Regulatory motifs for CREB-binding protein and Nfe2l2 transcription factors in the upstream enhancer of the mitochondrial uncoupling protein 1 gene.

PubMed

Rim, Jong S; Kozak, Leslie P

2002-09-13

Thermogenesis against cold exposure in mammals occurs in brown adipose tissue (BAT) through mitochondrial uncoupling protein (UCP1). Expression of the Ucp1 gene is unique in brown adipocytes and is regulated tightly. The 5'-flanking region of the mouse Ucp1 gene contains cis-acting elements including PPRE, TRE, and four half-site cAMP-responsive elements (CRE) with BAT-specific enhancer elements. In the course of analyzing how these half-site CREs are involved in Ucp1 expression, we found that a DNA regulatory element for NF-E2 overlaps CRE2. Electrophoretic mobility shift assay and competition assays with the CRE2 element indicates that nuclear proteins from BAT, inguinal fat, and retroperitoneal fat tissue interact with the CRE2 motif (CGTCA) in a specific manner. A supershift assay using an antibody against the CRE-binding protein (CREB) shows specific affinity to the complex from CRE2 and nuclear extract of BAT. Additionally, Western blot analysis for phospho-CREB/ATF1 shows an increase in phosphorylation of CREB/ATF1 in HIB-1B cells after norepinephrine treatment. Transient transfection assay using luciferase reporter constructs also indicates that the two half-site CREs are involved in transcriptional regulation of Ucp1 in response to norepinephrine and cAMP. We also show that a second DNA regulatory element for NF-E2 is located upstream of the CRE2 region. This element, which is found in a similar location in the 5'-flanking region of the human and rodent Ucp1 genes, shows specific binding to rat and human NF-E2 by electrophoretic mobility shift assay with nuclear extracts from brown fat. Co-transfections with an Nfe2l2 expression vector and a luciferase reporter construct of the Ucp1 enhancer region provide additional evidence that Nfe2l2 is involved in the regulation of Ucp1 by cAMP-mediated signaling.

Genomic Instability and Breast Cancer

DTIC Science & Technology

2011-06-01

Survival Assay—Atotal of 1 103 cells were seeded onto a 60-mm dish in triplicate. Twenty-four hours after seeding, cells were irradiated by using a JL...ShepherdMark I-68A 137Cs- irradiator at indicated doses and incubated for 14 days. Result- ing colonies were fixed and stainedwithCoomassie Blue. Num...antibodies, cell culture, transfection and siRNAs, DNA substrates protein purification in insect cells, electrophoretic mobility shift assay and the ATPase

Mapping the transcription start points of the Staphylococcus aureus eap, emp, and vwb promoters reveals a conserved octanucleotide sequence that is essential for expression of these genes.

PubMed

Harraghy, Niamh; Homerova, Dagmar; Herrmann, Mathias; Kormanec, Jan

2008-01-01

Mapping the transcription start points of the eap, emp, and vwb promoters revealed a conserved octanucleotide sequence (COS). Deleting this sequence abolished the expression of eap, emp, and vwb. However, electrophoretic mobility shift assays gave no evidence that this sequence was a binding site for SarA or SaeR, known regulators of eap and emp.

Identification of cis-elements for ethylene and circadian regulation of the Solanum melongena gene encoding cysteine proteinase.

PubMed

Rawat, Reetika; Xu, Zeng-Fu; Yao, Kwok-Ming; Chye, Mee-Len

2005-03-01

We have previously shown that the expression of SmCP which encodes Solanum melongena cysteine proteinase is ethylene-inducible and is under circadian control. To understand the regulation of SmCP, a 1.34-kb SmCP 5'-flanking region and its deletion derivatives were analyzed for cis-elements using GUS and luc fusions and by in vitro binding assays. Analysis of transgenic tobacco transformed with SmCP promoter-GUS constructs confirmed that the promoter region -415/+54 containing Ethylene Responsive Element ERE(-355/-348) conferred threefold ethylene-induction of GUS expression, while -827/+54 which also contains ERE(-683/-676), produced fivefold induction. Using gel mobility shift assays, we demonstrated that each ERE binds nuclear proteins from both ethephon-treated and untreated 5-week-old seedlings, suggesting that different transcriptions factors bind each ERE under varying physiological conditions. Binding was also observed in extracts from senescent, but not young, fruits. The variation in binding at the EREs in fruits and seedlings imply that organ-specific factors may participate in binding. Analysis of transgenic tobacco expressing various SmCP promoter-luc constructs containing wild-type or mutant Evening Elements (EEs) confirmed that both conserved EEs at -795/-787 and -785/-777 are important in circadian control. We confirmed the binding of total nuclear proteins to EEs in gel mobility shift assays and in DNase I footprinting. Our results suggest that multiple proteins bind the EEs which are conserved in plants other than Arabidopsis and that functional EEs and EREs are present in the 5'-flanking region of a gene encoding cysteine proteinase.

Manufacturing of a novel double-function ssDNA aptamer for sensitive diagnosis and efficient neutralization of SEA.

PubMed

Sedighian, Hamid; Halabian, Raheleh; Amani, Jafar; Heiat, Mohammad; Taheri, Ramezan Ali; Imani Fooladi, Abbas Ali

2018-05-01

Staphylococcal enterotoxin A (SEA) is an enterotoxin produced mainly by Staphylococcus aureus. In recent years, it has become the most prevalent compound for staphylococcal food poisoning (SFP) around the world. In this study, we isolate new dual-function single-stranded DNA (ssDNA) aptamers by using some new methods, such as the Taguchi method, by focusing on the detection and neutralization of SEA enterotoxin in food and clinical samples. For the asymmetric polymerase chain reaction (PCR) optimization of each round of systematic evolution of ligands by exponential enrichment (SELEX), we use Taguchi L9 orthogonal arrays, and the aptamer mobility shift assay (AMSA) is used for initial evaluation of the protein-DNA interactions on the last SELEX round. In our investigation the dissociation constant (K D ) value and the limit of detection (LOD) of the candidate aptamer were found to be 8.5 ± 0.91 of nM and 5 ng/ml using surface plasmon resonance (SPR). In the current study, the Taguchi and mobility shift assay methods were innovatively harnessed to improve the selection process and evaluate the protein-aptamer interactions. To the best of our knowledge, this is the first report on employing these two methods in aptamer technology especially against bacterial toxin. Copyright © 2018 Elsevier Inc. All rights reserved.

Fragment screening using capillary electrophoresis (CEfrag) for hit identification of heat shock protein 90 ATPase inhibitors.

PubMed

Austin, Carol; Pettit, Simon N; Magnolo, Sharon K; Sanvoisin, Jonathan; Chen, Wenjie; Wood, Stephen P; Freeman, Lauren D; Pengelly, Reuben J; Hughes, Dallas E

2012-08-01

CEfrag is a new fragment screening technology based on affinity capillary electrophoresis (ACE). Here we report on the development of a mobility shift competition assay using full-length human heat shock protein 90α (Hsp90α), radicicol as the competitor probe ligand, and successful screening of the Selcia fragment library. The CEfrag assay was able to detect weaker affinity (IC(50) >500 µM) fragments than were detected by a fluorescence polarization competition assay using FITC-labeled geldanamycin. The binding site of selected fragments was determined by co-crystallization with recombinant Hsp90α N-terminal domain and X-ray analysis. The results of this study confirm that CEfrag is a sensitive microscale technique enabling detection of fragments binding to the biological target in near-physiological solution.

High-mobility group (HMG) protein HMG-1 and TATA-binding protein-associated factor TAF(II)30 affect estrogen receptor-mediated transcriptional activation.

PubMed

Verrier, C S; Roodi, N; Yee, C J; Bailey, L R; Jensen, R A; Bustin, M; Parl, F F

1997-07-01

The estrogen receptor (ER) belongs to a family of ligand-inducible nuclear receptors that exert their effects by binding to cis-acting DNA elements in the regulatory region of target genes. The detailed mechanisms by which ER interacts with the estrogen response element (ERE) and affects transcription still remain to be elucidated. To study the ER-ERE interaction and transcription initiation, we employed purified recombinant ER expressed in both the baculovirus-Sf9 and his-tagged bacterial systems. The effect of high-mobility group (HMG) protein HMG-1 and purified recombinant TATA-binding protein-associated factor TAF(II)30 on ER-ERE binding and transcription initiation were assessed by electrophoretic mobility shift assay and in vitro transcription from an ERE-containing template (pERE2LovTATA), respectively. We find that purified, recombinant ER fails to bind to ERE in spite of high ligand-binding activity and electrophoretic and immunological properties identical to ER in MCF-7 breast cancer cells. HMG-1 interacts with ER and promotes ER-ERE binding in a concentration- and time-dependent manner. The effectiveness of HMG-1 to stimulate ER-ERE binding in the electrophoretic mobility shift assay depends on the sequence flanking the ERE consensus as well as the position of the latter in the oligonucleotide. We find that TAF(II)30 has no effect on ER-ERE binding either alone or in combination with ER and HMG-1. Although HMG-1 promotes ER-ERE binding, it fails to stimulate transcription initiation either in the presence or absence of hormone. In contrast, TAF(II)30, while not affecting ER-ERE binding, stimulates transcription initiation 20-fold in the presence of HMG-1. These results indicate that HMG-1 and TAF(II)30 act in sequence, the former acting to promote ER-ERE binding followed by the latter to stimulate transcription initiation.

The Vibrio parahaemolyticus small RNA RyhB promotes production of the siderophore vibrioferrin by stabilizing the polycistronic mRNA.

PubMed

Tanabe, Tomotaka; Funahashi, Tatsuya; Nakao, Hiroshi; Maki, Jun; Yamamoto, Shigeo

2013-08-01

High-affinity iron acquisition in Vibrio parahaemolyticus is mediated by the cognate siderophore vibrioferrin. We have previously reported that the vibrioferrin biosynthesis operon (pvsOp) is regulated at the transcriptional level by the iron-responsive repressor Fur (T. Tanabe, T. Funahashi, H. Nakao, S. Miyoshi, S. Shinoda, and S. Yamamoto, J. Bacteriol. 185:6938-6949, 2003). In this study, we identified the Fur-regulated small RNA RyhB and the RNA chaperone Hfq protein as additional regulatory proteins of vibrioferrin biosynthesis. We found that vibrioferrin production was greatly impaired in both the ryhB and hfq deletion mutants, and a TargetRNA search (http://snowwhite.wellesley.edu/targetRNA/index2.html) revealed that the 5'-untranslated region of pvsOp mRNA (pvsOp 5'-UTR) contains a potential base-pairing region required for the formation of the RyhB-pvsOp 5'-UTR duplex. An electrophoresis mobility shift assay indicated that RyhB can directly bind to the pvsOp 5'-UTR with the aid of Hfq. Rifampin chase experiments indicated that the half-life of pvsOp mRNA in the ryhB and hfq mutants was approximately 3-fold shorter than that in the parental strain, suggesting that both RyhB and Hfq are engaged in the stabilization of pvsOp mRNA. Chrome azurol S assays followed by electrophoresis mobility shift assays and rifampin chase experiments carried out for mutant strains indicated that base pairing between RyhB and the pvsOp 5'-UTR results in an increase in the stability of pvsOp mRNA, thereby leading to the promotion of vibrioferrin production. It is unprecedented that RyhB confers increased stability on a polycistronic mRNA involved in siderophore biosynthesis as a direct target.

Claudin-1 has tumor suppressive activity and is a direct target of RUNX3 in gastric epithelial cells.

PubMed

Chang, Ti Ling; Ito, Kosei; Ko, Tun Kiat; Liu, Qiang; Salto-Tellez, Manuel; Yeoh, Khay Guan; Fukamachi, Hiroshi; Ito, Yoshiaki

2010-01-01

The transcription factor RUNX3 is a gastric tumor suppressor. Tumorigenic Runx3(-/-) gastric epithelial cells attach weakly to each other, compared with nontumorigenic Runx3(+/+) cells. We aimed to identify RUNX3 target genes that promote cell-cell contact to improve our understanding of RUNX3's role in suppressing gastric carcinogenesis. We compared gene expression profiles of Runx3(+/+) and Runx3(-/-) cells and observed down-regulation of genes associated with cell-cell adhesion in Runx3(-/-) cells. Reporter, mobility shift, and chromatin immunoprecipitation assays were used to examine the regulation of these genes by RUNX3. Tumorigenesis assays and immunohistological analyses of human gastric tumors were performed to confirm the role of the candidate genes in gastric tumor development. Mobility shift and chromatin immunoprecipitation assays revealed that the promoter activity of the gene that encodes the tight junction protein claudin-1 was up-regulated via the binding of RUNX3 to the RUNX consensus sites. The tumorigenicity of gastric epithelial cells from Runx3(-/-) mice was significantly reduced by restoration of claudin-1 expression, whereas knockdown of claudin-1 increased the tumorigenicity of human gastric cancer cells. Concomitant expression of RUNX3 and claudin-1 was observed in human normal gastric epithelium and cancers. The tight junction protein claudin-1 has gastric tumor suppressive activity and is a direct transcriptional target of RUNX3. Claudin-1 is down-regulated during the epithelial-mesenchymal transition; RUNX3 might therefore act as a tumor suppressor to antagonize the epithelial-mesenchymal transition. Copyright 2010 AGA Institute. Published by Elsevier Inc. All rights reserved.

Role of Human DNA Polymerase and its Accessory Proteins in Breast Cancer.

DTIC Science & Technology

1999-09-01

by W estern blotting. Total mRNA was isolated from the Ac.in mRNA cells using RNA-STAT 60 (Tel- Test .t .... Inc) and subjected to Northern blotting...p53 expression on the activity of the POLDI promoter were tested using the 1.8 kb-luciferase POLD1 promoter construct in SAOS-2 cells which do not...activity. In preliminary studies using gel mobility shift assays we tested ds oligonucleotides corresponding to all five sites (P1-P5). The results

Perilipin, a critical regulator of fat storage and breakdown, is a target gene of estrogen receptor-related receptor {alpha}

DOE Office of Scientific and Technical Information (OSTI.GOV)

Akter, Mst. Hasina; Yamaguchi, Tomohiro; Hirose, Fumiko

2008-04-11

Perilipin is a protein localized on lipid droplet surfaces in adipocytes and steroidogenic cells, playing a central role in regulated lipolysis. Expression of the perilipin gene is markedly induced during adipogenesis. We found that transcription from the perilipin gene promoter is activated by an orphan nuclear receptor, estrogen receptor-related receptor (ERR){alpha}. A response element to this receptor was identified in the promoter region by a gene reporter assay, the electrophoretic-gel mobility-shift assay and the chromatin immunoprecipitation assay. Peroxisome proliferator-activated receptor {gamma} coactivator (PGC)-1{alpha} enhanced, whereas small heterodimer partner (SHP) repressed, the transactivating function of ERR{alpha} on the promoter. Thus, themore » perilipin gene expression is regulated by a transcriptional network controlling energy metabolism, substantiating the functional importance of perilipin in the maintenance of body energy balance.« less

GAS6 is an estrogen-inducible gene in mammary epithelial cells

PubMed Central

Mo, Rigen; Zhu, Yiwei Tony; Zhang, Zhongyi; Rao, Sambasiva M.; Zhu, Yi-Jun

2007-01-01

To identify estrogen responsive genes in mammary glands, microarray assays were performed. Twenty genes were found to be up-regulated while 16 genes were repressed in the 9h estrogen treated glands. The induction of GAS6, one of the genes up-regulated by estrogen, was confirmed by RNase protection assay. Furthermore, GAS6 was also demonstrated to be induced by estrogen in ER positive breast cancer cells. Analysis of GAS6 promoter revealed that GAS6 promoter was regulated by estrogen. An estrogen response element (ERE) was identified in the GAS6 promoter. Electrophoretic mobility shift assay revealed that ERα interacted with the ERE in the GAS6 promoter. Chromatin immunoprecipitation demonstrated that ERα was recruited to the GAS6 promoter upon estrogen stimulation. These results suggested that GAS6 is an estrogen target gene in mammary epithelial cells. PMID:17174935

High mobility group box (HMGB) proteins of Plasmodium falciparum: DNA binding proteins with pro-inflammatory activity.

PubMed

Kumar, Krishan; Singal, Ankita; Rizvi, M Moshahid A; Chauhan, Virander S

2008-06-01

High mobility group box chromosomal protein 1 (HMGB1), known as an abundant, non-histone architectural chromosomal protein, is highly conserved across different species. Homologues of HMGB1 were identified and cloned from malaria parasite, Plasmodium falciparum. Sequence analyses showed that the P. falciparum HMGB1 (PfHMGB1) exhibits 45, 23 and 18%, while PfHMGB2 shares 42, 21 and 17% homology with Saccharomyces cerevisiae, human and mouse HMG box proteins respectively. Parasite PfHMGB1and PfHMGB2 proteins contain one HMG Box domain similar to B-Box of mammalian HMGB1. Electrophoretic Mobility Shift Assay (EMSA) showed that recombinant PfHMGB1 and PfHMGB2 bind to DNA. Immunofluorescence Assay using specific antibodies revealed that these proteins are expressed abundantly in the ring stage nuclei. Significant levels of PfHMGB1 and PfHMGB2 were also present in the parasite cytosol at trophozoite and schizont stages. Both, PfHMGB1 and PfHMGB2 were found to be potent inducers of pro-inflammatory cytokines such as TNFalpha from mouse peritoneal macrophages as analyzed by both reverse transcription PCR and by ELISA. These results suggest that secreted PfHMGB1 and PfHMGB2 may be responsible for eliciting/ triggering host inflammatory immune responses associated with malaria infection.

Probing the Intermediacy of Covalent RNA Enzyme Complexes in RNA Modification Enzymes

PubMed Central

Chervin, Stephanie M.; Kittendorf, Jeffrey D.; Garcia, George A.

2009-01-01

Within the large and diverse group of RNA-modifying enzymes, a number of enzymes seem to form stable covalent linkages to their respective RNA substrates. A complete understanding of the chemical and kinetic mechanisms of these enzymes, some of which have identified pathological roles, is lacking. As part of our ongoing work studying the posttranscriptional modification of tRNA with queuine, we wish to understand fully the chemical and kinetic mechanisms involved in this key transglycosylation reaction. In our previous investigations, we have used a gel mobility-shift assay to characterize an apparent covalent enzyme-RNA intermediate believed to be operative in the catalytic pathway. However, the simple observation of a covalent complex is not sufficient to prove intermediacy. To be a true intermediate, the complex must be both chemically and kinetically competent. As a case study for the proof of intermediacy, we report the use of this gel-shift assay under mildly denaturing conditions to probe the kinetic competency of the covalent association between RNA and the tRNA modifying enzyme tRNA-guanine transglycosylase (TGT). PMID:17673081

Iron(II) supramolecular helicates interfere with the HIV-1 Tat-TAR RNA interaction critical for viral replication.

PubMed

Malina, Jaroslav; Hannon, Michael J; Brabec, Viktor

2016-07-12

The interaction between the HIV-1 transactivator protein Tat and TAR (transactivation responsive region) RNA, plays a critical role in HIV-1 transcription. Iron(II) supramolecular helicates were evaluated for their in vitro activity to inhibit Tat-TAR RNA interaction using UV melting studies, electrophoretic mobility shift assay, and RNase A footprinting. The results demonstrate that iron(II) supramolecular helicates inhibit Tat-TAR interaction at nanomolar concentrations by binding to TAR RNA. These studies provide a new insight into the biological potential of metallosupramolecular helicates.

A minimal murine Msx-1 gene promoter. Organization of its cis-regulatory motifs and their role in transcriptional activation in cells in culture and in transgenic mice.

PubMed

Takahashi, T; Guron, C; Shetty, S; Matsui, H; Raghow, R

1997-09-05

To dissect the cis-regulatory elements of the murine Msx-1 promoter, which lacks a conventional TATA element, a putative Msx-1 promoter DNA fragment (from -1282 to +106 base pairs (bp)) or its congeners containing site-specific alterations were fused to luciferase reporter and introduced into NIH3T3 and C2C12 cells, and the expression of luciferase was assessed in transient expression assays. The functional consequences of the sequential 5' deletions of the promotor revealed that multiple positive and negative regulatory elements participate in regulating transcription of the Msx-1 gene. Surprisingly, however, the optimal expression of Msx-1 promoter in either NIH3T3 or C2C12 cells required only 165 bp of the upstream sequence to warrant detailed examination of its structure. Therefore, the functional consequences of site-specific deletions and point mutations of the cis-acting elements of the minimal Msx-1 promoter were systematically examined. Concomitantly, potential transcriptional factor(s) interacting with the cis-acting elements of the minimal promoter were also studied by gel electrophoretic mobility shift assays and DNase I footprinting. Combined analyses of the minimal promoter by DNase I footprinting, electrophoretic mobility shift assays, and super shift assays with specific antibodies revealed that 5'-flanking regions from -161 to -154 and from -26 to -13 of the Msx-1 promoter contains an authentic E box (proximal E box), capable of binding a protein immunologically related to the upstream stimulating factor 1 (USF-1) and a GC-rich sequence motif which can bind to Sp1 (proximal Sp1), respectively. Additionally, we observed that the promoter activation was seriously hampered if the proximal E box was removed or mutated, and the promoter activity was eliminated completely if the proximal Sp1 site was similarly altered. Absolute dependence of the Msx-1 minimal promoter on Sp1 could be demonstrated by transient expression assays in the Sp1-deficient Drosophila cell line cotransfected with Msx-1-luciferase and an Sp1 expression vector pPacSp1. The transgenic mice embryos containing -165/106-bp Msx-1 promoter-LacZ DNA in their genomes abundantly expressed beta-galactosidase in maxillae and mandibles and in the cellular primordia involved in the formation of the meninges and the bones of the skull. Thus, the truncated murine Msx-1 promoter can target expression of a heterologous gene in the craniofacial tissues of transgenic embryos known for high level of expression of the endogenous Msx-1 gene and found to be severely defective in the Msx-1 knock-out mice.

The Vibrio parahaemolyticus Small RNA RyhB Promotes Production of the Siderophore Vibrioferrin by Stabilizing the Polycistronic mRNA

PubMed Central

Funahashi, Tatsuya; Nakao, Hiroshi; Maki, Jun; Yamamoto, Shigeo

2013-01-01

High-affinity iron acquisition in Vibrio parahaemolyticus is mediated by the cognate siderophore vibrioferrin. We have previously reported that the vibrioferrin biosynthesis operon (pvsOp) is regulated at the transcriptional level by the iron-responsive repressor Fur (T. Tanabe, T. Funahashi, H. Nakao, S. Miyoshi, S. Shinoda, and S. Yamamoto, J. Bacteriol. 185:6938–6949, 2003). In this study, we identified the Fur-regulated small RNA RyhB and the RNA chaperone Hfq protein as additional regulatory proteins of vibrioferrin biosynthesis. We found that vibrioferrin production was greatly impaired in both the ryhB and hfq deletion mutants, and a TargetRNA search (http://snowwhite.wellesley.edu/targetRNA/index2.html) revealed that the 5′-untranslated region of pvsOp mRNA (pvsOp 5′-UTR) contains a potential base-pairing region required for the formation of the RyhB-pvsOp 5′-UTR duplex. An electrophoresis mobility shift assay indicated that RyhB can directly bind to the pvsOp 5′-UTR with the aid of Hfq. Rifampin chase experiments indicated that the half-life of pvsOp mRNA in the ryhB and hfq mutants was approximately 3-fold shorter than that in the parental strain, suggesting that both RyhB and Hfq are engaged in the stabilization of pvsOp mRNA. Chrome azurol S assays followed by electrophoresis mobility shift assays and rifampin chase experiments carried out for mutant strains indicated that base pairing between RyhB and the pvsOp 5′-UTR results in an increase in the stability of pvsOp mRNA, thereby leading to the promotion of vibrioferrin production. It is unprecedented that RyhB confers increased stability on a polycistronic mRNA involved in siderophore biosynthesis as a direct target. PMID:23772063

DOE Office of Scientific and Technical Information (OSTI.GOV)

Danno, Hirosuke; Ishii, Kiyo-aki; Nakagawa, Yoshimi

To elucidate the physiological role of CREBH, the hepatic mRNA and protein levels of CREBH were estimated in various feeding states of wild and obesity mice. In the fast state, the expression of CREBH mRNA and nuclear protein were high and profoundly suppressed by refeeding in the wild-type mice. In ob/ob mice, the refeeding suppression was impaired. The diet studies suggested that CREBH expression was activated by fatty acids. CREBH mRNA levels in the mouse primary hepatocytes were elevated by addition of the palmitate, oleate and eicosapenonate. It was also induced by PPAR{alpha} agonist and repressed by PPAR{alpha} antagonist. Luciferasemore » reporter gene assays indicated that the CREBH promoter activity was induced by fatty acids and co-expression of PPAR{alpha}. Deletion studies identified the PPRE for PPAR{alpha} activation. Electrophoretic mobility shift assay and chromatin immunoprecipitation (ChIP) assay confirmed that PPAR{alpha} directly binds to the PPRE. Activation of CREBH at fasting through fatty acids and PPAR{alpha} suggest that CREBH is involved in nutritional regulation.« less

hnRNP L binds to CA repeats in the 3'UTR of bcl-2 mRNA

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lee, Dong-Hyoung; Lim, Mi-Hyun; Youn, Dong-Ye

We previously reported that the CA-repeat sequence in the 3'-untranslated region (3'UTR) of bcl-2 mRNA is involved in the decay of bcl-2 mRNA. However, the trans-acting factor for the CA element in bcl-2 mRNA remains unidentified. The heterogeneous nuclear ribonucleoprotein L (hnRNP L), an intron splicing factor, has been reported to bind to CA repeats and CA clusters in the 3'UTR of several genes. We reported herein that the CA repeats of bcl-2 mRNA have the potential to form a distinct ribonuclear protein complex in cytoplasmic extracts of MCF-7 cells, as evidenced by RNA electrophoretic mobility shift assays (REMSA). Amore » super-shift assay using the hnRNP L antibody completely shifted the complex. Immunoprecipitation with the hnRNP L antibody and MCF-7 cells followed by RT-PCR revealed that hnRNP L interacts with endogenous bcl-2 mRNA in vivo. Furthermore, the suppression of hnRNP L in MCF-7 cells by the transfection of siRNA for hnRNP L resulted in a delay in the degradation of RNA transcripts including CA repeats of bcl-2 mRNA in vitro, suggesting that the interaction between hnRNPL and CA repeats of bcl-2 mRNA participates in destabilizing bcl-2 mRNA.« less

A novel hsp110-related gene, apg-1, that is abundantly expressed in the testis responds to a low temperature heat shock rather than the traditional elevated temperatures.

PubMed

Kaneko, Y; Nishiyama, H; Nonoguchi, K; Higashitsuji, H; Kishishita, M; Fujita, J

1997-01-31

We isolated a novel hsp110-related gene, apg-1, from a testis cDNA library. The apg-1 transcripts were constitutively expressed in the testicular germ cells and, in some degree, most tissues examined. In a mouse TAMA26 Sertoli cell line, apg-1 transcripts were induced in 2 h by a temperature shift from 32 to 39 degrees C, but not by a shift from 37 to 42 degrees C, the traditional heat stress, or a shift from 32 to 42 degrees C. The heat response pattern of hsp110 expression was similar to that of apg-1. Although induction of a hsp70 transcript was observed in 2 h by a shift from 32 to 39 degrees C, the induction was more apparent by a shift from 37 to 42 degrees C or from 32 to 42 degrees C. Essentially similar differential response patterns were observed among these genes in NIH/3T3 fibroblasts as well. The nuclear run-on assay and the native gel mobility shift assay demonstrated that, by the 32 to 39 degrees C temperature shift, the apg-1 gene was transcriptionally activated, and heat shock factor 1 bound to the heat shock elements in the 5'-flanking region of the apg-1 gene. These results demonstrated that expressions of apg-1, hsp110, and hsp70 could be heat-induced at a temperature lower than the traditional elevated temperatures in somatic cells of both testis and nontestis origin and suggest that the mechanisms regulating the transcript levels of apg-1 and hsp110 are different from those of hsp70. Furthermore, the constitutive expression in germ cells suggests that APG-1 plays a specific role in spermatogenesis as well as in stress response.

The pig CYP2E1 promoter is activated by COUP-TF1 and HNF-1 and is inhibited by androstenone.

PubMed

Tambyrajah, Winston S; Doran, Elena; Wood, Jeffrey D; McGivan, John D

2004-11-15

Functional analysis of the pig cytochrome P4502E1 (CYP2E1) promoter identified two major activating elements. One corresponded to the hepatic nuclear factor 1 (HNF-1) consensus binding sequence at nucleotides -128/-98 and the other was located in the region -292/-266. The binding of proteins in pig liver nuclear extracts to a synthetic double-stranded oligonucleotide corresponding to this more distal activating sequence was studied by electrophoretic mobility shift assay. The minimum protein binding sequence was identified as TGTTCTGACCTCTGGG. Gel super-shift assays identified the protein binding to this site as chick ovalbumin upstream promoter transcription factor 1 (COUP-TF1). Androstenone inhibited promoter activity in transfection experiments only with constructs which included the COUP-TF1 binding site. Androstenone inhibited COUP-TF1 binding to synthetic oligonucleotides but did not affect HNF-1 binding. The results offer an explanation for the inhibition of CYP2E1 protein expression by androstenone in isolated pig hepatocytes and may be relevant to the low expression of hepatic CYP2E1 in those pigs which accumulate high levels of androstenone in vivo.

A minimalist biosensor: Quantitation of cyclic di-GMP using the conformational change of a riboswitch aptamer.

PubMed

Kellenberger, Colleen A; Sales-Lee, Jade; Pan, Yuchen; Gassaway, Madalee M; Herr, Amy E; Hammond, Ming C

2015-01-01

Cyclic di-GMP (c-di-GMP) is a second messenger that is important in regulating bacterial physiology and behavior, including motility and virulence. Many questions remain about the role and regulation of this signaling molecule, but current methods of detection are limited by either modest sensitivity or requirements for extensive sample purification. We have taken advantage of a natural, high affinity receptor of c-di-GMP, the Vc2 riboswitch aptamer, to develop a sensitive and rapid electrophoretic mobility shift assay (EMSA) for c-di-GMP quantitation that required minimal engineering of the RNA.

Iron(II) supramolecular helicates interfere with the HIV-1 Tat–TAR RNA interaction critical for viral replication

PubMed Central

Malina, Jaroslav; Hannon, Michael J.; Brabec, Viktor

2016-01-01

The interaction between the HIV-1 transactivator protein Tat and TAR (transactivation responsive region) RNA, plays a critical role in HIV-1 transcription. Iron(II) supramolecular helicates were evaluated for their in vitro activity to inhibit Tat–TAR RNA interaction using UV melting studies, electrophoretic mobility shift assay, and RNase A footprinting. The results demonstrate that iron(II) supramolecular helicates inhibit Tat-TAR interaction at nanomolar concentrations by binding to TAR RNA. These studies provide a new insight into the biological potential of metallosupramolecular helicates. PMID:27405089

Biochemical analysis of NSs from different tospoviruses.

PubMed

Hedil, Marcio; de Ronde, Dryas; Kormelink, Richard

2017-10-15

Tospoviruses suppress antiviral RNA interference by coding for an RNA silencing suppressor (NSs) protein. Previously, using NSs-containing crude plant and insect cell extracts, the affinity of NSs for double-stranded (ds)RNA molecules was demonstrated by electrophoretic mobility shifts assays (EMSAs). While NSs from tomato spotted wilt virus (TSWV) and groundnut ringspot virus (GRSV) were able to bind small and long dsRNA molecules, the one from tomato yellow ring virus (TYRV), a distinct Asian tospovirus, only bound small dsRNA. Here, using bacterially expressed and purified NSs from GRSV and TYRV, it is shown that they are both able to bind to small and long dsRNA. Binding of siRNAs by NSs revealed two consecutive shifts, i.e. a first shift at low NSs concentrations followed by a second larger one at higher concentrations. When NSs of TSWV resistance inducing (RI) and resistance breaking (RB) isolates were analyzed using extracts from infected plants only a major siRNA shift was observed. In contrast, plant extracts containing the respective transiently expressed NSs proteins showed only the lower shift with NSs RI but no shift with NSs RB . The observed affinity for RNA duplexes, as well as the two-stepwise shift pattern, is discussed in light of NSs as a suppressor of silencing and its importance for tospovirus infection. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.

Interleukin 2 transcription factors as molecular targets of cAMP inhibition: delayed inhibition kinetics and combinatorial transcription roles

PubMed Central

1994-01-01

Elevation of cAMP can cause gene-specific inhibition of interleukin 2 (IL-2) expression. To investigate the mechanism of this effect, we have combined electrophoretic mobility shift assays and in vivo genomic footprinting to assess both the availability of putative IL-2 transcription factors in forskolin-treated cells and the functional capacity of these factors to engage their sites in vivo. All observed effects of forskolin depended upon protein kinase A, for they were blocked by introduction of a dominant negative mutant subunit of protein kinase A. In the EL4.E1 cell line, we report specific inhibitory effects of cAMP elevation both on NF-kappa B/Rel family factors binding at -200 bp, and on a novel, biochemically distinct "TGGGC" factor binding at -225 bp with respect to the IL-2 transcriptional start site. Neither NF-AT nor AP-1 binding activities are detectably inhibited in gel mobility shift assays. Elevation of cAMP inhibits NF-kappa B activity with delayed kinetics in association with a delayed inhibition of IL-2 RNA accumulation. Activation of cells in the presence of forskolin prevents the maintenance of stable protein- DNA interactions in vivo, not only at the NF-kappa B and TGGGC sites of the IL-2 enhancer, but also at the NF-AT, AP-1, and other sites. This result, and similar results in cyclosporin A-treated cells, imply that individual IL-2 transcription factors cannot stably bind their target sequences in vivo without coengagement of all other distinct factors at neighboring sites. It is proposed that nonhierarchical, cooperative enhancement of binding is a structural basis of combinatorial transcription factor action at the IL-2 locus. PMID:8113685

Transforming growth factor-beta 1 (TGF-beta1) promotes IL-2 mRNA expression through the up-regulation of NF-kappaB, AP-1 and NF-AT in EL4 cells.

PubMed

Han, S H; Yea, S S; Jeon, Y J; Yang, K H; Kaminski, N E

1998-12-01

Transforming growth factor beta1 (TGF-beta1) has been previously shown to modulate interleukin 2 (IL-2) secretion by activated T-cells. In the present studies, we determined that TGF-beta1 induced IL-2 mRNA expression in the murine T-cell line EL4, in the absence of other stimuli. IL-2 mRNA expression was significantly induced by TGF-beta1 (0.1-1 ng/ml) over a relatively narrow concentration range, which led to the induction of IL-2 secretion. Under identical condition, we examined the effect of TGF-beta1 on the activity of nuclear factor AT (NF-AT), nuclear factor kappaB (NF-kappaB), activator protein-1 (AP-1) and octamer, all of which contribute to the regulation of IL-2 gene expression. Electrophoretic mobility shift assays showed that TGF-beta1 markedly increased NF-AT, NF-kappaB and AP-1 binding to their respective cognate DNA binding sites, whereas octamer binding remained constant, as compared with untreated cells. Employing a reporter gene expression system with p(NF-kappaB)3-CAT, p(NF-AT)3-CAT and p(AP-1)3-CAT, TGF-beta1 treatment of transfected EL4 cells induced a dose-related increase in chloramphenicol acetyltransferase activity that correlated well with the DNA binding profile found in the electrophoretic mobility shift assay studies. These results show that TGF-beta1, in the absence of any additional stimuli, up-regulates the activity of key transcription factors involved in IL-2 gene expression, including NF-AT, NF-kappaB and AP-1, to help promote IL-2 mRNA expression by EL4 cells.

A dimer of the lymphoid protein RAG1 recognizes the recombination signal sequence and the complex stably incorporates the high mobility group protein HMG2.

PubMed

Rodgers, K K; Villey, I J; Ptaszek, L; Corbett, E; Schatz, D G; Coleman, J E

1999-07-15

RAG1 and RAG2 are the two lymphoid-specific proteins required for the cleavage of DNA sequences known as the recombination signal sequences (RSSs) flanking V, D or J regions of the antigen-binding genes. Previous studies have shown that RAG1 alone is capable of binding to the RSS, whereas RAG2 only binds as a RAG1/RAG2 complex. We have expressed recombinant core RAG1 (amino acids 384-1008) in Escherichia coli and demonstrated catalytic activity when combined with RAG2. This protein was then used to determine its oligomeric forms and the dissociation constant of binding to the RSS. Electrophoretic mobility shift assays show that up to three oligomeric complexes of core RAG1 form with a single RSS. Core RAG1 was found to exist as a dimer both when free in solution and as the minimal species bound to the RSS. Competition assays show that RAG1 recognizes both the conserved nonamer and heptamer sequences of the RSS. Zinc analysis shows the core to contain two zinc ions. The purified RAG1 protein overexpressed in E.coli exhibited the expected cleavage activity when combined with RAG2 purified from transfected 293T cells. The high mobility group protein HMG2 is stably incorporated into the recombinant RAG1/RSS complex and can increase the affinity of RAG1 for the RSS in the absence of RAG2.

Nuclear factor I-A represses expression of the cell adhesion molecule L1

PubMed Central

2009-01-01

Background The neural cell adhesion molecule L1 plays a crucial role in development and plasticity of the nervous system. Neural cells thus require precise control of L1 expression. Results We identified a full binding site for nuclear factor I (NFI) transcription factors in the regulatory region of the mouse L1 gene. Electrophoretic mobility shift assay (EMSA) showed binding of nuclear factor I-A (NFI-A) to this site. Moreover, for a brain-specific isoform of NFI-A (NFI-A bs), we confirmed the interaction in vivo using chromatin immunoprecipitation (ChIP). Reporter gene assays showed that in neuroblastoma cells, overexpression of NFI-A bs repressed L1 expression threefold. Conclusion Our findings suggest that NFI-A, in particular its brain-specific isoform, represses L1 gene expression, and might act as a second silencer of L1 in addition to the neural restrictive silencer factor (NRSF). PMID:20003413

Analysis of a cis-Acting Element Involved in Regulation by Estrogen of Human Angiotensinogen Gene Expression.

PubMed

Zhao, Yan-Yan; Sun, Kai-Lai; Ashok, Kumar

1998-01-01

The work was aimed to identify the estrogen responsive element in the human angiotensinogen gene. The nucleotide sequence between the transcription initiation site and TATA box in angiotensinogen gene promoter was found to be strongly homologous with the consensus estrogen responsive element. This sequence was confirmed as the estrogen responsive element (HAG ERE) by electrophoretic mobility shift assay. The recombinant expression vectors were constructed in which chloramphenicol acetyltransferase (CAT) reporter gene was driven by angiotensinogen core promoter with HAG ERE of by TK core promoter with multiplied HAG ERE, and were used in cotransfection with the human estrogen receptor expression vector into HepG(2) cells; CAT assays showed an increase of the CAT activity on 17beta-estradiol treatment in those transfectants. These results suggest that the human angiotensinogen gene is transcriptionally up-regulated by estrogen through the estrogen responsive element near TATA box of the promoter.

Identification of insulin as a novel retinoic acid receptor-related orphan receptor α target gene.

PubMed

Kuang, Jiangying; Hou, Xiaoming; Zhang, Jinlong; Chen, Yulong; Su, Zhiguang

2014-03-18

Insulin plays an important role in regulation of lipid and glucose metabolism. Retinoic acid receptor-related orphan receptor α (RORα) modulates physiopathological processes such as dyslipidemia and diabetes. In this study, we found overexpression of RORα in INS1 cells resulted in increased expression and secretion of insulin. Suppression of endogenous RORα caused a decrease of insulin expression. Luciferase and electrophoretic mobility shift assay (EMSA) assays demonstrated that RORα activated insulin transcription via direct binding to its promoter. RORα was also observed to regulate BETA2 expression, which is one of the insulin active transfactors. In vivo analyses showed that the insulin transcription is increased by the synthetic RORα agonist SR1078. These findings identify RORα as a transcriptional activator of insulin and suggest novel therapeutic opportunities for management of the disease. Copyright © 2014 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.

Schooling Mobile Phones: Assumptions about Proximal Benefits, the Challenges of Shifting Meanings, and the Politics of Teaching

ERIC Educational Resources Information Center

Philip, Thomas M.; Garcia, Antero

2015-01-01

Mobile devices are increasingly upheld as powerful tools for learning and school reform. In this article, we prioritize youth voices to critically examine assumptions about student interest in mobile devices that often drive the incorporation of new technologies into schools. By demonstrating how the very meaning of mobile phones shift as they are…

Affinity Pulldown of Biotinylated RNA for Detection of Protein-RNA Complexes.

PubMed

Panda, Amaresh C; Martindale, Jennifer L; Gorospe, Myriam

2016-12-20

RNA-binding proteins (RBPs) have recently emerged as crucial players in the regulation of gene expression. The interactions of RBPs with target mRNAs control the levels of gene products by altering different regulatory steps, including pre-mRNA splicing and maturation, nuclear mRNA export, and mRNA stability and translation (Glisovic et al. , 2008). There are several methodologies available today to identify RNAs bound to specific RBPs; some detect only recombinant molecules in vitro , others detect recombinant and endogenous molecules, while others detect only endogenous molecules. Examples include systematic evolution of ligands by exponential enrichment (SELEX), biotinylated RNA pulldown assay, RNA immunoprecipitation (RIP) assay, electrophoretic mobility shift assay (EMSA), RNA footprinting analysis, and various UV crosslinking and immunoprecipitation (CLIP) methods such as CLIP, PAR-CLIP, and iCLIP (Popova et al. , 2015). Here, we describe a simple and informative method to study and identify the RNA region of interaction between an RBP and its target transcript (Panda et al. , 2014 and 2016). Its reproducibility and ease of use make this protocol a fast and useful method to identify interactions between RBPs and specific RNAs.

Lactoferricin B Inhibits the Phosphorylation of the Two-Component System Response Regulators BasR and CreB*

PubMed Central

Ho, Yu-Hsuan; Sung, Tzu-Cheng; Chen, Chien-Sheng

2012-01-01

Natural antimicrobial peptides provide fundamental protection for multicellular organisms from microbes, such as Lactoferricin B (Lfcin B). Many studies have shown that Lfcin B penetrates the cell membrane and has intracellular activities. To elucidate the intracellular behavior of Lfcin B, we first used Escherichia coli K12 proteome chips to identify the intracellular targets of Lfcin B. The results showed that Lfcin B binds to two response regulators, BasR and CreB, of the two-component system. For further analysis, we conducted several in vitro and in vivo experiments and utilized bioinformatics methods. The electrophoretic mobility shift assays and kinase assays indicate that Lfcin B inhibits the phosphorylation of the response regulators (BasR and CreB) and their cognate sensor kinases (BasS and CreC). Antibacterial assays showed that Lfcin B reduced E. coli's tolerance to environmental stimuli, such as excessive ferric ions and minimal medium conditions. This is the first study to show that an antimicrobial peptide inhibits the growth of bacteria by influencing the phosphorylation of a two-component system directly. PMID:22138548

Lactoferricin B inhibits the phosphorylation of the two-component system response regulators BasR and CreB.

PubMed

Ho, Yu-Hsuan; Sung, Tzu-Cheng; Chen, Chien-Sheng

2012-04-01

Natural antimicrobial peptides provide fundamental protection for multicellular organisms from microbes, such as Lactoferricin B (Lfcin B). Many studies have shown that Lfcin B penetrates the cell membrane and has intracellular activities. To elucidate the intracellular behavior of Lfcin B, we first used Escherichia coli K12 proteome chips to identify the intracellular targets of Lfcin B. The results showed that Lfcin B binds to two response regulators, BasR and CreB, of the two-component system. For further analysis, we conducted several in vitro and in vivo experiments and utilized bioinformatics methods. The electrophoretic mobility shift assays and kinase assays indicate that Lfcin B inhibits the phosphorylation of the response regulators (BasR and CreB) and their cognate sensor kinases (BasS and CreC). Antibacterial assays showed that Lfcin B reduced E. coli's tolerance to environmental stimuli, such as excessive ferric ions and minimal medium conditions. This is the first study to show that an antimicrobial peptide inhibits the growth of bacteria by influencing the phosphorylation of a two-component system directly.

Physician satisfaction with a multi-platform digital scheduling system

PubMed Central

Rocha, Leonardo Lima; Lima, Alex Heitor; Santiago, Caroline Reis Maia; Terra, Jose Cláudio Cyrineu; Dagan, Alon; Celi, Leo Anthony

2017-01-01

Objective Physician shift schedules are regularly created manually, using paper or a shared online spreadsheet. Mistakes are not unusual, leading to last minute scrambles to cover a shift. We developed a web-based shift scheduling system and a mobile application tool to facilitate both the monthly scheduling and shift exchanges between physicians. The primary objective was to compare physician satisfaction before and after the mobile application implementation. Methods Over a 9-month period, three surveys, using the 4-point Likert type scale were performed to assess the physician satisfaction. The first survey was conducted three months prior mobile application release, a second survey three months after implementation and the last survey six months after. Results 51 (77%) of the physicians answered the baseline survey. Of those, 32 (63%) were males with a mean age of 37.8 ± 5.5 years. Prior to the mobile application implementation, 36 (70%) of the responders were using more than one method to carry out shift exchanges and only 20 (40%) were using the official department report sheet to document shift exchanges. The second and third survey were answered by 48 (73%) physicians. Forty-eight (98%) of them found the mobile application easy or very easy to install and 47 (96%) did not want to go back to the previous method. Regarding physician satisfaction, at baseline 37% of the physicians were unsatisfied or very unsatisfied with shift scheduling. After the mobile application was implementation, only 4% reported being unsatisfied (OR = 0.11, p < 0.001). The satisfaction level improved from 63% to 96% between the first and the last survey. Satisfaction levels significantly increased between the three time points (OR = 13.33, p < 0.001). Conclusion Our web and mobile phone-based scheduling system resulted in better physician satisfaction. PMID:28328958

Physician satisfaction with a multi-platform digital scheduling system.

PubMed

Deliberato, Rodrigo Octávio; Rocha, Leonardo Lima; Lima, Alex Heitor; Santiago, Caroline Reis Maia; Terra, Jose Cláudio Cyrineu; Dagan, Alon; Celi, Leo Anthony

2017-01-01

Physician shift schedules are regularly created manually, using paper or a shared online spreadsheet. Mistakes are not unusual, leading to last minute scrambles to cover a shift. We developed a web-based shift scheduling system and a mobile application tool to facilitate both the monthly scheduling and shift exchanges between physicians. The primary objective was to compare physician satisfaction before and after the mobile application implementation. Over a 9-month period, three surveys, using the 4-point Likert type scale were performed to assess the physician satisfaction. The first survey was conducted three months prior mobile application release, a second survey three months after implementation and the last survey six months after. 51 (77%) of the physicians answered the baseline survey. Of those, 32 (63%) were males with a mean age of 37.8 ± 5.5 years. Prior to the mobile application implementation, 36 (70%) of the responders were using more than one method to carry out shift exchanges and only 20 (40%) were using the official department report sheet to document shift exchanges. The second and third survey were answered by 48 (73%) physicians. Forty-eight (98%) of them found the mobile application easy or very easy to install and 47 (96%) did not want to go back to the previous method. Regarding physician satisfaction, at baseline 37% of the physicians were unsatisfied or very unsatisfied with shift scheduling. After the mobile application was implementation, only 4% reported being unsatisfied (OR = 0.11, p < 0.001). The satisfaction level improved from 63% to 96% between the first and the last survey. Satisfaction levels significantly increased between the three time points (OR = 13.33, p < 0.001). Our web and mobile phone-based scheduling system resulted in better physician satisfaction.

The orphan receptor hepatic nuclear factor 4 functions as a transcriptional activator for tissue-specific and hypoxia-specific erythropoietin gene expression and is antagonized by EAR3/COUP-TF1.

PubMed

Galson, D L; Tsuchiya, T; Tendler, D S; Huang, L E; Ren, Y; Ogura, T; Bunn, H F

1995-04-01

The erythropoietin (Epo) gene is regulated by hypoxia-inducible cis-acting elements in the promoter and in a 3' enhancer, both of which contain consensus hexanucleotide hormone receptor response elements which are important for function. A group of 11 orphan nuclear receptors, transcribed and translated in vitro, were screened by the electrophoretic mobility shift assay. Of these, hepatic nuclear factor 4 (HNF-4), TR2-11, ROR alpha 1, and EAR3/COUP-TF1 bound specifically to the response elements in the Epo promoter and enhancer and, except for ROR alpha 1, formed DNA-protein complexes that had mobilities similar to those observed in nuclear extracts of the Epo-producing cell line Hep3B. Moreover, both anti-HNF-4 and anti-COUP antibodies were able to supershift complexes in Hep3B nuclear extracts. Like Epo, HNF-4 is expressed in kidney, liver, and Hep3B cells but not in HeLa cells. Transfection of a plasmid expressing HNF-4 into HeLa cells enabled an eightfold increase in the hypoxic induction of a luciferase reporter construct which contains the minimal Epo enhancer and Epo promoter, provided that the nuclear hormone receptor consensus DNA elements in both the promoter and the enhancer were intact. The augmentation by HNF-4 in HeLa cells could be abrogated by cotransfection with HNF-4 delta C, which retains the DNA binding domain of HNF-4 but lacks the C-terminal activation domain. Moreover, the hypoxia-induced expression of the endogenous Epo gene was significantly inhibited in Hep3B cells stably transfected with HNF-4 delta C. On the other hand, cotransfection of EAR3/COUP-TF1 and the Epo reporter either with HNF-4 into HeLa cells or alone into Hep3B cells suppressed the hypoxia induction of the Epo reporter. These electrophoretic mobility shift assay and functional experiments indicate that HNF-4 plays a critical positive role in the tissue-specific and hypoxia-inducible expression of the Epo gene, whereas the COUP family has a negative modulatory role.

Using a Smart City IoT to Incentivise and Target Shifts in Mobility Behaviour—Is It a Piece of Pie?

PubMed Central

Poslad, Stefan; Ma, Athen; Wang, Zhenchen; Mei, Haibo

2015-01-01

Whilst there is an increasing capability to instrument smart cities using fixed and mobile sensors to produce the big data to better understand and manage transportation use, there still exists a wide gap between the sustainability goals of smart cities, e.g., to promote less private car use at peak times, with respect to their ability to more dynamically support individualised shifts in multi-modal transportation use to help achieve such goals. We describe the development of the tripzoom system developed as part of the SUNSET—SUstainable social Network SErvices for Transport—project to research and develop a mobile and fixed traffic sensor system to help facilitate individual mobility shifts. Its main novelty was its ability to use mobile sensors to classify common multiple urban transportation modes, to generate information-rich individual and group mobility profiles and to couple this with the use of a targeted incentivised marketplace to gamify travel. This helps to promote mobility shifts towards achieving sustainability goals. This system was trialled in three European country cities operated as Living Labs over six months. Our main findings were that we were able to accomplish a level of behavioural shifts in travel behaviour. Hence, we have provided a proof-of-concept system that uses positive incentives to change individual travel behaviour. PMID:26053752

Using a Smart City IoT to Incentivise and Target Shifts in Mobility Behaviour--Is It a Piece of Pie?

PubMed

Poslad, Stefan; Ma, Athen; Wang, Zhenchen; Mei, Haibo

2015-06-04

Whilst there is an increasing capability to instrument smart cities using fixed and mobile sensors to produce the big data to better understand and manage transportation use, there still exists a wide gap between the sustainability goals of smart cities, e.g., to promote less private car use at peak times, with respect to their ability to more dynamically support individualised shifts in multi-modal transportation use to help achieve such goals. We describe the development of the tripzoom system developed as part of the SUNSET-SUstainable social Network SErvices for Transport-project to research and develop a mobile and fixed traffic sensor system to help facilitate individual mobility shifts. Its main novelty was its ability to use mobile sensors to classify common multiple urban transportation modes, to generate information-rich individual and group mobility profiles and to couple this with the use of a targeted incentivised marketplace to gamify travel. This helps to promote mobility shifts towards achieving sustainability goals. This system was trialled in three European country cities operated as Living Labs over six months. Our main findings were that we were able to accomplish a level of behavioural shifts in travel behaviour. Hence, we have provided a proof-of-concept system that uses positive incentives to change individual travel behaviour.

Bacteroides fragilis mobilizable transposon Tn5520 requires a 71 base pair origin of transfer sequence and a single mobilization protein for relaxosome formation during conjugation.

PubMed

Vedantam, Gayatri; Knopf, Sarah; Hecht, David W

2006-01-01

Tn5520 is the smallest known bacterial mobilizable transposon and was isolated from an antibiotic resistant Bacteroides fragilis clinical isolate. When a conjugation apparatus is provided in trans, Tn5520 is mobilized (transferred) efficiently within, and from, both Bacteroides spp. and Escherichia coli. Only two genes are present on Tn5520; one encodes an integrase, and the other a multifunctional mobilization (Mob) protein BmpH. BmpH is essential for Tn5520 mobility. The focus of this study was to identify the Tn5520 origin of conjugative transfer (oriT) and to study BmpH-oriT binding. We delimited the functional Tn5520 oriT to a 71 bp sequence upstream of the bmpH gene. A plasmid vector harbouring this minimal 71 bp oriT was mobilized at the same frequency as that of intact Tn5520. The minimal oriT contains one 17 bp inverted repeat (IR) sequence. We constructed and tested multiple IR mutants and showed that the IR was essential in its entirety for mobilization. A nick site sequence (5'-GCTAC-3') was also identified within the minimal oriT; this sequence resembled nick sites found in plasmids of Gram positive origin. We further showed that mutation of a highly conserved GC dinucleotide in the nick site sequence completely abolished mobilization. We also purified BmpH and showed that it specifically bound a Tn5520 oriT fragment in electrophoretic mobility shift assays. We also identified non-nick site sequences within the minimal oriT that were essential for mobilization. We hypothesize that transposon-based single Mob protein systems may contribute to efficient gene dissemination from Bacteroides spp., because fewer DNA processing proteins are required for relaxosome formation.

Missed detection of significant positive and negative shifts in gentamicin assay: implications for routine laboratory quality practices.

PubMed

Koerbin, Gus; Liu, Jiakai; Eigenstetter, Alex; Tan, Chin Hon; Badrick, Tony; Loh, Tze Ping

2018-02-15

A product recall was issued for the Roche/Hitachi Cobas Gentamicin II assays on 25 th May 2016 in Australia, after a 15 - 20% positive analytical shift was discovered. Laboratories were advised to employ the Thermo Fisher Gentamicin assay as an alternative. Following the reintroduction of the revised assay on 12 th September 2016, a second reagent recall was made on 20 th March 2017 after the discovery of a 20% negative analytical shift due to erroneous instrument adjustment factor. The practices of an index laboratory were examined to determine how the analytical shifts evaded detection by routine internal quality control (IQC) and external quality assurance (EQA) systems. The ability of the patient result-based approaches, including moving average (MovAvg) and moving sum of outliers (MovSO) approaches in detecting these shifts were examined. Internal quality control data of the index laboratory were acceptable prior to the product recall. The practice of adjusting IQC target following a change in assay method resulted in the missed negative shift when the revised Roche assay was reintroduced. While the EQA data of the Roche subgroup showed clear negative bias relative to other laboratory methods, the results were considered as possible 'matrix effect'. The MovAvg method detected the positive shift before the product recall. The MovSO did not detect the negative shift in the index laboratory but did so in another laboratory 5 days before the second product recall. There are gaps in current laboratory quality practices that leave room for analytical errors to evade detection.

The transcription factor CCAAT-binding factor CBF/NF-Y regulates the proximal promoter activity in the human alpha 1(XI) collagen gene (COL11A1).

PubMed

Matsuo, Noritaka; Yu-Hua, Wang; Sumiyoshi, Hideaki; Sakata-Takatani, Keiko; Nagato, Hitoshi; Sakai, Kumiko; Sakurai, Mami; Yoshioka, Hidekatsu

2003-08-29

We have characterized the proximal promoter region of the human COL11A1 gene. Transient transfection assays indicate that the segment from -199 to +1 is necessary for the activation of basal transcription. Electrophoretic mobility shift assays (EMSAs) demonstrated that the ATTGG sequence, within the -147 to -121 fragment, is critical to bind nuclear proteins in the proximal COL11A1 promoter. We demonstrated that the CCAAT binding factor (CBF/NF-Y) bound to this region using an interference assay with consensus oligonucleotides and a supershift assay with specific antibodies in an EMSA. In a chromatin immunoprecipitation assay and EMSA using DNA-affinity-purified proteins, CBF/NF-Y proteins directly bound this region in vitro and in vivo. We also showed that four tandem copies of the CBF/NF-Y-binding fragment produced higher transcriptional activity than one or two copies, whereas the absence of a CBF/NF-Y-binding fragment suppressed the COL11A1 promoter activity. Furthermore, overexpression of a dominant-negative CBF-B/NF-YA subunit significantly inhibited promoter activity in both transient and stable cells. These results indicate that the CBF/NF-Y proteins regulate the transcription of COL11A1 by directly binding to the ATTGG sequence in the proximal promoter region.

Identification of RNAIII-binding proteins in Staphylococcus aureus using tethered RNAs and streptavidin aptamers based pull-down assay.

PubMed

Zhang, Xu; Zhu, Qing; Tian, Tian; Zhao, Changlong; Zang, Jianye; Xue, Ting; Sun, Baolin

2015-05-15

It has been widely recognized that small RNAs (sRNAs) play important roles in physiology and virulence control in bacteria. In Staphylococcus aureus, many sRNAs have been identified and some of them have been functionally studied. Since it is difficult to identify RNA-binding proteins (RBPs), very little has been known about the RBPs in S. aureus, especially those associated with sRNAs. Here we adopted a tRNA scaffold streptavidin aptamer based pull-down assay to identify RBPs in S. aureus. The tethered RNA was successfully captured by the streptavidin magnetic beads, and proteins binding to RNAIII were isolated and analyzed by mass spectrometry. We have identified 81 proteins, and expressed heterologously 9 of them in Escherichia coli. The binding ability of the recombinant proteins with RNAIII was further analyzed by electrophoresis mobility shift assay, and the result indicates that proteins CshA, RNase J2, Era, Hu, WalR, Pyk, and FtsZ can bind to RNAIII. This study suggests that some proteins can bind to RNA III in S. aureus, and may be involved in RNA III function. And tRSA based pull-down assay is an effective method to search for RBPs in bacteria, which should facilitate the identification and functional study of RBPs in diverse bacterial species.

Datasets depicting mobility retardation of NCS proteins observed upon incubation with calcium, but not with magnesium, barium or strontium.

PubMed

Viviano, Jeffrey; Krishnan, Anuradha; Scully, Jenna; Wu, Hao; Venkataraman, Venkat

2016-06-01

In this data article we show the specificity of the Ca(2+)-induced mobility shift in three proteins that belong to the neuronal calcium sensor (NCS) protein family: Hippocalcin, GCAP1 and GCAP2. These proteins did not display a shift in mobility in native gels when incubated with divalent cations other than Ca(2+) - such as Mg(2+), Ba(2+), and Sr(2+), even at 10× concentrations. The data is similar to that obtained with another NCS protein, neurocalcin delta (Viviano et al., 2016, "Electrophoretic Mobility Shift in Native Gels Indicates Calcium-dependent Structural Changes of Neuronal Calcium Sensor Proteins", [1]).

Serine/Threonine kinase dependent transcription from the polyhedrin promoter of SpltNPV-I

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mishra, Gourav; Gautam, Hemant K.; Das, Rakha H.

2007-07-06

Polyhedrin (polh) and p10 are the two hyper-expressed very late genes of nucleopolyhedroviruses. Alpha amanitin resistant transcription from Spodoptera litura nucleopolyhedrovirus (SpltNPV-I) polyhedrin promoter was observed with virus infected nuclear extract of NIV-HA-197 cells but not with that from uninfected nuclear extract. Anti-protein kinase-1 (pk1) antibody inhibited the transcription and the inhibition reversed on addition of pk1, however, pk1 mutant protein, K50M having no phosphorylation activity did not overcome the transcription inhibition. Chromatin immuno-precipitation assays with viral anti-pk1 antibody showed the interaction of pk1 with the polh while electrophoretic mobility shift assays indicated the strong binding affinity (K {sub d}more » {approx} 5.5 x 10{sup -11}) of purified pk1 with the polh promoter. These results suggested that the viral coded pk1 acts as a transcription factor in transcribing baculovirus very late genes.« less

GATA-1 directly regulates Nanog in mouse embryonic stem cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Li, Wen-Zhong; Ai, Zhi-Ying; Key Laboratory of Animal Biotechnology, Ministry of Agriculture, Northwest A&F University, Yangling 712100

2015-09-25

Nanog safeguards pluripotency in mouse embryonic stem cells (mESCs). Insight into the regulation of Nanog is important for a better understanding of the molecular mechanisms that control pluripotency of mESCs. In a silico analysis, we identify four GATA-1 putative binding sites in Nanog proximal promoter. The Nanog promoter activity can be significantly repressed by ectopic expression of GATA-1 evidenced by a promoter reporter assay. Mutation studies reveal that one of the four putative binding sites counts for GATA-1 repressing Nanog promoter activity. Direct binding of GATA-1 on Nanog proximal promoter is confirmed by electrophoretic mobility shift assay and chromatin immunoprecipitation.more » Our data provide new insights into the expanded regulatory circuitry that coordinates Nanog expression. - Highlights: • The Nanog proximal promoter conceives functional element for GATA-1. • GATA-1 occupies the Nanog proximal promoter in vitro and in vivo. • GATA-1 transcriptionally suppresses Nanog.« less

Cytotoxicity, genotoxicity and oxidative stress of malachite green on the kidney and gill cell lines of freshwater air breathing fish Channa striata.

PubMed

Majeed, S Abdul; Nambi, K S N; Taju, G; Vimal, S; Venkatesan, C; Hameed, A S Sahul

2014-12-01

The cytotoxicity, genotoxicity and oxidative stress of malachite green (MG) was investigated using the fish Channa striata kidney (CSK) and Channa striata gill (CSG) cell lines. Five concentrations ranging from 0.001 to 10 μg mL(-1) were tested in three independent experiments. Cytotoxicity was assessed by 3-(4, 5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay, Rhodamine 123 and Alamar Blue. The mitochondrial changes and apoptosis of MG-exposed cells were observed by Rhodamine 123 and acridine orange/ethidium bromide (AO/EB) staining, respectively. In vitro potential DNA damaging effect of MG was tested using comet assay. Mitochondrial damage, apoptosis and DNA fragmentation increased in a concentration-dependent manner. Additionally, DNA electrophoretic mobility experiments were carried out to study the binding effect of MG to double-stranded DNA (dsDNA) of cells. DNA shift mobility experiments showed that MG is capable of strongly binding to linear dsDNA causing its degradation. Biochemical parameters such as lipid peroxidation (MDA), catalase (CAT) activity and reduced glutathione (GSH) levels were evaluated after exposure to MG. In CSK and CSG cell lines exposed to MG for 48 h, a significant increase in lipid peroxidation, which might be associated with decreased levels of reduced glutathione and catalase activity in these cell lines (p < 0.001), was observed.

Determination of DNA Binding Behavior of FoxA1 Constructs Using a Gold Nanoparticle-Based High Throughput Assay

NASA Astrophysics Data System (ADS)

Aung, Khin Moh Moh; Lim, Michelle Gek Liang; Hong, Shuzhen; Cheung, Edwin; Su, Xiaodi

Forkhead box protein 1 (FoxA1) is a member of the forkhead family of winged-helix transcription factors. It plays crucial roles in the development and differentiation of multiple organs and in the regulation of estrogen-stimulated genes. In this study, in order to determine the regions of FoxA1 necessary for efficient Deoxyribonucleic Acid (DNA) binding, we cloned, expressed and purified a series of FoxA1 constructs that contain either the DNA Binding Domain (DBD), the Transcription Activation Domain (TAD), or both. We determined the DNA binding behavior of these constructs using traditional electrophoretic mobility shift assay (EMSA) and a recently developed gold nanoparticles (AuNPs)-based fast screening method. We conclude that just the DBD region alone is not sufficient for protein-DNA binding activity. Amino acids flanking the upstream of the DBD region are required for maximal DNA binding activity. Through this study, we have also further validated the AuNPs assay for its generality and expanded the existing protocol for comparing the DNA binding behavior of multiple proteins of different charge properties and molecular weights.

Heat shock factor 1 upregulates transcription of Epstein-Barr Virus nuclear antigen 1 by binding to a heat shock element within the BamHI-Q promoter

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wang, Feng-Wei; Wu, Xian-Rui; Liu, Wen-Ju

Epstein-Barr virus (EBV) nuclear antigen 1 (EBNA1) is essential for maintenance of the episome and establishment of latency. In this study, we observed that heat treatment effectively induced EBNA1 transcription in EBV-transformed B95-8 and human LCL cell lines. Although Cp is considered as the sole promoter used for the expression of EBNA1 transcripts in the lymphoblastoid cell lines, the RT-PCR results showed that the EBNA1 transcripts induced by heat treatment arise from Qp-initiated transcripts. Using bioinformatics, a high affinity and functional heat shock factor 1 (HSF1)-binding element within the - 17/+4 oligonucleotide of the Qp was found, and was determinedmore » by electrophoretic mobility shift assay and chromatin immunoprecipitation assay. Moreover, heat shock and exogenous HSF1 expression induced Qp activity in reporter assays. Further, RNA interference-mediated HSF1 gene silencing attenuated heat-induced EBNA1 expression in B95-8 cells. These results provide evidence that EBNA1 is a new target for the transcription factor HSF1.« less

Opaque-2 is a transcriptional activator that recognizes a specific target site in 22-kD zein genes.

PubMed Central

Schmidt, R J; Ketudat, M; Aukerman, M J; Hoschek, G

1992-01-01

opaque-2 (o2) is a regulatory locus in maize that plays an essential role in controlling the expression of genes encoding the 22-kD zein proteins. Through DNase I footprinting and DNA binding analyses, we have identified the binding site for the O2 protein (O2) in the promoter of 22-kD zein genes. The sequence in the 22-kD zein gene promoter that is recognized by O2 is similar to the target site recognized by other "basic/leucine zipper" (bZIP) proteins in that it contains an ACGT core that is necessary for DNA binding. The site is located in the -300 region relative to the translation start and lies about 20 bp downstream of the highly conserved zein gene sequence motif known as the "prolamin box." Employing gel mobility shift assays, we used O2 antibodies and nuclear extracts from an o2 null mutant to demonstrate that the O2 protein in maize endosperm nuclei recognizes the target site in the zein gene promoter. Mobility shift assays using nuclear proteins from an o2 null mutant indicated that other endosperm proteins in addition to O2 can bind the O2 target site and that O2 may be associated with one of these proteins. We also demonstrated that in yeast cells the O2 protein can activate expression of a lacZ gene containing a multimer of the O2 target sequence as part of its promoter, thus confirming its role as a transcriptional activator. A computer-assisted search indicated that the O2 target site is not present in the promoters of zein genes other than those of the 22-kD class. These data suggest a likely explanation at the molecular level for the differential effect of o2 mutations on expression of certain members of the zein gene family. PMID:1392590

MicroRNA156: A Potential Graft-Transmissible MicroRNA That Modulates Plant Architecture and Tuberization in Solanum tuberosum ssp. andigena1[C][W][OPEN

PubMed Central

Bhogale, Sneha; Mahajan, Ameya S.; Natarajan, Bhavani; Rajabhoj, Mohit; Thulasiram, Hirekodathakallu V.; Banerjee, Anjan K.

2014-01-01

MicroRNA156 (miR156) functions in maintaining the juvenile phase in plants. However, the mobility of this microRNA has not been demonstrated. So far, only three microRNAs, miR399, miR395, and miR172, have been shown to be mobile. We demonstrate here that miR156 is a potential graft-transmissible signal that affects plant architecture and tuberization in potato (Solanum tuberosum). Under tuber-noninductive (long-day) conditions, miR156 shows higher abundance in leaves and stems, whereas an increase in abundance of miR156 has been observed in stolons under tuber-inductive (short-day) conditions, indicative of a photoperiodic control. Detection of miR156 in phloem cells of wild-type plants and mobility assays in heterografts suggest that miR156 is a graft-transmissible signal. This movement was correlated with changes in leaf morphology and longer trichomes in leaves. Overexpression of miR156 in potato caused a drastic phenotype resulting in altered plant architecture and reduced tuber yield. miR156 overexpression plants also exhibited altered levels of cytokinin and strigolactone along with increased levels of LONELY GUY1 and StCyclin D3.1 transcripts as compared with wild-type plants. RNA ligase-mediated rapid amplification of complementary DNA ends analysis validated SQUAMOSA PROMOTER BINDING-LIKE3 (StSPL3), StSPL6, StSPL9, StSPL13, and StLIGULELESS1 as targets of miR156. Gel-shift assays indicate the regulation of miR172 by miR156 through StSPL9. miR156-resistant SPL9 overexpression lines exhibited increased miR172 levels under a short-day photoperiod, supporting miR172 regulation via the miR156-SPL9 module. Overall, our results strongly suggest that miR156 is a phloem-mobile signal regulating potato development. PMID:24351688

Quantitative Experimental Determination of Primer-Dimer Formation Risk by Free-Solution Conjugate Electrophoresis

PubMed Central

Desmarais, Samantha M.; Leitner, Thomas; Barron, Annelise E.

2012-01-01

DNA barcodes are short, unique ssDNA primers that “mark” individual biomolecules. To gain better understanding of biophysical parameters constraining primer-dimer formation between primers that incorporate barcode sequences, we have developed a capillary electrophoresis method that utilizes drag-tag-DNA conjugates to quantify dimerization risk between primer-barcode pairs. Results obtained with this unique free-solution conjugate electrophoresis (FSCE) approach are useful as quantitatively precise input data to parameterize computation models of dimerization risk. A set of fluorescently labeled, model primer-barcode conjugates were designed with complementary regions of differing lengths to quantify heterodimerization as a function of temperature. Primer-dimer cases comprised two 30-mer primers, one of which was covalently conjugated to a lab-made, chemically synthesized poly-N-methoxyethylglycine drag-tag, which reduced electrophoretic mobility of ssDNA to distinguish it from ds primer-dimers. The drag-tags also provided a shift in mobility for the dsDNA species, which allowed us to quantitate primer-dimer formation. In the experimental studies, pairs of oligonucleotide primer-barcodes with fully or partially complementary sequences were annealed, and then separated by free-solution conjugate CE at different temperatures, to assess effects on primer-dimer formation. When less than 30 out of 30 basepairs were bonded, dimerization was inversely correlated to temperature. Dimerization occurred when more than 15 consecutive basepairs formed, yet non-consecutive basepairs did not create stable dimers even when 20 out of 30 possible basepairs bonded. The use of free-solution electrophoresis in combination with a peptoid drag-tag and different fluorophores enabled precise separation of short DNA fragments to establish a new mobility shift assay for detection of primer-dimer formation. PMID:22331820

The g.763G>C SNP of the bovine FASN gene affects its promoter activity via Sp-mediated regulation: implications for the bovine lactating mammary gland.

PubMed

Ordovás, Laura; Roy, Rosa; Pampín, Sandra; Zaragoza, Pilar; Osta, Rosario; Rodríguez-Rey, Jose Carlos; Rodellar, Clementina

2008-07-15

Fatty acid synthase (FASN) is an enzyme that catalyzes de novo synthesis of fatty acids in cells. The bovine FASN gene maps to BTA 19, where several quantitative trait loci for fat-related traits have been described. Our group recently reported the identification of a single nucleotide polymorphism (SNP), g.763G>C, in the bovine FASN 5' flanking region that was significantly associated with milk fat content in dairy cattle. The g.763G>C SNP was part of a GC-rich region that may constitute a cis element for members of the Sp transcription factor family. Thus the SNP could alter the transcription factor binding ability of the FASN promoter and consequently affect the promoter activity of the gene. However, the functional consequences of the SNP on FASN gene expression are unknown. The present study was therefore directed at elucidating the underlying molecular mechanism that could explain the association of the SNP with milk fat content. Three cellular lines (3T3L1, HepG2, and MCF-7) were used to test the promoter and the transcription factor binding activities by luciferase reporter assays and electrophoretic mobility shift assays, respectively. Band shift assays were also carried out with nuclear extracts from lactating mammary gland (LMG) to further investigate the role of the SNP in this tissue. Our results demonstrate that the SNP alters the bovine FASN promoter activity in vitro and the Sp1/Sp3 binding ability of the sequence. In bovine LMG, the specific binding of Sp3 may account for the association with milk fat content.

Carrier recovery techniques on satellite mobile channels

NASA Technical Reports Server (NTRS)

Vucetic, B.; Du, J.

1990-01-01

An analytical method and a stored channel model were used to evaluate error performance of uncoded quadrature phase shift keying (QPSK) and M-ary phase shift keying (MPSK) trellis coded modulation (TCM) over shadowed satellite mobile channels in the presence of phase jitter for various carrier recovery techniques.

Transcriptional regulation of human MUC4 gene: identification of a novel inhibitory element and its nuclear binding protein.

PubMed

Zhang, Jing-Jing; Zhu, Yi; Zhang, Xiong-Fei; Liang, Wen-Biao; Xie, Kun-Ling; Tao, Jin-Qiu; Peng, Yun-Peng; Xu, Ze-Kuan; Miao, Yi

2013-08-01

The human mucin 4 (MUC4) is aberrantly expressed in pancreatic adenocarcinoma and tumor cell lines, while remaining undetectable in normal pancreas, indicating its important role in pancreatic cancer development. Although its transcriptional regulation has been investigated in considerable detail, some important elements remain unknown. The aim of the present study was to demonstrate the existence of a novel inhibitory element in the MUC4 promoter and characterize some of its binding proteins. By luciferase reporter assay, we located the inhibitory element between nucleotides -2530 and -2521 in the MUC4 promoter using a series of deletion and mutant reporter constructs. Electrophoretic mobility shift assay (EMSA) with Bxpc-3 cell nuclear extracts revealed that one protein or protein complex bind to this element. The proteins binding to this element were purified and identified as Yin Yang 1 (YY1) by mass spectrometry. Supershift assay and chromatin immunoprecipitation (ChIP) assay confirmed that YY1 binds to this element in vitro and in vivo. Moreover, transient YY1 overexpression significantly inhibited MUC4 promoter activity and endogenous MUC4 protein expression. In conclusion, we reported here a novel inhibitory element in the human MUC4 promoter. This provides additional data on MUC4 gene regulation and indicates that YY1 may be a potential target for abnormal MUC4 expression.

REGULATION OF INFLAMMATORY TRANSCRIPTION FACTORS BY HEAT SHOCK PROTEIN 70 IN PRIMARY CULTURED ASTROCYTES EXPOSED TO OXYGEN–GLUCOSE DEPRIVATION

PubMed Central

KIM, J. Y.; YENARI, M. A.; LEE, J. E.

2018-01-01

Inflammation is an important event in ischemic injury. These immune responses begin with the expression of pro-inflammatory genes modulating transcription factors, such as nuclear factor-κB (NF-κB), activator protein-1 (AP-1), and signal transducers and activator of transcription-1 (STAT-1). The 70-kDa heat shock protein (Hsp70) can both induce and arrest inflammatory reactions and lead to improved neurological outcome in experimental brain injury and ischemia. Since Hsp70 are induced under heat stress, we investigated the link between Hsp70 neuroprotection and phosphorylation of inhibitor of κB (IκB), c-Jun N-terminal kinases (JNK) and p38 through co-immunoprecipitation and enzyme-linked immunosorbent assay (ELISA) assay. Transcription factors and pro-inflammatory genes were quantified by immunoblotting, electrophoretic-mobility shift assay and reverse transcription-polymerase chain reaction assays. The results showed that heat stress led to Hsp70 overexpression which rendered neuroprotection after ischemia-like injury. Overexpression Hsp70 also interrupts the phosphorylation of IκB, JNK and p38 and bluntsDNA binding of their transcription factors (NF-κB, AP-1 and STAT-1), effectively downregulating the expression of pro-inflammatory genes inheat-pretreatedastrocytes. Takentogether, these results suggest that overexpression of Hsp70 may protect against brain ischemia via an anti-inflammatory mechanism by interrupting the phosphorylation of upstream of transcription factors. PMID:25485480

Identification of T. gondii Myosin Light Chain-1 as a Direct Target of TachypleginA-2, a Small-Molecule Inhibitor of Parasite Motility and Invasion

PubMed Central

Leung, Jacqueline M.; Tran, Fanny; Pathak, Ravindra B.; Poupart, Séverine; Heaslip, Aoife T.; Ballif, Bryan A.; Westwood, Nicholas J.; Ward, Gary E.

2014-01-01

Motility of the protozoan parasite Toxoplasma gondii plays an important role in the parasite’s life cycle and virulence within animal and human hosts. Motility is driven by a myosin motor complex that is highly conserved across the Phylum Apicomplexa. Two key components of this complex are the class XIV unconventional myosin, TgMyoA, and its associated light chain, TgMLC1. We previously showed that treatment of parasites with a small-molecule inhibitor of T. gondii invasion and motility, tachypleginA, induces an electrophoretic mobility shift of TgMLC1 that is associated with decreased myosin motor activity. However, the direct target(s) of tachypleginA and the molecular basis of the compound-induced TgMLC1 modification were unknown. We show here by “click” chemistry labelling that TgMLC1 is a direct and covalent target of an alkyne-derivatized analogue of tachypleginA. We also show that this analogue can covalently bind to model thiol substrates. The electrophoretic mobility shift induced by another structural analogue, tachypleginA-2, was associated with the formation of a 225.118 Da adduct on S57 and/or C58, and treatment with deuterated tachypleginA-2 confirmed that the adduct was derived from the compound itself. Recombinant TgMLC1 containing a C58S mutation (but not S57A) was refractory to click labelling and no longer exhibited a mobility shift in response to compound treatment, identifying C58 as the site of compound binding on TgMLC1. Finally, a knock-in parasite line expressing the C58S mutation showed decreased sensitivity to compound treatment in a quantitative 3D motility assay. These data strongly support a model in which tachypleginA and its analogues inhibit the motility of T. gondii by binding directly and covalently to C58 of TgMLC1, thereby causing a decrease in the activity of the parasite’s myosin motor. PMID:24892871

Targeted DNA sequencing and in situ mutation analysis using mobile phone microscopy

NASA Astrophysics Data System (ADS)

Kühnemund, Malte; Wei, Qingshan; Darai, Evangelia; Wang, Yingjie; Hernández-Neuta, Iván; Yang, Zhao; Tseng, Derek; Ahlford, Annika; Mathot, Lucy; Sjöblom, Tobias; Ozcan, Aydogan; Nilsson, Mats

2017-01-01

Molecular diagnostics is typically outsourced to well-equipped centralized laboratories, often far from the patient. We developed molecular assays and portable optical imaging designs that permit on-site diagnostics with a cost-effective mobile-phone-based multimodal microscope. We demonstrate that targeted next-generation DNA sequencing reactions and in situ point mutation detection assays in preserved tumour samples can be imaged and analysed using mobile phone microscopy, achieving a new milestone for tele-medicine technologies.

A novel nonsteroidal antifibrotic oligo decoy containing the TGF-beta element found in the COL1A1 gene which regulates murine schistosomiasis liver fibrosis.

PubMed

Boros, D L; Singh, K P; Gerard, H C; Hudson, A P; White, S L; Cutroneo, K R

2005-08-01

Schistosomiasis mansoni disseminated worm eggs in mice and humans induce granulomatous inflammations and cumulative fibrosis causing morbidity and possibly mortality. In this study, intrahepatic and I.V. injections of a double-stranded oligodeoxynucleotide decoy containing the TGF-beta regulatory element found in the distal promoter of the COL1A1 gene into worm-infected mice suppressed TGF-beta1, COL1A1, tissue inhibitor of metalloproteinase-1, and decreased COL3A1 mRNAs to a lesser extent. Sequence comparisons within the mouse genome found homologous sequences within the COL3A1, TGF-beta1, and TIMP-1 5' flanking regions. Cold competition gel mobility shift assays using these homologous sequences with 5' and 3' flanking regions found in the natural COL1A1 gene showed competition. Competitive gel mobility assays in a separate experiment showed no competition using a 5-base mutated or scrambled sequence. Explanted liver granulomas from saline-injected mice incorporated 10.45 +/- 1.7% (3)H-proline into newly synthesized collagen, whereas decoy-treated mice showed no collagen synthesis. Compared with the saline control schistosomiasis mice phosphorothioate double-stranded oligodeoxynucleotide treatment decreased total liver collagen content (i.e. hydroxy-4-proline) by 34%. This novel molecular approach has the potential to be employed as a novel antifibrotic treatment modality. (c) 2005 Wiley-Liss, Inc.

Airport Analyses Informing New Mobility Shifts: Opportunities to Adapt Energy-Efficient Mobility Services and Infrastructure: Preprint

DOE Office of Scientific and Technical Information (OSTI.GOV)

Henao, Alejandro; Sperling, Joshua; Young, Stanley E

An airport is one of the most important assets for a region's economic development and connectivity with the rest of the nation and world. Key aspects for investigation of energy efficient mobility at airports is ground transportation including factors ranging from the infrastructure, mobility services, and associated revenues. Data is critical to understand the maturity of new mobility services that can inform both cities and airports on how to respond, approach, manage, and adapt to the challenges, opportunities, and uncertainties associated with shifts in new mobility that influence human behavior, energy-efficiency and sustainability strategies. One key question identified in thismore » article is how quickly we are adapting to new mobility options - such as app-based ride-hailing and 'pooling' services - that may provide an opportunity to influence energy efficiency of ground transportation to and from airports. By starting with airports in the regions of four smart city finalists in the U.S. DOT Smart City Challenge, this paper focuses on key observability aspects of new modes and the rate of shifts in mobility patterns across San Francisco, Portland, Denver, and Kansas City. With the emerging megatrend of rising urbanization and rising air travel demand (a predicted doubling in demand by 2035), airports are expected to increasingly be on the front lines of adaptation to new transportation technology and services in terms of infrastructure investments, policies, and revenues. As airports have demonstrated the most potential and capability of any public institution to implement fees for new ride-hailing services, they are also a prime resource for collecting important data to help understand smart mobility transitions. Results focused on the shifts in revenues for ground transportation at airports offer one vantage point into the pace of transitions and adaptations in the new emerging mobility landscape, and present an opportunity to analyze how future adaptations could support more energy-efficient scenarios.« less

Effect of passage number on electrophoretic mobility distributions of cultured human embryonic kidney cells

NASA Technical Reports Server (NTRS)

Kunze, M. E.

1985-01-01

A systematic investigation was undertaken to characterize population shifts that occur in cultured human embryonic kidney cells as a function of passage number in vitro after original explantation. This approach to cell population shift analysis follows the suggestion of Mehreshi, Klein and Revesz that perturbed cell populations can be characterized by electrophoretic mobility distributions if they contain subpopulations with different electrophoretic mobilities. It was shown that this is the case with early passage cultured human embryo cells.

Functional characterisation of Burkholderia pseudomallei biotin protein ligase: A toolkit for anti-melioidosis drug development.

PubMed

Bond, Thomas E H; Sorenson, Alanna E; Schaeffer, Patrick M

2017-06-01

Burkholderia pseudomallei (Bp) is the causative agent of melioidosis. The bacterium is responsible for 20% of community-acquired sepsis cases and 40% of sepsis-related mortalities in northeast Thailand, and is intrinsically resistant to aminoglycosides, macrolides, rifamycins, cephalosporins, and nonureidopenicillins. There is no vaccine and its diagnosis is problematic. Biotin protein ligase (BirA) which is essential for fatty acid synthesis has been proposed as a drug target in bacteria. Very few bacterial BirA have been characterized, and a better understanding of these enzymes is necessary to further assess their value as drug targets. BirA within the Burkholderia genus have not yet been investigated. We present for the first time the cloning, expression, purification and functional characterisation of the putative Bp BirA and orthologous B. thailandensis (Bt) biotin carboxyl carrier protein (BCCP) substrate. A GFP-tagged Bp BirA was produced and applied for the development of a high-throughput (HT) assay based on our differential scanning fluorimetry of GFP-tagged proteins (DSF-GTP) principle as well as an electrophoretic mobility shift assay. Our biochemical data in combination with the new HT DSF-GTP and biotinylation activity assay could facilitate future drug screening efforts against this drug-resistant organism. Copyright © 2017 Elsevier GmbH. All rights reserved.

POZ domain transcription factor, FBI-1, represses transcription of ADH5/FDH by interacting with the zinc finger and interfering with DNA binding activity of Sp1.

PubMed

Lee, Dong-Kee; Suh, Dongchul; Edenberg, Howard J; Hur, Man-Wook

2002-07-26

The POZ domain is a protein-protein interaction motif that is found in many transcription factors, which are important for development, oncogenesis, apoptosis, and transcription repression. We cloned the POZ domain transcription factor, FBI-1, that recognizes the cis-element (bp -38 to -22) located just upstream of the core Sp1 binding sites (bp -22 to +22) of the ADH5/FDH minimal promoter (bp -38 to +61) in vitro and in vivo, as revealed by electrophoretic mobility shift assay and chromatin immunoprecipitation assay. The ADH5/FDH minimal promoter is potently repressed by the FBI-1. Glutathione S-transferase fusion protein pull-down showed that the POZ domains of FBI-1, Plzf, and Bcl-6 directly interact with the zinc finger DNA binding domain of Sp1. DNase I footprinting assays showed that the interaction prevents binding of Sp1 to the GC boxes of the ADH5/FDH promoter. Gal4-POZ domain fusions targeted proximal to the GC boxes repress transcription of the Gal4 upstream activator sequence-Sp1-adenovirus major late promoter. Our data suggest that POZ domain represses transcription by interacting with Sp1 zinc fingers and by interfering with the DNA binding activity of Sp1.

The bZIP transcription factor MdHY5 regulates anthocyanin accumulation and nitrate assimilation in apple.

PubMed

An, Jian-Ping; Qu, Feng-Jia; Yao, Ji-Fang; Wang, Xiao-Na; You, Chun-Xiang; Wang, Xiao-Fei; Hao, Yu-Jin

2017-01-01

The basic leucine zipper (bZIP) transcription factor HY5 plays a multifaceted role in plant growth and development. Here the apple MdHY5 gene was cloned based on its homology with Arabidopsis HY5 . Expression analysis demonstrated that MdHY5 transcription was induced by light and abscisic acid treatments. Electrophoretic mobility shift assays and transient expression assays subsequently showed that MdHY5 positively regulated both its own transcription and that of MdMYB10 by binding to E-box and G-box motifs, respectively. Furthermore, we obtained transgenic apple calli that overexpressed the MdHY5 gene, and apple calli coloration assays showed that MdHY5 promoted anthocyanin accumulation by regulating expression of the MdMYB10 gene and downstream anthocyanin biosynthesis genes. In addition, the transcript levels of a series of nitrate reductase genes and nitrate uptake genes in both wild-type and transgenic apple calli were detected. In association with increased nitrate reductase activities and nitrate contents, the results indicated that MdHY5 might be an important regulator in nutrient assimilation. Taken together, these results indicate that MdHY5 plays a vital role in anthocyanin accumulation and nitrate assimilation in apple.

Autoregulation and Virulence Control by the Toxin-Antitoxin System SavRS in Staphylococcus aureus

PubMed Central

Wen, Wen; Liu, Banghui; Xue, Lu; Zhu, Zhongliang; Niu, Liwen

2018-01-01

ABSTRACT Toxin-antitoxin (TA) systems play diverse physiological roles, such as plasmid maintenance, growth control, and persister cell formation, but their involvement in bacterial pathogenicity remains largely unknown. Here, we have identified a novel type II toxin-antitoxin system, SavRS, and revealed the molecular mechanisms of its autoregulation and virulence control in Staphylococcus aureus. Electrophoretic mobility shift assay and isothermal titration calorimetry data indicated that the antitoxin SavR acted as the primary repressor bound to its own promoter, while the toxin SavS formed a complex with SavR to enhance the ability to bind to the operator site. DNase I footprinting assay identified the SavRS-binding site containing a short and long palindrome in the promoter region. Further, mutation and DNase I footprinting assay demonstrated that the two palindromes were crucial for DNA binding and transcriptional repression. More interestingly, genetic deletion of the savRS system led to the increased hemolytic activity and pathogenicity in a mouse subcutaneous abscess model. We further identified two virulence genes, hla and efb, by real-time quantitative reverse transcription-PCR and demonstrated that SavR and SavRS could directly bind to their promoter regions to repress virulence gene expression. PMID:29440365

Mechanistic insights into the link between visfatin gene C-1535T polymorphism and coronary artery disease: an in vitro study.

PubMed

Wang, Yong-Sheng; Gao, Wei; Li, Hong-Fen; Wang, Ze-Mu; Zhu, Jun; Zhao, Huan; Yan, Jian-Jun; Jia, En-Zhi; Yang, Zhi-Jian; Wang, Lian-Sheng

2012-04-01

Visfatin, a pro-inflammatory cytokine predominantly released from leucocytes, is correlated with coronary artery disease (CAD). We have previously reported that the -1535C>T polymorphism (rs1330082), which located on the promoter region of visfatin, was associated with decreased risk of CAD. Here, we investigated the underlying mechanism by which this polymorphism affects the genetic susceptibility to CAD. The difference of the promoter activities between -1535T variant and -1535C allele was tested by luciferase reporter gene assay. The difference of transcription factor binding activities between T and C allele was evaluated by electrophoretic mobility shift assay. In reporter gene assay, we showed that the T variant had a significantly reduced transcriptional activity compared with the C allele. The T-variant significantly attenuated the promoter binding affinity to nuclear transcription factors and this effect became much obvious after treatment with TNF-α. Moreover, competition experiment revealed that the retarded complex formed by T-1535- or C-1535-probe binding to nuclear extracts was nearly completely inhibited by unlabeled activator protein-1 (AP-1) specific probe, indicating that AP-1 might be the target nuclear effector. Taken together, our data provided potential mechanistic link between the visfatin -1535C>T polymorphism and reduced CAD risk.

Preparative two-step purification of recombinant H1.0 linker histone and its domains.

PubMed

Ivic, Nives; Bilokapic, Silvija; Halic, Mario

2017-01-01

H1 linker histones are small basic proteins that have a key role in the formation and maintenance of higher-order chromatin structures. Additionally, many examples have shown that linker histones play an important role in gene regulation, modulated by their various subtypes and posttranslational modifications. Obtaining high amounts of very pure linker histones, especially for efficient antibody production, remains a demanding and challenging procedure. Here we present an easy and fast method to purify human linker histone H1.0 overexpressed in Escherichia coli, as well as its domains: N-terminal/globular domain and C-terminal intrinsically disordered domain. This purification protocol relies on a simple affinity chromatography step followed by cation exchange due to the highly basic properties of histone proteins. Therefore, this protocol can also be applied to other linker histones. Highly pure proteins in amounts sufficient for most biochemical experiments can be obtained. The functional quality of purified H1.0 histone and its domains has been confirmed by pull-down, gel-mobility shift assays and the nuclear import assay.

Interactions between the nuclear matrix and an enhancer of the tryptophan oxygenase gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kaneoka, Hidenori; Miyake, Katsuhide, E-mail: miyake@nubio.nagoya-u.ac.jp; Iijima, Shinji

2009-10-02

The gene for tryptophan oxygenase (TO) is expressed in adult hepatocytes in a tissue- and differentiation-specific manner. The TO promoter has two glucocorticoid-responsive elements (GREs), and its expression is regulated by glucocorticoid hormone in the liver. We found a novel GRE in close proximity to a scaffold/matrix attachment region (S/MAR) that was located around -8.5 kb from the transcriptional start site of the TO gene by electrophoretic mobility shift and chromatin immunoprecipitation (ChIP) assays. A combination of nuclear fractionation and quantitative PCR analysis showed that the S/MAR was tethered to the nuclear matrix in both fetal and adult hepatocytes. ChIPmore » assay showed that, in adult hepatocytes, the S/MAR-GRE and the promoter proximal regions interacted with lamin and heterogeneous nuclear ribonucleoprotein U in a dexamethasone dependent manner, but this was not the case in fetal cells, suggesting that developmental stage-specific expression of the TO gene might rely on the binding of the enhancer (the -8.5 kb S/MAR-GRE) and the promoter to the inner nuclear matrix.« less

G-Quadruplex Induction by the Hairpin Pyrrole-Imidazole Polyamide Dimer.

PubMed

Obata, Shunsuke; Asamitsu, Sefan; Hashiya, Kaori; Bando, Toshikazu; Sugiyama, Hiroshi

2018-02-06

The G-quadruplex (G4) is one type of higher-order structure of nucleic acids and is thought to play important roles in various biological events such as regulation of transcription and inhibition of DNA replication. Pyrrole-imidazole polyamides (PIPs) are programmable small molecules that can sequence-specifically bind with high affinity to the minor groove of double-stranded DNA (dsDNA). Herein, we designed head-to-head hairpin PIP dimers and their target dsDNA in a model G4-forming sequence. Using an electrophoresis mobility shift assay and transcription arrest assay, we found that PIP dimers could induce the structural change to G4 DNA from dsDNA through the recognition by one PIP dimer molecule of two duplex-binding sites flanking both ends of the G4-forming sequence. This induction ability was dependent on linker length. This is the first study to induce G4 formation using PIPs, which are known to be dsDNA binders. The results reported here suggest that selective G4 induction in native sequences may be achieved with PIP dimers by applying the same design strategy.

The monomeric form of Neisseria DNA mimic protein DMP19 prevents DNA from binding to the histone-like HU protein

PubMed Central

Ko, Tzu-Ping; Liao, Yi-Ting; Hsu, Kai-Cheng

2017-01-01

DNA mimicry is a direct and effective strategy by which the mimic competes with DNA for the DNA binding sites on other proteins. Until now, only about a dozen proteins have been shown to function via this strategy, including the DNA mimic protein DMP19 from Neisseria meningitides. We have shown previously that DMP19 dimer prevents the operator DNA from binding to the transcription factor NHTF. Here, we provide new evidence that DMP19 monomer can also interact with the Neisseria nucleoid-associated protein HU. Using BS3 crosslinking, gel filtration and isothermal titration calorimetry assays, we found that DMP19 uses its monomeric form to interact with the Neisseria HU dimer. Crosslinking conjugated mass spectrometry was used to investigate the binding mode of DMP19 monomer and HU dimer. Finally, an electrophoretic mobility shift assay (EMSA) confirmed that the DNA binding affinity of HU is affected by DMP19. These results showed that DMP19 is bifunctional in the gene regulation of Neisseria through its variable oligomeric forms. PMID:29220372

Differential Transcription Factor Use by the KIR2DL4 Promoter Under Constitutive and IL-2/15-Treated Conditions

PubMed Central

Presnell, Steven R.; Zhang, Lei; Chlebowy, Corrin N.; Al-Attar, Ahmad; Lutz, Charles T.

2012-01-01

KIR2DL4 is unique among human KIR genes in expression, cellular localization, structure, and function, yet the transcription factors required for its expression have not been identified. Using mutagenesis, electrophoretic mobility shift assay, and co-transfection assays, we identified two redundant Runx binding sites in the 2DL4 promoter as essential for constitutive 2DL4 transcription, with contributions by a CRE site and initiator elements. IL-2-and IL-15-stimulated human NK cell lines increased 2DL4 promoter activity, which required functional Runx, CRE, and Ets sites. Chromatin immunoprecipitation experiments show that Runx3 and Ets1 bind the 2DL4 promoter in situ. 2DL4 promoter activity had similar transcription factor requirements in T cells. Runx, CRE, and Ets binding motifs are present in 2DL4 promoters from across primate species, but other postulated transcription factor binding sites are not preserved. Differences between 2DL4 and clonally-restricted KIR promoters suggest a model that explains the unique 2DL4 expression pattern in human NK cells. PMID:22467658

Identification and characterization of cell-specific enhancer elements for the mouse ETF/Tead2 gene.

PubMed

Tanoue, Y; Yasunami, M; Suzuki, K; Ohkubo, H

2001-12-21

We have identified and characterized by transient transfection assays the cell-specific 117-bp enhancer sequence in the first intron of the mouse ETF (Embryonic TEA domain-containing factor)/Tead2 gene required for transcriptional activation in ETF/Tead2 gene-expressing cells, such as P19 cells. The 117-bp enhancer contains one GC-rich sequence (5'-GGGGCGGGG-3'), termed the GC box, and two tandemly repeated GA-rich sequences (5'-GGGGGAGGGG-3'), termed the proximal and distal GA elements. Further analyses, including transfection studies and electrophoretic mobility shift assays using a series of deletion and mutation constructs, indicated that Sp1, a putative activator, may be required to predominate over its competition with another unknown putative repressor, termed the GA element-binding factor, for binding to both the GC box, which overlapped with the proximal GA element, and the distal GA element in the 117-bp sequence in order to achieve a full enhancer activity. We also discuss a possible mechanism underlying the cell-specific enhancer activity of the 117-bp sequence.

Wogonin suppresses TNF-{alpha}-induced MMP-9 expression by blocking the NF-{kappa}B activation via MAPK signaling pathways in human aortic smooth muscle cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lee, Syng-Ook; Jeong, Yun-Jeong; Yu, Mi Hee

2006-12-08

Matrix metalloproteinase-9 (MMP-9) plays a major role in the pathogenesis of atherosclerosis and restenosis by regulating both migration and proliferation of vascular smooth muscle cells (VSMC) after an arterial injury. In this study, we examined the inhibitory effect of three major flavonoids in Scutellariae Radix, baicalin, baicalein, and wogonin, on TNF-{alpha}-induced MMP-9 expression in human aortic smooth muscle cells (HASMC). Wogonin, but not baicalin and baicalein, significantly and selectively suppressed TNF-{alpha}-induced MMP-9 expression in HASMC. Reporter gene, electrophoretic mobility shift, and Western blotting assays showed that wogonin inhibits MMP-9 gene transcriptional activity by blocking the activation of NF-{kappa}B via MAPKmore » signaling pathways. Moreover, the Matrigel migration assay showed that wogonin reduced TNF-{alpha}-induced HASMC migration. These results suggest that wogonin effectively suppresses TNF-{alpha}-induced HASMC migration through the selective inhibition of MMP-9 expression and represents a potential agent for the prevention of vascular disorders related to the migration of VSMC.« less

A functional polymorphism of the TNF-{alpha} gene that is associated with type 2 DM

DOE Office of Scientific and Technical Information (OSTI.GOV)

Susa, Shinji; Daimon, Makoto; Sakabe, Jun-Ichi

2008-05-09

To examine the association of the tumor necrosis factor-{alpha} (TNF-{alpha}) gene region with type 2 diabetes (DM), 11 single-nucleotide polymorphisms (SNPs) of the region were analyzed. The initial study using a sample set (148 cases vs. 227 controls) showed a significant association of the SNP IVS1G + 123A of the TNF-{alpha} gene with DM (p = 0.0056). Multiple logistic regression analysis using an enlarged sample set (225 vs. 716) revealed the significant association of the SNP with DM independently of any clinical traits examined (OR: 1.49, p = 0.014). The functional relevance of the SNP were examined by the electrophoreticmore » mobility shift assays using nuclear extracts from the U937 and NIH3T3 cells and luciferase assays in these cells with Simian virus 40 promoter- and TNF-{alpha} promoter-reporter gene constructs. The functional analyses showed that YY1 transcription factor bound allele-specifically to the SNP region and, the IVS1 + 123A allele had an increase in luciferase expression compared with the G allele.« less

Bisphenol A induces corticotropin-releasing hormone expression in the placental cells JEG-3.

PubMed

Huang, Hui; Tan, Wenjuan; Wang, C C; Leung, Lai K

2012-11-01

Bisphenol A is utilized to make polycarbonate plastics and is an environmental pollutant. Recent research has indicated that it is an endocrine disruptor and may interfere with reproduction. Placental corticotrophin-releasing hormone (CRH) is a peptide hormone which is involved in fetal development. Increased plasma CRH is associated with elevated risk of premature delivery. In the present study, we demonstrated that bisphenol A increased CRH mRNA expression in the placental JEG-3 cells at or above 25μM. Reporter gene assay also demonstrated that bisphenol A could induce CRH gene transactivity. Since cyclic AMP response element (CRE) is a major regulatory element located in CRH promoter, the sequence-specific binding activity was investigated by using electrophoretic mobility shift assay. Our data indicated that bisphenol A increased the CRE binding activity. Western analysis further illustrated that PKA could be the signal triggering the CRE binding and CRH gene transactivation. In summary, the present study demonstrated that bisphenol A could induce CRH expression in placental cells and the underlying signal transduction pathway was also described. Copyright © 2012 Elsevier Inc. All rights reserved.

Identification of a p53-response element in the promoter of the proline oxidase gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Maxwell, Steve A.; Kochevar, Gerald J.

2008-05-02

Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significantmore » p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.« less

Targeted DNA sequencing and in situ mutation analysis using mobile phone microscopy

PubMed Central

Kühnemund, Malte; Wei, Qingshan; Darai, Evangelia; Wang, Yingjie; Hernández-Neuta, Iván; Yang, Zhao; Tseng, Derek; Ahlford, Annika; Mathot, Lucy; Sjöblom, Tobias; Ozcan, Aydogan; Nilsson, Mats

2017-01-01

Molecular diagnostics is typically outsourced to well-equipped centralized laboratories, often far from the patient. We developed molecular assays and portable optical imaging designs that permit on-site diagnostics with a cost-effective mobile-phone-based multimodal microscope. We demonstrate that targeted next-generation DNA sequencing reactions and in situ point mutation detection assays in preserved tumour samples can be imaged and analysed using mobile phone microscopy, achieving a new milestone for tele-medicine technologies. PMID:28094784

A high-throughput three-dimensional cell migration assay for toxicity screening with mobile device-based macroscopic image analysis

PubMed Central

Timm, David M.; Chen, Jianbo; Sing, David; Gage, Jacob A.; Haisler, William L.; Neeley, Shane K.; Raphael, Robert M.; Dehghani, Mehdi; Rosenblatt, Kevin P.; Killian, T. C.; Tseng, Hubert; Souza, Glauco R.

2013-01-01

There is a growing demand for in vitro assays for toxicity screening in three-dimensional (3D) environments. In this study, 3D cell culture using magnetic levitation was used to create an assay in which cells were patterned into 3D rings that close over time. The rate of closure was determined from time-lapse images taken with a mobile device and related to drug concentration. Rings of human embryonic kidney cells (HEK293) and tracheal smooth muscle cells (SMCs) were tested with ibuprofen and sodium dodecyl sulfate (SDS). Ring closure correlated with the viability and migration of cells in two dimensions (2D). Images taken using a mobile device were similar in analysis to images taken with a microscope. Ring closure may serve as a promising label-free and quantitative assay for high-throughput in vivo toxicity in 3D cultures. PMID:24141454

Analysis of E2F factors during epidermal differentiation.

PubMed

Chang, Wing Y; Dagnino, Lina

2005-01-01

The multigene E2F family of transcription factors is central in the control of cell cycle progression. The expression and activity of E2F proteins is tightly regulated transcriptionally and posttranslationally as a function of the proliferation and differentiation status of the cell. In this chapter, we review protocols designed to determine E2F mRNA abundance in tissues by in situ hybridization techniques. The ability to culture primary epidermal keratinocytes and maintain them as either undifferentiated or terminally differentiated cells allows the biochemical and molecular characterization of changes in E2F expression and activity. Thus, we also discuss in detail methods to analyze E2F protein abundance by immunoblot and their ability to bind DNA in cultured cells using electrophoretic mobility shift assays.

Cell proteins bind to multiple sites within the 5' untranslated region of poliovirus RNA.

PubMed Central

del Angel, R M; Papavassiliou, A G; Fernández-Tomás, C; Silverstein, S J; Racaniello, V R

1989-01-01

The 5' noncoding region of poliovirus RNA contains sequences necessary for translation and replication. These functions are probably carried out by recognition of poliovirus RNA by cellular and/or viral proteins. Using a mobility-shift electrophoresis assay and 1,10-phenanthroline/Cu+ footprinting, we demonstrate specific binding of cytoplasmic factors with a sequence from nucleotides 510-629 within the 5' untranslated region (UTR). Complex formation was also observed with a second sequence (nucleotides 97-182) within the 5' UTR. These two regions of the 5' UTR appear to be recognized by distinct cell factors as determined by competition analysis and the effects of ionic strength on complex formation. However, both complexes contain eukaryotic initiation factor 2 alpha, as revealed by their reaction with specific antibody. Images PMID:2554308

Reduced osteoblast activity in the mice lacking TR4 nuclear receptor leads to osteoporosis.

PubMed

Lin, Shin-Jen; Ho, Hsin-Chiu; Lee, Yi-Fen; Liu, Ning-Chun; Liu, Su; Li, Gonghui; Shyr, Chih-Rong; Chang, Chawnshang

2012-06-07

Early studies suggested that TR4 nuclear receptor might play important roles in the skeletal development, yet its detailed mechanism remains unclear. We generated TR4 knockout mice and compared skeletal development with their wild type littermates. Primary bone marrow cells were cultured and we assayed bone differentiation by alkaline phosphatase and alizarin red staining. Primary calvaria were cultured and osteoblastic marker genes were detected by quantitative PCR. Luciferase reporter assays, chromatin immunoprecipitation (ChIP) assays, and electrophoretic mobility shift assays (EMSA) were performed to demonstrate TR4 can directly regulate bone differentiation marker osteocalcin. We first found mice lacking TR4 might develop osteoporosis. We then found that osteoblast progenitor cells isolated from bone marrow of TR4 knockout mice displayed reduced osteoblast differentiation capacity and calcification. Osteoblast primary cultures from TR4 knockout mice calvaria also showed higher proliferation rates indicating lower osteoblast differentiation ability in mice after loss of TR4. Mechanism dissection found the expression of osteoblast markers genes, such as ALP, type I collagen alpha 1, osteocalcin, PTH, and PTHR was dramatically reduced in osteoblasts from TR4 knockout mice as compared to those from TR4 wild type mice. In vitro cell line studies with luciferase reporter assay, ChIP assay, and EMSA further demonstrated TR4 could bind directly to the promoter region of osteocalcin gene and induce its gene expression at the transcriptional level in a dose dependent manner. Together, these results demonstrate TR4 may function as a novel transcriptional factor to play pathophysiological roles in maintaining normal osteoblast activity during the bone development and remodeling, and disruption of TR4 function may result in multiple skeletal abnormalities.

Andrographolide Sensitizes Ras-Transformed Cells to Radiation in vitro and in vivo

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hung, Shih-Kai; Department of Radiation Oncology, Buddhist Dalin Tzu Chi General Hospital, Chiayi, Taiwan; Tzu Chi University School of Medicine, Hualian, Taiwan

2010-07-15

Purpose: Increasing the sensitivity of tumor cells to radiation is a major goal of radiotherapy. The present study investigated the radiosensitizing effects of andrographolide and examined the molecular mechanisms of andrographolide-mediated radiosensitization. Methods and Materials: An H-ras-transformed rat kidney epithelial (RK3E) cell line was used to measure the radiosensitizing effects of andrographolide in clonogenic assays, 3-(4,5-dimethyl-2-thiazolyl)-2,5-diphenyl-2H tetrazolium bromide assays, and a xenograft tumor growth model. The mechanism of andrographolide-sensitized cell death was analyzed using annexin V staining, caspase 3 activity assays, and terminal transferase uridyl nick end labeling assays. The roles of nuclear factor kappa B (NF-{kappa}B) and Akt inmore » andrographolide-mediated sensitization were examined using reporter assays, electrophoretic mobility shift assays, and Western blotting. Results: Concurrent andrographolide treatment (10 {mu}M, 3 h) sensitized Ras-transformed cells to radiation in vitro (sensitizer enhancement ratio, 1.73). Andrographolide plus radiation (one dose of 300 mg/kg peritumor andrographolide and one dose of 6 Gy radiation) resulted in significant tumor growth delay (27 {+-} 2.5 days) compared with radiation alone (22 {+-} 1.5 days; p <.05). Radiation induced apoptotic markers (e.g., caspase-3, membrane reversion, DNA fragmentation), and andrographolide treatment did not promote radiation-induced apoptosis. However, the protein level of activated Akt was significantly reduced by andrographolide. NF-{kappa}B activity was elevated in irradiated Ras-transformed cells, and andrographolide treatment significantly reduced radiation-induced NF-{kappa}B activity. Conclusion: Andrographolide sensitized Ras-transformed cells to radiation both in vitro and in vivo. Andrographolide-mediated radiosensitization was associated with downregulation of Akt and NF-{kappa}B activity. These observations indicate that andrographolide is a novel radiosensitizing agent with potential application in cancer radiotherapy.« less

The hURAT1 rs559946 polymorphism and the incidence of gout in Han Chinese men.

PubMed

Li, C; Yu, Q; Han, L; Wang, C; Chu, N; Liu, S

2014-01-01

Our previous study identified rs559946, a human urate transporter 1 (hURAT1) single nucleotide polymorphism (SNP), as being significantly associated with risk of primary hyperuricaemia (HUA) in a Han Chinese population. In the current study we aimed to identify the genetic effects of rs559946 on gout susceptibility in Han Chinese men. A total of 335 patients with gout and 376 healthy controls were recruited for a case-control association study. To examine the functional effect of rs559946, we performed luciferase reporter assays and an electrophoretic mobility shift assay (EMSA). rs559946 was found to be significantly associated with gout susceptibility (p = 0.004), with T-allele carriers showing a decreased risk of gout [odds ratio (OR) 0.70, 95% confidence interval (CI) 0.55-0.89]. Multiple linear regression analysis identified a significant association between rs559946 genotypes and tophi. Luciferase reporter assays show increased transcriptional activity of the hURAT1 promoter with the C allele of rs559946. EMSA detected binding of nuclear proteins to both the T and C alleles, although increased binding was observed with the T allele. Cold competition assays suggest that rs559946 may bind within a glucocorticoid receptor (GR) binding motif. Our study suggests that the rs559946 polymorphism is associated with increased HUA risk and may also contribute to gout development in Han Chinese men. The T to C substitution within rs559946 increased the transcriptional activity, and potentially increases gout susceptibility.

Transferability of antibody pairs from ELISA to fiber optic surface plasmon resonance for infliximab detection

NASA Astrophysics Data System (ADS)

Van Stappen, Thomas; Lu, Jiadi; Bloemen, Maarten; Geukens, Nick; Spasic, Dragana; Delport, Filip; Verbiest, Thierry; Lammertyn, Jeroen; Gils, Ann

2015-03-01

Tumor necrosis factor (TNF)-alpha is a pleiotropic cytokine up-regulated in inflammatory bowel disease, rheumatoid arthritis and psoriasis. The introduction of anti-TNF drugs such as infliximab has revolutionized the treatment of these diseases. Recently, therapeutic drug monitoring (TDM) of infliximab has been introduced in clinical decision making to increase cost-efficiency. Nowadays, TDM is performed using radio-immunoassays, homogeneous mobility shift assays or ELISA. Unfortunately, these assays do not allow for in situ treatment optimization, because of the required sample transportation to centralized laboratories and the subsequent assay execution time. In this perspective, we evaluated the potential of fiber optic-surface plasmon resonance (FO-SPR). To achieve this goal, a panel of 55 monoclonal anti-infliximab antibodies (MA-IFX) was developed and characterized in-house, leading to the identification of nine different clusters. Based on this high diversity, 22 antibody pairs were selected and tested for their reactivity towards IFX, using one MA-IFX as capture and one MA-IFX for detection, in a sandwich type ELISA and FO-SPR. This study showed that the reactivity towards IFX of each antibody pair in ELISA is highly similar to its reactivity on FO-SPR, indicating that antibody pairs are easily transferable between both platforms. Given the fact that FO-SPR shows the potential for miniaturization and fast assay time, it can be considered a highly promising platform for on-site infliximab monitoring.

A versatile assay for RNA-binding proteins in living cells

PubMed Central

Strein, Claudia; Alleaume, Anne-Marie; Rothbauer, Ulrich; Hentze, Matthias W.; Castello, Alfredo

2014-01-01

RNA-binding proteins (RBPs) control RNA fate from synthesis to decay. Since their cellular expression levels frequently do not reflect their in vivo activity, methods are needed to assess the steady state RNA-binding activity of RBPs as well as their responses to stimuli. While electrophoresis mobility shift assays (EMSA) have been used for such determinations, their results serve at best as proxies for the RBP activities in living cells. Here, we describe a quantitative dual fluorescence method to analyze protein–mRNA interactions in vivo. Known or candidate RBPs are fused to fluorescent proteins (eGFP, YFP), expressed in cells, cross-linked in vivo to RNA by ultraviolet light irradiation, and immunoprecipitated, after lysis, with a single chain antibody fragment directed against eGFP (GFP-binding protein, GBP). Polyadenylated RNA-binding activity of fusion proteins is assessed by hybridization with an oligo(DT) probe coupled with a red fluorophore. Since UV light is directly applied to living cells, the assay can be used to monitor dynamic changes in RNA-binding activities in response to biological or pharmacological stimuli. Notably, immunoprecipitation and hybridization can also be performed with commercially available GBP-coupled 96-well plates (GFP-multiTrap), allowing highly parallel RNA-binding measurements in a single experiment. Therefore, this method creates the possibility to conduct in vivo high-throughput RNA-binding assays. We believe that this fast and simple radioactivity-free method will find many useful applications in RNA biology. PMID:24664470

Bacterial Group II Introns: Identification and Mobility Assay.

PubMed

Toro, Nicolás; Molina-Sánchez, María Dolores; Nisa-Martínez, Rafael; Martínez-Abarca, Francisco; García-Rodríguez, Fernando Manuel

2016-01-01

Group II introns are large catalytic RNAs and mobile retroelements that encode a reverse transcriptase. Here, we provide methods for their identification in bacterial genomes and further analysis of their splicing and mobility capacities.

Modems for emerging digital cellular-mobile radio system

NASA Technical Reports Server (NTRS)

Feher, Kamilo

1991-01-01

Digital modem techniques for emerging digital cellular telecommunications-mobile radio system applications are described and analyzed. In particular, theoretical performance, experimental results, principles of operation, and various architectures of pi/4-QPSK (pi/4-shifted coherent or differential QPSK) modems for second-generation US digital cellular radio system applications are presented. The spectral/power efficiency and performance of the pi/4-QPSK modems (American and Japanese digital cellular emerging standards) are studied and briefly compared to GMSK (Gaussian minimum-shift keying) modems (proposed for European DECT and GSM cellular standards). Improved filtering strategies and digital pilot-aided (digital channel sounding) techniques are also considered for pi/4-QPSK and other digital modems. These techniques could significantly improve the performance of digital cellular and other digital land mobile and satellite mobile radio systems. More spectrally efficient modem trends for future cellular/mobile (land mobile) and satellite communication systems applications are also highlighted.

E4bp4 regulates carboxylesterase 2 enzymes through repression of the nuclear receptor Rev-erbα in mice.

PubMed

Zhao, Mengjing; Zhang, Tianpeng; Yu, Fangjun; Guo, Lianxia; Wu, Baojian

2018-06-01

Carboxylesterases (CES) are a family of phase I enzymes that play an important role in xenobiotic clearance and lipid metabolism. Here, we investigate a potential role of E4 promoter-binding protein 4 (E4bp4) in regulation of Ces and CPT-11 (irinotecan, a first-line drug for treating colorectal cancer) pharmacokinetics in mice. Mouse hepatoma Hepa-1c1c7 cells were transfected with Rev-erbα expression plasmid or siRNA targeting E4bp4. The relative mRNA and protein levels of Ces enzymes in the cells or the livers of wild-type and E4bp4-deficient (E4bp4 -/- ) mice were determined by qPCR and Western blotting, respectively. Transcriptional regulation of Ces by E4bp4/Rev-erbα were investigated using luciferase reporter, mobility shift, and co-immunoprecipitation (Co-IP) assays. Pharmacokinetic studies were performed with wild-type and E4bp4 -/- mice after intraperitoneal injection of CPT-11. E4bp4 ablation down-regulated an array of hepatic Ces genes in mice. E4bp4 -/- mice also showed reduced Ces-mediated metabolism and elevated systemic exposure of CPT-11, a well-known Ces substrate. Consistently, E4bp4 knockdown reduced the expression of Ces genes (Ces2b, Ces2e and Ces2f) in Hepa-1c1c7 cells. Furthermore, Rev-erbα repressed the transcription of Ces2b, whereas E4bp4 antagonized this repressive action. Co-IP experiment confirmed a direct interaction between E4bp4 and Rev-erbα. Through a combination of promoter analysis and mobility shift assays, we demonstrated that Rev-erbα trans-repressed Ces (Ces2b) through its specific binding to the -767 to-754 bp promoter region. In conclusion, E4bp4 regulates Ces enzymes through inhibition of the transrepression activity of Rev-erbα, thereby impacting the metabolism and pharmacokinetics of Ces substrates. Copyright © 2018 Elsevier Inc. All rights reserved.

Shifting Patterns of Student Mobility in Asia

ERIC Educational Resources Information Center

Chan, Sheng-Ju

2012-01-01

During the past decade, Asia--traditionally one of the largest exporters of mobile students--has experienced major changes in student mobility within higher education. As the worldwide competition for international students has escalated, many Asian countries have adopted a wide range of mechanisms and strategies in facilitating student mobility.…

Contact lens materials, mucin fragmentation and relation to symptoms.

PubMed

Berry, Monica; Purslow, Chris; Murphy, Paul J; Pult, Heiko

2012-07-01

Mucins adhere to contact lenses (CLs), reflecting the renewal of the preocular fluid and enzymatic activity at the ocular surface. In this study, we aimed to analyze mucin fragmentation on materials new to the ocular surface and investigate whether this correlates with wearing comfort. Lenses were obtained from new CL wearers after 2 weeks each of wearing vifilcon A, followed by senofilcon A, and then by vifilcon A lenses. Symptoms were evaluated using the Ocular Surface Disease Index (OSDI). CLs were extracted in a mixture of guanidinium hydrochloride and radioimmunoprecipitation assay buffer. Mucin mobility was analyzed after electrophoresis, Western blotting, and visualization with antibodies against mucin peptide core. Mobilities, normalized to total reactivity in the lane, were compared between visits for each subject and were expressed as shifts. Mucin (MUC)5AC polymers exceeding 260 kDa were observed in agarose gels; NuPAGE resolved polymers from 260 to 3.5 kDa: when large mucins were detected, the smallest fragments were missing. Fragmentation patterns were significantly different between lens types for MUC1 (analysis of variance, P = 0.006) and MUC4 (P < 0.001) but not for MUC5AC or MUC16 (P > 0.293). Mobility shifts of MUC1 and MUC4 were significantly negatively correlated (Pearson, r = -0.908; P = 0.002). For OSDI scores >15, mucin fragmentation was unchanged, whereas for OSDI scores <15, MUC4 and MUC5AC fragments were longer on vifilcon A than on senofilcon lenses (unpaired t test, P = 0.046), irrespective of the direction of change (analysis of variance, P > 0.366). Changes in MUC1 breakdown were significantly negatively correlated to the overall OSDI score (r = -0.891, P = 0.001). In asymptomatic CL wearers, only changes in mucin fragmentation in response to a new material were consistent and fast, irrespective of CL order. Lack of change seems, therefore, to be connected with discomfort during CL wear.

SU-F-J-188: Clinical Implementation of in Room Mobile CT for Image Guided Proton Therapy

DOE Office of Scientific and Technical Information (OSTI.GOV)

Li, H; Wu, R; Poenisch, F

Purpose: To implement soft-tissue image-guided proton therapy using inroom mobile CT. Methods: Anthropomorphic phantom was first used to determine the setup accuracy using in- room mobile CT. Laser and bbs were used for the initial setup (marked isocenter). CT data was then acquired with in-room mobile CT (daily CT). The shift between the marked isocenter and the planned isocenter (final isocenter) was determined from the daily CT using in-house Computer Assisted Targeting (CAT) software. Orthogonal DRRs of the day was also generated from the daily CT. The phantom was then transferred on the treatment couch top to the treatment machinemore » using a transportation system, and again aligned to the marked isocenter. Couch shifts were made to align the phantom to the final isocenter using the shifts as determined using the CAT software, and verified using orthogonal X-ray images with the daily DRRs. Results: Phantom data suggests that following the setup procedure as described above, targeting accuracy could be within 1 mm. Patient data are being acquired and analyzed. Conclusion: In-room mobile CT is capable of providing soft-tissue image-guided proton therapy.« less

Using advertisement light-panel and CMOS image sensor with frequency-shift-keying for visible light communication.

PubMed

Chow, Chi-Wai; Shiu, Ruei-Jie; Liu, Yen-Chun; Liao, Xin-Lan; Lin, Kun-Hsien; Wang, Yi-Chang; Chen, Yi-Yuan

2018-05-14

A frequency-shift-keying (FSK) visible light communication (VLC) system is proposed and demonstrated using advertisement light-panel as transmitter and mobile-phone image sensor as receiver. The developed application program (APP) in mobile-phone can retrieve the rolling shutter effect (RSE) pattern produced by the FSK VLC signal effectively. Here, we also define noise-ratio value (NRV) to evaluate the contrast of different advertisements displayed on the light-panel. Both mobile-phones under test can achieve success rate > 96% even when the transmission distance is up to 200 cm and the NRVs are low.

A Critical Review of 13 Years of Mobile Game-Based Learning

ERIC Educational Resources Information Center

Giannakas, Filippos; Kambourakis, Georgios; Papasalouros, Andreas; Gritzalis, Stefanos

2018-01-01

With the increasing popularity of smartphones and tablets, game-based learning (GBL) is undergoing a rapid shift to mobile platforms. This transformation is driven by mobility, wireless interfaces, and built-in sensors that these smart devices offer in order to enable blended and context-sensitive mobile learning (m-Learning) activities. Thus,…

An Introduction to Current Trends and Benefits of Mobile Wireless Technology Use in Higher Education

ERIC Educational Resources Information Center

Kim, Sang Hyun; Mims, Clif; Holmes, Kerry P.

2006-01-01

The development of mobile wireless technologies has generated a considerable amount of excitement among practitioners and academics because it results in shifting the academic environment from traditional settings to mobile learning (m-learning) settings. Increasing numbers of institutions of higher education offer courses using mobile wireless…

Methanol extract of Codium fragile inhibits tumor necrosis factor-α-induced matrix metalloproteinase-9 and invasiveness of MDA-MB-231 cells by suppressing nuclear factor-κB activation.

PubMed

Dilshara, Matharage Gayani; Jayasooriya, Rajapaksha Gedara Prasad Tharanga; Kang, Chang-Hee; Choi, Yung-Hyun; Kim, Gi-Young

2016-06-01

To evaluate whether the methanol extract of Codium fragile (MECF) regulates tumor necrosis factor-α (TNF-α)-induced invasion of human breast cancer MDA-MB-231 cells by suppressing matrix metalloproteinase-9 (MMP-9). Reverse transcription-polymerase chain reaction (RT-PCR) and western blot analysis were performed to analyze the expression of MMP-9 and nuclear factor-κB (NF-κB) subunits, p65 and p50, and IκB in MDA-MB-231 cells. 3-(4,5-Dimethyl-2-thiazolyl)-2,5-diphenyl-2H-tetrazolium bromide (MTT) assay was used for cell viability. MMP-9 activity and invasion were measured by gelatin zymography and a matrigel invasion assay, respectively. NF-κB activity was measured by an electrophoretic mobility shift assay and luciferase activity. MECF had no effect on cell viability up to a concentration of 100 μg/mL in human breast cancer MDA-MB-231 cells regardless of the presence of TNF-α. MDA-MB-231 cells that were stimulated with TNF-α showed a marked increase of invasion compared to the untreated control, whereas pretreatment with MECF downregulated the TNF-α-induced invasion of MDA-MB-231 cells. Additionally, zymography, western blot analysis, and RT-PCR confirmed that MECF decreased TNF-α-induced MMP-9 expression and activity which is a key regulator for cancer invasion. According to an electrophoretic morbidity shift assay, pretreatment with MECF in MDA-MB-231 cells significantly decreased the TNF-α-induced DNA-binding activity of NF-κB, which is an important transcription factor for regulating cancer invasion-related genes such as MMP-9. Furthermore, treatment with MECF sustained the expression of p65 and p50 in response to TNF-α in the cytosolic compartment. The luciferase assay demonstrated that MECF attenuated TNF-α-induced NF-κB luciferase activity. MECF exhibited its anti-invasive capability by downregulating TNF-α-induced MMP-9 expression, resulting from the suppression of NF-κB activity in the human breast cancer cell line MDA-MB-231. Copyright © 2016 Hainan Medical College. Production and hosting by Elsevier B.V. All rights reserved.

Yeast one-hybrid system used to identify the binding proteins for rat glutathione S-transferase P enhancer I.

PubMed

Liao, Ming-Xiang; Liu, Dong-Yuan; Zuo, Jin; Fang, Fu-De

2002-03-01

To detect the trans-factors specifically binding to the strong enhancer element (GPEI) in the upstream of rat glutathione S-transferase P (GST-P) gene. Yeast one-hybrid system was used to screen rat lung MATCHMAKER cDNA library to identify potential trans-factors that can interact with core sequence of GPEI(cGPEI). Electrophoresis mobility shift assay (EMSA) was used to analyze the binding of transfactors to cGPEI. cDNA fragments coding for the C-terminal part of the transcription factor c-Jun and rat adenine nucleotide translocator (ANT) were isolated. The binding of c-Jun and ANT to GPEI core sequence were confirmed. Rat c-jun transcriptional factor and ANT may interact with cGPEI. They could play an important role in the induced expression of GST-P gene.

Mass spectrometry for identification of proteins that specifically bind to a distal enhancer of the Oct4 gene

NASA Astrophysics Data System (ADS)

Bakhmet, E. I.; Nazarov, I. B.; Artamonova, T. O.; Khodorkovsky, M. A.; Tomilin, A. N.

2017-11-01

Transcription factor Oct4 is a marker of pluripotent stem cells and has a significant role in their self-renewal. Oct4 gene is controlled by three cis-regulatory elements - proximal promoter, proximal enhancer and distal enhancer. All of these elements are targets for binding of regulatory proteins. Distal enhancer is in our research focus because of its activity in early stages of embryonic development. There are two main sequences called site 2A and site 2B that are presented in distal enhancer. For this moment proteins which bind to a site 2A (CCCCTCCCCCC) remain unknown. Using combination of in vitro method electrophoretic mobility shift assay (EMSA) and mass spectromery we identified several candidates that can regulate Oct4 gene expression through site 2A.

Interactions of trans-acting factor(s) with the estradiol response element and nuclear factor 1 of the vitellogenin II gene of Japanese quail.

PubMed

Gupta, S; Upadhayay, R; Kanungo, M S

1996-08-01

This study was directed at achieving an understanding of the mechanisms by which steroid hormones control the synthesis of vitellogenin (VTG) protein in the liver of the Japanese quail. Northern hybridization shows that administration of estradiol alone or with progesterone stimulates the synthesis of VTG mRNA. Gel mobility shift assay of DNA fragments containing the ERE and NF 1 shows that estradiol alone or with progesterone increases the levels of nuclear proteins that bind to these cis-acting elements of the promoter of the VTG gene. The cooperative effect of the two hormones seen at the level of expression of the VTG gene may be due to protein-protein interactions of trans-acting factors that bind to ERE and NF 1.

In vivo phosphorylation of a peptide tag for protein purification.

PubMed

Goux, Marine; Fateh, Amina; Defontaine, Alain; Cinier, Mathieu; Tellier, Charles

2016-05-01

To design a new system for the in vivo phosphorylation of proteins in Escherichia coli using the co-expression of the α-subunit of casein kinase II (CKIIα) and a target protein, (Nanofitin) fused with a phosphorylatable tag. The level of the co-expressed CKIIα was controlled by the arabinose promoter and optimal phosphorylation was obtained with 2 % (w/v) arabinose as inductor. The effectiveness of the phosphorylation system was demonstrated by electrophoretic mobility shift assay (NUT-PAGE) and staining with a specific phosphoprotein-staining gel. The resulting phosphorylated tag was also used to purify the phosphoprotein by immobilized metal affinity chromatography, which relies on the specific interaction of phosphate moieties with Fe(III). The use of a single tag for both the purification and protein array anchoring provides a simple and straightforward system for protein analysis.

Bovine Pancreatic Trypsin Inhibitor-Trypsin Complex as a Detection System for Recombinant Proteins

NASA Astrophysics Data System (ADS)

Borjigin, Jimo; Nathans, Jeremy

1993-01-01

Bovine pancreatic trypsin inhibitor (BPTI) binds to trypsin and anhydrotrypsin (an enzymatically inactive derivative of trypsin) with affinities of 6 x 10-14 and 1.1 x 10-13 M, respectively. We have taken advantage of the high affinity and specificity of this binding reaction to develop a protein tagging system in which biotinylated trypsin or biotinylated anhydrotrypsin is used as the reagent to detect recombinant fusion proteins into which BPTI has been inserted. Two proteins, opsin and growth hormone, were used as targets for insertional mutagenesis with BPTI. In each case, both domains of the fusion protein appear to be correctly folded. The fusion proteins can be specifically and efficiently detected by biotinylated trypsin or biotinylated anhydrotrypsin, as demonstrated by staining of transfected cells, protein blotting, affinity purification, and a mobility shift assay in SDS/polyacrylamide gels.

Molecular interactions of ROOTLESS CONCERNING CROWN AND SEMINAL ROOTS, a LOB domain protein regulating shoot-borne root initiation in maize (Zea mays L.)

PubMed Central

Majer, Christine; Xu, Changzheng; Berendzen, Kenneth W.; Hochholdinger, Frank

2012-01-01

Rootless concerning crown and seminal roots (Rtcs) encodes a LATERAL ORGAN BOUNDARIES domain (LBD) protein that regulates shoot-borne root initiation in maize (Zea mays L.). GREEN FLUORESCENT PROTEIN (GFP)-fusions revealed RTCS localization in the nucleus while its paralogue RTCS-LIKE (RTCL) was detected in the nucleus and cytoplasm probably owing to an amino acid exchange in a nuclear localization signal. Moreover, enzyme-linked immunosorbent assay (ELISA) experiments demonstrated that RTCS primarily binds to LBD DNA motifs. RTCS binding to an LBD motif in the promoter of the auxin response factor (ARF) ZmArf34 and reciprocally, reciprocal ZmARF34 binding to an auxin responsive element motif in the promoter of Rtcs was shown by electrophoretic mobility shift assay experiments. In addition, comparative qRT-PCR of wild-type versus rtcs coleoptilar nodes suggested RTCS-dependent activation of ZmArf34 expression. Consistently, luciferase reporter assays illustrated the capacity of RTCS, RTCL and ZmARF34 to activate downstream gene expression. Finally, RTCL homo- and RTCS/RTCL hetero-interaction were demonstrated in yeast-two-hybrid and bimolecular fluorescence complementation experiments, suggesting a role of these complexes in downstream gene regulation. In summary, the data provide novel insights into the molecular interactions resulting in crown root initiation in maize. PMID:22527397

Structural insights into the recognition of the internal A-rich linker from OxyS sRNA by Escherichia coli Hfq

PubMed Central

Wang, Lijun; Wang, Weiwei; Li, Fudong; Zhang, Jiahai; Wu, Jihui; Gong, Qingguo; Shi, Yunyu

2015-01-01

Small RNA OxyS is induced during oxidative stress in Escherichia coli and it is an Hfq-dependent negative regulator of mRNA translation. OxyS represses the translation of fhlA and rpoS mRNA, which encode the transcriptional activator and σs subunit of RNA polymerase, respectively. However, little is known regarding how Hfq, an RNA chaperone, interacts with OxyS at the atomic level. Here, using fluorescence polarization and tryptophan fluorescence quenching assays, we verified that the A-rich linker region of OxyS sRNA binds Hfq at its distal side. We also report two crystal structures of Hfq in complex with A-rich RNA fragments from this linker region. Both of these RNA fragments bind to the distal side of Hfq and adopt a different conformation compared with those previously reported for the (A-R-N)n tripartite recognition motif. Furthermore, using fluorescence polarization, electrophoresis mobility shift assays and in vivo translation assays, we found that an Hfq mutant, N48A, increases the binding affinity of OxyS for Hfq in vitro but is defective in the negative regulation of fhlA translation in vivo, suggesting that the normal function of OxyS depends on the details of the interaction with Hfq that may be related to the rapid recycling of Hfq in the cell. PMID:25670676

Screening for lead compounds and herbal extracts with potential anti-influenza viral activity.

PubMed

Klaywong, Konrapob; Khutrakul, Gachagorn; Choowongkomon, Kiattawee; Lekcharoensuk, Chalermpol; Petcharat, Nantawan; Leckcharoensuk, Porntippa; Ramasoota, Pongrama

2014-01-01

Nonstructural protein 1 (NS1) of the highly pathogenic avian influenza virus (H5N1) contains a conserved RNA binding domain (RBD) that inhibits antiviral functions of host-innate immune response. Dimerization of NS1 forms a central groove and binds to double stranded (ds) RNA. This region might serve as a potential drug target. In this study, three dimensional structure model of NS1 RBD protein was constructed and virtual screening was performed to identify lead compounds that bound within and around the central groove. The virtual screening showed that 5 compounds bound within the central groove with binding energy ranging between -16.05 and -17.36 Kcal/mol. Two commercially available compounds, estradiol and veratridine, were selected for using in an in vitro screening assay. The results showed that neither of the compounds could inhibit the association between dsRNA and NS1 RBD protein. In addition, 34 herbal extracts were examined for their inhibitory effects. Five of them were able to inhibit association between NS1 RBD and dsRNA in electrophoresis mobility shift assay. Four herbs, Terminalia belirica, Salacia chinensis, Zingiber montanum and Peltophorum pterocarpum, could reduce > 50% of infectivity of H5N1 in a cell-based assay, and it is worth further studying their potential use as source of antiviral drugs.

Modulation of Nrf2/Keap1 system by Wasabi 6-methylthiohexyl isothiocyanate in ARE-mediated NQO1 expression.

PubMed

Korenori, Yoshimi; Tanigawa, Shunsuke; Kumamoto, Takuma; Qin, Si; Daikoku, Yosuke; Miyamori, Koji; Nagai, Masashi; Hou, De-Xing

2013-05-01

6-Methylthiohexyl isothiocyanate (6-MTITC), one of the major bioactive ingredients in Japanese Wasabi, has revealed cytoprotective and cancer chemopreventive effects. This study aims to clarify the molecular mechanisms how 6-MTITC modulates nuclear factor E2-related factor 2 (Nrf2)/Kelchlike ECH-associating protein 1 (Keap1) system in antioxidant-responsive element (ARE)-mediated nicotinamide adenine dinucleotide phosphate (NADP): quinone oxidoreductase 1 (NQO1) expression. HepG2 cells were treated with 6-MTITC with varying time and dose. NQO1, Nrf2, and Keap1 proteins were detected by Western blotting. ARE transactivation was detected by electrophilic mobility shift assay and reporter gene assay. Nuclear localization of Nrf2 was determined by immunocytochemistry assay. Ubiquitination of Nrf2 and Keap1 was detected using immunoprecipitation after treatment with MG132. Small interfering RNA was used to knockdown Nrf2 or Keap1. The results revealed that 6-MTITC modulated Nrf2/ARE pathway by stimulating Keap1 modification, and inhibiting Nrf2 ubiquitination and protein turnover. These actions finally increased nuclear Nrf2 accumulation and ARE-binding activity. Moreover, silencing Nrf2 markedly reduced ARE-driven activity induced by 6-MTITC. 6-MTITC modulated ARE-driven NQO1 expression by stabilizing Nrf2 with enhanced Keap1 modification and decreased Nrf2 degradation. © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

AutA and AutR, Two Novel Global Transcriptional Regulators, Facilitate Avian Pathogenic Escherichia coli Infection.

PubMed

Zhuge, Xiangkai; Tang, Fang; Zhu, Hongfei; Mao, Xiang; Wang, Shaohui; Wu, Zongfu; Lu, Chengping; Dai, Jianjun; Fan, Hongjie

2016-04-26

Bacteria can change its lifestyle during inhabiting in host niches where they survive and replicate by rapidly altering gene expression pattern to accommodate the new environment. In this study, two novel regulators in avian pathogenic Escherichia coli (APEC) were identified and designated as AutA and AutR. RT-PCR and β-galactosidase assay results showed that AutA and AutR co-regulated the expression of adhesin UpaB in APEC strain DE205B. Electrophoretic mobility shift assay showed that AutA and AutR could directly bind the upaB promoter DNA. In vitro transcription assay indicated that AutA could activate the upaB transcription, while AutR inhibited the upaB transcription due to directly suppressing the activating effect of AutA on UpaB expression. Transcriptome analysis showed that AutA and AutR coherently affected the expression of hundreds of genes. Our study confirmed that AutA and AutR co-regulated the expression of DE205B K1 capsule and acid resistance systems in E. coli acid fitness island (AFI). Moreover, phenotypic heterogeneity in expression of K1 capsule and acid resistance systems in AFI during host-pathogen interaction was associated with the regulation of AutA and AutR. Collectively speaking, our studies presented that AutA and AutR are involved in APEC adaptive lifestyle change to facilitate its infection.

Molecular interactions of ROOTLESS CONCERNING CROWN AND SEMINAL ROOTS, a LOB domain protein regulating shoot-borne root initiation in maize (Zea mays L.).

PubMed

Majer, Christine; Xu, Changzheng; Berendzen, Kenneth W; Hochholdinger, Frank

2012-06-05

Rootless concerning crown and seminal roots (Rtcs) encodes a LATERAL ORGAN BOUNDARIES domain (LBD) protein that regulates shoot-borne root initiation in maize (Zea mays L.). GREEN FLUORESCENT PROTEIN (GFP)-fusions revealed RTCS localization in the nucleus while its paralogue RTCS-LIKE (RTCL) was detected in the nucleus and cytoplasm probably owing to an amino acid exchange in a nuclear localization signal. Moreover, enzyme-linked immunosorbent assay (ELISA) experiments demonstrated that RTCS primarily binds to LBD DNA motifs. RTCS binding to an LBD motif in the promoter of the auxin response factor (ARF) ZmArf34 and reciprocally, reciprocal ZmARF34 binding to an auxin responsive element motif in the promoter of Rtcs was shown by electrophoretic mobility shift assay experiments. In addition, comparative qRT-PCR of wild-type versus rtcs coleoptilar nodes suggested RTCS-dependent activation of ZmArf34 expression. Consistently, luciferase reporter assays illustrated the capacity of RTCS, RTCL and ZmARF34 to activate downstream gene expression. Finally, RTCL homo- and RTCS/RTCL hetero-interaction were demonstrated in yeast-two-hybrid and bimolecular fluorescence complementation experiments, suggesting a role of these complexes in downstream gene regulation. In summary, the data provide novel insights into the molecular interactions resulting in crown root initiation in maize.

The region of CQQQKPQRRP of PGC-1{alpha} interacts with the DNA-binding complex of FXR/RXR{alpha}

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kanaya, Eiko; Jingami, Hisato

2006-04-14

PGC-1{alpha} co-activates transcription by several nuclear receptors. To study the interaction among PGC-1{alpha}, RXR{alpha}/FXR, and DNA, we performed electrophoresis mobility shift assays. The RXR{alpha}/FXR proteins specifically bound to DNA containing the IR-1 sequence in the absence of ligand. When the fusion protein of GST-PGC-1{alpha} was added to the mixture of RXR{alpha}/FXR/DNA, the ligand-influenced retardation of the mobility was observed. The ligand for RXR{alpha} (9-cis-retinoic acid) was necessary for this retardation, whereas, the ligand for FXR, chenodeoxycholic acid, barely had an effect. The results obtained using truncated PGC-1{alpha} proteins suggested that two regions are necessary for PGC-1{alpha} to interact with themore » DNA-binding complex of RXR{alpha}/FXR. One is the region of the second leucine-rich motif, and the other is that of the amino acid sequence CQQQKPQRRP, present between the second and third leucine-rich motifs. The results obtained with the SPQSS mutation for KPQRR suggested that the basic amino acids are important for the interaction.« less

Mobility of P elements in drosophilids and nondrosophilids

USDA-ARS?s Scientific Manuscript database

The mobility properties of the Drosophila melanogaster P element in drosophilid and nondrosophilid species has been determined using a P-element mobility assay that is conducted transiently in insect embryos. P elements are mobilizable in all drosophilids tested, including species outside the genus ...

Functional overload increases beta-MHC promoter activity in rodent fast muscle via the proximal MCAT (betae3) site.

PubMed

Giger, Julia M; Haddad, Fadia; Qin, Anqi X; Baldwin, Kenneth M

2002-03-01

Functional overload (OL) of the rat plantaris muscle by the removal of synergistic muscles induces a shift in the myosin heavy chain (MHC) isoform expression profile from the fast isoforms toward the slow type I, or, beta-MHC isoform. Different length rat beta-MHC promoters were linked to a firefly luciferase reporter gene and injected in control and OL plantaris muscles. Reporter activities of -3,500, -914, -408, and -215 bp promoters increased in response to 1 wk of OL. The smallest -171 bp promoter was not responsive to OL. Mutation analyses of putative regulatory elements within the -171 and -408 bp region were performed. The -408 bp promoters containing mutations of the betae1, distal muscle CAT (MCAT; betae2), CACC, or A/T-rich (GATA), were still responsive to OL. Only the proximal MCAT (betae3) mutation abolished the OL response. Gel mobility shift assays revealed a significantly higher level of complex formation of the betae3 probe with nuclear protein from OL plantaris compared with control plantaris. These results suggest that the betae3 site functions as a putative OL-responsive element in the rat beta-MHC gene promoter.

BrWRKY65, a WRKY Transcription Factor, Is Involved in Regulating Three Leaf Senescence-Associated Genes in Chinese Flowering Cabbage.

PubMed

Fan, Zhong-Qi; Tan, Xiao-Li; Shan, Wei; Kuang, Jian-Fei; Lu, Wang-Jin; Chen, Jian-Ye

2017-06-08

Plant-specific WRKY transcription factors (TFs) have been implicated to function as regulators of leaf senescence, but their association with postharvest leaf senescence of economically important leafy vegetables, is poorly understood. In this work, the characterization of a Group IIe WRKY TF, BrWRKY65, from Chinese flowering cabbage ( Brassica rapa var. parachinensis) is reported. The expression of BrWRKY65 was up-regulated following leaf chlorophyll degradation and yellowing during postharvest senescence. Subcellular localization and transcriptional activation assays showed that BrWRKY65 was localized in the nucleus and exhibited trans-activation ability. Further electrophoretic mobility shift assay (EMSA) and transient expression analysis clearly revealed that BrWRKY65 directly bound to the W-box motifs in the promoters of three senescence-associated genes ( SAGs ) such as BrNYC1 and BrSGR1 associated with chlorophyll degradation, and BrDIN1 , and subsequently activated their expressions. These findings demonstrate that BrWRKY65 may be positively associated with postharvest leaf senescence, at least partially, by the direct activation of SAGs . Taken together, these findings provide new insights into the transcriptional regulatory mechanism of postharvest leaf senescence in Chinese flowering cabbage.

Cloning and functional analysis of 5'-upstream region of the Pokemon gene.

PubMed

Yang, Yutao; Zhou, Xiaowei; Zhu, Xudong; Zhang, Chuanfu; Yang, Zhixin; Xu, Long; Huang, Peitang

2008-04-01

Pokemon, the POK erythroid myeloid ontogenic factor, not only regulates the expression of many genes, but also plays an important role in cell tumorigenesis. To investigate the molecular mechanism regulating expression of the Pokemon gene in humans, its 5'-upstream region was cloned and analyzed. Transient analysis revealed that the Pokemon promoter is constitutive. Deletion analysis and a DNA decoy assay indicated that the NEG-U and NEG-D elements were involved in negative regulation of the Pokemon promoter, whereas the POS-D element was mainly responsible for its strong activity. Electrophoretic mobility shift assays suggested that the NEG-U, NEG-D and POS-D elements were specifically bound by the nuclear extract from A549 cells in vitro. Mutation analysis demonstrated that cooperation of the NEG-U and NEG-D elements led to negative regulation of the Pokemon promoter. Moreover, the NEG-U and NEG-D elements needed to be an appropriate distance apart in the Pokemon promoter in order to cooperate. Taken together, our results elucidate the mechanism underlying the regulation of Pokemon gene transcription, and also define a novel regulatory sequence that may be used to decrease expression of the Pokemon gene in cancer gene therapy.

Specific labeling of zinc finger proteins using noncanonical amino acids and copper-free click chemistry.

PubMed

Kim, Younghoon; Kim, Sung Hoon; Ferracane, Dean; Katzenellenbogen, John A; Schroeder, Charles M

2012-09-19

Zinc finger proteins (ZFPs) play a key role in transcriptional regulation and serve as invaluable tools for gene modification and genetic engineering. Development of efficient strategies for labeling metalloproteins such as ZFPs is essential for understanding and controlling biological processes. In this work, we engineered ZFPs containing cysteine-histidine (Cys2-His2) motifs by metabolic incorporation of the unnatural amino acid azidohomoalanine (AHA), followed by specific protein labeling via click chemistry. We show that cyclooctyne promoted [3 + 2] dipolar cycloaddition with azides, known as copper-free click chemistry, provides rapid and specific labeling of ZFPs at high yields as determined by mass spectrometry analysis. We observe that the DNA-binding activity of ZFPs labeled by conventional copper-mediated click chemistry was completely abolished, whereas ZFPs labeled by copper-free click chemistry retain their sequence-specific DNA-binding activity under native conditions, as determined by electrophoretic mobility shift assays, protein microarrays, and kinetic binding assays based on Förster resonance energy transfer (FRET). Our work provides a general framework to label metalloproteins such as ZFPs by metabolic incorporation of unnatural amino acids followed by copper-free click chemistry.

Specific Labeling of Zinc Finger Proteins using Non-canonical Amino Acids and Copper-free Click Chemistry

PubMed Central

Kim, Younghoon; Kim, Sung Hoon; Ferracane, Dean; Katzenellenbogen, John A.

2012-01-01

Zinc finger proteins (ZFPs) play a key role in transcriptional regulation and serve as invaluable tools for gene modification and genetic engineering. Development of efficient strategies for labeling metalloproteins such as ZFPs is essential for understanding and controlling biological processes. In this work, we engineered ZFPs containing cysteine-histidine (Cys2-His2) motifs by metabolic incorporation of the unnatural amino acid azidohomoalanine (AHA), followed by specific protein labeling via click chemistry. We show that cyclooctyne promoted [3 + 2] dipolar cycloaddition with azides, known as copper-free click chemistry, provides rapid and specific labeling of ZFPs at high yields as determined by mass spectrometry analysis. We observe that the DNA-binding activity of ZFPs labeled by conventional copper-mediated click chemistry was completely abolished, whereas ZFPs labeled by copper-free click chemistry retain their sequence-specific DNA-binding activity under native conditions, as determined by electrophoretic mobility shift assays, protein microarrays and kinetic binding assays based on Förster resonance energy transfer (FRET). Our work provides a general framework to label metalloproteins such as ZFPs by metabolic incorporation of unnatural amino acids followed by copper-free click chemistry. PMID:22871171

Determination of equilibrium dissociation constants for recombinant antibodies by high-throughput affinity electrophoresis.

PubMed

Pan, Yuchen; Sackmann, Eric K; Wypisniak, Karolina; Hornsby, Michael; Datwani, Sammy S; Herr, Amy E

2016-12-23

High-quality immunoreagents enhance the performance and reproducibility of immunoassays and, in turn, the quality of both biological and clinical measurements. High quality recombinant immunoreagents are generated using antibody-phage display. One metric of antibody quality - the binding affinity - is quantified through the dissociation constant (K D ) of each recombinant antibody and the target antigen. To characterize the K D of recombinant antibodies and target antigen, we introduce affinity electrophoretic mobility shift assays (EMSAs) in a high-throughput format suitable for small volume samples. A microfluidic card comprised of free-standing polyacrylamide gel (fsPAG) separation lanes supports 384 concurrent EMSAs in 30 s using a single power source. Sample is dispensed onto the microfluidic EMSA card by acoustic droplet ejection (ADE), which reduces EMSA variability compared to sample dispensing using manual or pin tools. The K D for each of a six-member fragment antigen-binding fragment library is reported using ~25-fold less sample mass and ~5-fold less time than conventional heterogeneous assays. Given the form factor and performance of this micro- and mesofluidic workflow, we have developed a sample-sparing, high-throughput, solution-phase alternative for biomolecular affinity characterization.

Determination of equilibrium dissociation constants for recombinant antibodies by high-throughput affinity electrophoresis

PubMed Central

Pan, Yuchen; Sackmann, Eric K.; Wypisniak, Karolina; Hornsby, Michael; Datwani, Sammy S.; Herr, Amy E.

2016-01-01

High-quality immunoreagents enhance the performance and reproducibility of immunoassays and, in turn, the quality of both biological and clinical measurements. High quality recombinant immunoreagents are generated using antibody-phage display. One metric of antibody quality – the binding affinity – is quantified through the dissociation constant (KD) of each recombinant antibody and the target antigen. To characterize the KD of recombinant antibodies and target antigen, we introduce affinity electrophoretic mobility shift assays (EMSAs) in a high-throughput format suitable for small volume samples. A microfluidic card comprised of free-standing polyacrylamide gel (fsPAG) separation lanes supports 384 concurrent EMSAs in 30 s using a single power source. Sample is dispensed onto the microfluidic EMSA card by acoustic droplet ejection (ADE), which reduces EMSA variability compared to sample dispensing using manual or pin tools. The KD for each of a six-member fragment antigen-binding fragment library is reported using ~25-fold less sample mass and ~5-fold less time than conventional heterogeneous assays. Given the form factor and performance of this micro- and mesofluidic workflow, we have developed a sample-sparing, high-throughput, solution-phase alternative for biomolecular affinity characterization. PMID:28008969

High affinity γPNA sandwich hybridization assay for rapid detection of short nucleic acid targets with single mismatch discrimination.

PubMed

Goldman, Johnathan M; Zhang, Li Ang; Manna, Arunava; Armitage, Bruce A; Ly, Danith H; Schneider, James W

2013-07-08

Hybridization analysis of short DNA and RNA targets presents many challenges for detection. The commonly employed sandwich hybridization approach cannot be implemented for these short targets due to insufficient probe-target binding strengths for unmodified DNA probes. Here, we present a method capable of rapid and stable sandwich hybridization detection for 22 nucleotide DNA and RNA targets. Stable hybridization is achieved using an n-alkylated, polyethylene glycol γ-carbon modified peptide nucleic acid (γPNA) amphiphile. The γPNA's exceptionally high affinity enables stable hybridization of a second DNA-based probe to the remaining bases of the short target. Upon hybridization of both probes, an electrophoretic mobility shift is measured via interaction of the n-alkane modification on the γPNA with capillary electrophoresis running buffer containing nonionic surfactant micelles. We find that sandwich hybridization of both probes is stable under multiple binding configurations and demonstrate single base mismatch discrimination. The binding strength of both probes is also stabilized via coaxial stacking on adjacent hybridization to targets. We conclude with a discussion on the implementation of the proposed sandwich hybridization assay as a high-throughput microRNA detection method.

Dissection of Arabidopsis NCED9 promoter regulatory regions reveals a role for ABA synthesized in embryos in the regulation of GA-dependent seed germination.

PubMed

Seo, Mitsunori; Kanno, Yuri; Frey, Anne; North, Helen M; Marion-Poll, Annie

2016-05-01

Nine-cis-epoxycarotenoid dioxygenase (NCED) catalyzes the key step of abscisic acid (ABA) biosynthesis. There are five genes encoding NCED in Arabidopsis, which differentially regulate ABA biosynthesis in a spatiotemporal manner in response to endogenous and environmental stimuli. Previous studies have shown that NCED9 is expressed in testa and embryos during seed development. In the present study, we have identified promoter regions required for the expression of NCED9 in testa and embryos, respectively. Electrophoretic mobility shift assays (EMSA) and yeast one-hybrid (Y1H) assays showed that several homeodomain-leucine zipper (HD-Zip) proteins, namely ATHBs, bound to the sequence required for expression of NCED9 in testa, suggesting that they redundantly regulate NCED9 expression. By expressing the NCED9 gene under the control of a deleted NCED9 promoter in an nced9 mutant expression was limited to embryos. Transformants were complemented for the paclobutrazol resistant germination phenotype of the mutant, suggesting that the ABA synthesis mediated by NCED9 in embryos plays an important role in the regulation of gibberellin (GA)-dependent seed germination. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

Rce1, a novel transcriptional repressor, regulates cellulase gene expression by antagonizing the transactivator Xyr1 in Trichoderma reesei.

PubMed

Cao, Yanli; Zheng, Fanglin; Wang, Lei; Zhao, Guolei; Chen, Guanjun; Zhang, Weixin; Liu, Weifeng

2017-07-01

Cellulase gene expression in the model cellulolytic fungus Trichoderma reesei is supposed to be controlled by an intricate regulatory network involving multiple transcription factors. Here, we identified a novel transcriptional repressor of cellulase gene expression, Rce1. Disruption of the rce1 gene not only facilitated the induced expression of cellulase genes but also led to a significant delay in terminating the induction process. However, Rce1 did not participate in Cre1-mediated catabolite repression. Electrophoretic mobility shift (EMSA) and DNase I footprinting assays in combination with chromatin immunoprecipitation (ChIP) demonstrated that Rce1 could bind directly to a cbh1 (cellobiohydrolase 1-encoding) gene promoter region containing a cluster of Xyr1 binding sites. Furthermore, competitive binding assays revealed that Rce1 antagonized Xyr1 from binding to the cbh1 promoter. These results indicate that intricate interactions exist between a variety of transcription factors to ensure tight and energy-efficient regulation of cellulase gene expression in T. reesei. This study also provides important clues regarding increased cellulase production in T. reesei. © 2017 John Wiley & Sons Ltd.

The transcription of the human fructose-bisphosphate aldolase C gene is activated by nerve-growth-factor-induced B factor in human neuroblastoma cells.

PubMed Central

Buono, P; Conciliis, L D; Izzo, P; Salvatore, F

1997-01-01

A DNA region located at around -200 bp in the 5' flanking region (region D) of the human brain-type fructose-bisphosphate aldolase (aldolase C) gene has been analysed. We show by transient transfection assay and electrophoretic-mobility-shift assay (EMSA) that the binding of transcriptional activators to region D is much more efficient (80% versus 30%) in human neuroblastoma cells (SKNBE) than in the non-neuronal cell line A1251, which contains low levels of aldolase C mRNA. The sequence of region D, CAAGGTCA, is very similar to the AAAGGTCA motif present in the mouse steroid 21-hydroxylase gene; the latter motif binds nerve-growth-factor-induced B factor (NGFI-B), which is a member of the thyroid/steroid/retinoid nuclear receptor gene family. Competition experiments in EMSA and antibody-directed supershift experiments showed that NGFI-B is involved in the binding to region D of the human aldolase C gene. Furthermore, the regulation of the aldolase C gene (which is the second known target of NGFI-B) expression during development parallels that of NGFI-B. PMID:9173889

Involvement of the Global Crp Regulator in Cyclic AMP-Dependent Utilization of Aromatic Amino Acids by Pseudomonas putida

PubMed Central

Herrera, M. Carmen; Daddaoua, Abdelali; Fernández-Escamilla, Ana

2012-01-01

The phhAB operon encodes a phenylalanine hydroxylase involved in the conversion of l-phenylalanine into l-tyrosine in Pseudomonas putida. The phhAB promoter is transcribed by RNA polymerase sigma-70 and is unusual in that the specific regulator PhhR acts as an enhancer protein that binds to two distant upstream sites (−75 to −92 and −132 to −149). There is an integration host factor (IHF) binding site that overlaps the proximal PhhR box, and, consequently, IHF acts as an inhibitor of transcription. Use of l-phenylalanine is compromised in a crp-deficient background due to reduced expression from the phhAB promoter. Electrophoretic mobility shift assays and DNase I footprinting assays reveal that Crp binds at a site centered at −109 only in the presence of cyclic AMP (cAMP). We show, using circular permutation analysis, that the simultaneous binding of Crp/cAMP and PhhR bends DNA to bring positive regulators and RNA polymerase into close proximity. This nucleoprotein complex promotes transcription from phhA only in response to l-phenylalanine. PMID:22081386

The LacI family protein GlyR3 co-regulates the celC operon and manB in Clostridium thermocellum

DOE PAGES

Choi, Jinlyung; Klingeman, Dawn M.; Brown, Steven D.; ...

2017-06-24

In this paper, we demonstrate that the GlyR3 protein mediates the regulation of manB. We first identify putative GlyR3 binding sites within or just upstream of the coding regions of manB and celT. Using an electrophoretic mobility shift assay (EMSA), we determined that a higher concentration of GlyR3 is required to effectively bind to the putative manB site in comparison to the celC site. Neither the putative celT site nor random DNA significantly binds GlyR3. While laminaribiose interfered with GlyR3 binding to the celC binding site, binding to the manB site was unaffected. In the presence of laminaribiose, in vivomore » transcription of the celC–glyR3–licA gene cluster increases, while manB expression is repressed, compared to in the absence of laminaribiose, consistent with the results from the EMSA. An in vitro transcription assay demonstrated that GlyR3 and laminaribiose interactions were responsible for the observed patters of in vivo transcription.« less

In Vitro Antiviral Activity of Circular Triple Helix Forming Oligonucleotide RNA towards Feline Infectious Peritonitis Virus Replication

PubMed Central

Choong, Oi Kuan; Tejo, Bimo Ario; Omar, Abdul Rahman

2014-01-01

Feline Infectious Peritonitis (FIP) is a severe fatal immune-augmented disease in cat population. It is caused by FIP virus (FIPV), a virulent mutant strain of Feline Enteric Coronavirus (FECV). Current treatments and prophylactics are not effective. The in vitro antiviral properties of five circular Triple-Helix Forming Oligonucleotide (TFO) RNAs (TFO1 to TFO5), which target the different regions of virulent feline coronavirus (FCoV) strain FIPV WSU 79-1146 genome, were tested in FIPV-infected Crandell-Rees Feline Kidney (CRFK) cells. RT-qPCR results showed that the circular TFO RNAs, except TFO2, inhibit FIPV replication, where the viral genome copy numbers decreased significantly by 5-fold log10 from 1014 in the virus-inoculated cells to 109 in the circular TFO RNAs-transfected cells. Furthermore, the binding of the circular TFO RNA with the targeted viral genome segment was also confirmed using electrophoretic mobility shift assay. The strength of binding kinetics between the TFO RNAs and their target regions was demonstrated by NanoITC assay. In conclusion, the circular TFOs have the potential to be further developed as antiviral agents against FIPV infection. PMID:24707494

Pip, a Novel Activator of Phenazine Biosynthesis in Pseudomonas chlororaphis PCL1391▿ †

PubMed Central

Girard, Geneviève; Barends, Sharief; Rigali, Sébastien; van Rij, E. Tjeerd; Lugtenberg, Ben J. J.; Bloemberg, Guido V.

2006-01-01

Secondary metabolites are important factors for interactions between bacteria and other organisms. Pseudomonas chlororaphis PCL1391 produces the antifungal secondary metabolite phenazine-1-carboxamide (PCN) that inhibits growth of Fusarium oxysporum f. sp. radius lycopersici the causative agent of tomato foot and root rot. Our previous work unraveled a cascade of genes regulating the PCN biosynthesis operon, phzABCDEFGH. Via a genetic screen, we identify in this study a novel TetR/AcrR regulator, named Pip (phenazine inducing protein), which is essential for PCN biosynthesis. A combination of a phenotypical characterization of a pip mutant, in trans complementation assays of various mutant strains, and electrophoretic mobility shift assays identified Pip as the fifth DNA-binding protein so far involved in regulation of PCN biosynthesis. In this regulatory pathway, Pip is positioned downstream of PsrA (Pseudomonas sigma factor regulator) and the stationary-phase sigma factor RpoS, while it is upstream of the quorum-sensing system PhzI/PhzR. These findings provide further evidence that the path leading to the expression of secondary metabolism gene clusters in Pseudomonas species is highly complex. PMID:16997957

LEGO plot for simultaneous application of multiple quality requirements during trueness verification of quantitative laboratory tests.

PubMed

Park, Hae-il; Chae, Hyojin; Kim, Myungshin; Lee, Jehoon; Kim, Yonggoo

2014-03-01

We developed a two-dimensional plot for viewing trueness that takes into account potential shift and variable quality requirements to verify trueness using certified reference material (CRM). Glucose, total cholesterol (TC), and creatinine levels were determined by two kinds of assay in two levels of a CRM. Available quality requirements were collected, codified, and sorted in an ascending order in the plot's header row. Centering on the mean of measured values from CRM, the "mean ± US CLIA '88 allowable total error" was located in the header of the leftmost and rightmost columns. Twenty points were created in intervening columns as potential shifts. Uncertainties were calculated according to regression between certified values and uncertainties of CRM, and positioned in the corresponding columns. Cells were assigned different colors where column and row intersected based on comparison of the 95% confidence interval of the percentage bias with each quality requirement. A glucose assay failed to meet the highest quality criteria, for which shift of +0.13-0.14 mmol/l was required. A TC assay met the quality requirement and a shift of ±0.03 mmol/l was tolerable. A creatinine assay also met the quality requirement but any shift was not tolerable. The plot provides a systematic view of the trueness of quantitative laboratory tests. © 2014 Wiley Periodicals, Inc.

Mating patterns and pollinator mobility are critical traits in forest fragmentation genetics

PubMed Central

Breed, M F; Ottewell, K M; Gardner, M G; Marklund, M H K; Dormontt, E E; Lowe, A J

2015-01-01

Most woody plants are animal-pollinated, but the global problem of habitat fragmentation is changing the pollination dynamics. Consequently, the genetic diversity and fitness of the progeny of animal-pollinated woody plants sired in fragmented landscapes tend to decline due to shifts in plant-mating patterns (for example, reduced outcrossing rate, pollen diversity). However, the magnitude of this mating-pattern shift should theoretically be a function of pollinator mobility. We first test this hypothesis by exploring the mating patterns of three ecologically divergent eucalypts sampled across a habitat fragmentation gradient in southern Australia. We demonstrate increased selfing and decreased pollen diversity with increased fragmentation for two small-insect-pollinated eucalypts, but no such relationship for the mobile-bird-pollinated eucalypt. In a meta-analysis, we then show that fragmentation generally does increase selfing rates and decrease pollen diversity, and that more mobile pollinators tended to dampen these mating-pattern shifts. Together, our findings support the premise that variation in pollinator form contributes to the diversity of mating-pattern responses to habitat fragmentation. PMID:24002239

Kaempferol acts through mitogen-activated protein kinases and protein kinase B/AKT to elicit protection in a model of neuroinflammation in BV2 microglial cells

PubMed Central

Park, SE; Sapkota, K; Kim, S; Kim, H; Kim, SJ

2011-01-01

BACKGROUND AND PURPOSE Kaempferol, a dietary flavonoid and phyto-oestrogen, is known to have anti-inflammatory properties. Microglial activation has been implicated in various neurodegenerative diseases. Anti-inflammatory effects of kaempferol and the underlying mechanisms were investigated by using LPS-stimulated microglial BV2 cells. EXPERIMENTAL APPROACH Cell viability was measured using MTT and neutral red assays. elisa, Western blot, immunocytochemistry and electrophoretic mobility-shift assay were used to analyse NO, PGE2, TNF-α and IL-1β production, inducible NOS (iNOS), COX-2 expression and the involvement of signalling pathways such as toll-like receptor-4 (TLR4), MAPK cascades, PKB (AKT) and NF-κB. Accumulation of reaction oxygen species (ROS) was measured by nitroblue tetrazolium and 2′7′-dichlorofluorescein diacetate assay. Matrix metalloproteinase activity was investigated by zymography and immunoblot assay. Phagocytotic activity was assessed by use of latex beads. KEY RESULTS Kaempferol significantly attenuated LPS-induced NO, PGE2, TNF-α, IL-1β and ROS production and phagocytosis in a concentration-dependent manner. Kaempferol suppressed the expression of iNOS, COX-2, MMP-3 and blocked the TLR4 activation. Moreover, kaempferol inhibited LPS-induced NF-κB activation and p38 MAPK, JNK and AKT phosphorylation. CONCLUSION AND IMPLICATIONS Kaempferol was able to reduce LPS-induced inflammatory mediators through the down-regulation of TLR4, NF-κB, p38 MAPK, JNK and AKT suggesting that kaempferol has therapeutic potential for the treatment of neuroinflammatory diseases. PMID:21449918

An evaluation of transport mode shift policies on transport-related physical activity through simulations based on random forests.

PubMed

Brondeel, Ruben; Kestens, Yan; Chaix, Basile

2017-10-23

Physical inactivity is widely recognized as one of the leading causes of mortality, and transport accounts for a large part of people's daily physical activity. This study develops a simulation approach to evaluate the impact of the Ile-de-France Urban Mobility Plan (2010-2020) on physical activity, under the hypothesis that the intended transport mode shifts are realized. Based on the Global Transport Survey (2010, n = 21,332) and on the RECORD GPS Study (2012-2013, n = 229) from the French capital region of Paris (Ile-de-France), a simulation method was designed and tested. The simulation method used accelerometer data and random forest models to predict the impact of the transport mode shifts anticipated in the Mobility Plan on transport-related moderate-to-vigorous physical activity (T-MVPA). The transport mode shifts include less private motorized trips in favor of more public transport, walking, and biking trips. The simulation model indicated a mean predicted increase of 2 min per day of T-MVPA, in case the intended transport mode shifts in the Ile-de-France Urban Mobility Plan were realized. The positive effect of the transport mode shifts on T-MVPA would, however, be larger for people with a higher level of education. This heterogeneity in the positive effect would further increase the existing inequality in transport-related physical activity by educational level. The method presented in this paper showed a significant increase in transport-related physical activity in case the intended mode shifts in the Ile-de-France Urban Mobility Plan were realized. This simulation method could be applied on other important health outcomes, such as exposure to noise or air pollution, making it a useful tool to anticipate the health impact of transport interventions or policies.

Chemical composition, antioxidant, antitumor, anticancer and cytotoxic effects of Psidium guajava leaf extracts.

PubMed

Ashraf, Aisha; Sarfraz, Raja Adil; Rashid, Muhammad Abid; Mahmood, Adeel; Shahid, Muhammad; Noor, Nadia

2016-10-01

Context Psidium guajava L. (Myrtaceae) leaves are used in traditional medicines for the treatment of cancer, inflammation and other ailments. Objective The current study explores scientific validation for this traditional medication. Materials and methods We used ferric-reducing antioxidant power (FRAP) and 2,2-diphenyl-1-picryl hydrazil (DPPH) assays to estimate antioxidant activity of P. guajava leaf extracts (methanol, hexane and chloroform). Antitumour and in vivo cytotoxic activities were determined using potato disc assay (PDA) and brine shrimp lethality assay, respectively. Three human carcinoma cell lines (KBM5, SCC4 and U266) were incubated with different doses (10-100 μg/mL) of extracts and the anticancer activity was estimated by MTT assay. NF-κB suppressing activity was determined using electrophoretic mobility shift assay (EMSA). Chemical composition of the three extracts was identified by GC-MS. Total phenolic and flavonoid contents were measured by colorimetric assays. Results and discussions The order of antioxidant activity of three extracts was methanol > chloroform > hexane. The IC50 values ranged from 22.73 to 51.65 μg/mL for KBM5; 22.82 to 70.25 μg/mL for SCC4 and 20.97 to 89.55 μg/mL for U266 cells. The hexane extract exhibited potent antitumour (IC50  value = 65.02 μg/mL) and cytotoxic (LC50  value = 32.18 μg/mL) activities. This extract also completely inhibited the TNF-α induced NF-κB activation in KBM5 cells. GC-MS results showed that pyrogallol, palmitic acid and vitamin E were the major components of methanol, chloroform and hexane extracts. We observed significant (p < 0.05) difference in total phenolic and flavonoid contents of different solvent extracts. Conclusion The present study demonstrates that P. guajava leaf extracts play a substantial role against cancer and down-modulate inflammatory nuclear factor kB.

Bee venom suppresses PMA-mediated MMP-9 gene activation via JNK/p38 and NF-kappaB-dependent mechanisms.

PubMed

Cho, Hyun-Ji; Jeong, Yun-Jeong; Park, Kwan-Kyu; Park, Yoon-Yub; Chung, Il-Kyung; Lee, Kwang-Gill; Yeo, Joo-Hong; Han, Sang-Mi; Bae, Young-Seuk; Chang, Young-Chae

2010-02-17

Bee venom has been used for the treatment of inflammatory diseases such as rheumatoid arthritis and for the relief of pain in traditional oriental medicine. The purpose of this study is to elucidate the effects of bee venom on MMP-9 expression and determine possible mechanisms by which bee venom relieves or prevents the expression of MMP-9 during invasion and metastasis of breast cancer cells. We examined the expression and activity of MMP-9 and possible signaling pathway affected in PMA-induced MCF-7 cells. Bee venom was obtained from the National Institute of Agricultural Science and Technology of Korea. Matrigel invasion assay, wound-healing assay, zymography assay, western blot assay, electrophoretic mobility shift assay and luciferase gene assay were used for assessment. Bee venom inhibited cell invasion and migration, and also suppressed MMP-9 activity and expression, processes related to tumor invasion and metastasis, in PMA-induced MCF-7 cells. Bee venom specifically suppressed the phosphorylation of p38/JNK and at the same time, suppressed the protein expression, DNA binding and promoter activity of NF-kappaB. The levels of phosphorylated ERK1/2 and c-Jun did not change. We also investigated MMP-9 inhibition by melittin, apamin and PLA(2), representative single component of bee venom. We confirmed that PMA-induced MMP-9 activity was significantly decreased by melittin, but not by apamin and phospholipase A(2). These data demonstrated that the expression of MMP-9 was abolished by melittin, the main component of bee venom. Bee venom inhibits PMA-induced MMP-9 expression and activity by inhibition of NF-kappaB via p38 MAPK and JNK signaling pathways in MCF-7 cells. These results indicate that bee venom can be a potential anti-metastatic and anti-invasive agent. This useful effect may lead to future clinical research on the anti-cancer properties of bee venom. Copyright 2009 Elsevier Ireland Ltd. All rights reserved.

Altering the orientation of a fused protein to the RNA-binding ribosomal protein L7Ae and its derivatives through circular permutation.

PubMed

Ohuchi, Shoji J; Sagawa, Fumihiko; Sakamoto, Taiichi; Inoue, Tan

2015-10-23

RNA-protein complexes (RNPs) are useful for constructing functional nano-objects because a variety of functional proteins can be displayed on a designed RNA scaffold. Here, we report circular permutations of an RNA-binding protein L7Ae based on the three-dimensional structure information to alter the orientation of the displayed proteins on the RNA scaffold. An electrophoretic mobility shift assay and atomic force microscopy (AFM) analysis revealed that most of the designed circular permutants formed an RNP nano-object. Moreover, the alteration of the enhanced green fluorescent protein (EGFP) orientation was confirmed with AFM by employing EGFP on the L7Ae permutant on the RNA. The results demonstrate that targeted fine-tuning of the stereo-specific fixation of a protein on a protein-binding RNA is feasible by using the circular permutation technique. Copyright © 2015 Elsevier Inc. All rights reserved.

EMSA Analysis of DNA Binding By Rgg Proteins

PubMed Central

LaSarre, Breah; Federle, Michael J.

2016-01-01

In bacteria, interaction of various proteins with DNA is essential for the regulation of specific target gene expression. Electrophoretic mobility shift assay (EMSA) is an in vitro approach allowing for the visualization of these protein-DNA interactions. Rgg proteins comprise a family of transcriptional regulators widespread among the Firmicutes. Some of these proteins function independently to regulate target gene expression, while others have now been demonstrated to function as effectors of cell-to-cell communication, having regulatory activities that are modulated via direct interaction with small signaling peptides. EMSA analysis can be used to assess DNA binding of either type of Rgg protein. EMSA analysis of Rgg protein activity has facilitated in vitro confirmation of regulatory targets, identification of precise DNA binding sites via DNA probe mutagenesis, and characterization of the mechanism by which some cognate signaling peptides modulate Rgg protein function (e.g. interruption of DNA-binding in some cases). PMID:27430004

EMSA Analysis of DNA Binding By Rgg Proteins.

PubMed

LaSarre, Breah; Federle, Michael J

2013-08-20

In bacteria, interaction of various proteins with DNA is essential for the regulation of specific target gene expression. Electrophoretic mobility shift assay (EMSA) is an in vitro approach allowing for the visualization of these protein-DNA interactions. Rgg proteins comprise a family of transcriptional regulators widespread among the Firmicutes. Some of these proteins function independently to regulate target gene expression, while others have now been demonstrated to function as effectors of cell-to-cell communication, having regulatory activities that are modulated via direct interaction with small signaling peptides. EMSA analysis can be used to assess DNA binding of either type of Rgg protein. EMSA analysis of Rgg protein activity has facilitated in vitro confirmation of regulatory targets, identification of precise DNA binding sites via DNA probe mutagenesis, and characterization of the mechanism by which some cognate signaling peptides modulate Rgg protein function ( e.g. interruption of DNA-binding in some cases).

[The effect of hypoxia preconditioning no binding activity of HIF-1 on the HRE with EPO in the hippocampus of mice].

PubMed

Shao, Guo; Zhou, Wei-Hua; Gao, Cui-Ying; Zhang, Ran; Lu, Guo-Wei

2007-02-01

To observe change of binding activity of HIF-1 with erythropoietin (EPO) hypoxia response element (HRE) in the hippocampus of mice preconditioned to hypoxia and explore relationship between the changes and the preconditioning. The hippocampus was removed from mice exposed to hypoxia for 0 run (control group), 1 run (H1 group) and 4 runs(H4 group). Electrophoretic mobility shift assays (EMSA), chromatin immunoprecipitation (ChIP)and real time PCR were used to detect the change of activity of HIF-1 on HRE of EPO. Both in vitro and in vivo binding tests showed that the HIF-1 DNA-binding activities were increased in group H1 and markedly increased in group H4. The increase of HIF-1 and HRE of EPO binding activities is thought be involved in hypoxic preconditioning.

Synthesis of linear polyethylenimine derivatives for DNA transfection.

PubMed

Brissault, Blandine; Kichler, Antoine; Guis, Christine; Leborgne, Christian; Danos, Olivier; Cheradame, Hervé

2003-01-01

A series of linear polymers containing varying amounts of ethylenimine or N-propylethylenimine units were synthesized by hydrolysis and/or reduction of polyethyloxazolines. The pK(a)s of the polyamines were determined potentiometrically. Gel mobility shift assay showed that the efficiency of DNA complexation was related to the fraction of amino groups that are protonated at neutral pH. The effects of cationic charge density and molar weight of the polymers on the transfection efficiency were evaluated on HepG2 cells. The results obtained with different copolymers show that the transfection efficiency primarily depends on the fraction of ethylenimine units included in the polymer albeit the molar weight is also of importance. On the basis of the results obtained with poly(N-propylethylenimines), we also demonstrate that the high transfection efficiency of polyethylenimines does not solely rely on their capacity to capture protons which are transferred into the endo-lysosomes during acidification.

Mismatch repair factor MSH2-MSH3 binds and alters the conformation of branched DNA structures predicted to form during genetic recombination.

PubMed

Surtees, Jennifer A; Alani, Eric

2006-07-14

Genetic studies in Saccharomyces cerevisiae predict that the mismatch repair (MMR) factor MSH2-MSH3 binds and stabilizes branched recombination intermediates that form during single strand annealing and gene conversion. To test this model, we constructed a series of DNA substrates that are predicted to form during these recombination events. We show in an electrophoretic mobility shift assay that S. cerevisiae MSH2-MSH3 specifically binds branched DNA substrates containing 3' single-stranded DNA and that ATP stimulates its release from these substrates. Chemical footprinting analyses indicate that MSH2-MSH3 specifically binds at the double-strand/single-strand junction of branched substrates, alters its conformation and opens up the junction. Therefore, MSH2-MSH3 binding to its substrates creates a unique nucleoprotein structure that may signal downstream steps in repair that include interactions with MMR and nucleotide excision repair factors.

Altering the orientation of a fused protein to the RNA-binding ribosomal protein L7Ae and its derivatives through circular permutation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ohuchi, Shoji J.; Sagawa, Fumihiko; Sakamoto, Taiichi

RNA-protein complexes (RNPs) are useful for constructing functional nano-objects because a variety of functional proteins can be displayed on a designed RNA scaffold. Here, we report circular permutations of an RNA-binding protein L7Ae based on the three-dimensional structure information to alter the orientation of the displayed proteins on the RNA scaffold. An electrophoretic mobility shift assay and atomic force microscopy (AFM) analysis revealed that most of the designed circular permutants formed an RNP nano-object. Moreover, the alteration of the enhanced green fluorescent protein (EGFP) orientation was confirmed with AFM by employing EGFP on the L7Ae permutant on the RNA. Themore » results demonstrate that targeted fine-tuning of the stereo-specific fixation of a protein on a protein-binding RNA is feasible by using the circular permutation technique.« less

Regulation of hepatitis B virus ENI enhancer activity by hepatocyte-enriched transcription factor HNF3.

PubMed

Chen, M; Hieng, S; Qian, X; Costa, R; Ou, J H

1994-11-15

Hepatitis B virus (HBV) ENI enhancer can activate the expression of HBV and non-HBV genes in a liver-specific manner. By performing the electrophoretic mobility-shift assays, we demonstrated that the three related, liver-enriched, transcription factors, HNF3 alpha, HNF3 beta, and HNF3 gamma could all bind to the 2c site of HBV ENI enhancer. Mutations introduced in the 2c site to abolish the binding by HNF3 reduced the enhancer activity approximately 15-fold. Moreover, expression of HNF3 antisense sequences to suppress the expression of HNF3 in Huh-7 hepatoma cells led to reduction of the ENI enhancer activity. These results indicate that HNF3 positively regulates the ENI enhancer activity and this regulation is most likely mediated through the 2c site. The requirement of HNF3 for the ENI enhancer activity could explain the liver specificity of this enhancer element.

Supramolecular polymer formation by cyclic dinucleotides and intercalators affects dinucleotide enzymatic processing

PubMed Central

Nakayama, Shizuka; Zhou, Jie; Zheng, Yue; Szmacinski, Henryk; Sintim, Herman O

2016-01-01

Background: Cyclic dinucleotides form supramolecular aggregates with intercalators, and this property could be utilized in nanotechnology and medicine. Methods & results: Atomic force microscopy and electrophoretic mobility shift assays were used to show that cyclic diguanylic acid (c-di-GMP) forms G-wires in the presence of intercalators. The average fluorescence lifetime of thiazole orange, when bound to c-di-GMP was greater than when bound to DNA G-quadruplexes or dsDNA. The stability of c-di-GMP supramolecular polymers is dependent on both the nature of the cation present and the intercalator. C-di-GMP or cyclic diadenylic acid/intercalator complexes are more resistant to cleavage by YybT, a phosphodiesterase, than the uncomplexed nucleotides. Conclusion: Cleavage of bacterial cyclic dinucleotides could be slowed down via complexation with small molecules and that this could be utilized for diverse applications in nanotechnology and medicine. PMID:28031943

A Polypyrimidine Tract Binding Protein, Pumpkin RBP50, Forms the Basis of a Phloem-Mobile Ribonucleoprotein Complex[W

PubMed Central

Ham, Byung-Kook; Brandom, Jeri L.; Xoconostle-Cázares, Beatriz; Ringgold, Vanessa; Lough, Tony J.; Lucas, William J.

2009-01-01

RNA binding proteins (RBPs) are integral components of ribonucleoprotein (RNP) complexes and play a central role in RNA processing. In plants, some RBPs function in a non-cell-autonomous manner. The angiosperm phloem translocation stream contains a unique population of RBPs, but little is known regarding the nature of the proteins and mRNA species that constitute phloem-mobile RNP complexes. Here, we identified and characterized a 50-kD pumpkin (Cucurbita maxima cv Big Max) phloem RNA binding protein (RBP50) that is evolutionarily related to animal polypyrimidine tract binding proteins. In situ hybridization studies indicated a high level of RBP50 transcripts in companion cells, while immunolocalization experiments detected RBP50 in both companion cells and sieve elements. A comparison of the levels of RBP50 present in vascular bundles and phloem sap indicated that this protein is highly enriched in the phloem sap. Heterografting experiments confirmed that RBP50 is translocated from source to sink tissues. Collectively, these findings established that RBP50 functions as a non-cell-autonomous RBP. Protein overlay, coimmunoprecipitation, and cross-linking experiments identified the phloem proteins and mRNA species that constitute RBP50-based RNP complexes. Gel mobility-shift assays demonstrated that specificity, with respect to the bound mRNA, is established by the polypyrimidine tract binding motifs within such transcripts. We present a model for RBP50-based RNP complexes within the pumpkin phloem translocation stream. PMID:19122103

Xylem specific activation of 5' upstream regulatory region of two NAC transcription factors (MusaVND6 and MusaVND7) in banana is regulated by SNBE-like sites.

PubMed

Negi, Sanjana; Tak, Himanshu; Ganapathi, T R

2018-01-01

Deposition of secondary cell wall in the xylem elements is controlled by a subgroup of NAC (NAM, ATAF, CUC) family, known as vascular-related NAC transcription factors (VNDs). In the present study, we analyzed the 5' upstream regulatory region of two banana NAC transcription factors (MusaVND6 and MusaVND7) for tissue specific expression and presence of 19-bp secondary-wall NAC binding element (SNBE)-like motifs. Transgenic banana plants of Musa cultivar Rasthali harboring either PMusaVND7::GUS or PMusaVND6::GUS showed specific GUS (β-D-Glucuronidase) activity in cells of the xylem tissue. Approximately 1.2kb promoter region of either MusaVND6 or MusaVND7 showed presence of at least two SNBE-like motifs. This 1.2kb promoter region was retarded in a gel shift assay by three banana VND protein (VND1,VND2 and VND3). The banana VND1-VND3 could also retard the mobility of isolated SNBE-like motifs of MusaVND6 or MusaVND7 in a gel shift assay. Transcript levels of MusaVND6 and MusaVND7 were elevated in transgenic banana overexpressing either banana VND1, VND2 or VND3. Present study suggested a probable regulation of banana VND6 and VND7 expression through direct interaction of banana VND1- VND3 with SNBE-like motifs. Our study also indicated two promoter elements for possible utilization in cell wall modifications in plants especially banana, which is being recently considered as a potential biofuel crop.

Two MCAT elements of the SM alpha-actin promoter function differentially in SM vs. non-SM cells.

PubMed

Swartz, E A; Johnson, A D; Owens, G K

1998-08-01

Transcriptional activity of the smooth muscle (SM) alpha-actin gene is differentially regulated in SM vs. non-SM cells. Contained within the rat SM alpha-actin promoter are two MCAT motifs, binding sites for transcription enhancer factor 1 (TEF-1) transcriptional factors implicated in the regulation of many muscle-specific genes. Transfections of SM alpha-actin promoter-CAT constructs containing wild-type or mutagenized MCAT elements were performed to evaluate their functional significance. Mutation of the MCAT elements resulted in increased transcriptional activity in SM cells, whereas these mutations either had no effect or decreased activity in L6 myotubes or endothelial cells. High-resolution gel shift assays resolved several complexes of different mobilities that were formed between MCAT oligonucleotides and nuclear extracts from the different cell types, although no single band was unique to SM. Western blot analysis of nuclear extracts with polyclonal antibodies to conserved domains of the TEF-1 gene family revealed multiple reactive bands, some that were similar and others that differed between SM and non-SM. Supershift assays with a polyclonal antibody to the TEF-related protein family demonstrated that TEF-1 or TEF-1-related proteins were contained in the shifted complexes. Results suggest that the MCAT elements may contribute to cell type-specific regulation of the SM alpha-actin gene. However, it remains to be determined whether the differential transcriptional activity of MCAT elements in SM vs. non-SM is due to differences in expression of TEF-1 or TEF-1-related proteins or to unique (cell type specific) combinatorial interactions of the MCAT elements with other cis-elements and trans-factors.

Promoter variant -204A > C of the cholesterol 7α-hydroxylase gene: association with response to plant sterols in humans and increased transcriptional activity in transfected HepG2 cells.

PubMed

De Castro-Orós, Isabel; Pampín, Sandra; Cofán, Montserrat; Mozas, Pilar; Pintó, Xavier; Salas-Salvadó, Jordi; Rodríguez-Rey, Jose C; Ros, Emilio; Civeira, Fernando; Pocoví, Miguel

2011-04-01

The bile acid pool influences intestinal cholesterol absorption because this process is strictly dependent on micellar solubilization, which is disrupted by plant sterols (PS). Plasma lipid variation relates to promoter variant -204A > C (rs3808607) of the CYP7A1 gene encoding for 7α-hydroxylase, an enzyme for bile acid synthesis. We hypothesized that this polymorphism would be associated with variability in lipid responses to PS. We investigated 67 subjects (31 AA and 36 AC + CC) with lipid responses to PS documented in two studies. To assess the functionality of the -204A > C variant, electrophoretic mobility gel shift assays were performed and luciferase reporter plasmids containing the promoter were transfected into HepG2 cells. Compared to AA-subjects, C-carriers showed significantly higher adjusted mean reductions in total cholesterol (0.14 versus 0.43 mmol/L, P = 0.042) and increases in lathosterol-to-cholesterol ratios (0.10 versus 0.75, P = 0.013). The C-construct caused a 78% promoter activity increase and gel-shift assays showed lower affinity for nuclear transcription factors, while in silico experiments predicted a binding site for inhibitory nuclear factors RXR-CAR. Results suggest that promoter -204A > C variant is associated with enhanced CYP7A1 activity. Increased intestinal bile acids and ensuing more efficient cholesterol absorption might explain why C-allele carriers show enhanced cholesterol lowering and increased feedback cholesterol synthesis to PS intervention. Copyright © 2010 Elsevier Ltd and European Society for Clinical Nutrition and Metabolism. All rights reserved.

Xylem specific activation of 5’ upstream regulatory region of two NAC transcription factors (MusaVND6 and MusaVND7) in banana is regulated by SNBE-like sites

PubMed Central

2018-01-01

Deposition of secondary cell wall in the xylem elements is controlled by a subgroup of NAC (NAM, ATAF, CUC) family, known as vascular-related NAC transcription factors (VNDs). In the present study, we analyzed the 5’ upstream regulatory region of two banana NAC transcription factors (MusaVND6 and MusaVND7) for tissue specific expression and presence of 19-bp secondary-wall NAC binding element (SNBE)-like motifs. Transgenic banana plants of Musa cultivar Rasthali harboring either PMusaVND7::GUS or PMusaVND6::GUS showed specific GUS (β-D-Glucuronidase) activity in cells of the xylem tissue. Approximately 1.2kb promoter region of either MusaVND6 or MusaVND7 showed presence of at least two SNBE-like motifs. This 1.2kb promoter region was retarded in a gel shift assay by three banana VND protein (VND1,VND2 and VND3). The banana VND1-VND3 could also retard the mobility of isolated SNBE-like motifs of MusaVND6 or MusaVND7 in a gel shift assay. Transcript levels of MusaVND6 and MusaVND7 were elevated in transgenic banana overexpressing either banana VND1, VND2 or VND3. Present study suggested a probable regulation of banana VND6 and VND7 expression through direct interaction of banana VND1- VND3 with SNBE-like motifs. Our study also indicated two promoter elements for possible utilization in cell wall modifications in plants especially banana, which is being recently considered as a potential biofuel crop. PMID:29438404

Russian Snap Military Exercise in March of 2015; What Implications did this Exercise Have

DTIC Science & Technology

2017-06-09

Russia can mobilize rapidly the nation for war, shift substantial forces in its interior to meet any threat, and that Russia is willing to use military...Further, it demonstrates to any observer that Russia can mobilize rapidly the nation for war, shift substantial forces in its interior to meet any...the steps of qualitative research method in a class on Advanced Research Methods, September 12, 2016. 65 Robert K. Yin, Case Study Research: Design

The Research Imagination in a World on the Move

ERIC Educational Resources Information Center

Kenway, Jane; Fahey, Johannah

2006-01-01

This paper focuses on the shifting terrain of mobile researchers beginning with an overview of research and research policy on "brain mobility", and then discussing what we call their optical illusions/delusions. Subsequently, our main purpose is to elaborate on a line of inquiry that offers richer notions of researcher mobility, connectivity and…

Mobile suitcase laboratory for rapid detection of Leishmania donovani using recombinase polymerase amplification assay.

PubMed

Mondal, Dinesh; Ghosh, Prakash; Khan, Md Anik Ashfaq; Hossain, Faria; Böhlken-Fascher, Susanne; Matlashewski, Greg; Kroeger, Axel; Olliaro, Piero; Abd El Wahed, Ahmed

2016-05-13

Leishmania donovani (LD) is a protozoan parasite transmitted to humans from sand flies, which causes Visceral Leishmaniasis (VL). Currently, the diagnosis is based on presence of the anti-LD antibodies and clinical symptoms. Molecular diagnosis would require real-time PCR, which is not easy to implement at field settings. In this study, we report on the development and testing of a recombinase polymerase amplification (RPA) assay for the detection of LD. A genomic DNA sample was applied to determine the assay analytical sensitivity. The cross-reactivity of the assay was tested by DNA of Leishmania spp. and of pathogens considered for differential diagnosis. The clinical performance of the assay was evaluated on LD positive and negative samples. All results were compared with real-time PCR. To allow the use of the assay at field settings, a mobile suitcase laboratory (56 × 45.5 × 26.5 cm) was developed and operated at the local hospital in Mymensingh, Bangladesh. The LD RPA assay detected equivalent to one LD genomic DNA. The assay was performed at constant temperature (42 °C) in 15 min. The RPA assay also detected other Leishmania species (L. major, L. aethiopica and L. infantum), but did not identify nucleic acid of other pathogens. Forty-eight samples from VL, asymptomatic and post-kala-azar dermal leishmaniasis subjects were detected positive and 48 LD-negative samples were negative by both LD RPA and real-time PCR assays, which indicates 100 % agreement. The suitcase laboratory was successfully operated at the local hospital by using a solar-powered battery. DNA extraction was performed by a novel magnetic bead based method (SpeedXtract), in which a simple fast lysis protocol was applied. Moreover, All reagents were cold-chain independent. The mobile suitcase laboratory using RPA is ideal for rapid sensitive and specific detection of LD especially at low resource settings and could contribute to VL control and elimination programmes.

α -Actinin TvACTN3 of Trichomonas vaginalis is an RNA-binding protein that could participate in its posttranscriptional iron regulatory mechanism.

PubMed

Calla-Choque, Jaeson Santos; Figueroa-Angulo, Elisa Elvira; Ávila-González, Leticia; Arroyo, Rossana

2014-01-01

Trichomonas vaginalis is a sexually transmitted flagellated protist parasite responsible for trichomoniasis. This parasite is dependent on high levels of iron, favoring its growth and multiplication. Iron also differentially regulates some trichomonad virulence properties by unknown mechanisms. However, there is evidence to support the existence of gene regulatory mechanisms at the transcriptional and posttranscriptional levels that are mediated by iron concentration in T. vaginalis. Thus, the goal of this study was to identify an RNA-binding protein in T. vaginalis that interacts with the tvcp4 RNA stem-loop structure, which may participate in a posttranscriptional iron regulatory mechanism mediated by RNA-protein interactions. We performed RNA electrophoretic mobility shift assay (REMSA) and supershift, UV cross-linking, Northwestern blot, and western blot (WB) assays using cytoplasmic protein extracts from T. vaginalis with the tvcp4 RNA hairpin structure as a probe. We identified a 135-kDa protein isolated by the UV cross-linking assays as α-actinin 3 (TvACTN3) by MALDI-TOF-MS that was confirmed by LS-MS/MS and de novo sequencing. TvACTN3 is a cytoplasmic protein that specifically binds to hairpin RNA structures from trichomonads and humans when the parasites are grown under iron-depleted conditions. Thus, TvACTN3 could participate in the regulation of gene expression by iron in T. vaginalis through a parallel posttranscriptional mechanism similar to that of the IRE/IRP system.

On the mechanism of Cr (VI)-induced carcinogenesis: dose dependence of uptake and cellular responses.

PubMed

Liu, K; Husler, J; Ye, J; Leonard, S S; Cutler, D; Chen, F; Wang, S; Zhang, Z; Ding, M; Wang, L; Shi, X

2001-06-01

Cr (VI) compounds are widely used industrial chemicals and are recognized human carcinogens. The mechanisms of carcinogenesis associated with these compounds remain to be investigated. The present study focused on dose-dependence of Cr (VI)-induced uptake and cellular responses. The results show that Cr (VI) is able to enter the cells (human lung epithelial cell line A549) at low concentration (< 10 microM) and that the Cr (VI) uptake appears to be a combination of saturable transport and passive diffusion. Electron spin resonance (ESR) trapping measurements showed that upon stimulation with Cr (VI), A549 cells were able to generate reactive oxygen species (ROS). The amount of ROS generated depended on the Cr (VI) concentration. ROS generation involved NADPH-dependent flavoenzymes. Cr (VI) affected the following cellular parameters in a dose-dependent manner, (a) activation of nuclear transcription factors NF-kappaB, and p53, (b) DNA damage, (c) induction of cell apoptosis, and (d) inhibition of cell proliferation. The activation of transcription factors was assessed by electrophoretic mobility shift assay and western blot analysis, DNA damage by single cell gel electrophoresis assay, cell apoptosis by DNA fragmentation assay, and cell proliferation by a non-radioactive ELISA kit. At the concentration range used in the present study, no thresholds were found in all of these cell responses to Cr (VI). The results may guide further research to better understand and evaluate the risk of Cr (VI)-induced carcinogenesis at low levels of exposure.

α-Actinin TvACTN3 of Trichomonas vaginalis Is an RNA-Binding Protein That Could Participate in Its Posttranscriptional Iron Regulatory Mechanism

PubMed Central

Calla-Choque, Jaeson Santos; Figueroa-Angulo, Elisa Elvira; Ávila-González, Leticia; Arroyo, Rossana

2014-01-01

Trichomonas vaginalis is a sexually transmitted flagellated protist parasite responsible for trichomoniasis. This parasite is dependent on high levels of iron, favoring its growth and multiplication. Iron also differentially regulates some trichomonad virulence properties by unknown mechanisms. However, there is evidence to support the existence of gene regulatory mechanisms at the transcriptional and posttranscriptional levels that are mediated by iron concentration in T. vaginalis. Thus, the goal of this study was to identify an RNA-binding protein in T. vaginalis that interacts with the tvcp4 RNA stem-loop structure, which may participate in a posttranscriptional iron regulatory mechanism mediated by RNA-protein interactions. We performed RNA electrophoretic mobility shift assay (REMSA) and supershift, UV cross-linking, Northwestern blot, and western blot (WB) assays using cytoplasmic protein extracts from T. vaginalis with the tvcp4 RNA hairpin structure as a probe. We identified a 135-kDa protein isolated by the UV cross-linking assays as α-actinin 3 (TvACTN3) by MALDI-TOF-MS that was confirmed by LS-MS/MS and de novo sequencing. TvACTN3 is a cytoplasmic protein that specifically binds to hairpin RNA structures from trichomonads and humans when the parasites are grown under iron-depleted conditions. Thus, TvACTN3 could participate in the regulation of gene expression by iron in T. vaginalis through a parallel posttranscriptional mechanism similar to that of the IRE/IRP system. PMID:24719864

Coordinated regulation of IFITM1, 2 and 3 genes by an IFN-responsive enhancer through long-range chromatin interactions.

PubMed

Li, Ping; Shi, Ming-Lei; Shen, Wen-Long; Zhang, Zhang; Xie, De-Jian; Zhang, Xiang-Yuan; He, Chao; Zhang, Yan; Zhao, Zhi-Hu

2017-08-01

Interferon-induced transmembrane protein (IFITM) 1, 2 and 3 genes encode a family of interferon (IFN)-induced transmembrane proteins that block entry of a broad spectrum of pathogens. However, the transcriptional regulation of these genes, especially whether there exist any enhancers and their roles during the IFN induction process remain elusive. Here, through public data mining, episomal luciferase reporter assay and in vivo CRISPR-Cas9 genome editing, we identified an IFN-responsive enhancer located 35kb upstream of IFITM3 gene promoter upregulating the IFN-induced expression of IFITM1, 2 and 3 genes. Chromatin immunoprecipitation (ChIP), electrophoretic mobility shift assay (EMSA) and luciferase reporter assay demonstrated that signal transducers and activators of transcription (STAT) 1 bound to the enhancer with the treatment of IFN and was indispensable for the enhancer activity. Furthermore, using chromosome conformation capture technique, we revealed that the IFITM1, 2 and 3 genes physically clustered together and constitutively looped to the distal enhancer through long-range interactions in both HEK293 and A549 cells, providing structural basis for coordinated regulation of IFITM1, 2 and 3 by the enhancer. Finally, we showed that in vivo truncation of the enhancer impaired IFN-induced resistance to influenza A virus (IAV) infection. These findings expand our understanding of the mechanisms underlying the transcriptional regulation of IFITM1, 2 and 3 expression and its ability to mediate IFN signaling. Copyright © 2017 Elsevier B.V. All rights reserved.

EBV induces persistent NF-κB activation and contributes to survival of EBV-positive neoplastic T- or NK-cells.

PubMed

Takada, Honami; Imadome, Ken-Ichi; Shibayama, Haruna; Yoshimori, Mayumi; Wang, Ludan; Saitoh, Yasunori; Uota, Shin; Yamaoka, Shoji; Koyama, Takatoshi; Shimizu, Norio; Yamamoto, Kouhei; Fujiwara, Shigeyoshi; Miura, Osamu; Arai, Ayako

2017-01-01

Epstein-Barr virus (EBV) has been detected in several T- and NK-cell neoplasms such as extranodal NK/T-cell lymphoma nasal type, aggressive NK-cell leukemia, EBV-positive peripheral T-cell lymphoma, systemic EBV-positive T-cell lymphoma of childhood, and chronic active EBV infection (CAEBV). However, how this virus contributes to lymphomagenesis in T or NK cells remains largely unknown. Here, we examined NF-κB activation in EBV-positive T or NK cell lines, SNT8, SNT15, SNT16, SNK6, and primary EBV-positive and clonally proliferating T/NK cells obtained from the peripheral blood of patients with CAEBV. Western blotting, electrophoretic mobility shift assays, and immunofluorescent staining revealed persistent NF-κB activation in EBV-infected cell lines and primary cells from patients. Furthermore, we investigated the role of EBV in infected T cells. We performed an in vitro infection assay using MOLT4 cells infected with EBV. The infection directly induced NF-κB activation, promoted survival, and inhibited etoposide-induced apoptosis in MOLT4 cells. The luciferase assay suggested that LMP1 mediated NF-κB activation in MOLT4 cells. IMD-0354, a specific inhibitor of NF-κB that suppresses NF-κB activation in cell lines, inhibited cell survival and induced apoptosis. These results indicate that EBV induces NF-κB-mediated survival signals in T and NK cells, and therefore, may contribute to the lymphomagenesis of these cells.

EBV induces persistent NF-κB activation and contributes to survival of EBV-positive neoplastic T- or NK-cells

PubMed Central

Shibayama, Haruna; Yoshimori, Mayumi; Wang, Ludan; Saitoh, Yasunori; Uota, Shin; Yamaoka, Shoji; Koyama, Takatoshi; Shimizu, Norio; Yamamoto, Kouhei; Fujiwara, Shigeyoshi; Miura, Osamu

2017-01-01

Epstein–Barr virus (EBV) has been detected in several T- and NK-cell neoplasms such as extranodal NK/T-cell lymphoma nasal type, aggressive NK-cell leukemia, EBV-positive peripheral T-cell lymphoma, systemic EBV-positive T-cell lymphoma of childhood, and chronic active EBV infection (CAEBV). However, how this virus contributes to lymphomagenesis in T or NK cells remains largely unknown. Here, we examined NF-κB activation in EBV-positive T or NK cell lines, SNT8, SNT15, SNT16, SNK6, and primary EBV-positive and clonally proliferating T/NK cells obtained from the peripheral blood of patients with CAEBV. Western blotting, electrophoretic mobility shift assays, and immunofluorescent staining revealed persistent NF-κB activation in EBV-infected cell lines and primary cells from patients. Furthermore, we investigated the role of EBV in infected T cells. We performed an in vitro infection assay using MOLT4 cells infected with EBV. The infection directly induced NF-κB activation, promoted survival, and inhibited etoposide-induced apoptosis in MOLT4 cells. The luciferase assay suggested that LMP1 mediated NF-κB activation in MOLT4 cells. IMD-0354, a specific inhibitor of NF-κB that suppresses NF-κB activation in cell lines, inhibited cell survival and induced apoptosis. These results indicate that EBV induces NF-κB-mediated survival signals in T and NK cells, and therefore, may contribute to the lymphomagenesis of these cells. PMID:28346502

FXR induces SOCS3 and suppresses hepatocellular carcinoma

PubMed Central

Zhang, Yan; Jiang, Peng; Huang, Gang; Chen, Shan; Lyu, Xilin; Zheng, Ping; Zhao, Xin; Zeng, Yijun; Wang, Shuguang; He, Fengtian

2015-01-01

Suppressor of cytokine signaling 3 (SOCS3) is regarded as a vital repressor in the liver carcinogenesis mainly by inhibiting signal transducer and activator of transcription 3 (STAT3) activity. Farnesoid X Receptor (FXR), highly expressed in liver, has an important role in protecting against hepatocellular carcinoma (HCC). However, it is unclear whether the tumor suppressive activity of FXR involves the regulation of SOCS3. In the present study, we found that activation of FXR by its specific agonist GW4064 in HCC cells inhibited cell growth, induced cell cycle arrest at G1 phase, elevated p21 expression and repressed STAT3 activity. The above anti-tumor effects of FXR were dramatically alleviated by knockdown of SOCS3 with siRNA. Reporter assay revealed that FXR activation enhanced the transcriptional activity of SOCS3 promoter. Electrophoretic mobility shift assay (EMSA) and chromatin immunoprecipitation (ChIP) assay displayed that FXR directly bound to IR9 DNA motif within SOCS3 promoter region. The in vivo study in nude mice showed that treatment with FXR ligand GW4064 could decelerate the growth of HCC xenografts, up-regulate SOCS3 and p21 expression and inhibit STAT3 phosphorylation in the xenografts. These results suggest that induction of SOCS3 may be a novel mechanism by which FXR exerts its anti-HCC effects, and the FXR-SOCS3 signaling may serve as a new potential target for the prevention/treatment of HCC. PMID:26416445

Assessing Mobile Health Capacity and Task Shifting Strategies to Improve Hypertension Among Ghanaian Stroke Survivors.

PubMed

Nichols, Michelle; Sarfo, Fred Stephen; Singh, Arti; Qanungo, Suparna; Treiber, Frank; Ovbiagele, Bruce; Saulson, Raelle; Patel, Sachin; Jenkins, Carolyn

2017-12-01

There has been a tremendous surge in stroke prevalence in sub-Saharan Africa. Hypertension (HTN), the most potent, modifiable risk factor for stroke, is a particular challenge in sub-Saharan Africa. Culturally sensitive, efficacious HTN control programs that are timely and sustainable are needed, especially among stroke survivors. Mobile health (mHealth) technology and task-shifting offer promising approaches to address this need. Using a concurrent triangulation design, we collected data from stroke survivors, caregivers, community leaders, clinicians and hospital personnel to explore the barriers, facilitators and perceptions toward mHealth related to HTN management among poststroke survivors in Ghana. Exploration included perceptions of a nurse-led navigational model to facilitate care delivery and willingness of stroke survivors and caregivers to use mHealth technology. Two hundred stroke survivors completed study surveys while focus groups (n = 4) were conducted with stroke survivors, caregivers and community leaders (n = 28). Key informant interviews were completed with clinicians and hospital personnel (n = 10). A total of 93% of survey respondents had HTN (60% uncontrolled). Findings support mHealth strategies for poststroke care delivery and HTN management and for task-shifting through a nurse-led model. Of survey and focus group participants, 76% and 78.6%, respectively, have access to mobile phones and 90% express comfort in using mobile phones and conveyed assurance that task-shifting through a nurse-led model could facilitate management of HTN. Findings also identified barriers to care delivery and medication adherence across all levels of the social ecological model. Participants strongly supported enhanced care delivery through mobile health and were receptive toward a nurse-led navigational model. Copyright © 2017 Southern Society for Clinical Investigation. Published by Elsevier Inc. All rights reserved.

Effects of radiofrequency exposure emitted from a GSM mobile phone on proliferation, differentiation, and apoptosis of neural stem cells

PubMed Central

Eghlidospour, Mahsa; Ghanbari, Amir

2017-01-01

Due to the importance of neural stem cells (NSCs) in plasticity of the nervous system and treating neurodegenerative diseases, the main goal of this study was to evaluate the effects of radiofrequency radiation emitted from a GSM 900-MHz mobile phone with different exposure duration on proliferation, differentiation and apoptosis of adult murine NSCs in vitro. We used neurosphere assay to evaluate NSCs proliferation, and immunofluorescence assay of neural cell markers to examine NSCs differentiation. We also employed alamarBlue and caspase 3 apoptosis assays to assess harmful effects of mobile phone on NSCs. Our results showed that the number and size of resulting neurospheres and also the percentage of cells differentiated into neurons decreased significantly with increasing exposure duration to GSM 900-MHz radiofrequency (RF)-electromagnetic field (EMF). In contrast, exposure to GSM 900-MHz RF-EMF at different durations did not influence cell viability and apoptosis of NSCs and also their astrocytic differentiation. It is concluded that accumulating dose of GSM 900-MHz RF-EMF might have devastating effects on NSCs proliferation and neurogenesis requiring more causations in terms of using mobile devices. PMID:28713615

Effects of radiofrequency exposure emitted from a GSM mobile phone on proliferation, differentiation, and apoptosis of neural stem cells.

PubMed

Eghlidospour, Mahsa; Ghanbari, Amir; Mortazavi, Seyyed Mohammad Javad; Azari, Hassan

2017-06-01

Due to the importance of neural stem cells (NSCs) in plasticity of the nervous system and treating neurodegenerative diseases, the main goal of this study was to evaluate the effects of radiofrequency radiation emitted from a GSM 900-MHz mobile phone with different exposure duration on proliferation, differentiation and apoptosis of adult murine NSCs in vitro . We used neurosphere assay to evaluate NSCs proliferation, and immunofluorescence assay of neural cell markers to examine NSCs differentiation. We also employed alamarBlue and caspase 3 apoptosis assays to assess harmful effects of mobile phone on NSCs. Our results showed that the number and size of resulting neurospheres and also the percentage of cells differentiated into neurons decreased significantly with increasing exposure duration to GSM 900-MHz radiofrequency (RF)-electromagnetic field (EMF). In contrast, exposure to GSM 900-MHz RF-EMF at different durations did not influence cell viability and apoptosis of NSCs and also their astrocytic differentiation. It is concluded that accumulating dose of GSM 900-MHz RF-EMF might have devastating effects on NSCs proliferation and neurogenesis requiring more causations in terms of using mobile devices.

Identification of transactivation-responsive DNA-binding protein 43 (TARDBP43; TDP-43) as a novel factor for TNF-α expression upon lipopolysaccharide stimulation in human monocytes.

PubMed

Murata, H; Hattori, T; Maeda, H; Takashiba, S; Takigawa, M; Kido, J; Nagata, T

2015-08-01

Tumor necrosis factor alpha (TNF-α) is a major cytokine implicated in various inflammatory diseases. The nature of the nuclear factors associated with human TNF-α gene regulation is not well elucidated. We previously identified a novel region located from -550 to -487 in human TNF-α promoter that did not contain the reported binding sites for nuclear factor kappa B (NF-κB) but showed lipopolysaccharide (LPS)-induced transcriptional activity. The purpose of this study is to identify novel factors that bind to the promoter region and regulate TNF-α expression. To identify DNA-binding proteins that bound to the target region of TNF-α promoter, a cDNA library from LPS-stimulated human monocytic cell line THP-1 was screened using a yeast one-hybrid system. Cellular localizations of the DNA-binding protein in the cells were examined by subcellular immunocytochemistry. Nuclear amounts of the protein in LPS-stimulated THP-1 cells were identified by western blot analysis. Expression of mRNA of the protein in the cells was quantified by real-time polymerase chain reaction. Electrophoretic mobility shift assays were performed to confirm the DNA-binding profile. Overexpression of the protein and knockdown of the gene were also performed to investigate the role for TNF-α expression. Several candidates were identified from the cDNA library and transactivation-responsive DNA-binding protein 43 (TARDBP43; TDP-43) was focused on. Western blot analysis revealed that nuclear TDP-43 protein was increased in the LPS-stimulated THP-1 cells. Expression of TDP-43 mRNA was already enhanced before TNF-α induction by LPS. Electrophoretic mobility shift assay analysis showed that nuclear extracts obtained by overexpressing FLAG-tagged TDP-43 bound to the -550 to -487 TNF-α promoter fragments. Overexpression of TDP-43 in THP-1 cells resulted in an increase of TNF-α expression. Knockdown of TDP-43 in THP-1 cells downregulated TNF-α expression. We identified TDP-43 as one of the novel TNF-α factors and found that it bound to the LPS-responsive element in the TNF-α promoter to increase TNF-α expression. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Direct Reading of Bona Fide Barcode Assays for Diagnostics with Smartphone Apps.

PubMed

Wong, Jessica X H; Li, Xiaochun; Liu, Frank S F; Yu, Hua-Zhong

2015-06-30

The desire to develop new point-of-care (POC) diagnostic tools has led to the adaptation of smartphones to tackle limitations in state-of-the-art instrumentation and centralized laboratory facilities. Today's smartphones possess the computer-like ability to image and process data using mobile apps; barcode scanners are one such type of apps. We demonstrate herein that a diagnostic assay can be performed by patterning immunoassay strips in a bona fide barcode format such that after target binding and signal enhancement, the linear barcode can be read directly with a standard smartphone app. Quantitative analysis can then be performed based on the grayscale intensities with a customized mobile app. This novel diagnostic concept has been validated for a real-world application, i.e., the detection of human chorionic gonadotropin, a pregnancy hormone. With the possibility of multiplex detection, the barcode assay protocol promises to boost POC diagnosis research by the direct adaptation of mobile devices and apps.

Direct Reading of Bona Fide Barcode Assays for Diagnostics with Smartphone Apps

PubMed Central

Wong, Jessica X. H.; Li, Xiaochun; Liu, Frank S. F.; Yu, Hua-Zhong

2015-01-01

The desire to develop new point-of-care (POC) diagnostic tools has led to the adaptation of smartphones to tackle limitations in state-of-the-art instrumentation and centralized laboratory facilities. Today’s smartphones possess the computer-like ability to image and process data using mobile apps; barcode scanners are one such type of apps. We demonstrate herein that a diagnostic assay can be performed by patterning immunoassay strips in a bona fide barcode format such that after target binding and signal enhancement, the linear barcode can be read directly with a standard smartphone app. Quantitative analysis can then be performed based on the grayscale intensities with a customized mobile app. This novel diagnostic concept has been validated for a real-world application, i.e., the detection of human chorionic gonadotropin, a pregnancy hormone. With the possibility of multiplex detection, the barcode assay protocol promises to boost POC diagnosis research by the direct adaptation of mobile devices and apps. PMID:26122608

Direct Reading of Bona Fide Barcode Assays for Diagnostics with Smartphone Apps

NASA Astrophysics Data System (ADS)

Wong, Jessica X. H.; Li, Xiaochun; Liu, Frank S. F.; Yu, Hua-Zhong

2015-06-01

The desire to develop new point-of-care (POC) diagnostic tools has led to the adaptation of smartphones to tackle limitations in state-of-the-art instrumentation and centralized laboratory facilities. Today’s smartphones possess the computer-like ability to image and process data using mobile apps; barcode scanners are one such type of apps. We demonstrate herein that a diagnostic assay can be performed by patterning immunoassay strips in a bona fide barcode format such that after target binding and signal enhancement, the linear barcode can be read directly with a standard smartphone app. Quantitative analysis can then be performed based on the grayscale intensities with a customized mobile app. This novel diagnostic concept has been validated for a real-world application, i.e., the detection of human chorionic gonadotropin, a pregnancy hormone. With the possibility of multiplex detection, the barcode assay protocol promises to boost POC diagnosis research by the direct adaptation of mobile devices and apps.

Enhanced regeneration potential of mobilized dental pulp stem cells from immature teeth.

PubMed

Nakayama, H; Iohara, K; Hayashi, Y; Okuwa, Y; Kurita, K; Nakashima, M

2017-07-01

We have previously demonstrated that dental pulp stem cells (DPSCs) isolated from mature teeth by granulocyte colony-stimulating factor (G-CSF)-induced mobilization method can enhance angiogenesis/vasculogenesis and improve pulp regeneration when compared with colony-derived DPSCs. However, the efficacy of this method in immature teeth with root-formative stage has never been investigated. Therefore, the aim of this study was to examine the stemness, biological characteristics, and regeneration potential in mobilized DPSCs compared with colony-derived DPSCs from immature teeth. Mobilized DPSCs isolated from immature teeth were compared to colony-derived DPSCs using methods including flow cytometry, migration assays, mRNA expression of angiogenic/neurotrophic factor, and induced differentiation assays. They were also compared in trophic effects of the secretome. Regeneration potential was further compared in an ectopic tooth transplantation model. Mobilized DPSCs had higher migration ability and expressed more angiogenic/neurotrophic factors than DPSCs. The mobilized DPSC secretome produced a higher stimulatory effect on migration, immunomodulation, anti-apoptosis, endothelial differentiation, and neurite extension. In addition, vascularization and pulp regeneration potential were higher in mobilized DPSCs than in DPSCs. G-CSF-induced mobilization method enhances regeneration potential of colony-derived DPSCs from immature teeth. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Retinoid X receptor and peroxisome proliferator-activated receptor activate an estrogen responsive gene independent of the estrogen receptor.

PubMed

Nuñez, S B; Medin, J A; Braissant, O; Kemp, L; Wahli, W; Ozato, K; Segars, J H

1997-03-14

Estrogen receptors regulate transcription of genes essential for sexual development and reproductive function. Since the retinoid X receptor (RXR) is able to modulate estrogen responsive genes and both 9-cis RA and fatty acids influenced development of estrogen responsive tumors, we hypothesized that estrogen responsive genes might be modulated by RXR and the fatty acid receptor (peroxisome proliferator-activated receptor, PPAR). To test this hypothesis, transfection assays in CV-1 cells were performed with an estrogen response element (ERE) coupled to a luciferase reporter construct. Addition of expression vectors for RXR and PPAR resulted in an 11-fold increase in luciferase activity in the presence of 9-cis RA. Furthermore, mobility shift assays demonstrated binding of RXR and PPAR to the vitellogenin A2-ERE and an ERE in the oxytocin promoter. Methylation interference assays demonstrated that specific guanine residues required for RXR/PPAR binding to the ERE were similar to residues required for ER binding. Moreover, RXR domain-deleted constructs in transfection assays showed that activation required RXR since an RXR delta AF-2 mutant completely abrogated reporter activity. Oligoprecipitation binding studies with biotinylated ERE and (35)S-labeled in vitro translated RXR constructs confirmed binding of delta AF-2 RXR mutant to the ERE in the presence of baculovirus-expressed PPAR. Finally, in situ hybridization confirmed RXR and PPAR mRNA expression in estrogen responsive tissues. Collectively, these data suggest that RXR and PPAR are present in reproductive tissues, are capable of activating estrogen responsive genes and suggest that the mechanism of activation may involve direct binding of the receptors to estrogen response elements.

ERK inhibition enhances TSA-induced gastric cancer cell apoptosis via NF-κB-dependent and Notch-independent mechanism.

PubMed

Yao, Jun; Qian, Cui-Juan; Ye, Bei; Zhang, Xin; Liang, Yong

2012-09-04

To analyze the combined impact of the histone deacetylase inhibitor (HDACI) Trichostatin A (TSA) and the extracellular-signal-regulated kinase 1/2 (ERK1/2) inhibitor PD98059 on gastric cancer (GC) cell line SGC7901 growth. SGC7901 cells were treated with TSA, PD98059 or with a TSA-PD98059 combination. Effects of drug treatment on tumor cell proliferation, apoptosis, cell cycle progression, and cell signaling pathways were investigated by MTS assay, flow cytometry, Western blotting, chromatin immunoprecipitation (ChIP) assay, electrophoretic mobility shift assay (EMSA), and luciferase reporter assay, respectively. PD98059 enhanced TSA-induced cell growth arrest, apoptosis and activation of p21(WAF1/CIP1), but reversed TSA-induced activation of ERK1/2 and nuclear factor-κB (NF-κB). TSA alone up-regulated Notch1 and Hes1, and down-regulated Notch2, but PD98059 did not affect the trends of Notch1 and Notch2 induced by TSA. Particularly, PD98059 did potentiate the ability of TSA to down-regulate phospho-histone H3 protein, but increased levels of the acetylated forms of histone H3 bound to the p21(WAF1/CIP1) promoter, leading to enhanced expression of p21(WAF1/CIP1) in SGC7901 cells. PD98059 synergistically potentiates TSA-induced GC growth arrest and apoptosis by manipulating NF-κB and p21(WAF1/CIP1) independent of Notch. Therefore, concomitant administration of HDACIs and ERK1/2 inhibitors may be a promising treatment strategy for individuals with GC. Copyright © 2012 Elsevier Inc. All rights reserved.

The putative Agrobacterium transcriptional activator-like virulence protein VirD5 may target T-complex to prevent the degradation of coat proteins in the plant cell nucleus.

PubMed

Wang, Yafei; Peng, Wei; Zhou, Xu; Huang, Fei; Shao, Lingyun; Luo, Meizhong

2014-09-01

Agrobacterium exports at least five virulence proteins (VirE2, VirE3, VirF, VirD2, VirD5) into host cells and hijacks some host plant factors to facilitate its transformation process. Random DNA binding selection assays (RDSAs), electrophoretic mobility shift assays (EMSAs) and yeast one-hybrid systems were used to identify protein-bound DNA elements. Bimolecular fluorescence complementation, glutathione S-transferase pull-down and yeast two-hybrid assays were used to detect protein interactions. Protoplast transformation, coprecipitation, competitive binding and cell-free degradation assays were used to analyze the relationships among proteins. We found that Agrobacterium VirD5 exhibits transcriptional activation activity in yeast, is located in the plant cell nucleus, and forms homodimers. A specific VirD5-bound DNA element designated D5RE (VirD5 response element) was identified. VirD5 interacted directly with Arabidopsis VirE2 Interacting Protein 1 (AtVIP1). However, the ternary complex of VirD5-AtVIP1-VirE2 could be detected, whereas that of VirD5-AtVIP1-VBF (AtVIP1 Binding F-box protein) could not. We demonstrated that VirD5 competes with VBF for binding to AtVIP1 and stabilizes AtVIP1 and VirE2 in the cell-free degradation system. Our results indicated that VirD5 may act as both a transcriptional activator-like effector to regulate host gene expression and a protector preventing the coat proteins of the T-complex from being quickly degraded by the host's ubiquitin proteasome system (UPS). © 2014 The Authors. New Phytologist © 2014 New Phytologist Trust.

What Have We Learnt about Mobile LifeLong Learning (mLLL)?

ERIC Educational Resources Information Center

Seta, Luciano; Kukulska-Hulme, Agnes; Arrigo, Marco

2014-01-01

Mobile technologies are becoming ubiquitous in education, yet the wider implications of this phenomenon are not well understood. The paper discusses how mobile lifelong learning (mLLL) may be defined, and the challenges of forging a suitable definition in an ever-shifting technological and socio-economic landscape. mLLL appears as a ubiquitous…

Mobile Devices and Mobile Learning: Shifting the Mindset of Teachers and Learners

ERIC Educational Resources Information Center

Smith, Philippa K.; Grant, Lynn; Conway, Clare; Narayan, Vickel

2016-01-01

Incorporating new media technologies that enable mobile learning to be part of educational practice poses challenges to those used to teaching in a traditional classroom environment. In this article three lecturers and a learning advisor from a New Zealand university reflect on their experiences in the progressive redesign of a Bachelor of Arts…

Mobile phone based ELISA (MELISA).

PubMed

Zhdanov, Arsenii; Keefe, Jordan; Franco-Waite, Luis; Konnaiyan, Karthik Raj; Pyayt, Anna

2018-04-30

Enzyme-linked immunosorbent assay (ELISA) is one of the most important technologies for biochemical analysis critical for diagnosis and monitoring of many diseases. Traditional systems for ELISA incubation and reading are expensive and bulky, thus cannot be used at point-of-care or in the field. Here, we propose and demonstrate a new miniature mobile phone based system for ELISA (MELISA). This system can be used to complete all steps of the assay, including incubation and reading. It weighs just 1 pound, can be fabricated at low cost, portable, and can transfer test results via mobile phone. We successfully demonstrated how MELISA can be calibrated for accurate measurements of progesterone and demonstrated successful measurements with the calibrated system. Copyright © 2017 Elsevier B.V. All rights reserved.

Click-PEGylation - A mobility shift approach to assess the redox state of cysteines in candidate proteins.

PubMed

van Leeuwen, Lucie A G; Hinchy, Elizabeth C; Murphy, Michael P; Robb, Ellen L; Cochemé, Helena M

2017-07-01

The redox state of cysteine thiols is critical for protein function. Whereas cysteines play an important role in the maintenance of protein structure through the formation of internal disulfides, their nucleophilic thiol groups can become oxidatively modified in response to diverse redox challenges and thereby function in signalling and antioxidant defences. These oxidative modifications occur in response to a range of agents and stimuli, and can lead to the existence of multiple redox states for a given protein. To assess the role(s) of a protein in redox signalling and antioxidant defence, it is thus vital to be able to assess which of the multiple thiol redox states are present and to investigate how these alter under different conditions. While this can be done by a range of mass spectrometric-based methods, these are time-consuming, costly, and best suited to study abundant proteins or to perform an unbiased proteomic screen. One approach that can facilitate a targeted assessment of candidate proteins, as well as proteins that are low in abundance or proteomically challenging, is by electrophoretic mobility shift assays. Redox-modified cysteine residues are selectively tagged with a large group, such as a polyethylene glycol (PEG) polymer, and then the proteins are separated by electrophoresis followed by immunoblotting, which allows the inference of redox changes based on band shifts. However, the applicability of this method has been impaired by the difficulty of cleanly modifying protein thiols by large PEG reagents. To establish a more robust method for redox-selective PEGylation, we have utilised a Click chemistry approach, where free thiol groups are first labelled with a reagent modified to contain an alkyne moiety, which is subsequently Click-reacted with a PEG molecule containing a complementary azide function. This strategy can be adapted to study reversibly reduced or oxidised cysteines. Separation of the thiol labelling step from the PEG conjugation greatly facilitates the fidelity and flexibility of this approach. Here we show how the Click-PEGylation technique can be used to interrogate the redox state of proteins. Copyright © 2017. Published by Elsevier Inc.

Hypoxia inducible factor-1 mediates the expression of the immune checkpoint HLA-G in glioma cells through hypoxia response element located in exon 2.

PubMed

Yaghi, Layale; Poras, Isabelle; Simoes, Renata T; Donadi, Eduardo A; Tost, Jörg; Daunay, Antoine; de Almeida, Bibiana Sgorla; Carosella, Edgardo D; Moreau, Philippe

2016-09-27

HLA-G is an immune checkpoint molecule with specific relevance in cancer immunotherapy. It was first identified in cytotrophoblasts, protecting the fetus from maternal rejection. HLA-G tissue expression is very restricted but induced in numerous malignant tumors such as glioblastoma, contributing to their immune escape. Hypoxia occurs during placenta and tumor development and was shown to activate HLA-G. We aimed to elucidate the mechanisms of HLA-G activation under conditions combining hypoxia-mimicking treatment and 5-aza-2'deoxycytidine, a DNA demethylating agent used in anti-cancer therapy which also induces HLA-G. Both treatments enhanced the amount of HLA-G mRNA and protein in HLA-G negative U251MG glioma cells. Electrophoretic Mobility Shift Assays and luciferase reporter gene assays revealed that HLA-G upregulation depends on Hypoxia Inducible Factor-1 (HIF-1) and a hypoxia responsive element (HRE) located in exon 2. A polymorphic HRE at -966 bp in the 5'UT region may modulate the magnitude of the response mediated by the exon 2 HRE. We suggest that therapeutic strategies should take into account that HLA-G expression in response to hypoxic tumor environment is dependent on HLA-G gene polymorphism and DNA methylation state at the HLA-G locus.

Interactions between the promoter and first intron are involved in transcriptional control of alpha 1(I) collagen gene expression.

PubMed Central

Bornstein, P; McKay, J; Liska, D J; Apone, S; Devarayalu, S

1988-01-01

The first intron of the human collagen alpha 1(I) gene contains several positively and negatively acting elements. We have studied the transcription of collagen-human growth hormone fusion genes, containing deletions and rearrangements of collagen intronic sequences, by transient transfection of chick tendon fibroblasts and NIH 3T3 cells. In chick tendon fibroblasts, but not in 3T3 cells, inversion of intronic sequences containing a previously studied 274-base-pair segment, A274, resulted in markedly reduced human growth hormone mRNA levels as determined by an RNase protection assay. This inhibitory effect was largely alleviated when deletions were introduced in the collagen promoter of plasmids containing negatively oriented intronic sequences. Evidence for interaction of the promoter with the intronic segment, A274, was obtained by gel mobility shift assays. We suggest that promoter-intron interactions, mediated by DNA-binding proteins, regulate collagen gene transcription. Inversion of intronic segments containing critical interactive elements might then lead to an altered geometry and reduced activity of a transcriptional complex in those cells with sufficiently high levels of appropriate transcription factors. We further suggest that the deleted promoter segment plays a key role in directing DNA interactions involved in transcriptional control. Images PMID:3211130

Functional Analysis of the Epidermal-Specific MYB Genes CAPRICE and WEREWOLF in Arabidopsis[W

PubMed Central

Tominaga, Rumi; Iwata, Mineko; Okada, Kiyotaka; Wada, Takuji

2007-01-01

Epidermis cell differentiation in Arabidopsis thaliana is a model system for understanding the developmental end state of plant cells. Two types of MYB transcription factors, R2R3-MYB and R3-MYB, are involved in cell fate determination. To examine the molecular basis of this process, we analyzed the functional relationship of the R2R3-type MYB gene WEREWOLF (WER) and the R3-type MYB gene CAPRICE (CPC). Chimeric constructs made from the R3 MYB regions of WER and CPC used in reciprocal complementation experiments showed that the CPC R3 region cannot functionally substitute for the WER R3 region in the differentiation of hairless cells. However, WER R3 can substantially substitute for CPC R3. There are no differences in yeast interaction assays of WER or WER chimera proteins with GLABRA3 (GL3) or ENHANCER OF GLABRA3 (EGL3). CPC and CPC chimera proteins also have similar activity in preventing GL3 WER and EGL3 WER interactions. Furthermore, we showed by gel mobility shift assays that WER chimera proteins do not bind to the GL2 promoter region. However, a CPC chimera protein, which harbors the WER R3 motif, still binds to the GL2 promoter region. PMID:17644729

Functional analysis of the epidermal-specific MYB genes CAPRICE and WEREWOLF in Arabidopsis.

PubMed

Tominaga, Rumi; Iwata, Mineko; Okada, Kiyotaka; Wada, Takuji

2007-07-01

Epidermis cell differentiation in Arabidopsis thaliana is a model system for understanding the developmental end state of plant cells. Two types of MYB transcription factors, R2R3-MYB and R3-MYB, are involved in cell fate determination. To examine the molecular basis of this process, we analyzed the functional relationship of the R2R3-type MYB gene WEREWOLF (WER) and the R3-type MYB gene CAPRICE (CPC). Chimeric constructs made from the R3 MYB regions of WER and CPC used in reciprocal complementation experiments showed that the CPC R3 region cannot functionally substitute for the WER R3 region in the differentiation of hairless cells. However, WER R3 can substantially substitute for CPC R3. There are no differences in yeast interaction assays of WER or WER chimera proteins with GLABRA3 (GL3) or ENHANCER OF GLABRA3 (EGL3). CPC and CPC chimera proteins also have similar activity in preventing GL3 WER and EGL3 WER interactions. Furthermore, we showed by gel mobility shift assays that WER chimera proteins do not bind to the GL2 promoter region. However, a CPC chimera protein, which harbors the WER R3 motif, still binds to the GL2 promoter region.

A common FADS2 promoter polymorphism increases promoter activity and facilitates binding of transcription factor ELK1

PubMed Central

Lattka, E.; Eggers, S.; Moeller, G.; Heim, K.; Weber, M.; Mehta, D.; Prokisch, H.; Illig, T.; Adamski, J.

2010-01-01

Fatty acid desaturases (FADS) play an important role in the formation of omega-6 and omega-3 highly unsaturated fatty acids (HUFAs). The composition of HUFAs in the human metabolome is important for membrane fluidity and for the modulation of essential physiological functions such as inflammation processes and brain development. Several recent studies reported significant associations of single nucleotide polymorphisms (SNPs) in the human FADS gene cluster with HUFA levels and composition. The presence of the minor allele correlated with a decrease of desaturase reaction products and an accumulation of substrates. We performed functional studies with two of the associated polymorphisms (rs3834458 and rs968567) and showed an influence of polymorphism rs968567 on FADS2 promoter activity by luciferase reporter gene assays. Electrophoretic mobility shift assays proved allele-dependent DNA-binding ability of at least two protein complexes to the region containing SNP rs968567. One of the proteins binding to this region in an allele-specific manner was shown to be the transcription factor ELK1 (a member of ETS domain transcription factor family). These results indicate that rs968567 influences FADS2 transcription and offer first insights into the modulation of complex regulation mechanisms of FADS2 gene transcription by SNPs. PMID:19546342

A common FADS2 promoter polymorphism increases promoter activity and facilitates binding of transcription factor ELK1.

PubMed

Lattka, E; Eggers, S; Moeller, G; Heim, K; Weber, M; Mehta, D; Prokisch, H; Illig, T; Adamski, J

2010-01-01

Fatty acid desaturases (FADS) play an important role in the formation of omega-6 and omega-3 highly unsaturated fatty acids (HUFAs). The composition of HUFAs in the human metabolome is important for membrane fluidity and for the modulation of essential physiological functions such as inflammation processes and brain development. Several recent studies reported significant associations of single nucleotide polymorphisms (SNPs) in the human FADS gene cluster with HUFA levels and composition. The presence of the minor allele correlated with a decrease of desaturase reaction products and an accumulation of substrates. We performed functional studies with two of the associated polymorphisms (rs3834458 and rs968567) and showed an influence of polymorphism rs968567 on FADS2 promoter activity by luciferase reporter gene assays. Electrophoretic mobility shift assays proved allele-dependent DNA-binding ability of at least two protein complexes to the region containing SNP rs968567. One of the proteins binding to this region in an allele-specific manner was shown to be the transcription factor ELK1 (a member of ETS domain transcription factor family). These results indicate that rs968567 influences FADS2 transcription and offer first insights into the modulation of complex regulation mechanisms of FADS2 gene transcription by SNPs.

Isolation and characterization of target sequences of the chicken CdxA homeobox gene.

PubMed Central

Margalit, Y; Yarus, S; Shapira, E; Gruenbaum, Y; Fainsod, A

1993-01-01

The DNA binding specificity of the chicken homeodomain protein CDXA was studied. Using a CDXA-glutathione-S-transferase fusion protein, DNA fragments containing the binding site for this protein were isolated. The sources of DNA were oligonucleotides with random sequence and chicken genomic DNA. The DNA fragments isolated were sequenced and tested in DNA binding assays. Sequencing revealed that most DNA fragments are AT rich which is a common feature of homeodomain binding sites. By electrophoretic mobility shift assays it was shown that the different target sequences isolated bind to the CDXA protein with different affinities. The specific sequences bound by the CDXA protein in the genomic fragments isolated, were determined by DNase I footprinting. From the footprinted sequences, the CDXA consensus binding site was determined. The CDXA protein binds the consensus sequence A, A/T, T, A/T, A, T, A/G. The CAUDAL binding site in the ftz promoter is also included in this consensus sequence. When tested, some of the genomic target sequences were capable of enhancing the transcriptional activity of reporter plasmids when introduced into CDXA expressing cells. This study determined the DNA sequence specificity of the CDXA protein and it also shows that this protein can further activate transcription in cells in culture. Images PMID:7909943

Glucose Regulates the Expression of the Apolipoprotein A5 Gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Fruchart, Jamila; Nowak, Maxime; Helleboid-Chapman, Audrey

2008-04-07

The apolipoprotein A5 gene (APOA5) is a key player in determining triglyceride concentrations in humans and mice. Since diabetes is often associated with hypertriglyceridemia, this study explores whether APOA5 gene expression is regulated by alteration in glucose homeostasis and the related pathways. D-glucose activates APOA5 gene expression in a time- and dose-dependent manner in hepatocytes, and the glycolytic pathway involved was determined using D-glucose analogs and metabolites. Together, transient transfections, electrophoretic mobility shift assays and chromatin immunoprecipitation assays show that this regulation occurs at the transcriptional level through an increase of USF1/2 binding to an E-box in the APOA5 promoter.more » We show that this phenomenon is not due to an increase of mRNA or protein expression levels of USF. Using protein phosphatases 1 and 2A inhibitor, we demonstrate that D-glucose regulates APOA5 gene via a dephosphorylation mechanism, thereby resulting in an enhanced USF1/2-promoter binding. Last, subsequent suppressions of USF1/2 and phosphatases mRNA through siRNA gene silencing abolished the regulation. We demonstrate that APOA5 gene is up regulated by D-glucose and USF through phosphatase activation. These findings may provide a new cross talk between glucose and lipid metabolism.« less

Quantitative analysis of TALE-DNA interactions suggests polarity effects.

PubMed

Meckler, Joshua F; Bhakta, Mital S; Kim, Moon-Soo; Ovadia, Robert; Habrian, Chris H; Zykovich, Artem; Yu, Abigail; Lockwood, Sarah H; Morbitzer, Robert; Elsäesser, Janett; Lahaye, Thomas; Segal, David J; Baldwin, Enoch P

2013-04-01

Transcription activator-like effectors (TALEs) have revolutionized the field of genome engineering. We present here a systematic assessment of TALE DNA recognition, using quantitative electrophoretic mobility shift assays and reporter gene activation assays. Within TALE proteins, tandem 34-amino acid repeats recognize one base pair each and direct sequence-specific DNA binding through repeat variable di-residues (RVDs). We found that RVD choice can affect affinity by four orders of magnitude, with the relative RVD contribution in the order NG > HD ≈ NN > NI > NK. The NN repeat preferred the base G over A, whereas the NK repeat bound G with 10(3)-fold lower affinity. We compared AvrBs3, a naturally occurring TALE that recognizes its target using some atypical RVD-base combinations, with a designed TALE that precisely matches 'standard' RVDs with the target bases. This comparison revealed unexpected differences in sensitivity to substitutions of the invariant 5'-T. Another surprising observation was that base mismatches at the 5' end of the target site had more disruptive effects on affinity than those at the 3' end, particularly in designed TALEs. These results provide evidence that TALE-DNA recognition exhibits a hitherto un-described polarity effect, in which the N-terminal repeats contribute more to affinity than C-terminal ones.

Improved bioactivity of G-rich triplex-forming oligonucleotides containing modified guanine bases

PubMed Central

Rogers, Faye A; Lloyd, Janice A; Tiwari, Meetu Kaushik

2014-01-01

Triplex structures generated by sequence-specific triplex-forming oligonucleotides (TFOs) have proven to be promising tools for gene targeting strategies. In addition, triplex technology has been highly utilized to study the molecular mechanisms of DNA repair, recombination and mutagenesis. However, triplex formation utilizing guanine-rich oligonucleotides as third strands can be inhibited by potassium-induced self-association resulting in G-quadruplex formation. We report here that guanine-rich TFOs partially substituted with 8-aza-7-deaza-guanine (PPG) have improved target site binding in potassium compared with TFOs containing the natural guanine base. We designed PPG-substituted TFOs to bind to a polypurine sequence in the supFG1 reporter gene. The binding efficiency of PPG-substituted TFOs to the target sequence was analyzed using electrophoresis mobility gel shift assays. We have determined that in the presence of potassium, the non-substituted TFO, AG30 did not bind to its target sequence, however binding was observed with the PPG-substituted AG30 under conditions with up to 140 mM KCl. The PPG-TFOs were able to maintain their ability to induce genomic modifications as measured by an assay for gene-targeted mutagenesis. In addition, these compounds were capable of triplex-induced DNA double strand breaks, which resulted in activation of apoptosis. PMID:25483840

Molecular mechanism for sphingosine-induced Pseudomonas ceramidase expression through the transcriptional regulator SphR

PubMed Central

Okino, Nozomu; Ito, Makoto

2016-01-01

Pseudomonas aeruginosa, an opportunistic, but serious multidrug-resistant pathogen, secretes a ceramidase capable of cleaving the N-acyl linkage of ceramide to generate fatty acids and sphingosine. We previously reported that the secretion of P. aeruginosa ceramidase was induced by host-derived sphingolipids, through which phospholipase C-induced hemolysis was significantly enhanced. We herein investigated the gene(s) regulating sphingolipid-induced ceramidase expression and identified SphR, which encodes a putative AraC family transcriptional regulator. Disruption of the sphR gene in P. aeruginosa markedly decreased the sphingomyelin-induced secretion of ceramidase, reduced hemolytic activity, and resulted in the loss of sphingomyelin-induced ceramidase expression. A microarray analysis confirmed that sphingomyelin significantly induced ceramidase expression in P. aeruginosa. Furthermore, an electrophoretic mobility shift assay revealed that SphR specifically bound free sphingoid bases such as sphingosine, dihydrosphingosine, and phytosphingosine, but not sphingomyelin or ceramide. A β-galactosidase-assisted promoter assay showed that sphingosine activated ceramidase expression through SphR at a concentration of 100 nM. Collectively, these results demonstrated that sphingosine induces the secretion of ceramidase by promoting the mRNA expression of ceramidase through SphR, thereby enhancing hemolytic phospholipase C-induced cytotoxicity. These results facilitate understanding of the physiological role of bacterial ceramidase in host cells. PMID:27941831

To Move Forward, We Must Be Mobile: Practical Uses of Mobile Technology in Literacy Education Courses

ERIC Educational Resources Information Center

Husbye, Nicholas E.; Elsener, Anne A.

2013-01-01

Technology continues to shift the definition of what it means to be literate. As literacy educators in teacher preparation programs, we must consider how emerging and mobile technology may be used within coursework to not only create multiple ways to conceptualize teaching 21st century literacy, but also as a professional imperative. This article…

Potential protection of green tea polyphenols against 1800 MHz electromagnetic radiation-induced injury on rat cortical neurons.

PubMed

Liu, Mei-Li; Wen, Jian-Qiang; Fan, Yu-Bo

2011-10-01

Radiofrequency electromagnetic fields (EMF) are harmful to public health, but the certain anti-irradiation mechanism is not clear yet. The present study was performed to investigate the possible protective effects of green tea polyphenols against electromagnetic radiation-induced injury in the cultured rat cortical neurons. In this study, green tea polyphenols were used in the cultured cortical neurons exposed to 1800 MHz EMFs by the mobile phone. We found that the mobile phone irradiation for 24 h induced marked neuronal cell death in the MTT (3-(4,5-dimethylthiazole-2-yl)-2,5-diphenyl-tetrazolium bromide) and TUNEL (TdT mediated biotin-dUTP nicked-end labeling) assay, and protective effects of green tea polyphenols on the injured cortical neurons were demonstrated by testing the content of Bcl-2 Assaciated X protein (Bax) in the immunoprecipitation assay and Western blot assay. In our study results, the mobile phone irradiation-induced increases in the content of active Bax were inhibited significantly by green tea polyphenols, while the contents of total Bax had no marked changes after the treatment of green tea polyphenols. Our results suggested a neuroprotective effect of green tea polyphenols against the mobile phone irradiation-induced injury on the cultured rat cortical neurons.

Role of the ganSPQAB Operon in Degradation of Galactan by Bacillus subtilis.

PubMed

Watzlawick, Hildegard; Morabbi Heravi, Kambiz; Altenbuchner, Josef

2016-10-15

Bacillus subtilis possesses different enzymes for the utilization of plant cell wall polysaccharides. This includes a gene cluster containing galactan degradation genes (ganA and ganB), two transporter component genes (ganQ and ganP), and the sugar-binding lipoprotein-encoding gene ganS (previously known as cycB). These genes form an operon that is regulated by GanR. The degradation of galactan by B. subtilis begins with the activity of extracellular GanB. GanB is an endo-β-1,4-galactanase and is a member of glycoside hydrolase (GH) family 53. This enzyme was active on high-molecular-weight arabinose-free galactan and mainly produced galactotetraose as well as galactotriose and galactobiose. These galacto-oligosaccharides may enter the cell via the GanQP transmembrane proteins of the galactan ABC transporter. The specificity of the galactan ABC transporter depends on the sugar-binding lipoprotein, GanS. Purified GanS was shown to bind galactotetraose and galactotriose using thermal shift assay. The energy for this transport is provided by MsmX, an ATP-binding protein. The transported galacto-oligosaccharides are further degraded by GanA. GanA is a β-galactosidase that belongs to GH family 42. The GanA enzyme was able to hydrolyze short-chain β-1,4-galacto-oligosaccharides as well as synthetic β-galactopyranosides into galactose. Thermal shift assay as well as electrophoretic mobility shift assay demonstrated that galactobiose is the inducer of the galactan operon regulated by GanR. DNase I footprinting revealed that the GanR protein binds to an operator overlapping the -35 box of the σ(A)-type promoter of Pgan, which is located upstream of ganS IMPORTANCE: Bacillus subtilis is a Gram-positive soil bacterium that utilizes different types of carbohydrates, such as pectin, as carbon sources. So far, most of the pectin degradation systems and enzymes have been thoroughly studied in B. subtilis Nevertheless, the B. subtilis utilization system of galactan, which is found as the side chain of the rhamnogalacturonan type I complex in pectin, has remained partially studied. Here, we investigated the galactan utilization system consisting of the ganSPQAB operon and its regulator ganR This study improves our knowledge of the carbohydrate degradation systems of B. subtilis, especially the pectin degradation systems. Moreover, the galactan-degrading enzymes may be exploited for the production of galacto-oligosaccharides, which are used as prebiotic substances in the food industry. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

[The Effects of Mobile Social Networking Service-Based Cognitive Behavior Therapy on Insomnia in Nurses].

PubMed

Kim, Ji Eun; Kim, Suk Sun

2017-08-01

This study aimed to examine the effects of cognitive behavior therapy for insomnia (CBT-I) based on the mobile social networking service (SNS) on dysfunctional beliefs and attitudes about sleep, sleep quality, daytime sleepiness, depression, and quality of life among rotating-shift nurses in a hospital in Korea. A nonequivalent control group pre-post test design was used. The participants included 55 nurses with rotating three-shift work (25 in the experimental group and 30 in the control group). For the experimental group, CBT-I using mobile SNS was provided once a week for 60 minutes over six weeks. Data were analyzed using descriptive statistics, χ²-test, independent samples t-test, and Mann-whitney U test with the SPSS 21.0 program. In the homogeneity test of the general characteristics and study variables, there were no significant differences between the two groups. Nurses in the experimental group had significantly lower scores on dysfunctional beliefs and attitudes regarding sleep and sleepiness than nurses in the control group. Nurses in the experimental group had significantly higher scores on sleep quality and quality of life than nurses in the control group. These findings indicate that using the mobile SNS-based CBT-I is feasible and has significant and positive treatment-related effects on rotating-shift nurses' irrational thoughts and beliefs in association with sleep, sleep quality, daytime sleepiness, and quality of life. These contribute to expanding our knowledge of rotating-shift nurses' sleep issues and their preferences for intervention. © 2017 Korean Society of Nursing Science

Development and deployment of a rapid recombinase polymerase amplification Ebola virus detection assay in Guinea in 2015.

PubMed

Faye, Oumar; Faye, Ousmane; Soropogui, Barré; Patel, Pranav; El Wahed, Ahmed Abd; Loucoubar, Cheikh; Fall, Gamou; Kiory, Davy; Magassouba, N'Faly; Keita, Sakoba; Kondé, Mandy Kader; Diallo, Alpha Amadou; Koivogui, Lamine; Karlberg, Helen; Mirazimi, Ali; Nentwich, Oliver; Piepenburg, Olaf; Niedrig, Matthias; Weidmann, Manfred; Sall, Amadou Alpha

2015-01-01

In the absence of a vaccine or specific treatments for Ebola virus disease (EVD), early identification of cases is crucial for the control of EVD epidemics. We evaluated a new extraction kit (SpeedXtract (SE), Qiagen) on sera and swabs in combination with an improved diagnostic reverse transcription recombinase polymerase amplification assay for the detection of Ebola virus (EBOV-RT-RPA). The performance of combined extraction and detection was best for swabs. Sensitivity and specificity of the combined SE and EBOV-RT-RPA were tested in a mobile laboratory consisting of a mobile glovebox and a Diagnostics-in-a-Suitcase powered by a battery and solar panel, deployed to Matoto Conakry, Guinea as part of the reinforced surveillance strategy in April 2015 to reach the goal of zero cases. The EBOV-RT-RPA was evaluated in comparison to two real-time PCR assays. Of 928 post-mortem swabs, 120 tested positive, and the combined SE and EBOV-RT-RPA yielded a sensitivity and specificity of 100% in reference to one real-time RT-PCR assay. Another widely used real-time RT-PCR was much less sensitive than expected. Results were provided very fast within 30 to 60 min, and the field deployment of the mobile laboratory helped improve burial management and community engagement.

Exposure to non-ionizing electromagnetic fields emitted from mobile phones induced DNA damage in human ear canal hair follicle cells.

PubMed

Akdag, Mehmet; Dasdag, Suleyman; Canturk, Fazile; Akdag, Mehmet Zulkuf

2018-01-01

The aim of this study was to investigate effect of radiofrequency radiation (RFR) emitted from mobile phones on DNA damage in follicle cells of hair in the ear canal. The study was carried out on 56 men (age range: 30-60 years old)in four treatment groups with n = 14 in each group. The groups were defined as follows: people who did not use a mobile phone (Control), people use mobile phones for 0-30 min/day (second group), people use mobile phones for 30-60 min/day (third group) and people use mobile phones for more than 60 min/day (fourth group). Ear canal hair follicle cells taken from the subjects were analyzed by the Comet Assay to determine DNA damages. The Comet Assay parameters measured were head length, tail length, comet length, percentage of head DNA, tail DNA percentage, tail moment, and Olive tail moment. Results of the study showed that DNA damage indicators were higher in the RFR exposure groups than in the control subjects. In addition, DNA damage increased with the daily duration of exposure. In conclusion, RFR emitted from mobile phones has a potential to produce DNA damage in follicle cells of hair in the ear canal. Therefore, mobile phone users have to pay more attention when using wireless phones.

Quantifying attention shifts in augmented reality image-guided neurosurgery

PubMed Central

Drouin, Simon; Collins, D. Louis; Popa, Tiberiu; Kersten-Oertel, Marta

2017-01-01

Image-guided surgery (IGS) has allowed for more minimally invasive procedures, leading to better patient outcomes, reduced risk of infection, less pain, shorter hospital stays and faster recoveries. One drawback that has emerged with IGS is that the surgeon must shift their attention from the patient to the monitor for guidance. Yet both cognitive and motor tasks are negatively affected with attention shifts. Augmented reality (AR), which merges the realworld surgical scene with preoperative virtual patient images and plans, has been proposed as a solution to this drawback. In this work, we studied the impact of two different types of AR IGS set-ups (mobile AR and desktop AR) and traditional navigation on attention shifts for the specific task of craniotomy planning. We found a significant difference in terms of the time taken to perform the task and attention shifts between traditional navigation, but no significant difference between the different AR set-ups. With mobile AR, however, users felt that the system was easier to use and that their performance was better. These results suggest that regardless of where the AR visualisation is shown to the surgeon, AR may reduce attention shifts, leading to more streamlined and focused procedures. PMID:29184663

Quantifying attention shifts in augmented reality image-guided neurosurgery.

PubMed

Léger, Étienne; Drouin, Simon; Collins, D Louis; Popa, Tiberiu; Kersten-Oertel, Marta

2017-10-01

Image-guided surgery (IGS) has allowed for more minimally invasive procedures, leading to better patient outcomes, reduced risk of infection, less pain, shorter hospital stays and faster recoveries. One drawback that has emerged with IGS is that the surgeon must shift their attention from the patient to the monitor for guidance. Yet both cognitive and motor tasks are negatively affected with attention shifts. Augmented reality (AR), which merges the realworld surgical scene with preoperative virtual patient images and plans, has been proposed as a solution to this drawback. In this work, we studied the impact of two different types of AR IGS set-ups (mobile AR and desktop AR) and traditional navigation on attention shifts for the specific task of craniotomy planning. We found a significant difference in terms of the time taken to perform the task and attention shifts between traditional navigation, but no significant difference between the different AR set-ups. With mobile AR, however, users felt that the system was easier to use and that their performance was better. These results suggest that regardless of where the AR visualisation is shown to the surgeon, AR may reduce attention shifts, leading to more streamlined and focused procedures.

Protein–ligand interactions investigated by thermal shift assays (TSA) and dual polarization interferometry (DPI)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Grøftehauge, Morten K., E-mail: m.k.groftehauge@durham.ac.uk; Hajizadeh, Nelly R.; Swann, Marcus J.

2015-01-01

The biophysical characterization of protein–ligand interactions in solution using techniques such as thermal shift assay, or on surfaces using, for example, dual polarization interferometry, plays an increasingly important role in complementing crystal structure determinations. Over the last decades, a wide range of biophysical techniques investigating protein–ligand interactions have become indispensable tools to complement high-resolution crystal structure determinations. Current approaches in solution range from high-throughput-capable methods such as thermal shift assays (TSA) to highly accurate techniques including microscale thermophoresis (MST) and isothermal titration calorimetry (ITC) that can provide a full thermodynamic description of binding events. Surface-based methods such as surface plasmonmore » resonance (SPR) and dual polarization interferometry (DPI) allow real-time measurements and can provide kinetic parameters as well as binding constants. DPI provides additional spatial information about the binding event. Here, an account is presented of new developments and recent applications of TSA and DPI connected to crystallography.« less

Mobile Communication and Civil Society: Linking Patterns and Places of Use to Engagement with Others in Public

ERIC Educational Resources Information Center

Campbell, Scott W.; Kwak, Nojin

2011-01-01

This study examined whether and how mobile communication influences the extent to which one engages with new people in public settings. Contrary to our expectation, general use of the technology in public did not detract from conversing with strangers. Shifting focus from "where" one uses the mobile phone to "how" it is used, we found that uses…

Night shift work and levels of 6-sulfatoxymelatonin and cortisol in men.

PubMed

Mirick, Dana K; Bhatti, Parveen; Chen, Chu; Nordt, Frank; Stanczyk, Frank Z; Davis, Scott

2013-06-01

Night shift work is associated with cancer among men, but the biologic mechanism is unclear. We investigated whether male night shift workers showed changes in levels of melatonin and cortisol, potential biomarkers of cancer risk. Urine was collected from 185 night shift and 158 day shift-working male healthcare providers, aged 22 to 55 years, throughout work and sleep periods, and assayed for 6-sulfatoxymelatonin and cortisol. Morning serum was collected within 90 minutes of completing the night and assayed for cortisol. Night shift workers had significantly lower 6-sulfatoxymelatonin levels during daytime sleep, nighttime work, and nighttime sleep on off-nights (57%, 62%, and 40% lower, respectively), relative to the day shift workers during nighttime sleep (P < 0.0001); urinary cortisol in night shift workers was 16% higher during daytime sleep and 13% lower during nighttime sleep on off-nights (P < 0.05). Morning serum cortisol post-work and post-sleep in night shift workers were 24% and 43% lower, respectively, than post-sleep levels among day shift workers (P < 0.0001). Within-subject comparisons among the night shift workers revealed significantly lower melatonin levels and significantly higher urinary cortisol levels during daytime sleep and nighttime work, relative to nighttime sleep (P < 0.01); morning serum cortisol levels post-work were lower than those post-sleep. Night shift workers have substantially lower 6-sulfatoxymelatonin during night work and daytime sleep, and levels remain low when night shift workers sleep at night. Chronic reduction in melatonin among night shift workers may be an important carcinogenic mechanism. Cortisol secretion patterns may be impacted by night shift work, which could affect cancer risk. Shift work could be an important risk factor for many types of cancer.

Molecular Characterization and Transcriptional Regulation Analysis of the Bovine PDHB Gene.

PubMed

Li, Anning; Zhang, Yaran; Zhao, Zhidong; Wang, Mingming; Zan, Linsen

2016-01-01

The pyruvate dehydrogenase beta subunit (PDHB) is a subunit of pyruvate dehydrogenase (E1), which catalyzes pyruvate into acetyl-CoA and provides a linkage between the tricarboxylic acid cycle (TCA) and the glycolysis pathway. Previous studies demonstrated PDHB to be positively related to the intramuscular fat (IMF) content. However, the transcriptional regulation of PDHB remains unclear. In our present study, the cDNA of bovine PDHB was cloned and the genomic structure was analyzed. The phylogenetic tree showed bovine PDHB to be closely related to goat and sheep, and least related to chicken. Spatial expression pattern analysis revealed the products of bovine PDHB to be widely expressed with the highest level in the fat of testis. To understand the transcriptional regulation of bovine PDHB, 1899 base pairs (bp) of the 5'-regulatory region was cloned. Sequence analysis neither found consensus TATA-box nor CCAAT-box in the 5'-flanking region of bovine PDHB. However, a CpG island was predicted from nucleotides -284 to +117. Serial deletion constructs of the 5'-flanking region, evaluated in dual-luciferase reporter assay, revealed the core promoter to be located 490bp upstream from the transcription initiation site (+1). Electrophoretic mobility shift assay (EMSA) and chromatin immunoprecipitation assay (ChIP) in combination with asite-directed mutation experiment indicated both myogenin (MYOG) and the CCAAT/enhancer-binding protein beta (C/EBPß) to be important transcription factors for bovine PDHB in skeletal muscle cells and adipocytes. Our results provide an important basis for further investigation of the bovine PDHB function and regulation in cattle.

Molecular Characterization and Transcriptional Regulation Analysis of the Bovine PDHB Gene

PubMed Central

Li, Anning; Zhang, Yaran; Zhao, Zhidong; Wang, Mingming; Zan, Linsen

2016-01-01

The pyruvate dehydrogenase beta subunit (PDHB) is a subunit of pyruvate dehydrogenase (E1), which catalyzes pyruvate into acetyl-CoA and provides a linkage between the tricarboxylic acid cycle (TCA) and the glycolysis pathway. Previous studies demonstrated PDHB to be positively related to the intramuscular fat (IMF) content. However, the transcriptional regulation of PDHB remains unclear. In our present study, the cDNA of bovine PDHB was cloned and the genomic structure was analyzed. The phylogenetic tree showed bovine PDHB to be closely related to goat and sheep, and least related to chicken. Spatial expression pattern analysis revealed the products of bovine PDHB to be widely expressed with the highest level in the fat of testis. To understand the transcriptional regulation of bovine PDHB, 1899 base pairs (bp) of the 5’-regulatory region was cloned. Sequence analysis neither found consensus TATA-box nor CCAAT-box in the 5’-flanking region of bovine PDHB. However, a CpG island was predicted from nucleotides -284 to +117. Serial deletion constructs of the 5’-flanking region, evaluated in dual-luciferase reporter assay, revealed the core promoter to be located 490bp upstream from the transcription initiation site (+1). Electrophoretic mobility shift assay (EMSA) and chromatin immunoprecipitation assay (ChIP) in combination with asite-directed mutation experiment indicated both myogenin (MYOG) and the CCAAT/enhancer-binding protein beta (C/EBPß) to be important transcription factors for bovine PDHB in skeletal muscle cells and adipocytes. Our results provide an important basis for further investigation of the bovine PDHB function and regulation in cattle. PMID:27379520

Ferrocene and (arene)ruthenium(II) complexes of the natural anticancer naphthoquinone plumbagin with enhanced efficacy against resistant cancer cells and a genuine mode of action.

PubMed

Spoerlein-Guettler, Cornelia; Mahal, Katharina; Schobert, Rainer; Biersack, Bernhard

2014-09-01

A series of ferrocene and (arene)ruthenium(II) complexes attached to the naturally occurring anticancer naphthoquinones plumbagin and juglone was tested for efficacy against various cancer cell lines and for alterations in the mode of action. The plumbagin ferrocene and (p-cymene)Ru(II) conjugates 1c and 2a overcame the multi-drug drug resistance of KB-V1/Vbl cervix carcinoma cells and showed IC50 (72 h) values around 1 μM in growth inhibition assays using 3-(4,5-dimethyl-2-yl)-2,5-diphenyltetrazolium bromide (MTT). They were further investigated for their influence on the cell cycle of KB-V1/Vbl and HCT-116 colon carcinoma cells, on the generation of reactive oxygen species (ROS) by the latter cell line, for their substrate character for the P-glycoprotein drug eflux pump via the calcein-AM efflux assays, and for DNA affinity by the electrophoretic mobility shift assay (EMSA). The derivatives 1c and 2a increased the number of dead cancer cells (sub-G0/G1 fraction) in a dose- and time-dependent manner. ROS levels were significantly increased upon treatment with 1c and 2a. These compounds also showed a greater affinity to linear DNA than plumbagin. While plumbagin did not affect calcein-AM transport by P-glycoprotein the derivatives 1c and 2a exhibited a 50% or 80% inhibition of the P-glycoprotein-mediated calcein-AM efflux relative to the clinically established sensitizer verapamil. Copyright © 2014 Elsevier Inc. All rights reserved.

Dimeric PROP1 binding to diverse palindromic TAAT sequences promotes its transcriptional activity.

PubMed

Nakayama, Michie; Kato, Takako; Susa, Takao; Sano, Akiko; Kitahara, Kousuke; Kato, Yukio

2009-08-13

Mutations in the Prop1 gene are responsible for murine Ames dwarfism and human combined pituitary hormone deficiency with hypogonadism. Recently, we reported that PROP1 is a possible transcription factor for gonadotropin subunit genes through plural cis-acting sites composed of AT-rich sequences containing a TAAT motif which differs from its consensus binding sequence known as PRDQ9 (TAATTGAATTA). This study aimed to verify the binding specificity and sequence of PROP1 by applying the method of SELEX (Systematic Evolution of Ligands by EXponential enrichment), EMSA (electrophoretic mobility shift assay) and transient transfection assay. SELEX, after 5, 7 and 9 generations of selection using a random sequence library, showed that nucleotides containing one or two TAAT motifs were accumulated and accounted for 98.5% at the 9th generation. Aligned sequences and EMSA demonstrated that PROP1 binds preferentially to 11 nucleotides composed of an inverted TAAT motif separated by 3 nucleotides with variation in the half site of palindromic TAAT motifs and with preferential requirement of T at the nucleotide number 5 immediately 3' to a TAAT motif. Transient transfection assay demonstrated first that dimeric binding of PROP1 to an inverted TAAT motif and its cognates resulted in transcriptional activation, whereas monomeric binding of PROP1 to a single TAAT motif and an inverted ATTA motif did not mediate activation. Thus, this study demonstrated that dimeric binding of PROP1 is able to recognize diverse palindromic TAAT sequences separated by 3 nucleotides and to exhibit its transcriptional activity.

Changes in brain glioma incidence and laterality correlates with use of mobile phones--a nationwide population based study in Israel.

PubMed

Barchana, Micha; Margaliot, Menahem; Liphshitz, Irena

2012-01-01

Mobile phones are in extensive use worldwide and concerns regarding their role in tumor formation were raised. Over the years multiple studies were published in order to investigate this issue using several approaches. The current study looks at secular trends of brain gliomas (low and high grade) incidence and changes in tumor's laterality over 30 years in a population extensively using this technology with a possible correlation to the spread of use of mobile phones. All brain gliomas that were diagnosed from 1980-2009 were included and subdivided into two groups--low and high grade. Secular and periodic time trend analyses of incidence rates and changes in laterality were performed. Preferred side of head using mobile phones was assessed with a questionnaire in a sample of adult individuals. A decrease in incidence of low grade giomas (LGG) that correlated with introduction of mobile technology was found from 2.57, 2.34 and 2.79 for every 100,000 in the period 1980 to the end of 1994 to 1.72, 1.82 and 1.57, respectively, over the last three 5-years periods (1995-2009). High-grade glioma incidences increased significantly from 1980-2009 but in the period after mobile phones were introduced (1994-2009) a lower, non significant, rate of increase was observed in males and a lower one (significant) in females. A shift towards left sided tumor location for all adult gliomas combined and separately for LGG and HGG was noted from 1995 onward. The shift was more marked for those who were diagnosed in ages 20-49 (p=0.03). We found a statistically significant decrease in LGG's over 30-years period that correlates with introducing of mobile phones technology and a shift in laterality towards left-sided tumors, the latter occurred in both low and high-grade gliomas.

Making Shock Waves in Microfluidics: The Physics and Applications of Isotachophoresis

NASA Astrophysics Data System (ADS)

Santiago, Juan

2007-11-01

Microfluidics lies at the interfaces between engineering, chemistry, and biology, and aims to develop chemical laboratories on a chip. An important technique is on-chip capillary electrophoresis which has been applied to a wide range of chemical and biochemical assay applications over the last decade. Perhaps the best way of improving the sensitivity of on-chip electrophoresis is to integrate an online sample preconcentration method. At Stanford, we are developing methods to concentrate ions into small volumes using a method called isotachophoresis (ITP). In ITP, sample ions are injected between the high mobility co-ions of a leading electrolyte (LE) and the low mobility co-ions of a trailing electrolyte (TE). Upon application of an electric field, the disparate ion mobilities of the LE and TE cause sample species to segregate and focus into a series of narrow self-sharpening zones which migrate at equal velocity (hence ``isotacho''). ITP-type processes have been studied and used for more than 60 years, and yet there remain significant challenges in the robust modeling of these transport processes and the creation of widely applicable assays. We use ITP to create sample ion concentration ``shock waves'' in microchannels. These concentration waves can be integrated with on-chip electrophoresis for high sensitivity assays, and novel modes of operation. The talk will summarize the basic physics of ITP, experimental studies of ITP, models of ITP, and the development of novel ITP-assays with unprecedented sensitivity and new functionality. For example, using leading-to-sample ion concentration ratios of 10^15 and local electric fields of ˜4 kV/cm, we can achieve order one micron wide ITP zones. We can achieve million fold preconcentration in 120 s and can detect 100 attomolar sample concentrations (to our knowledge the highest demonstrated sensitivity for an electrophoresis-related assay). We have also developed a method that uses ITP to separate, indirectly detect, and identify the electrophoretic mobilities of unlabeled (non-fluorescent) analytes using surrogate fluorescent molecules. Our goal is the development of novel on-chip ITP assays which expand the design space of microfluidic devices.

Investigating the Use of Text Messages in Mobile Learning

ERIC Educational Resources Information Center

Geng, Gretchen

2013-01-01

Nowadays, teaching and learning have been shifted from traditional classrooms to technology-supported learning environment. By offering a convenient, efficient and financially affordable information technology learning environment, mobile learning is a topic that is of considerable interest for education audiences owing to the pervasive nature of…

Differential detection of Gaussian MSK in a mobile radio environment

NASA Technical Reports Server (NTRS)

Simon, M. K.; Wang, C. C.

1984-01-01

Minimum shift keying with Gaussian shaped transmit pulses is a strong candidate for a modulation technique that satisfies the stringent out-of-band radiated power requirements of the mobil radio application. Numerous studies and field experiments have been conducted by the Japanese on urban and suburban mobile radio channels with systems employing Gaussian minimum-shift keying (GMSK) transmission and differentially coherent reception. A comprehensive analytical treatment is presented of the performance of such systems emphasizing the important trade-offs among the various system design parameters such as transmit and receiver filter bandwidths and detection threshold level. It is shown that two-bit differential detection of GMSK is capable of offering far superior performance to the more conventional one-bit detection method both in the presence of an additive Gaussian noise background and Rician fading.

Differential detection of Gaussian MSK in a mobile radio environment

NASA Astrophysics Data System (ADS)

Simon, M. K.; Wang, C. C.

1984-11-01

Minimum shift keying with Gaussian shaped transmit pulses is a strong candidate for a modulation technique that satisfies the stringent out-of-band radiated power requirements of the mobil radio application. Numerous studies and field experiments have been conducted by the Japanese on urban and suburban mobile radio channels with systems employing Gaussian minimum-shift keying (GMSK) transmission and differentially coherent reception. A comprehensive analytical treatment is presented of the performance of such systems emphasizing the important trade-offs among the various system design parameters such as transmit and receiver filter bandwidths and detection threshold level. It is shown that two-bit differential detection of GMSK is capable of offering far superior performance to the more conventional one-bit detection method both in the presence of an additive Gaussian noise background and Rician fading.

Dexamethasone potently enhances phorbol ester-induced IL-1beta gene expression and nuclear factor NF-kappaB activation.

PubMed

Wang, Y; Zhang, J J; Dai, W; Lei, K Y; Pike, J W

1997-07-15

The synthetic glucocorticoid dexamethasone, an immunosuppressive and anti-inflammatory agent, was investigated for its effect on PMA-mediated expression of the inflammatory cytokine IL-1beta in the human monocytic leukemic cell line THP-1. PMA alone induced the production of low levels of IL-1beta in THP-1 cells, whereas dexamethasone alone had no effect. However, dexamethasone potently enhanced PMA-mediated IL-1beta production. Using a selective and potent inhibitor of protein kinase C, we found that synergistic interaction between PMA and dexamethasone requires protein kinase C activation. PMA has been known to activate nuclear factor NF-kappaB in THP-1 cells. Using an oligonucleotide probe corresponding to an NF-kappaB DNA-binding motif of the IL-1beta gene promoter in gel electrophoresis mobility shift assays, we demonstrated that PMA-induced NF-kappaB activation was greatly potentiated by dexamethasone. Our results indicate that glucocorticoids can be positive regulators of inflammatory cytokine gene expression during monocytic cell differentiation.

The clpB gene of Bifidobacterium breve UCC 2003: transcriptional analysis and first insights into stress induction.

PubMed

Ventura, Marco; Kenny, John G; Zhang, Ziding; Fitzgerald, Gerald F; van Sinderen, Douwe

2005-09-01

The so-called clp genes, which encode components of the Clp proteolytic complex, are widespread among bacteria. The Bifidobacterium breve UCC 2003 genome contains a clpB gene with significant homology to predicted clpB genes from other members of the Actinobacteridae group. The heat- and osmotic-inducibility of the B. breve UCC 2003 clpB homologue was verified by slot-blot analysis, while Northern blot and primer extension analyses showed that the clpB gene is transcribed as a monocistronic unit with a single promoter. The role of a hspR homologue, known to control the regulation of clpB and dnaK gene expression in other high G+C content bacteria was investigated by gel mobility shift assays. Moreover the predicted 3D structure of HspR provides further insight into the binding mode of this protein to the clpB promoter region, and highlights the key amino acid residues believed to be involved in the protein-DNA interaction.

High level transactivation by a modified Bombyx ecdysone receptor in mammalian cells without exogenous retinoid X receptor

PubMed Central

Suhr, Steven T.; Gil, Elad B.; Senut, Marie-Claude; Gage, Fred H.

1998-01-01

Our studies of the Bombyx mori ecdysone receptor (BE) revealed that, unlike the Drosophila melanogaster ecdysone receptor (DE), treatment of BE with the ecdysone agonist tebufenozide stimulated high level transactivation in mammalian cells without adding an exogenous heterodimer partner. Gel mobility shift and transfection assays with both the ultraspiracle gene product (Usp) and retinoid X receptor heterodimer partners indicated that this property of BE stems from significantly augmented heterodimer complex formation and concomitant DNA binding. We have mapped this “gain of function” to determinants within the D and E domains of BE and demonstrated that, although the D domain determinant is sufficient for high affinity heterodimerization with Usp, both determinants are necessary for high affinity interaction with retinoid X receptor. Modified BE receptors alone used as replication-defective retroviruses potently stimulated separate “reporter” viruses in all cell types examined, suggesting that BE has potentially broad utility in the modulation of transgene expression in mammalian cells. PMID:9653129

Inhibitory role of acyl homoserine lactones in hemolytic activity and viability of Streptococcus pyogenes M6 S165

PubMed Central

Saroj, Sunil D.; Holmer, Linda; Berengueras, Júlia M.; Jonsson, Ann-Beth

2017-01-01

Streptococcus pyogenes an adapted human pathogen asymptomatically colonizes the nasopharynx, among other polymicrobial communities. However, information on the events leading to the colonization and expression of virulence markers subject to interspecies and host-bacteria interactions are limited. The interference of acyl homoserine lactones (AHLs) with the hemolytic activity and viability of S. pyogenes M6 S165 was examined. AHLs, with fatty acid side chains ≥12 carbon atoms, inhibited hemolytic activity by downregulating the expression of the sag operon involved in the production of streptolysin S. Inhibitory AHLs upregulated the expression of transcriptional regulator LuxR. Electrophoretic mobility shift assays revealed the interaction of LuxR with the region upstream of sagA. AHL-mediated bactericidal activity observed at higher concentrations (mM range) was an energy-dependent process, constrained by the requirement of glucose and iron. Ferrichrome transporter FtsABCD facilitated transport of AHLs across the streptococcal membrane. The study demonstrates a previously unreported role for AHLs in S. pyogenes virulence. PMID:28303956

Inhibitory role of acyl homoserine lactones in hemolytic activity and viability of Streptococcus pyogenes M6 S165.

PubMed

Saroj, Sunil D; Holmer, Linda; Berengueras, Júlia M; Jonsson, Ann-Beth

2017-03-17

Streptococcus pyogenes an adapted human pathogen asymptomatically colonizes the nasopharynx, among other polymicrobial communities. However, information on the events leading to the colonization and expression of virulence markers subject to interspecies and host-bacteria interactions are limited. The interference of acyl homoserine lactones (AHLs) with the hemolytic activity and viability of S. pyogenes M6 S165 was examined. AHLs, with fatty acid side chains ≥12 carbon atoms, inhibited hemolytic activity by downregulating the expression of the sag operon involved in the production of streptolysin S. Inhibitory AHLs upregulated the expression of transcriptional regulator LuxR. Electrophoretic mobility shift assays revealed the interaction of LuxR with the region upstream of sagA. AHL-mediated bactericidal activity observed at higher concentrations (mM range) was an energy-dependent process, constrained by the requirement of glucose and iron. Ferrichrome transporter FtsABCD facilitated transport of AHLs across the streptococcal membrane. The study demonstrates a previously unreported role for AHLs in S. pyogenes virulence.

Fis protein induced λF-DNA bending observed by single-pair fluorescence resonance energy transfer

NASA Astrophysics Data System (ADS)

Chi-Cheng, Fu; Wunshain, Fann; Yuan Hanna, S.

2006-03-01

Fis, a site-specific DNA binding protein, regulates many biological processes including recombination, transcription, and replication in E.coli. Fis induced DNA bending plays an important role in regulating these functions and bending angle range from ˜50 to 95 dependent on the DNA sequence. For instance, the average bending angle of λF-DNA (26 bp, 8.8nm long, contained λF binding site on the center) measured by gel mobility shift assays was ˜ 94 . But the traditional method cannot provide information about the dynamics and the angle distribution. In this study, λF-DNA was labeled with donor (Alexa Fluor 546) and acceptor (Alexa Fluor 647) dyes on its two 5' ends and the donor-acceptor distances were measured using single-pair fluorescence resonance energy transfer (sp-FRET) with and without the present of Fis protein. Combing with structure information of Fis-DNA complex, the sp-FRET results are used to estimate the protein induced DNA bending angle distribution and dynamics.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Dahabieh, Matthew S., E-mail: dahabieh@interchange.ubc.ca; Ooms, Marcel, E-mail: marcel.ooms@mssm.edu; Malcolm, Tom, E-mail: tmalc1@yahoo.com

Transcription from the HIV-1 long terminal repeat (LTR) is mediated by numerous host transcription factors. In this study we characterized an E-box motif (RBE1) within the core promoter that was previously implicated in both transcriptional activation and repression. We show that RBE1 is a binding site for the RBF-2 transcription factor complex (USF1, USF2, and TFII-I), previously shown to bind an upstream viral element, RBE3. The RBE1 and RBE3 elements formed complexes of identical mobility and protein constituents in gel shift assays, both with Jurkat T-cell nuclear extracts and recombinant USF/TFII-I. Furthermore, both elements are regulators of HIV-1 expression; mutationsmore » in LTR-luciferase reporters and in HIV-1 molecular clones resulted in decreased transcription, virion production, and proviral expression in infected cells. Collectively, our data indicate that RBE1 is a bona fide RBF-2 binding site and that the RBE1 and RBE3 elements are necessary for mediating proper transcription from the HIV-1 LTR.« less

Rice homeobox transcription factor HOX1a positively regulates gibberellin responses by directly suppressing EL1.

PubMed

Wen, Bi-Qing; Xing, Mei-Qing; Zhang, Hua; Dai, Cheng; Xue, Hong-Wei

2011-11-01

Homeobox transcription factors are involved in various aspects of plant development, including maintenance of the biosynthesis and signaling pathways of different hormones. However, few direct targets of homeobox proteins have been identified. We here show that overexpression of rice homeobox gene HOX1a resulted in enhanced gibberellin (GA) response, indicating a positive effect of HOX1a in GA signaling. HOX1a is induced by GA and encodes a homeobox transcription factor with transcription repression activity. In addition, HOX1a suppresses the transcription of early flowering1 (EL1), a negative regulator of GA signaling, and further electrophoretic mobility shift assay and chromatin immunoprecipitation analysis revealed that HOX1a directly bound to the promoter region of EL1 to suppress its expression and stimulate GA signaling. These results demonstrate that HOX1a functions as a positive regulator of GA signaling by suppressing EL1, providing informative hints on the study of GA signaling. © 2011 Institute of Botany, Chinese Academy of Sciences.

Changes in Expression of Signal Transduction Proteins in T Lymphocytes of Patients with Leprosy

PubMed Central

Zea, Arnold H.; Ochoa, Maria T.; Ghosh, Paritosh; Longo, Dan L.; Alvord, W. Gregory; Valderrama, Liliana; Falabella, Rafael; Harvey, Linda K.; Saravia, Nancy; Moreno, Luis H.; Ochoa, Augusto C.

1998-01-01

Advanced stages of mycobacterial diseases such as leprosy and tuberculosis are characterized by a loss of T-cell function. The basis of this T-cell dysfunction is not well understood. The present report demonstrates major alterations in the expression of signal transduction molecules in T cells of leprosy patients. These alterations were most frequently observed in lepromatous leprosy (LL) patients. Of 29 LL patients, 69% had decreased T-cell receptor ζ-chain expression, 48% had decreased p56lck tyrosine kinase, and 63% had a loss of nuclear transcription factor NF-κB p65. An electrophoretic mobility shift assay with the gamma interferon core promoter region revealed a loss of the Th1 DNA-binding pattern in LL patients. In contrast, tuberculoid leprosy patients had only minor signal transduction alterations. These novel findings might improve our understanding of the T-cell dysfunction observed in leprosy and other infectious diseases and consequently might lead to better immunologic evaluation of patients. PMID:9453602

Electrophoretic mobilities of cultured human embryonic kidney cells in various buffers

NASA Technical Reports Server (NTRS)

1985-01-01

Data on the electrophoretic mobility distributions of cells in the new D-1 buffer and the interlaboratory standardization of urokinase assay methods are presented. A table of cell strains and recent data on cell dispersal methods are also included. It was decided that glycerol in A-1 electrophoretic mobility data on cultured human embryonic kidney cells subjected to electrophoresis in this buffer. The buffer composition is presented.

Effect of GSTM1 and GSTT1 Polymorphisms on Genetic Damage in Humans Populations Exposed to Radiation From Mobile Towers.

PubMed

Gulati, Sachin; Yadav, Anita; Kumar, Neeraj; Kanupriya; Aggarwal, Neeraj K; Kumar, Rajesh; Gupta, Ranjan

2016-04-01

All over the world, people have been debating about associated health risks due to radiation from mobile phones and mobile towers. The carcinogenicity of this nonionizing radiation has been the greatest health concern associated with mobile towers exposure until recently. The objective of our study was to evaluate the genetic damage caused by radiation from mobile towers and to find an association between genetic polymorphism of GSTM1 and GSTT1 genes and DNA damage. In our study, 116 persons exposed to radiation from mobile towers and 106 control subjects were genotyped for polymorphisms in the GSTM1 and GSTT1 genes by multiplex polymerase chain reaction method. DNA damage in peripheral blood lymphocytes was determined using alkaline comet assay in terms of tail moment (TM) value and micronucleus assay in buccal cells (BMN). There was a significant increase in BMN frequency and TM value in exposed subjects (3.65 ± 2.44 and 6.63 ± 2.32) compared with control subjects (1.23 ± 0.97 and 0.26 ± 0.27). However, there was no association of GSTM1 and GSTT1 polymorphisms with the level of DNA damage in both exposed and control groups.

30 CFR 56.14100 - Safety defects; examination, correction and records.

Code of Federal Regulations, 2010 CFR

2010-07-01

... MINES Machinery and Equipment Safety Devices and Maintenance Requirements § 56.14100 Safety defects; examination, correction and records. (a) Self-propelled mobile equipment to be used during a shift shall be... defective items including self-propelled mobile equipment shall be taken out of service and placed in a...

Internationalizing Higher Education in Malaysia: Government Policies and University's Response

ERIC Educational Resources Information Center

Tham, Siew Yean

2013-01-01

The intensity of internationalization has increased with an escalation in internationalization activities, leading to increasing student, program, and institutional mobility. In Malaysia, the internationalization of higher education in terms of student mobility has changed tremendously in the last two decades as the country has shifted from a…

Mobility and Hierarchy in the Age of Near-Universal Access

ERIC Educational Resources Information Center

Parry, Gareth

2011-01-01

With the shift toward near-universal access, the movement of students within and between systems of higher education has assumed a new importance, especially for policies aimed at widening participation and social equity. Globalization has given rise to increasing levels of student mobility across national boundaries, with participation in…

The crystal structure of the Sox4 HMG domain-DNA complex suggests a mechanism for positional interdependence in DNA recognition.

PubMed

Jauch, Ralf; Ng, Calista K L; Narasimhan, Kamesh; Kolatkar, Prasanna R

2012-04-01

It has recently been proposed that the sequence preferences of DNA-binding TFs (transcription factors) can be well described by models that include the positional interdependence of the nucleotides of the target sites. Such binding models allow for multiple motifs to be invoked, such as principal and secondary motifs differing at two or more nucleotide positions. However, the structural mechanisms underlying the accommodation of such variant motifs by TFs remain elusive. In the present study we examine the crystal structure of the HMG (high-mobility group) domain of Sox4 [Sry (sex-determining region on the Y chromosome)-related HMG box 4] bound to DNA. By comparing this structure with previously solved structures of Sox17 and Sox2, we observed subtle conformational differences at the DNA-binding interface. Furthermore, using quantitative electrophoretic mobility-shift assays we validated the positional interdependence of two nucleotides and the presence of a secondary Sox motif in the affinity landscape of Sox4. These results suggest that a concerted rearrangement of two interface amino acids enables Sox4 to accommodate primary and secondary motifs. The structural adaptations lead to altered dinucleotide preferences that mutually reinforce each other. These analyses underline the complexity of the DNA recognition by TFs and provide an experimental validation for the conceptual framework of positional interdependence and secondary binding motifs.

Agarose and Polyacrylamide Gel Electrophoresis Methods for Molecular Mass Analysis of 5–500 kDa Hyaluronan

PubMed Central

Bhilocha, Shardul; Amin, Ripal; Pandya, Monika; Yuan, Han; Tank, Mihir; LoBello, Jaclyn; Shytuhina, Anastasia; Wang, Wenlan; Wisniewski, Hans-Georg; de la Motte, Carol; Cowman, Mary K.

2011-01-01

Agarose and polyacrylamide gel electrophoresis systems for the molecular mass-dependent separation of hyaluronan (HA) in the size range of approximately 5–500 kDa have been investigated. For agarose-based systems, the suitability of different agarose types, agarose concentrations, and buffers systems were determined. Using chemoenzymatically synthesized HA standards of low polydispersity, the molecular mass range was determined for each gel composition, over which the relationship between HA mobility and logarithm of the molecular mass was linear. Excellent linear calibration was obtained for HA molecular mass as low as approximately 9 kDa in agarose gels. For higher resolution separation, and for extension to molecular masses as low as approximately 5 kDa, gradient polyacrylamide gels were superior. Densitometric scanning of stained gels allowed analysis of the range of molecular masses present in a sample, and calculation of weight-average and number-average values. The methods were validated for polydisperse HA samples with viscosity-average molecular masses of 112, 59, 37, and 22 kDa, at sample loads of 0.5 µg (for polyacrylamide) to 2.5 µg (for agarose). Use of the methods for electrophoretic mobility shift assays was demonstrated for binding of the HA-binding region of aggrecan (recombinant human aggrecan G1-IGD-G2 domains) to a 150 kDa HA standard. PMID:21684248

Sleep pattern and decision-making in physicians from mobile emergency care service with 12-h work schedules.

PubMed

Castro, Eleni de Araújo Sales; de Almondes, Katie Moraes

2018-06-01

Shift work schedules are biological standpoint worse because compel the body to anticipate periods of wakefulness and sleep and thus eventually cause a disruption of biological rhythms. The objective of this study is to evaluate the sleep pattern and decision-making in physicians working in mobile units of emergency attention undergoing day shift and rotating shift. The study included 26 physicians. The instruments utilized were a sociodemographic questionnaire, the Pittsburgh Sleep Quality Index, the Sleep Habits Questionnaire, the Epworth Sleepiness Scale and Chronotype Identification Questionnaire of Horne-Ostberg, the Iowa Gambling Task (IGT) and hypothetical scenarios of decision-making created according to the Policy-Capturing Technique. For inclusion and exclusion criteria, the participants answered the Chalder Fatigue Scale, the Beck Anxiety Inventory, the Beck Depression Inventory and the Inventory of Stress Symptoms for adults of Lipp. It was found good sleep quality for physicians on day shift schedule and bad sleep quality for physicians on rotating shift schedule. The IGT measure showed no impairment in decision-making, but the hypothetical scenarios revealed impairment decision-making during the shift for both schedules. Good sleep quality was related to a better performance in decision-making. Good sleep quality seems to influence a better performance in decision-making.

The hobo transposable element has transposase-dependent and -independent excision activity in drosophilid species

USDA-ARS?s Scientific Manuscript database

Mobility of the hobo transposable element was determined for several strains of Drosophila melanogaster and several Drosophila species. Mobility was assessed by use of an in vivo transient assay in the soma of developing embryos, which monitored hobo excision from injected indicator plasmids. Excisi...

Functional assignment of solute-binding proteins of ABC transporters using a fluorescence-based thermal shift assay.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Giulliani, S. E.; Frank, A. E.; Collart, F. R.

2008-12-08

We have used a fluorescence-based thermal shift (FTS) assay to identify amino acids that bind to solute-binding proteins in the bacterial ABC transporter family. The assay was validated with a set of six proteins with known binding specificity and was consistently able to map proteins with their known binding ligands. The assay also identified additional candidate binding ligands for several of the amino acid-binding proteins in the validation set. We extended this approach to additional targets and demonstrated the ability of the FTS assay to unambiguously identify preferential binding for several homologues of amino acid-binding proteins with known specificity andmore » to functionally annotate proteins of unknown binding specificity. The assay is implemented in a microwell plate format and provides a rapid approach to validate an anticipated function or to screen proteins of unknown function. The ABC-type transporter family is ubiquitous and transports a variety of biological compounds, but the current annotation of the ligand-binding proteins is limited to mostly generic descriptions of function. The results illustrate the feasibility of the FTS assay to improve the functional annotation of binding proteins associated with ABC-type transporters and suggest this approach that can also be extended to other protein families.« less

[Mechanisms for effect of osthole on inhibiting the growth and invasion of bladder cancer cells].

PubMed

Liu, Jun; Xu, Ran; Zhao, Xiaokun

2016-04-01

To investigate the effect of osthole on epidermal growth factor receptor tyrosine kinase (EGFR-TPK), matrix-metalloproteinase-2 (MMP-2), aminopeptidase N (APN) in bladder cancer cell and the underlying mechanism.
 The T24 cell lines were cultured. The inhibitory effects of osthole on EGFR-TPK, APN and MMP-2 were evaluated by spectrophotometric and MTT assay. The caspase-3 activity and the expression COX-2 and VEGF in T24 were examined. The activity of NF-κB was determined by electrophoretic mobility shift assay.
 The half inhibition concentrations (IC50) of osthole on EGFR-TPK, APN and MMP-2 were (45.33±3.98), (28.21±3.23) and (8.11±0.54) µmol/L, respectively. The growth inhibitory rates for T24 cells were increased in a dose-dependent manner (P<0.05). The caspase-3 activities were significantly increased in T24 cells in the osthole group compared with control group, while the expression of angiogenesis related-protein COX-2, VEGF, and NF-κB in T24 cells were decreased.
 Through the inhibitory effect on EGFR-TPK, APN and MMP-2, osthole can decrease COX-2, VEGF and NF-κB expression while increase the activity of caspase-3, eventually blocking the growth and invasion of bladder cancer cell.

Activation of the Early B-Cell-Specific mb-1 (Ig-α) Gene by Pax-5 Is Dependent on an Unmethylated Ets Binding Site

PubMed Central

Maier, Holly; Colbert, Jeff; Fitzsimmons, Daniel; Clark, Dawn R.; Hagman, James

2003-01-01

Methylation of cytosine in CpG dinucleotides promotes transcriptional repression in mammals by blocking transcription factor binding and recruiting methyl-binding proteins that initiate chromatin remodeling. Here, we use a novel cell-based system to show that retrovirally expressed Pax-5 protein activates endogenous early B-cell-specific mb-1 genes in plasmacytoma cells, but only when the promoter is hypomethylated. CpG methylation does not directly affect binding of the promoter by Pax-5. Instead, methylation of an adjacent CpG interferes with assembly of ternary complexes comprising Pax-5 and Ets proteins. In electrophoretic mobility shift assays, recruitment of Ets-1 is blocked by methylation of the Ets site (5′CCGGAG) on the antisense strand. In transfection assays, selective methylation of a single CpG within the Pax-5-dependent Ets site greatly reduces mb-1 promoter activity. Prior demethylation of the endogenous mb-1 promoter is required for its activation by Pax-5 in transduced cells. Although B-lineage cells have only unmethylated mb-1 genes and do not modulate methylation of the mb-1 promoter during development, other tissues feature high percentages of methylated alleles. Together, these studies demonstrate a novel DNA methylation-dependent mechanism for regulating transcriptional activity through the inhibition of DNA-dependent protein-protein interactions. PMID:12612069

The human insulin receptor mRNA contains a functional internal ribosome entry segment

PubMed Central

Spriggs, Keith A.; Cobbold, Laura C.; Ridley, Simon H.; Coldwell, Mark; Bottley, Andrew; Bushell, Martin; Willis, Anne E.; Siddle, Kenneth

2009-01-01

Regulation of mRNA translation is an important mechanism determining the level of expression of proteins in eukaryotic cells. Translation is most commonly initiated by cap-dependent scanning, but many eukaryotic mRNAs contain internal ribosome entry segments (IRESs), providing an alternative means of initiation capable of independent regulation. Here, we show by using dicistronic luciferase reporter vectors that the 5′-UTR of the mRNA encoding human insulin receptor (hIR) contains a functional IRES. RNAi-mediated knockdown showed that the protein PTB was required for maximum IRES activity. Electrophoretic mobility shift assays confirmed that PTB1, PTB2 and nPTB, but not unr or PTB4, bound to hIR mRNA, and deletion mapping implicated a CCU motif 448 nt upstream of the initiator AUG in PTB binding. The IR-IRES was functional in a number of cell lines, and most active in cells of neuronal origin, as assessed by luciferase reporter assays. The IRES was more active in confluent than sub-confluent cells, but activity did not change during differentiation of 3T3-L1 fibroblasts to adipocytes. IRES activity was stimulated by insulin in sub-confluent cells. The IRES may function to maintain expression of IR protein in tissues such as the brain where mRNA translation by cap-dependent scanning is less effective. PMID:19654240

Core-binding factor beta interacts with Runx2 and is required for skeletal development.

PubMed

Yoshida, Carolina A; Furuichi, Tatsuya; Fujita, Takashi; Fukuyama, Ryo; Kanatani, Naoko; Kobayashi, Shinji; Satake, Masanobu; Takada, Kenji; Komori, Toshihisa

2002-12-01

Core-binding factor beta (CBFbeta, also called polyomavirus enhancer binding protein 2beta (PEBP2B)) is associated with an inversion of chromosome 16 and is associated with acute myeloid leukemia in humans. CBFbeta forms a heterodimer with RUNX1 (runt-related transcription factor 1), which has a DNA binding domain homologous to the pair-rule protein runt in Drosophila melanogaster. Both RUNX1 and CBFbeta are essential for hematopoiesis. Haploinsufficiency of another runt-related protein, RUNX2 (also called CBFA1), causes cleidocranial dysplasia in humans and is essential in skeletal development by regulating osteoblast differentiation and chondrocyte maturation. Mice deficient in Cbfb (Cbfb(-/-)) die at midgestation, so the function of Cbfbeta in skeletal development has yet to be ascertained. To investigate this issue, we rescued hematopoiesis of Cbfb(-/-) mice by introducing Cbfb using the Gata1 promoter. The rescued Cbfb(-/-) mice recapitulated fetal liver hematopoiesis in erythroid and megakaryocytic lineages and survived until birth, but showed severely delayed bone formation. Although mesenchymal cells differentiated into immature osteoblasts, intramembranous bones were poorly formed. The maturation of chondrocytes into hypertrophic cells was markedly delayed, and no endochondral bones were formed. Electrophoretic mobility shift assays and reporter assays showed that Cbfbeta was necessary for the efficient DNA binding of Runx2 and for Runx2-dependent transcriptional activation. These findings indicate that Cbfbeta is required for the function of Runx2 in skeletal development.

Characterization of the c.(-203)A>G variant in the glucocerebrosidase gene and its association with phenotype in Gaucher disease.

PubMed

Alfonso, Pilar; Pampín, Sandra; García-Rodríguez, Beatriz; Tejedor, Teresa; Domínguez, Carmen; Rodríguez-Rey, Jose C; Giraldo, Pilar; Pocoví, Miguel

2011-01-30

Gaucher disease (GD) is a rare autosomal recessive disorder caused mainly by mutations in the glucocerebrosidase (GBA) gene. Great phenotypic variability has been observed among patients with the same genotype, suggesting other factors, such as polymorphic variants, might influence GD phenotypes. We previously reported the c.(-203)A>G (g.1256A>G) variant in exon 1 of the GBA gene in Spanish GD patients. We analyzed the frequency and transcriptional activity of the promoter carrying the G-allele using restriction isotyping, electrophoretic mobility shift assay, cell culture, transfection, and luciferase assays. We found the variant is present at a similar frequency to the control group. In our patients, the G-allele was always found in combination with another mutation in the same allele, and patients carrying the c.(-203)A>G variant showed a more severe GD phenotype. The promoter containing the G-allele showed a 35% reduction in promoter activity when transfected into HepG2 cells. The c.(-203)A>G variant seems to be a polymorphism resulting in a decrease in activity of the GBA promoter. The change, per se, is not enough to elicit a GD phenotype, but it may produce a more severe phenotype in GD patients when combined with an already defective GBA protein. Copyright © 2010 Elsevier B.V. All rights reserved.

Resveratrol-induced transcriptional up-regulation of ASMase (SMPD1) of human leukemia and cancer cells.

PubMed

Mizutani, Naoki; Omori, Yukari; Kawamoto, Yoshiyuki; Sobue, Sayaka; Ichihara, Masatoshi; Suzuki, Motoshi; Kyogashima, Mamoru; Nakamura, Mitsuhiro; Tamiya-Koizumi, Keiko; Nozawa, Yoshinori; Murate, Takashi

2016-02-19

Resveratrol (RSV) is a plant-derived phytoalexin present in plants, whose pleiotropic effects for health benefits have been previously reported. Its anti-cancer activity is among the current topics for novel cancer treatment. Here, effects of RSV on cell proliferation and the sphingolipid metabolism of K562, a human leukemia cell line, were analyzed. Some experiments were also performed in HCT116, a human colon cancer cell line. RSV inhibited cell proliferation of both cell lines. Increased cellular ceramide and decreased sphingomyelin and S1P by RSV were observed in RSV-treated K562 cells. Further analysis revealed that acid sphingomyelinase mRNA and enzyme activity levels were increased by RSV. Desipramine, a functional ASMase inhibitor, prevented RSV-induced ceramide increase. RSV increased ATF3, EGR1, EGR3 proteins and phosphorylated c-Jun and FOXO3. However, co-transfection using these transcription factor expression vectors and ASMase promoter reporter vector revealed positive effects of EGR1 and EGR3 but not others. Electrophoresis mobility shift assay (EMSA) and Chromatin immunoprecipitation (ChIP) assay demonstrated the direct binding of EGR1/3 transcription factors with ASMase 5'-promoter. These results indicate that increased EGR1/3 and ASMase expression play an important role in cellular ceramide increase by RSV treatment. Copyright © 2016 Elsevier Inc. All rights reserved.

CpsR, a GntR family regulator, transcriptionally regulates capsular polysaccharide biosynthesis and governs bacterial virulence in Streptococcus pneumoniae.

PubMed

Wu, Kaifeng; Xu, Hongmei; Zheng, Yuqiang; Wang, Libin; Zhang, Xuemei; Yin, Yibing

2016-07-08

Transcriptional regulation of capsule expression is critical for pneumococcal transition from carriage to infection, yet the underlying mechanism remains incompletely understood. Here, we describe the regulation of capsular polysaccharide, one of the most important pneumococcal virulence factor by a GntR family regulator, CpsR. Electrophoretic mobility-shift assays have shown the direct interaction between CpsR and the cps promoter (cpsp), and their interaction could be competitively interfered by glucose. DNase I footprinting assays localized the binding site to a region -146 to -114 base pairs relative to the transcriptional start site of the cps locus in S. pneumoniae D39. We found that CpsR negatively controlled the transcription of the cps locus and hence CPS production, which was confirmed by fine-tuning expression of CpsR in a ΔcpsR complemented strain. Increased expression of CpsR in complemented strain led to a decreased resistance to the whole-blood-mediated killing, suggesting a protective role for CpsR-cpsp interaction in the establishment of invasive infection. Finally, animal experiments showed that CpsR-cpsp interaction was necessary for both pneumococcal colonization and invasive infection. Taken together, our results provide a thorough insight into the regulation of capsule production mediated by CpsR and its important roles in pneumococcal pathogenesis.

Transcriptional activation of JC virus by human T-lymphotropic virus type I Tax protein in human neuronal cell lines.

PubMed

Okada, Y; Sawa, H; Tanaka, S; Takada, A; Suzuki, S; Hasegawa, H; Umemura, T; Fujisawa, J; Tanaka, Y; Hall, W W; Nagashima, K

2000-06-02

Polyomavirus JC (JCV) causes the human demyelinating disease, progressive multifocal leukoencephalopathy (PML). The recent demonstration of cases of PML in association with human T-lymphotropic virus type I (HTLV-I) infection prompted us to examine whether the HTLV-I-encoded regulatory protein Tax activates JCV transcription. By employing a dual luciferase assay, we initially found that the expression of Tax activated the transcriptional potential of both early and late promoters of JCV in human neuronal but not in non-neuronal cells. We subsequently analyzed the mechanism of Tax-induced activation of the JCV promoter in neuronal cells with the following results: 1) the JCV promoter that lacks the NF-kappaB-binding motif could not be activated by Tax; 2) the overexpression of IkappaBalpha abolished Tax-induced transcriptional activation of the JCV promoter; 3) a Tax mutant (M22) lacking the potential for activation via the NF-kappaB pathway did not activate the JCV promoter. Furthermore, Tax enhances the gene expression of JCV T antigen and VP1. We examined mechanisms of the cell-specific activation of the JCV promoter by Tax. Electrophoretic mobility shift assay demonstrated the presence of Tax-bound protein(s) that were specifically present in non-neuronal cells. This study is the first demonstration of the activation of JCV promoter by HTLV-I Tax in an NF-kappaB-dependent manner.

SUMO-Modification of the La Protein Facilitates Binding to mRNA In Vitro and in Cells.

PubMed

Kota, Venkatesh; Sommer, Gunhild; Durette, Chantal; Thibault, Pierre; van Niekerk, Erna A; Twiss, Jeffery L; Heise, Tilman

2016-01-01

The RNA-binding protein La is involved in several aspects of RNA metabolism including the translational regulation of mRNAs and processing of pre-tRNAs. Besides its well-described phosphorylation by Casein kinase 2, the La protein is also posttranslationally modified by the Small Ubiquitin-like MOdifier (SUMO), but the functional outcome of this modification has not been defined. The objective of this study was to test whether sumoylation changes the RNA-binding activity of La. Therefore, we established an in vitro sumoylation assay for recombinant human La and analyzed its RNA-binding activity by electrophoretic mobility shift assays. We identified two novel SUMO-acceptor sites within the La protein located between the RNA recognition motif 1 and 2 and we demonstrate for the first time that sumoylation facilitates the RNA-binding of La to small RNA oligonucleotides representing the oligopyrimidine tract (TOP) elements from the 5' untranslated regions (UTR) of mRNAs encoding ribosomal protein L22 and L37 and to a longer RNA element from the 5' UTR of cyclin D1 (CCND1) mRNA in vitro. Furthermore, we show by RNA immunoprecipitation experiments that a La mutant deficient in sumoylation has impaired RNA-binding activity in cells. These data suggest that modulating the RNA-binding activity of La by sumoylation has important consequences on its functionality.

SUMO-Modification of the La Protein Facilitates Binding to mRNA In Vitro and in Cells

PubMed Central

Kota, Venkatesh; Sommer, Gunhild; Durette, Chantal; Thibault, Pierre; van Niekerk, Erna A.; Twiss, Jeffery L.

2016-01-01

The RNA-binding protein La is involved in several aspects of RNA metabolism including the translational regulation of mRNAs and processing of pre-tRNAs. Besides its well-described phosphorylation by Casein kinase 2, the La protein is also posttranslationally modified by the Small Ubiquitin-like MOdifier (SUMO), but the functional outcome of this modification has not been defined. The objective of this study was to test whether sumoylation changes the RNA-binding activity of La. Therefore, we established an in vitro sumoylation assay for recombinant human La and analyzed its RNA-binding activity by electrophoretic mobility shift assays. We identified two novel SUMO-acceptor sites within the La protein located between the RNA recognition motif 1 and 2 and we demonstrate for the first time that sumoylation facilitates the RNA-binding of La to small RNA oligonucleotides representing the oligopyrimidine tract (TOP) elements from the 5’ untranslated regions (UTR) of mRNAs encoding ribosomal protein L22 and L37 and to a longer RNA element from the 5’ UTR of cyclin D1 (CCND1) mRNA in vitro. Furthermore, we show by RNA immunoprecipitation experiments that a La mutant deficient in sumoylation has impaired RNA-binding activity in cells. These data suggest that modulating the RNA-binding activity of La by sumoylation has important consequences on its functionality. PMID:27224031

STAT3-activated CD36 facilitates fatty acid uptake in chronic lymphocytic leukemia cells

PubMed Central

Rozovski, Uri; Harris, David M.; Li, Ping; Liu, Zhiming; Jain, Preetesh; Ferrajoli, Alessandra; Burger, Jan; Thompson, Phillip; Jain, Nitin; Wierda, William; Keating, Michael J.; Estrov, Zeev

2018-01-01

Although several studies established that unlike normal B cells chronic lymphocytic leukemia (CLL) cells metabolize fatty acids (FA), how CLL cells internalize FA is poorly understood. Because in various cell types CD36 facilitates FA uptake, we wondered whether a similar mechanism is operative CLL. We found that CD36 levels are higher in CLL cells than in normal B cells, and that small interfering RNA, CD36 neutralizing antibodies or sulfosuccinimidyl oleate (SSO) that inhibits CD36 significantly reduced the oxygen consumption of CLL cells incubated with FA. Because CD36 is oeverexpressed and STAT3 is constitutively activated in CLL cells, we wondered whether STAT3 induces CD36 expression. Sequence analysis identified putative STAT3 binding sites in the CD36 gene promoter. Chromatin immunoprecipitation and an electrophoretic mobility shift assay revealed that STAT3 binds to the CD36 gene promoter. A luciferase assay and STAT3-small hairpin RNA, that significantly decreased the levels of CD36 in CLL cells, established that STAT3 activates the transcription of the CD36 gene. Furthermore, SSO induced a dose-dependent apoptosis of CLL cells. Taken together, our data suggest that STAT3 activates CD36 and that CD36 facilitates FA uptake in CLL cells. Whether CD36 inhibition would provide clinical benefits in CLL remains to be determined. PMID:29765537

Ex vivo adenoviral gene transfer of constitutively activated STAT3 reduces post-transplant liver injury and promotes regeneration in a 20% rat partial liver transplant model.

PubMed

Huda, Kamrul A S M; Guo, Lei; Haga, Sanae; Murata, Hiroshi; Ogino, Tetsuya; Fukai, Moto; Yagi, Takahito; Iwagaki, Hiromi; Tanaka, Noriaki; Ozaki, Michitaka

2006-05-01

Signal transducer and activator of transcription-3 (STAT3) is one of the most important transcription factors for liver regeneration. This study was designed to examine the effects of constitutively activated STAT3 (STAT3-C) on post-transplant liver injury and regeneration in a rat 20% partial liver transplant (PLTx) model by ex vivo adenoviral gene transfer. Adenovirus encoding the STAT3-C gene was introduced intraportally into liver grafts and clamped for 30 min during cold preservation. After orthotopic PLTx, liver graft/body weights and serum biochemistry were monitored, and both a histological study and DNA binding assay were performed. STAT3-C protein expression and its binding to DNA in the liver graft were confirmed by Western blotting and electrophoretic mobility shift assay (EMSA), respectively. This treatment modality promoted post-Tx liver regeneration effectively and rapidly. The serum levels of alanine aminotransferase/aspartate aminotransferase (AST/ALT) and bilirubin decreased in rats with STAT3-C. However, albumin (a marker of liver function) did not. Ex vivo gene transfer of STAT3-C to liver grafts reduced post-Tx injury and promoted liver regeneration. Thus, the activation of STAT3 in the liver graft may be a potentially effective clinical strategy for improving the outcome of small-for-size liver transplantation.

Identification of small molecule inhibitors of ERCC1-XPF that inhibit DNA repair and potentiate cisplatin efficacy in cancer cells

PubMed Central

Arora, Sanjeevani; Heyza, Joshua; Zhang, Hao; Kalman-Maltese, Vivian; Tillison, Kristin; Floyd, Ashley M.; Chalfin, Elaine M.; Bepler, Gerold; Patrick, Steve M.

2016-01-01

ERCC1-XPF heterodimer is a 5′-3′ structure-specific endonuclease which is essential in multiple DNA repair pathways in mammalian cells. ERCC1-XPF (ERCC1-ERCC4) repairs cisplatin-DNA intrastrand adducts and interstrand crosslinks and its specific inhibition has been shown to enhance cisplatin cytotoxicity in cancer cells. In this study, we describe a high throughput screen (HTS) used to identify small molecules that inhibit the endonuclease activity of ERCC1-XPF. Primary screens identified two compounds that inhibit ERCC1-XPF activity in the nanomolar range. These compounds were validated in secondary screens against two other non-related endonucleases to ensure specificity. Results from these screens were validated using an in vitro gel-based nuclease assay. Electrophoretic mobility shift assays (EMSAs) further show that these compounds do not inhibit the binding of purified ERCC1-XPF to DNA. Next, in lung cancer cells these compounds potentiated cisplatin cytotoxicity and inhibited DNA repair. Structure activity relationship (SAR) studies identified related compounds for one of the original Hits, which also potentiated cisplatin cytotoxicity in cancer cells. Excitingly, dosing with NSC16168 compound potentiated cisplatin antitumor activity in a lung cancer xenograft model. Further development of ERCC1-XPF DNA repair inhibitors is expected to sensitize cancer cells to DNA damage-based chemotherapy. PMID:27650543

LmaPA2G4, a Homolog of Human Ebp1, Is an Essential Gene and Inhibits Cell Proliferation in L. major

PubMed Central

Joyce, Michelle V.; Morales, Miguel A.

2014-01-01

We have identified LmaPA2G4, a homolog of the human proliferation-associated 2G4 protein (also termed Ebp1), in a phosphoproteomic screening. Multiple sequence alignment and cluster analysis revealed that LmaPA2G4 is a non-peptidase member of the M24 family of metallopeptidases. This pseudoenzyme is structurally related to methionine aminopeptidases. A null mutant system based on negative selection allowed us to demonstrate that LmaPA2G4 is an essential gene in Leishmania major. Over-expression of LmaPA2G4 did not alter cell morphology or the ability to differentiate into metacyclic and amastigote stages. Interestingly, the over-expression affected cell proliferation and virulence in mouse footpad analysis. LmaPA2G4 binds a synthetic double-stranded RNA polyriboinosinic polyribocytidylic acid [poly(I∶C)] as shown in an electrophoretic mobility shift assay (EMSA). Quantitative proteomics revealed that the over-expression of LmaPA2G4 led to accumulation of factors involved in translation initiation and elongation. Significantly, we found a strong reduction of de novo protein biosynthesis in transgenic parasites using a non-radioactive metabolic labeling assay. In conclusion, LmaPA2G4 is an essential gene and is potentially implicated in fundamental biological mechanisms, such as translation, making it an attractive target for therapeutic intervention. PMID:24421916

Hypoxia inducible factor-1 mediates the expression of the immune checkpoint HLA-G in glioma cells through hypoxia response element located in exon 2

PubMed Central

Yaghi, Layale; Poras, Isabelle; Simoes, Renata T.; Donadi, Eduardo A.; Tost, Jörg; Daunay, Antoine; de Almeida, Bibiana Sgorla; Carosella, Edgardo D.; Moreau, Philippe

2016-01-01

HLA-G is an immune checkpoint molecule with specific relevance in cancer immunotherapy. It was first identified in cytotrophoblasts, protecting the fetus from maternal rejection. HLA-G tissue expression is very restricted but induced in numerous malignant tumors such as glioblastoma, contributing to their immune escape. Hypoxia occurs during placenta and tumor development and was shown to activate HLA-G. We aimed to elucidate the mechanisms of HLA-G activation under conditions combining hypoxia-mimicking treatment and 5-aza-2′deoxycytidine, a DNA demethylating agent used in anti-cancer therapy which also induces HLA-G. Both treatments enhanced the amount of HLA-G mRNA and protein in HLA-G negative U251MG glioma cells. Electrophoretic Mobility Shift Assays and luciferase reporter gene assays revealed that HLA-G upregulation depends on Hypoxia Inducible Factor-1 (HIF-1) and a hypoxia responsive element (HRE) located in exon 2. A polymorphic HRE at −966 bp in the 5′UT region may modulate the magnitude of the response mediated by the exon 2 HRE. We suggest that therapeutic strategies should take into account that HLA-G expression in response to hypoxic tumor environment is dependent on HLA-G gene polymorphism and DNA methylation state at the HLA-G locus. PMID:27577073

Effects of porcine 25 kDa amelogenin and its proteolytic derivatives on bone sialoprotein expression.

PubMed

Nakayama, Y; Yang, L; Mezawa, M; Araki, S; Li, Z; Wang, Z; Sasaki, Y; Takai, H; Nakao, S; Fukae, M; Ogata, Y

2010-10-01

Amelogenins are hydrophobic proteins that are the major component of developing enamel. Enamel matrix derivative has been used for periodontal regeneration. Bone sialoprotein is an early phenotypic marker of osteoblast differentiation. In this study, we examined the ability of porcine amelogenins to regulate bone sialoprotein transcription. To determine the molecular basis of the transcriptional regulation of the bone sialoprotein gene by amelogenins, we conducted northern hybridization, transient transfection analyses and gel mobility shift assays using the osteoblast-like ROS 17/2.8 cells. Amelogenins (100 ng/mL) up-regulated bone sialoprotein mRNA at 3 h, with maximal mRNA expression occurring at 12 h (25 and 20 kDa) and 6 h (13 and 6 kDa). Amelogenins (100 ng/mL, 12 h) increased luciferase activities in pLUC3 (nucleotides -116 to +60), and 6 kDa amelogenin up-regulated pLUC4 (nucleotides -425 to +60) activity. The tyrosine kinase inhibitor inhibited amelogenin-induced luciferase activities, whereas the protein kinase A inhibitor abolished 25 kDa amelogenin-induced bone sialoprotein transcription. The effects of amelogenins were abrogated by 2-bp mutations in the fibroblast growth factor 2 response element (FRE). Gel-shift assays with radiolabeled FRE, homeodomain-protein binding site (HOX) and transforming growth factor-beta1 activation element (TAE) double-strand oligonucleotides revealed increased binding of nuclear proteins from amelogenin-stimulated ROS 17/2.8 cells at 3 h (25 and 13 kDa) and 6 h (20 and 6 kDa). These results demonstrate that porcine 25 kDa amelogenin and its proteolytic derivatives stimulate bone sialoprotein transcription by targeting FRE, HOX and TAE in the bone sialoprotein gene promoter, and that full-length amelogenin and amelogenin cleavage products are able to regulate bone sialoprotein transcription via different signaling pathways. (c) 2010 John Wiley & Sons A/S.

DMSK: A practical 2400-bps receiver for the mobile satellite service: An MSAT-X Report

NASA Technical Reports Server (NTRS)

Davarian, F.; Simon, M. K.; Sumida, J.

1985-01-01

The partical aspects of a 2400-bps differential detection minimum-shift-keying (DMSK) receiver are investigated. Fundamental issues relating to hardware precision, Doppler shift, fading, and frequency offset are examined, and it is concluded that the receiver's implementation at baseband is more advantageous both in cost and simplicity than its IF implementation. The DMSK receiver has been fabricated and tested under simulated mobile satellite environment conditions. The measured receiver performance in the presence of anomalies pertinent to the link is presented in this report. Furthermore, the receiver behavior in a band-limited channel (GMSK) is also investigated. The DMSK receiver performs substantially better than a coherent minimum-shift-keying (MSK) receiver in a heavily fading environment. The DMSK radio is simple and robust, and results in a lower error floor than its coherent counterpart. Moreover, this receiver is suitable for burst-type signals, and its recovery from deep fades is fast.

Shifting Patterns of Transnational Academic Mobility: A Comparative and Historical Approach

ERIC Educational Resources Information Center

Kim, Terri

2009-01-01

This article is an initial attempt to illustrate how patterns of academic mobility in the history of universities have been framed by the international politics of particular time periods. The article briefly looks at "the medieval period" and then at the emergent colonial and nationalist periods, including the ways that institutions as…

Systematising the Field of Mobile Assisted Language Learning

ERIC Educational Resources Information Center

Viberg, Olga; Grönlund, Åke

2013-01-01

This study provides a systematic review of mobile assisted language (MALL) research within the specific area of second language acquisition (SLA) during the period of 2005-2012 in terms of research approaches, theories and methods, technology, and the linguistic knowledge and skills' results. The findings show a shift from the prevailing SMS-based…

Mobile medical computing driven by the complexity of neurologic diagnosis.

PubMed

Segal, Michael M

2006-07-01

Medical computing has been split between palm-sized computers optimized for mobility and desktop computers optimized for capability. This split was due to technology too immature to deliver both mobility and capability in the same computer and the lack of medical software that demanded both mobility and capability. Advances in hardware and software are ushering in an era in which fully capable computers will be available ubiquitously. As a result, medical practice, education and publishing will change. Medical practice will be improved by the use of software that not only assists with diagnosis but can do so at the bedside, where the doctor can act immediately upon suggestions such as useful findings to check. Medical education will shift away from a focus on details of unusual diseases and toward a focus on skills of physical examination and using computerized tools. Medical publishing, in contrast, will shift toward greater detail: it will be increasingly important to quantitate the frequency of findings in diseases and their time course since such information can have a major impact clinically when added to decision support software.

A two-fold reduction in measurement time for neutron assay: Initial tests of a prototype dual-gated shift register

DOE Office of Scientific and Technical Information (OSTI.GOV)

Stewart, J.E.; Bourret, S.C.; Krick, M.S.

1996-09-01

Neutron coincidence counting (NCC) is used routinely around the world for nondestructive mass assay of uranium and plutonium in many forms, including waste. Compared with other methods, NCC is generally the most flexible, economic, and rapid. Many applications of NCC would benefit from a reduction in counting time required for a fixed random error. We have developed and tested the first prototype of a dual- gated, shift-register-based electronics unit that offers the potential of decreased measurement time for all passive and active NCC applications.

A two-fold reduction in measurement time for neutron assay: Initial tests of a prototype dual-gated shift register

DOE Office of Scientific and Technical Information (OSTI.GOV)

Stewart, J.E.; Bourret, S.C.; Krick, M.S.

1996-12-31

Neutron coincidence counting (NCC) is used routinely around the world for nondestructive mass assay of uranium and plutonium in many forms, including waste. Compared with other methods, NCC is generally the most flexible, economic, and rapid. Many applications of NCC would benefit from a reduction in counting time required for a fixed random error. The authors have developed and tested the first prototype of a dual-gated, shift-register-based electronics unit that offers the potential of decreased measurement time for all passive and active NCC applications.

Mobility Effect on Poroelastic Seismic Signatures in Partially Saturated Rocks With Applications in Time-Lapse Monitoring of a Heavy Oil Reservoir

NASA Astrophysics Data System (ADS)

Zhao, Luanxiao; Yuan, Hemin; Yang, Jingkang; Han, De-hua; Geng, Jianhua; Zhou, Rui; Li, Hui; Yao, Qiuliang

2017-11-01

Conventional seismic analysis in partially saturated rocks normally lays emphasis on estimating pore fluid content and saturation, typically ignoring the effect of mobility, which decides the ability of fluids moving in the porous rocks. Deformation resulting from a seismic wave in heterogeneous partially saturated media can cause pore fluid pressure relaxation at mesoscopic scale, thereby making the fluid mobility inherently associated with poroelastic reflectivity. For two typical gas-brine reservoir models, with the given rock and fluid properties, the numerical analysis suggests that variations of patchy fluid saturation, fluid compressibility contrast, and acoustic stiffness of rock frame collectively affect the seismic reflection dependence on mobility. In particular, the realistic compressibility contrast of fluid patches in shallow and deep reservoir environments plays an important role in determining the reflection sensitivity to mobility. We also use a time-lapse seismic data set from a Steam-Assisted Gravity Drainage producing heavy oil reservoir to demonstrate that mobility change coupled with patchy saturation possibly leads to seismic spectral energy shifting from the baseline to monitor line. Our workflow starts from performing seismic spectral analysis on the targeted reflectivity interface. Then, on the basis of mesoscopic fluid pressure diffusion between patches of steam and heavy oil, poroelastic reflectivity modeling is conducted to understand the shift of the central frequency toward low frequencies after the steam injection. The presented results open the possibility of monitoring mobility change of a partially saturated geological formation from dissipation-related seismic attributes.

Sound Change and Mobility in Los Angeles

ERIC Educational Resources Information Center

Johnson, Lawrence

1975-01-01

Deals with the shift of the low-back vowel as in 'caught' to a low-central vowel as in 'cot' thereby merging such pairs as caught/cot, dawn/Don, and stalk/stock. The causes and the sociolinguistic implications of this shift are discussed. The majority of the informants were from West Los Angeles. (TL)

High-Throughput Screening of Myometrial Calcium-Mobilization to Identify Modulators of Uterine Contractility

PubMed Central

Herington, Jennifer L.; Swale, Daniel R.; Brown, Naoko; Shelton, Elaine L.; Choi, Hyehun; Williams, Charles H.; Hong, Charles C.; Paria, Bibhash C.; Denton, Jerod S.; Reese, Jeff

2015-01-01

The uterine myometrium (UT-myo) is a therapeutic target for preterm labor, labor induction, and postpartum hemorrhage. Stimulation of intracellular Ca2+-release in UT-myo cells by oxytocin is a final pathway controlling myometrial contractions. The goal of this study was to develop a dual-addition assay for high-throughput screening of small molecular compounds, which could regulate Ca2+-mobilization in UT-myo cells, and hence, myometrial contractions. Primary murine UT-myo cells in 384-well plates were loaded with a Ca2+-sensitive fluorescent probe, and then screened for inducers of Ca2+-mobilization and inhibitors of oxytocin-induced Ca2+-mobilization. The assay exhibited robust screening statistics (Z´ = 0.73), DMSO-tolerance, and was validated for high-throughput screening against 2,727 small molecules from the Spectrum, NIH Clinical I and II collections of well-annotated compounds. The screen revealed a hit-rate of 1.80% for agonist and 1.39% for antagonist compounds. Concentration-dependent responses of hit-compounds demonstrated an EC50 less than 10μM for 21 hit-antagonist compounds, compared to only 7 hit-agonist compounds. Subsequent studies focused on hit-antagonist compounds. Based on the percent inhibition and functional annotation analyses, we selected 4 confirmed hit-antagonist compounds (benzbromarone, dipyridamole, fenoterol hydrobromide and nisoldipine) for further analysis. Using an ex vivo isometric contractility assay, each compound significantly inhibited uterine contractility, at different potencies (IC50). Overall, these results demonstrate for the first time that high-throughput small-molecules screening of myometrial Ca2+-mobilization is an ideal primary approach for discovering modulators of uterine contractility. PMID:26600013

Robust multiperson detection and tracking for mobile service and social robots.

PubMed

Li, Liyuan; Yan, Shuicheng; Yu, Xinguo; Tan, Yeow Kee; Li, Haizhou

2012-10-01

This paper proposes an efficient system which integrates multiple vision models for robust multiperson detection and tracking for mobile service and social robots in public environments. The core technique is a novel maximum likelihood (ML)-based algorithm which combines the multimodel detections in mean-shift tracking. First, a likelihood probability which integrates detections and similarity to local appearance is defined. Then, an expectation-maximization (EM)-like mean-shift algorithm is derived under the ML framework. In each iteration, the E-step estimates the associations to the detections, and the M-step locates the new position according to the ML criterion. To be robust to the complex crowded scenarios for multiperson tracking, an improved sequential strategy to perform the mean-shift tracking is proposed. Under this strategy, human objects are tracked sequentially according to their priority order. To balance the efficiency and robustness for real-time performance, at each stage, the first two objects from the list of the priority order are tested, and the one with the higher score is selected. The proposed method has been successfully implemented on real-world service and social robots. The vision system integrates stereo-based and histograms-of-oriented-gradients-based human detections, occlusion reasoning, and sequential mean-shift tracking. Various examples to show the advantages and robustness of the proposed system for multiperson tracking from mobile robots are presented. Quantitative evaluations on the performance of multiperson tracking are also performed. Experimental results indicate that significant improvements have been achieved by using the proposed method.

Identification of a novel prophage-like gene cluster actively expressed in both virulent and avirulent strains of Leptospira interrogans serovar Lai.

PubMed

Qin, Jin-Hong; Zhang, Qing; Zhang, Zhi-Ming; Zhong, Yi; Yang, Yang; Hu, Bao-Yu; Zhao, Guo-Ping; Guo, Xiao-Kui

2008-06-01

DNA microarray analysis was used to compare the differential gene expression profiles between Leptospira interrogans serovar Lai type strain 56601 and its corresponding attenuated strain IPAV. A 22-kb genomic island covering a cluster of 34 genes (i.e., genes LA0186 to LA0219) was actively expressed in both strains but concomitantly upregulated in strain 56601 in contrast to that of IPAV. Reverse transcription-PCR assays proved that the gene cluster comprised five transcripts. Gene annotation of this cluster revealed characteristics of a putative prophage-like remnant with at least 8 of 34 sequences encoding prophage-like proteins, of which the LA0195 protein is probably a putative prophage CI-like regulator. The transcription initiation activities of putative promoter-regulatory sequences of transcripts I, II, and III, all proximal to the LA0195 gene, were further analyzed in the Escherichia coli promoter probe vector pKK232-8 by assaying the reporter chloramphenicol acetyltransferase (CAT) activities. The strong promoter activities of both transcripts I and II indicated by the E. coli CAT assay were well correlated with the in vitro sequence-specific binding of the recombinant LA0195 protein to the corresponding promoter probes detected by the electrophoresis mobility shift assay. On the other hand, the promoter activity of transcript III was very low in E. coli and failed to show active binding to the LA0195 protein in vitro. These results suggested that the LA0195 protein is likely involved in the transcription of transcripts I and II. However, the identical complete DNA sequences of this prophage remnant from these two strains strongly suggests that possible regulatory factors or signal transduction systems residing outside of this region within the genome may be responsible for the differential expression profiling in these two strains.

Aciculatin Inhibits Granulocyte Colony-Stimulating Factor Production by Human Interleukin 1β-Stimulated Fibroblast-Like Synoviocytes

PubMed Central

Shih, Kao-Shang; Wang, Jyh-Horng; Wu, Yi-Wen; Teng, Che-Ming; Chen, Chien-Chih; Yang, Chia-Ron

2012-01-01

The expression of granulocyte colony-stimulating factor (G-CSF), the major regulator of neutrophil maturation, by human fibroblast-like synoviocytes (FLS) can be stimulated by the inflammatory cytokine interleukin-1β (IL-1β). G-CSF is known to contribute to the pathologic processes of destructive arthritis, but the induction mechanism remains unknown. The aims of this study were to identify the signaling pathways involved in IL-1β-stimulated G-CSF production and to determine whether this process was inhibited by aciculatin (8-((2R,4S,5S,6R)-tetrahydro-4,5-dihydroxy-6-methyl-2H-pyran-2-yl)-5-hydroxy-2-(4-hydroxyphenyl)-7-methoxy-4H-chromen-4-one), the major bioactive component of Chrysopogon aciculatus. IL-1β-induced cytokine expression was evaluated by measuring mRNA and protein levels by RT-PCR, ELISA, and Milliplex® assay. Whether aciculatin inhibited IL-1β-stimulated G-CSF expression, and if so, how, were evaluated using western blot assay, an electrophoretic mobility shift assay, and a reporter gene assay. Neutrophil differentiation was determined by Wright-Giemsa staining and flow cytometry. Aciculatin markedly inhibited G-CSF expression induced by IL-1β (10 ng/mL) in a concentration-dependent manner (1–10 µM). In clarifying the mechanisms involved, aciculatin was found to inhibit the IL-1β-induced activation of the IκB kinase (IKK)/IκB/nuclear factor-κB (NF-κB) and mitogen-activated protein kinase (MAPK) pathways by suppressing the DNA binding activity of the transcription factors NF-κB and activator protein (AP)-1. Furthermore, aciculatin significantly inhibited the G-CSF-mediated phosphorylation of Janus kinase-signal transducer and activator of transcription (JAK-STAT) and Akt and neutrophil differentiation from precursor cells. Our results show that aciculatin inhibits IL-1β-stimulated G-CSF expression and the subsequent neutrophil differentiation, suggesting that it might have therapeutic potential for inflammatory arthritis. PMID:22860122

Molecular Cloning, Functional Characterization, and Evolutionary Analysis of Vitamin D Receptors Isolated from Basal Vertebrates

PubMed Central

Kollitz, Erin M.; Zhang, Guozhu; Hawkins, Mary Beth; Whitfield, G. Kerr; Reif, David M.; Kullman, Seth W.

2015-01-01

The vertebrate genome is a result of two rapid and successive rounds of whole genome duplication, referred to as 1R and 2R. Furthermore, teleost fish have undergone a third whole genome duplication (3R) specific to their lineage, resulting in the retention of multiple gene paralogs. The more recent 3R event in teleosts provides a unique opportunity to gain insight into how genes evolve through specific evolutionary processes. In this study we compare molecular activities of vitamin D receptors (VDR) from basal species that diverged at key points in vertebrate evolution in order to infer derived and ancestral VDR functions of teleost paralogs. Species include the sea lamprey (Petromyzon marinus), a 1R jawless fish; the little skate (Leucoraja erinacea), a cartilaginous fish that diverged after the 2R event; and the Senegal bichir (Polypterus senegalus), a primitive 2R ray-finned fish. Saturation binding assays and gel mobility shift assays demonstrate high affinity ligand binding and classic DNA binding characteristics of VDR has been conserved across vertebrate evolution. Concentration response curves in transient transfection assays reveal EC50 values in the low nanomolar range, however maximum transactivational efficacy varies significantly between receptor orthologs. Protein-protein interactions were investigated using co-transfection, mammalian 2-hybrid assays, and mutations of coregulator activation domains. We then combined these results with our previous study of VDR paralogs from 3R teleosts into a bioinformatics analysis. Our results suggest that 1, 25D3 acts as a partial agonist in basal species. Furthermore, our bioinformatics analysis suggests that functional differences between VDR orthologs and paralogs are influenced by differential protein interactions with essential coregulator proteins. We speculate that we may be observing a change in the pharmacodynamics relationship between VDR and 1, 25D3 throughout vertebrate evolution that may have been driven by changes in protein-protein interactions between VDR and essential coregulators. PMID:25855982

FOXD3 inhibits SCN2A gene transcription in intractable epilepsy cell models.

PubMed

Xiang, Jun; Wen, Fang; Zhang, Lingyun; Zhou, Yu

2018-04-01

The expression of sodium voltage-gated channel alpha subunit 2 (SCN2A) is closely related to the development of epilepsy. This study investigated regulatory element of the SCN2A gene involved in epilepsy. An intractable epilepsy cell model was constructed using hippocampal primary neurons and the SH-SY5Y cell line. SCN2A protein and gene expression in cells as well as the level of lactic acid dehydrogenase (LDH) in the cell culture supernatants was detected. Potential regulatory factors of SCN2A and its upstream regulatory elements were identified using the dual-luciferase reporter assay. Finally, the role of the hypothetical transcription factor in epilepsy was examined by using its small interfering RNA (siRNA). Results found that levels of LDH and expression of the hypothetical transcription factor, Forkhead box D3 (FOXD3), was both increased in the model cells, whereas that of SCN2A was decreased. The results of dual-luciferase reporter assays revealed that an upstream region of SCN2A gene spanning from nucleotides -1617 to -1470 was a transcription factor binding region and a trans-acting factor role of FOXD3 was identified in the core region (GGCAAAATTAT). Then the FOXD3 binding site was further verified by the chromatin immunoprecipitation (ChIP) assay and electrophoretic mobility shift assay (EMSA). After SH-SY5Y cells were transfected with FOXD3 siRNA, the release of LDH into culture supernatants and the LDH expression levels in cells were significantly decreased. SCN2A expression in model cells was increased by knockdown of FOXD3. Therefore, this study demonstrated that FOXD3 is a trans-acting factor of SCN2A, and this mechanism may play a role in cell injury after epilepsy. Copyright © 2017 Elsevier Inc. All rights reserved.

Toll-like receptor 4 mediates inflammatory signaling by bacterial lipopolysaccharide in human hepatic stellate cells.

PubMed

Paik, Yong-Han; Schwabe, Robert F; Bataller, Ramón; Russo, Maria P; Jobin, Christian; Brenner, David A

2003-05-01

Bacterial lipopolysaccharide (LPS) stimulates Kupffer cells and participates in the pathogenesis of alcohol-induced liver injury. However, it is unknown whether LPS directly affects hepatic stellate cells (HSCs), the main fibrogenic cell type in the injured liver. This study characterizes LPS-induced signal transduction and proinflammatory gene expression in activated human HSCs. Culture-activated HSCs and HSCs isolated from patients with hepatitis C virus-induced cirrhosis express LPS-associated signaling molecules, including CD14, toll-like receptor (TLR) 4, and MD2. Stimulation of culture-activated HSCs with LPS results in a rapid and marked activation of NF-kappaB, as assessed by in vitro kinase assays for IkappaB kinase (IKK), IkappaBalpha steady-state levels, p65 nuclear translocation, NF-kappaB-dependent luciferase reporter gene assays, and electrophoretic mobility shift assays. Lipid A induces NF-kappaB activation in a similar manner. Both LPS- and lipid A-induced NF-kappaB activation is blocked by preincubation with either anti-TLR4 blocking antibody (HTA125) or Polymyxin B. Lipid A induces NF-kappaB activation in HSCs from TLR4-sufficient (C3H/OuJ) mice but not from TLR4-deficient (C3H/HeJ) mice. LPS also activates c-Jun N-terminal kinase (JNK), as assessed by in vitro kinase assays. LPS up-regulates IL-8 and MCP-1 gene expression and secretion. LPS-induced IL-8 secretion is completely inhibited by the IkappaB super repressor (Ad5IkappaB) and partially inhibited by a specific JNK inhibitor, SP600125. LPS also up-regulates cell surface expression of ICAM-1 and VCAM-1. In conclusion, human activated HSCs utilize components of TLR4 signal transduction cascade to stimulate NF-kappaB and JNK and up-regulate chemokines and adhesion molecules. Thus, HSCs are a potential mediator of LPS-induced liver injury.

Dormancy-Associated MADS-Box (DAM) and the Abscisic Acid Pathway Regulate Pear Endodormancy Through a Feedback Mechanism.

PubMed

Tuan, Pham Anh; Bai, Songling; Saito, Takanori; Ito, Akiko; Moriguchi, Takaya

2017-08-01

In the pear 'Kosui' (Pyrus pyrifolia Nakai), the dormancy-associated MADS-box (PpDAM1 = PpMADS13-1) gene has been reported to play an essential role in bud endodormancy. Here, we found that PpDAM1 up-regulated expression of 9-cis-epoxycarotenoid dioxygenase (PpNCED3), which is a rate-limiting gene for ABA biosynthesis. Transient assays with a dual luciferase reporter system (LUC assay) and electrophoretic mobility shift assay (EMSA) showed that PpDAM1 activated PpNCED3 expression by binding to the CArG motif in the PpNCED3 promoter. PpNCED3 expression was increased toward endodormancy release in lateral flower buds of 'Kosui', which is consistent with the induced levels of ABA, its catabolism (ABA 8'-hydroxylase) and signaling genes (type 2C protein phosphatase genes and SNF1-related protein kinase 2 genes). In addition, we found that an ABA response element (ABRE)-binding transcription factor, PpAREB1, exhibiting high expression concomitant with endodormancy release, bound to three ABRE motifs in the promoter region of PpDAM1 and negatively regulated its activity. Taken together, our results suggested a feedback regulation between PpDAM1 and the ABA metabolism and signaling pathway during endodormancy of pear. This first evidence of an interaction between a DAM and ABA biosynthesis in vitro will provide further insights into bud endodormancy regulatory mechanisms of deciduous trees including pear. © The Author 2017. Published by Oxford University Press on behalf of Japanese Society of Plant Physiologists. All rights reserved. For permissions, please email: journals.permissions@oup.com.

Regulatory single nucleotide polymorphisms (rSNPs) at the promoters 1A and 1B of the human APC gene.

PubMed

Matveeva, Marina Yu; Kashina, Elena V; Reshetnikov, Vasily V; Bryzgalov, Leonid O; Antontseva, Elena V; Bondar, Natalia P; Merkulova, Tatiana I

2016-12-22

Germline mutations in the coding sequence of the tumour suppressor APC gene give rise to familial adenomatous polyposis (which leads to colorectal cancer) and are associated with many other oncopathologies. The loss of APC function because of deletion of putative promoter 1A or 1B also results in the development of colorectal cancer. Since the regions of promoters 1A and 1B contain many single nucleotide polymorphisms (SNPs), the aim of this study was to perform functional analysis of some of these SNPs by means of an electrophoretic mobility shift assay (EMSA) and a luciferase reporter assay. First, it was shown that both putative promoters of APC (1A and 1B) drive transcription in an in vitro reporter experiment. From eleven randomly selected SNPs of promoter 1A and four SNPs of promoter 1B, nine and two respectively showed differential patterns of binding of nuclear proteins to oligonucleotide probes corresponding to alternative alleles. The luciferase reporter assay showed that among the six SNPs tested, the rs75612255 C allele and rs113017087 C allele in promoter 1A as well as the rs138386816 T allele and rs115658307 T allele in promoter 1B significantly increased luciferase activity in the human erythromyeloblastoid leukaemia cell line K562. In human colorectal cancer HCT-116 cells, none of the substitutions under study had any effect, with the exception of minor allele G of rs79896135 in promoter 1B. This allele significantly decreased the luciferase reporter's activity CONCLUSION: Our results indicate that many SNPs in APC promoters 1A and 1B are functionally relevant and that allele G of rs79896135 may be associated with the predisposition to colorectal cancer.

The SloR Metalloregulator is Involved in the Streptococcus mutans Oxidative Stress Response

PubMed Central

Crepps, Sarah C.; Fields, Emily E.; Galan, Diego; Corbett, John P.; Von Hasseln, Elizabeth R.; Spatafora, Grace A.

2015-01-01

SUMMARY A 25kDa SloR metalloregulatory protein in Streptococcus mutans modulates the expression of multiple genes, including the sloABC operon that encodes essential Mn2+ transport and genes that promote cariogenesis. In this study, we report on SloC- and SloR-deficient strains of S. mutans (GMS284 and GMS584, respectively) that demonstrate compromised survivorship compared to their UA159 wildtype progenitor and their complemented strains (GMS285 and GMS585, respectively), when challenged with streptonigrin and/or in growth competition experiments. The results of streptonigrin assays revealed significantly larger zones of inhibition for GMS584 than for either UA159 or GMS585, indicating weakened S. mutans survivorship in the absence of SloR. Competition assays revealed a compromised ability for GMS284 and GMS584 to survive peroxide challenge compared with their SloC- and SloR-proficient counterparts. These findings are consistent with a role for SloC and SloR in S. mutans aerotolerance. We also predicted differential expression of oxidative stress tolerance genes in GMS584 versus UA159 and GMS585 when grown aerobically. The results of qRT-PCR experiments revealed S. mutans sod, tpx, and sloC expression that was up-regulated in GMS584 compared to UA159 and GMS585, indicating that the impact of oxidative stress on S. mutans is more severe in the absence of SloR than in its presence. The results of electrophoretic mobility shift assays indicate that SloR does not bind to the sod or tpx promoter regions directly, implicating intermediaries that may arbitrate the SloR response to oxidative stress. PMID:26577188

The SloR metalloregulator is involved in the Streptococcus mutans oxidative stress response.

PubMed

Crepps, S C; Fields, E E; Galan, D; Corbett, J P; Von Hasseln, E R; Spatafora, G A

2016-12-01

SloR, a 25-kDa metalloregulatory protein in Streptococcus mutans modulates the expression of multiple genes, including the sloABC operon that encodes essential Mn 2+ transport and genes that promote cariogenesis. In this study, we report on SloC- and SloR-deficient strains of S. mutans (GMS284 and GMS584, respectively) that demonstrate compromised survivorship compared with their UA159 wild-type progenitor and their complemented strains (GMS285 and GMS585, respectively), when challenged with streptonigrin and/or in growth competition experiments. The results of streptonigrin assays revealed significantly larger zones of inhibition for GMS584 than for either UA159 or GMS585, indicating weakened S. mutans survivorship in the absence of SloR. Competition assays revealed a compromised ability for GMS284 and GMS584 to survive peroxide challenge compared with their SloC- and SloR-proficient counterparts. These findings are consistent with a role for SloC and SloR in S. mutans aerotolerance. We also predicted differential expression of oxidative stress tolerance genes in GMS584 versus UA159 and GMS585 when grown aerobically. The results of quantitative RT-PCR experiments revealed S. mutans sod, tpx, and sloC expression that was upregulated in GMS584 compared with UA159 and GMS585, indicating that the impact of oxidative stress on S. mutans is more severe in the absence of SloR than in its presence. The results of electrophoretic mobility shift assays indicate that SloR does not bind to the sod or tpx promoter regions directly, implicating intermediaries that may arbitrate the SloR response to oxidative stress. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Suppression of survivin promoter activity by YM155 involves disruption of Sp1-DNA interaction in the survivin core promoter

PubMed Central

Cheng, Qiuying; Ling, Xiang; Haller, Andrew; Nakahara, Takahito; Yamanaka, Kentaro; Kita, Aya; Koutoku, Hiroshi; Takeuchi, Masahiro; Brattain, Michael G; Li, Fengzhi

2012-01-01

YM155, a novel survivin suppressant, shows potent antitumor activity against various human cancers and is currently in phase II clinical trials. In this study, we investigated whether YM155 selectively inhibits survivin transcription. We hypothesize that inhibition of survivin transcription plays a role in YM155-mediated survivin inhibition. We found that YM155 inhibited survivin promoter activity, while it showed minimal inhibitory effect on four control gene promoters in transfection and luciferase activity assay experiments, indicating its selectivity. Transfection of various survivin promoter-luciferase constructs followed by luciferase assays revealed that the survivin core promoter (269 bp) plays a major role in YM155-mediated inhibitory effects. However, flow cytometry analysis indicated that inhibition of survivin promoter activity by YM155 is cell cycle-independent without G1 cell arrests. Electrophoretic mobility shift assays (EMSA) identified that YM155 abrogates nuclear proteins binding to the region of -149 to -71, in which Sp1 is a major candidate, and that YM155 treatment induces Sp1 re-subcellular localization without inhibiting its expression. Forced expression of Sp1 neutralized YM155-mediated downregulation of survivin promoter activity. Consistently, mutation of the identified Sp1 sites in the oligonucleotide probe diminished DNA-protein interactions in EMSA experiments, and mutation of the Sp1 sites in the survivin promoter-luciferase construct diminished survivin promoter activity. These findings indicate that YM155 inhibition of survivin expression is at least in part through its inhibition of survivin transcription by disruption of Sp1 interaction with the region of -149 to -71 in the survivin core promoter. PMID:22773958

Mechanistic studies of DepR in regulating FK228 biosynthesis in Chromobacterium violaceum no. 968

PubMed Central

Xue, Jiao; Lin, Wenjing; Deng, Zixin; Cheng, Yi-Qiang

2018-01-01

DepR, a LysR-type transcriptional regulator encoded by the last gene of the putative min operon (orf21-20-19-depR) located at the downstream region of the anticancer agent FK228 biosynthetic gene cluster in Chromobacterium violaceum No. 968, positively regulates the biosynthesis of FK228. In this work, the mechanism underlining this positive regulation was probed by multiple approaches. Electrophoretic mobility shift assay (EMSA) and DNase I footprinting assay (DIFA) identified a conserved 35-nt DNA segment in the orf21-orf22 intergenic region where the purified recombinant DepR binds to. Quantitative reverse transcription PCR (RT-qPCR) and green fluorescent protein (GFP) promoter probe assays established that transcription of phasin gene orf22 increases in the depR deletion mutant of C. violaceum (CvΔdepR) compared to the wild-type strain. FK228 production in the orf22-overexpressed strain C. violaceum was reduced compared with the wild-type strain. DepR has two conserved cysteine residues C199 and C208 presumed to form a disulfide bridge upon sensing oxidative stress. C199X point mutations that locked DepR in a reduced conformation decreased the DNA-binding affinity of DepR; T232A or R278A mutation also had a negative impact on DNA binding of DepR. Complementation of CvΔdepR with any of those versions of depR carrying a single codon mutation was not able to restore FK228 production to the level of wild-type strain. All evidences collectively suggested that DepR positively regulates the biosynthesis of FK228 through indirect metabolic networking. PMID:29672625

Mechanistic studies of DepR in regulating FK228 biosynthesis in Chromobacterium violaceum no. 968.

PubMed

Qiao, Yongjian; Tong, Tiantian; Xue, Jiao; Lin, Wenjing; Deng, Zixin; Cheng, Yi-Qiang; Zhu, Dongqing

2018-01-01

DepR, a LysR-type transcriptional regulator encoded by the last gene of the putative min operon (orf21-20-19-depR) located at the downstream region of the anticancer agent FK228 biosynthetic gene cluster in Chromobacterium violaceum No. 968, positively regulates the biosynthesis of FK228. In this work, the mechanism underlining this positive regulation was probed by multiple approaches. Electrophoretic mobility shift assay (EMSA) and DNase I footprinting assay (DIFA) identified a conserved 35-nt DNA segment in the orf21-orf22 intergenic region where the purified recombinant DepR binds to. Quantitative reverse transcription PCR (RT-qPCR) and green fluorescent protein (GFP) promoter probe assays established that transcription of phasin gene orf22 increases in the depR deletion mutant of C. violaceum (CvΔdepR) compared to the wild-type strain. FK228 production in the orf22-overexpressed strain C. violaceum was reduced compared with the wild-type strain. DepR has two conserved cysteine residues C199 and C208 presumed to form a disulfide bridge upon sensing oxidative stress. C199X point mutations that locked DepR in a reduced conformation decreased the DNA-binding affinity of DepR; T232A or R278A mutation also had a negative impact on DNA binding of DepR. Complementation of CvΔdepR with any of those versions of depR carrying a single codon mutation was not able to restore FK228 production to the level of wild-type strain. All evidences collectively suggested that DepR positively regulates the biosynthesis of FK228 through indirect metabolic networking.

The organic solute transporters alpha and beta are induced by hypoxia in human hepatocytes

PubMed Central

Schaffner, Carlos A; Mwinyi, Jessica; Gai, Zhibo; Thasler, Wolfgang E; Eloranta, Jyrki J; Kullak-Ublick, Gerd A

2015-01-01

Background & Aims The organic solute transporters alpha and beta (OSTα-OSTβ) form a heterodimeric transporter located at the basolateral membrane of intestinal epithelial cells and hepatocytes. Liver injury caused by ischaemia-reperfusion, cancer, inflammation or cholestasis can induce a state of hypoxia in hepatocytes. Here, we studied the effect of hypoxia on the expression of OSTα-OSTβ. Methods OSTα-OSTβ expression was measured in Huh7 cells and primary human hepatocytes (PHH) exposed to chenodeoxycholic acid (CDCA), hypoxia or both. OSTα-OSTβ promoter activity was analysed in luciferase reporter gene assays. Binding of hypoxia-inducible factor-1 alpha (HIF-1α) to the OSTα-OSTβ gene promoters was studied in electrophoretic mobility shift assays (EMSA). Results Expression of OSTα and OSTβ increased in PHH under conditions of hypoxia. Exposure of Huh7 cells or PHH to CDCA (50 μM) enhanced the effect of hypoxia on OSTα mRNA levels. In luciferase assays and EMSA, the inducing effect of low oxygen could be assigned to HIF-1α, which binds to hypoxia responsive elements (HRE) in the OSTα and OSTβ gene promoters. Site-directed mutagenesis of either the predicted HRE or the bile acid responsive FXR binding site abolished inducibility of the OSTα promoter, indicating that both elements need to be intact for induction by hypoxia and CDCA. In a rat model of chronic renal failure, the known increase in hepatic OSTα expression was associated with an increase in HIF-1α protein levels. Conclusion OSTα-OSTβ expression is induced by hypoxia. FXR and HIF-1α bind in close proximity to the OSTα gene promoter and produce synergistic effects on OSTα expression. PMID:24703425

Tumor necrosis factor-α promotes the lymphangiogenesis of gallbladder carcinoma through nuclear factor-κB-mediated upregulation of vascular endothelial growth factor-C

PubMed Central

Du, Qiang; Jiang, Lei; Wang, Xiaoqian; Wang, Meiping; She, Feifei; Chen, Yanling

2014-01-01

Vascular endothelial growth factor (VEGF)-C is an important lymphangiogenic factor involved in the lymphangiogenesis of gallbladder carcinoma (GBC) and the lymph node metastasis of the tumor. Tumor necrosis factor (TNF)-α, a key inflammatory cytokine responding to chronic inflammation of GBC, has been reported to stimulate the expression of VEGF-C in some nonneoplastic cells. But whether TNF-α promotes the expression of VEGF-C in GBC has yet to be determined. Therefore, in the present study, the concentration of TNF-α and VEGF-C and the lymphatic vessel density (LVD) in the clinical GBC specimens were analyzed, and a linear correlation was found between the concentration of TNF-α and that of VEGF-C, the lymphatic vessel density (LVD); The transcription and protein level of VEGF-C in NOZ cell line were detected by real-time polymerase chain reaction (PCR) and enzyme linked immunosorbent assay (ELISA), and TNF-α enhanced the expression of VEGF-C in NOZ cell lines in a dose and time-dependent manner. Lymphatic tube formation in vitro was observed in a three-dimensional coculture system consisting of HDLECs and NOZ cell lines, and lymphatic vessels of GBC in nude mice model was detected by immunohistochemistry. TNF-α promoted the tube formation of lymphatic endothelial cells in vitro and the lymphangiogenesis of GBC in nude mice; The nuclear factor (NF)-κB binding site on the VEGF-C promoter was identified using Site-directed mutagenesis, electrophoretic mobility shift assay (EMSA) and chromatin immunoprecipitation assay (ChIP). Taken together, TNF-α can upregulate the expression of VEGF-C and promote the lymphangiogenesis of GBC via NF-κB combining with the promoter of VEGF-C. PMID:25154789

Lidocaine attenuates lipopolysaccharide-induced inflammatory responses in microglia.

PubMed

Yuan, Tong; Li, Zhiwen; Li, Xinbai; Yu, Gaoqi; Wang, Na; Yang, Xige

2014-11-01

Lidocaine has been used as a local anesthetic with anti-inflammatory properties, but its effects on neuroinflammation have not been well defined. In the present study, we investigated the prophylactic effects of lidocaine on lipopolysaccharide (LPS)-activated microglia and explored the underlying mechanisms. Microglial cells were incubated with or without 1 μg/mL LPS in the presence or absence of lidocaine, a p38 mitogen-activated protein kinase (p38 MAPK) inhibitor (SB203580), a nuclear factor-kappa B (NF-κB) inhibitor (pyrrolidine dithiocarbamate), or small interfering RNA. The protein and expression levels of inflammatory mediators, such as monocyte chemotactic protein 1, nitric oxide, prostaglandin E2, interleukin 1β, and tumor necrosis factor α were measured using enzyme-linked immunosorbent assays and real-time polymerase chain reaction. The effect of lidocaine on NF-κB and p38 MAPK activation was evaluated using enzyme-linked immunosorbent assays, Western blot analysis, and electrophoretic mobility shift assay. Lidocaine (≥2 μg/mL) significantly inhibited the release and expression of nitric oxide, monocyte chemotactic protein 1, prostaglandin E2, interleukin 1β, and tumor necrosis factor α in LPS-activated microglia. Treatment with lidocaine also significantly inhibited the phosphorylation of p38 MAPK and the nuclear translocation of NF-κB p50/p65, increased the protein levels of inhibitor kappa B-α. Furthermore, our study shows that the LPS-induced release of inflammatory mediators was suppressed by SB203580, pyrrolidine dithiocarbamate, and small interfering RNA. Prophylactic treatment with lidocaine inhibits LPS-induced release of inflammatory mediators from microglia, and these effects may be mediated by blockade of p38 MAPK and NF-κB signaling pathways. Copyright © 2014 Elsevier Inc. All rights reserved.

Functional characterization of SNPs in CHRNA3/B4 intergenic region associated with drug behaviors

PubMed Central

Flora, Amber V; Zambrano, Cristian A; Gallego, Xavier; Miyamoto, Jill H; Johnson, Krista A; Cowan, Katelyn A; Stitzel, Jerry A; Ehringer, Marissa A

2013-01-01

The cluster of human neuronal nicotinic receptor genes (CHRNA5/A3/B4) (15q25.1) has been associated with a variety of smoking and drug-related behaviors, as well as risk for lung cancer. CHRNA3/B4 intergenic single nucleotide polymorphisms (SNPs) rs1948 and rs8023462 have been associated with early initiation of alcohol and tobacco use, and rs6495309 has been associated with nicotine dependence and risk for lung cancer. An in vitro luciferase expression assay was used to determine whether these SNPs and surrounding sequences contribute to differences in gene expression using cell lines either expressing proteins characteristic of neuronal tissue or derived from lung cancers. Electrophoretic mobility shift assays (EMSAs) were performed to investigate whether nuclear proteins from these cell lines bind SNP alleles differentially. Results from expression assays were dependent on cell culture type and haplotype. EMSAs indicated that rs8023462 and rs6495309 bind nuclear proteins in an allele-specific way. Additionally, GATA transcription factors appeared to bind rs8023462 only when the minor/risk allele was present. Much work has been done to describe the rat Chrnb4/a3 intergenic region, but few studies have examined the human intergenic region effects on expression; therefore, these studies greatly aid human genetic research as it relates to observed nicotine phenotypes, lung cancer risk and potential underlying genetic mechanisms. Data from these experiments support the hypothesis that SNPs associated with human addiction-related phenotypes and lung cancer risk can affect gene expression, and are potential therapeutic targets. Additionally, this is the first evidence that rs8023462 interacts with GATA transcription factors to influence gene expression. PMID:23872218

Interaction of acute-phase-inducible and liver-enriched nuclear factors with the promoter region of the mouse alpha sub 1 -acid glycoprotein gene-1

DOE Office of Scientific and Technical Information (OSTI.GOV)

Alam, T.; Papaconstantinou, J.

1992-02-25

The synthesis and secretion of several acute-phase proteins increases markedly following physiological stress. {alpha}{sub 1}-Acid glycoprotein (AGP), a major acute-phase reactant made by the liver, is strongly induced by inflammatory agents such as lipopolysaccharide (LPS). Nuclear run-on assay showed a 17-fold increase in the rate of AGP transcription 4 h following LPS injection. DNase I footprinting assays revealed multiple protein binding domains in the mouse AGP-1 promoter region. Region B ({minus}104 to {minus}91) is protected by a liver-enriched transcription factor that is heat labile and in limiting quantity. An adjacent region, C ({minus}125 to {minus}104), is well-protected by nuclear extractsmore » from hepatocytes. Electrophoretic mobility shift assays indicated that only one DNA-protein complex can form with an oligonucleotide corresponding to region B. However, nuclear proteins from untreated mouse liver can form three strong complexes (C1, C2, and C3) and a weak one (C4) with oligonucleotide C. An acute-phase-inducible DNA-binding protein (AP-DBP) forms complex 4. A dramatic increase (over 11-fold) in AP-DBP binding activity is seen with nuclear proteins from LPS-stimulated animals. Interestingly, AP-DBP, a heat-stable factor, can form heterodimers with the transcription factor CCAAT/enhancer binding protein (C/EBP). Furthermore, purified C/EBP also binds avidly to region C. The studies indicate that several liver-enriched nuclear factors can interact with AGP-1 promoter and that AP-DBP binds to the AGP-1 promoter with high affinity only during the acute-phase induction.« less

Promoter Polymorphism G-6A, which Modulates Angiotensinogen Gene Expression, Is Associated with Non-Familial Sick Sinus Syndrome

PubMed Central

Chen, Jan-Yow; Liou, Ying-Ming; Wu, Hong-Dar Isaac; Lin, Kuo-Hung; Chang, Kuan-Cheng

2012-01-01

Background It is well known that familial sick sinus syndrome (SSS) is caused by functional alterations of ion channels and gap junction. Limited information is available on the mechanism of age-related non-familial SSS. Although evidence shows a close link between arrhythmia and the renin-angiotensin system (RAS), it remains to be determined whether the RAS is involved in the pathogenesis of non-familial SSS. Methods In this study, 113 patients with documented non-familial SSS and 125 controls were screened for angiotensinogen (AGT) and gap junction protein-connexin 40 (Cx40) promoter polymorphisms by gene sequencing, followed by an association study. A luciferase assay was used to determine the transcriptional activity of the promoter polymorphism. The interaction between nuclear factors and the promoter polymorphism was characterized by an electrophoretic mobility shift assay (EMSA). Results Association study showed the Cx40 -44/+71 polymorphisms are not associated with non-familial SSS; however, it indicated that four polymorphic sites at positions -6, -20, -152, and -217 in the AGT promoter are linked to non-familial SSS. Compared to controls, SSS patients had a lower frequency of the G-6A AA genotype (OR 2.88, 95% CI 1.58–5.22, P = 0.001) and a higher frequency of the G allele at -6 position (OR 2.65, 95% CI 1.54–4.57, P = 0.0003). EMSA and luciferase assays confirmed that nucleotide G at position -6 modulates the binding affinity with nuclear factors and yields a lower transcriptional activity than nucleotide A (P<0.01). Conclusion G-6A polymorphism, which modulates the transcriptional activity of the AGT promoter, may contribute to non-familial SSS susceptibility. PMID:22242192

ERalpha and AP-1 interact in vivo with a specific sequence of the F promoter of the human ERalpha gene in osteoblasts.

PubMed

Lambertini, Elisabetta; Tavanti, Elisa; Torreggiani, Elena; Penolazzi, Letizia; Gambari, Roberto; Piva, Roberta

2008-07-01

Estrogen-responsive genes often have an estrogen response element (ERE) positioned next to activator protein-1 (AP-1) binding sites. Considering that the interaction between ERE and AP-1 elements has been described for the modulation of bone-specific genes, we investigated the 17-beta-estradiol responsiveness and the role of these cis-elements present in the F promoter of the human estrogen receptor alpha (ERalpha) gene. The F promoter, containing the sequence analyzed here, is one of the multiple promoters of the human ERalpha gene and is the only active promoter in bone tissue. Through electrophoretic mobility shift (EMSA), chromatin immunoprecipitation (ChIP), and re-ChIP assays, we investigated the binding of ERalpha and four members of the AP-1 family (c-Jun, c-fos, Fra-2, and ATF2) to a region located approximately 800 bp upstream of the transcriptional start site of exon F of the human ERalpha gene in SaOS-2 osteoblast-like cells. Reporter gene assay experiments in combination with DNA binding assays demonstrated that F promoter activity is under the control of upstream cis-acting elements which are recognized by specific combinations of ERalpha, c-Jun, c-fos, and ATF2 homo- and heterodimers. Moreover, ChIP and re-ChIP experiments showed that these nuclear factors bind the F promoter in vivo with a simultaneous occupancy stimulated by 17-beta-estradiol. Taken together, our findings support a model in which ERalpha/AP-1 complexes modulate F promoter activity under conditions of 17-beta-estradiol stimulation. (c) 2008 Wiley-Liss, Inc.

Basic Helix-Loop-Helix Transcription Factor Bmsage Is Involved in Regulation of fibroin H-chain Gene via Interaction with SGF1 in Bombyx mori

PubMed Central

Li, Qiong-Yan; Hu, Wen-Bo; Zhou, Meng-Ting; Nie, Hong-Yi; Zhang, Yin-Xia; Peng, Zhang-Chuan; Zhao, Ping; Xia, Qing-You

2014-01-01

Silk glands are specialized in the synthesis of several secretory proteins. Expression of genes encoding the silk proteins in Bombyx mori silk glands with strict territorial and developmental specificities is regulated by many transcription factors. In this study, we have characterized B. mori sage, which is closely related to sage in the fruitfly Drosophila melanogaster. It is termed Bmsage; it encodes transcription factor Bmsage, which belongs to the Mesp subfamily, containing a basic helix–loop–helix motif. Bmsage transcripts were detected specifically in the silk glands of B. mori larvae through RT-PCR analysis. Immunoblotting analysis confirmed the Bmsage protein existed exclusively in B. mori middle and posterior silk gland cells. Bmsage has a low level of expression in the 4th instar molting stages, which increases gradually in the 5th instar feeding stages and then declines from the wandering to the pupation stages. Quantitative PCR analysis suggested the expression level of Bmsage in a high silk strain was higher compared to a lower silk strain on day 3 of the larval 5th instar. Furthermore, far western blotting and co-immunoprecipitation assays showed the Bmsage protein interacted with the fork head transcription factor silk gland factor 1 (SGF1). An electrophoretic mobility shift assay showed the complex of Bmsage and SGF1 proteins bound to the A and B elements in the promoter of fibroin H-chain gene(fib-H), respectively. Luciferase reporter gene assays confirmed the complex of Bmsage and SGF1 proteins increased the expression of fib-H. Together, these results suggest Bmsage is involved in the regulation of the expression of fib-H by being together with SGF1 in B. mori PSG cells. PMID:24740008

A functional haplotype of NFKB1 influence susceptibility to oral cancer: a population-based and in vitro study.

PubMed

Chen, Fa; Liu, Fengqiong; Yan, Lingjun; Lin, Lisong; Qiu, Yu; Wang, Jing; Wu, Junfeng; Bao, Xiaodan; Hu, Zhijian; Cai, Lin; He, Baochang

2018-05-01

Genetic variations of NF-κB and its inhibitor IκB genes and their biological mechanism in oral cancer were not well recognized. The purpose of this study was to evaluate the associations of polymorphisms in NFKB1 and NFKBIA with oral cancer susceptibility, and further explore their potential mechanism in vitro. First, the polymorphisms of NFKB1 and NFKBIA were genotyped through iPLEX Sequenom MassARRAY platform in a case-control study with 425 oral cancer patients and 485 healthy controls. Then, the function was explored by a luciferase reporter assay and an electrophoretic mobility shift assay (EMSA) in human tongue squamous cell carcinoma cell lines. The results indicated that NFKB1 rs28362491 Del/Del and rs72696119 G/G genotypes were associated with the risk of oral cancer, with a strong linkage disequilibrium (D' = 0.991, r 2  = 0.971). Moreover, DG haplotype of NFKB1 also showed a significant increased risk (OR = 1.25, 95% CI: 1.02-1.53, P = 0.030). Dual-luciferase reporter assays further revealed that the plasmids with DG or IG or DC haplotype transfected with Tca-8113 cells or CAL-27 cells had a lower luciferase expression than that with IC haplotype. EMSA demonstrated that 4-bp ATTG deletion in the promoter of NFKB1 abolished the binding site of transcription factor. Our preliminary findings suggest that the haplotype of rs28362491 and rs72696119 in NFKB1 could act as a novel genetic marker to predict oral cancer risk in the southeast of China, but much more extensive researches still need to be conducted. © 2018 The Authors. Cancer Medicine published by John Wiley & Sons Ltd.

Aspirin counteracts cancer stem cell features, desmoplasia and gemcitabine resistance in pancreatic cancer

PubMed Central

Zhang, Yiyao; Liu, Li; Fan, Pei; Bauer, Nathalie; Gladkich, Jury; Ryschich, Eduard; Bazhin, Alexandr V.; Giese, Nathalia A.; Strobel, Oliver; Hackert, Thilo; Hinz, Ulf; Gross, Wolfgang; Fortunato, Franco; Herr, Ingrid

2015-01-01

Pancreatic ductal adenocarcinoma (PDA) is characterized by an extremely poor prognosis. An inflammatory microenvironment triggers the pronounced desmoplasia, the selection of cancer stem-like cells (CSCs) and therapy resistance. The anti-inflammatory drug aspirin is suggested to lower the risk for PDA and to improve the treatment, although available results are conflicting and the effect of aspirin to CSC characteristics and desmoplasia in PDA has not yet been investigated. We characterized the influence of aspirin on CSC features, stromal reactions and gemcitabine resistance. Four established and 3 primary PDA cell lines, non-malignant cells, 3 patient tumor-derived CSC-enriched spheroidal cultures and tissues from patients who did or did not receive aspirin before surgery were analyzed using MTT assays, flow cytometry, colony and spheroid formation assays, Western blot analysis, antibody protein arrays, electrophoretic mobility shift assays (EMSAs), immunohistochemistry and in vivo xenotransplantation. Aspirin significantly induced apoptosis and reduced the viability, self-renewal potential, and expression of proteins involved in inflammation and stem cell signaling. Aspirin also reduced the growth and invasion of tumors in vivo, and it significantly prolonged the survival of mice with orthotopic pancreatic xenografts in combination with gemcitabine. This was associated with a decreased expression of markers for progression, inflammation and desmoplasia. These findings were confirmed in tissue samples obtained from patients who had or had not taken aspirin before surgery. Importantly, aspirin sensitized cells that were resistant to gemcitabine and thereby enhanced the therapeutic efficacy. Aspirin showed no obvious toxic effects on normal cells, chick embryos or mice. These results highlight aspirin as an effective, inexpensive and well-tolerated co-treatment to target inflammation, desmoplasia and CSC features PDA. PMID:25846752

The homeodomain transcription factors antennapedia and POU-M2 regulate the transcription of the steroidogenic enzyme gene Phantom in the silkworm.

PubMed

Meng, Meng; Cheng, Dao-Jun; Peng, Jian; Qian, Wen-Liang; Li, Jia-Rui; Dai, Dan-Dan; Zhang, Tian-Lei; Xia, Qing-You

2015-10-02

The steroid hormone ecdysone, which controls insect molting and metamorphosis, is synthesized in the prothoracic gland (PG), and several steroidogenic enzymes that are expressed specifically in the PG are involved in ecdysteroidogenesis. In this study, we identified new regulators that are involved in the transcriptional control of the silkworm steroidogenic enzyme genes. In silico analysis predicted several potential cis-regulatory elements (CREs) for the homeodomain transcription factors Antennapedia (Antp) and POU-M2 in the proximal promoters of steroidogenic enzyme genes. Antp and POU-M2 are expressed dynamically in the PG during larval development, and their overexpression in silkworm embryo-derived (BmE) cells induced the expression of steroidogenic enzyme genes. Importantly, luciferase reporter analyses, electrophoretic mobility shift assays, and chromatin immunoprecipitation assays revealed that Antp and POU-M2 promote the transcription of the silkworm steroidogenic enzyme gene Phantom (Phm) by binding directly to specific motifs within overlapping CREs in the Phm promoter. Mutations of these CREs in the Phm promoter suppressed the transcriptional activities of both Antp and POU-M2 in BmE cells and decreased the activities of mutated Phm promoters in the silkworm PG. In addition, pulldown and co-immunoprecipitation assays demonstrated that Antp can interact with POU-M2. Moreover, RNA interference-mediated down-regulation of either Antp or POU-M2 during silkworm wandering not only decreased the ecdysone titer but also led to the failure of metamorphosis. In summary, our results suggest that Antp and POU-M2 coordinate the transcription of the silkworm Phm gene directly, indicating new roles for homeodomain proteins in regulating insect ecdysteroidogenesis. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

Policy 2.0 Platform for Mobile Sensing and Incentivized Targeted Shifts in Mobility Behavior

PubMed Central

Semanjski, Ivana; Lopez Aguirre, Angel Javier; De Mol, Johan; Gautama, Sidharta

2016-01-01

Sustainable mobility and smart mobility management play important roles in achieving smart cities’ goals. In this context we investigate the role of smartphones as mobility behavior sensors and evaluate the responsivity of different attitudinal profiles towards personalized route suggestion incentives delivered via mobile phones. The empirical results are based on mobile sensed data collected from more than 3400 people’s real life over a period of six months. The findings show which user profiles are most likely to accept such incentives and how likely they are to result in more sustainable mode choices. In addition we provide insights into tendencies towards accepting more sustainable route options for different trip purposes and illustrate smart city platform potential (for collection of mobility behavior data and delivery of incentives) as a tool for development of personalized mobility management campaigns and policies. PMID:27399700

Mobile site safety review for the transuranic (TRU) waste characterization program

DOE Office of Scientific and Technical Information (OSTI.GOV)

Not Available

1996-11-01

This Safety Review Document (SRD) applies to the Active/Passive Neutron Examination and Assay (APNEA) system installed on a Lockheed Martin Specialty Components, Inc., (Specialty Components) trailer. The APNEA is designed to perform nuclear waste drum assay. The purpose of this document is to describe the safety features of the APNEA system.

Centrifugation assay for measuring adhesion of serially passaged bovine chondrocytes to polystyrene surfaces.

PubMed

Kaplan, David S; Hitchins, Victoria M; Vegella, Thomas J; Malinauskas, Richard A; Ferlin, Kimberly M; Fisher, John P; Frondoza, Carmelita G

2012-07-01

A major obstacle in chondrocyte-based therapy for cartilage repair is the limited availability of cells that maintain their original phenotype. Propagation of chondrocytes as monolayer cultures on polystyrene surfaces is used extensively for amplifying cell numbers. However, chondrocytes undergo a phenotypic shift when propagated in this manner and display characteristics of more adherent fibroblastic cells. Little information is available about the effect of this phenotypic shift on cellular adhesion properties. We evaluated changes in adhesion property as bovine chondrocytes were serially propagated up to five passages in monolayer culture using a centrifugation cell adhesion assay, which was based on counting of cells before and after being exposed to centrifugal dislodgement forces of 120 and 350 g. Chondrocytes proliferated well in a monolayer culture with doubling times of 2-3 days, but they appeared more fibroblastic and exhibited elongated cell morphology with continued passage. The centrifugation cell adhesion assay showed that chondrocytes became more adhesive with passage as the percentage of adherent cells after centrifugation increased and was not statistically different from the adhesion of the fibroblast cell line, L929, starting at passage 3. This increased adhesiveness correlated with a shift to a fibroblastic morphology and increased collagen I mRNA expression starting at passage 2. Our findings indicate that the centrifugation cell adhesion assay may serve as a reproducible tool to track alterations in chondrocyte phenotype during their extended propagation in culture.

Comparative performance of electrochemiluminescence immunoassay and EIA for HIV screening in a multiethnic region of China.

PubMed

Bi, Xiaohui; Ning, Hongxia; Wang, Tingting; Li, Dongdong; Liu, Yongming; Yang, Tingfu; Yu, Jiansheng; Tao, Chuanmin

2012-01-01

The recent approval of 4th generation HIV tests has forced many laboratories to decide whether to shift from 3rd to these tests. There are limited published studies on the comparative evaluation of these two different assays. We compare the performance of fourth-generation electrochemiluminescence immunoassay (ChIA) and third-generation enzyme linked immunosorbent assay (EIA) for human immunodeficiency virus (HIV) screening and gauge whether the shift from EIA to ChIA could be better in a multiethnic region of China. We identified a large number of routine specimens (345,492) using two different assays from Jan 2008 to Aug 2011 in a teaching hospital with high sample throughput. Of the 344,596 specimens with interpretable HIV test results, 526(0.23%) of 228,761 using EIA and 303(0.26%) of 115,835 using ChIA were HIV-1 positive. The false-positive rate of EIA was lower than that of ChIA [0.03% vs. 0.08%, odds ratio 0.33 (95% confidence interval 0.24, 0.45)]. The positive predictive value (PPV) of EIA (89.6%) was significantly higher than that of ChIA (76.1%) (<0.001), reflecting the difference between the two assays. The clinical sensitivities of two assays in this study were 99.64% for EIA and 99.88% for ChIA. Caution is needed before shifting from 3rd to 4th generation HIV tests. Since none of these tests are perfect, different geographic and ethnic area probably require different considerations with regard to HIV testing methods, taking into account the local conditions.

A Seamless Learning Design for Mobile Assisted Language Learning: An Iranian Context

ERIC Educational Resources Information Center

Foomani, Elham Mohammadi; Hedayati, Mohsen

2016-01-01

Recent developments in information communication technology (ICT) have resulted in a paradigm shift in e-Learning and there is a growing interest in developing design-based research (DBR) focusing on learners and their involvement in knowledge sharing in a contextualized mode. The present study reports a mobile-assisted language learning (MALL)…

Evaluation of Mobility, Bioavailability and Toxicity of Pb and Cd in Contaminated Soil Using TCLP, BCR and Earthworms

PubMed Central

Kede, Maria Luiza F. M.; Correia, Fabio V.; Conceição, Paulo F.; Salles Junior, Sidney F.; Marques, Marcia; Moreira, Josino C.; Pérez, Daniel V.

2014-01-01

The objective of the present study was to investigate the reduction of mobility, availability and toxicity found in soil contaminated with lead (Pb) and cadmium (Cd) from Santo Amaro Municipality, Bahia, Brazil using two combined methods, commonly tested separately according to the literature: metal mobilization with phosphates and phytoextraction. The strategy applied was the treatment with two sources of phosphates (separately and mixed) followed by phytoremediation with vetiver grass (Vetiveria zizanioides (L.)). The treatments applied (in triplicates) were: T1—potassium dihydrogen phosphate (KH2PO4); T2—reactive natural phosphate fertilizer (NRP) and; T3—a mixture 1:1 of KH2PO4 and NRP. After this step, untreated and treated soils were planted with vetiver grass. The extraction procedures and assays applied to contaminated soil before and after the treatments included metal mobility test (TCLP); sequential extraction with BCR method; toxicity assays with Eisenia andrei. The soil-to-plant transfer factors (TF) for Pb and Cd were estimated in all cases. All treatments with phosphates followed by phytoremediation reduced the mobility and availability of Pb and Cd, being KH2PO4 (T1) plus phytoremediation the most effective one. Soil toxicity however, remained high after all treatments. PMID:25386955

From teaching to learning in a mobile, wireless world.

PubMed

Billings, Diane M

2005-08-01

What research evidence justifies this shift from teaching to learning in the mobile, wireless world? We do not need evidence to answer questions such as, "Will the mobile, wireless device technology support teaching and learning?" (we already know it will), or "Will distance learning with mobile, wireless devices be as effective as that in the classroom?" (abundant evidence indicates there will be no significant differences). However, we do need to know, "How can we use these learning technologies to improve student learning and the outcomes of our academic programs?" Answers to this question will ultimately help educators prepare students to deliver safe and competent patient care in the mobile, wireless world.

Implications of Shifting Technology in Education

ERIC Educational Resources Information Center

Holland, Janet; Holland, John

2014-01-01

This article examines the implications of shifting technology trends by looking at what we've lost or are losing, where we are, and where we need to go for making the needed transitions in knowledge and skills. Areas of growth within new media and the tech industry are good indicators of our growing interests in mobility, improved quality,…

Elevational range shifts in four mountain ungulate species from the Swiss Alps

Treesearch

Ulf Büntgen; Lucie Greuter; Kurt Bollmann; Hannes Jenny; Andrew Liebhold; J. Diego Galván; Nils C. Stenseth; Carrie Andrew; Atle Mysterud

2017-01-01

Warming-induced range shifts along elevational and latitudinal gradients have been observed in several species from various taxa. The mobility and behavioral plasticity of large endothermic mammals, however, complicate the detection of climatic effects on their spatial distributions. Here, we analyzed 230,565 hunting locations of the four most abundant ungulate species...

Exercise leads to faster postural reflexes, improved balance and mobility, and fewer falls in older persons with chronic stroke.

PubMed

Marigold, Daniel S; Eng, Janice J; Dawson, Andrew S; Inglis, J Timothy; Harris, Jocelyn E; Gylfadóttir, Sif

2005-03-01

To determine the effect of two different community-based group exercise programs on functional balance, mobility, postural reflexes, and falls in older adults with chronic stroke. A randomized, clinical trial. Community center. Sixty-one community-dwelling older adults with chronic stroke. Participants were randomly assigned to an agility (n=30) or stretching/weight-shifting (n=31) exercise group. Both groups exercised three times a week for 10 weeks. Participants were assessed before, immediately after, and 1 month after the intervention for Berg Balance, Timed Up and Go, step reaction time, Activities-specific Balance Confidence, and Nottingham Health Profile. Testing of standing postural reflexes and induced falls evoked by a translating platform was also performed. In addition, falls in the community were tracked for 1 year from the start of the interventions. Although exercise led to improvements in all clinical outcome measures for both groups, the agility group demonstrated greater improvement in step reaction time and paretic rectus femoris postural reflex onset latency than the stretching/weight-shifting group. In addition, the agility group experienced fewer induced falls on the platform. Group exercise programs that include agility or stretching/weight shifting exercises improve postural reflexes, functional balance, and mobility and may lead to a reduction of falls in older adults with stroke.

Chemical & Biological Point Detection Decontamination

DTIC Science & Technology

2002-04-01

high priority in biological defense. Research on multivalent assays is also ongoing. Biased libraries, generated from immunized animals, or unbiased ...2003 TBD decontamination and modeling and simulation I I The Chem-Bio Point Detection Roadmap The summary level updated and expanded Bio Point... Molecular Imprinted Polymer Sensor, Dendrimer-based Antibody Assays, Pyrolysis-GC-ion mobility spectrometry, and surface enhanced Raman spectroscopy. Data

Reverse Transcription Recombinase Polymerase Amplification Assay for the Detection of Middle East Respiratory Syndrome Coronavirus

PubMed Central

Abd El Wahed, Ahmed; Patel, Pranav; Heidenreich, Doris; Hufert, Frank T.; Weidmann, Manfred

2013-01-01

The emergence of Middle East Respiratory Syndrome Coronavirus (MERS-CoV) in the eastern Mediterranean and imported cases to Europe has alerted public health authorities. Currently, detection of MERS-CoV in patient samples is done by real-time RT-PCR. Samples collected from suspected cases are sent to highly-equipped centralized laboratories for screening. A rapid point-of-care test is needed to allow more widespread mobile detection of the virus directly from patient material. In this study, we describe the development of a reverse transcription isothermal Recombinase Polymerase Amplification (RT-RPA) assay for the identification of MERS-CoV. A partial nucleocapsid gene RNA molecular standard of MERS-coronavirus was used to determine the assay sensitivity. The isothermal (42°C) MERS-CoV RT-RPA was as sensitive as real-time RT-PCR (10 RNA molecules), rapid (3-7 minutes) and mobile (using tubescanner weighing 1kg). The MERS-CoV RT-RPA showed cross-detection neither of any of the RNAs of several coronaviruses and respiratory viruses affecting humans nor of the human genome. The developed isothermal real-time RT-RPA is ideal for rapid mobile molecular MERS-CoV monitoring in acute patients and may also facilitate the search for the animal reservoir of MERS-CoV. PMID:24459611

Analysis of protein stability and ligand interactions by thermal shift assay.

PubMed

Huynh, Kathy; Partch, Carrie L

2015-02-02

Purification of recombinant proteins for biochemical assays and structural studies is time-consuming and presents inherent difficulties that depend on the optimization of protein stability. The use of dyes to monitor thermal denaturation of proteins with sensitive fluorescence detection enables rapid and inexpensive determination of protein stability using real-time PCR instruments. By screening a wide range of solution conditions and additives in a 96-well format, the thermal shift assay easily identifies conditions that significantly enhance the stability of recombinant proteins. The same approach can be used as an initial low-cost screen to discover new protein-ligand interactions by capitalizing on increases in protein stability that typically occur upon ligand binding. This unit presents a methodological workflow for small-scale, high-throughput thermal denaturation of recombinant proteins in the presence of SYPRO Orange dye. Copyright © 2015 John Wiley & Sons, Inc.

Chairs!: A Mobile Game for Organic Chemistry Students to Learn the Ring Flip of Cyclohexane

ERIC Educational Resources Information Center

Winter, Julia; Wentzel, Michael; Ahluwalia, Sonia

2016-01-01

The hallmark of game-based learning is that students discover concepts through trial and error as they play. With the digital landscape in higher education shifting to mobile-first, new tools for learning chemistry are both possible and needed. Interactive games for chemistry bring intuitive content directly to students through their devices. The…

E-bike trials’ potential to promote sustained changes in car owners mobility habits

NASA Astrophysics Data System (ADS)

Moser, Corinne; Blumer, Yann; Lena Hille, Stefanie

2018-04-01

Modal shifts hold considerable potential to mitigate carbon emissions. Electric bikes (e-bikes) represent a promising energy- and carbon-efficient alternative to cars. However, as mobility behaviour is highly habitual, convincing people to switch from cars to e-bikes is challenging. One strategy to accomplish this is the disruption of existing habits—a key idea behind an annual e-bike promotion programme in Switzerland, in which car owners can try out an e-bike for free over a two-week period in exchange for their car keys. By means of a longitudinal survey, we measured the long-term effects of this trial on mobility-related habitual associations. After one year, participants’ habitual association with car use had weakened significantly. This finding was valid both for participants who bought an e-bike after the trial and those who did not. Our findings contrast the results of other studies who find that the effect of interventions to induce modal shifts wears off over time. We conclude that an e-bike trial has the potential to break mobility habits and motivate car owners to use more sustainable means of transport.

Significance of the gate voltage-dependent mobility in the electrical characterization of organic field effect transistors

NASA Astrophysics Data System (ADS)

Kim, Jong Beom; Lee, Dong Ryeol

2018-04-01

We studied the effect of the addition of free hole- and electron-rich organic molecules to organic semiconductors (OSCs) in organic field effect transistors (OFETs) on the gate voltage-dependent mobility. The drain current versus gate voltage characteristics were quantitatively analyzed using an OFET mobility model of power law behavior based on hopping transport in an OSC. This analysis distinguished the threshold voltage shifts, depending on the materials and structures of the OFET device, and properly estimated the hopping transport of the charge carriers induced by the gate bias within the OSC from the power law exponent parameter. The addition of pentacene or C60 molecules to a one-monolayer pentacene-based OFET shifted the threshold voltages negatively or positively, respectively, due to the structural changes that occurred in the OFET device. On the other hand, the power law parameters revealed that the addition of charge carriers of the same or opposite polarity enhanced or hindered hopping transport, respectively. This study revealed the need for a quantitative analysis of the gate voltage-dependent mobility while distinguishing this effect from the threshold voltage effect in order to understand OSC hopping transport in OFETs.

Investigation of Defect Distributions in SiO2/AlGaN/GaN High-Electron-Mobility Transistors by Using Capacitance-Voltage Measurement with Resonant Optical Excitation

NASA Astrophysics Data System (ADS)

Kim, Tae-Soo; Lim, Seung-Young; Park, Yong-Keun; Jung, Gunwoo; Song, Jung-Hoon; Cha, Ho-Young; Han, Sang-Woo

2018-06-01

We investigated the distributions and the energy levels of defects in SiO2/AlGaN/GaN highelectron-mobility transistors (HEMTs) by using frequency-dependent ( F- D) capacitance-voltage ( C- V) measurements with resonant optical excitation. A Schottky barrier (SB) and a metal-oxidesemiconductor (MOS) HEMT were prepared to compare the effects of defects in their respective layers. We also investigated the effects of those layers on the threshold voltage ( V th ). A drastic voltage shift in the C- V curve at higher frequencies was caused by the large number of defect levels in the SiO2/GaN interface. A significant shift in V th with additional light illumination was observed due to a charging of the defect states in the SiO2/GaN interface. The voltage shifts were attributed to the detrapping of defect states at the SiO2/GaN interface.

ANKRD1 Acts as a Transcriptional Repressor of MMP13 via the AP-1 Site

PubMed Central

Almodóvar-García, Karinna; Kwon, Minjae; Samaras, Susan E.

2014-01-01

The transcriptional cofactor ANKRD1 is sharply induced during wound repair, and its overexpression enhances healing. We recently found that global deletion of murine Ankrd1 impairs wound contraction and enhances necrosis of ischemic wounds. A quantitative PCR array of Ankrd1−/− (KO) fibroblasts indicated that ANKRD1 regulates MMP genes. Yeast two-hybrid and coimmunoprecipitation analyses associated ANKRD1 with nucleolin, which represses AP-1 activation of MMP13. Ankrd1 deletion enhanced both basal and phorbol 12-myristate 13-acetate (PMA)-induced MMP13 promoter activity; conversely, Ankrd1 overexpression in control cells decreased PMA-induced MMP13 promoter activity. Ankrd1 reconstitution in KO fibroblasts decreased MMP13 mRNA, while Ankrd1 knockdown increased these levels. MMP13 mRNA and protein were elevated in intact skin and wounds of KO versus Ankrd1fl/fl (FLOX) mice. Electrophoretic mobility shift assay gel shift patterns suggested that additional transcription factors bind to the MMP13 AP-1 site in the absence of Ankrd1, and this concept was reinforced by chromatin immunoprecipitation analysis as greater binding of c-Jun to the AP-1 site in extracts from FLOX versus KO fibroblasts. We propose that ANKRD1, in association with factors such as nucleolin, represses MMP13 transcription. Ankrd1 deletion additionally relieved MMP10 transcriptional repression. Nuclear ANKRD1 appears to modulate extracellular matrix remodeling by MMPs. PMID:24515436

Persistent ecological shifts in marine molluscan assemblages across the end-Cretaceous mass extinction.

PubMed

Aberhan, Martin; Kiessling, Wolfgang

2015-06-09

Contemporary biodiversity loss and population declines threaten to push the biosphere toward a tipping point with irreversible effects on ecosystem composition and function. As a potential example of a global-scale regime shift in the geological past, we assessed ecological changes across the end-Cretaceous mass extinction based on molluscan assemblages at four well-studied sites. By contrasting preextinction and postextinction rank abundance and numerical abundance in 19 molluscan modes of life--each defined as a unique combination of mobility level, feeding mode, and position relative to the substrate--we find distinct shifts in ecospace utilization, which significantly exceed predictions from null models. The magnitude of change in functional traits relative to normal temporal fluctuations at far-flung sites indicates that molluscan assemblages shifted to differently structured systems and faunal response was global. The strengths of temporal ecological shifts, however, are mostly within the range of preextinction site-to-site variability, demonstrating that local ecological turnover was similar to geographic variation over a broad latitudinal range. In conjunction with varied site-specific temporal patterns of individual modes of life, these spatial and temporal heterogeneities argue against a concerted phase shift of molluscan assemblages from one well-defined regime to another. At a broader ecological level, by contrast, congruent tendencies emerge and suggest deterministic processes. These patterns comprise the well-known increase of deposit-feeding mollusks in postextinction assemblages and increases in predators and predator-resistant modes of life, i.e., those characterized by elevated mobility and infaunal life habits.

Phosphorylation of a WRKY transcription factor by two pathogen-responsive MAPKs drives phytoalexin biosynthesis in Arabidopsis.

PubMed

Mao, Guohong; Meng, Xiangzong; Liu, Yidong; Zheng, Zuyu; Chen, Zhixiang; Zhang, Shuqun

2011-04-01

Plant sensing of invading pathogens triggers massive metabolic reprogramming, including the induction of secondary antimicrobial compounds known as phytoalexins. We recently reported that MPK3 and MPK6, two pathogen-responsive mitogen-activated protein kinases, play essential roles in the induction of camalexin, the major phytoalexin in Arabidopsis thaliana. In search of the transcription factors downstream of MPK3/MPK6, we found that WRKY33 is required for MPK3/MPK6-induced camalexin biosynthesis. In wrky33 mutants, both gain-of-function MPK3/MPK6- and pathogen-induced camalexin production are compromised, which is associated with the loss of camalexin biosynthetic gene activation. WRKY33 is a pathogen-inducible transcription factor, whose expression is regulated by the MPK3/MPK6 cascade. Chromatin immunoprecipitation assays reveal that WRKY33 binds to its own promoter in vivo, suggesting a potential positive feedback regulatory loop. Furthermore, WRKY33 is a substrate of MPK3/MPK6. Mutation of MPK3/MPK6 phosphorylation sites in WRKY33 compromises its ability to complement the camalexin induction in the wrky33 mutant. Using a phospho-protein mobility shift assay, we demonstrate that WRKY33 is phosphorylated by MPK3/MPK6 in vivo in response to Botrytis cinerea infection. Based on these data, we conclude that WRKY33 functions downstream of MPK3/MPK6 in reprogramming the expression of camalexin biosynthetic genes, which drives the metabolic flow to camalexin production in Arabidopsis challenged by pathogens.

Nicotine suppresses bone sialoprotein gene expression.

PubMed

Nakayama, Y; Mezawa, M; Araki, S; Sasaki, Y; Wang, S; Han, J; Li, X; Takai, H; Ogata, Y

2009-10-01

Tobacco smoking is a risk factor for periodontitis and osteoporosis. Nicotine is a major component of tobacco, and has been reported to inhibit proliferation and differentiation of osteoblasts. Bone sialoprotein (BSP) is a mineralized tissue-specific protein expressed by differentiated osteoblasts that appears to function in the initial mineralization of bone. The purpose of this study was to determine the effects of nicotine on bone metabolism. We used rat osteobast-like UMR106 and ROS 17/2.8 cells and rat stromal bone marrow RBMC-D8 cells. To determine the molecular basis of the transcriptional regulation of the BSP gene by nicotine, we conducted Northern hybridization, transient transfection analyses with chimeric constructs of the BSP gene promoter linked to a luciferase reporter gene and gel mobility shift assays. Nicotine (250 microg/mL) decreased the BSP mRNA levels at 12 and 24 h in UMR106 and ROS 17/2.8 cells. From transient transfection assays using various sized BSP promoter-luciferase constructs, nicotine decreased the luciferase activities of the construct, including the promoter sequence nucleotides -116 to +60, in UMR106 and RBMC-D8 cells. Nicotine decreased the nuclear protein binding to the cAMP response element (CRE), fibroblast growth factor 2 response element (FRE) and homeodomain protein-binding site (HOX) at 12 and 24 h. This study indicates that nicotine suppresses BSP transcription mediated through CRE, FRE and HOX elements in the proximal promoter of the rat BSP gene.

Functional and Structural Characterization of Novel Type of Linker Connecting Capsid and Nucleocapsid Protein Domains in Murine Leukemia Virus.

PubMed

Doležal, Michal; Hadravová, Romana; Kožíšek, Milan; Bednárová, Lucie; Langerová, Hana; Ruml, Tomáš; Rumlová, Michaela

2016-09-23

The assembly of immature retroviral particles is initiated in the cytoplasm by the binding of the structural polyprotein precursor Gag with viral genomic RNA. The protein interactions necessary for assembly are mediated predominantly by the capsid (CA) and nucleocapsid (NC) domains, which have conserved structures. In contrast, the structural arrangement of the CA-NC connecting region differs between retroviral species. In HIV-1 and Rous sarcoma virus, this region forms a rod-like structure that separates the CA and NC domains, whereas in Mason-Pfizer monkey virus, this region is densely packed, thus holding the CA and NC domains in close proximity. Interestingly, the sequence connecting the CA and NC domains in gammaretroviruses, such as murine leukemia virus (MLV), is unique. The sequence is called a charged assembly helix (CAH) due to a high number of positively and negatively charged residues. Although both computational and deletion analyses suggested that the MLV CAH forms a helical conformation, no structural or biochemical data supporting this hypothesis have been published. Using an in vitro assembly assay, alanine scanning mutagenesis, and biophysical techniques (circular dichroism, NMR, microcalorimetry, and electrophoretic mobility shift assay), we have characterized the structure and function of the MLV CAH. We provide experimental evidence that the MLV CAH belongs to a group of charged, E(R/K)-rich, single α-helices. This is the first single α-helix motif identified in viral proteins. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

Fas/Fas ligand regulation mediates cell death in human Ewing's sarcoma cells treated with melatonin

PubMed Central

García-Santos, G; Martin, V; Rodríguez-Blanco, J; Herrera, F; Casado-Zapico, S; Sánchez-Sánchez, A M; Antolín, I; Rodríguez, C

2012-01-01

Background: Despite recent advances in cancer therapy, the 5-year survival rate for Ewing's sarcoma is still very low, and new therapeutic approaches are necessary. It was found previously that melatonin induces cell death in the Ewing's sarcoma cell line, SK-N-MC, by activating the extrinsic apoptotic pathway. Methods: Melatonin actions were analysed by metabolic viability/survival cell assays, flow cytometry, quantitative PCR for mRNA expression, western blot for protein activation/expression and electrophoretic mobility shift assay for transcription factor activation. Results: Melatonin increases the expression of Fas and its ligand Fas L, this increase being responsible for cell death induced by the indolamine. Melatonin also produces a transient increase in intracellular oxidants and activation of the redox-regulated transcription factor Nuclear factor-kappaB. Inhibition of such activation prevents cell death and Fas/Fas L upregulation. Cytotoxic effect and Fas/Fas L regulation occur in all Ewing's cell lines studied, and do not occur in the other tumour cell lines studied where melatonin does not induce cell death. Conclusion: Our data offers new insights in the study of alternative therapeutic strategies in the treatment of Ewing's sarcoma. Further attention deserves to be given to the differences in the cellular biology of sensitive tumours that could explain the cytotoxic effect of melatonin and the increase in the level of free radicals caused by this molecule, in particular cancer types. PMID:22382690

Induction of dystrophin Dp71 expression during neuronal differentiation: opposite roles of Sp1 and AP2alpha in Dp71 promoter activity.

PubMed

Morales-Lázaro, Sara Luz; González-Ramírez, Ricardo; Gómez, Pablo; Tapia-Ramírez, Victor; de León, Mario Bermúdez; Cisneros, Bulmaro

2010-01-01

In this study, we delineated the molecular mechanisms that modulate Dp71 expression during neuronal differentiation, using the N1E-115 cell line. We demonstrated that Dp71 expression is up-regulated in response to cAMP-mediated neuronal differentiation of these cells, and that this induction is controlled at promoter level. Functional deletion analysis of the Dp71 promoter revealed that a 5'-flanking 159-bp DNA fragment that contains Sp1 and AP2 binding sites is necessary and sufficient for basal expression of this TATA-less promoter, as well as for its induction during neuronal differentiation. Electrophoretic mobility shift and chromatin immunoprecipitation assays revealed that Sp1 and AP2alpha bind to their respective DNA elements within the Dp71 basal promoter. Overall, mutagenesis assays on the Sp1 and AP2 binding sites, over-expression of Sp1 and AP2alpha, as well as knock-down experiments on Sp1 and AP2alpha gene expression established that Dp71 basal expression is controlled by the combined action of Sp1 and AP2alpha, which act as activator and repressor, respectively. Furthermore, we demonstrated that induction of Dp71 expression in differentiated cells is the result of the maintenance of positive regulation exerted by Sp1, as well as of the loss of AP2alpha binding, which ultimately releases the promoter from repression.

DNA Methylation Influences Chlorogenic Acid Biosynthesis in Lonicera japonica by Mediating LjbZIP8 to Regulate Phenylalanine Ammonia-Lyase 2 Expression.

PubMed

Zha, Liangping; Liu, Shuang; Liu, Juan; Jiang, Chao; Yu, Shulin; Yuan, Yuan; Yang, Jian; Wang, Yaolong; Huang, Luqi

2017-01-01

The content of active compounds differ in buds and flowers of Lonicera japonica (FLJ) and L. japonica var. chinensis (rFLJ). Chlorogenic acid (CGAs) were major active compounds of L. japonica and regarded as measurements for quality evaluation. However, little is known concerning the formation of active compounds at the molecular level. We quantified the major CGAs in FLJ and rFLJ, and found the concentrations of CGAs were higher in the buds of rFLJ than those of FLJ. Further analysis of CpG methylation of CGAs biosynthesis genes showed differences between FLJ and rFLJ in the 5'-UTR of phenylalanine ammonia-lyase 2 ( PAL2 ). We identified 11 LjbZIP proteins and 24 rLjbZIP proteins with conserved basic leucine zipper domains, subcellular localization, and electrophoretic mobility shift assay showed that the transcription factor LjbZIP8 is a nuclear-localized protein that specifically binds to the G-box element of the LjPAL2 5'-UTR. Additionally, a transactivation assay and LjbZIP8 overexpression in transgenic tobacco indicated that LjbZIP8 could function as a repressor of transcription. Finally, treatment with 5-azacytidine decreased the transcription level of LjPAL2 and CGAs content in FLJ leaves. These results raise the possibility that DNA methylation might influence the recruitment of LjbZIP8, regulating PAL2 expression level and CGAs content in L. japonica .

DNA Methylation Influences Chlorogenic Acid Biosynthesis in Lonicera japonica by Mediating LjbZIP8 to Regulate Phenylalanine Ammonia-Lyase 2 Expression

PubMed Central

Zha, Liangping; Liu, Shuang; Liu, Juan; Jiang, Chao; Yu, Shulin; Yuan, Yuan; Yang, Jian; Wang, Yaolong; Huang, Luqi

2017-01-01

The content of active compounds differ in buds and flowers of Lonicera japonica (FLJ) and L. japonica var. chinensis (rFLJ). Chlorogenic acid (CGAs) were major active compounds of L. japonica and regarded as measurements for quality evaluation. However, little is known concerning the formation of active compounds at the molecular level. We quantified the major CGAs in FLJ and rFLJ, and found the concentrations of CGAs were higher in the buds of rFLJ than those of FLJ. Further analysis of CpG methylation of CGAs biosynthesis genes showed differences between FLJ and rFLJ in the 5′-UTR of phenylalanine ammonia-lyase 2 (PAL2). We identified 11 LjbZIP proteins and 24 rLjbZIP proteins with conserved basic leucine zipper domains, subcellular localization, and electrophoretic mobility shift assay showed that the transcription factor LjbZIP8 is a nuclear-localized protein that specifically binds to the G-box element of the LjPAL2 5′-UTR. Additionally, a transactivation assay and LjbZIP8 overexpression in transgenic tobacco indicated that LjbZIP8 could function as a repressor of transcription. Finally, treatment with 5-azacytidine decreased the transcription level of LjPAL2 and CGAs content in FLJ leaves. These results raise the possibility that DNA methylation might influence the recruitment of LjbZIP8, regulating PAL2 expression level and CGAs content in L. japonica. PMID:28740500

Molecular characterization of the sweet potato peroxidase SWPA4 promoter which responds to abiotic stresses and pathogen infection.

PubMed

Ryu, Sun-Hwa; Kim, Yun-Hee; Kim, Cha Young; Park, Soo-Young; Kwon, Suk-Yoon; Lee, Haeng-Soon; Kwak, Sang-Soo

2009-04-01

Previously, the swpa4 peroxidase gene has been shown to be inducible by a variety of abiotic stresses and pathogenic infections in sweet potato (Ipomoea batatas). To elucidate its regulatory mechanism at the transcriptional level under various stress conditions, we isolated and characterized the promoter region (2374 bp) of swpa4 (referred to as SWPA4). We performed a transient expression assay in tobacco protoplasts with deletions from the 5'-end of SWPA4 promoter fused to the beta-glucuronidase (GUS) reporter gene. The -1408 and -374 bp deletions relative to the transcription start site (+1) showed 8 and 4.5 times higher GUS expression than the cauliflower mosaic virus 35S promoter, respectively. In addition, transgenic tobacco plants expressing GUS under the control of -2374, -1408 or -374 bp region of SWPA4 promoter were generated and studied in various tissues under abiotic stresses and pathogen infection. Gel mobility shift assays revealed that nuclear proteins from sweet potato cultured cells specifically interacted with 60-bp fragment (-178/-118) in -374 bp promoter region. In silico analysis indicated that four kinds of cis-acting regulatory sequences, reactive oxygen species-related element activator protein 1 (AP1), CCAAT/enhancer-binding protein alpha element, ethylene-responsive element (ERE) and heat-shock element, are present in the -60 bp region (-178/-118), suggesting that the -60 bp region might be associated with stress inducibility of the SWPA4 promoter.

Location analysis for the estrogen receptor-α reveals binding to diverse ERE sequences and widespread binding within repetitive DNA elements

PubMed Central

Mason, Christopher E.; Shu, Feng-Jue; Wang, Cheng; Session, Ryan M.; Kallen, Roland G.; Sidell, Neil; Yu, Tianwei; Liu, Mei Hui; Cheung, Edwin; Kallen, Caleb B.

2010-01-01

Location analysis for estrogen receptor-α (ERα)-bound cis-regulatory elements was determined in MCF7 cells using chromatin immunoprecipitation (ChIP)-on-chip. Here, we present the estrogen response element (ERE) sequences that were identified at ERα-bound loci and quantify the incidence of ERE sequences under two stringencies of detection: <10% and 10–20% nucleotide deviation from the canonical ERE sequence. We demonstrate that ∼50% of all ERα-bound loci do not have a discernable ERE and show that most ERα-bound EREs are not perfect consensus EREs. Approximately one-third of all ERα-bound ERE sequences reside within repetitive DNA sequences, most commonly of the AluS family. In addition, the 3-bp spacer between the inverted ERE half-sites, rather than being random nucleotides, is C(A/T)G-enriched at bona fide receptor targets. Diverse ERα-bound loci were validated using electrophoretic mobility shift assay and ChIP-polymerase chain reaction (PCR). The functional significance of receptor-bound loci was demonstrated using luciferase reporter assays which proved that repetitive element ERE sequences contribute to enhancer function. ChIP-PCR demonstrated estrogen-dependent recruitment of the coactivator SRC3 to these loci in vivo. Our data demonstrate that ERα binds to widely variant EREs with less sequence specificity than had previously been suspected and that binding at repetitive and nonrepetitive genomic targets is favored by specific trinucleotide spacers. PMID:20047966

Location analysis for the estrogen receptor-alpha reveals binding to diverse ERE sequences and widespread binding within repetitive DNA elements.

PubMed

Mason, Christopher E; Shu, Feng-Jue; Wang, Cheng; Session, Ryan M; Kallen, Roland G; Sidell, Neil; Yu, Tianwei; Liu, Mei Hui; Cheung, Edwin; Kallen, Caleb B

2010-04-01

Location analysis for estrogen receptor-alpha (ERalpha)-bound cis-regulatory elements was determined in MCF7 cells using chromatin immunoprecipitation (ChIP)-on-chip. Here, we present the estrogen response element (ERE) sequences that were identified at ERalpha-bound loci and quantify the incidence of ERE sequences under two stringencies of detection: <10% and 10-20% nucleotide deviation from the canonical ERE sequence. We demonstrate that approximately 50% of all ERalpha-bound loci do not have a discernable ERE and show that most ERalpha-bound EREs are not perfect consensus EREs. Approximately one-third of all ERalpha-bound ERE sequences reside within repetitive DNA sequences, most commonly of the AluS family. In addition, the 3-bp spacer between the inverted ERE half-sites, rather than being random nucleotides, is C(A/T)G-enriched at bona fide receptor targets. Diverse ERalpha-bound loci were validated using electrophoretic mobility shift assay and ChIP-polymerase chain reaction (PCR). The functional significance of receptor-bound loci was demonstrated using luciferase reporter assays which proved that repetitive element ERE sequences contribute to enhancer function. ChIP-PCR demonstrated estrogen-dependent recruitment of the coactivator SRC3 to these loci in vivo. Our data demonstrate that ERalpha binds to widely variant EREs with less sequence specificity than had previously been suspected and that binding at repetitive and nonrepetitive genomic targets is favored by specific trinucleotide spacers.

Transcriptional regulation of human eosinophil RNases by an evolutionary- conserved sequence motif in primate genome

PubMed Central

Wang, Hsiu-Yu; Chang, Hao-Teng; Pai, Tun-Wen; Wu, Chung-I; Lee, Yuan-Hung; Chang, Yen-Hsin; Tai, Hsiu-Ling; Tang, Chuan-Yi; Chou, Wei-Yao; Chang, Margaret Dah-Tsyr

2007-01-01

Background Human eosinophil-derived neurotoxin (edn) and eosinophil cationic protein (ecp) are members of a subfamily of primate ribonuclease (rnase) genes. Although they are generated by gene duplication event, distinct edn and ecp expression profile in various tissues have been reported. Results In this study, we obtained the upstream promoter sequences of several representative primate eosinophil rnases. Bioinformatic analysis revealed the presence of a shared 34-nucleotide (nt) sequence stretch located at -81 to -48 in all edn promoters and macaque ecp promoter. Such a unique sequence motif constituted a region essential for transactivation of human edn in hepatocellular carcinoma cells. Gel electrophoretic mobility shift assay, transient transfection and scanning mutagenesis experiments allowed us to identify binding sites for two transcription factors, Myc-associated zinc finger protein (MAZ) and SV-40 protein-1 (Sp1), within the 34-nt segment. Subsequent in vitro and in vivo binding assays demonstrated a direct molecular interaction between this 34-nt region and MAZ and Sp1. Interestingly, overexpression of MAZ and Sp1 respectively repressed and enhanced edn promoter activity. The regulatory transactivation motif was mapped to the evolutionarily conserved -74/-65 region of the edn promoter, which was guanidine-rich and critical for recognition by both transcription factors. Conclusion Our results provide the first direct evidence that MAZ and Sp1 play important roles on the transcriptional activation of the human edn promoter through specific binding to a 34-nt segment present in representative primate eosinophil rnase promoters. PMID:17927842

The bZIP transcription factor HY5 interacts with the promoter of the monoterpene synthase gene QH6 in modulating its rhythmic expression.

PubMed

Zhou, Fei; Sun, Tian-Hu; Zhao, Lei; Pan, Xi-Wu; Lu, Shan

2015-01-01

The Artemisia annua L. β-pinene synthase QH6 was previously determined to be circadian-regulated at the transcriptional level, showing a rhythmic fluctuation of steady-state transcript abundances. Here we isolated both the genomic sequence and upstream promoter region of QH6. Different regulatory elements, such as G-box (TGACACGTGGCA, -421 bp from the translation initiation site) which might have effects on rhythmic gene expression, were found. Using the yeast one-hybrid and electrophoretic mobility shift assay (EMSA), we confirmed that the bZIP transcription factor HY5 binds to this motif of QH6. Studies with promoter truncations before and after this motif suggested that this G-box was important for the diurnal fluctuation of the transgenic β-glucuronidase gene (GUS) transcript abundance in Arabidopsis thaliana. GUS gene driven by the promoter region immediately after G-box showed an arrhythmic expression in both light/dark (LD) and constant dark (DD) conditions, whereas the control with G-box retained its fluctuation in both LD and DD. We further transformed A. thaliana with the luciferase gene (LUC) driven by an 1400 bp fragment upstream QH6 with its G-box intact or mutated, respectively. The luciferase activity assay showed that a peak in the early morning disappeared in the mutant. Gene expression analysis also demonstrated that the rhythmic expression of LUC was abolished in the hy5-1 mutant.

Persistence of STAT-1 inhibition and induction of cytokine resistance in pancreatic β cells treated with St John's wort and its component hyperforin.

PubMed

Novelli, Michela; Beffy, Pascale; Gregorelli, Alex; Porozov, Svetlana; Mascia, Fabrizio; Vantaggiato, Chiara; Masiello, Pellegrino; Menegazzi, Marta

2017-10-09

St John's wort extract (SJW) and its component hyperforin (HPF) were shown to potently inhibit cytokine-induced STAT-1 and NF-κB activation in pancreatic β cells and protect them against injury. This study aimed at exploring the time course of STAT-1 inhibition afforded by these natural compounds in the β-cell line INS-1E. INS-1E cells were pre-incubated with SJW extract (2-5 μg/ml) or HPF (0.5-2 μm) and then exposed to a cytokine mixture. In some experiments, these compounds were added after or removed before cytokine exposure. STAT-1 activation was assessed by electrophoretic mobility shift assay, apoptosis by caspase-3 activity assay, mRNA gene expression by RT-qPCR. Pre-incubation with SJW/HPF for 1-2 h exerted a remarkable STAT-1 downregulation, which was maintained upon removal of the compounds before early or delayed cytokine addition. When the protective compounds were added after cell exposure to cytokines, between 15 and 90 min, STAT-1 inhibition also occurred at a progressively decreasing extent. Upon 24-h incubation, SJW and HPF counteracted cytokine-induced β-cell dysfunction, apoptosis and target gene expression. SJW and HPF confer to β cells a state of 'cytokine resistance', which can be elicited both before and after cytokine exposure and safeguards these cells from deleterious cytokine effects. © 2017 Royal Pharmaceutical Society.

Structural and Functional Assessment of APOBEC3G Macromolecular Complexes

PubMed Central

Polevoda, Bogdan; McDougall, William M.; Bennett, Ryan P.; Salter, Jason D.; Smith, Harold C.

2016-01-01

There are eleven members in the human APOBEC family of proteins that are evolutionarily related through their zinc-dependent cytidine deaminase domains. The human APOBEC gene clusters arose on chromosome 6 and 22 through gene duplication and divergence to where current day APOBEC proteins are functionally diverse and broadly expressed in tissues. APOBEC serve enzymatic and non enzymatic functions in cells. In both cases, formation of higher-order structures driven by APOBEC protein-protein interactions and binding to RNA and/or single stranded DNA are integral to their function. In some circumstances, these interactions are regulatory and modulate APOBEC activities. We are just beginning to understand how macromolecular interactions drive processes such as APOBEC subcellular compartmentalization, formation of holoenzyme complexes, gene targeting, foreign DNA restriction, anti-retroviral activity, formation of ribonucleoprotein particles and APOBEC degradation. Protein-protein and protein-nucleic acid cross-linking methods coupled with mass spectrometry, electrophoretic mobility shift assays, glycerol gradient sedimentation, fluorescence anisotropy and APOBEC deaminase assays are enabling mapping of interacting surfaces that are essential for these functions. The goal of this methods review is through example of our research on APOBEC3G, describe the application of cross-linking methods to characterize and quantify macromolecular interactions and their functional implications. Given the homology in structure and function, it is proposed that these methods will be generally applicable to the discovery process for other APOBEC and RNA and DNA editing and modifying proteins. PMID:26988126

High-throughput cell-based screening reveals a role for ZNF131 as a repressor of ERalpha signaling

PubMed Central

Han, Xiao; Guo, Jinhai; Deng, Weiwei; Zhang, Chenying; Du, Peige; Shi, Taiping; Ma, Dalong

2008-01-01

Background Estrogen receptor α (ERα) is a transcription factor whose activity is affected by multiple regulatory cofactors. In an effort to identify the human genes involved in the regulation of ERα, we constructed a high-throughput, cell-based, functional screening platform by linking a response element (ERE) with a reporter gene. This allowed the cellular activity of ERα, in cells cotransfected with the candidate gene, to be quantified in the presence or absence of its cognate ligand E2. Results From a library of 570 human cDNA clones, we identified zinc finger protein 131 (ZNF131) as a repressor of ERα mediated transactivation. ZNF131 is a typical member of the BTB/POZ family of transcription factors, and shows both ubiquitous expression and a high degree of sequence conservation. The luciferase reporter gene assay revealed that ZNF131 inhibits ligand-dependent transactivation by ERα in a dose-dependent manner. Electrophoretic mobility shift assay clearly demonstrated that the interaction between ZNF131 and ERα interrupts or prevents ERα binding to the estrogen response element (ERE). In addition, ZNF131 was able to suppress the expression of pS2, an ERα target gene. Conclusion We suggest that the functional screening platform we constructed can be applied for high-throughput genomic screening candidate ERα-related genes. This in turn may provide new insights into the underlying molecular mechanisms of ERα regulation in mammalian cells. PMID:18847501

Expression of multidrug resistance efflux pump gene norA is iron responsive in Staphylococcus aureus.

PubMed

Deng, Xin; Sun, Fei; Ji, Quanjiang; Liang, Haihua; Missiakas, Dominique; Lan, Lefu; He, Chuan

2012-04-01

Staphylococcus aureus utilizes efflux transporter NorA to pump out a wide range of structurally dissimilar drugs, conferring low-level multidrug resistance. The regulation of norA expression has yet to be fully understood although past studies have revealed that this gene is under the control of the global transcriptional regulator MgrA and the two-component system ArlRS. To identify additional regulators of norA, we screened a transposon library in strain Newman expressing the transcriptional fusion norA-lacZ for altered β-galactosidase activity. We identify a transposon insertion in fhuB, a gene that encodes a ferric hydroxamate uptake system permease, and propose that the norA transcription is iron responsive. In agreement with this observation, addition of FeCl(3) repressed the induction of norA-lacZ, suggesting that bacterial iron uptake plays an important role in regulating norA transcription. In addition, a fur (ferric uptake regulator) deletion exhibited compromised norA transcription and reduced resistance to quinolone compared to the wild-type strain, indicating that fur functions as a positive regulator of norA. A putative Fur box identified in the promoter region of norA was confirmed by electrophoretic mobility shift and DNase I footprint assays. Finally, by employing a siderophore secretion assay, we reveal that NorA may contribute to the export of siderophores. Collectively, our experiments uncover some novel interactions between cellular iron level and norA regulation in S. aureus.

Expression of Multidrug Resistance Efflux Pump Gene norA Is Iron Responsive in Staphylococcus aureus

PubMed Central

Deng, Xin; Sun, Fei; Ji, Quanjiang; Liang, Haihua; Missiakas, Dominique; Lan, Lefu

2012-01-01

Staphylococcus aureus utilizes efflux transporter NorA to pump out a wide range of structurally dissimilar drugs, conferring low-level multidrug resistance. The regulation of norA expression has yet to be fully understood although past studies have revealed that this gene is under the control of the global transcriptional regulator MgrA and the two-component system ArlRS. To identify additional regulators of norA, we screened a transposon library in strain Newman expressing the transcriptional fusion norA-lacZ for altered β-galactosidase activity. We identify a transposon insertion in fhuB, a gene that encodes a ferric hydroxamate uptake system permease, and propose that the norA transcription is iron responsive. In agreement with this observation, addition of FeCl3 repressed the induction of norA-lacZ, suggesting that bacterial iron uptake plays an important role in regulating norA transcription. In addition, a fur (ferric uptake regulator) deletion exhibited compromised norA transcription and reduced resistance to quinolone compared to the wild-type strain, indicating that fur functions as a positive regulator of norA. A putative Fur box identified in the promoter region of norA was confirmed by electrophoretic mobility shift and DNase I footprint assays. Finally, by employing a siderophore secretion assay, we reveal that NorA may contribute to the export of siderophores. Collectively, our experiments uncover some novel interactions between cellular iron level and norA regulation in S. aureus. PMID:22267518

A detailed protocol for chromatin immunoprecipitation in the yeast Saccharomyces cerevisiae.

PubMed

Grably, Melanie; Engelberg, David

2010-01-01

Critical cellular processes such as DNA replication, DNA damage repair, and transcription are mediated and regulated by DNA-binding proteins. Many efforts have been invested therefore in developing methods that monitor the dynamics of protein-DNA association. As older techniques such as DNA footprinting, and electrophoretic mobility shift assays (EMSA) could be applied mostly in vitro, the development of the chromatin immunoprecipitation (ChIP) method, which allows quantitative measurement of protein-bound DNA most accurately in vivo, revolutionized our capabilities of understanding the mechanisms underlying the aforementioned processes. Furthermore, this powerful tool could be applied at the genomic-scale providing a global picture of the protein-DNA complexes at the entire genome.The procedure is conceptually simple; involves rapid crosslinking of proteins to DNA by the addition of formaldehyde to the culture, shearing the DNA and immunoprecipitating the protein of interest while covalently bound to its DNA targets. Following decrosslinking, DNA that was coimmunoprecipitated could be amplified by PCR or could serve as a probe of a genomic microarray to identify all DNA fragments that were bound to the protein.Although simple in principle, the method is not trivial to implement and the results might be misleading if proper controls are not included in the experiment. In this chapter, we provide therefore a highly detailed protocol of ChIP assay as is applied successfully in our laboratory. We pay special attention to describe every small detail, in order that any investigator could readily and successfully apply this important and powerful technology.

Mangiferin activates the Nrf2-ARE pathway and reduces etoposide-induced DNA damage in human umbilical cord mononuclear blood cells.

PubMed

Zhang, Benping; Zhao, Jie; Li, Shanshan; Zeng, Linglan; Chen, Yan; Fang, Jun

2015-04-01

Mangiferin (2-C-β-d-gluco-pyranosyl-1,3,6,7-tetrahydroxyxanthone) is a well-known natural antioxidant distributed in various plants of the Anacardiaceae and Gentianaceae families. Mangiferin can inhibit carcinogen-induced lung or colon tumor formation in experimental animals. However, the molecular mechanisms of its chemopreventive activity remain unexplored. This study aimed to investigate the effects of mangiferin on chemical carcinogen-induced DNA damage and Nrf2-ARE signaling in hematopoietic cells. Mononuclear cells (MNCs) were isolated from human umbilical cord blood (hUCB). DNA damage was evaluated by comet and micronucleus assays. The expression of Nrf2 and NQO1 was examined by immunofluorescence and western blotting. An electrophoretic mobility shift assay (EMSA) was used to detect the binding activity of Nrf2 with NQO1-ARE sequences. We found that mangiferin treatment significantly reduced DNA damage in etoposide-treated MNCs, which was verified by decreased olive tail moment (OTM) and micronucleus (MN) frequency. Mangiferin treatment significantly promoted Nrf2 translocation into the nucleus and increased nuclear Nrf2 expression. Moreover, NQO1, an Nrf2 signaling target, was significantly upregulated by mangiferin treatment, and the binding activity of Nrf2 with NQO1-ARE sequences was elevated after mangiferin treatment. Mangiferin activated Nrf2 signaling, upregulated NQO1 expression, and significantly reduced etoposide-induced DNA damage. Thus, mangiferin is a potential cytoprotective agent for hematopoietic cells.

The 3D protein of duck hepatitis A virus type 1 binds to a viral genomic 3' UTR and shows RNA-dependent RNA polymerase activity.

PubMed

Zhang, Yu; Cao, Qianda; Wang, Mingshu; Jia, Renyong; Chen, Shun; Zhu, Dekang; Liu, Mafeng; Sun, Kunfeng; Yang, Qiao; Wu, Ying; Zhao, Xinxin; Chen, Xiaoyue; Cheng, Anchun

2017-12-01

To explore the RNA-dependent RNA polymerase (RdRP) function of the 3D protein of duck hepatitis A virus type 1 (DHAV-1), the gene was cloned into the pET-32a(+) vector for prokaryotic expression. The 3' untranslated region (3' UTR) of DHAV-1 together with a T7 promoter was cloned into the pMD19-T vector for in vitro transcription of 3' UTR RNA, which was further used as a template in RNA-dependent RNA polymerization. In this study, three methods were applied to analyze the RdRP function of the 3D protein: (1) ammonium molybdate spectrophotometry to detect pyrophosphate produced during polymerization; (2) quantitative reverse transcription PCR (RT-qPCR) to investigate the changes in RNA quantity during polymerization; and (3) electrophoresis mobility shift assay to examine the interaction between the 3D protein and 3' UTR. The results showed the 3D protein was successfully expressed in bacteria culture supernatant in a soluble form, which could be purified by affinity chromatography. In 3D enzymatic activity assays, pyrophosphate and RNA were produced, the amounts of which increased based on approximative kinetics, and binding of the 3D protein to the 3' UTR was observed. These results indicate that prokaryotically expressed soluble DHAV-13D protein can bind to a viral genomic 3' UTR and exhibit RdRP activity.

Characteristics and Expression Profile of KRT71 Screened by Suppression Subtractive Hybridization cDNA Library in Curly Fleece Chinese Tan Sheep.

PubMed

Kang, Xiaolong; Liu, Yufang; Zhang, Jibin; Xu, Qinqin; Liu, Chengkun; Fang, Meiying

2017-07-01

As an important commercial trait for sheep, curly fleece has a great economic impact on production costs and efficiency in sheep industry. To identify genes that are important for curly fleece formation in mammals, a suppression subtractive hybridization analysis was performed on the shoulder skin tissues exposed to two different growth stages of Chinese Tan sheep with different phenotypes (curly fleece and noncurling fleece). BLAST analysis identified 67 differentially expressed genes, of which 31 were expressed lower and 36 were expressed higher in lambs than in adult sheep. Differential expressions of seven randomly selected genes were verified using quantitative real-time polymerase chain reaction (qRT-PCR). KRT71 gene was selected for further study due to its high correlation with the curly hair phenotype in various mammal species. Semi-qPCR showed distinctively high expression of KRT71 in skin tissues. Moreover, qPCR result showed a significantly higher expression of KRT71 in curly fleece than noncurling Tan sheep. The luciferase assay and electrophoresis mobility shift assay showed that there were transcription factor binding sites in the promoter region of KRT71 related to the differential expression of KRT71 at the two growth stages of Tan sheep. Online bioinformation tools predicted MFZ1 as a transcriptional factor that regulates the expression of KRT71. These studies on KRT71 gene revealed some mechanisms underlying the relationship between the KRT71 gene and the curly fleece phenotype of Tan sheep.

Purely aqueous PLGA nanoparticulate formulations of curcumin exhibit enhanced anticancer activity with dependence on the combination of the carrier.

PubMed

Nair, K Lekha; Thulasidasan, Arun Kumar T; Deepa, G; Anto, Ruby John; Kumar, G S Vinod

2012-04-04

Curcumin, a yellow pigment present in turmeric, possess potential anti-proliferative and anti-inflammatory activities but poor aqueous solubility limits its applications. In this study we report a novel comparative study of the formulation and characterization of curcumin nanoparticles (nanocurcumin) using two poly (lactide-co-glycolide) (PLGA) combinations, 50:50 and 75:25 having different lactide to glycolide ratios. Nanocurcumin 50:50 showed smaller size with higher encapsulation efficiency. Thermal evaluation suggested the presence of curcumin in molecular dispersion form which supported its sustained release up to a week where nanocurcumin 50:50 showed faster release. Cellular uptake studies in human epithelial cervical cancer cells (HeLa) exhibited enhanced intracellular fluorescence with nanocurcumin when compared to free curcumin, when both given in purely aqueous media. Antiproliferative studies using MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) assay, Annexin V/propidium iodide staining, poly (ADP-ribose) polymerase (PARP) cleavage and downregulation of clonogenic potential of HeLa cells proved the better antitumor activity of nanocurcumin 50:50 administered in aqueous media. Superior efficacy of nanocurcumin 50:50 in comparison to free curcumin was further demonstrated by electrophoretic mobility shift assay and immunocytochemical analysis. In conclusion, the enhanced aqueous solubility and higher anticancer efficacy of nanocurcumin administered in aqueous media clearly demonstrates its potential against cancer chemotherapy, with dependence on the combination of PLGA. Copyright © 2012. Published by Elsevier B.V.

Identification of the Drosophila eIF4A gene as a target of the DREF transcription factor

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ida, Hiroyuki; Insect Biomedical Research Center, Kyoto Institute of Technology, Matsugasaki, Sakyo-ku, Kyoto 606-8585; Yoshida, Hideki

2007-12-10

The DNA replication-related element-binding factor (DREF) regulates cell proliferation-related gene expression in Drosophila. We have carried out a genetic screening, taking advantage of the rough eye phenotype of transgenic flies that express full-length DREF in the eye imaginal discs and identified the eukaryotic initiation factor 4A (eIF4A) gene as a dominant suppressor of the DREF-induced rough eye phenotype. The eIF4A gene was here found to carry three DRE sequences, DRE1 (- 40 to - 47), DRE2 (- 48 to - 55), and DRE3 (- 267 to - 274) in its promoter region, these all being important for the eIF4A genemore » promoter activity in cultured Drosophila Kc cells and in living flies. Knockdown of DREF in Drosophila S2 cells decreased the eIF4A mRNA level and the eIF4A gene promoter activity. Furthermore, specific binding of DREF to genomic regions containing DRE sequences was demonstrated by chromatin immunoprecipitation assays using anti-DREF antibodies. Band mobility shift assays using Kc cell nuclear extracts revealed that DREF could bind to DRE1 and DRE3 sequences in the eIF4A gene promoter in vitro, but not to the DRE2 sequence. The results suggest that the eIF4A gene is under the control of the DREF pathway and DREF is therefore involved in the regulation of protein synthesis.« less

Use of a real time PCR assay for detection of the ctxA gene of Vibrio cholerae in an environmental survey of Mobile Bay.

PubMed

Blackstone, George M; Nordstrom, Jessica L; Bowen, Michael D; Meyer, Richard F; Imbro, Paula; DePaola, Angelo

2007-02-01

Toxigenic Vibrio cholerae, the etiological agent of cholera, is a natural inhabitant of the marine environment and causes severe diarrheal disease affecting thousands of people each year in developing countries. It is the subject of extensive testing of shrimp produced and exported from these countries. We report the development of a real time PCR (qPCR) assay to detect the gene encoding cholera toxin, ctxA, found in toxigenic V. cholerae strains. This assay was tested against DNA isolated from soil samples collected from diverse locations in the US, a panel of eukaryotic DNA from various sources, and prokaryotic DNA from closely related and unrelated bacterial sources. Only Vibrio strains known to contain ctxA generated a fluorescent signal with the 5' nuclease probe targeting the ctxA gene, thus confirming the specificity of the assay. In addition, the assay was quantitative in pure culture across a six-log dynamic range down to <10 CFU per reaction. To test the robustness of this assay, oysters, aquatic sediments, and seawaters from Mobile Bay, AL, were analyzed by qPCR and traditional culture methods. The assay was applied to overnight alkaline peptone water enrichments of these matrices after boiling the enrichments for 10 min. Toxigenic V. cholerae strains were not detected by either qPCR or conventional methods in the 16 environmental samples examined. A novel exogenous internal amplification control developed by us to prevent false negatives identified the samples that were inhibitory to the PCR. This assay, with the incorporated internal control, provides a highly specific, sensitive, and rapid detection method for the detection of toxigenic strains of V. cholerae.

Orphan nuclear receptor TLX regulates astrogenesis by modulating BMP signaling

PubMed Central

Qin, Song; Niu, Wenze; Iqbal, Nida; Smith, Derek K.; Zhang, Chun-Li

2014-01-01

Neural stem cells (NSCs) are self-renewing multipotent progenitors that generate both neurons and glia. The precise control of NSC behavior is fundamental to the architecture and function of the central nervous system. We previously demonstrated that the orphan nuclear receptor TLX is required for postnatal NSC activation and neurogenesis in the neurogenic niche. Here, we show that TLX modulates bone morphogenetic protein (BMP)-SMAD signaling to control the timing of postnatal astrogenesis. Genes involved in the BMP signaling pathway, such as Bmp4, Hes1, and Id3, are upregulated in postnatal brains lacking Tlx. Chromatin immunoprecipitation and electrophoretic mobility shift assays reveal that TLX can directly bind the enhancer region of Bmp4. In accordance with elevated BMP signaling, the downstream effectors SMAD1/5/8 are activated by phosphorylation in Tlx mutant mice. Consequently, Tlx mutant brains exhibit an early appearance and increased number of astrocytes with marker expression of glial fibrillary acidic protein (GFAP) and S100B. Taken together, these results suggest that TLX tightly controls postnatal astrogenesis through the modulation of BMP-SMAD signaling pathway activity. PMID:24782704

Orphan nuclear receptor TLX regulates astrogenesis by modulating BMP signaling.

PubMed

Qin, Song; Niu, Wenze; Iqbal, Nida; Smith, Derek K; Zhang, Chun-Li

2014-01-01

Neural stem cells (NSCs) are self-renewing multipotent progenitors that generate both neurons and glia. The precise control of NSC behavior is fundamental to the architecture and function of the central nervous system. We previously demonstrated that the orphan nuclear receptor TLX is required for postnatal NSC activation and neurogenesis in the neurogenic niche. Here, we show that TLX modulates bone morphogenetic protein (BMP)-SMAD signaling to control the timing of postnatal astrogenesis. Genes involved in the BMP signaling pathway, such as Bmp4, Hes1, and Id3, are upregulated in postnatal brains lacking Tlx. Chromatin immunoprecipitation and electrophoretic mobility shift assays reveal that TLX can directly bind the enhancer region of Bmp4. In accordance with elevated BMP signaling, the downstream effectors SMAD1/5/8 are activated by phosphorylation in Tlx mutant mice. Consequently, Tlx mutant brains exhibit an early appearance and increased number of astrocytes with marker expression of glial fibrillary acidic protein (GFAP) and S100B. Taken together, these results suggest that TLX tightly controls postnatal astrogenesis through the modulation of BMP-SMAD signaling pathway activity.

Carotenoid biosynthesis in bacteria: In vitro studies of a crt/bch transcription factor from Rhodobacter capsulatus and carotenoid enzymes from Erwinia herbicola

DOE Office of Scientific and Technical Information (OSTI.GOV)

O'Brien, D.A.

1992-11-01

A putative transcription factor in Rhodobactor capsulatus which binds upstream of the crt and bch pigment biosynthesis operons and appears to play a role in the adaptation of the organism from the aerobic to the anaerobic-photosynthetic growth mode was characterized. Chapter 2 describes the identification of this factor through an in vitro mobility shift assay, as well as the determination of its binding properties and sequence specificity. Chapter 3 focuses on the isolation of this factor. Biochemistry of later carotenoid biosynthesis enzymes derived from the non-photosynthetic bacterium, Erwinia herbicola. Chapter 4 describes the separate overexpression and in vitro analysis ofmore » two enzymes involved in the main sequence of the carotenoid biosynthesis pathway, lycopene cyclase and 5-carotene hydroxylase. Chapter 5 examines the overexpression and enzymology of functionally active zeaxanthin glucosyltransferase, an enzyme which carries out a more unusual transformation, converting a carotenoid into its more hydrophilic mono- and diglucoside derivatives. In addition, amino acid homology with other glucosyltransferases suggests a putative binding site for the UDP-activated glucose substrate.« less

Double-stranded RNA transcribed from vector-based oligodeoxynucleotide acts as transcription factor decoy

DOE Office of Scientific and Technical Information (OSTI.GOV)

Xiao, Xiao; Gang, Yi; Department of Infectious Diseases, Tangdu Hospital, Fourth Military Medical University, Xi’an 710038, Shaanxi Province

2015-02-06

Highlights: • A shRNA vector based transcription factor decoy, VB-ODN, was designed. • VB-ODN for NF-κB inhibited cell viability in HEK293 cells. • VB-ODN inhibited expression of downstream genes of target transcription factors. • VB-ODN may enhance nuclear entry ratio for its feasibility of virus production. - Abstract: In this study, we designed a short hairpin RNA vector-based oligodeoxynucleotide (VB-ODN) carrying transcription factor (TF) consensus sequence which could function as a decoy to block TF activity. Specifically, VB-ODN for Nuclear factor-κB (NF-κB) could inhibit cell viability and decrease downstream gene expression in HEK293 cells without affecting expression of NF-κB itself.more » The specific binding between VB-ODN produced double-stranded RNA and NF-κB was evidenced by electrophoretic mobility shift assay. Moreover, similar VB-ODNs designed for three other TFs also inhibit their downstream gene expression but not that of themselves. Our study provides a new design of decoy for blocking TF activity.« less

Regulation of CAPRICE transcription by MYB proteins for root epidermis differentiation in Arabidopsis.

PubMed

Koshino-Kimura, Yoshihiro; Wada, Takuji; Tachibana, Tatsuhiko; Tsugeki, Ryuji; Ishiguro, Sumie; Okada, Kiyotaka

2005-06-01

Epidermal cell differentiation in Arabidopsis root is studied as a model system for understanding cell fate specification. Two types of MYB-related transcription factors are involved in this cell differentiation. One of these, CAPRICE (CPC), encoding an R3-type MYB protein, is a positive regulator of hair cell differentiation and is preferentially transcribed in hairless cells. We analyzed the regulatory mechanism of CPC transcription. Deletion analyses of the CPC promoter revealed that hairless cell-specific transcription of the CPC gene required a 69 bp sequence, and a tandem repeat of this region was sufficient for its expression in epidermis. This region includes two MYB-binding sites, and the epidermis-specific transcription of CPC was abolished when base substitutions were introduced in these sites. We showed by gel mobility shift experiments and by yeast one-hybrid assay that WEREWOLF (WER), which is an R2R3-type MYB protein, directly binds to this region. We showed that WER also binds to the GL2 promoter region, indicating that WER directly regulates CPC and GL2 transcription by binding to their promoter regions.

Activity ranking of synthetic analogs targeting vascular endothelial growth factor receptor 2 by an integrated cell membrane chromatography system.

PubMed

Wang, Dongyao; Lv, Diya; Chen, Xiaofei; Liu, Yue; Ding, Xuan; Jia, Dan; Chen, Langdong; Zhu, Zhenyu; Cao, Yan; Chai, Yifeng

2015-12-01

Evaluating the biological activities of small molecules represents an important part of the drug discovery process. Cell membrane chromatography (CMC) is a well-developed biological chromatographic technique. In this study, we have developed combined SMMC-7721/CMC and HepG2/CMC with high-performance liquid chromatography and time-of-flight mass spectrometry to establish an integrated screening platform. These systems was subsequently validated and used for evaluating the activity of quinazoline compounds, which were designed and synthesized to target vascular endothelial growth factor receptor 2. The inhibitory activities of these compounds towards this receptor were also tested using a classical caliper mobility shift assay. The results revealed a significant correlation between these two methods (R(2) = 0.9565 or 0.9420) for evaluating the activities of these compounds. Compared with traditional methods of evaluating the activities analogous compounds, this integrated cell membrane chromatography screening system took less time and was more cost effective, indicating that it could be used as a practical method in drug discovery. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

The T4 Phage DNA Mimic Protein Arn Inhibits the DNA Binding Activity of the Bacterial Histone-like Protein H-NS*

PubMed Central

Ho, Chun-Han; Wang, Hao-Ching; Ko, Tzu-Ping; Chang, Yuan-Chih; Wang, Andrew H.-J.

2014-01-01

The T4 phage protein Arn (Anti restriction nuclease) was identified as an inhibitor of the restriction enzyme McrBC. However, until now its molecular mechanism remained unclear. In the present study we used structural approaches to investigate biological properties of Arn. A structural analysis of Arn revealed that its shape and negative charge distribution are similar to dsDNA, suggesting that this protein could act as a DNA mimic. In a subsequent proteomic analysis, we found that the bacterial histone-like protein H-NS interacts with Arn, implying a new function. An electrophoretic mobility shift assay showed that Arn prevents H-NS from binding to the Escherichia coli hns and T4 p8.1 promoters. In vitro gene expression and electron microscopy analyses also indicated that Arn counteracts the gene-silencing effect of H-NS on a reporter gene. Because McrBC and H-NS both participate in the host defense system, our findings suggest that T4 Arn might knock down these mechanisms using its DNA mimicking properties. PMID:25118281

NF-kappaB mediates FGF signal regulation of msx-1 expression.

PubMed

Bushdid, P B; Chen, C L; Brantley, D M; Yull, F; Raghow, R; Kerr, L D; Barnett, J V

2001-09-01

The nuclear factor-kappaB (NF-kappaB) family of transcription factors is involved in proliferation, differentiation, and apoptosis in a stage- and cell-dependent manner. Recent evidence has shown that NF-kappaB activity is necessary for both chicken and mouse limb development. We report here that the NF-kappaB family member c-rel and the homeodomain gene msx-1 have partially overlapping expression patterns in the developing chick limb. In addition, inhibition of NF-kappaB activity resulted in a decrease in msx-1 mRNA expression. Sequence analysis of the msx-1 promoter revealed three potential kappaB-binding sites similar to the interferon-gamma (IFN-gamma) kappaB-binding site. These sites bound to c-Rel, as shown by electrophoretic mobility shift assay (EMSA). Furthermore, inhibition of NF-kappaB activity significantly reduced transactivation of the msx-1 promoter in response to FGF-2/-4, known stimulators of msx-1 expression. These results suggest that NF-kappaB mediates the FGF-2/-4 signal regulation of msx-1 gene expression. Copyright 2001 Academic Press.

A homeodomain transcription factor gene, PfMSX, activates expression of Pif gene in the pearl oyster Pinctada fucata.

PubMed

Zhao, Mi; He, Maoxian; Huang, Xiande; Wang, Qi

2014-01-01

We reported pearl oyster Pinctada fucata cDNA and genomic characterization of a new homeobox-containing protein, PfMSX. The PfMSX gene encodes a transcription factor that was localized to the nucleus. Analyses of PfMSX mRNA in tissues and developmental stages showed high expressions in mantle or D-shaped larvae. In electrophoretic mobility shift assays (EMSAs) PfMSX binded to MSX consensus binding sites in the 5' flanking region of the Pif promoter. In co-transfection experiment PfMSX transactivated reporter constructs containing Pif promoter sequences, and mutation of the MSX-binding sites attenuated transactivation. A knockdown experiment using PfMSX dsRNA showed decreased Pif mRNA and unregular crystallization of the nacreous layer using scanning electron microscopy. Our results suggested that PfMSX was a conserved homeodomain transcription factor gene, which can activate Pif gene expression through MSX binding site, and was then involved in the mineralization process in pearl oyster Pinctada fucata. Our data provided important clues about mechanisms regulating biomineralization in pearl oyster.

Crystal Structure of the GRAS Domain of SCARECROW-LIKE7 in Oryza sativa

PubMed Central

Li, Shengping; Zhao, Yanhe; Zhao, Zheng; Wu, Xiuling; Sun, Lifang; Liu, Qingsong; Wu, Yunkun

2016-01-01

GRAS proteins belong to a plant-specific protein family with many members and play essential roles in plant growth and development, functioning primarily in transcriptional regulation. Proteins in the family are minimally defined as containing the conserved GRAS domain. Here, we determined the structure of the GRAS domain of Os-SCL7 from rice (Oryza sativa) to 1.82 Å. The structure includes cap and core subdomains and elucidates the features of the conserved GRAS LRI, VHIID, LRII, PFYRE, and SAW motifs. The structure is a dimer, with a clear groove to accommodate double-stranded DNA. Docking a DNA segment into the groove to generate an Os-SCL7/DNA complex provides insight into the DNA binding mechanism of GRAS proteins. Furthermore, the in vitro DNA binding property of Os-SCL7 and model-defined recognition residues are assessed by electrophoretic mobility shift analysis and mutagenesis assays. These studies reveal the structure and preliminary DNA interaction mechanisms of GRAS proteins and open the door to in-depth investigation and understanding of the individual pathways in which they play important roles. PMID:27081181

Inhibition of aldolase A blocks biogenesis of ATP and attenuates Japanese encephalitis virus production.

PubMed

Tien, Chih-Feng; Cheng, Shih-Ching; Ho, Yen-Peng; Chen, Yi-Shiuan; Hsu, Jung-Hsin; Chang, Ruey-Yi

2014-01-10

Viral replication depends on host proteins to supply energy and replication accessories for the sufficient production of viral progeny. In this study, we identified fructose-bisphosphate aldolase A as a binding partner of Japanese encephalitis virus (JEV) untranslated regions (UTRs) on the antigenome via RNA affinity capture and mass spectrometry. Direct interaction of aldolase A with JEV RNAs was confirmed by gel mobility shift assay and colocalization with active replication of double-stranded RNA in JEV-infected cells. Infection of JEV caused an increase in aldolase A expression of up to 33%. Knocking down aldolase A reduced viral translation, genome replication, and viral production significantly. Furthermore, JEV infection consumed 50% of cellular ATP, and the ATP level decreased by 70% in the aldolase A-knockdown cells. Overexpression of aldolase A in aldolase A-knockdown cells increased ATP levels significantly. Taken together, these results indicate that JEV replication requires aldolase A and consumes ATP. This is the first report of direct involvement of a host metabolic enzyme, aldolase A protein, in JEV replication. Copyright © 2013 Elsevier Inc. All rights reserved.

Chimeric RNase H–Competent Oligonucleotides Directed to the HIV-1 Rev Response Element

PubMed Central

Prater, Chrissy E.; Saleh, Anthony D.; Wear, Maggie P.; Miller, Paul S.

2007-01-01

Chimeric oligo-2′-O-methylribonucleotides containing centrally located patches of contiguous 2′-deoxyribonucleotides and terminating in a nuclease resistant 3′-methylphosphonate internucleotide linkage were prepared. The oligonucleotides were targeted to the 3′-side of HIV Rev response element (RRE) stem-loop IIB RNA, which is adjacent to the high affinity Rev protein binding site and is critical to virus function. Thermal denaturation experiments showed that chimeric oligonucleotides form very stable duplexes with a complementary single-stranded RNA, and gel electrophoretic mobility shift assays (EMSA) showed that they bind with high affinity and specificity to RRE stem-loop II RNA (KD approximately 200 nM). The chimeric oligonucleotides promote RNase H-mediated hydrolysis of RRE stem-loop II RNA and have half lives exceeding 24 h when incubated in cell culture medium containing 10% fetal calf serum. One of the chimeric oligonucleotides inhibited RRE mediated expression of chloramphenicol acetyl transferase (CAT) approximately 60% at a concentration of 300 nM in HEK 293T cells co-transfected with p-RRE/CAT and p-Rev mammalian expression vectors. PMID:17566743

Bovine herpesvirus 1 productive infection and immediate early transcription unit 1 promoter are stimulated by the synthetic corticosteroid dexamethasone.

PubMed

Kook, Insun; Henley, Caitlin; Meyer, Florencia; Hoffmann, Federico G; Jones, Clinton

2015-10-01

The primary site for life-long latency of bovine herpesvirus 1 (BHV-1) is sensory neurons. The synthetic corticosteroid dexamethasone consistently induces reactivation from latency; however the mechanism by which corticosteroids mediate reactivation is unclear. In this study, we demonstrate for the first time that dexamethasone stimulates productive infection, in part, because the BHV-1 genome contains more than 100 potential glucocorticoid receptor (GR) response elements (GREs). Immediate early transcription unit 1 (IEtu1) promoter activity, but not IEtu2 or VP16 promoter activity, was stimulated by dexamethasone. Two near perfect consensus GREs located within the IEtu1 promoter were necessary for dexamethasone-mediated stimulation. Electrophoretic mobility shift assays and chromatin immunoprecipitation studies demonstrated that the GR interacts with IEtu1 promoter sequences containing the GREs. Although we hypothesize that DEX-mediated stimulation of IEtu1 promoter activity is important during productive infection and perhaps reactivation from latency, stress likely has pleiotropic effects on virus-infected cells. Copyright © 2015 Elsevier Inc. All rights reserved.

A Homeodomain Transcription Factor Gene, PfMSX, Activates Expression of Pif Gene in the Pearl Oyster Pinctada fucata

PubMed Central

Zhao, Mi; He, Maoxian; Huang, Xiande; Wang, Qi

2014-01-01

We reported pearl oyster Pinctada fucata cDNA and genomic characterization of a new homeobox-containing protein, PfMSX. The PfMSX gene encodes a transcription factor that was localized to the nucleus. Analyses of PfMSX mRNA in tissues and developmental stages showed high expressions in mantle or D-shaped larvae. In electrophoretic mobility shift assays (EMSAs) PfMSX binded to MSX consensus binding sites in the 5′ flanking region of the Pif promoter. In co-transfection experiment PfMSX transactivated reporter constructs containing Pif promoter sequences, and mutation of the MSX-binding sites attenuated transactivation. A knockdown experiment using PfMSX dsRNA showed decreased Pif mRNA and unregular crystallization of the nacreous layer using scanning electron microscopy. Our results suggested that PfMSX was a conserved homeodomain transcription factor gene, which can activate Pif gene expression through MSX binding site, and was then involved in the mineralization process in pearl oyster Pinctada fucata. Our data provided important clues about mechanisms regulating biomineralization in pearl oyster. PMID:25099698

A nonradioactive assay for poly(a)-specific ribonuclease activity by methylene blue colorimetry.

PubMed

Cheng, Yuan; Liu, Wei-Feng; Yan, Yong-Bin; Zhou, Hai-Meng

2006-01-01

A simple nonradioactive assay, which was based on the specific shift of the absorbance maximum of methylene blue induced by its intercalation into poly(A) molecules, was developed for poly(A)-specific ribonuclease (PARN). A good linear relationship was found between the absorbance at 662 nm and the poly(A) concentration. The assay conditions, including the concentration of methylene blue, the incubation temperature and time, and the poly(A) concentration were evaluated and optimized.

SerpinE2, a poor biomarker of endometrial cancer, promotes the proliferation and mobility of EC cells.

PubMed

Shen, Yuan; Wang, Xiaoyu; Xu, Jianping; Lu, Lin

2017-07-04

The SerpinE2 pathway is evolutionarily conserved and plays an important role in tumorigenesis. SerpinE2 (a small ubiquitin-related modifier), like ubiquitin, conjugates SerpinE2 proteins onto lysine residues of target proteins. SerpinE2 over-expression has been found in several tumors. Here, we detected the level of SerpinE2 in 72 samples of EC tissue using immunohistochemistry to assess the role of SerpinE2 in EC prognosis. Meanwhile, we knocked down SerpinE2 by siRNA in the HTB-111 and Ishikawa EC cell lines and analyzed the viability and mobility change using an MTT assay, an annexin V/PI apoptosis assay, a wound scratch test and a transwell assay. A Kaplan-Meier analysis indicated a negative correlation between the level of SerpinE2 and the EC prognosis. Silencing SerpinE2 induced cell apoptosis and reduced the migration ability. Our data suggest SerpinE2 works as an oncogene in EC.

Cost Effective Paper-Based Colorimetric Microfluidic Devices and Mobile Phone Camera Readers for the Classroom

ERIC Educational Resources Information Center

Koesdjojo, Myra T.; Pengpumkiat, Sumate; Wu, Yuanyuan; Boonloed, Anukul; Huynh, Daniel; Remcho, Thomas P.; Remcho, Vincent T.

2015-01-01

We have developed a simple and direct method to fabricate paper-based microfluidic devices that can be used for a wide range of colorimetric assay applications. With these devices, assays can be performed within minutes to allow for quantitative colorimetric analysis by use of a widely accessible iPhone camera and an RGB color reader application…

Increased adenosine triphosphate production by peripheral blood CD4+ cells in patients with hematologic malignancies treated with stem cell mobilization agents.

PubMed

Manga, Kiran; Serban, Geo; Schwartz, Joseph; Slotky, Ronit; Patel, Nita; Fan, Jianshe; Bai, Xiaolin; Chari, Ajai; Savage, David; Suciu-Foca, Nicole; Colovai, Adriana I

2010-07-01

Hematopoietic stem cell (HSC) transplantation is an important therapeutic option for patients with hematologic malignancies. To explore the immunomodulatory effects of HSC mobilization agents, we studied the function and phenotype of CD4(+) T cells from 16 adult patients with hematologic malignancies undergoing HSC mobilization treatment for autologous transplantation. Immune cell function was determined using the Immuknow (Cylex) assay by measuring the amount of adenosine triphosphate (ATP) produced by CD4(+) cells from whole blood. ATP activity measured in G-CSF-treated patients was significantly higher than that measured in healthy individuals or "nonmobilized" patients. In patients treated with G-CSF, CD4(+) T cells were predominantly CD25(low)FOXP3(low), consistent with an activated phenotype. However, T-cell depletion did not abrogate ATP production in blood samples from G-CSF-treated patients, indicating that CD4(+) myeloid cells contributed to the increased ATP levels observed in these patients. There was a significant correlation between ATP activity and patient survival, suggesting that efficient activation of CD4(+) cells during mobilization treatment predicts a low risk of disease relapse. Monitoring immune cell reactivity using the Immuknow assay may assist in the clinical management of patients with hematologic malignancies and optimization of HSC mobilization protocols. Copyright 2010 American Society for Histocompatibility and Immunogenetics. Published by Elsevier Inc. All rights reserved.

Gasoline from coal in the state of Illinois: feasibility study. Volume I. Design. [KBW gasification process, ICI low-pressure methanol process and Mobil M-gasoline process

DOE Office of Scientific and Technical Information (OSTI.GOV)

Not Available

1980-01-01

Volume 1 describes the proposed plant: KBW gasification process, ICI low-pressure methanol process and Mobil M-gasoline process, and also with ancillary processes, such as oxygen plant, shift process, RECTISOL purification process, sulfur recovery equipment and pollution control equipment. Numerous engineering diagrams are included. (LTN)

Short-Term Study Tours as a Driver for Increasing Domestic Student Mobility in Order to Generate Global Work-Ready Students and Cultural Exchange in Asia Pacific

ERIC Educational Resources Information Center

Scharoun, Lisa

2016-01-01

Recent federal government programmes in Australia have seen a shift in focus from the international student towards increasing the possibilities for domestic mobility through short- and long-term exchange opportunities. The current New Colombo Plan funding scheme encourages Australian students, who have traditionally undertaken semester-long…

A Multi-Case Study of Research Using Mobile Imaging, Sensing and Tracking Technologies to Objectively Measure Behavior: Ethical Issues and Insights to Guide Responsible Research Practice

ERIC Educational Resources Information Center

Nebeker, Camille; Linares-Orozco, Rubi; Crist, Katie

2015-01-01

Introduction: The increased availability of mobile sensing technologies is creating a paradigm shift for health research by creating new opportunities for measuring and monitoring behavior. For example, researchers can now collect objective information about a participant's daily activity using wearable devices that have: 1- Global Positioning…

Use of Mobile Clinical Decision Support Software by Junior Doctors at a UK Teaching Hospital: Identification and Evaluation of Barriers to Engagement.

PubMed

Patel, Rakesh; Green, William; Shahzad, Muhammad Waseem; Larkin, Chris

2015-08-13

Clinical decision support (CDS) tools improve clinical diagnostic decision making and patient safety. The availability of CDS to health care professionals has grown in line with the increased prevalence of apps and smart mobile devices. Despite these benefits, patients may have safety concerns about the use of mobile devices around medical equipment. This research explored the engagement of junior doctors (JDs) with CDS and the perceptions of patients about their use. There were three objectives for this research: (1) to measure the actual usage of CDS tools on mobile devices (mCDS) by JDs, (2) to explore the perceptions of JDs about the drivers and barriers to using mCDS, and (3) to explore the perceptions of patients about the use of mCDS. This study used a mixed-methods approach to study the engagement of JDs with CDS accessed through mobile devices. Usage data were collected on the number of interactions by JDs with mCDS. The perceived drivers and barriers for JDs to using CDS were then explored by interviews. Finally, these findings were contrasted with the perception of patients about the use of mCDS by JDs. Nine of the 16 JDs made a total of 142 recorded interactions with the mCDS over a 4-month period. Only 27 of the 114 interactions (24%) that could be categorized as on-shift or off-shift occurred on-shift. Eight individual, institutional, and cultural barriers to engagement emerged from interviews with the user group. In contrast to reported cautions and concerns about the impact of clinicians' use of mobile phone on patient health and safety, patients had positive perceptions about the use of mCDS. Patients reported positive perceptions toward mCDS. The usage of mCDS to support clinical decision making was considered to be positive as part of everyday clinical practice. The degree of engagement was found to be limited due to a number of individual, institutional, and cultural barriers. The majority of mCDS engagement occurred outside of the workplace. Further research is required to verify these findings and assess their implications for future policy and practice.

The evolving potential of companion diagnostics.

PubMed

Khoury, Joseph D

2016-01-01

The scope of companion diagnostics in cancer has undergone significant shifts in the past few years, with increased development of targeted therapies and novel testing platforms. This has provided new opportunities to effect unprecedented paradigm shifts in the application of personalized medicine principles for patients with cancer. These shifts involve assay platforms, analytes, regulations, and therapeutic approaches. As opportunities involving each of these facets of companion diagnostics expand, close collaborations between key stakeholders should be enhanced to ensure optimal performance characteristics and patient outcomes.

Modulation and coding for fast fading mobile satellite communication channels

NASA Technical Reports Server (NTRS)

Mclane, P. J.; Wittke, P. H.; Smith, W. S.; Lee, A.; Ho, P. K. M.; Loo, C.

1988-01-01

The performance of Gaussian baseband filtered minimum shift keying (GMSK) using differential detection in fast Rician fading, with a novel treatment of the inherent intersymbol interference (ISI) leading to an exact solution is discussed. Trellis-coded differentially coded phase shift keying (DPSK) with a convolutional interleaver is considered. The channel is the Rician Channel with the line-of-sight component subject to a lognormal transformation.

SINE Retrotransposition: Evaluation of Alu Activity and Recovery of De Novo Inserts.

PubMed

Ade, Catherine; Roy-Engel, Astrid M

2016-01-01

Mobile element activity is of great interest due to its impact on genomes. However, the types of mobile elements that inhabit any given genome are remarkably varied. Among the different varieties of mobile elements, the Short Interspersed Elements (SINEs) populate many genomes, including many mammalian species. Although SINEs are parasites of Long Interspersed Elements (LINEs), SINEs have been highly successful in both the primate and rodent genomes. When comparing copy numbers in mammals, SINEs have been vastly more successful than other nonautonomous elements, such as the retropseudogenes and SVA. Interestingly, in the human genome the copy number of Alu (a primate SINE) outnumbers LINE-1 (L1) copies 2 to 1. Estimates suggest that the retrotransposition rate for Alu is tenfold higher than LINE-1 with about 1 insert in every twenty births. Furthermore, Alu-induced mutagenesis is responsible for the majority of the documented instances of human retroelement insertion-induced disease. However, little is known on what contributes to these observed differences between SINEs and LINEs. The development of an assay to monitor SINE retrotransposition in culture has become an important tool for the elucidation of some of these differences. In this chapter, we present details of the SINE retrotransposition assay and the recovery of de novo inserts. We also focus on the nuances that are unique to the SINE assay.

A method for modelling peak signal statistics on a mobile satellite transponder

NASA Technical Reports Server (NTRS)

Bilodeau, Andre; Lecours, Michel; Pelletier, Marcel; Delisle, Gilles Y.

1990-01-01

A simulation method is proposed. The simulation was developed to model the peak duration and energy content of signal peaks in a mobile communication satellite operating in a Frequency Division Multiple Access (FDMA) mode and presents an estimate of those power peaks for a system where the channels are modeled as band limited Gaussian noise, which is taken as a reasonable representation for Amplitude Commanded Single Sideband (ACSSB), Minimum Shift Keying (MSK), or Phase Shift Keying (PSK) modulated signals. The simulation results show that, under this hypothesis, the level of the signal power peaks for 10 percent, 1 percent, and 0.1 percent of the time are well described by a Rayleigh law and that their duration is extremely short and inversely proportional to the total FDM system bandwidth.

Exposure to 3G mobile phone signals does not affect the biological features of brain tumor cells.

PubMed

Liu, Yu-xiao; Li, Guo-qing; Fu, Xiang-ping; Xue, Jing-hui; Ji, Shou-ping; Zhang, Zhi-wen; Zhang, Yi; Li, An-ming

2015-08-08

The increase in mobile phone use has generated concerns about possible risks to human health, especially the development of brain tumors. Whether tumor patients should continue to use mobile telephones has remained unclear because of a paucity of information. Herein, we investigated whether electromagnetic fields from mobile phones could alter the biological features of human tumor cells and act as a tumor-promoting agent. Human glioblastoma cell lines, U251-MG and U87-MG, were exposed to 1950-MHz time division-synchronous code division multiple access (TD-SCDMA) at a specific absorption rate (maximum SAR = 5.0 W/kg) for 12, 24, and 48 h. Cell morphologies and ultra-structures were observed by microscopy and the rates of apoptosis and cell cycle progression were monitored by flow cytometry. Additionally, cell growth was determined using the CKK-8 assay, and the expression levels of tumor and apoptosis-related genes and proteins were analyzed by real-time PCR and western blotting, respectively. Tumor formation and invasiveness were measured using a tumorigenicity assay in vivo and migration assays in vitro. No significant differences in either biological features or tumor formation ability were observed between unexposed and exposed glioblastoma cells. Our data showed that exposure to 1950-MHz TD-SCDMA electromagnetic fields for up to 48 h did not act as a cytotoxic or tumor-promoting agent to affect the proliferation or gene expression profile of glioblastoma cells. Our findings implied that exposing brain tumor cells in vitro for up to 48 h to 1950-MHz continuous TD-SCDMA electromagnetic fields did not elicit a general cell stress response.

Role of IKK-alpha in the EGFR Signaling Regulation

DTIC Science & Technology

2014-09-01

Rho family GTPase (VAV2), and Phospholipase C (PLC) (4). These signaling activities regulate cell proliferation, mobility , and differentiation in...correlation coefficient r=0.63, pɘ.05) was found, suggesting that high IKK promotes EGFR phosphorylation in breast cancer cells (Fig. 3G ...phosphorylation (Figure 2E). Since protein phosphorylation sometimes results in a mobility shift in SDS-PAGE, we used a phospho-tag to capture phospho

Federated Ground Station Network Model and Interface Specification

DTIC Science & Technology

2014-12-01

interface definition language JSON JavaScript Object Notation LEO low Earth orbit LNA low-noise amplifier MC3 Mobile CubeSat Command and Control...Naval Research Laboratory OQPSK offset quadrature phase-shift keying xviii P2P peer-to-peer PKI public key infrastructure REST Representational...enhanced our work being performed on the Mobile CubeSat Command and Control (MC3) ground station network. You also provided crucial guidance from

A cost-effective assay for antioxidant using simple cotton thread combining paper based device with mobile phone detection.

PubMed

Sateanchok, Suphasinee; Wangkarn, Sunanta; Saenjum, Chalermpong; Grudpan, Kate

2018-01-15

A cost-effective assay for antioxidant using simple cotton thread combining paper based device with mobile phone detection has been investigated. Standard and sample solutions flow along a bunch of cotton thread treated with sodium hydroxide via microfluidic behaviors without external pumping. The analyte solution reacts with the reagents that have been immobilized on the paper strip fixed at the end of the cotton bunch. The developed platforms were used for the assays of total phenolic content and antioxidant capacity by employing Folin-Ciocalteu and 2, 2-diphenyl-1-picryhydrazyl (DPPH) respectively. Simple detection can be made by employing a mobile phone camera (iPhone 4S) with Image J or Photoshop for image processing and evaluation. Gallic acid was used as a reference standard in this work, as its polyphenol structures can be found in many plants. The total phenolic content is expressed as gallic acid equivalents (GAE) (mg/g material). Inhibition capacity is calculated by the equation: % I = [(I o - I s )/ I o ] × 100, where I s is the relative magenta intensity (CMYK mode) of sample, and I o the relative magenta intensity of DPPH•. IC 50 inhibition can be estimated from the graph and can be used for the antioxidant capacity consideration. Applications to the assay green tea samples were demonstrated. The total phenolic contents in the green tea samples were found to be 48-105mg/g, with %RSD of less than 10 for that of higher 50 GAE mg/g and IC 50 values of the samples studied were 25-50mg/L. The results obtained by the developed methods agree with that of the standard methods. Copyright © 2017 Elsevier B.V. All rights reserved.

Use of the heteroduplex mobility assay and cell sorting to select genome sequences of the CCR5 gene in HEK 293T cells edited by transcription activator-like effector nucleases.

PubMed

Nerys-Junior, Arildo; Costa, Lendel C; Braga-Dias, Luciene P; Oliveira, Márcia; Rossi, Atila D; da Cunha, Rodrigo Delvecchio; Gonçalves, Gabriel S; Tanuri, Amilcar

2014-03-01

Engineered nucleases such as zinc finger nucleases (ZFN) and transcription activator-like effector nucleases (TALEN) are one of the most promising tools for modifying genomes. These site-specific enzymes cause double-strand breaks that allow gene disruption or gene insertion, thereby facilitating genetic manipulation. The major problem associated with this approach is the labor-intensive procedures required to screen and confirm the cellular modification by nucleases. In this work, we produced a TALEN that targets the human CCR5 gene and developed a heteroduplex mobility assay for HEK 293T cells to select positive colonies for sequencing. This approach provides a useful tool for the quick detection and easy assessment of nuclease activity.

Development and validation of a liquid chromatography-tandem mass spectrometry method for the determination of pyridostigmine bromide from guinea pig plasma.

PubMed

Needham, Shane R; Ye, Binying; Smith, J Richard; Korte, William D

2003-11-05

An HPLC/MS/MS method was validated for the low level analysis of pyridostigmine bromide (PB) from guinea pig plasma. An advantage of this strong-cation exchange HPLC/MS/MS method was the enhancement of the ESI-MS signal by providing good retention and good peak shape of PB with a mobile phase of 70% acetonitrile. In addition, the use of 70% acetonitrile in the mobile phase allowed the direct injection of the supernant from the protein precipitated extracted sample. The assay was linear from the range of 0.1 to 50 ng/ml using only 25 microl of sample. The precision and accuracy of the assay was better than 9.1 and 113%, respectively.

Recombinase Polymerase Amplification Assay for Rapid Diagnostics of Dengue Infection

PubMed Central

Abd El Wahed, Ahmed; Patel, Pranav; Faye, Oumar; Thaloengsok, Sasikanya; Heidenreich, Doris; Matangkasombut, Ponpan; Manopwisedjaroen, Khajohnpong; Sakuntabhai, Anavaj; Sall, Amadou A.; Hufert, Frank T.; Weidmann, Manfred

2015-01-01

Background Over 2.5 billion people are exposed to the risk of contracting dengue fever (DF). Early diagnosis of DF helps to diminish its burden on public health. Real-time reverse transcription polymerase amplification assays (RT-PCR) are the standard method for molecular detection of the dengue virus (DENV). Real-time RT-PCR analysis is not suitable for on-site screening since mobile devices are large, expensive, and complex. In this study, two RT-recombinase polymerase amplification (RT-RPA) assays were developed to detect DENV1-4. Methodology/Principal Findings Using two quantitative RNA molecular standards, the analytical sensitivity of a RT-RPA targeting the 3´non-translated region of DENV1-4 was found to range from 14 (DENV4) to 241 (DENV1-3) RNA molecules detected. The assay was specific and did not cross detect other Flaviviruses. The RT-RPA assay was tested in a mobile laboratory combining magnetic-bead based total nucleic acid extraction and a portable detection device in Kedougou (Senegal) and in Bangkok (Thailand). In Kedougou, the RT-RPA was operated at an ambient temperature of 38°C with auxiliary electricity tapped from a motor vehicle and yielded a clinical sensitivity and specificity of 98% (n=31) and 100% (n=23), respectively. While in the field trial in Bangkok, the clinical sensitivity and specificity were 72% (n=90) and 100%(n=41), respectively. Conclusions/Significance During the first 5 days of infection, the developed DENV1-4 RT-RPA assays constitute a suitable accurate and rapid assay for DENV diagnosis. Moreover, the use of a portable fluorescence-reading device broadens its application potential to the point-of-care for outbreak investigations. PMID:26075598

"MXing it up": how African adolescents may affect social change through mobile phone use.

PubMed

Napolitano, Christopher M

2010-01-01

This chapter outlines mobile phone use among African (particularly South African) adolescents. With an estimated 350 million active mobile phone subscriptions, improving network infrastructure, low-cost Internet-ready handsets, innovative programs and applications, mobiles in Africa, and their increasingly younger, increasingly poorer, and increasingly savvy users have the potential to act as conduits for local and regional socially just change. This broad-based connectedness not only provides access to information, but also, and crucially, connects individuals and their social, intellectual, and financial capital. It may represent a powerful, transformative shift in a region where access to similar technologies was historically limited to a privileged few. In order to best leverage these developments and opportunities to promote socially just change, I argue that future mobile-based programs or initiatives in the region should be based in both contemporary developmental systems theory as well as current, popular mobile applications and services.

Identification of the cAMP response element that controls transcriptional activation of the insulin-like growth factor-I gene by prostaglandin E2 in osteoblasts

NASA Technical Reports Server (NTRS)

Thomas, M. J.; Umayahara, Y.; Shu, H.; Centrella, M.; Rotwein, P.; McCarthy, T. L.

1996-01-01

Insulin-like growth factor-I (IGF-I), a multifunctional growth factor, plays a key role in skeletal growth and can enhance bone cell replication and differentiation. We previously showed that prostaglandin E2 (PGE2) and other agents that increase cAMP activated IGF-I gene transcription in primary rat osteoblast cultures through promoter 1 (P1), the major IGF-I promoter, and found that transcriptional induction was mediated by protein kinase A. We now have identified a short segment of P1 that is essential for full hormonal regulation and have characterized inducible DNA-protein interactions involving this site. Transient transfections of IGF-I P1 reporter genes into primary rat osteoblasts showed that the 328-base pair untranslated region of exon 1 was required for a full 5.3-fold response to PGE2; mutation in a previously footprinted site, HS3D (base pairs +193 to +215), reduced induction by 65%. PGE2 stimulated nuclear protein binding to HS3D. Binding, as determined by gel mobility shift assay, was not seen in nuclear extracts from untreated osteoblast cultures, was detected within 2 h of PGE2 treatment, and was maximal by 4 h. This DNA-protein interaction was not observed in cytoplasmic extracts from PGE2-treated cultures, indicating nuclear localization of the protein kinase A-activated factor(s). Activation of this factor was not blocked by cycloheximide (Chx), and Chx did not impair stimulation of IGF-I gene expression by PGE2. In contrast, binding to a consensus cAMP response element (CRE; 5'-TGACGTCA-3') from the rat somatostatin gene was not modulated by PGE2 or Chx. Competition gel mobility shift analysis using mutated DNA probes identified 5'-CGCAATCG-3' as the minimal sequence needed for inducible binding. All modified IGF-I P1 promoterreporter genes with mutations within this CRE sequence also showed a diminished functional response to PGE2. These results identify the CRE within the 5'-untranslated region of IGF-I exon 1 that is required for hormonal activation of IGF-I gene transcription by cAMP in osteoblasts.

State of the cart.

PubMed

Bernstein, C; Weiss, S; Lorenzini, B

1994-03-15

Food on wheels: it's here, there and everywhere. But while some operations rev up cart expansion plans, others have shifted into low gear. Here's an update on that '90s phenomenon: mobile merchandising.

Photographic measurement of head and cervical posture when viewing mobile phone: a pilot study.

PubMed

Guan, Xiaofei; Fan, Guoxin; Wu, Xinbo; Zeng, Ying; Su, Hang; Gu, Guangfei; Zhou, Qi; Gu, Xin; Zhang, Hailong; He, Shisheng

2015-12-01

With the dramatic growth of mobile phone usage, concerns have been raised with regard to the adverse health effects of mobile phone on spinal posture. The aim of this study was to determine the head and cervical postures by photogrammetry when viewing the mobile phone screen, compared with those in neutral standing posture. A total of 186 subjects (81 females and 105 males) aged from 17 to 31 years old participated in this study. Subjects were instructed to stand neutrally and using mobile phone as in daily life. Using a photographic method, the sagittal head and cervical postures were assessed by head tilt angle, neck tilt angle, forward head shift and gaze angle. The photographic method showed a high intra-rater and inter-rater reliability in measuring the sagittal posture of cervical spine and gaze angle (ICCs ranged from 0.80 to 0.99). When looking at mobile phone, the head tilt angle significantly increased (from 74.55° to 95.22°, p = 0.000) and the neck angle decreased (from 54.68° to 38.77°, p = 0.000). The forward head posture was also confirmed by the significantly increased head shift (from 10.90 to 13.85 cm, p = 0.000). The posture assumed in mobile phone use was significantly correlated with neutral posture (p < 0.05). Males displayed a more forward head posture than females (p < 0.05). The head tilt angle was positively correlated with the gaze angle (r = 0.616, p = 0.000), while the neck tilt angle was negatively correlated with the gaze angle (r = -0.628, p = 0.000). Photogrammetry is a reliable, quantitative method to evaluate the head and cervical posture during mobile phone use. Compared to neutral standing, subjects display a more forward head posture when viewing the mobile phone screen, which is correlated with neutral posture, gaze angle and gender. Future studies will be needed to investigate a dose-response relationship between mobile phone use and assumed posture.

Social Properties of Mobile Video

NASA Astrophysics Data System (ADS)

Mitchell, April Slayden; O'Hara, Kenton; Vorbau, Alex

Mobile video is now an everyday possibility with a wide array of commercially available devices, services, and content. These new technologies have created dramatic shifts in the way video-based media can be produced, consumed, and delivered by people beyond the familiar behaviors associated with fixed TV and video technologies. Such technology revolutions change the way users behave and change their expectations in regards to their mobile video experiences. Building upon earlier studies of mobile video, this paper reports on a study using diary techniques and ethnographic interviews to better understand how people are using commercially available mobile video technologies in their everyday lives. Drawing on reported episodes of mobile video behavior, the study identifies the social motivations and values underpinning these behaviors that help characterize mobile video consumption beyond the simplistic notion of viewing video only to kill time. This paper also discusses the significance of user-generated content and the usage of video in social communities through the description of two mobile video technology services that allow users to create and share content. Implications for adoption and design of mobile video technologies and services are discussed as well.

Using Eye Tracking to Explore Consumers' Visual Behavior According to Their Shopping Motivation in Mobile Environments.

PubMed

Hwang, Yoon Min; Lee, Kun Chang

2017-07-01

Despite a strong shift to mobile shopping trends, many in-depth questions about mobile shoppers' visual behaviors in mobile shopping environments remain unaddressed. This study aims to answer two challenging research questions (RQs): (a) how much does shopping motivation like goal orientation and recreation influence mobile shoppers' visual behavior toward displays of shopping information on a mobile shopping screen and (b) how much of mobile shoppers' visual behavior influences their purchase intention for the products displayed on a mobile shopping screen? An eye-tracking approach is adopted to answer the RQs empirically. The experimental results showed that goal-oriented shoppers paid closer attention to products' information areas to meet their shopping goals. Their purchase intention was positively influenced by their visual attention to the two areas of interest such as product information and consumer opinions. In contrast, recreational shoppers tended to visually fixate on the promotion area, which positively influences their purchase intention. The results contribute to understanding mobile shoppers' visual behaviors and shopping intentions from the perspective of mindset theory.

Protein-ligand interactions investigated by thermal shift assays (TSA) and dual polarization interferometry (DPI).

PubMed

Grøftehauge, Morten K; Hajizadeh, Nelly R; Swann, Marcus J; Pohl, Ehmke

2015-01-01

Over the last decades, a wide range of biophysical techniques investigating protein-ligand interactions have become indispensable tools to complement high-resolution crystal structure determinations. Current approaches in solution range from high-throughput-capable methods such as thermal shift assays (TSA) to highly accurate techniques including microscale thermophoresis (MST) and isothermal titration calorimetry (ITC) that can provide a full thermodynamic description of binding events. Surface-based methods such as surface plasmon resonance (SPR) and dual polarization interferometry (DPI) allow real-time measurements and can provide kinetic parameters as well as binding constants. DPI provides additional spatial information about the binding event. Here, an account is presented of new developments and recent applications of TSA and DPI connected to crystallography.

Protein–ligand interactions investigated by thermal shift assays (TSA) and dual polarization interferometry (DPI)

PubMed Central

Grøftehauge, Morten K.; Hajizadeh, Nelly R.; Swann, Marcus J.; Pohl, Ehmke

2015-01-01

Over the last decades, a wide range of biophysical techniques investigating protein–ligand interactions have become indispensable tools to complement high-resolution crystal structure determinations. Current approaches in solution range from high-throughput-capable methods such as thermal shift assays (TSA) to highly accurate techniques including microscale thermophoresis (MST) and isothermal titration calorimetry (ITC) that can provide a full thermodynamic description of binding events. Surface-based methods such as surface plasmon resonance (SPR) and dual polarization interferometry (DPI) allow real-time measurements and can provide kinetic parameters as well as binding constants. DPI provides additional spatial information about the binding event. Here, an account is presented of new developments and recent applications of TSA and DPI connected to crystallography. PMID:25615858

From Multilingualism to Bilingualism: Changes in Language Use, Language Value, and Social Mobility among Engdewu Speakers in the Solomon Islands

ERIC Educational Resources Information Center

Emerine Hicks, Rachel

2017-01-01

On the island of Santa Cruz in the Solomon Islands, the Engdewu language is facing imminent language shift because of the increasing use of the lingua franca Solomon Islands Pijin in the community. In this article, I argue that this language shift is occurring because of changes to the social structure in Baemawz, one of the villages where Engdewu…

Dose related shifts in the developmental progress of chick embryos exposed to mobile phone induced electromagnetic fields.

PubMed

Zareen, Nusrat; Khan, Muhammad Yunus; Minhas, Liaqat Ali

2009-01-01

The possible adverse effects of Electromagnetic Fields (EMFs) emitted from mobile phones present a major public concern today. Some studies indicate EMFs effects on genes, free radical production, immunological and carcinogenic effects. On the other hand there are studies which do not support the hypothesis of any biological impacts of EMFs. This study was designed to observe the effects of mobile phone induced EMFs on survival and general growth and development of chick embryo, investigating dose-response relationship if any. This was an experimental study in which developing chick embryos were exposed to different doses of mobile phone induced EMFs. For this purpose a mobile phone was placed in the incubator in the centre of fertilised eggs in silent ringing mode and was 'rung' upon from any other line or cell phone. After incubation for 10 or 15 days the eggs were opened and the developmental mile-stones of the surviving embryos were compared with the non exposed subgroup. EMFs exposure significantly decreased the survivability of the chick embryos. The lower doses of EMFs caused growth retardation. However, this effect of growth retardation reallocated to partial growth enhancement on increasing the dose of EMFs and shifted over to definite growth enhancement on further raising the dose. There is an adverse effect of EMFs exposure on embryo survivability. Chick embryos developmental process is influenced by EMFs. However, these effects are variable depending upon the dose of EMFs exposure.

Analysis of energy states where electrons and holes coexist in pseudomorphically strained InAs high-electron-mobility transistors

NASA Astrophysics Data System (ADS)

Nishio, Yui; Sato, Takato; Hirayama, Naomi; Iida, Tsutomu; Takanashi, Yoshifumi

2016-04-01

In strained high-electron-mobility transistors (HEMTs) with InAs as the channel, excess electrons and holes are generated in the drain region by impact ionization. In the source region, electrons are injected to recombine with accumulated holes by the Auger process. This causes the shift of the gate potential, V GS,shift, for HEMTs. For a system where electrons and holes coexist, we established a theory taking into account the nonparabolicity of the conduction band in the InAs channel. This theory enables us to rigorously determine not only the energy states and the concentration profiles for both carriers but also the V GS,shift due to an accumulation of holes. We have derived the Auger recombination theory which takes into account the Fermi-Dirac statistics and is applicable to an arbitrary shape of potential energy. The Auger recombination lifetime τA for InAs-PHEMTs was estimated as a function of the sheet hole concentration, p s, and τA was on the order of psec for p s exceeding 1012 cm-2.

Assay of fluoxetine hydrochloride by titrimetric and HPLC methods.

PubMed

Bueno, F; Bergold, A M; Fröehlich, P E

2000-01-01

Two alternative methods were proposed to assay Fluoxetine Hydrochloride: a titrimetric method and another by HPLC using as mobile phase water pH 3.5: acetonitrile (65:35). These methods were applied to the determination of Fluoxetine as such or in formulations (capsules). The titrimetric method is an alternative for pharmacies and small industries. Both methods showed accuracy and precision and are an alternative to the official methods.

Plant-originated glycoprotein (24 kDa) has an inhibitory effect on proliferation of BNL CL.2 cells in response to di(2-ethylhexyl)phthalate.

PubMed

Lee, Jin; Lim, Kye-Taek

2011-08-01

Di(2-ethylhexyl)phthalate (DEHP) is one of the many environmental chemicals that are widely used in polyvinyl chloride products, vinyl flooring, food packaging and infant toys. They cause cell proliferation or dysfunction of human liver. The purpose of this study is to investigate the inhibitory effect of a glycoprotein (24 kDa) isolated from Zanthoxylum piperitum DC (ZPDC) on proliferation of liver cell in the DEHP-induced BNL CL. 2 cells. [³H]-thymidine incorporation, intracellular reactive oxygen species (ROS), intracellular Ca²⁺ mobilization and activity of protein kinase C (PKC) were measured using radioactivity and fluorescence method respectively. The expression of mitogen-activated protein kinases [extracellular signal-regulated kinase (ERK) and c-Jun N-terminal kinase (JNK)], activator protein (AP)-1 (c-Jun and c-Fos), proliferating cell nuclear antigen (PCNA) and cell cycle-related factors (cyclin D1/cyclin-dependent kinase [CDK] 4) were evaluated using Western blotting or electrophoretic mobility shift assay. The results in this study showed that the levels of [³H]-thymidine incorporation, intracellular ROS, intracellular Ca²⁺ mobilization and activity of PKCα were inhibited by ZPDC glycoprotein (100 µg/ml) in the DEHP-induced BNL CL. 2 cells. Also, activities of ERK, JNK and AP-1 were reduced by ZPDC glycoprotein (100 µg/ml). With regard to cell proliferation, activities of PCNA and cyclin D1/CDK4 were significantly suppressed at treatment with ZPDC glycoprotein (100 µg/ml) in the presence of DEHP. Taken together, these findings suggest that ZPDC glycoprotein significantly normalized activities of PCNA and cyclin D1/CDK4, which relate to cell proliferation factors. Thus, ZPDC glycoprotein appears to be one of the compounds derived from natural products that are able to inhibit cell proliferation in the phthalate-induced BNL CL. 2 cells. Copyright © 2011 John Wiley & Sons, Ltd.

Curcumin Regulates Low-Linear Energy Transfer {gamma}-Radiation-Induced NF{kappa}B-Dependent Telomerase Activity in Human Neuroblastoma Cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Aravindan, Natarajan, E-mail: naravind@ouhsc.ed; Veeraraghavan, Jamunarani; Madhusoodhanan, Rakhesh

2011-03-15

Purpose: We recently reported that curcumin attenuates ionizing radiation (IR)-induced survival signaling and proliferation in human neuroblastoma cells. Also, in the endothelial system, we have demonstrated that NF{kappa}B regulates IR-induced telomerase activity (TA). Accordingly, we investigated the effect of curcumin in inhibiting IR-induced NF{kappa}B-dependent hTERT transcription, TA, and cell survival in neuroblastoma cells. Methods and Materials: SK-N-MC or SH-SY5Y cells exposed to IR and treated with curcumin (10-100 nM) with or without IR were harvested after 1 h through 24 h. NF{kappa}B-dependent regulation was investigated either by luciferase reporter assays using pNF{kappa}B-, pGL3-354-, pGL3-347-, or pUSE-I{kappa}B{alpha}-Luc, p50/p65, or RelA siRNA-transfectedmore » cells. NF{kappa}B activity was analyzed using an electrophoretic mobility shift assay and hTERT expression using the quantitative polymerase chain reaction. TA was determined using the telomerase repeat amplification protocol assay and cell survival using the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltertrazolium bromide and clonogenic assay. Results: Curcumin profoundly inhibited IR-induced NF{kappa}B. Consequently, curcumin significantly inhibited IR-induced TA and hTERT mRNA at all points investigated. Furthermore, IR-induced TA is regulated at the transcriptional level by triggering telomerase reverse transcriptase (TERT) promoter activation. Moreover, NF{kappa}B becomes functionally activated after IR and mediates TA upregulation by binding to the {kappa}B-binding region in the promoter region of the TERT gene. Consistently, elimination of the NF{kappa}B-recognition site on the telomerase promoter or inhibition of NF{kappa}B by the I{kappa}B{alpha} mutant compromises IR-induced telomerase promoter activation. Significantly, curcumin inhibited IR-induced TERT transcription. Consequently, curcumin inhibited hTERT mRNA and TA in NF{kappa}B overexpressed cells. Furthermore, curcumin enhanced the IR-induced inhibition of cell survival. Conclusions: These results strongly suggest that curcumin inhibits IR-induced TA in an NF{kappa}B dependent manner in human neuroblastoma cells.« less

Temperature-induced band shift in bulk γ-InSe by angle-resolved photoemission spectroscopy

NASA Astrophysics Data System (ADS)

Xu, Huanfeng; Wang, Wei; Zhao, Yafei; Zhang, Xiaoqian; Feng, Yue; Tu, Jian; Gu, Chenyi; Sun, Yizhe; Liu, Chang; Nie, Yuefeng; Edmond Turcu, Ion C.; Xu, Yongbing; He, Liang

2018-05-01

Indium selenide (InSe) has recently become popular research topics because of its unique layered crystal structure, direct band gap and high electron mobilities. In this work, we have acquired the electronic structure of bulk γ-InSe at various temperatures using angle-resolved photoemission spectroscopy (ARPES). We have also found that as the temperature decreases, the valence bands of γ-InSe exhibit a monotonic shift to lower binding energies. This band shift is attributed to the change of lattice parameters and has been validated by variable temperature X-ray diffraction measurements and theoretical calculations.

Long non-coding RNA HOTAIR, a c-Myc activated driver of malignancy, negatively regulates miRNA-130a in gallbladder cancer

PubMed Central

2014-01-01

Background Protein coding genes account for only about 2% of the human genome, whereas the vast majority of transcripts are non-coding RNAs including long non-coding RNAs. A growing volume of literature has proposed that lncRNAs are important players in cancer. HOTAIR was previously shown to be an oncogene and negative prognostic factor in a variety of cancers. However, the factors that contribute to its upregulation and the interaction between HOTAIR and miRNAs are largely unknown. Methods A computational screen of HOTAIR promoter was conducted to search for transcription-factor-binding sites. HOTAIR promoter activities were examined by luciferase reporter assay. The function of the c-Myc binding site in the HOTAIR promoter region was tested by a promoter assay with nucleotide substitutions in the putative E-box. The association of c-Myc with the HOTAIR promoter in vivo was confirmed by chromatin immunoprecipitation assay and Electrophoretic mobility shift assay. A search for miRNAs with complementary base paring with HOTAIR was performed utilizing online software program. Gain and loss of function approaches were employed to investigate the expression changes of HOTAIR or miRNA-130a. The expression levels of HOTAIR, c-Myc and miRNA-130a were examined in 65 matched pairs of gallbladder cancer tissues. The effects of HOTAIR and miRNA-130a on gallbladder cancer cell invasion and proliferation was tested using in vitro cell invasion and flow cytometric assays. Results We demonstrate that HOTAIR is a direct target of c-Myc through interaction with putative c-Myc target response element (RE) in the upstream region of HOTAIR in gallbladder cancer cells. A positive correlation between c-Myc and HOTAIR mRNA levels was observed in gallbladder cancer tissues. We predicted that HOTAIR harbors a miRNA-130a binding site. Our data showed that this binding site is vital for the regulation of miRNA-130a by HOTAIR. Moreover, a negative correlation between HOTAIR and miRNA-130a was observed in gallbladder cancer tissues. Finally, we demonstrate that the oncogenic activity of HOTAIR is in part through its negative regulation of miRNA-130a. Conclusion Together, these results suggest that HOTAIR is a c-Myc-activated driver of malignancy, which acts in part through repression of miRNA-130a. PMID:24953832

Infrared Sensor System for Mobile-Robot Positioning in Intelligent Spaces

PubMed Central

Gorostiza, Ernesto Martín; Galilea, José Luis Lázaro; Meca, Franciso Javier Meca; Monzú, David Salido; Zapata, Felipe Espinosa; Puerto, Luis Pallarés

2011-01-01

The aim of this work was to position a Mobile Robot in an Intelligent Space, and this paper presents a sensorial system for measuring differential phase-shifts in a sinusoidally modulated infrared signal transmitted from the robot. Differential distances were obtained from these phase-shifts, and the position of the robot was estimated by hyperbolic trilateration. Due to the extremely severe trade-off between SNR, angle (coverage) and real-time response, a very accurate design and device selection was required to achieve good precision with wide coverage and acceptable robot speed. An I/Q demodulator was used to measure phases with one-stage synchronous demodulation to DC. A complete set of results from real measurements, both for distance and position estimations, is provided to demonstrate the validity of the system proposed, comparing it with other similar indoor positioning systems. PMID:22163907

The natural furanone (5Z)-4-bromo-5-(bromomethylene)-3-butyl-2(5H)-furanone disrupts quorum sensing-regulated gene expression in Vibrio harveyi by decreasing the DNA-binding activity of the transcriptional regulator protein luxR.

PubMed

Defoirdt, Tom; Miyamoto, Carol M; Wood, Thomas K; Meighen, Edward A; Sorgeloos, Patrick; Verstraete, Willy; Bossier, Peter

2007-10-01

This study aimed at getting a deeper insight in the molecular mechanism by which the natural furanone (5Z)-4-bromo-5-(bromomethylene)-3-butyl-2(5H)-furanone disrupts quorum sensing in Vibrio harveyi. Bioluminescence experiments with signal molecule receptor double mutants revealed that the furanone blocks all three channels of the V. harveyi quorum sensing system. In further experiments using mutants with mutations in the quorum sensing signal transduction pathway, the compound was found to block quorum sensing-regulated bioluminescence by interacting with a component located downstream of the Hfq protein. Furthermore, reverse transcriptase real-time polymerase chain reaction with specific primers showed that there was no effect of the furanone on luxR(Vh) mRNA levels in wild-type V. harveyi cells. In contrast, mobility shift assays showed that in the presence of the furanone, significantly lower levels of the LuxR(Vh) response regulator protein were able to bind to its target promoter sequences in wild-type V. harveyi. Finally, tests with purified LuxR(Vh) protein also showed less shifts with furanone-treated LuxR(Vh), whereas the LuxR(Vh) concentration was found not to be altered by the furanone (as determined by SDS-PAGE). Therefore, our data indicate that the furanone blocks quorum sensing in V. harveyi by rendering the quorum sensing master regulator protein LuxR(Vh) unable to bind to the promoter sequences of quorum sensing-regulated genes.

The effect of chemical carcinogenesis on rat glutathione S-transferase P1 gene transcriptional regulation.

PubMed

Liu, D; Liao, M; Zuo, J; Henner, W D; Fan, F

2001-03-01

To investigate mechanisms of rat glutathione S-transferase P1 gene (rGSTP1) expression regulation during chemical carcinogenesis. we studied enhancer elements located in the region between -2.5 kb to -2.2 kb. The region was upstream from the start site of transcription and was divided into two major fragments, GPEI and GPEII. The GPEII fragment was further divided into two smaller fragments, GPEII- I and GPEII-2. Using a luciferase reporter system, we identified a strong enhancer of GPEI and a weak enhancer of GPEII in HeLa and a rat hepatoma cell line CBRH79 19 cell. The enhancer of GPEII was located within the GPEII-I region. Chemical stimulation by glycidyl methatylate (GMA) and phorbol 12-o-tetradecanoate 13-acetate (TPA) analysis revealed that induction of rGSTP1 expression was mainly through GPEI. Although H2O2 could enhance GPEII enhancer activity, the enhancement is not mediated by the NF-kappaB factor that bound the NF-kappaB site in GPEII. Using electrophoretic mobility shift assays (EMSA) and the UV cross-linking assays, we found that HeLa and CBRH7919 cells had proteins that specifically bound GPEI core sequence and a 64 kDa protein that interacted with GPEII-1. The cells from normal rat liver did not express the binding proteins. Therefore, the trans-acting factors seem to be closely related to GPEI, GPEII enhancer activities and may play an important role in high expression of rGSTPI gene.

Aesculin inhibits matrix metalloproteinase-9 expression via p38 mitogen activated protein kinase and activator protein 1 in lipopolysachride-induced RAW264.7 cells.

PubMed

Choi, Hee-Jung; Chung, Tae-Wook; Kim, Jai-Eun; Jeong, Han-Sol; Joo, Myungsoo; Cha, Jaeho; Kim, Cheorl-Ho; Ha, Ki-Tae

2012-11-01

Expression of matrix metalloproteinase 9 (MMP-9) may contribute to inflammatory conditions such as arthritis, hepatitis, atherosclerosis, and pulmonary fibrosis, which involves the destruction of the extracellular matrix (ECM). Macrophages stimulated with lipopolysaccharide (LPS) express MMP-9 through the nuclear factor-kappa B (NF-κB) and activator protein 1 (AP-1) signaling pathways. Aesculin, a 6,7-dihydroxycoumarin-6-O-beta-glucopyranoside, has been highlighted for its anti-hepatotoxic, hypouricemic, antioxidative, photo-protective, and anti-apoptotic properties. In this study, we investigated the effects of aesculin on LPS-stimulated MMP-9 production and its regulatory mechanism by using murine macrophage RAW264.7 cells. Aesculin did not trigger any significant cytotoxic effect on RAW264.7 cells at concentration up to 150 μM. Secretion and expression levels of MMP-9, which were highly elevated by LPS treatment, were reduced by the addition of aesculin in a dose-dependent manner. However, gelatinolytic activity of MMP-9 was not reduced by aesculin. Luciferase activity assays and electrophoretic mobility shift assays using RAW264.7 cells showed that the inhibition of MMP-9 expression by aesculin was mediated by AP-1 rather than NF-κB. In addition, aesculin inhibited phosphorylation of p38 MAPK and subsequent activation of c-fos, a component of AP-1 transcription factor, but not JNK, ERK1/2, and c-jun. These findings suggest that aesculin is a potent drug candidate that protects against the inflammatory destruction of ECM. Copyright © 2012 Elsevier B.V. All rights reserved.

An oilseed rape WRKY-type transcription factor regulates ROS accumulation and leaf senescence in Nicotiana benthamiana and Arabidopsis through modulating transcription of RbohD and RbohF.

PubMed

Yang, Liu; Ye, Chaofei; Zhao, Yuting; Cheng, Xiaolin; Wang, Yiqiao; Jiang, Yuan-Qing; Yang, Bo

2018-06-01

Overexpression of BnaWGR1 causes ROS accumulation and promotes leaf senescence. BnaWGR1 binds to promoters of RbohD and RbohF and regulates their expression. Manipulation of leaf senescence process affects agricultural traits of crop plants, including biomass, seed yield and stress resistance. Since delayed leaf senescence usually enhances tolerance to multiple stresses, we analyzed the function of specific MAPK-WRKY cascades in abiotic and biotic stress tolerance as well as leaf senescence in oilseed rape (Brassica napus L.), one of the important oil crops. In the present study, we showed that expression of one WRKY gene from oilseed rape, BnaWGR1, induced an accumulation of reactive oxygen species (ROS), cell death and precocious leaf senescence both in Nicotiana benthamiana and transgenic Arabidopsis (Arabidopsis thaliana). BnaWGR1 regulates the transcription of two genes encoding key enzymes implicated in production of ROS, that is, respiratory burst oxidase homolog (Rboh) D and RbohF. A dual-luciferase reporter assay confirmed the transcriptional regulation of RbohD and RbohF by BnaWGR1. In vitro electrophoresis mobility shift assay (EMSA) showed that BnaWGR1 could bind to W-box cis-elements within promoters of RbohD and RbohF. Moreover, RbohD and RbohF were significantly upregulated in transgenic Arabidopsis overexpressing BnaWGR1. In summary, these results suggest that BnaWGR1 could positively regulate leaf senescence through regulating the expression of RbohD and RbohF genes.

Runx2- and histone deacetylase 3-mediated repression is relieved in differentiating human osteoblast cells to allow high bone sialoprotein expression.

PubMed

Lamour, Virginie; Detry, Cédric; Sanchez, Christelle; Henrotin, Yves; Castronovo, Vincent; Bellahcène, Akeila

2007-12-14

Bone sialoprotein (BSP) is a bone matrix glycoprotein whose expression coincides with terminal osteoblastic differentiation and the onset of mineralization. In this study we show that BSP expression is considerably increased in confluent Saos-2 human osteosarcoma cells and in differentiating normal human osteoblasts, concomitantly with the decrease of Runx2, a key transcription factor controlling bone formation. Therefore, we investigated the role of Runx2 in the regulation of BSP expression in Saos-2 cells. Using a mobility shift assay, we demonstrated that Runx2 binds to the BSP promoter only in preconfluent cells. Histone deacetylase 3 (HDAC3) has been recently shown to act as a Runx2 co-repressor. Chromatin immunoprecipitation assays demonstrated that both Runx2 and HDAC3 are detectable at the BSP promoter in preconfluent Saos-2 cells but not when they are confluent and overexpress BSP. Consistently, nuclear Runx2 protein level is down-regulated, whereas Saos-2 cells became increasingly confluent. Finally, the suppression of HDAC3, Runx2, or both by RNA interference induced the expression of BSP at both mRNA and protein levels in Saos-2 cells. Our data demonstrate that Runx2 and HDAC3 repress BSP gene expression and that this repression is suspended upon osteoblastic cell differentiation. Both the nuclear disappearance of Runx2 and the non-recruitment of HDAC3 represent new means to relieve Runx2-mediated suppression of BSP expression, thus allowing the acquisition of a fully differentiated and mineralization-competent phenotype by osteoblast cells.

Seasonal Abscisic Acid Signal and a Basic Leucine Zipper Transcription Factor, DkbZIP5, Regulate Proanthocyanidin Biosynthesis in Persimmon Fruit1[C][W][OA

PubMed Central

Akagi, Takashi; Katayama-Ikegami, Ayako; Kobayashi, Shozo; Sato, Akihiko; Kono, Atsushi; Yonemori, Keizo

2012-01-01

Proanthocyanidins (PAs) are secondary metabolites that contribute to plant protection and crop quality. Persimmon (Diospyros kaki) has a unique characteristic of accumulating large amounts of PAs, particularly in its fruit. Normal astringent-type and mutant nonastringent-type fruits show different PA accumulation patterns depending on the seasonal expression patterns of DkMyb4, which is a Myb transcription factor (TF) regulating many PA pathway genes in persimmon. In this study, attempts were made to identify the factors involved in DkMyb4 expression and the resultant PA accumulation in persimmon fruit. Treatment with abscisic acid (ABA) and an ABA biosynthesis inhibitor resulted in differential changes in the expression patterns of DkMyb4 and PA biosynthesis in astringent-type and nonastringent-type fruits depending on the development stage. To obtain an ABA-signaling TF, we isolated a full-length basic leucine zipper (bZIP) TF, DkbZIP5, which is highly expressed in persimmon fruit. We also showed that ectopic DkbZIP5 overexpression in persimmon calluses induced the up-regulation of DkMyb4 and the resultant PA biosynthesis. In addition, a detailed molecular characterization using the electrophoretic mobility shift assay and transient reporter assay indicated that DkbZIP5 recognized ABA-responsive elements in the promoter region of DkMyb4 and acted as a direct regulator of DkMyb4 in an ABA-dependent manner. These results suggest that ABA signals may be involved in PA biosynthesis in persimmon fruit via DkMyb4 activation by DkbZIP5. PMID:22190340

Processing of the 5'-UTR and existence of protein factors that regulate translation of tobacco chloroplast psbN mRNA.

PubMed

Kuroda, Hiroshi; Sugiura, Masahiro

2014-12-01

The chloroplast psbB operon includes five genes encoding photosystem II and cytochrome b 6 /f complex components. The psbN gene is located on the opposite strand. PsbN is localized in the thylakoid and is present even in the dark, although its level increases upon illumination and then decreases. However, the translation mechanism of the psbN mRNA remains unclear. Using an in vitro translation system from tobacco chloroplasts and a green fluorescent protein as a reporter protein, we show that translation occurs from a tobacco primary psbN 5'-UTR of 47 nucleotides (nt). Unlike many other chloroplast 5'-UTRs, the psbN 5'-UTR has two processing sites, at -39 and -24 upstream from the initiation site. Processing at -39 enhanced the translation rate fivefold. In contrast, processing at -24 did not affect the translation rate. These observations suggest that the two distinct processing events regulate, at least in part, the level of PsbN during development. The psbN 5'-UTR has no Shine-Dalgarno (SD)-like sequence. In vitro translation assays with excess amounts of the psbN 5'-UTR or with deleted psbN 5'-UTR sequences demonstrated that protein factors are required for translation and that their binding site is an 18 nt sequence in the 5'-UTR. Mobility shift assays using 10 other chloroplast 5'-UTRs suggested that common or similar proteins are involved in translation of a set of mRNAs lacking SD-like sequences.

A Naturally Occurring Mutation K220T in the Pleiotropic Activator PrfA of Listeria Monocytogenes Results in a Loss of Virulence Due to Decreasing DNA-Binding Affinity

DOE Office of Scientific and Technical Information (OSTI.GOV)

Velge,P.; Herler, M.; Johansson, J.

2007-01-01

The sequencing of prfA, encoding the transcriptional regulator of virulence genes, in 26 low-virulence field Listeria monocytogenes strains showed that eight strains exhibited the same single amino-acid substitution: PrfAK220T. These strains exhibited no expression of PrfA-regulated proteins and thus no virulence. This substitution inactivated PrfA, since expression of the PrfAK220T mutant gene in an EGD{Delta}prfA strain did not restore the haemolytic and phosphatidylcholine phospholipase C activities, in contrast to the wild-type prfA gene. The substitution of the lysine at position 220 occurred in the helix H. However, the data showed that the PrfAK220T protein is dimerized just as well asmore » its wild-type counterpart, but does not bind to PrfA-boxes. PrfAK220T did not form a PrfA-DNA complex in electrophoretic mobility shift assays, but low concentrations of CI complexes (PrfAK220T-RNA polymerase-DNA complex) were formed by adding RNA polymerase, suggesting that PrfA interacted with RNA polymerase in solution in the absence of DNA. Formation of some transcriptionally active complexes was confirmed by in vitro runoff transcription assays and quantitative RT-PCR. Crystallographic analyses described the structure of native PrfA and highlighted the key role of allosteric changes in the activity of PrfA and especially the role of the Lys220 in the conformation of the helix-turn-helix (HTH) motif.« less

KLF15 promotes transcription of KLF3 gene in bovine adipocytes.

PubMed

Guo, Hongfang; Khan, Rajwali; Raza, Sayed Haidar Abbas; Ning, Yue; Wei, Dawei; Wu, Sen; Hosseini, Seyed Mahdi; Ullah, Irfan; Garcia, Matthew D; Zan, Linsen

2018-06-15

The Krüppel-like factors (KLF) family plays an important role in adipogenesis, which is subject to internal hierarchical regulation. KLF3 is a member of KLF family, mainly responsible for adipocyte differentiation and fat deposition. However, the transcriptional regulation of bovine KLF3 gene and its relationship with KLF15 gene remains unclear during bovine adipogenesis. Here, we report that the expression pattern of KLF3 and KLF15 genes during bovine adipogenesis, when KLF15 gene was overexpressed through adenoviral vector (Ad-KLF15) in bovine adipocytes the expression level of KLF3 gene was increased, similarly when KLF15 was down regulated through siRNA the expression level of KLF3 was also reduced. To explore the transcriptional regulation of bovine KLF3 gene and its relationship with KLF15, serial deletion constructs of the 5'flanking region of bovine KLF3gene revealed through dual-luciferase reporter assay that the core promoter is located in -264 to -76 regions. The most proximal GGGG element in the promoter of the bovine KLF3 gene (located in -264 to -76 regions) is required for promotion by KLF15. Electrophoretic mobility shift (EMSA) and chromatin immunoprecipitation (ChIP) assays further confirmed that KLF15 gene binds to the KLF3 gene core promoter region in bovine adipocytes. These findings conclude that KLF15 promotes the transcriptional activity of KLF3 in bovine adipocytes. This mechanism to provides a new direction for further study of adipogenesis by internal regulation of members within KLF family. Copyright © 2018 Elsevier B.V. All rights reserved.

Cytotoxic effect of disulfiram/copper on human glioblastoma cell lines and ALDH-positive cancer-stem-like cells

PubMed Central

Liu, P; Brown, S; Goktug, T; Channathodiyil, P; Kannappan, V; Hugnot, J-P; Guichet, P-O; Bian, X; Armesilla, A L; Darling, J L; Wang, W

2012-01-01

Background: Glioblastoma multiforme (GBM) cells are resistant to anticancer drugs. Cancer stem cells (CSCs) are a key mediator of chemoresistance. We have reported that disulfiram (DS), an aldehyde dehydrogenase (ALDH) inhibitor, targets breast CSC-like cells. In this study, the effect of DS and combination of DS and gemcitabine (dFdC) on GBM cells and GBM stem-like cells was investigated. Methods: 1-(4,5-Dimethylthiazol-2-yl)-3,5-diphenylformazan (MTT), combination index (CI)-isobologram, western blot, luciferase reporter gene assay, electrophoretic mobility-shift assay and ALDH analysis were used in this study. Results: Disulfiram is cytotoxic in GBM cell lines in a copper (Cu)-dependent manner. Disulfiram/copper enhances the cytotoxicity of dFdC. Combination index-isobologram analysis indicates a synergistic effect between DS/Cu and dFdC. Disulfiram/copper induces reactive oxygen species (ROS), activates JNK and p38 pathways and inhibits nuclear factor-kappa B activity in GBM cell lines. Disulfiram/copper may trigger intrinsic apoptotic pathway via modulation of the Bcl2 family. Disulfiram/copper abolishes stem-like cell population in GBM cell lines. Conclusion: Our findings indicate that the cytotoxicity of DS/Cu and the enhancing effect of DS/Cu on the cytotoxicity of dFdC in GBM stem-like cells may be caused by induction of ROS and inhibition of both ALDH and the NFkB pathway. Both DS and dFdC can traverse the blood–brain barrier. Further study may lead them into GBM chemotherapy. PMID:23033007

Smad7 Protein Induces Interferon Regulatory Factor 1-dependent Transcriptional Activation of Caspase 8 to Restore Tumor Necrosis Factor-related Apoptosis-inducing Ligand (TRAIL)-mediated Apoptosis

PubMed Central

Hong, Suntaek; Kim, Hye-Youn; Kim, Jooyoung; Ha, Huyen Trang; Kim, Young-Mi; Bae, Eunjin; Kim, Tae Hyung; Lee, Kang Choon; Kim, Seong-Jin

2013-01-01

Smad7 has been known as a negative regulator for the transforming growth factor-β (TGF-β) signaling pathway through feedback regulation. However, Smad7 has been suspected to have other biological roles through the regulation of gene transcription. By screening differentially regulated genes, we found that the caspase 8 gene was highly up-regulated in Smad7-expressing cells. Smad7 was able to activate the caspase 8 promoter through recruitment of the interferon regulatory factor 1 (IRF1) transcription factor to the interferon-stimulated response element (ISRE) site. Interaction of Smad7 on the caspase 8 promoter was confirmed with electrophoretic mobility shift assay and chromatin immunoprecipitation experiment. Interestingly, Smad7 did not directly interact with the ISRE site, but it increased the binding activity of IRF1 with ISRE. These results support that Smad7 recruits IRF1 protein on the caspase 8 promoter and functions as a transcriptional coactivator. To confirm the biological significance of caspase 8 up-regulation, we tested tumor necrosis factor (TNF)-related apoptosis-inducing ligand (TRAIL)-mediated cell death assay in breast cancer cells. Smad7 in apoptosis-resistant MCF7 cells markedly sensitized the cells to TRAIL-induced cell death by restoring the caspase cascade. Furthermore, restoration of caspase 8-mediated apoptosis pathway repressed the tumor growth in the xenograft model. In conclusion, we suggest a novel role for Smad7 as a transcriptional coactivator for caspase 8 through the interaction with IRF1 in regulation of the cell death pathway. PMID:23255602

A Survey of Detergents for the Purification of Stable, Active Human Cystic Fibrosis Transmembrane Conductance Regulator (CFTR)

PubMed Central

Hildebrandt, Ellen; Zhang, Qinghai; Cant, Natasha; Ding, Haitao; Dai, Qun; Peng, Lingling; Fu, Yu; DeLucas, Lawrence J.; Ford, Robert; Kappes, John C.; Urbatsch, Ina L.

2014-01-01

Structural knowledge of the cystic fibrosis transmembrane conductance regulator (CFTR) requires developing methods to purify and stabilize this aggregation-prone membrane protein above 1 mg/ml. Starting with green fluorescent protein- and epitope-tagged human CFTR produced in mammalian cells known to properly fold and process CFTR, we devised a rapid tandem affinity purification scheme to minimize CFTR exposure to detergent in order to preserve its ATPase function. We compared a panel of detergents, including widely used detergents (maltosides, neopentyl gycols (MNG), C12E8, lysolipids, Chaps) and innovative detergents (branched alkylmaltosides, facial amphiphiles) for CFTR purification, function, monodispersity and stability. ATPase activity after reconstitution into proteoliposomes was 2–3 times higher when CFTR was purified using facial amphiphiles. ATPase activity was also demonstrated in purified CFTR samples without detergent removal using a novel lipid supplementation assay. By electron microscopy, negatively stained CFTR samples were monodisperse at low concentration, and size exclusion chromatography showed a predominance of monomer even after CFTR concentration above 1 mg/ml. Rates of CFTR aggregation quantified in an electrophoretic mobility shift assay showed that detergents which best preserved reconstituted ATPase activity also supported the greatest stability, with CFTR monomer half-lives of 6–9 days in MNG or Chaps, and 12–17 days in facial amphiphile. Cryoelectron microscopy of concentrated CFTR in MNG or facial amphiphile confirmed mostly monomeric protein, producing low resolution reconstructions in conformity with similar proteins. These protocols can be used to generate samples of pure, functional, stable CFTR at concentrations amenable to biophysical characterization. PMID:25065669

An ethylene-responsive enhancer element is involved in the senescence-related expression of the carnation glutathione-S-transferase (GST1) gene.

PubMed

Itzhaki, H; Maxson, J M; Woodson, W R

1994-09-13

The increased production of ethylene during carnation petal senescence regulates the transcription of the GST1 gene encoding a subunit of glutathione-S-transferase. We have investigated the molecular basis for this ethylene-responsive transcription by examining the cis elements and trans-acting factors involved in the expression of the GST1 gene. Transient expression assays following delivery of GST1 5' flanking DNA fused to a beta-glucuronidase receptor gene were used to functionally define sequences responsible for ethylene-responsive expression. Deletion analysis of the 5' flanking sequences of GST1 identified a single positive regulatory element of 197 bp between -667 and -470 necessary for ethylene-responsive expression. The sequences within this ethylene-responsive region were further localized to 126 bp between -596 and -470. The ethylene-responsive element (ERE) within this region conferred ethylene-regulated expression upon a minimal cauliflower mosaic virus-35S TATA-box promoter in an orientation-independent manner. Gel electrophoresis mobility-shift assays and DNase I footprinting were used to identify proteins that bind to sequences within the ERE. Nuclear proteins from carnation petals were shown to specifically interact with the 126-bp ERE and the presence and binding of these proteins were independent of ethylene or petal senescence. DNase I footprinting defined DNA sequences between -510 and -488 within the ERE specifically protected by bound protein. An 8-bp sequence (ATTTCAAA) within the protected region shares significant homology with promoter sequences required for ethylene responsiveness from the tomato fruit-ripening E4 gene.

Rapamycin reverses paraquat-induced acute lung injury in a rat model through inhibition of NFκB activation

PubMed Central

Chen, Da; Ma, Tao; Liu, Xiao-Wei; Yang, Chen; Liu, Zhi

2015-01-01

Objective: To evaluate the role of rapamycin (RAPA) in paraquat (PQ)-induced acute lung injury. Methods: Lung tissues were stained with HE and lung histology was observed. Mortality rate, and neutrophil and leukocyte count in blood and bronchoalveolar lavage fluid (BALF) were recorded. Protein content in BALF was determined by Coomassie blue staining. Malondialdehyde (MDA) content, glutathione peroxidase (GSH-Px) and superoxide dismutase (SOD) activity in blood were determined by thiobarbituric acid (TBA) assay, pyrogallol autoxidation method, and modified Haefman method, respectively. The NF-κB activity was measured by gel electrophoretic mobility shift assay (EMSA). Carbon dioxide partial pressure (PaCO2), partial pressure of oxygen (PaO2) and pH values were measured by automated blood gas analyzer. Results: HE staining results demonstrated RAPA alleviated pathological changes of acute alveolitis in SD rats. Trend of protein content in BALF was PQ group > RAPA treatment group > control group (P < 0.05). Neutrophil and leukocyte count in RAPA treatment group was significantly lower than PQ group at 3, 5, and 7 days after injection (P < 0.05). Trend of MDA content was RAPA treatment group > PQ group > control group (P < 0.05). Trend of GSH-Px and SOD activity was control group > RAPA treatment group > PQ group (P < 0.05). Compared with PQ group, PaO2 in RAPA treatment group was markedly higher and PaCO2 was lower (P < 0.05). Conclusion: PQ-induced acute lung injury was effectively reversed with RAPA, through inhibition of NF-κB activation. PMID:26191153

POU2F2-oriented network promotes human gastric cancer metastasis

PubMed Central

Wang, Si-Meng; Tie, Jun; Wang, Wen-Lan; Hu, Si-Jun; Yin, Ji-Peng; Yi, Xiao-Fang; Tian, Zu-Hong; Zhang, Xiang-Yuan; Li, Meng-Bin; Li, Zeng-Shan; Nie, Yong-Zhan; Wu, Kai-Chun; Fan, Dai-Ming

2016-01-01

Background and aims Aberrant upregulation of POU2F2 expression has been discovered in metastatic gastric cancer (GC). However, the mechanisms underlying the aberrant upregulation and the potential functions of POU2F2 remain uncertain. Design The role and mechanism of POU2F2 in GC metastasis were investigated in gastric epithelial cells, GC cell lines and an experimental metastasis animal model by gain of function and loss of function. Upstream and downstream targets of POU2F2 were selected by bioinformatics and identified by luciferase reporter assay, electrophoretic mobility shift assay and chromatin immunoprecipitation PCR. The influence of miR-218 on its putative target genes (POU2F2, ROBO1 and IKK-β) and GC metastasis was further explored via in vitro and in vivo approaches. Results Increased POU2F2 expression was detected in metastatic GC cell lines and patient samples. POU2F2 was induced by the activation of nuclear factor (NF)-κB and, in turn, regulated ROBO1 transcription, thus functionally contributing to GC metastasis. Finally, miR-218 was found to suppress GC metastasis by simultaneously mediating multiple molecules in the POU2F2-oriented network. Conclusions This study demonstrated that NF-κB and the SLIT2/ROBO1 interaction network with POU2F2 as the central part may exert critical effects on tumour metastasis. Blocking the activation of the POU2F2-oriented metastasis network using miR-218 precursors exemplified a promising approach that sheds light on new strategies for GC treatment. PMID:26019213

Ambient temperature enhanced freezing tolerance of Chrysanthemum dichrum CdICE1 Arabidopsis via miR398.

PubMed

Chen, Yu; Jiang, Jiafu; Song, Aiping; Chen, Sumei; Shan, Hong; Luo, Huolin; Gu, Chunsun; Sun, Jing; Zhu, Lu; Fang, Weimin; Chen, Fadi

2013-12-19

ICE (Inducer of CBF Expression) family genes play an important role in the regulation of cold tolerance pathways. In an earlier study, we isolated the gene CdICE1 from Chrysanthemum dichrum and demonstrated that freezing tolerance was enhanced by CdICE1 overexpression. Therefore, we sought to determine the mechanism by which ICE1 family genes participate in freezing tolerance. Using EMSA (Electrophoretic Mobility Shift Assay) and yeast one-hybrid assays, we confirmed that CdICE1 binds specifically to the MYC element in the CdDREBa promoter and activates transcription. In addition, overexpression of CdICE1 enhanced Arabidopsis freezing tolerance after transition from 23°C to 4°C or 16°C. We found that after acclimation to 4°C, CdICE1, like Arabidopsis AtICE1, promoted expression of CBFs (CRT/DRE Binding Factor) and their genes downstream involved in freezing tolerance, including COR15a (Cold-Regulated 15a), COR6.6, and RD29a (Responsive to Dessication 29a). Interestingly, we observed that CdICE1-overexpressing plants experienced significant reduction in miR398. In addition, its target genes CSD1 (Copper/zinc Superoxide Dismutase 1) and CSD2 showed inducible expression under acclimation at 16°C, indicating that the miR398-CSD pathway was involved in the induction of freezing tolerance. Our data indicate that CdICE1-mediated freezing tolerance occurs via different pathways, involving either CBF or miR398, under acclimation at two different temperatures.

Ambient temperature enhanced freezing tolerance of Chrysanthemum dichrum CdICE1 Arabidopsis via miR398

PubMed Central

2013-01-01

Background ICE (Inducer of CBF Expression) family genes play an important role in the regulation of cold tolerance pathways. In an earlier study, we isolated the gene CdICE1 from Chrysanthemum dichrum and demonstrated that freezing tolerance was enhanced by CdICE1 overexpression. Therefore, we sought to determine the mechanism by which ICE1 family genes participate in freezing tolerance. Results Using EMSA (Electrophoretic Mobility Shift Assay) and yeast one-hybrid assays, we confirmed that CdICE1 binds specifically to the MYC element in the CdDREBa promoter and activates transcription. In addition, overexpression of CdICE1 enhanced Arabidopsis freezing tolerance after transition from 23°C to 4°C or 16°C. We found that after acclimation to 4°C, CdICE1, like Arabidopsis AtICE1, promoted expression of CBFs (CRT/DRE Binding Factor) and their genes downstream involved in freezing tolerance, including COR15a (Cold-Regulated 15a), COR6.6, and RD29a (Responsive to Dessication 29a). Interestingly, we observed that CdICE1-overexpressing plants experienced significant reduction in miR398. In addition, its target genes CSD1 (Copper/zinc Superoxide Dismutase 1) and CSD2 showed inducible expression under acclimation at 16°C, indicating that the miR398-CSD pathway was involved in the induction of freezing tolerance. Conclusions Our data indicate that CdICE1-mediated freezing tolerance occurs via different pathways, involving either CBF or miR398, under acclimation at two different temperatures. PMID:24350981

RAV transcription factors are essential for disease resistance against cassava bacterial blight via activation of melatonin biosynthesis genes.

PubMed

Wei, Yunxie; Chang, Yanli; Zeng, Hongqiu; Liu, Guoyin; He, Chaozu; Shi, Haitao

2018-01-01

With 1 AP2 domain and 1 B3 domain, 7 MeRAVs in apetala2/ethylene response factor (AP2/ERF) gene family have been identified in cassava. However, the in vivo roles of these remain unknown. Gene expression assays showed that the transcripts of MeRAVs were commonly regulated after Xanthomonas axonopodis pv manihotis (Xam) and MeRAVs were specifically located in plant cell nuclei. Through virus-induced gene silencing (VIGS) in cassava, we found that MeRAV1 and MeRAV2 are essential for plant disease resistance against cassava bacterial blight, as shown by the bacterial propagation of Xam in plant leaves. Through VIGS in cassava leaves and overexpression in cassava leave protoplasts, we found that MeRAV1 and MeRAV2 positively regulated melatonin biosynthesis genes and the endogenous melatonin level. Further investigation showed that MeRAV1 and MeRAV2 are direct transcriptional activators of 3 melatonin biosynthesis genes in cassava, as evidenced by chromatin immunoprecipitation-PCR in cassava leaf protoplasts and electrophoretic mobility shift assay. Moreover, cassava melatonin biosynthesis genes also positively regulated plant disease resistance. Taken together, this study identified MeRAV1 and MeRAV2 as common and upstream transcription factors of melatonin synthesis genes in cassava and revealed a model of MeRAV1 and MeRAV2-melatonin biosynthesis genes-melatonin level in plant disease resistance against cassava bacterial blight. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Flavocoxid counteracts muscle necrosis and improves functional properties in mdx mice: a comparison study with methylprednisolone.

PubMed

Messina, Sonia; Bitto, Alessandra; Aguennouz, M'hammed; Mazzeo, Anna; Migliorato, Alba; Polito, Francesca; Irrera, Natasha; Altavilla, Domenica; Vita, Gian Luca; Russo, Massimo; Naro, Antonino; De Pasquale, Maria Grazia; Rizzuto, Emanuele; Musarò, Antonio; Squadrito, Francesco; Vita, Giuseppe

2009-12-01

Muscle degeneration in dystrophic muscle is exacerbated by the endogenous inflammatory response and increased oxidative stress. A key role is played by nuclear factor(NF)-kappaB. We showed that NF-kappaB inhibition through compounds with also antioxidant properties has beneficial effects in mdx mice, the murine model of Duchenne muscular dystrophy (DMD), but these drugs are not available for clinical studies. We evaluated whether flavocoxid, a mixed flavonoid extract with anti-inflammatory, antioxidant and NF-kappaB inhibiting properties, has beneficial effects in mdx mice in comparison with methylprednisolone, the gold standard treatment for DMD patients. Five-week-old mdx mice were treated for 5 weeks with flavocoxid, methylprednisolone or vehicle. The evaluation of in vivo and ex vivo functional properties and morphological parameters was performed. Serum samples were assayed for oxidative stress markers, creatine-kinase (CK) and leukotriene B-4. Cyclooxygenase-2 (COX-2), 5-lipoxygenase (5-LOX), tumor necrosis factor-alpha, p-38, JNK1 expression was evaluated in muscle by western blot analysis. NF-kappaB binding activity was investigated by electrophoresis mobility shift assay. The administration of flavocoxid: (1) ameliorated functional properties in vivo and ex vivo; (2) reduced CK; (3) reduced the expression of oxidative stress markers and of inflammatory mediators; (4) inhibited NF-kappaB and mitogen-activated protein kinases (MAPKs) signal pathways; (5) reduced muscle necrosis and enhanced regeneration. Our results highlight the detrimental effects of oxidative stress and NF-kappaB, MAPKs and COX/5-LOX pathways in the dystrophic process and show that flavocoxid is more effective in mdx mice than methylprednisolone.

Control of Transcriptional Repression of the Vitellogenin Receptor Gene in Largemouth Bass (Micropterus Salmoides) by Select Estrogen Receptors Isotypes

PubMed Central

Dominguez, Gustavo A.; Bisesi, Joseph H.; Kroll, Kevin J.; Denslow, Nancy D.; Sabo-Attwood, Tara

2014-01-01

The vitellogenin receptor (Vtgr) plays an important role in fish reproduction. This receptor functions to incorporate vitellogenin (Vtg), a macromolecule synthesized and released from the liver in the bloodstream, into oocytes where it is processed into yolk. Although studies have focused on the functional role of Vtgr in fish, the mechanistic control of this gene is still unexplored. Here we report the identification and analysis of the first piscine 5′ regulatory region of the vtgr gene which was cloned from largemouth bass (Micropterus salmoides). Using this putative promoter sequence, we investigated a role for hormones, including insulin and 17β-estradiol (E2), in transcriptional regulation through cell-based reporter assays. No effect of insulin was observed, however, E2 was able to repress transcriptional activity of the vtgr promoter through select estrogen receptor subtypes, Esr1 and Esr2a but not Esr2b. Electrophoretic mobility shift assay demonstrated that Esr1 likely interacts with the vtgr promoter region through half ERE and/or SP1 sites, in part. Finally we also show that ethinylestradiol (EE2), but not bisphenol-A (BPA), represses promoter activity similarly to E2. These results reveal for the first time that the Esr1 isoform may play an inhibitory role in the expression of LMB vtgr mRNA under the influence of E2, and potent estrogens such as EE2. In addition, this new evidence suggests that vtgr may be a target of select endocrine disrupting compounds through environmental exposures. PMID:25061109

The Arabidopsis PLAT domain protein1 is critically involved in abiotic stress tolerance.

PubMed

Hyun, Tae Kyung; van der Graaff, Eric; Albacete, Alfonso; Eom, Seung Hee; Großkinsky, Dominik K; Böhm, Hannah; Janschek, Ursula; Rim, Yeonggil; Ali, Walid Wahid; Kim, Soo Young; Roitsch, Thomas

2014-01-01

Despite the completion of the Arabidopsis genome sequence, for only a relatively low percentage of the encoded proteins experimental evidence concerning their function is available. Plant proteins that harbour a single PLAT (Polycystin, Lipoxygenase, Alpha-toxin and Triacylglycerol lipase) domain and belong to the PLAT-plant-stress protein family are ubiquitously present in monocot and dicots. However, the function of PLAT-plant-stress proteins is still poorly understood. Therefore, we have assessed the function of the uncharacterised Arabidopsis PLAT-plant-stress family members through a combination of functional genetic and physiological approaches. PLAT1 overexpression conferred increased abiotic stress tolerance, including cold, drought and salt stress, while loss-of-function resulted in opposite effects on abiotic stress tolerance. Strikingly, PLAT1 promoted growth under non-stressed conditions. Abiotic stress treatments induced PLAT1 expression and caused expansion of its expression domain. The ABF/ABRE transcription factors, which are positive mediators of abscisic acid signalling, activate PLAT1 promoter activity in transactivation assays and directly bind to the ABRE elements located in this promoter in electrophoretic mobility shift assays. This suggests that PLAT1 represents a novel downstream target of the abscisic acid signalling pathway. Thus, we showed that PLAT1 critically functions as positive regulator of abiotic stress tolerance, but also is involved in regulating plant growth, and thereby assigned a function to this previously uncharacterised PLAT domain protein. The functional data obtained for PLAT1 support that PLAT-plant-stress proteins in general could be promising targets for improving abiotic stress tolerance without yield penalty.

Molecular interactions of orthologues of floral homeotic proteins from the gymnosperm Gnetum gnemon provide a clue to the evolutionary origin of 'floral quartets'.

PubMed

Wang, Yong-Qiang; Melzer, Rainer; Theissen, Günter

2010-10-01

Several lines of evidence suggest that the identity of floral organs in angiosperms is specified by multimeric transcription factor complexes composed of MADS-domain proteins. These bind to specific cis-regulatory elements ('CArG-boxes') of their target genes involving DNA-loop formation, thus constituting 'floral quartets'. Gymnosperms, angiosperms' closest relatives, contain orthologues of floral homeotic genes, but when and how the interactions constituting floral quartets were established during evolution has remained unknown. We have comprehensively studied the dimerization and DNA-binding of several classes of MADS-domain proteins from the gymnosperm Gnetum gnemon. Determination of protein-protein and protein-DNA interactions by yeast two-hybrid, in vitro pull-down and electrophoretic mobility shift assays revealed complex patterns of homo- and heterodimerization among orthologues of floral homeotic class B, class C and class E proteins and B(sister) proteins. Using DNase I footprint assays we demonstrate that both orthologues of class B with C proteins, and orthologues of class C proteins alone, but not orthologues of class B proteins alone can loop DNA in floral quartet-like complexes. This is in contrast to class B and class C proteins from angiosperms, which require other factors such as class E floral homeotic proteins to 'glue' them together in multimeric complexes. Our findings suggest that the evolutionary origin of floral quartet formation is based on the interaction of different DNA-bound homodimers, does not depend on class E proteins, and predates the origin of angiosperms. © 2010 The Authors. Journal compilation © 2010 Blackwell Publishing Ltd.

C/EBPβ is a transcriptional key regulator of IL-36α in murine macrophages.

PubMed

Nerlich, Andreas; Ruangkiattikul, Nanthapon; Laarmann, Kristin; Janze, Nina; Dittrich-Breiholz, Oliver; Kracht, Michael; Goethe, Ralph

2015-08-01

Interleukin (IL)-36α - one of the novel members of the IL-1 family of cytokines - is a potent regulator of dendritic and T cells and plays an important role in inflammatory processes like experimental skin inflammation in mice and in mouse models for human psoriasis. Here, we demonstrate that C/EBPβ, a transcription factor required for the selective expression of inflammatory genes, is a key activator of the Il36A gene in murine macrophages. RNAi-mediated suppression of C/EBPβ expression in macrophages (C/EBPβ(low) cells) significantly impaired Il36A gene induction following challenge with LPS. Despite the presence of five predicted C/EBP binding sites, luciferase reporter assays demonstrated that C/EBPβ confers responsiveness to LPS primarily through a half-CRE•C/EBP element in the proximal Il36A promoter. Electrophoretic mobility shift assays showed that C/EBPβ but not CREB proteins interact with this critical half-CRE•C/EBP element. In addition, overexpression of C/EBPβ in C/EBPβ(low) cells enhanced the expression of Il36A whereas CREB-1 had no effect. Finally, chromatin immunoprecipitation confirmed that C/EBPβ but neither CREB-1, ATF-2 nor ATF4 is directly recruited to the proximal promoter region of the Il36A gene. Together, these findings demonstrate an essential role of C/EBPβ in the regulation of the Il36A gene via the proximal half-CRE•C/EBP element in response to inflammatory stimuli. Copyright © 2015 Elsevier B.V. All rights reserved.

Fructose 1-Phosphate Is the Preferred Effector of the Metabolic Regulator Cra of Pseudomonas putida*

PubMed Central

Chavarría, Max; Santiago, César; Platero, Raúl; Krell, Tino; Casasnovas, José M.; de Lorenzo, Víctor

2011-01-01

The catabolite repressor/activator (Cra) protein is a global sensor and regulator of carbon fluxes through the central metabolic pathways of Gram-negative bacteria. To examine the nature of the effector (or effectors) that signal such fluxes to the protein of Pseudomonas putida, the Cra factor of this soil microorganism has been purified and characterized and its three-dimensional structure determined. Analytical ultracentrifugation, gel filtration, and mobility shift assays showed that the effector-free Cra is a dimer that binds an operator DNA sequence in the promoter region of the fruBKA cluster. Furthermore, fructose 1-phosphate (F1P) was found to most efficiently dissociate the Cra-DNA complex. Thermodynamic parameters of the F1P-Cra-DNA interaction calculated by isothermal titration calorimetry revealed that the factor associates tightly to the DNA sequence 5′-TTAAACGTTTCA-3′ (KD = 26.3 ± 3.1 nm) and that F1P binds the protein with an apparent stoichiometry of 1.06 ± 0.06 molecules per Cra monomer and a KD of 209 ± 20 nm. Other possible effectors, like fructose 1,6-bisphosphate, did not display a significant affinity for the regulator under the assay conditions. Moreover, the structure of Cra and its co-crystal with F1P at a 2-Å resolution revealed that F1P fits optimally the geometry of the effector pocket. Our results thus single out F1P as the preferred metabolic effector of the Cra protein of P. putida. PMID:21239488

Transcriptional activity of the homopurine-homopyrimidine repeat of the c-Ki-ras promoter is independent of its H-forming potential.

PubMed Central

Raghu, G; Tevosian, S; Anant, S; Subramanian, K N; George, D L; Mirkin, S M

1994-01-01

The mouse c-Ki-ras protooncogene promoter contains an unusual DNA element consisting of a 27 bp-long homopurine-homopyrimidine mirror repeat (H-motif) adjacent to a d(C-G)5 repeat. We have previously shown that in vitro these repeats may adopt H and Z conformations, respectively, causing nuclease and chemical hypersensitivity. Here we have studied the functional role of these DNA stretches using fine deletion analysis of the promoter and a transient transcription assay in vivo. We found that while the H-motif is responsible for approximately half of the promoter activity in both mouse and human cell lines, the Z-forming sequence exhibits little, if any, such activity. Mutational changes introduced within the homopurine-homopyrimidine stretch showed that its sequence integrity, rather than its H-forming potential, is responsible for its effect on transcription. Electrophoretic mobility shift assays revealed that the putative H-motif tightly binds several nuclear proteins, one of which is likely to be transcription factor Sp1, as determined by competition experiments. Southwestern hybridization studies detected two major proteins specifically binding to the H-motif: a 97 kD protein which presumably corresponds to Sp1 and another protein of 60 kD in human and 64 kD in mouse cells. We conclude that the homopurine-homopyrimidine stretch is required for full transcriptional activity of the c-Ki-ras promoter and at least two distinct factors, Sp1 and an unidentified protein, potentially contribute to the positive effect on transcription. Images PMID:8078760

Transcriptional regulation of the novel monoamine oxidase renalase: Crucial roles of transcription factors Sp1, STAT3, and ZBP89.

PubMed

Sonawane, Parshuram J; Gupta, Vinayak; Sasi, Binu K; Kalyani, Ananthamohan; Natarajan, Bhargavi; Khan, Abrar A; Sahu, Bhavani S; Mahapatra, Nitish R

2014-11-11

Renalase, a novel monoamine oxidase, is emerging as an important regulator of cardiovascular, metabolic, and renal diseases. However, the mechanism of transcriptional regulation of this enzyme remains largely unknown. We undertook a systematic analysis of the renalase gene to identify regulatory promoter elements and transcription factors. Computational analysis coupled with transfection of human renalase promoter/luciferase reporter plasmids (5'-promoter-deletion constructs) into various cell types (HEK-293, IMR32, and HepG2) identified two crucial promoter domains at base pairs -485 to -399 and -252 to -150. Electrophoretic mobility shift assays using renalase promoter oligonucleotides with and without potential binding sites for transcription factors Sp1, STAT3, and ZBP89 displayed formation of specific complexes with HEK-293 nuclear proteins. Consistently, overexpression of Sp1, STAT3, and ZBP89 augmented renalase promoter activity; additionally, siRNA-mediated downregulation of Sp1, STAT3, and ZBP89 reduced the level of endogenous renalase transcription as well as the transfected renalase promoter activity. In addition, chromatin immunoprecipitation assays showed in vivo interactions of these transcription factors with renalase promoter. Interestingly, renalase promoter activity was augmented by nicotine and catecholamines; while Sp1 and STAT3 synergistically activated the nicotine-induced effect, Sp1 appeared to enhance epinephrine-evoked renalase transcription. Moreover, renalase transcript levels in mouse models of human essential hypertension were concomitantly associated with endogenous STAT3 and ZBP89 levels, suggesting crucial roles for these transcription factors in regulating renalase gene expression in cardiovascular pathological conditions.

Mutation of Rice BC12/GDD1, Which Encodes a Kinesin-Like Protein That Binds to a GA Biosynthesis Gene Promoter, Leads to Dwarfism with Impaired Cell Elongation[W][OA

PubMed Central

Li, Juan; Jiang, Jiafu; Qian, Qian; Xu, Yunyuan; Zhang, Cui; Xiao, Jun; Du, Cheng; Luo, Wei; Zou, Guoxing; Chen, Mingluan; Huang, Yunqing; Feng, Yuqi; Cheng, Zhukuan; Yuan, Ming; Chong, Kang

2011-01-01

The kinesins are a family of microtubule-based motor proteins that move directionally along microtubules and are involved in many crucial cellular processes, including cell elongation in plants. Less is known about kinesins directly regulating gene transcription to affect cellular physiological processes. Here, we describe a rice (Oryza sativa) mutant, gibberellin-deficient dwarf1 (gdd1), that has a phenotype of greatly reduced length of root, stems, spikes, and seeds. This reduced length is due to decreased cell elongation and can be rescued by exogenous gibberellic acid (GA3) treatment. GDD1 was cloned by a map-based approach, was expressed constitutively, and was found to encode the kinesin-like protein BRITTLE CULM12 (BC12). Microtubule cosedimentation assays revealed that BC12/GDD1 bound to microtubules in an ATP-dependent manner. Whole-genome microarray analysis revealed the expression of ent-kaurene oxidase (KO2), which encodes an enzyme involved in GA biosynthesis, was downregulated in gdd1. Electrophoretic mobility shift and chromatin immunoprecipitation assays revealed that GDD1 bound to the element ACCAACTTGAA in the KO2 promoter. In addition, GDD1 was shown to have transactivation activity. The level of endogenous GAs was reduced in gdd1, and the reorganization of cortical microtubules was altered. Therefore, BC12/GDD1, a kinesin-like protein with transcription regulation activity, mediates cell elongation by regulating the GA biosynthesis pathway in rice. PMID:21325138

The Arabidopsis PLAT Domain Protein1 Is Critically Involved in Abiotic Stress Tolerance

PubMed Central

Eom, Seung Hee; Großkinsky, Dominik K.; Böhm, Hannah; Janschek, Ursula; Rim, Yeonggil; Ali, Walid Wahid; Kim, Soo Young; Roitsch, Thomas

2014-01-01

Despite the completion of the Arabidopsis genome sequence, for only a relatively low percentage of the encoded proteins experimental evidence concerning their function is available. Plant proteins that harbour a single PLAT (Polycystin, Lipoxygenase, Alpha-toxin and Triacylglycerol lipase) domain and belong to the PLAT-plant-stress protein family are ubiquitously present in monocot and dicots. However, the function of PLAT-plant-stress proteins is still poorly understood. Therefore, we have assessed the function of the uncharacterised Arabidopsis PLAT-plant-stress family members through a combination of functional genetic and physiological approaches. PLAT1 overexpression conferred increased abiotic stress tolerance, including cold, drought and salt stress, while loss-of-function resulted in opposite effects on abiotic stress tolerance. Strikingly, PLAT1 promoted growth under non-stressed conditions. Abiotic stress treatments induced PLAT1 expression and caused expansion of its expression domain. The ABF/ABRE transcription factors, which are positive mediators of abscisic acid signalling, activate PLAT1 promoter activity in transactivation assays and directly bind to the ABRE elements located in this promoter in electrophoretic mobility shift assays. This suggests that PLAT1 represents a novel downstream target of the abscisic acid signalling pathway. Thus, we showed that PLAT1 critically functions as positive regulator of abiotic stress tolerance, but also is involved in regulating plant growth, and thereby assigned a function to this previously uncharacterised PLAT domain protein. The functional data obtained for PLAT1 support that PLAT-plant-stress proteins in general could be promising targets for improving abiotic stress tolerance without yield penalty. PMID:25396746

VraR Binding to the Promoter Region of agr Inhibits Its Function in Vancomycin-Intermediate Staphylococcus aureus (VISA) and Heterogeneous VISA.

PubMed

Dai, Yuanyuan; Chang, Wenjiao; Zhao, Changcheng; Peng, Jing; Xu, Liangfei; Lu, Huaiwei; Zhou, Shusheng; Ma, Xiaoling

2017-05-01

Acquisition of vancomycin resistance in Staphylococcus aureus is often accompanied by a reduction in virulence, but the mechanisms underlying this change remain unclear. The present study was undertaken to investigate this process in a clinical heterogeneous vancomycin-intermediate S. aureus (hVISA) strain, 10827; an hVISA reference strain, Mu3; and a VISA reference strain, Mu50, along with their respective series of vancomycin-induced resistant strains. In these strains, increasing MICs of vancomycin were associated with increased expression of the vancomycin resistance-associated regulator gene ( vraR ) and decreased expression of virulence genes ( hla , hlb , and coa ) and virulence-regulated genes (RNAIII, agrA , and saeR ). These results suggested that VraR might have a direct or indirect effect on virulence in S. aureus In electrophoretic mobility shift assays, VraR did not bind to promoter sequences of hla , hlb , and coa genes, but it did bind to the agr promoter region. In DNase I footprinting assays, VraR protected a 15-nucleotide (nt) sequence in the intergenic region between the agr P2 and P3 promoters. These results indicated that when S. aureus is subject to induction by vancomycin, expression of vraR is upregulated, and VraR binding inhibits the function of the Agr quorum-sensing system, causing reductions in the virulence of VISA/hVISA strains. Our results suggested that VraR in S. aureus is involved not only in the regulation of vancomycin resistance but also in the regulation of virulence. Copyright © 2017 American Society for Microbiology.

Use of the heteroduplex mobility assay and cell sorting to select genome sequences of the CCR5 gene in HEK 293T cells edited by transcription activator-like effector nucleases

PubMed Central

Nerys-Junior, Arildo; Costa, Lendel C.; Braga-Dias, Luciene P.; Oliveira, Márcia; Rossi, Átila D.; da Cunha, Rodrigo Delvecchio; Gonçalves, Gabriel S.; Tanuri, Amilcar

2014-01-01

Engineered nucleases such as zinc finger nucleases (ZFN) and transcription activator-like effector nucleases (TALEN) are one of the most promising tools for modifying genomes. These site-specific enzymes cause double-strand breaks that allow gene disruption or gene insertion, thereby facilitating genetic manipulation. The major problem associated with this approach is the labor-intensive procedures required to screen and confirm the cellular modification by nucleases. In this work, we produced a TALEN that targets the human CCR5 gene and developed a heteroduplex mobility assay for HEK 293T cells to select positive colonies for sequencing. This approach provides a useful tool for the quick detection and easy assessment of nuclease activity. PMID:24688299

Growth Inhibition and Apoptosis Induced by Osthole, A Natural Coumarin, in Hepatocellular Carcinoma

PubMed Central

Zhang, Lurong; Jiang, Guorong; Yao, Fei; He, Yan; Liang, Guoqiang; Zhang, Yinsheng; Hu, Bo; Wu, Yan; Li, Yunsen; Liu, Haiyan

2012-01-01

Background Hepatocellular carcinoma (HCC) is one of the most commonly diagnosed tumors worldwide and is known to be resistant to conventional chemotherapy. New therapeutic strategies are urgently needed for treating HCC. Osthole, a natural coumarin derivative, has been shown to have anti-tumor activity. However, the effects of osthole on HCC have not yet been reported. Methods and Findings HCC cell lines were treated with osthole at various concentrations for 24, 48 and 72 hours. The proliferations of the HCC cells were measured by MTT assays. Cell cycle distribution and apoptosis were determined by flow cytometry. HCC tumor models were established in mice by subcutaneously injection of SMMC-7721 or Hepa1-6 cells and the effect of osthole on tumor growths in vivo and the drug toxicity were studied. NF-κB activity after osthole treatment was determined by electrophoretic mobility shift assays and the expression of caspase-3 was measured by western blotting. The expression levels of other apoptosis-related genes were also determined by real-time PCR (PCR array) assays. Osthole displayed a dose- and time-dependent inhibition of the HCC cell proliferations in vitro. It also induced apoptosis and caused cell accumulation in G2 phase. Osthole could significantly suppress HCC tumor growth in vivo with no toxicity at the dose we used. NF-κB activity was significantly suppressed by osthole at the dose- and time-dependent manner. The cleaved caspase-3 was also increased by osthole treatment. The expression levels of some apoptosis-related genes that belong to TNF ligand family, TNF receptor family, Bcl-2 family, caspase family, TRAF family, death domain family, CIDE domain and death effector domain family and CARD family were all increased with osthole treatment. Conclusion Osthole could significantly inhibit HCC growth in vitro and in vivo through cell cycle arrest and inducing apoptosis by suppressing NF-κB activity and promoting the expressions of apoptosis-related genes. PMID:22662241

3,3'-Diindolylmethane inhibits VEGF expression through the HIF-1α and NF-κB pathways in human retinal pigment epithelial cells under chemical hypoxic conditions.

PubMed

Park, Hongzoo; Lee, Dae-Sung; Yim, Mi-Jin; Choi, Yung Hyun; Park, Saegwang; Seo, Su-Kil; Choi, Jung Sik; Jang, Won Hee; Yea, Sung Su; Park, Won Sun; Lee, Chang-Min; Jung, Won-Kyo; Choi, Il-Whan

2015-07-01

Oxidative stress in the retinal pigment epithelium (RPE) can lead to the pathological causes of age-related macular degeneration (AMD). Hypoxia induces oxidative damage in retinal pigment epithelial cells (RPE cells). In this study, we investigated the capacity of 3,3'-diindolylmethane (DIM) to reduce the expression of vascular endothelial growth factor (VEGF) under hypoxic conditions, as well as the molecular mechanisms involved. Human RPE cells (ARPE-19 cells) were treated with cobalt chloride (CoCl2, 200 µM) and/or DIM (10 and 20 µM). The production of VEGF was measured by enzyme-linked immunosorbent assay. The translocation of hypoxia-inducible factor-1α (HIF-1α) and nuclear factor-κB (NF-κB) was determined by western blot analysis. The binding activity of HIF-1α and NF-κB was analyzed by electrophoretic mobility shift assay. The phosphorylation levels of mitogen-activated protein kinases (MAPKs) were measured by western blot analysis. The levels of mitochondrial reactive oxygen species (ROS) were detected by fluorescence microplate assay. The results revealed that DIM significantly attenuated the CoCl2-induced expression of VEGF in the ARPE-19 cells. The CoCl2-induced translocation and activation of HIF-1α and NF-κB were also attenuated by treatment with DIM. In addition, DIM inhibited the CoCl2-induced activation of p38 MAPK in the ARPE-19 cells. Pre-treatment with YCG063, a mitochondrial ROS inhibitor, led to the downregulation of the CoCl2-induced production of VEGF by suppressing HIF-1α and NF-κB activity. Taken together, the findings of our study demonstrate that DIM inhibits the CoCl2-induced production of VEGF by suppressing mitochondrial ROS production, thus attenuating the activation of HIF-1α and p38 MAPK/NF-κB.

Lead Neurotoxicity on Human Neuroblastoma Cell Line SH-SY5Y is Mediated via Transcription Factor EGR1/Zif268 Induced Disrupted in Scherophernia-1 Activation.

PubMed

You, Yuanyuan; Peng, Bo; Ben, Songbin; Hou, Weijian; Sun, Liguang; Jiang, Wei

2018-07-01

Lead (Pb 2+ ) is a well-known type of neurotoxin and chronic exposure to Pb 2+ induces cognition dysfunction. In this work, the potential role of early growth response gene 1 (EGR1) in the linkage of Pb 2+ exposure and disrupted in scherophernia-1 (DISC1) activity was investigated. Human neuroblastoma cell line SH-SY5Y was subjected to different concentrations of lead acetate (PbAc) to determine the effect of Pb 2+ exposure on the cell viability, apoptosis, and activity of EGR1 and DISC1. Then the expression of EGR1 in SH-SY5Y cells was knocked down with specific siRNA to assess the function of EGR1 in Pb 2+ induced activation of DISC1. The interaction between EGR1 and DISC1 was further validated with dual luciferase assay, Supershift electrophoretic mobility shift assay (EMSA), and chromatin immunoprecipitation (ChIP)-PCR. Administration of PbAc decreased cell viability and induced apoptosis in SH-SY5Y cells in a dose-dependent manner. Additionally, exposure to PbAc also up-regulated expression of EGR1 and DISC1 at all concentrations. Knockdown of EGR1 blocked the effect of PbAc on SH-SY5Y cells, indicating the central role of EGR1 in the function of Pb 2+ on activity of DISC1. Based on the results of dual luciferase assay, Supershift EMSA, and ChIP-PCR, EGR1 mediated the effect of Pb 2+ on DISC1 by directly bound to the promoter region of DISC1 gene. The current study elaborated the mechanism involved in the effect of Pb 2+ exposure on expression of DISC1 for the first time: EGR1 activated by Pb 2+ substitution of zinc triggered the transcription of DISC1 gene by directly binding to its promoter.

Hepatic nuclear factor 3 and nuclear factor 1 regulate 5-aminolevulinate synthase gene expression and are involved in insulin repression.

PubMed

Scassa, María E; Guberman, Alejandra S; Ceruti, Julieta M; Cánepa, Eduardo T

2004-07-02

Although the negative regulation of gene expression by insulin has been widely studied, the transcription factors responsible for the insulin effect are still unknown. The purpose of this work was to explore the molecular mechanisms involved in the insulin repression of the 5-aminolevulinate synthase (ALAS) gene. Deletion analysis of the 5'-regulatory region allowed us to identify an insulin-responsive region located at -459 to -354 bp. This fragment contains a highly homologous insulin-responsive (IRE) sequence. By transient transfection assays, we determined that hepatic nuclear factor 3 (HNF3) and nuclear factor 1 (NF1) are necessary for an appropriate expression of the ALAS gene. Insulin overrides the HNF3beta or HNF3beta plus NF1-mediated stimulation of ALAS transcriptional activity. Electrophoretic mobility shift assay and Southwestern blotting indicate that HNF3 binds to the ALAS promoter. Mutational analysis of this region revealed that IRE disruption abrogates insulin action, whereas mutation of the HNF3 element maintains hormone responsiveness. This dissociation between HNF3 binding and insulin action suggests that HNF3beta is not the sole physiologic mediator of insulin-induced transcriptional repression. Furthermore, Southwestern blotting assay shows that at least two polypeptides other than HNF3beta can bind to ALAS promoter and that this binding is dependent on the integrity of the IRE. We propose a model in which insulin exerts its negative effect through the disturbance of HNF3beta binding or transactivation potential, probably due to specific phosphorylation of this transcription factor by Akt. In this regard, results obtained from transfection experiments using kinase inhibitors support this hypothesis. Due to this event, NF1 would lose accessibility to the promoter. The posttranslational modification of HNF3 would allow the binding of a protein complex that recognizes the core IRE. These results provide a potential mechanism for the insulin-mediated repression of IRE-containing promoters.

Reconstitution of R-spondin:LGR4:ZNRF3 adult stem cell growth factor signaling complexes with recombinant proteins produced in Escherichia coli.

PubMed

Moad, Heather E; Pioszak, Augen A

2013-10-15

R-Spondins are secreted glycoproteins (RSPO1-RSPO4) that have proliferative effects on adult stem cells by potentiating Wnt signaling. RSPO actions are mediated by the leucine-rich repeat (LRR)-containing seven-transmembrane receptors LGR4-LGR6 and the transmembrane E3 ubiquitin ligases ZNRF3 and RNF43. Here, we present a methodology for the bacterial expression and purification of the signaling competent, cysteine-rich Fu1-Fu2 domains of the four human RSPOs, a fragment of the human LGR4 extracellular domain (ECD) containing LRR1-14, and the human ZNRF3 ECD. In a cell-based signaling assay, the nonglycosylated RSPOs enhanced low-dose Wnt3a signaling with potencies comparable to those of mammalian cell-produced RSPOs and RSPO2 and -3 were more potent than RSPO1 and -4. LGR4 LRR1-14 and ZNRF3 ECD inhibited RSPO2-enhanced Wnt3a signaling. The RSPOs bound LGR4 LRR1-14 with nanomolar affinities that decreased in the following order in a time-resolved fluorescence resonance energy transfer (TR-FRET) assay: RSPO4 > RSPO2 > RSPO3 > RSPO1. RSPO-receptor interactions were further characterized with a native gel electrophoretic mobility shift assay, which corroborated the RSPO-LGR4 TR-FRET results and indicated that RSPOs weakly bound ZNRF3 with affinities that decreased in the following order: RSPO2 > RSPO3 > RSPO1. RSPO4:ZNRF3 complexes were not detected. Lastly, ternary RSPO:LGR4:ZNRF3 complexes were detected for RSPO2 and -3. Our results indicate that RSPO and LGR4 N-glycans are dispensable for function, demonstrate RSPO-mediated ternary complex formation, and suggest that the stronger signaling potencies of RSPO2 and -3 result from their strong binding of both receptors. Our unique protein production methodology may provide a cost-effective source of recombinant RSPOs for regenerative medicine applications.

A basic leucine zipper transcription factor, AabZIP1, connects abscisic acid signaling with artemisinin biosynthesis in Artemisia annua.

PubMed

Zhang, Fangyuan; Fu, Xueqing; Lv, Zongyou; Lu, Xu; Shen, Qian; Zhang, Ling; Zhu, Mengmeng; Wang, Guofeng; Sun, Xiaofen; Liao, Zhihua; Tang, Kexuan

2015-01-01

Artemisinin is a sesquiterpenoid especially synthesized in the Chinese herbal plant, Artemisia annua, which is widely used in the treatment of malaria. Artemisinin accumulation can be enhanced by exogenous abscisic acid (ABA) treatment. However, it is not known how ABA signaling regulates artemisinin biosynthesis. A global expression profile and phylogenetic analysis as well as the dual-LUC screening revealed that a basic leucine zipper family transcription factor from A. annua (namely AabZIP1) was involved in ABA signaling to regulate artemisinin biosynthesis. AabZIP1 had a higher expression level in the inflorescences than in other tissues; ABA treatment, drought, and salt stress strongly induced the expression of AabZIP1. Yeast one-hybrid assay and electrophoretic mobility shift assay (EMSA) showed that AabZIP1 bound to the ABA-responsive elements (ABRE) in the promoter regions of the amorpha-4,11-diene synthase (ADS) gene and CYP71AV1, which are two key structural genes of the artemisinin biosynthetic pathway. A mutagenesis assay showed that the C1 domain in the N-terminus of AabZIP1 was important for its transactivation activity. Furthermore, the activation of ADS and CYP71AV1 promoters by AabZIP1 was enhanced by ABA treatment in transient dual-LUC analysis. The AabZIP1 variant with C1 domain deletion lost the ability to activate ADS and CYP71AV1 promoters regardless of ABA treatment. Notably, overexpression of AabZIP1 in A. annua resulted in significantly increased accumulation of artemisinin. Our results indicate that ABA promotes artemisinin biosynthesis, likely through 1 activation of ADS and CYP71AV1 expression by AabZIP in A. annua. Meanwhile, our findings reveal the potential value of AabZIP1 in genetic engineering of artemisinin production. Copyright © 2015 The Author. Published by Elsevier Inc. All rights reserved.

A murine host cell factor required for nicking of the dimer bridge of MVM recognizes two CG nucleotides displaced by 10 basepairs.

PubMed

Liu, Q; Astell, C R

1996-10-01

During replication of the minute virus of mice (MVM) genome, a dimer replicative form (RF) intermediate is resolved into two monomer RF molecules in such a way as to retain a unique sequence within the left hand hairpin terminus of the viral genome. Although the proposed mechanism for resolution of the dimer RF remains uncertain, it likely involves site-specific nicking of the dimer bridge. The RF contains two double-stranded copies of the viral genome joined by the extended 3' hairpin. Minor sequence asymmetries within the 3' hairpin allow the two halves of the dimer bridge to be distinguished. The A half contains the sequence [sequence: see text], whereas the B half contains the sequence [sequence: see text]. Using an in vitro assay, we show that only the B half of the MVM dimer bridge is nicked site-specifically when incubated with crude NS-1 protein (expressed in insect cells) and mouse LA9 cellular extract. When highly purified NS-1, the major nonstructural protein of MVM, is used in this nicking reaction, there is an absolute requirement for the LA9 cellular extract, suggesting a cellular factor (or factors) is (are) required. A series of mutations were created in the putative host factor binding region (HFBR) on the B half of the MVM dimer bridge adjacent to the NS-1 binding site. Nicking assays of these B half mutants showed that two CG motifs displaced by 10 nucleotides are important for nicking. Gel mobility shift assays demonstrated that a host factor(s) can bind to the HFBR of the B half of the dimer bridge and efficient binding depends on the presence of both CG motifs. Competitor DNA containing the wild-type HFBR sequence is able to specifically inhibit nicking of the B half, indicating that the host factor(s) bound to the HFBR is(are) essential for site-specific nicking to occur.

MAX Mutations in Endometrial Cancer: Clinicopathologic Associations and Recurrent MAX p.His28Arg Functional Characterization.

PubMed

Walker, Christopher J; Rush, Craig M; Dama, Paola; O'Hern, Matthew J; Cosgrove, Casey M; Gillespie, Jessica L; Zingarelli, Roman A; Smith, Blair; Stein, Maggie E; Mutch, David G; Shakya, Reena; Chang, Chia-Wen; Selvendiran, Karuppaiyah; Song, Jonathan W; Cohn, David E; Goodfellow, Paul J

2018-05-01

Genomic studies have revealed that multiple genes are mutated at varying frequency in endometrial cancer (EC); however, the relevance of many of these mutations is poorly understood. An EC-specific recurrent mutation in the MAX transcription factor p.His28Arg was recently discovered. We sought to assess the functional consequences of this hotspot mutation and determine its association with cancer-relevant phenotypes. MAX was sequenced in 509 endometrioid ECs, and associations between mutation status and clinicopathologic features were assessed. EC cell lines stably expressing MAXH28R were established and used for functional experiments. DNA binding was examined using electrophoretic mobility shift assays and chromatin immunoprecipitation. Transcriptional profiling was performed with microarrays. Murine flank (six to 11 mice per group) and intraperitoneal tumor models were used for in vivo studies. Vascularity of xenografts was assessed by MECA-32 immunohistochemistry. The paracrine pro-angiogenic nature of MAXH28R-expressing EC cells was tested using microfluidic HUVEC sprouting assays and VEGFA enzyme-linked immunosorbent assays. All statistical tests were two-sided. Twenty-two of 509 tumors harbored mutations in MAX, including 12 tumors with the p.His28Arg mutation. Patients with a MAX mutation had statistically significantly reduced recurrence-free survival (hazard ratio = 4.00, 95% confidence interval = 1.15 to 13.91, P = .03). MAXH28R increased affinity for canonical E-box sequences, and MAXH28R-expressing EC cells dramatically altered transcriptional profiles. MAXH28R-derived xenografts statistically significantly increased vascular area compared with MAXWT and empty vector tumors (P = .003 and P = .008, respectively). MAXH28R-expressing EC cells secreted nearly double the levels of VEGFA compared with MAXWT cells (P = .03, .005, and .005 at 24, 48, and 72 hours, respectively), and conditioned media from MAXH28R cells increased sprouting when applied to HUVECs. These data highlight the importance of MAX mutations in EC and point to increased vascularity as one mechanism contributing to clinical aggressiveness of EC.

Multiple microRNAs function as self-protective modules in acetaminophen-induced hepatotoxicity in humans.

PubMed

Yu, Dianke; Wu, Leihong; Gill, Pritmohinder; Tolleson, William H; Chen, Si; Sun, Jinchun; Knox, Bridgett; Jin, Yaqiong; Xiao, Wenming; Hong, Huixiao; Wang, Yong; Ren, Zhen; Guo, Lei; Mei, Nan; Guo, Yongli; Yang, Xi; Shi, Leming; Chen, Yinting; Zeng, Linjuan; Dreval, Kostiantyn; Tryndyak, Volodymyr; Pogribny, Igor; Fang, Hong; Shi, Tieliu; McCullough, Sandra; Bhattacharyya, Sudeepa; Schnackenberg, Laura; Mattes, William; Beger, Richard D; James, Laura; Tong, Weida; Ning, Baitang

2018-02-01

Acetaminophen (APAP) overdose is the leading cause of acute liver failure. Yet the mechanisms underlying adaptive tolerance toward APAP-induced liver injury are not fully understood. To better understand molecular mechanisms contributing to adaptive tolerance to APAP is an underpinning foundation for APAP-related precision medicine. In the current study, the mRNA and microRNA (miRNA) expression profiles derived from next generation sequencing data for APAP-treated (5 and 10 mM) HepaRG cells and controls were analyzed systematically. Putative miRNAs targeting key dysregulated genes involved in APAP hepatotoxicity were selected using in silico prediction algorithms, un-biased gene ontology, and network analyses. Luciferase reporter assays, RNA electrophoresis mobility shift assays, and miRNA pull-down assays were performed to investigate the role of miRNAs affecting the expression of dysregulated genes. Levels of selected miRNAs were measured in serum samples obtained from children with APAP overdose (58.6-559.4 mg/kg) and from healthy controls. As results, 2758 differentially expressed genes and 47 miRNAs were identified. Four of these miRNAs (hsa-miR-224-5p, hsa-miR-320a, hsa-miR-449a, and hsa-miR-877-5p) suppressed drug metabolizing enzyme (DME) levels involved in APAP-induced liver injury by downregulating HNF1A, HNF4A and NR1I2 expression. Exogenous transfection of these miRNAs into HepaRG cells effectively rescued them from APAP toxicity, as indicated by decreased alanine aminotransferase levels. Importantly, hsa-miR-320a and hsa-miR-877-5p levels were significantly elevated in serum samples obtained from children with APAP overdose compared to health controls. Collectively, these data indicate that hsa-miR-224-5p, hsa-miR-320a, hsa-miR-449a, and hsa-miR-877-5p suppress DME expression involved in APAP-induced hepatotoxicity and they contribute to an adaptive response in hepatocytes.

The gallium complex KP46 exerts strong activity against primary explanted melanoma cells and induces apoptosis in melanoma cell lines

PubMed Central

Valiahdi, Seied Mojtaba; Heffeter, Petra; Jakupec, Michael A.; Marculescu, Rodrig; Berger, Walter; Rappersberger, Klemens; Keppler, Bernhard K.

2012-01-01

The antineoplastic properties of gallium are well documented. Owing to their robust accumulation of gallium, melanoma cells should be amenable to gallium-based anticancer drugs. With the aim of improving the disappointingly low activity of inorganic gallium salts, we have developed the orally bioavailable gallium complex KP46 [tris(8-quinolinolato)gallium(III)] that was already successfully studied in a phase I clinical trial. To assess its therapeutic potential in malignant melanoma, its antiproliferative effects were investigated in series of human cell lines and primary explanted melanoma samples by means of the MTT [3-(4,5-dimethylthiazol-2-yl)-2, 5-diphenyltetrazolium bromide] assay and the Human Tumor Cloning Assay, respectively. When compared with other cell lines, the majority of melanoma cells rank among the KP46-sensitive cell lines (50% inhibitory concentration values: 0.8–3.7 μmol/l). Clinically achievable concentrations of KP46 proved to be highly effective in melanoma cells from primary explants of cutaneous and lymph node metastases. Colony growth was inhibited in 10 of 10 specimens by 5 lmol/l KP46 (corresponding to the steady-state plasma concentration measured earlier in a study patient) and in four of 10 specimens by 0.5 μmol/l KP46. In-vitro potency of KP46 is higher than that of dacarbazine or fotemustine and comparable with that of cisplatin. The effects induced by KP46 in melanoma cell lines involve cell cycle perturbations (S-phase arrest) and apoptosis (activation of caspase-9, PARP [poly(ADP-ribose) polymerase] cleavage, formation of apoptotic bodies). No effects on DNA secondary structure could be observed in an electrophoretic mobility shift assay using double-stranded plasmid DNA. Thus, further studies on the therapeutic applicability of KP46 in malignant melanoma are warranted. PMID:19584767

Domain-specific phosphomimetic mutation allows dissection of different protein kinase C (PKC) isotype-triggered activities of the RNA binding protein HuR.

PubMed

Schulz, Sebastian; Doller, Anke; Pendini, Nicole R; Wilce, Jacqueline A; Pfeilschifter, Josef; Eberhardt, Wolfgang

2013-12-01

The ubiquitous mRNA binding protein human antigen R (HuR) participates in the post-transcriptional regulation of many AU-rich element (ARE)-bearing mRNAs. Previously, by using in vitro kinase assay, we have identified serines (Ser) 158, 221 and 318 as targets of protein kinase C (PKC)-triggered phosphorylation. In this study, we tested whether GFP- or GST-tagged HuR constructs bearing a phosphomimetic Ser (S)-to-Asp (D) substitution at the different PKC target sites, would affect different HuR functions including HuR nucleo-cytoplasmic redistribution and binding to different types of ARE-containing mRNAs. The phosphomimetic GFP-tagged HuR protein bearing a phosphomimetic substitution in the hinge region of HuR (HuR-S221D) showed an increased cytoplasmic abundance when compared to wild-type HuR. Conversely, data from in vitro kinase assay and electrophoretic mobility shift assay (EMSA), implicates that phosphorylation at Ser 221 is not relevant for mRNA binding of HuR. Quantification of in vitro binding affinities of GST-tagged wild-type HuR and corresponding HuR proteins bearing a phosphomimetic substitution in either RRM2 (HuR-S158D) or in RRM3 (HuR-S318D) by microscale thermophoresis (MST) indicates a specific binding of wild-type HuR to type I, II or type III-ARE-oligonucleotides in the high nanomolar range. Interestingly, phosphomimetic mutation at position 158 or 318 had a negative influence on HuR binding to type I- and type II-ARE-mRNAs whereas it significantly enhanced HuR affinity to a type III-ARE substrate. Our data suggest that differential phosphorylation of HuR by PKCs at different HuR domains coordinates subcellular HuR distribution and leads to a preferential binding to U-rich bearing target mRNA. © 2013.

dsRNA binding characterization of full length recombinant wild type and mutants Zaire ebolavirus VP35.

PubMed

Zinzula, Luca; Esposito, Francesca; Pala, Daniela; Tramontano, Enzo

2012-03-01

The Ebola viruses (EBOVs) VP35 protein is a multifunctional major virulence factor involved in EBOVs replication and evasion of the host immune system. EBOV VP35 is an essential component of the viral RNA polymerase, it is a key participant of the nucleocapsid assembly and it inhibits the innate immune response by antagonizing RIG-I like receptors through its dsRNA binding function and, hence, by suppressing the host type I interferon (IFN) production. Insights into the VP35 dsRNA recognition have been recently revealed by structural and functional analysis performed on its C-terminus protein. We report the biochemical characterization of the Zaire ebolavirus (ZEBOV) full-length recombinant VP35 (rVP35)-dsRNA binding function. We established a novel in vitro magnetic dsRNA binding pull down assay, determined the rVP35 optimal dsRNA binding parameters, measured the rVP35 equilibrium dissociation constant for heterologous in vitro transcribed dsRNA of different length and short synthetic dsRNA of 8bp, and validated the assay for compound screening by assessing the inhibitory ability of auryntricarboxylic acid (IC(50) value of 50μg/mL). Furthermore, we compared the dsRNA binding properties of full length wt rVP35 with those of R305A, K309A and R312A rVP35 mutants, which were previously reported to be defective in dsRNA binding-mediated IFN inhibition, showing that the latter have measurably increased K(d) values for dsRNA binding and modified migration patterns in mobility shift assays with respect to wt rVP35. Overall, these results provide the first characterization of the full-length wt and mutants VP35-dsRNA binding functions. Copyright © 2012 Elsevier B.V. All rights reserved.

Arabidopsis miR171-Targeted Scarecrow-Like Proteins Bind to GT cis-Elements and Mediate Gibberellin-Regulated Chlorophyll Biosynthesis under Light Conditions

PubMed Central

Ma, Zhaoxue; Hu, Xupeng; Cai, Wenjuan; Huang, Weihua; Zhou, Xin; Luo, Qian; Yang, Hongquan; Wang, Jiawei; Huang, Jirong

2014-01-01

An extraordinarily precise regulation of chlorophyll biosynthesis is essential for plant growth and development. However, our knowledge on the complex regulatory mechanisms of chlorophyll biosynthesis is very limited. Previous studies have demonstrated that miR171-targeted scarecrow-like proteins (SCL6/22/27) negatively regulate chlorophyll biosynthesis via an unknown mechanism. Here we showed that SCLs inhibit the expression of the key gene encoding protochlorophyllide oxidoreductase (POR) in light-grown plants, but have no significant effect on protochlorophyllide biosynthesis in etiolated seedlings. Histochemical analysis of β-glucuronidase (GUS) activity in transgenic plants expressing pSCL27::rSCL27-GUS revealed that SCL27-GUS accumulates at high levels and suppresses chlorophyll biosynthesis at the leaf basal proliferation region during leaf development. Transient gene expression assays showed that the promoter activity of PORC is indeed regulated by SCL27. Consistently, chromatin immunoprecipitation and quantitative PCR assays showed that SCL27 binds to the promoter region of PORC in vivo. An electrophoretic mobility shift assay revealed that SCL27 is directly interacted with G(A/G)(A/T)AA(A/T)GT cis-elements of the PORC promoter. Furthermore, genetic analysis showed that gibberellin (GA)-regulated chlorophyll biosynthesis is mediated, at least in part, by SCLs. We demonstrated that SCL27 interacts with DELLA proteins in vitro and in vivo by yeast-two-hybrid and coimmunoprecipitation analysis and found that their interaction reduces the binding activity of SCL27 to the PORC promoter. Additionally, we showed that SCL27 activates MIR171 gene expression, forming a feedback regulatory loop. Taken together, our data suggest that the miR171-SCL module is critical for mediating GA-DELLA signaling in the coordinate regulation of chlorophyll biosynthesis and leaf growth in light. PMID:25101599

Chemical Mass Shifts in a Digital Linear Ion Trap as Analytical Identity of o-, m-, and p-Xylene.

PubMed

Sun, Lulu; Xue, Bing; Huang, Zhengxu; Cheng, Ping; Ma, Li; Ding, Li; Zhou, Zhen

2018-07-01

Chemical mass shifts between isomeric ions of o-, m-, and p-xylene were measured using a digital linear ion trap, and the directions and values of the shifts were found to be correlated to the collision cross sections of the isomers. Both forward and reverse scans were used and the chemical shifts for each pair of isomers in scans of opposite directions were in opposite signs. Using different voltage settings (namely the voltage dividing ratio-VDR) of the ion trap allows adding high order field components in the quadrupole field and results in larger chemical mass shifts. The differential chemical mass shift which combined the shifts from forward and reverse scans doubled the amount of chemical shift, e.g., 0.077 Th between o- and p-xylene, enough for identification of the type of isomer without using an additional ion mobility spectrometer. The feature of equal and opposite chemical mass shifts also allowed to null out the chemical mass shift by calculating the mean m/z value between the two opposite scans and remove or reduce the mass error caused by chemical mass shift. Graphical Abstract ᅟ.

Chemical Mass Shifts in a Digital Linear Ion Trap as Analytical Identity of o-, m-, and p-Xylene

NASA Astrophysics Data System (ADS)

Sun, Lulu; Xue, Bing; Huang, Zhengxu; Cheng, Ping; Ma, Li; Ding, Li; Zhou, Zhen

2018-04-01

Chemical mass shifts between isomeric ions of o-, m-, and p-xylene were measured using a digital linear ion trap, and the directions and values of the shifts were found to be correlated to the collision cross sections of the isomers. Both forward and reverse scans were used and the chemical shifts for each pair of isomers in scans of opposite directions were in opposite signs. Using different voltage settings (namely the voltage dividing ratio-VDR) of the ion trap allows adding high order field components in the quadrupole field and results in larger chemical mass shifts. The differential chemical mass shift which combined the shifts from forward and reverse scans doubled the amount of chemical shift, e.g., 0.077 Th between o- and p-xylene, enough for identification of the type of isomer without using an additional ion mobility spectrometer. The feature of equal and opposite chemical mass shifts also allowed to null out the chemical mass shift by calculating the mean m/z value between the two opposite scans and remove or reduce the mass error caused by chemical mass shift. [Figure not available: see fulltext.

Mechanisms of diminished natural killer cell activity in pregnant women and neonates

DOE Office of Scientific and Technical Information (OSTI.GOV)

Baley, J.E.; Schacter, B.Z.

1985-05-01

Because alterations in natural killer (NK) activity in the perinatal period may be important in the maintenance of a healthy pregnancy, the mechanisms by which these alterations are mediated in neonates and in pregnant and postpartum women was examined. NK activity, as measured in a 4-hr /sup 51/Cr-release assay and compared with adult controls, is significantly diminished in all three trimesters of pregnancy and in immediately postpartum women. In postpartum women, NK activity appears to be higher than in pregnant women, although this does not reach statistical significance. Pregnant and postpartum women have normal numbers of large granular lymphocytes andmore » normal target cell binding in an agarose single cell assay but decreased lysis of the bound target cells. NK activity of mononuclear cells from postpartum women, in addition, demonstrate a shift in distribution to higher levels of resistance to gamma-irradiation. Further, sera from postpartum women cause a similar shift to increased radioresistance in mononuclear cells from adult controls. Because radioresistance is a property of interleukin 2-stimulated NK, the shift to radioresistance may represent lymphokine-mediated stimulation occurring during parturition. In contrast, cord blood cells have a more profound decrease in NK activity as determined by /sup 51/Cr-release assay and decreases in both binding and lysis of bound target cells in the single cell assay. The resistance of NK activity in cord cells to gamma-irradiation is also increased, as seen in postpartum women. Cord blood serum, however, did not alter radioresistance or inhibit NK activity. The results suggest that the observed diminished NK activity in pregnant women and neonates arise by different mechanisms: an absence of mature NK cells in the neonate and an alteration of the NK cell in pregnancy leading to decreased killing.« less

A study on the high temperature-dependence of the electrical properties in a solution-deposited zinc-tin-oxide thin-film transistor operated in the saturation region

NASA Astrophysics Data System (ADS)

Yu, Kyeong Min; Bae, Byung Seong; Jung, Myunghee; Yun, Eui-Jung

2016-06-01

We investigate the effects of high temperatures in the range of 292 - 393 K on the electrical properties of solution-processed amorphous zinc-tin-oxide (a-ZTO) thin-film transistors (TFTs) operated in the saturation region. The fabricated a-ZTO TFTs have a non-patterned bottom gate and top contact structure, and they use a heavily-doped Si wafer and SiO2 as a gate electrode and a gate insulator layer, respectively. In a-ZTO TFTs, the trap release energy ( E TR ) was deduced by using Maxwell-Boltzmann statistics. The decreasing E TR toward zero with increasing gate voltage (the density of trap states ( n s )) in the a-ZTO active layer can be attributed to a shift of the Fermi level toward the mobility edge with increasing gate voltage. The TFTs with low gate voltage (low n s ) exhibit multiple trap and release characteristics and show thermally-activated behavior. In TFTs with a high gate voltage (high n s ), however, we observe decreasing mobility and conductivity with increasing temperature at temperatures ranging from 303 to 363 K. This confirms that the E TR can drop to zero, indicating a shift of the Fermi level beyond the mobility edge. Hence, the mobility edge is detected at the cusp between thermally-activated transport and band transport.

3D shape measurement system developed on mobile platform

NASA Astrophysics Data System (ADS)

Wu, Zhoujie; Chang, Meng; Shi, Bowen; Zhang, Qican

2017-02-01

Three-dimensional (3-D) shape measurement technology based on structured light has become one hot research field inspired by the increasing requirements. Many methods have been implemented and applied in the industry applications, but most of their equipments are large and complex, cannot be portable. Meanwhile, the popularity of the smart mobile terminals, such as smart phones, provides a platform for the miniaturization and portability of this technology. The measurement system based on phase-shift algorithm and Gray-code pattern under the Android platform on a mobile phone is mainly studied and developed, and it has been encapsulated into a mobile phone application in order to reconstruct 3-D shape data in the employed smart phone easily and quickly. The experimental results of two measured object are given in this paper and demonstrate the application we developed in the mobile platform is effective.

Information Literacy in a Digital Era: Understanding the Impact of Mobile Information for Undergraduate Nursing Students.

PubMed

Doyle, Glynda J; Furlong, Karen E; Secco, Loretta

2016-01-01

Recent entry-to-practice nursing informatics competencies for Registered Nurses in Canada mean nurse educators need educational strategies to promote student competency within the rapidly evolving informatics field. A collaborative research team from three Canadian nursing programs completed a mixed method survey to describe how nursing students used mobile nursing information support and the extent of this support for learning. The Mobile Information Support Evaluation Tool (MISET) assessed Usefulness/Helpfulness, Information Literacy Support, and Use of Evidence-Based Sources. The quantitative and qualitative data were analyzed to describe students' perspectives and the ways they used mobile resources in learning situations. Findings suggest nursing students mainly accessed mobile resources to support clinical learning, and specifically for task-oriented information such as drug medication or patient conditions/diagnoses. Researchers recommend a paradigm shift whereby educators emphasize information literacy in a way that supports evidence-based quality care.

A robust methodology to subclassify pseudokinases based on their nucleotide-binding properties

PubMed Central

Murphy, James M.; Zhang, Qingwei; Young, Samuel N.; Reese, Michael L.; Bailey, Fiona P.; Eyers, Patrick A.; Ungureanu, Daniela; Hammaren, Henrik; Silvennoinen, Olli; Varghese, Leila N.; Chen, Kelan; Tripaydonis, Anne; Jura, Natalia; Fukuda, Koichi; Qin, Jun; Nimchuk, Zachary; Mudgett, Mary Beth; Elowe, Sabine; Gee, Christine L.; Liu, Ling; Daly, Roger J.; Manning, Gerard; Babon, Jeffrey J.; Lucet, Isabelle S.

2017-01-01

Protein kinase-like domains that lack conserved residues known to catalyse phosphoryl transfer, termed pseudokinases, have emerged as important signalling domains across all kingdoms of life. Although predicted to function principally as catalysis-independent protein-interaction modules, several pseudokinase domains have been attributed unexpected catalytic functions, often amid controversy. We established a thermal-shift assay as a benchmark technique to define the nucleotide-binding properties of kinase-like domains. Unlike in vitro kinase assays, this assay is insensitive to the presence of minor quantities of contaminating kinases that may otherwise lead to incorrect attribution of catalytic functions to pseudokinases. We demonstrated the utility of this method by classifying 31 diverse pseudokinase domains into four groups: devoid of detectable nucleotide or cation binding; cation-independent nucleotide binding; cation binding; and nucleotide binding enhanced by cations. Whereas nine pseudokinases bound ATP in a divalent cation-dependent manner, over half of those examined did not detectably bind nucleotides, illustrating that pseudokinase domains predominantly function as non-catalytic protein-interaction modules within signalling networks and that only a small subset is potentially catalytically active. We propose that henceforth the thermal-shift assay be adopted as the standard technique for establishing the nucleotide-binding and catalytic potential of kinase-like domains. PMID:24107129

Femtomole-Scale High-Throughput Screening of Protein Ligands with Droplet-Based Thermal Shift Assay.

PubMed

Liu, Wen-Wen; Zhu, Ying; Fang, Qun

2017-06-20

There is a great demand to measure protein-ligand interactions in rapid and low cost way. Here, we developed a microfluidic droplet-based thermal shift assay (dTSA) system for high-throughput screening of small-molecule protein ligands. The system is composed of a nanoliter droplet array chip, a microfluidic droplet robot, and a real-time fluorescence detection system. Total 324 assays could be performed in parallel in a single chip with an 18 × 18 droplet array. The consumption of dTSA for each protein or ligand sample was only 5 nL (femtomole scale), which is significantly reduced by over 3 orders of magnitude compared with those in 96- or 384-well plate-based systems. We also observed the implementation of TSA in nanoliter droplet format could substantially improve assay precision with relative standard deviation (RSD) of 0.2% (n = 50), which can be ascribed to the enhanced thermal conduction in small volume reactors. The dTSA system was optimized by studying the effect of droplet volumes, as well as protein and fluorescent dye (SYPRO Orange) concentrations. To demonstrate its potential in drug discovery, we applied the dTSA system in screening inhibitors of human thrombin with a commercial library containing 100 different small molecule compounds, and two inhibitors were successfully identified and confirmed.

Kidney cell electrophoresis, continuing task

NASA Technical Reports Server (NTRS)

Todd, P. W.

1985-01-01

Materials and procedures for microgravity electrophoresis of living human embryonic kidney cells were evaluated to provide ground support in the form of analytical cell electrophoresis and flow cytometry. Preflight culture media, electrophoresis buffer, fraction collection media, temperature profiles, and urokinase assay procedures were tested prior to flight. Electrophoretic mobility distributions of aliquots of the cell population to be fractionated in flight were obtained. Cells were prepared in suspension prior to flight in electrophoresis buffer and 10% calf serum. Electrophoretic separation proceeded in electrophoresis buffer without serum in the Continuous Flow Electrophoretic Separator, and fractions were collected into sample bags containing culture medium and concentrated serum. Fractions that yielded enough progeny cells were analyzed for morphology and electrophoretic mobility distributions. It is noted that the lowest mobility fraction studied produced higher mobility progeny while the other fractions produced progeny cells with mobilities related to the fractions from which they were collected.

The Catabolite Control Protein E (CcpE) Affects Virulence Determinant Production and Pathogenesis of Staphylococcus aureus*

PubMed Central

Hartmann, Torsten; Baronian, Grégory; Nippe, Nadine; Voss, Meike; Schulthess, Bettina; Wolz, Christiane; Eisenbeis, Janina; Schmidt-Hohagen, Kerstin; Gaupp, Rosmarie; Sunderkötter, Cord; Beisswenger, Christoph; Bals, Robert; Somerville, Greg A.; Herrmann, Mathias; Molle, Virginie; Bischoff, Markus

2014-01-01

Carbon metabolism and virulence determinant production are often linked in pathogenic bacteria, and several regulatory elements have been reported to mediate this linkage in Staphylococcus aureus. Previously, we described a novel protein, catabolite control protein E (CcpE) that functions as a regulator of the tricarboxylic acid cycle. Here we demonstrate that CcpE also regulates virulence determinant biosynthesis and pathogenesis. Specifically, deletion of ccpE in S. aureus strain Newman revealed that CcpE affects transcription of virulence factors such as capA, the first gene in the capsule biosynthetic operon; hla, encoding α-toxin; and psmα, encoding the phenol-soluble modulin cluster α. Electrophoretic mobility shift assays demonstrated that CcpE binds to the hla promoter. Mice challenged with S. aureus strain Newman or its isogenic ΔccpE derivative revealed increased disease severity in the ΔccpE mutant using two animal models; an acute lung infection model and a skin infection model. Complementation of the mutant with the ccpE wild-type allele restored all phenotypes, demonstrating that CcpE is negative regulator of virulence in S. aureus. PMID:25193664

Suppressive effects of Lithospermum erythrorhizon extracts on lipopolysaccharide-induced activation of AP-1 and NF-kappaB via mitogen-activated protein kinase pathways in mouse macrophage cells.

PubMed

Han, Kyu Yeon; Kwon, Taek Hwan; Lee, Tae Hoon; Lee, Sung-Joon; Kim, Sung-Hoon; Kim, Jiyoung

2008-04-30

A variety of anti-inflammatory agents have been shown to exert chemopreventive activity via targeting of transcription factors such as NF-kappaB and AP-1. Lithospermum erythrorhizon (LE) has long been used in traditional oriental medicine. In this study, we demonstrated the inhibitory effects of LE extracts on lipopolysaccharide (LPS)-stimulated production of inflammatory cytokines. As an underlying mechanism of inhibition, LE extracts reduced LPS-induced transactivation of AP-1 as well as NF-kappaB in mouse macrophage cells. Electrophoretic mobility shift assays indicated that LE extracts inhibited the DNA binding activities of AP-1 and NF-kappaB. In addition, phosphorylation of IkappaB-alpha protein was suppressed by LE extracts. Moreover, LE extracts inhibited c-Jun N-terminal kinase and extracellular signal-regulated signaling pathways. Our results suggest that the anti-inflammatory activity of LE extracts may be mediated by the inhibition of signal transduction pathways that normally lead to the activation of AP-1and NF-kappaB. These inhibitory effects may be useful for chemoprevention of cancer or other chronic inflammatory diseases.

The tertiary structures of porcine AhR and ARNT proteins and molecular interactions within the TCDD/AhR/ARNT complex.

PubMed

Orlowska, Karina; Molcan, Tomasz; Swigonska, Sylwia; Sadowska, Agnieszka; Jablonska, Monika; Nynca, Anna; Jastrzebski, Jan P; Ciereszko, Renata E

2016-06-01

The aryl hydrocarbon receptor (AhR) is a ligand-dependent transcription factor that can be activated by structurally diverse synthetic and natural chemicals, including toxic environmental contaminant 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD). In the present study, homology models of the porcine AhR-ligand binding domain (LBD) and the porcine aryl hydrocarbon receptor nuclear translocator-ligand binding domain (ARNT-LBD) were created on the basis of structures of closely related respective proteins i.e., human Hif-2α and ARNT. Molecular docking of TCDD to the porcine AhR-LBD model revealed high binding affinity (-8.8kcal/mol) between TCDD and the receptor. Moreover, formation of the TCDD/AhR-LBD complex was confirmed experimentally with the use of electrophoretic mobility shift assay (EMSA). It was found that TCDD (10nM, 2h of incubation) not only bound to the AhR in the porcine granulosa cells but also activated the receptor. The current study provides a framework for examining the key events involved in the ligand-dependent activation of the AhR. Copyright © 2016 Elsevier Inc. All rights reserved.

Targeting of Arabidopsis KNL2 to Centromeres Depends on the Conserved CENPC-k Motif in Its C Terminus.

PubMed

Sandmann, Michael; Talbert, Paul; Demidov, Dmitri; Kuhlmann, Markus; Rutten, Twan; Conrad, Udo; Lermontova, Inna

2017-01-01

KINETOCHORE NULL2 (KNL2) is involved in recognition of centromeres and in centromeric localization of the centromere-specific histone cenH3. Our study revealed a cenH3 nucleosome binding CENPC-k motif at the C terminus of Arabidopsis thaliana KNL2, which is conserved among a wide spectrum of eukaryotes. Centromeric localization of KNL2 is abolished by deletion of the CENPC-k motif and by mutating single conserved amino acids, but can be restored by insertion of the corresponding motif of Arabidopsis CENP-C. We showed by electrophoretic mobility shift assay that the C terminus of KNL2 binds DNA sequence-independently and interacts with the centromeric transcripts in vitro. Chromatin immunoprecipitation with anti-KNL2 antibodies indicated that in vivo KNL2 is preferentially associated with the centromeric repeat pAL1 Complete deletion of the CENPC-k motif did not influence its ability to interact with DNA in vitro. Therefore, we suggest that KNL2 recognizes centromeric nucleosomes, similar to CENP-C, via the CENPC-k motif and binds adjoining DNA. © 2017 American Society of Plant Biologists. All rights reserved.

Affinity of yeast nucleotide excision repair factor 2, consisting of the Rad4 and Rad23 proteins, for ultraviolet damaged DNA.

PubMed

Guzder, S N; Sung, P; Prakash, L; Prakash, S

1998-11-20

Saccharomyces cerevisiae Rad4 and Rad23 proteins are required for the nucleotide excision repair of UV light-damaged DNA. Previous studies have indicated that these two DNA repair proteins are associated in a tight complex, which we refer to as nucleotide excision repair factor 2 (NEF2). In a reconstituted nucleotide excision repair reaction, incision of UV-damaged DNA is dependent on NEF2, indicating a role of NEF2 in an early step of the repair process. NEF2 does not, however, possess an enzymatic activity, and its function in the damage-specific incision reaction has not yet been defined. Here we use a DNA mobility shift assay to demonstrate that NEF2 binds specifically to UV-damaged DNA. Elimination of cyclobutane pyrimidine dimers from the UV-damaged DNA by enzymatic photoreactivation has little effect on the affinity of NEF2 for the DNA, suggesting that NEF2 recognizes the 6-(1, 2)-dihydro-2-oxo-4-pyrimidinyl)-5-methyl-2,4-(1H,3H)-pyrimidinedione photoproducts in the damaged DNA. These results highlight the intricacy of the DNA damage-demarcation reaction during nucleotide excision repair in eukaryotes.

Transcriptional activation of rat creatine kinase B by 17beta-estradiol in MCF-7 cells involves an estrogen responsive element and GC-rich sites.

PubMed

Wang, F; Samudio, I; Safe, S

2001-01-01

The rat creatine kinase B (CKB) gene is induced by estrogen in the uterus, and constructs containing rat CKB gene promoter inserts are highly estrogen-responsive in cell culture. Analysis of the upstream -568 to -523 region of the promoter in HeLa cells has identified an imperfect palindromic estrogen response element (ERE) that is required for hormone inducibility. Analysis of the CKB gene promoter in MCF-7 breast cancer cells confirmed that pCKB7 (containing the -568 to -523 promoter insert) was estrogen-responsive in transient transfection studies. However, mutation and deletion analysis of this region of the promoter showed that two GC-rich sites and the concensus ERE were functional cis-elements that bound estrogen receptor alpha (ERalpha)/Sp1 and ERalpha proteins, respectively. The role of these elements was confirmed in gel mobility shift and chromatin immunoprecipitation assays and transfection studies in MDA-MB-231 and Schneider Drosophila SL-2 cells. These results show that transcriptional activation of CKB by estrogen is dependent, in part, on ERalpha/Sp1 action which is cell context-dependent. Copyright 2001 Wiley-Liss, Inc.

Increased expression of Aspergillus parasiticus aflR, encoding a sequence-specific DNA-binding protein, relieves nitrate inhibition of aflatoxin biosynthesis.

PubMed Central

Chang, P K; Ehrlich, K C; Yu, J; Bhatnagar, D; Cleveland, T E

1995-01-01

The aflR gene from Aspergillus parasiticus and Aspergillus flavus may be involved in the regulation of aflatoxin biosynthesis. The aflR gene product, AFLR, possesses a GAL4-type binuclear zinc finger DNA-binding domain. A transformant, SU1-N3 (pHSP), containing an additional copy of aflR, showed increased transcription of aflR and the aflatoxin pathway structural genes, nor-1, ver-1, and omt-1, when cells were grown in nitrate medium, which normally suppresses aflatoxin production. Electrophoretic mobility shift assays showed that the recombinant protein containing the DNA-binding domain, AFLR1, bound specifically to the palindromic sequence, TTAGGCCTAA, 120 bp upstream of the AFLR translation start site. Expression of aflR thus appears to be autoregulated. Increased expression of aflatoxin biosynthetic genes in the transformant might result from an elevated basal level of AFLR, allowing it to overcome nitrate inhibition and to bind to the aflR promotor region, thereby initiating aflatoxin biosynthesis. Results further suggest that aflR is involved in the regulation of multiple parts of the aflatoxin biosynthetic pathway. PMID:7793958

Genome-wide association study of breast cancer in Latinas identifies novel protective variants on 6q25.

PubMed

Fejerman, Laura; Ahmadiyeh, Nasim; Hu, Donglei; Huntsman, Scott; Beckman, Kenneth B; Caswell, Jennifer L; Tsung, Karen; John, Esther M; Torres-Mejia, Gabriela; Carvajal-Carmona, Luis; Echeverry, María Magdalena; Tuazon, Anna Marie D; Ramirez, Carolina; Gignoux, Christopher R; Eng, Celeste; Gonzalez-Burchard, Esteban; Henderson, Brian; Le Marchand, Loic; Kooperberg, Charles; Hou, Lifang; Agalliu, Ilir; Kraft, Peter; Lindström, Sara; Perez-Stable, Eliseo J; Haiman, Christopher A; Ziv, Elad

2014-10-20

The genetic contributions to breast cancer development among Latinas are not well understood. Here we carry out a genome-wide association study of breast cancer in Latinas and identify a genome-wide significant risk variant, located 5' of the Estrogen Receptor 1 gene (ESR1; 6q25 region). The minor allele for this variant is strongly protective (rs140068132: odds ratio (OR) 0.60, 95% confidence interval (CI) 0.53-0.67, P=9 × 10(-18)), originates from Indigenous Americans and is uncorrelated with previously reported risk variants at 6q25. The association is stronger for oestrogen receptor-negative disease (OR 0.34, 95% CI 0.21-0.54) than oestrogen receptor-positive disease (OR 0.63, 95% CI 0.49-0.80; P heterogeneity=0.01) and is also associated with mammographic breast density, a strong risk factor for breast cancer (P=0.001). rs140068132 is located within several transcription factor-binding sites and electrophoretic mobility shift assays with MCF-7 nuclear protein demonstrate differential binding of the G/A alleles at this locus. These results highlight the importance of conducting research in diverse populations.

Characterization of monomeric DNA-binding protein Histone H1 in Leishmania braziliensis.

PubMed

Carmelo, Emma; González, Gloria; Cruz, Teresa; Osuna, Antonio; Hernández, Mariano; Valladares, Basilio

2011-08-01

Histone H1 in Leishmania presents relevant differences compared to higher eukaryote counterparts, such as the lack of a DNA-binding central globular domain. Despite that, it is apparently fully functional since its differential expression levels have been related to changes in chromatin condensation and infectivity, among other features. The localization and the aggregation state of L. braziliensis H1 has been determined by immunolocalization, mass spectrometry, cross-linking and electrophoretic mobility shift assays. Analysis of H1 sequences from the Leishmania Genome Database revealed that our protein is included in a very divergent group of histones H1 that is present only in L. braziliensis. An antibody raised against recombinant L. braziliensis H1 recognized specifically that protein by immunoblot in L. braziliensis extracts, but not in other Leishmania species, a consequence of the sequence divergences observed among Leishmania species. Mass spectrometry analysis and in vitro DNA-binding experiments have also proven that L. braziliensis H1 is monomeric in solution, but oligomerizes upon binding to DNA. Finally, despite the lack of a globular domain, L. braziliensis H1 is able to form complexes with DNA in vitro, with higher affinity for supercoiled compared to linear DNA.

RPA and XPA interaction with DNA structures mimicking intermediates of the late stages in nucleotide excision repair

PubMed Central

Maltseva, Ekaterina A.

2018-01-01

Replication protein A (RPA) and the xeroderma pigmentosum group A (XPA) protein are indispensable for both pathways of nucleotide excision repair (NER). Here we analyze the interaction of RPA and XPA with DNA containing a flap and different size gaps that imitate intermediates of the late NER stages. Using gel mobility shift assays, we found that RPA affinity for DNA decreased when DNA contained both extended gap and similar sized flap in comparison with gapped-DNA structure. Moreover, crosslinking experiments with the flap-gap DNA revealed that RPA interacts mainly with the ssDNA platform within the long gap and contacts flap in DNA with a short gap. XPA exhibits higher affinity for bubble-DNA structures than to flap-gap-containing DNA. Protein titration analysis showed that formation of the RPA-XPA-DNA ternary complex depends on the protein concentration ratio and these proteins can function as independent players or in tandem. Using fluorescently-labelled RPA, direct interaction of this protein with XPA was detected and characterized quantitatively. The data obtained allow us to suggest that XPA can be involved in the post-incision NER stages via its interaction with RPA. PMID:29320546

Kinetics of interaction of Cotton Leaf Curl Kokhran Virus-Dabawali (CLCuKV-Dab) coat protein and its mutants with ssDNA

DOE Office of Scientific and Technical Information (OSTI.GOV)

Priyadarshini, C.G. Poornima; Savithri, H.S., E-mail: bchss@biochem.iisc.ernet.i

Gemini viral assembly and transport of viral DNA into nucleus for replication, essentially involve DNA-coat protein interactions. The kinetics of interaction of Cotton Leaf Curl Kokhran Virus-Dabawali recombinant coat protein (rCP) with DNA was studied by electrophoretic mobility shift assay (EMSA) and surface plasmon resonance (SPR). The rCP interacted with ssDNA with a K{sub A}, of 2.6 +- 0.29 x 10{sup 8} M{sup -1} in a sequence non-specific manner. The CP has a conserved C2H2 type zinc finger motif composed of residues C68, C72, H81 and H85. Mutation of these residues to alanine resulted in reduced binding to DNA probes.more » The H85A mutant rCP showed the least binding with approximately 756 fold loss in the association rate and a three order magnitude decrease in the binding affinity as compared to rCP. The CP-DNA interactions via the zinc finger motif could play a crucial role in virus assembly and in nuclear transport.« less

Involvement of WRKY Transcription Factors in Abscisic-Acid-Induced Cold Tolerance of Banana Fruit.

PubMed

Luo, Dong-Lan; Ba, Liang-Jie; Shan, Wei; Kuang, Jian-Fei; Lu, Wang-Jin; Chen, Jian-Ye

2017-05-10

Phytohormone abscisic acid (ABA) and plant-specific WRKY transcription factors (TFs) have been implicated to play important roles in various stress responses. The involvement of WRKY TFs in ABA-mediated cold tolerance of economical fruits, such as banana fruit, however remains largely unknown. Here, we reported that ABA application could induce expressions of ABA biosynthesis-related genes MaNCED1 and MaNCED2, increase endogenous ABA contents, and thereby enhance cold tolerance in banana fruit. Four banana fruit WRKY TFs, designated as MaWRKY31, MaWRKY33, MaWRKY60, and MaWRKY71, were identified and characterized. All four of these MaWRKYs were nuclear-localized and displayed transactivation activities. Their expressions were induced by ABA treatment during cold storage. More importantly, the gel mobility shift assay and transient expression analysis revealed that MaWRKY31, MaWRKY33, MaWRKY60, and MaWRKY71 directly bound to the W-box elements in MaNCED1 and MaNCED2 promoters and activated their expressions. Taken together, our findings demonstrate that banana fruit WRKY TFs are involved in ABA-induced cold tolerance by, at least in part, increasing ABA levels via directly activating NECD expressions.

In vitro binding of the asialoglycoprotein receptor to the beta adaptin of plasma membrane coated vesicles.

PubMed Central

Beltzer, J P; Spiess, M

1991-01-01

The asialoglycoprotein (ASGP) receptor was used to probe total clathrin-coated vesicle proteins and purified adaptor proteins (APs) which had been fractionated by gel electrophoresis and transferred to nitrocellulose. The receptor was found to interact with proteins of approximately 100 kDa. The cytoplasmic domain of the ASGP receptor subunit H1 fused to dihydrofolate reductase competed for receptor binding to the 100 kDa polypeptide in the plasma membrane-type AP complexes (AP-2). A fusion protein containing the cytoplasmic domain of the endocytic mutant haemagglutinin HA-Y543 also competed, but a protein with the wild-type haemagglutinin sequence did not. This indicates that the observed interaction is specific for the cytoplasmic domain of the receptor and involves the tyrosine signal for endocytosis. When fractionated by gel electrophoresis in the presence of urea, the ASGP receptor binding polypeptide displayed a characteristic shift in electrophoretic mobility identifying it as the beta adaptin. Partial proteolysis of the AP-2 preparation followed by the receptor binding assay revealed that the aminoterminal domain of the beta adaptin contains the binding site for receptors. Images PMID:1935897

The Sin3p PAH Domains Provide Separate Functions Repressing Meiotic Gene Transcription in Saccharomyces cerevisiae ▿

PubMed Central

Mallory, Michael J.; Law, Michael J.; Buckingham, Lela E.; Strich, Randy

2010-01-01

Meiotic genes in budding yeast are repressed during vegetative growth but are transiently induced during specific stages of meiosis. Sin3p represses the early meiotic gene (EMG) by bridging the DNA binding protein Ume6p to the histone deacetylase Rpd3p. Sin3p contains four paired amphipathic helix (PAH) domains, one of which (PAH3) is required for repressing several genes expressed during mitotic cell division. This report examines the roles of the PAH domains in mediating EMG repression during mitotic cell division and following meiotic induction. PAH2 and PAH3 are required for mitotic EMG repression, while electrophoretic mobility shift assays indicate that only PAH2 is required for stable Ume6p-promoter interaction. Unlike mitotic repression, reestablishing EMG repression following transient meiotic induction requires PAH3 and PAH4. In addition, the role of Sin3p in reestablishing repression is expanded to include additional loci that it does not control during vegetative growth. These findings indicate that mitotic and postinduction EMG repressions are mediated by two separate systems that utilize different Sin3p domains. PMID:20971827

Leptin rapidly activates PPARs in C2C12 muscle cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bendinelli, Paola; Piccoletti, Roberta; Maroni, Paola

2005-07-08

Experimental evidence suggests that leptin operates on the tissues, including skeletal muscle, also by modulating gene expression. Using electrophoretic mobility shift assays, we have shown that physiological doses of leptin promptly increase the binding of C2C12 cell nuclear extracts to peroxisome proliferator-activated receptor (PPAR) response elements in oligonucleotide probes and that all three PPAR isoforms participate in DNA-binding complexes. We pre-treated C2C12 cells with AACOCF{sub 3}, a specific inhibitor of cytosolic phospholipase A{sub 2} (cPLA{sub 2}), an enzyme that supplies ligands to PPARs, and found that it abrogates leptin-induced PPAR DNA-binding activity. Leptin treatment significantly increased cPLA{sub 2} activity, evaluatedmore » as the release of [{sup 3}H]arachidonic acid from pre-labelled C2C12 cells, as well as phosphorylation. Further, using MEK1 inhibitor PD-98059 we showed that leptin activates cPLA{sub 2} through ERK induction. These results support a direct effect of leptin on skeletal muscle cells, and suggest that the hormone may modulate muscle transcription also by precocious activation of PPARs through ERK-cPLA{sub 2} pathway.« less

A two-component regulatory system controls autoregulated serpin expression in Bifidobacterium breve UCC2003.

PubMed

Alvarez-Martin, Pablo; O'Connell Motherway, Mary; Turroni, Francesca; Foroni, Elena; Ventura, Marco; van Sinderen, Douwe

2012-10-01

This work reports on the identification and molecular characterization of a two-component regulatory system (2CRS), encoded by serRK, which is believed to control the expression of the ser(2003) locus in Bifidobacterium breve UCC2003. The ser(2003) locus consists of two genes, Bbr_1319 (sagA) and Bbr_1320 (serU), which are predicted to encode a hypothetical membrane-associated protein and a serpin-like protein, respectively. The response regulator SerR was shown to bind to the promoter region of ser(2003), and the probable recognition sequence of SerR was determined by a combinatorial approach of in vitro site-directed mutagenesis coupled to transcriptional fusion and electrophoretic mobility shift assays (EMSAs). The importance of the serRK 2CRS in the response of B. breve to protease-mediated induction was confirmed by generating a B. breve serR insertion mutant, which was shown to exhibit altered ser(2003) transcriptional induction patterns compared to the parent strain, UCC2003. Interestingly, the analysis of a B. breve serU mutant revealed that the SerRK signaling pathway appears to include a SerU-dependent autoregulatory loop.

A Two-Component Regulatory System Controls Autoregulated Serpin Expression in Bifidobacterium breve UCC2003

PubMed Central

Alvarez-Martin, Pablo; O'Connell Motherway, Mary; Turroni, Francesca; Foroni, Elena; Ventura, Marco

2012-01-01

This work reports on the identification and molecular characterization of a two-component regulatory system (2CRS), encoded by serRK, which is believed to control the expression of the ser2003 locus in Bifidobacterium breve UCC2003. The ser2003 locus consists of two genes, Bbr_1319 (sagA) and Bbr_1320 (serU), which are predicted to encode a hypothetical membrane-associated protein and a serpin-like protein, respectively. The response regulator SerR was shown to bind to the promoter region of ser2003, and the probable recognition sequence of SerR was determined by a combinatorial approach of in vitro site-directed mutagenesis coupled to transcriptional fusion and electrophoretic mobility shift assays (EMSAs). The importance of the serRK 2CRS in the response of B. breve to protease-mediated induction was confirmed by generating a B. breve serR insertion mutant, which was shown to exhibit altered ser2003 transcriptional induction patterns compared to the parent strain, UCC2003. Interestingly, the analysis of a B. breve serU mutant revealed that the SerRK signaling pathway appears to include a SerU-dependent autoregulatory loop. PMID:22843530

Transcriptional regulation of the Borrelia burgdorferi antigenically variable VlsE surface protein.

PubMed

Bykowski, Tomasz; Babb, Kelly; von Lackum, Kate; Riley, Sean P; Norris, Steven J; Stevenson, Brian

2006-07-01

The Lyme disease agent Borrelia burgdorferi can persistently infect humans and other animals despite host active immune responses. This is facilitated, in part, by the vls locus, a complex system consisting of the vlsE expression site and an adjacent set of 11 to 15 silent vls cassettes. Segments of nonexpressed cassettes recombine with the vlsE region during infection of mammalian hosts, resulting in combinatorial antigenic variation of the VlsE outer surface protein. We now demonstrate that synthesis of VlsE is regulated during the natural mammal-tick infectious cycle, being activated in mammals but repressed during tick colonization. Examination of cultured B. burgdorferi cells indicated that the spirochete controls vlsE transcription levels in response to environmental cues. Analysis of PvlsE::gfp fusions in B. burgdorferi indicated that VlsE production is controlled at the level of transcriptional initiation, and regions of 5' DNA involved in the regulation were identified. Electrophoretic mobility shift assays detected qualitative and quantitative changes in patterns of protein-DNA complexes formed between the vlsE promoter and cytoplasmic proteins, suggesting the involvement of DNA-binding proteins in the regulation of vlsE, with at least one protein acting as a transcriptional activator.

OsDREB2A, a Rice Transcription Factor, Significantly Affects Salt Tolerance in Transgenic Soybean

PubMed Central

Ma, Qi-bin; Yang, Cun-yi; Mu, Ying-hui; Suo, Hai-cui; Luo, Lai-hui; Nian, Hai

2013-01-01

The dehydration responsive element binding (DREB) transcription factors play an important role in regulating stress-related genes. OsDREB2A, a member of the DREBP subfamily of AP2/ERF transcription factors in rice (Oryza sativa), is involved in the abiotic stress response. OsDREB2A expression is induced by drought, low-temperature and salt stresses. Here, we report the ability of OsDREB2A to regulate high-salt response in transgenic soybean. Overexpressing OsDREB2A in soybeans enhanced salt tolerance by accumulating osmolytes, such as soluble sugars and free proline, and improving the expression levels of some stress-responsive transcription factors and key genes. The phenotypic characterization of transgenic soybean were significantly better than those of wild-type (WT). Electrophoresis mobility shift assay (EMSA) revealed that the OsDREB2A can bind to the DRE core element in vitro. These results indicate that OsDREB2A may participate in abiotic stress by directly binding with DRE element to regulate the expression of downstream genes. Overexpression of OsDREB2A in soybean might be used to improve tolerance to salt stress. PMID:24376625

Recognition of the CDEI motif GTCACATG by mouse nuclear proteins and interference with the early development of the mouse embryo.

PubMed Central

Blangy, A; Léopold, P; Vidal, F; Rassoulzadegan, M; Cuzin, F

1991-01-01

We have reported previously (1) two unexpected consequences of the microinjection into fertilized mouse eggs of a recombinant plasmid designated p12B1, carrying a 343 bp insert of non-repetitive mouse DNA. Injected at very low concentrations, this plasmid could be established as an extrachromosomal genetic element. When injected in greater concentration, an early arrest of embryonic development resulted. In the present work, we have studied this toxic effect in more detail by microinjecting short synthetic oligonucleotides with sequences from the mouse insert. Lethality was associated with the nucleotide sequence GTCACATG, identical with the CDEl element of yeast centromeres. Development of injected embryos was arrested between the one-cell and the early morula stages, with abnormal structures and DNA contents. Electrophoretic mobility shift and DNAse foot-printing assays demonstrated the binding of mouse nuclear protein(s) to the CDEl-like box. Base changes within the CDEl sequence prevented both the toxic effects in embryos and the formation of protein complex in vitro, suggesting that protein binding at such sites in chromosomal DNA plays an important role in early development. Images PMID:1766880

Genome-wide association study of breast cancer in Latinas identifies novel protective variants on 6q25

PubMed Central

Fejerman, Laura; Ahmadiyeh, Nasim; Hu, Donglei; Huntsman, Scott; Beckman, Kenneth B.; Caswell, Jennifer L.; Tsung, Karen; John, Esther M.; Torres-Mejia, Gabriela; Carvajal-Carmona, Luis; Echeverry, María Magdalena; Tuazon, Anna Marie D.; Ramirez, Carolina; Carvajal-Carmona, Luis; Echeverry, María Magdalena; Bohórquez, Mabel Elena; Prieto, Rodrigo; Criollo, Ángel; Ramírez, Carolina; Estrada, Ana Patricia; Suáres, John Jairo; Mateus, Gilbert; Castro, Jorge Mario; Sánchez, Yesid; Murillo, Raúl; Lucia Serrano, Martha; Sanabria, Carolina; Olaya, Justo Germán; Bolaños, Fernando; Vélez, Alejandro; Carmona, Jenny Andrea; Vélez, Alejandro; Rodríguez, Nancy Guerrero; Serón Sousa, Cristina; Mendez, Cesar Eduardo Alvarez; Galviz, Ana Isabel Orduz; Gignoux, Christopher R.; Eng, Celeste; Gonzalez-Burchard, Esteban; Henderson, Brian; Marchand, Loic Le; Kooperberg, Charles; Hou, Lifang; Agalliu, Ilir; Kraft, Peter; Lindström, Sara; Perez-Stable, Eliseo J.; Haiman, Christopher A.; Ziv, Elad

2014-01-01

The genetic contributions to breast cancer development among Latinas are not well understood. Here we carry out a genome-wide association study of breast cancer in Latinas and identify a genome-wide significant risk variant, located 5′ of the Estrogen Receptor 1 gene (ESR1; 6q25 region). The minor allele for this variant is strongly protective (rs140068132: odds ratio (OR) 0.60, 95% confidence interval (CI) 0.53–0.67, P=9 × 10−18), originates from Indigenous Americans and is uncorrelated with previously reported risk variants at 6q25. The association is stronger for oestrogen receptor-negative disease (OR 0.34, 95% CI 0.21–0.54) than oestrogen receptor-positive disease (OR 0.63, 95% CI 0.49–0.80; P heterogeneity=0.01) and is also associated with mammographic breast density, a strong risk factor for breast cancer (P=0.001). rs140068132 is located within several transcription factor-binding sites and electrophoretic mobility shift assays with MCF-7 nuclear protein demonstrate differential binding of the G/A alleles at this locus. These results highlight the importance of conducting research in diverse populations. PMID:25327703

RPA and XPA interaction with DNA structures mimicking intermediates of the late stages in nucleotide excision repair.

PubMed

Krasikova, Yuliya S; Rechkunova, Nadejda I; Maltseva, Ekaterina A; Lavrik, Olga I

2018-01-01

Replication protein A (RPA) and the xeroderma pigmentosum group A (XPA) protein are indispensable for both pathways of nucleotide excision repair (NER). Here we analyze the interaction of RPA and XPA with DNA containing a flap and different size gaps that imitate intermediates of the late NER stages. Using gel mobility shift assays, we found that RPA affinity for DNA decreased when DNA contained both extended gap and similar sized flap in comparison with gapped-DNA structure. Moreover, crosslinking experiments with the flap-gap DNA revealed that RPA interacts mainly with the ssDNA platform within the long gap and contacts flap in DNA with a short gap. XPA exhibits higher affinity for bubble-DNA structures than to flap-gap-containing DNA. Protein titration analysis showed that formation of the RPA-XPA-DNA ternary complex depends on the protein concentration ratio and these proteins can function as independent players or in tandem. Using fluorescently-labelled RPA, direct interaction of this protein with XPA was detected and characterized quantitatively. The data obtained allow us to suggest that XPA can be involved in the post-incision NER stages via its interaction with RPA.

Regulation of the scp Genes in the Cyanobacterium Synechocystis sp. PCC 6803--What is New?

PubMed

Cheregi, Otilia; Funk, Christiane

2015-08-12

In the cyanobacterium Synechocystis sp. PCC 6803 there are five genes encoding small CAB-like (SCP) proteins, which have been shown to be up-regulated under stress. Analyses of the promoter sequences of the scp genes revealed the existence of an NtcA binding motif in two scp genes, scpB and scpE. Binding of NtcA, the key transcriptional regulator during nitrogen stress, to the promoter regions was shown by electrophoretic mobility shift assay. The metabolite 2-oxoglutarate did not increase the affinity of NtcA for binding to the promoters of scpB and scpE. A second motif, the HIP1 palindrome 5' GGCGATCGCC 3', was detected in the upstream regions of scpB and scpC. The transcription factor encoded by sll1130 has been suggested to recognize this motif to regulate heat-responsive genes. Our data suggest that HIP1 is not a regulatory element within the scp genes. Further, the presence of the high light regulatory (HLR1) motif was confirmed in scpB-E, in accordance to their induced transcriptions in cells exposed to high light. The HLR1 motif was newly discovered in eight additional genes.

Ligand specificity of MobR, a transcriptional regulator for the 3-hydroxybenzoate hydroxylase gene of Comamonas testosteroni KH122-3s

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yoshida, Mariko; Hiromoto, Takeshi; Hosokawa, Keiichi

2007-10-19

MobR from Comamonas testosteroni KH122-3s is a member of the MarR family of transcriptional regulators and functions as a repressor for the mobA gene that encodes a 3-hydroxybenzoate 4-hydroxylase. 3-Hydroxybenzoate binds to MobR as a ligand, resulting in an efficient induction of mobA. Various 3-hydroxybenzoate analogues were examined for their inducibilities using the mobA::lacZ transcriptional fusion system. {beta}-Galactosidase was induced by the addition of 2,3-dihydroxybenzoate or 3,5-dihydroxybenzoate besides 3-hydroxybenzoate, suggesting that the hydroxyl group at position 3 is critical in addition to the carboxyl group on the aromatic ring. A gel mobility-shift assay also showed that MobR was released frommore » the target DNA in the presence of these compounds. Circular dichroism studies demonstrated that MobR adopted two conformational states corresponding to the 3-hydroxybenzoate-bound and unbound forms. Other ligands also induced the structural change as well; however, the tertiary structures of converted forms were different from those by 3-hydroxybenzoate.« less

Replication origins oriGNAI3 and oriB of the mammalian AMPD2 locus nested in a region of straight DNA flanked by intrinsically bent DNA sites.

PubMed

Balani, Valério Américo; de Lima Neto, Quirino Alves; Takeda, Karen Izumi; Gimenes, Fabrícia; Fiorini, Adriana; Debatisse, Michelle; Fernandez, Maria Aparecida

2010-11-01

The aim of this work was to determine whether intrinsically bent DNA sites are present at, or close to, the mammalian replication origins oriGNAI3 and oriB in the Chinese hamster AMPD2 locus. Using an electrophoretic mobility shift assay and in silico analysis, we located four intrinsically bent DNA sites (b1 to b4) in a fragment that contains the oriGNAI3 and one site (b5) proximal to oriB. The helical parameters show that each bent DNA site is curved in a left-handed superhelical writhe. A 2D projection of 3D fragment trajectories revealed that oriGNAI3 is located in a relatively straight segment flanked by bent sites b1 and b2, which map in previously identified Scaffold/Matrix Attachment Region. Sites b3 and b4 are located approximately 2 kb downstream and force the fragment into a strong closed loop structure. The b5 site is also located in an S/MAR that is found just downstream of oriB.

Using Mobile Apps to Communicate Vaccination Records: A City-wide Evaluation with a National Immunization App, Maternal Child Registry and Public Health Authorities.

PubMed

Atkinson, Katherine M; El-Khatib, Ziad; Barnum, Geoffery; Bell, Cameron; Turcotte, Marie-Claude; Murphy, Malia S Q; Teitelbaum, Mari; Chakraborty, Pranesh; Laflamme, Lucie; Wilson, Kumanan

2017-01-01

Medicine is experiencing a paradigm shift, where patients are increasingly involved in the management of their health data. We created a mobile app which permitted parental reporting of immunization status to public health authorities. We describe app use as a proxy for feasibility and acceptability as well as data utility for public health surveillance. The evaluation period ran from April 27, 2015, to April 18, 2017, during which time 2,653 unique children's records were transmitted, containing 36,105 vaccinations. Our findings suggest that mobile immunization reporting is feasible and may be an acceptable complement to existing reporting methods. Measures of data utility suggest that mobile reporting could enable more accurate assessments of vaccine coverage.

Design of an anti-Rician-fading modem for mobile satellite communication systems

NASA Technical Reports Server (NTRS)

Kojima, Toshiharu; Ishizu, Fumio; Miyake, Makoto; Murakami, Keishi; Fujino, Tadashi

1995-01-01

To design a demodulator applicable to mobile satellite communication systems using differential phase shift keying modulation, we have developed key technologies including an anti-Rician-fading demodulation scheme, an initial acquisition scheme, automatic gain control (AGC), automatic frequency control (AFC), and bit timing recovery (BTR). Using these technologies, we have developed one-chip digital signal processor (DSP) modem for mobile terminal, which is compact, of light weight, and of low power consumption. Results of performance test show that the developed DSP modem achieves good performance in terms of bit error ratio in mobile satellite communication environment, i.e., Rician fading channel. It is also shown that the initial acquisition scheme acquires received signal rapidly even if the carrier-to-noise power ratio (CNR) of the received signal is considerably low.

Bright blue-shifted fluorescent proteins with Cys in the GAF domain engineered from bacterial phytochromes: fluorescence mechanisms and excited-state dynamics.

PubMed

Hontani, Yusaku; Shcherbakova, Daria M; Baloban, Mikhail; Zhu, Jingyi; Verkhusha, Vladislav V; Kennis, John T M

2016-11-18

Near-infrared fluorescent proteins (NIR FPs) engineered from bacterial phytochromes (BphPs) are of great interest for in vivo imaging. They utilize biliverdin (BV) as a chromophore, which is a heme degradation product, and therefore they are straightforward to use in mammalian tissues. Here, we report on fluorescence properties of NIR FPs with key alterations in their BV binding sites. BphP1-FP, iRFP670 and iRFP682 have Cys residues in both PAS and GAF domains, rather than in the PAS domain alone as in wild-type BphPs. We found that NIR FP variants with Cys in the GAF or with Cys in both PAS and GAF show blue-shifted emission with long fluorescence lifetimes. In contrast, mutants with Cys in the PAS only or no Cys residues at all exhibit red-shifted emission with shorter lifetimes. Combining these results with previous biochemical and BphP1-FP structural data, we conclude that BV adducts bound to Cys in the GAF are the origin of bright blue-shifted fluorescence. We propose that the long fluorescence lifetime follows from (i) a sterically more constrained thioether linkage, leaving less mobility for ring A than in canonical BphPs, and (ii) that π-electron conjugation does not extend on ring A, making excited-state deactivation less sensitive to ring A mobility.

[Blocking 1800 MHz mobile phone radiation-induced reactive oxygen species production and DNA damage in lens epithelial cells by noise magnetic fields].

PubMed

Wu, Wei; Yao, Ke; Wang, Kai-jun; Lu, De-qiang; He, Ji-liang; Xu, Li-hong; Sun, Wen-jun

2008-01-01

To investigate whether the exposure to the electromagnetic noise can block reactive oxygen species (ROS) production and DNA damage of lens epithelial cells induced by 1800 MHz mobile phone radiation. The DCFH-DA method and comet assay were used respectively to detect the intracellular ROS and DNA damage of cultured human lens epithelial cells induced by 4 W/kg 1800 MHz mobile phone radiation or/and 2 muT electromagnetic noise for 24 h intermittently. 1800 MHz mobile phone radiation at 4 W/kg for 24 h increased intracellular ROS and DNA damage significantly (P<0.05). However, the ROS level and DNA damage of mobile phone radiation plus noise group were not significant enhanced (P>0.05) as compared to sham exposure group. Electromagnetic noise can block intracellular ROS production and DNA damage of human lens epithelial cells induced by 1800 MHz mobile phone radiation.

Peptide-based, two-fluorophore, ratiometric probe for quantifying mobile zinc in biological solutions.

PubMed

Zhang, Daniel Y; Azrad, Maria; Demark-Wahnefried, Wendy; Frederickson, Christopher J; Lippard, Stephen J; Radford, Robert J

2015-02-20

Small-molecule fluorescent sensors are versatile agents for detecting mobile zinc in biology. Capitalizing on the abundance of validated mobile zinc probes, we devised a strategy for repurposing existing intensity-based sensors for quantitative applications. Using solid-phase peptide synthesis, we conjugated a zinc-sensitive Zinpyr-1 derivative and a zinc-insensitive 7-hydroxycoumarin derivative onto opposite ends of a rigid P9K peptide scaffold to create HcZ9, a ratiometric fluorescent probe for mobile zinc. A plate reader-based assay using HcZ9 was developed, the accuracy of which is comparable to that of atomic absorption spectroscopy. We investigated zinc accumulation in prostatic cells and zinc levels in human seminal fluid. When normal and tumorigenic cells are bathed in zinc-enriched media, cellular mobile zinc is buffered and changes slightly, but total zinc levels increase significantly. Quantification of mobile and total zinc levels in human seminal plasma revealed that the two are positively correlated with a Pearson's coefficient of 0.73.

A new metabolomic assay to examine inflammation and redox pathways following LPS challenge

PubMed Central

2012-01-01

Background Shifts in intracellular arginine (Arg) and sulfur amino acid (SAA) redox metabolism modulate macrophage activation, polarization and phenotype. Despite their importance in inflammation and redox regulatory pathways, comprehensive analysis of these metabolic networks was not previously possible with existing analytical methods. Methods The Arg/thiol redox LC-MS/MS metabolomics assay permits simultaneous assessment of amino acids and derivative products generated from Arg and SAA metabolism. Using this assay, LPS-induced changes in macrophage amino acid metabolism were monitored to identify pathway shifts during activation and their linkage to cellular redox regulation. Results Metabolite concentrations most significantly changed after treatment of a macrophage-like cell line (RAW) with LPS for 24 hrs were citrulline (Cit) (48-fold increase), ornithine (Orn) (8.5-fold increase), arginine (Arg) (66% decrease), and aspartic acid (Asp) (73% decrease). The ratio Cit + Orn/Arg + Asp (CO/AA) was more sensitive to LPS stimulation than other amino acid ratios commonly used to measure LPS-dependent inflammation (e.g., SAM/SAH, GSH/GSSG) and total media NOx. The CO/AA ratio was also the first ratio to change significantly after LPS treatment (4 hrs). Changes in the overall metabolomic profile over time indicated that metabolic pathways shifted from Arg catabolism to thiol oxidation. Conclusions Simultaneous quantification of Arg and SAA metabolic pathway shifts following LPS challenge of macrophage indicate that, in this system, the Arg-Citrulline/NO cycle and arginase pathways are the amino acid metabolic pathways most sensitive to LPS-challenge. The cellular (Cit + Orn)/(Arg + Asp) ratio, which summarizes this pathway, was more responsive to lower concentrations of LPS and responded earlier than other metabolic biomarkers of macrophage activation including GSH redox. It is suggested that the CO/AA ratio is a redox- independent early biomarker of macrophage activation. The ability to measure both the CO/AA and GSH-redox ratios simultaneously permits quantification of the relative effects of LPS challenge on macrophage inflammation and oxidative stress pathways. The use of this assay in humans is discussed, as are clinical implications. PMID:23036094

Diaphorase Coupling Protocols for Red-Shifting Dehydrogenase Assays

PubMed Central

Davis, Mindy I.; Shen, Min; Simeonov, Anton

2016-01-01

Abstract Dehydrogenases are an important target for the development of cancer therapeutics. Dehydrogenases either produce or consume NAD(P)H, which is fluorescent but at a wavelength where many compounds found in chemical libraries are also fluorescent. By coupling dehydrogenases to diaphorase, which utilizes NAD(P)H to produce the fluorescent molecule resorufin from resazurin, the assay can be red-shifted into a spectral region that reduces interference from compound libraries. Dehydrogenases that produce NAD(P)H, such as isocitrate dehydrogenase 1 (IDH1), can be read in kinetic mode. Dehydrogenases that consume NAD(P)H, such as mutant IDH1 R132H, can be read in endpoint mode. Here, we report protocols for robust and miniaturized 1,536-well assays for WT IDH1 and IDH1 R132H coupled to diaphorase, and the counterassays used to further detect compound interference with the coupling reagents. This coupling technique is applicable to dehydrogenases that either produce or consume NAD(P)H, and the examples provided here can act as guidelines for the development of high-throughput screens against this enzyme class. PMID:27078681

Irradiation defect dispersions and effective dislocation mobility in strained ferritic grains: A statistical analysis based on 3D dislocation dynamics simulations

NASA Astrophysics Data System (ADS)

Li, Y.; Robertson, C.

2018-06-01

The influence of irradiation defect dispersions on plastic strain spreading is investigated by means of three-dimensional dislocation dynamics (DD) simulations, accounting for thermally activated slip and cross-slip mechanisms in Fe-2.5%Cr grains. The defect-induced evolutions of the effective screw dislocation mobility are evaluated by means of statistical comparisons, for various defect number density and defect size cases. Each comparison is systematically associated with a quantitative Defect-Induced Apparent Straining Temperature shift (or «ΔDIAT»), calculated without any adjustable parameters. In the investigated cases, the ΔDIAT level associated with a given defect dispersion closely replicates the measured ductile to brittle transition temperature shift (ΔDBTT) due to the same, actual defect dispersion. The results are further analyzed in terms of dislocation-based plasticity mechanisms and their possible relations with the dose-dependent changes of the ductile to brittle transition temperature.

Transmission of influenza reflects seasonality of wild birds across the annual cycle

USGS Publications Warehouse

Hill, Nichola J.; Ma, Eric J.; Meixell, Brandt W.; Lindberg, Mark S.; Boyce, Walter M.; Runstadler, Jonathan A.

2016-01-01

Influenza A Viruses (IAV) in nature must overcome shifting transmission barriers caused by the mobility of their primary host, migratory wild birds, that change throughout the annual cycle. Using a phylogenetic network of viral sequences from North American wild birds (2008–2011) we demonstrate a shift from intraspecific to interspecific transmission that along with reassortment, allows IAV to achieve viral flow across successive seasons from summer to winter. Our study supports amplification of IAV during summer breeding seeded by overwintering virus persisting locally and virus introduced from a wide range of latitudes. As birds migrate from breeding sites to lower latitudes, they become involved in transmission networks with greater connectivity to other bird species, with interspecies transmission of reassortant viruses peaking during the winter. We propose that switching transmission dynamics may be a critical strategy for pathogens that infect mobile hosts inhabiting regions with strong seasonality.

Live Cell Visualization of Multiple Protein-Protein Interactions with BiFC Rainbow.

PubMed

Wang, Sheng; Ding, Miao; Xue, Boxin; Hou, Yingping; Sun, Yujie

2018-05-18

As one of the most powerful tools to visualize PPIs in living cells, bimolecular fluorescence complementation (BiFC) has gained great advancement during recent years, including deep tissue imaging with far-red or near-infrared fluorescent proteins or super-resolution imaging with photochromic fluorescent proteins. However, little progress has been made toward simultaneous detection and visualization of multiple PPIs in the same cell, mainly due to the spectral crosstalk. In this report, we developed novel BiFC assays based on large-Stokes-shift fluorescent proteins (LSS-FPs) to detect and visualize multiple PPIs in living cells. With the large excitation/emission spectral separation, LSS-FPs can be imaged together with normal Stokes shift fluorescent proteins to realize multicolor BiFC imaging using a simple illumination scheme. We also further demonstrated BiFC rainbow combining newly developed BiFC assays with previously established mCerulean/mVenus-based BiFC assays to achieve detection and visualization of four PPI pairs in the same cell. Additionally, we prove that with the complete spectral separation of mT-Sapphire and CyOFP1, LSS-FP-based BiFC assays can be readily combined with intensity-based FRET measurement to detect ternary protein complex formation with minimal spectral crosstalk. Thus, our newly developed LSS-FP-based BiFC assays not only expand the fluorescent protein toolbox available for BiFC but also facilitate the detection and visualization of multiple protein complex interactions in living cells.

High-pressure liquid chromatographic determination of chlorphenesin carbamate and the beta-isomeric carbamate.

PubMed

Beyer, W F

1976-12-01

A high-pressure liquid chromatographic assay was developed for the determination of chlorphenesin carbamate and its beta-isomeric carbamate. A single 4-mm i.d. X 30-cm column, prepacked with 10 micrometer fully porous silica gel particles, is used with 3% methanol in 50% water-saturated butyl chloride as the mobile phase. The procedure separates chlorphenesin carbamate from several possible impurities in addition to the beta-isomeric carbamate. The assay was applied to bulk drug and compressed tablets. The relative standard deviations for the assays of chlorphenesin carbamate and the beta-isomer are approximately 1 and 2%, respectively.

Cytogenetic investigation of subjects professionally exposed to radiofrequency radiation.

PubMed

Maes, Annemarie; Van Gorp, Urbain; Verschaeve, Luc

2006-03-01

Nowadays, virtually everybody is exposed to radiofrequency radiation (RFR) from mobile phone base station antennas or other sources. At least according to some scientists, this exposure can have detrimental health effects. We investigated cytogenetic effects in peripheral blood lymphocytes from subjects who were professionally exposed to mobile phone electromagnetic fields in an attempt to demonstrate possible RFR-induced genetic effects. These subjects can be considered well suited for this purpose as their RFR exposure is 'normal' though rather high, and definitely higher than that of the 'general population'. The alkaline comet assay, sister chromatid exchange (SCE) and chromosome aberration tests revealed no evidence of RFR-induced genetic effects. Blood cells were also exposed to the well known chemical mutagen mitomycin C in order to investigate possible combined effects of RFR and the chemical. No cooperative action was found between the electromagnetic field exposure and the mutagen using either the comet assay or SCE test.

Pseudo-random dynamic address configuration (PRDAC) algorithm for mobile ad hoc networks

NASA Astrophysics Data System (ADS)

Wu, Shaochuan; Tan, Xuezhi

2007-11-01

By analyzing all kinds of address configuration algorithms, this paper provides a new pseudo-random dynamic address configuration (PRDAC) algorithm for mobile ad hoc networks. Based on PRDAC, the first node that initials this network randomly chooses a nonlinear shift register that can generates an m-sequence. When another node joins this network, the initial node will act as an IP address configuration sever to compute an IP address according to this nonlinear shift register, and then allocates this address and tell the generator polynomial of this shift register to this new node. By this means, when other node joins this network, any node that has obtained an IP address can act as a server to allocate address to this new node. PRDAC can also efficiently avoid IP conflicts and deal with network partition and merge as same as prophet address (PA) allocation and dynamic configuration and distribution protocol (DCDP). Furthermore, PRDAC has less algorithm complexity, less computational complexity and more sufficient assumption than PA. In addition, PRDAC radically avoids address conflicts and maximizes the utilization rate of IP addresses. Analysis and simulation results show that PRDAC has rapid convergence, low overhead and immune from topological structures.

Load shift potential of electric vehicles in Europe

NASA Astrophysics Data System (ADS)

Babrowski, Sonja; Heinrichs, Heidi; Jochem, Patrick; Fichtner, Wolf

2014-06-01

Many governments highly encourage electric mobility today, aiming at a high market penetration. This development would bring forth an impact on the energy system, which strongly depends on the driving and charging behavior of the users. While an uncontrolled immediate charging might strain the local grid and/or higher peak loads, there are benefits to be gained by a controlled charging. We examine six European mobility studies in order to display the effects of controlled and uncontrolled unidirectional charging. Taking into account country-specific driving patterns, we generate for each country a charging load curve corresponding to uncontrolled charging and consider the corresponding parking time at charging facilities in order to identify load shift potentials. The main results are that besides the charging power of the vehicles, the possibility to charge at the work place has a significant influence on the uncontrolled charging curve. Neither national nor regional differences are as significant. When charging is only possible at home, the vehicle availability at charging facilities during the day for all countries is at least 24%. With the additional possibility to charge at work, at least 45% are constantly available. Accordingly, we identified a big potential for load shifting through controlled charging.

The Cutting Edge of Affinity Electrophoresis Technology

PubMed Central

Kinoshita, Eiji; Kinoshita-Kikuta, Emiko; Koike, Tohru

2015-01-01

Affinity electrophoresis is an important technique that is widely used to separate and analyze biomolecules in the fields of biology and medicine. Both quantitative and qualitative information can be gained through affinity electrophoresis. Affinity electrophoresis can be applied through a variety of strategies, such as mobility shift electrophoresis, charge shift electrophoresis or capillary affinity electrophoresis. These strategies are based on changes in the electrophoretic patterns of biological macromolecules that result from interactions or complex-formation processes that induce changes in the size or total charge of the molecules. Nucleic acid fragments can be characterized through their affinity to other molecules, for example transcriptional factor proteins. Hydrophobic membrane proteins can be identified by means of a shift in the mobility induced by a charged detergent. The various strategies have also been used in the estimation of association/disassociation constants. Some of these strategies have similarities to affinity chromatography, in that they use a probe or ligand immobilized on a supported matrix for electrophoresis. Such methods have recently contributed to profiling of major posttranslational modifications of proteins, such as glycosylation or phosphorylation. Here, we describe advances in analytical techniques involving affinity electrophoresis that have appeared during the last five years. PMID:28248262

Omni-directional L-band antenna for mobile communications

NASA Technical Reports Server (NTRS)

Kim, C. S.; Moldovan, N.; Kijesky, J.

1988-01-01

The principle and design of an L-band omni-directional mobile communication antenna are discussed. The antenna is a circular wave guide aperture with hybrid circuits attached to higher order mode excitation. It produces polarized and symmetric two split beams in elevation. The circular waveguide is fed by eight probes with a 90 degree phase shift between their inputs. Radiation pattern characteristics are controlled by adjusting the aperture diameter and mode excitation. This antenna satisfies gain requirements as well as withstanding the harsh environment.

Trellis coded multilevel DPSK system with doppler correction for mobile satellite channels

NASA Technical Reports Server (NTRS)

Divsalar, Dariush (Inventor); Simon, Marvin K. (Inventor)

1991-01-01

A trellis coded multilevel differential phase shift keyed mobile communication system. The system of the present invention includes a trellis encoder for translating input signals into trellis codes; a differential encoder for differentially encoding the trellis coded signals; a transmitter for transmitting the differentially encoded trellis coded signals; a receiver for receiving the transmitted signals; a differential demodulator for demodulating the received differentially encoded trellis coded signals; and a trellis decoder for decoding the differentially demodulated signals.

Fluorescence of nitrobenzoxadiazole (NBD)-labeled lipids in model membranes is connected not to lipid mobility but to probe location.

PubMed

Amaro, Mariana; Filipe, Hugo A L; Prates Ramalho, J P; Hof, Martin; Loura, Luís M S

2016-03-14

Nitrobenzoxadiazole (NBD)-labeled lipids are popular fluorescent membrane probes. However, the understanding of important aspects of the photophysics of NBD remains incomplete, including the observed shift in the emission spectrum of NBD-lipids to longer wavelengths following excitation at the red edge of the absorption spectrum (red-edge excitation shift or REES). REES of NBD-lipids in membrane environments has been previously interpreted as reflecting restricted mobility of solvent surrounding the fluorophore. However, this requires a large change in the dipole moment (Δμ) of NBD upon excitation. Previous calculations of the value of Δμ of NBD in the literature have been carried out using outdated semi-empirical methods, leading to conflicting values. Using up-to-date density functional theory methods, we recalculated the value of Δμ and verified that it is rather small (∼2 D). Fluorescence measurements confirmed that the value of REES is ∼16 nm for 1,2-dioleoyl-sn-glycero-3-phospho-l-serine-N-(NBD) (NBD-PS) in dioleoylphosphatidylcholine vesicles. However, the observed shift is independent of both the temperature and the presence of cholesterol and is therefore insensitive to the mobility and hydration of the membrane. Moreover, red-edge excitation leads to an increased contribution of the decay component with a shorter lifetime, whereas time-resolved emission spectra of NBD-PS displayed an atypical blue shift following excitation. This excludes restrictions to solvent relaxation as the cause of the measured REES and TRES of NBD, pointing instead to the heterogeneous transverse location of probes as the origin of these effects. The latter hypothesis was confirmed by molecular dynamics simulations, from which the calculated heterogeneity of the hydration and location of NBD correlated with the measured fluorescence lifetimes/REES. Globally, our combination of theoretical and experiment-based techniques has led to a considerably improved understanding of the photophysics of NBD and a reinterpretation of its REES in particular.

Activation of a development-specific gene, dofA, by FruA, an essential transcription factor for development of Myxococcus xanthus.

PubMed

Ueki, Toshiyuki; Inouye, Sumiko

2005-12-01

FruA is an essential transcription factor for Myxococcus xanthus development. The expression of tps and dofA genes is fruA dependent. In this study, we show by gel shift and footprint assays with the C-terminal DNA-binding domain of FruA and by a lacZ fusion assay that FruA may directly activate dofA expression during development.

Vacuum Bloch-Siegert shift in Landau polaritons with ultra-high cooperativity

NASA Astrophysics Data System (ADS)

Li, Xinwei; Bamba, Motoaki; Zhang, Qi; Fallahi, Saeed; Gardner, Geoff C.; Gao, Weilu; Lou, Minhan; Yoshioka, Katsumasa; Manfra, Michael J.; Kono, Junichiro

2018-06-01

A two-level system resonantly interacting with an a.c. magnetic or electric field constitutes the physical basis of diverse phenomena and technologies. However, Schrödinger's equation for this seemingly simple system can be solved exactly only under the rotating-wave approximation, which neglects the counter-rotating field component. When the a.c. field is sufficiently strong, this approximation fails, leading to a resonance-frequency shift known as the Bloch-Siegert shift. Here, we report the vacuum Bloch-Siegert shift, which is induced by the ultra-strong coupling of matter with the counter-rotating component of the vacuum fluctuation field in a cavity. Specifically, an ultra-high-mobility two-dimensional electron gas inside a high-Q terahertz cavity in a quantizing magnetic field revealed ultra-narrow Landau polaritons, which exhibited a vacuum Bloch-Siegert shift up to 40 GHz. This shift, clearly distinguishable from the photon-field self-interaction effect, represents a unique manifestation of a strong-field phenomenon without a strong field.

Bladder inflammatory transcriptome in response to tachykinins: Neurokinin 1 receptor-dependent genes and transcription regulatory elements

PubMed Central

Saban, Ricardo; Simpson, Cindy; Vadigepalli, Rajanikanth; Memet, Sylvie; Dozmorov, Igor; Saban, Marcia R

2007-01-01

Background Tachykinins (TK), such as substance P, and their neurokinin receptors which are ubiquitously expressed in the human urinary tract, represent an endogenous system regulating bladder inflammatory, immune responses, and visceral hypersensitivity. Increasing evidence correlates alterations in the TK system with urinary tract diseases such as neurogenic bladders, outflow obstruction, idiopathic detrusor instability, and interstitial cystitis. However, despite promising effects in animal models, there seems to be no published clinical study showing that NK-receptor antagonists are an effective treatment of pain in general or urinary tract disorders, such as detrusor overactivity. In order to search for therapeutic targets that could block the tachykinin system, we set forth to determine the regulatory network downstream of NK1 receptor activation. First, NK1R-dependent transcripts were determined and used to query known databases for their respective transcription regulatory elements (TREs). Methods An expression analysis was performed using urinary bladders isolated from sensitized wild type (WT) and NK1R-/- mice that were stimulated with saline, LPS, or antigen to provoke inflammation. Based on cDNA array results, NK1R-dependent genes were selected. PAINT software was used to query TRANSFAC database and to retrieve upstream TREs that were confirmed by electrophoretic mobility shift assays. Results The regulatory network of TREs driving NK1R-dependent genes presented cRel in a central position driving 22% of all genes, followed by AP-1, NF-kappaB, v-Myb, CRE-BP1/c-Jun, USF, Pax-6, Efr-1, Egr-3, and AREB6. A comparison between NK1R-dependent and NK1R-independent genes revealed Nkx-2.5 as a unique discriminator. In the presence of NK1R, Nkx2-5 _01 was significantly correlated with 36 transcripts which included several candidates for mediating bladder development (FGF) and inflammation (PAR-3, IL-1R, IL-6, α-NGF, TSP2). In the absence of NK1R, the matrix Nkx2-5_02 had a predominant participation driving 8 transcripts, which includes those involved in cancer (EYA1, Trail, HSF1, and ELK-1), smooth-to-skeletal muscle trans-differentiation, and Z01, a tight-junction protein, expression. Electrophoretic mobility shift assays confirmed that, in the mouse urinary bladder, activation of NK1R by substance P (SP) induces both NKx-2.5 and NF-kappaB translocations. Conclusion This is the first report describing a role for Nkx2.5 in the urinary tract. As Nkx2.5 is the unique discriminator of NK1R-modulated inflammation, it can be imagined that in the near future, new based therapies selective for controlling Nkx2.5 activity in the urinary tract may be used in the treatment in a number of bladder disorders. PMID:17519035

ScaMo: Realisation of an OO-functional DSL for cross platform mobile applications development

NASA Astrophysics Data System (ADS)

Macos, Dragan; Solymosi, Andreas

2013-10-01

The software market is dynamically changing: the Internet is going mobile, the software applications are shifting from the desktop hardware onto the mobile devices. The largest markets are the mobile applications for iOS, Android and Windows Phone and for the purpose the typical programming languages include Objective-C, Java and C ♯. The realization of the native applications implies the integration of the developed software into the environments of mentioned mobile operating systems to enable the access to different hardware components of the devices: GPS module, display, GSM module, etc. This paper deals with the definition and possible implementation of an environment for the automatic application generation for multiple mobile platforms. It is based on a DSL for mobile application development, which includes the programming language Scala and a DSL defined in Scala. As part of a multi-stage cross-compiling algorithm, this language is translated into the language of the affected mobile platform. The advantage of our method lies in the expressiveness of the defined language and the transparent source code translation between different languages, which implies, for example, the advantages of debugging and development of the generated code.

A high-throughput in vitro ring assay for vasoactivity using magnetic 3D bioprinting

PubMed Central

Tseng, Hubert; Gage, Jacob A.; Haisler, William L.; Neeley, Shane K.; Shen, Tsaiwei; Hebel, Chris; Barthlow, Herbert G.; Wagoner, Matthew; Souza, Glauco R.

2016-01-01

Vasoactive liabilities are typically assayed using wire myography, which is limited by its high cost and low throughput. To meet the demand for higher throughput in vitro alternatives, this study introduces a magnetic 3D bioprinting-based vasoactivity assay. The principle behind this assay is the magnetic printing of vascular smooth muscle cells into 3D rings that functionally represent blood vessel segments, whose contraction can be altered by vasodilators and vasoconstrictors. A cost-effective imaging modality employing a mobile device is used to capture contraction with high throughput. The goal of this study was to validate ring contraction as a measure of vasoactivity, using a small panel of known vasoactive drugs. In vitro responses of the rings matched outcomes predicted by in vivo pharmacology, and were supported by immunohistochemistry. Altogether, this ring assay robustly models vasoactivity, which could meet the need for higher throughput in vitro alternatives. PMID:27477945

Frequency-dependent polarization-angle-phase-shift in the microwave-induced magnetoresistance oscillations

DOE Office of Scientific and Technical Information (OSTI.GOV)

Liu, Han-Chun; Ye, Tianyu; Mani, R. G.

2015-02-14

Linear polarization angle, θ, dependent measurements of the microwave radiation-induced oscillatory magnetoresistance, R{sub xx}, in high mobility GaAs/AlGaAs 2D electron devices have shown a θ dependence in the oscillatory amplitude along with magnetic field, frequency, and extrema-dependent phase shifts, θ{sub 0}. Here, we suggest a microwave frequency dependence of θ{sub 0}(f) using an analysis that averages over other smaller contributions, when those contributions are smaller than estimates of the experimental uncertainty.

Trellis coding with Continuous Phase Modulation (CPM) for satellite-based land-mobile communications

NASA Technical Reports Server (NTRS)

1989-01-01

This volume of the final report summarizes the results of our studies on the satellite-based mobile communications project. It includes: a detailed analysis, design, and simulations of trellis coded, full/partial response CPM signals with/without interleaving over various Rician fading channels; analysis and simulation of computational cutoff rates for coherent, noncoherent, and differential detection of CPM signals; optimization of the complete transmission system; analysis and simulation of power spectrum of the CPM signals; design and development of a class of Doppler frequency shift estimators; design and development of a symbol timing recovery circuit; and breadboard implementation of the transmission system. Studies prove the suitability of the CPM system for mobile communications.

Cycle of charge carrier states with formation and extinction of a floating gate in an ambipolar tetracyanoquaterthienoquinoid-based field-effect transistor

NASA Astrophysics Data System (ADS)

Itoh, Takuro; Toyota, Taro; Higuchi, Hiroyuki; Matsushita, Michio M.; Suzuki, Kentaro; Sugawara, Tadashi

2017-03-01

A tetracyanoquaterthienoquinoid (TCT4Q)-based field effect transistor is characterized by the ambipolar transfer characteristics and the facile shift of the threshold voltage induced by the bias stress. The trapping and detrapping kinetics of charge carriers was investigated in detail by the temperature dependence of the decay of source-drain current (ISD). We found a repeatable formation of a molecular floating gate is derived from a 'charge carrier-and-gate' cycle comprising four stages, trapping of mobile carriers, formation of a floating gate, induction of oppositely charged mobile carriers, and recombination between mobile and trapped carriers to restore the initial state.

Studies on wound healing potential of polyherbal formulation using in vitro and in vivo assays.

PubMed

Talekar, Yogesh P; Apte, Kishori G; Paygude, Shubhangi V; Tondare, Prasad R; Parab, Pradeep B

The use of herbal plant extracts in wound healing is known through decades, but it is necessary to provide scientific data through reverse pharmacology. The aim of the present study is to find the mechanism behind the healing of wounds using in vitro and in vivo assays. The study was designed to determine proliferation and mobilization of fibroblast and keratinocytes at the site of injury, angiogenesis at the site of healing and reduction in oxidative stress while healing. In our earlier studies it was observed that herbal extract of Vitex negundo L. (VN), Emblica officinalis Gaertn (EO), and Tridax procumbens L. (TP) showed rapid regeneration of skin, wound contraction and collagen synthesis at the site of injury in excision wound model. In the present study the cell mobilization was monitored in the scratch assay on L929 fibroblastic cell line and HaCaT keratinocytes cell line under the influence of aqueous plant extracts and its formulation. This formulation was also assessed for its angiogenic potential using CAM assay. Study was carried out to probe synergistic effect of polyherbal formulation using excision model in rat. The formulation was found to contain high amount of flavonoids, tannins and phenols which facilitate wound healing. At 20 μg/ml concentration of formulation, significant increase in tertiary and quaternary vessels were observed due to angiogenic potential of formulation. Formulation at the concentration of 3 μg/ml and 5 μg/ml showed significant mobilization of keratinocytes and fibroblasts respectively at the site of injury. Polyherbal formulation showed rapid regeneration of skin and wound contraction. Biochemical parameters like hydroxyproline, hexosamine and collagen turnover was increased in test drug treated animals as compared to untreated, whereas antioxidants such as catalase and GSH were increased significantly and decreased amount of tissue MDA was observed. Polyherbal formulation prepared from the plant extracts accelerates wound healing process by proliferation and mobilization of fibroblast and keratinocytes, and angiogenesis at the site of injury. It also shows fast contraction of wound with its beneficial improvement in tissue biochemical and antioxidant parameters. Copyright © 2017 Transdisciplinary University, Bangalore and World Ayurveda Foundation. Published by Elsevier B.V. All rights reserved.

Cloud-based crowd sensing: a framework for location-based crowd analyzer and advisor

NASA Astrophysics Data System (ADS)

Aishwarya, K. C.; Nambi, A.; Hudson, S.; Nadesh, R. K.

2017-11-01

Cloud computing is an emerging field of computer science to integrate and explore large and powerful computing systems and storages for personal and also for enterprise requirements. Mobile Cloud Computing is the inheritance of this concept towards mobile hand-held devices. Crowdsensing, or to be precise, Mobile Crowdsensing is the process of sharing resources from an available group of mobile handheld devices that support sharing of different resources such as data, memory and bandwidth to perform a single task for collective reasons. In this paper, we propose a framework to use Crowdsensing and perform a crowd analyzer and advisor whether the user can go to the place or not. This is an ongoing research and is a new concept to which the direction of cloud computing has shifted and is viable for more expansion in the near future.

Structural characterization by NMR of the natively unfolded extracellular domain of beta-dystroglycan: toward the identification of the binding epitope for alpha-dystroglycan.

PubMed

Bozzi, Manuela; Bianchi, Marzia; Sciandra, Francesca; Paci, Maurizio; Giardina, Bruno; Brancaccio, Andrea; Cicero, Daniel O

2003-11-25

Dystroglycan (DG) is an adhesion molecule playing a crucial role for tissue stability during both early embriogenesis and adulthood and is composed by two tightly interacting subunits: alpha-DG, membrane-associated and highly glycosylated, and the transmembrane beta-DG. Recently, by solid-phase binding assays and NMR experiments, we have shown that the C-terminal domain of alpha-DG interacts with a recombinant extracellular fragment of beta-DG (positions 654-750) independently from glycosylation and that the linear binding epitope is located between residues 550 and 565 of alpha-DG. In order to elucidate which moieties of beta-DG are specifically involved in the complex with alpha-DG, the ectodomain has been recombinantly expressed and purified in a labeled ((13)C,(15)N) form and studied by multidimensional NMR. Although it represents a natively unfolded protein domain, we obtained an almost complete backbone assignment. Chemical shift index, (1)H-(15)N heteronuclear single-quantum coherence and nuclear Overhauser effect (HSQC-NOESY) spectra and (3)J(HN,H)(alpha) coupling constant values confirm that this protein is highly disordered, but (1)H-(15)N steady-state NOE experiments indicate that the protein presents two regions of different mobility. The first one, between residues 659 and 722, is characterized by a limited degree of mobility, whereas the C-terminal portion, containing about 30 amino acids, is highly flexible. The binding of beta-DG(654-750) to the C-terminal region of the alpha subunit, alpha-DG(485-620), has been investigated, showing that the region of beta-DG(654-750) between residues 691 and 719 is involved in the interaction.

Improved Tandem Measurement Techniques for Aerosol Particle Analysis

NASA Astrophysics Data System (ADS)

Rawat, Vivek Kumar

Non-spherical, chemically inhomogeneous (complex) nanoparticles are encountered in a number of natural and engineered environments, including combustion systems (which produces highly non-spherical aggregates), reactors used in gas-phase materials synthesis of doped or multicomponent materials, and in ambient air. These nanoparticles are often highly diverse in size, composition and shape, and hence require determination of property distribution functions for accurate characterization. This thesis focuses on development of tandem mobility-mass measurement techniques coupled with appropriate data inversion routines to facilitate measurement of two dimensional size-mass distribution functions while correcting for the non-idealities of the instruments. Chapter 1 provides the detailed background and motivation for the studies performed in this thesis. In chapter 2, the development of an inversion routine is described which is employed to determine two dimensional size-mass distribution functions from Differential Mobility Analyzer-Aerosol Particle Mass analyzer tandem measurements. Chapter 3 demonstrates the application of the two dimensional distribution function to compute cumulative mass distribution function and also evaluates the validity of this technique by comparing the calculated total mass concentrations to measured values for a variety of aerosols. In Chapter 4, this tandem measurement technique with the inversion routine is employed to analyze colloidal suspensions. Chapter 5 focuses on application of a transverse modulation ion mobility spectrometer coupled with a mass spectrometer to study the effect of vapor dopants on the mobility shifts of sub 2 nm peptide ion clusters. These mobility shifts are then compared to models based on vapor uptake theories. Finally, in Chapter 6, a conclusion of all the studies performed in this thesis is provided and future avenues of research are discussed.

More screen operation than calling: the results of observing cyclists' behaviour while using mobile phones.

PubMed

de Waard, Dick; Westerhuis, Frank; Lewis-Evans, Ben

2015-03-01

Operating a mobile telephone while riding a bicycle is fairly common practice in the Netherlands, yet it is unknown if this use is stable or increasing. As such, whether the prevalence of mobile phone use while cycling has changed over the past five years was studied via on-road observation. In addition the impact of mobile phone use on lateral position, i.e. distance from the front wheel to the curb, was also examined to see if it compared to the results seen in previous experimental studies. Bicyclists were observed at six different locations and their behaviour was scored. It was found that compared to five years ago the use of mobile phones while cycling has changed, not in frequency, but in how cyclists were operating their phones. As found in 2008, three percent of the bicyclists were observed to be operating a phone, but a shift from calling (0.7% of cyclists observed) to operating (typing, texting, 2.3% of cyclists) was found. In 2008 nearly the complete opposite usage was observed: 2.2% of the cyclists were calling and 0.6% was texting. Another finding was that effects on lateral position were similar to those seen in experimental studies in that cyclists using a phone maintained a cycling position which was further away from the curb. It was also found that when at an intersection, cyclist's operating their phone made less head movements to the right than cyclists who were just cycling. This shift from calling to screen operation, when combined with the finding related to reduced head movements at intersections, is worrying and potentially dangerous. Copyright © 2015 Elsevier Ltd. All rights reserved.

Effect of Phase Shift from Corals to Zoantharia on Reef Fish Assemblages

PubMed Central

Cruz, Igor C. S.; Loiola, Miguel; Albuquerque, Tiago; Reis, Rodrigo; de Anchieta C. C. Nunes, José; Reimer, James D.; Mizuyama, Masaru; Kikuchi, Ruy K. P.; Creed, Joel C.

2015-01-01

Consequences of reef phase shifts on fish communities remain poorly understood. Studies on the causes, effects and consequences of phase shifts on reef fish communities have only been considered for coral-to-macroalgae shifts. Therefore, there is a large information gap regarding the consequences of novel phase shifts and how these kinds of phase shifts impact on fish assemblages. This study aimed to compare the fish assemblages on reefs under normal conditions (relatively high cover of corals) to those which have shifted to a dominance of the zoantharian Palythoa cf. variabilis on coral reefs in Todos os Santos Bay (TSB), Brazilian eastern coast. We examined eight reefs, where we estimated cover of corals and P. cf. variabilis and coral reef fish richness, abundance and body size. Fish richness differed significantly between normal reefs (48 species) and phase-shift reefs (38 species), a 20% reduction in species. However there was no difference in fish abundance between normal and phase shift reefs. One fish species, Chaetodon striatus, was significantly less abundant on normal reefs. The differences in fish assemblages between different reef phases was due to differences in trophic groups of fish; on normal reefs carnivorous fishes were more abundant, while on phase shift reefs mobile invertivores dominated. PMID:25629532

The effects of shift work and time of day on fine motor control during handwriting.

PubMed

Hölzle, Patricia; Hermsdörfer, Joachim; Vetter, Céline

2014-01-01

Handwriting is an elaborate and highly automatised skill relying on fine motor control. In laboratory conditions handwriting kinematics are modulated by the time of day. This study investigated handwriting kinematics in a rotational shift system and assessed whether similar time of day fluctuations at the work place can be observed. Handwriting performance was measured in two tasks of different levels of complexity in 34 shift workers across morning (6:00-14:00), evening (14:00-22:00) and night shifts (22:00-6:00). Participants were tested during all three shifts in 2-h intervals with mobile testing devices. We calculated average velocity, script size and writing frequency to quantify handwriting kinematics and fluency. Average velocity and script size were significantly affected by the shift work schedule with the worst performance during morning shifts and the best performance during evening shifts. Our data are of high economic relevance as fine motor skills are indispensable for accurate and effective production at the work place. Handwriting is one of the most complex fine motor skills in humans, which is frequently performed in daily life. In this study, we tested handwriting repeatedly at the work place in a rotational shift system. We found slower handwriting velocity and reduced script size during morning shifts.

Detection of DNA damage in workers exposed to JP-8 jet fuel.

PubMed

Krieg, Edward F; Mathias, Patricia I; Toennis, Christine A; Clark, John C; Marlow, Kate L; B'hymer, Clayton; Singh, Narendra P; Gibson, Roger L; Butler, Mary Ann

2012-09-18

The genotoxicity of jet propulsion fuel 8 (JP-8) was assessed in the leukocytes of archived blood specimens from U.S. Air Force personnel using the comet assay. No differences in mean comet assay measurements were found between low, moderate, and high exposure groups before or after a 4h work shift. Before the work shift, mean tail DNA and mean tail (Olive) moment increased as the concentration of benzene measured in end-exhaled breath increased, indicating that prior environmental or work-related exposures to benzene produced DNA damage. The number of cells with highly damaged DNA decreased as the pre-shift benzene concentration in breath increased. It is not clear why the decrease is occurring. Mean tail DNA and mean tail (Olive) moment decreased as the concentrations of benzene and naphthalene measured in breath immediately after the work shift increased. These inverse relationships may reflect a slower rate of absorption or a faster rate of expiration of benzene in the lung. The number of cells with highly damaged DNA increased as the concentration of urinary (2-methoxyethoxy)acetic acid (MEAA) increased. This relationship was not seen in urinary MEAA adjusted for creatinine. MEAA is a metabolite of the deicing agent 2-(2-methoxyethoxy)ethanol contained in JP-8. MEAA or a component of JP-8 correlated with MEAA may have a toxic effect on DNA. Published by Elsevier B.V.

Activation of a Development-Specific Gene, dofA, by FruA, an Essential Transcription Factor for Development of Myxococcus xanthus

PubMed Central

Ueki, Toshiyuki; Inouye, Sumiko

2005-01-01

FruA is an essential transcription factor for Myxococcus xanthus development. The expression of tps and dofA genes is fruA dependent. In this study, we show by gel shift and footprint assays with the C-terminal DNA-binding domain of FruA and by a lacZ fusion assay that FruA may directly activate dofA expression during development. PMID:16321956

Stat5-mediated regulation of the human type II 3beta-hydroxysteroid dehydrogenase/delta5-delta4 isomerase gene: activation by prolactin.

PubMed

Feltus, F A; Groner, B; Melner, M H

1999-07-01

Altered PRL levels are associated with infertility in women. Molecular targets at which PRL elicits these effects have yet to be determined. These studies demonstrate transcriptional regulation by PRL of the gene encoding the final enzymatic step in progesterone biosynthesis: 3beta-hydroxysteroid dehydrogenase/delta5-delta4 isomerase (3beta-HSD). A 9/9 match with the consensus Stat5 response element was identified at -110 to -118 in the human Type II 3beta-HSD promoter. 3beta-HSD chloramphenicol acetyltransferase (CAT) reporter constructs containing either an intact or mutated Stat5 element were tested for PRL activation. Expression vectors for Stat5 and the PRL receptor were cotransfected with a -300 --> +45 3beta-HSD CAT reporter construct into HeLa cells, which resulted in a 21-fold increase in reporter activity in the presence of PRL. Promoter activity showed an increased response with a stepwise elevation of transfected Stat5 expression or by treatment with increasing concentrations of PRL (max, 250 ng/ml). This effect was dramatically reduced when the putative Stat5 response element was removed by 5'-deletion of the promoter or by the introduction of a 3-bp mutation into critical nucleotides in the element. Furthermore, 32P-labeled promoter fragments containing the Stat5 element were shifted in electrophoretic mobility shift assay experiments using nuclear extracts from cells treated with PRL, and this complex was supershifted with antibodies to Stat5. These results demonstrate that PRL has the ability to regulate expression of a key human enzyme gene (type II 3beta-HSD) in the progesterone biosynthetic pathway, which is essential for maintaining pregnancy.

Allosteric Inhibition of Human Porphobilinogen Synthase*

PubMed Central

Lawrence, Sarah H.; Ramirez, Ursula D.; Selwood, Trevor; Stith, Linda; Jaffe, Eileen K.

2009-01-01

Porphobilinogen synthase (PBGS) catalyzes the first common step in tetrapyrrole (e.g. heme, chlorophyll) biosynthesis. Human PBGS exists as an equilibrium of high activity octamers, low activity hexamers, and alternate dimer configurations that dictate the stoichiometry and architecture of further assembly. It is posited that small molecules can be found that inhibit human PBGS activity by stabilizing the hexamer. Such molecules, if present in the environment, could potentiate disease states associated with reduced PBGS activity, such as lead poisoning and ALAD porphyria, the latter of which is associated with human PBGS variants whose quaternary structure equilibrium is shifted toward the hexamer (Jaffe, E. K., and Stith, L. (2007) Am. J. Hum. Genet. 80, 329–337). Hexamer-stabilizing inhibitors of human PBGS were identified using in silico prescreening (docking) of ∼111,000 structures to a hexamer-specific surface cavity of a human PBGS crystal structure. Seventy-seven compounds were evaluated in vitro; three provided 90–100% conversion of octamer to hexamer in a native PAGE mobility shift assay. Based on chemical purity, two (ML-3A9 and ML-3H2) were subjected to further evaluation of their effect on the quaternary structure equilibrium and enzymatic activity. Naturally occurring ALAD porphyria-associated human PBGS variants are shown to have an increased susceptibility to inhibition by both ML-3A9 and ML-3H2. ML-3H2 is a structural analog of amebicidal drugs, which have porphyria-like side effects. Data support the hypothesis that human PBGS hexamer stabilization may explain these side effects. The current work identifies allosteric ligands of human PBGS and, thus, identifies human PBGS as a medically relevant allosteric enzyme. PMID:19812033

Genomic organization of the Neurospora crassa gsn gene: possible involvement of the STRE and HSE elements in the modulation of transcription during heat shock.

PubMed

Freitas, F Zanolli; Bertolini, M C

2004-12-01

Glycogen synthase, an enzyme involved in glycogen biosynthesis, is regulated by phosphorylation and by the allosteric ligand glucose-6-phosphate (G6P). In addition, enzyme levels can be regulated by changes in gene expression. We recently cloned a cDNA for glycogen synthase ( gsn) from Neurospora crassa, and showed that gsn transcription decreased when cells were exposed to heat shock (shifted from 30 degrees C to 45 degrees C). In order to understand the mechanisms that control gsn expression, we isolated the gene, including its 5' and 3' flanking regions, from the genome of N. crassa. An ORF of approximately 2.4 kb was identified, which is interrupted by four small introns (II-V). Intron I (482 bp) is located in the 5'UTR region. Three putative Transcription Initiation Sites (TISs) were mapped, one of which lies downstream of a canonical TATA-box sequence (5'-TGTATAAA-3'). Analysis of the 5'-flanking region revealed the presence of putative transcription factor-binding sites, including Heat Shock Elements (HSEs) and STress Responsive Elements (STREs). The possible involvement of these motifs in the negative regulation of gsn transcription was investigated using Electrophoretic Mobility Shift Assays (EMSA) with nuclear extracts of N. crassa mycelium obtained before and after heat shock, and DNA fragments encompassing HSE and STRE elements from the 5'-flanking region. While elements within the promoter region are involved in transcription under heat shock, elements in the 5'UTR intron may participate in transcription during vegetative growth. The results thus suggest that N. crassa possesses trans -acting elements that interact with the 5'-flanking region to regulate gsn transcription during heat shock and vegetative growth.

Resveratrol-induced transcriptional up-regulation of ASMase (SMPD1) of human leukemia and cancer cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mizutani, Naoki; College of Life and Health Sciences, Chubu University, Kasugai; Omori, Yukari

2016-02-19

Resveratrol (RSV) is a plant-derived phytoalexin present in plants, whose pleiotropic effects for health benefits have been previously reported. Its anti-cancer activity is among the current topics for novel cancer treatment. Here, effects of RSV on cell proliferation and the sphingolipid metabolism of K562, a human leukemia cell line, were analyzed. Some experiments were also performed in HCT116, a human colon cancer cell line. RSV inhibited cell proliferation of both cell lines. Increased cellular ceramide and decreased sphingomyelin and S1P by RSV were observed in RSV-treated K562 cells. Further analysis revealed that acid sphingomyelinase mRNA and enzyme activity levels were increasedmore » by RSV. Desipramine, a functional ASMase inhibitor, prevented RSV-induced ceramide increase. RSV increased ATF3, EGR1, EGR3 proteins and phosphorylated c-Jun and FOXO3. However, co-transfection using these transcription factor expression vectors and ASMase promoter reporter vector revealed positive effects of EGR1 and EGR3 but not others. Electrophoresis mobility shift assay (EMSA) and Chromatin immunoprecipitation (ChIP) assay demonstrated the direct binding of EGR1/3 transcription factors with ASMase 5′-promoter. These results indicate that increased EGR1/3 and ASMase expression play an important role in cellular ceramide increase by RSV treatment. - Highlights: • Resveratrol inhibited cell proliferation of K562 and HCT116 cells. • Resveratrol increased cellular ceramide and decreased sphingomyelin and S1P. • ASMase mRNA and activity were increased with resveratrol. • ASMase inhibition suppressed RSV-induced ceramide accumulation. • Increased ASMase transcription was at least partially due to EGR family proteins.« less

Nitric Oxide Increases the Decay of Matrix Metalloproteinase 9 mRNA by Inhibiting the Expression of mRNA-Stabilizing Factor HuR

PubMed Central

Akool, El-Sayed; Kleinert, Hartmut; Hamada, Farid M. A.; Abdelwahab, Mohamed H.; Förstermann, Ulrich; Pfeilschifter, Josef; Eberhardt, Wolfgang

2003-01-01

Dysregulation of extracellular matrix turnover is an important feature of many inflammatory processes. Rat renal mesangial cells express high levels of matrix metalloproteinase 9 (MMP-9) in response to inflammatory cytokines such as interleukin-1 beta. We demonstrate that NO does strongly destabilize MMP-9 mRNA, since different luciferase reporter gene constructs containing the MMP-9 3′ untranslated region (UTR) displayed significant reduced luciferase activity in response to the presence of NO. Moreover, by use of an in vitro degradation assay we found that the cytoplasmic fractions of NO-treated cells contained a higher capacity to degrade MMP-9 transcripts than those obtained from control cells. An RNA electrophoretic mobility shift assay demonstrated that three of four putative AU-rich elements present in the 3′ UTR of MMP-9 were constitutively occupied by the mRNA-stabilizing factor HuR and that the RNA binding was strongly attenuated by the presence of NO. The addition of recombinant glutathione transferase-HuR prevented the rapid decay of MMP-9 mRNA, whereas the addition of a neutralizing anti-HuR antibody caused an acceleration of MMP-9 mRNA degradation. Furthermore, the expression of HuR mRNA and protein was significantly reduced by exogenously and endogenously produced NO. These inhibitory effects were mimicked by the cGMP analog 8-bromo-cGMP and reversed by LY-83583, an inhibitor of soluble guanylyl cyclase. These results demonstrate that NO acts in a cGMP-dependent mechanism to inhibit the expression level of HuR, thereby reducing the stability of MMP-9 mRNA. PMID:12832476

Orphan nuclear receptor Nur77 is a novel negative regulator of endothelin-1 expression in vascular endothelial cells.

PubMed

Qin, Qing; Chen, Ming; Yi, Bing; You, Xiaohua; Yang, Ping; Sun, Jianxin

2014-12-01

Endothelin-1 (ET-1) produced by vascular endothelial cells plays essential roles in the regulation of vascular tone and development of cardiovascular diseases. The objective of this study is to identify novel regulators implicated in the regulation of ET-1 expression in vascular endothelial cells (ECs). By using quantitative real-time PCR (qRT-PCR) and enzyme-linked immunosorbent assay (ELISA), we show that either ectopic expression of orphan nuclear receptor Nur77 or pharmacological activation of Nur77 by 6-mercaptopurine (6-MP) substantially inhibits ET-1 expression in human umbilical vein endothelial cells (HUVECs), under both basal and thrombin-stimulated conditions. Furthermore, thrombin-stimulated ET expression is significantly augmented in both Nur77 knockdown ECs and aort from Nur77 knockout mice, suggesting that Nur77 is a negative regulator of ET-1 expression. Inhibition of ET-1 expression by Nur77 occurs at gene transcriptional levels, since Nur77 potently inhibits ET-1 promoter activity, without affecting ET-1 mRNA stability. As shown in electrophoretic mobility shift assay (EMSA), Nur77 overexpression markedly inhibits both basal and thrombin-stimulated transcriptional activity of AP-1. Mechanistically, we demonstrate that Nur77 specially interacts with c-Jun and inhibits AP-1 dependent c-Jun promoter activity, which leads to a decreased expression of c-Jun, a critical component involved in both AP-1 transcriptional activity and ET-1 expression in ECs. These findings demonstrate that Nur77 is a novel negative regulator of ET-1 expression in vascular ECs through an inhibitory interaction with the c-Jun/AP-1 pathway. Activation of Nur77 may represent a useful therapeutic strategy for preventing certain cardiovascular diseases, such as atherosclerosis and pulmonary artery hypertension. Copyright © 2014 Elsevier Ltd. All rights reserved.

Capturing the target genes of BldD in Saccharopolyspora erythraea using improved genomic SELEX method.

PubMed

Wu, Hang; Mao, Yongrong; Chen, Meng; Pan, Hui; Huang, Xunduan; Ren, Min; Wu, Hao; Li, Jiali; Xu, Zhongdong; Yuan, Hualing; Geng, Ming; Weaver, David T; Zhang, Lixin; Zhang, Buchang

2015-03-01

BldD (SACE_2077), a key developmental regulator in actinomycetes, is the first identified transcriptional factor in Saccharopolyspora erythraea positively regulating erythromycin production and morphological differentiation. Although the BldD of S. erythraea binds to the promoters of erythromycin biosynthetic genes, the interaction affinities are relatively low, implying the existence of its other target genes in S. erythraea. Through the genomic systematic evolution of ligands by exponential enrichment (SELEX) method that we herein improved, four DNA sequences of S. erythraea A226, corresponding to the promoter regions of SACE_0306 (beta-galactosidase), SACE_0811 (50S ribosomal protein L25), SACE_3410 (fumarylacetoacetate hydrolase), and SACE_6014 (aldehyde dehydrogenase), were captured with all three BldD concentrations of 0.5, 1, and 2 μM, while the previously identified intergenic regions of eryBIV-eryAI and ermE-eryCI plus the promoter region of SACE_7115, the amfC homolog for aerial mycelium formation, could be captured only when the BldD's concentration reached 2 μM. Electrophoretic mobility shift assay (EMSA) analysis indicated that BldD specifically bound to above seven DNA sequences, and quantitative real-time PCR (qRT-PCR) assay showed that the transcriptional levels of the abovementioned target genes decreased when bldD was disrupted in A226. Furthermore, SACE_7115 and SACE_0306 in A226 were individually inactivated, showing that SACE_7115 was predominantly involved in aerial mycelium formation, while SACE_0306 mainly controlled erythromycin production. This study provides valuable information for better understanding of the pleiotropic regulator BldD in S. erythraea, and the improved method may be useful for uncovering regulatory networks of other transcriptional factors.

Inhibition of glucose turnover by 3-bromopyruvate counteracts pancreatic cancer stem cell features and sensitizes cells to gemcitabine

PubMed Central

Bauer, Nathalie; Liu, Li; Fan, Pei; Zhang, Yiyao; Gladkich, Jury; Nwaeburu, Clifford C.; Mattern, Jürgen; Mollenhauer, Martin; Rückert, Felix; Zach, Sebastian; Haberkorn, Uwe; Gross, Wolfgang; Schönsiegel, Frank; Bazhin, Alexandr V.; Herr, Ingrid

2014-01-01

According to the cancer stem cell (CSC) hypothesis, the aggressive growth and early metastasis of pancreatic ductal adenocarcinoma (PDA) is due to the activity of CSCs, which are not targeted by current therapies. Otto Warburg suggested that the growth of cancer cells is driven by a high glucose metabolism. Here, we investigated whether glycolysis inhibition targets CSCs and thus may enhance therapeutic efficacy. Four established and 3 primary PDA cell lines, non-malignant cells, and 3 patient-tumor-derived CSC-enriched spheroidal cultures were analyzed by glucose turnover measurements, MTT and ATP assays, flow cytometry of ALDH1 activity and annexin positivity, colony and spheroid formation, western blotting, electrophoretic mobility shift assay, xenotransplantation, and immunohistochemistry. The effect of siRNA-mediated inhibition of LDH-A and LDH-B was also investigated. The PDA cells exhibited a high glucose metabolism, and glucose withdrawal or LDH inhibition by siRNA prevented growth and colony formation. Treatment with the anti-glycolytic agent 3-bromopyruvate almost completely blocked cell viability, self-renewal potential, NF-κB binding activity, and stem cell-related signaling and reverted gemcitabine resistance. 3-bromopyruvate was less effective in weakly malignant PDA cells and did not affect non-malignant cells, predicting minimal side effects. 3-bromopyruvate inhibited in vivo tumor engraftment and growth on chicken eggs and mice and enhanced the efficacy of gemcitabine by influencing the expression of markers of proliferation, apoptosis, self-renewal, and metastasis. Most importantly, primary CSC-enriched spheroidal cultures were eliminated by 3-bromopyruvate. These findings propose that CSCs may be specifically dependent on a high glucose turnover and suggest 3-bromopyruvate for therapeutic intervention. PMID:25015789