns.

  11. Analysis of a marine picoplankton community by 16S rRNA gene cloning and sequencing.

    PubMed Central

    Schmidt, T M; DeLong, E F; Pace, N R


    The phylogenetic diversity of an oligotrophic marine picoplankton community was examined by analyzing the sequences of cloned ribosomal genes. This strategy does not rely on cultivation of the resident microorganisms. Bulk genomic DNA was isolated from picoplankton collected in the north central Pacific Ocean by tangential flow filtration. The mixed-population DNA was fragmented, size fractionated, and cloned into bacteriophage lambda. Thirty-eight clones containing 16S rRNA genes were identified in a screen of 3.2 x 10(4) recombinant phage, and portions of the rRNA gene were amplified by polymerase chain reaction and sequenced. The resulting sequences were used to establish the identities of the picoplankton by comparison with an established data base of rRNA sequences. Fifteen unique eubacterial sequences were obtained, including four from cyanobacteria and eleven from proteobacteria. A single eucaryote related to dinoflagellates was identified; no archaebacterial sequences were detected. The cyanobacterial sequences are all closely related to sequences from cultivated marine Synechococcus strains and with cyanobacterial sequences obtained from the Atlantic Ocean (Sargasso Sea). Several sequences were related to common marine isolates of the gamma subdivision of proteobacteria. In addition to sequences closely related to those of described bacteria, sequences were obtained from two phylogenetic groups of organisms that are not closely related to any known rRNA sequences from cultivated organisms. Both of these novel phylogenetic clusters are proteobacteria, one group within the alpha subdivision and the other distinct from known proteobacterial subdivisions. The rRNA sequences of the alpha-related group are nearly identical to those of some Sargasso Sea picoplankton, suggesting a global distribution of these organisms. Images PMID:2066334

  12. Rhipicephalus microplus strain Deutsch, 10 BAC clone sequences

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The cattle tick, Rhipicephalus (Boophilus) microplus, has a genome over 2.4 times the size of the human genome, and with over 70% of repetitive DNA, this genome would prove very costly to sequence at today's prices and difficult to assemble and analyze. We used labeled DNA probes from the coding reg...

  13. Cloning


    ... that have been cloned from somatic cells include: cat, deer, dog, horse, mule, ox, rabbit and rat. ... with cell division. In other mammals, such as cats, rabbits and mice, the two spindle proteins are ...

  14. Cloning, sequencing and expression of the Schwanniomyces occidentalis NADP-dependent glutamate dehydrogenase gene.


    De Zoysa, P A; Connerton, I F; Watson, D C; Johnston, J R


    The cloned NADP-specific glutamate dehydrogenase (GDH) genes of Aspergillus nidulans (gdhA) and Neurospora crassa (am) have been shown to hybridize under reduced stringency conditions to genomic sequences of the yeast Schwanniomyces occidentalis. Using 5' and 3' gene-specific probes, a unique 5.1 kb BclI restriction fragment that encompasses the entire Schwanniomyces sequence has been identified. A recombinant clone bearing the unique BclI fragment has been isolated from a pool of enriched clones in the yeast/E. coli shuttle vector pWH5 by colony hybridization. The identity of the plasmid clone was confirmed by functional complementation of the Saccharomyces cerevisiae gdh-1 mutation. The nucleotide sequence of the Schw. occidentalis GDH gene, which consists of 1380 nucleotides in a continuous reading frame of 459 amino acids, has been determined. The predicted amino acid sequence shows considerable homology with GDH proteins from other fungi and significant homology with all other available GDH sequences.

  15. Characterization of sphere-forming HCT116 clones by whole RNA sequencing

    PubMed Central

    Chung, Eunkyung; Oh, Inkyung


    Purpose To determine CD133+ cells defined as cancer stem cells (CSCs) in colon cancer, we examined whether CD133+ clones in HCT116 demonstrate known features of CSCs like sphere-forming ability, chemodrug-resistance, and metastatic potential. Methods Magnetic cell isolation and cell separation demonstrated that <1% of HCT116 cells expressed CD133, with the remaining cells being CD133- clones. In colon cancer cells, radioresistance is also considered a CSC characteristic. We performed clonogenic assay using 0.4 Gy γ-irradiation. Results Interestingly, there were no differences between HCT116 parental and HCT116 CD133+ clones when the cells comprised 0.5% of the total cells, and CD133- clone demonstrated radiosensitive changes compared with parental and CD133+ clones. Comparing gene expression profiles between sphere-forming and nonforming culture conditions of HCT116 subclones by whole RNA sequencing failed to obtain specific genes expressed in CD133+ clones. Conclusion Despite no differences of gene expression profiles in monolayer attached culture conditions of each clone, sphere-forming conditions of whole HCT116 subclones, parental, CD133+, and CD133- increased 1,761 coding genes and downregulated 1,384 genes related to CSCs self-renewal and survival. Thus, spheroid cultures of HCT116 cells could be useful to expand colorectal CSCs rather than clonal expansion depending on CD133 expressions. PMID:27073788

  16. Novel repeated DNA sequences in safflower (Carthamus tinctorius L.) (Asteraceae): cloning, sequencing, and physical mapping by fluorescence in situ hybridization.


    Raina, S N; Sharma, S; Sasakuma, T; Kishii, M; Vaishnavi, S


    Two novel repetitive DNA sequences, pCtKpnI-1 and pCtKpnI-2, were isolated from Carthamus tinctorius (2n = 2x = 24) and cloned. Both represent tandemly repeated sequences. The pCtKpnI-1 and pCtKpnI-2 clones constitute repeat units of 343-345 bp and 367 bp, respectively, with 63% sequence heterogeneity between the two. Fluorescence in situ hybridization (FISH) was employed on metaphase chromosomes of C. tinctorius using, simultaneously, pCtKpnI-1 and pCtKpnI-2 repeated sequences. The pCtKpnI-1 sequence was found to be exclusively localized at subtelomeric regions on most of the chromosomes. On the other hand, sequence of the pCtKpnI-2 clone was distributed on two nucleolar and one nonnucleolar chromosome pairs. The satellite, and the intervening chromosome segment between the primary and secondary constrictions, in the two nucleolar chromosome pairs were wholly constituted by pCtKpnI-2 repeated sequence. The pCtKpnI-2 repeated sequence, showing partial homology to intergenic spacer (IGS) of 18S-25S ribosomal RNA genes of an Asteraceae taxon (Centaurea stoebe), and the 18S-25S rRNA gene clusters were located at independent, but juxtaposed sites in the nucleolar chromosomes. Variability in the number, size, and location of the two repeated sequences provided identification of most of the chromosomes in the otherwise not too distinctive homologues within the complement. This article reports the start of a molecular cytogenetics program targeting the genome of safflower, a major world oil crop about whose genetics very little is known.

  17. Molecular cloning, sequence analysis, and functional expression of a novel growth regulator, oncostatin M.

    PubMed Central

    Malik, N; Kallestad, J C; Gunderson, N L; Austin, S D; Neubauer, M G; Ochs, V; Marquardt, H; Zarling, J M; Shoyab, M; Wei, C M


    Oncostatin M is a polypeptide of Mr approximately 28,000 that acts as a growth regulator for many cultured mammalian cells. We report the cDNA and genomic cloning, sequence analysis, and functional expression in heterologous cells of oncostatin M. cDNA clones were isolated from mRNA of U937 cells that had been induced to differentiate into macrophagelike cells by treatment with phorbol 12-myristate 13-acetate, and a genomic clone was also isolated from human brain DNA. Sequence analysis of these clones established the 1,814-base-pair cDNA sequence as well as exon boundaries. This sequence predicted that oncostatin M is synthesized as a 252-amino-acid polypeptide, with a 25-residue hydrophobic sequence resembling a signal peptide at the N terminus. The predicted oncostatin M amino acid sequence shared no homology with other known proteins, but the sequence of the 3' noncoding region of the cDNA contained an A + T-rich stretch with sequence motifs found in the 3' untranslated regions of many cytokine and lymphokine cDNAs. Oncostatin M mRNA of approximately 2 kilobase pairs was detected in phorbol 12-myristate 13-acetate-treated U937 cells and in activated human T cells. Transfection of cDNA encoding the oncostatin M precursor into COS cells resulted in the secretion of proteins with the structural and functional properties of oncostatin M. The unique amino acid sequence, expression by lymphoid cells, and growth-regulatory activities of oncostatin M suggest that it is a novel cytokine. Images PMID:2779549

  18. From expression cloning to gene modeling: the development of Xenopus gene sequence resources.


    Gilchrist, Michael J


    The Xenopus community has made concerted efforts over the last 10-12 years systematically to improve the available sequence information for this amphibian model organism ideally suited to the study of early development in vertebrates. Here I review progress in the collection of both sequence data and physical clone reagents for protein coding genes. I conclude that we have cDNA sequences for around 50% and full-length clones for about 35% of the genes in Xenopus tropicalis, and similar numbers but a smaller proportion for Xenopus laevis. In addition, I demonstrate that the gaps in the current genome assembly create problems for the computational elucidation of gene sequences, and suggest some ways to ameliorate the effects of this.

  19. Cloning and nucleotide sequence of the aroA gene of Bordetella pertussis.

    PubMed Central

    Maskell, D J; Morrissey, P; Dougan, G


    The aroA locus of Bordetella pertussis, encoding 5-enolpyruvylshikimate 3-phosphate synthase, has been cloned into Escherichia coli by using a cosmid vector. The gene is expressed in E. coli and complemented an E. coli aroA mutant. The nucleotide sequence of the B. pertussis aroA gene was determined and contains an open reading frame encoding 442 amino acids, with a calculated molecular weight for 5-enolpyruvylshikimate 3-phosphate synthase of 46,688. The amino acid sequence derived from the nucleotide sequence shows homology with the published amino acid sequences of aroA gene products of other microorganisms. PMID:2897356

  20. Hypervirulent Clone of Group B Streptococcus Serotype III Sequence Type 283, Hong Kong, 1993–2012

    PubMed Central

    Ang, Irene; Fung, Kitty; Liyanapathirana, Veranja; Luo, Ming Jing; Lai, Raymond


    We describe a hypervirulent clone of group B Streptococcus serotype III, subtype 4, sequence type 283, that caused invasive disease with a predilection for meningitis in Hong Kong during 1993–2012. The organism is associated with high mortality and increased summer prevalence and is linked to diseased fish from freshwater fish farms. PMID:27648702

  1. Cloning, sequencing and characterization of lipase from a polyhydroxyalkanoate- (PHA-) synthesizing Pseudomonas resinovorans

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Lipase gene (lip) of a biodegradable polyhydroxyalkanoate- (PHA-) synthesizing bacterium P. resinovorans NRRL B-2649 was cloned, sequenced and characterized by using consensus primers and PCR-based genome walking method. The ORF of the putative Lip (314 amino acids) and its active site (Ser111, Asp...

  2. Cloning and sequencing of a cDNA encoding a taste-modifying protein, miraculin.


    Masuda, Y; Nirasawa, S; Nakaya, K; Kurihara, Y


    A cDNA clone encoding a taste-modifying protein, miraculin (MIR), was isolated and sequenced. The encoded precursor to MIR was composed of 220 amino acid (aa) residues, including a possible signal sequence of 29 aa. Northern blot analysis showed that the mRNA encoding MIR was already expressed in fruits of Richadella dulcifica at 3 weeks after pollination and was present specifically in the pulp.

  3. Nucleotide sequence of cloned cDNA for human pancreatic kallikrein.


    Fukushima, D; Kitamura, N; Nakanishi, S


    Cloned cDNA sequences for human pancreatic kallikrein have been isolated and determined by molecular cloning and sequence analysis. The identity between human pancreatic and urinary kallikreins is indicated by the complete coincidence between the amino acid sequence deduced from the cloned cDNA sequence and that reported partially for urinary kallikrein. The active enzyme form of the human pancreatic kallikrein consists of 238 amino acids and is preceded by a signal peptide and a profragment of 24 amino acids. A sequence comparison of this with other mammalian kallikreins indicates that key amino acid residues required for both serine protease activity and kallikrein-like cleavage specificity are retained in the human sequence, and residues corresponding to some external loops of the kallikrein diverge from other kallikreins. Analyses by RNA blot hybridization, primer extension, and S1 nuclease mapping indicate that the pancreatic kallikrein mRNA is also expressed in the kidney and sublingual gland, suggesting the active synthesis of urinary kallikrein in these tissues. Furthermore, the tissue-specific regulation of the expression of the members of the human kallikrein gene family has been discussed.

  4. Cloning flanking sequence by single-primer PCR in transgenic plants.


    Ma, J; Wang, Y P; Ren, S; Zhang, Z; Lu, S; Wang, P W


    The insertion position of exogenous genes in plant genomes is usually identified by adapter ligation-mediated polymerase chain reaction (PCR), thermal asymmetric interlaced PCR, and restriction site extension PCR in transgenic plant research. However, these methods have various limitations, such as the complexity of designing primers and time-consuming and multiple-step procedures. The goal of this study was to establish an easier, more rapid, and more accurate method to clone flanking sequence using single-primer PCR in transgenic plants. Unknown flanking genome sequences in transgenic plants, including those in tobacco, soybean, rice, and maize, were cloned using the single-primer PCR method established in this study, with the Bar gene as the anchor gene. The primer 1 (P1), P2, and P3 PCRs obtained 4 sequences, and the completely correct flanking sequence of 508 bp that was obtained in the P3 PCR was verified by sequencing analysis. The single-primer PCR is more rapid and accurate than conventional methods, justifying its application widely in cloning flanking sequences in transgenic plants.

  5. Design and construction of improved new vectors for Zymomonas mobilis recombinants.


    Dong, Hong-Wei; Bao, Jie; Ryu, Dewey D Y; Zhong, Jian-Jiang


    Zymomonas mobilis is a very important gram-negative bacterium having a potential application to simultaneous co-production of biofuel and other high value-added products through biorefinery process technology development. Up to now, pLOI193 has been used as the plasmid of choice for Z. mobilis strains. However, its application has been limited due to its relatively low transformation efficiency, a large plasmid size (13.4 kb), and limited choice of cloning sites for gene manipulations. Some of these limitations can be overcome by the newly designed and constructed plasmid pHW20a, which provides significantly higher transformation efficiency (about two orders of magnitude greater), better stability (for at least 120 generation times), and an ease of gene manipulations. The pHW20a contains three complete cis-acting genes (repA, repB, and repC) encoding the Rep proteins for primosome formation. It has the origin of replication (oriV) to ensure replication in gram-negative bacteria, two mob genes that enhances transformation efficiency, a screening marker (lacZα), expanded multiple cloning sites (MCS) that enables easy gene manipulation, and the tetracycline resistance gene (tc(r) ). The utility of screening marker, lacZα with MCS, was confirmed by the blue-white screening test. Several examples of applications of gene expression in Z. mobilis ZM4 have been demonstrated in this article by using several new pHW20a-derived plasmids and expressing the homologous genes (gfo and ppc) and the heterologous genes (bglA, mdh, and fdh1). The results show that pHW20a is a very useful new vector for construction of new Z. mobilis recombinant strains that will enable simultaneous co-production of biofuel and high value added products.

  6. Identification of genomic sequences corresponding to cDNA clones

    SciTech Connect

    Spoerel, N.A.; Kafatos, F.C.


    The general methods applicable to the isolation of genomic sequences from phage lambda or cosmid libraries have been described. This chapter presents strategies for the investigation of genes that occur in several identical or nonidentical copies per genome, or that share a common conserved domain with other genes. The methods discussed are applicable both to the identification of the genes in Southern blots and to their isolation from libraries. Furthermore, the methods are well suited for the analysis of homologous genes in different species. A high proportion of genes in eukaryotes are known to be members of multigene families. Carefully controlled hybridization conditions and well-tailored probes are powerful tools in the isolation and analysis of genes which share a common domain or are members of multigene families. This chapter consists of a short review of recommended strategies and relevant parameters, which have been discussed in more detail earlier. Using three examples from the authors' analysis of the silk moth choriun locus, they demonstrate how powerful carefully tailored short single-stranded probes can be in the analysis of closely related gene copies.

  7. Cloning, sequencing and expression of the gene encoding the extracellular metalloprotease of Aeromonas caviae.


    Kawakami, K; Toma, C; Honma, Y


    A gene (apk) encoding the extracellular protease of Aeromonas caviae Ae6 has been cloned and sequenced. For cloning the gene, the DNA genomic library was screened using skim milk LB agar. One clone harboring plasmid pKK3 was selected for sequencing. Nucleotide sequencing of the 3.5 kb region of pKK3 revealed a single open reading frame (ORF) of 1,785 bp encoding 595 amino acids. The deduced polypeptide contained a putative 16-amino acid signal peptide followed by a large propeptide. The N-terminal amino acid sequence of purified recombinant protein (APK) was consistent with the DNA sequence. This result suggested a mature protein of 412 amino acids with a molecular mass of 44 kDa. However, the molecular mass of purified recombinant APK revealed 34 kDa by SDS-PAGE, suggesting that further processing at the C-terminal region took place. The 2 motifs of zinc binding sites deduced are highly conserved in the APK as well as in other zinc metalloproteases including Vibrio proteolyticus neutral protease, Emp V from Vibrio vulnificus, HA/P from Vibrio cholerae, and Pseudomonas aeruginosa elastase. Proteolytic activity was inhibited by EDTA, Zincov, 1,10-phenanthroline and tetraethylenepentamine while unaffected by the other inhibitors tested. The protease showed maximum activity at pH 7.0 and was inactivated by heating at 80 C for 15 min. These results together suggest that APK belongs to the thermolysin family of metalloendopeptidases.

  8. Molecular cloning, expression, and sequence of the pilin gene from nontypeable Haemophilus influenzae M37.

    PubMed Central

    Coleman, T; Grass, S; Munson, R


    Nontypeable Haemophilus influenzae M37 adheres to human buccal epithelial cells and exhibits mannose-resistant hemagglutination of human erythrocytes. An isogenic variant of this strain which was deficient in hemagglutination was isolated. A protein with an apparent molecular weight of 22,000 was present in the sodium dodecyl sulfate-polyacrylamide gel profile of sarcosyl-insoluble proteins from the hemagglutination-proficient strain but was absent from the profile of the isogenic hemagglutination-deficient variant. A monoclonal antibody which reacts with the hemagglutination-proficient isolate but not with the hemagglutination-deficient isolate has been characterized. This monoclonal antibody was employed in an affinity column for purification of the protein as well as to screen a genomic library for recombinant clones expressing the gene. Several clones which contained overlapping genomic fragments were identified by reaction with the monoclonal antibody. The gene for the 22-kDa protein was subcloned and sequenced. The gene for the type b pilin from H. influenzae type b strain MinnA was also cloned and sequenced. The DNA sequence of the strain MinnA gene was identical to that reported previously for two other type b strains. The DNA sequence of the strain M37 gene is 77% identical to that of the type b pilin gene, and the derived amino acid sequence is 68% identical to that of the type b pilin. Images PMID:1673447

  9. Cloning and characterization of the Dictyostelium discoideum rasG genomic sequences.


    Robbins, S M; Williams, J G; Spiegelman, G B; Weeks, G


    A Dictyostelium discoideum genomic DNA clone containing the ras-related gene, rasG was isolated using the rasG cDNA as a probe. The genomic clone encompasses the entire coding region of the gene and 1.5 kb of 5' flanking region. The rasG gene contains a single intron as determined by sequence comparison with the cDNA, whereas the highly related rasD gene contains three introns. Primer extension analysis showed that transcription of the rasG gene initiates at multiple sites. Sequence analysis of the 5' flanking region of the gene revealed a stretch of thymine residues upstream from the transcription start sites but there is no evidence for a TATA box sequence.

  10. Complete genomic sequence and an infectious BAC clone of feline herpesvirus-1 (FHV-1).


    Tai, S H Sheldon; Niikura, Masahiro; Cheng, Hans H; Kruger, John M; Wise, Annabel G; Maes, Roger K


    Infection with feline herpesvirus-1 (FHV-1) is a major cause of upper respiratory and ocular diseases in Felidae. We report the first complete genomic sequence of FHV-1, as well as the construction and characterization of a bacterial artificial chromosome (BAC) clone of FHV-1, which contains the entire FHV-1 genome and has the BAC vector inserted at the left end of U(L). Complete genomic sequences were derived from both the FHV-1 BAC clone and purified virion DNA. The FHV-1 genome is 135,797bp in size with an overall G+C content of 45%. A total of 78 open reading frames were predicted, encoding 74 distinct proteins. The gene arrangement is collinear with that of most sequenced varicelloviruses. The virus regenerated from the BAC was very similar to the parental C-27 strain in vitro in terms of plaque morphology and growth characteristics and highly virulent in cats in a preliminary in vivo study.

  11. Construction and utility of 10-kb libraries for efficient clone-gap closure for rice genome sequencing.


    Yang, Tae-Jin; Yu, Yeisoo; Nah, Gyoungju; Atkins, Michael; Lee, Seunghee; Frisch, David A; Wing, Rod A


    Rice is an important crop and a model system for monocot genomics, and is a target for whole genome sequencing by the International Rice Genome Sequencing Project (IRGSP). The IRGSP is using a clone by clone approach to sequence rice based on minimum tiles of BAC or PAC clones. For chromosomes 10 and 3 we are using an integrated physical map based on two fingerprinted and end-sequenced BAC libraries to identifying a minimum tiling path of clones. In this study we constructed and tested two rice genomic libraries with an average insert size of 10 kb (10-kb library) to support the gap closure and finishing phases of the rice genome sequencing project. The HaeIII library contains 166,752 clones covering approximately 4.6x rice genome equivalents with an average insert size of 10.5 kb. The Sau3AI library contains 138,960 clones covering 4.2x genome equivalents with an average insert size of 11.6 kb. Both libraries were gridded in duplicate onto 11 high-density filters in a 5 x 5 pattern to facilitate screening by hybridization. The libraries contain an unbiased coverage of the rice genome with less than 5% contamination by clones containing organelle DNA or no insert. An efficient method was developed, consisting of pooled overgo hybridization, the selection of 10-kb gap spanning clones using end sequences, transposon sequencing and utilization of in silico draft sequence, to close relatively small gaps between sequenced BAC clones. Using this method we were able to close a majority of the gaps (up to approximately 50 kb) identified during the finishing phase of chromosome-10 sequencing. This method represents a useful way to close clone gaps and thus to complete the entire rice genome.

  12. Cloning, expression, and sequencing of squalene-hopene cyclase, a key enzyme in triterpenoid metabolism.

    PubMed Central

    Ochs, D; Kaletta, C; Entian, K D; Beck-Sickinger, A; Poralla, K


    The pentacyclic hopanoids, a class of eubacterial lipids, are synthesized by squalene-hopene cyclase and side chain-elongating enzymes. With the aid of DNA probes based on the amino-terminal sequence of purified squalene-hopene cyclase from Bacillus acidocaldarius, clones of Escherichia coli that express this enzyme in the cytoplasmic membrane were isolated. According to the DNA sequence, the cyclase contained 627 amino acids with a molecular mass of 69,473 Da. A high percentage of the amino acids were basic. No significant similarity to existing sequenced proteins was found. Images PMID:1729216

  13. Molecular cloning and sequencing of the gene encoding the fimbrial subunit protein of Bacteroides gingivalis.

    PubMed Central

    Dickinson, D P; Kubiniec, M A; Yoshimura, F; Genco, R J


    The gene encoding the fimbrial subunit protein of Bacteroides gingivalis 381, fimbrilin, has been cloned and sequenced. The gene was present as a single copy on the bacterial chromosome, and the codon usage in the gene conformed closely to that expected for an abundant protein. The predicted size of the mature protein was 35,924 daltons, and the secretory form may have had a 10-amino-acid, hydrophilic leader sequence similar to the leader sequences of the MePhe fimbriae family. The protein sequence had no marked similarity to known fimbrial sequences, and no homologous sequences could be found in other black-pigmented Bacteroides species, suggesting that fimbrillin represents a class of fimbrial subunit protein of limited distribution. Images PMID:2895100

  14. Cloning and sequence analysis of the muramidase-2 gene from Enterococcus hirae.

    PubMed Central

    Chu, C P; Kariyama, R; Daneo-Moore, L; Shockman, G D


    Extracellular muramidase-2 of Enterococcus hirae ATCC 9790 was purified to homogeneity by substrate binding, guanidine-HCl extraction, and reversed-phase chromatography. A monoclonal antibody, 2F8, which specifically recognizes muramidase-2, was used to screen a genomic library of E. hirae ATCC 9790 DNA in bacteriophage lambda gt11. A positive phage clone containing a 4.5-kb DNA insert was isolated and analyzed. The EcoRI-digested 4.5-kb fragment was cut into 2.3-, 1.0-, and 1.5-kb pieces by using restriction enzymes KpnI, Sau3AI, and PstI, and each fragment was subcloned into plasmid pJDC9 or pUC19. The nucleotide sequence of each subclone was determined. The sequence data indicated an open reading frame encoding a polypeptide of 666 amino acid residues, with a calculated molecular mass of 70,678 Da. The first 24 N-terminal amino acids of purified extracellular muramidase-2 were in very good agreement with the deduced amino acid sequence after a 49-amino-acid putative signal sequence. Analysis of the deduced amino acid sequence showed the presence at the C-terminal region of the protein of six highly homologous repeat units separated by nonhomologous intervening sequences that are highly enriched in serine and threonine. The overall sequence showed a high degree of homology with a recently cloned Streptococcus faecalis autolysin. Images PMID:1347040

  15. Fine Structure of Ectothiorhodospira mobilis Pelsh1

    PubMed Central

    Remsen, C. C.; Watson, S. W.; Waterbury, J. B.; Trüper, H. G.


    The cell wall structure, arrangement of photosynthetic membranes, and the attachment of flagella of Ectothiorhodospira mobilis strain 8112 were examined by using freeze-etching and conventional electron microscopic techniques. The outer coat of the multilayered cell wall is comprised of 50 A repeating subunits, arranged in a regular array. The photosynthetic membranes, which originate from and are attached to the plasma membrane, are arranged in a more complex pattern than previously seen in other bacteria. The tuft of flagella in E. mobilis is inserted into a polar organelle. The relationship of this organelle to the polar membrane and the mechanism of attachment of the flagella to the polar organelle is discussed. Images PMID:5669908

  16. Cloning and nucleotide sequence of wild type and a mutant histidine decarboxylase from Lactobacillus 30a.


    Vanderslice, P; Copeland, W C; Robertus, J D


    Prohistidine decarboxylase from Lactobacillus 30a is a protein that autoactivates to histidine decarboxylase by cleaving its peptide chain between serines 81 and 82 and converting Ser-82 to a pyruvoyl moiety. The pyruvoyl group serves as the prosthetic group for the decarboxylation reaction. We have cloned and determined the nucleotide sequence of the gene for this enzyme from a wild type strain and from a mutant with altered autoactivation properties. The nucleotide sequence modifies the previously determined amino acid sequence of the protein. A tripeptide missed in the chemical sequence is inserted, and three other amino acids show conservative changes. The activation mutant shows a single change of Gly-58 to an Asp. Sequence analysis up- and downstream from the gene suggests that histidine decarboxylase is part of a polycistronic message, and that the transcriptional promotor region is strongly homologous to those of other Gram-positive organisms.

  17. Cloning and sequencing of cDNA and genomic DNA encoding PDM phosphatase of Fusarium moniliforme.


    Yoshida, Hiroshi; Iizuka, Mari; Narita, Takao; Norioka, Naoko; Norioka, Shigemi


    PDM phosphatase was purified approximately 500-fold through six steps from the extract of dried powder of the culture filtrate of Fusarium moniliforme. The purified preparation appeared homogeneous on SDS-PAGE although the protein band was broad. Amino acid sequence information was collected on tryptic peptides from this preparation. cDNA cloning was carried out based on the information. A full-length cDNA was obtained and sequenced. The sequence had an open reading frame of 651 amino acid residues with a molecular mass of 69,988 Da. Cloning and sequencing of the genomic DNA corresponding to the cDNA was also conducted. The deduced amino acid sequence could account for many but not all of the tryptic peptides, suggesting presence of contaminant protein(s). SDS-PAGE analysis after chemical deglycosylation showed two proteins with molecular masses of 58 and 68 kDa. This implied that the 58 kDa protein had been copurified with PDM phosphatase. Homology search showed that PDM phosphatase belongs to the purple acid phosphatase family, which is widely distributed in the biosphere. Sequence data of fungal purple acid phosphatases were collected from the database. Processing of the data revealed presence of two types, whose evolutionary relationships were discussed.

  18. Cloning and sequencing of human intestinal alkaline phosphatase cDNA

    SciTech Connect

    Berger, J.; Garattini, E.; Hua, J.C.; Udenfriend, S.


    Partial protein sequence data obtained on intestinal alkaline phosphatase indicated a high degree of homology with the reported sequence of the placental isoenzyme. Accordingly, placental alkaline phosphatase cDNA was cloned and used as a probe to clone intestinal alkaline phosphatase cDNA. The latter is somewhat larger (3.1 kilobases) than the cDNA for the placental isozyme (2.8 kilobases). Although the 3' untranslated regions are quite different, there is almost 90% homology in the translated regions of the two isozymes. There are, however, significant differences at their amino and carboxyl termini and a substitution of an alanine in intestinal alkaline phosphatase for a glycine in the active site of the placental isozyme.

  19. Recombinant Zymomonas mobilis with improved xylose utilization


    Zhang, Min


    A strain derived from Zymomonas mobilis ATCC31821 or its derivative capable of producing ethanol upon fermentation of a carbohydrate medium containing xylose to provide enhanced xylose utilization and enhanced ethanol process yield, the strain or its derivative comprising exogenous genes encoding xylose isornerase, xylulokinase, transaldolase and transketolase, the genes are fused to at least one promotor recognized by Zymomonas which regulates the expression of at least one of the genes.

  20. Mechanism of glutamate uptake in Zymomonas mobilis.

    PubMed Central

    Ruhrmann, J; Krämer, R


    The energetics of the anaerobic gram-negative bacterium Zymomonas mobilis, a well-known ethanol-producing organism, is based solely on synthesis of 1 mol of ATP per mol of glucose by the Entner-Doudoroff pathway. When grown in the presence of glucose as a carbon and energy source, Z. mobilis had a cytosolic ATP content of 3.5 to 4 mM. Because of effective pH homeostasis, the components of the proton motive force strongly depended on the external pH. At pH 5.5, i.e., around the optimal pH for growth, the proton motive force was about -135 mV and was composed of a pH gradient of 0.6 pH units (internal pH 6.1) and a membrane potential of about -100 mV. Measurement of these parameters was complicated since ionophores and lipophilic probes were ineffective in this organism. So far, only glucose transport by facilitated diffusion is well characterized for Z. mobilis. We investigated a constitutive secondary glutamate uptake system. Glutamate can be used as a nitrogen source for Z. mobilis. Transport of glutamate at pH 5.5 shows a relatively high Vmax of 40 mumol.min-1.g (dry mass) of cells-1 and a low affinity (Km = 1.05 mM). Glutamate is taken up by a symport with two H+ ions, leading to substantial accumulation in the cytosol at low pH values. PMID:1332937

  1. Cloning and sequence analysis of the LOC339524 gene in Sprague-Dawley rats.


    Long, Z H; Li, H; Chen, F; Zou, L Y


    We cloned the LOC339524 gene in Sprague-Dawley (SD) rats and analyzed the structure and function of the protein encoded by it. Based on the known human LOC339524 gene sequences, the full-length coding sequence of the LOC339524 gene in SD rats was cloned and amplified by the polymerase chain reaction using the complementary DNA of SD rats as a template. Bioinformatics analysis showed that the length of the cloned LOC339524 gene (GenBank accession No. KM224520) was 831 bp and it encoded a deduced protein of 276 amino acids. Sequence analysis revealed that the coded protein was identical to that produced in humans and its functional domain was located in the 138-236 amino acid fragments, a proline-rich region. Our results suggest that the encoded protein may be a significant regulator of the inflammatory response and may provide sufficient information to justify an in-depth investigation of the role of the LOC339524 gene.

  2. Enhancement of acid tolerance in Zymomonas mobilis by a proton-buffering peptide.


    Baumler, David J; Hung, Kai F; Bose, Jeffrey L; Vykhodets, Boris M; Cheng, Chorng M; Jeong, Kwang-Cheol; Kaspar, Charles W


    A portion of the cbpA gene from Escherichia coli K-12 encoding a 24 amino acid proton-buffering peptide (Pbp) was cloned via the shuttle vector pJB99 into E. coli JM105 and subsequently into Zymomonas mobilis CP4. Expression of Pbp was confirmed in both JM105 and CP4 by HPLC. Z. mobilis CP4 carrying pJB99-2 (Pbp) exhibited increased acid tolerance (p < 0.05) in acidified TSB (HCl [pH 3.0] or acetic acid [pH 3.5]), glycine-HCl buffer (pH 3.0), and sodium acetate-acetic acid buffer (pH 3.5) in comparison to the parent strain (CP4) and CP4 with pJB99 (control plasmid). Although the expression of Pbp influenced survival at a low pH, the minimum growth pH was unaffected. Growth of Z. mobilis in the presence of ampicillin also significantly increased acid tolerance by an unknown mechanism. Results from this study demonstrate that the production of a peptide with a high proportion of basic amino acids can contribute to protection from low pH and weak organic acids such as acetic acid.

  3. New Approaches to Attenuated Hepatitis A Vaccine Development: Cloning and Sequencing of Cell-Culture Adapted Viral cDNA.

    DTIC Science & Technology


    A Vaccine, Molecular Cloning & Hybridization 06 13 Strain Differences 06 03 19. ABSTRACT ("n on reverse if necessary and identify by block number) N...immediate objective of work supported under this contract has been the molecular cloning of RNA from a variant of HM175 virus which is derived from the...dideoxynucleotide sequencing technique is currently being explored as a means of specific strain identification. RESEARCH PROGRESS 1. Molecular Cloning and

  4. DNA Cloning of Plasmodium falciparum Circumsporozoite Gene: Amino Acid Sequence of Repetitive Epitope

    NASA Astrophysics Data System (ADS)

    Enea, Vincenzo; Ellis, Joan; Zavala, Fidel; Arnot, David E.; Asavanich, Achara; Masuda, Aoi; Quakyi, Isabella; Nussenzweig, Ruth S.


    A clone of complementary DNA encoding the circumsporozoite (CS) protein of the human malaria parasite Plasmodium falciparum has been isolated by screening an Escherichia coli complementary DNA library with a monoclonal antibody to the CS protein. The DNA sequence of the complementary DNA insert encodes a four-amino acid sequence: proline-asparagine-alanine-asparagine, tandemly repeated 23 times. The CS β -lactamase fusion protein specifically binds monoclonal antibodies to the CS protein and inhibits the binding of these antibodies to native Plasmodium falciparum CS protein. These findings provide a basis for the development of a vaccine against Plasmodium falciparum malaria.

  5. Cloning and sequencing of dolphinfish (Coryphaena hippurus, Coryphaenidae) growth hormone-encoding cDNA.


    Peduel, A D; Elizur, A; Knibb, W


    The cDNA encoding the preprotein growth hormone from the dolphinfish (Coryphaena hippurus) has been cloned and sequenced. The cDNA was derived by reverse transcription of RNA from the pituitary of a young fish using the method known as Rapid Amplification of cDNA Ends (RACE). An oligonucleotide primer corresponding to the 5' region of Pagrus major and the universal RACE primer enabled amplification using the Polymerase Chain Reaction (PCR). The dolphinfish and yellow-tail, Seriola quineqeradiata, are both members of the sub-order Percoidei (Perciforme) and their GH sequences show a high level of homology.

  6. Cloning and sequencing of part of the S10 operon from Actinobacillus actinomycetemcomitans FDC Y4.


    Hayashida, H; Hotokezaka, H; Ohara, N; Kimura, M; Takagi, O; Yamada, T


    We have cloned and sequenced the 5.2 kb EcoRI fragment that contained part of the S10 operon from Actinobacillus actinomycetemcomitans FDC Y4. The order of the ribosomal protein genes was identical to that of the S10 operon of Haemophilus influenzae and Escherichia coli. The deduced amino acid sequences of ribosomal proteins in this operon displayed significant homologies (65.3%-100%) to those of H. influenzae, E. coli, Yersinia enterocolitica and Yersinia pseudotuberculosis. Phylogenetic trees obtained for these ribosomal proteins were similar to that obtained for 16S rRNA.

  7. Cloning, sequencing and application of the LEU2 gene from the sour dough yeast Candida milleri.


    Turakainen, Hilkka; Korhola, Matti


    We have cloned by complementation in Saccharomyces cerevisiae and sequenced a LEU2 gene from the sour dough yeast Candida milleri CBS 8195 and studied its chromosomal location. The LEU2 coding sequence was 1092 nt long encoding a putative beta-isopropylmalate dehydrogenase protein of 363 amino acids. The nucleotide sequence in the coding region had 71.6% identity to S. cerevisiae LEU2 sequence. On the protein level, the identity of C. milleri Leu2p to S. cerevisiae Leu2p was 84.1%. The CmLEU2 DNA probe hybridized to one to three chromosomal bands and two or three BamHI restriction fragments in C. milleri but did not give any signal to chromosomes or restriction fragments of C. albicans, S. cerevisiae, S. exiguus or Torulaspora delbrueckii. Using CmLEU2 probe for DNA hybridization makes it easy to quickly identify C. milleri among other sour dough yeasts.

  8. Isolation, cloning and sequencing of AFLP markers related to disease-resistance traits in Fenneropenaeus chinensis

    NASA Astrophysics Data System (ADS)

    Yue, Zhiqin; Wang, Weiji; Kong, Jie; Dai, Jixun


    Amplified fragment length polymorphism (AFLP) technique was used to analyze the fingerprinting of four successive generations of Fenneropenaeus chinensis to reveal their disease-resistance traits. Some loci showed quite different genetic frequencies due to artificial selection, which implied that these fragments were putative markers related to the disease-resistance trait. We developed a simple and effective method to further characterize these AFLP fragments. Specific AFLP bands were cut directly from polyacrylamide gels, re-amplified, cloned and sequenced. Eight putative genetic markers were sequenced and their sizes ranged from 63 to 209 bp. The sequences were submitted to dbGSS (database of Genome Sequence Survey); and the BLAST analysis showed low similarity to the function genes, indicating these markers were tightly linked to a disease-resistance trait but were not functional genes.

  9. Simulations of ordering and sequence reconstruction of random DNA clones hybridized with a small number of oligomeric probes

    SciTech Connect

    Labat, I.; Drmanac, R.


    The sequencing by hybridization (SBH) method has been developed for assaying millions of 0.5- to 2-kb-tong clones. This opens up an efficient way for defining the order of short clones and creating a physical map at 100-bp resolution. Moreover, complete sequences can be obtained using a modest number (about 3000) of probes if hybridization and gel sequence data from overlapped or similar sequences are used. In light of these possibilities, various heuristic algorithms have been developed and tested in simulation experiments. This approach can influence the interpretation of the intuitively obvious term, ``known sequence.``

  10. Cloning and sequence analysis of a class A beta-lactamase from Mycobacterium tuberculosis H37Ra.

    PubMed Central

    Hackbarth, C J; Unsal, I; Chambers, H F


    A cosmid library from Mycobacterium tuberculosis H37Ra was introduced into Mycobacterium smegmatis, and eight recombinant clones with increased resistance to cefoxitin were identified. Isoelectric focusing detected an M. tuberculosis-derived beta-lactamase in one of these recombinant clones. A sequence analysis identified it as a class A beta-lactamase whose expression correlated with the increased resistance phenotype. PMID:9145897

  11. Draft Genome Sequence of VIM-2-Producing Multidrug-Resistant Pseudomonas aeruginosa ST175, an Epidemic High-Risk Clone.


    Viedma, Esther; Juan, Carlos; Otero, Joaquín R; Oliver, Antonio; Chaves, Fernando


    The VIM-2-producing multidrug-resistant high-risk clone Pseudomonas aeruginosa sequence type (ST) 175 was isolated in the setting of a large outbreak in Hospital Universitario 12 de Octubre (Spain) from 2007 to 2010. This strain was resistant to all β-lactams, fluoroquinolones, and aminoglycosides, with the exception of amikacin, and has become an endemic clone in our institution.

  12. A new trilocus sequence-based multiplex-PCR to detect major Acinetobacter baumannii clones.


    Martins, Natacha; Picão, Renata Cristina; Cerqueira-Alves, Morgana; Uehara, Aline; Barbosa, Lívia Carvalho; Riley, Lee W; Moreira, Beatriz Meurer


    A collection of 163 Acinetobacter baumannii isolates detected in a large Brazilian hospital, was potentially related with the dissemination of four clonal complexes (CC): 113/79, 103/15, 109/1 and 110/25, defined by University of Oxford/Institut Pasteur multilocus sequence typing (MLST) schemes. The urge of a simple multiplex-PCR scheme to specify these clones has motivated the present study. The established trilocus sequence-based typing (3LST, for ompA, csuE and blaOXA-51-like genes) multiplex-PCR rapidly identifies international clones I (CC109/1), II (CC118/2) and III (CC187/3). Thus, the system detects only one (CC109/1) out of four main CC in Brazil. We aimed to develop an alternative multiplex-PCR scheme to detect these clones, known to be present additionally in Africa, Asia, Europe, USA and South America. MLST, performed in the present study to complement typing our whole collection of isolates, confirmed that all isolates belonged to the same four CC detected previously. When typed by 3LST-based multiplex-PCR, only 12% of the 163 isolates were classified into groups. By comparative sequence analysis of ompA, csuE and blaOXA-51-like genes, a set of eight primers was designed for an alternative multiplex-PCR to distinguish the five CC 113/79, 103/15, 109/1, 110/25 and 118/2. Study isolates and one CC118/2 isolate were blind-tested with the new alternative PCR scheme; all were correctly clustered in groups of the corresponding CC. The new multiplex-PCR, with the advantage of fitting in a single reaction, detects five leading A. baumannii clones and could help preventing the spread in healthcare settings.

  13. Sequence analysis of zein cDNAs obtained by an efficient mRNA cloning method.

    PubMed Central

    Heidecker, G; Messing, J


    A cDNA library was generated from mRNA isolated from the developing endosperm of W22 maize inbred. cDNA clones for zein, the maize storage protein family, were isolated and analyzed by DNA sequencing. The DNA sequences of four clones containing cDNA copies of mRNAs belonging to one zein subfamily were determined. The data support the following conclusions: a) genes encoding the larger of the two zein species contain eleven instead of nine repeat units within the coding sequence of the gene; b) transcription can be terminated at either of the two polyadenlation signals and c) transcription starts 31 basepairs downstream from the first T in the TATA box. To facilitate this analysis a new method for the construction of cDNA libraries was developed. The mRNA was annealed to linearized and oligo-dT tailed pUC9 plasmid DNA, which then primed synthesis of the first strand of the cDNA. Oligo-dG tails were added to the cDNA-plasmid molecules, which were then centrifuged through an alkaline sucrose gradient. The gradient step removed small molecules and separated the two cDNAs which were formerly attached to the same double stranded plasmid molecule. An excess of oligo-dC tailed denatured pUC9 DNA was added and the DNA was renatured under conditions that favor the circularization of monomers by the oligo-dC and oligo-dG tails. The oligo-dC tail served as primer for the synthesis of the second strand of the cDNA. The library was screened by colony hybridization using 32P-labelled cDNA and DNA from genomic zein clones as probes. We obtained 20,000 clones hybridizing total cDNA starting with 1 microgram of plasmid DNA and 1 microgram of mRNA. Images PMID:6688299

  14. Cloning, partial sequence, expression, and antigenic analysis of the filamentous hemagglutinin gene of Bordetella pertussis.

    PubMed Central

    Delisse-Gathoye, A M; Locht, C; Jacob, F; Raaschou-Nielsen, M; Heron, I; Ruelle, J L; de Wilde, M; Cabezon, T


    The gene coding for the filamentous hemagglutinin (FHA), one of the main factors involved in mediating adherence of Bordetella pertussis to ciliated host cells, was cloned in Escherichia coli, and the 3,500-base-pair nucleotide sequence encoding the amino-terminal region was determined. Molecular cloning, together with the characterization of recombinant FHA-related proteins produced in E. coli, revealed that the primary translation product is a protein of about 370 kilodaltons (kDa). The mature 220-kDa FHA polypeptide secreted by B. pertussis is most probably generated by proteolytic processing that eliminates a carboxy-terminal portion of about 150 kDa. The 1,087 amino-terminal residues of the predicted FHA sequence showed a number of remarkable features. Extensive homology to the Serratia marcescens and Proteus mirabilis hemolysin proteins was found between amino acids 91 and 205 of the FHA sequence, suggesting involvement of this FHA domain in host cell binding or secretion of FHA from B. pertussis. In addition, two regions containing repetitive amino acid sequences were identified. One region, extending from residues 382 to 664, was formed by six repeats, and a second, extending from residues 701 to 912, contained three repeats. The reactivities of several recombinant FHA-derived proteins with a panel of monoclonal antibodies identified at least four epitopes composing an immunoreactive domain present in the carboxy-terminal moiety of the mature FHA. Images PMID:1696934

  15. Cloning, nucleotide sequence, and expression of the Pasteurella haemolytica A1 glycoprotease gene.

    PubMed Central

    Abdullah, K M; Lo, R Y; Mellors, A


    Pasteurella haemolytica serotype A1 secretes a glycoprotease which is specific for O-sialoglycoproteins such as glycophorin A. The gene encoding the glycoprotease enzyme has been cloned in the recombinant plasmid pH1, and its nucleotide sequence has been determined. The gene (designated gcp) codes for a protein of 35.2 kDa, and an active enzyme protein of this molecular mass can be observed in Escherichia coli clones carrying pPH1. In vivo labeling of plasmid-encoded proteins in E. coli maxicells demonstrated the expression of a 35-kDa protein from pPH1. The amino-terminal sequence of the heterologously expressed protein corresponds to that predicted from the nucleotide sequence. The glycoprotease is a neutral metalloprotease, and the predicted amino acid sequence of the glycoprotease contains a putative zinc-binding site. The gene shows no significant homology with the genes for other proteases of procaryotic or eucaryotic origin. However, there is substantial homology between gcp and an E. coli gene, orfX, whose product is believed to function in the regulation of macromolecule biosynthesis. Images PMID:1885539

  16. Molecular cloning and nucleotide sequence of cDNA for human liver arginase

    SciTech Connect

    Haraguchi, Y.; Takiguchi, M.; Amaya, Y.; Kawamoto, S.; Matsuda, I.; Mori, M.


    Arginase (EC3.5.3.1) catalyzes the last step of the urea cycle in the liver of ureotelic animals. Inherited deficiency of the enzyme results in argininemia, an autosomal recessive disorder characterized by hyperammonemia. To facilitate investigation of the enzyme and gene structures and to elucidate the nature of the mutation in argininemia, the authors isolated cDNA clones for human liver arginase. Oligo(dT)-primed and random primer human liver cDNA libraries in lambda gt11 were screened using isolated rat arginase cDNA as a probe. Two of the positive clones, designated lambda hARG6 and lambda hARG109, contained an overlapping cDNA sequence with an open reading frame encoding a polypeptide of 322 amino acid residues (predicted M/sub r/, 34,732), a 5'-untranslated sequence of 56 base pairs, a 3'-untranslated sequence of 423 base pairs, and a poly(A) segment. Arginase activity was detected in Escherichia coli cells transformed with the plasmid carrying lambda hARG6 cDNA insert. RNA gel blot analysis of human liver RNA showed a single mRNA of 1.6 kilobases. The predicted amino acid sequence of human liver arginase is 87% and 41% identical with those of the rat liver and yeast enzymes, respectively. There are several highly conserved segments among the human, rat, and yeast enzymes.

  17. Ethanol production by recombinant Escherichia coli carrying genes from Zymomonas mobilis

    SciTech Connect

    Lawford, H.G.; Rousseau, J.D.


    Efficient utilization of lignocellulosic feedstocks offers an opportunity to reduce the cost of producing fuel ethanol. The fermentation performance characteristics of recombinant Escherichia coli ATCC 11303 carrying the {open_quotes}PET plasmid{close_quotes} (pLO1297) with the lac operon controlling the expression of pyruvate decarboxylase (pdc) and alcohol dehydrogenase 11 (adhB) genes cloned from Zymomonas mobilis CP4 were assessed in batch and continuous processes with sugar mixtures designed to mimic process streams from lignocellulosic hydrolysis systems.

  18. Molecular cloning and nucleotide sequence of a transforming gene detected by transfection of chicken B-cell lymphoma DNA

    NASA Astrophysics Data System (ADS)

    Goubin, Gerard; Goldman, Debra S.; Luce, Judith; Neiman, Paul E.; Cooper, Geoffrey M.


    A transforming gene detected by transfection of chicken B-cell lymphoma DNA has been isolated by molecular cloning. It is homologous to a conserved family of sequences present in normal chicken and human DNAs but is not related to transforming genes of acutely transforming retroviruses. The nucleotide sequence of the cloned transforming gene suggests that it encodes a protein that is partially homologous to the amino terminus of transferrin and related proteins although only about one tenth the size of transferrin.

  19. Cloning and sequence analysis of chitin synthase gene fragments of Demodex mites*

    PubMed Central

    Zhao, Ya-e; Wang, Zheng-hang; Xu, Yang; Xu, Ji-ru; Liu, Wen-yan; Wei, Meng; Wang, Chu-ying


    To our knowledge, few reports on Demodex studied at the molecular level are available at present. In this study our group, for the first time, cloned, sequenced and analyzed the chitin synthase (CHS) gene fragments of Demodex folliculorum, Demodex brevis, and Demodex canis (three isolates from each species) from Xi’an China, by designing specific primers based on the only partial sequence of the CHS gene of D. canis from Japan, retrieved from GenBank. Results show that amplification was successful only in three D. canis isolates and one D. brevis isolate out of the nine Demodex isolates. The obtained fragments were sequenced to be 339 bp for D. canis and 338 bp for D. brevis. The CHS gene sequence similarities between the three Xi’an D. canis isolates and one Japanese D. canis isolate ranged from 99.7% to 100.0%, and those between four D. canis isolates and one D. brevis isolate were 99.1%–99.4%. Phylogenetic trees based on maximum parsimony (MP) and maximum likelihood (ML) methods shared the same clusters, according with the traditional classification. Two open reading frames (ORFs) were identified in each CHS gene sequenced, and their corresponding amino acid sequences were located at the catalytic domain. The relatively conserved sequences could be deduced to be a CHS class A gene, which is associated with chitin synthesis in the integument of Demodex mites. PMID:23024043

  20. Cloning and sequence analysis of chitin synthase gene fragments of Demodex mites.


    Zhao, Ya-e; Wang, Zheng-hang; Xu, Yang; Xu, Ji-ru; Liu, Wen-yan; Wei, Meng; Wang, Chu-ying


    To our knowledge, few reports on Demodex studied at the molecular level are available at present. In this study our group, for the first time, cloned, sequenced and analyzed the chitin synthase (CHS) gene fragments of Demodex folliculorum, Demodex brevis, and Demodex canis (three isolates from each species) from Xi'an China, by designing specific primers based on the only partial sequence of the CHS gene of D. canis from Japan, retrieved from GenBank. Results show that amplification was successful only in three D. canis isolates and one D. brevis isolate out of the nine Demodex isolates. The obtained fragments were sequenced to be 339 bp for D. canis and 338 bp for D. brevis. The CHS gene sequence similarities between the three Xi'an D. canis isolates and one Japanese D. canis isolate ranged from 99.7% to 100.0%, and those between four D. canis isolates and one D. brevis isolate were 99.1%-99.4%. Phylogenetic trees based on maximum parsimony (MP) and maximum likelihood (ML) methods shared the same clusters, according with the traditional classification. Two open reading frames (ORFs) were identified in each CHS gene sequenced, and their corresponding amino acid sequences were located at the catalytic domain. The relatively conserved sequences could be deduced to be a CHS class A gene, which is associated with chitin synthesis in the integument of Demodex mites.

  1. Cloning and sequencing of the beta-glucosidase gene from Acetobacter xylinum ATCC 23769.


    Tajima, K; Nakajima, K; Yamashita, H; Shiba, T; Munekata, M; Takai, M


    The beta-glucosidase gene (bglxA) was cloned from the genomic DNA of Acetobacter xylinum ATCC 23769 and its nucleotide sequence (2200 bp) was determined. This bglxA gene was present downstream of the cellulose synthase operon and coded for a polypeptide of molecular mass 79 kDa. The overexpression of the beta-glucosidase in A. xylinum caused a tenfold increase in activity compared to the wild-type strain. In addition, the action pattern of the enzyme was identified as G3ase activity. The deduced amino acid sequence of the bglxA gene showed 72.3%, 49.6%, and 45.1% identity with the beta-glucosidases from A. xylinum subsp. sucrofermentans, Cellvibrio gilvus, and Mycobacterium tuberculosis, respectively. Based on amino acid sequence similarities, the beta-glucosidase (BglxA) was assigned to family 3 of the glycosyl hydrolases.

  2. Isolation and nucleotide sequence of a cDNA clone encoding rat mitochondrial malate dehydrogenase.

    PubMed Central

    Grant, P M; Tellam, J; May, V L; Strauss, A W


    We have determined the complete sequence of the rat mitochondrial malate dehydrogenase (mMDH) precursor derived from nucleotide sequence of the cDNA. A single synthetic oligodeoxynucleotide probe was used to screen a rat atrial cDNA library constructed in lambda gt10. A 1.2 kb full-length cDNA clone provided the first complete amino acid sequence of pre-mMDH. The 1014 nucleotide-long open reading frame encodes the 314 residue long mature mMDH protein and a 24 amino acid NH2-terminal extension which directs mitochondrial import and is cleaved from the precursor after import to generate mature mMDH. The amino acid composition of the transit peptide is polar and basic. The pre-mMDH transit peptide shows marked homology with those of two other enzymes targeted to the rat mitochondrial matrix. Images PMID:3755817

  3. Cloning and characterization of a Leishmania gene encoding a RNA spliced leader sequence.

    PubMed Central

    Miller, S I; Landfear, S M; Wirth, D F


    Recent studies on leishmania enriettii tubulin mRNAs revealed a 35 nucleotide addition to their 5' end. The gene that codes for this 35 nucleotide leader sequence has now been cloned and sequenced. In the Leishmania genome, the spliced leader gene exists as a tandem repeat of 438 bases. There are approximately 150 copies of this gene comprising 0.1% of the parasite genome. This gene codes for a 85 nucleotide transcript that contains the spliced leader at its 5' end. The 35 nucleotide sequence and the regions immediately 5' and 3' to it are highly conserved across trypanosomatids. We have detected a RNA molecule that is a putative by-product of the processing reaction in which the 35 nucleotide spliced leader has been transferred to mRNA. We suggest that this molecule is the remnant of the spliced leader transcript after removal of the 35 nucleotide spliced leader. Images PMID:2429261

  4. Cloning and nucleotide sequence of a specific DNA fragment from Paracoccidioides brasiliensis.


    Goldani, L Z; Maia, A L; Sugar, A M


    We cloned and sequenced a species-specific 110-bp DNA fragment from Paracoccidioides brasiliensis. The DNA fragment was generated by PCR with primers complementary to the rat beta-actin gene under a low annealing temperature. Comparison of the nucleotide sequence, after excluding the primers, with those in the GenBank database identified approximately 60% homology with an exon of a major surface glycoprotein gene from Pneumocystis carinii and a fragment of unknown function in Saccharomyces cerevisiae chromosome VIII. By Southern hybridization analysis, the 32P-labelled fragment detected 1.0- and 1.9-kb restriction fragments within whole-cell genomic DNA of P. brasiliensis digested with HindIII and PstI, respectively, but failed to hybridize to genomic DNAs from Candida albicans, Blastomyces dermatitidis, Cryptococcus neoformans, Aspergillus fumigatus, Saccharomyces cerevisiae, Pneumocystis carinii, rat tissue, or humans under low-stringency hybridization conditions. Additionally, the specific DNA fragment from three different P. brasiliensis isolates (Pb18, RP18, RP17) was amplified by PCR with primers mostly complementary to nonactin sequences of the 110-bp DNA fragment. In contrast, there were no amplified products from other fungus genomic DNAs previously tested, including Histoplasma capsulatum. To date, this is the first species-specific DNA fragment cloned from P. brasiliensis which might be useful as a diagnostic marker for the identification and classification of different P. brasiliensis isolates.

  5. Purification of Helicobacter pylori superoxide dismutase and cloning and sequencing of the gene.

    PubMed Central

    Spiegelhalder, C; Gerstenecker, B; Kersten, A; Schiltz, E; Kist, M


    The superoxide dismutase (SOD) of Helicobacter pylori, a pathogenic bacterium which colonizes the gastric mucosa, evoking a marked inflammatory response, was purified and characterized, and the N-terminal amino acid sequence was determined. The enzyme consists of two identical subunits each with an apparent molecular weight of 24,000. Analysis of the primary structure and inhibition studies revealed that H. pylori possesses a typical procaryotic iron-containing enzyme. No other isoenzymes could be detected. Indirect gold immunostaining of H. pylori SOD with a polyclonal antibody directed against the iron-containing SOD of Escherichia coli showed a surface-associated localization of the enzyme. The H. pylori SOD gene was cloned by functional complementation of a SOD-deficient E. coli mutant. Sequencing and alignment revealed striking homology to the following facultative intracellular human pathogens: Listeria ivanovii, Listeria monocytogenes, Coxiella burnetti, Porphyromonas gingivalis, Legionella pneumophila, and Entamoeba histolytica. An open reading frame of 642 bp encoding 214 amino acids was determined. There was no leader sequence detectable. Cloning of the H. pylori SOD gene is one of the prerequisites to investigation of its pathophysiological role in the defense against antimicrobial mechanisms of polymorphonuclear granulocytes. Images PMID:8225605

  6. Cloning and nucleotide sequence of a specific DNA fragment from Paracoccidioides brasiliensis.

    PubMed Central

    Goldani, L Z; Maia, A L; Sugar, A M


    We cloned and sequenced a species-specific 110-bp DNA fragment from Paracoccidioides brasiliensis. The DNA fragment was generated by PCR with primers complementary to the rat beta-actin gene under a low annealing temperature. Comparison of the nucleotide sequence, after excluding the primers, with those in the GenBank database identified approximately 60% homology with an exon of a major surface glycoprotein gene from Pneumocystis carinii and a fragment of unknown function in Saccharomyces cerevisiae chromosome VIII. By Southern hybridization analysis, the 32P-labelled fragment detected 1.0- and 1.9-kb restriction fragments within whole-cell genomic DNA of P. brasiliensis digested with HindIII and PstI, respectively, but failed to hybridize to genomic DNAs from Candida albicans, Blastomyces dermatitidis, Cryptococcus neoformans, Aspergillus fumigatus, Saccharomyces cerevisiae, Pneumocystis carinii, rat tissue, or humans under low-stringency hybridization conditions. Additionally, the specific DNA fragment from three different P. brasiliensis isolates (Pb18, RP18, RP17) was amplified by PCR with primers mostly complementary to nonactin sequences of the 110-bp DNA fragment. In contrast, there were no amplified products from other fungus genomic DNAs previously tested, including Histoplasma capsulatum. To date, this is the first species-specific DNA fragment cloned from P. brasiliensis which might be useful as a diagnostic marker for the identification and classification of different P. brasiliensis isolates. PMID:7650207

  7. Cloning, sequencing, and expression of interferon-γ from elk in North America

    USGS Publications Warehouse

    Sweeney, Steven J.; Emerson, Carlene; Eriks, Inge S.


    Eradication of Mycobacterium bovis relies on accurate detection of infected animals, including potential domestic and wildlife reservoirs. Available diagnostic tests lack the sensitivity and specificity necessary for accurate detection, particularly in infected wildlife populations. Recently, an in vitro diagnostic test for cattle which measures plasma interferon-gamma (IFN-γ) levels in blood following in vitro incubation with M. bovis purified protein derivative has been enveloped. This test appears to have increased sensitivity over traditional testing. Unfortunately, it does not detect IFN-γ from Cervidae. To begin to address this problem, the IFN-γ gene from elk (Cervus elaphus) was cloned, sequenced, expressed, and characterized. cDNA was cloned from mitogen stimulated peripheral blood mononuclear cells. The predicted amino acid (aa) sequence was compared to known sequences from cattle, sheep, goats, red deer (Cervus elaphus), humans, and mice. Biological activity of the recombinant elk IFN-γ (rElkIFN-γ) was confirmed in a vesicular stomatitis virus cytopathic effect reduction assay. Production of monoclonal antibodies to IFN-γ epitopes conserved between ruminant species could provide an important tool for the development of reliable, practical diagnostic assays for detection of a delayed type hypersensitivity response to a variety of persistent infectious agents in ruminants, including M. bovis and Brucella abortus. Moreover, development of these reagents will aid investigators in studies to explore immunological responses of elk that are associated with resistance to infectious diseases.

  8. Coxiella burnetii superoxide dismutase gene: cloning, sequencing, and expression in Escherichia coli.

    PubMed Central

    Heinzen, R A; Frazier, M E; Mallavia, L P


    A superoxide dismutase (SOD) gene from the obligate intracellular bacterium Coxiella burnetii has been cloned, and its DNA sequence has been determined and expressed in Escherichia coli. The gene was identified on pSJR50, a pHC79-derived genomic clone, by using the polymerase chain reaction with degenerate oligonucleotide primers corresponding to conserved regions of known SODs. Sequences resembling conventional E. coli ribosomal and RNA polymerase-binding sites preceded the C. burnetii 579-bp SOD open reading frame. An E. coli SOD-deficient double mutant (sodA sodB) that carried pSJR50 had growth and survival responses similar to those of the wild type when the transformant was challenged with 0.05 mM paraquat and 5 mM hydrogen peroxide, respectively. These observations indicated that the C. burnetii gene was functionally expressed in E. coli. Staining of native polyacrylamide gels for SOD activity demonstrated that pSJR50 insert DNA codes for an SOD that comigrates with an SOD found in C. burnetii cell lysates. The enzyme was inactivated by 5 mM hydrogen peroxide, which is indicative of an iron-containing SOD. Additionally, the predicted amino acid sequence was significantly more homologous to known iron-containing SODs than to manganese-containing SODs. Isolation of the C. burnetii SOD gene may provide an opportunity to examine its role in the intracellular survival of this rickettsia. Images PMID:1500190

  9. Murine muscle-specific enolase: cDNA cloning, sequence, and developmental expression.

    PubMed Central

    Lamandé, N; Mazo, A M; Lucas, M; Montarras, D; Pinset, C; Gros, F; Legault-Demare, L; Lazar, M


    In vertebrates, the glycolytic enzyme enolase (EC is present as homodimers and heterodimers formed from three distinct subunits of identical molecular weight, alpha, beta, and gamma. We report the cloning and sequencing of a cDNA encoding the beta subunit of murine muscle-specific enolase. The corresponding amino acid sequence shows greater than 80% homology with the beta subunit from chicken obtained by protein sequencing and with alpha and gamma subunits from rat and mouse deduced from cloned cDNAs. In contrast, there is no homology between the 3' untranslated regions of mouse alpha, beta, and gamma enolase mRNAs, which also differ greatly in length. The short 3' untranslated region of beta enolase mRNA accounts for its distinct length, 1600 bases. It is known that a progressive transition from alpha alpha to beta beta enolase occurs in developing skeletal muscle. We show that this transition mainly results from a differential regulation of alpha and beta mRNA levels. Analysis of myogenic cell lines shows that beta enolase gene is expressed at the myoblast stage. Moreover, transfection of premyogenic C3H10T1/2 cells with MyoD1 cDNA shows that the initial expression of beta transcripts occurs during the very first steps of the myogenic pathway, suggesting that it could be a marker event of myogenic lineage determination. Images PMID:2734297

  10. Gene cloning, sequence analysis, purification, and characterization of a thermostable aminoacylase from Bacillus stearothermophilus.

    PubMed Central

    Sakanyan, V; Desmarez, L; Legrain, C; Charlier, D; Mett, I; Kochikyan, A; Savchenko, A; Boyen, A; Falmagne, P; Pierard, A


    A genomic DNA fragment encoding aminoacylase activity of the eubacterium Bacillus stearothermophilus was cloned into Escherichia coli. Transformants expressing aminoacylase activity were selected by their ability to complement E. coli mutants defective in acetylornithine deacetylase activity, the enzyme that converts N-acetylornithine to ornithine in the arginine biosynthetic pathway. The 2.3-kb cloned fragment has been entirely sequenced. Analysis of the sequence revealed two open reading frames, one of which encoded the aminoacylase. B. stearothermophilus aminoacylase, produced in E. coli, was purified to near homogeneity in three steps, one of which took advantage of the intrinsic thermostability of the enzyme. The enzyme exists as homotetramer of 43-kDa subunits as shown by cross-linking experiments. The deacetylating capacity of purified aminoacylase varies considerably depending on the nature of the amino acid residue in the substrate. The enzyme hydrolyzes N-acyl derivatives of aromatic amino acids most efficiently. Comparison of the predicted amino acid sequence of B. stearothermophilus aminoacylase with those of eubacterial acetylornithine deacylase, succinyldiaminopimelate desuccinylase, carboxypeptidase G2, and eukaryotic aminoacylase I suggests a common origin for these enzymes. Images PMID:8285691

  11. Molecular cloning, overexpression, purification, and sequence analysis of the giant panda (Ailuropoda melanoleuca) ferritin light polypeptide.


    Fu, L; Hou, Y L; Ding, X; Du, Y J; Zhu, H Q; Zhang, N; Hou, W R


    The complementary DNA (cDNA) of the giant panda (Ailuropoda melanoleuca) ferritin light polypeptide (FTL) gene was successfully cloned using reverse transcription-polymerase chain reaction technology. We constructed a recombinant expression vector containing FTL cDNA and overexpressed it in Escherichia coli using pET28a plasmids. The expressed protein was then purified by nickel chelate affinity chromatography. The cloned cDNA fragment was 580 bp long and contained an open reading frame of 525 bp. The deduced protein sequence was composed of 175 amino acids and had an estimated molecular weight of 19.90 kDa, with an isoelectric point of 5.53. Topology prediction revealed one N-glycosylation site, two casein kinase II phosphorylation sites, one N-myristoylation site, two protein kinase C phosphorylation sites, and one cell attachment sequence. Alignment indicated that the nucleotide and deduced amino acid sequences are highly conserved across several mammals, including Homo sapiens, Cavia porcellus, Equus caballus, and Felis catus, among others. The FTL gene was readily expressed in E. coli, which gave rise to the accumulation of a polypeptide of the expected size (25.50 kDa, including an N-terminal polyhistidine tag).

  12. Generation of expressed sequence tags of random root cDNA clones of Brassica napus by single-run partial sequencing.

    PubMed Central

    Park, Y S; Kwak, J M; Kwon, O Y; Kim, Y S; Lee, D S; Cho, M J; Lee, H H; Nam, H G


    Two hundred thirty-seven expressed sequence tags (ESTs) of Brassica napus were generated by single-run partial sequencing of 197 random root cDNA clones. A computer search of these root ESTs revealed that 21 ESTs show significant similarity to the protein-coding sequences in the existing data bases, including five stress- or defense-related genes and four clones related to the genes from other kingdoms. Northern blot analysis of the 10 data base-matched cDNA clones revealed that many of the clones are expressed most abundantly in root but less abundantly in other organs. However, two clones were highly root specific. The results show that generation of the root ESTs by partial sequencing of random cDNA clones along with the expression analysis is an efficient approach to isolate genes that are functional in plant root in a large scale. We also discuss the results of the examination of cDNA libraries and sequencing methods suitable for this approach. PMID:8029332

  13. Shuttle cloning and nucleotide sequences of Helicobacter pylori genes responsible for urease activity.

    PubMed Central

    Labigne, A; Cussac, V; Courcoux, P


    Production of a potent urease has been described as a trait common to all Helicobacter pylori so far isolated from humans with gastritis as well as peptic ulceration. The detection of urease activity from genes cloned from H. pylori was made possible by use of a shuttle cosmid vector, allowing replication and movement of cloned DNA sequences in either Escherichia coli or Campylobacter jejuni. With this approach, we cloned a 44-kb portion of H. pylori chromosomal DNA which did not lead to urease activity when introduced into E. coli but permitted, although temporarily, biosynthesis of the urease when transferred by conjugation to C. jejuni. The recombinant cosmid (pILL585) expressing the urease phenotype was mapped and used to subclone an 8.1-kb fragment (pILL590) able to confer the same property to C. jejuni recipient strains. By a series of deletions and subclonings, the urease genes were localized to a 4.2-kb region of DNA and were sequenced by the dideoxy method. Four open reading frames were found, encoding polypeptides with predicted molecular weights of 26,500 (ureA), 61,600 (ureB), 49,200 (ureC), and 15,000 (ureD). The predicted UreA and UreB polypeptides correspond to the two structural subunits of the urease enzyme; they exhibit a high degree of homology with the three structural subunits of Proteus mirabilis (56% exact matches) as well as with the unique structural subunit of jack bean urease (55.5% exact matches). Although the UreD-predicted polypeptide has domains relevant to transmembrane proteins, no precise role could be attributed to this polypeptide or to the UreC polypeptide, which both mapped to a DNA sequence shown to be required to confer urease activity to a C. jejuni recipient strain. Images PMID:2001995

  14. Molecular cloning, nucleotide sequence and expression of a Sulfolobus solfataricus gene encoding a class II fumarase.


    Colombo, S; Grisa, M; Tortora, P; Vanoni, M


    Fumarase catalyzes the interconversion of L-malate and fumarate. A Sulfolobus solfataricus fumarase gene (fumC) was cloned and sequenced. Typical archaebacterial regulatory sites were identified in the region flanking the fumC open reading frame. The fumC gene encodes a protein of 438 amino acids (47,899 Da) which shows several significant similarities with class II fumarases from both eubacterial and eukariotic sources as well as with aspartases. S. solfataricus fumarase expressed in Escherichia coli retains enzymatic activity and its thermostability is comparable to that of S. solfataricus purified enzyme despite a 11 amino acid C-terminal deletion.

  15. Cloning and sequencing of a dextranase-encoding cDNA from Penicillium minioluteum.


    Garcia, B; Margolles, E; Roca, H; Mateu, D; Raices, M; Gonzales, M E; Herrera, L; Delgado, J


    A cDNA from Penicillium minioluteum HI-4 encoding a dextranase (1,6-alpha-glucan hydrolase, EC was isolated and characterized. cDNA clones corresponding to genes expressed in dextran-induced cultures were identified by differential hybridization. Southern hybridization and restriction mapping analysis of selected clones revealed four different groups of cDNAs. The dextranase cDNA was identified after expressing a cDNA fragment from each of the isolated groups of cDNA clones in the Escherichia coli T7 system. The expression of a 2 kb cDNA fragment in E. coli led to the production of a 67 kDa protein which was recognized by an anti-dextranase polyclonal antibody. The cDNA contains 2109 bp plus a poly(A) tail, coding for a protein of 608 amino acids, including 20 N-terminal amino acid residues which might correspond to a signal peptide. There was 29% sequence identity between the P. minioluteum dextranase and the dextranase from Arthrobacter sp. CB-8.

  16. Phenotype microarray profiling of Zymomonas mobilis ZM4.


    Bochner, Barry; Gomez, Vanessa; Ziman, Michael; Yang, Shihui; Brown, Steven D


    In this study, we developed a Phenotype MicroArray (PM) protocol to profile cellular phenotypes in Zymomonas mobilis, which included a standard set of nearly 2,000 assays for carbon, nitrogen, phosphorus and sulfur source utilization, nutrient stimulation, pH and osmotic stresses, and chemical sensitivities with 240 inhibitory chemicals. We observed two positive assays for C-source utilization (fructose and glucose) using the PM screen, which uses redox chemistry and cell respiration as a universal reporter to profile growth phenotypes in a high-throughput 96-well plate-based format. For nitrogen metabolism, the bacterium showed a positive test results for ammonia, aspartate, asparagine, glutamate, glutamine, and peptides. Z. mobilis appeared to use a diverse array of P-sources with two exceptions being pyrophosphate and tripolyphosphate. The assays suggested that Z. mobilis uses both inorganic and organic compounds as S-sources. No stimulation by nutrients was detected; however, there was evidence of partial inhibition by purines and pyrimidines, NAD, and deferoxamine. Z. mobilis was relatively resistant to acid pH, tolerating a pH down to about 4.0. It also tolerated phosphate, sulfate, and nitrate, but was rather sensitive to chloride and nitrite. Z. mobilis showed resistance to a large number of diverse chemicals that inhibit most bacteria. The information from PM analysis provides an overview of Z. mobilis physiology and a foundation for future comparisons of other wild-type and mutant Z. mobilis strains.

  17. Phenotype Microarray Profiling of Zymomonas mobilis ZM4

    SciTech Connect

    Bochner, Barry; Gomez, Vanessa; Ziman, michael; Yang, Shihui; Brown, Steven D


    In this study, we developed a Phenotype MicroArray{trademark} (PM) protocol to profile cellular phenotypes in Zymomonas mobilis, which included a standard set of nearly 2,000 assays for carbon, nitrogen, phosphorus and sulfur source utilization, nutrient stimulation, pH and osmotic stresses, and chemical sensitivities with 240 inhibitory chemicals. We observed two positive assays for C-source utilization (fructose and glucose) using the PM screen, which uses redox chemistry and cell respiration as a universal reporter to profile growth phenotypes in a high-throughput 96-well plate-based format. For nitrogen metabolism, the bacterium showed a positive test results for ammonia, aspartate, asparagine, glutamate, glutamine, and peptides. Z. mobilis appeared to use a diverse array of P-sources with two exceptions being pyrophosphate and tripolyphosphate. The assays suggested that Z. mobilis uses both inorganic and organic compounds as S-sources. No stimulation by nutrients was detected; however, there was evidence of partial inhibition by purines and pyrimidines, NAD, and deferoxamine. Z. mobilis was relatively resistant to acid pH, tolerating a pH down to about 4.0. It also tolerated phosphate, sulfate, and nitrate, but was rather sensitive to chloride and nitrite. Z. mobilis showed resistance to a large number of diverse chemicals that inhibit most bacteria. The information from PM analysis provides an overview of Z. mobilis physiology and a foundation for future comparisons of other wild-type and mutant Z. mobilis strains.

  18. Stable zymomonas mobilis xylose and arabinose fermenting strains


    Zhang, Min; Chou, Yat-Chen


    The present invention briefly includes a transposon for stable insertion of foreign genes into a bacterial genome, comprising at least one operon having structural genes encoding enzymes selected from the group consisting of xylAxylB, araBAD and tal/tkt, and at least one promoter for expression of the structural genes in the bacterium, a pair of inverted insertion sequences, the operons contained inside the insertion sequences, and a transposase gene located outside of the insertion sequences. A plasmid shuttle vector for transformation of foreign genes into a bacterial genome, comprising at least one operon having structural genes encoding enzymes selected from the group consisting of xylAxylB, araBAD and tal/tkt, at least one promoter for expression of the structural genes in the bacterium, and at least two DNA fragments having homology with a gene in the bacterial genome to be transformed, is also provided.The transposon and shuttle vectors are useful in constructing significantly different Zymomonas mobilis strains, according to the present invention, which are useful in the conversion of the cellulose derived pentose sugars into fuels and chemicals, using traditional fermentation technology, because they are stable for expression in a non-selection medium.

  19. Cloning, sequencing, and expression of the adenosylcobalamin-dependent ribonucleotide reductase from Lactobacillus leichmannii.

    PubMed Central

    Booker, S; Stubbe, J


    Ribonucleoside-triphosphate reductase (RTPR, EC from Lactobacillus leichmannii, a monomeric adenosylcobalamin-requiring enzyme, catalyzes the conversion of nucleoside triphosphates to deoxynucleoside triphosphates. The gene for this enzyme has been cloned and sequenced. In contrast to expectations based on mechanistic considerations, there is no statistically significant sequence homology with the Escherichia coli reductase that requires a dinuclear-iron center and tyrosyl radical cofactor. The RTPR has been overexpressed and purified to homogeneity, yielding 90 mg of protein from 2.5 g of bacteria. Initial characterization of the recombinant RTPR indicates that its properties are identical to those of the RTPR isolated from L. leichmannii. PMID:8397403

  20. Cloning, sequencing, and overexpression of the Anaerobiospirillum succiniciproducens phosphoenolpyruvate carboxykinase (pckA) gene.

    PubMed Central

    Laivenieks, M; Vieille, C; Zeikus, J G


    The phosphoenolpyruvate (PEP) carboxykinase-encoding gene from the anaerobic, CO2-fixing, succinate-producing bacterium Anaerobiospirillum succiniciproducens was cloned, sequenced, and expressed in Escherichia coli. The gene encoded a 532-residue polypeptide with a calculated molecular mass of 58.7 kDa. The sequence of the A. succiniciproducens PEP carboxykinase was similar to those of all known ATP/ADP-dependent PEP carboxykinases. In particular, the A. succiniciproducens enzyme was 67.3% identical and 79.2% similar to the E. coli enzyme. The A. succiniciproducens pckA transcription start site was determined, and putative promoter regions were identified. The recombinant enzyme was overexpressed in E. coli. The purified enzyme was indiscernible from the native enzyme by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and had the same activity as the native enzyme. PMID:9172347

  1. Cloning and sequence analysis of the cellobiohydrolase I genes from some basidiomycetes.


    Chukeatirote, Ekachai; Maharachchikumbura, Sajeewa S N; Wongkham, Shannaphimon; Sysouphanthong, Phongeun; Phookamsak, Rungtiwa; Hyde, Kevin D


    Genes encoding the cellobiohydrolase enzyme (CBHI), designated as cbhI, were isolated from the basidiomycetes Auricularia fuscosuccinea, Pleurotus giganteus, P. eryngii, P. ostreatus, and P. sajor-caju. Initially, the fungal genomic DNA was extracted using a modified cetyltrimethyl ammonium bromide (CTAB) protocol and used as a DNA template. The cbhI genes were then amplified and cloned using the pGEM-T Easy Vector Systems. The sizes of these PCR amplicons were between 700~800 bp. The DNA sequences obtained were similar showing high identity to the cbhI gene family. These cbhI genes were partial consisting of three coding regions and two introns. The deduced amino acid sequences exhibited significant similarity to those of fungal CBHI enzymes belonging to glycosyl hydrolase family 7.

  2. Cloning and Sequence Analysis of the Cellobiohydrolase I Genes from Some Basidiomycetes

    PubMed Central

    Maharachchikumbura, Sajeewa S. N.; Wongkham, Shannaphimon; Sysouphanthong, Phongeun; Phookamsak, Rungtiwa; Hyde, Kevin D.


    Genes encoding the cellobiohydrolase enzyme (CBHI), designated as cbhI, were isolated from the basidiomycetes Auricularia fuscosuccinea, Pleurotus giganteus, P. eryngii, P. ostreatus, and P. sajor-caju. Initially, the fungal genomic DNA was extracted using a modified cetyltrimethyl ammonium bromide (CTAB) protocol and used as a DNA template. The cbhI genes were then amplified and cloned using the pGEM-T Easy Vector Systems. The sizes of these PCR amplicons were between 700~800 bp. The DNA sequences obtained were similar showing high identity to the cbhI gene family. These cbhI genes were partial consisting of three coding regions and two introns. The deduced amino acid sequences exhibited significant similarity to those of fungal CBHI enzymes belonging to glycosyl hydrolase family 7. PMID:22870052

  3. Biodegradable plastic-degrading enzyme from Pseudozyma antarctica: cloning, sequencing, and characterization.


    Shinozaki, Yukiko; Morita, Tomotake; Cao, Xiao-hong; Yoshida, Shigenobu; Koitabashi, Motoo; Watanabe, Takashi; Suzuki, Ken; Sameshima-Yamashita, Yuka; Nakajima-Kambe, Toshiaki; Fujii, Takeshi; Kitamoto, Hiroko K


    Pseudozyma antarctica JCM 10317 exhibits a strong degradation activity for biodegradable plastics (BPs) such as agricultural mulch films composed of poly(butylene succinate) (PBS) and poly(butylene succinate-co-adipate) (PBSA). An enzyme named PaE was isolated and the gene encoding PaE was cloned from the strain by functional complementation in Saccharomyces cerevisiae. The deduced amino acid sequence of PaE contains 198 amino acids with a predicted molecular weight of 20,362.41. High identity was observed between this sequence and that of cutinase-like enzymes (CLEs) (61-68%); therefore, the gene encoding PaE was named PaCLE1. The specific activity of PaE against emulsified PBSA was 54.8±6.3 U/mg. In addition to emulsified BPs, PaE degraded solid films of PBS, PBSA, poly(ε-caprolactone), and poly(lactic acid).

  4. Rapid in silico cloning of genes using expressed sequence tags (ESTs).


    Gill, R W; Sanseau, P


    Expressed sequence tags (ESTs) are short single-pass DNA sequences obtained from either end of cDNA clones. These ESTs are derived from a vast number of cDNA libraries obtained from different species. Human ESTs are the bulk of the data and have been widely used to identify new members of gene families, as markers on the human chromosomes, to discover polymorphism sites and to compare expression patterns in different tissues or pathologies states. Information strategies have been devised to query EST databases. Since most of the analysis is performed with a computer, the term "in silico" strategy has been coined. In this chapter we will review the current status of EST databases, the pros and cons of EST-type data and describe possible strategies to retrieve meaningful information.

  5. cDNA cloning, sequence analysis, and chromosomal localization of the gene for human carnitine palmitoyltransferase

    SciTech Connect

    Finocchiaro, G.; Taroni, F.; Martin, A.L.; Colombo, I.; Tarelli, G.T.; DiDonato, S. ); Rocchi, M. )


    The authors have cloned and sequenced a cDNA encoding human liver carnitine palmitoyltransferase an inner mitochondrial membrane enzyme that plays a major role in the fatty acid oxidation pathway. Mixed oligonucleotide primers whose sequences were deduced from one tryptic peptide obtained from purified CPTase were used in a polymerase chain reaction, allowing the amplification of a 0.12-kilobase fragment of human genomic DNA encoding such a peptide. A 60-base-pair (bp) oligonucleotide synthesized on the basis of the sequence from this fragment was used for the screening of a cDNA library from human liver and hybridized to a cDNA insert of 2255 bp. This cDNA contains an open reading frame of 1974 bp that encodes a protein of 658 amino acid residues including 25 residues of an NH{sub 2}-terminal leader peptide. The assignment of this open reading frame to human liver CPTase is confirmed by matches to seven different amino acid sequences of tryptic peptides derived from pure human CPTase and by the 82.2% homology with the amino acid sequence of rat CPTase. The NH{sub 2}-terminal region of CPTase contains a leucine-proline motif that is shared by carnitine acetyl- and octanoyltransferases and by choline acetyltransferase. The gene encoding CPTase was assigned to human chromosome 1, region 1q12-1pter, by hybridization of CPTase cDNA with a DNA panel of 19 human-hanster somatic cell hybrids.

  6. Cloning, sequencing, and disruption of the Bacillus subtilis sigma 28 gene.

    PubMed Central

    Helmann, J D; Márquez, L M; Chamberlin, M J


    Bacillus subtilis contains multiple forms of RNA polymerase holoenzyme, distinguished by the presence of different specificity determinants known as sigma factors. The sigma 28 factor was initially purified as a unique transcriptional activity in vegetatively growing B. subtilis cells. Purification of the sigma 28 protein has allowed tryptic peptides to be prepared and sequenced. The sequence of one tryptic peptide fragment was used to prepare an oligonucleotide probe specific for the sigma 28 structural gene, and the gene was isolated from a B. subtilis subgenomic library. The complete nucleotide sequence of the sigma 28 gene was determined, and the cloned sigma 28 gene was used to construct a mutant strain which does not express the sigma 28 protein. This strain also failed to synthesize flagellin protein and grew as long filaments. The predicted sigma 28 gene product is a 254-amino-acid polypeptide with a calculated molecular weight of 29,500. The sigma 28 protein sequence was similar to that of other sequenced sigma factors and to the flbB gene product of Escherichia coli. Since the flbB gene product is a positive regulator of flagellar synthesis in E. coli, it is likely that sigma 28 functions to regulate flagellar synthesis in B. subtilis. Images PMID:2832368

  7. Cloning and sequence analysis of candidate human natural killer-enhancing factor genes

    SciTech Connect

    Shau, H.; Butterfield, L.H.; Chiu, R.; Kim, A.


    A cytosol factor from human red blood cells enhances natural killer (NK) activity. This factor, termed NK-enhancing factor (NKEF), is a protein of 44000 M{sub r} consisting of two subunits of equal size linked by disulfide bonds. NKEF is expressed in the NK-sensitive erythroleukemic cell line K562. Using an antibody specific for NKEF as a probe for immunoblot screening, we isolated several clones from a {lambda}gt11 cDNA library of K562. Additional subcloning and sequencing revealed that the candidate NKEF cDNAs fell into one of two categories of closely related but non-identical genes, referred to as NKEF A and B. They are 88% identical in amino acid sequence and 71% identical in nucleotide sequence. Southern blot analysis suggests that there are two to three NKEF family members in the genome. Analysis of predicted amino acid sequences indicates that both NKEF A and B are cytosol proteins with several phosphorylation sites each, but that they have no glycosylation sites. They are significantly homologous to several other proteins from a wide variety of organisms ranging from prokaryotes to mammals, especially with regard to several well-conserved motifs within the amino acid sequences. The biological functions of these proteins in other species are mostly unknown, but some of them were reported to be induced by oxidative stress. Therefore, as well as for immunoregulation of NK activity, NKEF may be important for cells in coping with oxidative insults. 32 refs., 3 figs.

  8. Sequencing and generation of an infectious clone of the pathogenic goose parvovirus strain LH.


    Wang, Jianye; Duan, Jinkun; Zhu, Liqian; Jiang, Zhiwei; Zhu, Guoqiang


    In this study, the complete genome of the virulent strain LH of goose parvovirus (GPV) was sequenced and cloned into the pBluescript II (SK) plasmid vector. Sequence alignments of the inverted terminal repeats (ITR) of GPV strains revealed a common 14-nt-pair deletion in the stem of the palindromic structure in the LH strain and three other strains isolated after 1982 when compared to three GPV strains isolated earlier than that time. Transfection of 11-day-old embryonated goose eggs with the plasmid pLH, which contains the entire genome of strain LH, resulted in successful rescue of the infectious virus. Death of embryos after transfection via the chorioallantoic membrane infiltration route occurred earlier than when transfection was done via the allantoic cavity inoculation route. The rescued virus exhibited virulence similar to that of its parental virus, as evaluated by the mortality rate in goslings. Generation of the pathogenic infectious clone provides us with a powerful tool to elucidate the molecular pathogenesis of GPV in the future.

  9. Cloning of two glutamate dehydrogenase cDNAs from Asparagus officinalis: sequence analysis and evolutionary implications.


    Pavesi, A; Ficarelli, A; Tassi, F; Restivo, F M


    Two different amplification products, termed c1 and c2, showing a high similarity to glutamate dehydrogenase sequences from plants, were obtained from Asparagus officinalis using two degenerated primers and RT-PCR (reverse transcriptase polymerase chain reaction). The genes corresponding to these cDNA clones were designated aspGDHA and aspGDHB. Screening of a cDNA library resulted in the isolation of cDNA clones for aspGDHB only. Analysis of the deduced amino acid (aa) sequence from the full-length cDNA suggests that the gene product contains all regions associated with metabolic function of NAD glutamate dehydrogenase (NAD-GDH). A first phylogenetic analysis including only GDHs from plants suggested that the two GDH genes of A. officinalis arose by an ancient duplication event, pre-dating the divergence of monocots and dicots. Codon usage analysis showed a bias towards A/T ending codons. This tendency is likely due to the biased nucleotide composition of the asparagus genome, rather than to the translational selection for specific codons. Using principal coordinate analysis, the evolutionary relatedness of plant GDHs with homologous sequences from a large spectrum of organisms was investigated. The results showed a closer affinity of plant GDHs to GDHs of thermophilic archaebacterial and eubacterial species, when compared to those of unicellular eukaryotic fungi. Sequence analysis at specific amino acid signatures, known to affect the thermal stability of GDH, and assays of enzyme activity at non-physiological temperatures, showed a greater adaptation to heat-stress conditions for the asparagus and tobacco enzymes compared with the Saccharomyces cerevisiae enzyme.

  10. Genome Sequence of Acinetobacter baumannii Strain D36, an Antibiotic-Resistant Isolate from Lineage 2 of Global Clone 1

    PubMed Central

    Hamidian, Mohammad; Hawkey, Jane


    Multiply antibiotic-resistant Acinetobacter baumannii isolate D36 was recovered in Australia in 2008 and belongs to a distinct lineage of global clone 1 (GC1). Here, we present the complete 4.13 Mbp genome sequence (chromosome plus 4 plasmids), generated via long read sequencing (PacBio). PMID:26679588

  11. An efficient strategy for large-scale high-throughput transposon-mediated sequencing of cDNA clones

    PubMed Central

    Butterfield, Yaron S. N.; Marra, Marco A.; Asano, Jennifer K.; Chan, Susanna Y.; Guin, Ranabir; Krzywinski, Martin I.; Lee, Soo Sen; MacDonald, Kim W. K.; Mathewson, Carrie A.; Olson, Teika E.; Pandoh, Pawan K.; Prabhu, Anna-Liisa; Schnerch, Angelique; Skalska, Ursula; Smailus, Duane E.; Stott, Jeff M.; Tsai, Miranda I.; Yang, George S.; Zuyderduyn, Scott D.; Schein, Jacqueline E.; Jones, Steven J. M.


    We describe an efficient high-throughput method for accurate DNA sequencing of entire cDNA clones. Developed as part of our involvement in the Mammalian Gene Collection full-length cDNA sequencing initiative, the method has been used and refined in our laboratory since September 2000. Amenable to large scale projects, we have used the method to generate >7 Mb of accurate sequence from 3695 candidate full-length cDNAs. Sequencing is accomplished through the insertion of Mu transposon into cDNAs, followed by sequencing reactions primed with Mu-specific sequencing primers. Transposon insertion reactions are not performed with individual cDNAs but rather on pools of up to 96 clones. This pooling strategy reduces the number of transposon insertion sequencing libraries that would otherwise be required, reducing the costs and enhancing the efficiency of the transposon library construction procedure. Sequences generated using transposon-specific sequencing primers are assembled to yield the full-length cDNA sequence, with sequence editing and other sequence finishing activities performed as required to resolve sequence ambiguities. Although analysis of the many thousands (22 785) of sequenced Mu transposon insertion events revealed a weak sequence preference for Mu insertion, we observed insertion of the Mu transposon into 1015 of the possible 1024 5mer candidate insertion sites. PMID:12034834

  12. Molecular cloning and sequence analysis of prion protein gene in Xiji donkey in China.


    Zhang, Zhuming; Wang, Renli; Xu, Lihua; Yuan, Fangzhong; Zhou, Xiangmei; Yang, Lifeng; Yin, Xiaomin; Xu, Binrui; Zhao, Deming


    Prion diseases are a group of human and animal neurodegenerative disorders caused by the deposition of an abnormal isoform prion protein (PrP(Sc)) encoded by a single copy prion protein gene (PRNP). Prion disease has been reported in many herbivores but not in Equus and the species barrier might be playing a role in resistance of these species to the disease. Therefore, analysis of genotype of prion protein (PrP) in these species may help understand the transmission of the disease. Xiji donkey is a rare species of Equus not widely reared in Ningxia, China, for service, food and medicine, but its PRNP has not been studied. Based on the reported PrP sequence in GenBank we designed primers and amplified, cloned and sequenced the PRNP of Xiji donkey. The sequence analysis showed that the Xiji donkey PRNP was consisted of an open reading frame of 768 nucleotides encoding 256 amino acids. Amino acid residues unique to donkey as compared with some Equus animals, mink, cow, sheep, human, dog, sika deer, rabbit and hamster were identified. The results showed that the amino acid sequence of Xiji donkey PrP starts with the consensus sequence MVKSH, with almost identical amino acid sequence to the PrP of other Equus species in this study. Amino acid sequence analysis showed high identity within species and close relation to the PRNP of sika deer, sheep, dog, camel, cow, mink, rabbit and hamster with 83.1-99.7% identity. The results provided the PRNP data for an additional Equus species, which should be useful to the study of the prion disease pathogenesis, resistance and cross species transmission.

  13. Next-generation sequencing enables the discovery of more diverse positive clones from a phage-displayed antibody library

    PubMed Central

    Yang, Wonjun; Yoon, Aerin; Lee, Sanghoon; Kim, Soohyun; Han, Jungwon; Chung, Junho


    Phage display technology provides a powerful tool to screen a library for a binding molecule via an enrichment process. It has been adopted as a critical technology in the development of therapeutic antibodies. However, a major drawback of phage display technology is that because the degree of the enrichment cannot be controlled during the bio-panning process, it frequently results in a limited number of clones. In this study, we applied next-generation sequencing (NGS) to screen clones from a library and determine whether a greater number of clones can be identified using NGS than using conventional methods. Three chicken immune single-chain variable fragment (scFv) libraries were subjected to bio-panning on prostate-specific antigen (PSA). Phagemid DNA prepared from the original libraries as well as from the Escherichia coli pool after each round of bio-panning was analyzed using NGS, and the heavy chain complementarity-determining region 3 (HCDR3) sequences of the scFv clones were determined. Subsequently, through two-step linker PCR and cloning, the entire scFv gene was retrieved and analyzed for its reactivity to PSA in a phage enzyme immunoassay. After four rounds of bio-panning, the conventional colony screening method was performed for comparison. The scFv clones retrieved from NGS analysis included all clones identified by the conventional colony screening method as well as many additional clones. The enrichment of the HCDR3 sequence throughout the bio-panning process was a positive predictive factor for the selection of PSA-reactive scFv clones. PMID:28336957

  14. Characterization of cDNA clones encoding rabbit and human serum paraoxonase: The mature protein retains its signal sequence

    SciTech Connect

    Hassett, C.; Richter, R.J.; Humbert, R.; Omiecinski, C.J.; Furlong, C.E. ); Chapline, C.; Crabb, J.W. )


    Serum paraoxonase hydrolyzes the toxic metabolites of a variety of organophosphorus insecticides. High serum paraoxonase levels appear to protect against the neurotoxic effects of organophosphorus substrates of this enzyme. The amino acid sequence accounting for 42% of rabbit paraoxonase was determined. From these data, two oligonucleotide probes were synthesized and used to screen a rabbit liver cDNA library. Human paraoxonase clones were isolated from a liver cDNA library by using the rabbit cDNA as a hybridization probe. Inserts from three of the longest clones were sequenced, and one full-length clone contained an open reading frame encoding 355 amino acids, four less than the rabbit paraoxonase protein. Amino-terminal sequences derived from purified rabbit and human paraoxonase proteins suggested that the signal sequence is retained, with the exception of the initiator methionine residue. Characterization of the rabbit and human paraoxonase cDNA clones confirms that the signal sequences are not processed, except for the N-terminal methionine residue. The rabbit and human cDNA clones demonstrate striking nucleotide and deduced amino acid similarities (greater than 85%), suggesting an important metabolic role and constraints on the evolution of this protein.

  15. Analysis of cloned cDNA and genomic sequences for phytochrome: complete amino acid sequences for two gene products expressed in etiolated Avena.

    PubMed Central

    Hershey, H P; Barker, R F; Idler, K B; Lissemore, J L; Quail, P H


    Cloned cDNA and genomic sequences have been analyzed to deduce the amino acid sequence of phytochrome from etiolated Avena. Restriction endonuclease site polymorphism between clones indicates that at least four phytochrome genes are expressed in this tissue. Sequence analysis of two complete and one partial coding region shows approximately 98% homology at both the nucleotide and amino acid levels, with the majority of amino acid changes being conservative. High sequence homology is also found in the 5'-untranslated region but significant divergence occurs in the 3'-untranslated region. The phytochrome polypeptides are 1128 amino acid residues long corresponding to a molecular mass of 125 kdaltons. The known protein sequence at the chromophore attachment site occurs only once in the polypeptide, establishing that phytochrome has a single chromophore per monomer covalently linked to Cys-321. Computer analyses of the amino acid sequences have provided predictions regarding a number of structural features of the phytochrome molecule. PMID:3001642

  16. Molecular cloning, expression, and primary sequence of outer membrane protein P2 of Haemophilus influenzae type b.

    PubMed Central

    Munson, R; Tolan, R W


    The structural gene for the porin of Haemophilus influenzae type b, designated outer membrane protein P2, was cloned, and the DNA sequence was determined. An oligonucleotide probe generated by reverse translation of N-terminal amino acid sequence data from the purified protein was used to screen genomic DNA. The probe detected a single EcoRI fragment of approximately 1,700 base pairs which was cloned to lambda gt11 and then into M13 and partially sequenced. The derived amino acid sequence indicated that we had cloned the N-terminal portion of the P2 gene. An overlapping approximately 1,600-base-pair PvuII genomic fragment was cloned into M13, and the sequence of the remainder of the P2 gene was determined. The gene for P2 was then reconstructed under the control of the T7 promoter and expressed in Escherichia coli. The N-terminal sequence of the purified protein corresponds to residues 21 through 34 of the derived amino acid sequence. Thus, the protein is synthesized with a 20-amino-acid leader peptide. The Mr of the processed protein is 37,782, in good agreement with the estimate of 37,000 from sodium dodecyl sulfate-polyacrylamide gel electrophoresis. Images PMID:2535836

  17. Cloning and expression of Staphylococcus saprophyticus urease gene sequences in Staphylococcus carnosus and contribution of the enzyme to virulence.

    PubMed Central

    Gatermann, S; Marre, R


    The urease gene of Staphylococcus saprophyticus CCM883 was cloned and expressed in Staphylococcus carnosus TM300. In vitro translation of the cloned DNA sequences revealed six polypeptides (of 70, 47, 29, 27, 20, and 17 kilodaltons) that were associated with enzyme activity. Introduction of the cloned genes into a urease-negative mutant of S. saprophyticus restored the virulence of this strain, confirming our previous suggestion (S. Gatermann, J. John, and R. Marre, Infect. Immun. 57:110-116, 1989) that this enzyme is a major virulence factor of the organism and contributes mainly to cystopathogenicity. Images PMID:2777370

  18. Molecular cloning and sequencing of the banded dogfish (Triakis scyllia) interleukin-8 cDNA.


    Inoue, Yuuki; Haruta, Chiaki; Usui, Kazushige; Moritomo, Tadaaki; Nakanishi, Teruyuki


    The dogfish (Triakis scyllia) interleukin-8 (IL-8) cDNA was isolated from mitogen-stimulated peripheral white blood cells (WBCs) utilising the polymerase chain reaction (PCR). The cDNA sequence showed that the dogfish IL-8 clones contained an open reading frame encoding 101 amino acids. A short 5' untranslated region (UTR) of 70 nucleotides and a long 3' UTR of 893 nucleotides were also present in this 1.2-kb cDNA. Furthermore, the 3' UTR of the mRNA contained the AUUUA sequence that has been implicated in shortening of the half-life of several cytokines and growth factors. The predicted IL-8 peptide had one potential N-linked glycosylation site (Asn-72-Thr-74) that is not conserved in other vertebrates. It also contained four cysteine residues (Cys-34, 36, 61 and 77), which are characteristic of CXC subfamily cytokines and found in all vertebrates, to date. The dogfish IL-8 lacked an ELR motif as found in the lamprey and trout. Comparison of the deduced amino acids showed that the dogfish IL-8 sequence shared 50.5, 41.2, 37.1 and 40.4-45.5% identity with the chicken, lamprey, trout and mammalian IL-8 sequences, respectively.

  19. Molecular cloning and nucleotide sequencing of human immunoglobulin epsilon chain cDNA.

    PubMed Central

    Seno, M; Kurokawa, T; Ono, Y; Onda, H; Sasada, R; Igarashi, K; Kikuchi, M; Sugino, Y; Nishida, Y; Honjo, T


    DNA complementary to mRNA of human immunoglobulin E heavy chain (epsilon chain) isolated and purified from U266 cells has been synthesized and inserted into the PstI site of pBR322 by G-C tailing. This recombinant plasmid was used to transform E. coli chi 1776 to screen 1445 tetracycline resistant colonies. Nine clones (pGETI - 9) containing cDNA coding for the human epsilon chain were recognized by colony hybridization and Southern blotting analysis with a nick-translated human IgE genome fragment. The nucleotide sequence of the longest cDNA contained in pGET2 was determined. The results indicate that the sequence of 1657 nucleotides codes for 494 amino acids covering a part of the variable region and all of the constant region of the human epsilon chain. Most of the amino acid sequence deduced from the nucleotide sequence is in substantial agreement with that reported. Furthermore a termination codon after the -COOH terminal amino acid marks the beginning of a 3' untranslated region of 125 nucleotides with a poly A tail. Taking this into account, the structure of the human epsilon chain mRNA, except a part of the 5' end, is conserved fairly well in the cDNA insert in pGET2. Images PMID:6300763

  20. Flow Cytometry-assisted Cloning of Specific Sequence Motifs fromComplex 16S ribosomal RNA Gene Libraries.

    SciTech Connect

    Nielsen, J.L.; Schramm, A.; Bernhard, A.E.; van den Engh, G.J.; Stahl, D.A.


    A flow cytometry method was developed for rapid screeningand recovery of cloned DNA containing common sequence motifs. Thisapproach, termed fluorescence-activated cell sorting-assisted cloning,was used to recover sequences affiliated with a unique lineage within theBacteroidetes not abundant in a clone library of environmental 16S rRNAgenes. Retrieval and sequence analysis of phylogenetically informativegenes has become a standard cultivation-independent technique toinvestigate microbial diversity in nature (7, 18). Genes encoding the 16SrRNA, because of the relative ease of their selective amplification, havebeen most frequently employed for general diversity surveys (16).Environmental studies have also focused on specific subpopulationsaffiliated with a phylogenetic group or identified by genes encodingspecific metabolic functions (e.g., ammonia oxidation, sulfaterespiration, and nitrate reduction) (8,15,20). However, specificpopulations may be of low abundance (1,23), or the genes encodingspecific metabolic functions may be insufficiently conserved to providepriming sites for general PCR amplification. Three general approacheshave been used to obtain 16S rRNA sequence information from low-abundancepopulations: screening hundreds to thousands of clones in a general 16SrRNA gene library (21), flow cytometric sorting of a subpopulation ofenvironmentally derived cells labeled by fluorescent in situhybridization (FISH) (27), or selective PCR amplification using primersspecific for the subpopulation (2,23). While the first approach is simplytime-consuming and tedious, the second has been restricted to fairlylarge and strongly fluorescent cells from aquatic samples (5, 27). Thethird approach often generates fragments of only a few hundred bases dueto the limited number of specific priming sites. Partial sequenceinformation often degrades analysis, obscuring or distorting thephylogenetic placement of the new sequences (11, 20). A more robustcharacterization of environ

  1. Continuous production of ethanol by use of flocculent zymomonas mobilis


    Arcuri, Edward J.; Donaldson, Terrence L.


    Ethanol is produced by means of a floc-forming strain of Zymomonas mobilis bacteria. Gas is vented along the length of a column containing the flocculent bacteria to preclude disruption of liquid flow.

  2. Novel classical MHC class I alleles identified in horses by sequencing clones of reverse transcription-PCR products.


    Chung, C; Leib, S R; Fraser, D G; Ellis, S A; McGuire, T C


    Improved typing of horse classical MHC class I is required to more accurately define these molecules and to extend the number identified further than current serological assays. Defining classical MHC class I alleleic polymorphism is important in evaluating cytotoxic T lymphocyte (CTL) responses in horses. In this study, horse classical MHC class I genes were analyzed based on reverse transcription (RT)-PCR amplification of sequences encoding the polymorphic peptide binding region and the more conserved alpha 3, transmembrane and cytoplasmic regions followed by cloning and sequencing. Primer sets included a horse classical MHC class I-specific reverse primer and a forward primer conserved in all known horse MHC class I genes. Sequencing at least 25 clones containing MHC class I sequences from each of 13 horses identified 25 novel sequences and three others which had been described. Of these, nine alleles were identified from different horses or different RT-PCR and 19 putative alleles were identified in multiple clones from the same RT-PCR. The primer pairs did not amplify putative non-classical MHC class I genes as only classical MHC class I and related pseudogenes were found in 462 clones. This method also identified classical MHC class I alleles shared between horses by descent, and defined differences in alleles between horses varying in equine leukocyte antigen (ELA)-A haplotype as determined by serology. However, horses sharing ELA-A haplotypes defined by serotyping did not always share cDNA sequences, suggesting subhaplotypic variations within serologically defined ELA-A haplotypes. The 13 horses in this study had two to five classical MHC class I sequences, indicating that multiple loci code for these genes. Sequencing clones from RT-PCR with classical MHC class I-specific primers should be useful for selection of haplotype matched and mismatched horses for CTL studies, and provides sequence information needed to develop easier and more discriminating

  3. Development of positive control materials for DNA-based detection of cystic fibrosis: Cloning and sequencing of 31 mutations

    SciTech Connect

    Iovannisci, D.; Brown, C.; Winn-Deen, E.


    The cloning and sequencing of the gene associated with cystic fibrosis (CF) now provides the opportunity for earlier detection and carrier screening through DNA-based detection schemes. To date, over 300 mutations have been reported to the CF Consortium; however, only 30 mutations have been observed frequently enough world-wide to warrant routine screening. Many of these mutations are not available as cloned material or as established tissue culture cell lines to aid in the development of DNA-based detection assays. We have therefore cloned the 30 most frequently reported mutations, plus the mutation R347H due to its association with male infertility (31 mutations, total). Two approaches were employed: direct PCR amplification, where mutations were available from patient sources, and site-directed PCR mutagenesis of normal genomic DNA to generate the remaining mutations. After amplification, products were cloned into a sequencing vector, bacterial transformants were screened by a novel method (PCR/oligonucleotide litigation assay/sequence-coded separation), and plamid DNA sequences determined by automated fluorescent methods on the Applied Biosystems 373A. Mixing of the clones allows the construction of artificial genotypes useful as positive control material for assay validation. A second round of mutagenesis, resulting in the construction of plasmids bearing multiple mutations, will be evaluated for their utility as reagent control materials in kit development.

  4. Production, characterization, cloning and sequence analysis of a monofunctional catalase from Serratia marcescens SYBC08.


    Zeng, Hua-Wei; Cai, Yu-Jie; Liao, Xiang-Ru; Zhang, Feng; Zhang, Da-Bing


    A monofunctional catalase from Serratia marcescens SYBC08 produced by liquid state fermentation in 7 liter fermenter was isolated and purified by ammonium sulfate precipitation (ASP), ion exchange chromatography (IEC), and gel filtration (GF) and characterized. Its sequence was analyzed by LC-MS/MS technique and gene cloning. The highest catalase production (20,289 U · ml(-1)) was achieved after incubation for 40 h. The purified catalase had an estimated molecular mass of 230 kDa, consisting of four identical subunits of 58 kDa. High specific activity of the catalase (199,584 U · mg(-1) protein) was 3.44 times higher than that of Halomonas sp. Sk1 catalase (57,900 U · mg(-1) protein). The enzyme without peroxidase activity was found to be an atypical electronic spectrum of monofunctional catalase. The apparent K(m) and V(max) were 78 mM and 188, 212 per µM H(2) O(2) µM heme(-1) s(-1), respectivly. The enzyme displayed a broad pH activity range (pH 5.0-11.0), with optimal pH range of 7.0-9.0: It was most active at 20 °C and had 78% activity at 0 °C. Its thermo stability was slightly higher compared to that of commercial catalase from bovine liver. LC-MS/MS analysis confirmed that the deduced amino acid sequence of cloning gene was the catalase sequence from Serratia marcescens SYBC08. The sequence was compared with that of 23 related catalases. Although most of active site residues, NADPH-binding residues, proximal residues of the heme, distal residues of the heme and residues interacting with a water molecule in the enzyme were well conserved in 23 related catalases, weakly conserved residues were found. Its sequence was closely related with that of catalases from pathogenic bacterium in the family Enterobacteriaceae. This result imply that the enzyme with high specific activity plays a significant role in preventing those microorganisms of the family Enterobacteriaceae against hydrogen peroxide resulted in cellular damage. Calalase yield by Serratia

  5. Phosphatidylinositol-specific phospholipase C of Bacillus cereus: cloning, sequencing, and relationship to other phospholipases.

    PubMed Central

    Kuppe, A; Evans, L M; McMillen, D A; Griffith, O H


    The phosphatidylinositol (PI)-specific phospholipase C (PLC) of Bacillus cereus was cloned into Escherichia coli by using monoclonal antibody probes raised against the purified protein. The enzyme is specific for hydrolysis of the membrane lipid PI and PI-glycan-containing membrane anchors, which are important structural components of one class of membrane proteins. The protein expressed in E. coli comigrated with B. cereus PI-PLC in sodium dodecyl sulfate-polyacrylamide gel electrophoresis, as detected by immunoblotting, and conferred PI-PLC activity on the host. This enzyme activity was inhibited by PI-PLC-specific monoclonal antibodies. The nucleotide sequence of the PI-PLC gene suggests that this secreted bacterial protein is synthesized as a larger precursor with a 31-amino-acid N-terminal extension to the mature enzyme of 298 amino acids. From analysis of coding and flanking sequences of the gene, we conclude that the PI-PLC gene does not reside next to the gene cluster of the other two secreted phospholipases C on the bacterial chromosome. The deduced amino acid sequence of the B. cereus PI-PLC contains a stretch of significant similarity to the glycosylphosphatidylinositol-specific PLC of Trypanosoma brucei. The conserved peptide is proposed to play a role in the function of these enzymes. Images PMID:2509427

  6. Cloning and sequencing of badger (Meles meles) interferon gamma and its detection in badger lymphocytes.


    Dalley, D J; Hogarth, P J; Hughes, S; Hewinson, R G; Chambers, M A


    The European badger (Meles meles) has been identified as a reservoir for Mycobacterium bovis and is implicated in the maintenance and transmission of tuberculosis in cattle. There is a need for a sensitive test of M. bovis infection in badgers and the current serodiagnostic test used for this purpose has low sensitivity. As observed for other species, assay of interferon-gamma (IFNgamma) produced in response to M. bovis antigens is a more sensitive test of tuberculosis. With this objective in sight, we report the first step in the development of an ELISA for badger IFNgamma. The badger IFNgamma gene was cloned and sequenced and used to generate a specific polyclonal antibody to the cytokine. The gene sequence demonstrated regions that were conserved within the IFNgamma genes of other mammals. The badger sequence was most similar to the canine, showing similar structural organisation of the gene and 88% amino acid identity. Rabbits were immunised with DNA encoding badger IFNgamma and the resulting polyclonal antiserum demonstrated specificity for canine IFNgamma by immunoblot of a commercial recombinant canine IFNgamma. The antiserum was used to detect intracellular badger IFNgamma by flow cytometry analysis of badger lymphocytes stimulated with mitogen.



    Zhu, Hui; Wang, Wen-Xiu; Wang, Bao-Qin; Zhu, Xiao-Fu; Wu, Xu-Jin; Ma, Qing-Yi; Chen, De-Kun


    The giant panda (Ailuropoda melanoleuca) is an endangered species and indigenous to China. Interferon-gamma (IFN-γ) is the only member of type □ IFN and is vital for the regulation of host adapted immunity and inflammatory response. Little is known aboutthe FN-γ gene and its roles in giant panda.In this study, IFN-γ gene of Qinling giant panda was amplified from total blood RNA by RT-CPR, cloned, sequenced and analysed. The open reading frame (ORF) of Qinling giant panda IFN-γ encodes 152 amino acidsand is highly similar to Sichuan giant panda with an identity of 99.3% in cDNA sequence. The IFN-γ cDNA sequence was ligated to the pET32a vector and transformed into E. coli BL21 competent cells. Expression of recombinant IFN-γ protein of Qinling giant panda in E. coli was confirmed by SDS-PAGE and Western blot analysis. Biological activity assay indicated that the recombinant IFN-γ protein at the concentration of 4-10 µg/ml activated the giant panda peripheral blood lymphocytes,while at 12 µg/mlinhibited. the activation of the lymphocytes.These findings provide insights into the evolution of giant panda IFN-γ and information regarding amino acid residues essential for their biological activity.

  8. Cloning and sequence analysis of ornithine decarboxylase gene fragments from the Ascomycota.


    Jiménez-Bremont, Juan Francisco; Rodríguez-Kessler, Margarita; Rodríguez-Guerra, Raul; Cortes-Penagos, Carlos; Torres-Guzman, Juan Carlos; Williamson, June Simpson


    Ornithine decarboxylase (ODC; EC catalyzes the initial step in the biosynthesis of polyamines, the conversion of ornithine to putrescine. Based on the most conserved regions of fungal ODCs, we designed and synthesized oligonucleotides to amplify homologous fragments of three important plant pathogenic Pyrenomycete fungi (Ascomycota), Magnaporthe grisea, Colletotrichum lindemuthianum and Fusarium solani, and one insect pathogenic fungus Metarhizium anisopliae. Cloning and sequencing of the amplified fragments revealed homologies of between 37 to 88% with other fungal ODCs. The predicted peptide sequences were compared by Clustal analysis and conserved sequences corresponding to the substrate and cofactor binding sites were identified. Comparative analyses of the ODC fragments isolated in this study, revealed high homology between them (68.3-81.1%) and also with other Pyrenomycetes such as Neurospora crassa (order Sordariales; 68.6-72.9%) and Fusarium graminearum (order Hypocreales; 70.8-88.1%). Data obtained in this work revealed that these fungi constitute a compact group separated from other eukaryotic ODCs.

  9. Cloning and sequencing of the PIF gene involved in repair and recombination of yeast mitochondrial DNA.

    PubMed Central

    Foury, F; Lahaye, A


    The nuclear gene PIF of Saccharomyces cerevisiae is required for both repair of mitochondrial DNA (mtDNA) and recognition of a recombinogenic signal characterized by a 26-bp palindromic AT sequence in the ery region of mtDNA. This gene has been cloned in yeast by genetic complementation of pif mutants. Its chromosomal disruption does not destroy the genetic function of mitochondria. The nucleotide sequence of the 3.5-kb insert from a complementing plasmid reveals an open reading frame encoding a potential protein of 857 amino acids and Mr = 97,500. An ATP-binding domain is present in the central part of the gene and in the carboxy-terminal region a putative DNA-binding site is present. Its alpha helix-turn-alpha helix motif is found in DNA-binding proteins such as lambda and lactose repressors which recognize symmetric sequences. Significant amino acid homology is observed with yeast RAD3 and E. coli UvrD (helicase II) proteins which are required for excision repair of damaged DNA. Images Fig. 1. Fig. 2. PMID:3038524

  10. Cloning, Sequencing, and Role in Serum Susceptibility of Porin II from Mesophilic Aeromonas hydrophila

    PubMed Central

    Nogueras, Maria Mercé; Merino, Susana; Aguilar, Alicia; Benedi, Vicente Javier; Tomás, Juan M.


    We cloned and sequenced the structural gene for Aeromonas hydrophila porin II from strain AH-3 (serogroup O:34). The genetic position of this gene, like that of ompF in Escherichia coli, is adjacent to aspC and transcribed in the same direction. However, upstream of the porin II gene no similarities with E. coli were found. We obtained defined insertion mutants in porin II gene either in A. hydrophila (O:34) or A. veronii sobria (serogroup O:11) serum-resistant or -sensitive strains. Furthermore, we complemented these mutants with a plasmid harboring only the porin II gene, which allowed us to define the role of porin II as an important surface molecule involved in serum susceptibility and C1q binding in these strains. PMID:10722573

  11. The complete genome sequences, unique mutational spectra and developmental potency of adult neurons revealed by cloning

    PubMed Central

    Rodriguez, Alberto R.; Ferguson, William C.; Shumilina, Svetlana; Clark, Royden A.; Boland, Michael J.; Martin, Greg; Chubukov, Pavel; Tsunemoto, Rachel K.; Torkamani, Ali; Kupriyanov, Sergey; Hall, Ira M.; Baldwin, Kristin K.


    Somatic mutation in neurons is linked to neurologic disease and implicated in cell type diversification. However, the origin, extent and patterns of genomic mutation in neurons remain unknown. We established a nuclear transfer method to clonally amplify the genomes of neurons from adult mice for whole genome sequencing. Comprehensive mutation detection and independent validation revealed that individual neurons harbor ~100 unique mutations from all classes, but lack recurrent rearrangements. Most neurons contain at least one gene disrupting mutation and rare (0-2) mobile element insertions. The frequency and gene bias of neuronal mutations differs from other lineages, potentially due to novel mechanisms governing post-mitotic mutation. Fertile mice were cloned from several neurons, establishing the compatibility of mutated adult neuronal genomes with reprogramming to pluripotency and development. PMID:26948891

  12. Cloning, overexpression and nucleotide sequence of a thermostable DNA ligase-encoding gene.


    Barany, F; Gelfand, D H


    Thermostable DNA ligase has been harnessed for the detection of single-base genetic diseases using the ligase chain reaction [Barany, Proc. Natl. Acad. Sci. USA 88 (1991) 189-193]. The Thermus thermophilus (Tth) DNA ligase-encoding gene (ligT) was cloned in Escherichia coli by genetic complementation of a ligts 7 defect in an E. coli host. Nucleotide sequence analysis of the gene revealed a single chain of 676 amino acid residues with 47% identity to the E. coli ligase. Under phoA promoter control, Tth ligase was overproduced to greater than 10% of E. coli cellular proteins. Adenylated and deadenylated forms of the purified enzyme were distinguished by apparent molecular weights of 81 kDa and 78 kDa, respectively, after separation via sodium dodecyl sulfate-polyacrylamide-gel electrophoresis.

  13. The Complete Genome Sequences, Unique Mutational Spectra, and Developmental Potency of Adult Neurons Revealed by Cloning.


    Hazen, Jennifer L; Faust, Gregory G; Rodriguez, Alberto R; Ferguson, William C; Shumilina, Svetlana; Clark, Royden A; Boland, Michael J; Martin, Greg; Chubukov, Pavel; Tsunemoto, Rachel K; Torkamani, Ali; Kupriyanov, Sergey; Hall, Ira M; Baldwin, Kristin K


    Somatic mutation in neurons is linked to neurologic disease and implicated in cell-type diversification. However, the origin, extent, and patterns of genomic mutation in neurons remain unknown. We established a nuclear transfer method to clonally amplify the genomes of neurons from adult mice for whole-genome sequencing. Comprehensive mutation detection and independent validation revealed that individual neurons harbor ∼100 unique mutations from all classes but lack recurrent rearrangements. Most neurons contain at least one gene-disrupting mutation and rare (0-2) mobile element insertions. The frequency and gene bias of neuronal mutations differ from other lineages, potentially due to novel mechanisms governing postmitotic mutation. Fertile mice were cloned from several neurons, establishing the compatibility of mutated adult neuronal genomes with reprogramming to pluripotency and development.

  14. ddClone: joint statistical inference of clonal populations from single cell and bulk tumour sequencing data.


    Salehi, Sohrab; Steif, Adi; Roth, Andrew; Aparicio, Samuel; Bouchard-Côté, Alexandre; Shah, Sohrab P


    Next-generation sequencing (NGS) of bulk tumour tissue can identify constituent cell populations in cancers and measure their abundance. This requires computational deconvolution of allelic counts from somatic mutations, which may be incapable of fully resolving the underlying population structure. Single cell sequencing (SCS) is a more direct method, although its replacement of NGS is impeded by technical noise and sampling limitations. We propose ddClone, which analytically integrates NGS and SCS data, leveraging their complementary attributes through joint statistical inference. We show on real and simulated datasets that ddClone produces more accurate results than can be achieved by either method alone.

  15. Cloning, sequencing and transcriptional analysis of the Choristoneura fumiferana entomopoxvirus spheroidin gene.


    Li, X; Barrett, J W; Yuen, L; Arif, B M


    The Choristoneura fumiferana entomopoxvirus (CfEPV) spheroidin gene was identified and localized on three XbaI restriction fragments (total size 4.73 kb). The fragments were cloned and sequenced. The spheroidin gene had an open reading frame of 2997 nucleotides encoding a putative protein with a predicted size of 115 kDa. Sequence analysis indicated that the putative protein contained 14 potential N-glycosylation sites (Asn-X-Thr; Asn-X-Ser), that are probably not used since the protein migrates on SDS-PAGE as a 115 kDa band. The protein is rich in cysteine residues (34), which explains the need for reducing agents when dissolving the occlusion bodies with alkali. The spheroidin gene sequence contains motifs characteristic of the late genes of poxviruses. These include the typical TAAATG sequence at the beginning of the coding region and two early gene termination signals (TTTTTNT) in the untranslated region of the gene. The promoter region has three TAA termination signals immediately upstream of the ATG start site. Spheroidin (SPH) appears to be conserved among different EPVs. There was 82.2% identity and 97.2% similarity at the amino acid level between the SPHs of CfEPV and Amsacta moorei EPV. Less conservation was seen with the SPH from Melolontha melolontha EPV (39.8% identity and 73.4% similarity). Transcriptional analyses of the spheroidin gene by Northern blots showed that the transcript had a size of approximately 3 kb, which is in agreement with the length of the ORF. Primer extension results, anchor PCR and sequencing confirmed that there was a poly (A)17 tract at the 5' end of the spheroidin gene transcript, a structure typical of late gene transcripts of poxviruses.

  16. Isolation, characterization, and primary structure of rubredoxin from the photosynthetic bacterium, Heliobacillus mobilis

    NASA Technical Reports Server (NTRS)

    Lee, W. Y.; Brune, D. C.; LoBrutto, R.; Blankenship, R. E.


    Rubredoxin is a small nonheme iron protein that serves as an electron carrier in bacterial systems. Rubredoxin has now been isolated and characterized from the strictly anaerobic phototroph, Heliobacillus mobilis. THe molecular mass (5671.3 Da from the amino acid sequence) was confirmed and partial formylation of the N-terminal methionyl residue was established by matrix-assisted laser desorption mass spectroscopy. The complete 52-amino-acid sequence was determined by a combination of N-terminal sequencing by Edman degradation and C-terminal sequencing by a novel method using carboxypeptidase treatment in conjunction with amino acid analysis and laser desorption time of flight mass spectrometry. The molar absorption coefficient of Hc. mobilis rubredoxin at 490 nm is 6.9 mM-1 cm-1 and the midpoint redox potential at pH 8.0 is -46 mV. The EPR spectrum of the oxidized form shows resonances at g = 9.66 and 4.30 due to a high-spin ferric iron. The amino acid sequence is homologous to those of rubredoxins from other species, in particular, the gram-positive bacteria, and the phototrophic green sulfur bacteria, and the evolutionary implications of this are discussed.

  17. Cloning, expression, and nucleotide sequence of the Lactobacillus helveticus 481 gene encoding the bacteriocin helveticin J.

    PubMed Central

    Joerger, M C; Klaenhammer, T R


    Lactobacillus helveticus 481 produces a 37-kDa bacteriocin called helveticin J. Libraries of chromosomal DNA from L. helveticus were prepared in lambda gt11 and probed for phage-producing fusion proteins that could react with polyclonal helveticin J antibody. Two recombinant phage, HJ1 and HJ4, containing homologous inserts of 350 and 600 bp, respectively, produced proteins that reacted with antibody. These two phage clones specifically hybridized to L. helveticus 481 total genomic DNA but not to DNA from strains that did not produce helveticin J or strains producing unrelated bacteriocins. HJ1 and HJ4 lysogens produced beta-galactosidase fusion proteins that shared similar epitopes with each other and helveticin J. The intact helveticin J gene (hlv) was isolated by screening a library of L. helveticus chromosomal DNA in lambda EMBL3 with the insert DNA from phage HJ4 as a probe. The DNA sequence of a contiguous 3,364-bp region was determined. Two complete open reading frames (ORF), designated ORF2 and ORF3, were identified within the sequenced fragment. The 3' end of another open reading frame, ORF1, was located upstream of ORF2. A noncoding region and a putative promoter were located between ORF1 and ORF2. ORF2 could encode an 11,808-Da protein. The L. helveticus DNA inserts of the HJ1 and HJ4 clones reside within ORF3, which begins 30 bp downstream from the termination codon of ORF2. ORF3 could encode a 37,511-Da protein. Downstream from ORF3, the 5' end of another ORF (ORF4) was found. A Bg/II fragment containing ORF2 and ORF3 was cloned into pGK12, and the recombinant plasmid, pTRK135, was transformed into Lactobacillus acidophilus via electroporation. Transformants carrying pTRK135 produced a bacteriocin that was heat labile and exhibited an acitivity spectrum that was the same as that of helveticin J. Images PMID:2228964

  18. A Sequence-Ready BAC Clone Contig of a 2.2-Mb Segment of Human Chromosome 1q24

    PubMed Central

    Vollrath, Douglas; Jaramillo-Babb, Virna L.


    Human chromosomal region 1q24 encodes two cloned disease genes and lies within large genetic inclusion intervals for several disease genes that have yet to be identified. We have constructed a single bacterial artificial chromosome (BAC) clone contig that spans over 2 Mb of 1q24 and consists of 78 clones connected by 100 STSs. The average density of mapped STSs is one of the highest described for a multimegabase region of the human genome. The contig was efficiently constructed by generating STSs from clone ends, followed by library walking. Distance information was added by determining the insert sizes of all clones, and expressed sequence tags (ESTs) and genes were incorporated to create a partial transcript map of the region, providing candidate genes for local disease loci. The gene order and content of the region provide insight into ancient duplication events that have occurred on proximal 1q. The stage is now set for further elucidation of this interesting region through large-scale sequencing. [The sequence data described in this paper have been submitted to GenBank under accession nos. G42259–G42312 and G42330–G42335.] PMID:10022979

  19. Expression and nucleotide sequence of the Clostridium acetobutylicum beta-galactosidase gene cloned in Escherichia coli.

    PubMed Central

    Hancock, K R; Rockman, E; Young, C A; Pearce, L; Maddox, I S; Scott, D B


    A gene library for Clostridium acetobutylicum NCIB 2951 was constructed in the broad-host-range cosmid pLAFR1, and cosmids containing the beta-galactosidase gene were isolated by direct selection for enzyme activity on X-Gal (5-bromo-4-chloro-3-indolyl-beta-D-galactoside) plates after conjugal transfer of the library to a lac deletion derivative of Escherichia coli. Analysis of various pSUP202 subclones of the lac cosmids on X-Gal plates localized the beta-galactosidase gene to a 5.1-kb EcoRI fragment. Expression of the Clostridium beta-galactosidase gene in E. coli was not subject to glucose repression. By using transposon Tn5 mutagenesis, two gene loci, cbgA (locus I) and cbgR (locus II), were identified as necessary for beta-galactosidase expression in E. coli. DNA sequence analysis of the entire 5.1-kb fragment identified open reading frames of 2,691 and 303 bp, corresponding to locus I and locus II, respectively, and in addition a third truncated open reading frame of 825 bp. The predicted gene product of locus I, CbgA (molecular size, 105 kDa), showed extensive amino acid sequence homology with E. coli LacZ, E. coli EbgA, and Klebsiella pneumoniae LacZ and was in agreement with the size of a polypeptide synthesized in maxicells containing the cloned 5.1-kb fragment. The predicted gene product of locus II, CbgR (molecular size, 11 kDa) shares no significant homology with any other sequence in the current DNA and protein sequence data bases, but Tn5 insertions in this gene prevent the synthesis of CbgA. Complementation experiments indicate that the gene product of cbgR is required in cis with cbgA for expression of beta-galactosidase in E. coli. Images PMID:1850729

  20. A multilocus sequence typing scheme for Streptococcus pneumoniae: identification of clones associated with serious invasive disease.


    Enright, M C; Spratt, B G


    The population biology of Streptococcus pneumoniae is poorly understood. Most of the important issues could be addressed by the molecular characterization of large, well sampled populations from carriage and from the different manifestations of pneumococcal disease. The authors have therefore developed a pneumococcal multilocus sequence typing scheme and database by sequencing approximately 450 bp fragments of seven housekeeping loci from 295 isolates. The combination of alleles at the seven loci provided an allelic profile, or sequence type (ST), and the relatedness between isolates was obtained by constructing a dendrogram from the matrix of pairwise differences between STs. The typing scheme was validated using pneumococci of known genetic relatedness and could resolve >6 billion STs. Among 274 isolates from recent cases of invasive pneumococcal disease in eight countries, 143 STs were resolved, but 12 STs contained at least five isolates (range 5-21 isolates). The repeated recovery of indistinguishable isolates from invasive disease in different countries implies that these STs define strains with an increased capacity to cause invasive disease. The relationship between STs and serotypes suggested that, in the longer term, capsular genes have been distributed horizontally within the pneumococcal population, but in the short term, expansion of clones occurs with only occasional changes of serotype. The multilocus sequence typing scheme provides a powerful new approach to the characterization of pneumococci, since it provides molecular typing data that are electronically portable between laboratories, and which can be used to probe aspects of the population and evolutionary biology of these organisms. A Web site for the molecular characterization of pneumococci by MLST is available (http ://

  1. Cloning and sequencing of the gene coding for the large subunit of methylamine dehydrogenase from Thiobacillus versutus.

    PubMed Central

    Huitema, F; van Beeumen, J; van Driessche, G; Duine, J A; Canters, G W


    The gene that codes for the alpha-subunit of methylamine dehydrogenase from Thiobacillus versutus, madA, was cloned and sequenced. It codes for a protein of 395 amino acids preceded by a leader sequence of 31 amino acids. The derived amino acid sequence was confirmed by partial amino acid sequencing. The start of the mature protein could not be determined by direct sequencing, since the N terminus appeared to be blocked. Instead, it was determined by electrospray mass spectrometry. Confirmation of the results was obtained by sequencing the N terminus after pyroglutamate aminopeptidase digestion. The sequence is homologous to the Paracoccus denitrificans nucleotide sequence. A second open reading frame, called open reading frame 3, is located immediately downstream of madA. PMID:8407797

  2. Cloning, sequencing, and expression of the gene coding for the human platelet. cap alpha. /sub 2/-adrenergic receptor

    SciTech Connect

    Kobilka, B.K.; Matsui, H.; Kobilka, T.S.; Yang-Feng, T.L.; Francke, U.; Caron, M.G.; Lefkowitz, R.J.; Regan, J.W.


    The gene for the human platelet ..cap alpha../sub 2/-adrenergic receptor has been cloned with oligonucleotides corresponding to the partial amino acid sequence of the purified receptor. The identity of this gene has been confirmed by the binding of ..cap alpha../sub 2/-adrenergic ligands to the cloned receptor expressed in Xenopus laevis oocytes. The deduced amino acid sequence is most similar to the recently cloned human ..beta../sub 2/- and ..beta../sub 1/-adrenergic receptors; however, similarities to the muscarinic cholinergic receptors are also evident. Two related genes have been identified by low stringency Southern blot analysis. These genes may represent additional ..cap alpha../sub 2/-adrenergic receptor subtypes.

  3. Isolation and sequencing of infectious clones of feline foamy virus and a human/feline foamy virus Env chimera.


    Hatama, S; Otake, K; Omoto, S; Murase, Y; Ikemoto, A; Mochizuki, M; Takahashi, E; Okuyama, H; Fujii, Y


    Full-length DNAs of the Coleman and S7801 strains (pSKY3.0, pSKY5.0) of infectious feline foamy viruses (FFVs) were cloned and sequenced. Parental viruses, designated SKY3.0 and SKY5.0, were secreted following transfection of Crandell feline kidney (CRFK) cells. Production of the rescued parental viruses was enhanced in the presence of trichostatin A. Amino acid sequence similarities between FFV and human foamy virus (HFV) are extremely low for the envelope protein and capsid antigen, as predicted from the two clones. However, a chimeric FFV clone was constructed with the HFV Env substituted for the FFV Env. The chimeric virus (HFFV, SKY4.0) was able to infect and replicate in CRFK cells as well as in peripheral blood mononuclear cells of cats in vivo. Consequently, the chimeric HFFV may be useful for the creation of FV vectors for gene transfer strategies.

  4. Cloning of DNA sequences localized on proximal fluorescent chromosome bands by microdissection in Pinus densiflora Sieb. & Zucc.


    Hizume, M; Shibata, F; Maruyama, Y; Kondo, T


    Japanese red pine, Pinus densiflora, has 2n=24 chromosomes, of which most carry chromomycin A3 (CMA) and 4',6-diamidino-2-phenylindole (DAPI) bands at their centromere-proximal regions. It was proposed that these regions contain highly repetitive DNA. The DNA localized in the proximal fluorescent bands was isolated and characterized. In P. densiflora, centromeric and neighboring segments of the somatic chromosomes were dissected with a manual micromanipulator. The centromeric DNA was amplified from the DNA contained in dissected centromeric segments by degenerate oligonucleotide primed-polymerase chain reaction (DOP-PCR) and a cloned DNA library was constructed. Thirty-one clones carrying highly repetitive DNA were selected by colony hybridization using Cot-1 DNA from this species as a probe, and their chromosomal localization was determined by fluorescent in situ hybridization (FISH). Clone PDCD501 was localized to the proximal CMA band of 20 chromosomes. This clone contained tandem repeats, comprising a 27 bp repeat unit, which was sufficient to provide the proximal FISH signal, with a 52.3% GC content. The repetitive sequence was named PCSR (proximal CMA band-specific repeat). Clone PDCD159 was 1700 bp in length, with a 61.7% AT content, and produced FISH signals at the proximal DAPI band of the remaining four chromosomes. Four clones hybridized strongly to the secondary constriction and gave weak signals at the centromeric region of several chromosomes. Clone PDCD537, one of the four clones, was homologous to the 26S rRNA gene. A PCR experiment using microdissected centromeric regions suggested that the centromeric region contains 18S and 26S rDNA. Another 24 clones hybridized to whole chromosome arms, with varying intensities and might represent dispersed repetitive DNA.

  5. Cloning and genomic nucleotide sequence of the matrix attachment region binding protein from the halotolerant alga Dunaliella salina.


    Wang, Peng-Ju; Wang, Tian-Yun; Wang, Ya-Feng; Yang, Rui; Li, Zhao-Xi


    In our previous study, the sequence of a matrix attachment region binding protein (MBP) cDNA was cloned from the unicellular green alga Dunaliella salina. However, the nucleotide sequence of this gene has not been reported so far. In this paper, the nucleotide sequence of MBP was cloned and characterized, and its gene copy number was determined. The MBP nucleotide sequence is 5641 bp long, and interrupted by 12 introns ranging from 132 to 562 bp. All the introns in the D. salina MBP gene have orthodox splice sites, exhibiting GT at the 5' end and AG at the 3' end. Southern blot analysis showed that MBP only has one copy in the D. salina genome.

  6. Molecular cloning, sequencing and expression of cDNA encoding human trehalase.


    Ishihara, R; Taketani, S; Sasai-Takedatsu, M; Kino, M; Tokunaga, R; Kobayashi, Y


    A complete cDNA clone encoding human trehalase, a glycoprotein of brush-border membranes, has been isolated from a human kidney library. The cDNA encodes a protein of 583 amino acids with a calculated molecular weight of 66,595. Human enzyme contains a typical cleavable signal peptide at amino terminus, five potential glycosylation sites, and a hydrophobic region at carboxyl terminus where the protein is anchored to plasma membranes via glycosylphosphatidylinositol. The deduced amino acid sequence of the human enzyme showed similarity to sequences of the enzyme from rabbit, silk worm, Tenebrio molitor, Escherichia coli and yeast. Northern blots revealed that human trehalase mRNA of approx. 2.0 kb was found mainly in the kidney, liver and small intestine. Expression of the recombinant trehalase in E. coli provided a high level of the enzyme activity. The isolation and expression of cDNA for human trehalase should facilitate studies of the structure of the gene, as well as a basis for a better understanding of the catalytic mechanism.

  7. Cloning, sequencing and analysis of dnaK -dnaJ gene cluster of Bacillus megaterium.


    Bao, Fangming; Gong, Lei; Shao, Weilan


    The DNA fragment of heat shock genes (hrcA-grpE-dnaK-dnaJ) containing complete hrcA-grpE-dnaK operon and the transcription unit of dnaJ was cloned, sequensed and analyzed from Bacillus megaterium RF5. The sequence of hrcA, grpE and dnaJ were first time reported, and their coding products exibit 60%, 63% and 81% of identities to the homologs of B. subtilis. A sigmaA-type promoter of Gram-positive bacteria (PA1) and a terminator were located upstream of the hrcA and downstream of dnaK, and a Controlling inverted repeat of chaperone expression element (CIRCE) was identified between PA1 and hrcA. Another sigmaA-type promoter (PA2) and a terminator were found upstream and downstream of dnaJ, indicating B. megaterium has a transcription unit containing a single gene dnaJ. The structure of dnaJ transcription unit is more similar to that of Listeria monocytogenes than other species of Bacillus. A partial protein-based phylogenetic tree, derived from Gram-positive bacteria using HrcA sequence, indicated a closer phylogenetic relationship between B. megaterium and Geobacillus species than other two Bacillus species.

  8. Molecular cloning, encoding sequence, and expression of vaccinia virus nucleic acid-dependent nucleoside triphosphatase gene.

    PubMed Central

    Rodriguez, J F; Kahn, J S; Esteban, M


    A rabbit poxvirus genomic library contained within the expression vector lambda gt11 was screened with polyclonal antiserum prepared against vaccinia virus nucleic acid-dependent nucleoside triphosphatase (NTPase)-I enzyme. Five positive phage clones containing from 0.72- to 2.5-kilobase-pair (kbp) inserts expressed a beta-galactosidase fusion protein that was reactive by immunoblotting with the NTPase-I antibody. Hybridization analysis allowed the location of this gene within the vaccinia HindIIID restriction fragment. From the known nucleotide sequence of the 16-kbp vaccinia HindIIID fragment, we identified a region that contains a 1896-base open reading frame coding for a 631-amino acid protein. Analysis of the complete sequence revealed a highly basic protein, with hydrophilic COOH and NH2 termini, various hydrophobic domains, and no significant homology to other known proteins. Translational studies demonstrate that NTPase-I belongs to a late class of viral genes. This protein is highly conserved among Orthopoxviruses. Images PMID:3025846

  9. Enolase isoenzymes in adult and developing Xenopus laevis and characterization of a cloned enolase sequence.

    PubMed Central

    Segil, N; Shrutkowski, A; Dworkin, M B; Dworkin-Rastl, E


    As part of a study of glycolysis during early development we have examined the pattern of expression of enolase isoenzymes in Xenopus laevis. In addition, the nucleotide sequence of a cDNA clone coding for the complete amino acid sequence of one enolase gene (ENO1) in X. laevis was determined. X. laevis ENO1 shows highest homology to mammalian non-neuronal enolase. Analysis of enolase isoenzymes in X. laevis by non-denaturing electrophoresis on cellulose acetate strips revealed five isoenzymes. One form was present in all tissues tested, two additional forms were expressed in oocytes, embryos, adult liver and adult brain, and two further forms were restricted to larval and adult muscle. Since enolase is a dimer, three different monomers (gene products) could account for the observed number of isoenzymes. This pattern of enolase isoenzyme expression in X. laevis differs from that of birds and mammals. In birds and mammals the most acidic form is neuron-specific and there is only one major isoenzyme expressed in the liver. RNAase protection experiments showed the presence of ENO1 mRNA in oocytes, liver and muscle, suggesting that it codes for a non-tissue-restricted isoenzyme. ENO1 mRNA concentrations are high in early oocytes, decrease during oogenesis and decrease further after fertilization. Enolase protein, however, is maintained at high concentrations throughout this period. Images Fig. 3. Fig. 4. Fig. 5. PMID:3390159

  10. Cloning and sequence analysis of FSH and LH in the giant panda (Ailuropoda melanoleuca).


    Liao, Ming-Juan; Zhu, Mu-Yuan; Zhang, Zhi-He; Zhang, An-Ju; Li, Guang-Han; Sheng, Fu-Jun


    The giant panda (Ailuropoda melanoleuca) is an endangered species and indigenous to China. It has been proposed that it has a highly specialized reproductive pattern with low fecundity, but little is known about its basic reproductive biology at the molecular level. In this report the genes encoding gonadotropin subunits alpha, follicle-stimulating hormone (FSH) beta and luteinizing hormone (LH) beta of the giant panda were amplified for the first time by RT-PCR from pituitary total RNA, and were cloned, sequenced and analyzed. The results revealed that the open reading region (ORF) of gonadotropin subunits alpha, FSH beta and LH beta are 363, 390 and 426 bp long, respectively. They displayed a reasonably high degree (74-94, 85-93, 75-91%, for alpha, FSH beta and LH beta subunits, respectively) of identity when deduced amino acids were compared with homologous sequences from partial available mammals including human, cattle, sheep, pig, rat, mouse. Three distinct differences were found at the site of 59 aa of the alpha subunit and 55 aa, 68 aa of FSH beta subunit. Our results provide an insight into understanding the mechanism of reproduction regulation and genetic characteristics of giant panda which will make an actual contribution to its conservation. In addition they lay a foundation for a further study towards producing recombinant panda FSH and LH which can be used in artificial breeding aimed to increase its captive reproductive efficiency.

  11. xylA cloning and sequencing and biochemical characterization of xylose isomerase from Thermotoga neapolitana.

    PubMed Central

    Vieille, C; Hess, J M; Kelly, R M; Zeikus, J G


    The xylA gene coding for xylose isomerase from the hyperthermophile Thermotoga neapolitana 5068 was cloned, sequenced, and expressed in Escherichia coli. The gene encoded a polypeptide of 444 residues with a calculated molecular weight of 50,892. The native enzyme was a homotetramer with a molecular weight of 200,000. This xylose isomerase was a member of the family II enzymes (these differ from family I isomerases by the presence of approximately 50 additional residues at the amino terminus). The enzyme was extremely thermostable, with optimal activity above 95 degrees C. The xylose isomerase showed maximum activity at pH 7.1, but it had high relative activity over a broad pH range. The catalytic efficiency (kcat/Km) of the enzyme was essentially constant between 60 and 90 degrees C, and the catalytic efficiency decreased between 90 and 98 degrees C primarily because of a large increase in Km. The T. neapolitana xylose isomerase had a higher turnover number and a lower Km for glucose than other family II xylose isomerases. Comparisons with other xylose isomerases showed that the catalytic and cation binding regions were well conserved. Comparison of different xylose isomerase sequences showed that numbers of asparagine and glutamine residues decreased with increasing enzyme thermostability, presumably as a thermophilic strategy for diminishing the potential for chemical denaturation through deamidation at elevated temperatures. PMID:7646024

  12. Cloning, sequencing, and expression of Bacillus subtilis genes involved in ATP-dependent nuclease synthesis.

    PubMed Central

    Kooistra, J; Venema, G


    The genes encoding the subunits of the Bacillus subtilis ATP-dependent nuclease (add genes) have been cloned. The genes were located on an 8.8-kb SalI-SmaI chromosomal DNA fragment. Transformants of a recBCD deletion mutant of Escherichia coli with plasmid pGV1 carrying this DNA fragment showed ATP-dependent nuclease activity. Three open reading frames were identified on the 8.8-kb SalI-SmaI fragment, which could encode three proteins with molecular masses of 135 (AddB protein), 141 (AddA protein), and 28 kDa. Only the AddB and AddA proteins are required for ATP-dependent exonuclease activity. Both the AddB and AddA proteins contained a conserved amino acid sequence for ATP binding. In the AddA protein, a number of small regions were present showing a high degree of sequence similarity with regions in the E. coli RecB protein. The AddA protein contained six conserved motifs which were also present in the E. coli helicase II (UvrD protein) and the Rep helicase, suggesting that these motifs are involved in the DNA unwinding activity of the enzyme. When linked to the T7 promoter, a high level of expression was obtained in E. coli. Images PMID:1646786

  13. Complete sequence analysis of cDNA clones encoding rat whey phosphoprotein: homology to a protease inhibitor.


    Dandekar, A M; Robinson, E A; Appella, E; Qasba, P K


    Lactoprotein clones have been isolated from a rat mammary gland recombinant library of cDNA plasmids. Clones p-Wp 52 and p-Wp 47 were shown by hybrid selection, in vitro translation, and immunoprecipitation to represent a cloned DNA sequence encoding rat whey phosphoprotein. We report here the nucleotide sequence of the cDNA insert of p-Wp 52 and shows that it encodes the complete whey phosphoprotein sequence. The encoded sequence shows a high content of half-cystine, glutamic acid, aspartic acid, and serine but an absence of tyrosine. The half-cystines appear in unique arrangements and are repeated in two domains of the protein. The second domain has striking similarities with the second domain of the red sea turtle protease inhibitor. Clone p-Wp 52 has allowed the study of expression of whey phosphoprotein mRNA during functional differentiation of rat mammary gland and in mammary tumors. The whey phosphoprotein mRNA is detected during midpregnancy and lactation in the rat mammary gland but is barely detected in mammary tumors in which other milk protein mRNAs are expressed. The whey phosphoprotein gene in these tumors is hypermethylated, correlating with the reduced expression of this gene.

  14. Selection of Unique Escherichia coli Clones by Random Amplified Polymorphic DNA (RAPD): Evaluation by Whole Genome Sequencing

    PubMed Central

    Nielsen, Karen L.; Godfrey, Paul A.; Stegger, Marc; Andersen, Paal S.; Feldgarden, Michael; Frimodt-Møller, Niels


    Identifying and characterizing clonal diversity is important when analysing fecal flora. We evaluated random amplified polymorphic DNA (RAPD) PCR, applied for selection of Escherichia coli isolates, by whole genome sequencing. RAPD was fast, and reproducible as screening method for selection of distinct E. coli clones in fecal swabs. PMID:24912108

  15. Cloning and sequencing of a Candida albicans catalase gene and effects of disruption of this gene.


    Wysong, D R; Christin, L; Sugar, A M; Robbins, P W; Diamond, R D


    Catalase plays a key role as an antioxidant, protecting aerobic organisms from the toxic effects of hydrogen peroxide, and in some cases has been postulated to be a virulence factor. To help elucidate the function of catalase in Candida albicans, a single C. albicans-derived catalase gene, designated CAT1, was isolated and cloned. Degenerate PCR primers based on highly conserved areas of other fungal catalase genes were used to amplify a 411-bp product from genomic DNA of C. albicans ATCC 10261. By using this product as a probe, catalase clones were isolated from genomic libraries of C. albicans. Nucleotide sequence analysis revealed an open reading frame encoding a protein of 487 amino acid residues. Construction of a CAT1-deficient mutant was achieved by using the Ura-blaster technique for sequential disruption of multiple alleles by integrative transformation using URA3 as a selectable marker. Resulting mutants exhibited normal morphology and comparable growth rates of both yeast and mycelial forms. Enzymatic analysis revealed an abundance of catalase in the wild-type strain but decreasing catalase activity in heterozygous mutants and no detectable catalase in a homozygous null mutant. In vitro assays showed the mutant strains to be more sensitive to damage by both neutrophils and concentrations of exogenous peroxide that were sublethal for the parental strain. Compared to the parental strain, the homozygous null mutant strain was far less virulent for mice in an intravenous infection model of disseminated candidiasis. Definitive linkage of CAT1 with virulence would require restoration of activity by reintroduction of the gene into mutants. However, initial results in mice, taken together with the enhanced susceptibility of catalase-deficient hyphae to damage by human neutrophils, suggest that catalase may enhance the pathogenicity of C. albicans.

  16. Cloning, sequencing and characterization of a gene encoding dihydroxyacetone kinase from Zygosaccharomyces rouxii NRRL2547.


    Wang, Zheng-Xiang; Kayingo, Gerald; Blomberg, Anders; Prior, Bernard A


    The dihydroxyacetone pathway, an alternative pathway for the dissimilation of glycerol via reduction by glycerol dehydrogenase and subsequent phosphorylation by dihydroxyacetone (DHA) kinase, is activated in the yeasts Saccharomyces cerevisiae and Zygosaccharomyces rouxii during osmotic stress. In experiments aimed at investigating the physiological function of the DHA pathway in Z. rouxii, a typical osmotolerant yeast, we cloned and characterized a DAK gene encoding dihydroxyacetone kinase from Z. rouxii NRRL 2547. Sequence analysis revealed a 1761 bp open reading frame, encoding a peptide composed of 587 deduced amino acids with the predicted molecular weight of 61 664 Da. As the amino acid sequence was most closely homologous (68% identity) to the S. cerevisiae Dak1p, we named the gene and protein ZrDAK1 and ZrDak1p, respectively. A putative ATP binding site was also found but no consensus element associated with osmoregulation was found in the upstream region of the ZrDAK1 gene. The ZrDAK1 gene complemented a S. cerevisiae W303-1A dak1delta dak2 delta strain by improving the growth of the mutant on 50 mmol/l dihydroxyacetone and by increasing the tolerance to dihydroxyacetone in a medium containing 5% sodium chloride, suggesting that it is a functional homologue of the S. cerevisiae DAK1. However, expression of the ZrDAK1 gene in the S. cerevisiae dak1delta dak2 delta strain had no significant effect on glycerol levels during osmotic stress. The ZrDAK1 sequence has been deposited in the public data bases under Accession No. AJ294719; regions upstream and downstream of ZrDAK1are deposited as Accession Nos AJ294739 and AJ294720, respectively.

  17. Deciphering KRAS and NRAS mutated clone dynamics in MLL-AF4 paediatric leukaemia by ultra deep sequencing analysis.


    Trentin, Luca; Bresolin, Silvia; Giarin, Emanuela; Bardini, Michela; Serafin, Valentina; Accordi, Benedetta; Fais, Franco; Tenca, Claudya; De Lorenzo, Paola; Valsecchi, Maria Grazia; Cazzaniga, Giovanni; Kronnie, Geertruy Te; Basso, Giuseppe


    To induce and sustain the leukaemogenic process, MLL-AF4+ leukaemia seems to require very few genetic alterations in addition to the fusion gene itself. Studies of infant and paediatric patients with MLL-AF4+ B cell precursor acute lymphoblastic leukaemia (BCP-ALL) have reported mutations in KRAS and NRAS with incidences ranging from 25 to 50%. Whereas previous studies employed Sanger sequencing, here we used next generation amplicon deep sequencing for in depth evaluation of RAS mutations in 36 paediatric patients at diagnosis of MLL-AF4+ leukaemia. RAS mutations including those in small sub-clones were detected in 63.9% of patients. Furthermore, the mutational analysis of 17 paired samples at diagnosis and relapse revealed complex RAS clone dynamics and showed that the mutated clones present at relapse were almost all originated from clones that were already detectable at diagnosis and survived to the initial therapy. Finally, we showed that mutated patients were indeed characterized by a RAS related signature at both transcriptional and protein levels and that the targeting of the RAS pathway could be of beneficial for treatment of MLL-AF4+ BCP-ALL clones carrying somatic RAS mutations.

  18. Deciphering KRAS and NRAS mutated clone dynamics in MLL-AF4 paediatric leukaemia by ultra deep sequencing analysis

    PubMed Central

    Trentin, Luca; Bresolin, Silvia; Giarin, Emanuela; Bardini, Michela; Serafin, Valentina; Accordi, Benedetta; Fais, Franco; Tenca, Claudya; De Lorenzo, Paola; Valsecchi, Maria Grazia; Cazzaniga, Giovanni; Kronnie, Geertruy te; Basso, Giuseppe


    To induce and sustain the leukaemogenic process, MLL-AF4+ leukaemia seems to require very few genetic alterations in addition to the fusion gene itself. Studies of infant and paediatric patients with MLL-AF4+ B cell precursor acute lymphoblastic leukaemia (BCP-ALL) have reported mutations in KRAS and NRAS with incidences ranging from 25 to 50%. Whereas previous studies employed Sanger sequencing, here we used next generation amplicon deep sequencing for in depth evaluation of RAS mutations in 36 paediatric patients at diagnosis of MLL-AF4+ leukaemia. RAS mutations including those in small sub-clones were detected in 63.9% of patients. Furthermore, the mutational analysis of 17 paired samples at diagnosis and relapse revealed complex RAS clone dynamics and showed that the mutated clones present at relapse were almost all originated from clones that were already detectable at diagnosis and survived to the initial therapy. Finally, we showed that mutated patients were indeed characterized by a RAS related signature at both transcriptional and protein levels and that the targeting of the RAS pathway could be of beneficial for treatment of MLL-AF4+ BCP-ALL clones carrying somatic RAS mutations. PMID:27698462

  19. Improvement of ethanol productivity and energy efficiency by degradation of inhibitors using recombinant Zymomonas mobilis (pHW20a-fdh).


    Dong, Hong-Wei; Fan, Li-Qiang; Luo, Zichen; Zhong, Jian-Jiang; Ryu, Dewey D Y; Bao, Jie


    Toxic compounds, such as formic acid, furfural, and hydroxymethylfurfural (HMF) generated during pretreatment of corn stover (CS) at high temperature and low pH, inhibit growth of Zymomonas mobilis and lower the conversion efficiency of CS to biofuel and other products. The inhibition of toxic compounds is considered as one of the major technical barriers in the lignocellulose bioconversion. In order to detoxify and/or degrade these toxic compounds by the model ethanologenic strain Z. mobilis itself in situ the fermentation medium, we constructed a recombinant Z. mobilis ZM4 (pHW20a-fdh) strain that is capable of degrading toxic inhibitor, formate. This is accomplished by cloning heterologous formate dehydrogenase gene (fdh) from Saccharomyces cerevisiae and by coupling this reaction of NADH regeneration reaction system with furfural and HMF degradation in the recombinant Z. mobilis strain. The NADH regeneration reaction also improved both the energy efficiency and cell physiological activity of the recombinant organism, which were definitely confirmed by the improved cell growth, ethanol yield, and ethanol productivity during fermentation with CS hydrolysate.

  20. Genetic approaches to improvement of alcohol production by Zymomonas mobilis

    SciTech Connect

    Buchholz, S.E.


    A single spontaneous mutant of Z. mobilis was isolated which was capable of feeble growth on mannitol as the sole carbohydrate source. Several months of continuous culture, including addition of a mutagen to a chemostat, led to the isolation of a sequential series of mutants, each with improved growth rates on mannitol. Metabolism of mannitol is oxygen-dependent, resulting in limited production of ethanol and increased production of lactic acid. The conversion of mannitol to fructose is apparently via an altered alcohol dehydrogenase. Analogously, for development of another mutant series, very limited growth of Z. mobilis has been obtained on raffinose after extended incubation in shake flasks. Z. mobilis containing the lactose operon fails to grow on lactose. A single plasmid carrying both the lactose and galactose operons was constructed and introduced into Z. mobilis CP4.45, followed by mutation to yield a culture with slow growth on lactose. Z. mobilis SB6 is capable of producing 0.25% ethanol from 5% lactose in 15 days.

  1. Nucleotide sequence and infectious cDNA clone of the L1 isolate of Pea seed-borne mosaic potyvirus.


    Olsen, B S; Johansen, I E


    The complete nucleotide sequence of Pea seed-borne mosaic potyvirus isolate L1 has been determined from cloned virus cDNA. The PSbMV L1 genome is 9895 nucleotides in length excluding the poly(A) tail. Computer analysis of the sequence revealed a single long open reading frame (ORF) of 9594 nucleotides. The ORF potentially encodes a polyprotein of 3198 amino acids with a deduced Mr of 363537. Nine putative proteolytic cleavage sites were identified by analogy to consensus sequences and genome arrangement in other potyviruses. Two full-length cDNA clones, p35S-L1-4 and p35S-L1-5, were assembled under control of an enhanced 35S promoter and nopaline synthase terminator. Clone p35S-L1-4 was constructed with four introns and p35S-L1-5 with five introns inserted in the cDNA. Clone p35S-L1-4 was unstable in Escherichia coli often resulting in amplification of plasmids with deletions. Clone p35S-L1-5 was stable and apparently less toxic to Escherichia coli resulting in larger bacterial colonies and higher plasmid yield. Both clones were infectious upon mechanical inoculation of plasmid DNA on susceptible pea cultivars Fjord, Scout, and Brutus. Eight pea genotypes resistant to L1 virus were also resistant to the cDNA derived L1 virus. Both native PSbMV L1 and the cDNA derived virus infected Chenopodium quinoa systemically giving rise to characteristic necrotic lesions on uninoculated leaves.

  2. Simultaneous saccharification: fermentation with Zymomonas mobilis

    SciTech Connect

    Spangler, D.J.; Emert, G.H.


    In recent years, an ethanol production process has been developed which utilizes Trichoderma reesei cellulase and Candida brassicae IFO 1664 in the simultaneous saccharification/fermentation (SSF) of cellulose to ethanol. The direct production of ethanol from cellulose in an SSF process alleviates the problem of end production inhibition. Glucose does not accumulate in this system, but rather is fermented to ethanol immediately following saccharification. The result is an increase in yield of 25% or greater as compared with separate processes of saccharification and fermentation. An alternative organisms which might be used in place of yeasts in ethanol production processes is Zymomonas mobilis. The optimum temperature for hydrolysis of cellulose by Trichoderma reesei cellulases is 50/sup 0/C. Since this hydrolysis is the rate limiting step in the SSF process, it is advantageous to utilize the most temperature tolerant ethanol producer available. Candida brassicae is currently the organism of choice due to its ability to produce ethanol efficiently at 40/sup 0/C. This investigation reports on the screening of Zymomonas strains and evaluating the feasibility of utilizing the most temperature tolerant strain in place of C. brassicae in SSF.

  3. Outbreak of OXA-48-Producing Klebsiella pneumoniae Involving a Sequence Type 101 Clone in Batna University Hospital, Algeria.


    Loucif, Lotfi; Kassah-Laouar, Ahmed; Saidi, Mahdia; Messala, Amina; Chelaghma, Widad; Rolain, Jean-Marc


    Seven nonredundant ertapenem-resistant Klebsiella pneumoniae isolates were collected between May 2014 and 19 January 2015 in the nephrology and hematology units of Batna University Hospital in Algeria. All strains coproduced the blaOXA-48, blaCTX-M-15, blaSHV-1, and blaTEM-1D genes. Six of these isolates belonged to the pandemic clone sequence type 101 (ST101). The blaOXA-48 gene was located on a conjugative IncL/M-type plasmid. This is the first known outbreak of OXA-48-producing K. pneumoniae isolates involving an ST101 clone in Batna University Hospital.

  4. Cloning of flanking sequence in transgenic plants by restriction site-anchored single-primer polymerase chain reaction.


    Ma, J; Wang, N N; Ren, S; Fu, Y P; Lu, S; Wang, Y P; Wang, P W


    Determining the insertion position of an exogenous gene in the target plant genome is one of the main issues in the transgenic plant field. This study introduced a simple, rapid, and accurate method to clone the flanking sequences of the transgenic bar gene as the anchoring gene in the transgenic maize genome using single-primer polymerase chain reaction (PCR). This method was based on the distribution of restriction sites in the maize genome and adopted the single-primer PCR method. Cloning the flanking sequences with the restriction site-anchored single-primer PCR simplified the experimental procedures by about 70% and reduced the experimental time by more than 80%. In conclusion, the restriction site-anchored single-primer PCR was a simple, rapid method to obtain the unknown flanking sequences in the transgenic plants.

  5. A cytochrome ba3 functions as a quinol oxidase in Paracoccus denitrificans. Purification, cloning, and sequence comparison.


    Richter, O M; Tao, J S; Turba, A; Ludwig, B


    A quinol oxidase has been purified from the cytoplasmic membrane of Paracoccus denitrificans; its heme composition and CO binding properties identify it as a cytochrome ba3. On SDS gels, the purified enzyme complex is separated into five polypeptides. Using partial peptide sequence information for subunit II, the gene locus has been cloned and sequenced. In a typical operon pattern, four genes were identified: qoxA, -B, -C, and -D, coding for subunits II, I, III, and IV. DNA-derived amino acid sequence comparisons reveal extensive similarities to other members of the terminal oxidase superfamily.

  6. Cloning, sequencing and characterization of the biosynthetic gene cluster of sanglifehrin A, a potent cyclophilin inhibitor.


    Qu, Xudong; Jiang, Nan; Xu, Fei; Shao, Lei; Tang, Gongli; Wilkinson, Barrie; Liu, Wen


    Sanglifehrin A (SFA), a potent cyclophilin inhibitor produced by Streptomyces flaveolus DSM 9954, bears a unique [5.5] spirolactam moiety conjugated with a 22-membered, highly functionalized macrolide through a linear carbon chain. SFA displays a diverse range of biological activities and offers significant therapeutic potential. However, the structural complexity of SFA poses a tremendous challenge for new analogue development via chemical synthesis. Based on a rational prediction of its biosynthetic origin, herein we report the cloning, sequencing and characterization of the gene cluster responsible for SFA biosynthesis. Analysis of the 92 776 bp contiguous DNA region reveals a mixed polyketide synthase (PKS)/non-ribosomal peptide synthetase (NRPS) pathway which includes a variety of unique features for unusual PKS and NRPS building block formation. Our findings suggest that SFA biosynthesis requires a crotonyl-CoA reductase/carboxylase (CCR) for generation of the putative unusual PKS starter unit (2R)-2-ethylmalonamyl-CoA, an iterative type I PKS for the putative atypical extender unit (2S)-2-(2-oxo-butyl)malonyl-CoA and a phenylalanine hydroxylase for the NRPS extender unit (2S)-m-tyrosine. A spontaneous ketalization of significant note, may trigger spirolactam formation in a stereo-selective manner. This study provides a framework for the application of combinatorial biosynthesis methods in order to expand the structural diversity of SFA.

  7. Multilocus Sequence Typing Identifies Epidemic Clones of Flavobacterium psychrophilum in Nordic Countries

    PubMed Central

    Duchaud, Eric; Nicolas, Pierre; Dalsgaard, Inger; Madsen, Lone; Aspán, Anna; Jansson, Eva; Colquhoun, Duncan J.; Wiklund, Tom


    Flavobacterium psychrophilum is the causative agent of bacterial cold water disease (BCWD), which affects a variety of freshwater-reared salmonid species. A large-scale study was performed to investigate the genetic diversity of F. psychrophilum in the four Nordic countries: Denmark, Finland, Norway, and Sweden. Multilocus sequence typing of 560 geographically and temporally disparate F. psychrophilum isolates collected from various sources between 1983 and 2012 revealed 81 different sequence types (STs) belonging to 12 clonal complexes (CCs) and 30 singleton STs. The largest CC, CC-ST10, which represented almost exclusively isolates from rainbow trout and included the most predominant genotype, ST2, comprised 65% of all isolates examined. In Norway, with a shorter history (<10 years) of BCWD in rainbow trout, ST2 was the only isolated CC-ST10 genotype, suggesting a recent introduction of an epidemic clone. The study identified five additional CCs shared between countries and five country-specific CCs, some with apparent host specificity. Almost 80% of the singleton STs were isolated from non-rainbow trout species or the environment. The present study reveals a simultaneous presence of genetically distinct CCs in the Nordic countries and points out specific F. psychrophilum STs posing a threat to the salmonid production. The study provides a significant contribution toward mapping the genetic diversity of F. psychrophilum globally and support for the existence of an epidemic population structure where recombination is a significant driver in F. psychrophilum evolution. Evidence indicating dissemination of a putatively virulent clonal complex (CC-ST10) with commercial movement of fish or fish products is strengthened. PMID:24561585

  8. Cloning and sequencing of a plasmid-borne gene (opd) encoding a phosphotriesterase.

    PubMed Central

    McDaniel, C S; Harper, L L; Wild, J R


    Plasmid pCMS1 was isolated from Pseudomonas diminuta MG, a strain which constitutively hydrolyzes a broad spectrum of organophosphorus compounds. The native plasmid was restricted with PstI, and individual DNA fragments were subcloned into pBR322. A recombinant plasmid transformed into Escherichia coli possessed weak hydrolytic activity, and Southern blotting with the native plasmid DNA verified that the DNA sequence originated from pCMS1. When the cloned 1.3-kilobase fragment was placed behind the lacZ' promoter of M13mp10 and retransformed into E. coli, clear-plaque isolates with correctly sized inserts exhibited isopropyl-beta-D-thiogalactopyranoside-inducible whole-cell activity. Sequence determination of the M13 constructions identified an open reading frame of 975 bases preceded by a putative ribosome-binding site appropriately positioned upstream of the first ATG codon in the open reading frame. An intragenic fusion of the opd gene with the lacZ gene produced a hybrid polypeptide which was purified by beta-galactosidase immunoaffinity chromatography and used to confirm the open reading frame of opd. The gene product, an organophosphorus phosphotriesterase, would have a molecular weight of 35,418 if the presumed start site is correct. Eighty to ninety percent of the enzymatic activity was associated with the pseudomonad membrane fractions. When dissociated by treatment with 0.1% Triton and 1 M NaCl, the enzymatic activity was associated with a molecular weight of approximately 65,000, suggesting that the active enzyme was dimeric. Images PMID:2834339

  9. Molecular cloning of the unintegrated squirrel monkey retrovirus genome: organization and distribution of related sequences in primate DNAs.

    PubMed Central

    Chiu, I M; Andersen, P R; Aaronson, S A; Tronick, S R


    The closed circular form of the endogenous squirrel monkey type D retrovirus (SMRV) was molecularly cloned in a bacteriophage vector. The restriction map of the biologically active clone was determined and found to be identical to that of the parental SMRV linear DNA except for the deletion of one long terminal repeat. Restriction enzyme analysis and Southern blotting indicated that the SMRV long terminal repeat was approximately 300 base pairs long. The SMRV restriction map was oriented to the viral RNA by using a gene-specific probe from baboon endogenous virus. Restriction enzyme digests of a variety of vertebrate DNAs were analyzed for DNA sequence homology with SMRV by using the cloned SMRV genome as a probe. Consistent with earlier studies, multiple copies of SMRV were detected in squirrel monkey DNA. Related fragments were also detected in the DNAs from other primate species, including humans. Images PMID:6312076

  10. Molecular cloning and nucleotide sequence of cDNA for human glucose-6-phosphate dehydrogenase variant A(-)

    SciTech Connect

    Hirono, A.; Beutler, E. )


    Glucose-6-phosphate dehydrogenase A(-) is a common variant in Blacks that causes sensitivity to drug- and infection-induced hemolytic anemia. A cDNA library was constructed from Epstein-Barr virus-transformed lymphoblastoid cells from a male who was G6PD A(-). One of four cDNA clones isolated contained a sequence not found in the other clones nor in the published cDNA sequence. Consisting of 138 bases and coding 46 amino acids, this segment of cDNA apparently is derived from the alternative splicing involving the 3{prime} end of intron 7. Comparison of the remaining sequences of these clones with the published sequence revealed three nucleotide substitutions: C{sup 33} {yields} G, G{sup 202} {yields} A, and A{sup 376} {yields} G. Each change produces a new restriction site. Genomic DNA from five G6PD A(-) individuals was amplified by the polymerase chain reaction. The findings of the same mutation in G6PD A(-) as is found in G6PD A(+) strongly suggests that the G6PD A(-) mutation arose in an individual with G6PD A(+), adding another mutation that causes the in vivo instability of this enzyme protein.

  11. Cloning, sequencing and overexpression of the gene for prokaryotic factor EF-P involved in peptide bond synthesis.

    PubMed Central

    Aoki, H; Adams, S L; Chung, D G; Yaguchi, M; Chuang, S E; Ganoza, M C


    A soluble protein EF-P (elongation factor P) from Escherichia coli has been purified and shown to stimulate efficient translation and peptide-bond synthesis on native or reconstituted 70S ribosomes in vitro. Based on the partial amino acid sequence of EF-P, 18- and 24-nucleotide DNA probes were synthesized and used to screen lambda phage clones from the Kohara Gene Bank. The entire EF-P gene was detected on lambda clone #650 which contains sequences from the 94 minute region of the E.coli genome. Two DNA fragments, 3.0 and 0.78 kilobases in length encompassing the gene, were isolated and cloned into pUC18 and pUC19. Partially purified extracts from cells transformed with these plasmids overrepresented a protein which co-migrates with EF-P upon SDS polyacrylamide gel electrophoresis, and also exhibited increased EF-P mediated peptide-bond synthetic activity. Based on DNA sequence analysis of this gene, the EF-P protein consists of 187 amino acids with a calculated molecular weight of 20,447. The sequence and chromosomal location of EF-P establishes it as a unique gene product. Images PMID:1956781

  12. Single Zymomonas mobilis strain for xylose and arabinose fermentation


    Zhang, M.; Chou, Y.C.; Picataggio, S.K.; Finkelstein, M.


    This invention relates to single microorganisms which normally do not ferment pentose sugars which are genetically altered to ferment the pentose sugars, xylose and arabinose, to produce ethanol, and a fermentation process utilizing the same. Examples include Zymomonas mobilis which has been transformed with a combination of E. coli genes for xylose isomerase, xylulokinase, L-arabinose isomerase, L-ribulokinase, L-ribulose 5-phosphate 4-epimerase, transaldolase and transketolase. Expression of added genes are under the control of Z. mobilis promoters. These newly created microorganisms are useful for fermenting glucose, xylose and arabinose, produced by hydrolysis of hemicellulose and cellulose or starch, to produce ethanol. 6 figs.

  13. Single zymomonas mobilis strain for xylose and arabinose fermentation


    Zhang, Min; Chou, Yat-Chen; Picataggio, Stephen K.; Finkelstein, Mark


    This invention relates to single microorganisms which normally do not ferment pentose sugars which are genetically altered to ferment the pentose sugars, xylose and arabinose, to produce ethanol, and a fermentation process utilizing the same. Examples include Zymomonas mobilis which has been transformed with a combination of E. coli genes for xylose isomerase, xylulokinase, L-arabinose isomerase, L-ribulokinase, L-ribulose 5-phosphate 4-epimerase, transaldolase and transketolase. Expression of added genes are under the control of Z. mobilis promoters. These newly created microorganisms are useful for fermenting glucose, xylose and arabinose, produced by hydrolysis of hemicellulose and cellulose or starch, to produce ethanol.

  14. Paradigm for industrial strain improvement identifies sodium acetate tolerance loci in Zymomonas mobilis and Saccharomyces cerevisiae.


    Yang, Shihui; Land, Miriam L; Klingeman, Dawn M; Pelletier, Dale A; Lu, Tse-Yuan S; Martin, Stanton L; Guo, Hao-Bo; Smith, Jeremy C; Brown, Steven D


    The application of systems biology tools holds promise for rational industrial microbial strain development. Here, we characterize a Zymomonas mobilis mutant (AcR) demonstrating sodium acetate tolerance that has potential importance in biofuel development. The genome changes associated with AcR are determined using microarray comparative genome sequencing (CGS) and 454-pyrosequencing. Sanger sequencing analysis is employed to validate genomic differences and to investigate CGS and 454-pyrosequencing limitations. Transcriptomics, genetic data and growth studies indicate that over-expression of the sodium-proton antiporter gene nhaA confers the elevated AcR sodium acetate tolerance phenotype. nhaA over-expression mostly confers enhanced sodium (Na(+)) tolerance and not acetate (Ac(-)) tolerance, unless both ions are present in sufficient quantities. NaAc is more inhibitory than potassium and ammonium acetate for Z. mobilis and the combination of elevated Na(+) and Ac(-) ions exerts a synergistic inhibitory effect for strain ZM4. A structural model for the NhaA sodium-proton antiporter is constructed to provide mechanistic insights. We demonstrate that Saccharomyces cerevisiae sodium-proton antiporter genes also contribute to sodium acetate, potassium acetate, and ammonium acetate tolerances. The present combination of classical and systems biology tools is a paradigm for accelerated industrial strain improvement and combines benefits of few a priori assumptions with detailed, rapid, mechanistic studies.

  15. A paradigm for strain improvement identifies sodium acetate tolerance loci in Zymomonas mobilis and Saccharomyces cerevisiae

    SciTech Connect

    Yang, Shihui; Land, Miriam L; Klingeman, Dawn Marie; Pelletier, Dale A; Lu, Tse-Yuan; Martin, S L.; Guo, Hao-Bo; Smith, Jeremy C; Brown, Steven D


    The application of systems biology tools holds promise for rational industrial microbial strain development. Here, we characterize a Zymomonas mobilis mutant (AcR) demonstrating sodium acetate tolerance that has potential importance in biofuel development. The genome changes associated with AcR are determined using microarray comparative genome sequencing (CGS) and 454-pyrosequencing. Sanger sequencing analysis is employed to validate genomic differences and to investigate CGS and 454-pyrosequencing limitations. Transcriptomics, genetic data and growth studies indicate that over-expression of the sodium-proton antiporter gene nhaA confers the elevated AcR sodium acetate tolerance phenotype. nhaA over-expression mostly confers enhanced sodium (Na+) tolerance and not acetate (Ac-) tolerance, unless both ions are present in sufficient quantities. NaAc is more inhibitory than potassium and ammonium acetate for Z. mobilis and the combination of elevated Na+ and Ac- ions exerts a synergistic inhibitory effect for strain ZM4. A structural model for the NhaA sodium-proton antiporter is constructed to provide mechanistic insights. We demonstrate that Saccharomyces cerevisiae sodium-proton antiporter genes also contribute to sodium acetate, potassium acetate, and ammonium acetate tolerances. The present combination of classical and systems biology tools is a paradigm for accelerated industrial strain improvement and combines benefits of few a priori assumptions with detailed, rapid, mechanistic studies.

  16. Paradigm for industrial strain improvement identifies sodium acetate tolerance loci in Zymomonas mobilis and Saccharomyces cerevisiae

    SciTech Connect

    Yang, Shihui; Land, Miriam L; Klingeman, Dawn Marie; Pelletier, Dale A; Lu, Tse-Yuan; Martin, S L.; Guo, Hao-Bo; Smith, Jeremy C; Brown, Steven D


    The application of systems biology tools holds promise for rational industrial microbial strain development. Here, we characterize a Zymomonas mobilis mutant (AcR) demonstrating sodium acetate tolerance that has potential importance in biofuel development. The genome changes associated with AcR are determined using microarray comparative genome sequencing (CGS) and 454-pyrosequencing. Sanger sequencing analysis is employed to validate genomic differences and to investigate CGS and 454-pyrosequencing limitations. Transcriptomics, genetic data and growth studies indicate that over-expression of the sodium-proton antiporter gene nhaA confers the elevated AcR sodium acetate tolerance phenotype. nhaA over-expression mostly confers enhanced sodium (Na{sup +}) tolerance and not acetate (Ac{sup -}) tolerance, unless both ions are present in sufficient quantities. NaAc is more inhibitory than potassium and ammonium acetate for Z. mobilis and the combination of elevated Na{sup +} and Ac{sup -} ions exerts a synergistic inhibitory effect for strain ZM4. A structural model for the NhaA sodium-proton antiporter is constructed to provide mechanistic insights. We demonstrate that Saccharomyces cerevisiae sodium-proton antiporter genes also contribute to sodium acetate, potassium acetate, and ammonium acetate tolerances. The present combination of classical and systems biology tools is a paradigm for accelerated industrial strain improvement and combines benefits of few a priori assumptions with detailed, rapid, mechanistic studies.

  17. pDUAL: A transposon-based cosmid cloning vector for generating nested deletions and DNA sequencing templates in vivo

    SciTech Connect

    Wang, Gan; Berg, C.M. ); Blakesley, R.W. ); Berg, D.E. )


    The authors describe a transposon [gamma][delta]-containing cosmid cloning vector, pDUAL (previously called pJANUS), and demonstrate an efficient strategy for isolating nested deletions in both large-scale and small-scale DNA sequencing efforts. This [open quotes]deletion factory[close quotes] strategy takes advantage of the ability of [gamma][delta](Tn1000) to generate deletions that extend from an end of the transposon into adjacent DNA when [gamma][delta] transposes to new sites in the same DNA molecule. pDUAL contains the contraselectable (conditional lethal) sacB[sup +] (sucrose sensitivity) and strA[sup +] (streptomycin sensitivity) genes just outside each end of an engineered [gamma][delta] and selectable kan[sup +] (Kan[sup r]) and tet[sup +] (Tet[sup r]) genes between the cloning site and sacB and strA, respectively. Selection on sucrose tetracycline medium yields deletions that extend from one [gamma][delta] end for various distances in to the cloned DNA, while selection on streptomycin kanamycin medium yields comparable deletions in the other direction. Both types of deletions are recoverable because the essential plasmid replication origin is embedded in the [gamma][delta] component and is thereby retained in each deletion product. Pilot experiments with pDUAL clones showed that deletion end points can be mapped or selected by plasmid size and that both DNA strands of any single clone can be accessed for sequencing by using a pair of universal primers specific for sequences that are just interior to the [gamma][delta] ends. 27 refs., 3 figs.

  18. Arthropod hemocyanins. Molecular cloning and sequencing of cDNAs encoding the tarantula hemocyanin subunits a and e.


    Voit, R; Feldmaier-Fuchs, G


    cDNA clones comprising the entire coding region of two out of the seven heterogeneous subunits of hemocyanin from the tarantula, Eurypelma californicum, were isolated from four cDNA libraries constructed from total RNA from the heart tissue of single spiders. Hybridization was first carried out using a tarantula hemocyanin subunit e partial cDNA, and several positive clones were isolated, including one containing a 2.2-kilobase full-length cDNA (lambda M1). The cDNA comprises an open reading frame for 623 amino acids, 34 nucleotides of the 5'noncoding region, and 286 nucleotides of the 3'-noncoding region. To select for other hemocyanin subunits, two 17-mer oligonucleotide mixtures, corresponding to the conserved regions in the copper A and copper B oxygen-binding site of chelicerate hemocyanins, were used as probes. Among the positive clones obtained, full-length cDNAs coding for subunit a were identified. The cDNA sequence determined from clone lambda K1 provides an open reading frame coding for 630 amino acids and includes the 5'- and 3'-noncoding regions. Northern blot analysis revealed single transcripts for subunits a and e, each 2.3 kilobases long. The cDNAs for subunits a and e were both found to lack any leader peptide sequence. This supports the idea that the mature protein accumulates in the cytoplasm and is released by cell rupture.

  19. Nucleotide sequence of polypyrimidines from cloned mouse DNA as determined by base-specific blockage of exonuclease action

    SciTech Connect

    Deugau, K.V.; Mitchel, R.E.J.; Birnboim, H.C.


    Cloned fragments of mouse DNA have been screened for the presence of long polypyrimidine/polypurine segments. The polypyrimidine portion of one such segment (about 2000 nucleotides in length) has been isolated by acidic depurination of the entire cloned fragment and plasmid vector followed by selective precipitation and 5'-/sup 32/P labeling. This polypyrimidine has been used to demonstrate a new procedure for sequencing. Covalent modification of thymine with a water-soluble carbodiimide, or cytosine with glutaric anhydride, at low levels blocked in the action of snake venom exonuclease. After deblocking, separation of the products of digestion by polyacrylamide gel electrophoresis yields a sequence ladder which can be used to determine the position of C and T residues as in other sequencing methods. A sequence of 72 residues adjacent to the 5' end had been established, consisting principally of the repeating tetranucleotide (CCTT)n. A low ratio of endonuclease to exonuclease is essential for application of this method to sequences of this size. Accordingly, a very sensitive modification of a fluorometric endonuclease assay was developed and used to optimize pH and Mg/sup 2 +/ conditions to favor exonuclease activity over the accompanying endonuclease activity. The results clearly indicate that long polypyrimidine tracts can be efficiently prepared and their sequences determined with this method using commercially available exonuclease preparations without additional purification. 26 references, 5 figures.

  20. Expressed sequence tags and molecular cloning and characterization of gene encoding pinoresinol/lariciresinol reductase from Podophyllum hexandrum.


    Wankhede, Dhammaprakash Pandhari; Biswas, Dipul Kumar; Rajkumar, Subramani; Sinha, Alok Krishna


    Podophyllotoxin, an aryltetralin lignan, is the source of important anticancer drugs etoposide, teniposide, and etopophos. Roots/rhizome of Podophyllum hexandrum form one of the most important sources of podophyllotoxin. In order to understand genes involved in podophyllotoxin biosynthesis, two suppression subtractive hybridization libraries were synthesized, one each from root/rhizome and leaves using high and low podophyllotoxin-producing plants of P. hexandrum. Sequencing of clones identified a total of 1,141 Expressed Sequence Tags (ESTs) resulting in 354 unique ESTs. Several unique ESTs showed sequence similarity to the genes involved in metabolism, stress/defense responses, and signalling pathways. A few ESTs also showed high sequence similarity with genes which were shown to be involved in podophyllotoxin biosynthesis in other plant species such as pinoresinol/lariciresinol reductase. A full length coding sequence of pinoresinol/lariciresinol reductase (PLR) has been cloned from P. hexandrum which was found to encode protein with 311 amino acids and show sequence similarity with PLR from Forsythia intermedia and Linum spp. Spatial and stress-inducible expression pattern of PhPLR and other known genes of podophyllotoxin biosynthesis, secoisolariciresinol dehydrogenase (PhSDH), and dirigent protein oxidase (PhDPO) have been studied. All the three genes showed wounding and methyl jasmonate-inducible expression pattern. The present work would form a basis for further studies to understand genomics of podophyllotoxin biosynthesis in P. hexandrum.

  1. Molecular Cloning, Nucleotide Sequence, and Expression of Genes Encoding a Polycyclic Aromatic Ring Dioxygenase from Mycobacterium sp. Strain PYR-1

    PubMed Central

    Khan, Ashraf A.; Wang, Rong-Fu; Cao, Wei-Wen; Doerge, Daniel R.; Wennerstrom, David; Cerniglia, Carl E.


    Mycobacterium sp. strain PYR-1 degrades high-molecular-weight polycyclic hydrocarbons (PAHs) primarily through the introduction of both atoms of molecular oxygen by a dioxygenase. To clone the dioxygenase genes involved in PAH degradation, two-dimensional (2D) gel electrophoresis of PAH-induced proteins from cultures of Mycobacterium sp. strain PYR-1 was used to detect proteins that increased after phenanthrene, dibenzothiophene, and pyrene exposure. Comparison of proteins from induced and uninduced cultures on 2D gels indicated that at least six major proteins were expressed (105, 81, 52, 50, 43, and 13 kDa). The N-terminal sequence of the 50-kDa protein was similar to those of other dioxygenases. A digoxigenin-labeled oligonucleotide probe designed from this protein sequence was used to screen dioxygenase-positive clones from a genomic library of Mycobacterium sp. strain PYR-1. Three clones, each containing a 5,288-bp DNA insert with three genes of the dioxygenase system, were obtained. The genes in the DNA insert, from the 5′ to the 3′ direction, were a dehydrogenase, the dioxygenase small (β)-subunit, and the dioxygenase large (α)-subunit genes, arranged in a sequence different from those of genes encoding other bacterial dioxygenase systems. Phylogenetic analysis showed that the large α subunit did not cluster with most of the known α-subunit sequences but rather with three newly described α subunits of dioxygenases from Rhodococcus spp. and Nocardioides spp. The genes from Mycobacterium sp. strain PYR-1 were subcloned and overexpressed in Escherichia coli with the pBAD/ThioFusion system. The functionality of the genes for PAH degradation was confirmed in a phagemid clone containing all three genes, as well as in plasmid subclones containing the two genes encoding the dioxygenase subunits. PMID:11472934

  2. Molecular cloning, nucleotide sequence, and abscisic acid induction of a suberization-associated highly anionic peroxidase.


    Roberts, E; Kolattukudy, P E


    A highly anionic peroxidase induced in suberizing cells was suggested to be the key enzyme involved in polymerization of phenolic monomers to generate the aromatic matrix of suberin. The enzyme encoded by a potato cDNA was found to be highly homologous to the anionic peroxidase induced in suberizing tomato fruit. A tomato genomic library was screened using the potato anionic peroxidase cDNA and one genomic clone was isolated that contained two tandemly oriented anionic peroxidase genes. These genes were sequenced and were 96% and 87% identical to the mRNA for potato anionic peroxidase. Both genes consist of three exons with the relative positions of their two introns being conserved between the two genes. Primer extension analysis showed that only one of the genes is expressed in the periderm of 3 day wound-healed tomato fruits. Southern blot analyses suggested that there are two copies each of the two highly homologous genes per haploid genome in both potato and tomato. Abscisic acid (ABA) induced the accumulation of the anionic peroxidase transcripts in potato and tomato callus tissues. Northern blots showed that peroxidase mRNA was detectable at 2 days and was maximal at 8 days after transfer of potato callus to solid agar media containing 10(-4) M ABA. The transcripts induced by ABA in both potato and tomato callus were identical in size to those induced in wound-healing potato tuber and tomato fruit. The anionic peroxidase peptide was detected in extracts of potato callus grown on the ABA-containing media by western blot analysis. The results support the suggestion that stimulation of suberization by ABA involves the induction of the highly anionic peroxidase.

  3. Third-Generation Sequencing and Analysis of Four Complete Pig Liver Esterase Gene Sequences in Clones Identified by Screening BAC Library

    PubMed Central

    Zhou, Qiongqiong; Sun, Wenjuan; Liu, Xiyan; Wang, Xiliang; Xiao, Yuncai; Bi, Dingren; Yin, Jingdong; Shi, Deshi


    Aim Pig liver carboxylesterase (PLE) gene sequences in GenBank are incomplete, which has led to difficulties in studying the genetic structure and regulation mechanisms of gene expression of PLE family genes. The aim of this study was to obtain and analysis of complete gene sequences of PLE family by screening from a Rongchang pig BAC library and third-generation PacBio gene sequencing. Methods After a number of existing incomplete PLE isoform gene sequences were analysed, primers were designed based on conserved regions in PLE exons, and the whole pig genome used as a template for Polymerase chain reaction (PCR) amplification. Specific primers were then selected based on the PCR amplification results. A three-step PCR screening method was used to identify PLE-positive clones by screening a Rongchang pig BAC library and PacBio third-generation sequencing was performed. BLAST comparisons and other bioinformatics methods were applied for sequence analysis. Results Five PLE-positive BAC clones, designated BAC-10, BAC-70, BAC-75, BAC-119 and BAC-206, were identified. Sequence analysis yielded the complete sequences of four PLE genes, PLE1, PLE-B9, PLE-C4, and PLE-G2. Complete PLE gene sequences were defined as those containing regulatory sequences, exons, and introns. It was found that, not only did the PLE exon sequences of the four genes show a high degree of homology, but also that the intron sequences were highly similar. Additionally, the regulatory region of the genes contained two 720bps reverse complement sequences that may have an important function in the regulation of PLE gene expression. Significance This is the first report to confirm the complete sequences of four PLE genes. In addition, the study demonstrates that each PLE isoform is encoded by a single gene and that the various genes exhibit a high degree of sequence homology, suggesting that the PLE family evolved from a single ancestral gene. Obtaining the complete sequences of these PLE genes

  4. Cloning and nucleotide sequence of the gene (citA) encoding a citrate carrier from Salmonella typhimurium.


    Shimamoto, T; Izawa, H; Daimon, H; Ishiguro, N; Shinagawa, M; Sakano, Y; Tsuda, M; Tsuchiya, T


    A cryptic citrate transport gene (citA) from Salmonella typhimurium chromosome was cloned and its nucleotide sequence was determined. The cloned plasmid conferred citrate-utilizing ability on wild-type Escherichia coli, which cannot grow on citrate as the sole source of carbon. The resultant E. coli transformant was able to transport citrate. A 1,302-base-pair open reading frame with a preceding ribosomal binding site was found in the cloned DNA fragment. The 434-amino-acid protein that could be translated from this open reading frame is highly hydrophobic (69% nonpolar amino acid residues), consistent with the fact that the transport protein is an intrinsic membrane protein. The molecular weight of this protein was calculated to be 47,188. The gene sequence determined is highly homologous to those of Cit+ plasmid-mediated citrate transport gene, citA, from E. coli, the chromosomal citA gene from Citrobacter amalonaticus and the chromosomal cit+ gene from Klebsiella pneumoniae. The hydropathy profile of the deduced amino acid sequence suggests that this carrier has 12 hydrophobic segments, which may span the membrane lipid bilayer.

  5. Cloning, sequence analysis, expression of Cyathus bulleri laccase in Pichia pastoris and characterization of recombinant laccase

    PubMed Central


    Background Laccases are blue multi-copper oxidases and catalyze the oxidation of phenolic and non-phenolic compounds. There is considerable interest in using these enzymes for dye degradation as well as for synthesis of aromatic compounds. Laccases are produced at relatively low levels and, sometimes, as isozymes in the native fungi. The investigation of properties of individual enzymes therefore becomes difficult. The goal of this study was to over-produce a previously reported laccase from Cyathus bulleri using the well-established expression system of Pichia pastoris and examine and compare the properties of the recombinant enzyme with that of the native laccase. Results In this study, complete cDNA encoding laccase (Lac) from white rot fungus Cyathus bulleri was amplified by RACE-PCR, cloned and expressed in the culture supernatant of Pichia pastoris under the control of the alcohol oxidase (AOX)1 promoter. The coding region consisted of 1,542 bp and encodes a protein of 513 amino acids with a signal peptide of 16 amino acids. The deduced amino acid sequence of the matured protein displayed high homology with laccases from Trametes versicolor and Coprinus cinereus. The sequence analysis indicated the presence of Glu 460 and Ser 113 and LEL tripeptide at the position known to influence redox potential of laccases placing this enzyme as a high redox enzyme. Addition of copper sulfate to the production medium enhanced the level of laccase by about 12-fold to a final activity of 7200 U L-1. The recombinant laccase (rLac) was purified by ~4-fold to a specific activity of ~85 U mg-1 protein. A detailed study of thermostability, chloride and solvent tolerance of the rLac indicated improvement in the first two properties when compared to the native laccase (nLac). Altered glycosylation pattern, identified by peptide mass finger printing, was proposed to contribute to altered properties of the rLac. Conclusion Laccase of C. bulleri was successfully produced extra

  6. Molecular cloning, nucleotide sequence, and expression of a carboxypeptidase-encoding gene from the archaebacterium Sulfolobus solfataricus.

    PubMed Central

    Colombo, S; Toietta, G; Zecca, L; Vanoni, M; Tortora, P


    Mammalian metallocarboxypeptidases play key roles in major biological processes, such as digestive-protein degradation and specific proteolytic processing. A Sulfolobus solfataricus gene (cpsA) encoding a recently described zinc carboxypeptidase with an unusually broad substrate specificity was cloned, sequenced, and expressed in Escherichia coli. Despite the lack of overall sequence homology with known carboxypeptidases, seven homology blocks, including the Zn-coordinating and catalytic residues, were identified by multiple alignment with carboxypeptidases A, B, and T. S. solfataricus carboxypeptidase expressed in E. coli was found to be enzymatically active, and both its substrate specificity and thermostability were comparable to those of the purified S. solfataricus enzyme. PMID:7559343

  7. Molecular cloning, nucleotide sequence, and expression of a carboxypeptidase-encoding gene from the archaebacterium Sulfolobus solfataricus.


    Colombo, S; Toietta, G; Zecca, L; Vanoni, M; Tortora, P


    Mammalian metallocarboxypeptidases play key roles in major biological processes, such as digestive-protein degradation and specific proteolytic processing. A Sulfolobus solfataricus gene (cpsA) encoding a recently described zinc carboxypeptidase with an unusually broad substrate specificity was cloned, sequenced, and expressed in Escherichia coli. Despite the lack of overall sequence homology with known carboxypeptidases, seven homology blocks, including the Zn-coordinating and catalytic residues, were identified by multiple alignment with carboxypeptidases A, B, and T. S. solfataricus carboxypeptidase expressed in E. coli was found to be enzymatically active, and both its substrate specificity and thermostability were comparable to those of the purified S. solfataricus enzyme.

  8. Cloning, sequencing, and characterization of the gene encoding the class I fructose-1,6-bisphosphate aldolase of Staphylococcus carnosus.

    PubMed Central

    Witke, C; Götz, F


    fda from Staphylococcus carnosus TM300, encoding the class I fructose-1,6-bisphosphate aldolase, was cloned in Escherichia coli and sequenced. The 888-nucleotide open reading frame encoding a protein with an M(r) of 32,855 had an E. coli-like promoter sequence. Plasmids containing fda complemented E. coli NP315 (Fda-). Expression of fda in S. carnosus led to a six- to eightfold increase in aldolase production and activity; low levels of glucose in the growth medium stimulated activity. Images PMID:8226699

  9. Cloning and sequencing of 28 kDa outer membrane protein gene of Brucella melitensis Rev. 1.


    Chaudhuri, Pallab; Kumar, S Vinoth; Prasad, Rajeev; Srivastava, S K; Yadav, M P


    Brucella melitensis is an organism of paramount zoonotic importance. The 28 kDa outer membrane protein (OMP) is one of the immunodominant antigens of B. melitensis. The gene encoding 28 kDa OMP (omp28) has been amplified from B. melitensis Rev. 1 strain. A PCR product of 753 bp, encoding complete omp28 gene of B. melitensis, was obtained. The gene was further cloned and sequenced. The nucleotide sequence of B. melitensis Rev. 1 strain showed substitution of 2 nucleotides from that of 16M strain.

  10. Cloning and sequencing of a cDNA encoding a heat-stable sweet protein, mabinlin II.


    Nirasawa, S; Masuda, Y; Nakaya, K; Kurihara, Y


    A cDNA clone encoding a heat-stable sweet protein, mabinlin II (MAB), was isolated and sequenced. The encoded precursor to MAB was composed of 155 amino acid (aa) residues, including a signal sequence of 20 aa, an N-terminal extension peptide of 15 aa, a linker peptide of 14 aa and one residue of C-terminal extension. Comparison of the proteolytic cleavage sites during post-translational processing of MAB precursor with those of like 2S seed-storage proteins of Arabidopsis thaliana, Brassica napus and Bertholletia excelsa shows that the three individual cleavage sites between respective species are conserved.

  11. Molecular cloning and sequence analysis of the Zygosaccharomyces bailii HIS3 gene encoding the imidazole glycerolphosphate dehydratase.


    Branduardi, Paola


    Zygosaccharomyces bailii is a spoilage yeast belonging to the Zygosaccharomyces genus. In recent years these yeasts, due to their exceptional resistance to several stresses, have become more and more interesting as model organisms to study the molecular basis of the said resistance. A Z. bailii cDNA library has been built and the 672 bp nucleotide sequence coding for the HIS3 gene was cloned by complementation of a Saccharomyces cerevisiae his3 mutant strain. The deduced 223 amino acid sequence shares a high degree of homology with His3p homologues in other non-conventional yeast species. The GeneBank Accession No. is AY050224.

  12. Cloning and sequence analysis of IL-2, IL-4 and IFN-γ from Indian Dromedary camels (Camelus dromedarius).


    Nagarajan, G; Swami, Shelesh Kumar; Ghorui, S K; Pathak, K M L; Singh, R K; Patil, N V


    The cDNAs of three cytokines, viz., IL-2, IL-4 and IFN-γ from Dromedary camels were amplified by PCR using Bactrian camel sequences and subsequently cloned for sequence analysis. Relationship based on amino acid sequences revealed that Dromedary camel IL-2 shared 99.5% and 99.3% identity at the nucleotide and amino acid levels with Bactrian camel IL-2. In the case of IL-4, the identity of Dromedary camel was 99.7% and 99.2% at the nucleotide and amino acid levels, respectively with that of Bactrian camel. The Dromedary camel IFN-γ shared 100% identity both at nucleotide and amino acid levels with Bactrian camel IFN-γ. Phylogenetic analysis based on amino acid sequences indicated the close relationship in these cytokine genes between the Dromedary camel and other camelids.

  13. Cloning and sequencing of the gene encoding the cell surface glycoprotein of Haloarcula japonica strain TR-1.


    Wakai, H; Nakamura, S; Kawasaki, H; Takada, K; Mizutani, S; Aono, R; Horikoshi, K


    The triangular disk-shaped halophilic archaeon Haloarcula japonica strain TR-1 has a glycoprotein on its cell surface. The complete gene encoding the cell surface glycoprotein (CSG) was cloned and sequenced. The gene has an open reading frame of 2586 bp, and a potential archaeal promoter sequence approximately 150 bp upstream of the ATG initiation codon. The mature CSG is composed of 828 amino acids and is preceded by a signal sequence of 34 amino acid residues. A hydropathy analysis showed a hydrophobic stretch at the C-terminus, that probably serves as a transmembrane domain. The amino acid sequence of the Ha. japonica CSG showed 52.1% and 43.2% identities to those from the Halobacterium halobium and Haloferax volcanii CSGs, respectively. Five potential N-glycosylation sites were found in the mature Ha. japonica CSG, sites that were distinctly different from those in Hb. halobium and Hf. volcanii. The Ha. japonica CSG gene was expressed in Escherichia coli.

  14. Cloning and sequencing of the trpE gene from Arthrobacter globiformis ATCC 8010 and several related subsurface Arthrobacter isolates

    SciTech Connect

    Chernova, T.; Viswanathan, V.K.; Austria, N.; Nichols, B.P.


    Tryptophan dependent mutants of Arthrobacter globiformis ATCC 8010 were isolated and trp genes were cloned by complementation and marker rescue of the auxotrophic strains. Rescue studies and preliminary sequence analysis reveal that at least the genes trpE, trpC, and trpB are clustered together in this organism. In addition, sequence analysis of the entire trpE gene, which encodes component I of anthranilate synthase, is described. Segments of the trpE gene from 17 subsurface isolates of Arthrobacter sp. were amplified by PCR and sequenced. The partial trpE sequences from the various strains were aligned and subjected to phylogenetic analysis. The data suggest that in addition to single base changes, recombination and genetic exchange play a major role in the evolution of the Arthrobacter genome.

  15. Tracking molecular evolution of photosynthesis by characterization of a major photosynthesis gene cluster from Heliobacillus mobilis.


    Xiong, J; Inoue, K; Bauer, C E


    A DNA sequence has been obtained for a 35.6-kb genomic segment from Heliobacillus mobilis that contains a major cluster of photosynthesis genes. A total of 30 ORFs were identified, 20 of which encode enzymes for bacteriochlorophyll and carotenoid biosynthesis, reaction-center (RC) apoprotein, and cytochromes for cyclic electron transport. Donor side electron-transfer components to the RC include a putative RC-associated cytochrome c553 and a unique four-large-subunit cytochrome bc complex consisting of Rieske Fe-S protein (encoded by petC), cytochrome b6 (petB), subunit IV (petD), and a diheme cytochrome c (petX). Phylogenetic analysis of various photosynthesis gene products indicates a consistent grouping of oxygenic lineages that are distinct and descendent from anoxygenic lineages. In addition, H. mobilis was placed as the closest relative to cyanobacteria, which form a monophyletic origin to chloroplast-based photosynthetic lineages. The consensus of the photosynthesis gene trees also indicates that purple bacteria are the earliest emerging photosynthetic lineage. Our analysis also indicates that an ancient gene-duplication event giving rise to the paralogous bchI and bchD genes predates the divergence of all photosynthetic groups. In addition, our analysis of gene duplication of the photosystem I and photosystem II core polypeptides supports a "heterologous fusion model" for the origin and evolution of oxygenic photosynthesis.

  16. Emergence of KPC-producing Klebsiella pneumoniae hypervirulent clone of capsular serotype K1 that belongs to sequence type 11 in Mainland China.


    Wei, Dan-Dan; Wan, La-Gen; Deng, Qiong; Liu, Yang


    KPC-2 has been rarely reported in hypervirulent Klebsiella pneumoniae strains. Here, we describe a KPC-2-producing K. pneumoniae hypervirulent clone of capsular serotype K1 belonging to sequence type 11. The presence of KPC carbapenemase in hypervirulent clone could mark an evolutionary step toward its establishment as major nosocomial pathogen.

  17. Cloning and characterization of genomic DNA sequences of four self-incompatibility alleles in sweet cherry ( Prunus avium L.).


    Wünsch, A; Hormaza, J I


    Gametophytic self-incompatibility (GSI) in sweet cherry is determined by a locus S with multiple alleles. In the style, the S-locus codifies for an allele-specific ribonuclease ( S-RNase) that is involved in the rejection of pollen that carries the same S allele. In this work we report the cloning and genomic DNA sequence analysis including the 5' flanking regions of four S-RNases of sweet cherry ( Prunus avium L., Rosaceae). DNA from the cultivars Ferrovia, Pico Colorado, Taleguera Brillante and Vittoria was amplified through PCR using primers designed in the conserved sequences of sweet cherry S-RNases. Two alleles were amplified for each cultivar and three of them correspond to three new S-alleles named S23, S24 and S25 present in 'Pico Colorado', 'Vittoria' and 'Taleguera Brillante' respectively. To confirm the identity of the amplified fragments, the genomic DNA of these three putative S-RNases and the allele S12 amplified in the cultivar Ferrovia were cloned and sequenced. The nucleotide and deduced amino-acid sequences obtained contained the structural features of rosaceous S-RNases. The isolation of the 5'-flanking sequences of these four S-RNases revealed a conserved putative TATA box and high similarity among them downstream from that sequence. However, similarity was low compared with the 5'-flanking regions of S-RNases from the Maloideae. S6- and S24-RNase sequences are highly similar, and most amino-acid substitutions among these two RNases occur outside the rosaceous hypervariable region (RHV), but within another highly variable region. The confirmation of the different specificity of these two S-RNases would help elucidate which regions of the S-RNase sequences play a role in S-pollen specific recognition.

  18. Digital cloning: identification of human cDNAs homologous to novel kinases through expressed sequence tag database searching.


    Chen, H C; Kung, H J; Robinson, D


    Identification of novel kinases based on their sequence conservation within kinase catalytic domain has relied so far on two major approaches, low-stringency hybridization of cDNA libraries, and PCR method using degenerate primers. Both of these approaches at times are technically difficult and time-consuming. We have developed a procedure that can significantly reduce the time and effort involved in searching for novel kinases and increase the sensitivity of the analysis. This procedure exploits the computer analysis of a vast resource of human cDNA sequences represented in the expressed sequence tag (EST) database. Seventeen novel human cDNA clones showing significant homology to serine/threonine kinases, including STE-20, CDK- and YAK-related family kinases, were identified by searching EST database. Further sequence analysis of these novel kinases obtained either directly from EST clones or from PCR-RACE products confirmed their identity as protein kinases. Given the rapid accumulation of the EST database and the advent of powerful computer analysis software, this approach provides a fast, sensitive, and economical way to identify novel kinases as well as other genes from EST database.

  19. Molecular cloning, sequence analysis and phylogeny of first caudata g-type lysozyme in axolotl (Ambystoma mexicanum).


    Yu, Haining; Gao, Jiuxiang; Lu, Yiling; Guang, Huijuan; Cai, Shasha; Zhang, Songyan; Wang, Yipeng


    Lysozymes are key proteins that play important roles in innate immune defense in many animal phyla by breaking down the bacterial cell-walls. In this study, we report the molecular cloning, sequence analysis and phylogeny of the first caudate amphibian g-lysozyme: a full-length spleen cDNA library from axolotl (Ambystoma mexicanum). A goose-type (g-lysozyme) EST was identified and the full-length cDNA was obtained using RACE-PCR. The axolotl g-lysozyme sequence represents an open reading frame for a putative signal peptide and the mature protein composed of 184 amino acids. The calculated molecular mass and the theoretical isoelectric point (pl) of this mature protein are 21523.0 Da and 4.37, respectively. Expression of g-lysozyme mRNA is predominantly found in skin, with lower levels in spleen, liver, muscle, and lung. Phylogenetic analysis revealed that caudate amphibian g-lysozyme had distinct evolution pattern for being juxtaposed with not only anura amphibian, but also with the fish, bird and mammal. Although the first complete cDNA sequence for caudate amphibian g-lysozyme is reported in the present study, clones encoding axolotl's other functional immune molecules in the full-length cDNA library will have to be further sequenced to gain insight into the fundamental aspects of antibacterial mechanisms in caudate.

  20. An efficient and high fidelity method for amplification, cloning and sequencing of complete tospovirus genomic RNA segments.


    Marshall, Spencer H; Adegbola, Raphael O; Adkins, Scott; Naidu, Rayapati A


    Tospoviruses (genus Tospovirus, family Bunyaviridae) are responsible for major losses in an extensive range of crops worldwide. New species of these single-stranded, ambisense RNA viruses regularly emerge and have been shown to maintain heterogeneous populations with individual isolates having quite variable biological and virulence characteristics. Most tospovirus phylogenetic studies have focused on analysis of a single gene, most often the nucleocapsid protein gene. Complete genomic RNA segment amplification as a single fragment would facilitate more detailed analyses of genome-wide sequence variability, but obtaining such sequences for a large number of tospovirus isolates using traditional methods of amplification and cloning of small overlapping fragments is tedious, time consuming and expensive. In this study, protocols were optimized to amplify, clone and sequence full-length M- and S-RNA genome segments of Tomato spotted wilt virus and Impatiens necrotic spot virus. The strategy presented here is straightforward, scalable and offers several advantages over the previously commonplace and overlapping amplicon-based approach. Use of whole genome segments, instead of individual gene sequences or defined portions of genome segments, will facilitate a better understanding of the underlying molecular diversity of tospoviruses in mixed infections.

  1. Molecular characterization and clonal diversity of meticillin-resistant Staphylococcus aureus isolated from the community in Spain: emergence of clone sequence type 72.


    Potel, C; Rey, S; Otero, S; Rubio, J; Álvarez, M


    Sequence type 72 meticillin-resistant Staphylococcus aureus (ST72 MRSA) was recently detected in our hospital. Although in Europe this clone is rarely isolated, it is the leading cause of community-associated MRSA infections in Korea, spreading also into hospitals, where it has also emerged as the main MRSA clone recovered from raw meat. We studied MRSA isolated from outpatients in Spain during a nine-year period. More than 70% of the isolates belonged to predominant clones found in hospitals. There was a significant increase in the ST72 prevalence. It appears that boundaries of dominance among MRSA clones have become blurred, demanding continuous surveillance.

  2. cDNA, genomic sequence cloning and overexpression of glyceraldehyde-3-phosphate dehydrogenase gene (GAPDH) from the Giant Panda.


    Hou, Wan-Ru; Hou, Yi-Ling; Du, Yu-Jie; Zhang, Tian; Hao, Yan-Zhe


    GAPDH (glyceraldehyde-3-phosphate dehydrogenase) is a key enzyme of the glycolytic pathway and it is related to the occurrence of some diseases. The cDNA and the genomic sequence of GAPDH were cloned successfully from the Giant Panda (Ailuropoda melanoleuca) using the RT-PCR technology and Touchdown-PCR, respectively. Both sequences were analyzed preliminarily. The cDNA of GAPDH cloned from the Giant Panda is 1191 bp in size, contains an open reading frame of 1002 bp encoding 333 amino acids. The genomic sequence is 3941 bp in length and was found to possess 10 exons and 9 introns. Alignment analysis indicates that the nucleotide sequence and the deduced amino acid sequence are highly conserved in some mammalian species, including Homo sapiens, Mu musculus, Rattus norvegicus, Canis lupus familiaris and Bos taurus. The homologies for the nucleotide sequences of the Giant Panda GAPDH to that of these species are 90.67, 90.92, 90.62, 95.01 and 92.32% respectively, while the homologies for the amino acid sequences are 94.93, 95.5, 95.8, 98.8 and 97.0%. Primary structure analysis revealed that the molecular weight of the putative GAPDH protein is 35.7899 kDa with a theoretical pI of 8.21. Topology prediction showed that there is one Glyceraldehyde 3-phosphate dehydrogenase active site, two N-glycosylation sites, four Casein kinase II phosphorylation sites, seven Protein kinase C phosphorylation sites and eight N-myristoylation sites in the GAPDH protein of the Giant Panda. The GAPDH gene was overexpressed in E. coli BL21. The results indicated that the fusion of GAPDH with the N-terminally His-tagged form gave rise to the accumulation of an expected 43 kDa polypeptide. The SDS-PAGE analysis also showed that the recombinant GAPDH was soluble and thus could be used for further functional studies.

  3. 22 Genes from chromosome 17q21: Cloning, sequencing, and characterization of mutations in breast cancer families and tumors

    SciTech Connect

    Friedman, L.S.; Ostermeyer, E.A.; Lynch, E.D.


    In our effort to identify BRCA1, 22 genes were cloned from a 1-Mb region of chromosome 17q21 defined by meiotic recombinants in families with inherited breast and/or ovarian cancer. Subsequent discovery of another meiotic recombinant narrowed the region to {approximately}650 kb. Genes were cloned from fibroblast and ovarian cDNA libraries by direct screening with YACs and cosmids. The more than 400 cDNA clones so identified were mapped to cosmids, YACs, and P1 clones and to a chromosome 17 somatic panel informative for the BRCA1 region. Clones that mapped back to the region were hybridized to each other and consolidated into clusters reflecting 22 genes. Ten genes were known human genes, 5 were human homologs of known genes, and 7 were novel. Each gene was sequenced, compared to genes in the databases to find homologies, and analyzed for mutations in BRCA1-linked families and tumors. Eight mutations were found in tumors or families and not in controls. In the gene encoding {alpha}-N-acetylglucosaminidase, {approximately}100 kb proximal to the 650-kb linked region, somatic nonsense, missense, and splice junction mutations occurred in 3 breast tumors, but not in these patients` germline DNA nor in controls. In an ets-related oncogene in the linked region, a missense mutation cosegregated with breast cancer in one family and was not observed in controls. In a human homolog of a yeast pre-mRNA splicing factor, 3 different mutations cosegregated with breast cancer in 3 families and were not observed in controls. In these and the other genes in the region, 36 polymorphic variants were observed in both cases and controls. 36 refs., 2 figs., 3 tabs.

  4. Molecular Profiling of Microbial Communities from Contaminated Sources: Use of Subtractive Cloning Methods and rDNA Spacer Sequences

    SciTech Connect

    Robb, Frank T.


    The major objective of this research was to provide appropriate sequences and assemble a DNA array of oligonucleotides to be used for rapid profiling of microbial populations from polluted areas and other areas of interest. The sequences to be assigned to the DNA array were chosen from cloned genomic DNA taken from groundwater sites having well characterized pollutant histories at Hanford Nuclear Plant and Lawrence Livermore Site 300. Glass-slide arrays were made and tested; and a new multiplexed, bead-based method was developed that uses nucleic acid hybridization on the surface of microscopic polystyrene spheres to identify specific sequences in heterogeneous mixtures of DNA sequences. The test data revealed considerable strain variation between sample sites showing a striking distribution of sequences. It also suggests that diversity varies greatly with bioremediation, and that there are many bacterial intergenic spacer region sequences that can indicate its effects. The bead method exhibited superior sequence discrimination and has features for easier and more accurate measurement.

  5. The primary structure of a procaryotic glycoprotein. Cloning and sequencing of the cell surface glycoprotein gene of halobacteria.


    Lechner, J; Sumper, M


    The hexagonally patterned surface layer of halobacteria consists of a true glycoprotein. This procaryotic glycoprotein has recently been shown to exhibit novel features with respect to saccharide structure and saccharide biosynthesis. The primary structure and the location of glycosylation sites were determined by cloning and sequencing of the glycoprotein gene of Halobacterium halobium. According to the predicted amino acid sequence, the glycoprotein is synthesized with a N-terminal leader sequence of 34 amino acid residues reminiscent of eucaryotic and procaryotic signal peptides. A hydrophobic stretch of 21 amino acid residues at the C terminus probably serves as a transmembrane domain. 14 threonine residues are clustered adjacent to this membrane anchor and linked to these threonines are all the disaccharides of the cell surface glycoprotein. 12 N-glycosylation sites are distributed over the polypeptide chain.

  6. Mulberry (Morus L.) methionine sulfoxide rreductase gene cloning, sequence analysis, and expression in plant development and stress response.


    Tong, Wei; Zhang, Yinghua; Wang, Heng; Li, Feng; Liu, Zhaoyue; Wang, Yuhua; Fang, Rongjun; Zhao, Weiguo; Li, Long


    Methionine sulfoxide reductase plays a regulatory role in plant growth and development, especially in scavenging reactive oxygen species by restoration of the oxidation of methionine in protein. A full-length cDNA sequence encoding methionine sulfoxide reductase (MSR) from mulberry, which we designated MMSR, was cloned based on mulberry expressed sequence tags (ESTs). Sequence analysis showed that the MMSR is 810 bp long, encoding 194 amino acids with a predicted molecular weight of 21.6 kDa and an isoelectric point of 6.78. The expression level of the MMSR gene under conditions of drought and salt stresses was quantified by qRT-PCR. The results show that the expression level changed significantly under the stress conditions compared to the normal growth environment. It helps us to get a better understanding of the molecular basis for signal transduction mechanisms underlying the stress response in mulberry.

  7. Cloning, phenotypic expression, and DNA sequence of the gene for lactacin F, an antimicrobial peptide produced by Lactobacillus spp.

    PubMed Central

    Muriana, P M; Klaenhammer, T R


    Lactacin F is a heat-stable bacteriocin produced by Lactobacillus acidophilus 11088. A 63-mer oligonucleotide probe deduced from the N-terminal lactacin F amino acid sequence was used to clone the putative laf structural gene from plasmid DNA of a lactacin F-producing transconjugant, L. acidophilus T143. One clone, NCK360, harbored a recombinant plasmid, pTRK160, which contained a 2.2-kb EcoRI fragment of the size expected from hybridization experiments. An Escherichia coli-L. acidophilus shuttle vector was constructed, and a subclone (pTRK162) containing the 2.2-kb EcoRI fragment was introduced by electroporation into two lactacin F-negative strains, L. acidophilus 89 and 88-C. Lactobacillus transformants containing pTRK162 expressed lactacin F activity and immunity. Bacteriocin produced by the transformants exhibited an inhibitory spectrum and heat stability identical to those of the wild-type bacteriocin. An 873-bp region of the 2.2-kb fragment was sequenced by using a 20-mer degenerate lactacin F-specific primer to initiate sequencing from within the lactacin F structural gene. Analysis of the resulting sequence identified an open reading frame which could encode a protein of 75 amino acids. The 25 N-terminal amino acids for lactacin F were identified within the open reading frame along with an N-terminal extension, possibly a signal sequence. The lactacin F N-terminal sequence, through the remainder of the open reading frame (57 amino acids; 6.3 kDa), correlated extremely well with composition analyses of purified lactacin F which also predicted a size of 51 to 56 amino acid residues. Molecular characterization of lactacin F identified a small hydrophobic peptide that may be representative of a common bacteriocin class in lactic acid bacteria. Images PMID:1900281

  8. Molecular cloning, sequencing and expression in Escherichia coli of the bean yellow mosaic virus coat protein gene.


    Hammond, J; Hammond, R W


    The sequence of 1015 nucleotides from the 3' poly(A) tract of the potyvirus bean yellow mosaic virus (BYMV) RNA has been determined from two cDNA clones. This sequence contained a single long open reading frame (ORF) starting upstream of the cloned region. The ORF was expressed as a fusion protein in Escherichia coli, and the product was detected by antibodies specific for the coat protein of BYMV. The predicted length of the coat protein gene was 822 nucleotides, corresponding to a 273 amino acid coat protein of Mr 30910. The deduced amino acid sequence of the BYMV coat protein was compared to the chemically determined amino acid composition of purified virion protein, and of protein prepared from trypsin-treated virions. The nucleotide and deduced amino acid sequences were compared to the sequences of the coat protein genes of other potyviruses. The BYMV coat protein gene was found to be 50 to 61% homologous to those of other potyviruses at both the nucleotide and amino acid levels; the greatest variation was between the 5'-proximal one-fifth of the genes. Amino acid sequences and hydrophilicity plots of the different potyvirus coat proteins showed similarities which indicated that the structure of the coat protein is highly conserved; a non-terminal region of variability was predicted to be exposed on the exterior of the virion. A putative cleavage site at a glutamine-serine dipeptide was identified by similarity in context to the cleavage sites of tobacco etch virus and tobacco vein mottling virus coat proteins from the viral polyproteins. The BYMV 3'-terminal non-coding region of 166 nucleotides is followed by a poly(A) tract.

  9. cDNA, genomic sequence cloning and overexpression of giant panda (Ailuropoda melanoleuca) mitochondrial ATP synthase ATP5G1.


    Hou, W-R; Hou, Y-L; Ding, X; Wang, T


    The ATP5G1 gene is one of the three genes that encode mitochondrial ATP synthase subunit c of the proton channel. We cloned the cDNA and determined the genomic sequence of the ATP5G1 gene from the giant panda (Ailuropoda melanoleuca) using RT-PCR technology and touchdown-PCR, respectively. The cloned cDNA fragment contains an open reading frame of 411 bp encoding 136 amino acids; the length of the genomic sequence is of 1838 bp, containing three exons and two introns. Alignment analysis revealed that the nucleotide sequence and the deduced protein sequence are highly conserved compared to Homo sapiens, Mus musculus, Rattus norvegicus, Bos taurus, and Sus scrofa. The homologies for nucleotide sequences of the giant panda ATP5G1 to those of these species are 93.92, 92.21, 92.46, 93.67, and 92.46%, respectively, and the homologies for amino acid sequences are 90.44, 95.59, 93.38, 94.12, and 91.91%, respectively. Topology prediction showed that there is one protein kinase C phosphorylation site, one casein kinase II phosphorylation site, five N-myristoylation sites, and one ATP synthase c subunit signature in the ATP5G1 protein of the giant panda. The cDNA of ATP5G1 was transfected into Escherichia coli, and the ATP5G1 fused with the N-terminally GST-tagged protein gave rise to accumulation of an expected 40-kDa polypeptide, which had the characteristics of the predicted protein.

  10. Cloning Sequencing and Structural Manipulation of the Enterotoxin D and E Genes from Staphylococcus aureus

    DTIC Science & Technology


    sign in mice injected with toxin samples from these clones. Only the mouse injected with whole cells from KS1866 showed flaking and peeling of the... epidermis . Even the E. coli strains containing pJJ825 (KSI825 and 15 KSI858) did not show exfoliation. It is possible that the E. coli strains do not

  11. Cloning, sequence, and properties of the soluble pyridine nucleotide transhydrogenase of Pseudomonas fluorescens.

    PubMed Central

    French, C E; Boonstra, B; Bufton, K A; Bruce, N C


    The gene encoding the soluble pyridine nucleotide transhydrogenase (STH) of Pseudomonas fluorescens was cloned and expressed in Escherichia coli. STH is related to the flavoprotein disulfide oxidoreductases but lacks one of the conserved redox-active cysteine residues. The gene is highly similar to an E. coli gene of unknown function. PMID:9098078

  12. PCR Cloning of Partial "nbs" Sequences from Grape ("Vitis aestivalis" Michx)

    ERIC Educational Resources Information Center

    Chang, Ming-Mei; DiGennaro, Peter; Macula, Anthony


    Plants defend themselves against pathogens via the expressions of disease resistance (R) genes. Many plant R gene products contain the characteristic nucleotide-binding site (NBS) and leucine-rich repeat (LRR) domains. There are highly conserved motifs within the NBS domain which could be targeted for polymerase chain reaction (PCR) cloning of R…

  13. The human myosin light chain kinase (MLCK) from hippocampus: Cloning, sequencing, expression, and localization to 3qcen-q21

    SciTech Connect

    Potier, M.C.; Rossier, J.; Turnell, W.G.; Pekarsky, Y.; Gardiner, K.


    Myosin light chain kinase (MLCK), a key enzyme in muscle contraction, has been shown by immunohistology to be present in neurons and glia. We describe here the cloning of the cDNA for human MLCK from hippocampus, encoding a protein sequence 95% similar to smooth muscle MLCKs but less than 60% similar to skeletal muscle MLCKs. The cDNA clone detected two RNA transcripts in human frontal and entorhinal cortex, in hippocampus, and in jejunum, one corresponding to MLCK and the other probably to telokin, the carboxy-terminal 154 codons of MLCK expressed as an independent protein in smooth muscle. Levels of expression were lower in brain compared to smooth muscle. We show that within the protein sequence, a motif of 28 or 24 residues is repeated five times, the second repeat ending with the putative methionine start codon. These repeats overlap with a second previously reported module of 12 residues repeated five times in the human sequence. In addition, the acidic C-terminus of all MLCKs from both brain and smooth muscle resembles the C-terminus of tubulins. The chromosomal localization of the gene for human MLCK is shown to be at 3qcen-q21, as determined by PCR and Southern blotting using two somatic cell hybrid panels. 33 refs., 8 figs.

  14. Cloning and sequence analysis of an Ophiophagus hannah cDNA encoding a precursor of two natriuretic peptide domains.


    Lei, Weiwei; Zhang, Yong; Yu, Guoyu; Jiang, Ping; He, Yingying; Lee, Wenhui; Zhang, Yun


    The king cobra (Ophiophagus hannah) is the largest venomous snake. Despite the components are mainly neurotoxins, the venom contains several proteins affecting blood system. Natriuretic peptide (NP), one of the important components of snake venoms, could cause local vasodilatation and a promoted capillary permeability facilitating a rapid diffusion of other toxins into the prey tissues. Due to the low abundance, it is hard to purify the snake venom NPs. The cDNA cloning of the NPs become a useful approach. In this study, a 957 bp natriuretic peptide-encoding cDNA clone was isolated from an O. hannah venom gland cDNA library. The open-reading frame of the cDNA encodes a 210-amino acid residues precursor protein named Oh-NP. Oh-NP has a typical signal peptide sequence of 26 amino acid residues. Surprisingly, Oh-NP has two typical NP domains which consist of the typical sequence of 17-residue loop of CFGXXDRIGC, so it is an unusual NP precursor. These two NP domains share high amino acid sequence identity. In addition, there are two homologous peptides of unknown function within the Oh-NP precursor. To our knowledge, Oh-NP is the first protein precursor containing two NP domains. It might belong to another subclass of snake venom NPs.

  15. Complete Genome Sequences of Isolates of Enterococcus faecium Sequence Type 117, a Globally Disseminated Multidrug-Resistant Clone

    PubMed Central

    Tedim, Ana P.; Lanza, Val F.; Manrique, Marina; Pareja, Eduardo; Ruiz-Garbajosa, Patricia; Cantón, Rafael; Baquero, Fernando; Tobes, Raquel


    ABSTRACT The emergence of nosocomial infections by multidrug-resistant sequence type 117 (ST117) Enterococcus faecium has been reported in several European countries. ST117 has been detected in Spanish hospitals as one of the main causes of bloodstream infections. We analyzed genome variations of ST117 strains isolated in Madrid and describe the first ST117 closed genome sequences. PMID:28360174

  16. Cloning and nucleotide sequence of the gene coding for enzymatically active fragments of the Bacillus polymyxa beta-amylase.


    Kawazu, T; Nakanishi, Y; Uozumi, N; Sasaki, T; Yamagata, H; Tsukagoshi, N; Udaka, S


    The gene encoding beta-amylase was cloned from Bacillus polymyxa 72 into Escherichia coli HB101 by inserting HindIII-generated DNA fragments into the HindIII site of pBR322. The 4.8-kilobase insert was shown to direct the synthesis of beta-amylase. A 1.8-kilobase AccI-AccI fragment of the donor strain DNA was sufficient for the beta-amylase synthesis. Homologous DNA was found by Southern blot analysis to be present only in B. polymyxa 72 and not in other bacteria such as E. coli or B. subtilis. B. polymyxa, as well as E. coli harboring the cloned DNA, was found to produce enzymatically active fragments of beta-amylases (70,000, 56,000, or 58,000, and 42,000 daltons), which were detected in situ by sodium dodecyl sulfate-polyacrylamide gel electrophoresis. Nucleotide sequence analysis of the cloned 3.1-kilobase DNA revealed that it contains one open reading frame of 2,808 nucleotides without a translational stop codon. The deduced amino acid sequence for these 2,808 nucleotides encoding a secretory precursor of the beta-amylase protein is 936 amino acids including a signal peptide of 33 or 35 residues at its amino-terminal end. The existence of a beta-amylase of larger than 100,000 daltons, which was predicted on the basis of the results of nucleotide sequence analysis of the gene, was confirmed by examining culture supernatants after various cultivation periods. It existed only transiently during cultivation, but the multiform beta-amylases described above existed for a long time. The large beta-amylase (approximately 160,000 daltons) existed for longer in the presence of a protease inhibitor such as chymostatin, suggesting that proteolytic cleavage is the cause of the formation of multiform beta-amylases.

  17. Preliminary functional characterization, cloning and primary sequence of Fastuosain, a cysteine peptidase isolated from fruits of Bromelia fastuosa.


    Cabral, Hamilton; Leopoldino, Andréia M; Tajara, Eloiza H; Greene, Lewis J; Faça, Vitor M; Mateus, Rogério P; Ceron, Carlos R; de Souza Judice, Wagner A; Julianod, Luiz; Bonilla-Rodriguez, Gustavo O


    The present work reports the characterization of Fastuosain, a novel cysteine protease of 25kDa, purified from the unripe fruits of Bromelia fastuosa, a wild South American Bromeliaceae. Proteolytic activity, measured using casein and synthetic substrates, was dependent on the presence of thiol reagents, having maximum activity at pH 7.0. The present work reports cDNA cloning of Fastuosain; cDNA was amplified by PCR using specific primers. The product was 1096pb long. Mature fastuosain has 217 residues, and with the proregion has a total length of 324 residues. Its primary sequence showed high homology with ananain(74%), stem bromelain (66%) and papain (44%).

  18. Cloning and nucleotide sequence of the gene coding for aspartokinase II from a thermophilic methylotrophic Bacillus sp.

    PubMed Central

    Schendel, F J; Flickinger, M C


    The structural gene coding for the lysine-sensitive aspartokinase II of the methylotrophic thermotolerant Bacillus sp. strain MGA3 was cloned from a genomic library by complementation of an Escherichia coli auxotrophic mutant lacking all three aspartokinase isozymes. The nucleotide sequence of the entire 2.2-kb PstI fragment was determined, and a single open reading frame coding for the aspartokinase II enzyme was found. Aspartokinase II was shown to be an alpha 2 beta 2 tetramer (M(r) 122,000) with the beta subunit (M(r) 18,000) encoded within the alpha subunit (M(r) 45,000) in the samea reading frame. The enzyme was purified, and the N-terminal sequences of the alpha and beta subunits were identical with those predicted from the gene sequences. The predicted amino acid sequence was 76% identical with the sequence of the Bacillus subtilis aspartokinase II. The transcription initiation site was located approximately 350 bp upstream of the translation start site, and putative promoter regions at -10 (TATGCT) and -35 (ATGACA) were identified. A 300-nucleotide intervening sequence between the transcription initiation and translational start sites suggests a possible attenuation mechanism for the regulation of transcription of this enzyme in the presence of lysine. Images PMID:1444390

  19. Molecular cloning, nucleotide sequence, and expression in Escherichia coli of a hemolytic toxin (aerolysin) gene from Aeromonas trota

    SciTech Connect

    Khan, A.A.; Kim, E.; Cerniglia, C.E.


    Aeromonas trota AK2, which was derived from ATCC 49659 and produces the extracellular pore-forming hemolytic toxin aerolysin, was mutagenized with the transposon mini-Tn5Km1 to generate a hemolysin-deficient mutant, designated strain AK253. Southern blotting data indicated that an 8.7-kb NotI fragment of the genomic DNA of strain AK253 contained the kanamycin resistance gene of mini-Tn5Km1. The 8.7-kb NotI DNA fragment was cloned into the vector pGEM5Zf({minus}) by selecting for kanamycin resistance, and the resultant clone, pAK71, showed aerolysin activity in Escherichia coli JM109. The nucleotide sequence of the aerA gene, located on the 1.8-kb ApaI-EcoRI fragment, was determined to consist of 1,479 bp and to have an ATG initiation codon and a TAA termination codon. An in vitro coupled transcription-translation analysis of the 1.8-kb region suggested that the aerA gene codes for a 54-kDa protein, in agreement with nucleotide sequence data. The deduced amino acid sequence of the aerA gene product of A. trota exhibited 99% homology with the amino acid sequence of the aerA product of Aeromonas sobria AB3 and 57% homology with the amino acid sequences of the products of the aerA genes of Aeromonas salmonicida 17-2 and A. sobria 33.

  20. Fermentation pattern of sucrose to ethanol conversions by Zymomonas mobilis

    SciTech Connect

    Lyness, E.; Doelle, H.W.


    General patterns of sucrose fermentation by two strains of Zymomonas mobilis, designated Z7 and Z10, were established using sucrose concentrations from 50 to 200 g/liter. Strain Z7 showed a higher invertase activity than Z10. Strain Z10 showed a reduced specific growth rate at high sucrose concentrations while Z7 was unaffected. High sucrose hydrolyzing activity in strain Z7 lead to glucose accumulation in the medium at high sucrose concentrations. Ethanol production and fermentation time depend on the rate of catabolism of the products of sucrose hydrolysis, glucose and fructose. The metabolic quotients for sucrose utilization, qs, and ethanol production, qp (g/, are unsuitable for describing sucrose utilization by Zymomonas mobilis as the logarithmic phase of growth precedes the phase of highest substrate utilization (g/ and ethanol production (g/ in batch culture. (Refs. 10).

  1. Sequencing and analysis of 10967 full-length cDNA clones from Xenopus laevis and Xenopus tropicalis

    SciTech Connect

    Morin, R D; Chang, E; Petrescu, A; Liao, N; Kirkpatrick, R; Griffith, M; Butterfield, Y; Stott, J; Barber, S; Babakaiff, R; Matsuo, C; Wong, D; Yang, G; Smailus, D; Brown-John, M; Mayo, M; Beland, J; Gibson, S; Olson, T; Tsai, M; Featherstone, R; Chand, S; Siddiqui, A; Jang, W; Lee, E; Klein, S; Prange, C; Myers, R M; Green, E D; Wagner, L; Gerhard, D; Marra, M; Jones, S M; Holt, R


    Sequencing of full-insert clones from full-length cDNA libraries from both Xenopus laevis and Xenopus tropicalis has been ongoing as part of the Xenopus Gene Collection initiative. Here we present an analysis of 10967 clones (8049 from X. laevis and 2918 from X. tropicalis). The clone set contains 2013 orthologs between X. laevis and X. tropicalis as well as 1795 paralog pairs within X. laevis. 1199 are in-paralogs, believed to have resulted from an allotetraploidization event approximately 30 million years ago, and the remaining 546 are likely out-paralogs that have resulted from more ancient gene duplications, prior to the divergence between the two species. We do not detect any evidence for positive selection by the Yang and Nielsen maximum likelihood method of approximating d{sub N}/d{sub S}. However, d{sub N}/d{sub S} for X. laevis in-paralogs is elevated relative to X. tropicalis orthologs. This difference is highly significant, and indicates an overall relaxation of selective pressures on duplicated gene pairs. Within both groups of paralogs, we found evidence of subfunctionalization, manifested as differential expression of paralogous genes among tissues, as measured by EST information from public resources. We have observed, as expected, a higher instance of subfunctionalization in out-paralogs relative to in-paralogs.

  2. Continuous production of ethanol by use of flocculent Zymomonas mobilis

    SciTech Connect

    Arcuri, E.J.; Donaldson, T.L.


    Improved means and process for producing ethanol by fermentation are provided. Another object of the invention is to produce ethanol in a continuous-flow process by means of a biological catalyst that can be retained in a continuous-flow reactor vessel without being bonded to or held within a support material. An additional object of the invention is to provide a fermentation reactor vessel wherein disturbance of the desirable plug flow of sugar solution is minimized. These objects are attained by the preferred apparatus and process of the invention which utilize a newly-discovered flocculent strain of Zymomonas mobilis for converting sugar to ethanol in a continuous flow-type reactor vessel. The flow rate of a sugar-containing solution through a column containing the floc-forming strain of Z. mobilis is adjusted so that a sufficient conversion of sugar to ethanol is achieved in the column and the flocculent Z. mobilis is not washed away in effluent from the column. Carbon dioxide gas generated by the fermentation process is vented from a plurality of points spaced along an inclined column in which the process is conducted, thus minimizing disturbance of the plug flow of liquid by this gas.

  3. Molecular cloning of the Clostridium botulinum structural gene encoding the type B neurotoxin and determination of its entire nucleotide sequence.

    PubMed Central

    Whelan, S M; Elmore, M J; Bodsworth, N J; Brehm, J K; Atkinson, T; Minton, N P


    DNA fragments derived from the Clostridium botulinum type A neurotoxin (BoNT/A) gene (botA) were used in DNA-DNA hybridization reactions to derive a restriction map of the region of the C. botulinum type B strain Danish chromosome encoding botB. As the one probe encoded part of the BoNT/A heavy (H) chain and the other encoded part of the light (L) chain, the position and orientation of botB relative to this map were established. The temperature at which hybridization occurred indicated that a higher degree of DNA homology occurred between the two genes in the H-chain-encoding region. By using the derived restriction map data, a 2.1-kb BglII-XbaI fragment encoding the entire BoNT/B L chain and 108 amino acids of the H chain was cloned and characterized by nucleotide sequencing. A contiguous 1.8-kb XbaI fragment encoding a further 623 amino acids of the H chain was also cloned. The 3' end of the gene was obtained by cloning a 1.6-kb fragment amplified from genomic DNA by inverse polymerase chain reaction. Translation of the nucleotide sequence derived from all three clones demonstrated that BoNT/B was composed of 1,291 amino acids. Comparative alignment of its sequence with all currently characterized BoNTs (A, C, D, and E) and tetanus toxin (TeTx) showed that a wide variation in percent homology occurred dependent on which component of the dichain was compared. Thus, the L chain of BoNT/B exhibits the greatest degree of homology (50% identity) with the TeTx L chain, whereas its H chain is most homologous (48% identity) with the BoNT/A H chain. Overall, the six neurotoxins were shown to be composed of highly conserved amino acid domains interceded with amino acid tracts exhibiting little overall similarity. In total, 68 amino acids of an average of 442 are absolutely conserved between L chains and 110 of 845 amino acids are conserved between H chains. Conservation of Trp residues (one in the L chain and nine in the H chain) was particularly striking. The most

  4. Cloning and sequencing of beta-1,4-endoglucanase gene (celA) from Pseudomonas sp. YD-15.


    Her, S; Lee, H S; Choi, S J; Choi, S W; Choi, H J; Yoon, S S; Oh, D H


    A beta-1,4-endoglucanase gene (celA) from Pseudomonas sp. YD-15 was cloned in Escherichia coli DH5 alpha and its nucleotide sequence determined. The open reading frame of celA was 1830 base pairs and the enzyme was composed of 609 amino acids with a molecular weight of 63,617 Da. The deduced amino acid sequence and putative active site of CelA had high amino acid homology with family E cellulases. By dot blot analysis, the induction of celA according to carbon sources was determined. The transcripts hybridizing to the internal fragment of celA were detected in total RNA isolated from Pseudomonas sp. YD-15 cells grown on avicel and glycerol, but not from cells grown on glucose and cellobiose.

  5. Identification and sequence of a cDNA clone corresponding to a gene involved in development of Undaria pinnatifida

    NASA Astrophysics Data System (ADS)

    Hou, He-Shen; Li, Ning; Wu, Chao-Yuan


    During the induction of gamete-producing gametangia, induced gametophytes were collected at 4 days intervals (0,4,8,12 d) and total RNAs were isolated by CsCl gradient ultracentrifugation. Some stage-specific expressed mRNAs were identified by differential display of mRNAs from different developing stages of the gametophytes. The cDNA of one specific mRNA was verified, cloned and sequenced. This gene was specifically expressed during 4 days of induction, and had partial homologous sequence with tobacco IAA-binding protein gene. It suggests that this cDNA may represent a gene which is related to the IAA regulating function during the development of the gametophytes.

  6. Molecular cloning and sequencing of a cDNA encoding partial putative molt-inhibiting hormone from Penaeus chinensis

    NASA Astrophysics Data System (ADS)

    Wang, Zai-Zhao; Xiang, Jian-Hai


    Total RNA was extracted from eyestalks of shrimp Penaeus chinensis. Eyestalk cDNA was obtained from total RNA by reverse transcription. Reverse transcriptase-polymerase chain reaction (RT-PCR) was initiated using eyestalk cDNA and degenerate primers designed from the amino acid sequence of molt-inhibiting hormone from shrimp Penaeus japonicus. A specific cDNA was obtained and cloned into a T vector for sequencing. The cDNA consisted of 201 base pairs and encoding for a peptide of 67 amino acid residues. The peptide of P. chinensis had the highest identity with molt-inhibiting hormones of P. japonicus. The cDNA could be a partial gene of molt-inhibiting hormones from P. chinensis. This paper reports for the first time cDNA encoding for neuropeptide of P. chinensis.

  7. The nucleotide sequence of the putative transcription initiation site of a cloned ribosomal RNA gene of the mouse.

    PubMed Central

    Urano, Y; Kominami, R; Mishima, Y; Muramatsu, M


    Approximately one kilobase pairs surrounding and upstream the transcription initiation site of a cloned ribosomal DNA (rDNA) of the mouse were sequenced. The putative transcription initiation site was determined by two independent methods: one nuclease S1 protection and the other reverse transcriptase elongation mapping using isolated 45S ribosomal RNA precursor (45S RNA) and appropriate restriction fragments of rDNA. Both methods gave an identical result; 45S RNA had a structure starting from ACTCTTAG---. Characteristically, mouse rDNA had many T clusters (greater than or equal to 5) upstream the initiation site, the longest being 21 consecutive T's. A pentadecanucleotide, TGCCTCCCGAGTGCA, appeared twice within 260 nucleotides upstream the putative initiation site. No such characteristic sequences were found downstream this site. Little similarity was found in the upstream of the transcription initiation site between the mouse, Xenopus laevis and Saccharomyces cerevisiae rDNA. Images PMID:6162156

  8. A swordless knight: epidemiology and molecular characteristics of the blaKPC-negative sequence type 258 Klebsiella pneumoniae clone.


    Adler, Amos; Paikin, Svetlana; Sterlin, Yelena; Glick, Josef; Edgar, Rotem; Aronov, Rima; Schwaber, Mitchell J; Carmeli, Yehuda


    In June 2010, a bla(KPC)-negative, ertapenem-resistant ST-258 Klebsiella pneumoniae strain was isolated from a patient in the Laniado Medical Center (LMC). Our aims were (i) to describe its molecular characteristics and resistance mechanisms and (ii) to assess whether the bla(KPC)-negative ST-258 K. pneumoniae clone spreads as efficiently as its KPC-producing isogenic strain. In a prospective study, surveillance of all ertapenem-resistant, carbapenemase-negative K. pneumoniae (ERCNKP) isolates was conducted from June 2010 to May 2011 at LMC (314 beds) and from July 2008 to December 2010 at the Tel Aviv Sourasky Medical Center (TASMC) (1,200 beds). Molecular typing was done by arbitrarily primed PCR, pulsed-field gel electrophoresis (PFGE), and multilocus sequence typing (MLST). A total of 8 of 42 (19%) ERCNKP isolates in LMC and 1 of 32 (3.1%) in TASMC belonged to the ST-258 clone. These strains carried the bla(CTX-M-2) or the bla(CTX-M-25) extended-spectrum β-lactamase (ESBL) gene. Sequencing of the ompK genes showed a frameshift mutation in the ompK35 gene. The fate of the bla(KPC)-carrying plasmid, pKpQIL, was determined by S1 analysis and by PCR of the Tn4401 transposon, repA, and the truncated bla(OXA-9). Plasmid analysis of the ERCNKP ST-258 isolates showed variability in plasmid composition and absence of the Tn4401 transposon and the pKpQIL plasmid. In addition, the ST-258 clone was identified in 35/35 (100%) of KPC-producing K. pneumoniae isolates but in none of 62 ertapenem-susceptible K. pneumoniae isolates collected in the two centers. Our results suggest that ERCNKP ST-258 evolved by loss of the bla(KPC)-carrying plasmid pKpQIL. ERCNKP ST-258 appears to have low epidemic potential.

  9. Crystal structure of cbbF from Zymomonas mobilis and its functional implication

    SciTech Connect

    Hwang, Hyo-Jeong; Park, Suk-Youl; Kim, Jeong-Sun


    Highlights: • The crystal structure of one cbbF from Zymomonas mobilis was revealed. • Scores of residues form two secondary structures with a non-polar protruded residue. • It exists as a dimeric form in solution. - Abstract: A phosphate group at the C1-atom of inositol-monophosphate (IMP) and fructose-1,6-bisphosphate (FBP) is hydrolyzed by a phosphatase IMPase and FBPase in a metal-dependent way, respectively. The two enzymes are almost indiscernible from each other because of their highly similar sequences and structures. Metal ions are bound to residues on the β1- and β2-strands and one mobile loop. However, FBP has another phosphate and FBPases exist as a higher oligomeric state, which may discriminate FBPases from IMPases. There are three genes annotated as FBPases in Zymomonas mobilis, termed also cbbF (ZmcbbF). The revealed crystal structure of one ZmcbbF shows a globular structure formed by five stacked layers. Twenty-five residues in the middle of the sequence form an α-helix and a β-strand, which occupy one side of the catalytic site. A non-polar Leu residue among them is protruded to the active site, pointing out unfavorable access of a bulky charged group to this side. In vitro assays have shown its dimeric form in solution. Interestingly, two β-strands of β1 and β2 are disordered in the ZmcbbF structure. These data indicate that ZmcbbF might structurally belong to IMPase, and imply that its active site would be reorganized in a yet unreported way.

  10. The human sorbitol dehydrogenase gene: cDNA cloning, sequence determination, and mapping by fluorescence in situ hybridization

    SciTech Connect

    Lee, F.K.; Chung, S. ); Cheung, M.C. )


    The cDNA for human sorbitol dehydrogenase (SORD) has been cloned and sequenced. It translates into a peptide of 356 amino acid residues, one more than the sequence previously reported from peptide analysis. An extra alanine was found at the acetyl-blocked N-terminal, between positions 1 and 4. This matches the rat cDNA, which also has 356 amino acids, with an extra proline at position 3. Four other mismatches were also observed, but these are all amino acid substitutions that occur outside proposed functionally important regions. Further work must be performed to determine whether these discrepancies represent polymorphic forms of the enzyme. The SORD gene was mapped by fluorescence in situ hybridization and found to occupy a single site on chromosome 15q15, indicating that it is a single-copy gene. This was confirmed by Southern blot hybridization. SORD is thought to be involved in the etiology of diabetic complications, and its deficiency has been linked to congenital cataracts. The cloned gene could be used as a probe to study the role of this enzyme in the pathogenesis of these diseases. 24 refs., 4 figs.

  11. Human uroporphyrinogen III synthase: Molecular cloning, nucleotide sequence, and expression of a full-length cDNA

    SciTech Connect

    Tsai, Shihfeng; Bishop, D.F.; Desnick, R.J. )


    Uroporphyrinogen III synthase, the fourth enzyme in the heme biosynthetic pathway, is responsible for conversion of the linear tetrapyrrole, hydroxymethylbilane, to the cyclic tetrapyrrole, uroporphyrinogen III. The deficient activity of URO-synthase is the enzymatic defect in the autosomal recessive disorder congenital erythropoietic porphyria. To facilitate the isolation of a full-length cDNA for human URO-synthase, the human erythrocyte enzyme was purified to homogeneity and 81 nonoverlapping amino acids were determined by microsequencing the N terminus and four tryptic peptides. Two synthetic oligonucleotide mixtures were used to screen 1.2 {times} 10{sup 6} recombinants from a human adult liver cDNA library. Eight clones were positive with both oligonucleotide mixtures. Of these, dideoxy sequencing of the 1.3 kilobase insert from clone pUROS-2 revealed 5' and 3' untranslated sequences of 196 and 284 base pairs, respectively, and an open reading frame of 798 base pairs encoding a protein of 265 amino acids with a predicted molecular mass of 28,607 Da. The isolation and expression of this full-length cDNA for human URO-synthase should facilitate studies of the structure, organization, and chromosomal localization of this heme biosynthetic gene as well as the characterization of the molecular lesions causing congenital erythropoietic porphyria.

  12. DNA sequences and composition from 12 BAC clones-derived MUSB SSR markers mapped to cotton (Gossypium Hirsutum L. x G. Barbadense L.)chromosomes 11 and 21

    Technology Transfer Automated Retrieval System (TEKTRAN)

    To discover resistance (R) and/or pathogen-induced (PR) genes involved in disease response, 12 bacterial artificial chromosome (BAC) clones from cv. Acala Maxxa (G. hirsutum) were sequenced at the Clemson University, Genomics Institute, Clemson, SC. These BACs derived MUSB single sequence repeat (SS...

  13. Evolution of translational elongation factor (EF) sequences: reliability of global phylogenies inferred from EF-1 alpha(Tu) and EF-2(G) proteins.

    PubMed Central

    Creti, R; Ceccarelli, E; Bocchetta, M; Sanangelantoni, A M; Tiboni, O; Palm, P; Cammarano, P


    The EF-2 coding genes of the Archaea Pyrococcus woesei and Desulfurococcus mobilis were cloned and sequenced. Global phylogenies were inferred by alternative tree-making methods from available EF-2(G) sequence data and contrasted with phylogenies constructed from the more conserved but shorter EF-1 alpha(Tu) sequences. Both the monophyly (sensu Hennig) of Archaea and their subdivision into the kingdoms Crenarchaeota and Euryarchaeota are consistently inferred by analysis of EF-2(G) sequences, usually at a high bootstrap confidence level. In contrast, EF-1 alpha(Tu) phylogenies tend to be inconsistent with one another and show low bootstrap confidence levels. While evolutionary distance and DNA maximum parsimony analyses of EF-1 alpha(Tu) sequences do show archaeal monophyly, protein parsimony and DNA maximum-likelihood analyses of these data do not. In no case, however, do any of the tree topologies inferred from EF-1 alpha(Tu) sequence analyses receive significant bootstrap support. PMID:8159735

  14. Cloning and sequencing of a molluscan endo-beta-1,4-glucanase gene from the blue mussel, Mytilus edulis.


    Xu, B; Janson, J C; Sellos, D


    Using polymerase chain reaction, cloning and sequencing techniques, a complementary DNA encoding a low molecular mass cellulase (endo-1,4-beta-D-glucanase, EC has been identified in the digestive gland of the marine mussel, Mytilus edulis. It contains a 5' untranslated region, a 633-nucleotide ORF encoding a 211 amino-acid protein, including a 17 amino-acid signal peptide and a complete 3' untranslated region. At the C-terminal end of the purified mature protein, a 13 amino-acid peptide is lacking in comparison to the protein sequence deduced from the ORF. This peptide is probably removed as a consequence of post-translational amidation of the C-terminal glutamine. The endoglucanase genes have been isolated and sequenced from both Swedish and French mussels. The coding parts of these two sequences are identical. Both genes contain two introns, the positions of which are conserved. However the length of the introns are different due to base substitutions, insertions or deletions showing the existence of interspecies length polymorphism. The percentage of similarity for the introns of the two gene sequences is 96.9%. This is the first time a molluscan cellulase is characterized at DNA level. Amino acid sequence-based classification has revealed that the enzyme belongs to the glycosyl hydrolase family 45 [B. Henrissat (Centre de Recherches sur les Macromolecules Végétales, CNRS, Joseph Fourier Université, Grenoble, France), personal communication]. There is no cellulose binding domain associated with the sequence.

  15. Amino acid substitutions in genetic variants of human serum albumin and in sequences inferred from molecular cloning

    SciTech Connect

    Takahashi, N.; Takahashi, Y.; Blumberg, B.S.; Putnam, F.W.


    The structural changes in four genetic variants of human serum albumin were analyzed by tandem high-pressure liquid chromatography (HPLC) of the tryptic peptides, HPLC mapping and isoelectric focusing of the CNBr fragments, and amino acid sequence analysis of the purified peptides. Lysine-372 of normal (common) albumin A was changed to glutamic acid both in albumin Naskapi, a widespread polymorphic variant of North American Indians, and in albumin Mersin found in Eti Turks. The two variants also exhibited anomalous migration in NaDodSO/sub 4//PAGE, which is attributed to a conformational change. The identity of albumins Naskapi and Mersin may have originated through descent from a common mid-Asiatic founder of the two migrating ethnic groups, or it may represent identical but independent mutations of the albumin gene. In albumin Adana, from Eti Turks, the substitution site was not identified but was localized to the region from positions 447 through 548. The substitution of aspartic acid-550 by glycine was found in albumin Mexico-2 from four individuals of the Pima tribe. Although only single-point substitutions have been found in these and in certain other genetic variants of human albumin, five differences exist in the amino acid sequences inferred from cDNA sequences by workers in three other laboratories. However, our results on albumin A and on 14 different genetic variants accord with the amino acid sequence of albumin deduced from the genomic sequence. The apparent amino acid substitutions inferred from comparison of individual cDNA sequences probably reflect artifacts in cloning or in cDNA sequence analysis rather than polymorphism of the coding sections of the albumin gene.

  16. Cloning and sequence analysis of a cDNA encoding a Brazil nut protein exceptionally rich in methionine.


    Altenbach, S B; Pearson, K W; Leung, F W; Sun, S S


    The primary amino acid sequence of an abundant methionine-rich seed protein found in Brazil nut (Bertholletia excelsa H.B.K.) has been elucidated by protein sequencing and from the nucleotide sequence of cDNA clones. The 9 kDa subunit of this protein was found to contain 77 amino acids of which 14 were methionine (18%) and 6 were cysteine (8%). Over half of the methionine residues in this subunit are clustered in two regions of the polypeptide where they are interspersed with arginine residues. In one of these regions, methionine residues account for 5 out of 6 amino acids and four of these methionine residues are contiguous. The sequence data verifies that the Brazil nut sulfur-rich protein is synthesized as a precursor polypeptide that is considerably larger than either of the two subunits of the mature protein. Three proteolytic processing steps by which the encoded polypeptide is sequentially trimmed to the 9 kDa and 3 kDa subunit polypeptides have been correlated with the sequence information. In addition, we have found that the sulfur-rich protein from Brazil nut is homologous in its amino acid sequence to small water-soluble proteins found in two other oilseeds, castor bean (Ricinus communis) and rapeseed (Brassica napus). When the amino acid sequences of these three proteins are aligned to maximize homology, the arrangement of cysteine residues is conserved. However, the two subunits of the Brazil nut protein contain over 19% methionine whereas the homologous proteins from castor bean and rapeseed contain only 2.1% and 2.6% methionine, respectively.

  17. Single-Cell Analysis and Next-Generation Immuno-Sequencing Show That Multiple Clones Persist in Patients with Chronic Lymphocytic Leukemia.


    Kriangkum, Jitra; Motz, Sarah N; Mack, Tanner; Beiggi, Sara; Baigorri, Eva; Kuppusamy, Hemalatha; Belch, Andrew R; Johnston, James B; Pilarski, Linda M


    The immunoglobulin heavy chain (IGH) gene rearrangement in chronic lymphocytic leukemia (CLL) provides a unique molecular signature; however, we demonstrate that 26/198 CLL patients (13%) had more than one IGH rearrangement, indicating the power of molecular technology over phenotypic analysis. Single-cell PCR analysis and next-generation immuno-sequencing identified IGH-defined clones. In 23% (18/79) of cases whose clones carried unmutated immunoglobulin heavy chain variable (IGHV) genes (U-CLL), IGH rearrangements were bialleic with one productive (P) and one non-productive (NP) allele. Two U-CLL were biclonal, each clone being monoallelic (P). In 119 IGHV-mutated (M-CLL) cases, one had biallelic rearrangements in their CLL (P/NP) and five had 2-4 distinct clones. Allelic exclusion was maintained in all B-clones analyzed. Based on single-cell PCR analysis, 5/11 partner clones (45%) reached levels of >5x10(9) cells/L, suggesting second CLL clones. Partner clones persisted over years. Conventional IGH characterization and next-generation sequencing of 13 CLL, 3 multiple myeloma, 2 Waldenstrom's macroglobulinemia and 3 age-matched healthy donors consistently identified the same rearranged IGH sequences. Most multiple clones occurred in M-CLL, perhaps indicative of weak clonal dominance, thereby associating with a good prognosis. In contrast, biallelic CLL occurred primarily in U-CLL thus being associated with poor prognosis. Extending beyond intra-clonal diversity, molecular analysis of clonal evolution and apparent subclones in CLL may also reflect inter-clonal diversity.

  18. Cloning and sequence analysis of the gene encoding isocitrate lyase from Rhodococcus fascians.


    Vereecke, D; Villarroel, R; Van Montagu, M; Desomer, J


    An isocitrate lyase (Icl)-encoding gene (icl) from the Gram+ plant pathogen Rhodococcus fascians was identified serendipitously as part of a scrambled fragment after shotgun cloning in the promoter probe vector, pDP1. The Icl protein is 429 amino acids long (47.11 kDa) and has a predicted pI of 4.84; it is 54% similar to the Escherichia coli Icl and 24-27% to eukaryotic homologues. Comparison of the prokaryotic and eukaryotic Icl confirms the earlier proposal of Matsuoka and McFadden [J. Bacteriol. 143 (1988) 4528-4536] that the enzyme has enlarged during evolution.

  19. Molecular cloning and organization of two leghaemoglobin genomic sequences of soybean

    NASA Astrophysics Data System (ADS)

    Sullivan, D.; Brisson, N.; Goodchild, B.; Verma, D. P. S.


    The leghaemoglobins (Lb) are myoglobin-like proteins found in all nitrogen-fixing root nodules of legumes1-3. They are encoded by plant nuclear genes4 which are specifically induced and form the predominant protein in nodules developed in symbiosis with the appropriate species of Rhizobium. The Lb is located in the host-cell cytoplasm of the infected cell5 and is thought to facilitate oxygen diffusion6,7. Amino acid sequencing of the soybean Lbs has revealed at least four primary structures differing only in a few amino acids8-10. We have previously estimated about 40 copies of Lb sequences in the soybean (Glycine max L.) genome by cDNA hybridization4. To investigate Lb gene organization and function, we prepared and characterized a Lb cDNA recombinant molecule, pLb1, and used it to isolate two genomic Lb sequences from a library constructed in Charon 4. We report here that the organization of the two genomic Lb sequences is quite distinct and one of them seems to have an intervening sequence(s). Hybridization of pLb1 with genomic DNA from various tissues showed that Lb sequences are dispersed through more than 30 kilobases of genomic DNA and that there is no apparent sequence rearrangement or methylation changes following induction of Lb genes.

  20. Investigation of bacterial and archaeal communities: novel protocols using modern sequencing by Illumina MiSeq and traditional DGGE-cloning.


    Kraková, Lucia; Šoltys, Katarína; Budiš, Jaroslav; Grivalský, Tomáš; Ďuriš, František; Pangallo, Domenico; Szemes, Tomáš


    Different protocols based on Illumina high-throughput DNA sequencing and denaturing gradient gel electrophoresis (DGGE)-cloning were developed and applied for investigating hot spring related samples. The study was focused on three target genes: archaeal and bacterial 16S rRNA and mcrA of methanogenic microflora. Shorter read lengths of the currently most popular technology of sequencing by Illumina do not allow analysis of the complete 16S rRNA region, or of longer gene fragments, as was the case of Sanger sequencing. Here, we demonstrate that there is no need for special indexed or tailed primer sets dedicated to short variable regions of 16S rRNA since the presented approach allows the analysis of complete bacterial 16S rRNA amplicons (V1-V9) and longer archaeal 16S rRNA and mcrA sequences. Sample augmented with transposon is represented by a set of approximately 300 bp long fragments that can be easily sequenced by Illumina MiSeq. Furthermore, a low proportion of chimeric sequences was observed. DGGE-cloning based strategies were performed combining semi-nested PCR, DGGE and clone library construction. Comparing both investigation methods, a certain degree of complementarity was observed confirming that the DGGE-cloning approach is not obsolete. Novel protocols were created for several types of laboratories, utilizing the traditional DGGE technique or using the most modern Illumina sequencing.

  1. Cloning, expression, and sequence analysis of the Haemophilus influenzae type b strain M43p+ pilin gene.

    PubMed Central

    Gilsdorf, J R; Marrs, C F; McCrea, K W; Forney, L J


    By using antiserum against Haemophilus influenzae type b (Hib) strain M43p+ denatured pilin, we screened a genomic library of Hib strain M43p+ and identified a clone that expressed pilin, but not assembled pili, on its surface. Southern blot analysis revealed the presence of one structural gene, which was also present in strain M42p-, a nonpiliated variant. Five exonuclease III deletion mutants, two of which had deletions that extended into the structural gene and failed to express pilin, were used to obtain the nucleotide sequence of the structural gene. The amino acid sequence of the open reading frame agrees with 38 of 40 amino acids from the published sequence of purified Hib M43p+ pilin. The pilin gene coded for a mature protein of 193 amino acids, with a calculated molecular mass of 21,101 daltons. Comparison of the Hib M43p+ pilin amino acid sequence with those of pilins of other bacteria revealed strong conservation of amino- and carboxy-terminal regions in M43p+ and Escherichia coli F17, type 1C, and several members of the P pili family, as well as Klebsiella pneumoniae type 3 MR/K, Bordetella pertussis serotype 2, and Serratia marcescens US46 fimbriae. Images PMID:1969389

  2. [Cloning of full-length coding sequence of tree shrew CD4 and prediction of its molecular characteristics].


    Tian, Wei-Wei; Gao, Yue-Dong; Guo, Yan; Huang, Jing-Fei; Xiao, Chang; Li, Zuo-Sheng; Zhang, Hua-Tang


    The tree shrews, as an ideal animal model receiving extensive attentions to human disease research, demands essential research tools, in particular cellular markers and monoclonal antibodies for immunological studies. In this paper, a 1 365 bp of the full-length CD4 cDNA encoding sequence was cloned from total RNA in peripheral blood of tree shrews, the sequence completes two unknown fragment gaps of tree shrews predicted CD4 cDNA in the GenBank database, and its molecular characteristics were analyzed compared with other mammals by using biology software such as Clustal W2.0 and so forth. The results showed that the extracellular and intracellular domains of tree shrews CD4 amino acid sequence are conserved. The tree shrews CD4 amino acid sequence showed a close genetic relationship with Homo sapiens and Macaca mulatta. Most regions of the tree shrews CD4 molecule surface showed positive charges as humans. However, compared with CD4 extracellular domain D1 of human, CD4 D1 surface of tree shrews showed more negative charges, and more two N-glycosylation sites, which may affect antibody binding. This study provides a theoretical basis for the preparation and functional studies of CD4 monoclonal antibody.

  3. Cloning, sequencing, expression and structural investigation of mnemiopsin from Mnemiopsis leidyi: an attempt toward understanding Ca2+-regulated photoproteins.


    Aghamaali, Mahmoud Reza; Jafarian, Vahab; Sariri, Reyhaneh; Molakarimi, Maryam; Rasti, Behnam; Taghdir, Majid; Sajedi, Reza Hasan; Hosseinkhani, Saman


    A comparison of the two most famous groups of calcium-regulated photoproteins, cnidarians and ctenophores, showed unexpectedly high degree of structural similarity regardless of their low sequence identity. It was suggested these photoproteins can play an important role in understanding the structural basis of bioluminescence activity. Based on this postulate, in this study the cDNA of mnemiopsin from luminous ctenophore Mnemiopsis leidyi was cloned, expressed, purified and sequenced. The purified cDNA, with 621 base pairs, coded a 206 residues protein. Sequence of mnemiopsin showed 93.5 and 51% similarity to other ctenophore proteins and cnidarians, respectively. The cDNA encoding apo-mnemiopsin of M. leidyi was expressed in Escherichia coli. The purified apo-protein showed a single band on SDS-PAGE (molecular weight ~27 kDa). A semi-synthetic mnemiopsin was prepared using coelenterazine and EDTA and its luminescence activity was measured in the presence of CaCl(2). The results showed an optimum pH of 9.0 and lower calcium sensitivity compared to aequorin. Comparison of amino acid residues in substrate binding site indicated that binding pocket of ctenophores contains less aromatic residues than cnidarians. This can lead to a decline in the number of stacking interactions between substrate and protein which can affect the stability of coelenterazine in binding cavity. Structural comparison of photoproteins with low sequence identity and high 3D structural similarity, can present a new insight into the mechanism of light emission in photoproteins.

  4. Molecular cloning and sequencing of a cDNA encoding the thioesterase domain of the rat fatty acid synthetase.


    Naggert, J; Witkowski, A; Mikkelsen, J; Smith, S


    A cloned cDNA containing the entire coding sequence for the long-chain S-acyl fatty acid synthetase thioester hydrolase (thioesterase I) component as well as the 3'-noncoding region of the fatty acid synthetase has been isolated using an expression vector and domain-specific antibodies. The coding region was assigned to the thioesterase I domain by identification of sequences coding for characterized peptide fragments, amino-terminal analysis of the isolated thioesterase I domain and the presence of the serine esterase active-site sequence motif. The thioesterase I domain is 306 amino acids long with a calculated molecular mass of 33,476 daltons; its DNA is flanked at the 5'-end by a region coding for the acyl carrier protein domain and at the 3'-end by a 1,537-base pairs-long noncoding sequence with a poly(A) tail. The thioesterase I domain exhibits a low, albeit discernible, homology with the discrete medium-chain S-acyl fatty acid synthetase thioester hydrolases (thioesterase II) from rat mammary gland and duck uropygial gland, suggesting a distant but common evolutionary ancestry for these proteins.

  5. Cloning and sequencing of a putative Escherichia coli [NiFe] hydrogenase-1 operon containing six open reading frames.

    PubMed Central

    Menon, N K; Robbins, J; Peck, H D; Chatelus, C Y; Choi, E S; Przybyla, A E


    DNA encompassing the structural genes of an Escherichia coli [NiFe] hydrogenase has been cloned and sequenced. The genes were identified as those encoding the large and small subunits of hydrogenase isozyme 1 based on NH2-terminal sequences of purified subunits (kindly provided by K. Francis and K. T. Shanmugam). The structural genes formed part of a putative operon that contained four additional open reading frames. We have designated the operon hya and the six open reading frames hyaA through F. hyaA and hyaB encode the small and large structural subunits, respectively. The nucleotide-derived amino acid sequence of hyaC has a calculated molecular mass of 27.6 kilodaltons, contains 20% aromatic residues, and has four potential membrane-spanning regions. Open reading frames hyaD through F could encode polypeptides of 21.5, 14.9, and 31.5 kilodaltons, respectively. These putative peptides have no homology to other reported protein sequences, and their functions are unknown. Images FIG. 2 FIG. 3 PMID:2180913

  6. Molecular cloning and sequence analysis of a novel chalcone synthase cDNA from Ginkgo biloba.


    Pang, Yongzhen; Shen, Guo-An; Liu, Chenghong; Liu, Xiaojun; Tan, Feng; Sun, Xiaofen; Tang, Kexuan


    A chalcone synthase (CHS) gene was cloned from Ginkgo biloba for the first time and it was also the first cloned gene involved in flavonoids metabolic pathway in G. biloba. The full-length cDNA of G. biloba CHS (designated as Gbchs) was 1608bp with poly(A) tailing and it contained a 1173bp open reading frame (ORF) encoding a 391 amino acid protein. Gbchs was found to have extensive homology with those of other plant chs genes via multiple alignments. The active sites of the CoA binding, coumaroyl pocket and cyclization pocket in CHS protein of Medicago sativa were also found in GbCHS. Molecular modeling of GbCHS indicated that the three-dimensional structure of GbCHS strongly resembled that of M. sativa (MsCHS2), implying GbCHS may have similar functions with MsCHS2. Phylogenetic tree analysis revealed that GbCHS had closer relationship with CHSs from gymnosperm plants than from other plants. Gbchs is a useful tool to study the regulation of flavonoids metabolism in G. biloba.

  7. Cloning and comparative mapping of a human chromosome 4-specific alpha satellite DNA sequence

    SciTech Connect

    D'Aiuto, L.; Marzella, R.; Archidiacono, N.; Rocchi, M. ); Antonacci, R. )


    The authors have isolated and characterized two human alphoid DNA clones: p4n1/4 and pZ4.1. Clone p4n1/4 identifies specifically the centromeric region of chromosome 4; pZ4.1 recognizes a subset of alphoid DNA shared by chromosomes 4 and 9. The specificity was determined using fluorescence in situ hybridization experiments on metaphase spreads and Southern blotting analysis of human-hamster somatic cell hybrids. The genomic organization of both subsets was also investigated. Comparative mapping on chimpanzee and gorilla chromosomes was performed. p4n1/4 hybridizes to chimpanzee chromosomes 11 and 13, homologs of human chromosomes 9 and 2q, respectively. On gorilla metaphase spreads, p4n1/4 hybridizes exclusively to the centromeric region of chromosome 19, partially homologous to human chromosome 17. No hybridization signal was detected on chromosome 3 of both chimpanzee and gorilla, in both species homolog of human chromosome 4. Identical comparative mapping results were obtained using pZ4.1 probe, although the latter recognizes an alphoid subset distinct from the one recognized by p4n1/4. The implications of these results in the evolution of centromeric regions of primate chromosomes are discussed. 33 refs., 4 figs.

  8. Cloning and comparative mapping of a human chromosome 4-specific alpha satellite DNA sequence.


    D'Aiuto, L; Antonacci, R; Marzella, R; Archidiacono, N; Rocchi, M


    We have isolated and characterized two human alphoid DNA clones: p4n1/4 and pZ4.1. Clone p4n1/4 identifies specifically the centromeric region of chromosome 4; pZ4.1 recognizes a subset of alphoid DNA shared by chromosomes 4 and 9. The specificity was determined using fluorescence in situ hybridization experiments on metaphase spreads and Southern blotting analysis of human-hamster somatic cell hybrids. The genomic organization of both subsets was also investigated. Comparative mapping on chimpanzee and gorilla chromosomes was performed. p4n1/4 hybridizes to chimpanzee chromosomes 11 and 13, homologs of human chromosomes 9 and 2q, respectively. On gorilla metaphase spreads, p4n1/4 hybridizes exclusively to the centromeric region of chromosome 19, partially homologous to human chromosome 17. No hybridization signal was detected on chromosome 3 of both chimpanzee and gorilla, in both species homolog of human chromosome 4. Identical comparative mapping results were obtained using pZ4.1 probe, although the latter recognizes an alphoid subset distinct from the one recognized by p4n1/4. The implications of these results in the evolution of centromeric regions of primate chromosomes are discussed.

  9. Cloning, sequencing, and regulation of a xylanase gene from the fungus Aureobasidium pullulans Y-2311-1

    SciTech Connect

    Li, Xin-Liang; Ljungdahl, L.G.


    Aureobasidium pullulans Y-2311-1 growing on xylan secretes four major xylanases with different masses and isoelectric points. Two of these enzymes, named APX-I and APX-II, have been purified previously. Their N-terminal amino acid sequences are identical except that APX-I has Asp and APX-II has Asn at position 7. An 83-bp DNA region was amplified by PCR and used as a probe for the xylanase gene cloning. The longest cDNA (xynA) obtained by cDNA cloning and PCR amplification consisted of 895 bp. A. pullulans xynA had an open reading frame encoding a polypeptide of 221 amino acids with a calculated mass of 23,531 Da and contained a putative 34-amino-acid signal peptide in front of the amino terminus of the mature enzyme. Strong homology was found between the deduced amino acid sequence of XynA and some xylanases from bacterial and fungal sources. It is suggested that A. pullulans XynA belongs to the family G glycanases. Northern (RNA blot) analysis revealed that only one transcript of 900 bases was present in cultures grown in medium containing D-xylose or oat spelt xylan. Transcription was completely repressed in the presence of glucose in the medium. Southern blot analysis indicated that A. pullulans xynA was present as a single copy in the genome. Comparison between the genomic and cDNA sequences revealed that one intron of 59 bp was present in the coding region. The data presented suggest that the highly active xylanases, APX-I and APX-II, secreted by A. pullulans are encoded by the same gene. 36 refs., 7 figs., 3 tabs.

  10. Identification of cDNA clones encoding secretory isoenzyme forms: sequence determination of canine pancreatic prechymotrypsinogen 2 mRNA.

    PubMed Central

    Pinsky, S D; LaForge, K S; Luc, V; Scheele, G


    A cDNA library has been constructed from canine poly(A)+ mRNA. Clones containing cDNA inserts coding for prechymotrypsinogen 2 (isoelectric point = 7.1; Mr = 27,500), one of three canine pancreatic isoenzyme forms, were selected by colony hybridization using a cDNA probe synthesized from immunoselected prechymotrypsinogen 2 mRNA. To verify that cDNA clones code for prechymotrypsinogen 2 forms that translocate across rough endoplasmic reticulum membranes and fold into stable and identifiable secretory proteins, we conducted in vitro translation of hybrid-selected mRNA in the presence of microsomal membranes and optimal concentrations of glutathione and analyzed nascent translation products in their nonreduced state by two-dimensional isoelectric focusing/NaDodSO4 gel electrophoresis and fluorography. A near full-length chymotrypsinogen 2 cDNA and its primed extension were used to determine the nucleotide sequence for the entire coding region of prechymotrypsinogen 2 mRNA and 87 residues, including a poly(A) addition signal, in the 3' nontranslated region. The deduced amino acid sequence shows a 263-residue presecretory protein containing an 18-residue amino-terminal transport peptide (Met-Ala-Phe-Leu-Trp-Leu-Leu-Ser-Cys-Phe-Ala-Leu-Leu-Gly-Thr-Ala-Phe-Gly ), which we have previously shown to mediate the translocation of chymotrypsinogen 2 across the rough endoplasmic reticulum membrane. Following the transport peptide is a 245-residue proenzyme, which shows 82% and 80% sequence identity with bovine chymotrypsinogens A and B, respectively. Conserved among the three zymogens are 10 Cys residues that form five disulfide bonds in bovine chymotrypsinogens A and B and the residues that are required for zymogen activation, substrate binding, and catalytic activity. Images PMID:6584866

  11. Mining tissue-specific contigs from peanut (Arachis hypogaea L.) for promoter cloning by deep transcriptome sequencing.


    Geng, Lili; Duan, Xiaohong; Liang, Chun; Shu, Changlong; Song, Fuping; Zhang, Jie


    Peanut (Arachis hypogaea L.), one of the most important oil legumes in the world, is heavily damaged by white grubs. Tissue-specific promoters are needed to incorporate insect resistance genes into peanut by genetic transformation to control the subterranean pests. Transcriptome sequencing is the most effective way to analyze differential gene expression in this non-model species and contribute to promoter cloning. The transcriptomes of the roots, seeds and leaves of peanut were sequenced using Illumina technology. A simple digital expression profile was established based on number of transcripts per million clean tags (TPM) from different tissues. Subsequently, 584 root-specific candidate transcript assembly contigs (TACs) and 316 seed-specific candidate TACs were identified. Among these candidate TACs, 55.3% were root-specific and 64.6% were seed-specific by semi-quantitative RT-PCR analysis. Moreover, the consistency of semi-quantitative RT-PCR with the simple digital expression profile was correlated with the length and TPM value of TACs. The results of gene ontology showed that some root-specific TACs are involved in stress resistance and respond to auxin stimulus, whereas, seed-specific candidate TACs are involved in embryo development, lipid storage and long-chain fatty acid biosynthesis. One root-specific promoter was cloned and characterized. We developed a high-yield screening system in peanut by establishing a simple digital expression profile based on Illumina sequencing. The feasible and rapid method presented by this study can be used for other non-model crops to explore tissue-specific or spatially specific promoters.

  12. Serial Next Generation Sequencing of Circulating Cell Free DNA Evaluating Tumour Clone Response To Molecularly Targeted Drug Administration

    PubMed Central

    Frenel, Jean Sebastien; Carreira, Suzanne; Goodall, Jane; Roda, Desam; Perez-Lopez, Raquel; Tunariu, Nina; Riisnaes, Ruth; Miranda, Susana; Figueiredo, Ines; NavaRodrigues, Daniel; Smith, Alan; Leux, Christophe; Garcia-Murillas, Isaac; Ferraldeschi, Roberta; Lorente, David; Mateo, Joaquin; Ong, Michael; Yap, Timothy A; Banerji, Udai; Tandefelt, Delila Gasi; Turner, Nick; Attard, Gerhardt; de Bono, Johann S


    Background We evaluated whether next generation sequencing (NGS) of cfDNA could be used for patient selection and as a tumor clone response biomarker in patients with advanced cancers participating in early phase clinical trials of targeted drugs. Methods Plasma samples from patients with known tumor mutations who completed at least 2 courses of investigational targeted therapy were collected monthly, until disease progression. NGS was performed sequentially on the Ion Torrent PGM platform. Results cfDNA was extracted from 39 patients with various tumor types. Treatments administered targeted mailnly the PI3K-AKT-mTOR pathway (n=28) or MEK (n=7). Overall 159 plasma samples were sequenced with a mean sequencing coverage achieved of 1,685X across experiments. At trial initiation (C1D1), 23 of 39 (59%) patients had at least one mutation identified in cfDNA (mean 2, range 1-5). TP53, PIK3CA and KRAS were the top 3 mutated genes identified, with 16 (39%), 9 (22%) and 8 (17%) different mutations, respectively. Out of these 23 patients, 13 received a targeted drug matching their tumor profile. For the 23 patients with cfDNA mutation at C1D1, the monitoring of mutation allele frequency (AF) in consecutive plasma samples during treatment with targeted drugs demonstrated potential treatment associated clonal responses. Longitudinal monitoring of cfDNA samples with multiple mutations indicated the presence of separate clones behaving discordantly. Molecular changes at cfDNA mutation level were associated with time to disease progression by RECIST criteria. Conclusion Targeted NGS of cfDNA has potential clinical utility to monitor the delivery of targeted therapies. PMID:26085511

  13. Nucleotide sequence and taxonomical distribution of the bacteriocin gene lin cloned from Brevibacterium linens M18.


    Valdes-Stauber, N; Scherer, S


    Linocin M18 is an antilisterial bacteriocin produced by the red smear cheese bacterium Brevibacterium linens M18. Oligonucleotide probes based on the N-terminal amino acid sequence were used to locate its single copy gene, lin, on the chromosomal DNA. The amino acid composition, N-terminal sequence, and molecular mass derived from the nucleotide sequence of an open reading frame of 798 nucleotides coding for 266 amino acids found on a 3-kb BamHI restriction fragment correspond closely to those obtained from the purified protein (N. Valdés-Stauber and S. Scherer, Appl. Environ. Microbiol. 60:3809-3814, 1994). No sequence homology to any protein or nucleotide sequences deposited in databases was found. Comparison of the nucleotide sequence and the N-terminal amino acid sequence derived from the protein suggests that B. linens M18 produces an N-formyl-methionyl-CAC tRNA. A wide taxonomical distribution of the gene within coryneform bacteria has been demonstrated by PCR amplification. The structural gene from linocin M18 is present at least in three Brevibacterium species, five Arthrobacter species, and five Corynebacterium species.

  14. Cloning and sequencing of the gene encoding glutamine synthetase I from the archaeum Pyrococcus woesei: anomalous phylogenies inferred from analysis of archaeal and bacterial glutamine synthetase I sequences.

    PubMed Central

    Tiboni, O; Cammarano, P; Sanangelantoni, A M


    The gene glnA encoding glutamine synthetase I (GSI) from the archaeum Pyrococcus woesei was cloned and sequenced with the Sulfolobus solfataricus glnA gene as the probe. An operon reading frame of 448 amino acids was identified within a DNA segment of 1,528 bp. The encoded protein was 49% identical with the GSI of Methanococcus voltae and exhibited conserved regions characteristic of the GSI family. The P. woesei GSI was aligned with available homologs from other archaea (S. solfataricus, M. voltae) and with representative sequences from cyanobacteria, proteobacteria, and gram-positive bacteria. Phylogenetic trees were constructed from both the amino acid and the nucleotide sequence alignments. In accordance with the sequence similarities, archaeal and bacterial sequences did not segregate on a phylogeny. On the basis of sequence signatures, the GSI trees could be subdivided into two ensembles. One encompassed the GSI of cyanobacteria and proteobacteria, but also that of the high-G + C gram-positive bacterium Streptomyces coelicolor (all of which are regulated by the reversible adenylylation of the enzyme subunits); the other embraced the GSI of the three archaea as well as that of the low-G + C gram-positive bacteria (Clostridium acetobutilycum, Bacillus subtilis) and Thermotoga maritima (none of which are regulated by subunit adenylylation). The GSIs of the Thermotoga and the Bacillus-Clostridium lineages shared a direct common ancestor with that of P. woesei and the methanogens and were unrelated to their homologs from cyanobacteria, proteobacteria, and S. coelicolor. The possibility is presented that the GSI gene arose among the archaea and was then laterally transferred from some early methanogen to a Thermotoga-like organism. However, the relationship of the cyanobacterial-proteobacterial GSIs to the Thermotoga GSI and the GSI of low-G+C gram-positive bacteria remains unexplained. PMID:8098326

  15. Analysis of a cDNA clone expressing a human autoimmune antigen: full-length sequence of the U2 small nuclear RNA-associated B antigen

    SciTech Connect

    Habets, W.J.; Sillekens, P.T.G.; Hoet, M.H.; Schalken, J.A.; Roebroek, A.J.M.; Leunissen, J.A.M.; Van de Ven, W.J.M.; Van Venrooij, W.J.


    A U2 small nuclear RNA-associated protein, designated B'', was recently identified as the target antigen for autoimmune sera from certain patients with systemic lupus erythematosus and other rheumatic diseases. Such antibodies enabled them to isolate cDNA clone lambdaHB''-1 from a phage lambdagt11 expression library. This clone appeared to code for the B'' protein as established by in vitro translation of hybrid-selected mRNA. The identity of clone lambdaHB''-1 was further confirmed by partial peptide mapping and analysis of the reactivity of the recombinant antigen with monospecific and monoclonal antibodies. Analysis of the nucleotide sequence of the 1015-base-pair cDNA insert of clone lambdaHB''-1 revealed a large open reading frame of 800 nucleotides containing the coding sequence for a polypeptide of 25,457 daltons. In vitro transcription of the lambdaHB''-1 cDNA insert and subsequent translation resulted in a protein product with the molecular size of the B'' protein. These data demonstrate that clone lambdaHB''-1 contains the complete coding sequence of this antigen. The deduced polypeptide sequence contains three very hydrophilic regions that might constitute RNA binding sites and/or antigenic determinants. These findings might have implications both for the understanding of the pathogenesis of rheumatic diseases as well as for the elucidation of the biological function of autoimmune antigens.

  16. cDNA, genomic sequence cloning and overexpression of ribosomal protein S25 gene (RPS25) from the Giant Panda.


    Hao, Yan-Zhe; Hou, Wan-Ru; Hou, Yi-Ling; Du, Yu-Jie; Zhang, Tian; Peng, Zheng-Song


    RPS25 is a component of the 40S small ribosomal subunit encoded by RPS25 gene, which is specific to eukaryotes. Studies in reference to RPS25 gene from animals were handful. The Giant Panda (Ailuropoda melanoleuca), known as a "living fossil", are increasingly concerned by the world community. Studies on RPS25 of the Giant Panda could provide scientific data for inquiring into the hereditary traits of the gene and formulating the protective strategy for the Giant Panda. The cDNA of the RPS25 cloned from Giant Panda is 436 bp in size, containing an open reading frame of 378 bp encoding 125 amino acids. The length of the genomic sequence is 1,992 bp, which was found to possess four exons and three introns. Alignment analysis indicated that the nucleotide sequence of the coding sequence shows a high homology to those of Homo sapiens, Bos taurus, Mus musculus and Rattus norvegicus as determined by Blast analysis, 92.6, 94.4, 89.2 and 91.5%, respectively. Primary structure analysis revealed that the molecular weight of the putative RPS25 protein is 13.7421 kDa with a theoretical pI 10.12. Topology prediction showed there is one N-glycosylation site, one cAMP and cGMP-dependent protein kinase phosphorylation site, two Protein kinase C phosphorylation sites and one Tyrosine kinase phosphorylation site in the RPS25 protein of the Giant Panda. The RPS25 gene was overexpressed in E. coli BL21 and Western Blotting of the RPS25 protein was also done. The results indicated that the RPS25 gene can be really expressed in E. coli and the RPS25 protein fusioned with the N-terminally his-tagged form gave rise to the accumulation of an expected 17.4 kDa polypeptide. The cDNA and the genomic sequence of RPS25 were cloned successfully for the first time from the Giant Panda using RT-PCR technology and Touchdown-PCR, respectively, which were both sequenced and analyzed preliminarily; then the cDNA of the RPS25 gene was overexpressed in E. coli BL21 and immunoblotted, which is the first

  17. Completion sequence and cloning of the infectious cDNA of a chb isolate of cucumber green mottle mosaic virus.


    Zhong, M; Zhao, X; Liu, Y; Wang, Y; Cao, K


    Cucumber green mottle mosaic virus (CGMMV) is an important and widespread seed-borne virus that infects Cucurbitaceous plants. It is a member of the genus Tobamovirus in the family Virgaviridae with a monopartite (+) ssRNA genome. Here we report the complete genome sequence, construction and testing of the infectious clones of a chb isolate of CGMMV. Full-length CGMMV cDNA was cloned into the vector pUC19. The linearized vector containing full-length cDNA was used as template for in vitro transcription, and the synthesized capped transcript was highly infectious in Chenopodium amaranticolor and cucumber (Cucumis sativus). Inoculated plants showed symptoms typical of CGMMV infection. The infectivity was confirmed by mechanical transmission to new plants, RT-PCR and western blot. Progeny virus derived from infectious transcripts had the same biological and biochemical properties as wild-type virus. To our knowledge, this is the first detailed report of a biologically active transcript from CGMMV.

  18. Analysis of a cloned colicin Ib gene: complete nucleotide sequence and implications for regulation of expression.

    PubMed Central

    Varley, J M; Boulnois, G J


    The complete nucleotide sequence of a 2,971 base pair EcoRI fragment carrying the structural gene for colicin Ib has been determined. The length of the gene is 1,881 nucleotides which is predicted to produce a protein of 626 amino acids and of molecular weight 71,364. The structural gene is flanked by likely promoter and terminator signals and in between the promoter and the ribosome binding site is an inverted repeat sequence which resembles other sequences known to bind the LexA protein. Further analysis of the 5' flanking sequences revealed a second region which may act either as a second LexA binding site and/or in the binding of cyclic AMP receptor protein. Comparison of the predicted amino acid sequence of colicin Ib with that of colicins A and E1 reveals localised homology. The implications of these similarities in the proteins and of regulation of the colicin Ib structural gene are discussed. Images PMID:6091036

  19. [Analysis of the molecular characteristics and cloning of full-length coding sequence of interleukin-2 in tree shrews].


    Huang, Xiao-Yan; Li, Ming-Li; Xu, Juan; Gao, Yue-Dong; Wang, Wen-Guang; Yin, An-Guo; Li, Xiao-Fei; Sun, Xiao-Mei; Xia, Xue-Shan; Dai, Jie-Jie


    While the tree shrew (Tupaia belangeri chinensis) is an excellent animal model for studying the mechanisms of human diseases, but few studies examine interleukin-2 (IL-2), an important immune factor in disease model evaluation. In this study, a 465 bp of the full-length IL-2 cDNA encoding sequence was cloned from the RNA of tree shrew spleen lymphocytes, which were then cultivated and stimulated with ConA (concanavalin). Clustal W 2.0 was used to compare and analyze the sequence and molecular characteristics, and establish the similarity of the overall structure of IL-2 between tree shrews and other mammals. The homology of the IL-2 nucleotide sequence between tree shrews and humans was 93%, and the amino acid homology was 80%. The phylogenetic tree results, derived through the Neighbour-Joining method using MEGA5.0, indicated a close genetic relationship between tree shrews, Homo sapiens, and Macaca mulatta. The three-dimensional structure analysis showed that the surface charges in most regions of tree shrew IL-2 were similar to between tree shrews and humans; however, the N-glycosylation sites and local structures were different, which may affect antibody binding. These results provide a fundamental basis for the future study of IL-2 monoclonal antibody in tree shrews, thereby improving their utility as a model.

  20. Cloning, sequence analysis and expression of the F1F0-ATPase beta-subunit from wine lactic acid bacteria.


    Sievers, Martin; Uermösi, Christina; Fehlmann, Marc; Krieger, Sibylle


    The nucleotide sequences of the genes encoding the F1F0-ATPase beta-subunit from Oenococcus oeni, Leuconostoc mesenteroides subsp. mesenteroides, Pediococcus damnosus, Pediococcus parvulus, Lactobacillus brevis and Lactobacillus hilgardii were determined. Their deduced amino acid sequences showed homology values of 79-98%. Data from the alignment and ATPase tree indicated that O. oeni and L. mesenteroides subsp. mesenteroides formed a group well-separated from P. damnosus and P. parvulus and from the group comprises L. brevis and L. hilgardii. The N-terminus of the F1F0-ATPase beta-subunit of O. oeni contains a stretch of additional 38 amino acid residues. The catalytic site of the ATPase beta-subunit of the investigated strains is characterized by the two conserved motifs GGAGVGKT and GERTRE. The amplified atpD coding sequences were inserted into the pCRT7/CT-TOPO vector using TA-cloning strategy and transformed in Escherichia coli. SDS-PAGE and Western blot analyses confirmed that O. oeni has an ATPase beta-subunit protein which is larger in size than the corresponding molecules from the investigated strains.

  1. Cloning, sequence identification and expression profile analysis of α-L-fucosidase gene from the Mediterranean fruit fly Ceratitis capitata.


    Intra, Jari; Perotti, Maria-Elisa; Pasini, Maria Enrica


    The Mediterranean fruit fly Ceratitis capitata (Diptera: Tephritidae) is one of the most destructive agricultural pests, a polyphagus insect of relevant economic importance and is widespread in many regions around the world. It is the best-studied fruit fly pest at genetic and molecular level and much has been learned on its ecology and behaviour. An α-L-fucosidase has been recently hypothesized to be involved in sperm-egg interactions in Drosophila melanogaster and in other Drosophila species. Here, a complete cDNA encoding a putative α-L-fucosidase of the medfly was amplified using the reverse polymerase chain reaction (RT-PCR) with degenerate based on the conserved coding sequence information of several insect α-L-fucosidases, cloned and sequenced (GenBank accession no. FJ177429). The coding region consisted of 1482 bp which encoded a 485-residues protein (named CcFUCA) with a predicted molecular mass of 56.1 kDa. The deduced protein sequence showed 75% amino acid identity to D. melanogaster α-L-fucosidase, and in fact the phylogenetic tree analysis revealed that CcFUCA had closer relationships with the α-L-fucosidases of drosophilid species. The tissue expression analysis indicated that CcFuca was expressed in a single transcript in all tissues, suggesting a ubiquitous localization pattern of the encoded protein. Our findings provide novel insights on a gene encoding a protein potentially involved in primary gamete interactions in C. capitata.

  2. Molecular cloning, sequence analysis and expression of Fein-Penaeidin from the haemocytes of Indian white shrimp Fenneropenaeus indicus.


    Vaseeharan, Baskaralingam; Shanthi, Sathappan; Chen, Jiann-Chu; Espiñeira, Montserrat


    Penaeidins are members of a special family of antimicrobial peptide existing in penaeid shrimp and play an important role in the immunological defense of shrimp. Here, we report a penaeidin sequence cloned from the Indian white shrimp Fenneropenaus indicus (Fein-Penaeidin). The Fein-Penaeidin open reading frame encodes a 77 amino acid peptide including a 19 amino acid signal peptide. The deduced amino acid sequences of Fein-Penaeidin include a proline rich N-terminal domain and a carboxyl-domain that contains six cysteine residues. Structural analysis revealed an alpha-helix in its secondary structure and the predicted 3D structure indicated two-disulphide bridges in the alpha-helix. Phylogenetic analysis and sequence comparison with other known peaneidin suggest the gene shows high similarity to that of penaeidin from Peneaus monodon (95%), F. indicus (80%) and Fenneropenaeus chinensis (74%). Fein-Penaeidin was examined in normal and microbial challenged shrimp and was found to be constitutively expressed in haemocytes, Heart, gills, muscles, intestine, hepatopancreas and eyestalk. Bacterial challenge resulted in mRNA up-regulation, inducing expression at 6 h post injection indicating the penaeidin involved in the innate immunity.

  3. ppc, the gene for phosphoenolpyruvate carboxylase from an extremely thermophilic bacterium, Rhodothermus obamensis: cloning, sequencing and overexpression in Escherichia coli.


    Takai, K; Sako, Y; Uchida, A


    The ppc gene, which encodes phosphoenolpyruvate carboxylase (PEPC) of an extremely thermophilic bacterium, Rhodothermus obamensis, was directly sequenced by the thermal asymmetric interlaced (TAIL) PCR method. An ORF for a 937 amino acid polypeptide was found in the gene. The ppc gene had a high G+C content (66.2 mol%) and the third position of the codon exhibited strong preference for G or C usage (85.0 mol%). The calculated molecular mass was 107,848 Da, which was consistent with the molecular mass of the enzyme as determined by SDS-PAGE (100 kDa). The amino acid sequence of R. obamensis PEPC was closely related to that of PEPC from another thermophile, a Thermus sp., and from a mesophile, Corynebacterium glutamicum, exhibiting 45.3% or 37.7% identity and 61.5% or 56.5% similarity, respectively. By Southern analysis, the ppc gene was found to be present in a single copy in the genomic DNA of this organism. The cloned gene was expressed in Escherichia coli using a pET expression vector system and a thermostable recombinant PEPC was obtained. Comparison of the deduced amino acid sequences of the thermophilic and mesophilic PEPCs revealed distinct or common preferences for specific amino acid composition and substitutions in the two thermophilic enzymes.

  4. [Cloning of 5', 3' flanking sequence of ovine BLG and regulating the expression of GFP in mammary gland cell line].


    Liu, Ming-Jun; Li, Wen-Rong; Wu, Jian; Huang, Jun-Cheng; Guo, Zhi-Qin; Qu, Xin-Yong; Paul, Kroon


    5' and 3' flanking region of ovine BLG were amplified from sheep genomic DNA according to the published whole sequence of ovine BLG and cloned to pGEM-T vector correspondently. By partially sequencing, the sequences of BLG 5' and 3' flanking were the same as that of publication completely. The recombinant structure used to direct exogenous gene especially to express in mammary gland was constructed by joining 4.2 kb 5' flanking with 2.1 kb 3' flanking. In order to assess the efficiency of BLG regulatory elements, green fluorescent protein (GFP) gene as a reporter was fused with BLG construct and transfected the mammary epithelial cells (TD47). Through observation under UV microscope and detection by fluorometer, it is demonstrated that the GFP has been successfully expressed in TD47 cell line. By virtue of direct observation and quantitative analysis, the BLG-GFP construct can be served as a model for the quick assessment of mammary gland expression construct.

  5. Cloning, sequencing, and expression of the gene coding for an antigenic 120-kilodalton protein of Rickettsia conorii.

    PubMed Central

    Schuenke, K W; Walker, D H


    Several high-molecular-mass (above 100 kDa) antigens are recognized by sera from humans infected with spotted fever group rickettsiae and may be important stimulators of the host immune response. Molecular cloning techniques were used to make genomic Rickettsia conorii (Malish 7 strain) libraries in expression vector lambda gt11. The 120-kDa R. conorii antigen was identified by monospecific antibodies to the recombinant protein expressed on construct lambda 4-7. The entire gene DNA sequence was obtained by using this construct and two other overlapping constructs. An open reading frame of 3,068 bp with a calculated molecular mass of approximately 112 kDa was identified. Promoters and a ribosome-binding site were identified on the basis of their DNA sequence homology to other rickettsial genes and their relative positions in the sequence. The DNA coding region shares no significant homology with other spotted fever group rickettsial antigen genes (i.e., the R. rickettsii 190-, 135-, and 17-kDa antigen-encoding genes). The PCR technique was used to amplify the gene from eight species of spotted fever group rickettsiae. A 75-kDa portion of the 120-kDa antigen was overexpressed in and purified from Escherichia coli. This polypeptide was recognized by antirickettsial antibodies and may be a useful diagnostic reagent for spotted fever group rickettsioses. Images PMID:8112862

  6. Cloning and sequencing of an acetyl-CoA synthetase (ADP-forming) gene from the amitochondriate protist, Giardia lamblia.


    Sánchez, L B; Morrison, H G; Sogin, M L; Müller, M


    A Giardia lamblia gene, Glacs, was cloned, sequenced and expressed in Escheria Coli. This gene codes for a 726 residue long acetyl-CoA synthetase (ADP-forming). This enzyme is responsible for the formation of acetate, a metabolic endproduct of G. lamblia. It is known from only two Type I amitochondriate eukaryotes, G. lamblia and Entamoeba histolytica and from the archaebacterium, Pyrococcus furiosus. With Glacs as query, homologous unidentified open reading frames were detected in the complete genomes of only a few archaebacteria and eubacteria. These form a new protein family present in all three domains of life, which probably plays a central role in the acyl-CoA metabolism but is of restricted taxonomic distribution.

  7. Molecular cloning and sequencing of cDNAs encoding insecticidal peptides from the primitive hunting spider, Plectreurys tristis (Simon).


    Leisy, D J; Mattson, J D; Quistad, G B; Kramer, S J; Van Beek, N; Tsai, L W; Enderlin, F E; Woodworth, A R; Digan, M E


    Plectreurys tristis cephalothorax mRNA was isolated and amplified by PCR using degenerate primers corresponding to reverse translated mature Plt-VI toxin. An oligonucleotide corresponding to a portion of the amplified product was then used to screen a P. tristis cDNA library. The cDNAs from 10 positive clones were sequenced. Eight of these cDNAs corresponded to Plt-VI toxin, one to Plt-XI toxin, and one was very similar to Plt-VIII toxin, with the exception of a single amino acid substitution. Analysis of these cDNAs indicated that these toxins are initially synthesized as prepro-forms which undergo signal cleavage followed by additional processing at both their N- and C-termini to produce the mature products.

  8. A general strategy for cloning viroids and other small circular RNAs that uses minimal amounts of template and does not require prior knowledge of its sequence.


    Navarro, B; Daròs, J A; Flores, R


    Two PCR-based methods are described for obtaining clones of small circular RNAs of unknown sequence and for which only minute amounts are available. To avoid introducing any assumption about the RNA sequence, synthesis of the cDNAs is initiated with random primers. The cDNA population is then PCR-amplified using a primer whose sequence is present at both sides of the cDNAs, since they have been obtained with random hexamers and then a linker with the sequence of the PCR primer has been ligated to their termini, or because the cDNAs have been synthesized with an oligonucleotide that contains the sequence of the PCR primer at its 5' end and six randomized positions at its 3' end. The procedures need only approximately 50 ng of purified RNA template. The reasons for the emergence of cloning artifacts and precautions to avoid them are discussed.

  9. [Molecular cloning and analysis of cDNA sequences encoding serine proteinase and Kunitz type inhibitor in venom gland of Vipera nikolskii viper].


    Ramazanova, A S; Fil'kin, S Iu; Starkov, V G; Utkin, Iu N


    Serine proteinases and Kunitz type inhibitors are widely represented in venoms of snakes from different genera. During the study of the venoms from snakes inhabiting Russia we have cloned cDNAs encoding new proteins belonging to these protein families. Thus, a new serine proteinase called nikobin was identified in the venom gland of Vipera nikolskii viper. By amino acid sequence deduced from the cDNA sequence, nikobin differs from serine proteinases identified in other snake species. Nikobin amino acid sequence contains 15 unique substitutions. This is the first serine proteinase of viper from Vipera genus for which a complete amino acid sequence established. The cDNA encoding Kunitz type inhibitor was also cloned. The deduced amino acid sequence of inhibitor is homologous to those of other proteins from that snakes of Vipera genus. However there are several unusual amino acid substitutions that might result in the change of biological activity of inhibitor.

  10. Cloning, sequencing, and expression of the cold-inducible hutU gene from the antarctic psychrotrophic bacterium Pseudomonas syringae.


    Janiyani, Kamala L; Ray, M K


    A promoter-fusion study with a Tn 5-based promoter probe vector had earlier found that the hutU gene which encodes the enzyme urocanase for the histidine utilization pathway is upregulated at a lower temperature (4 degrees C) in the Antarctic psychrotrophic bacterium Pseudomonas syringae. To examine the characteristics of the urocanase gene and its promoter elements from the psychrotroph, the complete hutU and its upstream region from P. syringae were cloned, sequenced, and analyzed in the present study. Northern blot and primer extension analyses suggested that the hutU gene is inducible upon a downshift of temperature (22 to 4 degrees C) and that there is more than one transcription initiation site. One of the initiation sites was specific to the cells grown at 4 degrees C, which was different from the common initiation sites observed at both 4 and 22 degrees C. Although no typical promoter consensus sequences were observed in the flanking region of the transcription initiation sites, there was a characteristic CAAAA sequence at the -10 position of the promoters. Additionally, the location of the transcription and translation initiation sites suggested that the hutU mRNA contains a long 5'-untranslated region, a characteristic feature of many cold-inducible genes of mesophilic bacteria. A comparison of deduced amino acid sequences of urocanase from various bacteria, including the mesophilic and psychrotrophic Pseudomonas spp., suggests that there is a high degree of similarity between the enzymes. The enzyme sequence contains a signature motif (GXGX(2)GX(10)G) of the Rossmann fold for dinucleotide (NAD(+)) binding and two conserved cysteine residues in and around the active site. The psychrotrophic enzyme, however, has an extended N-terminal end.

  11. Cloning, characterization, and DNA sequence of the rfaLK region for lipopolysaccharide synthesis in Salmonella typhimurium LT2.

    PubMed Central

    MacLachlan, P R; Kadam, S K; Sanderson, K E


    We have cloned and sequenced the rfaL and rfaK genes for lipopolysaccharide synthesis in Salmonella typhimurium LT2 on a 4.28-kb HindIII fragment from the previously described R' factor pKZ3 (S. K. Kadam, A. Rehemtulla, and K. E. Sanderson, J. Bacteriol. 161:277-284, 1985). rfaL is thought to encode a component of the O-antigen ligase, and rfaK is believed to encode the N-acetylglucosamine transferase. The genes were identified by the loss of complementation of prototype rfaL and rfaK mutations after Tn1000 mutagenesis. Translation of the nucleotide sequence predicted sizes of 45.9 and 43.1 kDa for the rfaL and rfaK gene products, respectively. Hydropathy analysis of the rfaL product suggested that it was an integral membrane protein. A third gene, rfaZ, was found to be an 808-bp open reading frame on the pyrE side of rfaK. Insertions into rfaZ reduced rfaK complementation, suggesting cotranscription in the pyrE-cysE direction. The rfaL gene is transcribed in the opposite direction in a separate operon which may also include rfaC. An incomplete open reading frame with homology to an Escherichia coli gene in the same region, rfaY, was found on the pyrE side of rfaZ. Complementation studies with Tn1000 insertions in rfaL showed that rfaL446 and rfaL447 are allelic. With the cloning of the rfaL and -K genes, the order of genes within the rfa cluster at 79 units on the linkage map was found to be cysE-rfaDFCLKZYJIBG-pyrE. Images FIG. 3 PMID:1657881

  12. Intrahost evolution of envelope glycoprotein and OrfA sequences after experimental infection of cats with a molecular clone and a biological isolate of feline immunodeficiency virus.


    Huisman, Willem; Schrauwen, Eefje J A; Rimmelzwaan, Guus F; Osterhaus, Albert D M E


    Feline immunodeficiency virus (FIV) is a member of the genus Lentivirus and causes AIDS-like disease in its natural host, the cat. Like other lentiviruses, FIV displays a high degree of nucleotide sequence variability that is reflected in both the geographic distribution of the viruses and the different cat species that are infected. Although a lot of data on sequence variation at the population level is available, relatively little is known about the intrahost variation of FIV sequences. In the present study, cats were infected with either a biological isolate of FIV or a molecular clone that was derived from the same isolate, AM19. After infection, the cats were monitored for up to 3 years and at various time points sequences were obtained of virus circulating in the plasma. Regions of the env gene and the orfA gene were amplified, cloned and their nucleotide sequence analyzed. Furthermore, the extent of sequence variation in the original inocula was also determined. It was found that FIV is displaying relative little sequence variation during infection of its host, both in the env and the orfA gene, especially after infection with molecular clone 19k1. Although the extent of variation was higher after infection with biological isolate AM19, a large portion of these variant sequences was already present in the inoculum.

  13. Fermentation pattern of sucrose to ethanol conversions by Zymomonas mobilis

    SciTech Connect

    Lyness, Ed.; Doelle, H.W.


    General patterns of sucrose fermentation by two strains of Zymomonas mobilis, designated Z7 and Z10, were established using sucrose concentrations from 50 to 200 g/liter. Strain Z7 showed a higher invertase activity than Z10. Strain Z10 showed a reduced specific growth rate a high sucrose concentrations while Z7 was unaffected. High sucrose hydrolyzing activity in strain Z7 lead to glucose accumulation in the medium at high sucrose concentrations. Ethanol production and fermentation time depend on the rate of catabolism of the products of sucrose hydrolysis, glucose and fructose. 10 refs.

  14. Molecular Cloning and Sequence Analysis of the Sta58 Major Antigen Gene of Rickettsia tsutsugamushi: Sequence homology and Antigenic Comparison of Sta58 to the 60-Kilodalton Family of Stress Proteins

    DTIC Science & Technology


    on the cell envelopes of Rickettsia 29. Messing, J. 1983. New M13 vectors for cloning. Methods prowazekii, Rickettsia rickettsii , and Rickettsia ...gene of Rickettsia tsu sugamushi:Sequence homology and antigenic comparison to the 60-kilodalton family of stresproteins. 12. PERSONAL AUTHOR(S...IuwRnuiy dy "jmber FIELD GROUP S ROUP Rickettsia tsutsugamushi, antigens, molecular cloning,. FIED_ GROU__ SUB-GROUP scrub typhus, heat-shock proteins

  15. Complete Genomic Sequence and an Infectious BAC Clone of Feline Herpesvirus-1 (FHV-1)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Feline herpesvirus type 1 (FHV-1) is classified under the genus Varicellovirus within the Alphaherpesvirinae subfamily, and is a major cause of upper respiratory infection in cats. In this report, we present the first complete genomic sequence of FHV-1, as well as a bacterial artificial chromosome (...

  16. Cloning and Characterization of a Human Genomic Sequence that Alleviates Repeat-Induced Gene Silencing.


    Fukuma, Miki; Ganmyo, Yuto; Miura, Osamu; Ohyama, Takashi; Shimizu, Noriaki


    Plasmids bearing a mammalian replication initiation region (IR) and a nuclear matrix attachment region (MAR) are spontaneously amplified in transfected mammalian cells, and such amplification generates chromosomal homogeneously staining regions (HSRs) or extrachromosomal double minutes (DMs). This method provides a novel, efficient, and rapid way to establish cells that stably produce high levels of recombinant proteins. However, because IR/MAR plasmids are amplified as repeats, they are frequently targeted by repeat-induced gene silencing (RIGS), which silences a variety of repeated sequences in transgenes and the genome. To address this problem, we developed a novel screening system using the IR/MAR plasmid to isolate human genome sequences that alleviate RIGS. The screen identified a 3,271 bp sequence (B-3-31) that elevated transgene expression without affecting the amplification process. Neither non-B structure (i.e., the inverted repeats or bending) nor known epigenetic modifier elements such as MARs, insulators, UCOEs, or STARs could explain the anti-silencing activity of B-3-31. Instead, the activity was distributed throughout the entire B-3-31 sequence, which was extremely A/T-rich and CpG-poor. Because B-3-31 effectively and reproducibly alleviated RIGS of repeated genes, it could be used to increase recombinant protein production.

  17. Cloning and Characterization of a Human Genomic Sequence that Alleviates Repeat-Induced Gene Silencing

    PubMed Central

    Miura, Osamu; Ohyama, Takashi; Shimizu, Noriaki


    Plasmids bearing a mammalian replication initiation region (IR) and a nuclear matrix attachment region (MAR) are spontaneously amplified in transfected mammalian cells, and such amplification generates chromosomal homogeneously staining regions (HSRs) or extrachromosomal double minutes (DMs). This method provides a novel, efficient, and rapid way to establish cells that stably produce high levels of recombinant proteins. However, because IR/MAR plasmids are amplified as repeats, they are frequently targeted by repeat-induced gene silencing (RIGS), which silences a variety of repeated sequences in transgenes and the genome. To address this problem, we developed a novel screening system using the IR/MAR plasmid to isolate human genome sequences that alleviate RIGS. The screen identified a 3,271 bp sequence (B-3-31) that elevated transgene expression without affecting the amplification process. Neither non-B structure (i.e., the inverted repeats or bending) nor known epigenetic modifier elements such as MARs, insulators, UCOEs, or STARs could explain the anti-silencing activity of B-3-31. Instead, the activity was distributed throughout the entire B-3-31 sequence, which was extremely A/T-rich and CpG-poor. Because B-3-31 effectively and reproducibly alleviated RIGS of repeated genes, it could be used to increase recombinant protein production. PMID:27078685

  18. Molecular Cloning and Sequencing of Channel Catfish, Ictalurus punctatus, Cathepsin H and L cDNA

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Cathepsin H and L, a lysosomal cysteine endopeptidase of the papain family, are ubiquitously expressed and involve in antigen processing. In this communication, the channel catfish cathepsin H and L transcripts were sequenced and analyzed. Total RNA from tissues was extracted and cDNA libraries we...

  19. Molecular Cloning and Expression of Sequence Variants of Manganese Superoxide Dismutase Genes from Wheat

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Reactive oxygen species (ROS) are very harmful to living organisms due to the potential oxidation of membrane lipids, DNA, proteins, and carbohydrates. Transformed E.coli strain QC 871, superoxide dismutase (SOD) double-mutant, with three sequence variant MnSOD1, MnSOD2, and MnSOD3 manganese supero...

  20. Cloning, sequence, and developmental expression of a type 5, tartrate-resistant, acid phosphatase of rat bone.


    Ek-Rylander, B; Bill, P; Norgård, M; Nilsson, S; Andersson, G


    Tartrate-resistant acid phosphatase (TRAP) is a characteristic constituent of osteoclasts and some mononuclear preosteoclasts and, therefore, used as a histochemical and biochemical marker for osteoclasts and bone resorption. We now report the isolation of a 1397-base pair (bp) full-length TRAP/tartrate-resistant acid ATPase (TrATPase) cDNA clone from a neonatal rat calvaria lambda gt11 cDNA library. The cDNA clone consists of a 92-bp untranslated 5'-flank, an open reading frame of 981 bp and a 324-bp untranslated 3'-poly(A)-containing region. The deduced protein sequence of 327 amino acids contains a putative cleavable signal sequence of 21 amino acids. The mature polypeptide of 306 amino acids has a calculated Mr of 34,350 Da and a pI of 9.18, and it contains two potential N-glycosylation sites and the lysosomal targeting sequence DKRFQ. At the protein level, the sequence displays 89-94% homology to TRAP enzymes from human placenta, beef spleen, and uteroferrin and identity to the N terminus of purified rat bone TRAP/TrATPase. An N-terminal amino acid segment is strikingly homologous to the corresponding region in lysosomal and prostatic acid phosphatases. The cDNA recognized a 1.5-kilobase mRNA in long bones and calvaria, and in vitro translation using, as template, mRNA transcribed from the full-length insert yielded an immunoprecipitated product of 34 kDa. In neonatal rats, TRAP/TrATPase mRNA was highly expressed in skeletal tissues, with much lower (less than 10%) levels detected in spleen, thymus, liver, skin, brain, kidney, brain, lung, and heart. In situ hybridization demonstrated specific labeling of osteoclasts at endostal surfaces and bone trabeculae of long bones. Thus, despite the apparent similarity of this osteoclastic TRAP/TrATPase with type 5, tartrate-resistant and purple, acid phosphatases expressed in other mammalian tissues, this gene appears to be preferentially expressed at skeletal sites.

  1. Russell body inducing threshold depends on the variable domain sequences of individual human IgG clones and the cellular protein homeostasis.


    Stoops, Janelle; Byrd, Samantha; Hasegawa, Haruki


    Russell bodies are intracellular aggregates of immunoglobulins. Although the mechanism of Russell body biogenesis has been extensively studied by using truncated mutant heavy chains, the importance of the variable domain sequences in this process and in immunoglobulin biosynthesis remains largely unknown. Using a panel of structurally and functionally normal human immunoglobulin Gs, we show that individual immunoglobulin G clones possess distinctive Russell body inducing propensities that can surface differently under normal and abnormal cellular conditions. Russell body inducing predisposition unique to each immunoglobulin G clone was corroborated by the intrinsic physicochemical properties encoded in the heavy chain variable domain/light chain variable domain sequence combinations that define each immunoglobulin G clone. While the sequence based intrinsic factors predispose certain immunoglobulin G clones to be more prone to induce Russell bodies, extrinsic factors such as stressful cell culture conditions also play roles in unmasking Russell body propensity from immunoglobulin G clones that are normally refractory to developing Russell bodies. By taking advantage of heterologous expression systems, we dissected the roles of individual subunit chains in Russell body formation and examined the effect of non-cognate subunit chain pair co-expression on Russell body forming propensity. The results suggest that the properties embedded in the variable domain of individual light chain clones and their compatibility with the partnering heavy chain variable domain sequences underscore the efficiency of immunoglobulin G biosynthesis, the threshold for Russell body induction, and the level of immunoglobulin G secretion. We propose that an interplay between the unique properties encoded in variable domain sequences and the state of protein homeostasis determines whether an immunoglobulin G expressing cell will develop the Russell body phenotype in a dynamic cellular setting.

  2. New Approaches to Attenuated Hepatitis a Vaccine Development: Cloning and Sequencing of Cell-Culture Adapted Viral cDNA.

    DTIC Science & Technology


    reverse if necessary and identify by block number) FIELD GROUP SUB-GROUP Hepatitis A Vaccine, Molecular Cloning and Hybridization, 06 13 Strain Differences...cells. Molecular cloning of p16 HM175 virus cDNA. cDNA clones were derived from p16 HM175 virus RNA by cloning cDNA-RNA hybrid molecules into the Pstl... molecular cloning . Clones derived from cDNA synthesized with oligo-dT_12 18 as primer were nearly always restricted to the 3’ terminus of the genome, while

  3. Sequence analysis of two cryptic plasmids from Bifidobacterium longum DJO10A and construction of a shuttle cloning vector.


    Lee, Ju-Hoon; O'Sullivan, Daniel J


    Bifidobacterium longum DJO10A is a recent human isolate with probiotic characteristics and contains two plasmids, designated pDOJH10L and pDOJH10S. The complete sequences of both these plasmids have now been determined and consist of two circular DNA molecules of 10,073 and 3,661 bp, with G+C contents of 62.2% and 66.2%, respectively. Plasmid pDOJH10L is a cointegrate plasmid consisting of DNA regions exhibiting very high sequence identity to two other B. longum plasmids, pNAC2 (98%) and pKJ50 (96%), together with another region. Interestingly, the rolling circular replication (RCR) regions of both the pNAC2- and pKJ50-like plasmids were disrupted during the recombination event leading to a further recombination event to acquire a functional replicon. This consists of a new fused rep gene and an RCR-type ori consisting of a conserved DnaA box in an AT-rich region followed by four contiguous repeated sequences consistent with an iteron structure and an inverted repeat. The smaller pDOJH10S had no sequence similarity to any other characterized plasmid from bifidobacteria. In addition, it did not contain any features consistent with RCR, which is the replication mechanism proposed for all the bifidobacteria plasmids characterized to date. It did exhibit sequence similarity with several theta replication-related replication proteins from other gram-positive, high-G+C bacteria, with the closest match from a Rhodococcus rhodochrous plasmid, suggesting a theta mechanism of replication. S1 nuclease analysis of both plasmids in B. longum DJO10A revealed single-strand DNA intermediates for pDOJH10L, which is consistent for RCR, but none were detected for pDOJH10S. As the G+C content of pDOJH10S is similar to that of Rhodococcus rhodochrous (67%) and significantly higher than that of B. longum (60.1%), it may have been acquired through horizontal gene transfer from a Rhodococcus species, as both genera are members of the Actinomycetes and are intestinal inhabitants. An

  4. Cellulosic Ethanol Production by Recombinant Cellulolytic Bacteria Harbouring pdc and adh II Genes of Zymomonas mobilis

    PubMed Central

    Piriya, P. Sobana; Vasan, P. Thirumalai; Padma, V. S.; Vidhyadevi, U.; Archana, K.; Vennison, S. John


    The ethanol fermenting genes such as pyruvate decarboxylase (pdc) and alcohol dehydrogenase II (adh II) were cloned from Zymomonas mobilis and transformed into three different cellulolytic bacteria, namely Enterobacter cloacae JV, Proteus mirabilis JV and Erwinia chrysanthemi and their cellulosic ethanol production capability was studied. Recombinant E. cloacae JV was found to produce 4.5% and 3.5% (v/v) ethanol, respectively, when CMC and 4% NaOH pretreated bagasse were used as substrates, whereas recombinant P. mirabilis and E. chrysanthemi with the same substrates could only produce 4%, 3.5%, 1%, and 1.5 % of ethanol, respectively. The recombinant E. cloacae strain produced twofold higher percentage of ethanol than the wild type. The recombinant E. cloacae strain could be improved further by increasing its ethanol tolerance capability through media optimization and also by combining multigene cellulase expression for enhancing ethanol production from various types of lignocellulosic biomass so that it can be used for industrial level ethanol production. PMID:22919503

  5. [Evaluation on glucose-xylose co-fermentation by a recombinant Zymomonas mobilis strain].


    Feng, Quanzhou; Li, Shizhong; Wang, Li; Li, Tiancheng


    Co-fermentation of glucose and xylose is critical for cellulosic ethanol, as xylose is the second most abundant sugar in lignocellulosic hydrolysate. In this study, a xylose-utilizing recombinant Zymomonas mobilis TSH01 was constructed by gene cloning, and ethanol fermentation of the recombinant was evaluated under batch fermentation conditions with a fermentation time of 72 h. When the medium containing 8% glucose or xylose, was tested, all glucose and 98.9% xylose were consumed, with 87.8% and 78.3% ethanol yield, respectively. Furthermore, the medium containing glucose and xylose, each at a concentration of 8%, was tested, and 98.5% and 97.4% of glucose and xylose was fermented, with an ethanol yield of 94.9%. As for the hydrolysate of corn stover containing 3.2% glucose and 3.5% xylose, all glucose and 92.3% xylose were consumed, with an ethanol yield of 91.5%. In addition, monopotassium phosphate can facilitate the consumption of xylose and enhance ethanol yield.

  6. cDNA cloning and sequence analysis of human pancreatic procarboxypeptidase A1.

    PubMed Central

    Catasús, L; Villegas, V; Pascual, R; Avilés, F X; Wicker-Planquart, C; Puigserver, A


    Using polyclonal antibodies raised against human pancreatic procarboxypeptidases, a full-length cDNA coding for an A-type proenzyme was isolated from a lambda gt11 human pancreatic library. This cDNA contains standard 3' and 5' flanking regions, a poly(A)+ tail and a central region of 1260 nucleotides coding for a protein of 419 amino acids. On the basis of sequence comparisons, the human protein was classified as a procarboxypeptidase A1 which is very similar to the previously described A1 forms from rat and bovine pancreatic glands. The presence of the amino acid sequences assumed to be of importance for the zymogen inhibition by its activation segment, primarily on the basis of the recently reported crystal structure of the B form, further supports the proposed classification. PMID:1417781

  7. Cloning and sequencing of columbid circovirus (coCV), a new circovirus from pigeons.


    Mankertz, A; Hattermann, K; Ehlers, B; Soike, D


    The complete nucleotide sequence of columbid circovirus (CoCV) isolated from pigeons is described. CoCV was amplified using a consensus primer PCR approach directed against conserved sequences within the rep genes of vertebrate circoviruses. The genome of CoCV is circular and 2037 nt in size. It displays 55% homology to the genome of psittacine beak and feather disease virus and is more distantly related (< 40% homology) to porcine circovirus type 1 and 2. Two major open reading frames were identified, encoding the replicase and the putative capsid protein of CoCV. A region similar to the origin of replication of other circoviruses was found: it encompasses a stem-loop structure with the nonamer 5'-TAGTATTAC, conserved in circo-, nano- and geminiviruses. Phylogenetic analyses suggest classification of CoCV as member of the genus Circovirus of the virus family Circoviridae.

  8. Molecular cloning, sequence characterization and expression pattern of Rab18 gene from watermelon (Citrullus lanatus).


    Xinli, Xiao; Lei, Peng


    The complete mRNA sequence of watermelon Rab18 gene was amplified through the rapid amplification of cDNA ends (RACE) method. The full-length mRNA was 1010 bp containing a 645 bp open reading frame, which encodes a protein of 214 amino acids. Sequence analysis revealed that watermelon Rab18 protein shares high homology with the Rab18 of cucumber (99%), muskmelon (98%), Morus notabilis (90%), tomato (89%), wine grape (89%) and potato (88%). Phylogenetic analysis revealed that watermelon Rab18 gene has a closer genetic relationship with Rab18 gene of cucumber and muskmelon. Tissue expression profile analysis indicated that watermelon Rab18 gene was highly expressed in root, stem and leaf, moderately expressed in flower and weakly expressed in fruit.

  9. Cloning and nucleotide sequences of the genes for the subunits of NAD-reducing hydrogenase of Alcaligenes eutrophus H16.

    PubMed Central

    Tran-Betcke, A; Warnecke, U; Böcker, C; Zaborosch, C; Friedrich, B


    The genes hoxF, -U, -Y, and -H which encode the four subunit polypeptides alpha, gamma, delta, and beta of the NAD-reducing hydrogenase (HoxS) of Alcaligenes eutrophus H16, were cloned, expressed in Pseudomonas facilis, and sequenced. On the basis of the nucleotide sequence, the predicted amino acid sequences, and the N-terminal amino acid sequences, it was concluded that the structural genes are tightly linked and presumably organized as an operon, denoted hoxS. Two pairs of -24 and -12 consensus sequences resembling RpoN-activatable promoters lie upstream of hoxF, the first of the four genes. Primer extension experiments indicate that the second promoter is responsible for hoxS transcription. hoxF and hoxU code for the flavin-containing dimer (alpha and gamma subunits) of HoxS which exhibits NADH:oxidoreductase activity. A putative flavin-binding region is discussed. The 26.0-kilodalton (kDa) gamma subunit contains two cysteine clusters which may participate in the coordination of two [4F3-4S]centers. The genes hoxY and hoxH code for the small 22.9-kDa delta subunit and the nickel-containing 54.8-kDa beta subunit, respectively, of the hydrogenase dimer of HoxS. The latter dimer exhibits several conserved regions found in all nickel-containing hydrogenases. The roles of these regions in coordinating iron and nickel are discussed. Although the deduced amino acid sequences of the delta and beta subunits share some conserved regions with the corresponding polypeptides of other [NiFe] hydrogenases, the overall amino acid homology is marginal. Nevertheless, significant sequence homology (35%) to the corresponding polypeptides of the soluble methylviologen-reducing hydrogenase of Methanobacterium thermoautotrophicum was found. Unlike the small subunits of the membrane-bound and soluble periplasmic hydrogenases, the HoxS protein does not appear to be synthesized with an N-terminal leader peptide. Images PMID:2188945

  10. [Tryptophan 7-halogenase from Pseudomonas aureofaciens ACN strain: gene cloning and sequencing and the enzyme expression].


    Burd', V N; van Pee, K H


    The gene of tryptophan 7-halogenase was isolated from the Pseudomonas aureofaciens ACN strain producing pyrrolnitrin, a chlorocontaining antibiotic, and sequenced. A high homology degree (over 95%) was established for the genes and the corresponding halogenases from P. aureofaciens ACN and P. fluorescens BL915. The tryptophan 7-halogenase gene was amplified by PCR, and the corresponding enzyme was expressed in Escherichia coli cells using the pBSII SK+ vector.

  11. Cloning, Sequencing, and the Expression of the Elusive Sarcomeric TPM4α Isoform in Humans

    PubMed Central

    Abbott, Lynn; Alshiekh-Nasany, Ruham; Mitschow, Charles


    In mammals, tropomyosin is encoded by four known TPM genes (TPM1, TPM2, TPM3, and TPM4) each of which can generate a number of TPM isoforms via alternative splicing and/or using alternate promoters. In humans, the sarcomeric isoform(s) of each of the TPM genes, except for the TPM4, have been known for a long time. Recently, on the basis of computational analyses of the human genome sequence, the predicted sequence of TPM4α has been posted in GenBank. We designed primer-pairs for RT-PCR and showed the expression of the transcripts of TPM4α and a novel isoform TPM4δ in human heart and skeletal muscle. qRT-PCR shows that the relative expression of TPM4α and TPM4δ is higher in human cardiac muscle. Western blot analyses using CH1 monoclonal antibodies show the absence of the expression of TPM4δ protein (~28 kDa) in human heart muscle. 2D western blot analyses with the same antibody show the expression of at least nine distinct tropomyosin molecules with a mass ~32 kD and above in adult heart. By Mass spectrometry, we determined the amino acid sequences of the extracted proteins from these spots. Spot “G” reveals the putative expression of TPM4α along with TPM1α protein in human adult heart. PMID:27703814

  12. Cloning and sequencing of the genes from Salmonella typhimurium encoding a new bacterial ribonucleotide reductase.

    PubMed Central

    Jordan, A; Gibert, I; Barbé, J


    A plasmid library of Salmonella typhimurium was used to complement a temperature-sensitive nrdA mutant of Escherichia coli. Complementation was obtained with two different classes of plasmids, one carrying the E. coli nrdAB-like genes and the second containing an operon encoding a new bacterial ribonucleotide reductase. Plasmids harboring these new reductase genes also enable obligately anaerobic nrdB::Mud1 E. coli mutants to grow in the presence of oxygen. This operon consists of two open reading frames, which have been designated nrdE (2,145 bp) and nrdF (969 bp). The deduced amino acid sequences of the nrdE and nrdF products include the catalytically important residues conserved in ribonucleotide reductase enzymes of class I and show 25 and 28% overall identity with the R1 and R2 protein, respectively, of the aerobic ribonucleoside diphosphate reductase of E. coli. The 3' end of the sequenced 4.9-kb fragment corresponds to the upstream region of the previously published proU operon of both S. typhimurium and E. coli, indicating that the nrdEF genes are at 57 min on the chromosomal maps of these two bacterial species. Analysis of the nrdEF and proU sequences demonstrates that transcription of the nrdEF genes is in the clockwise direction on the S. typhimurium and E. coli maps. Images PMID:8195103

  13. Cloning and sequence analysis of the Chlamydia trachomatis spc ribosomal protein gene cluster.

    PubMed Central

    Kaul, R; Gray, G J; Koehncke, N R; Gu, L J


    We identified and sequenced a segment of Chlamydia trachomatis chromosomal DNA that shows homology to the Escherichia coli spc and distal region of the S10 ribosomal protein (r-protein) operons. Its sequence revealed a high degree of nucleotide and operon context conservation with the E. coli r-protein genes. The C. trachomatis spec operon contains the r-protein genes for L14, L24, L5, S8, L6, L18, S5, L15, and Sec Y along with the genes for r-proteins L16, L29, and S17 of the S10 operon. The two operons are separated by a 16-bp intragenic region which contains no transcription signals. However, a putative promoter for the transcription of the spc operon was found 162 nucleotides upstream of the CtrL14e start site; it revealed significant homology to the E. coli consensus promoter sequences. Interestingly, our results indicate the absence of any structure resembling an EcoS8 regulatory target site on C. trachomatis spc mRNA in spite of significant amino acid identity between E. coli and C. trachomatis r-proteins. Also, the intrinsic aminoglycoside resistance in C. trachomatis is unlikely to be mediated by CtrL6e since E. coli expressing CtrL6e remained susceptible to gentamicin (MIC less than 0.5 micrograms/ml). Images PMID:1735714

  14. Complete nucleotide sequence and construction of an infectious clone of Chinese yam necrotic mosaic virus suggest that macluraviruses have the smallest genome among members of the family Potyviridae.


    Kondo, Toru; Fujita, Takashi


    The complete nucleotide sequence of Chinese yam necrotic mosaic virus (CYNMV) was determined from cloned virus cDNA. The CYNMV genomic RNA is 8224 nucleotides in length, excluding the poly(A) tail, and contains one long open reading frame encoding a large polyprotein of 2620 amino acids. CYNMV has no counterpart to the P1 cistron and a short HC-Pro cistron located at the 5' side of the potyvirus genome. A full-length cDNA clone, pCYNMV, was assembled under the control of the cauliflower mosaic virus 35S promoter and the nopaline synthase terminator. Biolistic inoculation of Nagaimo plants with cDNA resulted in systemic necrotic mosaic symptoms typical of CYNMV infection. To our knowledge, this is the first report of the complete nucleotide sequence and construction of an infectious cDNA clone of a member of the genus Macluravirus.

  15. Molecular cloning, sequence analysis and homology modeling of the first caudata amphibian antifreeze-like protein in axolotl (Ambystoma mexicanum).


    Zhang, Songyan; Gao, Jiuxiang; Lu, Yiling; Cai, Shasha; Qiao, Xue; Wang, Yipeng; Yu, Haining


    Antifreeze proteins (AFPs) refer to a class of polypeptides that are produced by certain vertebrates, plants, fungi, and bacteria and which permit their survival in subzero environments. In this study, we report the molecular cloning, sequence analysis and three-dimensional structure of the axolotl antifreeze-like protein (AFLP) by homology modeling of the first caudate amphibian AFLP. We constructed a full-length spleen cDNA library of axolotl (Ambystoma mexicanum). An EST having highest similarity (∼42%) with freeze-responsive liver protein Li16 from Rana sylvatica was identified, and the full-length cDNA was subsequently obtained by RACE-PCR. The axolotl antifreeze-like protein sequence represents an open reading frame for a putative signal peptide and the mature protein composed of 93 amino acids. The calculated molecular mass and the theoretical isoelectric point (pl) of this mature protein were 10128.6 Da and 8.97, respectively. The molecular characterization of this gene and its deduced protein were further performed by detailed bioinformatics analysis. The three-dimensional structure of current AFLP was predicted by homology modeling, and the conserved residues required for functionality were identified. The homology model constructed could be of use for effective drug design. This is the first report of an antifreeze-like protein identified from a caudate amphibian.

  16. cDNA cloning and sequencing of human fibrillarin, a conserved nucleolar protein recognized by autoimmune antisera

    SciTech Connect

    Aris, J.P.; Blobel, G. )


    The authors have isolated a 1.1-kilobase cDNA clone that encodes human fibrillarin by screening a hepatoma library in parallel with DNA probes derived from the fibrillarin genes of Saccharomyces cerevisiae (NOP1) and Xenopus laevis. RNA blot analysis indicates that the corresponding mRNA is {approximately}1,300 nucleotides in length. Human fibrillarin expressed in vitro migrates on SDS gels as a 36-kDa protein that is specifically immunoprecipitated by antisera from humans with scleroderma autoimmune disease. Human fibrillarin contains an amino-terminal repetitive domain {approximately}75-80 amino acids in length that is rich in glycine and arginine residues and is similar to amino-terminal domains in the yeast and Xenopus fibrillarins. The occurrence of a putative RNA-binding domain and an RNP consensus sequence within the protein is consistent with the association of fibrillarin with small nucleolar RNAs. Protein sequence alignments show that 67% of amino acids from human fibrillarin are identical to those in yeast fibrillarin and that 81% are identical to those in Xenopus fibrillarin. This identity suggests the evolutionary conservation of an important function early in the pathway for ribosome biosynthesis.

  17. Xylose isomerase from polycentric fungus Orpinomyces: gene sequencing, cloning, and expression in Saccharomyces cerevisiae for bioconversion of xylose to ethanol.


    Madhavan, Anjali; Tamalampudi, Sriappareddy; Ushida, Kazunari; Kanai, Daisuke; Katahira, Satoshi; Srivastava, Aradhana; Fukuda, Hideki; Bisaria, Virendra S; Kondo, Akihiko


    The cDNA sequence of the gene for xylose isomerase from the rumen fungus Orpinomyces was elucidated by rapid amplification of cDNA ends. The 1,314-nucleotide gene was cloned and expressed constitutively in Saccharomyces cerevisiae. The deduced polypeptide sequence encoded a protein of 437 amino acids which showed the highest similarity to the family II xylose isomerases. Further, characterization revealed that the recombinant enzyme was a homodimer with a subunit of molecular mass 49 kDa. Cell extract of the recombinant strain exhibited high specific xylose isomerase activity. The pH optimum of the enzyme was 7.5, while the low temperature optimum at 37 degrees C was the property that differed significantly from the majority of the reported thermophilic xylose isomerases. In addition to the xylose isomerase gene, the overexpression of the S. cerevisiae endogenous xylulokinase gene and the Pichia stipitis SUT1 gene for sugar transporter in the recombinant yeast facilitated the efficient production of ethanol from xylose.

  18. Cloning, sequencing and characterization of a novel phosphatase gene, phoI, from soil bacterium Enterobacter sp. 4.


    Kang, Seung Ha; Cho, Kwang Keun; Bok, Jin Duck; Kim, Sung Chan; Cho, Jaie Soon; Lee, Peter Chang-Whan; Kang, Sang Kee; Lee, Hong Gu; Woo, Jung Hee; Lee, Hyun Jeong; Lee, Sang Cheol; Choi, Yun Jaie


    A gene, phoI, coding for a phosphatase from Enterobacter sp. 4 was cloned in Escherichia coli and sequenced. Analysis of the sequence revealed one open reading frame (ORF) that encodes a 269-amino acid protein with a calculated molecular mass of 29 kDa. PhoI belongs to family B acid phosphatase and exhibits 49.4% identity and 62.4% homology to the hel gene from Heamophilus influenzae, which encoded an outer membrane protein (P4). The optimum pH and temperature for phosphatase activity were pH 5.5 and 40 degrees C, respectively. Its specific activity on rho-nitrophenyl phosphatate was 70 U/mg at pH 5.5 and 40 degrees C. Enzyme activity was inhibited by Al3+, EDTA, and DTT, but fivefold activated by Cu2+ ion (350 U/mg). PhoI showed a strong synergistic effect when used with a purified E. coli phytase, AppA, to estimate combination effects.

  19. Cloning, Sequencing, Purification, and Crystal Structure of Grenache (Vitis vinifera) Polyphenol Oxidase

    SciTech Connect

    Virador, V.; Reyes Grajeda, J; Blanco-Labra, A; Mendiola-Olaya, E; Smith, G; Moreno, A; Whitaker, J


    The full-length cDNA sequence (P93622{_}VITVI) of polyphenol oxidase (PPO) cDNA from grape Vitis vinifera L., cv Grenache, was found to encode a translated protein of 607 amino acids with an expected molecular weight of ca. 67 kDa and a predicted pI of 6.83. The translated amino acid sequence was 99%, identical to that of a white grape berry PPO (1) (5 out of 607 amino acid potential sequence differences). The protein was purified from Grenache grape berries by using traditional methods, and it was crystallized with ammonium acetate by the hanging-drop vapor diffusion method. The crystals were orthorhombic, space group C2221. The structure was obtained at 2.2 {angstrom} resolution using synchrotron radiation using the 39 kDa isozyme of sweet potato PPO (PDB code: 1BT1) as a phase donor. The basic symmetry of the cell parameters (a, b, and c and {alpha}, {beta}, and {gamma}) as well as in the number of asymmetric units in the unit cell of the crystals of PPO, differed between the two proteins. The structures of the two enzymes are quite similar in overall fold, the location of the helix bundles at the core, and the active site in which three histidines bind each of the two catalytic copper ions, and one of the histidines is engaged in a thioether linkage with a cysteine residue. The possibility that the formation of the Cys-His thioether linkage constitutes the activation step is proposed. No evidence of phosphorylation or glycoslyation was found in the electron density map. The mass of the crystallized protein appears to be only 38.4 kDa, and the processing that occurs in the grape berry that leads to this smaller size is discussed.

  20. Sequence analysis, cloning and over-expression of an endoxylanase from the alkaliphilic Bacillus halodurans.


    Martínez, M Alejandra; Delgado, Osvaldo D; Baigorí, Mario D; Siñeriz, Faustino


    The BhMIR32 xyn11A gene, encoding an extracellular endoxylanase of potential interest in bio-bleaching applications, was amplified from Bacillus halodurans MIR32 genomic DNA. The protein encoded is an endo-1,4-beta-xylanase belonging to family 11 of glycosyl hydrolases. Its nucleotide sequence was analysed and the mature peptide was subcloned into pET22b(+) expression vector. The enzyme was over-expressed in a high density Escherichia coli culture as a soluble and active protein, and purified in a single step by immobilised metal ion affinity chromatography with a specific activity of 3073 IU mg-1.

  1. Rhipicephalus (Boophilus) microplus strain Deutsch, 5 BAC clone sequencing, including two encoding Cytochrome P450s and one encoding CzEst9 carboxylesterase

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The cattle tick, Rhipicephalus (Boophilus) microplus, has a genome over 2.4 times the size of the human genome, and with over 70% of repetitive DNA, this genome would prove very costly to sequence at today's prices and difficult to assemble and analyze. BAC clones give insight into the genome struct...

  2. [Cloning and sequence analysis of MYB transcriptional regulator SmP gene of Saussurea medusa Maxim].


    Jin, Zhi-Ping; Zhao, De-Xiu; Qiao, Chuan-Ling; Qu, Wen-Quan; Chen, Ya-Qiong; Fu, Chun-Xiang


    A full-length cDNA encoding a MYB-related regulatory gene was isolated from a cDNA library prepared from mRNAs of the red line callus of S. medusa by TD-PCR. The cDNA, designated SmP, is 969 nucleotides long and has an open reading frame of 771 bp with a deduced amino acid sequence of 256 residues. The putative protein of SmP has two typical conversed R2R3-Myb DNA-binding domains in N-terminal and displays a rather high degree of similarity to OsMYB from rice and LBMI from tobacco, showing 73% and 70% identity within the DNA-binding domains. However, the C-terminal domain of the SmP protein does not show obvious similarity to any other known protein sequence. It is rich in hydrophilic amino acids, especially in serine residues (18.38%), partly organized in homopolymeric stretches, a feature often found in activation domain of transcription factors.

  3. Cloning, sequencing, and identification using proteomic tools of a protease from Bromelia hieronymi Mez.


    Bruno, Mariela Anahí; Trejo, Sebastián Alejandro; Avilés, Francesc Xavier; Caffini, Néstor Oscar; López, Laura Maria Isabel


    Fruits of Bromelia hieronymi, a tropical South American plant, possess a high content of peptidases with potential biotechnological uses. Total RNA was extracted from unripe fruits and peptidase cDNA was obtained by 3'RACE-PCR. The consensus sequence of the cysteine peptidase cDNA contained 875 bp, the 690 first ones codifying for a hypothetical polypeptide chain of the mature peptidase, named Bh-CP1 (molecular mass 24.773 kDa, pI 8.6, extinction molar coefficient 58,705 M(-1) cm(-1)). Bh-CP1 sequence shows a high percentage of identity with those of other cysteine plant proteases. The presence of highly preserved residues is observed, like those forming the catalytic site (Gln19, Cys25, His159, and Asn175, papain numbering), as well as other six Cys residues, involved in the formation of disulfide bounds. Molecular modeling results suggest the enzyme belongs to the α + β class of proteins, with two disulfide bridges (Cys23-Cys63 and Cys57-Cys96) in the α domain, while the β domain is stabilized by another disulfide bridge (Cys153-Cys203). Additionally, peptide mass fingerprints (PMFs) of the three peptidases previously isolated from B. hieronymi fruits (namely hieronymain I, II, and III) were performed and compared with the theoretical fingerprint of PMF of Bh-CP1, showing a partial matching between the in silico-translated protein and hieronymain II.

  4. Agouti signalling protein (ASIP) gene: molecular cloning, sequence characterisation and tissue distribution in domestic goose.


    Zhang, J; Wang, C; Liu, Y; Liu, J; Wang, H Y; Liu, A F; He, D Q


    Agouti signalling protein (ASIP) is an endogenous antagonist of melanocortin-1 receptor (MC1R) and is involved in the regulation of pigmentation in mammals. The objective of this study was to identify and characterise the ASIP gene in domestic goose. The goose ASIP cDNA consisted of a 44-nucleotide 5'-terminal untranslated region (UTR), a 390-nucleotide open-reading frame (ORF) and a 45-nucleotide 3'-UTR. The length of goose ASIP genomic DNA was 6176 bp, including three coding exons and two introns. Bioinformatic analysis indicated that the ORF encodes a protein of 130 amino-acid residues with a molecular weight of 14.88 kDa and an isoelectric point of 9.73. Multiple sequence alignments and phylogenetic analysis showed that the amino-acid sequence of ASIP was conserved in vertebrates, especially in the avian species. RT-qPCR showed that the goose ASIP mRNA was differentially expressed in the pigment deposition tissues, including eye, foot, feather follicle, skin of the back, as well as in skin of the abdomen. The expression level of the ASIP gene in skin of the abdomen was higher than that in skin of the back. Those findings will contribute to further understanding the functions of the ASIP gene in geese plumage colouring.

  5. Sizes, locations, and directions of transcription of two genes on a cloned maize chloroplast DNA sequence

    PubMed Central

    Link, Gerhard; Bogorad, Lawrence


    mRNA for the large subunit (LS) of ribulose-1,5-bisphosphate carboxylase [3-phospho-D-glycerate carboxylase (dimerizing), EC] of Zea mays is complementary to an uninterrupted 1600-base-pair-long chloroplast DNA sequence that has been mapped precisely within the 4350-base-pair-long chloroplast DNA fragment Bam 9 to which it had been traced earlier [Bedbrook, J. R., Coen, D. M., Beaton, A. R., Bogorad, L. & Rich, A. (1979) J. Biol. Chem. 254, 905-910]. An additional 1400-base-pair-long uninterrupted region that is colinear with a chloroplast RNA has been detected on Bam 9. The transcript from this region is part of a 2200-nucleotide-long RNA. The remainder of the DNA sequence for the 2200-base-pair RNA maps outside Bam 9. The 1600-base-pair LS gene and the gene for the 2200-nucleotide transcript are close to one another. They are separated by an untranscribed intercistronic “gap” about 330 base pairs long. These two closely packed genes are inverted on the chromosome—i.e., their 3′ termini are at opposite ends of the untranscribed gap and they map on opposite strands. Images PMID:16592800

  6. Cloning and sequencing of the Bet v 1-homologous allergen Fra a 1 in strawberry (Fragaria ananassa) shows the presence of an intron and little variability in amino acid sequence.


    Musidlowska-Persson, Anna; Alm, Rikard; Emanuelsson, Cecilia


    The Fra a 1 allergen in strawberry (Fragaria ananassa) is homologous to the major birch pollen allergen Bet v 1, which has numerous isoforms differing in terms of amino acid sequence and immunological impact. To map the extent of sequence differences in the Fra a 1 allergen, PCR cloning and sequencing was applied. Several genomic sequences of Fra a 1, with a length of either 584, 591 or 594 nucleotides, were obtained from three different strawberry varieties. All contained one intron, with the length of either 101 or 110 nucleotides. By sequencing 30 different clones, eight different DNA sequences were obtained, giving in total five potential Fra a 1 protein isoforms, with high sequence similarity (>97% sequence identity) and only seven positions of amino acid variability, which were largely confirmed by mass spectrometry of expressed proteins. We conclude that the sequence variability in the strawberry allergen Fra a 1 is small, within and between strawberry varieties, and that multiple spots, previously detected in 2DE, are presumably due to differences in post-translational modification rather than differences in amino acid sequence. The most abundant Fra a 1 isoform sequence, recombinantly expressed in Escherichia coli after removal of the intron, was recognized by IgE from strawberry allergic patients. It cross-reacted with antibodies to Bet v 1 and the homologous apple allergen Mal d 1 (61 and 78% sequence identity, respectively), and will be used in further analyses of variation in Fra a 1-expression.

  7. Molecular cloning, sequence and structural analysis of dehairing Mn(2+) dependent alkaline serine protease (MASPT) of Bacillus pumilus TMS55.


    Ibrahim, Kalibulla Syed; Muniyandi, Jeyaraj; Pandian, Shunmugiah Karutha


    Leather industries release a large amount of pollution-causing chemicals which creates one of the major industrial pollutions. The development of enzyme based processes as a potent alternative to pollution-causing chemicals is useful to overcome this issue. Proteases are enzymes which have extensive applications in leather processing and in several bioremediation processes due to their high alkaline protease activity and dehairing efficacy. In the present study, we report cloning, characterization of a Mn2+ dependent alkaline serine protease gene (MASPT) of Bacillus pumilus TMS55. The gene encoding the protease from B. pumilus TMS55 was cloned and its nucleotide sequence was determined. This gene has an open reading frame (ORF) of 1,149 bp that encodes a polypeptide of 383 amino acid residues. Our analysis showed that this polypeptide is composed of 29 residues N-terminal signal peptide, a propeptide of 79 residues and a mature protein of 275 amino acids. We performed bioinformatics analysis to compare MASPT enzyme with other proteases. Homology modeling was employed to model three dimensional structure for MASPT. Structural analysis showed that MASPT structure is composed of nine α-helices and nine β-strands. It has 3 catalytic residues and 14 metal binding residues. Docking analysis showed that residues S223, A260, N263, T328 and S329 interact with Mn2+. This study allows initial inferences about the structure of the protease and will allow the rational design of its derivatives for structure-function studies and also for further improvement of the enzyme.

  8. Primary structure of human pancreatic elastase 2 determined by sequence analysis of the cloned mRNA

    SciTech Connect

    Fletcher, T.S.; Shen, W.F.; Largman, C.


    A cDNA encoding elastase 2 has been cloned from a human pancreatic cDNA library. The cDNA contains a translation initiation site and a poly(A) recognition site and encodes a protein of 269 amino acids, including a proposed 16-residue signal peptide. The amino acid sequence of the deduced mature protein contains a 12-residue activation peptide containing a cysteine at residue 1 similar to that of chymotryspin. The proposed active enzyme contains all of the characteristic active-site amino acids, including His-57, Asp-102, and Ser-195. The S1 binding pocket is bounded by Gly-216 and Ser-226, making this pocket intermediate in size between chymotrypsins and elastase 1 or protease E, consistent with the substrate specificity of elastase 2 for long-chain aliphatic or aromatic amino acids. Computer modeling studies using the amino acid sequence of elastase 2 superimposed on the X-ray structure of porcine elastase 1 suggest that a change of Gln-192 in elastase 1 to Asn-192 in elastase 2 may account for the lower catalytic efficiency of the latter enzyme. Several basic residues appear to be near the ends of the extended binding pocket of elastases which might serve to anchor the enzyme to the elastin substrate. These studies indicate that elastases 2 and elastase 1 both contain an Arg-65A as well as a basic dipeptide at 223/224 which is not present in chymotrypsins. In addition, Arg-217A is present in humaan elastase 2 but absent in rat pancreatic protein which has been proposed to be an elastase 2 on the basis of sequence homology, but which was not isolated during screening of rat pancreatic tissue extracts for elastolytic activity.

  9. Purification, characterization, gene cloning and nucleotide sequencing of D: -stereospecific amino acid amidase from soil bacterium: Delftia acidovorans.


    Hongpattarakere, Tipparat; Komeda, Hidenobu; Asano, Yasuhisa


    The D-amino acid amidase-producing bacterium was isolated from soil samples using an enrichment culture technique in medium broth containing D-phenylalanine amide as a sole source of nitrogen. The strain exhibiting the strongest activity was identified as Delftia acidovorans strain 16. This strain produced intracellular D-amino acid amidase constitutively. The enzyme was purified about 380-fold to homogeneity and its molecular mass was estimated to be about 50 kDa, on sodium dodecyl sulfate polyacrylamide gel electrophoresis. The enzyme was active preferentially toward D-amino acid amides rather than their L-counterparts. It exhibited strong amino acid amidase activity toward aromatic amino acid amides including D-phenylalanine amide, D-tryptophan amide and D-tyrosine amide, yet it was not specifically active toward low-molecular-weight D-amino acid amides such as D-alanine amide, L-alanine amide and L-serine amide. Moreover, it was not specifically active toward oligopeptides. The enzyme showed maximum activity at 40 degrees C and pH 8.5 and appeared to be very stable, with 92.5% remaining activity after the reaction was performed at 45 degrees C for 30 min. However, it was mostly inactivated in the presence of phenylmethanesulfonyl fluoride or Cd2+, Ag+, Zn2+, Hg2+ and As3+ . The NH2 terminal and internal amino acid sequences of the enzyme were determined; and the gene was cloned and sequenced. The enzyme gene damA encodes a 466-amino-acid protein (molecular mass 49,860.46 Da); and the deduced amino acid sequence exhibits homology to the D-amino acid amidase from Variovorax paradoxus (67.9% identity), the amidotransferase A subunit from Burkholderia fungorum (50% identity) and other enantioselective amidases.

  10. Structure of the Zymomonas mobilis respiratory chain: oxygen affinity of electron transport and the role of cytochrome c peroxidase.


    Balodite, Elina; Strazdina, Inese; Galinina, Nina; McLean, Samantha; Rutkis, Reinis; Poole, Robert K; Kalnenieks, Uldis


    The genome of the ethanol-producing bacterium Zymomonas mobilis encodes a bd-type terminal oxidase, cytochrome bc1 complex and several c-type cytochromes, yet lacks sequences homologous to any of the known bacterial cytochrome c oxidase genes. Recently, it was suggested that a putative respiratory cytochrome c peroxidase, receiving electrons from the cytochrome bc1 complex via cytochrome c552, might function as a peroxidase and/or an alternative oxidase. The present study was designed to test this hypothesis, by construction of a cytochrome c peroxidase mutant (Zm6-perC), and comparison of its properties with those of a mutant defective in the cytochrome b subunit of the bc1 complex (Zm6-cytB). Disruption of the cytochrome c peroxidase gene (ZZ60192) caused a decrease of the membrane NADH peroxidase activity, impaired the resistance of growing culture to exogenous hydrogen peroxide and hampered aerobic growth. However, this mutation did not affect the activity or oxygen affinity of the respiratory chain, or the kinetics of cytochrome d reduction. Furthermore, the peroxide resistance and membrane NADH peroxidase activity of strain Zm6-cytB had not decreased, but both the oxygen affinity of electron transport and the kinetics of cytochrome d reduction were affected. It is therefore concluded that the cytochrome c peroxidase does not terminate the cytochrome bc1 branch of Z. mobilis, and that it is functioning as a quinol peroxidase.

  11. Molecular cloning and sequencing of pheU, a gene for Escherichia coli tRNAPhe.

    PubMed Central

    Schwartz, I; Klotsky, R A; Elseviers, D; Gallagher, P J; Krauskopf, M; Siddiqui, M A; Wong, J F; Roe, B A


    A recombinant plasmid (designated pID2) carrying the E. coli gene for tRNAPhe has been isolated from a plasmid bank constructed by the ligation of a total EcoRI digest of E. coli K12 DNA into the EcoRI site of pACYC184 DNA. The plasmid was selected by virtue of its ability to complement a temperature-sensitive lesion in the gene (PheS) for the alpha-subunit of phenylalanyl-tRNA synthetase. Crude tRNA isolated from such transformants exhibited elevated levels of phenylalanine acceptor activity. The tRNAPhe gene has been localized within the first 300 base pairs of a 3.6 kb SalI fragment of pID2. The sequence of the gene and its flanking regions is presented. Images PMID:6306588

  12. Clostridium sticklandii glycine reductase selenoprotein A gene: cloning, sequencing, and expression in Escherichia coli.

    PubMed Central

    Garcia, G E; Stadtman, T C


    Gene grdA, which encodes selenoprotein A of the glycine reductase complex from Clostridium sticklandii, was identified and characterized. This gene encodes a protein of 158 amino acids with a calculated M(r) of 17,142. The known sequence of 15 amino acids around the selenocysteine residue and the known carboxy terminus of the protein are correctly predicted by the nucleotide sequence. An opal termination codon (TGA) corresponding to the location of the single selenocysteine residue in the polypeptide was found in frame at position 130. The C. sticklandii grdA gene was inserted behind the tac promotor of an Escherichia coli expression vector. An E. coli strain transformed with this vector produced an 18-kDa polypeptide that was not detected in extracts of nontransformed cells. Affinity-purified anti-C. sticklandii selenoprotein A immunoglobulin G reacted specifically with this polypeptide, which was indistinguishable from authentic C. sticklandii selenoprotein A by immunological analysis. Addition of the purified expressed protein to glycine reductase protein components B and C reconstituted the active glycine reductase complex. Although synthesis of enzymically active protein A depended on the presence of selenium in the growth medium, formation of immunologically reactive protein did not. Moreover, synthesis of enzymically active protein in a transformed E. coli selD mutant strain indicated that there is a nonspecific mechanism of selenocysteine incorporation. These findings imply that mRNA secondary structures of C. sticklandii grdA are not functional for UGA-directed selenocysteine insertion in the E. coli expression system. Images PMID:1429431

  13. Clostridium sticklandii glycine reductase selenoprotein A gene: cloning, sequencing, and expression in Escherichia coli.


    Garcia, G E; Stadtman, T C


    Gene grdA, which encodes selenoprotein A of the glycine reductase complex from Clostridium sticklandii, was identified and characterized. This gene encodes a protein of 158 amino acids with a calculated M(r) of 17,142. The known sequence of 15 amino acids around the selenocysteine residue and the known carboxy terminus of the protein are correctly predicted by the nucleotide sequence. An opal termination codon (TGA) corresponding to the location of the single selenocysteine residue in the polypeptide was found in frame at position 130. The C. sticklandii grdA gene was inserted behind the tac promotor of an Escherichia coli expression vector. An E. coli strain transformed with this vector produced an 18-kDa polypeptide that was not detected in extracts of nontransformed cells. Affinity-purified anti-C. sticklandii selenoprotein A immunoglobulin G reacted specifically with this polypeptide, which was indistinguishable from authentic C. sticklandii selenoprotein A by immunological analysis. Addition of the purified expressed protein to glycine reductase protein components B and C reconstituted the active glycine reductase complex. Although synthesis of enzymically active protein A depended on the presence of selenium in the growth medium, formation of immunologically reactive protein did not. Moreover, synthesis of enzymically active protein in a transformed E. coli selD mutant strain indicated that there is a nonspecific mechanism of selenocysteine incorporation. These findings imply that mRNA secondary structures of C. sticklandii grdA are not functional for UGA-directed selenocysteine insertion in the E. coli expression system.

  14. Identification and Phylogenetic analysis of thermophilic sulfate-reducing bacteria in oil field samples by 16S rDNA gene cloning and sequencing.


    Leu, J Y; McGovern-Traa, C P; Porter, A J; Harris, W J; Hamilton, W A


    Thermophilic sulfate-reducing bacteria (SRB) have been recognized as an important source of hydrogen sulfide (H2S) in hydrocarbon reservoirs and in production systems. Four thermophilic SRB enrichment cultures from three different oil field samples (sandstone core, drilling mud, and production water) were investigated using 16S rDNA sequence comparative analysis. In total, 15 different clones were identified. We found spore-forming, low G+C content, thermophilic, sulfate-reducing Desulfotomaculum-related sequences present in all oil field samples, and additionally a clone originating from sandstone core which was assigned to the mesophilic Desulfomicrobium group. Furthermore, three clones related to Gram-positive, non-sulfate-reducing Thermoanaerobacter species and four clones close to Clostridium thermocopriae were found in enrichment cultures from sandstone core and from production water, respectively. In addition, the deeply rooted lineage of two of the clones suggested previously undescribed, Gram-positive, low G+C content, thermophilic, obligately anaerobic bacteria present in production water. Such thermophilic, non-sulfate-reducing microorganisms may play an important ecological role alongside SRB in oil field environments.

  15. Sequence composition of BAC clones and SSR markers mapped to Upland cotton chromosomes 11 and 21 targeting resistance to soil-borne pathogens

    PubMed Central

    Wang, Congli; Ulloa, Mauricio; Shi, Xinyi; Yuan, Xiaohui; Saski, Christopher; Yu, John Z.; Roberts, Philip A.


    Genetic and physical framework mapping in cotton (Gossypium spp.) were used to discover putative gene sequences involved in resistance to common soil-borne pathogens. Chromosome (Chr) 11 and its homoeologous Chr 21 of Upland cotton (G. hirsutum) are foci for discovery of resistance (R) or pathogen-induced R (PR) genes underlying QTLs involved in response to root-knot nematode (Meloidogyne incognita), reniform nematode (Rotylenchulus reniformis), Fusarium wilt (Fusarium oxysporum f.sp. vasinfectum), Verticillium wilt (Verticillium dahliae), and black root rot (Thielaviopsis basicola). Simple sequence repeat (SSR) markers and bacterial artificial chromosome (BAC) clones from a BAC library developed from the Upland cotton Acala Maxxa were mapped on Chr 11 and Chr 21. DNA sequence through Gene Ontology (GO) of 99 of 256 Chr 11 and 109 of 239 Chr 21 previously mapped SSRs revealed response elements to internal and external stimulus, stress, signaling process, and cell death. The reconciliation between genetic and physical mapping of gene annotations from new DNA sequences of 20 BAC clones revealed 467 (Chr 11) and 285 (Chr 21) G. hirsutum putative coding sequences, plus 146 (Chr 11) and 98 (Chr 21) predicted genes. GO functional profiling of Unigenes uncovered genes involved in different metabolic functions and stress response elements (SRE). Our results revealed that Chrs 11 and 21 harbor resistance gene rich genomic regions. Sequence comparisons with the ancestral diploid D5 (G. raimondii), A2 (G. arboreum) and domesticated tetraploid TM-1 AD1 (G. hirsutum) genomes revealed abundance of transposable elements and confirmed the richness of resistance gene motifs in these chromosomes. The sequence information of SSR markers and BAC clones and the genetic mapping of BAC clones provide enhanced genetic and physical frameworks of resistance gene-rich regions of the cotton genome, thereby aiding discovery of R and PR genes and breeding for resistance to cotton diseases. PMID

  16. Cloning, sequencing and phylogenetic analysis of the small GTPase gene cdc-42 from Ancylostoma caninum.


    Yang, Yurong; Zheng, Jing; Chen, Jiaxin


    CDC-42 is a member of the Rho GTPase subfamily that is involved in many signaling pathways, including mitosis, cell polarity, cell migration and cytoskeleton remodeling. Here, we present the first characterization of a full-length cDNA encoding the small GTPase cdc-42, designated as Accdc-42, isolated from the parasitic nematode Ancylostoma caninum. The encoded protein contains 191 amino acid residues with a predicted molecular weight of 21 kDa and displays a high level of identity with the Rho-family GTPase protein CDC-42. Phylogenetic analysis revealed that Accdc-42 was most closely related to Caenorhabditis briggsae cdc-42. Comparison with selected sequences from the free-living nematode Caenorhabditis elegans, Drosophila melanogaster, Xenopus laevis, Danio rerio, Mus musculus and human genomes showed that Accdc-42 is highly conserved. AcCDC-42 demonstrates the highest identity to CDC-42 from C. briggsae (94.2%), and it also exhibits 91.6% identity to CDC-42 from C. elegans and 91.1% from Brugia malayi. Additionally, the transcript of Accdc-42 was analyzed during the different developmental stages of the worm. Accdc-42 was expressed in the L1/L2 larvae, L3 larvae and female and male adults of A. caninum.

  17. Pseudomonas aeruginosa outer membrane lipoprotein I gene: molecular cloning, sequence, and expression in Escherichia coli.

    PubMed Central

    Duchêne, M; Barron, C; Schweizer, A; von Specht, B U; Domdey, H


    Lipoprotein I (OprI) is one of the major proteins of the outer membrane of Pseudomonas aeruginosa. Like porin protein F (OprF), it is a vaccine candidate because it antigenically cross-reacts with all serotype strains of the International Antigenic Typing Scheme. Since lipoprotein I was expressed in Escherichia coli under the control of its own promoter, we were able to isolate the gene by screening a lambda EMBL3 phage library with a mouse monoclonal antibody directed against lipoprotein I. The monocistronic OprI mRNA encodes a precursor protein of 83 amino acid residues including a signal peptide of 19 residues. The mature protein has a molecular weight of 6,950, not including bound glycerol and lipid. Although the amino acid sequences of protein I of P. aeruginosa and Braun's lipoprotein of E. coli differ considerably (only 30.1% identical amino acid residues), peptidoglycan in E. coli, are identical. Using lipoprotein I expressed in E. coli, it can now be tested whether this protein alone, without P. aeruginosa lipopolysaccharide contaminations, has a protective effect against P. aeruginosa infections. Images PMID:2502533

  18. The group 10 allergen of Dermatophagoides farinae (Acari: Pyroglyphidae): cDNA cloning, sequence analysis, and expression in Escherichia coli BL21.


    Cui, Yubao; Zhou, Ying; Wang, Yungang; Ma, Guifang; Yang, Li


    Dermatophagoides farinae Hughes, American house dust mite, is highly allergenic, producing symptoms in people worldwide. Identifying and cloning the allergens in this species may enable better diagnostic and therapeutic approaches. Here, we cloned, sequenced, and expressed the full-length cDNA encoding D. farinae group 10 allergen (Der f 10) isolated from dust mites in China. Bioinformatic analysis indicated that the 888 bp sequence encoded a cytoskeleton protein 295 amino acids long, with a molecular weight of approximately equal 34 kDa. Sequence alignment with the group 10 allergens of Pyroglyphidae, Acaridae, and Glycyphagidae families revealed that the group 10 allergen from D. farinae is 95% similar to D. pteronyssinus Trouessart and Psoroptes ovis (Hering). These findings lay the groundwork for future studies, including large-scale production of recombinant Der f 10 allergen for diagnostic and therapeutic agents.

  19. Comparison of next-generation sequencing and clone-based sequencing in analysis of hepatitis B virus reverse transcriptase quasispecies heterogeneity.


    Gong, Ling; Han, Yue; Chen, Li; Liu, Feng; Hao, Pei; Sheng, Jia; Li, Xin-Hua; Yu, De-Min; Gong, Qi-Ming; Tian, Fei; Guo, Xiao-Kui; Zhang, Xin-Xin


    We previously reported that, based on clone-based sequencing (CBS), hepatitis B virus (HBV) heterogeneity within the reverse transcriptase (RT) region was a predictor of antiviral efficacy. Here, by comparing ultradeep pyrosequencing (UDPS), i.e., next-generation sequencing (NGS), with CBS in characterizing the genetic heterogeneity of HBV quasispecies within the RT region, we evaluated the performance of UDPS in the analysis of HBV viral populations. HBV genomic DNA was extracted from serum samples from 31 antiviral treatment-naive patients with chronic hepatitis B. The RT region quasispecies were analyzed in parallel using CBS and UDPS. Characterization of quasispecies heterogeneity was conducted using bioinformatics analysis. Quasispecies complexity values were calculated with the formula Sn = -Σi(pilnpi)/lnN. The number of qualified strains obtained by UDPS was much larger than that obtained by CBS (P < 0.001). Pearson analysis showed that there was a positive correlation of quasispecies complexity values at the nucleotide level for the two methods (P < 0.05), while the complexity value derived from UDPS data was higher than that derived from CBS data (P < 0.001). Study of the prevalences of variations within the RT region showed that CBS detected an average of 9.7 ± 1.1 amino acid substitutions/sample and UDPS detected an average of 16.2 ± 1.4 amino acid substitutions/sample. The phylogenetic analysis based on UDPS data showed more genetic entities than did that based on CBS data. Viral heterogeneity determination by the UDPS technique is more sensitive and efficient in terms of low-abundance variation detection and quasispecies simulation than that by the CBS method, although imperfect, and thus sheds light on the future clinical application of NGS in HBV quasispecies studies.

  20. Cloning, Sequencing, and Role in Virulence of Two Phospholipases (A1 and C) from Mesophilic Aeromonas sp. Serogroup O:34

    PubMed Central

    Merino, Susana; Aguilar, Alicia; Nogueras, Maria Mercedes; Regue, Miguel; Swift, Simon; Tomás, Juan M.


    Two different representative recombinant clones encoding Aeromonas hydrophila lipases were found upon screening on tributyrin (phospholipase A1) and egg yolk agar (lecithinase-phospholipase C) plates of a cosmid-based genomic library of Aeromonas hydrophila AH-3 (serogroup O34) introduced into Escherichia coli DH5α. Subcloning, nucleotide sequencing, and in vitro-coupled transcription-translation experiments showed that the phospholipase A1 (pla) and C (plc) genes code for an 83-kDa putative lipoprotein and a 65-kDa protein, respectively. Defined insertion mutants of A. hydrophila AH-3 defective in either pla or plc genes were defective in phospholipase A1 and C activities, respectively. Lecithinase (phospholipase C) was shown to be cytotoxic but nonhemolytic or poorly hemolytic. A. hydrophila AH-3 plc mutants showed a more than 10-fold increase in their 50% lethal dose on fish and mice, and complementation of the plc single gene on these mutants abolished this effect, suggesting that Plc protein is a virulence factor in the mesophilic Aeromonas sp. serogroup O:34 infection process. PMID:10417167

  1. Cloning, sequencing, and expression of the gene encoding the high-molecular-weight cytochrome c from Desulfovibrio vulgaris Hildenborough

    SciTech Connect

    Pollock, W.B.R.; Voordouw, G. ); Loutfi, M.; Bruschi, M. ); Rapp-Giles, B.J.; Wall, J.D. )


    By using a synthetic deoxyoligonucleotide probe designed to recognize the structural gene for cytochrome cc{sub 3} from Desulfovibrio vulgaris Hildenborough, a 3.7-kb XhoI genomic DNA fragment containing the cc{sub 3} gene was isolated. The gene encodes a precursor polypeptide of 58.9 kDa, with an NH{sub 2}-terminal signal sequence of 31 residues. The mature polypeptide (55.7 kDa) has 16 heme binding sites of the form C-X-X-C-H. Covalent binding of heme to these 16 sites gives a holoprotein of 65.5 kDa with properties similar to those of the high-molecular-weight cytochrome c (Hmc) isolated from the same strain by Higuchi et al. Since the data indicate that cytochrome cc{sub 3} and Hmc are the same protein, the gene has been named hmc. The Hmc polypeptide contains 31 histidinyl residues, 16 of which are integral to heme binding sites. Thus, only 15 of the 16 hemes can have bis-histidinyl coordination. A comparison of the arrangement of heme binding sites and coordinated histidines in the amino acid sequences of cytochrome c{sub 3} and Hme from D. vulgaris Hildenborough suggest that the latter contains three cytochrome c{sub 3}-like domains. Cloning of the D. vulgaris Hildenborough hmc gene into the broad-host-range vector pJRD215 and subsequent conjugational transfer of the recombinant plasmid into D. desulfuricans G200 led to expression of a periplasmic Hmc gene produce with covalently bound hemes.

  2. Genes galore: a summary of methods for accessing results from large-scale partial sequencing of anonymous Arabidopsis cDNA clones.

    PubMed Central

    Newman, T; de Bruijn, F J; Green, P; Keegstra, K; Kende, H; McIntosh, L; Ohlrogge, J; Raikhel, N; Somerville, S; Thomashow, M


    High-throughput automated partial sequencing of anonymous cDNA clones provides a method to survey the repertoire of expressed genes from an organism. Comparison of the coding capacity of these expressed sequence tags (ESTs) with the sequences in the public data bases results in assignment of putative function to a significant proportion of the ESTs. Thus, the more than 13,400 plant ESTs that are currently available provide a new resource that will facilitate progress in many areas of plant biology. These opportunities are illustrated by a description of the results obtained from analysis of 1500 Arabidopsis ESTs from a cDNA library prepared from equal portions of poly(A+) mRNA from etiolated seedlings, roots, leaves, and flowering inflorescences. More than 900 different sequences were represented, 32% of which showed significant nucleotide or deduced amino acid sequences similarity to previously characterized genes or proteins from a wide range of organisms. At least 165 of the clones had significant deduced amino acid sequence homology to proteins or gene products that have not been previously characterized from higher plants. A summary of methods for accessing the information and materials generated by the Arabidopsis cDNA sequencing project is provided. PMID:7846151

  3. Identification of key factors conquering developmental arrest of somatic cell cloned embryos by combining embryo biopsy and single-cell sequencing

    PubMed Central

    Liu, Wenqiang; Liu, Xiaoyu; Wang, Chenfei; Gao, Yawei; Gao, Rui; Kou, Xiaochen; Zhao, Yanhong; Li, Jingyi; Wu, You; Xiu, Wenchao; Wang, Su; Yin, Jiqing; Liu, Wei; Cai, Tao; Wang, Hong; Zhang, Yong; Gao, Shaorong


    Differentiated somatic cells can be reprogrammed into totipotent embryos through somatic cell nuclear transfer. However, most cloned embryos arrest at early stages and the underlying molecular mechanism remains largely unexplored. Here, we first developed a somatic cell nuclear transfer embryo biopsy system at two- or four-cell stage, which allows us to trace the developmental fate of the biopsied embryos precisely. Then, through single-cell transcriptome sequencing of somatic cell nuclear transfer embryos with different developmental fates, we identified that inactivation of Kdm4b, a histone H3 lysine 9 trimethylation demethylase, functions as a barrier for two-cell arrest of cloned embryos. Moreover, we discovered that inactivation of another histone demethylase Kdm5b accounts for the arrest of cloned embryos at the four-cell stage through single-cell analysis. Co-injection of Kdm4b and Kdm5b can restore transcriptional profiles of somatic cell nuclear transfer embryos and greatly improve the blastocyst development (over 95%) as well as the production of cloned mice. Our study therefore provides an effective approach to identify key factors responsible for the developmental arrest of somatic cell cloned embryos. PMID:27462457

  4. Identification of key factors conquering developmental arrest of somatic cell cloned embryos by combining embryo biopsy and single-cell sequencing.


    Liu, Wenqiang; Liu, Xiaoyu; Wang, Chenfei; Gao, Yawei; Gao, Rui; Kou, Xiaochen; Zhao, Yanhong; Li, Jingyi; Wu, You; Xiu, Wenchao; Wang, Su; Yin, Jiqing; Liu, Wei; Cai, Tao; Wang, Hong; Zhang, Yong; Gao, Shaorong


    Differentiated somatic cells can be reprogrammed into totipotent embryos through somatic cell nuclear transfer. However, most cloned embryos arrest at early stages and the underlying molecular mechanism remains largely unexplored. Here, we first developed a somatic cell nuclear transfer embryo biopsy system at two- or four-cell stage, which allows us to trace the developmental fate of the biopsied embryos precisely. Then, through single-cell transcriptome sequencing of somatic cell nuclear transfer embryos with different developmental fates, we identified that inactivation of Kdm4b, a histone H3 lysine 9 trimethylation demethylase, functions as a barrier for two-cell arrest of cloned embryos. Moreover, we discovered that inactivation of another histone demethylase Kdm5b accounts for the arrest of cloned embryos at the four-cell stage through single-cell analysis. Co-injection of Kdm4b and Kdm5b can restore transcriptional profiles of somatic cell nuclear transfer embryos and greatly improve the blastocyst development (over 95%) as well as the production of cloned mice. Our study therefore provides an effective approach to identify key factors responsible for the developmental arrest of somatic cell cloned embryos.

  5. The imported preprotein of the proteolipid subunit of the mitochondrial ATP synthase from Neurospora crassa. Molecular cloning and sequencing of the mRNA.

    PubMed Central

    Viebrock, A; Perz, A; Sebald, W


    The proteolipid subunit of the mitochondrial ATP synthase from Neurospora crassa is an extremely hydrophobic protein of 81 amino acid residues, which is imported into mitochondria as a precursor of mol. wt. 15 000. The primary structure of the imported form has now been determined by isolating and analyzing cDNA clones of the preproteolipid mRNA. An initial cDNA clone was identified by hybridizing total polyadenylated RNA to pooled cDNA recombinant plasmids from an ordered clone bank and subsequent cell-free translation of hybridization-selected mRNA. Further preproteolipid clones were identified at a frequency of 0.2% by colony filter hybridization. One isolated cDNA represented the major part of the preproteolipid mRNA. The nucleotide sequence showed 243 bases corresponding to the mature proteolipid and, in addition, 178 bases coding for an amino-terminal presequence . Non-coding sequences of 48 bases at the 5' end and of 358 bases at the 3' end plus a poly(A) tail were determined. The long presequence of 66 amino acids is very polar, in contrast to the lipophilic mature proteolipid, and includes 12 basic and no acidic side chains. It is suggested that the presequence is specifically designed to solubilize the proteolipid for post-translational import into the mitochondria. Images Fig. 1. PMID:6329691

  6. Fusion primer and nested integrated PCR (FPNI-PCR): a new high-efficiency strategy for rapid chromosome walking or flanking sequence cloning

    PubMed Central


    Background The advent of genomics-based technologies has revolutionized many fields of biological enquiry. However, chromosome walking or flanking sequence cloning is still a necessary and important procedure to determining gene structure. Such methods are used to identify T-DNA insertion sites and so are especially relevant for organisms where large T-DNA insertion libraries have been created, such as rice and Arabidopsis. The currently available methods for flanking sequence cloning, including the popular TAIL-PCR technique, are relatively laborious and slow. Results Here, we report a simple and effective fusion primer and nested integrated PCR method (FPNI-PCR) for the identification and cloning of unknown genomic regions flanked known sequences. In brief, a set of universal primers was designed that consisted of various 15-16 base arbitrary degenerate oligonucleotides. These arbitrary degenerate primers were fused to the 3' end of an adaptor oligonucleotide which provided a known sequence without degenerate nucleotides, thereby forming the fusion primers (FPs). These fusion primers are employed in the first step of an integrated nested PCR strategy which defines the overall FPNI-PCR protocol. In order to demonstrate the efficacy of this novel strategy, we have successfully used it to isolate multiple genomic sequences namely, 21 orthologs of genes in various species of Rosaceace, 4 MYB genes of Rosa rugosa, 3 promoters of transcription factors of Petunia hybrida, and 4 flanking sequences of T-DNA insertion sites in transgenic tobacco lines and 6 specific genes from sequenced genome of rice and Arabidopsis. Conclusions The successful amplification of target products through FPNI-PCR verified that this novel strategy is an effective, low cost and simple procedure. Furthermore, FPNI-PCR represents a more sensitive, rapid and accurate technique than the established TAIL-PCR and hiTAIL-PCR procedures. PMID:22093809

  7. Cloning, sequence analysis and expression profiles of Toll-like receptor 7 from Chinese giant salamander Andrias davidianus.


    Huang, Lili; Fan, Yuding; Zhou, Yong; Jiang, Nan; Liu, Wenzhi; Meng, Yan; Zeng, Lingbing


    The Chinese giant salamander, Andrias davidianus, is the largest extant amphibian species in the world, which is of significance due to its specific position in the evolutionary history of vertebrates. Currently, limited information about the innate immune system of this animal is known. In this study, the toll-like receptor 7 (TLR7), designated CgsTLR7, was cloned from Chinese giant salamander, A. davidianus. The full-length cDNA of CgsTLR7 is 3747 bp, with an open reading frame of 3150 bp, encoding 1049 amino acids. The TLR family motifs, including the leucine-rich repeat (LRR) and Toll/interleukin (IL)-1 receptor (TIR) domain are conserved in CgsTLR7, which includes 19 LRRs and a TIR domain. The predicted amino acid sequence of CgsTLR7 has 71%, 65%, 63% and 55% identity with turtle, chicken, human and fugu TLR7 homologues, respectively. Phylogenetic analysis showed that CgsTLR7 is closest to that of frog TLR7 among the examined species. Quantitative real-time PCR analysis revealed broad expression of CgsTLR7 in tissues from apparently healthy Chinese giant salamanders with the highest expression in the liver and the lowest expression in the intestine. The mRNA expression was up-regulated and reached a peak level in the kidney, liver and spleen at 12 h, 24 h and 48 h after infecting the animals with the giant salamander iridovirus (GSIV), respectively. These results suggest that CgsTLR7 has a conserved gene structure and might play an important role in immune regulation against viral infections in the Chinese giant salamander.

  8. Molecular cloning, sequence analysis and expression of a GHF 43 xylanase from Aspergillus niger in Escherichia coli.


    Zhou, Chen-Yan; Wang, Yong-Tao; Zhu, Tie-Chui; Fu, Guan-Hua; Wang, Dan-Dan


    A new xylanase gene (xyn43A) from Aspergillus niger XZ-3S was cloned and expressed in Escherichia coli BL21-CodonPlus (DE3)-RIL. The coding region of the gene was separated by only one intron 86 bp in length. It encoded 318 amino acid residues of a protein with a calculated molecular weight (MW) of 33.47 kDa plus a signal peptide of 19 amino acids. The amino acid sequence of the xyn43A gene showed 77.56% amino acid identity to A. nidulans xylanase, and the phylogenetic tree analysis revealed that xyn43A had close relationships with those of family 43 of glycosyl hydrolases reported from other microorganisms. Three-dimensional structure modeling showed that Xyn43A had a typical five-blade β-propeller fold. The mature peptide encoding cDNA was subcloned into pET-28a (+) expression vector. The resultant recombinant plasmid pET-28a-xyn43A was transformed into Escherichia coli BL21-CodonPlus (DE3)-RIL, and xylanase activity was measured. A maximum activity of 61.43 U/mg was obtained from the cellular extract of E. coli BL21-CodonPlus (DE3)-RIL harboring pET-28a-xyn43A. The recombinant xylanase had optimal activity at pH5.0 and 45°C. Fe(3+), Cu(2+) and EDTA had an obvious active effect on the enzyme.

  9. Cloning, sequencing, and expression of the uroporphyrinogen III methyltransferase cobA gene of Propionibacterium freudenreichii (shermanii).


    Sattler, I; Roessner, C A; Stolowich, N J; Hardin, S H; Harris-Haller, L W; Yokubaitis, N T; Murooka, Y; Hashimoto, Y; Scott, A I


    We cloned, sequenced, and overexpressed cobA, the gene encoding uroporphyrinogen III methyltransferase in Propionibacterium freudenreichii, and examined the catalytic properties of the enzyme. The methyltransferase is similar in mass (27 kDa) and homologous to the one isolated from Pseudomonas denitrificans. In contrast to the much larger isoenzyme encoded by the cysG gene of Escherichia coli (52 kDa), the P. freudenreichii enzyme does not contain the additional 22-kDa peptide moiety at its N-terminal end bearing the oxidase-ferrochelatase activity responsible for the conversion of dihydrosirohydrochlorin (precorrin-2) to siroheme. Since it does not contain this moiety, it is not a likely candidate for synthesis of a cobalt-containing early intermediate that has been proposed for the vitamin B12 biosynthetic pathway in P. freudenreichii. Uroporphyrinogen III methyltransferase of P. freudenreichii not only catalyzes the addition of two methyl groups to uroporphyrinogen III to afford the early vitamin B12 intermediate, precorrin-2, but also has an overmethylation property that catalyzes the synthesis of several tri- and tetra-methylated compounds that are not part of the vitamin B12 pathway. The enzyme catalyzes the addition of three methyl groups to uroporphyrinogen I to form trimethylpyrrocorphin, the intermediate necessary for biosynthesis of the natural products, factors S1 and S3, previously isolated from this organism. A second gene found upstream from the cobA gene encodes a protein homologous to CbiO of Salmonella typhimurium, a membrane-bound, ATP-dependent transport protein thought to be part of the cobalt transport system involved in vitamin B12 synthesis. These two genes do not appear to constitute part of an extensive cobalamin operon.

  10. Examination of exhaustive cloning attempts reveals that C. elegans piRNAs, transposons, and repeat sequences are efficiently cloned in yeast, but not in bacteria.


    Sagy, Or; Shamir, Ron; Rechavi, Oded


    Genome sequencing requires insertion of random fragments of the sequenced organism's DNA into a unicellular host, most often Escherichia coli bacteria. This manipulation was found in the past to be analogous to naturally occurring horizontal gene transfer, and moreover has proved valuable to understanding toxicity of foreign genetic elements to E. coli. Sequencing of the Caenorhabditis elegans genome was similarly achieved via DNA transformation into E. coli. However, numerous attempts have proven a significant percentage of the genome unclonable using bacteria, although clonable via yeast. We examined the genomic segments that were not clonable in bacteria but were clonable in yeast, and observed that, in line with previous hypotheses, such sequences are more repetitive on average compared with the entire C. elegans genome. In addition, we found that these gap-sequences encode significantly more for DNA transposons. Surprisingly, we discovered that although the vast majority of the C. elegans genome is clonable in bacteria (77.5%), almost all the thousands of sequences that encode for PIWI-interacting small RNAs, or 21U-RNAs (91.6%) were only clonable in yeast. These results might help understanding why most piRNAs in C. elegans are physically clustered on particular loci on chromosome IV. In worms and in a large number of other organisms, piRNAs serve to distinguish "Self" from "Non-Self" sequences, and thus to protect the integrity of the genome against foreign genetic elements, such as transposons. We discuss the possible implications of these discoveries.

  11. Cloning, genetic analysis, and nucleotide sequence of a determinant coding for a 19-kilodalton peptidoglycan-associated protein (Ppl) of Legionella pneumophila.

    PubMed Central

    Ludwig, B; Schmid, A; Marre, R; Hacker, J


    A genomic library of Legionella pneumophila, the causative agent of Legionnaires disease in humans, was constructed in Escherichia coli K-12, and the recombinant clones were screened by immuno-colony blots with an antiserum raised against heat-killed L. pneumophila. Twenty-three clones coding for a Legionella-specific protein of 19 kDa were isolated. The 19-kDa protein, which represents an outer membrane protein, was found to be associated with the peptidoglycan layer both in L. pneumophila and in the recombinant E. coli clones. This was shown by electrophoresis and Western immunoblot analysis of bacterial cell membrane fractions with a monospecific polyclonal 19-kDa protein-specific antiserum. The protein was termed peptidoglycan-associated protein of L. pneumophila (Ppl). The corresponding genetic determinant, ppl, was subcloned on a 1.8-kb ClaI fragment. DNA sequence studies revealed that two open reading frames, pplA and pplB, coding for putative proteins of 18.9 and 16.8 kDa, respectively, were located on the ClaI fragment. Exonuclease III digestion studies confirmed that pplA is the gene coding for the peptidoglycan-associated 19-kDa protein of L. pneumophila. The amino acid sequence of PplA exhibits a high degree of homology to the sequences of the Pal lipoproteins of E. coli K-12 and Haemophilus influenzae. Images PMID:1855972

  12. Molecular cloning, sequence analysis, and cadmium stress-rated expression changes of BTG1 in freshwater pearl mussel (Hyriopsis schlegelii).


    Peng, Kou; Wang, Cheng-Yuan; Wang, Jun-Hua; Sheng, Jun-Qing; Shi, Jian-Wu; Li, Jian; Hong, Yi-Jiang


    The B cells translocation gene 1 (BTG1) is a member of the BTG/TOB family of anti-proliferative genes, which have recently emerged as important regulators of cell growth and differentiation among verteates. Here, for the first time we cloned the full-length cDNA sequence of Hyriopsis schlegelii (Hs-BTG1), an economically important freshwater shellfish and potential indicator of environmental heavy metal pollution, for the first time. Using rapid amplification of cDNA ends (RACE) together with splicing the EST sequence from a haemocyte cDNA liary, we found that Hs-BTG1 contains a 525 bp open reading frame (ORF) encoding a 174 amino-acid polypeptide, a 306 bp 5' untranslated region (5' UTR), and a 571 bp 3' UTR with a Poly(A) tail as well as a transcription termination signal (AATAAA). Homologue searching against GenBank revealed that Hs-BTG1 was closest to Crassostrea gigas BTG1, sharing 50.57% of protein identities. Hs-BTG1 also shares some typical features of the BTG/TOB family, possessing two well-conserved A and B boxes. Clustering analysis of Hs-BTG1 and other known BTGs showed that Hs-BTG1 was also closely related to BTG1 of C. gigas from the inverteate BTG1 clade. Function prediction via homology modeling showed that both Hs-BTG1 and C. gigas BTG1 share a similar three-dimensional structure with Homo sapiens BTG1. Tissue-specific expression analysis of the Hs-BTG1 via real-time PCR showed that the transcripts were constitutively expressed, with the highest levels in the hepatopancreas and gills, and the lowest in both haemocyte and muscle tissue. Expression levels of Hs-BTG1 in hepatopancreas (2.03-fold), mantle (2.07-fold), kidney (2.2-fold) and haemocyte (2.5-fold) were enhanced by cadmium (Cd²⁺) stress, suggesting that Hs-BTG1 may have played a significant role in H. schlegelii adaptation to adverse environmental conditions.

  13. Molecular cloning and DNA sequence analysis of genes encoding cytotoxic T lymphocyte-defined HLA-A3 subtypes: the E1 subtype.


    Cowan, E P; Jordan, B R; Coligan, J E


    Influenza-specific cytotoxic T cells restricted by HLA-A3 and allogeneic CTL specific for HLA-A3 recognize differences between serologically indistinguishable HLA-A3 antigens. Previous biochemical studies have indicated that such differential recognition can be explained by alterations in the primary structure of class I heavy chains. Characterization of these sequence differences may therefore identify portions of the class I molecule that form determinants recognized by CTL. In this study, we describe the cloning and sequencing of an HLA-A3 subtype from donor E1 (E1-A3). Cloning of the gene encoding E1-A3 was simplified by determining that a 15.5-kb BamHI fragment contains the complete gene and is characteristic of HLA-A3 and only one other class I gene (HLA-A11). Comparison of the E1-A3 sequence to that of a previously sequenced HLA-A3 gene for exons encoding extracellular class I domains revealed three nucleotide differences. All of these differences were located within a discrete region of exon 3 (encoding the alpha 2 domain) and result in a change of two amino acids, at positions 152 (Glu----Val) and 156 (Leu----Gln). This finding suggests that these amino acids are crucial for the information of a determinant recognized by CTL. Furthermore, the altered nucleotide sequence of E1-A3 is identical to the sequence of the HLA-Aw24 gene for codons 128 to 161. These observations of multiple clustered changes in the E1-A3 subtype (relative to the prototype sequence) and identity of the altered sequence with the sequence of another class I gene support the concept that gene conversion is a primary mechanism for the generation of class I polymorphism.

  14. Cloning and sequencing of the genes encoding the large and small subunits of the periplasmic (NiFeSe) hydrogenase of Desulfovibrio baculatus

    SciTech Connect

    Menon, N.K.; Peck, H.D. Jr.; Le Gall, J.; Przybyla, A.E.


    The genes coding for the large and small subunits of the periplasmic hydrogenase from Desulfovibrio baculatus have been cloned and sequenced. The genes are arranged in an operon with the small subunit gene preceding the large subunit gene. The small subunit gene codes for a 32 amino acid leader sequence supporting the periplasmic localization of the protein, however no ferredoxin-like or other characteristic iron-sulfur coordination sites were observed. The periplasmic hydrogenases from D. baculatus (an NiFeSe protein) and D. vulgaris (an Fe protein) exhibit no homology suggesting that they are structurally different, unrelated entities.

  15. Species-Level Phylogeny and Polyploid Relationships in Hordeum (Poaceae) Inferred by Next-Generation Sequencing and In Silico Cloning of Multiple Nuclear Loci.


    Brassac, Jonathan; Blattner, Frank R


    Polyploidization is an important speciation mechanism in the barley genus Hordeum. To analyze evolutionary changes after allopolyploidization, knowledge of parental relationships is essential. One chloroplast and 12 nuclear single-copy loci were amplified by polymerase chain reaction (PCR) in all Hordeum plus six out-group species. Amplicons from each of 96 individuals were pooled, sheared, labeled with individual-specific barcodes and sequenced in a single run on a 454 platform. Reference sequences were obtained by cloning and Sanger sequencing of all loci for nine supplementary individuals. The 454 reads were assembled into contigs representing the 13 loci and, for polyploids, also homoeologues. Phylogenetic analyses were conducted for all loci separately and for a concatenated data matrix of all loci. For diploid taxa, a Bayesian concordance analysis and a coalescent-based dated species tree was inferred from all gene trees. Chloroplast matK was used to determine the maternal parent in allopolyploid taxa. The relative performance of different multilocus analyses in the presence of incomplete lineage sorting and hybridization was also assessed. The resulting multilocus phylogeny reveals for the first time species phylogeny and progenitor-derivative relationships of all di- and polyploid Hordeum taxa within a single analysis. Our study proves that it is possible to obtain a multilocus species-level phylogeny for di- and polyploid taxa by combining PCR with next-generation sequencing, without cloning and without creating a heavy load of sequence data.

  16. Sequencing analysis of 20,000 full-length cDNA clones from cassava reveals lineage specific expansions in gene families related to stress response

    PubMed Central

    Sakurai, Tetsuya; Plata, Germán; Rodríguez-Zapata, Fausto; Seki, Motoaki; Salcedo, Andrés; Toyoda, Atsushi; Ishiwata, Atsushi; Tohme, Joe; Sakaki, Yoshiyuki; Shinozaki, Kazuo; Ishitani, Manabu


    Background Cassava, an allotetraploid known for its remarkable tolerance to abiotic stresses is an important source of energy for humans and animals and a raw material for many industrial processes. A full-length cDNA library of cassava plants under normal, heat, drought, aluminum and post harvest physiological deterioration conditions was built; 19968 clones were sequence-characterized using expressed sequence tags (ESTs). Results The ESTs were assembled into 6355 contigs and 9026 singletons that were further grouped into 10577 scaffolds; we found 4621 new cassava sequences and 1521 sequences with no significant similarity to plant protein databases. Transcripts of 7796 distinct genes were captured and we were able to assign a functional classification to 78% of them while finding more than half of the enzymes annotated in metabolic pathways in Arabidopsis. The annotation of sequences that were not paired to transcripts of other species included many stress-related functional categories showing that our library is enriched with stress-induced genes. Finally, we detected 230 putative gene duplications that include key enzymes in reactive oxygen species signaling pathways and could play a role in cassava stress response features. Conclusion The cassava full-length cDNA library here presented contains transcripts of genes involved in stress response as well as genes important for different areas of cassava research. This library will be an important resource for gene discovery, characterization and cloning; in the near future it will aid the annotation of the cassava genome. PMID:18096061

  17. Species-Level Phylogeny and Polyploid Relationships in Hordeum (Poaceae) Inferred by Next-Generation Sequencing and In Silico Cloning of Multiple Nuclear Loci

    PubMed Central

    Brassac, Jonathan; Blattner, Frank R.


    Polyploidization is an important speciation mechanism in the barley genus Hordeum. To analyze evolutionary changes after allopolyploidization, knowledge of parental relationships is essential. One chloroplast and 12 nuclear single-copy loci were amplified by polymerase chain reaction (PCR) in all Hordeum plus six out-group species. Amplicons from each of 96 individuals were pooled, sheared, labeled with individual-specific barcodes and sequenced in a single run on a 454 platform. Reference sequences were obtained by cloning and Sanger sequencing of all loci for nine supplementary individuals. The 454 reads were assembled into contigs representing the 13 loci and, for polyploids, also homoeologues. Phylogenetic analyses were conducted for all loci separately and for a concatenated data matrix of all loci. For diploid taxa, a Bayesian concordance analysis and a coalescent-based dated species tree was inferred from all gene trees. Chloroplast matK was used to determine the maternal parent in allopolyploid taxa. The relative performance of different multilocus analyses in the presence of incomplete lineage sorting and hybridization was also assessed. The resulting multilocus phylogeny reveals for the first time species phylogeny and progenitor-derivative relationships of all di- and polyploid Hordeum taxa within a single analysis. Our study proves that it is possible to obtain a multilocus species-level phylogeny for di- and polyploid taxa by combining PCR with next-generation sequencing, without cloning and without creating a heavy load of sequence data. PMID:26048340

  18. Structural analysis of a Lotus japonicus genome. III. Sequence features and mapping of sixty-two TAC clones which cover the 6.7 Mb regions of the genome.


    Kaneko, Takakazu; Asamizu, Erika; Kato, Tomohiko; Sato, Shusei; Nakamura, Yasukazu; Tabata, Satoshi


    A total of sixty-two clones were selected from a TAC (transformation-competent artificial chromosome) genomic library of the Lotus japonicus accession MG-20 based on the sequence information of expressed sequence tags (ESTs), cDNA and gene information, and their nucleotide sequences were determined. The length of the sequenced regions in this study is 6,682,189 bp, and the total length of the regions sequenced so far is 18,711,484 bp together with the nucleotide sequences of 121 TAC clones previously reported. By comparison with the sequences in protein and EST databases and analysis with computer programs for gene modeling, a total of 573 potential protein-coding genes with known or predicted functions, 91 gene segments and 272 pseudogenes were identified in the newly sequenced regions. Each of the sequenced clones was localized onto the linkage map of two accessions of L. japonicus, Gifu B-129 and Miyakojima MG-20, using simple sequence repeat length polymorphism (SSLP) or derived cleaved amplified polymorphic sequence (dCAPS) markers generated based on the nucleotide sequences of the clones. The sequence data, gene information and mapping information are available through the World Wide Web at

  19. Analysis of Fungal Diversity in the Wheat Rhizosphere by Sequencing of Cloned PCR-Amplified Genes Encoding 18S rRNA and Temperature Gradient Gel Electrophoresis

    PubMed Central

    Smit, Eric; Leeflang, Paula; Glandorf, Boet; Dirk van Elsas, Jan; Wernars, Karel


    Like bacteria, fungi play an important role in the soil ecosystem. As only a small fraction of the fungi present in soil can be cultured, conventional microbiological techniques yield only limited information on the composition and dynamics of fungal communities in soil. DNA-based methods do not depend on the culturability of microorganisms, and therefore they offer an attractive alternative for the study of complex fungal community structures. For this purpose, we designed various PCR primers that allow the specific amplification of fungal 18S-ribosomal-DNA (rDNA) sequences, even in the presence of nonfungal 18S rDNA. DNA was extracted from the wheat rhizosphere, and 18S rDNA gene banks were constructed in Escherichia coli by cloning PCR products generated with primer pairs EF4-EF3 (1.4 kb) and EF4-fung5 (0.5 kb). Fragments of 0.5 kb from the cloned inserts were sequenced and compared to known rDNA sequences. Sequences from all major fungal taxa were amplified by using both primer pairs. As predicted by computer analysis, primer pair EF4-EF3 appeared slightly biased to amplify Basidiomycota and Zygomycota, whereas EF4-fung5 amplified mainly Ascomycota. The 61 clones that were sequenced matched the sequences of 24 different species in the Ribosomal Database Project (RDP) database. Similarity values ranged from 0.676 to 1. Temperature gradient gel electrophoresis (TGGE) analysis of the fungal community in the wheat rhizosphere of a microcosm experiment was carried out after amplification of total DNA with both primer pairs. This resulted in reproducible, distinctive fingerprints, confirming the difference in amplification specificity. Clear banding patterns were obtained with soil and rhizosphere samples by using both primer sets in combination. By comparing the electrophoretic mobility of community fingerprint bands to that of the bands obtained with separate clones, some could be tentatively identified. While 18S-rDNA sequences do not always provide the taxonomic

  20. Discovery of Novel dsRNA Viral Sequences by In Silico Cloning and Implications for Viral Diversity, Host Range and Evolution

    PubMed Central

    Liu, Huiquan; Fu, Yanping; Xie, Jiatao; Cheng, Jiasen; Ghabrial, Said A.; Li, Guoqing; Yi, Xianhong; Jiang, Daohong


    Genome sequence of viruses can contribute greatly to the study of viral evolution, diversity and the interaction between viruses and hosts. Traditional molecular cloning methods for obtaining RNA viral genomes are time-consuming and often difficult because many viruses occur in extremely low titers. DsRNA viruses in the families, Partitiviridae, Totiviridae, Endornaviridae, Chrysoviridae, and other related unclassified dsRNA viruses are generally associated with symptomless or persistent infections of their hosts. These characteristics indicate that samples or materials derived from eukaryotic organisms used to construct cDNA libraries and EST sequencing might carry these viruses, which were not easily detected by the researchers. Therefore, the EST databases may include numerous unknown viral sequences. In this study, we performed in silico cloning, a procedure for obtaining full or partial cDNA sequence of a gene by bioinformatics analysis, using known dsRNA viral sequences as queries to search against NCBI Expressed Sequence Tag (EST) database. From this analysis, we obtained 119 novel virus-like sequences related to members of the families, Endornaviridae, Chrysoviridae, Partitiviridae, and Totiviridae. Many of them were identified in cDNA libraries of eukaryotic lineages, which were not known to be hosts for these viruses. Furthermore, comprehensive phylogenetic analysis of these newly discovered virus-like sequences with known dsRNA viruses revealed that these dsRNA viruses may have co-evolved with respective host supergroups over a long evolutionary time while potential horizontal transmissions of viruses between different host supergroups also is possible. We also found that some of the plant partitiviruses may have originated from fungal viruses by horizontal transmissions. These findings extend our knowledge of the diversity and possible host range of dsRNA viruses and offer insight into the origin and evolution of relevant viruses with their hosts. PMID

  1. The Zymomonas mobilis regulator hfq contributes to tolerance against multiple lignocellulosic pretreatment inhibitors

    SciTech Connect

    Yang, Shihui; Pelletier, Dale A; Lu, Tse-Yuan; Brown, Steven D


    Zymomonas mobilis produces near theoretical yields of ethanol and recombinant strains are candidate industrial microorganisms. To date, few studies have examined its responses to various stresses at the gene level. Hfq is a conserved bacterial member of the Sm-like family of RNA-binding proteins, coordinating a broad array of responses including multiple stress responses. In a previous study, we observed Z. mobilis ZM4 gene ZMO0347 showed higher expression under anaerobic, stationary phase compared to that of aerobic, stationary conditions. We have shown the utility of the pKNOCK suicide plasmid for mutant construction in Z. mobilis, and constructed a Gateway compatible expression plasmid for use in Z. mobilis for the first time. We have also used genetics to show Z. mobilis Hfq and S. cerevisiae Lsm proteins play important roles in resisting multiple, important industrially relevant inhibitors. The conserved nature of this global regulator offers the potential to apply insights from these fundamental studies for further industrial strain development.

  2. Electrochemical and biochemical analysis of ethanol fermentation of zymomonas mobilis KCCM11336.


    Jeon, Bo Young; Hwang, Tae Sik; Park, Doo Hyun


    An electrochemical bioreactor (ECB) composed of a cathode compartment and an air anode was used in this study to characterize the ethanol fermentation of Zymomonas mobilis. The cathode and air anode were constructed of modified graphite felt with neutral red (NR) and a modified porous carbon plate with cellulose acetate and porous ceramic membrane, respectively. The air anode operates as a catalyst to generate protons and electrons from water. The growth and ethanol production of Z. mobilis were 50% higher in the ECB than were observed under anoxic nitrogen conditions. Ethanol production by growing cells and the crude enzyme of Z. mobilis were significantly lower under aerobic conditions than under other conditions. The growing cells and crude enzyme of Z. mobilis did not catalyze ethanol production from pyruvate and acetaldehyde. The membrane fraction of crude enzyme catalyzed ethanol production from glucose, but the soluble fraction did not. NADH was oxidized to NAD+ in association with H2O2 reduction, via the catalysis of crude enzyme. Our results suggested that NADH/NAD+ balance may be a critical factor for ethanol producton from glucose in the metabolism of Z. mobilis, and that the metabolic activity of both growing cells and crude enzyme for ethanol fermentation may be induced in the presence of glucose.

  3. Structural analysis of a Lotus japonicus genome. IV. Sequence features and mapping of seventy-three TAC clones which cover the 7.5 mb regions of the genome.


    Asamizu, Erika; Kato, Tomohiko; Sato, Shutsei; Nakamura, Yasukazu; Kaneko, Takakazu; Tabata, Satoshi


    Using the sequence information of expressed sequences tags (ESTs), cDNAs and genes from Lotus japonicus and other legumes, 73 TAC (transformation-competent artificial chromosomes) clones were selected from a genomic library of L. japonicus accession MG-20, and their nucleotide sequences were determined. The length of the DNA sequenced in this study was 7,455,959 bp, and the total length of the DNA regions sequenced so far is 26,167,443 bp together with the nucleotide sequences of 183 TAC clones previously reported. By similarity searches against the sequences in protein and EST databases and prediction by computer programs, a total of 699 potential protein-encoding genes with known or predicted functions, 163 gene segments and 267 pseudogenes were assigned to the newly sequenced regions. Based oil the nucleotide sequences of the clones, simple sequence repeat length polymorphism (SSLP) or derived cleaved amplified polymorphic sequence (dCAPS) markers were generated, and each clone was located onto the linkage map of two accessions of L. japonicus, Gifu B-129 and Miyakojima MG-20. The sequence data, gene information and mapping information are available through the World Wide Web at

  4. Structural analysis of a Lotus japonicus genome. V. Sequence features and mapping of sixty-four TAC clones which cover the 6.4 mb regions of the genome.


    Kato, Tomohiko; Sato, Shusei; Nakamura, Yasukazu; Kaneko, Takakazu; Asamizu, Erika; Tabata, Satoshi


    We determined the nucleotide sequences of 64 TAC (transformation-competent artificial chromosome) clones selected from genomic libraries of Lotus japonicus accession Miyakojima MG-20 based on the sequence information of expressed sequence tags (ESTs), cDNAs, genes and DNA markers from L. japonicus and other legumes. The length of the DNA regions sequenced in this study was 6,370,255 bp, and the total length of the L. japonicus genome sequenced so far is 32,537,698 bp together with the nucleotide sequences of 256 TAC clones previously reported. Five hundred forty-eight potential protein-encoding genes with known or predicted functions, 127 gene segments and 224 pseudogenes were assigned to the newly sequenced regions by computer prediction and similarity searches against the sequences in protein and EST databases. Based on the nucleotide sequences of the clones, simple sequence repeat length polymorphism (SSLP) or derived cleaved amplified polymorphic sequence (dCAPS) markers were generated, and each clone was genetically localized onto the linkage map of two accessions of L. japonicus, MG-20 and Gifu B-129. The sequence data, gene information and mapping information are available through the World Wide Web at

  5. Sequencing and analysis of 10,967 full-length cDNA clones from Xenopus laevis and Xenopus tropicalis reveals post-tetraploidization transcriptome remodeling.


    Morin, Ryan D; Chang, Elbert; Petrescu, Anca; Liao, Nancy; Griffith, Malachi; Chow, William; Kirkpatrick, Robert; Butterfield, Yaron S; Young, Alice C; Stott, Jeffrey; Barber, Sarah; Babakaiff, Ryan; Dickson, Mark C; Matsuo, Corey; Wong, David; Yang, George S; Smailus, Duane E; Wetherby, Keith D; Kwong, Peggy N; Grimwood, Jane; Brinkley, Charles P; Brown-John, Mabel; Reddix-Dugue, Natalie D; Mayo, Michael; Schmutz, Jeremy; Beland, Jaclyn; Park, Morgan; Gibson, Susan; Olson, Teika; Bouffard, Gerard G; Tsai, Miranda; Featherstone, Ruth; Chand, Steve; Siddiqui, Asim S; Jang, Wonhee; Lee, Ed; Klein, Steven L; Blakesley, Robert W; Zeeberg, Barry R; Narasimhan, Sudarshan; Weinstein, John N; Pennacchio, Christa Prange; Myers, Richard M; Green, Eric D; Wagner, Lukas; Gerhard, Daniela S; Marra, Marco A; Jones, Steven J M; Holt, Robert A


    Sequencing of full-insert clones from full-length cDNA libraries from both Xenopus laevis and Xenopus tropicalis has been ongoing as part of the Xenopus Gene Collection Initiative. Here we present 10,967 full ORF verified cDNA clones (8049 from X. laevis and 2918 from X. tropicalis) as a community resource. Because the genome of X. laevis, but not X. tropicalis, has undergone allotetraploidization, comparison of coding sequences from these two clawed (pipid) frogs provides a unique angle for exploring the molecular evolution of duplicate genes. Within our clone set, we have identified 445 gene trios, each comprised of an allotetraploidization-derived X. laevis gene pair and their shared X. tropicalis ortholog. Pairwise dN/dS, comparisons within trios show strong evidence for purifying selection acting on all three members. However, dN/dS ratios between X. laevis gene pairs are elevated relative to their X. tropicalis ortholog. This difference is highly significant and indicates an overall relaxation of selective pressures on duplicated gene pairs. We have found that the paralogs that have been lost since the tetraploidization event are enriched for several molecular functions, but have found no such enrichment in the extant paralogs. Approximately 14% of the paralogous pairs analyzed here also show differential expression indicative of subfunctionalization.

  6. Isolation and sequence of a cDNA clone for human tyrosinase that maps at the mouse c-albino locus

    SciTech Connect

    Kwon, B.S.; Haq, A.K.; Pomerantz, S.H.; Halaban, R.


    Screening of a lambdagt11 human melanocyte cDNA library with antibodies against hamster tyrosinase resulted in the isolation of 16 clones. The cDNA inserts from 13 of the 16 clones cross-hybridized with each other, indicating that they were form related mRNA species. One of the cDNA clones, Pmel34, detected one mRNA species with an approximate length of 2.4 kilobases that was expressed preferentially in normal and malignant melanocytes but not in other cell types. The amino acid sequence deduced from the nucleotide sequence showed that the putative human tyrosinase is composed of 548 amino acids with a molecular weight of 62,610. The deduced protein contains glycosylation sites and histidine-rich sites that could be used for copper binding. Southern blot analysis of DNA derived from newborn mice carrying lethal albino deletion mutations revealed that Pmel34 maps near or at the c-albino locus, the position of the structural gene for tyrosinase.

  7. Cloning, nucleotide sequence, mutagenesis, and mapping of the Bacillus subtilis pbpD gene, which codes for penicillin-binding protein 4.

    PubMed Central

    Popham, D L; Setlow, P


    The gene encoding penicillin-binding protein 4 (PBP 4) of Bacillus subtilis, pbpD, was cloned by two independent methods. PBP 4 was purified, and the amino acid sequence of a cyanogen bromide digestion product was used to design an oligonucleotide probe for identification of the gene. An oligonucleotide probe designed to hybridize to genes encoding class A high-molecular-weight PBPs also identified this gene. DNA sequence analysis of the cloned DNA revealed that (i) the amino acid sequence of PBP 4 was similar to those of other class A high-molecular-weight PBPs and (ii) pbpD appeared to be cotranscribed with a downstream gene (termed orf2) of unknown function. The orf2 gene is followed by an apparent non-protein-coding region which exhibits nucleotide sequence similarity with at least two other regions of the chromosome and which has a high potential for secondary structure formation. Mutations in pbpD resulted in the disappearance of PBP 4 but had no obvious effect on growth, cell division, sporulation, spore heat resistance, or spore germination. Expression of a transcriptional fusion of pbpD to lacZ increased throughout growth, decreased during sporulation, and was induced approximately 45 min into spore germination. A single transcription start site was detected just upstream of pbpD. The pbpD locus was mapped to the 275 to 280 degrees region of the chromosomal genetic map. Images PMID:7961491

  8. Zymomonas mobilis mutants with an increased rate of alcohol production

    SciTech Connect

    Osman, Y.A.; Ingram, L.O.


    Two new derivatives of Zymomonas mobilis CP4 were isolated from enrichment cultures after 18 months of serial transfer. These new strains were selected for the ability to grow and produce ethanol rapidly on transfer into fresh broth containing ethanol and allyl alcohol. Ethanol production by these strains was examined in batch fermentations under three sets of conditions. Both new derivatives were found to be superior to the parent strain CP4 with respect to the speed and completeness of glucose conversion to ethanol. The best of these, strain YO2, produced 9.5% ethanol (by weight; 11.9% by volume) after 17.4 h compared with 31.8 h for the parent strain CP4. The addition of 1 mM magnesium sulfate improved ethanol production in all three strains. Two factors contributed to the decrease in fermentation time required by the mutants: more rapid growth with minimal lag on subculturing and the retention of higher rates of ethanol production as fermentation proceeded. Alcohol dehydrogenase isozymes were altered in both new strains and no longer catalyzed the oxidation of allyl alcohol into the toxic product acrolein. This loss of allyl alcohol-oxidizing capacity is proposed as a primary factor contributing to increased allyl alcohol resistance, although it is likely that other mutations affecting glycolysis also contribute to the improvement in ethanol production.

  9. Complete sequence and development of a full-length infectious clone of an Ohio isolate of Maize dwarf mosaic virus (MDMV).


    Stewart, L R; Bouchard, R; Redinbaugh, M G; Meulia, T


    Maize dwarf mosaic virus (MDMV) is an important and widespread aphid-transmitted virus of maize. It is a member of the genus Potyvirus in the family Potyviridae with a monopartite (+) ssRNA genome. Here we report the complete genome sequence and construction and testing of infectious clones of an Ohio isolate of MDMV. Full-length MDMV cDNA was cloned into the vector pSPORT. Full-length cDNA PCR-amplified from the vector constructs were used as template for in vitro transcription, and transcripts were inoculated to maize seeds by vascular puncture inoculation. Plants inoculated by this procedure showed symptoms typical of MDMV infection, and infection was confirmed by RT-PCR and mechanical transmission to new plants.

  10. Cloning and sequencing of Lol pI, the major allergenic protein of rye-grass pollen.


    Griffith, I J; Smith, P M; Pollock, J; Theerakulpisut, P; Avjioglu, A; Davies, S; Hough, T; Singh, M B; Simpson, R J; Ward, L D


    We have isolated a full length cDNA clone encoding the major glycoprotein allergen Lol pI. The clone was selected using a combination of immunological screening of a cDNA expression library and PCR amplification of Lol pI-specific transcripts. Lol pI expressed in bacteria as a fusion protein shows recognition by specific IgE antibodies present in sera of grass pollen-allergic subjects. Northern analysis has shown that the Lol pI transcripts are expressed only in pollen of rye-grass. Molecular cloning of Lol pI provides a molecular genetic approach to study the structure-function relationship of allergens.

  11. Cloning and sequencing of a gene encoding a novel extracellular neutral proteinase from Streptomyces sp. strain C5 and expression of the gene in Streptomyces lividans 1326.

    PubMed Central

    Lampel, J S; Aphale, J S; Lampel, K A; Strohl, W R


    The gene encoding a novel milk protein-hydrolyzing proteinase was cloned on a 6.56-kb SstI fragment from Streptomyces sp. strain C5 genomic DNA into Streptomyces lividans 1326 by using the plasmid vector pIJ702. The gene encoding the small neutral proteinase (snpA) was located within a 2.6-kb BamHI-SstI restriction fragment that was partially sequenced. The molecular mass of the deduced amino acid sequence of the mature protein was determined to be 15,740, which corresponds very closely with the relative molecular mass of the purified protein (15,500) determined by sodium dodecyl sulfate-polyacrylamide gel electrophoresis. The N-terminal amino acid sequence of the purified neutral proteinase was determined, and the DNA encoding this sequence was found to be located within the sequenced DNA. The deduced amino acid sequence contains a conserved zinc binding site, although secondary ligand binding and active sites typical of thermolysinlike metalloproteinases are absent. The combination of its small size, deduced amino acid sequence, and substrate and inhibition profile indicate that snpA encodes a novel neutral proteinase. Images PMID:1569011

  12. New alpha-L-arabinofuranosidase produced by Streptomyces lividans: cloning and DNA sequence of the abfB gene and characterization of the enzyme.

    PubMed Central

    Vincent, P; Shareck, F; Dupont, C; Morosoli, R; Kluepfel, D


    A fully secreted alpha-l-arabinofuranosidase was cloned from the homologous expression system of Streptomyces lividans. The gene, located upstream adjacent to the previously described xylanase A gene, was sequenced. It is divergently transcribed from the xlnA gene and the two genes are separated by an intercistronic region of 391nt which contains a palindromic AT-rich sequence. The deduced amino acid sequence of the protein shows that the enzyme contains a distinct catalytic domain which is linked to a specific xylan-binding domain by a linker region. The purified enzyme has a specific arabinofuranose-debranching activity on xylan from Gramineae, acts synergistically with the S. lividans xylanases and binds specifically to xylan. From small arabinoxylo-oligosides, it liberates arabinose and, after prolonged incubation, the purified enzyme exhibits some xylanolytic activity as well. PMID:9148759

  13. Ultra-deep T cell receptor sequencing reveals the complexity and intratumour heterogeneity of T cell clones in renal cell carcinomas.


    Gerlinger, Marco; Quezada, Sergio A; Peggs, Karl S; Furness, Andrew J S; Fisher, Rosalie; Marafioti, Teresa; Shende, Vishvesh H; McGranahan, Nicholas; Rowan, Andrew J; Hazell, Steven; Hamm, David; Robins, Harlan S; Pickering, Lisa; Gore, Martin; Nicol, David L; Larkin, James; Swanton, Charles


    The recognition of cancer cells by T cells can impact upon prognosis and be exploited for immunotherapeutic approaches. This recognition depends on the specific interaction between antigens displayed on the surface of cancer cells and the T cell receptor (TCR), which is generated by somatic rearrangements of TCR α- and β-chains (TCRb). Our aim was to assess whether ultra-deep sequencing of the rearranged TCRb in DNA extracted from unfractionated clear cell renal cell carcinoma (ccRCC) samples can provide insights into the clonality and heterogeneity of intratumoural T cells in ccRCCs, a tumour type that can display extensive genetic intratumour heterogeneity (ITH). For this purpose, DNA was extracted from two to four tumour regions from each of four primary ccRCCs and was analysed by ultra-deep TCR sequencing. In parallel, tumour infiltration by CD4, CD8 and Foxp3 regulatory T cells was evaluated by immunohistochemistry and correlated with TCR-sequencing data. A polyclonal T cell repertoire with 367-16 289 (median 2394) unique TCRb sequences was identified per tumour region. The frequencies of the 100 most abundant T cell clones/tumour were poorly correlated between most regions (Pearson correlation coefficient, -0.218 to 0.465). 3-93% of these T cell clones were not detectable across all regions. Thus, the clonal composition of T cell populations can be heterogeneous across different regions of the same ccRCC. T cell ITH was higher in tumours pretreated with an mTOR inhibitor, which could suggest that therapy can influence adaptive tumour immunity. These data show that ultra-deep TCR-sequencing technology can be applied directly to DNA extracted from unfractionated tumour samples, allowing novel insights into the clonality of T cell populations in cancers. These were polyclonal and displayed ITH in ccRCC. TCRb sequencing may shed light on mechanisms of cancer immunity and the efficacy of immunotherapy approaches.

  14. Molecular cloning, sequencing and tissue expression of vasotocin and isotocin precursor genes from Ostariophysian catfishes: phylogeny and evolutionary considerations in teleosts

    PubMed Central

    Banerjee, Putul; Chaube, Radha; Joy, Keerikkattil P.


    Basic and neutral neurohypophyseal (NH) nonapeptides have evolved from vasotocin (VT) by a gene duplication at the base of the gnathostome lineage. In teleosts, VT and IT are the basic and neutral peptides, respectively. In the present study, VT and IT precursor genes of Heteropneustes fossilis and Clarias batrachus (Siluriformes, Ostariophysi) were cloned and sequenced. The channel catfish Icatalurus punctatus NH precursor sequences were obtained from EST database. The catfish NH sequences were used along with the available Acanthopterygii and other vertebrate NH precursor sequences to draw phylogenetic inference on the evolutionary history of the teleost NH peptides. Synteny analysis of the NH gene loci in various teleost species was done to complement the phylogenetic analysis. In H. fossilis, the NH transcripts were also sequenced from the ovary. The cloned genes and the deduced precursor proteins showed conserved characteristics of the NH nonapeptide precursors. The genes are expressed in brain and ovary (follicular envelope) of H. fossilis with higher transcript abundance in the brain. The addition of the catfish sequences in the phylogenetic analysis revealed that the VT and IT precursors of the species-rich superorders of teleosts have a distinct phylogenetic history with the Acanthopterygii VT and IT precursors sharing a less evolutionary distance and the Ostariophysi VT and IT having a greater evolutionary distance. The genomic location of VT and IT precursors, and synteny analysis of the NH loci lend support to the phylogenetic inference and suggest a footprint of fish- specific whole genome duplication (3R) and subsequent diploidization in the NH loci. The VT and IT precursor genes are most likely lineage-specific paralogs resulting from differential losses of the 3R NH paralogs in the two superorders. The independent yet consistent retention of VT and IT in the two superorders might be directed by a stringent ligand-receptor selectivity. PMID:26029040

  15. Cloning of cDNAs encoding a rabbit renal brush border membrane protein immunologically related to band 3. Sequence similarity with microsomal dipeptidase.

    PubMed Central

    Igarashi, P; Karniski, L P


    Distinct anion transport processes have been identified in the mammalian renal proximal tubule, but none of the responsible proteins or genes have been isolated. A 43 kDa rabbit microvillus membrane protein that is immunologically related to the erythroid anion exchanger (band 3) was a candidate for a renal anion transporter. To examine the structural relationship with band 3, we cloned cDNAs encoding the 43 kDa protein. The 43 kDa band-3-like protein was purified, and a novel sequence of 24 amino acids was obtained from the N-terminus. Degenerate oligonucleotides were synthesized based on this sequence, and the polymerase chain reaction with single-sided specificity was used to amplify and clone a 1330 bp cDNA from rabbit renal cortex. Additional overlapping 272 bp and 1123 bp cDNAs were obtained by synthesizing and screening a rabbit renal cortical cDNA library. The composite sequence was 1483 bp, terminated with (A)16, and was similar in size to the principal transcript expressed in rabbit renal cortex. The single long open reading frame was predicted to encode a protein composed of 410 amino acids with a molecular mass of 45,193 Da; 15 amino acids predicted to reside at the N-terminus were absent in the mature protein and may constitute a signal peptide. There was only limited sequence similarity with human erythroid band 3. Rather, the sequence was highly similar to microsomal dipeptidase, including the presence of a signal peptide and a consensus sequence for covalent linkage to glycosylphosphatidylinositol. In summary, the 43 kDa protein from rabbit renal cortex that is recognized by a monospecific antibody to erythroid band 3 is most likely a microvillus membrane dipeptidase. Images Fig. 1. Fig. 5. Fig. 6. PMID:1741759

  16. Heterologous expression and extracellular secretion of cellulolytic enzymes by Zymomonas mobilis.


    Linger, Jeffrey G; Adney, William S; Darzins, Al


    Development of the strategy known as consolidated bioprocessing (CBP) involves the use of a single microorganism to convert pretreated lignocellulosic biomass to ethanol through the simultaneous production of saccharolytic enzymes and fermentation of the liberated monomeric sugars. In this report, the initial steps toward achieving this goal in the fermentation host Zymomonas mobilis were investigated by expressing heterologous cellulases and subsequently examining the potential to secrete these cellulases extracellularly. Numerous strains of Z. mobilis were found to possess endogenous extracellular activities against carboxymethyl cellulose, suggesting that this microorganism may harbor a favorable environment for the production of additional cellulolytic enzymes. The heterologous expression of two cellulolytic enzymes, E1 and GH12 from Acidothermus cellulolyticus, was examined. Both proteins were successfully expressed as soluble, active enzymes in Z. mobilis although to different levels. While the E1 enzyme was less abundantly expressed, the GH12 enzyme comprised as much as 4.6% of the total cell protein. Additionally, fusing predicted secretion signals native to Z. mobilis to the N termini of E1 and GH12 was found to direct the extracellular secretion of significant levels of active E1 and GH12 enzymes. The subcellular localization of the intracellular pools of cellulases revealed that a significant portion of both the E1 and GH12 secretion constructs resided in the periplasmic space. Our results strongly suggest that Z. mobilis is capable of supporting the expression and secretion of high levels of cellulases relevant to biofuel production, thereby serving as a foundation for developing Z. mobilis into a CBP platform organism.

  17. Molecular cloning and characterization of satellite DNA sequences from constitutive heterochromatin of the habu snake (Protobothrops flavoviridis, Viperidae) and the Burmese python (Python bivittatus, Pythonidae).


    Matsubara, Kazumi; Uno, Yoshinobu; Srikulnath, Kornsorn; Seki, Risako; Nishida, Chizuko; Matsuda, Yoichi


    Highly repetitive DNA sequences of the centromeric heterochromatin provide valuable molecular cytogenetic markers for the investigation of genomic compartmentalization in the macrochromosomes and microchromosomes of sauropsids. Here, the relationship between centromeric heterochromatin and karyotype evolution was examined using cloned repetitive DNA sequences from two snake species, the habu snake (Protobothrops flavoviridis, Crotalinae, Viperidae) and Burmese python (Python bivittatus, Pythonidae). Three satellite DNA (stDNA) families were isolated from the heterochromatin of these snakes: 168-bp PFL-MspI from P. flavoviridis and 196-bp PBI-DdeI and 174-bp PBI-MspI from P. bivittatus. The PFL-MspI and PBI-DdeI sequences were localized to the centromeric regions of most chromosomes in the respective species, suggesting that the two sequences were the major components of the centromeric heterochromatin in these organisms. The PBI-MspI sequence was localized to the pericentromeric region of four chromosome pairs. The PFL-MspI and the PBI-DdeI sequences were conserved only in the genome of closely related species, Gloydius blomhoffii (Crotalinae) and Python molurus, respectively, although their locations on the chromosomes were slightly different. In contrast, the PBI-MspI sequence was also in the genomes of P. molurus and Boa constrictor (Boidae), and additionally localized to the centromeric regions of eight chromosome pairs in B. constrictor, suggesting that this sequence originated in the genome of a common ancestor of Pythonidae and Boidae, approximately 86 million years ago. The three stDNA sequences showed no genomic compartmentalization between the macrochromosomes and microchromosomes, suggesting that homogenization of the centromeric and/or pericentromeric stDNA sequences occurred in the macrochromosomes and microchromosomes of these snakes.

  18. Cloning, sequencing and expression analysis of the first cellulase gene encoding cellobiohydrolase 1 from a cold-adaptive Penicillium chrysogenum FS010.


    Hou, Yunhua; Wang, Tianhong; Long, Hao; Zhu, Huiyuan


    A cellobiohydrolase 1 gene (cbh1) was cloned from Penicillium chrysogenum FS010 by a modified thermal asymmetric interlaced polymerase chain reaction (TAIL-PCR). DNA sequencing shows that cbh1 has an open reading frame of 1590 bp, encoding a putative protein of 529 amino acid residues. The deduced amino acid sequence revealed that CBHI has a modular structure with a predicted molecular mass of 56 kDa and consists of a fungal type carbohydrate binding module separated from a catalytic domain by a threonine rich linker region. The putative gene product is homologous to fungal cellobiohydrolases in Family 7 of the glycosyl hydrolases. A novel cbh1 promoter (1.3 kb) was also cloned and sequenced, which contains seven putative binding sites (5'-SYGGRG-3') for the carbon catabolite repressor CRE1. Effect of various carbon sources to the cbh1 transcription of P. chrysogenum was examined by Northern analysis, suggesting that the expression of cbh1 is regulated at transcriptional level. The cbh1 gene in cold-adaptive fungus P. chysogenum was expressed as an active enzyme in Saccharomyces cerevisiae H158. The recombinant CBHI accumulated intracellularly and could not be secreted into the medium.

  19. Cloning and Sequence Analysis of cDNAs Encoding Two Acidic PLA(2) from venom of Ophiophagus hannah(King Cobra), Guangxi Species.


    Wang, Qiu-Yan; Shu, Yu-Yan; Zhuang, Mao-Xing; Lin, Zheng-Jiong


    Total RNA was extracted from venom glands of Ophiophagus hannah, Guangxi species. The cDNAs encoding PLA(2) were amplified by RT-PCR and cloned into the PUCm-T vector. The positive clones encoding two acidic PLA(2) (APLA(2)-1 and APLA(2)-2) were selected and bidirectionally sequenced. Their complete amino acid sequences were deduced and found to be identical to the known amino acid sequences. Their isoelectric points calculated by computer agreed with the values determined with their protein. Homology analysis indicated that the mature peptide of APLA(2)-1 had high homology with PLA(2) from venoms of Ophiophagus hannah, Fujian and Taiwan species, but APLA(2)-2 had lower homology. The most striking difference between APLA(2)-2 and other PLA(2) from Ophiophagus hannah venoms is the missing of a extra "pancreatic loop" at residues 62--66 in APLA(2)-2, and it may be related to their species evolution and biological activity.

  20. Cloning, sequence and structure of a gene encoding an antifungal glucan 1,3-beta-glucosidase from Trichoderma atroviride (T. harzianum).


    Donzelli, B G; Lorito, M; Scala, F; Harman, G E


    A gene (gluc78) encoding an antifungal glucan 1,3-beta-glucosidase was cloned from strain P1 of the biocontrol fungus Trichoderma atroviride (formerly T. harzianum). A putative regulatory sequence upstream from the coding region was cloned using single-strand extension from a primer in the known portion of the gene, circularized with T4 ligase, and then reamplified with PCR to generate double-stranded DNA. The entire genomic DNA sequence consisted of 3440 bp, with 559 and 579 bp, respectively, in 5' and 3' untranslated regions. The transcription unit contains a single intron, positioned in the 5' untranslated region. The gene encodes for a protein of 770 aa, including a 40 aa signal peptide. Symmetry between the first and second halves of the mature protein was found. The gene is present as a single copy in T. atroviride and a similar gene also is present in T. harzianum and T. virens. The encoded protein has similarity to a small group of sequences from filamentous fungi and no significant similarity to 1,3-beta-glucanases or glucosidases from other organisms. Northern analysis indicates that the gene is repressed in the presence of 3% glucose and expressed in media containing 0.1% of the sugar. Laminarin (0.1%) enhances expression after 18 h and other polymers such as scleroglucan and pustulan may enhance expression after 40 h of growth.

  1. Cloning and sequencing of cDNAs encoding plasma alpha-macroglobulin and murinoglobulin from guinea pig: implications for molecular evolution of alpha-macroglobulin family.


    Iwasaki, H; Suzuki, Y; Sinohara, H


    Several clones encoding plasma alpha-macroglobulin and murinoglobulin were isolated from guinea pig liver cDNA library and sequenced. The clones for alpha-macroglobulin contained overlapping sequences which together spanned a stretch of 4,546 nucleotides with one open reading frame coding for 1,476 amino acid residues. The clones for murinoglobulin contained overlapping sequences which together spanned a stretch of 4,578 nucleotides with one open reading frame coding for 1,464 amino acid residues. The phylogenetic analyses of 11 proteins of the alpha-macroglobulin family revealed that the mammalian tetrameric alpha-macroglobulins consist of two main branches: alpha M-1 subfamily (rat alpha 1- and mouse alpha-macroglobulins) and alpha M-2 subfamily (human alpha 2-, rat alpha 2-, and guinea pig alpha-macroglobulins). This dichotomy is in good accordance with their immunological, chemical, and physicochemical properties, and indicates that guinea pig alpha-macroglobulin is orthologous to human and rat alpha 2-macroglobulins but paralogous to rat alpha 1- and mouse alpha-macroglobulins. The divergence of the two subfamilies was a phylogenetically ancient event which occurred around the separation of metatherians and eutherians. The genes of the two subfamilies have been maintained in the rat, but either one became extinct in the mouse, guinea pig, or human. The tree also shows that guinea pig murinoglobulin forms one clade with mouse and rat murinoglobulins (alpha 1-inhibitor 3) prior to joining the alpha M-2 lineage, and suggests that murinoglobulin is not a primitive form of tetrameric alpha-macroglobulin, but rather has evolved under selective pressure which is different from that of the tetrameric paralogues.

  2. Identification of an androgen-repressed mRNA in rat ventral prostate as coding for sulphated glycoprotein 2 by cDNA cloning and sequence analysis.

    PubMed Central

    Bettuzzi, S; Hiipakka, R A; Gilna, P; Liao, S T


    The concentrations of a small number of mRNAs in the rat ventral prostate increase after castration and then decrease upon androgen treatment. Since the repression of specific gene expression may be important in the regulation of organ growth, we have cloned a cDNA for an androgen-repressed mRNA, the concentration of which increased 17-fold 4 days after castration, and this increase was reversed rapidly by androgen treatment. By sequence analysis the androgen-repressed mRNA was identified as that coding for sulphated glycoprotein 2. Images Fig. 1. PMID:2920020

  3. Cloning and nucleotide sequencing of a novel 7 beta-(4-carboxybutanamido)cephalosporanic acid acylase gene of Bacillus laterosporus and its expression in Escherichia coli and Bacillus subtilis.


    Aramori, I; Fukagawa, M; Tsumura, M; Iwami, M; Ono, H; Kojo, H; Kohsaka, M; Ueda, Y; Imanaka, H


    A strain of Bacillus species which produced an enzyme named glutaryl 7-ACA acylase which converts 7 beta-(4-carboxybutanamido)cephalosporanic acid (glutaryl 7-ACA) to 7-amino cephalosporanic acid (7-ACA) was isolated from soil. The gene for the glutaryl 7-ACA acylase was cloned with pHSG298 in Escherichia coli JM109, and the nucleotide sequence was determined by the M13 dideoxy chain termination method. The DNA sequence revealed only one large open reading frame composed of 1,902 bp corresponding to 634 amino acid residues. The deduced amino acid sequence contained a potential signal sequence in its amino-terminal region. Expression of the gene for glutaryl 7-ACA acylase was performed in both E. coli and Bacillus subtilis. The enzyme preparations purified from either recombinant strain of E. coli or B. subtilis were shown to be identical with each other as regards the profile of sodium dodecyl sulfate-polyacrylamide gel electrophoresis and were composed of a single peptide with the molecular size of 70 kDa. Determination of the amino-terminal sequence of the two enzyme preparations revealed that both amino-terminal sequences (the first nine amino acids) were identical and completely coincided with residues 28 to 36 of the open reading frame. Extracellular excretion of the enzyme was observed in a recombinant strain of B. subtilis.

  4. Cloning and nucleotide sequencing of a novel 7 beta-(4-carboxybutanamido)cephalosporanic acid acylase gene of Bacillus laterosporus and its expression in Escherichia coli and Bacillus subtilis.

    PubMed Central

    Aramori, I; Fukagawa, M; Tsumura, M; Iwami, M; Ono, H; Kojo, H; Kohsaka, M; Ueda, Y; Imanaka, H


    A strain of Bacillus species which produced an enzyme named glutaryl 7-ACA acylase which converts 7 beta-(4-carboxybutanamido)cephalosporanic acid (glutaryl 7-ACA) to 7-amino cephalosporanic acid (7-ACA) was isolated from soil. The gene for the glutaryl 7-ACA acylase was cloned with pHSG298 in Escherichia coli JM109, and the nucleotide sequence was determined by the M13 dideoxy chain termination method. The DNA sequence revealed only one large open reading frame composed of 1,902 bp corresponding to 634 amino acid residues. The deduced amino acid sequence contained a potential signal sequence in its amino-terminal region. Expression of the gene for glutaryl 7-ACA acylase was performed in both E. coli and Bacillus subtilis. The enzyme preparations purified from either recombinant strain of E. coli or B. subtilis were shown to be identical with each other as regards the profile of sodium dodecyl sulfate-polyacrylamide gel electrophoresis and were composed of a single peptide with the molecular size of 70 kDa. Determination of the amino-terminal sequence of the two enzyme preparations revealed that both amino-terminal sequences (the first nine amino acids) were identical and completely coincided with residues 28 to 36 of the open reading frame. Extracellular excretion of the enzyme was observed in a recombinant strain of B. subtilis. Images FIG. 2 FIG. 5 FIG. 6 PMID:1744041

  5. Identification of a cDNA clone that contains the complete coding sequence for a 140-kD rat NCAM polypeptide

    PubMed Central


    Neural cell adhesion molecules (NCAMs) are cell surface glycoproteins that appear to mediate cell-cell adhesion. In vertebrates NCAMs exist in at least three different polypeptide forms of apparent molecular masses 180, 140, and 120 kD. The 180- and 140-kD forms span the plasma membrane whereas the 120-kD form lacks a transmembrane region. In this study, we report the isolation of NCAM clones from an adult rat brain cDNA library. Sequence analysis indicated that the longest isolate, pR18, contains a 2,574 nucleotide open reading frame flanked by 208 bases of 5' and 409 bases of 3' untranslated sequence. The predicted polypeptide encoded by clone pR18 contains a single membrane-spanning region and a small cytoplasmic domain (120 amino acids), suggesting that it codes for a full-length 140-kD NCAM form. In Northern analysis, probes derived from 5' sequences of pR18, which presumably code for extracellular portions of the molecule hybridized to five discrete mRNA size classes (7.4, 6.7, 5.2, 4.3, and 2.9 kb) in adult rat brain but not to liver or muscle RNA. However, the 5.2- and 2.9-kb mRNA size classes did not hybridize to either a large restriction fragment or three oligonucleotides derived from the putative transmembrane coding region and regions that lie 3' to it. The 3' probes did hybridize to the 7.4-, 6.7-, and 4.3-kb message size classes. These combined results indicate that clone pR18 is derived from either the 7.4-, 6.7-, or 4.3- kb adult rat brain RNA size class. Comparison with chicken and mouse NCAM cDNA sequences suggests that pR18 represents the amino acid coding region of the 6.7- or 4.3-kb mRNA. The isolation of pR18, the first cDNA that contains the complete coding sequence of an NCAM polypeptide, unambiguously demonstrates the predicted linear amino acid sequence of this probable rat 140-kD polypeptide. This cDNA also contains a 30-base pair segment not found in NCAM cDNAs isolated from other species. The significance of this segment and other

  6. CATO: The Clone Alignment Tool.


    Henstock, Peter V; LaPan, Peter


    High-throughput cloning efforts produce large numbers of sequences that need to be aligned, edited, compared with reference sequences, and organized as files and selected clones. Different pieces of software are typically required to perform each of these tasks. We have designed a single piece of software, CATO, the Clone Alignment Tool, that allows a user to align, evaluate, edit, and select clone sequences based on comparisons to reference sequences. The input and output are designed to be compatible with standard data formats, and thus suitable for integration into a clone processing pipeline. CATO provides both sequence alignment and visualizations to facilitate the analysis of cloning experiments. The alignment algorithm matches each of the relevant candidate sequences against each reference sequence. The visualization portion displays three levels of matching: 1) a top-level summary of the top candidate sequences aligned to each reference sequence, 2) a focused alignment view with the nucleotides of matched sequences displayed against one reference sequence, and 3) a pair-wise alignment of a single reference and candidate sequence pair. Users can select the minimum matching criteria for valid clones, edit or swap reference sequences, and export the results to a summary file as part of the high-throughput cloning workflow.

  7. Spread of an Enterococcus faecalis sequence type 6 (CC2) clone in patients undergoing selective decontamination of the digestive tract.


    Muruzábal-Lecumberri, Izaskun; Girbau, Cecilia; Canut, Andrés; Alonso, Rodrigo; Fernández-Astorga, Aurora


    Enterococcus faecalis (E. faecalis) is a common cause of nosocomial infection in immunocompromised patients. The presence and dissemination of high-risk clonal complexes, such as CC2, is an ongoing problem in hospitals. The aim of this work was to characterize 24 E. faecalis isolates from ICU patients undergoing selective decontamination of the digestive tract (SDD) by phenotypical (antimicrobial susceptibility) and genotypical (presence of virulence genes, RAPD-PCR and MLST) methods. Our results showed high prevalence of the ST6 E. faecalis clone (91.6%), especially adapted to the hospital environment, with a multidrug resistance pattern and a multitude of putative virulence genes. In addition, ST179 (4.2%) and ST191 (4.2%) were detected. By RAPD-PCR analysis, the 22 isolates identified as ST6 showed six different DNA patterns, while the two remaining isolates, ST179 and ST191, showed two additional profiles. CC2 is a known clonal complex with high adaptability to hospital environment and worldwide distribution. The high prevalence of the ST6 clone in the studied population could be related to the presence of gentamicin in the SDD mixture since most strains were gentamicin resistant. Consequently, strict surveillance should be applied for rapid detection and control of this clone to prevent future spread outside the ICU.

  8. Development of corn silk as a biocarrier for Zymomonas mobilis biofilms in ethanol production from rice straw.


    Todhanakasem, Tatsaporn; Tiwari, Rashmi; Thanonkeo, Pornthap


    Z. mobilis cell immobilization has been proposed as an effective means of improving ethanol production. In this work, polystyrene and corn silk were used as biofilm developmental matrices for Z. mobilis ethanol production with rice straw hydrolysate as a substrate. Rice straw was hydrolyzed by dilute sulfuric acid (H2SO4) and enzymatic hydrolysis. The final hydrolysate contained furfural (271.95 ± 76.30 ppm), 5-hydroxymethyl furfural (0.07 ± 0.00 ppm), vanillin (1.81 ± 0.00 ppm), syringaldehyde (5.07 ± 0.83 ppm), 4-hydroxybenzaldehyde (4-HB) (2.39 ± 1.20 ppm) and acetic acid (0.26 ± 0.08%). Bacterial attachment or biofilm formation of Z. mobilis strain TISTR 551 on polystyrene and delignified corn silk carrier provided significant ethanol yields. Results showed up to 0.40 ± 0.15 g ethanol produced/g glucose consumed when Z. mobilis was immobilized on a polystyrene carrier and 0.51 ± 0.13 g ethanol produced/g glucose consumed when immobilized on delignified corn silk carrier under batch fermentation by Z. mobilis TISTR 551 biofilm. The higher ethanol yield from immobilized, rather than free living, Z. mobilis could possibly be explained by a higher cell density, better control of anaerobic conditions and higher toxic tolerance of Z. mobilis biofilms over free cells.

  9. Whole genome sequencing to investigate a putative outbreak of the virulent community-associated methicillin-resistant Staphylococcus aureus ST93 clone in a remote Indigenous community

    PubMed Central

    Andersson, Patiyan; Yeaman, Fiona; Oldfield, Sarah; Lilliebridge, Rachael; Bentley, Stephen D.; Krause, Vicki; Beaman, Miles; Currie, Bart J.; Holt, Deborah C.; Giffard, Philip M.; Tong, Steven Y. C.


    We report two cases of severe pneumonia due to clone ST93 methicillin-resistant Staphylococcus aureus (MRSA) presenting from a remote Australian Indigenous community within a 2-week period, and the utilization of whole genome sequences to determine whether these were part of an outbreak. S. aureus was isolated from 12 of 92 nasal swabs collected from 25 community households (including the two index households); one isolate was ST93. Three of five skin lesion S. aureus isolates obtained at the community were ST93. Whole genome sequencing of the ST93 isolates from this study and a further 20 ST93 isolates from the same region suggested that recent transmission and progression to disease had not taken place. The proximity in time and space of the two severe pneumonia cases is probably a reflection of the high burden of disease due to ST93 MRSA in this population where skin infections and household crowding are common. PMID:28348837

  10. Cloning, nucleotide sequence, and characterization of mtr, the structural gene for a tryptophan-specific permease of Escherichia coli K-12.

    PubMed Central

    Heatwole, V M; Somerville, R L


    The mtr gene of Escherichia coli K-12 encodes an L-tryptophan-specific permease. This gene was originally identified through the isolation of mutations in the 69-min region of the chromosome, closely linked to argG. Cells with lesions in mtr display a phenotype of 5-methyltryptophan resistance. The mtr gene was cloned by using the mini-Mu system. The amino acid sequence of Mtr (414 codons), deduced by DNA sequence analysis, was found to be 33% identical to that of another single-component transport protein, the tyrosine-specific permease, TyrP. The hydropathy plots of the two permeases were similar. Possible operator sites for the tyrosine and tryptophan repressors are situated within the region of DNA that is likely to be the mtr promoter. PMID:1987112

  11. Analysis of two cosmid clones from chromosome 4 of Drosophila melanogaster reveals two new genes amid an unusual arrangement of repeated sequences.


    Locke, J; Podemski, L; Roy, K; Pilgrim, D; Hodgetts, R


    Chromosome 4 from Drosophila melanogaster has several unusual features that distinguish it from the other chromosomes. These include a diffuse appearance in salivary gland polytene chromosomes, an absence of recombination, and the variegated expression of P-element transgenes. As part of a larger project to understand these properties, we are assembling a physical map of this chromosome. Here we report the sequence of two cosmids representing approximately 5% of the polytenized region. Both cosmid clones contain numerous repeated DNA sequences, as identified by cross hybridization with labeled genomic DNA, BLAST searches, and dot matrix analysis, which are positioned between and within the transcribed sequences. The repetitive sequences include three copies of the mobile element Hoppel, one copy of the mobile element HB, and 18 DINE repeats. DINE is a novel, short repeated sequence dispersed throughout both cosmid sequences. One cosmid includes the previously described cubitus interruptus (ci) gene and two new genes: that a gene with a predicted amino acid sequence similar to ribosomal protein S3a which is consistent with the Minute(4)101 locus thought to be in the region, and a novel member of the protein family that includes plexin and met-hepatocyte growth factor receptor. The other cosmid contains only the two short 5'-most exons from the zinc-finger-homolog-2 (zfh-2) gene. This is the first extensive sequence analysis of noncoding DNA from chromosome 4. The distribution of the various repeats suggests its organization is similar to the beta-heterochromatic regions near the base of the major chromosome arms. Such a pattern may account for the diffuse banding of the polytene chromosome 4 and the variegation of many P-element transgenes on the chromosome.

  12. Complementary DNA cloning, sequence analysis, and tissue transcription profile of a novel U2AF2 gene from the Chinese Banna mini-pig inbred line.


    Wang, S Y; Huo, J L; Miao, Y W; Cheng, W M; Zeng, Y Z


    U2 small nuclear RNA auxiliary factor 2 (U2AF2) is an important gene for pre-messenger RNA splicing in higher eukaryotes. In this study, the Banna mini-pig inbred line (BMI) U2AF2 coding sequence (CDS) was cloned, sequenced, and characterized. The U2AF2 complete CDS was amplified using the reverse transcription-polymerase chain reaction (RT-PCR) technique based on the conserved sequence information of cattle and known highly homologous swine expressed sequence tags. This novel gene was deposited into the National Center for Biotechnology Information database (Accession No. JQ839267). Sequence analysis revealed that the BMI U2AF2 coding sequence consisted of 1416 bp and encoded 471 amino acids with a molecular weight of 53.12 kDa. The protein sequence has high sequence homology with U2AF65 of 6 species - Homo sapiens (100%), Equus caballus (100%), Canis lupus (100%), Macaca mulatta (99.8%), Bos taurus (74.4%), and Mus musculus (74.4%). The phylogenetic tree analysis revealed that BMI U2AF65 has a closer genetic relationship with B. taurus U2AF65 than with U2AF65 of E. caballus, C. lupus, M. mulatta, H. sapiens, and M. musculus. RT-PCR analysis showed that BMI U2AF2 was most highly expressed in the brain; moderately expressed in the spleen, lung, muscle, and skin; and weakly expressed in the liver, kidney, and ovary. Its expression was nearly silent in the spinal cord, nerve fiber, heart, stomach, pancreas, and intestine. Three microRNA target sites were predicted in the CDS of BMI U2AF2 messenger RNA. Our results establish a foundation for further insight into this swine gene.

  13. Analysis of Two Cosmid Clones from Chromosome 4 of Drosophila melanogaster Reveals Two New Genes Amid an Unusual Arrangement of Repeated Sequences

    PubMed Central

    Locke, John; Podemski, Lynn; Roy, Ken; Pilgrim, David; Hodgetts, Ross


    Chromosome 4 from Drosophila melanogaster has several unusual features that distinguish it from the other chromosomes. These include a diffuse appearance in salivary gland polytene chromosomes, an absence of recombination, and the variegated expression of P-element transgenes. As part of a larger project to understand these properties, we are assembling a physical map of this chromosome. Here we report the sequence of two cosmids representing ∼5% of the polytenized region. Both cosmid clones contain numerous repeated DNA sequences, as identified by cross hybridization with labeled genomic DNA, BLAST searches, and dot matrix analysis, which are positioned between and within the transcribed sequences. The repetitive sequences include three copies of the mobile element Hoppel, one copy of the mobile element HB, and 18 DINE repeats. DINE is a novel, short repeated sequence dispersed throughout both cosmid sequences. One cosmid includes the previously described cubitus interruptus (ci) gene and two new genes: that a gene with a predicted amino acid sequence similar to ribosomal protein S3a which is consistent with the Minute(4)101 locus thought to be in the region, and a novel member of the protein family that includes plexin and met–hepatocyte growth factor receptor. The other cosmid contains only the two short 5′-most exons from the zinc-finger-homolog-2 (zfh-2) gene. This is the first extensive sequence analysis of noncoding DNA from chromosome 4. The distribution of the various repeats suggests its organization is similar to the β-heterochromatic regions near the base of the major chromosome arms. Such a pattern may account for the diffuse banding of the polytene chromosome 4 and the variegation of many P-element transgenes on the chromosome. PMID:10022978

  14. Cloning, sequence analysis, and expression in Escherichia coli of the gene encoding an alpha-amino acid ester hydrolase from Acetobacter turbidans.


    Polderman-Tijmes, Jolanda J; Jekel, Peter A; de Vries, Erik J; van Merode, Annet E J; Floris, René; van der Laan, Jan-Metske; Sonke, Theo; Janssen, Dick B


    The alpha-amino acid ester hydrolase from Acetobacter turbidans ATCC 9325 is capable of hydrolyzing and synthesizing beta-lactam antibiotics, such as cephalexin and ampicillin. N-terminal amino acid sequencing of the purified alpha-amino acid ester hydrolase allowed cloning and genetic characterization of the corresponding gene from an A. turbidans genomic library. The gene, designated aehA, encodes a polypeptide with a molecular weight of 72,000. Comparison of the determined N-terminal sequence and the deduced amino acid sequence indicated the presence of an N-terminal leader sequence of 40 amino acids. The aehA gene was subcloned in the pET9 expression plasmid and expressed in Escherichia coli. The recombinant protein was purified and found to be dimeric with subunits of 70 kDa. A sequence similarity search revealed 26% identity with a glutaryl 7-ACA acylase precursor from Bacillus laterosporus, but no homology was found with other known penicillin or cephalosporin acylases. There was some similarity to serine proteases, including the conservation of the active site motif, GXSYXG. Together with database searches, this suggested that the alpha-amino acid ester hydrolase is a beta-lactam antibiotic acylase that belongs to a class of hydrolases that is different from the Ntn hydrolase superfamily to which the well-characterized penicillin acylase from E. coli belongs. The alpha-amino acid ester hydrolase of A. turbidans represents a subclass of this new class of beta-lactam antibiotic acylases.

  15. Cloning and sequence analysis of the StsI restriction-modification gene: presence of homology to FokI restriction-modification enzymes.

    PubMed Central

    Kita, K; Suisha, M; Kotani, H; Yanase, H; Kato, N


    StsI endonuclease (R.StsI), a type IIs restriction endonuclease found in Streptococcus sanguis 54, recognizes the same sequence as FokI but cleaves at different positions. A DNA fragment that carried the genes for R.StsI and StsI methylase (M.StsI) was cloned from the chromosomal DNA of S.sanguis 54, and its nucleotide sequence was analyzed. The endonuclease gene was 1,806 bp long, corresponding to a protein of 602 amino acid residues (M(r) = 68,388), and the methylase gene was 1,959 bp long, corresponding to a protein of 653 amino acid residues (M(r) = 76,064). The assignment of the endonuclease gene was confirmed by analysis of the N-terminal amino acid sequence. Genes for the two proteins were in a tail-to-tail orientation, separated by a 131-nucleotide intercistronic region. The predicted amino acid sequences between the StsI system and the FokI system showed a 49% identity between the methylases and a 30% identity between the endonucleases. The sequence comparison of M.StsI with various methylases showed that the N-terminal half of M.StsI matches M.NIaIII, and the C-terminal half matches adenine methylases that recognize GATC and GATATC. PMID:1387204

  16. NADP(+)-isocitrate dehydrogenase from the cyanobacterium Anabaena sp. strain PCC 7120: purification and characterization of the enzyme and cloning, sequencing, and disruption of the icd gene.

    PubMed Central

    Muro-Pastor, M I; Florencio, F J


    NADP(+)-isocitrate dehydrogenase (NADP(+)-IDH) from the dinitrogen-fixing filamentous cyanobacterium Anabaena sp. strain PCC 7120 was purified to homogeneity. The native enzyme is composed of two identical subunits (M(r), 57,000) and cross-reacts with antibodies obtained against the previously purified NADP(+)-IDH from the unicellular cyanobacterium Synechocystis sp. strain PCC 6803. Anabaena NADP(+)-IDH resembles in its physicochemical and kinetic parameters the typical dimeric IDHs from prokaryotes. The gene encoding Anabaena NADP(+)-IDH was cloned by complementation of an Escherichia coli icd mutant with an Anabaena genomic library. The complementing DNA was located on a 6-kb fragment. It encodes an NADP(+)-IDH that has the same mobility as that of Anabaena NADP(+)-IDH on nondenaturing polyacrylamide gels. The icd gene was subcloned and sequenced. Translation of the nucleotide sequence gave a polypeptide of 473 amino acids that showed high sequence similarity to the E. coli enzyme (59% identity) and with IDH1 and IDH2, the two subunits of the heteromultimeric NAD(+)-IDH from Saccharomyces cerevisiae (30 to 35% identity); however, a low level of similarity to NADP(+)-IDHs of eukaryotic origin was found (23% identity). Furthermore, Anabaena NADP(+)-IDH contains a 44-residue amino acid sequence in its central region that is absent in the other IDHs so far sequenced. Attempts to generate icd mutants by insertional mutagenesis were unsuccessful, suggesting an essential role of IDH in Anabaena sp. strain PCC 7120. Images PMID:8169222

  17. Molecular profiling of microbial communities from contaminated sources: Use of subtractive cloning methods and rDNA spacer sequences. 1998 annual progress report

    SciTech Connect

    Robb, F.T.


    'The major objective of the research is to provide appropriate sequences and to assemble a high-density DNA array of oligonucleotides that can be used for rapid profiling of microbial populations from polluted areas. The sequences to be assigned to the DNA array are chosen from from cloned genomic DNA sequences (the ribosomal operon, described below) from groundwater at DOE sites containing organic solvents. The sites, Hanford Nuclear Plant and Lawrence Livermore Site 300, have well characterized pollutant histories, which have been provided by the collaborators. At this mid-point of the project, over 60 unique sequence classes of intergenic spacer region have been idedntified from the first sample site. The use of these sequences as hybridization probes, and their frequency of occurrence, allow a clear distinction between bacterial communities before and after remediation by acetate/nitrate pumping. The authors have developed the hybridization conditions for identifying PCR products in a 96 well format, a versatile alignment and visualization program (acronym: MALIGN) developed by Dr. Dennis Maeder, has been used to align the ISRs, which are variable in length and sometimes in position of the tRNAs. Finally, in collaboration with Dr. W. Chen and Dr. J. Zhou at ORNL, they have significant evidence that mass spectrometer analysis can be used to determine the lengths of PCR amplified intergenic spacer DNA.'

  18. Diversification of mitochondrial genome of Daphnia galeata (Cladocera, Crustacea): Comparison with phylogenetic consideration of the complete sequences of clones isolated from five lakes in Japan.


    Tokishita, Shin-Ichi; Shibuya, Hiroyuki; Kobayashi, Taku; Sakamoto, Masaki; Ha, Jin-Yong; Yokobori, Shin-Ichi; Yamagata, Hideo; Hanazato, Takayuki


    To characterize genetic diversity and gene flow among Daphnia galeata populations, the complete nucleotide (nt) sequences of the mitochondrial (mt) DNAs of D. galeata clones isolated from five lakes in Japan (Lakes Shirakaba, Suwa, Kizaki, Kasumigaura, and Biwa) were determined. Comparison of non-synonymous (amino acid altering) substitution rates with synonymous substitution rates of D. galeata mt protein-coding genes demonstrated that ATPase8 and COI genes were the most and least susceptible, respectively, to the evolutional forces selecting the aa substitutions. Several non-synonymous substitutions were found in ATPase8 and ATPase6 even in the comparison that no synonymous substitution was found. Comparison of the total number of nt variations among the mt DNAs suggested the phylogenetic relationship ((((Shirakaba/Suwa, Kizaki), Kasumigaura), Biwa), D. pulex). Maximum-likelihood analysis using the total nt sequences of mt protein-coding genes confirmed this relationship with bootstrap values higher than 98%. All the mtDNAs of the analyzed Japanese D. galeata clones contained a control region of essentially the same structure that is distinct from those of the previously reported European Daphnia species of the D. longispina complex. The two control regions of different structures spread among mtDNAs of the Japanese and European Daphnia species, respectively, probably after the divergence of the Japanese D. galeata under different selection pressures associated with their habitats.

  19. PCR amplification and sequences of cDNA clones for the small and large subunits of ADP-glucose pyrophosphorylase from barley tissues.


    Villand, P; Aalen, R; Olsen, O A; Lüthi, E; Lönneborg, A; Kleczkowski, L A


    Several cDNAs encoding the small and large subunit of ADP-glucose pyrophosphorylase (AGP) were isolated from total RNA of the starchy endosperm, roots and leaves of barley by polymerase chain reaction (PCR). Sets of degenerate oligonucleotide primers, based on previously published conserved amino acid sequences of plant AGP, were used for synthesis and amplification of the cDNAs. For either the endosperm, roots and leaves, the restriction analysis of PCR products (ca. 550 nucleotides each) has revealed heterogeneity, suggesting presence of three transcripts for AGP in the endosperm and roots, and up to two AGP transcripts in the leaf tissue. Based on the derived amino acid sequences, two clones from the endosperm, beps and bepl, were identified as coding for the small and large subunit of AGP, respectively, while a leaf transcript (blpl) encoded the putative large subunit of AGP. There was about 50% identity between the endosperm clones, and both of them were about 60% identical to the leaf cDNA. Northern blot analysis has indicated that beps and bepl are expressed in both the endosperm and roots, while blpl is detectable only in leaves. Application of the PCR technique in studies on gene structure and gene expression of plant AGP is discussed.

  20. Evolution of multi-drug resistant HCV clones from pre-existing resistant-associated variants during direct-acting antiviral therapy determined by third-generation sequencing

    PubMed Central

    Takeda, Haruhiko; Ueda, Yoshihide; Inuzuka, Tadashi; Yamashita, Yukitaka; Osaki, Yukio; Nasu, Akihiro; Umeda, Makoto; Takemura, Ryo; Seno, Hiroshi; Sekine, Akihiro; Marusawa, Hiroyuki


    Resistance-associated variant (RAV) is one of the most significant clinical challenges in treating HCV-infected patients with direct-acting antivirals (DAAs). We investigated the viral dynamics in patients receiving DAAs using third-generation sequencing technology. Among 283 patients with genotype-1b HCV receiving daclatasvir + asunaprevir (DCV/ASV), 32 (11.3%) failed to achieve sustained virological response (SVR). Conventional ultra-deep sequencing of HCV genome was performed in 104 patients (32 non-SVR, 72 SVR), and detected representative RAVs in all non-SVR patients at baseline, including Y93H in 28 (87.5%). Long contiguous sequences spanning NS3 to NS5A regions of each viral clone in 12 sera from 6 representative non-SVR patients were determined by third-generation sequencing, and showed the concurrent presence of several synonymous mutations linked to resistance-associated substitutions in a subpopulation of pre-existing RAVs and dominant isolates at treatment failure. Phylogenetic analyses revealed close genetic distances between pre-existing RAVs and dominant RAVs at treatment failure. In addition, multiple drug-resistant mutations developed on pre-existing RAVs after DCV/ASV in all non-SVR cases. In conclusion, multi-drug resistant viral clones at treatment failure certainly originated from a subpopulation of pre-existing RAVs in HCV-infected patients. Those RAVs were selected for and became dominant with the acquisition of multiple resistance-associated substitutions under DAA treatment pressure. PMID:28361915

  1. Uroporphyrinogen-III synthase: Molecular cloning, nucleotide sequence, expression of a mouse full-length cDNA, and its localization on mouse chromosome 7

    SciTech Connect

    Xu, W.; Desnick, R.J.; Kozak, C.A.


    Uroporphyrinogen-III synthase, the fourth enzyme in the heme biosynthetic pathway, is responsible for the conversion of hydroxymethylbilane to the cyclic tetrapyrrole, uroporphyrinogen III. The deficient activity of URO-S is the enzymatic defect in congenital erythropoietic porphyria (CEP), an autosomal recessive disorder. For the generation of a mouse model of CEP, the human URO-S cDNA was used to screen 2 X 10{sup 6} recombinants from a mouse adult liver cDNA library. Ten positive clones were isolated, and dideoxy sequencing of the entire 1.6-kb insert of clone pmUROS-1 revealed 5{prime} and 3{prime} untranslated sequences of 144 and 623 bp, respectively, and an open reading frame of 798 bp encoding a 265-amino-acid polypeptide with a predicted molecular mass of 28,501 Da. The mouse and human coding sequences had 80.5 and 77.8% nucleotide and amino acid identity, respectively. The authenticity of the mouse cDNA was established by expression of the active monomeric enzyme in Escherichia coli. In addition, the analysis of two multilocus genetic crosses localized the mouse gene on chromosome 7, consistent with the mapping of the human gene to a position of conserved synteny on chromosome 10. The isolation, expression, and chromosomal mapping of this full-length cDNA should facilitate studies of the structure and organization of the mouse genomic sequence and the development of a mouse model of CEP for characterization of the disease pathogenesis and evaluation of gene therapy. 38 refs., 1 tab.

  2. cDNA, genomic sequence cloning, and overexpression of EIF1 from the giant panda (Ailuropoda Melanoleuca) and the black bear (Ursus Thibetanus Mupinensis).


    Hou, Wan-ru; Tang, Yun; Hou, Yi-ling; Song, Yan; Zhang, Tian; Wu, Guang-fu


    Eukaryotic initiation factor (eIF) EIF1 is a universally conserved translation factor that is involved in translation initiation site selection. The cDNA and the genomic sequences of EIF1 were cloned successfully from the giant panda (Ailuropoda melanoleuca) and the black bear (Ursus thibetanus mupinensis) using reverse transcription polymerase chain reaction (RT-PCR) technology and touchdown-polymerase chain reaction, respectively. The cDNAs of the EIF1 cloned from the giant panda and the black bear are 418 bp in size, containing an open reading frame (ORF) of 342 bp encoding 113 amino acids. The length of the genomic sequence of the giant panda is 1909 bp, which contains four exons and three introns. The length of the genomic sequence of the black bear is 1897 bp, which also contains four exons and three introns. Sequence alignment indicates a high degree of homology to those of Homo sapiens, Mus musculus, Rattus norvegicus, and Bos Taurus at both amino acid and DNA levels. Topology prediction shows there are one N-glycosylation site, two Casein kinase II phosphorylation sites, and a Amidation site in the EIF1 protein of the giant panda and black bear. In addition, there is a protein kinase C phosphorylation site in EIF1 of the giant panda. The giant panda and the black bear EIF1 genes were overexpressed in E. coli BL21. The results indicated that the both EIF1 fusion proteins with the N-terminally His-tagged form gave rise to the accumulation of two expected 19 kDa polypeptide. The expression products obtained could be used to purify the proteins and study their function further.

  3. Genetic variability analysis of Zymomonas mobilis strains from the UFPEDA microorganisms collection.


    Silva, L C N; Araújo, J M; Azevedo, J L; Padilha, R J S A; Yara, R


    Zymomonas mobilis is a Gram-negative bacterium that has drawn attention in the bioethanol industry. Besides bioethanol, this bacterium also produces other biotechnological products such as levans, which show antitumor activity. Molecular studies involving Z. mobilis have advanced to the point that allows us to characterize interspecies genetic diversity and understand their metabolism, and these data are essential for better utilization of this species. In this study, the genetic diversity of 24 strains from the Microorganisms Collection of Departamento de Antibióticos (UFPEDA) from Universidade Federal de Pernambuco were characterized. The methods used were amplified ribosomal DNA restriction analysis and diversity analysis of the internally transcribed 16S-23S rDNA spacer region (ISR). These analyses revealed low genetic variability of the 16S rDNA gene. These data confirm that these isolates are, or are closely related to, Z. mobilis. Moreover, the analysis of the ISR confirmed the genetic variability of strains deposited in the UFPEDA collection of microorganisms and grouped these strains into ten ribotypes, which can be used in the future for breeding programs and for the preservation of biodiversity. Furthermore, this study characterized the genetic variability between the UFPEDA 205/ ZAP, UFPEDA 98/AG11, and ZAG strains, which were obtained by spheroplast fusion among them. The data also indicate that there is genetic variability among the UFPEDA 202/CP4 and UFPEDA 633/ ZM4 strains, demonstrating that these important Z. mobilis strains are distinct, as suggested in previous studies.

  4. Inhibition of pyruvate decarboxylase from Z. mobilis by novel analogues of thiamine pyrophosphate: investigating pyrophosphate mimics.


    Erixon, Karl M; Dabalos, Chester L; Leeper, Finian J


    Replacement of the thiazolium ring of thiamine pyrophosphate with a triazole gives extremely potent inhibitors of pyruvate decarboxylase from Z. mobilis, with K(I) values down to 20 pM; this system was used to explore pyrophosphate mimics and several effective analogues were discovered.

  5. Very high gravity ethanol and fatty acid production of Zymomonas mobilis without amino acid and vitamin.


    Wang, Haoyong; Cao, Shangzhi; Wang, William Tianshuo; Wang, Kaven Tianyv; Jia, Xianhui


    Very high gravity (VHG) fermentation is the mainstream technology in ethanol industry, which requires the strains be resistant to multiple stresses such as high glucose concentration, high ethanol concentration, high temperature and harsh acidic conditions. To our knowledge, it was not reported previously that any ethanol-producing microbe showed a high performance in VHG fermentations without amino acid and vitamin. Here we demonstrate the engineering of a xylose utilizing recombinant Zymomonas mobilis for VHG ethanol fermentations. The recombinant strain can produce ethanol up to 136 g/L without amino acid and vitamin with a theoretical yield of 90 %, which is significantly superior to that produced by all the reported ethanol-producing strains. The intracellular fatty acids of the bacterial were about 16 % of the bacterial dry biomass, with the ratio of ethanol:fatty acids was about 273:1 (g/g). The recombinant strain was achieved by a multivariate-modular strategy tackles with the multiple stresses which are closely linked to the ethanol productivity of Z. mobilis. The over-expression of metB/yfdZ operon enabled the growth of the recombinant Z. mobilis in a chemically defined medium without amino acid and vitamin; and the fatty acids overproduction significantly increased ethanol tolerance and ethanol production. The coupled production of ethanol with fatty acids of the Z. mobilis without amino acid and vitamin under VHG fermentation conditions may permit a significant reduction of the production cost of ethanol and microbial fatty acids.

  6. Xylose utilizing zymomonas mobilis with improved ethanol production in biomass hydrolysate medium

    SciTech Connect

    Caimi, Perry G; Hitz, William D; Stieglitz, Barry; Viitanen, Paul V


    Xylose-utilizing, ethanol producing strains of Zymomonas mobilis with improved performance in medium comprising biomass hydrolysate were isolated using an adaptation process. Independently isolated strains were found to have independent mutations in the same coding region. Mutation in this coding may be engineered to confer the improved phenotype.

  7. Xylose utilizing Zymomonas mobilis with improved ethanol production in biomass hydrolysate medium

    SciTech Connect

    Caimi, Perry G; Hitz, William D; Viitanen, Paul V; Stieglitz, Barry


    Xylose-utilizing, ethanol producing strains of Zymomonas mobilis with improved performance in medium comprising biomass hydrolysate were isolated using an adaptation process. Independently isolated strains were found to have independent mutations in the same coding region. Mutation in this coding may be engineered to confer the improved phenotype.

  8. Ecophysiology and Comparative Genomics of Nitrosomonas mobilis Ms1 Isolated from Autotrophic Nitrifying Granules of Wastewater Treatment Bioreactor.


    Thandar, Soe Myat; Ushiki, Norisuke; Fujitani, Hirotsugu; Sekiguchi, Yuji; Tsuneda, Satoshi


    Ammonia-oxidizing bacteria (AOB), which oxidize ammonia to nitrite in the first step of nitrification, play an important role in biological wastewater treatment systems. Nitrosomonas mobilis is an important and dominant AOB in various wastewater treatment systems. However, the detailed physiological and genomic properties of N. mobilis have not been thoroughly investigated because of limited success isolating pure cultures. This study investigated the key physiological characteristics of N. mobilis Ms1, which was previously isolated into pure culture from the nitrifying granules of wastewater treatment bioreactor. The pure culture of N. mobilis Ms1 was cultivated in liquid mineral medium with 30 mg-N L(-1) (2.14 mM) of ammonium at room temperature under dark conditions. The optimum growth of N. mobilis Ms1 occurred at 27°C and pH 8, with a maximum growth rate of 0.05-0.07 h(-1), which corresponded to a generation time of 10-14 h. The half saturation constant for ammonium uptake rate and the maximum ammonium uptake rate of N. mobilis Ms1 were 30.70 ± 0.51 μM NH4(+) and 0.01 ± 0.002 pmol NH4(+) cells(-1) h(-1), respectively. N. mobilis Ms1 had higher ammonia oxidation activity than N. europaea in this study. The oxygen uptake activity kinetics of N. mobilis Ms1 were Km(O2) = 21.74 ± 4.01 μM O2 and V max(O2) = 0.06 ± 0.02 pmol O2 cells(-1) h(-1). Ms1 grew well at ammonium and NaCl concentrations of up to 100 and 500 mM, respectively. The nitrite tolerance of N. mobilis Ms1 was extremely high (up to 300 mM) compared to AOB previously isolated from activated sludge and wastewater treatment plants. The average nucleotide identity between the genomes of N. mobilis Ms1 and other Nitrosomonas species indicated that N. mobilis Ms1 was distantly related to other Nitrosomonas species. The organization of the genes encoding protein inventory involved in ammonia oxidation and nitrifier denitrification processes were different from other Nitrosomonas species. The current

  9. Ecophysiology and Comparative Genomics of Nitrosomonas mobilis Ms1 Isolated from Autotrophic Nitrifying Granules of Wastewater Treatment Bioreactor

    PubMed Central

    Thandar, Soe Myat; Ushiki, Norisuke; Fujitani, Hirotsugu; Sekiguchi, Yuji; Tsuneda, Satoshi


    Ammonia-oxidizing bacteria (AOB), which oxidize ammonia to nitrite in the first step of nitrification, play an important role in biological wastewater treatment systems. Nitrosomonas mobilis is an important and dominant AOB in various wastewater treatment systems. However, the detailed physiological and genomic properties of N. mobilis have not been thoroughly investigated because of limited success isolating pure cultures. This study investigated the key physiological characteristics of N. mobilis Ms1, which was previously isolated into pure culture from the nitrifying granules of wastewater treatment bioreactor. The pure culture of N. mobilis Ms1 was cultivated in liquid mineral medium with 30 mg-N L-1 (2.14 mM) of ammonium at room temperature under dark conditions. The optimum growth of N. mobilis Ms1 occurred at 27°C and pH 8, with a maximum growth rate of 0.05–0.07 h-1, which corresponded to a generation time of 10–14 h. The half saturation constant for ammonium uptake rate and the maximum ammonium uptake rate of N. mobilis Ms1 were 30.70 ± 0.51 μM NH4+ and 0.01 ± 0.002 pmol NH4+ cells-1 h-1, respectively. N. mobilis Ms1 had higher ammonia oxidation activity than N. europaea in this study. The oxygen uptake activity kinetics of N. mobilis Ms1 were Km(O2) = 21.74 ± 4.01 μM O2 and V max(O2) = 0.06 ± 0.02 pmol O2 cells-1 h-1. Ms1 grew well at ammonium and NaCl concentrations of up to 100 and 500 mM, respectively. The nitrite tolerance of N. mobilis Ms1 was extremely high (up to 300 mM) compared to AOB previously isolated from activated sludge and wastewater treatment plants. The average nucleotide identity between the genomes of N. mobilis Ms1 and other Nitrosomonas species indicated that N. mobilis Ms1 was distantly related to other Nitrosomonas species. The organization of the genes encoding protein inventory involved in ammonia oxidation and nitrifier denitrification processes were different from other Nitrosomonas species. The current study

  10. Molecular cloning and sequencing of infC, the gene encoding translation initiation factor IF3, from four enterobacterial species.


    Liveris, D; Schwartz, J J; Geertman, R; Schwartz, I


    Translation initiation factor IF3 plays a crucial role in initiation of protein synthesis in bacteria. In order to elucidate the IF3 structural elements required for these functions, the evolutionary conservation of IF3 and its gene, infC, was investigated. Homologous infC sequences from Salmonella typhimurium, Klebsiella pneumoniae, Serratia marcescens and Proteus vulgaris were amplified by the polymerase chain reaction and sequenced. Analysis of these sequences, as well as that from Bacillus stearothermophilus, revealed several regions (e.g. residues 62-73 and 173-177) of absolute sequence conservation, suggesting an important role for these regions in IF3 function.

  11. Alpha-amylase genes (amyR2 and amyE+) from an alpha-amylase-hyperproducing Bacillus subtilis strain: molecular cloning and nucleotide sequences.

    PubMed Central

    Yamazaki, H; Ohmura, K; Nakayama, A; Takeichi, Y; Otozai, K; Yamasaki, M; Tamura, G; Yamane, K


    amyR2, amyE+, and aroI+ alleles from an alpha-amylase-hyperproducing strain, Bacillus subtilis NA64, were cloned in temperate B. subtilis phage p11, and the amyR2 and amyE+ genes were then recloned in plasmid pUB110, which was designated pTUB4. The order of the restriction sites, ClaI-EcoRI-PstI-SalI-SmaI, found in the DNA fragment carrying amyR2 and amyE+ from the phage genome was also found in the 2.3-kilobase insert of pTUB4. Approximately 2,600 base pairs of the DNA nucleotide sequence of the amyR2 and amyE+ gene region in pTUB4 were determined. Starting from an ATG initiator codon, an open reading frame was composed of a total 1,776 base pairs (592 amino acids). Among the 1,776 base pairs, 1,674 (558 amino acids) were found in the cloned DNA fragment, and 102 base pairs (34 amino acids) were in the vector pUB110 DNA. The COOH terminal region of the alpha-amylase of pTUB4 was encoded in pUB110. The electrophoretic mobility in a 7.5% polyacrylamide gel of the alpha-amylase was slightly faster than that of the parental alpha-amylases. The NH2 termination portion of the gene encoded a 41-amino acid-long signal sequence (Ohmura et al., Biochem. Biophys. Res. Commun. 112:687-683, 1983). The DNA sequence of the mature extracellular alpha-amylase, a potential RNA polymerase recognition site and Pribnow box (TTGATAGAGTGATTGTGATAATTTAAAAT), and an AT-rich inverted repeat structure which has free energy of -8.2 kcal/mol (-34.3 kJ/mol) were identified. The AT-rich inverted repeat structure seemed to correspond to the hyperproducing character. The nucleotide sequence around the region was quite different from the promoter region of the B. subtilis 168 alpha-amylase gene which was cloned in the Escherichia coli vector systems. Images PMID:6413492

  12. Inhibition of growth of Zymomonas mobilis by model compounds found in lignocellulosic hydrolysates

    PubMed Central


    Background During the pretreatment of biomass feedstocks and subsequent conditioning prior to saccharification, many toxic compounds are produced or introduced which inhibit microbial growth and in many cases, production of ethanol. An understanding of the toxic effects of compounds found in hydrolysate is critical to improving sugar utilization and ethanol yields in the fermentation process. In this study, we established a useful tool for surveying hydrolysate toxicity by measuring growth rates in the presence of toxic compounds, and examined the effects of selected model inhibitors of aldehydes, organic and inorganic acids (along with various cations), and alcohols on growth of Zymomonas mobilis 8b (a ZM4 derivative) using glucose or xylose as the carbon source. Results Toxicity strongly correlated to hydrophobicity in Z. mobilis, which has been observed in Escherichia coli and Saccharomyces cerevisiae for aldehydes and with some exceptions, organic acids. We observed Z. mobilis 8b to be more tolerant to organic acids than previously reported, although the carbon source and growth conditions play a role in tolerance. Growth in xylose was profoundly inhibited by monocarboxylic organic acids compared to growth in glucose, whereas dicarboxylic acids demonstrated little or no effects on growth rate in either substrate. Furthermore, cations can be ranked in order of their toxicity, Ca++ > > Na+ > NH4+ > K+. HMF (5-hydroxymethylfurfural), furfural and acetate, which were observed to contribute to inhibition of Z. mobilis growth in dilute acid pretreated corn stover hydrolysate, do not interact in a synergistic manner in combination. We provide further evidence that Z. mobilis 8b is capable of converting the aldehydes furfural, vanillin, 4-hydroxybenzaldehyde and to some extent syringaldehyde to their alcohol forms (furfuryl, vanillyl, 4-hydroxybenzyl and syringyl alcohol) during fermentation. Conclusions Several key findings in this report provide a

  13. Sequence of a cDNA clone encoding the polysialic acid-rich and cytoplasmic domains of the neural cell adhesion molecule N-CAM.

    PubMed Central

    Hemperly, J J; Murray, B A; Edelman, G M; Cunningham, B A


    Purified fractions of the neural cell-adhesion molecule N-CAM from embryonic chicken brain contain two similar polypeptides (Mr, 160,000 and 130,000), each containing an amino-terminal external binding region, a carbohydrate-rich central region, and a carboxyl-terminal region that is associated with the cell. Previous studies indicate that the two polypeptides arise by alternative splicing of mRNAs transcribed from a single gene. We report here the 3556-nucleotide sequence of a cDNA clone (pEC208) that encodes 964 amino acids from the carbohydrate and cell-associated domains of the larger N-CAM polypeptide followed by 664 nucleotides of 3' untranslated sequence. The predicted protein sequence contains attachment sites for polysialic acid-containing oligosaccharides, four tandem homologous regions of polypeptide resembling those seen in the immunoglobulin superfamily, and a single hydrophobic sequence that appears to be the membrane-spanning segment. The cytoplasmic domain carboxyl terminal to this segment includes a block of approximately equal to 250 amino acids present in the larger but not in the smaller N-CAM polypeptide. We designate these the ld (large domain) polypeptide and the sd (small domain) polypeptide. The intracellular domains of the ld and sd polypeptides are likely to be critical for cell-surface modulation of N-CAM by interacting in a differential fashion with other intrinsic proteins or with the cytoskeleton. PMID:3458261

  14. Isolation and sequencing of cDNA clones coding for the catalytic unit of glucose-6-phosphatase from two haplochromine cichlid fishes.


    Nagl, S; Mayer, W E; Klein, J


    Complementary DNA clones coding for the catalytic unit of the enzyme glucose-6-phosphatase (G6Pase) were obtained from Haplochromis nubilus and Haplochromis xenognathus, two cichlid fish species from Lake Victoria. The translated sequence of these two cDNAs identifies a polypeptide consisting of 352 amino acid residues and showing a 54.4% similarity to the human form of G6Pase. The amino acid sequences of the two fish species are identical. The comparison of the fish amino acid sequence with the corresponding sequences of rat, mouse, and human G6Pase revealed that the amino acid residues, which are involved in G6Pase catalysis in humans, are also conserved in fish G6Pase. Northern blot analysis showed that G6Pase is expressed at the same level in 6- and 10-day-old fish. A three base pair insertion/deletion polymorphism was found in the 3'-untranslated region of the fish G6Pase gene. The polymorphism will be a useful marker in a phylogenetic study of Lake Victoria cichlids.

  15. Cloning and sequencing of the gltX gene, encoding the glutamyl-tRNA synthetase of Rhizobium meliloti A2.

    PubMed Central

    Laberge, S; Gagnon, Y; Bordeleau, L M; Lapointe, J


    The gltX gene, coding for the glutamyl-tRNA synthetase of Rhizobium meliloti A2, was cloned by using as probe a synthetic oligonucleotide corresponding to the amino acid sequence of a segment of the glutamyl-tRNA synthetase. The codons chosen for this 42-mer were those most frequently used in a set of R. meliloti genes. DNA sequence analysis revealed an open reading frame of 484 codons, encoding a polypeptide of Mr 54,166 containing the amino acid sequences of an NH2-terminal and various internal fragments of the enzyme. Compared with the amino acid sequence of the glutamyl-tRNA synthetase of Escherichia coli, the N-terminal third of the R. meliloti enzyme was strongly conserved (52% identity); the second third was moderately conserved (38% identity) and included a few highly conserved segments, whereas no significant similarity was found in the C-terminal third. These results suggest that the C-terminal part of the protein is probably not involved in the recognition of substrates, a feature shared with other aminoacyl-tRNA synthetases. Images PMID:2661539

  16. Cloning and sequencing of two Ceriporiopsis subvermispora bicupin oxalate oxidase allelic isoforms: implications for the reaction specificity of oxalate oxidases and decarboxylases.


    Escutia, Marta R; Bowater, Laura; Edwards, Anne; Bottrill, Andrew R; Burrell, Matthew R; Polanco, Rubén; Vicuña, Rafael; Bornemann, Stephen


    Oxalate oxidase is thought to be involved in the production of hydrogen peroxide for lignin degradation by the dikaryotic white rot fungus Ceriporiopsis subvermispora. This enzyme was purified, and after digestion with trypsin, peptide fragments of the enzyme were sequenced using quadrupole time-of-flight mass spectrometry. Starting with degenerate primers based on the peptide sequences, two genes encoding isoforms of the enzyme were cloned, sequenced, and shown to be allelic. Both genes contained 14 introns. The sequences of the isoforms revealed that they were both bicupins that unexpectedly shared the greatest similarity to microbial bicupin oxalate decarboxylases rather than monocupin plant oxalate oxidases (also known as germins). We have shown that both fungal isoforms, one of which was heterologously expressed in Escherichia coli, are indeed oxalate oxidases that possess < or =0.2% oxalate decarboxylase activity and that the organism is capable of rapidly degrading exogenously supplied oxalate. They are therefore the first bicupin oxalate oxidases to have been described. Heterologous expression of active enzyme was dependent on the addition of manganese salts to the growth medium. Molecular modeling provides new and independent evidence for the identity of the catalytic site and the key amino acid involved in defining the reaction specificities of oxalate oxidases and oxalate decarboxylases.

  17. De novo sequencing and transcriptome analysis of a low temperature tolerant Saccharum spontaneum clone IND 00-1037.


    Dharshini, S; Chakravarthi, M; J, Ashwin Narayan; Manoj, V M; Naveenarani, M; Kumar, Ravinder; Meena, Minturam; Ram, Bakshi; Appunu, C


    Saccharum spontaneum L., a wild relative of sugarcane, is known for its adaptability to environmental stresses, particularly cold stress. In the present study, an attempt was made for transcriptome profiling of the low temperature (10°C) tolerant S. spontaneum clone IND 00-1037 collected from high altitude regions of Arunachal Pradesh, North Eastern India. The Illumina Nextseq500 platform yielded a total of 47.63 and 48.18 million reads corresponding to 4.7 and 4.8 gigabase pairs (Gb) of processed reads for control and cold stressed (10°C for 24h) samples, respectively. These reads were de novo assembled into 214,611 unigenes with an average length of 801bp. Further, all unigenes were aligned to GO, KEGG and COG databases in order to identify novel genes and pathways responsive upon low temperature conditions. The differential gene expression analysis revealed that about 2583 genes were upregulated and 3302 genes were down regulated during the stress. This is perhaps the comprehensive transcriptome data of a low temperature tolerant clone of S. spontaneum. This study would aid in identifying novel genes and also in future genomic studies pertaining to sugarcane and its wild relatives.

  18. Detection and Resolution of Cryptosporidium Species and Species Mixtures by Genus-Specific Nested PCR-Restriction Fragment Length Polymorphism Analysis, Direct Sequencing, and Cloning

    PubMed Central

    Ruecker, Norma J.; Hoffman, Rebecca M.; Chalmers, Rachel M.; Neumann, Norman F.


    Molecular methods incorporating nested PCR-restriction fragment length polymorphism (RFLP) analysis of the 18S rRNA gene of Cryptosporidium species were validated to assess performance based on limit of detection (LoD) and for detecting and resolving mixtures of species and genotypes within a single sample. The 95% LoD was determined for seven species (Cryptosporidium hominis, C. parvum, C. felis, C. meleagridis, C. ubiquitum, C. muris, and C. andersoni) and ranged from 7 to 11 plasmid template copies with overlapping 95% confidence limits. The LoD values for genomic DNA from oocysts on microscope slides were 7 and 10 template copies for C. andersoni and C. parvum, respectively. The repetitive nested PCR-RFLP slide protocol had an LoD of 4 oocysts per slide. When templates of two species were mixed in equal ratios in the nested PCR-RFLP reaction mixture, there was no amplification bias toward one species over another. At high ratios of template mixtures (>1:10), there was a reduction or loss of detection of the less abundant species by RFLP analysis, most likely due to heteroduplex formation in the later cycles of the PCR. Replicate nested PCR was successful at resolving many mixtures of Cryptosporidium at template concentrations near or below the LoD. The cloning of nested PCR products resulted in 17% of the cloned sequences being recombinants of the two original templates. Limiting-dilution nested PCR followed by the sequencing of PCR products resulted in no sequence anomalies, suggesting that this method is an effective and accurate way to study the species diversity of Cryptosporidium, particularly for environmental water samples, in which mixtures of parasites are common. PMID:21498746

  19. Cloning, sequencing, and characterization of a membrane-associated Prevotella ruminicola B(1)4 beta-glucosidase with cellodextrinase and cyanoglycosidase activities.

    PubMed Central

    Wulff-Strobel, C R; Wilson, D B


    Prevotella ruminicola B(1)4 is a gram-negative, anaerobic gastrointestinal bacterium. A 2.4-kbp chromosomal fragment from P. ruminicola encoding an 87-kDa aryl-glucosidase (CdxA) with cellodextrinase activity was cloned into Escherichia coli DH5 alpha and sequenced. CdxA activity was found predominantly in the membrane fraction of both P. ruminicola and E. coli, but P. ruminicola localized the protein extracellularly while E. coli did not. The hydrolase had the highest activity on cellodextrins (3.43 to 4.13 mumol of glucose released min-1 mg of protein-1) and p-nitrophenyl-beta-D-glucoside (3.54 mumol min-1 mg of protein-1). Significant activity (70% of p-nitrophenyl-beta-D-glucoside activity) was also detected on arbutin and prunasin. Less activity was obtained with cellobiose, amygdalin, or gentiobiose. CdxA attacks cellodextrins from the nonreducing end, releasing glucose units, and appears to be an exo-1,4-beta-glucosidase (EC which also is able to attack beta-1,6 linkages. Comparison of the deduced amino acid sequence with other glycosyl-hydrolases suggests that this enzyme belongs to family 3 (B. Henrissat, Biochem. J. 280:309-316, 1991). On the basis of this sequence alignment, the catalytic residues are believed to be Asp-275 and Glu-265. This is the first report of a cloned ruminal bacterial enzyme which can cleave cyanogenic plant compounds and which may therefore contribute to cyanide toxicity in ruminants. PMID:7592339

  20. Ultra-deep T cell receptor sequencing reveals the complexity and intratumour heterogeneity of T cell clones in renal cell carcinomas

    PubMed Central

    Gerlinger, Marco; Quezada, Sergio A; Peggs, Karl S; Furness, Andrew JS; Fisher, Rosalie; Marafioti, Teresa; Shende, Vishvesh H; McGranahan, Nicholas; Rowan, Andrew J; Hazell, Steven; Hamm, David; Robins, Harlan S; Pickering, Lisa; Gore, Martin; Nicol, David L; Larkin, James; Swanton, Charles


    The recognition of cancer cells by T cells can impact upon prognosis and be exploited for immunotherapeutic approaches. This recognition depends on the specific interaction between antigens displayed on the surface of cancer cells and the T cell receptor (TCR), which is generated by somatic rearrangements of TCR α- and β-chains (TCRb). Our aim was to assess whether ultra-deep sequencing of the rearranged TCRb in DNA extracted from unfractionated clear cell renal cell carcinoma (ccRCC) samples can provide insights into the clonality and heterogeneity of intratumoural T cells in ccRCCs, a tumour type that can display extensive genetic intratumour heterogeneity (ITH). For this purpose, DNA was extracted from two to four tumour regions from each of four primary ccRCCs and was analysed by ultra-deep TCR sequencing. In parallel, tumour infiltration by CD4, CD8 and Foxp3 regulatory T cells was evaluated by immunohistochemistry and correlated with TCR-sequencing data. A polyclonal T cell repertoire with 367–16 289 (median 2394) unique TCRb sequences was identified per tumour region. The frequencies of the 100 most abundant T cell clones/tumour were poorly correlated between most regions (Pearson correlation coefficient, –0.218 to 0.465). 3–93% of these T cell clones were not detectable across all regions. Thus, the clonal composition of T cell populations can be heterogeneous across different regions of the same ccRCC. T cell ITH was higher in tumours pretreated with an mTOR inhibitor, which could suggest that therapy can influence adaptive tumour immunity. These data show that ultra-deep TCR-sequencing technology can be applied directly to DNA extracted from unfractionated tumour samples, allowing novel insights into the clonality of T cell populations in cancers. These were polyclonal and displayed ITH in ccRCC. TCRb sequencing may shed light on mechanisms of cancer immunity and the efficacy of immunotherapy approaches. Copyright © 2013 Pathological Society of

  1. [Molecular cloning, sequence analysis and stress-related changes of the heat shock protein 60 gene in Neobenedenia melleni].


    Wang, Fang; Chen, Jiong; Shi, Yu-Hong; Lu, Xin-Jiang; Li, Ming-Yun


    Heat shock protein 60 is an essential chaperone that can maintain the natural structure and function of mitochondrial proteins. Here, we successfully cloned the full length cDNA of HSP60 from Neobenedenia melleni, designated as NmHSP60. Real-time quantitative PCR and Western blot were used to analyze the expression change of NmHSP60 under different temperature and salinity. Compared with the typical 25 Degrees Celsius, expressions decreased dramatically in eggs and adults at 18 Degrees Celsius. Conversely, at 32 Degrees Celsius, expression increase dramatically in adults. Compared with salinity 24, expressions were significantly down-regulated in adults at salinity 18, and up-regulated in eggs at salinity 30. Experimental results suggest that NmHSP60 may play an significant role in N. melleni's adaptation to adverse environmental conditions.

  2. Characterization, gene cloning, and sequencing of a fungal phytase, PhyA, from Penicillium oxalicum PJ3.


    Lee, Seung Ho; Cho, Jaiesoon; Bok, Jinduck; Kang, Seungha; Choi, Yunjaie; Lee, Peter C W


    A phytase from Penicillium oxalicum PJ3, PhyA, was purified near to homogeneity with 427-fold increase in specific phytase activity by ammonium sulfate precipitation, gel filtration, and ion-exchange chromatographies. Sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) and zymogram analysis of the purified enzyme indicated an estimated molecular mass of 65 kD. The optimal pH and temperature of the purified enzyme were pH 4.5 and 55°C, respectively. The enzyme activity was strongly inhibited by Ca(2+), Cu(2+), Zn(2+), and phenylmethylsulfonyl fluoride (PMSF). The Km value for sodium phytate was 0.545 mM with a Vmax of 600 U/mg of protein. The phyA gene was cloned, and it contains an open reading frame of 1,383 with a single intron (118 bp), and encodes a protein of 461 amino acids.

  3. Multilocus Sequence Typing and rtxA Toxin Gene Sequencing Analysis of Kingella kingae Isolates Demonstrates Genetic Diversity and International Clones

    PubMed Central

    Basmaci, Romain; Yagupsky, Pablo; Ilharreborde, Brice; Guyot, Kathleen; Porat, Nurith; Chomton, Marilyn; Thiberge, Jean-Michel; Mazda, Keyvan; Bingen, Edouard


    Background Kingella kingae, a normal component of the upper respiratory flora, is being increasingly recognized as an important invasive pathogen in young children. Genetic diversity of this species has not been studied. Methods We analyzed 103 strains from different countries and clinical origins by a new multilocus sequence-typing (MLST) schema. Putative virulence gene rtxA, encoding an RTX toxin, was also sequenced, and experimental virulence of representative strains was assessed in a juvenile-rat model. Results Thirty-six sequence-types (ST) and nine ST-complexes (STc) were detected. The main STc 6, 14 and 23 comprised 23, 17 and 20 strains respectively, and were internationally distributed. rtxA sequencing results were mostly congruent with MLST, and showed horizontal transfer events. Of interest, all members of the distantly related ST-6 (n = 22) and ST-5 (n = 4) harboured a 33 bp duplication or triplication in their rtxA sequence, suggesting that this genetic trait arose through selective advantage. The animal model revealed significant differences in virulence among strains of the species. Conclusion MLST analysis reveals international spread of ST-complexes and will help to decipher acquisition and evolution of virulence traits and diversity of pathogenicity among K. kingae strains, for which an experimental animal model is now available. PMID:22693588

  4. Low incidence of off-target mutations in individual CRISPR-Cas9 and TALEN targeted human stem cell clones detected by whole-genome sequencing.


    Veres, Adrian; Gosis, Bridget S; Ding, Qiurong; Collins, Ryan; Ragavendran, Ashok; Brand, Harrison; Erdin, Serkan; Cowan, Chad A; Talkowski, Michael E; Musunuru, Kiran


    Genome editing has attracted wide interest for the generation of cellular models of disease using human pluripotent stem cells and other cell types. CRISPR-Cas systems and TALENs can target desired genomic sites with high efficiency in human cells, but recent publications have led to concern about the extent to which these tools may cause off-target mutagenic effects that could potentially confound disease-modeling studies. Using CRISPR-Cas9 and TALEN targeted human pluripotent stem cell clones, we performed whole-genome sequencing at high coverage in order to assess the degree of mutagenesis across the entire genome. In both types of clones, we found that off-target mutations attributable to the nucleases were very rare. From this analysis, we suggest that, although some cell types may be at risk for off-target mutations, the incidence of such effects in human pluripotent stem cells may be sufficiently low and thus not a significant concern for disease modeling and other applications.

  5. Cloning, sequence analysis, and expression in Escherichia coli of a gene coding for a beta-mannanase from the extremely thermophilic bacterium "Caldocellum saccharolyticum".

    PubMed Central

    Lüthi, E; Jasmat, N B; Grayling, R A; Love, D R; Bergquist, P L


    A lambda recombinant phage expressing beta-mannanase activity in Escherichia coli has been isolated from a genomic library of the extremely thermophilic anaerobe "Caldocellum saccharolyticum." The gene was cloned into pBR322 on a 5-kb BamHI fragment, and its location was obtained by deletion analysis. The sequence of a 2.1-kb fragment containing the mannanase gene has been determined. One open reading frame was found which could code for a protein of Mr 38,904. The mannanase gene (manA) was overexpressed in E. coli by cloning the gene downstream from the lacZ promoter of pUC18. The enzyme was most active at pH 6 and 80 degrees C and degraded locust bean gum, guar gum, Pinus radiata glucomannan, and konjak glucomannan. The noncoding region downstream from the mannanase gene showed strong homology to celB, a gene coding for a cellulase from the same organism, suggesting that the manA gene might have been inserted into its present position on the "C. saccharolyticum" genome by homologous recombination. Images PMID:2039230

  6. Cloning, sequencing, and expression of nitrile hydratase gene of mutant 4D strain of Rhodococcus rhodochrous PA 34 in E. coli.


    Pratush, Amit; Seth, Amit; Bhalla, T C


    The NHase encoding gene of mutant 4D was isolated by PCR amplification. The NHase gene of mutant 4D was successfully cloned and expressed in Escherichia coli by using Ek/LIC Duet cloning kits (Novagen). For the active expression of the NHase gene, the co-expression of small cobalt transporter gene (P-protein gene) has also been co-expressed with NHase gene E. coli. The nucleotide sequence of this NHase gene revealed high homology with the H-NHase of Rhodococcus rhodochrous J1. The recombinant E. coli cells showed higher NHase activity (5.9 U/mg dcw) as compared to the wild (4.1 U/mg dcw) whereas it is less than the mutant strain (8.4 U/mg dcw). Addition of cobalt ion in Luria-Bertani medium is needed up to a very small concentration (0.4 mM) for NHase activity. The recombinant E. coli exhibited maximum NHase activity at 6 h of incubation and was purified with a yield of 56 % with specific activity of 37.1 U/mg protein.

  7. Cloning, characterization, and nucleotide sequence of a gene encoding Microbispora bispora BglB, a thermostable beta-glucosidase expressed in Escherichia coli.

    PubMed Central

    Wright, R M; Yablonsky, M D; Shalita, Z P; Goyal, A K; Eveleigh, D E


    Genomic DNA fragments encoding beta-glucosidase activities of the thermophilic actinomycete Microbispora bispora were cloned into Escherichia coli. Transformants expressing beta-glucosidase activity were selected by their ability to hydrolyze the fluorogenic substrate 4-methylumbelliferyl-beta-D-glucoside. Two genes encoding beta-glucosidase activity were isolated and distinguished by restriction analysis, Southern hybridization, and the substrate specificities of the encoded enzymes. One gene, bglB, encoded a beta-glucosidase that was expressed intracellularly in E. coli. It exhibited a molecular mass of approximately 52,000 Da by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (PAGE) and 51,280 Da by nondenaturing gradient PAGE, a pI of 4.6, and temperature and pH optima of 60 degrees C and 6.2, respectively. Cloned BglB showed greater activity against cellobiose than against aryl-beta-D-glucosides and was thermostable, retaining about 70% of its activity after 48 h at 60 degrees C. BglB activity is activated two- to threefold in the presence of 2 to 5% (0.1 to 0.3 M) glucose. The DNA sequence of the 2.2-kb insert carrying bglB has been determined. An open reading frame which codes for a protein of 473 amino acids with a predicted molecular mass of 52,227 Da showed significant homology (40 to 47% identity) with beta-glucosidases from glycosal hydrolase family 1. Images PMID:1482172

  8. CTLA-8, cloned from an activated T cell, bearing AU-rich messenger RNA instability sequences, and homologous to a herpesvirus saimiri gene.


    Rouvier, E; Luciani, M F; Mattéi, M G; Denizot, F; Golstein, P


    To detect novel molecules involved in immune functions, a subtracted cDNA library between closely related murine lymphoid cells was prepared using improved technology. Differential screening of this library yielded several clones with a very restricted tissue specificity, including one that we named CTLA-8. CTLA-8 transcripts could be detected only in T cell hybridoma clones related to the one used to prepare the library. Southern blots showed that the CTLA-8 gene was single copy in mice, rats, and humans. By radioactive in situ hybridization, the CTLA-8 gene was mapped at a single site on mouse chromosome 1A and human chromosome 2q31, in a known interspecific syntenic region. The CTLA-8 cDNA sequence indicated the presence, in the 3'-untranslated region of the mRNA, of AU-rich repeats previously found in the mRNA of various cytokines, growth factors, and oncogenes. The CTLA-8 cDNA contained an open reading frame encoding a putative protein of 150 amino acids. This protein was 57% homologous to the putative protein encoded by the ORF13 gene of herpesvirus Saimiri, a T lymphotropic virus. These findings are discussed in the context of other genes of this herpesvirus homologous to known immunologically active molecules. More generally, CTLA-8 may belong to the growing set of virus-captured functionally important cellular genes related to the immune system or to cell death and cell survival.

  9. [cDNA cloning and sequence analysis of the seventh segment of maize rough dwarf virus genome].


    Deng, W; Yang, X; Zhang, Y; Liu, Y; Kang, L


    The double strand RNA of maize rough dwarf virus (MRDV) was prepared from the maize samples showing symptoms which was from the Luanchen county of Heibei province of China. The primers were designed according to the known sequence of MRDV, the cDNA sequence of the seventh segment of MRDV was obtained by RT-PCR, the S7 sequence was analyzed by computer after sequencing. The results showed: the full length of the S7 cDNA is 1936 bp and equal to that of the S7 cDNA from abroad, the two open reading frame(ORF1 and ORF2) contained in the S7 segment are also unchanged. In comparison with the S7 segment from Italy, the homology of S7 nucleotide is 87.7% and the homology of ORF1 amino acid sequence is 91.6%. However, the MRDV S7 segment and the rice black strike dwarf virus S8 segment showed 95.5% nucleotide identities and 93.5% ORF1 amino acid identities.

  10. [Cloning and sequence analysis of the DHBV genome of the brown ducks in Guilin region and establishment of the quantitative method for detecting DHBV].


    Su, He-Ling; Huang, Ri-Dong; He, Song-Qing; Xu, Qing; Zhu, Hua; Mo, Zhi-Jing; Liu, Qing-Bo; Liu, Yong-Ming


    Brown ducks carrying DHBV were widely used as hepatitis B animal model in the research of the activity and toxicity of anti-HBV dugs. Studies showed that the ratio of DHBV carriers in the brown ducks in Guilin region was relatively high. Nevertheless, the characters of the DHBV genome of Guilin brown duck remain unknown. Here we report the cloning of the genome of Guilin brown duck DHBV and the sequence analysis of the genome. The full length of the DHBV genome of Guilin brown duck was 3 027bp. Analysis using ORF finder found that there was an ORF for an unknown peptide other than S-ORF, PORF and C-ORF in the genome of the DHBV. Vector NTI 8. 0 analysis revealed that the unknown peptide contained a motif which binded to HLA * 0201. Aligning with the DHBV sequences from different countries and regions indicated that there were no obvious differences of regional distribution among the sequences. A fluorescence quantitative PCR for detecting DHBV was establishment based on the recombinant plasmid pGEM-DHBV-S constructed. This study laid the groundwork for using Guilin brown duck as a hepatitis B animal model.

  11. Molecular cloning of the goose ACSL3 and ACSL5 coding domain sequences and their expression characteristics during goose fatty liver development.


    He, H; Liu, H H; Wang, J W; Lv, J; Li, L; Pan, Z X


    It has been demonstrated that ACSL3 and ACSL5 play important roles in fat metabolism. To investigate the primary functions of ACSL3 and ACSL5 and to evaluate their expression levels during goose fatty liver development, we cloned the ACSL3 and ACSL5 coding domain sequences (CDSs) of geese using RT-PCR and analyzed their expression characteristics under different conditions using qRT-PCR. The results showed that the goose ACSL3 (JX511975) and ACSL5 (JX511976) sequences have high similarities with the chicken sequences both at the nucleotide and amino acid levels. Both ACSL3 and ACSL5 have high expression levels in goose liver. The expression levels of ACSL3 and ACSL5 in goose liver and hepatocytes can be changed by overfeeding geese and by treatment with unsaturated fatty acids, respectively. Together, these results indicate that ACSL3 and ACSL5 play important roles during fatty liver development. The different expression characteristics of goose ACSL3 and ACSL5 suggest that these two genes may be responsible for specific functions.

  12. A Simple Method for the Extraction, PCR-amplification, Cloning, and Sequencing of Pasteuria 16S rDNA from Small Numbers of Endospores

    PubMed Central

    Atibalentja, N.; Noel, G. R.; Ciancio, A.


    For many years the taxonomy of the genus Pasteuria has been marred with confusion because the bacterium could not be cultured in vitro and, therefore, descriptions were based solely on morphological, developmental, and pathological characteristics. The current study sought to devise a simple method for PCR-amplification, cloning, and sequencing of Pasteuria 16S rDNA from small numbers of endospores, with no need for prior DNA purification. Results show that DNA extracts from plain glass bead-beating of crude suspensions containing 10,000 endospores at 0.2 × 10⁶ endospores ml-1 were sufficient for PCR-amplification of Pasteuria 16S rDNA, when used in conjunction with specific primers. These results imply that for P. penetrans and P. nishizawae only one parasitized female of Meloidogyne spp. and Heterodera glycines, respectively, should be sufficient, and as few as eight cadavers of Belonolaimus longicaudatus with an average number of 1,250 endospores of "Candidatus Pasteuria usgae" are needed for PCR-amplification of Pasteuria 16S rDNA. The method described in this paper should facilitate the sequencing of the 16S rDNA of the many Pasteuria isolates that have been reported on nematodes and, consequently, expedite the classification of those isolates through comparative sequence analysis. PMID:19262793

  13. Molecular cloning and characterization of a new cDNA sequence encoding a venom peptide from the centipede Scolopendra subspinipes mutilans.


    Liu, Wanhong; Luo, Feng; He, Jing; Cao, Zhijian; Miao, Lixia


    Many studies have been performed on venomous peptides derived from animals. However, little of this research has focused on peptides from centipede venoms. Here, a venom gland cDNA library was successfully constructed for the centipede Scolopendra subspinipes mutilans. A new cDNA encoding the precursor of a venom peptide, named SsmTx, was cloned from the venomous gland cDNA library of the centipede S. subspinipes mutilans. The full-length SsmTx cDNA sequence is 465 nt, including a 249 nt ORF, a 45 nt 5' UTR and a 171 nt 3' UTR. There is a signal tail AATAAA 31 nt upstream of the poly (A) tail. The precursor nucleotide sequence of SsmTx encodes a signal peptide of 25 residues and a mature peptide of 57 residues, which is bridged by two pairs of disulfide bonds. SsmTx displays a unique cysteine motif that is completely different from that of other venomous animal toxins. This is the first reported cDNA sequence encoding a venom peptide from the centipede S. subspinipes mutilans.

  14. Tumour suppressor gene p53 in the horse: identification, cloning, sequencing and a possible role in the pathogenesis of equine sarcoid.


    Bucher, K; Szalai, G; Marti, E; Griot-Wenk, M E; Lazary, S; Pauli, U


    The tumour suppressor protein p53 enhances the genetic stability of the cell and plays a critical role in tumour suppression. Equine p53 was analysed by sequencing exons 5 to 9, a region which includes most known mutations and all the mutational hotspots in the species that have been investigated. The fragment was amplified, cloned and sequenced from genomic and complementary DNA. A comparison of the predicted amino acid sequences between the horse and other species resulted in identities between 66 per cent with the clawed frog and 92 per cent with the cat. Using the single strand conformation polymorphism technique, exons 5 to 8 amplified from sarcoid tissue and peripheral leucocytes of 28 sarcoid-affected and 11 healthy horses were screened for mutations. No mutations were identified, suggesting that the frequency of p53 mutations in equine sarcoid might be low. However, the high incidence of bovine papillomavirus (BPV) infection in equine sarcoid may indicate the functional inactivation of p53 by BPV-encoded E6 protein.

  15. Cloning, sequencing, and analysis of a gene cluster from Chelatobacter heintzii ATCC 29600 encoding nitrilotriacetate monooxygenase and NADH:flavin mononucleotide oxidoreductase.

    PubMed Central

    Xu, Y; Mortimer, M W; Fisher, T S; Kahn, M L; Brockman, F J; Xun, L


    Nitrilotriacetate (NTA) is an important chelating agent in detergents and has also been used extensively in processing radionuclides. In Chelatobacter heintzii ATCC 29600, biodegradation of NTA is initiated by NTA monooxygenase that oxidizes NTA to iminodiacetate and glyoxylate. The NTA monooxygenase activity requires two component proteins, component A and component B, but the function of each component is unclear. We have cloned and sequenced a gene cluster encoding components A and B (nmoA and nmoB) and two additional open reading frames, nmoR and nmoT, downstream of nmoA. Based on sequence similarities, nmoR and nmoT probably encode a regulatory protein and a transposase, respectively. The NmoA sequence was similar to a monooxygenase that uses reduced flavin mononucleotide (FMNH2) as reductant; NmoB was similar to an NADH:flavin mononucleotide (FMN) oxidoreductase. On the basis of this information, we tested the function of each component. Purified component B was shown to be an NADH:FMN oxidoreductase, and its activity could be separated from that of component A. When the Photobacterium fischeri NADH:FMN oxidoreductase was substituted for component B in the complete reaction, NTA was oxidized, showing that the substrate specificity of the reaction resides in component A. Component A is therefore an NTA monooxygenase that uses FMNH2 and O2 to oxidize NTA, and component B is an NADH:FMN oxidoreductase that provides FMNH2 for NTA oxidation. PMID:9023192

  16. Sequence type 72 community-associated meticillin-resistant Staphylococcus aureus emerged as a predominant clone of nasal colonization in newly admitted patients.


    Park, S Y; Chung, D R; Yoo, J R; Baek, J Y; Kim, S H; Ha, Y E; Kang, C-I; Peck, K R; Lee, N Y; Song, J-H


    Current knowledge of community-associated (CA) meticillin-resistant Staphylococcus aureus (MRSA) carriage in hospitalized patients is incomplete. Genotypic characteristics of 637 nasal MRSA isolates from newly admitted patients in South Korea were investigated. Sequence type (ST) 72 accounted for 52.1%, 46.3%, and 52.8% of the isolates during the periods of 2007-2008, 2009-2010, and 2013-2014, respectively. Instead of classic MRSA clones responsible for healthcare-associated infections, including ST5 and ST239, MRSA with community genotype ST72 was the predominant strain in newly admitted patients regardless of age and home province of the patients. Active strategies are needed to prevent healthcare-associated infection by CA-MRSA.

  17. Cloning, sequencing, and expression of a Eubacterium cellulosolvens 5 gene encoding an endoglucanase (Cel5A) with novel carbohydrate-binding modules, and properties of Cel5A.


    Yoda, Kazutoyo; Toyoda, Atsushi; Mukoyama, Yoshihiro; Nakamura, Yutaka; Minato, Hajime


    A novel Eubacterium cellulosolvens 5 gene encoding an endoglucanase (Cel5A) was cloned and expressed in Escherichia coli, and its enzymatic properties were characterized. The cel5A gene consists of a 3,444-bp open reading frame and encodes a 1,148-amino-acid protein with a molecular mass of 127,047 Da. Cel5A is a modular enzyme consisting of an N-terminal signal peptide, two glycosyl hydrolase family 5 catalytic modules, two novel carbohydrate-binding modules (CBMs), two linker sequences, and a C-terminal sequence with an unknown function. The amino acid sequences of the two catalytic modules and the two CBMs are 94% and 73% identical to each other, respectively. Two regions that consisted of one CBM and one catalytic module were tandemly connected via a linker sequence. The CBMs did not exhibit significant sequence similarity with any other CBMs. Analyses of the hydrolytic activity of the recombinant Cel5A (rCel5A) comprising the CBMs and the catalytic modules showed that the enzyme is an endoglucanase with activities with carboxymethyl cellulose, lichenan, acid-swollen cellulose, and oat spelt xylan. To investigate the functions of the CBMs and the catalytic modules, truncated derivatives of rCel5A were constructed and characterized. There were no differences in the hydrolytic activities with various polysaccharides or in the hydrolytic products obtained from cellooligosaccharides between the two catalytic modules. Both CBMs had the same substrate affinity with intact rCel5A. Removal of the CBMs from rCel5A reduced the catalytic activities with various polysaccharides remarkably. These observations show that CBMs play an important role in the catalytic function of the enzyme.

  18. Cloning and sequence analysis of a full-length cDNA of SmPP1cb encoding turbot protein phosphatase 1 beta catalytic subunit

    NASA Astrophysics Data System (ADS)

    Qi, Fei; Guo, Huarong; Wang, Jian


    Reversible protein phosphorylation, catalyzed by protein kinases and phosphatases, is an important and versatile mechanism by which eukaryotic cells regulate almost all the signaling processes. Protein phosphatase 1 (PP1) is the first and well-characterized member of the protein serine/threonine phosphatase family. In the present study, a full-length cDNA encoding the beta isoform of the catalytic subunit of protein phosphatase 1(PP1cb), was for the first time isolated and sequenced from the skin tissue of flatfish turbot Scophthalmus maximus, designated SmPP1cb, by the rapid amplification of cDNA ends (RACE) technique. The cDNA sequence of SmPP1cb we obtained contains a 984 bp open reading frame (ORF), flanked by a complete 39 bp 5' untranslated region and 462 bp 3' untranslated region. The ORF encodes a putative 327 amino acid protein, and the N-terminal section of this protein is highly acidic, Met-Ala-Glu-Gly-Glu-Leu-Asp-Val-Asp, a common feature for PP1 catalytic subunit but absent in protein phosphatase 2B (PP2B). And its calculated molecular mass is 37 193 Da and pI 5.8. Sequence analysis indicated that, SmPP1cb is extremely conserved in both amino acid and nucleotide acid levels compared with the PP1cb of other vertebrates and invertebrates, and its Kozak motif contained in the 5'UTR around ATG start codon is GXXAXXGXX ATGG, which is different from mammalian in two positions A-6 and G-3, indicating the possibility of different initiation of translation in turbot, and also the 3'UTR of SmPP1cb is highly diverse in the sequence similarity and length compared with other animals, especially zebrafish. The cloning and sequencing of SmPP1cb gene lays a good foundation for the future work on the biological functions of PP1 in the flatfish turbot.

  19. Molecular cloning, nucleotide sequencing, and expression of genes encoding alcohol dehydrogenases from the thermophile Thermoanaerobacter brockii and the mesophile Clostridium beijerinckii.


    Peretz, M; Bogin, O; Tel-Or, S; Cohen, A; Li, G; Chen, J S; Burstein, Y


    Proteins play a pivotal role in thermophily. Comparing the molecular properties of homologous proteins from thermophilic and mesophilic bacteria is important for understanding the mechanisms of microbial adaptation to extreme environments. The thermophile Thermoanaerobacter (Thermoanaerobium) brockii and the mesophile Clostridium beijerinckii contain an NADP(H)-linked, zinc-containing secondary alcohol dehydrogenase (TBADH and CBADH) showing a similarly broad substrate range. The structural genes encoding the TBADH and the CBADH were cloned, sequenced, and highly expressed in Escherichia coli. The coding sequences of the TB adh and the CB adh genes are, respectively, 1056 and 1053 nucleotides long. The TB adh gene encoded an amino acid sequence identical to that of the purified TBADH. Alignment of the deduced amino acid sequences of the TB and CB adh genes showed a 76% identity and a 86% similarity, and the two genes had a similar preference for codons with A or T in the third position. Multiple sequence alignment of ADHs from different sources revealed that two (Cys-46 and His-67) of the three ligands for the catalytic Zn atom of the horse-liver ADH are preserved in TBADH and CBADH. Both the TBADH and CBADH were homotetramers. The substrate specificities and thermostabilities of the TBADH and CBADH expressed inE. coli were identical to those of the enzymes isolated from T. brockii and C. beijerinckii, respectively. A comparison of the amino acid composition of the two ADHs suggests that the presence of eight additional proline residues in TBADH than in CBADH and the exchange of hydrophilic and large hydrophobic residues in CBADH for the small hydrophobic amino acids Pro, Ala, and Val in TBADH might contribute to the higher thermostability of the T. brockii enzyme.

  20. Cloning and sequence analysis of the plasmid-borne genes encoding the Eco29kI restriction and modification enzymes.


    Zakharova, M V; Beletskaya, I V; Kravetz, A N; Pertzev, A V; Mayorov, S G; Shlyapnikov, M G; Solonin, A S


    The Eco29kI restriction-modification system (RMS2) has been found to be localized on the plasmid pECO29 occurring naturally in the Escherichia coli strain 29k (Pertzev, A.V., Ruban, N.M., Zakharova, M.V., Beletskaya, I.V., Petrov, S.I., Kravetz, A.N., Solonin, A.S., 1992. Eco29kI, a novel plasmid encoded restriction endonuclease from Escherichia coli. Nucleic Acids Res. 20, 1991). The genes coding for this RMS2, a SacII isoschizomer recognizing the sequence CCGCGG have been cloned in Escherichia coli K802 and sequenced. The DNA sequence predicts the restriction endonuclease (ENase) of 214 amino acids (aa) (24,556 Da) and the DNA-methyltransferase (MTase) of 382 aa (43,007 Da) where the genes are separated by 2 bp and arranged in tandem with eco29kIR preceding eco29kIM. The recombinant plasmid with eco29kIR produces a protein of expected size. MEco29kI contains all the conserved aa sequence motifs characteristic of m5C-MTases. Remarkably, its variable region exhibits a significant similarity to the part of the specific target-recognition domain (TRD) from MBssHII--multispecific m5C-MTase (Schumann, J.J., Walter, J., Willert, J., Wild, C., Koch D., Trautner, T.A., 1996. MBssHII: a multispecific cytosine-C5-DNA-methyltransferase with unusual target recognizing properties. J. Mol. Biol. 257, 949-959), which recognizes five different sites on DNA (HaeII, MluI, Cfr10I, SacII and BssHII), and the comparison of the nt sequences of its variable regions allowed us to determine the putative TRD of MEco29kI.

  1. Variant discovery and breakpoint region prediction for studying the human 22q11.2 deletion using BAC clone and whole genome sequencing analysis.


    Guo, Xingyi; Delio, Maria; Haque, Nousin; Castellanos, Raquel; Hestand, Matthew S; Vermeesch, Joris R; Morrow, Bernice E; Zheng, Deyou


    Velo-cardio-facial syndrome/DiGeorge syndrome/22q11.2 deletion syndrome (22q11.2DS) is caused by meiotic non-allelic homologous recombination events between flanking low copy repeats termed LCR22A and LCR22D, resulting in a 3 million base pair (Mb) deletion. Due to their complex structure, large size and high sequence identity, genetic variation within LCR22s among different individuals has not been well characterized. In this study, we sequenced 13 BAC clones derived from LCR22A/D and aligned them with 15 previously available BAC sequences to create a new genetic variation map. The thousands of variants identified by this analysis were not uniformly distributed in the two LCR22s. Moreover, shared single nucleotide variants between LCR22A and LCR22D were enriched in the Breakpoint Cluster Region pseudogene (BCRP) block, suggesting the existence of a possible recombination hotspot there. Interestingly, breakpoints for atypical 22q11.2 rearrangements have previously been located to BCRPs To further explore this finding, we carried out in-depth analyses of whole genome sequence (WGS) data from two unrelated probands harbouring a de novo 3Mb 22q11.2 deletion and their normal parents. By focusing primarily on WGS reads uniquely mapped to LCR22A, using the variation map from our BAC analysis to help resolve allele ambiguity, and by performing PCR analysis, we infer that the deletion breakpoints were most likely located near or within the BCRP module. In summary, we found a high degree of sequence variation in LCR22A and LCR22D and a potential recombination breakpoint near or within the BCRP block, providing a starting point for future breakpoint mapping using additional trios.

  2. Molecular cloning, sequence characterization, and gene expression profiling of a novel water buffalo (Bubalus bubalis) gene, AGPAT6.


    Song, S; Huo, J L; Li, D L; Yuan, Y Y; Yuan, F; Miao, Y W


    Several 1-acylglycerol-3-phosphate-O-acyltransferases (AGPATs) can acylate lysophosphatidic acid to produce phosphatidic acid. Of the eight AGPAT isoforms, AGPAT6 is a crucial enzyme for glycerolipids and triacylglycerol biosynthesis in some mammalian tissues. We amplified and identified the complete coding sequence (CDS) of the water buffalo AGPAT6 gene by using the reverse transcription-polymerase chain reaction, based on the conversed sequence information of the cattle or expressed sequence tags of other Bovidae species. This novel gene was deposited in the NCBI database (accession No. JX518941). Sequence analysis revealed that the CDS of this AGPAT6 encodes a 456-amino acid enzyme (molecular mass = 52 kDa; pI = 9.34). Water buffalo AGPAT6 contains three hydrophobic transmembrane regions and a signal 37-amino acid peptide, localized in the cytoplasm. The deduced amino acid sequences share 99, 98, 98, 97, 98, 98, 97 and 95% identity with their homologous sequences from cattle, horse, human, mouse, orangutan, pig, rat, and chicken, respectively. The phylogenetic tree analysis based on the AGPAT6 CDS showed that water buffalo has a closer genetic relationship with cattle than with other species. Tissue expression profile analysis shows that this gene is highly expressed in the mammary gland, moderately expressed in the heart, muscle, liver, and brain; weakly expressed in the pituitary gland, spleen, and lung; and almost silently expressed in the small intestine, skin, kidney, and adipose tissues. Four predicted microRNA target sites are found in the water buffalo AGPAT6 CDS. These results will establish a foundation for further insights into this novel water buffalo gene.

  3. Small RNA Library Cloning Procedure for Deep Sequencing of Specific Endogenous siRNA Classes in Caenorhabditis elegans

    PubMed Central

    Ow, Maria C.; Lau, Nelson C.; Hall, Sarah E.


    In recent years, distinct classes of small RNAs ranging in size from ~21 to 26 nucleotides have been discovered and shown to play important roles in a wide array of cellular functions. Because of the abundance of these small RNAs, library preparation from an RNA sample followed by deep sequencing provides the identity and quantity of a particular class of small RNAs. In this chapter we describe a detailed protocol for preparing small RNA libraries for deep sequencing on the Illumina platform from the nematode C. elegans. PMID:24920360

  4. Sequence-Independent Cloning and Post-Translational Modification of Repetitive Protein Polymers through Sortase and Sfp-Mediated Enzymatic Ligation.


    Ott, Wolfgang; Nicolaus, Thomas; Gaub, Hermann E; Nash, Michael A


    Repetitive protein-based polymers are important for many applications in biotechnology and biomaterials development. Here we describe the sequential additive ligation of highly repetitive DNA sequences, their assembly into genes encoding protein-polymers with precisely tunable lengths and compositions, and their end-specific post-translational modification with organic dyes and fluorescent protein domains. Our new Golden Gate-based cloning approach relies on incorporation of only type IIS BsaI restriction enzyme recognition sites using PCR, which allowed us to install ybbR-peptide tags, Sortase c-tags, and cysteine residues onto either end of the repetitive gene polymers without leaving residual cloning scars. The assembled genes were expressed in Escherichia coli and purified using inverse transition cycling (ITC). Characterization by cloud point spectrophotometry, and denaturing polyacrylamide gel electrophoresis with fluorescence detection confirmed successful phosphopantetheinyl transferase (Sfp)-mediated post-translational N-terminal labeling of the protein-polymers with a coenzyme A-647 dye (CoA-647) and simultaneous sortase-mediated C-terminal labeling with a GFP domain containing an N-terminal GG-motif in a one-pot reaction. In a further demonstration, we installed an N-terminal cysteine residue into an elastin-like polypeptide (ELP) that was subsequently conjugated to a single chain poly(ethylene glycol)-maleimide (PEG-maleimide) synthetic polymer, noticeably shifting the ELP cloud point. The ability to straightforwardly assemble repetitive DNA sequences encoding ELPs of precisely tunable length and to post-translationally modify them specifically at the N- and C- termini provides a versatile platform for the design and production of multifunctional smart protein-polymeric materials.

  5. Cloning and sequencing of a gene encoding a 21-kilodalton outer membrane protein from Bordetella avium and expression of the gene in Salmonella typhimurium.

    PubMed Central

    Gentry-Weeks, C R; Hultsch, A L; Kelly, S M; Keith, J M; Curtiss, R


    Three gene libraries of Bordetella avium 197 DNA were prepared in Escherichia coli LE392 by using the cosmid vectors pCP13 and pYA2329, a derivative of pCP13 specifying spectinomycin resistance. The cosmid libraries were screened with convalescent-phase anti-B. avium turkey sera and polyclonal rabbit antisera against B. avium 197 outer membrane proteins. One E. coli recombinant clone produced a 56-kDa protein which reacted with convalescent-phase serum from a turkey infected with B. avium 197. In addition, five E. coli recombinant clones were identified which produced B. avium outer membrane proteins with molecular masses of 21, 38, 40, 43, and 48 kDa. At least one of these E. coli clones, which encoded the 21-kDa protein, reacted with both convalescent-phase turkey sera and antibody against B. avium 197 outer membrane proteins. The gene for the 21-kDa outer membrane protein was localized by Tn5seq1 mutagenesis, and the nucleotide sequence was determined by dideoxy sequencing. DNA sequence analysis of the 21-kDa protein revealed an open reading frame of 582 bases that resulted in a predicted protein of 194 amino acids. Comparison of the predicted amino acid sequence of the gene encoding the 21-kDa outer membrane protein with protein sequences in the National Biomedical Research Foundation protein sequence data base indicated significant homology to the OmpA proteins of Shigella dysenteriae, Enterobacter aerogenes, E. coli, and Salmonella typhimurium and to Neisseria gonorrhoeae outer membrane protein III, Haemophilus influenzae protein P6, and Pseudomonas aeruginosa porin protein F. The gene (ompA) encoding the B. avium 21-kDa protein hybridized with 4.1-kb DNA fragments from EcoRI-digested, chromosomal DNA of Bordetella pertussis and Bordetella bronchiseptica and with 6.0- and 3.2-kb DNA fragments from EcoRI-digested, chromosomal DNA of B. avium and B. avium-like DNA, respectively. A 6.75-kb DNA fragment encoding the B. avium 21-kDa protein was subcloned into the

  6. Cloning and sequence analysis of human breast epithelial antigen BA46 reveals an RGD cell adhesion sequence presented on an epidermal growth factor-like domain.


    Couto, J R; Taylor, M R; Godwin, S G; Ceriani, R L; Peterson, J A


    The BA46 antigen of the human milk fat globule (HMFG) membrane is expressed in human breast carcinomas and has been used successfully as a target for experimental breast cancer radioimmunotherapy. To characterize this antigen further, we obtained the entire cDNA sequence and focused on its possible role in cell adhesion. The derived protein sequence of BA46 encodes a 387-residue precursor composed of a putative signal peptide, an amino-terminal epidermal growth factor (EGF)-like domain containing the cell adhesion tripeptide arginine-glycine-aspartic acid (RGD), and human factor V and factor VIII C1/C2-like domains. The EGF-like domain of BA46 is similar to the calcium-binding EGF-like domains of several coagulation factors, but the BA46 domain lacks a residue required for calcium binding and the coagulation factor domains do not include an RGD sequence. Assuming that all EGF-like domains fold into a similar structure, the RGD-containing sequence in BA46 is inserted between two antiparallel beta strands. This positioning suggests a novel function for the EGF-like domain as a scaffold for RGD presentation.

  7. Cloned bacteriophage phi X174 DNA sequence interferes with synthesis of the complementary strand of infecting bacteriophage phi X174.

    PubMed Central

    van der Avoort, H G; van Arkel, G A; Weisbeek, P J


    The insertion of a particular phi X DNA sequence in the plasmid pACYC177 strongly decreased the capacity of Escherichia coli cells containing such a plasmid to propagate bacteriophage phi X174. The smallest DNA sequence tested that showed the effect was the HindII fragment R4. This fragment does not code for a complete protein. It contains the sequence specifying the C-terminal part of the gene H protein and the N-terminal part of the gene A protein, as well as the noncoding region between these genes. Analysis of cells that contain plasmids with the "reduction sequence" showed that (i) the adsorption of the phages to the host cells is normal, (ii) in a single infection cycle much less phage is formed, (iii) only 10% of the infecting viral single-stranded DNA is converted to double-stranded replicative-form DNA, and (iv) less progeny replicative form DNA is synthesized. The reduction process is phi X174 specific, since the growth of the related G4 and St-1 phages was not affected in these cells. The effect of the recombinant plasmids on infecting phage DNA shows similarity to the process of superinfection exclusion. Images PMID:6211550

  8. S-layer protein gene of Lactobacillus brevis: cloning by polymerase chain reaction and determination of the nucleotide sequence.

    PubMed Central

    Vidgrén, G; Palva, I; Pakkanen, R; Lounatmaa, K; Palva, A


    The surface (S)-layer protein of Lactobacillus brevis was isolated, purified, and characterized. The S-layer protein is the major protein of the cell, with an apparent molecular mass of 46 kDa in sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). Immunogold electron microscopy with polyclonal antiserum against the isolated 46-kDa protein was used to confirm the surface location of this protein. N-terminal amino acid sequences of the intact 46-kDa protein and its tryptic peptides were determined. The gene of the S-layer protein was amplified from the genome of L. brevis by polymerase chain reaction with oligonucleotides, synthesized according to the N-terminal amino acid sequences, as primers. The polymerase chain reaction fragments containing the entire S-layer gene and its regulatory regions were sequenced. Nucleic acid sequence analysis revealed one open reading frame with a capacity to encode a protein of 48,159 Da. From the regulatory region of the gene, two subsequent promoters and a ribosome binding site, showing typical features of prokaryotic consensus sequences, were found. The coding region contained a characteristic gram-positive-type signal peptide of 30 amino acids. Removal of the signal peptide results in a polypeptide of 435 amino acids, which is in excellent agreement with the size of the S-layer protein determined by SDS-PAGE. The size and the 5' end analyses of the S-layer transcripts confirmed the monocistronic nature of the S-layer operon and the functionality of the two promoters found. Images PMID:1429463

  9. Molecular Cloning, Sequence Characterization and Expression Analysis of a CD63 Homologue from the Coleopteran Beetle, Tenebrio molitor

    PubMed Central

    Patnaik, Bharat Bhusan; Kang, Seong Min; Seo, Gi Won; Lee, Hyo Jeong; Patnaik, Hongray Howrelia; Jo, Yong Hun; Tindwa, Hamisi; Lee, Yong Seok; Lee, Bok Luel; Kim, Nam Jung; Bang, In Seok; Han, Yeon Soo


    CD63, a member of the tetraspanin membrane protein family, plays a pivotal role in cell growth, motility, signal transduction, host-pathogen interactions and cancer. In this work, the cDNA encoding CD63 homologue (TmCD63) was cloned from larvae of a coleopteran beetle, Tenebrio molitor. The cDNA is comprised of an open reading frame of 705 bp, encoding putative protein of 235 amino acid residues. In silico analysis shows that the protein has four putative transmembrane domains and one large extracellular loop. The characteristic “Cys-Cys-Gly” motif and “Cys188” residues are highly conserved in the large extracellular loop. Phylogenetic analysis of TmCD63 revealed that they belong to the insect cluster with 50%–56% identity. Analysis of spatial expression patterns demonstrated that TmCD63 mRNA is mainly expressed in gut and Malphigian tubules of larvae and the testis of the adult. Developmental expression patterns of CD63 mRNA showed that TmCD63 transcripts are detected in late larval, pupal and adult stages. Interestingly, TmCD63 transcripts are upregulated to the maximum level of 4.5 fold, in response to DAP-type peptidoglycan during the first 6 h, although other immune elicitors also caused significant increase to the transcript level at later time-points. These results suggest that CD63 might contribute to T. molitor immune response against various microbial pathogens. PMID:24132157

  10. Molecular cloning and sequence of the thdF gene involved in the thiophene and furan oxidation by Escherichia coli

    SciTech Connect

    Alam, K.Y.; Clark, D.P.


    Since sulfur dioxide emission from burning high sulfur coals is a major contributor to acid rain, it is important to develop bacteria which are capable of efficiently removing the sulfur from coal before combustion. Inorganic sulfur can be removed from coal by certain strains of Thiobacillus or Sulfolobus; however the organic sulfur remains intransigent. Since high sulfur Illinois coals typically contain 60% to 70% of their sulfur in the form of the heterocyclic thiophene ring we have started to investigate the biodegradation of derivatives of thiophene and the corresponding oxygen heterocycle, furan. Our previous work resulted in the isolation of a triple mutant, NAR30, capable of oxidizing a range of furan and thiophene derivatives. However, NAR30 does not completely degrade thiophenes or furans and its oxidation of these compounds is slow and inefficient. We decided to clone the thd genes both in order to increase the efficiency of degradation and to investigate the nature of the reactions involved. 37 refs., 4 figs., 3 tabs.

  11. Cloning and sequence of the gene encoding a cefotaxime-hydrolyzing class A beta-lactamase isolated from Escherichia coli.

    PubMed Central

    Ishii, Y; Ohno, A; Taguchi, H; Imajo, S; Ishiguro, M; Matsuzawa, H


    Escherichia coli TUH12191, which is resistant to piperacillin, cefazolin, cefotiam, ceftizoxime, cefuzonam, and aztreonam but is susceptible to cefoxitin, latamoxef, flomoxef, and imipenem, was isolated from the urine of a patient treated with beta-lactam antibiotics. The beta-lactamase (Toho-1) purified from the bacteria had a pI of 7.8, had a molecular weight of about 29,000, and hydrolyzed beta-lactam antibiotics such as penicillin G, ampicillin, oxacillin, carbenicillin, piperacillin, cephalothin, cefoxitin, cefotaxime, ceftazidime, and aztreonam. Toho-1 was markedly inhibited by beta-lactamase inhibitors such as clavulanic acid and tazobactam. Resistance to beta-lactams, streptomycin, spectinomycin, sulfamethoxazole, and trimethoprim was transferred by conjugational transfer from E. coli TUH12191 to E. coli ML4903, and the transferred plasmid was about 58 kbp, belonging to incompatibility group M. The cefotaxime resistance gene for Toho-1 was subcloned from the 58-kbp plasmid by transformation of E. coli MV1184. The sequence of the gene for Toho-1 was determined, and the open reading frame of the gene consisted of 873 or 876 bases (initial sequence, ATGATG). The nucleotide sequence of the gene (DDBJ accession number D37830) was found to be about 73% homologous to the sequence of the gene encoding a class A beta-lactamase produced by Klebsiella oxytoca E23004. According to the amino acid sequence deduced from the DNA sequence, the precursor consisted of 290 or 291 amino acid residues, which contained amino acid motifs common to class A beta-lactamases (70SXXK, 130SDN, and 234KTG). Toho-1 was about 83% homologous to the beta-lactamase mediated by the chromosome of K. oxytoca D488 and the beta-lactamase mediated by the plasmid of E. coli MEN-1. Therefore, the newly isolated beta-lactamase Toho-1 produced by E. coli TUH12191 is similar to beta-lactamases produced by K. oxytoca D488, K. oxytoca E23004, and E. coli MEN-1 rather than to mutants of TEM or SHV enzymes

  12. Neutral red-mediated microbial electrosynthesis by Escherichia coli, Klebsiella pneumoniae, and Zymomonas mobilis

    PubMed Central

    Harrington, Timothy D.; Mohamed, Abdelrhman; Tran, Vi N.; Biria, Saeid; Gargouri, Mahmoud; Park, Jeong-Jin; Gang, David R.; Beyenal, Haluk


    The aim of this work was to compare the effects of electrosynthesis on different bacterial species. The effects of neutral red-mediated electrosynthesis on the metabolite profiles of three microorganisms: Escherichia coli, Klebsiella pneumoniae, and Zymomonas mobilis, were measured and compared and contrasted. A statistically comprehensive analysis of neutral red-mediated electrosynthesis is presented using the analysis of end-product profiles, current delivered, and changes in cellular protein expression. K. pneumoniae displayed the most dramatic response to electrosynthesis of the three bacteria, producing 93% more ethanol and 76% more lactate vs. control fermentation with no neutral red and no electron delivery. Z. mobilis showed no response to electrosynthesis except elevated acetate titers. Stoichiometric comparison showed that NAD+ reduction by neutral red could not account for changes in metabolites during electrosynthesis. Neutral red-mediated electrosynthesis was shown to have multifarious effects on the three species. PMID:26096579

  13. Neutral red-mediated microbial electrosynthesis by Escherichia coli, Klebsiella pneumoniae, and Zymomonas mobilis.


    Harrington, Timothy D; Mohamed, Abdelrhman; Tran, Vi N; Biria, Saeid; Gargouri, Mahmoud; Park, Jeong-Jin; Gang, David R; Beyenal, Haluk


    The aim of this work was to compare the effects of electrosynthesis on different bacterial species. The effects of neutral red-mediated electrosynthesis on the metabolite profiles of three microorganisms: Escherichia coli, Klebsiella pneumoniae, and Zymomonas mobilis, were measured and compared and contrasted. A statistically comprehensive analysis of neutral red-mediated electrosynthesis is presented using the analysis of end-product profiles, current delivered, and changes in cellular protein expression. K. pneumoniae displayed the most dramatic response to electrosynthesis of the three bacteria, producing 93% more ethanol and 76% more lactate vs. control fermentation with no neutral red and no electron delivery. Z. mobilis showed no response to electrosynthesis except elevated acetate titers. Stoichiometric comparison showed that NAD(+) reduction by neutral red could not account for changes in metabolites during electrosynthesis. Neutral red-mediated electrosynthesis was shown to have multifarious effects on the three species.

  14. Biosynthesis of D-alanyl-lipoteichoic acid: cloning, nucleotide sequence, and expression of the Lactobacillus casei gene for the D-alanine-activating enzyme.

    PubMed Central

    Heaton, M P; Neuhaus, F C


    The D-alanine-activating enzyme (Dae; EC encoded by the dae gene from Lactobacillus casei ATCC 7469 is a cytosolic protein essential for the formation of the D-alanyl esters of membrane-bound lipoteichoic acid. The gene has been cloned, sequenced, and expressed in Escherichia coli, an organism which does not possess Dae activity. The open reading frame is 1,518 nucleotides and codes for a protein of 55.867 kDa, a value in agreement with the 56 kDa obtained by electrophoresis. A putative promoter and ribosome-binding site immediately precede the dae gene. A second open reading frame contiguous with the dae gene has also been partially sequenced. The organization of these genetic elements suggests that more than one enzyme necessary for the biosynthesis of D-alanyl-lipoteichoic acid may be present in this operon. Analysis of the amino acid sequence deduced from the dae gene identified three regions with significant homology to proteins in the following groups of ATP-utilizing enzymes: (i) the acid-thiol ligases, (ii) the activating enzymes for the biosynthesis of enterobactin, and (iii) the synthetases for tyrocidine, gramicidin S, and penicillin. From these comparisons, a common motif (GXXGXPK) has been identified that is conserved in the 19 protein domains analyzed. This motif may represent the phosphate-binding loop of an ATP-binding site for this class of enzymes. A DNA fragment (1,568 nucleotides) containing the dae gene and its putative ribosome-binding site has been subcloned and expressed in E. coli. Approximately 0.5% of the total cell protein is active Dae, whereas 21% is in the form of inclusion bodies. The isolation of this minimal fragment without a native promoter sequence provides the basis for designing a genetic system for modulating the D-alanine ester content of lipoteichoic acid. PMID:1385594

  15. The 1998 Senegal Epidemic of Meningitis Was Due to the Clonal Expansion of A:4:P1.9, Clone III-1, Sequence Type 5 Neisseria meningitidis Strains

    PubMed Central

    Nicolas, Pierre; Raphenon, Georges; Guibourdenche, Martine; Decousset, Laurent; Stor, Richard; Gaye, Abou Beckr


    Between January and April 1998, a meningitis outbreak due to serogroup A meningococcus took place in Senegal. The outbreak began in Gandiaye, 165 km to the east of Dakar, and progressed towards the towns of Gossas, Niakkhar, Guinguineo, Fatik, Foundiougne, Dioffior, Sokone, Kaolack, and Nioro. At the same time, the outbreak reached regions of Kaffrine, Koungheul, and Tambacounda in the east of Senegal. A total of 1,350 cases and 200 deaths were reported. The WHO Collaborating Center in Marseilles received 24 strains for analysis. All were serogroup A Neisseria meningitidis, type 4 and subtype P1.9. Multilocus enzyme electrophoresis, performed by Institut Pasteur Paris, showed that the strains belonged to clone III-1. DNA restriction fragments generated by endonuclease BglII and analyzed by pulsed-field gel electrophoresis showed 24 indistinguishable fingerprint patterns similar to those of meningococcus strains isolated from African outbreaks since 1988. Three strains were studied by multilocus sequence typing (MLST) with seven loci. The comparison between sequences and existing alleles on the MLST website ( allowed us to assign these strains to sequence type 5 (ST5), as their sequences were identical to the consensus at seven loci. All 24 strains were susceptible to penicillin, amoxicillin, chloramphenicol, and rifampin. Subgroup III is finishing its spread towards west of the meningitis belt of Africa. To our knowledge, this is the first time subgroup III, and more precisely ST5, strains are reported as being responsible for a meningitis outbreak in Senegal. PMID:10618087

  16. cDNA, genomic sequence cloning and overexpression of ribosomal protein gene L9 (rpL9) of the giant panda (Ailuropoda melanoleuca).


    Hou, W R; Hou, Y L; Wu, G F; Song, Y; Su, X L; Sun, B; Li, J


    The ribosomal protein L9 (RPL9), a component of the large subunit of the ribosome, has an unusual structure, comprising two compact globular domains connected by an α-helix; it interacts with 23 S rRNA. To obtain information about rpL9 of Ailuropoda melanoleuca (the giant panda) we designed primers based on the known mammalian nucleotide sequence. RT-PCR and PCR strategies were employed to isolate cDNA and the rpL9 gene from A. melanoleuca; these were sequenced and analyzed. We overexpressed cDNA of the rpL9 gene in Escherichia coli BL21. The cloned cDNA fragment was 627 bp in length, containing an open reading frame of 579 bp. The deduced protein is composed of 192 amino acids, with an estimated molecular mass of 21.86 kDa and an isoelectric point of 10.36. The length of the genomic sequence is 3807 bp, including six exons and five introns. Based on alignment analysis, rpL9 has high similarity among species; we found 85% agreement of DNA and amino acid sequences with the other species that have been analyzed. Based on topology predictions, there are two N-glycosylation sites, five protein kinase C phosphorylation sites, one casein kinase II phosphorylation site, two tyrosine kinase phosphorylation sites, three N-myristoylation sites, one amidation site, and one ribosomal protein L6 signature 2 in the L9 protein of A. melanoleuca. The rpL9 gene can be readily expressed in E. coli; it fuses with the N-terminal GST-tagged protein, giving rise to the accumulation of an expected 26.51-kDa polypeptide, which is in good agreement with the predicted molecular weight. This expression product could be used for purification and further study of its function.

  17. Cloning and expression of a gene encoding a bacterial enzyme for decontamination of organophosphorus nerve agents and nucleotide sequence of the enzyme.

    PubMed Central

    Cheng, T C; Harvey, S P; Chen, G L


    Organophosphorus acid (OPA) anhydrolase enzymes have been found in a wide variety of prokaryotic and eukaryotic organisms. Interest in these enzymes has been prompted by their ability to catalyze the hydrolysis of toxic organophosphorus cholinesterase-inhibiting compounds, including pesticides and chemical nerve agents. The natural substrates for these enzymes are unknown. The gene (opaA) which encodes an OPA anhydrolase (OPAA-2) was isolated from an Alteromonas sp. strain JD6.5 EcoRI-lambda ZAPII chromosomal library expressed in Escherichia coli and identified by immunodetection with anti-OPAA-2 serum. OPA anhydrolase activity expressed by the immunopositive recombinant clones was demonstrated by using diisopropylfluorophosphate (DFP) as a substrate. A comparison of the recombinant enzyme with native, purified OPAA-2 showed they had the same apparent molecular mass (60 kDa), antigenic properties, and enzyme activity against DFP and the chemical nerve agents sarin, soman, and O-cyclohexyl methylphosphonofluoridate. The gene expressing this activity was found in a 1.74-kb PstI-HindIII fragment of the original 6.1-kb EcoRI DNA insert. The nucleotide sequence of this PstI-HindIII fragment revealed an open reading frame of 1,551 nucleotides, coding for a protein of 517 amino acid residues. Amino acid sequence comparison of OPAA-2 with the protein database showed that OPAA-2 is similar to a 647-amino-acid sequence produced by an open reading frame which appears to be the E. coli pepQ gene. Further comparison of OPAA-2, the E. coli PepQ protein sequence, E. coli aminopeptidase P, and human prolidase showed regions of different degrees of similarity or functionally conserved amino acid substitutions. These findings, along with preliminary data confirming the presence of prolidase activity expressed by OPAA-2, suggest that the OPAA-2 enzyme may, in nature, be used in peptide metabolism. PMID:8633861

  18. Molecular cloning, sequencing, and distribution of feline GnRH receptor (GnRHR) and resequencing of canine GnRHR.


    Samoylov, Alexandre M; Napier, India D; Morrison, Nancy E; Martin, Douglas R; Cox, Nancy R; Samoylova, Tatiana I


    GnRH receptors play vital roles in mammalian reproduction via regulation of gonadotropin secretion, which is essential for gametogenesis and production of gonadal steroids. GnRH receptors for more than 20 mammalian species have been sequenced, including human, mouse, and dog. This study reports the molecular cloning and sequencing of GnRH receptor (GnRHR) cDNA from the pituitary gland of the domestic cat, an important species in biomedical research. Feline GnRHR cDNA is composed of 981 nucleotides and encodes a 327 amino acid protein. Unlike the majority of mammalian species sequenced so far, but similar to canine GnRHR, feline GnRHR protein lacks asparagine in position three of the extracellular domain of the protein. At the amino acid level, feline GnRHR exhibits 95.1% identity with canine, 93.8% with human, and 88.9% with mouse GnRHR. Comparative sequence analysis of GnRHRs for multiple mammalian species led to resequencing of canine GnRHR, which differed from that previously published by a single base change that translates to a different amino acid in position 193. This single base change was confirmed in dogs of multiple breeds. Reverse transcriptase PCR analysis of GnRHR messenger RNA in different tissues from four normal cats indicated the presence of amplicons of varying lengths, including full-length as well as shortened GnRHR amplicons, pointing to the existence of truncated GnRHR transcripts in the domestic cat. This study is the first insight into molecular composition and expression of feline GnRHR and promotes better understanding of receptor organization, and distribution in various tissues of this species.

  19. [Cloning and function identification of gene 'admA' and up-stream regulatory sequence related to antagonistic activity of Enterobacter cloacae B8].


    Zhu, Jun-Li; Li, De-Bao; Yu, Xu-Ping


    To reveal the antagonistic mechanism of B8 strain to Xanthomonas oryzae pv. oryzae, transposon tagging method and chromosome walking were deployed to clone antagonistic related fragments around Tn5 insertion site in the mutant strain B8B. The function of up-stream regulatory sequence of gene 'admA' involved in the antagonistic activity was further identified by gene knocking out technique. An antagonistic related left fragment of Tn5 insertion site, 2 608 bp in length, was obtained by tagging with Kan resistance gene of Tn5. A 2 354 bp right fragment of Tn5 insertion site was amplified with 2 rounds of chromosome walking. The length of the B contig around the Tn5 insertion site was 4 611 bp, containing 7 open reading frames (ORFs). Bioinformatic analysis revealed that these ORFs corresponded to the partial coding regions of glyceraldehyde-3-phosphate dehydrogenase, two LysR family transcriptional regulators, hypothetical protein VSWAT3-20465 of Vibrionales and admA, admB, and partial sequence of admC gene of Pantoea agglomerans biosynthetic gene cluster, respectively. Tn5 was inserted in the up-stream of 200 bp or 894 bp of the sequence corresponding to anrP ORF or admA gene on B8B, respectively. The B-1 and B-2 mutants that lost antagonistic activity were selected by homeologuous recombination technology in association with knocking out plasmid pMB-BG. These results suggested that the transcription and expression of anrP gene might be disrupted as a result of the knocking out of up-stream regulatory sequence by Tn5 in B8B strain, further causing biosythesis regulation of the antagonistic related gene cluster. Thus, the antagonistic related genes in B8 strain is a gene family similar as andrimid biosynthetic gene cluster, and the upstream regulatory region appears to be critical for the antibiotics biosynthesis.

  20. Cloning and sequence analysis of the neuropeptide Y receptors Y5 and Y6 in the coelacanth Latimeria chalumnae.


    Larsson, Tomas A; Larson, Earl T; Larhammar, Dan


    Two coelacanth species, Latimeria chalumnae and Latimeria menadoensis, the recently discovered second species, have a key evolutionary position at the divergence of bony fishes and tetrapods. Together with lungfishes, they are the only living species separating the species-rich tetrapods from the other major group of vertebrates, the ray-finned fishes. The coelacanth is therefore of great importance for comparisons of gene families that differ between these two groups, such as the neuropeptide Y (NPY) receptor family. In this work we have sequenced the full-length genes for two NPY receptors in Latimeria chalumnae. Phylogenetic analysis indicated that the two sequences are orthologs of the mammalian Y5 and Y6 receptors. The Y5 gene has been implicated in appetite stimulation in mammals but is absent from teleost fishes. The presence of the Y5 receptor in Latimeria together with phylogenetic analysis shows that Y5 existed before the separation of bony fishes and tetrapods. The Latimeria receptor has about 62% identity to tetrapod Y5 sequences and contains the extended third intracellular loop with several highly conserved motifs that may be involved in signal transduction. The Latimeria Y6 receptor has about 60% identity to tetrapod Y6 sequences. The functional role of Y6 is unclear as the gene is seemingly functional in some mammals but is non-functional in others. The Y6 receptor is also missing in teleost fishes. Our results confirm an early vertebrate origin for all NPY receptor subtypes presently found in mammals followed by differential gene loss in the different classes of vertebrates.

  1. Interspecies diversity of the occludin sequence: cDNA cloning of human, mouse, dog, and rat-kangaroo homologues.


    Ando-Akatsuka, Y; Saitou, M; Hirase, T; Kishi, M; Sakakibara, A; Itoh, M; Yonemura, S; Furuse, M; Tsukita, S


    Occludin has been identified from chick liver as a novel integral membrane protein localizing at tight junctions (Furuse, M., T. Hirase, M. Itoh, A. Nagafuchi, S. Yonemura, Sa. Tsukita, and Sh. Tsukita. 1993. J. Cell Biol. 123:1777-1788). To analyze and modulate the functions of tight junctions, it would be advantageous to know the mammalian homologues of occludin and their genes. Here we describe the nucleotide sequences of full length cDNAs encoding occludin of rat-kangaroo (potoroo), human, mouse, and dog. Rat-kangaroo occludin cDNA was prepared from RNA isolated from PtK2 cell culture, using a mAb against chicken occludin, whereas the others were amplified by polymerase chain reaction based on the sequence found around the human neuronal apoptosis inhibitory protein gene. The amino acid sequences of the three mammalian (human, murine, and canine) occludins were very closely related to each other (approximately 90% identity), whereas they diverged considerably from those of chicken and rat-kangaroo (approximately 50% identity). Implications of these data and novel experimental options in cell biological research are discussed.

  2. Metabolic engineering of Zymomonas mobilis for 2,3-butanediol production from lignocellulosic biomass sugars


    Yang, Shihui; Mohagheghi, Ali; Franden, Mary Ann; ...


    To develop pathways for advanced biofuel production, and to understand the impact of host metabolism and environmental conditions on heterologous pathway engineering for economic advanced biofuels production from biomass, we seek to redirect the carbon flow of the model ethanologen Zymomonas mobilis to produce desirable hydrocarbon intermediate 2,3-butanediol (2,3-BDO). 2,3-BDO is a bulk chemical building block, and can be upgraded in high yields to gasoline, diesel, and jet fuel. 2,3-BDO biosynthesis pathways from various bacterial species were examined, which include three genes encoding acetolactate synthase, acetolactate decarboxylase, and butanediol dehydrogenase. Bioinformatics analysis was carried out to pinpoint potential bottlenecks formore » high 2,3-BDO production. Different combinations of 2,3-BDO biosynthesis metabolic pathways using genes from different bacterial species have been constructed. Our results demonstrated that carbon flux can be deviated from ethanol production into 2,3-BDO biosynthesis, and all three heterologous genes are essential to efficiently redirect pyruvate from ethanol production for high 2,3-BDO production in Z. mobilis. The down-selection of best gene combinations up to now enabled Z. mobilis to reach the 2,3-BDO production of more than 10 g/L from glucose and xylose, as well as mixed C6/C5 sugar streams derived from the deacetylation and mechanical refining process. In conclusion, this study confirms the value of integrating bioinformatics analysis and systems biology data during metabolic engineering endeavors, provides guidance for value-added chemical production in Z. mobilis, and reveals the interactions between host metabolism, oxygen levels, and a heterologous 2,3-BDO biosynthesis pathway. Taken together, this work provides guidance for future metabolic engineering efforts aimed at boosting 2,3-BDO titer anaerobically.« less

  3. Adaptive laboratory evolution of ethanologenic Zymomonas mobilis strain tolerant to furfural and acetic acid inhibitors.


    Shui, Zong-Xia; Qin, Han; Wu, Bo; Ruan, Zhi-yong; Wang, Lu-shang; Tan, Fu-Rong; Wang, Jing-Li; Tang, Xiao-Yu; Dai, Li-Chun; Hu, Guo-Quan; He, Ming-Xiong


    Furfural and acetic acid from lignocellulosic hydrolysates are the prevalent inhibitors to Zymomonas mobilis during cellulosic ethanol production. Developing a strain tolerant to furfural or acetic acid inhibitors is difficul by using rational engineering strategies due to poor understanding of their underlying molecular mechanisms. In this study, strategy of adaptive laboratory evolution (ALE) was used for development of a furfural and acetic acid-tolerant strain. After three round evolution, four evolved mutants (ZMA7-2, ZMA7-3, ZMF3-2, and ZMF3-3) that showed higher growth capacity were successfully obtained via ALE method. Based on the results of profiling of cell growth, glucose utilization, ethanol yield, and activity of key enzymes, two desired strains, ZMA7-2 and ZMF3-3, were achieved, which showed higher tolerance under 7 g/l acetic acid and 3 g/l furfural stress condition. Especially, it is the first report of Z. mobilis strain that could tolerate higher furfural. The best strain, Z. mobilis ZMF3-3, has showed 94.84% theoretical ethanol yield under 3-g/l furfural stress condition, and the theoretical ethanol yield of ZM4 is only 9.89%. Our study also demonstrated that ALE method might also be used as a powerful metabolic engineering tool for metabolic engineering in Z. mobilis. Furthermore, the two best strains could be used as novel host for further metabolic engineering in cellulosic ethanol or future biorefinery. Importantly, the two strains may also be used as novel-tolerant model organisms for the genetic mechanism on the "omics" level, which will provide some useful information for inverse metabolic engineering.

  4. Genetic engineering and improvement of a Zymomonas mobilis for arabinose utilization and its performance on pretreated corn stover hydrolyzate


    Chou, Yat -Chen; Linger, Jeffrey; Yang, Shihui; ...


    In this paper, a glucose, xylose and arabinose utilizing Zymomonas mobilis strain was constructed by incorporating arabinose catabolic pathway genes, araBAD encoding L-ribulokinase, L-arabinose isomerase and L-ribulose-5-phosphate- 4-epimerase in a glucose, xylose co-fermenting host, 8b, using a transposition integration approach. Further improvement on this arabinose-capable integrant, 33C was achieved by applying a second transposition to create a genomic knockout (KO) mutant library. Using arabinose as a sole carbon source and a selection pressure, the KO library was subjected to a growth-enrichment process involving continuous sub-culturing for over 120 generations. Strain 13-1-17, isolated from such process demonstrated significant improvement in metabolizingmore » arabinose in a dilute acid pretreated, saccharified corn stover slurry. Through Next Generation Sequencing (NGS) analysis, integration sites of the transposons were identified. Furthermore, multiple additional point mutations (SNPs: Single Nucleotide Polymorphisms) were discovered in 13-1-17, affecting genes araB and RpiB in the genome. Finally, we speculate that these mutations may have impacted the expression of the enzymes coded by these genes, ribulokinase and Ribose 5-P-isomerase, thus attributing to the improvement of the arabinose utilization.« less

  5. Fermentation of Soybean Meal Hydrolyzates with Saccharomyces cerevisiae and Zymomonas mobilis for Ethanol Production.


    Luján-Rhenals, Deivis E; Morawicki, Rubén O; Gbur, Edward E; Ricke, Steven C


    Most of the ethanol currently produced by fermentation is derived from sugar cane, corn, or beets. However, it makes good ecological and economic sense to use the carbohydrates contained in by-products and coproducts of the food processing industry for ethanol production. Soybean meal, a co-product of the production of soybean oil, has a relatively high carbohydrate content that could be a reasonable substrate for ethanol production after fermentable sugars are released via hydrolysis. In this research, the capability of Saccharomyces cerevisiae NRRL Y-2233 and Zymomonas mobilis subsp. mobilis NRRL B-4286 to produce ethanol was evaluated using soybean meal hydrolyzates as substrates for the fermentation. These substrates were produced from the dilute-acid hydrolysis of soybean meal at 135 °C for 45 min with 0, 0.5%, 1.25%, and 2% H2 SO4 and at 120 °C for 30 min with 1.25% H2 SO4 . Kinetic parameters of the fermentation were estimated using the logistic model. Ethanol production using S. cerevisiae was highest with the substrates obtained at 135 °C, 45 min, and 0.5% H2 SO4 and fermented for 8 h, 8 g/L (4 g ethanol/100 g fresh SBM), while Z. mobilis reached its maximum ethanol production, 9.2 g/L (4.6 g ethanol/100 g fresh SBM) in the first 20 h of fermentation with the same hydrolyzate.

  6. Levan production by Zymomonas mobilis in batch and continuous fermentation systems.


    Silbir, Selim; Dagbagli, Seval; Yegin, Sirma; Baysal, Taner; Goksungur, Yekta


    Levan production in batch and continuous fermentation systems by Zymomonas mobilis B-14023 was investigated. The culture medium used in both of the fermentation systems contained sucrose and various organic nitrogen sources. Maximum concentration of levan was produced with yeast extract among the nitrogen sources tested. Response surface methodology was used to investigate the effects of three factors on the concentration of levan in batch cultures of Z. mobilis. Maximum levan concentration was 40.2 g/L and this concentration was reached at the optimum levels of process variables, which were 299.1 g/L initial substrate concentration, 42.3 h incubation time, and initial pH 6.0. Continuous fermentation experiments were done in packed bed bioreactor using Ca-alginate immobilized Z. mobilis cells. The highest levan concentration (31.8 ± 0.21 g/L) was obtained at a dilution rate of 0.14 h(-1) while maximum volumetric productivity (6.556 g/(Lh)) was obtained at a dilution rate of 0.22 h(-1). Increasing the dilution rate resulted in decreased levan and increased residual sugar concentrations.

  7. Development of an arabinose-fermenting Zymomonas mobilis strain by metabolic pathway engineering.

    PubMed Central

    Deanda, K; Zhang, M; Eddy, C; Picataggio, S


    The substrate fermentation range of the ethanologenic bacterium Zymomonas mobilis was expanded to include the pentose sugar, L-arabinose, which is commonly found in agricultural residues and other lignocellulosic biomass. Five genes, encoding L-arabinose isomerase (araA), L-ribulokinase (araB), L-ribulose-5-phosphate-4-epimerase (araD), transaldolase (talB), and transketolase (tktA), were isolated from Escherichia coli and introduced into Z. mobilis under the control of constitutive promoters that permitted their expression even in the presence of glucose. The engineered strain grew on and produced ethanol from L-arabinose as a sole C source at 98% of the maximum theoretical ethanol yield, based on the amount of consumed sugar. This indicates that arabinose was metabolized almost exclusively to ethanol as the sole fermentation product, with little by-product formation. Although no diauxic growth pattern was evident, the microorganism preferentially utilized glucose before arabinose, apparently reflecting the specificity of the indigenous facilitated diffusion transport system. This microorganism may be useful, along with the previously developed xylose-fermenting Z. mobilis (M. Zhang, C. Eddy, K. Deanda, M. Finkelstein, and S. Picataggio, Science 267:240-243, 1995), in a mixed culture for efficient fermentation of the predominant hexose and pentose sugars in agricultural residues and other lignocellulosic feedstocks to ethanol. PMID:8953718

  8. Components of glycine reductase from Eubacterium acidaminophilum. Cloning, sequencing and identification of the genes for thioredoxin reductase, thioredoxin and selenoprotein PA.


    Lübbers, M; Andreesen, J R


    The genes encoding thioredoxin reductase (trxB), thioredoxin (trxA), protein PA of glycine reductase (grdA) and the first 23 amino acids of the large subunit of protein PC of glycine reductase (grdC) belonging to the reductive deamination systems present in Eubacterium acidaminophilum were cloned and sequenced. The proteins were products of closely linked genes with 314 codons (thioredoxin reductase), 110 codons (thioredoxin), and 158 codons (protein PA). The protein previously called 'atypically small lipoamide dehydrogenase' or 'electron transferring flavoprotein' could now conclusively be identified as a thioredoxin reductase (subunit mass of 34781 Da) by the alignment with the enzyme of Escherichia coli showing the same typical order of the corresponding domains. The thioredoxin (molecular mass of 11742 Da) deviated considerably from the known consensus sequence, even in the most strongly conserved redox-active segment WCGPC that was now GCVPC. The selenocysteine of protein PA (molecular mass of 16609 Da) was encoded by TGA. The protein was highly similar to those of Clostridium purinolyticum and Clostridium sticklandii involved in glycine reductase. Thioredoxin reductase and thioredoxin of E. acidaminophilum could be successfully expressed in E. coli.

  9. Purification of the integration host factor homolog of Rhodobacter capsulatus: cloning and sequencing of the hip gene, which encodes the beta subunit.

    PubMed Central

    Toussaint, B; Delic-Attree, I; De Sury D'Aspremont, R; David, L; Vinçon, M; Vignais, P M


    We describe a method for rapid purification of the integration host factor (IHF) homolog of Rhodobacter capsulatus that has allowed us to obtain microgram quantities of highly purified protein. R. capsulatus IHF is an alpha beta heterodimer similar to IHF of Escherichia coli. We have cloned and sequenced the hip gene, which encodes the beta subunit. The deduced amino acid sequence (10.7 kDa) has 46% identity with the beta subunit of IHF from E. coli. In gel electrophoretic mobility shift DNA binding assays, R. capsulatus IHF was able to form a stable complex in a site-specific manner with a DNA fragment isolated from the promoter of the structural hupSL operon, which contains the IHF-binding site. The mutated IHF protein isolated from the Hup- mutant IR4, which is mutated in the himA gene (coding for the alpha subunit), gave a shifted band of greater mobility, and DNase I footprinting analysis has shown that the mutated IHF interacts with the DNA fragment from the hupSL promoter region differently from the way that the wild-type IHF does. Images PMID:8407826

  10. Interferon-induced 56,000 Mr protein and its mRNA in human cells: molecular cloning and partial sequence of the cDNA.

    PubMed Central

    Chebath, J; Merlin, G; Metz, R; Benech, P; Revel, M


    Treatment of responsive cells by interferons (IFNs) induces within a few hours a rise in the concentration of several proteins and mRNAs. In order to characterize these IFN-induced mRNA species, we have cloned in E. coli the cDNA made from a 17-18S poly(A)+ RNA of human fibroblastoid cells (SV80) treated with IFN-beta. We describe here a pBR322 recombinant plasmid (C56) which contains a 400 bp cDNA insert corresponding to a 18S mRNA species newly induced by IFN. The C56 mRNA codes for a 56,000 dalton protein easily detectable by hybridization-translation experiments. The sequence of 66 of the carboxy-terminal amino-acids of the protein can be deduced from the cDNA sequence. IFNs-alpha, beta or gamma are able to activate the expression of this gene in human fibroblasts as well as lymphoblastoid cells. The mRNA is not detectable without IFN; it reaches maximum levels (0.1% of the total poly(A)+ RNA) within 4-8 hrs and decreases after 16 hrs. Images PMID:6186990

  11. Molecular cloning, sequence identification and tissue expression profile of three novel sheep (Ovis aries) genes - BCKDHA, NAGA and HEXA.


    Liu, G Y; Gao, S Z


    The complete coding sequences of three sheep genes- BCKDHA, NAGA and HEXA were amplified using the reverse transcriptase polymerase chain reaction (RT-PCR), based on the conserved sequence information of the mouse or other mammals. The nucleotide sequences of these three genes revealed that the sheep BCKDHA gene encodes a protein of 313 amino acids which has high homology with the BCKDHA gene that encodes a protein of 447 amino acids that has high homology with the Branched chain keto acid dehydrogenase El, alpha polypeptide (BCKDHA) of five species chimpanzee (93%), human (96%), crab-eating macaque (93%), bovine (98%) and mouse (91%). The sheep NAGA gene encodes a protein of 411 amino acids that has high homology with the alpha-N-acetylgalactosaminidase (NAGA) of five species human (85%), bovine (94%), mouse (91%), rat (83%) and chicken (74%). The sheep HEXA gene encodes a protein of 529 amino acids that has high homology with the hexosaminidase A(HEXA) of five species bovine (98%), human (84%), Bornean orangután (84%), rat (80%) and mouse (81%). Finally these three novel sheep genes were assigned to GenelDs: 100145857, 100145858 and 100145856. The phylogenetic tree analysis revealed that the sheep BCKDHA, NAGA, and HEXA all have closer genetic relationships to the BCKDHA, NAGA, and HEXA of bovine. Tissue expression profile analysis was also carried out and results revealed that sheep BCKDHA, NAGA and HEXA genes were differentially expressed in tissues including muscle, heart, liver, fat, kidney, lung, small and large intestine. Our experiment is the first to establish the primary foundation for further research on these three sheep genes.

  12. Cloning of insertion site flanking sequence and construction of transfer DNA insert mutant library in Stylosanthes colletotrichum.


    Chen, Helong; Hu, Caiping; Yi, Kexian; Huang, Guixiu; Gao, Jianming; Zhang, Shiqing; Zheng, Jinlong; Liu, Qiaolian; Xi, Jingen


    Stylosanthes sp. is the most important forage legume in tropical areas worldwide. Stylosanthes anthracnose, which is mainly caused by Colletotrichum gloeosporioides, is a globally severe disease in stylo production. Little progress has been made in anthracnose molecular pathogenesis research. In this study, Agrobacterium tumefaciens-mediated transformation was used to transform Stylosanthes colletotrichum strain CH008. The major factors of the genetic transformation system of S. colletotrichum were optimized as follows: A. tumefaciens' AGL-1 concentration (OD(600)), 0.8; concentration of Colletotrichum conidium, 1 × 10(6) conidia/mL; acetosyringone concentration, 100 mmol/L; induction time, 6 h; co-culture temperature, 25 °C; and co-culture time, 3 d. Thus, the transformation efficiency was increased to 300-400 transformants per 106 conidia. Based on the optimized system, a mutant library containing 4616 mutants was constructed, from which some mutants were randomly selected for analysis. Results show that the mutants were single copies that could be stably inherited. The growth rate, spore amount, spore germination rate, and appressorium formation rate in some mutants were significantly different from those in the wild-type strain. We then selected the most appropriate method for the preliminary screening and re-screening of each mutant's pathogenic defects. We selected 1230 transformants, and obtained 23 strains with pathogenic defects, namely, 18 strains with reduced pathogenicity and five strains with lost pathogenicity. Thermal asymmetric interlaced PCR was used to identify the transfer DNA (T-DNA) integration site in the mutant that was coded 2430, and a sequence of 476 bp was obtained. The flanking sequence of T-DNA was compared with the Colletotrichum genome by BLAST, and a sequence of 401 bp was found in Contig464 of the Colletotrichum genome. By predicting the function of the flanking sequence, we discovered that T-DNA insertion in the promoter region

  13. New Approaches to Attenuated Hepatitis a Vaccine Development: Cloning and Sequencing of Cell-Culture Adapted Viral cDNA

    DTIC Science & Technology


    samples were placed into reaction tubes coated with monoclonal antibodies to HAV, poliovirus type I (PVl), or respiratory syncytial virus (RSV) for assay...variant (K24F2") was favored over replication of virus with normal antigenic phenotype (K24F2+) during persistent infection in BS-C-l cells, while K24F2... infection (p16 HM175 virus ). The sequence of the P1 genomic regions of plaque-purified variants of each virus type was determined from virion RNA. Compared

  14. Cloning of Insertion Site Flanking Sequence and Construction of Transfer DNA Insert Mutant Library in Stylosanthes Colletotrichum

    PubMed Central

    Huang, Guixiu; Gao, Jianming; Zhang, Shiqing; Zheng, Jinlong; Liu, Qiaolian; Xi, Jingen


    Stylosanthes sp. is the most important forage legume in tropical areas worldwide. Stylosanthes anthracnose, which is mainly caused by Colletotrichum gloeosporioides, is a globally severe disease in stylo production. Little progress has been made in anthracnose molecular pathogenesis research. In this study, Agrobacterium tumefaciens-mediated transformation was used to transform Stylosanthes colletotrichum strain CH008. The major factors of the genetic transformation system of S. colletotrichum were optimized as follows: A. tumefaciens’ AGL-1 concentration (OD600), 0.8; concentration of Colletotrichum conidium, 1×106 conidia/mL; acetosyringone concentration, 100 mmol/L; induction time, 6 h; co-culture temperature, 25°C; and co-culture time, 3 d. Thus, the transformation efficiency was increased to 300–400 transformants per 106 conidia. Based on the optimized system, a mutant library containing 4616 mutants was constructed, from which some mutants were randomly selected for analysis. Results show that the mutants were single copies that could be stably inherited. The growth rate, spore amount, spore germination rate, and appressorium formation rate in some mutants were significantly different from those in the wild-type strain. We then selected the most appropriate method for the preliminary screening and re-screening of each mutant’s pathogenic defects. We selected 1230 transformants, and obtained 23 strains with pathogenic defects, namely, 18 strains with reduced pathogenicity and five strains with lost pathogenicity. Thermal asymmetric interlaced PCR was used to identify the transfer DNA (T-DNA) integration site in the mutant that was coded 2430, and a sequence of 476 bp was obtained. The flanking sequence of T-DNA was compared with the Colletotrichum genome by BLAST, and a sequence of 401 bp was found in Contig464 of the Colletotrichum genome. By predicting the function of the flanking sequence, we discovered that T-DNA insertion in the promoter region of

  15. Molecular cloning and sequence analysis of the Sta58 major antigen gene of Rickettsia tsutsugamushi: sequence homology and antigenic comparison of Sta58 to the 60-kilodalton family of stress proteins.

    PubMed Central

    Stover, C K; Marana, D P; Dasch, G A; Oaks, E V


    The scrub typhus 58-kilodalton (kDa) antigen (Sta58) of Rickettsia tsutsugamushi is a major protein antigen often recognized by humans infected with scrub typhus rickettsiae. A 2.9-kilobase HindIII fragment containing a complete sta58 gene was cloned in Escherichia coli and found to express the entire Sta58 antigen and a smaller protein with an apparent molecular mass of 11 kDa (Stp11). DNA sequence analysis of the 2.9-kilobase HindIII fragment revealed two adjacent open reading frames encoding proteins of 11 (Stp11) and 60 (Sta58) kDa. Comparisons of deduced amino acid sequences disclosed a high degree of homology between the R. tsutsugamushi proteins Stp11 and Sta58 and the E. coli proteins GroES and GroEL, respectively, and the family of primordial heat shock proteins designated Hsp10 Hsp60. Although the sequence homology between the Sta58 antigen and the Hsp60 protein family is striking, the Sta58 protein appeared to be antigenically distinct among a sample of other bacterial Hsp60 homologs, including the typhus group of rickettsiae. The antigenic uniqueness of the Sta58 antigen indicates that this protein may be a potentially protective antigen and a useful diagnostic reagent for scrub typhus fever. Images PMID:2108930

  16. Cloning, sequence determination, and regulation of the ribonucleotide reductase subunits from Plasmodium falciparum: a target for antimalarial therapy.

    PubMed Central

    Rubin, H; Salem, J S; Li, L S; Yang, F D; Mama, S; Wang, Z M; Fisher, A; Hamann, C S; Cooperman, B S


    Malaria remains a leading cause of morbidity and mortality worldwide, accounting for more than one million deaths annually. We have focused on the reduction of ribonucleotides to 2'-deoxyribonucleotides, catalyzed by ribonucleotide reductase, which represents the rate-determining step in DNA replication as a target for antimalarial agents. We report the full-length DNA sequence corresponding to the large (PfR1) and small (PfR2) subunits of Plasmodium falciparum ribonucleotide reductase. The small subunit (PfR2) contains the major catalytic motif consisting of a tyrosyl radical and a dinuclear Fe site. Whereas PfR2 shares 59% amino acid identity with human R2, a striking sequence divergence between human R2 and PfR2 at the C terminus may provide a selective target for inhibition of the malarial enzyme. A synthetic oligopeptide corresponding to the C-terminal 7 residues of PfR2 inhibits mammalian ribonucleotide reductase at concentrations approximately 10-fold higher than that predicted to inhibit malarial R2. The gene encoding the large subunit (PfR1) contains a single intron. The cysteines thought to be involved in the reduction mechanism are conserved. In contrast to mammalian ribonucleotide reductase, the genes for PfR1 and PfR2 are located on the same chromosome and the accumulation of mRNAs for the two subunits follow different temporal patterns during the cell cycle. Images Fig. 2 Fig. 4 Fig. 5 PMID:8415692

  17. Characterization and cloning of a Tenebrio molitor hemolymph protein with sequence similarity to insect odorant-binding proteins.


    Graham, L A; Tang, W; Baust, J G; Liou, Y C; Reid, T S; Davies, P L


    The yellow mealworm beetle, Tenebrio molitor, produces a number of moderately abundant low molecular weight hemolymph proteins ( approximately 12 kDa) which behave in a similar manner during purification and share antigenic epitopes. The cDNA sequence of the major component (THP12) was determined and the deduced protein sequence was found to be similar to those of insect odorant-binding proteins. Southern blot analysis suggests that at least some of the diversity in this family of proteins is encoded at the gene level. Both northern and western blot analysis indicate that THP12 is present in a variety of developmental stages and both sexes. THP12 was originally classified as an antifreeze protein, but the lack of antifreeze activity in the recombinant protein, as well as the clear separation of the antifreeze activity from THP12 following HPLC purification, has ruled out this function. The abundance of THP12, the similarity of THP12 to insect odorant-binding proteins, and the presence of hydrophobic cavities inside the protein (Rothemund et al., A new class of hexahelical insect proteins revealed as putative carriers of small hydrophobic ligands. Structure, 7 (1999) 1325-1332.) suggest that THP12 may function to carry non-water soluble compounds in the hemolymph. THP12 is also similar, particularly in structurally important regions, to other insect proteins from non-sensory tissues, suggesting the existence of a large family of carrier proteins which may perform diverse functions throughout the insect.

  18. Molecular Cloning and Sequence Analysis of Novel Cytochrome P450 cDNA Fragments from Dastarcus helophoroides

    PubMed Central

    Wang, Hai-Dong; Li, Fei-Fei; He, Cai; Cui, Jun; Song, Wang; Li, Meng-Lou


    The predatory beetle Dastarcus helophoroides (Fairmaire) (Coleoptera: Bothrideridae) is a natural enemy of many longhorned beetles and is mainly distributed in both China and Japan. To date, no research on D. helophoroides P450 enzymes has been reported. In our study, for the better understanding of P450 enzymes in D. helophoroides, 100 novel cDNA fragments encoding cytochrome P450 were amplified from the total RNA of adult D. helophoroides abdomens using five pairs of degenerate primers designed according to the conserved amino acid sequences of the CYP6 family genes in insects through RT-PCR. The obtained nucleotide sequences were 250 bp, 270 bp, and 420 bp in length depending on different primers. Ninety-six fragments were determined to represent CYP6 genes, mainly from CYP6BK, CYP6BQ, and CYP6BR subfamilies, and four fragments were determined to represent CYP9 genes. Twenty-two fragments, submitted to GenBank, were selected for further homologous analysis, which revealed that some fragments of different sizes might be parts of the same P450 gene. PMID:25373175

  19. Molecular cloning and sequence analysis of novel cytochrome P450 cDNA fragments from Dastarcus helophoroides.


    Wang, Hai-Dong; Li, Fei-Fei; He, Cai; Cui, Jun; Song, Wang; Li, Meng-Lou


    The predatory beetle Dastarcus helophoroides (Fairmaire) (Coleoptera: Bothrideridae) is a natural enemy of many longhorned beetles and is mainly distributed in both China and Japan. To date, no research on D. helophoroides P450 enzymes has been reported. In our study, for the better understanding of P450 enzymes in D. helophoroides, 100 novel cDNA fragments encoding cytochrome P450 were amplified from the total RNA of adult D. helophoroides abdomens using five pairs of degenerate primers designed according to the conserved amino acid sequences of the CYP6 family genes in insects through RT-PCR. The obtained nucleotide sequences were 250 bp, 270 bp, and 420 bp in length depending on different primers. Ninety-six fragments were determined to represent CYP6 genes, mainly from CYP6BK, CYP6BQ, and CYP6BR subfamilies, and four fragments were determined to represent CYP9 genes. Twenty-two fragments, submitted to GenBank, were selected for further homologous analysis, which revealed that some fragments of different sizes might be parts of the same P450 gene.

  20. Genome sequence of a serotype M3 strain of group A Streptococcus: phage-encoded toxins, the high-virulence phenotype, and clone emergence.


    Beres, Stephen B; Sylva, Gail L; Barbian, Kent D; Lei, Benfang; Hoff, Jessica S; Mammarella, Nicole D; Liu, Meng-Yao; Smoot, James C; Porcella, Stephen F; Parkins, Larye D; Campbell, David S; Smith, Todd M; McCormick, John K; Leung, Donald Y M; Schlievert, Patrick M; Musser, James M


    Genome sequences are available for many bacterial strains, but there has been little progress in using these data to understand the molecular basis of pathogen emergence and differences in strain virulence. Serotype M3 strains of group A Streptococcus (GAS) are a common cause of severe invasive infections with unusually high rates of morbidity and mortality. To gain insight into the molecular basis of this high-virulence phenotype, we sequenced the genome of strain MGAS315, an organism isolated from a patient with streptococcal toxic shock syndrome. The genome is composed of 1,900,521 bp, and it shares approximately 1.7 Mb of related genetic material with genomes of serotype M1 and M18 strains. Phage-like elements account for the great majority of variation in gene content relative to the sequenced M1 and M18 strains. Recombination produces chimeric phages and strains with previously uncharacterized arrays of virulence factor genes. Strain MGAS315 has phage genes that encode proteins likely to contribute to pathogenesis, such as streptococcal pyrogenic exotoxin A (SpeA) and SpeK, streptococcal superantigen (SSA), and a previously uncharacterized phospholipase A(2) (designated Sla). Infected humans had anti-SpeK, -SSA, and -Sla antibodies, indicating that these GAS proteins are made in vivo. SpeK and SSA were pyrogenic and toxic for rabbits. Serotype M3 strains with the phage-encoded speK and sla genes increased dramatically in frequency late in the 20th century, commensurate with the rise in invasive disease caused by M3 organisms. Taken together, the results show that phage-mediated recombination has played a critical role in the emergence of a new, unusually virulent clone of serotype M3 GAS.

  1. Cloning, Nucleotide Sequencing, and Analysis of the Gene Encoding an AmpC β-Lactamase in Acinetobacter baumannii

    PubMed Central

    Bou, Germán; Martínez-Beltrán, Jesús


    A clinical strain of Acinetobacter baumannii (strain Ab RYC 52763/97) that was isolated during an outbreak in our hospital and that was resistant to all β-lactam antibiotics tested produced three β-lactamases: a TEM-1-type (pI, 5.4) plasmid-mediated β-lactamase, a chromosomally mediated OXA-derived (pI, 9.0) β-lactamase, and a presumptive chromosomal cephalosporinase (pI, 9.4). The nucleotide sequence of the chromosomal cephalosporinase gene shows for the first time the gene encoding an AmpC β-lactamase in A. baumannii. In addition, we report here the biochemical properties of this A. baumannii AmpC β-lactamase. PMID:10639377

  2. cDNA cloning and sequence of MAL, a hydrophobic protein associated with human T-cell differentiation.

    PubMed Central

    Alonso, M A; Weissman, S M


    We have isolated a human cDNA that is expressed in the intermediate and late stages of T-cell differentiation. The cDNA encodes a highly hydrophobic protein, termed MAL, that lacks a hydrophobic leader peptide sequence and contains four potential transmembrane domains separated by short hydrophilic segments. The predicted configuration of the MAL protein resembles the structure of integral proteins that form pores or channels in the plasma membrane and that are believed to act as transporters of water-soluble molecules and ions across the lipid bilayer. The presence of MAL mRNA in a panel of T-cell lines that express both the T-cell receptor and the T11 antigen suggests that MAL may be involved in membrane signaling in T cells activated via either T11 or T-cell receptor pathways. Images PMID:3494249

  3. Molecular cloning and sequence analysis of a human 372-kDA protein localized in the Golgi complex.


    Sohda, M; Misumi, Y; Fujiwara, T; Nishioka, M; Ikehara, Y


    Autoantibodies from a patient with chronic rheumatoid arthritis recognized an antigen localized in the Golgi complex of various cells from different tissues and species. The autoantibodies were used as a probe for screening human QGP-1 cDNA library, resulting in identification of a 10.3-kb cDNA. The cDNA insert contained an open reading frame which encodes a 3225-residue protein with a calculated mass of 372 kDa. The predicted protein was found to have no NH2-terminal signal sequence but a single hydrophobic domain at the COOH terminus. These results indicate that the 372-kDa antigen is cytoplasmically disposed and anchored to the Golgi membrane by the COOH-terminal hydrophobic domain