Sample records for model dna base

  1. All-Atom Polarizable Force Field for DNA Based on the Classical Drude Oscillator Model

    PubMed Central

    Savelyev, Alexey; MacKerell, Alexander D.

    2014-01-01

    Presented is a first generation atomistic force field for DNA in which electronic polarization is modeled based on the classical Drude oscillator formalism. The DNA model is based on parameters for small molecules representative of nucleic acids, including alkanes, ethers, dimethylphosphate, and the nucleic acid bases and empirical adjustment of key dihedral parameters associated with the phosphodiester backbone, glycosidic linkages and sugar moiety of DNA. Our optimization strategy is based on achieving a compromise between satisfying the properties of the underlying model compounds in the gas phase targeting QM data and reproducing a number of experimental properties of DNA duplexes in the condensed phase. The resulting Drude force field yields stable DNA duplexes on the 100 ns time scale and satisfactorily reproduces (1) the equilibrium between A and B forms of DNA and (2) transitions between the BI and BII sub-states of B form DNA. Consistency with the gas phase QM data for the model compounds is significantly better for the Drude model as compared to the CHARMM36 additive force field, which is suggested to be due to the improved response of the model to changes in the environment associated with the explicit inclusion of polarizability. Analysis of dipole moments associated with the nucleic acid bases shows the Drude model to have significantly larger values than those present in CHARMM36, with the dipoles of individual bases undergoing significant variations during the MD simulations. Additionally, the dipole moment of water was observed to be perturbed in the grooves of DNA. PMID:24752978

  2. Effect of Base Sequence "Defects" on the Electrostatic Potential of Dissolved DNA

    NASA Astrophysics Data System (ADS)

    Adams, Scott V.; Wagner, Katrina; Kephart, Thomas S.; Edwards, Glenn

    1997-11-01

    An analytical model of the electrostatic potential surrounding dissolved DNA has been developed. The model consists of an all-atom, mathematically helical structure for DNA, in which the atoms are arranged in infinite lines of discrete point charges on concentric cylindrical surfaces. The surrounding solvent and counterions are treated with the Debye-Huckel approximation (Wagner et al., Biophysical Journal 73, 21-30, 1997). Variation in the electrostatic potential due to structural differences between A, B, and Z conformations and homopolymer base sequence is apparent. The most recent modification to the model exploits the principle of superposition to calculate the potential of DNA with a base sequence containing `defects.' That is, the base sequence is no longer uniform along the polymer. Differences between the potential of homopolymer DNA and the potential of DNA containing base `defects' are immediately obvious. These results may aid in understanding the role of electrostatics in base-sequence specificity exhibited by DNA-binding proteins.

  3. Modeling DNA bubble formation at the atomic scale

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Beleva, V; Rasmussen, K. O.; Garcia, A. E.

    We describe the fluctuations of double stranded DNA molecules using a minimalist Go model over a wide range of temperatures. Minimalist models allow us to describe, at the atomic level, the opening and formation of bubbles in DNA double helices. This model includes all the geometrical constraints in helix melting imposed by the 3D structure of the molecule. The DNA forms melted bubbles within double helices. These bubbles form and break as a function of time. The equilibrium average number of broken base pairs shows a sharp change as a function of T. We observe a temperature profile of sequencemore » dependent bubble formation similar to those measured by Zeng et al. Long nuclei acid molecules melt partially through the formations of bubbles. It is known that CG rich sequences melt at higher temperatures than AT rich sequences. The melting temperature, however, is not solely determined by the CG content, but by the sequence through base stacking and solvent interactions. Recently, models that incorporate the sequence and nonlinear dynamics of DNA double strands have shown that DNA exhibits a very rich dynamics. Recent extensions of the Bishop-Peyrard model show that fluctuations in the DNA structure lead to opening in localized regions, and that these regions in the DNA are associated with transcription initiation sites. 1D and 2D models of DNA may contain enough information about stacking and base pairing interactions, but lack the coupling between twisting, bending and base pair opening imposed by the double helical structure of DNA that all atom models easily describe. However, the complexity of the energy function used in all atom simulations (including solvent, ions, etc) does not allow for the description of DNA folding/unfolding events that occur in the microsecond time scale.« less

  4. A new model for ancient DNA decay based on paleogenomic meta-analysis

    PubMed Central

    Ware, Roselyn; Smith, Oliver; Collins, Matthew

    2017-01-01

    Abstract The persistence of DNA over archaeological and paleontological timescales in diverse environments has led to a revolutionary body of paleogenomic research, yet the dynamics of DNA degradation are still poorly understood. We analyzed 185 paleogenomic datasets and compared DNA survival with environmental variables and sample ages. We find cytosine deamination follows a conventional thermal age model, but we find no correlation between DNA fragmentation and sample age over the timespans analyzed, even when controlling for environmental variables. We propose a model for ancient DNA decay wherein fragmentation rapidly reaches a threshold, then subsequently slows. The observed loss of DNA over time may be due to a bulk diffusion process in many cases, highlighting the importance of tissues and environments creating effectively closed systems for DNA preservation. This model of DNA degradation is largely based on mammal bone samples due to published genomic dataset availability. Continued refinement to the model to reflect diverse biological systems and tissue types will further improve our understanding of ancient DNA breakdown dynamics. PMID:28486705

  5. An experimentally-informed coarse-grained 3-site-per-nucleotide model of DNA: Structure, thermodynamics, and dynamics of hybridization

    PubMed Central

    Hinckley, Daniel M.; Freeman, Gordon S.; Whitmer, Jonathan K.; de Pablo, Juan J.

    2013-01-01

    A new 3-Site-Per-Nucleotide coarse-grained model for DNA is presented. The model includes anisotropic potentials between bases involved in base stacking and base pair interactions that enable the description of relevant structural properties, including the major and minor grooves. In an improvement over available coarse-grained models, the correct persistence length is recovered for both ssDNA and dsDNA, allowing for simulation of non-canonical structures such as hairpins. DNA melting temperatures, measured for duplexes and hairpins by integrating over free energy surfaces generated using metadynamics simulations, are shown to be in quantitative agreement with experiment for a variety of sequences and conditions. Hybridization rate constants, calculated using forward-flux sampling, are also shown to be in good agreement with experiment. The coarse-grained model presented here is suitable for use in biological and engineering applications, including nucleosome positioning and DNA-templated engineering. PMID:24116642

  6. Comparisons of non-Gaussian statistical models in DNA methylation analysis.

    PubMed

    Ma, Zhanyu; Teschendorff, Andrew E; Yu, Hong; Taghia, Jalil; Guo, Jun

    2014-06-16

    As a key regulatory mechanism of gene expression, DNA methylation patterns are widely altered in many complex genetic diseases, including cancer. DNA methylation is naturally quantified by bounded support data; therefore, it is non-Gaussian distributed. In order to capture such properties, we introduce some non-Gaussian statistical models to perform dimension reduction on DNA methylation data. Afterwards, non-Gaussian statistical model-based unsupervised clustering strategies are applied to cluster the data. Comparisons and analysis of different dimension reduction strategies and unsupervised clustering methods are presented. Experimental results show that the non-Gaussian statistical model-based methods are superior to the conventional Gaussian distribution-based method. They are meaningful tools for DNA methylation analysis. Moreover, among several non-Gaussian methods, the one that captures the bounded nature of DNA methylation data reveals the best clustering performance.

  7. Comparisons of Non-Gaussian Statistical Models in DNA Methylation Analysis

    PubMed Central

    Ma, Zhanyu; Teschendorff, Andrew E.; Yu, Hong; Taghia, Jalil; Guo, Jun

    2014-01-01

    As a key regulatory mechanism of gene expression, DNA methylation patterns are widely altered in many complex genetic diseases, including cancer. DNA methylation is naturally quantified by bounded support data; therefore, it is non-Gaussian distributed. In order to capture such properties, we introduce some non-Gaussian statistical models to perform dimension reduction on DNA methylation data. Afterwards, non-Gaussian statistical model-based unsupervised clustering strategies are applied to cluster the data. Comparisons and analysis of different dimension reduction strategies and unsupervised clustering methods are presented. Experimental results show that the non-Gaussian statistical model-based methods are superior to the conventional Gaussian distribution-based method. They are meaningful tools for DNA methylation analysis. Moreover, among several non-Gaussian methods, the one that captures the bounded nature of DNA methylation data reveals the best clustering performance. PMID:24937687

  8. Insights into DNA-mediated interparticle interactions from a coarse-grained model

    NASA Astrophysics Data System (ADS)

    Ding, Yajun; Mittal, Jeetain

    2014-11-01

    DNA-functionalized particles have great potential for the design of complex self-assembled materials. The major hurdle in realizing crystal structures from DNA-functionalized particles is expected to be kinetic barriers that trap the system in metastable amorphous states. Therefore, it is vital to explore the molecular details of particle assembly processes in order to understand the underlying mechanisms. Molecular simulations based on coarse-grained models can provide a convenient route to explore these details. Most of the currently available coarse-grained models of DNA-functionalized particles ignore key chemical and structural details of DNA behavior. These models therefore are limited in scope for studying experimental phenomena. In this paper, we present a new coarse-grained model of DNA-functionalized particles which incorporates some of the desired features of DNA behavior. The coarse-grained DNA model used here provides explicit DNA representation (at the nucleotide level) and complementary interactions between Watson-Crick base pairs, which lead to the formation of single-stranded hairpin and double-stranded DNA. Aggregation between multiple complementary strands is also prevented in our model. We study interactions between two DNA-functionalized particles as a function of DNA grafting density, lengths of the hybridizing and non-hybridizing parts of DNA, and temperature. The calculated free energies as a function of pair distance between particles qualitatively resemble experimental measurements of DNA-mediated pair interactions.

  9. A physiologically based biodynamic (PBBD) model for estragole DNA binding in rat liver based on in vitro kinetic data and estragole DNA adduct formation in primary hepatocytes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Paini, Alicia, E-mail: alicia.paini@rdls.nestle.co; Nestle Research Center, PO Box 44, Lausanne; Punt, Ans

    2010-05-15

    Estragole has been shown to be hepatocarcinogenic in rodent species at high-dose levels. Translation of these results into the likelihood of formation of DNA adducts, mutation, and ultimately cancer upon more realistic low-dose exposures remains a challenge. Recently we have developed physiologically based biokinetic (PBBK) models for rat and human predicting bioactivation of estragole. These PBBK models, however, predict only kinetic characteristics. The present study describes the extension of the PBBK model to a so-called physiologically based biodynamic (PBBD) model predicting in vivo DNA adduct formation of estragole in rat liver. This PBBD model was developed using in vitro datamore » on DNA adduct formation in rat primary hepatocytes exposed to 1'-hydroxyestragole. The model was extended by linking the area under the curve for 1'-hydroxyestragole formation predicted by the PBBK model to the area under the curve for 1'-hydroxyestragole in the in vitro experiments. The outcome of the PBBD model revealed a linear increase in DNA adduct formation with increasing estragole doses up to 100 mg/kg bw. Although DNA adduct formation of genotoxic carcinogens is generally seen as a biomarker of exposure rather than a biomarker of response, the PBBD model now developed is one step closer to the ultimate toxic effect of estragole than the PBBK model described previously. Comparison of the PBBD model outcome to available data showed that the model adequately predicts the dose-dependent level of DNA adduct formation. The PBBD model predicts DNA adduct formation at low levels of exposure up to a dose level showing to cause cancer in rodent bioassays, providing a proof of principle for modeling a toxicodynamic in vivo endpoint on the basis of solely in vitro experimental data.« less

  10. Development of solution-gated graphene transistor model for biosensors

    NASA Astrophysics Data System (ADS)

    Karimi, Hediyeh; Yusof, Rubiyah; Rahmani, Rasoul; Hosseinpour, Hoda; Ahmadi, Mohammad T.

    2014-02-01

    The distinctive properties of graphene, characterized by its high carrier mobility and biocompatibility, have stimulated extreme scientific interest as a promising nanomaterial for future nanoelectronic applications. In particular, graphene-based transistors have been developed rapidly and are considered as an option for DNA sensing applications. Recent findings in the field of DNA biosensors have led to a renewed interest in the identification of genetic risk factors associated with complex human diseases for diagnosis of cancers or hereditary diseases. In this paper, an analytical model of graphene-based solution gated field effect transistors (SGFET) is proposed to constitute an important step towards development of DNA biosensors with high sensitivity and selectivity. Inspired by this fact, a novel strategy for a DNA sensor model with capability of single-nucleotide polymorphism detection is proposed and extensively explained. First of all, graphene-based DNA sensor model is optimized using particle swarm optimization algorithm. Based on the sensing mechanism of DNA sensors, detective parameters ( I ds and V gmin) are suggested to facilitate the decision making process. Finally, the behaviour of graphene-based SGFET is predicted in the presence of single-nucleotide polymorphism with an accuracy of more than 98% which guarantees the reliability of the optimized model for any application of the graphene-based DNA sensor. It is expected to achieve the rapid, quick and economical detection of DNA hybridization which could speed up the realization of the next generation of the homecare sensor system.

  11. Development of solution-gated graphene transistor model for biosensors

    PubMed Central

    2014-01-01

    The distinctive properties of graphene, characterized by its high carrier mobility and biocompatibility, have stimulated extreme scientific interest as a promising nanomaterial for future nanoelectronic applications. In particular, graphene-based transistors have been developed rapidly and are considered as an option for DNA sensing applications. Recent findings in the field of DNA biosensors have led to a renewed interest in the identification of genetic risk factors associated with complex human diseases for diagnosis of cancers or hereditary diseases. In this paper, an analytical model of graphene-based solution gated field effect transistors (SGFET) is proposed to constitute an important step towards development of DNA biosensors with high sensitivity and selectivity. Inspired by this fact, a novel strategy for a DNA sensor model with capability of single-nucleotide polymorphism detection is proposed and extensively explained. First of all, graphene-based DNA sensor model is optimized using particle swarm optimization algorithm. Based on the sensing mechanism of DNA sensors, detective parameters (Ids and Vgmin) are suggested to facilitate the decision making process. Finally, the behaviour of graphene-based SGFET is predicted in the presence of single-nucleotide polymorphism with an accuracy of more than 98% which guarantees the reliability of the optimized model for any application of the graphene-based DNA sensor. It is expected to achieve the rapid, quick and economical detection of DNA hybridization which could speed up the realization of the next generation of the homecare sensor system. PMID:24517158

  12. A new model for ancient DNA decay based on paleogenomic meta-analysis.

    PubMed

    Kistler, Logan; Ware, Roselyn; Smith, Oliver; Collins, Matthew; Allaby, Robin G

    2017-06-20

    The persistence of DNA over archaeological and paleontological timescales in diverse environments has led to a revolutionary body of paleogenomic research, yet the dynamics of DNA degradation are still poorly understood. We analyzed 185 paleogenomic datasets and compared DNA survival with environmental variables and sample ages. We find cytosine deamination follows a conventional thermal age model, but we find no correlation between DNA fragmentation and sample age over the timespans analyzed, even when controlling for environmental variables. We propose a model for ancient DNA decay wherein fragmentation rapidly reaches a threshold, then subsequently slows. The observed loss of DNA over time may be due to a bulk diffusion process in many cases, highlighting the importance of tissues and environments creating effectively closed systems for DNA preservation. This model of DNA degradation is largely based on mammal bone samples due to published genomic dataset availability. Continued refinement to the model to reflect diverse biological systems and tissue types will further improve our understanding of ancient DNA breakdown dynamics. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  13. ANN modeling of DNA sequences: new strategies using DNA shape code.

    PubMed

    Parbhane, R V; Tambe, S S; Kulkarni, B D

    2000-09-01

    Two new encoding strategies, namely, wedge and twist codes, which are based on the DNA helical parameters, are introduced to represent DNA sequences in artificial neural network (ANN)-based modeling of biological systems. The performance of the new coding strategies has been evaluated by conducting three case studies involving mapping (modeling) and classification applications of ANNs. The proposed coding schemes have been compared rigorously and shown to outperform the existing coding strategies especially in situations wherein limited data are available for building the ANN models.

  14. Oxidative DNA damage background estimated by a system model of base excision repair

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sokhansanj, B A; Wilson, III, D M

    Human DNA can be damaged by natural metabolism through free radical production. It has been suggested that the equilibrium between innate damage and cellular DNA repair results in an oxidative DNA damage background that potentially contributes to disease and aging. Efforts to quantitatively characterize the human oxidative DNA damage background level based on measuring 8-oxoguanine lesions as a biomarker have led to estimates varying over 3-4 orders of magnitude, depending on the method of measurement. We applied a previously developed and validated quantitative pathway model of human DNA base excision repair, integrating experimentally determined endogenous damage rates and model parametersmore » from multiple sources. Our estimates of at most 100 8-oxoguanine lesions per cell are consistent with the low end of data from biochemical and cell biology experiments, a result robust to model limitations and parameter variation. Our results show the power of quantitative system modeling to interpret composite experimental data and make biologically and physiologically relevant predictions for complex human DNA repair pathway mechanisms and capacity.« less

  15. An experimentally-informed coarse-grained 3-site-per-nucleotide model of DNA: Structure, thermodynamics, and dynamics of hybridization

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hinckley, Daniel M.; Freeman, Gordon S.; Whitmer, Jonathan K.

    2013-10-14

    A new 3-Site-Per-Nucleotide coarse-grained model for DNA is presented. The model includes anisotropic potentials between bases involved in base stacking and base pair interactions that enable the description of relevant structural properties, including the major and minor grooves. In an improvement over available coarse-grained models, the correct persistence length is recovered for both ssDNA and dsDNA, allowing for simulation of non-canonical structures such as hairpins. DNA melting temperatures, measured for duplexes and hairpins by integrating over free energy surfaces generated using metadynamics simulations, are shown to be in quantitative agreement with experiment for a variety of sequences and conditions. Hybridizationmore » rate constants, calculated using forward-flux sampling, are also shown to be in good agreement with experiment. The coarse-grained model presented here is suitable for use in biological and engineering applications, including nucleosome positioning and DNA-templated engineering.« less

  16. DNA methylation-based age prediction from various tissues and body fluids

    PubMed Central

    Jung, Sang-Eun; Shin, Kyoung-Jin; Lee, Hwan Young

    2017-01-01

    Aging is a natural and gradual process in human life. It is influenced by heredity, environment, lifestyle, and disease. DNA methylation varies with age, and the ability to predict the age of donor using DNA from evidence materials at a crime scene is of considerable value in forensic investigations. Recently, many studies have reported age prediction models based on DNA methylation from various tissues and body fluids. Those models seem to be very promising because of their high prediction accuracies. In this review, the changes of age-associated DNA methylation and the age prediction models for various tissues and body fluids were examined, and then the applicability of the DNA methylation-based age prediction method to the forensic investigations was discussed. This will improve the understandings about DNA methylation markers and their potential to be used as biomarkers in the forensic field, as well as the clinical field. PMID:28946940

  17. Functional helicoidal model of DNA molecule with elastic nonlinearity

    NASA Astrophysics Data System (ADS)

    Tseytlin, Y. M.

    2013-06-01

    We constructed a functional DNA molecule model on the basis of a flexible helicoidal sensor, specifically, a pretwisted hollow nano-strip. We study in this article the helicoidal nano- sensor model with a pretwisted strip axial extension corresponding to the overstretching transition of DNA from dsDNA to ssDNA. Our model and the DNA molecule have similar geometrical and nonlinear mechanical features unlike models based on an elastic rod, accordion bellows, or an imaginary combination of "multiple soft and hard linear springs", presented in some recent publications.

  18. Modeling the mechanical properties of DNA nanostructures.

    PubMed

    Arbona, Jean Michel; Aimé, Jean-Pierre; Elezgaray, Juan

    2012-11-01

    We discuss generalizations of a previously published coarse-grained description [Mergell et al., Phys. Rev. E 68, 021911 (2003)] of double stranded DNA (dsDNA). The model is defined at the base-pair level and includes the electrostatic repulsion between neighbor helices. We show that the model reproduces mechanical and elastic properties of several DNA nanostructures (DNA origamis). We also show that electrostatic interactions are necessary to reproduce atomic force microscopy measurements on planar DNA origamis.

  19. Approaching mathematical model of the immune network based DNA Strand Displacement system.

    PubMed

    Mardian, Rizki; Sekiyama, Kosuke; Fukuda, Toshio

    2013-12-01

    One biggest obstacle in molecular programming is that there is still no direct method to compile any existed mathematical model into biochemical reaction in order to solve a computational problem. In this paper, the implementation of DNA Strand Displacement system based on nature-inspired computation is observed. By using the Immune Network Theory and Chemical Reaction Network, the compilation of DNA-based operation is defined and the formulation of its mathematical model is derived. Furthermore, the implementation on this system is compared with the conventional implementation by using silicon-based programming. From the obtained results, we can see a positive correlation between both. One possible application from this DNA-based model is for a decision making scheme of intelligent computer or molecular robot. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

  20. Geometrical correlations in the nucleosomal DNA conformation and the role of the covalent bonds rigidity

    PubMed Central

    Ghorbani, Maryam; Mohammad-Rafiee, Farshid

    2011-01-01

    We develop a simple elastic model to study the conformation of DNA in the nucleosome core particle. In this model, the changes in the energy of the covalent bonds that connect the base pairs of each strand of the DNA double helix, as well as the lateral displacements and the rotation of adjacent base pairs are considered. We show that because of the rigidity of the covalent bonds in the sugar-phosphate backbones, the base pair parameters are highly correlated, especially, strong twist-roll-slide correlation in the conformation of the nucleosomal DNA is vividly observed in the calculated results. This simple model succeeds to account for the detailed features of the structure of the nucleosomal DNA, particularly, its more important base pair parameters, roll and slide, in good agreement with the experimental results. PMID:20972223

  1. Introducing improved structural properties and salt dependence into a coarse-grained model of DNA

    NASA Astrophysics Data System (ADS)

    Snodin, Benedict E. K.; Randisi, Ferdinando; Mosayebi, Majid; Šulc, Petr; Schreck, John S.; Romano, Flavio; Ouldridge, Thomas E.; Tsukanov, Roman; Nir, Eyal; Louis, Ard A.; Doye, Jonathan P. K.

    2015-06-01

    We introduce an extended version of oxDNA, a coarse-grained model of deoxyribonucleic acid (DNA) designed to capture the thermodynamic, structural, and mechanical properties of single- and double-stranded DNA. By including explicit major and minor grooves and by slightly modifying the coaxial stacking and backbone-backbone interactions, we improve the ability of the model to treat large (kilobase-pair) structures, such as DNA origami, which are sensitive to these geometric features. Further, we extend the model, which was previously parameterised to just one salt concentration ([Na+] = 0.5M), so that it can be used for a range of salt concentrations including those corresponding to physiological conditions. Finally, we use new experimental data to parameterise the oxDNA potential so that consecutive adenine bases stack with a different strength to consecutive thymine bases, a feature which allows a more accurate treatment of systems where the flexibility of single-stranded regions is important. We illustrate the new possibilities opened up by the updated model, oxDNA2, by presenting results from simulations of the structure of large DNA objects and by using the model to investigate some salt-dependent properties of DNA.

  2. Introducing improved structural properties and salt dependence into a coarse-grained model of DNA

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Snodin, Benedict E. K., E-mail: benedict.snodin@chem.ox.ac.uk; Mosayebi, Majid; Schreck, John S.

    2015-06-21

    We introduce an extended version of oxDNA, a coarse-grained model of deoxyribonucleic acid (DNA) designed to capture the thermodynamic, structural, and mechanical properties of single- and double-stranded DNA. By including explicit major and minor grooves and by slightly modifying the coaxial stacking and backbone-backbone interactions, we improve the ability of the model to treat large (kilobase-pair) structures, such as DNA origami, which are sensitive to these geometric features. Further, we extend the model, which was previously parameterised to just one salt concentration ([Na{sup +}] = 0.5M), so that it can be used for a range of salt concentrations including thosemore » corresponding to physiological conditions. Finally, we use new experimental data to parameterise the oxDNA potential so that consecutive adenine bases stack with a different strength to consecutive thymine bases, a feature which allows a more accurate treatment of systems where the flexibility of single-stranded regions is important. We illustrate the new possibilities opened up by the updated model, oxDNA2, by presenting results from simulations of the structure of large DNA objects and by using the model to investigate some salt-dependent properties of DNA.« less

  3. In the Absence of Writhe, DNA Relieves Torsional Stress with Localized, Sequence-Dependent Structural Failure to Preserve B-form

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Randall, Graham L.; Zechiedrich, E. L.; Pettitt, Bernard M.

    2009-09-01

    To understand how underwinding and overwinding the DNA helix affects its structure, we simulated 19 independent DNA systems with fixed degrees of twist using molecular dynamics in a system that does not allow writhe. Underwinding DNA induced spontaneous, sequence-dependent base flipping and local denaturation, while overwinding DNA induced the formation of Pauling-like DNA (P-DNA). The winding resulted in a bimodal state simultaneously including local structural failure and B-form DNA for both underwinding and extreme overwinding. Our simulations suggest that base flipping and local denaturation may provide a landscape influencing protein recognition of DNA sequence to affect, for examples, replication, transcriptionmore » and recombination. Additionally, our findings help explain results from singlemolecule experiments and demonstrate that elastic rod models are strictly valid on average only for unstressed or overwound DNA up to P-DNA formation. Finally, our data support a model in which base flipping can result from torsional stress.« less

  4. Direct observation of single flexible polymers using single stranded DNA†

    PubMed Central

    Brockman, Christopher; Kim, Sun Ju

    2012-01-01

    Over the last 15 years, double stranded DNA (dsDNA) has been used as a model polymeric system for nearly all single polymer dynamics studies. However, dsDNA is a semiflexible polymer with markedly different molecular properties compared to flexible chains, including synthetic organic polymers. In this work, we report a new system for single polymer studies of flexible chains based on single stranded DNA (ssDNA). We developed a method to synthesize ssDNA for fluorescence microscopy based on rolling circle replication, which generates long strands (>65 kb) of ssDNA containing “designer” sequences, thereby preventing intramolecular base pair interactions. Polymers are synthesized to contain amine-modified bases randomly distributed along the backbone, which enables uniform labelling of polymer chains with a fluorescent dye to facilitate fluorescence microscopy and imaging. Using this approach, we synthesized ssDNA chains with long contour lengths (>30 μm) and relatively low dye loading ratios (~1 dye per 100 bases). In addition, we used epifluorescence microscopy to image single ssDNA polymer molecules stretching in flow in a microfluidic device. Overall, we anticipate that ssDNA will serve as a useful model system to probe the dynamics of polymeric materials at the molecular level. PMID:22956981

  5. The mechanism of the emergence of distinct overstretched DNA states

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhu, You-Liang; Sun, Zhao-Yan, E-mail: zysun@ciac.ac.cn; Lu, Zhong-Yuan

    Although multiple overstretched DNA states were identified in experiments, the mechanism of the emergence of distinct states is still unclear. Molecular dynamics simulation is an ideal tool to clarify the mechanism, but the force loading rates in stretching achieved by conventional all-atom DNA models are much faster, which essentially affect overstretching states. We employed a modified coarse-grained DNA model with an unprecedented low loading rate in simulations to study the overstretching transitions of end-opened double-stranded DNA. We observed two-strand peeling off for DNA with low stability and the S-DNA with high stability under tension. By introducing a melting-forbidden model whichmore » prevents base-pair breaking, we still observed the overstretching transition induced by the formation of S-DNA due to the change of dihedral angle. Hence, we confirmed that the competition between the two strain-softening manners, i.e., base-pair breaking and dihedral angle variation, results in the emergence of distinct overstretched DNA states.« less

  6. NASA Radiation Track Image GUI for Assessing Space Radiation Biological Effects

    NASA Technical Reports Server (NTRS)

    Ponomarev, Artem L.; Cucinotta, Francis A.

    2006-01-01

    The high-charge high-energy (HZE) ion components of the galactic cosmic rays when compared to terrestrial forms of radiations present unique challenges to biological systems. In this paper we present a deoxyribonucleic acid (DNA) breakage model to visualize and analyze the impact of chromatin domains and DNA loops on clustering of DNA damage from X rays, protons, and HZE ions. Our model of DNA breakage is based on a stochastic process of DNA double-strand break (DSB) formulation that includes the amorphous model of the radiation track and a polymer model of DNA packed in the cell nucleus. Our model is a Monte-Carlo simulation based on a randomly located DSB cluster formulation that accomodates both high- and low-linear energy transfer radiations. We demonstrate that HZE ions have a strong impact on DSB clustering, both along the chromosome length and in the nucleus volume. The effects of chromosomal domains and DNA loops on the DSB fragment-size distribution and the spatial distribution of DSB in the nucleus were studied. We compare our model predictions with the spatial distribution of DSB obtained from experiments. The implications of our model predictions for radiation protection are discussed.

  7. Charge transport properties of DNA aperiodic molecule: The role of interbase hopping in Watson-Crick base pair

    NASA Astrophysics Data System (ADS)

    Sinurat, E. N.; Yudiarsah, E.

    2017-07-01

    The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.

  8. Macroscopic modeling and simulations of supercoiled DNA with bound proteins

    NASA Astrophysics Data System (ADS)

    Huang, Jing; Schlick, Tamar

    2002-11-01

    General methods are presented for modeling and simulating DNA molecules with bound proteins on the macromolecular level. These new approaches are motivated by the need for accurate and affordable methods to simulate slow processes (on the millisecond time scale) in DNA/protein systems, such as the large-scale motions involved in the Hin-mediated inversion process. Our approaches, based on the wormlike chain model of long DNA molecules, introduce inhomogeneous potentials for DNA/protein complexes based on available atomic-level structures. Electrostatically, treat those DNA/protein complexes as sets of effective charges, optimized by our discrete surface charge optimization package, in which the charges are distributed on an excluded-volume surface that represents the macromolecular complex. We also introduce directional bending potentials as well as non-identical bead hydrodynamics algorithm to further mimic the inhomogeneous effects caused by protein binding. These models thus account for basic elements of protein binding effects on DNA local structure but remain computational tractable. To validate these models and methods, we reproduce various properties measured by both Monte Carlo methods and experiments. We then apply the developed models to study the Hin-mediated inversion system in long DNA. By simulating supercoiled, circular DNA with or without bound proteins, we observe significant effects of protein binding on global conformations and long-time dynamics of the DNA on the kilo basepair length.

  9. Modelling of DNA-protein recognition

    NASA Technical Reports Server (NTRS)

    Rein, R.; Garduno, R.; Colombano, S.; Nir, S.; Haydock, K.; Macelroy, R. D.

    1980-01-01

    Computer model-building procedures using stereochemical principles together with theoretical energy calculations appear to be, at this stage, the most promising route toward the elucidation of DNA-protein binding schemes and recognition principles. A review of models and bonding principles is conducted and approaches to modeling are considered, taking into account possible di-hydrogen-bonding schemes between a peptide and a base (or a base pair) of a double-stranded nucleic acid in the major groove, aspects of computer graphic modeling, and a search for isogeometric helices. The energetics of recognition complexes is discussed and several models for peptide DNA recognition are presented.

  10. The Effect of Basepair Mismatch on DNA Strand Displacement.

    PubMed

    Broadwater, D W Bo; Kim, Harold D

    2016-04-12

    DNA strand displacement is a key reaction in DNA homologous recombination and DNA mismatch repair and is also heavily utilized in DNA-based computation and locomotion. Despite its ubiquity in science and engineering, sequence-dependent effects of displacement kinetics have not been extensively characterized. Here, we measured toehold-mediated strand displacement kinetics using single-molecule fluorescence in the presence of a single basepair mismatch. The apparent displacement rate varied significantly when the mismatch was introduced in the invading DNA strand. The rate generally decreased as the mismatch in the invader was encountered earlier in displacement. Our data indicate that a single base pair mismatch in the invader stalls branch migration and displacement occurs via direct dissociation of the destabilized incumbent strand from the substrate strand. We combined both branch migration and direct dissociation into a model, which we term the concurrent displacement model, and used the first passage time approach to quantitatively explain the salient features of the observed relationship. We also introduce the concept of splitting probabilities to justify that the concurrent model can be simplified into a three-step sequential model in the presence of an invader mismatch. We expect our model to become a powerful tool to design DNA-based reaction schemes with broad functionality. Copyright © 2016 Biophysical Society. Published by Elsevier Inc. All rights reserved.

  11. RNA-DNA and DNA-DNA base-pairing at the upstream edge of the transcription bubble regulate translocation of RNA polymerase and transcription rate.

    PubMed

    KIreeva, Maria; Trang, Cyndi; Matevosyan, Gayane; Turek-Herman, Joshua; Chasov, Vitaly; Lubkowska, Lucyna; Kashlev, Mikhail

    2018-06-20

    Translocation of RNA polymerase (RNAP) along DNA may be rate-limiting for transcription elongation. The Brownian ratchet model posits that RNAP rapidly translocates back and forth until the post-translocated state is stabilized by NTP binding. An alternative model suggests that RNAP translocation is slow and poorly reversible. To distinguish between these two models, we take advantage of an observation that pyrophosphorolysis rates directly correlate with the abundance of the pre-translocated fraction. Pyrophosphorolysis by RNAP stabilized in the pre-translocated state by bacteriophage HK022 protein Nun was used as a reference point to determine the pre-translocated fraction in the absence of Nun. The stalled RNAP preferentially occupies the post-translocated state. The forward translocation rate depends, among other factors, on melting of the RNA-DNA base pair at the upstream edge of the transcription bubble. DNA-DNA base pairing immediately upstream from the RNA-DNA hybrid stabilizes the post-translocated state. This mechanism is conserved between E. coli RNAP and S. cerevisiae RNA polymerase II and is partially dependent on the lid domain of the catalytic subunit. Thus, the RNA-DNA hybrid and DNA reannealing at the upstream edge of the transcription bubble emerge as targets for regulation of the transcription elongation rate.

  12. High-speed detection of DNA translocation in nanopipettes

    NASA Astrophysics Data System (ADS)

    Fraccari, Raquel L.; Ciccarella, Pietro; Bahrami, Azadeh; Carminati, Marco; Ferrari, Giorgio; Albrecht, Tim

    2016-03-01

    We present a high-speed electrical detection scheme based on a custom-designed CMOS amplifier which allows the analysis of DNA translocation in glass nanopipettes on a microsecond timescale. Translocation of different DNA lengths in KCl electrolyte provides a scaling factor of the DNA translocation time equal to p = 1.22, which is different from values observed previously with nanopipettes in LiCl electrolyte or with nanopores. Based on a theoretical model involving electrophoresis, hydrodynamics and surface friction, we show that the experimentally observed range of p-values may be the result of, or at least be affected by DNA adsorption and friction between the DNA and the substrate surface.We present a high-speed electrical detection scheme based on a custom-designed CMOS amplifier which allows the analysis of DNA translocation in glass nanopipettes on a microsecond timescale. Translocation of different DNA lengths in KCl electrolyte provides a scaling factor of the DNA translocation time equal to p = 1.22, which is different from values observed previously with nanopipettes in LiCl electrolyte or with nanopores. Based on a theoretical model involving electrophoresis, hydrodynamics and surface friction, we show that the experimentally observed range of p-values may be the result of, or at least be affected by DNA adsorption and friction between the DNA and the substrate surface. Electronic supplementary information (ESI) available: Gel electrophoresis confirming lengths and purity of DNA samples, comparison between Axopatch 200B and custom-built setup, comprehensive low-noise amplifier characterization, representative I-V curves of nanopipettes used, typical scatter plots of τ vs. peak amplitude for the four LDNA's used, table of most probable τ values, a comparison between different fitting models for the DNA translocation time distribution, further details on the stochastic numerical simulation of the scaling statistics and the derivation of the extended model for the length dependence of τ. See DOI: 10.1039/c5nr08634e

  13. [Definition of the specificity of DNA-methyltransferase M.Bsc4I in cell lysate by blocking of restriction endonucleases and computer modeling].

    PubMed

    Dedkov, V S

    2009-01-01

    The specificity of DNA-methyltransferase M.Bsc4I was defined in cellular lysate of Bacillus schlegelii 4. For this purpose, we used methylation sensitivity of restriction endonucleases, and also modeling of methylation. The modeling consisted in editing sequences of DNA using replacements of methylated bases and their complementary bases. The substratum DNA processed by M.Bsc4I also were used for studying sensitivity of some restriction endonucleases to methylation. Thus, it was shown that M.Bsc4I methylated 5'-Cm4CNNNNNNNGG-3' and the overlapped dcm-methylation blocked its activity. The offered approach can appear universal enough and simple for definition of specificity of DNA-methyltransferases.

  14. DNA-binding mechanism of the Escherichia coli Ada O6-alkylguanine–DNA alkyltransferase

    PubMed Central

    Verdemato, Philip E.; Brannigan, James A.; Damblon, Christian; Zuccotto, Fabio; Moody, Peter C. E.; Lian, Lu-Yun

    2000-01-01

    The C-terminal domain of the Escherichia coli Ada protein (Ada-C) aids in the maintenance of genomic integrity by efficiently repairing pre-mutagenic O6-alkylguanine lesions in DNA. Structural and thermodynamic studies were carried out to obtain a model of the DNA-binding process. Nuclear magnetic resonance (NMR) studies map the DNA-binding site to helix 5, and a loop region (residues 151–160) which form the recognition helix and the ‘wing’ of a helix–turn–wing motif, respectively. The NMR data also suggest the absence of a large conformational change in the protein upon binding to DNA. Hence, an O6-methylguanine (O6meG) lesion would be inaccessible to active site nucleophile Cys146 if the modified base remained stacked within the DNA duplex. The experimentally determined DNA-binding face of Ada-C was used in combination with homology modelling, based on the catabolite activator protein, and the accepted base-flipping mechanism, to construct a model of how Ada-C binds to DNA in a productive manner. To complement the structural studies, thermodynamic data were obtained which demonstrate that binding to unmethylated DNA was entropically driven, whilst the demethylation reaction provoked an exothermic heat change. Methylation of Cys146 leads to a loss of structural integrity of the DNA-binding subdomain. PMID:11000262

  15. GUI to Facilitate Research on Biological Damage from Radiation

    NASA Technical Reports Server (NTRS)

    Cucinotta, Frances A.; Ponomarev, Artem Lvovich

    2010-01-01

    A graphical-user-interface (GUI) computer program has been developed to facilitate research on the damage caused by highly energetic particles and photons impinging on living organisms. The program brings together, into one computational workspace, computer codes that have been developed over the years, plus codes that will be developed during the foreseeable future, to address diverse aspects of radiation damage. These include codes that implement radiation-track models, codes for biophysical models of breakage of deoxyribonucleic acid (DNA) by radiation, pattern-recognition programs for extracting quantitative information from biological assays, and image-processing programs that aid visualization of DNA breaks. The radiation-track models are based on transport models of interactions of radiation with matter and solution of the Boltzmann transport equation by use of both theoretical and numerical models. The biophysical models of breakage of DNA by radiation include biopolymer coarse-grained and atomistic models of DNA, stochastic- process models of deposition of energy, and Markov-based probabilistic models of placement of double-strand breaks in DNA. The program is designed for use in the NT, 95, 98, 2000, ME, and XP variants of the Windows operating system.

  16. A symmetry model for genetic coding via a wallpaper group composed of the traditional four bases and an imaginary base E: towards category theory-like systematization of molecular/genetic biology.

    PubMed

    Sawamura, Jitsuki; Morishita, Shigeru; Ishigooka, Jun

    2014-05-07

    Previously, we suggested prototypal models that describe some clinical states based on group postulates. Here, we demonstrate a group/category theory-like model for molecular/genetic biology as an alternative application of our previous model. Specifically, we focus on deoxyribonucleic acid (DNA) base sequences. We construct a wallpaper pattern based on a five-letter cruciform motif with letters C, A, T, G, and E. Whereas the first four letters represent the standard DNA bases, the fifth is introduced for ease in formulating group operations that reproduce insertions and deletions of DNA base sequences. A basic group Z5 = {r, u, d, l, n} of operations is defined for the wallpaper pattern, with which a sequence of points can be generated corresponding to changes of a base in a DNA sequence by following the orbit of a point of the pattern under operations in group Z5. Other manipulations of DNA sequence can be treated using a vector-like notation 'Dj' corresponding to a DNA sequence but based on the five-letter base set; also, 'Dj's are expressed graphically. Insertions and deletions of a series of letters 'E' are admitted to assist in describing DNA recombination. Likewise, a vector-like notation Rj can be constructed for sequences of ribonucleic acid (RNA). The wallpaper group B = {Z5×∞, ●} (an ∞-fold Cartesian product of Z5) acts on Dj (or Rj) yielding changes to Dj (or Rj) denoted by 'Dj◦B(j→k) = Dk' (or 'Rj◦B(j→k) = Rk'). Based on the operations of this group, two types of groups-a modulo 5 linear group and a rotational group over the Gaussian plane, acting on the five bases-are linked as parts of the wallpaper group for broader applications. As a result, changes, insertions/deletions and DNA (RNA) recombination (partial/total conversion) are described. As an exploratory study, a notation for the canonical "central dogma" via a category theory-like way is presented for future developments. Despite the large incompleteness of our methodology, there is fertile ground to consider a symmetry model for genetic coding based on our specific wallpaper group. A more integrated formulation containing "central dogma" for future molecular/genetic biology remains to be explored.

  17. Structural Confirmation of a Bent and Open Model for the Initiation Complex of T7 RNA Polymerase

    PubMed Central

    Turingan, Rosemary S.; Liu, Cuihua; Hawkins, Mary E.; Martin, Craig T.

    2008-01-01

    T7 RNA polymerase is known to induce bending of its promoter DNA upon binding, as evidenced by gel-shift assays and by recent end-to-end fluorescence energy transfer distance measurements. Crystal structures of promoter-bound and initially transcribing complexes, however, lack downstream DNA, providing no information on the overall path of the DNA through the protein. Crystal structures of the elongation complex do include downstream DNA and provide valuable guidance in the design of models for the complete melted bubble structure at initiation. In the current study, we test a specific structural model for the initiation complex, obtained by alignment of the C-terminal regions of the protein structures from both initiation and elongation and then simple transferal of the downstream DNA from the elongation complex onto the initiation complex. FRET measurement of distances from a point upstream on the promoter DNA to various points along the downstream helix reproduce the expected helical periodicity in the distances and support the model’s orientation and phasing of the downstream DNA. The model also makes predictions about the extent of melting downstream of the active site. By monitoring fluorescent base analogs incorporated at various positions in the DNA we have mapped the downstream edge of the bubble, confirming the model. The initially melted bubble, in the absence of substrate, encompasses 7–8 bases and is sufficient to allow synthesis of a 3 base transcript before further melting is required. The results demonstrate that despite massive changes in the N-terminal portion of the protein and in the DNA upstream of the active site, the DNA downstream of the active site is virtually identical in both initiation and elongation complexes. PMID:17253774

  18. Double-stranded DNA organization in bacteriophage heads: an alternative toroid-based model.

    PubMed Central

    Hud, N V

    1995-01-01

    Studies of the organization of double-stranded DNA within bacteriophage heads during the past four decades have produced a wealth of data. However, despite the presentation of numerous models, the true organization of DNA within phage heads remains unresolved. The observations of toroidal DNA structures in electron micrographs of phage lysates have long been cited as support for the organization of DNA in a spool-like fashion. This particular model, like all other models, has not been found to be consistent will all available data. Recently we proposed that DNA within toroidal condensates produced in vitro is organized in a manner significantly different from that suggested by the spool model. This new toroid model has allowed the development of an alternative model for DNA organization within bacteriophage heads that is consistent with a wide range of biophysical data. Here we propose that bacteriophage DNA is packaged in a toroid that is folded into a highly compact structure. Images FIGURE 1 FIGURE 2 FIGURE 3 FIGURE 4 PMID:8534805

  19. IDENTIFICATION OF ACTIVE BACTERIAL COMMUNITIES IN A MODEL DRINKING WATER BIOFILM SYSTEM USING 16S RRNA-BASED CLONE LIBRARIES

    EPA Science Inventory

    Recent phylogenetic studies have used DNA as the target molecule for the development of environmental 16S rDNA clone libraries. As DNA may persist in the environment, DNA-based libraries cannot be used to identify metabolically active bacteria in water systems. In this study, a...

  20. Direct observation of the oxidation of DNA bases by phosphate radicals formed under radiation: a model of the backbone-to-base hole transfer.

    PubMed

    Ma, Jun; Marignier, Jean-Louis; Pernot, Pascal; Houée-Levin, Chantal; Kumar, Anil; Sevilla, Michael D; Adhikary, Amitava; Mostafavi, Mehran

    2018-05-30

    In irradiated DNA, by the base-to-base and backbone-to-base hole transfer processes, the hole (i.e., the unpaired spin) localizes on the most electropositive base, guanine. Phosphate radicals formed via ionization events in the DNA-backbone must play an important role in the backbone-to-base hole transfer process. However, earlier studies on irradiated hydrated DNA, on irradiated DNA-models in frozen aqueous solution and in neat dimethyl phosphate showed the formation of carbon-centered radicals and not phosphate radicals. Therefore, to model the backbone-to-base hole transfer process, we report picosecond pulse radiolysis studies of the reactions between H2PO4˙ with the DNA bases - G, A, T, and C in 6 M H3PO4 at 22 °C. The time-resolved observations show that in 6 M H3PO4, H2PO4˙ causes the one-electron oxidation of adenine, guanine and thymine, by forming the cation radicals via a single electron transfer (SET) process; however, the rate constant of the reaction of H2PO4˙ with cytosine is too low (<107 L mol-1 s-1) to be measured. The rates of these reactions are influenced by the protonation states and the reorganization energies of the base radicals and of the phosphate radical in 6 M H3PO4.

  1. An integrated QSAR-PBK/D modelling approach for predicting detoxification and DNA adduct formation of 18 acyclic food-borne α,β-unsaturated aldehydes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kiwamoto, R., E-mail: reiko.kiwamoto@wur.nl; Spenkelink, A.; Rietjens, I.M.C.M.

    Acyclic α,β-unsaturated aldehydes present in food raise a concern because the α,β-unsaturated aldehyde moiety is considered a structural alert for genotoxicity. However, controversy remains on whether in vivo at realistic dietary exposure DNA adduct formation is significant. The aim of the present study was to develop physiologically based kinetic/dynamic (PBK/D) models to examine dose-dependent detoxification and DNA adduct formation of a group of 18 food-borne acyclic α,β-unsaturated aldehydes without 2- or 3-alkylation, and with no more than one conjugated double bond. Parameters for the PBK/D models were obtained using quantitative structure–activity relationships (QSARs) defined with a training set of sixmore » selected aldehydes. Using the QSARs, PBK/D models for the other 12 aldehydes were defined. Results revealed that DNA adduct formation in the liver increases with decreasing bulkiness of the molecule especially due to less efficient detoxification. 2-Propenal (acrolein) was identified to induce the highest DNA adduct levels. At realistic dietary intake, the predicted DNA adduct levels for all aldehydes were two orders of magnitude lower than endogenous background levels observed in disease free human liver, suggesting that for all 18 aldehydes DNA adduct formation is negligible at the relevant levels of dietary intake. The present study provides a proof of principle for the use of QSAR-based PBK/D modelling to facilitate group evaluations and read-across in risk assessment. - Highlights: • Physiologically based in silico models were made for 18 α,β-unsaturated aldehydes. • Kinetic parameters were determined by in vitro incubations and a QSAR approach. • DNA adduct formation was negligible at levels relevant for dietary intake. • The use of QSAR-based PBK/D modelling facilitates group evaluations and read-across.« less

  2. Stacking interactions and DNA intercalation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Li, Dr. Shen; Cooper, Valentino R; Thonhauser, Prof. Timo

    2009-01-01

    The relationship between stacking interactions and the intercalation of proflavine and ellipticine within DNA is investigated using a nonempirical van der Waals density functional for the correlation energy. Our results, employing a binary stack model, highlight fundamental, qualitative differences between base-pair base-pair interactions and that of the stacked intercalator base pair system. Most notable result is the paucity of torque which so distinctively defines the Twist of DNA. Surprisingly, this model, when combined with a constraint on the twist of the surrounding base-pair steps to match the observed unwinding of the sugar-phosphate backbone, was sufficient for explaining the experimentally observedmore » proflavine intercalator configuration. Our extensive mapping of the potential energy surface of base-pair intercalator interactions can provide valuable information for future nonempirical studies of DNA intercalation dynamics.« less

  3. Structure and conformational dynamics of scaffolded DNA origami nanoparticles

    DTIC Science & Technology

    2017-05-08

    all-atom molecular dynamics and coarse-grained finite element modeling to DX-based nanoparticles to elucidate their fine-scale and global conforma... finite element (FE) modeling approach CanDo is also routinely used to predict the 3D equilibrium conformation of programmed DNA assemblies based on a...model with both experimental cryo-electron microscopy (cryo-EM) data and all-atom modeling. MATERIALS AND METHODS Lattice-free finite element model

  4. Solving probability reasoning based on DNA strand displacement and probability modules.

    PubMed

    Zhang, Qiang; Wang, Xiaobiao; Wang, Xiaojun; Zhou, Changjun

    2017-12-01

    In computation biology, DNA strand displacement technology is used to simulate the computation process and has shown strong computing ability. Most researchers use it to solve logic problems, but it is only rarely used in probabilistic reasoning. To process probabilistic reasoning, a conditional probability derivation model and total probability model based on DNA strand displacement were established in this paper. The models were assessed through the game "read your mind." It has been shown to enable the application of probabilistic reasoning in genetic diagnosis. Copyright © 2017 Elsevier Ltd. All rights reserved.

  5. Mutants of the Base Excision Repair Glycosylase, Endonuclease III: DNA Charge Transport as a First Step in Lesion Detection

    PubMed Central

    Romano, Christine A.; Sontz, Pamela A.; Barton, Jacqueline K.

    2011-01-01

    Endonuclease III (EndoIII) is a base excision repair glycosylase that targets damaged pyrimidines and contains a [4Fe-4S] cluster. We have proposed a model where BER proteins that contain redox-active [4Fe-4S] clusters utilize DNA charge transport (CT) as a first step in the detection of DNA lesions. Here, several mutants of EndoIII were prepared to probe their efficiency of DNA/protein charge transport. Cyclic voltammetry experiments on DNA-modified electrodes show that aromatic residues F30, Y55, Y75 and Y82 help mediate charge transport between DNA and the [4Fe-4S] cluster. Based on circular dichroism studies to measure protein stability, mutations at residues W178 and Y185 are found to destabilize the protein; these residues may function to protect the [4Fe-4S] cluster. Atomic force microscopy studies furthermore reveal a correlation in the ability of mutants to carry out protein/DNA CT and their ability to relocalize onto DNA strands containing a single base mismatch; EndoIII mutants that are defective in carrying out DNA/protein CT do not redistribute onto mismatch-containing strands, consistent with our model. These results demonstrate a link between the ability of the repair protein to carry out DNA CT and its ability to relocalize near lesions, thus pointing to DNA CT as a key first step in the detection of base damage in the genome. PMID:21651304

  6. Radiation damage to DNA in DNA-protein complexes.

    PubMed

    Spotheim-Maurizot, M; Davídková, M

    2011-06-03

    The most aggressive product of water radiolysis, the hydroxyl (OH) radical, is responsible for the indirect effect of ionizing radiations on DNA in solution and aerobic conditions. According to radiolytic footprinting experiments, the resulting strand breaks and base modifications are inhomogeneously distributed along the DNA molecule irradiated free or bound to ligands (polyamines, thiols, proteins). A Monte-Carlo based model of simulation of the reaction of OH radicals with the macromolecules, called RADACK, allows calculating the relative probability of damage of each nucleotide of DNA irradiated alone or in complexes with proteins. RADACK calculations require the knowledge of the three dimensional structure of DNA and its complexes (determined by X-ray crystallography, NMR spectroscopy or molecular modeling). The confrontation of the calculated values with the results of the radiolytic footprinting experiments together with molecular modeling calculations show that: (1) the extent and location of the lesions are strongly dependent on the structure of DNA, which in turns is modulated by the base sequence and by the binding of proteins and (2) the regions in contact with the protein can be protected against the attack by the hydroxyl radicals via masking of the binding site and by scavenging of the radicals. 2011 Elsevier B.V. All rights reserved.

  7. Thermodynamics-Based Models of Transcriptional Regulation by Enhancers: The Roles of Synergistic Activation, Cooperative Binding and Short-Range Repression

    PubMed Central

    He, Xin; Samee, Md. Abul Hassan; Blatti, Charles; Sinha, Saurabh

    2010-01-01

    Quantitative models of cis-regulatory activity have the potential to improve our mechanistic understanding of transcriptional regulation. However, the few models available today have been based on simplistic assumptions about the sequences being modeled, or heuristic approximations of the underlying regulatory mechanisms. We have developed a thermodynamics-based model to predict gene expression driven by any DNA sequence, as a function of transcription factor concentrations and their DNA-binding specificities. It uses statistical thermodynamics theory to model not only protein-DNA interaction, but also the effect of DNA-bound activators and repressors on gene expression. In addition, the model incorporates mechanistic features such as synergistic effect of multiple activators, short range repression, and cooperativity in transcription factor-DNA binding, allowing us to systematically evaluate the significance of these features in the context of available expression data. Using this model on segmentation-related enhancers in Drosophila, we find that transcriptional synergy due to simultaneous action of multiple activators helps explain the data beyond what can be explained by cooperative DNA-binding alone. We find clear support for the phenomenon of short-range repression, where repressors do not directly interact with the basal transcriptional machinery. We also find that the binding sites contributing to an enhancer's function may not be conserved during evolution, and a noticeable fraction of these undergo lineage-specific changes. Our implementation of the model, called GEMSTAT, is the first publicly available program for simultaneously modeling the regulatory activities of a given set of sequences. PMID:20862354

  8. Monte Carlo approach in assessing damage in higher order structures of DNA

    NASA Technical Reports Server (NTRS)

    Chatterjee, A.; Schmidt, J. B.; Holley, W. R.

    1994-01-01

    We have developed a computer monitor of nuclear DNA in the form of chromatin fibre. The fibres are modeled as a ideal solenoid consisting of twenty helical turns with six nucleosomes per turn. The chromatin model, in combination with are Monte Carlo theory of radiation damage induces by charged particles, based on general features of tack structure and stopping power theory, has been used to evaluate the influence of DNA structure on initial damage. An interesting has emerged from our calculations. Our calculated results predict the existence of strong spatial correlations in damage sites associated with the symmetries in the solenoidal model. We have calculated spectra of short fragments of double stranded DNA produced by multiple double strand breaks induced by both high and low LET radiation. The spectra exhibit peaks at multiples of approximately 85 base pairs (the nucleosome periodicity), and approximately 1000 base pairs (solenoid periodicity). Preliminary experiments to investigate the fragment distributions from irradiated DNA, made by B. Rydberg at Lawrence Berkeley Laboratory, confirm the existence of short DNA fragments and are in substantial agreement with the predictions of our theory.

  9. Testing the Use of Implicit Solvent in the Molecular Dynamics Modelling of DNA Flexibility

    NASA Astrophysics Data System (ADS)

    Mitchell, J.; Harris, S.

    DNA flexibility controls packaging, looping and in some cases sequence specific protein binding. Molecular dynamics simulations carried out with a computationally efficient implicit solvent model are potentially a powerful tool for studying larger DNA molecules than can be currently simulated when water and counterions are represented explicitly. In this work we compare DNA flexibility at the base pair step level modelled using an implicit solvent model to that previously determined from explicit solvent simulations and database analysis. Although much of the sequence dependent behaviour is preserved in implicit solvent, the DNA is considerably more flexible when the approximate model is used. In addition we test the ability of the implicit solvent to model stress induced DNA disruptions by simulating a series of DNA minicircle topoisomers which vary in size and superhelical density. When compared with previously run explicit solvent simulations, we find that while the levels of DNA denaturation are similar using both computational methodologies, the specific structural form of the disruptions is different.

  10. Mesoscopic modeling of DNA denaturation rates: Sequence dependence and experimental comparison

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Dahlen, Oda, E-mail: oda.dahlen@ntnu.no; Erp, Titus S. van, E-mail: titus.van.erp@ntnu.no

    Using rare event simulation techniques, we calculated DNA denaturation rate constants for a range of sequences and temperatures for the Peyrard-Bishop-Dauxois (PBD) model with two different parameter sets. We studied a larger variety of sequences compared to previous studies that only consider DNA homopolymers and DNA sequences containing an equal amount of weak AT- and strong GC-base pairs. Our results show that, contrary to previous findings, an even distribution of the strong GC-base pairs does not always result in the fastest possible denaturation. In addition, we applied an adaptation of the PBD model to study hairpin denaturation for which experimentalmore » data are available. This is the first quantitative study in which dynamical results from the mesoscopic PBD model have been compared with experiments. Our results show that present parameterized models, although giving good results regarding thermodynamic properties, overestimate denaturation rates by orders of magnitude. We believe that our dynamical approach is, therefore, an important tool for verifying DNA models and for developing next generation models that have higher predictive power than present ones.« less

  11. Balancing the Interactions of Ions, Water, and DNA in the Drude Polarizable Force Field

    PubMed Central

    2015-01-01

    Recently we presented a first-generation all-atom Drude polarizable force field for DNA based on the classical Drude oscillator model, focusing on optimization of key dihedral angles followed by extensive validation of the force field parameters. Presently, we describe the procedure for balancing the electrostatic interactions between ions, water, and DNA as required for development of the Drude force field for DNA. The proper balance of these interactions is shown to impact DNA stability and subtler conformational properties, including the conformational equilibrium between the BI and BII states, and the A and B forms of DNA. The parametrization efforts were simultaneously guided by gas-phase quantum mechanics (QM) data on small model compounds and condensed-phase experimental data on the hydration and osmotic properties of biologically relevant ions and their solutions, as well as theoretical predictions for ionic distribution around DNA oligomer. In addition, fine-tuning of the internal base parameters was performed to obtain the final DNA model. Notably, the Drude model is shown to more accurately reproduce counterion condensation theory predictions of DNA charge neutralization by the condensed ions as compared to the CHARMM36 additive DNA force field, indicating an improved physical description of the forces dictating the ionic solvation of DNA due to the explicit treatment of electronic polarizability. In combination with the polarizable DNA force field, the availability of Drude polarizable parameters for proteins, lipids, and carbohydrates will allow for simulation studies of heterogeneous biological systems. PMID:24874104

  12. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tamrin, Mohd Izzuddin Mohd; Turaev, Sherzod; Sembok, Tengku Mohd Tengku

    There are tremendous works in biotechnology especially in area of DNA molecules. The computer society is attempting to develop smaller computing devices through computational models which are based on the operations performed on the DNA molecules. A Watson-Crick automaton, a theoretical model for DNA based computation, has two reading heads, and works on double-stranded sequences of the input related by a complementarity relation similar with the Watson-Crick complementarity of DNA nucleotides. Over the time, several variants of Watson-Crick automata have been introduced and investigated. However, they cannot be used as suitable DNA based computational models for molecular stochastic processes andmore » fuzzy processes that are related to important practical problems such as molecular parsing, gene disease detection, and food authentication. In this paper we define new variants of Watson-Crick automata, called weighted Watson-Crick automata, developing theoretical models for molecular stochastic and fuzzy processes. We define weighted Watson-Crick automata adapting weight restriction mechanisms associated with formal grammars and automata. We also study the generative capacities of weighted Watson-Crick automata, including probabilistic and fuzzy variants. We show that weighted variants of Watson-Crick automata increase their generative power.« less

  13. Weighted Watson-Crick automata

    NASA Astrophysics Data System (ADS)

    Tamrin, Mohd Izzuddin Mohd; Turaev, Sherzod; Sembok, Tengku Mohd Tengku

    2014-07-01

    There are tremendous works in biotechnology especially in area of DNA molecules. The computer society is attempting to develop smaller computing devices through computational models which are based on the operations performed on the DNA molecules. A Watson-Crick automaton, a theoretical model for DNA based computation, has two reading heads, and works on double-stranded sequences of the input related by a complementarity relation similar with the Watson-Crick complementarity of DNA nucleotides. Over the time, several variants of Watson-Crick automata have been introduced and investigated. However, they cannot be used as suitable DNA based computational models for molecular stochastic processes and fuzzy processes that are related to important practical problems such as molecular parsing, gene disease detection, and food authentication. In this paper we define new variants of Watson-Crick automata, called weighted Watson-Crick automata, developing theoretical models for molecular stochastic and fuzzy processes. We define weighted Watson-Crick automata adapting weight restriction mechanisms associated with formal grammars and automata. We also study the generative capacities of weighted Watson-Crick automata, including probabilistic and fuzzy variants. We show that weighted variants of Watson-Crick automata increase their generative power.

  14. Microdosimetry of DNA conformations: relation between direct effect of (60)Co gamma rays and topology of DNA geometrical models in the calculation of A-, B- and Z-DNA radiation-induced damage yields.

    PubMed

    Semsarha, Farid; Raisali, Gholamreza; Goliaei, Bahram; Khalafi, Hossein

    2016-05-01

    In order to obtain the energy deposition pattern of ionizing radiation in the nanometric scale of genetic material and to investigate the different sensitivities of the DNA conformations, direct effects of (60)Co gamma rays on the three A, B and Z conformations of DNA have been studied. For this purpose, single-strand breaks (SSB), double-strand breaks (DSB), base damage (BD), hit probabilities and three microdosimetry quantities (imparted energy, mean chord length and lineal energy) in the mentioned DNA conformations have been calculated and compared by using GEometry ANd Tracking 4 (Geant4) toolkit. The results show that A-, B- and Z-DNA conformations have the highest yields of DSB (1.2 Gy(-1) Gbp(-1)), SSB (25.2 Gy(-1) Gbp(-1)) and BD (4.81 Gy(-1) Gbp(-1)), respectively. Based on the investigation of direct effects of radiation, it can be concluded that the DSB yield is largely correlated to the topological characteristics of DNA models, although the SSB yield is not. Moreover, according to the comparative results of the present study, a reliable candidate parameter for describing the relationship between DNA damage yields and geometry of DNA models in the theoretical radiation biology research studies would be the mean chord length (4 V/S) of the models.

  15. Calculation on spectrum of direct DNA damage induced by low-energy electrons including dissociative electron attachment.

    PubMed

    Liu, Wei; Tan, Zhenyu; Zhang, Liming; Champion, Christophe

    2017-03-01

    In this work, direct DNA damage induced by low-energy electrons (sub-keV) is simulated using a Monte Carlo method. The characteristics of the present simulation are to consider the new mechanism of DNA damage due to dissociative electron attachment (DEA) and to allow determining damage to specific bases (i.e., adenine, thymine, guanine, or cytosine). The electron track structure in liquid water is generated, based on the dielectric response model for describing electron inelastic scattering and on a free-parameter theoretical model and the NIST database for calculating electron elastic scattering. Ionization cross sections of DNA bases are used to generate base radicals, and available DEA cross sections of DNA components are applied for determining DNA-strand breaks and base damage induced by sub-ionization electrons. The electron elastic scattering from DNA components is simulated using cross sections from different theoretical calculations. The resulting yields of various strand breaks and base damage in cellular environment are given. Especially, the contributions of sub-ionization electrons to various strand breaks and base damage are quantitatively presented, and the correlation between complex clustered DNA damage and the corresponding damaged bases is explored. This work shows that the contribution of sub-ionization electrons to strand breaks is substantial, up to about 40-70%, and this contribution is mainly focused on single-strand break. In addition, the base damage induced by sub-ionization electrons contributes to about 20-40% of the total base damage, and there is an evident correlation between single-strand break and damaged base pair A-T.

  16. Rupture of DNA aptamer: New insights from simulations

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Mishra, Rakesh Kumar; Nath, Shesh; Kumar, Sanjay

    2015-10-28

    Base-pockets (non-complementary base-pairs) in a double-stranded DNA play a crucial role in biological processes. Because of thermal fluctuations, it can lower the stability of DNA, whereas, in case of DNA aptamer, small molecules, e.g., adenosinemonophosphate and adenosinetriphosphate, form additional hydrogen bonds with base-pockets termed as “binding-pockets,” which enhance the stability. Using the Langevin dynamics simulations of coarse grained model of DNA followed by atomistic simulations, we investigated the influence of base-pocket and binding-pocket on the stability of DNA aptamer. Striking differences have been reported here for the separation induced by temperature and force, which require further investigation by single moleculemore » experiments.« less

  17. cgDNA: a software package for the prediction of sequence-dependent coarse-grain free energies of B-form DNA.

    PubMed

    Petkevičiūtė, D; Pasi, M; Gonzalez, O; Maddocks, J H

    2014-11-10

    cgDNA is a package for the prediction of sequence-dependent configuration-space free energies for B-form DNA at the coarse-grain level of rigid bases. For a fragment of any given length and sequence, cgDNA calculates the configuration of the associated free energy minimizer, i.e. the relative positions and orientations of each base, along with a stiffness matrix, which together govern differences in free energies. The model predicts non-local (i.e. beyond base-pair step) sequence dependence of the free energy minimizer. Configurations can be input or output in either the Curves+ definition of the usual helical DNA structural variables, or as a PDB file of coordinates of base atoms. We illustrate the cgDNA package by comparing predictions of free energy minimizers from (a) the cgDNA model, (b) time-averaged atomistic molecular dynamics (or MD) simulations, and (c) NMR or X-ray experimental observation, for (i) the Dickerson-Drew dodecamer and (ii) three oligomers containing A-tracts. The cgDNA predictions are rather close to those of the MD simulations, but many orders of magnitude faster to compute. Both the cgDNA and MD predictions are in reasonable agreement with the available experimental data. Our conclusion is that cgDNA can serve as a highly efficient tool for studying structural variations in B-form DNA over a wide range of sequences. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  18. Computational method and system for modeling, analyzing, and optimizing DNA amplification and synthesis

    DOEpatents

    Vandersall, Jennifer A.; Gardner, Shea N.; Clague, David S.

    2010-05-04

    A computational method and computer-based system of modeling DNA synthesis for the design and interpretation of PCR amplification, parallel DNA synthesis, and microarray chip analysis. The method and system include modules that address the bioinformatics, kinetics, and thermodynamics of DNA amplification and synthesis. Specifically, the steps of DNA selection, as well as the kinetics and thermodynamics of DNA hybridization and extensions, are addressed, which enable the optimization of the processing and the prediction of the products as a function of DNA sequence, mixing protocol, time, temperature and concentration of species.

  19. An analytical framework for estimating aquatic species density from environmental DNA

    USGS Publications Warehouse

    Chambert, Thierry; Pilliod, David S.; Goldberg, Caren S.; Doi, Hideyuki; Takahara, Teruhiko

    2018-01-01

    Environmental DNA (eDNA) analysis of water samples is on the brink of becoming a standard monitoring method for aquatic species. This method has improved detection rates over conventional survey methods and thus has demonstrated effectiveness for estimation of site occupancy and species distribution. The frontier of eDNA applications, however, is to infer species density. Building upon previous studies, we present and assess a modeling approach that aims at inferring animal density from eDNA. The modeling combines eDNA and animal count data from a subset of sites to estimate species density (and associated uncertainties) at other sites where only eDNA data are available. As a proof of concept, we first perform a cross-validation study using experimental data on carp in mesocosms. In these data, fish densities are known without error, which allows us to test the performance of the method with known data. We then evaluate the model using field data from a study on a stream salamander species to assess the potential of this method to work in natural settings, where density can never be known with absolute certainty. Two alternative distributions (Normal and Negative Binomial) to model variability in eDNA concentration data are assessed. Assessment based on the proof of concept data (carp) revealed that the Negative Binomial model provided much more accurate estimates than the model based on a Normal distribution, likely because eDNA data tend to be overdispersed. Greater imprecision was found when we applied the method to the field data, but the Negative Binomial model still provided useful density estimates. We call for further model development in this direction, as well as further research targeted at sampling design optimization. It will be important to assess these approaches on a broad range of study systems.

  20. Global force-torque phase diagram for the DNA double helix: structural transitions, triple points and collapsed plectonemes

    PubMed Central

    Marko, John F.; Neukirch, Sébastien

    2014-01-01

    We present a free energy model for structural transitions of the DNA double helix driven by tensile and torsional stress. Our model is coarse grained, and is based on semiflexible polymer descriptions of B-DNA, underwound L-DNA, and highly overwound P-DNA. The statistical-mechanical model of plectonemic supercoiling previously developed for B-DNA is applied to semiflexible polymer models of P and L-DNA, to obtain a model of DNA structural transitions in quantitative accord with experiment. We identify two distinct plectonemic states, one “inflated” by electrostatic repulsion and thermal fluctuations, and the other “collapsed”, with the two double helices inside the supercoils driven to close contact. We find that supercoiled B and L are stable only in inflated form, while supercoiled P is always collapsed. We also predict the behavior and experimental signatures of highly underwound “Q”-DNA, the left-handed analog of P-DNA; as for P, supercoiled Q is always collapsed. Overstretched “S”-DNA and strand-separated “stress-melted” DNA are also included in our model, allowing prediction of a global phase diagram for forces up to 1000 pN and torques between ±60 pN nm, or in terms of linking number density, from σ = −5 to +3. PMID:24483501

  1. Dose-dependent DNA adduct formation by cinnamaldehyde and other food-borne α,β-unsaturated aldehydes predicted by physiologically based in silico modelling.

    PubMed

    Kiwamoto, R; Ploeg, D; Rietjens, I M C M; Punt, A

    2016-03-01

    Genotoxicity of α,β-unsaturated aldehydes shown in vitro raises a concern for the use of the aldehydes as food flavourings, while at low dose exposures the formation of DNA adducts may be prevented by detoxification. Unlike many α,β-unsaturated aldehydes for which in vivo data are absent, cinnamaldehyde was shown to be not genotoxic or carcinogenic in vivo. The present study aimed at comparing dose-dependent DNA adduct formation by cinnamaldehyde and 18 acyclic food-borne α,β-unsaturated aldehydes using physiologically based kinetic/dynamic (PBK/D) modelling. In rats, cinnamaldehyde was predicted to induce higher DNA adducts levels than 6 out of the 18 α,β-unsaturated aldehydes, indicating that these 6 aldehydes may also test negative in vivo. At the highest cinnamaldehyde dose that tested negative in vivo, cinnamaldehyde was predicted to form at least three orders of magnitude higher levels of DNA adducts than the 18 aldehydes at their respective estimated daily intake. These results suggest that for all the 18 α,β-unsaturated aldehydes DNA adduct formation at doses relevant for human dietary exposure may not raise a concern. The present study illustrates a possible use of physiologically based in silico modelling to facilitate a science-based comparison and read-across on the possible risks posed by DNA reactive agents. Copyright © 2015 Elsevier B.V. All rights reserved.

  2. Modeling Structural Dynamics of Biomolecular Complexes by Coarse-Grained Molecular Simulations.

    PubMed

    Takada, Shoji; Kanada, Ryo; Tan, Cheng; Terakawa, Tsuyoshi; Li, Wenfei; Kenzaki, Hiroo

    2015-12-15

    Due to hierarchic nature of biomolecular systems, their computational modeling calls for multiscale approaches, in which coarse-grained (CG) simulations are used to address long-time dynamics of large systems. Here, we review recent developments and applications of CG modeling methods, focusing on our methods primarily for proteins, DNA, and their complexes. These methods have been implemented in the CG biomolecular simulator, CafeMol. Our CG model has resolution such that ∼10 non-hydrogen atoms are grouped into one CG particle on average. For proteins, each amino acid is represented by one CG particle. For DNA, one nucleotide is simplified by three CG particles, representing sugar, phosphate, and base. The protein modeling is based on the idea that proteins have a globally funnel-like energy landscape, which is encoded in the structure-based potential energy function. We first describe two representative minimal models of proteins, called the elastic network model and the classic Go̅ model. We then present a more elaborate protein model, which extends the minimal model to incorporate sequence and context dependent local flexibility and nonlocal contacts. For DNA, we describe a model developed by de Pablo's group that was tuned to well reproduce sequence-dependent structural and thermodynamic experimental data for single- and double-stranded DNAs. Protein-DNA interactions are modeled either by the structure-based term for specific cases or by electrostatic and excluded volume terms for nonspecific cases. We also discuss the time scale mapping in CG molecular dynamics simulations. While the apparent single time step of our CGMD is about 10 times larger than that in the fully atomistic molecular dynamics for small-scale dynamics, large-scale motions can be further accelerated by two-orders of magnitude with the use of CG model and a low friction constant in Langevin dynamics. Next, we present four examples of applications. First, the classic Go̅ model was used to emulate one ATP cycle of a molecular motor, kinesin. Second, nonspecific protein-DNA binding was studied by a combination of elaborate protein and DNA models. Third, a transcription factor, p53, that contains highly fluctuating regions was simulated on two perpendicularly arranged DNA segments, addressing intersegmental transfer of p53. Fourth, we simulated structural dynamics of dinucleosomes connected by a linker DNA finding distinct types of internucleosome docking and salt-concentration-dependent compaction. Finally, we discuss many of limitations in the current approaches and future directions. Especially, more accurate electrostatic treatment and a phospholipid model that matches our CG resolutions are of immediate importance.

  3. A deformation energy-based model for predicting nucleosome dyads and occupancy

    PubMed Central

    Liu, Guoqing; Xing, Yongqiang; Zhao, Hongyu; Wang, Jianying; Shang, Yu; Cai, Lu

    2016-01-01

    Nucleosome plays an essential role in various cellular processes, such as DNA replication, recombination, and transcription. Hence, it is important to decode the mechanism of nucleosome positioning and identify nucleosome positions in the genome. In this paper, we present a model for predicting nucleosome positioning based on DNA deformation, in which both bending and shearing of the nucleosomal DNA are considered. The model successfully predicted the dyad positions of nucleosomes assembled in vitro and the in vitro map of nucleosomes in Saccharomyces cerevisiae. Applying the model to Caenorhabditis elegans and Drosophila melanogaster, we achieved satisfactory results. Our data also show that shearing energy of nucleosomal DNA outperforms bending energy in nucleosome occupancy prediction and the ability to predict nucleosome dyad positions is attributed to bending energy that is associated with rotational positioning of nucleosomes. PMID:27053067

  4. Voltage dependency of transmission probability of aperiodic DNA molecule

    NASA Astrophysics Data System (ADS)

    Wiliyanti, V.; Yudiarsah, E.

    2017-07-01

    Characteristics of electron transports in aperiodic DNA molecules have been studied. Double stranded DNA model with the sequences of bases, GCTAGTACGTGACGTAGCTAGGATATGCCTGA, in one chain and its complements on the other chains has been used. Tight binding Hamiltonian is used to model DNA molecules. In the model, we consider that on-site energy of the basis has a linearly dependency on the applied electric field. Slater-Koster scheme is used to model electron hopping constant between bases. The transmission probability of electron from one electrode to the next electrode is calculated using a transfer matrix technique and scattering matrix method simultaneously. The results show that, generally, higher voltage gives a slightly larger value of the transmission probability. The applied voltage seems to shift extended states to lower energy. Meanwhile, the value of the transmission increases with twisting motion frequency increment.

  5. A symmetry model for genetic coding via a wallpaper group composed of the traditional four bases and an imaginary base E: Towards category theory-like systematization of molecular/genetic biology

    PubMed Central

    2014-01-01

    Background Previously, we suggested prototypal models that describe some clinical states based on group postulates. Here, we demonstrate a group/category theory-like model for molecular/genetic biology as an alternative application of our previous model. Specifically, we focus on deoxyribonucleic acid (DNA) base sequences. Results We construct a wallpaper pattern based on a five-letter cruciform motif with letters C, A, T, G, and E. Whereas the first four letters represent the standard DNA bases, the fifth is introduced for ease in formulating group operations that reproduce insertions and deletions of DNA base sequences. A basic group Z5 = {r, u, d, l, n} of operations is defined for the wallpaper pattern, with which a sequence of points can be generated corresponding to changes of a base in a DNA sequence by following the orbit of a point of the pattern under operations in group Z5. Other manipulations of DNA sequence can be treated using a vector-like notation ‘Dj’ corresponding to a DNA sequence but based on the five-letter base set; also, ‘Dj’s are expressed graphically. Insertions and deletions of a series of letters ‘E’ are admitted to assist in describing DNA recombination. Likewise, a vector-like notation Rj can be constructed for sequences of ribonucleic acid (RNA). The wallpaper group B = {Z5×∞, ●} (an ∞-fold Cartesian product of Z5) acts on Dj (or Rj) yielding changes to Dj (or Rj) denoted by ‘Dj◦B(j→k) = Dk’ (or ‘Rj◦B(j→k) = Rk’). Based on the operations of this group, two types of groups—a modulo 5 linear group and a rotational group over the Gaussian plane, acting on the five bases—are linked as parts of the wallpaper group for broader applications. As a result, changes, insertions/deletions and DNA (RNA) recombination (partial/total conversion) are described. As an exploratory study, a notation for the canonical “central dogma” via a category theory-like way is presented for future developments. Conclusions Despite the large incompleteness of our methodology, there is fertile ground to consider a symmetry model for genetic coding based on our specific wallpaper group. A more integrated formulation containing “central dogma” for future molecular/genetic biology remains to be explored. PMID:24885369

  6. Mutants of the base excision repair glycosylase, endonuclease III: DNA charge transport as a first step in lesion detection.

    PubMed

    Romano, Christine A; Sontz, Pamela A; Barton, Jacqueline K

    2011-07-12

    Endonuclease III (EndoIII) is a base excision repair glycosylase that targets damaged pyrimidines and contains a [4Fe-4S] cluster. We have proposed a model where BER proteins that contain redox-active [4Fe-4S] clusters utilize DNA charge transport (CT) as a first step in the detection of DNA lesions. Here, several mutants of EndoIII were prepared to probe their efficiency of DNA/protein charge transport. Cyclic voltammetry experiments on DNA-modified electrodes show that aromatic residues F30, Y55, Y75, and Y82 help mediate charge transport between DNA and the [4Fe-4S] cluster. On the basis of circular dichroism studies to measure protein stability, mutations at residues W178 and Y185 are found to destabilize the protein; these residues may function to protect the [4Fe-4S] cluster. Atomic force microscopy studies furthermore reveal a correlation in the ability of mutants to carry out protein/DNA CT and their ability to relocalize onto DNA strands containing a single base mismatch; EndoIII mutants that are defective in carrying out DNA/protein CT do not redistribute onto mismatch-containing strands, consistent with our model. These results demonstrate a link between the ability of the repair protein to carry out DNA CT and its ability to relocalize near lesions, thus pointing to DNA CT as a key first step in the detection of base damage in the genome.

  7. Development and validation of open-source software for DNA mixture interpretation based on a quantitative continuous model

    PubMed Central

    Manabe, Sho; Morimoto, Chie; Hamano, Yuya; Fujimoto, Shuntaro

    2017-01-01

    In criminal investigations, forensic scientists need to evaluate DNA mixtures. The estimation of the number of contributors and evaluation of the contribution of a person of interest (POI) from these samples are challenging. In this study, we developed a new open-source software “Kongoh” for interpreting DNA mixture based on a quantitative continuous model. The model uses quantitative information of peak heights in the DNA profile and considers the effect of artifacts and allelic drop-out. By using this software, the likelihoods of 1–4 persons’ contributions are calculated, and the most optimal number of contributors is automatically determined; this differs from other open-source software. Therefore, we can eliminate the need to manually determine the number of contributors before the analysis. Kongoh also considers allele- or locus-specific effects of biological parameters based on the experimental data. We then validated Kongoh by calculating the likelihood ratio (LR) of a POI’s contribution in true contributors and non-contributors by using 2–4 person mixtures analyzed through a 15 short tandem repeat typing system. Most LR values obtained from Kongoh during true-contributor testing strongly supported the POI’s contribution even for small amounts or degraded DNA samples. Kongoh correctly rejected a false hypothesis in the non-contributor testing, generated reproducible LR values, and demonstrated higher accuracy of the estimated number of contributors than another software based on the quantitative continuous model. Therefore, Kongoh is useful in accurately interpreting DNA evidence like mixtures and small amounts or degraded DNA samples. PMID:29149210

  8. Development and validation of open-source software for DNA mixture interpretation based on a quantitative continuous model.

    PubMed

    Manabe, Sho; Morimoto, Chie; Hamano, Yuya; Fujimoto, Shuntaro; Tamaki, Keiji

    2017-01-01

    In criminal investigations, forensic scientists need to evaluate DNA mixtures. The estimation of the number of contributors and evaluation of the contribution of a person of interest (POI) from these samples are challenging. In this study, we developed a new open-source software "Kongoh" for interpreting DNA mixture based on a quantitative continuous model. The model uses quantitative information of peak heights in the DNA profile and considers the effect of artifacts and allelic drop-out. By using this software, the likelihoods of 1-4 persons' contributions are calculated, and the most optimal number of contributors is automatically determined; this differs from other open-source software. Therefore, we can eliminate the need to manually determine the number of contributors before the analysis. Kongoh also considers allele- or locus-specific effects of biological parameters based on the experimental data. We then validated Kongoh by calculating the likelihood ratio (LR) of a POI's contribution in true contributors and non-contributors by using 2-4 person mixtures analyzed through a 15 short tandem repeat typing system. Most LR values obtained from Kongoh during true-contributor testing strongly supported the POI's contribution even for small amounts or degraded DNA samples. Kongoh correctly rejected a false hypothesis in the non-contributor testing, generated reproducible LR values, and demonstrated higher accuracy of the estimated number of contributors than another software based on the quantitative continuous model. Therefore, Kongoh is useful in accurately interpreting DNA evidence like mixtures and small amounts or degraded DNA samples.

  9. Identification of promising DNA GyrB inhibitors for Tuberculosis using pharmacophore-based virtual screening, molecular docking and molecular dynamics studies.

    PubMed

    Islam, Md Ataul; Pillay, Tahir S

    2017-08-01

    In this study, we searched for potential DNA GyrB inhibitors using pharmacophore-based virtual screening followed by molecular docking and molecular dynamics simulation approaches. For this purpose, a set of 248 DNA GyrB inhibitors was collected from the literature and a well-validated pharmacophore model was generated. The best pharmacophore model explained that two each of hydrogen bond acceptors and hydrophobicity regions were critical for inhibition of DNA GyrB. Good statistical results of the pharmacophore model indicated that the model was robust in nature. Virtual screening of molecular databases revealed three molecules as potential antimycobacterial agents. The final screened promising compounds were evaluated in molecular docking and molecular dynamics simulation studies. In the molecular dynamics studies, RMSD and RMSF values undoubtedly explained that the screened compounds formed stable complexes with DNA GyrB. Therefore, it can be concluded that the compounds identified may have potential for the treatment of TB. © 2017 John Wiley & Sons A/S.

  10. The contribution of phosphate–phosphate repulsions to the free energy of DNA bending

    PubMed Central

    Range, Kevin; Mayaan, Evelyn; Maher, L. J.; York, Darrin M.

    2005-01-01

    DNA bending is important for the packaging of genetic material, regulation of gene expression and interaction of nucleic acids with proteins. Consequently, it is of considerable interest to quantify the energetic factors that must be overcome to induce bending of DNA, such as base stacking and phosphate–phosphate repulsions. In the present work, the electrostatic contribution of phosphate–phosphate repulsions to the free energy of bending DNA is examined for 71 bp linear and bent-form model structures. The bent DNA model was based on the crystallographic structure of a full turn of DNA in a nucleosome core particle. A Green's function approach based on a linear-scaling smooth conductor-like screening model was applied to ascertain the contribution of individual phosphate–phosphate repulsions and overall electrostatic stabilization in aqueous solution. The effect of charge neutralization by site-bound ions was considered using Monte Carlo simulation to characterize the distribution of ion occupations and contribution of phosphate repulsions to the free energy of bending as a function of counterion load. The calculations predict that the phosphate–phosphate repulsions account for ∼30% of the total free energy required to bend DNA from canonical linear B-form into the conformation found in the nucleosome core particle. PMID:15741179

  11. Theory and modeling of particles with DNA-mediated interactions

    NASA Astrophysics Data System (ADS)

    Licata, Nicholas A.

    2008-05-01

    In recent years significant attention has been attracted to proposals which utilize DNA for nanotechnological applications. Potential applications of these ideas range from the programmable self-assembly of colloidal crystals, to biosensors and nanoparticle based drug delivery platforms. In Chapter I we introduce the system, which generically consists of colloidal particles functionalized with specially designed DNA markers. The sequence of bases on the DNA markers determines the particle type. Due to the hybridization between complementary single-stranded DNA, specific, type-dependent interactions can be introduced between particles by choosing the appropriate DNA marker sequences. In Chapter II we develop a statistical mechanical description of the aggregation and melting behavior of particles with DNA-mediated interactions. In Chapter III a model is proposed to describe the dynamical departure and diffusion of particles which form reversible key-lock connections. In Chapter IV we propose a method to self-assemble nanoparticle clusters using DNA scaffolds. A natural extension is discussed in Chapter V, the programmable self-assembly of nanoparticle clusters where the desired cluster geometry is encoded using DNA-mediated interactions. In Chapter VI we consider a nanoparticle based drug delivery platform for targeted, cell specific chemotherapy. In Chapter VII we present prospects for future research: the connection between DNA-mediated colloidal crystallization and jamming, and the inverse problem in self-assembly.

  12. cgDNAweb: a web interface to the cgDNA sequence-dependent coarse-grain model of double-stranded DNA.

    PubMed

    De Bruin, Lennart; Maddocks, John H

    2018-06-14

    The sequence-dependent statistical mechanical properties of fragments of double-stranded DNA is believed to be pertinent to its biological function at length scales from a few base pairs (or bp) to a few hundreds of bp, e.g. indirect read-out protein binding sites, nucleosome positioning sequences, phased A-tracts, etc. In turn, the equilibrium statistical mechanics behaviour of DNA depends upon its ground state configuration, or minimum free energy shape, as well as on its fluctuations as governed by its stiffness (in an appropriate sense). We here present cgDNAweb, which provides browser-based interactive visualization of the sequence-dependent ground states of double-stranded DNA molecules, as predicted by the underlying cgDNA coarse-grain rigid-base model of fragments with arbitrary sequence. The cgDNAweb interface is specifically designed to facilitate comparison between ground state shapes of different sequences. The server is freely available at cgDNAweb.epfl.ch with no login requirement.

  13. Size-Expanded yDNA bases: An Ab Initio Study

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Fuentes-Cabrera, Miguel A; Sumpter, Bobby G; Lipkowski, Pawel

    2006-01-01

    xDNA and yDNA are new classes of synthetic nucleic acids characterized by having base-pairs with one of the bases larger than the natural congeners. Here these larger bases are called x- and y-bases. We recently investigated and reported the structural and electronic properties of the x-bases (Fuentes-Cabrera et al. J. Phys. Chem. B 2005, 109, 21135-21139). Here we extend this study by investigating the structure and electronic properties of the y-bases. These studies are framed within our interest that xDNA and yDNA could function as nanowires, for they could have smaller HOMO-LUMO gaps than natural DNA. The limited amount ofmore » experimental structural data in these synthetic duplexes makes it necessary to first understand smaller models and, subsequently, to use that information to build larger models. In this paper, we report the results on the chemical and electronic structure of the y-bases. In particular, we predict that the y-bases have smaller HOMO-LUMO gaps than their natural congeners, which is an encouraging result for it indicates that yDNA could have a smaller HOMO-LUMO gap than natural DNA. Also, we predict that the y-bases are less planar than the natural ones. Particularly interesting are our results corresponding to yG. Our studies show that yG is unstable because it is less aromatic and has a Coulombic repulsion that involves the amino group, as compared with a more stable tautomer. However, yG has a very small HOMO-LUMO gap, the smallest of all the size-expanded bases we have considered. The results of this study provide useful information that may allow the synthesis of an yG-mimic that is stable and has a small HOMO-LUMO gap.« less

  14. Modeling photoionization of aqueous DNA and its components.

    PubMed

    Pluhařová, Eva; Slavíček, Petr; Jungwirth, Pavel

    2015-05-19

    Radiation damage to DNA is usually considered in terms of UVA and UVB radiation. These ultraviolet rays, which are part of the solar spectrum, can indeed cause chemical lesions in DNA, triggered by photoexcitation particularly in the UVB range. Damage can, however, be also caused by higher energy radiation, which can ionize directly the DNA or its immediate surroundings, leading to indirect damage. Thanks to absorption in the atmosphere, the intensity of such ionizing radiation is negligible in the solar spectrum at the surface of Earth. Nevertheless, such an ionizing scenario can become dangerously plausible for astronauts or flight personnel, as well as for persons present at nuclear power plant accidents. On the beneficial side, ionizing radiation is employed as means for destroying the DNA of cancer cells during radiation therapy. Quantitative information about ionization of DNA and its components is important not only for DNA radiation damage, but also for understanding redox properties of DNA in redox sensing or labeling, as well as charge migration along the double helix in nanoelectronics applications. Until recently, the vast majority of experimental and computational data on DNA ionization was pertinent to its components in the gas phase, which is far from its native aqueous environment. The situation has, however, changed for the better due to the advent of photoelectron spectroscopy in liquid microjets and its most recent application to photoionization of aqueous nucleosides, nucleotides, and larger DNA fragments. Here, we present a consistent and efficient computational methodology, which allows to accurately evaluate ionization energies and model photoelectron spectra of aqueous DNA and its individual components. After careful benchmarking, the method based on density functional theory and its time-dependent variant with properly chosen hybrid functionals and polarizable continuum solvent model provides ionization energies with accuracy of 0.2-0.3 eV, allowing for faithful modeling and interpretation of DNA photoionization. The key finding is that the aqueous medium is remarkably efficient in screening the interactions within DNA such that, unlike in the gas phase, ionization of a base, nucleoside, or nucleotide depends only very weakly on the particular DNA context. An exception is the electronic interaction between neighboring bases which can lead to sequence-specific effects, such as a partial delocalization of the cationic hole upon ionization enabled by presence of adjacent bases of the same type.

  15. Fluctuations in the DNA double helix

    NASA Astrophysics Data System (ADS)

    Peyrard, M.; López, S. C.; Angelov, D.

    2007-08-01

    DNA is not the static entity suggested by the famous double helix structure. It shows large fluctuational openings, in which the bases, which contain the genetic code, are temporarily open. Therefore it is an interesting system to study the effect of nonlinearity on the physical properties of a system. A simple model for DNA, at a mesoscopic scale, can be investigated by computer simulation, in the same spirit as the original work of Fermi, Pasta and Ulam. These calculations raise fundamental questions in statistical physics because they show a temporary breaking of equipartition of energy, regions with large amplitude fluctuations being able to coexist with regions where the fluctuations are very small, even when the model is studied in the canonical ensemble. This phenomenon can be related to nonlinear excitations in the model. The ability of the model to describe the actual properties of DNA is discussed by comparing theoretical and experimental results for the probability that base pairs open an a given temperature in specific DNA sequences. These studies give us indications on the proper description of the effect of the sequence in the mesoscopic model.

  16. A DNA-based semantic fusion model for remote sensing data.

    PubMed

    Sun, Heng; Weng, Jian; Yu, Guangchuang; Massawe, Richard H

    2013-01-01

    Semantic technology plays a key role in various domains, from conversation understanding to algorithm analysis. As the most efficient semantic tool, ontology can represent, process and manage the widespread knowledge. Nowadays, many researchers use ontology to collect and organize data's semantic information in order to maximize research productivity. In this paper, we firstly describe our work on the development of a remote sensing data ontology, with a primary focus on semantic fusion-driven research for big data. Our ontology is made up of 1,264 concepts and 2,030 semantic relationships. However, the growth of big data is straining the capacities of current semantic fusion and reasoning practices. Considering the massive parallelism of DNA strands, we propose a novel DNA-based semantic fusion model. In this model, a parallel strategy is developed to encode the semantic information in DNA for a large volume of remote sensing data. The semantic information is read in a parallel and bit-wise manner and an individual bit is converted to a base. By doing so, a considerable amount of conversion time can be saved, i.e., the cluster-based multi-processes program can reduce the conversion time from 81,536 seconds to 4,937 seconds for 4.34 GB source data files. Moreover, the size of result file recording DNA sequences is 54.51 GB for parallel C program compared with 57.89 GB for sequential Perl. This shows that our parallel method can also reduce the DNA synthesis cost. In addition, data types are encoded in our model, which is a basis for building type system in our future DNA computer. Finally, we describe theoretically an algorithm for DNA-based semantic fusion. This algorithm enables the process of integration of the knowledge from disparate remote sensing data sources into a consistent, accurate, and complete representation. This process depends solely on ligation reaction and screening operations instead of the ontology.

  17. A DNA-Based Semantic Fusion Model for Remote Sensing Data

    PubMed Central

    Sun, Heng; Weng, Jian; Yu, Guangchuang; Massawe, Richard H.

    2013-01-01

    Semantic technology plays a key role in various domains, from conversation understanding to algorithm analysis. As the most efficient semantic tool, ontology can represent, process and manage the widespread knowledge. Nowadays, many researchers use ontology to collect and organize data's semantic information in order to maximize research productivity. In this paper, we firstly describe our work on the development of a remote sensing data ontology, with a primary focus on semantic fusion-driven research for big data. Our ontology is made up of 1,264 concepts and 2,030 semantic relationships. However, the growth of big data is straining the capacities of current semantic fusion and reasoning practices. Considering the massive parallelism of DNA strands, we propose a novel DNA-based semantic fusion model. In this model, a parallel strategy is developed to encode the semantic information in DNA for a large volume of remote sensing data. The semantic information is read in a parallel and bit-wise manner and an individual bit is converted to a base. By doing so, a considerable amount of conversion time can be saved, i.e., the cluster-based multi-processes program can reduce the conversion time from 81,536 seconds to 4,937 seconds for 4.34 GB source data files. Moreover, the size of result file recording DNA sequences is 54.51 GB for parallel C program compared with 57.89 GB for sequential Perl. This shows that our parallel method can also reduce the DNA synthesis cost. In addition, data types are encoded in our model, which is a basis for building type system in our future DNA computer. Finally, we describe theoretically an algorithm for DNA-based semantic fusion. This algorithm enables the process of integration of the knowledge from disparate remote sensing data sources into a consistent, accurate, and complete representation. This process depends solely on ligation reaction and screening operations instead of the ontology. PMID:24116207

  18. Genetic determinants of freckle occurrence in the Spanish population: Towards ephelides prediction from human DNA samples.

    PubMed

    Hernando, Barbara; Ibañez, Maria Victoria; Deserio-Cuesta, Julio Alberto; Soria-Navarro, Raquel; Vilar-Sastre, Inca; Martinez-Cadenas, Conrado

    2018-03-01

    Prediction of human pigmentation traits, one of the most differentiable externally visible characteristics among individuals, from biological samples represents a useful tool in the field of forensic DNA phenotyping. In spite of freckling being a relatively common pigmentation characteristic in Europeans, little is known about the genetic basis of this largely genetically determined phenotype in southern European populations. In this work, we explored the predictive capacity of eight freckle and sunlight sensitivity-related genes in 458 individuals (266 non-freckled controls and 192 freckled cases) from Spain. Four loci were associated with freckling (MC1R, IRF4, ASIP and BNC2), and female sex was also found to be a predictive factor for having a freckling phenotype in our population. After identifying the most informative genetic variants responsible for human ephelides occurrence in our sample set, we developed a DNA-based freckle prediction model using a multivariate regression approach. Once developed, the capabilities of the prediction model were tested by a repeated 10-fold cross-validation approach. The proportion of correctly predicted individuals using the DNA-based freckle prediction model was 74.13%. The implementation of sex into the DNA-based freckle prediction model slightly improved the overall prediction accuracy by 2.19% (76.32%). Further evaluation of the newly-generated prediction model was performed by assessing the model's performance in a new cohort of 212 Spanish individuals, reaching a classification success rate of 74.61%. Validation of this prediction model may be carried out in larger populations, including samples from different European populations. Further research to validate and improve this newly-generated freckle prediction model will be needed before its forensic application. Together with DNA tests already validated for eye and hair colour prediction, this freckle prediction model may lead to a substantially more detailed physical description of unknown individuals from DNA found at the crime scene. Copyright © 2017 Elsevier B.V. All rights reserved.

  19. 11th International Conference of Radiation Research

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    NONE

    1999-07-18

    Topics discussed in the conference included the following: Radiation Physics, Radiation Chemistry and modelling--Radiation physics and dosimetry; Electron transfer in biological media; Radiation chemistry; Biophysical and biochemical modelling; Mechanisms of DNA damage; Assays of DNA damage; Energy deposition in micro volumes; Photo-effects; Special techniques and technologies; Oxidative damage. Molecular and cellular effects-- Photobiology; Cell cycle effects; DNA damage: Strand breaks; DNA damage: Bases; DNA damage Non-targeted; DNA damage: other; Chromosome aberrations: clonal; Chromosomal aberrations: non-clonal; Interactions: Heat/Radiation/Drugs; Biochemical effects; Protein expression; Gene induction; Co-operative effects; ``Bystander'' effects; Oxidative stress effects; Recovery from radiation damage. DNA damage and repair -- DNAmore » repair genes; DNA repair deficient diseases; DNA repair enzymology; Epigenetic effects on repair; and Ataxia and ATM.« less

  20. Exploring the common molecular basis for the universal DNA mutation bias: Revival of Loewdin mutation model

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Fu, Liang-Yu; Center for Bioinformatics, Huazhong Agricultural University, Wuhan 430070; Wang, Guang-Zhong

    2011-06-10

    Highlights: {yields} There exists a universal G:C {yields} A:T mutation bias in three domains of life. {yields} This universal mutation bias has not been sufficiently explained. {yields} A DNA mutation model proposed by Loewdin 40 years ago offers a common explanation. -- Abstract: Recently, numerous genome analyses revealed the existence of a universal G:C {yields} A:T mutation bias in bacteria, fungi, plants and animals. To explore the molecular basis for this mutation bias, we examined the three well-known DNA mutation models, i.e., oxidative damage model, UV-radiation damage model and CpG hypermutation model. It was revealed that these models cannot providemore » a sufficient explanation to the universal mutation bias. Therefore, we resorted to a DNA mutation model proposed by Loewdin 40 years ago, which was based on inter-base double proton transfers (DPT). Since DPT is a fundamental and spontaneous chemical process and occurs much more frequently within GC pairs than AT pairs, Loewdin model offers a common explanation for the observed universal mutation bias and thus has broad biological implications.« less

  1. Evaluating variation in human gut microbiota profiles due to DNA extraction method and inter-subject differences.

    PubMed

    Wagner Mackenzie, Brett; Waite, David W; Taylor, Michael W

    2015-01-01

    The human gut contains dense and diverse microbial communities which have profound influences on human health. Gaining meaningful insights into these communities requires provision of high quality microbial nucleic acids from human fecal samples, as well as an understanding of the sources of variation and their impacts on the experimental model. We present here a systematic analysis of commonly used microbial DNA extraction methods, and identify significant sources of variation. Five extraction methods (Human Microbiome Project protocol, MoBio PowerSoil DNA Isolation Kit, QIAamp DNA Stool Mini Kit, ZR Fecal DNA MiniPrep, phenol:chloroform-based DNA isolation) were evaluated based on the following criteria: DNA yield, quality and integrity, and microbial community structure based on Illumina amplicon sequencing of the V4 region of bacterial and archaeal 16S rRNA genes. Our results indicate that the largest portion of variation within the model was attributed to differences between subjects (biological variation), with a smaller proportion of variation associated with DNA extraction method (technical variation) and intra-subject variation. A comprehensive understanding of the potential impact of technical variation on the human gut microbiota will help limit preventable bias, enabling more accurate diversity estimates.

  2. Nuclear magnetic resonance-based model of a TF1/HmU-DNA complex.

    PubMed

    Silva, M V; Pasternack, L B; Kearns, D R

    1997-12-15

    Transcription factor 1 (TF1), a type II DNA-binding protein encoded by the Bacillus subtilis bacteriophage SPO1, has the capacity for sequence-selective DNA binding and a preference for 5-hydroxymethyl-2'-deoxyuridine (HmU)-containing DNA. In NMR studies of the TF1/HmU-DNA complex, intermolecular NOEs indicate that the flexible beta-ribbon and C-terminal alpha-helix are involved in the DNA-binding site of TF1, placing it in the beta-sheet category of DNA-binding proteins proposed to bind by wrapping two beta-ribbon "arms" around the DNA. Intermolecular and intramolecular NOEs were used to generate an energy-minimized model of the protein-DNA complex in which both DNA bending and protein structure changes are evident.

  3. Geant4-DNA: overview and recent developments

    NASA Astrophysics Data System (ADS)

    Štěpán, Václav

    Space travel and high altitude flights are inherently associated with prolonged exposure to cosmic and solar radiation. Understanding and simulation of radiation action on cellular and subcellular level contributes to precise assessment of the associated health risks and remains a challenge of today’s radiobiology research. The Geant4-DNA project (http://geant4-dna.org) aims at developing an experimentally validated simulation platform for modelling of the damage induced by ionizing radiation at DNA level. The platform is based on the Geant4 Monte Carlo simulation toolkit. This project extends specific functionalities of Geant4 in following areas: The step-by-step single scattering modelling of elementary physical interactions of electrons, protons, alpha particles and light ions with liquid water and DNA bases, for the so-called “physical” stage. The modelling of the “physico-chemical and chemical” stages corresponding to the production, the diffusion, the chemical reactions occurring between chemical species produced by water radiolysis, and to the radical attack on the biological targets. Physical and chemical stage simulations are combined with biological target models on several scales, from DNA double helix, through nucleosome, to chromatin segments and cell geometries. In addition, data mining clustering algorithms have been developed and optimised for the purpose of DNA damage scoring in simulated tracks. Experimental measurements on pBR322 plasmid DNA are being carried out in order to validate the Geant4-DNA models. The plasmid DNA has been irradiated in dry conditions by protons with energies from 100 keV to 30 MeV and in aqueous conditions, with and without scavengers, by 30 MeV protons, 290 MeV/u carbon and 500 MeV/u iron ions. Agarose gel electrophoresis combined with enzymatic treatment has been used to measure the resulting DNA damage. An overview of the developments undertaken by the Geant4-DNA collaboration including a description of software already available for download, as well as future perspectives, will be presented, on behalf of the Geant4-DNA Collaboration.

  4. DNA strand displacement system running logic programs.

    PubMed

    Rodríguez-Patón, Alfonso; Sainz de Murieta, Iñaki; Sosík, Petr

    2014-01-01

    The paper presents a DNA-based computing model which is enzyme-free and autonomous, not requiring a human intervention during the computation. The model is able to perform iterated resolution steps with logical formulae in conjunctive normal form. The implementation is based on the technique of DNA strand displacement, with each clause encoded in a separate DNA molecule. Propositions are encoded assigning a strand to each proposition p, and its complementary strand to the proposition ¬p; clauses are encoded comprising different propositions in the same strand. The model allows to run logic programs composed of Horn clauses by cascading resolution steps. The potential of the model is demonstrated also by its theoretical capability of solving SAT. The resulting SAT algorithm has a linear time complexity in the number of resolution steps, whereas its spatial complexity is exponential in the number of variables of the formula. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

  5. A Toda lattice model of DNA

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Christiansen, P.L.; Scott, A.C.; Muto, V.

    In recent years the possibility that anharmonic excitations could play a role in the dynamics of SNA has been considered by several authors. It has been suggested that solitons may be generated thermally at biological temperatures. The denaturation of the DNA double helix has been investigated by statistical mechanics methods and by dynamical simulations. Here the potential for the hydrogen bond in each base pair is approximated by a Morse potential. In the present paper we describe the Toda lattice model of DNA. Temperature enters via the initial conditions and through a perturbation of the dynamical equations. The model ismore » refined by introduction of transversal motion of the Toda lattice and by transversal coupling of two lattices in the hydrogen bonds present in the base pairs. Using Lennard-Jones potentials to model these bonds we are able to obtain results concerning the open states of DNA at biological temperatures. 39 refs., 7 figs.« less

  6. HDOCK: a web server for protein–protein and protein–DNA/RNA docking based on a hybrid strategy

    PubMed Central

    Yan, Yumeng; Zhang, Di; Zhou, Pei; Li, Botong

    2017-01-01

    Abstract Protein–protein and protein–DNA/RNA interactions play a fundamental role in a variety of biological processes. Determining the complex structures of these interactions is valuable, in which molecular docking has played an important role. To automatically make use of the binding information from the PDB in docking, here we have presented HDOCK, a novel web server of our hybrid docking algorithm of template-based modeling and free docking, in which cases with misleading templates can be rescued by the free docking protocol. The server supports protein–protein and protein–DNA/RNA docking and accepts both sequence and structure inputs for proteins. The docking process is fast and consumes about 10–20 min for a docking run. Tested on the cases with weakly homologous complexes of <30% sequence identity from five docking benchmarks, the HDOCK pipeline tied with template-based modeling on the protein–protein and protein–DNA benchmarks and performed better than template-based modeling on the three protein–RNA benchmarks when the top 10 predictions were considered. The performance of HDOCK became better when more predictions were considered. Combining the results of HDOCK and template-based modeling by ranking first of the template-based model further improved the predictive power of the server. The HDOCK web server is available at http://hdock.phys.hust.edu.cn/. PMID:28521030

  7. Sentaurus® based modeling and simulation for GFET's characteristic for ssDNA immobilization and hybridization

    NASA Astrophysics Data System (ADS)

    Yunfang, Jia; Cheng, Ju

    2016-01-01

    The graphene field effect transistor (GFET) has been widely studied and developed as sensors and functional devices. The first report about GFET sensing simulation on the device level is proposed. The GFET's characteristics, its responding for single strand DNA (ssDNA) and hybridization with the complimentary DNA (cDNA) are simulated based on Sentaurus, a popular CAD tool for electronic devices. The agreement between the simulated blank GFET feature and the reported experimental data suggests the feasibility of the presented simulation method. Then the simulations of ssDNA immobilization on GFET and hybridization with its cDNA are performed, the results are discussed based on the electron transfer (ET) mechanism between DNA and graphene. Project supported by the National Natural Science Foundation of China (No. 61371028) and the Tianjin Natural Science Foundation (No. 12JCZDJC22400).

  8. Modeling DNA

    ERIC Educational Resources Information Center

    Robertson, Carol

    2016-01-01

    Deoxyribonucleic acid (DNA) is life's most amazing molecule. It carries the genetic instructions that almost every organism needs to develop and reproduce. In the human genome alone, there are some three billion DNA base pairs. The most difficult part of teaching DNA structure, however, may be getting students to visualize something as small as a…

  9. Ancient DNA and the rewriting of human history: be sparing with Occam's razor.

    PubMed

    Haber, Marc; Mezzavilla, Massimo; Xue, Yali; Tyler-Smith, Chris

    2016-01-11

    Ancient DNA research is revealing a human history far more complex than that inferred from parsimonious models based on modern DNA. Here, we review some of the key events in the peopling of the world in the light of the findings of work on ancient DNA.

  10. Integrating prior knowledge in multiple testing under dependence with applications to detecting differential DNA methylation.

    PubMed

    Kuan, Pei Fen; Chiang, Derek Y

    2012-09-01

    DNA methylation has emerged as an important hallmark of epigenetics. Numerous platforms including tiling arrays and next generation sequencing, and experimental protocols are available for profiling DNA methylation. Similar to other tiling array data, DNA methylation data shares the characteristics of inherent correlation structure among nearby probes. However, unlike gene expression or protein DNA binding data, the varying CpG density which gives rise to CpG island, shore and shelf definition provides exogenous information in detecting differential methylation. This article aims to introduce a robust testing and probe ranking procedure based on a nonhomogeneous hidden Markov model that incorporates the above-mentioned features for detecting differential methylation. We revisit the seminal work of Sun and Cai (2009, Journal of the Royal Statistical Society: Series B (Statistical Methodology)71, 393-424) and propose modeling the nonnull using a nonparametric symmetric distribution in two-sided hypothesis testing. We show that this model improves probe ranking and is robust to model misspecification based on extensive simulation studies. We further illustrate that our proposed framework achieves good operating characteristics as compared to commonly used methods in real DNA methylation data that aims to detect differential methylation sites. © 2012, The International Biometric Society.

  11. Programmable energy landscapes for kinetic control of DNA strand displacement.

    PubMed

    Machinek, Robert R F; Ouldridge, Thomas E; Haley, Natalie E C; Bath, Jonathan; Turberfield, Andrew J

    2014-11-10

    DNA is used to construct synthetic systems that sense, actuate, move and compute. The operation of many dynamic DNA devices depends on toehold-mediated strand displacement, by which one DNA strand displaces another from a duplex. Kinetic control of strand displacement is particularly important in autonomous molecular machinery and molecular computation, in which non-equilibrium systems are controlled through rates of competing processes. Here, we introduce a new method based on the creation of mismatched base pairs as kinetic barriers to strand displacement. Reaction rate constants can be tuned across three orders of magnitude by altering the position of such a defect without significantly changing the stabilities of reactants or products. By modelling reaction free-energy landscapes, we explore the mechanistic basis of this control mechanism. We also demonstrate that oxDNA, a coarse-grained model of DNA, is capable of accurately predicting and explaining the impact of mismatches on displacement kinetics.

  12. Molecular Data for a Biochemical Model of DNA Radiation Damage: Electron Impact Ionization and Dissociative Ionization of DNA Bases and Sugar-Phosphate Backbone

    NASA Technical Reports Server (NTRS)

    Dateo, Christopher E.; Fletcher, Graham D.

    2004-01-01

    As part of the database for building up a biochemical model of DNA radiation damage, electron impact ionization cross sections of sugar-phosphate backbone and DNA bases have been calculated using the improved binary-encounter dipole (iBED) model. It is found that the total ionization cross sections of C3'- and C5'-deoxyribose-phospate, two conformers of the sugar-phosphate backbone, are close to each other. Furthermore, the sum of the ionization cross sections of the separate deoxyribose and phosphate fragments is in close agreement with the C3'- and C5'-deoxyribose-phospate cross sections, differing by less than 10%. Of the four DNA bases, the ionization cross section of guanine is the largest, then in decreasing order, adenine, thymine, and cytosine. The order is in accordance with the known propensity of oxidation of the bases by ionizing radiation. Dissociative ionization (DI), a process that both ionizes and dissociates a molecule, is investigated for cytosine. The DI cross section for the formation of H and (cytosine-Hl)(+), with the cytosine ion losing H at the 1 position, is also reported. The threshold of this process is calculated to be 17.1 eV. Detailed analysis of ionization products such as in DI is important to trace the sequential steps in the biochemical process of DNA damage.

  13. Optical Materials with a Genome: Nanophotonics with DNA-Stabilized Silver Clusters

    NASA Astrophysics Data System (ADS)

    Copp, Stacy M.

    Fluorescent silver clusters with unique rod-like geometries are stabilized by DNA. The sizes and colors of these clusters, or AgN-DNA, are selected by DNA base sequence, which can tune peak emission from blue-green into the near-infrared. Combined with DNA nanostructures, AgN-DNA promise exciting applications in nanophotonics and sensing. Until recently, however, a lack of understanding of the mechanisms controlling AgN-DNA fluorescence has challenged such applications. This dissertation discusses progress toward understanding the role of DNA as a "genome" for silver clusters and toward using DNA to achieve atomic-scale precision of silver cluster size and nanometer-scale precision of silver cluster position on a DNA breadboard. We also investigate sensitivity of AgN-DNA to local solvent environment, with an eye toward applications in chemical and biochemical sensing. Using robotic techniques to generate large data sets, we show that fluorescent silver clusters are templated by certain DNA base motifs that select "magic-sized" cluster cores of enhanced stabilities. The linear arrangement of bases on the phosphate backbone imposes a unique rod-like geometry on the clusters. Harnessing machine learning and bioinformatics techniques, we also demonstrate that sequences of DNA templates can be selected to stabilize silver clusters with desired optical properties, including high fluorescence intensity and specific fluorescence wavelengths, with much higher rates of success as compared to current strategies. The discovered base motifs can be also used to design modular DNA host strands that enable individual silver clusters with atomically precise sizes to bind at specific programmed locations on a DNA nanostructure. We show that DNA-mediated nanoscale arrangement enables near-field coupling of distinct clusters, demonstrated by dual-color cluster assemblies exhibiting resonant energy transfer. These results demonstrate a new degree of control over the optical properties and relative positions of nanoparticles, selected almost solely by the sequence of DNA. AgN-DNA are promising chemical and biochemical sensors due to the sensitivity of their fluorescence to local environment. However, the mechanisms behind many sensing schemes are not understood, and the nature of the excited state of the silver cluster itself remains unknown. To probe the fluorescence mechanisms of AgN-DNA, we investigate the behavior of purified solutions of these clusters in various solvents. We find that standard models for fluorophore solvatochromism, including the Lippert-Mataga model, do not describe AgN-DNA fluorescence because such models neglect specific interactions between the cluster and surrounding solvent molecules. Fluorescence colors are well-modeled by Mie-Gans theory, suggesting that the local dielectric environment of the cluster does play a role in fluorescence, although additional specific solvent interactions and cluster shape changes may also determine fluorescence color and intensity. These results suggest that AgN-DNA may be sensitive to changes in local dielectric environment on nanometer length scales and may also act as sensors for small molecules with affinity for DNA.

  14. Manipulative interplay of two adozelesin molecules with d(ATTAAT)₂achieving ligand-stacked Watson-Crick and Hoogsteen base-paired duplex adducts.

    PubMed

    Hopton, Suzanne R; Thompson, Andrew S

    2011-05-17

    Previous structural studies of the cyclopropapyrroloindole (CPI) antitumor antibiotics have shown that these ligands bind covalently edge-on into the minor groove of double-stranded DNA. Reversible covalent modification of the DNA via N3 of adenine occurs in a sequence-specific fashion. Early nuclear magnetic resonance and molecular modeling studies with both mono- and bis-alkylating ligands indicated that the ligands fit tightly within the minor groove, causing little distortion of the helix. In this study, we propose a new binding model for several of the CPI-based analogues, in which the aromatic secondary rings form π-stacked complexes within the minor groove. One of the adducts, formed with adozelesin and the d(ATTAAT)(2) sequence, also demonstrates the ability of these ligands to manipulate the DNA of the binding site, resulting in a Hoogsteen base-paired adduct. Although this type of base pairing has been previously observed with the bisfunctional CPI analogue bizelesin, this is the first time that such an observation has been made with a monoalkylating nondimeric analogue. Together, these results provide a new model for the design of CPI-based antitumor antibiotics, which also has a significant bearing on other structurally related and structurally unrelated minor groove-binding ligands. They indicate the dynamic nature of ligand-DNA interactions, demonstrating both DNA conformational flexibility and the ability of two DNA-bound ligands to interact to form stable covalent modified complexes.

  15. A coarse-grained model for DNA origami.

    PubMed

    Reshetnikov, Roman V; Stolyarova, Anastasia V; Zalevsky, Arthur O; Panteleev, Dmitry Y; Pavlova, Galina V; Klinov, Dmitry V; Golovin, Andrey V; Protopopova, Anna D

    2018-02-16

    Modeling tools provide a valuable support for DNA origami design. However, current solutions have limited application for conformational analysis of the designs. In this work we present a tool for a thorough study of DNA origami structure and dynamics. The tool is based on a novel coarse-grained model dedicated to geometry optimization and conformational analysis of DNA origami. We explored the ability of the model to predict dynamic behavior, global shapes, and fine details of two single-layer systems designed in hexagonal and square lattices using atomic force microscopy, Förster resonance energy transfer spectroscopy, and all-atom molecular dynamic simulations for validation of the results. We also examined the performance of the model for multilayer systems by simulation of DNA origami with published cryo-electron microscopy and atomic force microscopy structures. A good agreement between the simulated and experimental data makes the model suitable for conformational analysis of DNA origami objects. The tool is available at http://vsb.fbb.msu.ru/cosm as a web-service and as a standalone version.

  16. A coarse-grained model for DNA origami

    PubMed Central

    Stolyarova, Anastasia V; Zalevsky, Arthur O; Panteleev, Dmitry Y; Pavlova, Galina V; Klinov, Dmitry V; Golovin, Andrey V; Protopopova, Anna D

    2018-01-01

    Abstract Modeling tools provide a valuable support for DNA origami design. However, current solutions have limited application for conformational analysis of the designs. In this work we present a tool for a thorough study of DNA origami structure and dynamics. The tool is based on a novel coarse-grained model dedicated to geometry optimization and conformational analysis of DNA origami. We explored the ability of the model to predict dynamic behavior, global shapes, and fine details of two single-layer systems designed in hexagonal and square lattices using atomic force microscopy, Förster resonance energy transfer spectroscopy, and all-atom molecular dynamic simulations for validation of the results. We also examined the performance of the model for multilayer systems by simulation of DNA origami with published cryo-electron microscopy and atomic force microscopy structures. A good agreement between the simulated and experimental data makes the model suitable for conformational analysis of DNA origami objects. The tool is available at http://vsb.fbb.msu.ru/cosm as a web-service and as a standalone version. PMID:29267876

  17. A novel chaotic based image encryption using a hybrid model of deoxyribonucleic acid and cellular automata

    NASA Astrophysics Data System (ADS)

    Enayatifar, Rasul; Sadaei, Hossein Javedani; Abdullah, Abdul Hanan; Lee, Malrey; Isnin, Ismail Fauzi

    2015-08-01

    Currently, there are many studies have conducted on developing security of the digital image in order to protect such data while they are sending on the internet. This work aims to propose a new approach based on a hybrid model of the Tinkerbell chaotic map, deoxyribonucleic acid (DNA) and cellular automata (CA). DNA rules, DNA sequence XOR operator and CA rules are used simultaneously to encrypt the plain-image pixels. To determine rule number in DNA sequence and also CA, a 2-dimension Tinkerbell chaotic map is employed. Experimental results and computer simulations, both confirm that the proposed scheme not only demonstrates outstanding encryption, but also resists various typical attacks.

  18. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Serwer, Philip, E-mail: serwer@uthscsa.edu; Wright, Elena T.; Liu, Zheng

    DNA packaging of phages phi29, T3 and T7 sometimes produces incompletely packaged DNA with quantized lengths, based on gel electrophoretic band formation. We discover here a packaging ATPase-free, in vitro model for packaged DNA length quantization. We use directed evolution to isolate a five-site T3 point mutant that hyper-produces tail-free capsids with mature DNA (heads). Three tail gene mutations, but no head gene mutations, are present. A variable-length DNA segment leaks from some mutant heads, based on DNase I-protection assay and electron microscopy. The protected DNA segment has quantized lengths, based on restriction endonuclease analysis: six sharp bands of DNAmore » missing 3.7–12.3% of the last end packaged. Native gel electrophoresis confirms quantized DNA expulsion and, after removal of external DNA, provides evidence that capsid radius is the quantization-ruler. Capsid-based DNA length quantization possibly evolved via selection for stalling that provides time for feedback control during DNA packaging and injection. - Graphical abstract: Highlights: • We implement directed evolution- and DNA-sequencing-based phage assembly genetics. • We purify stable, mutant phage heads with a partially leaked mature DNA molecule. • Native gels and DNase-protection show leaked DNA segments to have quantized lengths. • Native gels after DNase I-removal of leaked DNA reveal the capsids to vary in radius. • Thus, we hypothesize leaked DNA quantization via variably quantized capsid radius.« less

  19. Combined effects of metal complexation and size expansion in the electronic structure of DNA base pairs

    NASA Astrophysics Data System (ADS)

    Brancolini, Giorgia; Di Felice, Rosa

    2011-05-01

    Novel DNA derivatives have been recently investigated in the pursuit of modified DNA duplexes to tune the electronic structure of DNA-based assemblies for nanotechnology applications. Size-expanded DNAs (e.g., xDNA) and metalated DNAs (M-DNA) may enhance stacking interactions and induce metallic conductivity, respectively. Here we explore possible ways of tailoring the DNA electronic structure by combining the aromatic size expansion with the metal-doping. We select the salient structures from our recent study on natural DNA pairs complexed with transition metal ions and consider the equivalent model configurations for xDNA pairs. We present the results of density functional theory electronic structure calculations of the metalated expanded base-pairs with various localized basis sets and exchange-correlation functionals. Implicit solvent and coordination water molecules are also included. Our results indicate that the effect of base expansion is largest in Ag-xGC complexes, while Cu-xGC complexes are the most promising candidates for nanowires with enhanced electron transfer and also for on-purpose modification of the DNA double-helix for signal detection.

  20. Antibody-controlled actuation of DNA-based molecular circuits.

    PubMed

    Engelen, Wouter; Meijer, Lenny H H; Somers, Bram; de Greef, Tom F A; Merkx, Maarten

    2017-02-17

    DNA-based molecular circuits allow autonomous signal processing, but their actuation has relied mostly on RNA/DNA-based inputs, limiting their application in synthetic biology, biomedicine and molecular diagnostics. Here we introduce a generic method to translate the presence of an antibody into a unique DNA strand, enabling the use of antibodies as specific inputs for DNA-based molecular computing. Our approach, antibody-templated strand exchange (ATSE), uses the characteristic bivalent architecture of antibodies to promote DNA-strand exchange reactions both thermodynamically and kinetically. Detailed characterization of the ATSE reaction allowed the establishment of a comprehensive model that describes the kinetics and thermodynamics of ATSE as a function of toehold length, antibody-epitope affinity and concentration. ATSE enables the introduction of complex signal processing in antibody-based diagnostics, as demonstrated here by constructing molecular circuits for multiplex antibody detection, integration of multiple antibody inputs using logic gates and actuation of enzymes and DNAzymes for signal amplification.

  1. Antibody-controlled actuation of DNA-based molecular circuits

    NASA Astrophysics Data System (ADS)

    Engelen, Wouter; Meijer, Lenny H. H.; Somers, Bram; de Greef, Tom F. A.; Merkx, Maarten

    2017-02-01

    DNA-based molecular circuits allow autonomous signal processing, but their actuation has relied mostly on RNA/DNA-based inputs, limiting their application in synthetic biology, biomedicine and molecular diagnostics. Here we introduce a generic method to translate the presence of an antibody into a unique DNA strand, enabling the use of antibodies as specific inputs for DNA-based molecular computing. Our approach, antibody-templated strand exchange (ATSE), uses the characteristic bivalent architecture of antibodies to promote DNA-strand exchange reactions both thermodynamically and kinetically. Detailed characterization of the ATSE reaction allowed the establishment of a comprehensive model that describes the kinetics and thermodynamics of ATSE as a function of toehold length, antibody-epitope affinity and concentration. ATSE enables the introduction of complex signal processing in antibody-based diagnostics, as demonstrated here by constructing molecular circuits for multiplex antibody detection, integration of multiple antibody inputs using logic gates and actuation of enzymes and DNAzymes for signal amplification.

  2. Architecture with GIDEON, A Program for Design in Structural DNA Nanotechnology

    PubMed Central

    Birac, Jeffrey J.; Sherman, William B.; Kopatsch, Jens; Constantinou, Pamela E.; Seeman, Nadrian C.

    2012-01-01

    We present geometry based design strategies for DNA nanostructures. The strategies have been implemented with GIDEON – a Graphical Integrated Development Environment for OligoNucleotides. GIDEON has a highly flexible graphical user interface that facilitates the development of simple yet precise models, and the evaluation of strains therein. Models are built on a simple model of undistorted B-DNA double-helical domains. Simple point and click manipulations of the model allow the minimization of strain in the phosphate-backbone linkages between these domains and the identification of any steric clashes that might occur as a result. Detailed analysis of 3D triangles yields clear predictions of the strains associated with triangles of different sizes. We have carried out experiments that confirm that 3D triangles form well only when their geometrical strain is less than 4% deviation from the estimated relaxed structure. Thus geometry-based techniques alone, without energetic considerations, can be used to explain general trends in DNA structure formation. We have used GIDEON to build detailed models of double crossover and triple crossover molecules, evaluating the non-planarity associated with base tilt and junction mis-alignments. Computer modeling using a graphical user interface overcomes the limited precision of physical models for larger systems, and the limited interaction rate associated with earlier, command-line driven software. PMID:16630733

  3. Computational and experimental analysis of DNA shuffling

    PubMed Central

    Maheshri, Narendra; Schaffer, David V.

    2003-01-01

    We describe a computational model of DNA shuffling based on the thermodynamics and kinetics of this process. The model independently tracks a representative ensemble of DNA molecules and records their states at every stage of a shuffling reaction. These data can subsequently be analyzed to yield information on any relevant metric, including reassembly efficiency, crossover number, type and distribution, and DNA sequence length distributions. The predictive ability of the model was validated by comparison to three independent sets of experimental data, and analysis of the simulation results led to several unique insights into the DNA shuffling process. We examine a tradeoff between crossover frequency and reassembly efficiency and illustrate the effects of experimental parameters on this relationship. Furthermore, we discuss conditions that promote the formation of useless “junk” DNA sequences or multimeric sequences containing multiple copies of the reassembled product. This model will therefore aid in the design of optimal shuffling reaction conditions. PMID:12626764

  4. DNA bending and a flip-out mechanism for base excision by the helix–hairpin–helix DNA glycosylase, Escherichia coli AlkA

    PubMed Central

    Hollis, Thomas; Ichikawa, Yoshitaka; Ellenberger, Tom

    2000-01-01

    The Escherichia coli AlkA protein is a base excision repair glycosylase that removes a variety of alkylated bases from DNA. The 2.5 Å crystal structure of AlkA complexed to DNA shows a large distortion in the bound DNA. The enzyme flips a 1–azaribose abasic nucleotide out of DNA and induces a 66° bend in the DNA with a marked widening of the minor groove. The position of the 1–azaribose in the enzyme active site suggests an SN1-type mechanism for the glycosylase reaction, in which the essential catalytic Asp238 provides direct assistance for base removal. Catalytic selectivity might result from the enhanced stacking of positively charged, alkylated bases against the aromatic side chain of Trp272 in conjunction with the relative ease of cleaving the weakened glycosylic bond of these modified nucleotides. The structure of the AlkA–DNA complex offers the first glimpse of a helix–hairpin–helix (HhH) glycosylase complexed to DNA. Modeling studies suggest that other HhH glycosylases can bind to DNA in a similar manner. PMID:10675345

  5. In depth analysis of the quenching of three fluorene-phenylene-based cationic conjugated polyelectrolytes by DNA and DNA bases.

    PubMed

    Davies, Matthew L; Douglas, Peter; Burrows, Hugh D; Martincigh, Bice; Miguel, Maria da Graça; Scherf, Ullrich; Mallavia, Ricardo; Douglas, Alastair

    2014-01-16

    The interaction of three cationic poly {9,9-bis[N,N-(trimethylammonium)hexyl]fluorene-co-1,4-phenylene} polymers with average chain lengths of ∼6, 12, and 100 repeat units (PFP-NR36(I),12(Br),100(Br)) with both double and single stranded, short and long, DNA and DNA bases have been studied by steady state and time-resolved fluorescence techniques. Fluorescence of PFP-NR3 polymers is quenched with high efficiency by DNA (both double and single stranded) and DNA bases. The resulting quenching plots are sigmoidal and are not accurately described by using a Stern-Volmer quenching mechanism. Here, the quenching mechanism is well modeled in terms of an equilibrium in which a PFP-NR3/DNA aggregate complex is formed which brings polymer chains into close enough proximity to allow interchain excitation energy migration and quenching at aggregate or DNA base traps. Such an analysis gives equilibrium constants of 8.4 × 10(6) (±1.2 × 10(6)) M(-1) for short-dsDNA and 8.6 × 10(6) (±1.7 × 10(6)) M(-1) for short-ssDNA with PFP-NR36(I).

  6. DNA Methylation-a Potential Source of Mitochondria DNA Base Mismatch in the Development of Diabetic Retinopathy.

    PubMed

    Mishra, Manish; Kowluru, Renu A

    2018-04-21

    In the development of diabetic retinopathy, retinal mitochondria are dysfunctional, and mitochondrial DNA (mtDNA) is damaged with increased base mismatches and hypermethylated cytosines. DNA methylation is also a potential source of mutation, and in diabetes, the noncoding region, the displacement loop (D-loop), experiences more methylation and base mismatches than other regions of the mtDNA. Our aim was to investigate a possible crosstalk between mtDNA methylation and base mismatches in the development of diabetic retinopathy. The effect of inhibition of Dnmts (by 5-aza-2'-deoxycytidine or Dnmt1-siRNA) on glucose-induced mtDNA base mismatches was investigated in human retinal endothelial cells by surveyor endonuclease digestion and validated by Sanger sequencing. The role of deamination factors on increased base mismatches was determined in the cells genetically modulated for mitochondrial superoxide dismutase (Sod2) or cytidine-deaminase (APOBEC3A). The results were confirmed in an in vivo model using retinal microvasculature from diabetic mice overexpressing Sod2. Inhibition of DNA methylation, or regulation of cytosine deamination, significantly inhibited an increase in base mismatches at the D-loop and prevented mitochondrial dysfunction. Overexpression of Sod2 in mice also prevented diabetes-induced D-loop hypermethylation and increase in base mismatches. The crosstalk between DNA methylation and base mismatches continued even after termination of hyperglycemia, suggesting its role in the metabolic memory phenomenon associated with the progression of diabetic retinopathy. Inhibition of DNA methylation limits the availability of methylated cytosine for deamination, suggesting a crosstalk between DNA methylation and base mismatches. Thus, regulation of DNA methylation, or its deamination, should impede the development of diabetic retinopathy by preventing formation of base mismatches and mitochondrial dysfunction.

  7. DNA compaction into new DNA vectors based on cyclodextrin polymer: surface enhanced Raman spectroscopy characterization.

    PubMed

    Burckbuchler, V; Wintgens, V; Lecomte, S; Percot, A; Leborgne, C; Danos, O; Kichler, A; Amiel, C

    2006-04-05

    The ability of DNA to bind polycation yielding polyplexes is widely used in nonviral gene delivery. The aim of the present study was to evaluate the DNA compaction with a new DNA vector using Raman spectroscopy. The polyplexes result from an association of a beta-cyclodextrin polymer (polybeta-CD), an amphiphilic cationic connector (DC-Chol or adamantane derivative Ada2), and DNA. The charge of the polymeric vector is effectively controlled by simple addition of cationic connector in the medium. We used surface enhanced Raman spectroscopy (SERS) to characterize this ternary complex, monitoring the accessibility of adenyl residues to silver colloids. The first experiments were performed using model systems based on polyA (polyadenosine monophosphate) well characterized by SERS. This model was then extended to plasmid DNA to study polybeta-CD/Ada2/DNA and polybeta-CD/DC-Chol/DNA polyplexes. The SERS spectra show a decrease of signal intensity when the vector/DNA charge ratio (Z+/-) increases. At the highest ratio (Z+/- = 10) the signal is 6-fold and 3-fold less intense than the DNA reference signal for Ada2 and DC-Chol polyplexes, respectively. Thus adenyl residues have a reduced accessibility as DNA is bound to the vector. Moreover, the SERS intensity variations are in agreement with gel electrophoresis and zeta potential experiments on the same systems. The overall study clearly demonstrates that the cationic charges neutralizing the negative charges of DNA result in the formation of stable polyplexes. In vitro transfection efficiency of those DNA vectors are also presented and compared to the classical DC-Chol lipoplexes (DC-Chol/DNA). The results show an increase of the transfection efficiency 2-fold higher with our vector based on polybeta-CD. Copyright 2005 Wiley Periodicals, Inc.

  8. Collaborations between CpG sites in DNA methylation

    NASA Astrophysics Data System (ADS)

    Song, You; Ren, Honglei; Lei, Jinzhi

    2017-08-01

    DNA methylation patterns have profound impacts on genome stability, gene expression and development. The molecular base of DNA methylation patterns has long been focused at single CpG sites level. Here, we construct a kinetic model of DNA methylation with collaborations between CpG sites, from which a correlation function was established based on experimental data. The function consists of three parts that suggest three possible sources of the correlation: movement of enzymes along DNA, collaboration between DNA methylation and nucleosome modification, and global enzyme concentrations within a cell. Moreover, the collaboration strength between DNA methylation and nucleosome modification is universal for mouse early embryo cells. The obtained correlation function provides insightful understanding for the mechanisms of inheritance of DNA methylation patterns.

  9. An Investigative Graduate Laboratory Course for Teaching Modern DNA Techniques

    ERIC Educational Resources Information Center

    de Lencastre, Alexandre; Torello, A. Thomas; Keller, Lani C.

    2017-01-01

    This graduate-level DNA methods laboratory course is designed to model a discovery-based research project and engages students in both traditional DNA analysis methods and modern recombinant DNA cloning techniques. In the first part of the course, students clone the "Drosophila" ortholog of a human disease gene of their choosing using…

  10. Prediction of TF target sites based on atomistic models of protein-DNA complexes

    PubMed Central

    Angarica, Vladimir Espinosa; Pérez, Abel González; Vasconcelos, Ana T; Collado-Vides, Julio; Contreras-Moreira, Bruno

    2008-01-01

    Background The specific recognition of genomic cis-regulatory elements by transcription factors (TFs) plays an essential role in the regulation of coordinated gene expression. Studying the mechanisms determining binding specificity in protein-DNA interactions is thus an important goal. Most current approaches for modeling TF specific recognition rely on the knowledge of large sets of cognate target sites and consider only the information contained in their primary sequence. Results Here we describe a structure-based methodology for predicting sequence motifs starting from the coordinates of a TF-DNA complex. Our algorithm combines information regarding the direct and indirect readout of DNA into an atomistic statistical model, which is used to estimate the interaction potential. We first measure the ability of our method to correctly estimate the binding specificities of eight prokaryotic and eukaryotic TFs that belong to different structural superfamilies. Secondly, the method is applied to two homology models, finding that sampling of interface side-chain rotamers remarkably improves the results. Thirdly, the algorithm is compared with a reference structural method based on contact counts, obtaining comparable predictions for the experimental complexes and more accurate sequence motifs for the homology models. Conclusion Our results demonstrate that atomic-detail structural information can be feasibly used to predict TF binding sites. The computational method presented here is universal and might be applied to other systems involving protein-DNA recognition. PMID:18922190

  11. Understanding the Elementary Steps in DNA Tile-Based Self-Assembly.

    PubMed

    Jiang, Shuoxing; Hong, Fan; Hu, Huiyu; Yan, Hao; Liu, Yan

    2017-09-26

    Although many models have been developed to guide the design and implementation of DNA tile-based self-assembly systems with increasing complexity, the fundamental assumptions of the models have not been thoroughly tested. To expand the quantitative understanding of DNA tile-based self-assembly and to test the fundamental assumptions of self-assembly models, we investigated DNA tile attachment to preformed "multi-tile" arrays in real time and obtained the thermodynamic and kinetic parameters of single tile attachment in various sticky end association scenarios. With more sticky ends, tile attachment becomes more thermostable with an approximately linear decrease in the free energy change (more negative). The total binding free energy of sticky ends is partially compromised by a sequence-independent energy penalty when tile attachment forms a constrained configuration: "loop". The minimal loop is a 2 × 2 tetramer (Loop4). The energy penalty of loops of 4, 6, and 8 tiles was analyzed with the independent loop model assuming no interloop tension, which is generalizable to arbitrary tile configurations. More sticky ends also contribute to a faster on-rate under isothermal conditions when nucleation is the rate-limiting step. Incorrect sticky end contributes to neither the thermostability nor the kinetics. The thermodynamic and kinetic parameters of DNA tile attachment elucidated here will contribute to the future improvement and optimization of tile assembly modeling, precise control of experimental conditions, and structural design for error-free self-assembly.

  12. Modeling kinetic rate variation in third generation DNA sequencing data to detect putative modifications to DNA bases

    PubMed Central

    Schadt, Eric E.; Banerjee, Onureena; Fang, Gang; Feng, Zhixing; Wong, Wing H.; Zhang, Xuegong; Kislyuk, Andrey; Clark, Tyson A.; Luong, Khai; Keren-Paz, Alona; Chess, Andrew; Kumar, Vipin; Chen-Plotkin, Alice; Sondheimer, Neal; Korlach, Jonas; Kasarskis, Andrew

    2013-01-01

    Current generation DNA sequencing instruments are moving closer to seamlessly sequencing genomes of entire populations as a routine part of scientific investigation. However, while significant inroads have been made identifying small nucleotide variation and structural variations in DNA that impact phenotypes of interest, progress has not been as dramatic regarding epigenetic changes and base-level damage to DNA, largely due to technological limitations in assaying all known and unknown types of modifications at genome scale. Recently, single-molecule real time (SMRT) sequencing has been reported to identify kinetic variation (KV) events that have been demonstrated to reflect epigenetic changes of every known type, providing a path forward for detecting base modifications as a routine part of sequencing. However, to date no statistical framework has been proposed to enhance the power to detect these events while also controlling for false-positive events. By modeling enzyme kinetics in the neighborhood of an arbitrary location in a genomic region of interest as a conditional random field, we provide a statistical framework for incorporating kinetic information at a test position of interest as well as at neighboring sites that help enhance the power to detect KV events. The performance of this and related models is explored, with the best-performing model applied to plasmid DNA isolated from Escherichia coli and mitochondrial DNA isolated from human brain tissue. We highlight widespread kinetic variation events, some of which strongly associate with known modification events, while others represent putative chemically modified sites of unknown types. PMID:23093720

  13. Modeling kinetic rate variation in third generation DNA sequencing data to detect putative modifications to DNA bases.

    PubMed

    Schadt, Eric E; Banerjee, Onureena; Fang, Gang; Feng, Zhixing; Wong, Wing H; Zhang, Xuegong; Kislyuk, Andrey; Clark, Tyson A; Luong, Khai; Keren-Paz, Alona; Chess, Andrew; Kumar, Vipin; Chen-Plotkin, Alice; Sondheimer, Neal; Korlach, Jonas; Kasarskis, Andrew

    2013-01-01

    Current generation DNA sequencing instruments are moving closer to seamlessly sequencing genomes of entire populations as a routine part of scientific investigation. However, while significant inroads have been made identifying small nucleotide variation and structural variations in DNA that impact phenotypes of interest, progress has not been as dramatic regarding epigenetic changes and base-level damage to DNA, largely due to technological limitations in assaying all known and unknown types of modifications at genome scale. Recently, single-molecule real time (SMRT) sequencing has been reported to identify kinetic variation (KV) events that have been demonstrated to reflect epigenetic changes of every known type, providing a path forward for detecting base modifications as a routine part of sequencing. However, to date no statistical framework has been proposed to enhance the power to detect these events while also controlling for false-positive events. By modeling enzyme kinetics in the neighborhood of an arbitrary location in a genomic region of interest as a conditional random field, we provide a statistical framework for incorporating kinetic information at a test position of interest as well as at neighboring sites that help enhance the power to detect KV events. The performance of this and related models is explored, with the best-performing model applied to plasmid DNA isolated from Escherichia coli and mitochondrial DNA isolated from human brain tissue. We highlight widespread kinetic variation events, some of which strongly associate with known modification events, while others represent putative chemically modified sites of unknown types.

  14. Experimental comparison of forces resisting viral DNA packaging and driving DNA ejection

    NASA Astrophysics Data System (ADS)

    Keller, Nicholas; Berndsen, Zachary T.; Jardine, Paul J.; Smith, Douglas E.

    2017-05-01

    We compare forces resisting DNA packaging and forces driving DNA ejection in bacteriophage phi29 with theoretical predictions. Ejection of DNA from prohead-motor complexes is triggered by heating complexes after in vitro packaging and force is inferred from the suppression of ejection by applied osmotic pressure. Ejection force from 0 % to 80 % filling is found to be in quantitative agreement with predictions of a continuum mechanics model that assumes a repulsive DNA-DNA interaction potential based on DNA condensation studies and predicts an inverse-spool conformation. Force resisting DNA packaging from ˜80 % to 100 % filling inferred from optical tweezers studies is also consistent with the predictions of this model. The striking agreement with these two different measurements suggests that the overall energetics of DNA packaging is well described by the model. However, since electron microscopy studies of phi29 do not reveal a spool conformation, our findings suggest that the spool model overestimates the role of bending rigidity and underestimates the role of intrastrand repulsion. Below ˜80 % filling the inferred forces resisting packaging are unexpectedly lower than the inferred ejection forces, suggesting that in this filling range the forces are less accurately determined or strongly temperature dependent.

  15. Experimental comparison of forces resisting viral DNA packaging and driving DNA ejection.

    PubMed

    Keller, Nicholas; Berndsen, Zachary T; Jardine, Paul J; Smith, Douglas E

    2017-05-01

    We compare forces resisting DNA packaging and forces driving DNA ejection in bacteriophage phi29 with theoretical predictions. Ejection of DNA from prohead-motor complexes is triggered by heating complexes after in vitro packaging and force is inferred from the suppression of ejection by applied osmotic pressure. Ejection force from 0% to 80% filling is found to be in quantitative agreement with predictions of a continuum mechanics model that assumes a repulsive DNA-DNA interaction potential based on DNA condensation studies and predicts an inverse-spool conformation. Force resisting DNA packaging from ∼80% to 100% filling inferred from optical tweezers studies is also consistent with the predictions of this model. The striking agreement with these two different measurements suggests that the overall energetics of DNA packaging is well described by the model. However, since electron microscopy studies of phi29 do not reveal a spool conformation, our findings suggest that the spool model overestimates the role of bending rigidity and underestimates the role of intrastrand repulsion. Below ∼80% filling the inferred forces resisting packaging are unexpectedly lower than the inferred ejection forces, suggesting that in this filling range the forces are less accurately determined or strongly temperature dependent.

  16. Differential Impact of the Monovalent Ions Li+, Na+, K+, and Rb+ on DNA Conformational Properties

    PubMed Central

    2015-01-01

    The present report demonstrates that the conformational properties of DNA in solution are sensitive to the type of monovalent ion. Results are based on the ability of a polarizable force field using the classical Drude oscillator to reproduce experimental solution X-ray scattering data more accurately than two nonpolarizable DNA models, AMBER Parmbsc0 and CHARMM36. The polarizable model is then used to calculate scattering profiles of DNA in the presence of four different monovalent salts, LiCl, NaCl, KCl, and RbCl, showing the conformational properties of DNA to vary as a function of ion type, with that effect being sequence-dependent. The primary conformational mode associated with the variations is contraction of the DNA minor groove width with decreasing cation size. These results indicate that the Drude polarizable model provides a more realistic representation of ion–DNA interactions than additive models that may lead to a new level of understanding of the physical mechanisms driving salt-mediated biological processes involving nucleic acids. PMID:25580188

  17. Definition of the persistence length in the coarse-grained models of DNA elasticity.

    PubMed

    Fathizadeh, A; Eslami-Mossallam, B; Ejtehadi, M R

    2012-11-01

    By considering the detailed structure of DNA in the base pair level, two possible definitions of the persistence length are compared. One definition is related to the orientation of the terminal base pairs, and the other is based on the vectors which connect two adjacent base pairs at each end of the molecule. It is shown that although these definitions approach each other for long DNA molecules, they are dramatically different on short length scales. We show analytically that the difference mostly comes from the shear flexibility of the molecule and can be used to measure the shear modulus of DNA.

  18. High-speed detection of DNA translocation in nanopipettes.

    PubMed

    Fraccari, Raquel L; Ciccarella, Pietro; Bahrami, Azadeh; Carminati, Marco; Ferrari, Giorgio; Albrecht, Tim

    2016-04-14

    We present a high-speed electrical detection scheme based on a custom-designed CMOS amplifier which allows the analysis of DNA translocation in glass nanopipettes on a microsecond timescale. Translocation of different DNA lengths in KCl electrolyte provides a scaling factor of the DNA translocation time equal to p = 1.22, which is different from values observed previously with nanopipettes in LiCl electrolyte or with nanopores. Based on a theoretical model involving electrophoresis, hydrodynamics and surface friction, we show that the experimentally observed range of p-values may be the result of, or at least be affected by DNA adsorption and friction between the DNA and the substrate surface.

  19. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sobottka, Marcelo, E-mail: sobottka@mtm.ufsc.br; Hart, Andrew G., E-mail: ahart@dim.uchile.cl

    Highlights: {yields} We propose a simple stochastic model to construct primitive DNA sequences. {yields} The model provide an explanation for Chargaff's second parity rule in primitive DNA sequences. {yields} The model is also used to predict a novel type of strand symmetry in primitive DNA sequences. {yields} We extend the results for bacterial DNA sequences and compare distributional properties intrinsic to the model to statistical estimates from 1049 bacterial genomes. {yields} We find out statistical evidences that the novel type of strand symmetry holds for bacterial DNA sequences. -- Abstract: Chargaff's second parity rule for short oligonucleotides states that themore » frequency of any short nucleotide sequence on a strand is approximately equal to the frequency of its reverse complement on the same strand. Recent studies have shown that, with the exception of organellar DNA, this parity rule generally holds for double-stranded DNA genomes and fails to hold for single-stranded genomes. While Chargaff's first parity rule is fully explained by the Watson-Crick pairing in the DNA double helix, a definitive explanation for the second parity rule has not yet been determined. In this work, we propose a model based on a hidden Markov process for approximating the distributional structure of primitive DNA sequences. Then, we use the model to provide another possible theoretical explanation for Chargaff's second parity rule, and to predict novel distributional aspects of bacterial DNA sequences.« less

  20. DNA barcode-based molecular identification system for fish species.

    PubMed

    Kim, Sungmin; Eo, Hae-Seok; Koo, Hyeyoung; Choi, Jun-Kil; Kim, Won

    2010-12-01

    In this study, we applied DNA barcoding to identify species using short DNA sequence analysis. We examined the utility of DNA barcoding by identifying 53 Korean freshwater fish species, 233 other freshwater fish species, and 1339 saltwater fish species. We successfully developed a web-based molecular identification system for fish (MISF) using a profile hidden Markov model. MISF facilitates efficient and reliable species identification, overcoming the limitations of conventional taxonomic approaches. MISF is freely accessible at http://bioinfosys.snu.ac.kr:8080/MISF/misf.jsp .

  1. Mapping Base Modifications in DNA by Transverse-Current Sequencing

    NASA Astrophysics Data System (ADS)

    Alvarez, Jose R.; Skachkov, Dmitry; Massey, Steven E.; Kalitsov, Alan; Velev, Julian P.

    2018-02-01

    Sequencing DNA modifications and lesions, such as methylation of cytosine and oxidation of guanine, is even more important and challenging than sequencing the genome itself. The traditional methods for detecting DNA modifications are either insensitive to these modifications or require additional processing steps to identify a particular type of modification. Transverse-current sequencing in nanopores can potentially identify the canonical bases and base modifications in the same run. In this work, we demonstrate that the most common DNA epigenetic modifications and lesions can be detected with any predefined accuracy based on their tunneling current signature. Our results are based on simulations of the nanopore tunneling current through DNA molecules, calculated using nonequilibrium electron-transport methodology within an effective multiorbital model derived from first-principles calculations, followed by a base-calling algorithm accounting for neighbor current-current correlations. This methodology can be integrated with existing experimental techniques to improve base-calling fidelity.

  2. A new biochromatography model based on DNA origami assembled PPARγ: construction and evaluation.

    PubMed

    Zhou, Jie; Meng, Lingchang; Sun, Chong; Chen, Shanshan; Sun, Fang; Luo, Pei; Zhao, Yongxing

    2017-05-01

    As drug targets, receptors have potential to screen drugs. Silica is an attractive support to immobilize receptors; however, the lack of biocompatibility makes it easier for receptors to lose bioactivity, which remains an obstacle to its widespread use. With the advantage of biocompatibility, DNA origami can be used as a biological carrier to improve the biocompatibility of silica and assemble receptors. In this study, a new biochromatography model based on DNA origami was constructed. A large quantity of M13ssDNA was used as a scaffold, leading to significant costs, so M13ssDNA was self-produced from the bacteriophage particles. This approach is demonstrated using the ligand binding domain of gamma isoform peroxisome proliferator-activated receptor (PPARγ-LBD) as a research object. PPARγ-LBD was assembled on DNA origami carrier and then coupled on the surface of silica. The products were packed into the column as stationary phase to construct the biochromatography with the ability to recognize drugs. Affinity and specificity of the biochromatography model were evaluated by HPLC. The final results showed that the biochromatography could recognize rosiglitazone specifically, which further proved that the model could screen chemical compositions interacted with PPARγ. It was the first time to take advantage of DNA origami to assemble PPARγ to construct biochromatography. The new biochromatography model has the advantages of being efficient, convenient, and high-throughput. This method affords a new way to rapidly and conveniently screen active ingredients from complex sample plant extracts and natural product-like libraries.

  3. HDOCK: a web server for protein-protein and protein-DNA/RNA docking based on a hybrid strategy.

    PubMed

    Yan, Yumeng; Zhang, Di; Zhou, Pei; Li, Botong; Huang, Sheng-You

    2017-07-03

    Protein-protein and protein-DNA/RNA interactions play a fundamental role in a variety of biological processes. Determining the complex structures of these interactions is valuable, in which molecular docking has played an important role. To automatically make use of the binding information from the PDB in docking, here we have presented HDOCK, a novel web server of our hybrid docking algorithm of template-based modeling and free docking, in which cases with misleading templates can be rescued by the free docking protocol. The server supports protein-protein and protein-DNA/RNA docking and accepts both sequence and structure inputs for proteins. The docking process is fast and consumes about 10-20 min for a docking run. Tested on the cases with weakly homologous complexes of <30% sequence identity from five docking benchmarks, the HDOCK pipeline tied with template-based modeling on the protein-protein and protein-DNA benchmarks and performed better than template-based modeling on the three protein-RNA benchmarks when the top 10 predictions were considered. The performance of HDOCK became better when more predictions were considered. Combining the results of HDOCK and template-based modeling by ranking first of the template-based model further improved the predictive power of the server. The HDOCK web server is available at http://hdock.phys.hust.edu.cn/. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  4. The HIrisPlex-S system for eye, hair and skin colour prediction from DNA: Introduction and forensic developmental validation.

    PubMed

    Chaitanya, Lakshmi; Breslin, Krystal; Zuñiga, Sofia; Wirken, Laura; Pośpiech, Ewelina; Kukla-Bartoszek, Magdalena; Sijen, Titia; Knijff, Peter de; Liu, Fan; Branicki, Wojciech; Kayser, Manfred; Walsh, Susan

    2018-07-01

    Forensic DNA Phenotyping (FDP), i.e. the prediction of human externally visible traits from DNA, has become a fast growing subfield within forensic genetics due to the intelligence information it can provide from DNA traces. FDP outcomes can help focus police investigations in search of unknown perpetrators, who are generally unidentifiable with standard DNA profiling. Therefore, we previously developed and forensically validated the IrisPlex DNA test system for eye colour prediction and the HIrisPlex system for combined eye and hair colour prediction from DNA traces. Here we introduce and forensically validate the HIrisPlex-S DNA test system (S for skin) for the simultaneous prediction of eye, hair, and skin colour from trace DNA. This FDP system consists of two SNaPshot-based multiplex assays targeting a total of 41 SNPs via a novel multiplex assay for 17 skin colour predictive SNPs and the previous HIrisPlex assay for 24 eye and hair colour predictive SNPs, 19 of which also contribute to skin colour prediction. The HIrisPlex-S system further comprises three statistical prediction models, the previously developed IrisPlex model for eye colour prediction based on 6 SNPs, the previous HIrisPlex model for hair colour prediction based on 22 SNPs, and the recently introduced HIrisPlex-S model for skin colour prediction based on 36 SNPs. In the forensic developmental validation testing, the novel 17-plex assay performed in full agreement with the Scientific Working Group on DNA Analysis Methods (SWGDAM) guidelines, as previously shown for the 24-plex assay. Sensitivity testing of the 17-plex assay revealed complete SNP profiles from as little as 63 pg of input DNA, equalling the previously demonstrated sensitivity threshold of the 24-plex HIrisPlex assay. Testing of simulated forensic casework samples such as blood, semen, saliva stains, of inhibited DNA samples, of low quantity touch (trace) DNA samples, and of artificially degraded DNA samples as well as concordance testing, demonstrated the robustness, efficiency, and forensic suitability of the new 17-plex assay, as previously shown for the 24-plex assay. Finally, we provide an update to the publically available HIrisPlex website https://hirisplex.erasmusmc.nl/, now allowing the estimation of individual probabilities for 3 eye, 4 hair, and 5 skin colour categories from HIrisPlex-S input genotypes. The HIrisPlex-S DNA test represents the first forensically validated tool for skin colour prediction, and reflects the first forensically validated tool for simultaneous eye, hair and skin colour prediction from DNA. Copyright © 2018 Elsevier B.V. All rights reserved.

  5. New t-gap insertion-deletion-like metrics for DNA hybridization thermodynamic modeling.

    PubMed

    D'yachkov, Arkadii G; Macula, Anthony J; Pogozelski, Wendy K; Renz, Thomas E; Rykov, Vyacheslav V; Torney, David C

    2006-05-01

    We discuss the concept of t-gap block isomorphic subsequences and use it to describe new abstract string metrics that are similar to the Levenshtein insertion-deletion metric. Some of the metrics that we define can be used to model a thermodynamic distance function on single-stranded DNA sequences. Our model captures a key aspect of the nearest neighbor thermodynamic model for hybridized DNA duplexes. One version of our metric gives the maximum number of stacked pairs of hydrogen bonded nucleotide base pairs that can be present in any secondary structure in a hybridized DNA duplex without pseudoknots. Thermodynamic distance functions are important components in the construction of DNA codes, and DNA codes are important components in biomolecular computing, nanotechnology, and other biotechnical applications that employ DNA hybridization assays. We show how our new distances can be calculated by using a dynamic programming method, and we derive a Varshamov-Gilbert-like lower bound on the size of some of codes using these distance functions as constraints. We also discuss software implementation of our DNA code design methods.

  6. Kinetics of DSB rejoining and formation of simple chromosome exchange aberrations

    NASA Technical Reports Server (NTRS)

    Cucinotta, F. A.; Nikjoo, H.; O'Neill, P.; Goodhead, D. T.

    2000-01-01

    PURPOSE: To investigate the role of kinetics in the processing of DNA double strand breaks (DSB), and the formation of simple chromosome exchange aberrations following X-ray exposures to mammalian cells based on an enzymatic approach. METHODS: Using computer simulations based on a biochemical approach, rate-equations that describe the processing of DSB through the formation of a DNA-enzyme complex were formulated. A second model that allows for competition between two processing pathways was also formulated. The formation of simple exchange aberrations was modelled as misrepair during the recombination of single DSB with undamaged DNA. Non-linear coupled differential equations corresponding to biochemical pathways were solved numerically by fitting to experimental data. RESULTS: When mediated by a DSB repair enzyme complex, the processing of single DSB showed a complex behaviour that gives the appearance of fast and slow components of rejoining. This is due to the time-delay caused by the action time of enzymes in biomolecular reactions. It is shown that the kinetic- and dose-responses of simple chromosome exchange aberrations are well described by a recombination model of DSB interacting with undamaged DNA when aberration formation increases with linear dose-dependence. Competition between two or more recombination processes is shown to lead to the formation of simple exchange aberrations with a dose-dependence similar to that of a linear quadratic model. CONCLUSIONS: Using a minimal number of assumptions, the kinetics and dose response observed experimentally for DSB rejoining and the formation of simple chromosome exchange aberrations are shown to be consistent with kinetic models based on enzymatic reaction approaches. A non-linear dose response for simple exchange aberrations is possible in a model of recombination of DNA containing a DSB with undamaged DNA when two or more pathways compete for DSB repair.

  7. 3D replicon distributions arise from stochastic initiation and domino-like DNA replication progression.

    PubMed

    Löb, D; Lengert, N; Chagin, V O; Reinhart, M; Casas-Delucchi, C S; Cardoso, M C; Drossel, B

    2016-04-07

    DNA replication dynamics in cells from higher eukaryotes follows very complex but highly efficient mechanisms. However, the principles behind initiation of potential replication origins and emergence of typical patterns of nuclear replication sites remain unclear. Here, we propose a comprehensive model of DNA replication in human cells that is based on stochastic, proximity-induced replication initiation. Critical model features are: spontaneous stochastic firing of individual origins in euchromatin and facultative heterochromatin, inhibition of firing at distances below the size of chromatin loops and a domino-like effect by which replication forks induce firing of nearby origins. The model reproduces the empirical temporal and chromatin-related properties of DNA replication in human cells. We advance the one-dimensional DNA replication model to a spatial model by taking into account chromatin folding in the nucleus, and we are able to reproduce the spatial and temporal characteristics of the replication foci distribution throughout S-phase.

  8. Calibration and LOD/LOQ estimation of a chemiluminescent hybridization assay for residual DNA in recombinant protein drugs expressed in E. coli using a four-parameter logistic model.

    PubMed

    Lee, K R; Dipaolo, B; Ji, X

    2000-06-01

    Calibration is the process of fitting a model based on reference data points (x, y), then using the model to estimate an unknown x based on a new measured response, y. In DNA assay, x is the concentration, and y is the measured signal volume. A four-parameter logistic model was used frequently for calibration of immunoassay when the response is optical density for enzyme-linked immunosorbent assay (ELISA) or adjusted radioactivity count for radioimmunoassay (RIA). Here, it is shown that the same model or a linearized version of the curve are equally useful for the calibration of a chemiluminescent hybridization assay for residual DNA in recombinant protein drugs and calculation of performance measures of the assay.

  9. Model Checking Temporal Logic Formulas Using Sticker Automata

    PubMed Central

    Feng, Changwei; Wu, Huanmei

    2017-01-01

    As an important complex problem, the temporal logic model checking problem is still far from being fully resolved under the circumstance of DNA computing, especially Computation Tree Logic (CTL), Interval Temporal Logic (ITL), and Projection Temporal Logic (PTL), because there is still a lack of approaches for DNA model checking. To address this challenge, a model checking method is proposed for checking the basic formulas in the above three temporal logic types with DNA molecules. First, one-type single-stranded DNA molecules are employed to encode the Finite State Automaton (FSA) model of the given basic formula so that a sticker automaton is obtained. On the other hand, other single-stranded DNA molecules are employed to encode the given system model so that the input strings of the sticker automaton are obtained. Next, a series of biochemical reactions are conducted between the above two types of single-stranded DNA molecules. It can then be decided whether the system satisfies the formula or not. As a result, we have developed a DNA-based approach for checking all the basic formulas of CTL, ITL, and PTL. The simulated results demonstrate the effectiveness of the new method. PMID:29119114

  10. A Binary-Encounter-Bethe Approach to Simulate DNA Damage by the Direct Effect

    NASA Technical Reports Server (NTRS)

    Plante, Ianik; Cucinotta, Francis A.

    2013-01-01

    The DNA damage is of crucial importance in the understanding of the effects of ionizing radiation. The main mechanisms of DNA damage are by the direct effect of radiation (e.g. direct ionization) and by indirect effect (e.g. damage by.OH radicals created by the radiolysis of water). Despite years of research in this area, many questions on the formation of DNA damage remains. To refine existing DNA damage models, an approach based on the Binary-Encounter-Bethe (BEB) model was developed[1]. This model calculates differential cross sections for ionization of the molecular orbitals of the DNA bases, sugars and phosphates using the electron binding energy, the mean kinetic energy and the occupancy number of the orbital. This cross section has an analytic form which is quite convenient to use and allows the sampling of the energy loss occurring during an ionization event. To simulate the radiation track structure, the code RITRACKS developed at the NASA Johnson Space Center is used[2]. This code calculates all the energy deposition events and the formation of the radiolytic species by the ion and the secondary electrons as well. We have also developed a technique to use the integrated BEB cross section for the bases, sugar and phosphates in the radiation transport code RITRACKS. These techniques should allow the simulation of DNA damage by ionizing radiation, and understanding of the formation of double-strand breaks caused by clustered damage in different conditions.

  11. Research and Design of the Three-tier Distributed Network Management System Based on COM / COM + and DNA

    NASA Astrophysics Data System (ADS)

    Liang, Likai; Bi, Yushen

    Considered on the distributed network management system's demand of high distributives, extensibility and reusability, a framework model of Three-tier distributed network management system based on COM/COM+ and DNA is proposed, which adopts software component technology and N-tier application software framework design idea. We also give the concrete design plan of each layer of this model. Finally, we discuss the internal running process of each layer in the distributed network management system's framework model.

  12. Exact method for numerically analyzing a model of local denaturation in superhelically stressed DNA

    NASA Astrophysics Data System (ADS)

    Fye, Richard M.; Benham, Craig J.

    1999-03-01

    Local denaturation, the separation at specific sites of the two strands comprising the DNA double helix, is one of the most fundamental processes in biology, required to allow the base sequence to be read both in DNA transcription and in replication. In living organisms this process can be mediated by enzymes which regulate the amount of superhelical stress imposed on the DNA. We present a numerically exact technique for analyzing a model of denaturation in superhelically stressed DNA. This approach is capable of predicting the locations and extents of transition in circular superhelical DNA molecules of kilobase lengths and specified base pair sequences. It can also be used for closed loops of DNA which are typically found in vivo to be kilobases long. The analytic method consists of an integration over the DNA twist degrees of freedom followed by the introduction of auxiliary variables to decouple the remaining degrees of freedom, which allows the use of the transfer matrix method. The algorithm implementing our technique requires O(N2) operations and O(N) memory to analyze a DNA domain containing N base pairs. However, to analyze kilobase length DNA molecules it must be implemented in high precision floating point arithmetic. An accelerated algorithm is constructed by imposing an upper bound M on the number of base pairs that can simultaneously denature in a state. This accelerated algorithm requires O(MN) operations, and has an analytically bounded error. Sample calculations show that it achieves high accuracy (greater than 15 decimal digits) with relatively small values of M (M<0.05N) for kilobase length molecules under physiologically relevant conditions. Calculations are performed on the superhelical pBR322 DNA sequence to test the accuracy of the method. With no free parameters in the model, the locations and extents of local denaturation predicted by this analysis are in quantitatively precise agreement with in vitro experimental measurements. Calculations performed on the fructose-1,6-bisphosphatase gene sequence from yeast show that this approach can also accurately treat in vivo denaturation.

  13. Energetics of protein-DNA interactions.

    PubMed

    Donald, Jason E; Chen, William W; Shakhnovich, Eugene I

    2007-01-01

    Protein-DNA interactions are vital for many processes in living cells, especially transcriptional regulation and DNA modification. To further our understanding of these important processes on the microscopic level, it is necessary that theoretical models describe the macromolecular interaction energetics accurately. While several methods have been proposed, there has not been a careful comparison of how well the different methods are able to predict biologically important quantities such as the correct DNA binding sequence, total binding free energy and free energy changes caused by DNA mutation. In addition to carrying out the comparison, we present two important theoretical models developed initially in protein folding that have not yet been tried on protein-DNA interactions. In the process, we find that the results of these knowledge-based potentials show a strong dependence on the interaction distance and the derivation method. Finally, we present a knowledge-based potential that gives comparable or superior results to the best of the other methods, including the molecular mechanics force field AMBER99.

  14. An Analysis of Enzyme Kinetics Data for Mitochondrial DNA Strand Termination by Nucleoside Reverse Transcription Inhibitors

    PubMed Central

    Wendelsdorf, Katherine V.; Song, Zhuo; Cao, Yang; Samuels, David C.

    2009-01-01

    Nucleoside analogs used in antiretroviral treatment have been associated with mitochondrial toxicity. The polymerase-γ hypothesis states that this toxicity stems from the analogs' inhibition of the mitochondrial DNA polymerase (polymerase-γ) leading to mitochondrial DNA (mtDNA) depletion. We have constructed a computational model of the interaction of polymerase-γ with activated nucleoside and nucleotide analog drugs, based on experimentally measured reaction rates and base excision rates, together with the mtDNA genome size, the human mtDNA sequence, and mitochondrial dNTP concentrations. The model predicts an approximately 1000-fold difference in the activated drug concentration required for a 50% probability of mtDNA strand termination between the activated di-deoxy analogs d4T, ddC, and ddI (activated to ddA) and the activated forms of the analogs 3TC, TDF, AZT, FTC, and ABC. These predictions are supported by experimental and clinical data showing significantly greater mtDNA depletion in cell culture and patient samples caused by the di-deoxy analog drugs. For zidovudine (AZT) we calculated a very low mtDNA replication termination probability, in contrast to its reported mitochondrial toxicity in vitro and clinically. Therefore AZT mitochondrial toxicity is likely due to a mechanism that does not involve strand termination of mtDNA replication. PMID:19132079

  15. A Structural Model for the Single-Stranded DNA Genome of Filamentous Bacteriophage Pf1†

    PubMed Central

    Tsuboi, Masamichi; Tsunoda, Masaru; Overman, Stacy A.; Benevides, James M.; Thomas, George J.

    2010-01-01

    The filamentous bacteriophage Pf1, which infects strain PAK of Pseudomonas aeruginosa, is a flexible filament (~2000 × 6.5 nm) consisting of a covalently closed DNA loop of 7349 nucleotides sheathed by 7350 copies of a 46-residue α-helical subunit. The subunit α-helices, which are inclined at a small average angle (~16°) from the virion axis, are arranged compactly around the DNA core. Orientations of the Pf1 DNA nucleotides with respect to the filament axis are not known. In this work we report and interpret the polarized Raman spectra of oriented Pf1 filaments. We demonstrate that the polarizations of DNA Raman band intensities establish that the nucleotide bases of packaged Pf1 DNA are well ordered within the virion and that the base planes are positioned close to parallel to the filament axis. The present results are combined with a previously proposed projection of the intraviral path of Pf1 DNA (1) to develop a novel molecular model for the Pf1 assembly. PMID:20078135

  16. Watson-Crick Base Pair Radical Cation as a Model for Oxidative Damage in DNA.

    PubMed

    Feketeová, Linda; Chan, Bun; Khairallah, George N; Steinmetz, Vincent; Maitre, Philippe; Radom, Leo; O'Hair, Richard A J

    2017-07-06

    The deleterious cellular effects of ionizing radiation are well-known, but the mechanisms causing DNA damage are poorly understood. The accepted molecular events involve initial oxidation and deprotonation at guanine sites, triggering hydrogen atom abstraction reactions from the sugar moieties, causing DNA strand breaks. Probing the chemistry of the initially formed radical cation has been challenging. Here, we generate, spectroscopically characterize, and examine the reactivity of the Watson-Crick nucleobase pair radical cation in the gas phase. We observe rich chemistry, including proton transfer between the bases and propagation of the radical site in deoxyguanosine from the base to the sugar, thus rupturing the sugar. This first example of a gas-phase model system providing molecular-level details on the chemistry of an ionized DNA base pair paves the way toward a more complete understanding of molecular processes induced by radiation. It also highlights the role of radical propagation in chemistry, biology, and nanotechnology.

  17. Network-based regularization for matched case-control analysis of high-dimensional DNA methylation data.

    PubMed

    Sun, Hokeun; Wang, Shuang

    2013-05-30

    The matched case-control designs are commonly used to control for potential confounding factors in genetic epidemiology studies especially epigenetic studies with DNA methylation. Compared with unmatched case-control studies with high-dimensional genomic or epigenetic data, there have been few variable selection methods for matched sets. In an earlier paper, we proposed the penalized logistic regression model for the analysis of unmatched DNA methylation data using a network-based penalty. However, for popularly applied matched designs in epigenetic studies that compare DNA methylation between tumor and adjacent non-tumor tissues or between pre-treatment and post-treatment conditions, applying ordinary logistic regression ignoring matching is known to bring serious bias in estimation. In this paper, we developed a penalized conditional logistic model using the network-based penalty that encourages a grouping effect of (1) linked Cytosine-phosphate-Guanine (CpG) sites within a gene or (2) linked genes within a genetic pathway for analysis of matched DNA methylation data. In our simulation studies, we demonstrated the superiority of using conditional logistic model over unconditional logistic model in high-dimensional variable selection problems for matched case-control data. We further investigated the benefits of utilizing biological group or graph information for matched case-control data. We applied the proposed method to a genome-wide DNA methylation study on hepatocellular carcinoma (HCC) where we investigated the DNA methylation levels of tumor and adjacent non-tumor tissues from HCC patients by using the Illumina Infinium HumanMethylation27 Beadchip. Several new CpG sites and genes known to be related to HCC were identified but were missed by the standard method in the original paper. Copyright © 2012 John Wiley & Sons, Ltd.

  18. A new general model for predicting melting thermodynamics of complementary and mismatched B-form duplexes containing locked nucleic acids: application to probe design for digital PCR detection of somatic mutations.

    PubMed

    Hughesman, Curtis; Fakhfakh, Kareem; Bidshahri, Roza; Lund, H Louise; Haynes, Charles

    2015-02-17

    Advances in real-time polymerase chain reaction (PCR), as well as the emergence of digital PCR (dPCR) and useful modified nucleotide chemistries, including locked nucleic acids (LNAs), have created the potential to improve and expand clinical applications of PCR through their ability to better quantify and differentiate amplification products, but fully realizing this potential will require robust methods for designing dual-labeled hydrolysis probes and predicting their hybridization thermodynamics as a function of their sequence, chemistry, and template complementarity. We present here a nearest-neighbor thermodynamic model that accurately predicts the melting thermodynamics of a short oligonucleotide duplexed either to its perfect complement or to a template containing mismatched base pairs. The model may be applied to pure-DNA duplexes or to duplexes for which one strand contains any number and pattern of LNA substitutions. Perturbations to duplex stability arising from mismatched DNA:DNA or LNA:DNA base pairs are treated at the Gibbs energy level to maintain statistical significance in the regressed model parameters. This approach, when combined with the model's accounting of the temperature dependencies of the melting enthalpy and entropy, permits accurate prediction of T(m) values for pure-DNA homoduplexes or LNA-substituted heteroduplexes containing one or two independent mismatched base pairs. Terms accounting for changes in solution conditions and terminal addition of fluorescent dyes and quenchers are then introduced so that the model may be used to accurately predict and thereby tailor the T(m) of a pure-DNA or LNA-substituted hydrolysis probe when duplexed either to its perfect-match template or to a template harboring a noncomplementary base. The model, which builds on classic nearest-neighbor thermodynamics, should therefore be of use to clinicians and biologists who require probes that distinguish and quantify two closely related alleles in either a quantitative PCR or dPCR assay. This potential is demonstrated by using the model to design allele-specific probes that completely discriminate and quantify clinically relevant mutant alleles (BRAF V600E and KIT D816V) in a dPCR assay.

  19. Structural modeling and molecular simulation analysis of HvAP2/EREBP from barley.

    PubMed

    Pandey, Bharati; Sharma, Pradeep; Tyagi, Chetna; Goyal, Sukriti; Grover, Abhinav; Sharma, Indu

    2016-06-01

    AP2/ERF transcription factors play a critical role in plant development and stress adaptation. This study reports the three-dimensional ab initio-based model of AP2/EREBP protein of barley and its interaction with DNA. Full-length coding sequence of HvAP2/EREBP gene isolated from two Indian barley cultivars, RD 2503 and RD 31, was used to model the protein. Of five protein models obtained, the one with lowest C-score was chosen for further analysis. The N- and C-terminal regions of HvAP2 protein were found to be highly disordered. The dynamic properties of AP2/EREBP and its interaction with DNA were investigated by molecular dynamics simulation. Analysis of trajectories from simulation yielded the equilibrated conformation between 2-10ns for protein and 7-15ns for protein-DNA complex. We established relationship between DNA having GCC box and DNA-binding domain of HvAP2/EREBP was established by modeling 11-base-pair-long nucleotide sequence and HvAP2/EREBP protein using ab initio method. Analysis of protein-DNA interaction showed that a β-sheet motif constituting amino acid residues THR105, ARG100, ARG93, and ARG83 seems to play important role in stabilizing the complex as they form strong hydrogen bond interactions with the DNA motif. Taken together, this study provides first-hand comprehensive information detailing structural conformation and interactions of HvAP2/EREBP proteins in barley. The study intensifies the role of computational approaches for preliminary examination of unknown proteins in the absence of experimental information. It also provides molecular insight into protein-DNA binding for understanding and enhancing abiotic stress resistance for improving the water use efficiency in crop plants.

  20. Synthesis and DNA interaction of a mixed proflavine-phenanthroline Tröger base.

    PubMed

    Baldeyrou, Brigitte; Tardy, Christelle; Bailly, Christian; Colson, Pierre; Houssier, Claude; Charmantray, Franck; Demeunynck, Martine

    2002-04-01

    We report the synthesis of an asymmetric Tröger base containing the two well characterised DNA binding chromophores, proflavine and phenanthroline. The mode of interaction of the hybrid molecule was investigated by circular and linear dichroism experiments and a biochemical assay using DNA topoisomerase I. The data are compatible with a model in which the proflavine moiety intercalates between DNA base pairs and the phenanthroline ring occupies the DNA groove. DNase I cleavage experiments were carried out to investigate the sequence preference of the hybrid ligand and a well resolved footprint was detected at a site encompassing two adjacent 5'-GTC.5-GAC triplets. The sequence preference of the asymmetric molecule is compared to that of the symmetric analogues.

  1. Polarizable Force Field for DNA Based on the Classical Drude Oscillator: I. Refinement Using Quantum Mechanical Base Stacking and Conformational Energetics.

    PubMed

    Lemkul, Justin A; MacKerell, Alexander D

    2017-05-09

    Empirical force fields seek to relate the configuration of a set of atoms to its energy, thus yielding the forces governing its dynamics, using classical physics rather than more expensive quantum mechanical calculations that are computationally intractable for large systems. Most force fields used to simulate biomolecular systems use fixed atomic partial charges, neglecting the influence of electronic polarization, instead making use of a mean-field approximation that may not be transferable across environments. Recent hardware and software developments make polarizable simulations feasible, and to this end, polarizable force fields represent the next generation of molecular dynamics simulation technology. In this work, we describe the refinement of a polarizable force field for DNA based on the classical Drude oscillator model by targeting quantum mechanical interaction energies and conformational energy profiles of model compounds necessary to build a complete DNA force field. The parametrization strategy employed in the present work seeks to correct weak base stacking in A- and B-DNA and the unwinding of Z-DNA observed in the previous version of the force field, called Drude-2013. Refinement of base nonbonded terms and reparametrization of dihedral terms in the glycosidic linkage, deoxyribofuranose rings, and important backbone torsions resulted in improved agreement with quantum mechanical potential energy surfaces. Notably, we expand on previous efforts by explicitly including Z-DNA conformational energetics in the refinement.

  2. Breathing dynamics based parameter sensitivity analysis of hetero-polymeric DNA

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Talukder, Srijeeta; Sen, Shrabani; Chaudhury, Pinaki, E-mail: pinakc@rediffmail.com

    We study the parameter sensitivity of hetero-polymeric DNA within the purview of DNA breathing dynamics. The degree of correlation between the mean bubble size and the model parameters is estimated for this purpose for three different DNA sequences. The analysis leads us to a better understanding of the sequence dependent nature of the breathing dynamics of hetero-polymeric DNA. Out of the 14 model parameters for DNA stability in the statistical Poland-Scheraga approach, the hydrogen bond interaction ε{sub hb}(AT) for an AT base pair and the ring factor ξ turn out to be the most sensitive parameters. In addition, the stackingmore » interaction ε{sub st}(TA-TA) for an TA-TA nearest neighbor pair of base-pairs is found to be the most sensitive one among all stacking interactions. Moreover, we also establish that the nature of stacking interaction has a deciding effect on the DNA breathing dynamics, not the number of times a particular stacking interaction appears in a sequence. We show that the sensitivity analysis can be used as an effective measure to guide a stochastic optimization technique to find the kinetic rate constants related to the dynamics as opposed to the case where the rate constants are measured using the conventional unbiased way of optimization.« less

  3. Genetic dissection of the consensus sequence for the class 2 and class 3 flagellar promoters

    PubMed Central

    Wozniak, Christopher E.; Hughes, Kelly T.

    2008-01-01

    Summary Computational searches for DNA binding sites often utilize consensus sequences. These search models make assumptions that the frequency of a base pair in an alignment relates to the base pair’s importance in binding and presume that base pairs contribute independently to the overall interaction with the DNA binding protein. These two assumptions have generally been found to be accurate for DNA binding sites. However, these assumptions are often not satisfied for promoters, which are involved in additional steps in transcription initiation after RNA polymerase has bound to the DNA. To test these assumptions for the flagellar regulatory hierarchy, class 2 and class 3 flagellar promoters were randomly mutagenized in Salmonella. Important positions were then saturated for mutagenesis and compared to scores calculated from the consensus sequence. Double mutants were constructed to determine how mutations combined for each promoter type. Mutations in the binding site for FlhD4C2, the activator of class 2 promoters, better satisfied the assumptions for the binding model than did mutations in the class 3 promoter, which is recognized by the σ28 transcription factor. These in vivo results indicate that the activator sites within flagellar promoters can be modeled using simple assumptions but that the DNA sequences recognized by the flagellar sigma factor require more complex models. PMID:18486950

  4. Functional Studies and Homology Modeling of Msh2-Msh3 Predict that Mispair Recognition Involves DNA Bending and Strand Separation▿ †

    PubMed Central

    Dowen, Jill M.; Putnam, Christopher D.; Kolodner, Richard D.

    2010-01-01

    The Msh2-Msh3 heterodimer recognizes various DNA mispairs, including loops of DNA ranging from 1 to 14 nucleotides and some base-base mispairs. Homology modeling of the mispair-binding domain (MBD) of Msh3 using the related Msh6 MBD revealed that mismatch recognition must be different, even though the MBD folds must be similar. Model-based point mutation alleles of Saccharomyces cerevisiae msh3 designed to disrupt mispair recognition fell into two classes. One class caused defects in repair of both small and large insertion/deletion mispairs, whereas the second class caused defects only in the repair of small insertion/deletion mispairs; mutations of the first class also caused defects in the removal of nonhomologous tails present at the ends of double-strand breaks (DSBs) during DSB repair, whereas mutations of the second class did not cause defects in the removal of nonhomologous tails during DSB repair. Thus, recognition of small insertion/deletion mispairs by Msh3 appears to require a greater degree of interactions with the DNA conformations induced by small insertion/deletion mispairs than with those induced by large insertion/deletions that are intrinsically bent and strand separated. Mapping of the two classes of mutations onto the Msh3 MBD model appears to distinguish mispair recognition regions from DNA stabilization regions. PMID:20421420

  5. Functional studies and homology modeling of Msh2-Msh3 predict that mispair recognition involves DNA bending and strand separation.

    PubMed

    Dowen, Jill M; Putnam, Christopher D; Kolodner, Richard D

    2010-07-01

    The Msh2-Msh3 heterodimer recognizes various DNA mispairs, including loops of DNA ranging from 1 to 14 nucleotides and some base-base mispairs. Homology modeling of the mispair-binding domain (MBD) of Msh3 using the related Msh6 MBD revealed that mismatch recognition must be different, even though the MBD folds must be similar. Model-based point mutation alleles of Saccharomyces cerevisiae msh3 designed to disrupt mispair recognition fell into two classes. One class caused defects in repair of both small and large insertion/deletion mispairs, whereas the second class caused defects only in the repair of small insertion/deletion mispairs; mutations of the first class also caused defects in the removal of nonhomologous tails present at the ends of double-strand breaks (DSBs) during DSB repair, whereas mutations of the second class did not cause defects in the removal of nonhomologous tails during DSB repair. Thus, recognition of small insertion/deletion mispairs by Msh3 appears to require a greater degree of interactions with the DNA conformations induced by small insertion/deletion mispairs than with those induced by large insertion/deletions that are intrinsically bent and strand separated. Mapping of the two classes of mutations onto the Msh3 MBD model appears to distinguish mispair recognition regions from DNA stabilization regions.

  6. A Graphene-Based Biosensing Platform Based on Regulated Release of an Aptameric DNA Biosensor

    PubMed Central

    Mao, Yu; Chen, Yongli; Li, Song; Lin, Shuo; Jiang, Yuyang

    2015-01-01

    A novel biosensing platform was developed by integrating an aptamer-based DNA biosensor with graphene oxide (GO) for rapid and facile detection of adenosine triphosphate (ATP, as a model target). The DNA biosensor, which is locked by GO, is designed to contain two sensing modules that include recognition site for ATP and self-replication track that yields the nicking domain for Nt.BbvCI. By taking advantage of the different binding affinity of single-stranded DNA, double-stranded DNA and aptamer-target complex toward GO, the DNA biosensor could be efficiently released from GO in the presence of target with the help of a complementary DNA strand (CPDNA) that partially hybridizes to the DNA biosensor. Then, the polymerization/nicking enzyme synergetic isothermal amplification could be triggered, leading to the synthesis of massive DNA amplicons, thus achieving an enhanced sensitivity with a wide linear dynamic response range of four orders of magnitude and good selectivity. This biosensing strategy expands the applications of GO-DNA nanobiointerfaces in biological sensing, showing great potential in fundamental research and biomedical diagnosis. PMID:26569239

  7. A Graphene-Based Biosensing Platform Based on Regulated Release of an Aptameric DNA Biosensor.

    PubMed

    Mao, Yu; Chen, Yongli; Li, Song; Lin, Shuo; Jiang, Yuyang

    2015-11-09

    A novel biosensing platform was developed by integrating an aptamer-based DNA biosensor with graphene oxide (GO) for rapid and facile detection of adenosine triphosphate (ATP, as a model target). The DNA biosensor, which is locked by GO, is designed to contain two sensing modules that include recognition site for ATP and self-replication track that yields the nicking domain for Nt.BbvCI. By taking advantage of the different binding affinity of single-stranded DNA, double-stranded DNA and aptamer-target complex toward GO, the DNA biosensor could be efficiently released from GO in the presence of target with the help of a complementary DNA strand (CPDNA) that partially hybridizes to the DNA biosensor. Then, the polymerization/nicking enzyme synergetic isothermal amplification could be triggered, leading to the synthesis of massive DNA amplicons, thus achieving an enhanced sensitivity with a wide linear dynamic response range of four orders of magnitude and good selectivity. This biosensing strategy expands the applications of GO-DNA nanobiointerfaces in biological sensing, showing great potential in fundamental research and biomedical diagnosis.

  8. Model Averaging for Predicting the Exposure to Aflatoxin B1 Using DNA Methylation in White Blood Cells of Infants

    NASA Astrophysics Data System (ADS)

    Rahardiantoro, S.; Sartono, B.; Kurnia, A.

    2017-03-01

    In recent years, DNA methylation has been the special issue to reveal the pattern of a lot of human diseases. Huge amount of data would be the inescapable phenomenon in this case. In addition, some researchers interesting to take some predictions based on these huge data, especially using regression analysis. The classical approach would be failed to take the task. Model averaging by Ando and Li [1] could be an alternative approach to face this problem. This research applied the model averaging to get the best prediction in high dimension of data. In the practice, the case study by Vargas et al [3], data of exposure to aflatoxin B1 (AFB1) and DNA methylation in white blood cells of infants in The Gambia, take the implementation of model averaging. The best ensemble model selected based on the minimum of MAPE, MAE, and MSE of predictions. The result is ensemble model by model averaging with number of predictors in model candidate is 15.

  9. Separation of large DNA molecules by applying pulsed electric field to size exclusion chromatography-based microchip

    NASA Astrophysics Data System (ADS)

    Azuma, Naoki; Itoh, Shintaro; Fukuzawa, Kenji; Zhang, Hedong

    2018-02-01

    Through electrophoresis driven by a pulsed electric field, we succeeded in separating large DNA molecules with an electrophoretic microchip based on size exclusion chromatography (SEC), which was proposed in our previous study. The conditions of the pulsed electric field required to achieve the separation were determined by numerical analyses using our originally proposed separation model. From the numerical results, we succeeded in separating large DNA molecules (λ DNA and T4 DNA) within 1600 s, which was approximately half of that achieved under a direct electric field in our previous study. Our SEC-based electrophoresis microchip will be one of the effective tools to meet the growing demand of faster and more convenient separation of large DNA molecules, especially in the field of epidemiological research of infectious diseases.

  10. Repair of Clustered Damage and DNA Polymerase Iota.

    PubMed

    Belousova, E A; Lavrik, O I

    2015-08-01

    Multiple DNA lesions occurring within one or two turns of the DNA helix known as clustered damage are a source of double-stranded DNA breaks, which represent a serious threat to the cells. Repair of clustered lesions is accomplished in several steps. If a clustered lesion contains oxidized bases, an individual DNA lesion is repaired by the base excision repair (BER) mechanism involving a specialized DNA polymerase after excising DNA damage. Here, we investigated DNA synthesis catalyzed by DNA polymerase iota using damaged DNA templates. Two types of DNA substrates were used as model DNAs: partial DNA duplexes containing breaks of different length, and DNA duplexes containing 5-formyluracil (5-foU) and uracil as a precursor of apurinic/apyrimidinic sites (AP) in opposite DNA strands. For the first time, we showed that DNA polymerase iota is able to catalyze DNA synthesis using partial DNA duplexes having breaks of different length as substrates. In addition, we found that DNA polymerase iota could catalyze DNA synthesis during repair of clustered damage via the BER system by using both undamaged and 5-foU-containing templates. We found that hPCNA (human proliferating cell nuclear antigen) increased efficacy of DNA synthesis catalyzed by DNA polymerase iota.

  11. Theory and modeling of particles with DNA-mediated interactions

    NASA Astrophysics Data System (ADS)

    Licata, Nicholas A.

    In recent years significant attention has been attracted to proposals which utilize DNA for nanotechnological applications. Potential applications of these ideas range from the programmable self-assembly of colloidal crystals, to biosensors and nanoparticle based drug delivery platforms. In Chapter I we introduce the system, which generically consists of colloidal particles functionalized with specially designed DNA markers. The sequence of bases on the DNA markers determines the particle type. Due to the hybridization between complementary single-stranded DNA, specific, type-dependent interactions can be introduced between particles by choosing the appropriate DNA marker sequences. In Chapter II we develop a statistical mechanical description of the aggregation and melting behavior of particles with DNA-mediated interactions. A quantitative comparison between the theory and experiments is made by calculating the experimentally observed melting profile. In Chapter III a model is proposed to describe the dynamical departure and diffusion of particles which form reversible key-lock connections. The model predicts a crossover from localized to diffusive behavior. The random walk statistics for the particles' in plane diffusion is discussed. The lateral motion is analogous to dispersive transport in disordered semiconductors, ranging from standard diffusion with a renormalized diffusion coefficient to anomalous, subdiffusive behavior. In Chapter IV we propose a method to self-assemble nanoparticle clusters using DNA scaffolds. An optimal concentration ratio is determined for the experimental implementation of our self-assembly proposal. A natural extension is discussed in Chapter V, the programmable self-assembly of nanoparticle clusters where the desired cluster geometry is encoded using DNA-mediated interactions. We determine the probability that the system self-assembles the desired cluster geometry, and discuss the connections to jamming in granular and colloidal systems. In Chapter VI we consider a nanoparticle based drug delivery platform for targeted, cell specific chemotherapy. A key-lock model is proposed to describe the results of in-vitro experiments, and the situation in-vivo is discussed. The cooperative binding, and hence the specificity to cancerous cells, is kinetically limited. The implications for optimizing the design of nanoparticle based drug delivery platforms is discussed. In Chapter VII we present prospects for future research: the connection between DNA-mediated colloidal crystallization and jamming, and the inverse problem in self-assembly.

  12. An integrated QSAR-PBK/D modelling approach for predicting detoxification and DNA adduct formation of 18 acyclic food-borne α,β-unsaturated aldehydes.

    PubMed

    Kiwamoto, R; Spenkelink, A; Rietjens, I M C M; Punt, A

    2015-01-01

    Acyclic α,β-unsaturated aldehydes present in food raise a concern because the α,β-unsaturated aldehyde moiety is considered a structural alert for genotoxicity. However, controversy remains on whether in vivo at realistic dietary exposure DNA adduct formation is significant. The aim of the present study was to develop physiologically based kinetic/dynamic (PBK/D) models to examine dose-dependent detoxification and DNA adduct formation of a group of 18 food-borne acyclic α,β-unsaturated aldehydes without 2- or 3-alkylation, and with no more than one conjugated double bond. Parameters for the PBK/D models were obtained using quantitative structure-activity relationships (QSARs) defined with a training set of six selected aldehydes. Using the QSARs, PBK/D models for the other 12 aldehydes were defined. Results revealed that DNA adduct formation in the liver increases with decreasing bulkiness of the molecule especially due to less efficient detoxification. 2-Propenal (acrolein) was identified to induce the highest DNA adduct levels. At realistic dietary intake, the predicted DNA adduct levels for all aldehydes were two orders of magnitude lower than endogenous background levels observed in disease free human liver, suggesting that for all 18 aldehydes DNA adduct formation is negligible at the relevant levels of dietary intake. The present study provides a proof of principle for the use of QSAR-based PBK/D modelling to facilitate group evaluations and read-across in risk assessment. Copyright © 2014 Elsevier Inc. All rights reserved.

  13. Perturbations in DNA structure upon interaction with porphyrins revealed by chemical probes, DNA footprinting and molecular modelling.

    PubMed

    Ford, K G; Neidle, S

    1995-06-01

    The interactions of several porphyrins with a 74 base-pair DNA sequence have been examined by footprinting and chemical protection methods. Tetra-(4-N-methyl-(pyridyl)) porphyrin (TMPy), two of its metal complexes and tetra-(4-trimethylanilinium) porphyrin (TMAP) bind to closely similar AT-rich sequences. The three TMPy ligands produce modest changes in DNA structure and base accessibility on binding, in contrast to the large-scale conformational changes observed with TMAP. Molecular modelling studies have been performed on TMPy and TMAP bound in the AT-rich minor groove of an oligonucleotide. These have shown that significant structural change is needed to accommodate the bulky trimethyl substituent groups of TMAP, in contrast to the facile minor groove fit of TMPy.

  14. Short cell-penetrating peptides: a model of interactions with gene promoter sites.

    PubMed

    Khavinson, V Kh; Tarnovskaya, S I; Linkova, N S; Pronyaeva, V E; Shataeva, L K; Yakutseni, P P

    2013-01-01

    Analysis of the main parameters of molecular mechanics (number of hydrogen bonds, hydrophobic and electrostatic interactions, DNA-peptide complex minimization energy) provided the data to validate the previously proposed qualitative models of peptide-DNA interactions and to evaluate their quantitative characteristics. Based on these estimations, a three-dimensional model of Lys-Glu and Ala-Glu-Asp-Gly peptide interactions with DNA sites (GCAG and ATTTC) located in the promoter zones of genes encoding CD5, IL-2, MMP2, and Tram1 signal molecules.

  15. A physiologically based in silico model for trans-2-hexenal detoxification and DNA adduct formation in human including interindividual variation indicates efficient detoxification and a negligible genotoxicity risk.

    PubMed

    Kiwamoto, R; Spenkelink, A; Rietjens, I M C M; Punt, A

    2013-09-01

    A number of α,β-unsaturated aldehydes are present in food both as natural constituents and as flavouring agents. Their reaction with DNA due to their electrophilic α,β-unsaturated aldehyde moiety may result in genotoxicity as observed in some in vitro models, thereby raising a safety concern. A question that remains is whether in vivo detoxification would be efficient enough to prevent DNA adduct formation and genotoxicity. In this study, a human physiologically based kinetic/dynamic (PBK/D) model of trans-2-hexenal (2-hexenal), a selected model α,β-unsaturated aldehyde, was developed to examine dose-dependent detoxification and DNA adduct formation in humans upon dietary exposure. The kinetic model parameters for detoxification were quantified using relevant pooled human tissue fractions as well as tissue fractions from 11 different individual subjects. In addition, a Monte Carlo simulation was performed so that the impact of interindividual variation in 2-hexenal detoxification on the DNA adduct formation in the population as a whole could be examined. The PBK/D model revealed that DNA adduct formation due to 2-hexenal exposure was 0.039 adducts/10⁸ nucleotides (nt) at the estimated average 2-hexenal dietary intake (0.04 mg 2-hexenal/kg bw) and 0.18 adducts/10⁸ nt at the 95th percentile of the dietary intake (0.178 mg 2-hexenal/kg bw) in the most sensitive people. These levels are three orders of magnitude lower than natural background DNA adduct levels that have been reported in disease-free humans (6.8-110 adducts/10⁸ nt), suggesting that the genotoxicity risk for the human population at realistic dietary daily intakes of 2-hexenal may be negligible.

  16. A strand graph semantics for DNA-based computation

    PubMed Central

    Petersen, Rasmus L.; Lakin, Matthew R.; Phillips, Andrew

    2015-01-01

    DNA nanotechnology is a promising approach for engineering computation at the nanoscale, with potential applications in biofabrication and intelligent nanomedicine. DNA strand displacement is a general strategy for implementing a broad range of nanoscale computations, including any computation that can be expressed as a chemical reaction network. Modelling and analysis of DNA strand displacement systems is an important part of the design process, prior to experimental realisation. As experimental techniques improve, it is important for modelling languages to keep pace with the complexity of structures that can be realised experimentally. In this paper we present a process calculus for modelling DNA strand displacement computations involving rich secondary structures, including DNA branches and loops. We prove that our calculus is also sufficiently expressive to model previous work on non-branching structures, and propose a mapping from our calculus to a canonical strand graph representation, in which vertices represent DNA strands, ordered sites represent domains, and edges between sites represent bonds between domains. We define interactions between strands by means of strand graph rewriting, and prove the correspondence between the process calculus and strand graph behaviours. Finally, we propose a mapping from strand graphs to an efficient implementation, which we use to perform modelling and simulation of DNA strand displacement systems with rich secondary structure. PMID:27293306

  17. Aspergillus section Versicolores: nine new species and multilocus DNA sequence based phylogeny

    USDA-ARS?s Scientific Manuscript database

    ß-tubulin, calmodulin, internal transcribed spacer and partial lsu-rDNA, RNA polymerase, DNA replication licensing factor Mcm7, and pre-rRNA processing protein Tsr1 were amplified and sequenced from 62 A. versicolor clade isolates and analyzed phylogenetically using the concordance model to establis...

  18. Aspergillus section Versicolores, nine new species and multilocus DNA sequence based phylogeny

    USDA-ARS?s Scientific Manuscript database

    ß-tubulin, calmodulin, internal transcribed spacer and partial lsu-rDNA, RNA polymerase, DNA replication licensing factor Mcm7, and pre-rRNA processing protein Tsr1 were amplified and sequenced from 62 A. versicolor clade isolates and analyzed phylogenetically using the concordance model to establis...

  19. Promoter Sequences Prediction Using Relational Association Rule Mining

    PubMed Central

    Czibula, Gabriela; Bocicor, Maria-Iuliana; Czibula, Istvan Gergely

    2012-01-01

    In this paper we are approaching, from a computational perspective, the problem of promoter sequences prediction, an important problem within the field of bioinformatics. As the conditions for a DNA sequence to function as a promoter are not known, machine learning based classification models are still developed to approach the problem of promoter identification in the DNA. We are proposing a classification model based on relational association rules mining. Relational association rules are a particular type of association rules and describe numerical orderings between attributes that commonly occur over a data set. Our classifier is based on the discovery of relational association rules for predicting if a DNA sequence contains or not a promoter region. An experimental evaluation of the proposed model and comparison with similar existing approaches is provided. The obtained results show that our classifier overperforms the existing techniques for identifying promoter sequences, confirming the potential of our proposal. PMID:22563233

  20. Platinum-Based Chemotherapy Induces Methylation Changes in Blood DNA Associated with Overall Survival in Patients with Ovarian Cancer.

    PubMed

    Flanagan, James M; Wilson, Angela; Koo, Chail; Masrour, Nahal; Gallon, John; Loomis, Erick; Flower, Kirsty; Wilhelm-Benartzi, Charlotte; Hergovich, Alexander; Cunnea, Paula; Gabra, Hani; Braicu, Elena Ioana; Sehouli, Jalid; Darb-Esfahani, Silvia; Vanderstichele, Adriaan; Vergote, Ignace; Kreuzinger, Caroline; Castillo-Tong, Dan Cacsire; Wisman, G Bea A; Berns, Els Mjj; Siddiqui, Nadeem; Paul, James; Brown, Robert

    2017-05-01

    Purpose: DNA damage repair can lead to epigenetic changes. DNA mismatch repair proteins bind to platinum DNA adducts and at sites of DNA damage can recruit the DNA methylating enzyme DNMT1, resulting in aberrant methylation. We hypothesised that DNA damage repair during platinum-based chemotherapy may cause aberrant DNA methylation in normal tissues of patients such as blood. Experimental Design: We used Illumina 450k methylation arrays and bisulphite pyrosequencing to investigate methylation at presentation and relapse in blood DNA from patients with ovarian cancer enrolled in the SCOTROC1 trial ( n = 247) and in a cohort of ovarian tumor DNA samples collected at first relapse ( n = 46). We used an ovarian cancer cell line model to investigate the role of the DNA mismatch repair gene MLH1 in platinum-induced methylation changes. Results: Specific CpG methylation changes in blood at relapse are observed following platinum-based chemotherapy and are associated with patient survival, independent of other clinical factors [hazard ratio, 3.7; 95% confidence interval, 1.8-7.6, P = 2.8 × 10 -4 ]. Similar changes occur in ovarian tumors at relapse, also associated with patient survival (hazard ratio, 2.6; 95% confidence interval, 1.0-6.8, P = 0.048). Using an ovarian cancer cell line model, we demonstrate that functional mismatch repair increases the frequency of platinum-induced methylation. Conclusions: DNA methylation in blood at relapse following chemotherapy, and not at presentation, is informative regarding survival of patients with ovarian cancer. Functional DNA mismatch repair increases the frequency of DNA methylation changes induced by platinum. DNA methylation in blood following chemotherapy could provide a noninvasive means of monitoring patients' epigenetic responses to treatment without requiring a tumor biopsy. Clin Cancer Res; 23(9); 2213-22. ©2016 AACR . ©2016 American Association for Cancer Research.

  1. DNA glycosylases search for and remove oxidized DNA bases.

    PubMed

    Wallace, Susan S

    2013-12-01

    This review article presents, an overview of the DNA glycosylases that recognize oxidized DNA bases using the Fpg/Nei family of DNA glycosylases as models for how structure can inform function. For example, even though human NEIL1 and the plant and fungal orthologs lack the zinc finger shown to be required for binding, DNA crystal structures revealed a "zincless finger" with the same properties. Moreover, the "lesion recognition loop" is not involved in lesion recognition, rather, it stabilizes 8-oxoG in the active site pocket. Unlike the other Fpg/Nei family members, Neil3 lacks two of the three void-filling residues that stabilize the DNA duplex and interact with the opposite strand to the damage which may account for its preference for lesions in single-stranded DNA. Also single-molecule approaches show that DNA glycosylases search for their substrates in a sea of undamaged DNA by using a wedge residue that is inserted into the DNA helix to probe for the presence of damage. Copyright © 2013 Wiley Periodicals, Inc.

  2. Computational Identification of Diverse Mechanisms Underlying Transcription Factor-DNA Occupancy

    PubMed Central

    Cheng, Qiong; Kazemian, Majid; Pham, Hannah; Blatti, Charles; Celniker, Susan E.; Wolfe, Scot A.; Brodsky, Michael H.; Sinha, Saurabh

    2013-01-01

    ChIP-based genome-wide assays of transcription factor (TF) occupancy have emerged as a powerful, high-throughput method to understand transcriptional regulation, especially on a global scale. This has led to great interest in the underlying biochemical mechanisms that direct TF-DNA binding, with the ultimate goal of computationally predicting a TF's occupancy profile in any cellular condition. In this study, we examined the influence of various potential determinants of TF-DNA binding on a much larger scale than previously undertaken. We used a thermodynamics-based model of TF-DNA binding, called “STAP,” to analyze 45 TF-ChIP data sets from Drosophila embryonic development. We built a cross-validation framework that compares a baseline model, based on the ChIP'ed (“primary”) TF's motif, to more complex models where binding by secondary TFs is hypothesized to influence the primary TF's occupancy. Candidates interacting TFs were chosen based on RNA-SEQ expression data from the time point of the ChIP experiment. We found widespread evidence of both cooperative and antagonistic effects by secondary TFs, and explicitly quantified these effects. We were able to identify multiple classes of interactions, including (1) long-range interactions between primary and secondary motifs (separated by ≤150 bp), suggestive of indirect effects such as chromatin remodeling, (2) short-range interactions with specific inter-site spacing biases, suggestive of direct physical interactions, and (3) overlapping binding sites suggesting competitive binding. Furthermore, by factoring out the previously reported strong correlation between TF occupancy and DNA accessibility, we were able to categorize the effects into those that are likely to be mediated by the secondary TF's effect on local accessibility and those that utilize accessibility-independent mechanisms. Finally, we conducted in vitro pull-down assays to test model-based predictions of short-range cooperative interactions, and found that seven of the eight TF pairs tested physically interact and that some of these interactions mediate cooperative binding to DNA. PMID:23935523

  3. SPRi-based biosensing platforms for detection of specific DNA sequences using thiolate and dithiocarbamate assemblies

    NASA Astrophysics Data System (ADS)

    Drozd, Marcin; Pietrzak, Mariusz D.; Malinowska, Elżbieta

    2018-05-01

    The framework of presented study covers the development and examination of the analytical performance of surface plasmon resonance-based (SPR) DNA biosensors dedicated for a detection of model target oligonucleotide sequence. For this aim, various strategies of immobilization of DNA probes on gold transducers were tested. Besides the typical approaches: chemisorption of thiolated ssDNA (DNA-thiol) and physisorption of non-functionalized oligonucleotides, relatively new method based on chemisorption of dithiocarbamate-functionalized ssDNA (DNA-DTC) was applied for the first time for preparation of DNA-based SPR biosensor. The special emphasis was put on the correlation between the method of DNA immobilization and the composition of obtained receptor layer. The carried out studies focused on the examination of the capability of developed receptors layers to interact with both target DNA and DNA-functionalized AuNPs. It was found, that the detection limit of target DNA sequence (27 nb length) depends on the strategy of probe immobilization and backfilling method, and in the best case it amounted to 0,66 nM. Moreover, the application of ssDNA-functionalized gold nanoparticles (AuNPs) as plasmonic labels for secondary enhancement of SPR response is presented. The influence of spatial organization and surface density of a receptor layer on the ability to interact with DNA-functionalized AuNPs is discussed. Due to the best compatibility of receptors immobilized via DTC chemisorption: 1.47 ± 0.4 ·1012 molecules • cm-2 (with the calculated area occupied by single nanoparticle label of 132.7 nm2), DNA chemisorption based on DTCs is pointed as especially promising for DNA biosensors utilizing indirect detection in competitive assays.

  4. SPRi-Based Biosensing Platforms for Detection of Specific DNA Sequences Using Thiolate and Dithiocarbamate Assemblies.

    PubMed

    Drozd, Marcin; Pietrzak, Mariusz D; Malinowska, Elżbieta

    2018-01-01

    The framework of presented study covers the development and examination of the analytical performance of surface plasmon resonance-based (SPR) DNA biosensors dedicated for a detection of model target oligonucleotide sequence. For this aim, various strategies of immobilization of DNA probes on gold transducers were tested. Besides the typical approaches: chemisorption of thiolated ssDNA (DNA-thiol) and physisorption of non-functionalized oligonucleotides, relatively new method based on chemisorption of dithiocarbamate-functionalized ssDNA (DNA-DTC) was applied for the first time for preparation of DNA-based SPR biosensor. The special emphasis was put on the correlation between the method of DNA immobilization and the composition of obtained receptor layer. The carried out studies focused on the examination of the capability of developed receptors layers to interact with both target DNA and DNA-functionalized AuNPs. It was found, that the detection limit of target DNA sequence (27 nb length) depends on the strategy of probe immobilization and backfilling method, and in the best case it amounted to 0.66 nM. Moreover, the application of ssDNA-functionalized gold nanoparticles (AuNPs) as plasmonic labels for secondary enhancement of SPR response is presented. The influence of spatial organization and surface density of a receptor layer on the ability to interact with DNA-functionalized AuNPs is discussed. Due to the best compatibility of receptors immobilized via DTC chemisorption: 1.47 ± 0.4 · 10 12 molecules · cm -2 (with the calculated area occupied by single nanoparticle label of ~132.7 nm 2 ), DNA chemisorption based on DTCs is pointed as especially promising for DNA biosensors utilizing indirect detection in competitive assays.

  5. Stabilised DNA secondary structures with increasing transcription localise hypermutable bases for somatic hypermutation in IGHV3-23.

    PubMed

    Duvvuri, Bhargavi; Duvvuri, Venkata R; Wu, Jianhong; Wu, Gillian E

    2012-07-01

    Somatic hypermutation (SHM) mediated by activation-induced cytidine deaminase (AID) is a transcription-coupled mechanism most responsible for generating high affinity antibodies. An issue remaining enigmatic in SHM is how AID is preferentially targeted during transcription to hypermutable bases in its substrates (WRC motifs) on both DNA strands. AID targets only single stranded DNA. By modelling the dynamical behaviour of IGHV3-23 DNA, a commonly used human variable gene segment, we observed that hypermutable bases on the non-transcribed strand are paired whereas those on transcribed strand are mostly unpaired. Hypermutable bases (both paired and unpaired) are made accessible to AID in stabilised secondary structures formed with increasing transcription levels. This observation provides a rationale for the hypermutable bases on both the strands of DNA being targeted to a similar extent despite having differences in unpairedness. We propose that increasing transcription and RNAP II stalling resulting in the formation and stabilisation of stem-loop structures with AID hotspots in negatively supercoiled region can localise the hypermutable bases of both strands of DNA, to AID-mediated SHM.

  6. Molecular determinants of the interactions between proteins and ssDNA.

    PubMed

    Mishra, Garima; Levy, Yaakov

    2015-04-21

    ssDNA binding proteins (SSBs) protect ssDNA from chemical and enzymatic assault that can derail DNA processing machinery. Complexes between SSBs and ssDNA are often highly stable, but predicting their structures is challenging, mostly because of the inherent flexibility of ssDNA and the geometric and energetic complexity of the interfaces that it forms. Here, we report a newly developed coarse-grained model to predict the structure of SSB-ssDNA complexes. The model is successfully applied to predict the binding modes of six SSBs with ssDNA strands of lengths of 6-65 nt. In addition to charge-charge interactions (which are often central to governing protein interactions with nucleic acids by means of electrostatic complementarity), an essential energetic term to predict SSB-ssDNA complexes is the interactions between aromatic residues and DNA bases. For some systems, flexibility is required from not only the ssDNA but also, the SSB to allow it to undergo conformational changes and the penetration of the ssDNA into its binding pocket. The association mechanisms can be quite varied, and in several cases, they involve the ssDNA sliding along the protein surface. The binding mechanism suggests that coarse-grained models are appropriate to study the motion of SSBs along ssDNA, which is expected to be central to the function carried out by the SSBs.

  7. 3D replicon distributions arise from stochastic initiation and domino-like DNA replication progression

    PubMed Central

    Löb, D.; Lengert, N.; Chagin, V. O.; Reinhart, M.; Casas-Delucchi, C. S.; Cardoso, M. C.; Drossel, B.

    2016-01-01

    DNA replication dynamics in cells from higher eukaryotes follows very complex but highly efficient mechanisms. However, the principles behind initiation of potential replication origins and emergence of typical patterns of nuclear replication sites remain unclear. Here, we propose a comprehensive model of DNA replication in human cells that is based on stochastic, proximity-induced replication initiation. Critical model features are: spontaneous stochastic firing of individual origins in euchromatin and facultative heterochromatin, inhibition of firing at distances below the size of chromatin loops and a domino-like effect by which replication forks induce firing of nearby origins. The model reproduces the empirical temporal and chromatin-related properties of DNA replication in human cells. We advance the one-dimensional DNA replication model to a spatial model by taking into account chromatin folding in the nucleus, and we are able to reproduce the spatial and temporal characteristics of the replication foci distribution throughout S-phase. PMID:27052359

  8. A model for chromosome organization during the cell cycle in live E. coli.

    PubMed

    Liu, Yuru; Xie, Ping; Wang, Pengye; Li, Ming; Li, Hui; Li, Wei; Dou, Shuoxing

    2015-11-24

    Bacterial chromosomal DNA is a highly compact nucleoid. The organization of this nucleoid is poorly understood due to limitations in the methods used to monitor the complexities of DNA organization in live bacteria. Here, we report that circular plasmid DNA is auto-packaged into a uniform dual-toroidal-spool conformation in response to mechanical stress stemming from sharp bending and un-winding by atomic force microscopic analysis. The mechanism underlying this phenomenon was deduced with basic physical principles to explain the auto-packaging behaviour of circular DNA. Based on our observations and previous studies, we propose a dynamic model of how chromosomal DNA in E. coli may be organized during a cell division cycle. Next, we test the model by monitoring the development of HNS clusters in live E. coli during a cell cycle. The results were in close agreement with the model. Furthermore, the model accommodates a majority of the thus-far-discovered remarkable features of nucleoids in vivo.

  9. A model for chromosome organization during the cell cycle in live E. coli

    PubMed Central

    Liu, Yuru; Xie, Ping; Wang, Pengye; Li, Ming; Li, Hui; Li, Wei; Dou, Shuoxing

    2015-01-01

    Bacterial chromosomal DNA is a highly compact nucleoid. The organization of this nucleoid is poorly understood due to limitations in the methods used to monitor the complexities of DNA organization in live bacteria. Here, we report that circular plasmid DNA is auto-packaged into a uniform dual-toroidal-spool conformation in response to mechanical stress stemming from sharp bending and un-winding by atomic force microscopic analysis. The mechanism underlying this phenomenon was deduced with basic physical principles to explain the auto-packaging behaviour of circular DNA. Based on our observations and previous studies, we propose a dynamic model of how chromosomal DNA in E. coli may be organized during a cell division cycle. Next, we test the model by monitoring the development of HNS clusters in live E. coli during a cell cycle. The results were in close agreement with the model. Furthermore, the model accommodates a majority of the thus-far-discovered remarkable features of nucleoids in vivo. PMID:26597953

  10. A novel quantitative electrochemical method to monitor DNA double-strand breaks caused by a DNA cleavage agent at a DNA sensor.

    PubMed

    Banasiak, Anna; Cassidy, John; Colleran, John

    2018-06-01

    To date, DNA cleavage, caused by cleavage agents, has been monitored mainly by gel and capillary electrophoresis. However, these techniques are time-consuming, non-quantitative and require gel stains. In this work, a novel, simple and, importantly, a quantitative method for monitoring the DNA nuclease activity of potential anti-cancer drugs, at a DNA electrochemical sensor, is presented. The DNA sensors were prepared using thiol-modified oligonucleotides that self-assembled to create a DNA monolayer at gold electrode surfaces. The quantification of DNA double-strand breaks is based on calculating the DNA surface coverage, before and after exposure to a DNA cleavage agent. The nuclease properties of a model DNA cleavage agent, copper bis-phenanthroline ([Cu II (phen) 2 ] 2+ ), that can cleave DNA in a Fenton-type reaction, were quantified electrochemically. The DNA surface coverage decreased on average by 21% after subjecting the DNA sensor to a nuclease assay containing [Cu II (phen) 2 ] 2+ , a reductant and an oxidant. This percentage indicates that 6 base pairs were cleaved in the nuclease assay from the immobilised 30 base pair strands. The DNA cleavage can be also induced electrochemically in the absence of a chemical reductant. [Cu II (phen) 2 ] 2+ intercalates between DNA base pairs and, on application of a suitable potential, can be reduced to [Cu I (phen) 2 ] + , with dissolved oxygen acting as the required oxidant. This reduction process is facilitated through DNA strands via long-range electron transfer, resulting in DNA cleavage of 23%. The control measurements for both chemically and electrochemically induced cleavage revealed that DNA strand breaks did not occur under experimental conditions in the absence of [Cu II (phen) 2 ] 2+ . Copyright © 2018 Elsevier B.V. All rights reserved.

  11. DNA Base-Calling from a Nanopore Using a Viterbi Algorithm

    PubMed Central

    Timp, Winston; Comer, Jeffrey; Aksimentiev, Aleksei

    2012-01-01

    Nanopore-based DNA sequencing is the most promising third-generation sequencing method. It has superior read length, speed, and sample requirements compared with state-of-the-art second-generation methods. However, base-calling still presents substantial difficulty because the resolution of the technique is limited compared with the measured signal/noise ratio. Here we demonstrate a method to decode 3-bp-resolution nanopore electrical measurements into a DNA sequence using a Hidden Markov model. This method shows tremendous potential for accuracy (∼98%), even with a poor signal/noise ratio. PMID:22677395

  12. A primer on thermodynamic-based models for deciphering transcriptional regulatory logic.

    PubMed

    Dresch, Jacqueline M; Richards, Megan; Ay, Ahmet

    2013-09-01

    A rigorous analysis of transcriptional regulation at the DNA level is crucial to the understanding of many biological systems. Mathematical modeling has offered researchers a new approach to understanding this central process. In particular, thermodynamic-based modeling represents the most biophysically informed approach aimed at connecting DNA level regulatory sequences to the expression of specific genes. The goal of this review is to give biologists a thorough description of the steps involved in building, analyzing, and implementing a thermodynamic-based model of transcriptional regulation. The data requirements for this modeling approach are described, the derivation for a specific regulatory region is shown, and the challenges and future directions for the quantitative modeling of gene regulation are discussed. Copyright © 2013 Elsevier B.V. All rights reserved.

  13. DNABP: Identification of DNA-Binding Proteins Based on Feature Selection Using a Random Forest and Predicting Binding Residues.

    PubMed

    Ma, Xin; Guo, Jing; Sun, Xiao

    2016-01-01

    DNA-binding proteins are fundamentally important in cellular processes. Several computational-based methods have been developed to improve the prediction of DNA-binding proteins in previous years. However, insufficient work has been done on the prediction of DNA-binding proteins from protein sequence information. In this paper, a novel predictor, DNABP (DNA-binding proteins), was designed to predict DNA-binding proteins using the random forest (RF) classifier with a hybrid feature. The hybrid feature contains two types of novel sequence features, which reflect information about the conservation of physicochemical properties of the amino acids, and the binding propensity of DNA-binding residues and non-binding propensities of non-binding residues. The comparisons with each feature demonstrated that these two novel features contributed most to the improvement in predictive ability. Furthermore, to improve the prediction performance of the DNABP model, feature selection using the minimum redundancy maximum relevance (mRMR) method combined with incremental feature selection (IFS) was carried out during the model construction. The results showed that the DNABP model could achieve 86.90% accuracy, 83.76% sensitivity, 90.03% specificity and a Matthews correlation coefficient of 0.727. High prediction accuracy and performance comparisons with previous research suggested that DNABP could be a useful approach to identify DNA-binding proteins from sequence information. The DNABP web server system is freely available at http://www.cbi.seu.edu.cn/DNABP/.

  14. Evaluating the role of coherent delocalized phonon-like modes in DNA cyclization

    DOE PAGES

    Alexandrov, Ludmil B.; Rasmussen, Kim Ø.; Bishop, Alan R.; ...

    2017-08-29

    The innate flexibility of a DNA sequence is quantified by the Jacobson-Stockmayer’s J-factor, which measures the propensity for DNA loop formation. Recent studies of ultra-short DNA sequences revealed a discrepancy of up to six orders of magnitude between experimentally measured and theoretically predicted J-factors. These large differences suggest that, in addition to the elastic moduli of the double helix, other factors contribute to loop formation. We develop a new theoretical model that explores how coherent delocalized phonon-like modes in DNA provide single-stranded ”flexible hinges” to assist in loop formation. We also combine the Czapla-Swigon-Olson structural model of DNA with ourmore » extended Peyrard-Bishop-Dauxois model and, without changing any of the parameters of the two models, apply this new computational framework to 86 experimentally characterized DNA sequences. Our results demonstrate that the new computational framework can predict J-factors within an order of magnitude of experimental measurements for most ultra-short DNA sequences, while continuing to accurately describe the J-factors of longer sequences. Furthermore, we demonstrate that our computational framework can be used to describe the cyclization of DNA sequences that contain a base pair mismatch. Overall, our results support the conclusion that coherent delocalized phonon-like modes play an important role in DNA cyclization.« less

  15. Evaluating the role of coherent delocalized phonon-like modes in DNA cyclization

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Alexandrov, Ludmil B.; Rasmussen, Kim Ø.; Bishop, Alan R.

    The innate flexibility of a DNA sequence is quantified by the Jacobson-Stockmayer’s J-factor, which measures the propensity for DNA loop formation. Recent studies of ultra-short DNA sequences revealed a discrepancy of up to six orders of magnitude between experimentally measured and theoretically predicted J-factors. These large differences suggest that, in addition to the elastic moduli of the double helix, other factors contribute to loop formation. We develop a new theoretical model that explores how coherent delocalized phonon-like modes in DNA provide single-stranded ”flexible hinges” to assist in loop formation. We also combine the Czapla-Swigon-Olson structural model of DNA with ourmore » extended Peyrard-Bishop-Dauxois model and, without changing any of the parameters of the two models, apply this new computational framework to 86 experimentally characterized DNA sequences. Our results demonstrate that the new computational framework can predict J-factors within an order of magnitude of experimental measurements for most ultra-short DNA sequences, while continuing to accurately describe the J-factors of longer sequences. Furthermore, we demonstrate that our computational framework can be used to describe the cyclization of DNA sequences that contain a base pair mismatch. Overall, our results support the conclusion that coherent delocalized phonon-like modes play an important role in DNA cyclization.« less

  16. DNA-PKcs deficiency leads to persistence of oxidatively-induced clustered DNA lesions in human tumor cells

    PubMed Central

    Peddi, Prakash; Loftin, Charles W.; Dickey, Jennifer S.; Hair, Jessica M.; Burns, Kara J.; Aziz, Khaled; Francisco, Dave C.; Panayiotidis, Mihalis I.; Sedelnikova, Olga A.; Bonner, William M.; Winters, Thomas A.; Georgakilas, Alexandros G.

    2010-01-01

    DNA-dependent protein kinase (DNA-PK) is a key non-homologous end joining (NHEJ) nuclear serine/threonine protein kinase involved in various DNA metabolic and damage signaling pathways contributing to the maintenance of genomic stability and prevention of cancer. In order to examine the role of DNA-PK in processing of non-DSB clustered DNA damage, we have used three different models of DNA-PK deficiency i.e. chemical inactivation of its kinase activity by novel inhibitors IC86621 and NU7026, knock-down and complete absence of the protein in human breast cancer (MCF-7) and glioblastoma cell lines (MO59-J/K). Compromised DNA-PK repair pathway has lead to accumulation of clustered DNA lesions induced by γ-rays. Tumor cells lacking protein expression or with inhibited kinase activity showed a marked decrease in their ability to process oxidatively-induced non-DSB clustered DNA lesions measured using a modified version of pulsed field gel electrophoresis or single cell gel electrophoresis (Comet assay). In all cases, DNA-PK inactivation lead to a higher level of lesion persistence even after 24–72 hrs of repair. We suggest a model in which DNA-PK deficiency affects the processing of these clusters by first compromising base excision repair and second by the presence of catalytically inactive DNA-PK inhibiting the efficient processing of these lesions due to the failure of DNA-PK to disassociate from the DNA ends. The information rendered will be important not only for understating cancer etiology in the presence of a NHEJ deficiency but also lead to a better understanding of cancer treatments based on the induction of oxidative stress and inhibition of cluster repair. PMID:20193758

  17. Sequence-based prediction of protein-binding sites in DNA: comparative study of two SVM models.

    PubMed

    Park, Byungkyu; Im, Jinyong; Tuvshinjargal, Narankhuu; Lee, Wook; Han, Kyungsook

    2014-11-01

    As many structures of protein-DNA complexes have been known in the past years, several computational methods have been developed to predict DNA-binding sites in proteins. However, its inverse problem (i.e., predicting protein-binding sites in DNA) has received much less attention. One of the reasons is that the differences between the interaction propensities of nucleotides are much smaller than those between amino acids. Another reason is that DNA exhibits less diverse sequence patterns than protein. Therefore, predicting protein-binding DNA nucleotides is much harder than predicting DNA-binding amino acids. We computed the interaction propensity (IP) of nucleotide triplets with amino acids using an extensive dataset of protein-DNA complexes, and developed two support vector machine (SVM) models that predict protein-binding nucleotides from sequence data alone. One SVM model predicts protein-binding nucleotides using DNA sequence data alone, and the other SVM model predicts protein-binding nucleotides using both DNA and protein sequences. In a 10-fold cross-validation with 1519 DNA sequences, the SVM model that uses DNA sequence data only predicted protein-binding nucleotides with an accuracy of 67.0%, an F-measure of 67.1%, and a Matthews correlation coefficient (MCC) of 0.340. With an independent dataset of 181 DNAs that were not used in training, it achieved an accuracy of 66.2%, an F-measure 66.3% and a MCC of 0.324. Another SVM model that uses both DNA and protein sequences achieved an accuracy of 69.6%, an F-measure of 69.6%, and a MCC of 0.383 in a 10-fold cross-validation with 1519 DNA sequences and 859 protein sequences. With an independent dataset of 181 DNAs and 143 proteins, it showed an accuracy of 67.3%, an F-measure of 66.5% and a MCC of 0.329. Both in cross-validation and independent testing, the second SVM model that used both DNA and protein sequence data showed better performance than the first model that used DNA sequence data. To the best of our knowledge, this is the first attempt to predict protein-binding nucleotides in a given DNA sequence from the sequence data alone. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  18. A new parallel DNA algorithm to solve the task scheduling problem based on inspired computational model.

    PubMed

    Wang, Zhaocai; Ji, Zuwen; Wang, Xiaoming; Wu, Tunhua; Huang, Wei

    2017-12-01

    As a promising approach to solve the computationally intractable problem, the method based on DNA computing is an emerging research area including mathematics, computer science and molecular biology. The task scheduling problem, as a well-known NP-complete problem, arranges n jobs to m individuals and finds the minimum execution time of last finished individual. In this paper, we use a biologically inspired computational model and describe a new parallel algorithm to solve the task scheduling problem by basic DNA molecular operations. In turn, we skillfully design flexible length DNA strands to represent elements of the allocation matrix, take appropriate biological experiment operations and get solutions of the task scheduling problem in proper length range with less than O(n 2 ) time complexity. Copyright © 2017. Published by Elsevier B.V.

  19. DNA condensation and size effects of DNA condensation agent

    NASA Astrophysics Data System (ADS)

    Liu, Yan-Hui; Jiang, Chong-Ming; Guo, Xin-Miao; Tang, Yan-Lin; Hu, Lin

    2013-08-01

    Based on the model of the strong correlation of counterions condensed on DNA molecule, by tailoring interaction potential, interduplex spacing and correlation spacing between condensed counterions on DNA molecule and interduplex spacing fluctuation strength, toroidal configuration, rod-like configuration and two-hole configurations are possible. The size effects of counterion structure on the toroidal structure can be detected by this model. The autocorrelation function of the tangent vectors is found as an effective way to detect the structure of toroidal conformations and the generic pathway of the process of DNA condensation. The generic pathway of all of the configurations involves an initial nucleation loop, and the next part of the DNA chain is folded on the top of the initial nucleation loop with different manners, in agreement with the recent experimental results.

  20. A Biophysical Model of CRISPR/Cas9 Activity for Rational Design of Genome Editing and Gene Regulation

    PubMed Central

    Farasat, Iman; Salis, Howard M.

    2016-01-01

    The ability to precisely modify genomes and regulate specific genes will greatly accelerate several medical and engineering applications. The CRISPR/Cas9 (Type II) system binds and cuts DNA using guide RNAs, though the variables that control its on-target and off-target activity remain poorly characterized. Here, we develop and parameterize a system-wide biophysical model of Cas9-based genome editing and gene regulation to predict how changing guide RNA sequences, DNA superhelical densities, Cas9 and crRNA expression levels, organisms and growth conditions, and experimental conditions collectively control the dynamics of dCas9-based binding and Cas9-based cleavage at all DNA sites with both canonical and non-canonical PAMs. We combine statistical thermodynamics and kinetics to model Cas9:crRNA complex formation, diffusion, site selection, reversible R-loop formation, and cleavage, using large amounts of structural, biochemical, expression, and next-generation sequencing data to determine kinetic parameters and develop free energy models. Our results identify DNA supercoiling as a novel mechanism controlling Cas9 binding. Using the model, we predict Cas9 off-target binding frequencies across the lambdaphage and human genomes, and explain why Cas9’s off-target activity can be so high. With this improved understanding, we propose several rules for designing experiments for minimizing off-target activity. We also discuss the implications for engineering dCas9-based genetic circuits. PMID:26824432

  1. A partial structural and functional rescue of a retinitis pigmentosa model with compacted DNA nanoparticles.

    PubMed

    Cai, Xue; Nash, Zack; Conley, Shannon M; Fliesler, Steven J; Cooper, Mark J; Naash, Muna I

    2009-01-01

    Previously we have shown that compacted DNA nanoparticles can drive high levels of transgene expression after subretinal injection in the mouse eye. Here we delivered compacted DNA nanoparticles containing a therapeutic gene to the retinas of a mouse model of retinitis pigmentosa. Nanoparticles containing the wild-type retinal degeneration slow (Rds) gene were injected into the subretinal space of rds(+/-) mice on postnatal day 5. Gene expression was sustained for up to four months at levels up to four times higher than in controls injected with saline or naked DNA. The nanoparticles were taken up into virtually all photoreceptors and mediated significant structural and biochemical rescue of the disease without histological or functional evidence of toxicity. Electroretinogram recordings showed that nanoparticle-mediated gene transfer restored cone function to a near-normal level in contrast to transfer of naked plasmid DNA. Rod function was also improved. These findings demonstrate that compacted DNA nanoparticles represent a viable option for development of gene-based interventions for ocular diseases and obviate major barriers commonly encountered with non-viral based therapies.

  2. Molecular dynamics simulation of the opposite-base preference and interactions in the active site of formamidopyrimidine-DNA glycosylase.

    PubMed

    Popov, Alexander V; Endutkin, Anton V; Vorobjev, Yuri N; Zharkov, Dmitry O

    2017-05-08

    Formamidopyrimidine-DNA glycosylase (Fpg) removes abundant pre-mutagenic 8-oxoguanine (oxoG) bases from DNA through nucleophilic attack of its N-terminal proline at C1' of the damaged nucleotide. Since oxoG efficiently pairs with both C and A, Fpg must excise oxoG from pairs with C but not with A, otherwise a mutation occurs. The crystal structures of several Fpg-DNA complexes have been solved, yet no structure with A opposite the lesion is available. Here we use molecular dynamic simulation to model interactions in the pre-catalytic complex of Lactococcus lactis Fpg with DNA containing oxoG opposite C or A, the latter in either syn or anti conformation. The catalytic dyad, Pro1-Glu2, was modeled in all four possible protonation states. Only one transition was observed in the experimental reaction rate pH dependence plots, and Glu2 kept the same set of interactions regardless of its protonation state, suggesting that it does not limit the reaction rate. The adenine base opposite oxoG was highly distorting for the adjacent nucleotides: in the more stable syn models it formed non-canonical bonds with out-of-register nucleotides in both the damaged and the complementary strand, whereas in the anti models the adenine either formed non-canonical bonds or was expelled into the major groove. The side chains of Arg109 and Phe111 that Fpg inserts into DNA to maintain its kinked conformation tended to withdraw from their positions if A was opposite to the lesion. The region showing the largest differences in the dynamics between oxoG:C and oxoG:A substrates was unexpectedly remote from the active site, located near the linker joining the two domains of Fpg. This region was also highly conserved among 124 analyzed Fpg sequences. Three sites trapping water molecules through multiple bonds were identified on the protein-DNA interface, apparently helping to maintain enzyme-induced DNA distortion and participating in oxoG recognition. Overall, the discrimination against A opposite to the lesion seems to be due to incorrect DNA distortion around the lesion-containing base pair and, possibly, to gross movement of protein domains connected by the linker.

  3. Comparative reactivity of mismatched and unpaired bases in relation to their type and surroundings. Chemical cleavage of DNA mismatches in mutation detection analysis.

    PubMed

    Yakubovskaya, Marianna G; Belyakova, Anna A; Gasanova, Viktoria K; Belitsky, Gennady A; Dolinnaya, Nina G

    2010-07-01

    Systematic study of chemical reactivity of non-Watson-Crick base pairs depending on their type and microenvironment was performed on a model system that represents two sets of synthetic DNA duplexes with all types of mismatched and unmatched bases flanked by T.A or G.C pairs. Using comparative cleavage pattern analysis, we identified the main and additional target bases and performed quantitative study of the time course and efficacy of DNA modification caused by potassium permanganate or hydroxylamine. Potassium permanganate in combination with tetraethylammonium chloride was shown to induce DNA cleavage at all mismatched or bulged T residues, as well as at thymines of neighboring canonical pairs. Other mispaired (bulged) bases and thymine residues located on the second position from the mismatch site were not the targets for KMnO(4) attack. In contrast, hydroxylamine cleaved only heteroduplexes containing mismatched or unmatched C residues, and did not modify adjacent cytosines. However when G.C pairs flank bulged C residue, neighboring cytosines are also attacked by hydroxylamine due to defect migration. Chemical reactivity of target bases was shown to correlate strongly with the local disturbance of DNA double helix at mismatch or bulge site. With our model system, we were able to prove the absence of false-negative and false-positive results. Portion of heteroduplex reliably revealed in a mixture with corresponding homoduplex consists of 5% for bulge bases and "open" non-canonical pairs, and 10% for wobble base pairs giving minimal violations in DNA structure. This study provides a complete understanding of the principles of mutation detection methodology based on chemical cleavage of mismatches and clarifies the advantages and limitations of this approach in various biological and conformational studies of DNA. Copyright 2010 Elsevier Masson SAS. All rights reserved.

  4. DNA in the material world: electrical properties and nano-applications.

    PubMed

    Triberis, Georgios P; Dimakogianni, Margarita

    2009-01-01

    Contradictory experimental findings and theoretical interpretations have spurred intense debate over the electrical properties of the DNA double helix. In the present review article the various factors responsible for these divergences are discussed. The enlightenment of this issue could improve long range chemistry of oxidative DNA damage and repair processes, monitoring protein-DNA interactions and possible applications in nano-electronic circuit technology. The update experimental situation concerning measurements of the electrical conductivity is given. The character of the carriers responsible for the electrical conductivity measured in DNA is investigated. A theoretical model for the temperature dependence of the electrical conductivity of DNA is presented, based on microscopic models and percolation theoretical arguments. The theoretical results, excluding or including correlation effects, are applied to recent experimental findings for DNA, considering it as a one dimensional molecular wire. The results indicate that correlation effects are probably responsible for large hopping distances in DNA samples. Other theoretical conductivity models proposed for the interpretation of the responsible transport mechanism are also reviewed. Some of the most known and pioneering works on DNA's nano-applications, future developments and perspectives along with current technological limitations and patents are presented and discussed.

  5. Low-dose environmental radiation, DNA damage, and cancer: the possible contribution of psychological factors.

    PubMed

    Cwikel, Julie G; Gidron, Yori; Quastel, Michael

    2010-01-01

    Radiation causes DNA damage, increases risk of cancer, and is associated with psychological stress responses. This article proposes an evidence-based integrative model in which psychological factors could interact with radiation by either augmenting or moderating the adverse effects of radiation on DNA integrity and eventual tumorigenesis. Based on a review of the literature, we demonstrate the following: (1) the effects of low-dose radiation exposures on DNA integrity and on tumorigenesis; (2) the effects of low-dose radiation exposure on psychological distress; (3) the relationship between psychological factors and DNA damage; and (4) the possibility that psychological stress augments and that psychological resource variables moderate radiation-induced DNA damage and risk of cancer. The additional contribution of psychological processes to radiation-DNA damage-cancer relationships needs further study, and if verified, has clinical implications.

  6. The DNA glycosylase AlkD uses a non-base-flipping mechanism to excise bulky lesions

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Mullins, Elwood A.; Shi, Rongxin; Parsons, Zachary D.

    Threats to genomic integrity arising from DNA damage are mitigated by DNA glycosylases, which initiate the base excision repair pathway by locating and excising aberrant nucleobases. How these enzymes find small modifications within the genome is a current area of intensive research. A hallmark of these and other DNA repair enzymes is their use of base flipping to sequester modified nucleotides from the DNA helix and into an active site pocket. Consequently, base flipping is generally regarded as an essential aspect of lesion recognition and a necessary precursor to base excision. In this paper, we present the first, to ourmore » knowledge, DNA glycosylase mechanism that does not require base flipping for either binding or catalysis. Using the DNA glycosylase AlkD from Bacillus cereus, we crystallographically monitored excision of an alkylpurine substrate as a function of time, and reconstructed the steps along the reaction coordinate through structures representing substrate, intermediate and product complexes. Instead of directly interacting with the damaged nucleobase, AlkD recognizes aberrant base pairs through interactions with the phosphoribose backbone, while the lesion remains stacked in the DNA duplex. Quantum mechanical calculations revealed that these contacts include catalytic charge–dipole and CH–π interactions that preferentially stabilize the transition state. We show in vitro and in vivo how this unique means of recognition and catalysis enables AlkD to repair large adducts formed by yatakemycin, a member of the duocarmycin family of antimicrobial natural products exploited in bacterial warfare and chemotherapeutic trials. Bulky adducts of this or any type are not excised by DNA glycosylases that use a traditional base-flipping mechanism. Finally and hence, these findings represent a new model for DNA repair and provide insights into catalysis of base excision.« less

  7. The DNA glycosylase AlkD uses a non-base-flipping mechanism to excise bulky lesions

    DOE PAGES

    Mullins, Elwood A.; Shi, Rongxin; Parsons, Zachary D.; ...

    2015-10-28

    Threats to genomic integrity arising from DNA damage are mitigated by DNA glycosylases, which initiate the base excision repair pathway by locating and excising aberrant nucleobases. How these enzymes find small modifications within the genome is a current area of intensive research. A hallmark of these and other DNA repair enzymes is their use of base flipping to sequester modified nucleotides from the DNA helix and into an active site pocket. Consequently, base flipping is generally regarded as an essential aspect of lesion recognition and a necessary precursor to base excision. In this paper, we present the first, to ourmore » knowledge, DNA glycosylase mechanism that does not require base flipping for either binding or catalysis. Using the DNA glycosylase AlkD from Bacillus cereus, we crystallographically monitored excision of an alkylpurine substrate as a function of time, and reconstructed the steps along the reaction coordinate through structures representing substrate, intermediate and product complexes. Instead of directly interacting with the damaged nucleobase, AlkD recognizes aberrant base pairs through interactions with the phosphoribose backbone, while the lesion remains stacked in the DNA duplex. Quantum mechanical calculations revealed that these contacts include catalytic charge–dipole and CH–π interactions that preferentially stabilize the transition state. We show in vitro and in vivo how this unique means of recognition and catalysis enables AlkD to repair large adducts formed by yatakemycin, a member of the duocarmycin family of antimicrobial natural products exploited in bacterial warfare and chemotherapeutic trials. Bulky adducts of this or any type are not excised by DNA glycosylases that use a traditional base-flipping mechanism. Finally and hence, these findings represent a new model for DNA repair and provide insights into catalysis of base excision.« less

  8. QPSO-Based Adaptive DNA Computing Algorithm

    PubMed Central

    Karakose, Mehmet; Cigdem, Ugur

    2013-01-01

    DNA (deoxyribonucleic acid) computing that is a new computation model based on DNA molecules for information storage has been increasingly used for optimization and data analysis in recent years. However, DNA computing algorithm has some limitations in terms of convergence speed, adaptability, and effectiveness. In this paper, a new approach for improvement of DNA computing is proposed. This new approach aims to perform DNA computing algorithm with adaptive parameters towards the desired goal using quantum-behaved particle swarm optimization (QPSO). Some contributions provided by the proposed QPSO based on adaptive DNA computing algorithm are as follows: (1) parameters of population size, crossover rate, maximum number of operations, enzyme and virus mutation rate, and fitness function of DNA computing algorithm are simultaneously tuned for adaptive process, (2) adaptive algorithm is performed using QPSO algorithm for goal-driven progress, faster operation, and flexibility in data, and (3) numerical realization of DNA computing algorithm with proposed approach is implemented in system identification. Two experiments with different systems were carried out to evaluate the performance of the proposed approach with comparative results. Experimental results obtained with Matlab and FPGA demonstrate ability to provide effective optimization, considerable convergence speed, and high accuracy according to DNA computing algorithm. PMID:23935409

  9. The price of performance: a cost and performance analysis of the implementation of cell-free fetal DNA testing for Down syndrome in Ontario, Canada.

    PubMed

    Okun, N; Teitelbaum, M; Huang, T; Dewa, C S; Hoch, J S

    2014-04-01

    To examine the cost and performance implications of introducing cell-free fetal DNA (cffDNA) testing within modeled scenarios in a publicly funded Canadian provincial Down syndrome (DS) prenatal screening program. Two clinical algorithms were created: the first to represent the current screening program and the second to represent one that incorporates cffDNA testing. From these algorithms, eight distinct scenarios were modeled to examine: (1) the current program (no cffDNA), (2) the current program with first trimester screening (FTS) as the nuchal translucency-based primary screen (no cffDNA), (3) a program substituting current screening with primary cffDNA, (4) contingent cffDNA with current FTS performance, (5) contingent cffDNA at a fixed price to result in overall cost neutrality,(6) contingent cffDNA with an improved detection rate (DR) of FTS, (7) contingent cffDNA with higher uptake of FTS, and (8) contingent cffDNA with optimized FTS (higher uptake and improved DR). This modeling study demonstrates that introducing contingent cffDNA testing improves performance by increasing the number of cases of DS detected prenatally, and reducing the number of amniocenteses performed and concomitant iatrogenic pregnancy loss of pregnancies not affected by DS. Costs are modestly increased, although the cost per case of DS detected is decreased with contingent cffDNA testing. Contingent models of cffDNA testing can improve overall screening performance while maintaining the provision of an 11- to 13-week scan. Costs are modestly increased, but cost per prenatally detected case of DS is decreased. © 2013 John Wiley & Sons, Ltd.

  10. Modeling Hybridization Kinetics of Gene Probes in a DNA Biochip Using FEMLAB

    PubMed Central

    Munir, Ahsan; Waseem, Hassan; Williams, Maggie R.; Stedtfeld, Robert D.; Gulari, Erdogan; Tiedje, James M.; Hashsham, Syed A.

    2017-01-01

    Microfluidic DNA biochips capable of detecting specific DNA sequences are useful in medical diagnostics, drug discovery, food safety monitoring and agriculture. They are used as miniaturized platforms for analysis of nucleic acids-based biomarkers. Binding kinetics between immobilized single stranded DNA on the surface and its complementary strand present in the sample are of interest. To achieve optimal sensitivity with minimum sample size and rapid hybridization, ability to predict the kinetics of hybridization based on the thermodynamic characteristics of the probe is crucial. In this study, a computer aided numerical model for the design and optimization of a flow-through biochip was developed using a finite element technique packaged software tool (FEMLAB; package included in COMSOL Multiphysics) to simulate the transport of DNA through a microfluidic chamber to the reaction surface. The model accounts for fluid flow, convection and diffusion in the channel and on the reaction surface. Concentration, association rate constant, dissociation rate constant, recirculation flow rate, and temperature were key parameters affecting the rate of hybridization. The model predicted the kinetic profile and signal intensities of eighteen 20-mer probes targeting vancomycin resistance genes (VRGs). Predicted signal intensities and hybridization kinetics strongly correlated with experimental data in the biochip (R2 = 0.8131). PMID:28555058

  11. Modeling Hybridization Kinetics of Gene Probes in a DNA Biochip Using FEMLAB.

    PubMed

    Munir, Ahsan; Waseem, Hassan; Williams, Maggie R; Stedtfeld, Robert D; Gulari, Erdogan; Tiedje, James M; Hashsham, Syed A

    2017-05-29

    Microfluidic DNA biochips capable of detecting specific DNA sequences are useful in medical diagnostics, drug discovery, food safety monitoring and agriculture. They are used as miniaturized platforms for analysis of nucleic acids-based biomarkers. Binding kinetics between immobilized single stranded DNA on the surface and its complementary strand present in the sample are of interest. To achieve optimal sensitivity with minimum sample size and rapid hybridization, ability to predict the kinetics of hybridization based on the thermodynamic characteristics of the probe is crucial. In this study, a computer aided numerical model for the design and optimization of a flow-through biochip was developed using a finite element technique packaged software tool (FEMLAB; package included in COMSOL Multiphysics) to simulate the transport of DNA through a microfluidic chamber to the reaction surface. The model accounts for fluid flow, convection and diffusion in the channel and on the reaction surface. Concentration, association rate constant, dissociation rate constant, recirculation flow rate, and temperature were key parameters affecting the rate of hybridization. The model predicted the kinetic profile and signal intensities of eighteen 20-mer probes targeting vancomycin resistance genes (VRGs). Predicted signal intensities and hybridization kinetics strongly correlated with experimental data in the biochip (R² = 0.8131).

  12. DNA sequence+shape kernel enables alignment-free modeling of transcription factor binding.

    PubMed

    Ma, Wenxiu; Yang, Lin; Rohs, Remo; Noble, William Stafford

    2017-10-01

    Transcription factors (TFs) bind to specific DNA sequence motifs. Several lines of evidence suggest that TF-DNA binding is mediated in part by properties of the local DNA shape: the width of the minor groove, the relative orientations of adjacent base pairs, etc. Several methods have been developed to jointly account for DNA sequence and shape properties in predicting TF binding affinity. However, a limitation of these methods is that they typically require a training set of aligned TF binding sites. We describe a sequence + shape kernel that leverages DNA sequence and shape information to better understand protein-DNA binding preference and affinity. This kernel extends an existing class of k-mer based sequence kernels, based on the recently described di-mismatch kernel. Using three in vitro benchmark datasets, derived from universal protein binding microarrays (uPBMs), genomic context PBMs (gcPBMs) and SELEX-seq data, we demonstrate that incorporating DNA shape information improves our ability to predict protein-DNA binding affinity. In particular, we observe that (i) the k-spectrum + shape model performs better than the classical k-spectrum kernel, particularly for small k values; (ii) the di-mismatch kernel performs better than the k-mer kernel, for larger k; and (iii) the di-mismatch + shape kernel performs better than the di-mismatch kernel for intermediate k values. The software is available at https://bitbucket.org/wenxiu/sequence-shape.git. rohs@usc.edu or william-noble@uw.edu. Supplementary data are available at Bioinformatics online. © The Author(s) 2017. Published by Oxford University Press.

  13. Computation of marginal distributions of peak-heights in electropherograms for analysing single source and mixture STR DNA samples.

    PubMed

    Cowell, Robert G

    2018-05-04

    Current models for single source and mixture samples, and probabilistic genotyping software based on them used for analysing STR electropherogram data, assume simple probability distributions, such as the gamma distribution, to model the allelic peak height variability given the initial amount of DNA prior to PCR amplification. Here we illustrate how amplicon number distributions, for a model of the process of sample DNA collection and PCR amplification, may be efficiently computed by evaluating probability generating functions using discrete Fourier transforms. Copyright © 2018 Elsevier B.V. All rights reserved.

  14. Chromatin conformation in living cells: support for a zig-zag model of the 30 nm chromatin fiber

    NASA Technical Reports Server (NTRS)

    Rydberg, B.; Holley, W. R.; Mian, I. S.; Chatterjee, A.

    1998-01-01

    A new method was used to probe the conformation of chromatin in living mammalian cells. The method employs ionizing radiation and is based on the concept that such radiation induces correlated breaks in DNA strands that are in spatial proximity. Human dermal fibroblasts in G0 phase of the cell cycle and Chinese hamster ovary cells in mitosis were irradiated by X-rays or accelerated ions. Following lysis of the cells, DNA fragments induced by correlated breaks were end-labeled and separated according to size on denaturing polyacrylamide gels. A characteristic peak was obtained for a fragment size of 78 bases, which is the size that corresponds to one turn of DNA around the nucleosome. Additional peaks between 175 and 450 bases reflect the relative position of nearest-neighbor nucleosomes. Theoretical calculations that simulate the indirect and direct effect of radiation on DNA demonstrate that the fragment size distributions are closely related to the chromatin structure model used. Comparison of the experimental data with theoretical results support a zig-zag model of the chromatin fiber rather than a simple helical model. Thus, radiation-induced damage analysis can provide information on chromatin structure in the living cell. Copyright 1998 Academic Press.

  15. Cooperative Assembly of Co-Smad4 MH1 with R-Smad1/3 MH1 on DNA: A Molecular Dynamics Simulation Study

    PubMed Central

    Wang, Guihong; Li, Chaoqun; Wang, Yan; Chen, Guangju

    2013-01-01

    Background Smads, the homologs of Sma and MAD proteins, play a key role in gene expression regulation in the transforming growth factor-β (TGF-β) signaling pathway. Recent experimental studies have revealed that Smad4/R-Smad heterodimers bound on DNA are energetically more favorable than homodimeric R-Smad/R-Smad complexes bound on DNA, which indicates that Smad4 might act as binding vehicle to cooperatively assemble with activated R-Smads on DNA in the nucleus. However, the details of interaction mechanism for cooperative recruitment of Smad4 protein to R-Smad proteins on DNA, and allosteric communication between the Smad4-DNA and R-Smad-DNA interfaces via DNA mediating are not yet clear so far. Methodology In the present work, we have constructed a series of Smadn+DNA+Smadn (n = 1, 3, 4) models and carried out molecular dynamics simulations, free energy calculations and DNA dynamics analysis for them to study the interaction properties of Smadn (n = 1, 3, 4) with DNA molecule. Results The results revealed that the binding of Smad4 protein to DNA molecule facilitates energetically the formation of the heteromeric Smad4+DNA+Smad1/3 complex by increasing the affinity of Smad1/3 with DNA molecule. Further investigations through the residue/base motion correlation and DNA dynamics analyses predicted that the binding of Smad4 protein to DNA molecule in the heteromeric Smad4+DNA+Smad1/3 model induces an allosteric communication from the Smad4-DNA interface to Smad1/Smad3-DNA interface via DNA base-pair helical motions, surface conformation changes and new hydrogen bond formations. The present work theoretically explains the mechanism of cooperative recruitment of Smad4 protein to Smad1/3 protein via DNA-mediated indirect readout mode in the nucleus. PMID:23326519

  16. Track structure based modelling of light ion radiation effects on nuclear and mitochondrial DNA

    NASA Astrophysics Data System (ADS)

    Schmitt, Elke; Ottolenghi, Andrea; Dingfelder, Michael; Friedland, Werner; Kundrat, Pavel; Baiocco, Giorgio

    2016-07-01

    Space radiation risk assessment is of great importance for manned spaceflights in order to estimate risks and to develop counter-measures to reduce them. Biophysical simulations with PARTRAC can help greatly to improve the understanding of initial biological response to ionizing radiation. Results from modelling radiation quality dependent DNA damage and repair mechanisms up to chromosomal aberrations (e.g. dicentrics) can be used to predict radiation effects depending on the kind of mixed radiation field exposure. Especially dicentric yields can serve as a biomarker for an increased risk due to radiation and hence as an indicator for the effectiveness of the used shielding. PARTRAC [1] is a multi-scale biophysical research MC code for track structure based initial DNA damage and damage response modelling. It integrates physics, radiochemistry, detailed nuclear DNA structure and molecular biology of DNA repair by NHEJ-pathway to assess radiation effects on cellular level [2]. Ongoing experiments with quasi-homogeneously distributed compared to sub-micrometre focused bunches of protons, lithium and carbon ions allow a separation of effects due to DNA damage complexity on nanometre scale from damage clustering on (sub-) micrometre scale [3, 4]. These data provide an unprecedented benchmark for the DNA damage response model in PARTRAC and help understand the mechanisms leading to cell killing and chromosomal aberrations (e.g. dicentrics) induction. A large part of space radiation is due to a mixed ion field of high energy protons and few heavier ions that can be only partly absorbed by the shielding. Radiation damage induced by low-energy ions significantly contributes to the high relative biological efficiency (RBE) of ion beams around Bragg peak regions. For slow light ions the physical cross section data basis in PARTRAC has been extended to investigate radiation quality effects in the Bragg peak region [5]. The resulting range and LET values agree with ICRU data and SRIM calculations. Preliminary studies regarding the biological endpoints DSB (cluster) and chromosomal aberrations have been performed for selected light ions up to neon. Validation with experimental data as well as further calculations are underway and final results will be presented at the meeting. Mitochondrial alterations have been implicated in radiation-induced cardiovascular effects. To extend the applicability of PARTRAC biophysical tool towards effects on mitochondria, the nuclear DNA and chromatin as the primary target of radiation has been complemented by a model of mitochondrial DNA (mtDNA) to mimic a coronary cell with thousand mitochondria contained in the cytoplasm. Induced mtDNA damage (SSB, DSB) has been scored for 60Co photons and 5 MeV alpha-particle irradiation, assuming alternative radical scavenging capacities within the mitochondria. While direct radiation effects in mtDNA are identical to nuclear DNA, indirect effects in mtDNA are in general larger due to lower scavenging and the lack of DNA-protecting histones. These simulations complement the scarce experimental data on radiation-induced mtDNA damage and help elucidate the relative roles of initial mtDNA versus nuclear DNA damage and of pathways that amplify their respective effects. Ongoing and planned developments of PARTRAC include coupling with a radiation transport code and track-structure based calculations of cell killing for RBE studies on macroscopic scales within a mixed ion field. [1] Friedland, Dingfelder et al. (2011): "Track structures, DNA targets and radiation effects in the biophysical Monte Carlo simulation code PARTRAC", Mutat. Res. 711, 28-40 [2] Friedland et al. (2013): "Track structure based modelling of chromosome aberrations after photon and alpha-particle irradiation", Mutat. Res. 756, 213-223 [3] Schmid, Friedland et al. (2015): "Sub-micrometer 20 MeV protons or 45 MeV lithium spot irradiation enhances yields of dicentric chromosomes due to clustering of DNA double-strand breaks", Mutat. Res. 793, 30-40 [4] Friedland, Schmitt, Kundrat (2015): "Modelling Proton bunches focussed to submicrometre scales: Low-LET Radiation damage in high-LET-like spatial structure", Radiat. Prot. Dosim. 166, 34-37 [5] Schmitt, Friedland, Kundrat, Dingfelder, Ottolenghi (2015): "Cross section scaling for track structure simulations of low-energy ions in liquid water", Radiat. Prot. Dosim. 166, 15-18} Supported by the European Atomic Energy Community's Seventh Framework Programme (FP7/2007-2011) under grant agreement no 249689 "DoReMi" and the German Federal Ministry on Education and Research (KVSF-Projekt "LET-Verbund").

  17. A ranking index for quality assessment of forensic DNA profiles forensic DNA profiles

    PubMed Central

    2010-01-01

    Background Assessment of DNA profile quality is vital in forensic DNA analysis, both in order to determine the evidentiary value of DNA results and to compare the performance of different DNA analysis protocols. Generally the quality assessment is performed through manual examination of the DNA profiles based on empirical knowledge, or by comparing the intensities (allelic peak heights) of the capillary electrophoresis electropherograms. Results We recently developed a ranking index for unbiased and quantitative quality assessment of forensic DNA profiles, the forensic DNA profile index (FI) (Hedman et al. Improved forensic DNA analysis through the use of alternative DNA polymerases and statistical modeling of DNA profiles, Biotechniques 47 (2009) 951-958). FI uses electropherogram data to combine the intensities of the allelic peaks with the balances within and between loci, using Principal Components Analysis. Here we present the construction of FI. We explain the mathematical and statistical methodologies used and present details about the applied data reduction method. Thereby we show how to adapt the ranking index for any Short Tandem Repeat-based forensic DNA typing system through validation against a manual grading scale and calibration against a specific set of DNA profiles. Conclusions The developed tool provides unbiased quality assessment of forensic DNA profiles. It can be applied for any DNA profiling system based on Short Tandem Repeat markers. Apart from crime related DNA analysis, FI can therefore be used as a quality tool in paternal or familial testing as well as in disaster victim identification. PMID:21062433

  18. Brownian dynamics simulations of sequence-dependent duplex denaturation in dynamically superhelical DNA

    NASA Astrophysics Data System (ADS)

    Mielke, Steven P.; Grønbech-Jensen, Niels; Krishnan, V. V.; Fink, William H.; Benham, Craig J.

    2005-09-01

    The topological state of DNA in vivo is dynamically regulated by a number of processes that involve interactions with bound proteins. In one such process, the tracking of RNA polymerase along the double helix during transcription, restriction of rotational motion of the polymerase and associated structures, generates waves of overtwist downstream and undertwist upstream from the site of transcription. The resulting superhelical stress is often sufficient to drive double-stranded DNA into a denatured state at locations such as promoters and origins of replication, where sequence-specific duplex opening is a prerequisite for biological function. In this way, transcription and other events that actively supercoil the DNA provide a mechanism for dynamically coupling genetic activity with regulatory and other cellular processes. Although computer modeling has provided insight into the equilibrium dynamics of DNA supercoiling, to date no model has appeared for simulating sequence-dependent DNA strand separation under the nonequilibrium conditions imposed by the dynamic introduction of torsional stress. Here, we introduce such a model and present results from an initial set of computer simulations in which the sequences of dynamically superhelical, 147 base pair DNA circles were systematically altered in order to probe the accuracy with which the model can predict location, extent, and time of stress-induced duplex denaturation. The results agree both with well-tested statistical mechanical calculations and with available experimental information. Additionally, we find that sites susceptible to denaturation show a propensity for localizing to supercoil apices, suggesting that base sequence determines locations of strand separation not only through the energetics of interstrand interactions, but also by influencing the geometry of supercoiling.

  19. Brownian dynamics simulations of sequence-dependent duplex denaturation in dynamically superhelical DNA.

    PubMed

    Mielke, Steven P; Grønbech-Jensen, Niels; Krishnan, V V; Fink, William H; Benham, Craig J

    2005-09-22

    The topological state of DNA in vivo is dynamically regulated by a number of processes that involve interactions with bound proteins. In one such process, the tracking of RNA polymerase along the double helix during transcription, restriction of rotational motion of the polymerase and associated structures, generates waves of overtwist downstream and undertwist upstream from the site of transcription. The resulting superhelical stress is often sufficient to drive double-stranded DNA into a denatured state at locations such as promoters and origins of replication, where sequence-specific duplex opening is a prerequisite for biological function. In this way, transcription and other events that actively supercoil the DNA provide a mechanism for dynamically coupling genetic activity with regulatory and other cellular processes. Although computer modeling has provided insight into the equilibrium dynamics of DNA supercoiling, to date no model has appeared for simulating sequence-dependent DNA strand separation under the nonequilibrium conditions imposed by the dynamic introduction of torsional stress. Here, we introduce such a model and present results from an initial set of computer simulations in which the sequences of dynamically superhelical, 147 base pair DNA circles were systematically altered in order to probe the accuracy with which the model can predict location, extent, and time of stress-induced duplex denaturation. The results agree both with well-tested statistical mechanical calculations and with available experimental information. Additionally, we find that sites susceptible to denaturation show a propensity for localizing to supercoil apices, suggesting that base sequence determines locations of strand separation not only through the energetics of interstrand interactions, but also by influencing the geometry of supercoiling.

  20. Multivariate Boosting for Integrative Analysis of High-Dimensional Cancer Genomic Data

    PubMed Central

    Xiong, Lie; Kuan, Pei-Fen; Tian, Jianan; Keles, Sunduz; Wang, Sijian

    2015-01-01

    In this paper, we propose a novel multivariate component-wise boosting method for fitting multivariate response regression models under the high-dimension, low sample size setting. Our method is motivated by modeling the association among different biological molecules based on multiple types of high-dimensional genomic data. Particularly, we are interested in two applications: studying the influence of DNA copy number alterations on RNA transcript levels and investigating the association between DNA methylation and gene expression. For this purpose, we model the dependence of the RNA expression levels on DNA copy number alterations and the dependence of gene expression on DNA methylation through multivariate regression models and utilize boosting-type method to handle the high dimensionality as well as model the possible nonlinear associations. The performance of the proposed method is demonstrated through simulation studies. Finally, our multivariate boosting method is applied to two breast cancer studies. PMID:26609213

  1. Ancient DNA analysis reveals woolly rhino evolutionary relationships.

    PubMed

    Orlando, Ludovic; Leonard, Jennifer A; Thenot, Aurélie; Laudet, Vincent; Guerin, Claude; Hänni, Catherine

    2003-09-01

    With ancient DNA technology, DNA sequences have been added to the list of characters available to infer the phyletic position of extinct species in evolutionary trees. We have sequenced the entire 12S rRNA and partial cytochrome b (cyt b) genes of one 60-70,000-year-old sample, and partial 12S rRNA and cyt b sequences of two 40-45,000-year-old samples of the extinct woolly rhinoceros (Coelodonta antiquitatis). Based on these two mitochondrial markers, phylogenetic analyses show that C. antiquitatis is most closely related to one of the three extant Asian rhinoceros species, Dicerorhinus sumatrensis. Calculations based on a molecular clock suggest that the lineage leading to C. antiquitatis and D. sumatrensis diverged in the Oligocene, 21-26 MYA. Both results agree with morphological models deduced from palaeontological data. Nuclear inserts of mitochondrial DNA were identified in the ancient specimens. These data should encourage the use of nuclear DNA in future ancient DNA studies. It also further establishes that the degraded nature of ancient DNA does not completely protect ancient DNA studies based on mitochondrial data from the problems associated with nuclear inserts.

  2. Ecological niche modelling and nDNA sequencing support a new, morphologically cryptic beetle species unveiled by DNA barcoding.

    PubMed

    Hawlitschek, Oliver; Porch, Nick; Hendrich, Lars; Balke, Michael

    2011-02-09

    DNA sequencing techniques used to estimate biodiversity, such as DNA barcoding, may reveal cryptic species. However, disagreements between barcoding and morphological data have already led to controversy. Species delimitation should therefore not be based on mtDNA alone. Here, we explore the use of nDNA and bioclimatic modelling in a new species of aquatic beetle revealed by mtDNA sequence data. The aquatic beetle fauna of Australia is characterised by high degrees of endemism, including local radiations such as the genus Antiporus. Antiporus femoralis was previously considered to exist in two disjunct, but morphologically indistinguishable populations in south-western and south-eastern Australia. We constructed a phylogeny of Antiporus and detected a deep split between these populations. Diagnostic characters from the highly variable nuclear protein encoding arginine kinase gene confirmed the presence of two isolated populations. We then used ecological niche modelling to examine the climatic niche characteristics of the two populations. All results support the status of the two populations as distinct species. We describe the south-western species as Antiporus occidentalis sp.n. In addition to nDNA sequence data and extended use of mitochondrial sequences, ecological niche modelling has great potential for delineating morphologically cryptic species.

  3. Ecological Niche Modelling and nDNA Sequencing Support a New, Morphologically Cryptic Beetle Species Unveiled by DNA Barcoding

    PubMed Central

    Hawlitschek, Oliver; Porch, Nick; Hendrich, Lars; Balke, Michael

    2011-01-01

    Background DNA sequencing techniques used to estimate biodiversity, such as DNA barcoding, may reveal cryptic species. However, disagreements between barcoding and morphological data have already led to controversy. Species delimitation should therefore not be based on mtDNA alone. Here, we explore the use of nDNA and bioclimatic modelling in a new species of aquatic beetle revealed by mtDNA sequence data. Methodology/Principal Findings The aquatic beetle fauna of Australia is characterised by high degrees of endemism, including local radiations such as the genus Antiporus. Antiporus femoralis was previously considered to exist in two disjunct, but morphologically indistinguishable populations in south-western and south-eastern Australia. We constructed a phylogeny of Antiporus and detected a deep split between these populations. Diagnostic characters from the highly variable nuclear protein encoding arginine kinase gene confirmed the presence of two isolated populations. We then used ecological niche modelling to examine the climatic niche characteristics of the two populations. All results support the status of the two populations as distinct species. We describe the south-western species as Antiporus occidentalis sp.n. Conclusion/Significance In addition to nDNA sequence data and extended use of mitochondrial sequences, ecological niche modelling has great potential for delineating morphologically cryptic species. PMID:21347370

  4. Modeling the relaxation of internal DNA segments during genome mapping in nanochannels.

    PubMed

    Jain, Aashish; Sheats, Julian; Reifenberger, Jeffrey G; Cao, Han; Dorfman, Kevin D

    2016-09-01

    We have developed a multi-scale model describing the dynamics of internal segments of DNA in nanochannels used for genome mapping. In addition to the channel geometry, the model takes as its inputs the DNA properties in free solution (persistence length, effective width, molecular weight, and segmental hydrodynamic radius) and buffer properties (temperature and viscosity). Using pruned-enriched Rosenbluth simulations of a discrete wormlike chain model with circa 10 base pair resolution and a numerical solution for the hydrodynamic interactions in confinement, we convert these experimentally available inputs into the necessary parameters for a one-dimensional, Rouse-like model of the confined chain. The resulting coarse-grained model resolves the DNA at a length scale of approximately 6 kilobase pairs in the absence of any global hairpin folds, and is readily studied using a normal-mode analysis or Brownian dynamics simulations. The Rouse-like model successfully reproduces both the trends and order of magnitude of the relaxation time of the distance between labeled segments of DNA obtained in experiments. The model also provides insights that are not readily accessible from experiments, such as the role of the molecular weight of the DNA and location of the labeled segments that impact the statistical models used to construct genome maps from data acquired in nanochannels. The multi-scale approach used here, while focused towards a technologically relevant scenario, is readily adapted to other channel sizes and polymers.

  5. Analytical Debye-Huckel model for electrostatic potentials around dissolved DNA.

    PubMed

    Wagner, K; Keyes, E; Kephart, T W; Edwards, G

    1997-07-01

    We present an analytical, Green-function-based model for the electric potential of DNA in solution, treating the surrounding solvent with the Debye-Huckel approximation. The partial charge of each atom is accounted for by modeling DNA as linear distributions of atoms on concentric cylindrical surfaces. The condensed ions of the solvent are treated with the Debye-Huckel approximation. The resultant leading term of the potential is that of a continuous shielded line charge, and the higher order terms account for the helical structure. Within several angstroms of the surface there is sufficient information in the electric potential to distinguish features and symmetries of DNA. Plots of the potential and equipotential surfaces, dominated by the phosphate charges, reflect the structural differences between the A, B, and Z conformations and, to a smaller extent, the difference between base sequences. As the distances from the helices increase, the magnitudes of the potentials decrease. However, the bases and sugars account for a larger fraction of the double helix potential with increasing distance. We have found that when the solvent is treated with the Debye-Huckel approximation, the potential decays more rapidly in every direction from the surface than it did in the concentric dielectric cylinder approximation.

  6. Real-time reliable determination of binding kinetics of DNA hybridization using a multi-channel graphene biosensor

    NASA Astrophysics Data System (ADS)

    Xu, Shicai; Zhan, Jian; Man, Baoyuan; Jiang, Shouzhen; Yue, Weiwei; Gao, Shoubao; Guo, Chengang; Liu, Hanping; Li, Zhenhua; Wang, Jihua; Zhou, Yaoqi

    2017-03-01

    Reliable determination of binding kinetics and affinity of DNA hybridization and single-base mismatches plays an essential role in systems biology, personalized and precision medicine. The standard tools are optical-based sensors that are difficult to operate in low cost and to miniaturize for high-throughput measurement. Biosensors based on nanowire field-effect transistors have been developed, but reliable and cost-effective fabrication remains a challenge. Here, we demonstrate that a graphene single-crystal domain patterned into multiple channels can measure time- and concentration-dependent DNA hybridization kinetics and affinity reliably and sensitively, with a detection limit of 10 pM for DNA. It can distinguish single-base mutations quantitatively in real time. An analytical model is developed to estimate probe density, efficiency of hybridization and the maximum sensor response. The results suggest a promising future for cost-effective, high-throughput screening of drug candidates, genetic variations and disease biomarkers by using an integrated, miniaturized, all-electrical multiplexed, graphene-based DNA array.

  7. Langevin Equation for DNA Dynamics

    NASA Astrophysics Data System (ADS)

    Grych, David; Copperman, Jeremy; Guenza, Marina

    Under physiological conditions, DNA oligomers can contain well-ordered helical regions and also flexible single-stranded regions. We describe the site-specific motion of DNA with a modified Rouse-Zimm Langevin equation formalism that describes DNA as a coarse-grained polymeric chain with global structure and local flexibility. The approach has successfully described the protein dynamics in solution and has been extended to nucleic acids. Our approach provides diffusive mode analytical solutions for the dynamics of global rotational diffusion and internal motion. The internal DNA dynamics present a rich energy landscape that accounts for an interior where hydrogen bonds and base-stacking determine structure and experience limited solvent exposure. We have implemented several models incorporating different coarse-grained sites with anisotropic rotation, energy barrier crossing, and local friction coefficients that include a unique internal viscosity and our models reproduce dynamics predicted by atomistic simulations. The models reproduce bond autocorrelation along the sequence as compared to that directly calculated from atomistic molecular dynamics simulations. The Langevin equation approach captures the essence of DNA dynamics without a cumbersome atomistic representation.

  8. Significance of DNA bond strength in programmable nanoparticle thermodynamics and dynamics.

    PubMed

    Yu, Qiuyan; Hu, Jinglei; Hu, Yi; Wang, Rong

    2018-04-04

    Assembly of nanoparticles (NPs) coated with complementary DNA strands leads to novel crystals with nanosized basic units rather than classic atoms, ions or molecules. The assembly process is mediated by hybridization of DNA via specific base pairing interaction, and is kinetically linked to the disassociation of DNA duplexes. DNA-level physiochemical quantities, both thermodynamic and kinetic, are key to understanding this process and essential for the design of DNA-NP crystals. The melting transition properties are helpful to judge the thermostability and sensitivity of relative DNA probes or other applications. Three different cases are investigated by changing the linker length and the spacer length on which the melting properties depend using the molecular dynamics method. Melting temperature is determined by sigmoidal melting curves based on hybridization percentage versus temperature and the Lindemann melting rule simultaneously. We provide a computational strategy based on a coarse-grained model to estimate the hybridization enthalpy, entropy and free energy from percentages of hybridizations which are readily accessible in experiments. Importantly, the lifetime of DNA bond dehybridization based on temperature and the activation energy depending on DNA bond strength are also calculated. The simulation results are in good agreement with the theoretical analysis and the present experimental data. Our study provides a good strategy to predict the melting temperature which is important for the DNA-directed nanoparticle system, and bridges the dynamics and thermodynamics of DNA-directed nanoparticle systems by estimating the equilibrium constant from the hybridization of DNA bonds quantitatively.

  9. Petri-net-based 2D design of DNA walker circuits.

    PubMed

    Gilbert, David; Heiner, Monika; Rohr, Christian

    2018-01-01

    We consider localised DNA computation, where a DNA strand walks along a binary decision graph to compute a binary function. One of the challenges for the design of reliable walker circuits consists in leakage transitions, which occur when a walker jumps into another branch of the decision graph. We automatically identify leakage transitions, which allows for a detailed qualitative and quantitative assessment of circuit designs, design comparison, and design optimisation. The ability to identify leakage transitions is an important step in the process of optimising DNA circuit layouts where the aim is to minimise the computational error inherent in a circuit while minimising the area of the circuit. Our 2D modelling approach of DNA walker circuits relies on coloured stochastic Petri nets which enable functionality, topology and dimensionality all to be integrated in one two-dimensional model. Our modelling and analysis approach can be easily extended to 3-dimensional walker systems.

  10. Coarse-grained molecular dynamics simulations for giant protein-DNA complexes

    NASA Astrophysics Data System (ADS)

    Takada, Shoji

    Biomolecules are highly hierarchic and intrinsically flexible. Thus, computational modeling calls for multi-scale methodologies. We have been developing a coarse-grained biomolecular model where on-average 10-20 atoms are grouped into one coarse-grained (CG) particle. Interactions among CG particles are tuned based on atomistic interactions and the fluctuation matching algorithm. CG molecular dynamics methods enable us to simulate much longer time scale motions of much larger molecular systems than fully atomistic models. After broad sampling of structures with CG models, we can easily reconstruct atomistic models, from which one can continue conventional molecular dynamics simulations if desired. Here, we describe our CG modeling methodology for protein-DNA complexes, together with various biological applications, such as the DNA duplication initiation complex, model chromatins, and transcription factor dynamics on chromatin-like environment.

  11. Influence of amine and thiol modifications at the 3' ends of single stranded DNA molecules on their adsorption on gold surface and the efficiency of their hybridization.

    PubMed

    Jaworska, Aleksandra; Jablonska, Anna; Wilanowski, Tomasz; Palys, Barbara; Sek, Slawomir; Kudelski, Andrzej

    2018-05-24

    Adsorption of molecules of DNA (deoxyribonucleic acid) or modified DNA on gold surfaces is often the first step in construction of many various biosensors, including biosensors for detection of DNA with a particular sequence. In this work we study the influence of amine and thiol modifications at the 3' ends of single stranded DNA (ssDNA) molecules on their adsorption on the surface of gold substrates and on the efficiency of hybridization of immobilized DNA with the complementary single stranded DNA. The characterization of formed layers has been carried out using infrared spectroscopy and atomic force microscopy. As model single stranded DNA we used DNA containing 20 adenine bases, whereas the complementary DNA contained 20 thymine bases. We found that the bands in polarization modulation-infrared reflection-adsorption spectroscopy (PM-IRRAS) spectra of layers formed from thiol-modified DNA are significantly narrower and sharper, indicating their higher regularity in the orientation of DNA on gold surface when using thiol linker. Also, hybridization of the layer of thiol-modified DNA containing 20 adenine bases with the respective DNA containing thymine bases leads to formation of much more organized structures than in the case of unmodified DNA or DNA with the amine linker. We conclude that the thiol-modified ssDNA is more promising for the preparation of biosensors, in comparison with the amine-modified or unmodified ssDNA. We have also found that the above-mentioned modifications at the 3' end of ssDNA significantly influence the IR spectrum (and hence the structure) of polycrystalline films formed from such compounds, even though adsorbed fragments contain less than 5% of the DNA chain. This effect should be taken into account when comparing IR spectra of various polycrystalline films formed from modified and unmodified DNA. Copyright © 2018. Published by Elsevier B.V.

  12. Use of wavelet-packet transforms to develop an engineering model for multifractal characterization of mutation dynamics in pathological and nonpathological gene sequences

    NASA Astrophysics Data System (ADS)

    Walker, David Lee

    1999-12-01

    This study uses dynamical analysis to examine in a quantitative fashion the information coding mechanism in DNA sequences. This exceeds the simple dichotomy of either modeling the mechanism by comparing DNA sequence walks as Fractal Brownian Motion (fbm) processes. The 2-D mappings of the DNA sequences for this research are from Iterated Function System (IFS) (Also known as the ``Chaos Game Representation'' (CGR)) mappings of the DNA sequences. This technique converts a 1-D sequence into a 2-D representation that preserves subsequence structure and provides a visual representation. The second step of this analysis involves the application of Wavelet Packet Transforms, a recently developed technique from the field of signal processing. A multi-fractal model is built by using wavelet transforms to estimate the Hurst exponent, H. The Hurst exponent is a non-parametric measurement of the dynamism of a system. This procedure is used to evaluate gene- coding events in the DNA sequence of cystic fibrosis mutations. The H exponent is calculated for various mutation sites in this gene. The results of this study indicate the presence of anti-persistent, random walks and persistent ``sub-periods'' in the sequence. This indicates the hypothesis of a multi-fractal model of DNA information encoding warrants further consideration. This work examines the model's behavior in both pathological (mutations) and non-pathological (healthy) base pair sequences of the cystic fibrosis gene. These mutations both natural and synthetic were introduced by computer manipulation of the original base pair text files. The results show that disease severity and system ``information dynamics'' correlate. These results have implications for genetic engineering as well as in mathematical biology. They suggest that there is scope for more multi-fractal models to be developed.

  13. Melting of genomic DNA: Predictive modeling by nonlinear lattice dynamics

    NASA Astrophysics Data System (ADS)

    Theodorakopoulos, Nikos

    2010-08-01

    The melting behavior of long, heterogeneous DNA chains is examined within the framework of the nonlinear lattice dynamics based Peyrard-Bishop-Dauxois (PBD) model. Data for the pBR322 plasmid and the complete T7 phage have been used to obtain model fits and determine parameter dependence on salt content. Melting curves predicted for the complete fd phage and the Y1 and Y2 fragments of the ϕX174 phage without any adjustable parameters are in good agreement with experiment. The calculated probabilities for single base-pair opening are consistent with values obtained from imino proton exchange experiments.

  14. WE-H-BRA-08: A Monte Carlo Cell Nucleus Model for Assessing Cell Survival Probability Based On Particle Track Structure Analysis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lee, B; Georgia Institute of Technology, Atlanta, GA; Wang, C

    Purpose: To correlate the damage produced by particles of different types and qualities to cell survival on the basis of nanodosimetric analysis and advanced DNA structures in the cell nucleus. Methods: A Monte Carlo code was developed to simulate subnuclear DNA chromatin fibers (CFs) of 30nm utilizing a mean-free-path approach common to radiation transport. The cell nucleus was modeled as a spherical region containing 6000 chromatin-dense domains (CDs) of 400nm diameter, with additional CFs modeled in a sparser interchromatin region. The Geant4-DNA code was utilized to produce a particle track database representing various particles at different energies and dose quantities.more » These tracks were used to stochastically position the DNA structures based on their mean free path to interaction with CFs. Excitation and ionization events intersecting CFs were analyzed using the DBSCAN clustering algorithm for assessment of the likelihood of producing DSBs. Simulated DSBs were then assessed based on their proximity to one another for a probability of inducing cell death. Results: Variations in energy deposition to chromatin fibers match expectations based on differences in particle track structure. The quality of damage to CFs based on different particle types indicate more severe damage by high-LET radiation than low-LET radiation of identical particles. In addition, the model indicates more severe damage by protons than of alpha particles of same LET, which is consistent with differences in their track structure. Cell survival curves have been produced showing the L-Q behavior of sparsely ionizing radiation. Conclusion: Initial results indicate the feasibility of producing cell survival curves based on the Monte Carlo cell nucleus method. Accurate correlation between simulated DNA damage to cell survival on the basis of nanodosimetric analysis can provide insight into the biological responses to various radiation types. Current efforts are directed at producing cell survival curves for high-LET radiation.« less

  15. Electrochemical detection of DNA hybridization based on signal DNA probe modified with Au and apoferritin nanoparticles.

    PubMed

    Yu, Fengli; Li, Gang; Qu, Bin; Cao, Wei

    2010-11-15

    A novel and ultrasensitive electrochemical approach for sequence-specific DNA detection based on signal dual-amplification with Au NPs and marker-loaded apoferritin NPs was reported. Target DNA was sandwiched between capture DNA coupled to magnetic beads and signal DNA self-assembled on Au NPs which were incorporated with marker-loaded apoferritin NPs. Subsequent electrochemical stripping analysis of the electroactive markers released from apoferritin NPs in acidic buffers provided a means to quantify the concentration of target DNA. In this means, one target signal could be transformed into multiple redox signals of the markers since a single Au NP could be loaded with dozens of apoferritin NPs, and an apoferritin NP could be loaded with thousands of markers. Under the optimum conditions, the linear range was from 2.0 × 10(-16) to 1.0 × 10(-14)M and the detection limit was 5.1 × 10(-17)M by using the cadmium as a model marker. The proposed DNA biosensor not only exhibited excellent sensitivity but also had good reproducibility and selectivity against two-base mismatched DNA. Copyright © 2010 Elsevier B.V. All rights reserved.

  16. DNA base-calling from a nanopore using a Viterbi algorithm.

    PubMed

    Timp, Winston; Comer, Jeffrey; Aksimentiev, Aleksei

    2012-05-16

    Nanopore-based DNA sequencing is the most promising third-generation sequencing method. It has superior read length, speed, and sample requirements compared with state-of-the-art second-generation methods. However, base-calling still presents substantial difficulty because the resolution of the technique is limited compared with the measured signal/noise ratio. Here we demonstrate a method to decode 3-bp-resolution nanopore electrical measurements into a DNA sequence using a Hidden Markov model. This method shows tremendous potential for accuracy (~98%), even with a poor signal/noise ratio. Copyright © 2012 Biophysical Society. Published by Elsevier Inc. All rights reserved.

  17. From in vitro to in vivo: Integration of the virtual cell based assay with physiologically based kinetic modelling.

    PubMed

    Paini, Alicia; Sala Benito, Jose Vicente; Bessems, Jos; Worth, Andrew P

    2017-12-01

    Physiologically based kinetic (PBK) models and the virtual cell based assay can be linked to form so called physiologically based dynamic (PBD) models. This study illustrates the development and application of a PBK model for prediction of estragole-induced DNA adduct formation and hepatotoxicity in humans. To address the hepatotoxicity, HepaRG cells were used as a surrogate for liver cells, with cell viability being used as the in vitro toxicological endpoint. Information on DNA adduct formation was taken from the literature. Since estragole induced cell damage is not directly caused by the parent compound, but by a reactive metabolite, information on the metabolic pathway was incorporated into the model. In addition, a user-friendly tool was developed by implementing the PBK/D model into a KNIME workflow. This workflow can be used to perform in vitro to in vivo extrapolation and forward as backward dosimetry in support of chemical risk assessment. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.

  18. Electronic transport in methylated fragments of DNA

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Almeida, M. L. de; Oliveira, J. I. N.; Lima Neto, J. X.

    2015-11-16

    We investigate the electronic transport properties of methylated deoxyribonucleic-acid (DNA) strands, a biological system in which methyl groups are added to DNA (a major epigenetic modification in gene expression), sandwiched between two metallic platinum electrodes. Our theoretical simulations apply an effective Hamiltonian based on a tight-binding model to obtain current-voltage curves related to the non-methylated/methylated DNA strands. The results suggest potential applications in the development of novel biosensors for molecular diagnostics.

  19. Electronic transport in methylated fragments of DNA

    NASA Astrophysics Data System (ADS)

    de Almeida, M. L.; Oliveira, J. I. N.; Lima Neto, J. X.; Gomes, C. E. M.; Fulco, U. L.; Albuquerque, E. L.; Freire, V. N.; Caetano, E. W. S.; de Moura, F. A. B. F.; Lyra, M. L.

    2015-11-01

    We investigate the electronic transport properties of methylated deoxyribonucleic-acid (DNA) strands, a biological system in which methyl groups are added to DNA (a major epigenetic modification in gene expression), sandwiched between two metallic platinum electrodes. Our theoretical simulations apply an effective Hamiltonian based on a tight-binding model to obtain current-voltage curves related to the non-methylated/methylated DNA strands. The results suggest potential applications in the development of novel biosensors for molecular diagnostics.

  20. Multi-pedal DNA walker biosensors based on catalyzed hairpin assembly and isothermal strand-displacement polymerase reaction for the chemiluminescent detection of proteins.

    PubMed

    Li, Ningxing; Du, Mingyuan; Liu, Yucheng; Ji, Xinghu; He, Zhike

    2018-06-25

    Two kinds of sensitive biosensors based on multi-pedal DNA walker along a 3-D DNA functional magnet particles track for the chemiluminescent detection of streptavidin are constructed and compared in this study. In the presence of SA, multi-pedal DNA walker has been constructed by biotin-modified catalyst as a result of the terminal protection for avoiding the digestion by exonuclease I. Then a toehold of CHA-H1 conjugated with magnetic microparticles (MMPs) could interact with a 'leg' of multi-pedal DNA walker to open the hairpin via toehold-mediated strand exchange catalysis. A newly exposed DNA segment in CHA-H1 would be hybridized with a toehold of biotin-labeled H2. Via the strand displacement process, H2 displaces one 'leg' of multi-pedal DNA walker, and the other 'leg' could still hybridize with neighboring H1 to initiate the next cycle. In order to solve the high background caused by the hybridization between CHA-H1 and H2 without CHA-catalyst, the other model has been designed. The principle of the other model (ISDPR DNA walker) is similar to the above one. After the terminal protection of SA, a 'leg' of multi-pedal DNA walker triggers the opening of the hairpin of ISDPR-H1 conjugated with MMPs. Then the biotin-modified primer could hybridize with the open stem, triggering the polymerization reaction in the presence of dNTPs/polymerase. As the extension of the primer, the 'leg' of multi-pedal DNA walker is displaced so that the other 'leg' could trigger proximal H1 to go on the next cycle. Due to its lower background and stronger signal, multi-pedal DNA walker based on ISDPR has a lower limit of detection for SA. The limit of detection (LOD) for SA is 6.5 pM. What's more, these DNA walker methods have been applied in complex samples successfully.

  1. The Role of Repulsion in Colloidal Crystal Engineering with DNA

    DOE PAGES

    Seo, Soyoung E.; Li, Tao; Senesi, Andrew J.; ...

    2017-10-24

    Hybridization interactions between DNA-functionalized nanoparticles (DNA-NPs) can be used to program the crystallization behavior of superlattices, yielding access to complex three-dimensional structures with more than 30 different lattice symmetries. The first superlattice structures using DNA-NPs as building blocks were identified almost a decade ago, yet the role of repulsive interactions in guiding structure formation is still largely unexplored. In this paper, a comprehensive approach is taken to study the role of repulsion in the assembly behavior of DNA-NPs, enabling the calculation of interparticle interaction potentials based on experimental results. In this work, we used two different means to assemble DNA-NPs—Watson–Crickmore » base-pairing interactions and depletion interactions—and systematically varied the salt concentration to study the effective interactions in DNA-NP superlattices. A comparison between the two systems allows us to decouple the repulsive forces from the attractive hybridization interactions that are sensitive to the ionic environment. We find that the gap distance between adjacent DNA-NPs follows a simple power law dependence on solution ionic strength regardless of the type of attractive forces present. This result suggests that the observed trend is driven by repulsive interactions. To better understand such behavior, we propose a mean-field model that provides a mathematical description for the observed trend. Finally, this model shows that the trend is due to the variation in the effective cross-sectional diameter of DNA duplex and the thickness of DNA shell.« less

  2. The Role of Repulsion in Colloidal Crystal Engineering with DNA

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Seo, Soyoung E.; Li, Tao; Senesi, Andrew J.

    Hybridization interactions between DNA-functionalized nanoparticles (DNA-NPs) can be used to program the crystallization behavior of superlattices, yielding access to complex three-dimensional structures with more than 30 different lattice symmetries. The first superlattice structures using DNA-NPs as building blocks were identified almost a decade ago, yet the role of repulsive interactions in guiding structure formation is still largely unexplored. In this paper, a comprehensive approach is taken to study the role of repulsion in the assembly behavior of DNA-NPs, enabling the calculation of interparticle interaction potentials based on experimental results. In this work, we used two different means to assemble DNA-NPs—Watson–Crickmore » base-pairing interactions and depletion interactions—and systematically varied the salt concentration to study the effective interactions in DNA-NP superlattices. A comparison between the two systems allows us to decouple the repulsive forces from the attractive hybridization interactions that are sensitive to the ionic environment. We find that the gap distance between adjacent DNA-NPs follows a simple power law dependence on solution ionic strength regardless of the type of attractive forces present. This result suggests that the observed trend is driven by repulsive interactions. To better understand such behavior, we propose a mean-field model that provides a mathematical description for the observed trend. Finally, this model shows that the trend is due to the variation in the effective cross-sectional diameter of DNA duplex and the thickness of DNA shell.« less

  3. The Role of Repulsion in Colloidal Crystal Engineering with DNA

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Seo, Soyoung E.; Li, Tao; Senesi, Andrew J.

    Hybridization interactions between DNA-functionalized nanoparticles (DNA-NPs) can be used to program the crystallization behavior of superlattices, yielding access to complex three-dimensional structures with more than 30 different lattice symmetries. The first superlattice structures using DNA-NPs as building blocks were identified almost two decades ago, yet the role of repulsive interactions in guiding structure formation is still largely unexplored. Here, a com-prehensive approach is taken to study the role of repulsion in the assembly behavior of DNA-NPs, enabling the calculation of interparticle interaction potentials based on experimental results. In this work, we used two different means to assemble DNA-NPs—Watson-Crick base pairingmore » interactions and depletion interactions—and systematically varied the salt concen-tration to study the effective interactions in DNA-NP superlattices. A comparison between the two systems allows us to decouple the repulsive forces from the attractive hybridization interactions that are sensitive to the ionic environment. We find that the gap distance between adjacent DNA-NPs follows a simple power law dependence on solution ionic strength regardless of the type of attractive forces present. This result suggests that the observed trend is driven by repulsive inter-actions. To better understand such behavior, we propose a mean-field model that provides a mathematical description for the observed trend. This model shows that the trend is due to the variation in the effective cross-sectional diameter of DNA duplex and the thickness of DNA shell.« less

  4. Retroviral DNA Integration Directed by HIV Integration Protein in Vitro

    NASA Astrophysics Data System (ADS)

    Bushman, Frederic D.; Fujiwara, Tamio; Craigie, Robert

    1990-09-01

    Efficient retroviral growth requires integration of a DNA copy of the viral RNA genome into a chromosome of the host. As a first step in analyzing the mechanism of integration of human immunodeficiency virus (HIV) DNA, a cell-free system was established that models the integration reaction. The in vitro system depends on the HIV integration (IN) protein, which was partially purified from insect cells engineered to express IN protein in large quantities. Integration was detected in a biological assay that scores the insertion of a linear DNA containing HIV terminal sequences into a λ DNA target. Some integration products generated in this assay contained five-base pair duplications of the target DNA at the recombination junctions, a characteristic of HIV integration in vivo; the remaining products contained aberrant junctional sequences that may have been produced in a variation of the normal reaction. These results indicate that HIV IN protein is the only viral protein required to insert model HIV DNA sequences into a target DNA in vitro.

  5. All-atom molecular dynamics simulations of spin labelled double and single-strand DNA for EPR studies.

    PubMed

    Prior, C; Danilāne, L; Oganesyan, V S

    2018-05-16

    We report the first application of fully atomistic molecular dynamics (MD) simulations to the prediction of electron paramagnetic resonance (EPR) spectra of spin labelled DNA. Models for two structurally different DNA spin probes with either the rigid or flexible position of the nitroxide group in the base pair, employed in experimental studies previously, have been developed. By the application of the combined MD-EPR simulation methodology we aimed at the following. Firstly, to provide a test bed against a sensitive spectroscopic technique for the recently developed improved version of the parmbsc1 force field for MD modelling of DNA. The predicted EPR spectra show good agreement with the experimental ones available from the literature, thus confirming the accuracy of the currently employed DNA force fields. Secondly, to provide a quantitative interpretation of the motional contributions into the dynamics of spin probes in both duplex and single-strand DNA fragments and to analyse their perturbing effects on the local DNA structure. Finally, a combination of MD and EPR allowed us to test the validity of the application of the Model-Free (M-F) approach coupled with the partial averaging of magnetic tensors to the simulation of EPR spectra of DNA systems by comparing the resultant EPR spectra with those simulated directly from MD trajectories. The advantage of the M-F based EPR simulation approach over the direct propagation techniques is that it requires motional and order parameters that can be calculated from shorter MD trajectories. The reported MD-EPR methodology is transferable to the prediction and interpretation of EPR spectra of higher order DNA structures with novel types of spin labels.

  6. Applications of statistical physics and information theory to the analysis of DNA sequences

    NASA Astrophysics Data System (ADS)

    Grosse, Ivo

    2000-10-01

    DNA carries the genetic information of most living organisms, and the of genome projects is to uncover that genetic information. One basic task in the analysis of DNA sequences is the recognition of protein coding genes. Powerful computer programs for gene recognition have been developed, but most of them are based on statistical patterns that vary from species to species. In this thesis I address the question if there exist universal statistical patterns that are different in coding and noncoding DNA of all living species, regardless of their phylogenetic origin. In search for such species-independent patterns I study the mutual information function of genomic DNA sequences, and find that it shows persistent period-three oscillations. To understand the biological origin of the observed period-three oscillations, I compare the mutual information function of genomic DNA sequences to the mutual information function of stochastic model sequences. I find that the pseudo-exon model is able to reproduce the mutual information function of genomic DNA sequences. Moreover, I find that a generalization of the pseudo-exon model can connect the existence and the functional form of long-range correlations to the presence and the length distributions of coding and noncoding regions. Based on these theoretical studies I am able to find an information-theoretical quantity, the average mutual information (AMI), whose probability distributions are significantly different in coding and noncoding DNA, while they are almost identical in all studied species. These findings show that there exist universal statistical patterns that are different in coding and noncoding DNA of all studied species, and they suggest that the AMI may be used to identify genes in different living species, irrespective of their taxonomic origin.

  7. Stochastic properties of radiation-induced DSB: DSB distributions in large scale chromatin loops, the HPRT gene and within the visible volumes of DNA repair foci.

    PubMed

    Ponomarev, Artem L; Costes, Sylvain V; Cucinotta, Francis A

    2008-11-01

    We computed probabilities to have multiple double-strand breaks (DSB), which are produced in DNA on a regional scale, and not in close vicinity, in volumes matching the size of DNA damage foci, of a large chromatin loop, and in the physical volume of DNA containing the HPRT (human hypoxanthine phosphoribosyltransferase) locus. The model is based on a Monte Carlo description of DSB formation by heavy ions in the spatial context of the entire human genome contained within the cell nucleus, as well as at the gene sequence level. We showed that a finite physical volume corresponding to a visible DNA repair focus, believed to be associated with one DSB, can contain multiple DSB due to heavy ion track structure and the DNA supercoiled topography. A corrective distribution was introduced, which was a conditional probability to have excess DSB in a focus volume, given that there was already one present. The corrective distribution was calculated for 19.5 MeV/amu N ions, 3.77 MeV/amu alpha-particles, 1000 MeV/amu Fe ions, and X-rays. The corrected initial DSB yield from the experimental data on DNA repair foci was calculated. The DSB yield based on the corrective function converts the focus yield into the DSB yield, which is comparable with the DSB yield based on the earlier PFGE experiments. The distribution of DSB within the physical limits of the HPRT gene was analyzed by a similar method as well. This corrective procedure shows the applicability of the model and empowers the researcher with a tool to better analyze focus statistics. The model enables researchers to analyze the DSB yield based on focus statistics in real experimental situations that lack one-to-one focus-to-DSB correspondance.

  8. [Forced Oscillations of DNA Bases].

    PubMed

    Yakushevich, L V; Krasnobaeva, L A

    2016-01-01

    This paper presents the results of the studying of forced angular oscillations of the DNA bases with the help of the mathematical model consisting of two coupled nonlinear differential equations that take into account the effects of dissipation and the influence of an external periodic field. The calculation results are illustrated for sequence of gene encoding interferon alpha 17 (IFNA 17).

  9. DNA gel electrophoresis: the reptation model(s).

    PubMed

    Slater, Gary W

    2009-06-01

    DNA gel electrophoresis has been the most important experimental tool to separate DNA fragments for several decades. The introduction of PFGE in the 1980s and capillary gel electrophoresis in the 1990s made it possible to study, map and sequence entire genomes. Explaining how very large DNA molecules move in a gel and why PFGE is needed to separate them has been an active field of research ever since the launch of the journal Electrophoresis. This article presents a personal and historical overview of the development of the theory of gel electrophoresis, focusing on the reptation model, the band broadening mechanisms, and finally the factors that limit the read length and the resolution of electrophoresis-based sequencing systems. I conclude with a short discussion of some of the questions that remain unanswered.

  10. The energetics of tightly bent DNA: a composite elastica model including local melting

    NASA Astrophysics Data System (ADS)

    Evans, Arthur; Levine, Alex

    2012-02-01

    Melting transitions are well-known to be affected by the application of mechanical stress. Motivated by the experiments of Zocchi and collaborators (Qu and Zocchi 2011, EPL 94 18003), we explore the effect of the application of mechanical stress on DNA melting in a particular composite of a stiff double stranded piece of DNA (dsDNA), shorter than its own persistence length, whose ends are linked by a flexible single stranded piece of DNA (ssDNA). The flexible ssDNA acts as a Gaussian polymer coil bending the stiff dsDNA through an elastic force that is controllable by the length of the ssDNA chain. In this talk we present theoretical predictions for two experimentally accessible features: the degree of local dsDNA melting and the local elastic energy of the dsDNA/ssDNA construct both as a function of the length of the attached ssDNA. We also address the effect of introducing a nick (broken covalent bond) in the dsDNA backbone on these results and discuss the implications of such data on the relative importance of backbone elasticity versus base stacking and base pairing interactions in determining the elasticity of dsDNA. This work also addresses open questions in the nonlinear elasticity of DNA in tightly bent curves.

  11. Investigating the epigenetic effects of a prototype smoke-derived carcinogen in human cells.

    PubMed

    Tommasi, Stella; Kim, Sang-in; Zhong, Xueyan; Wu, Xiwei; Pfeifer, Gerd P; Besaratinia, Ahmad

    2010-05-12

    Global loss of DNA methylation and locus/gene-specific gain of DNA methylation are two distinct hallmarks of carcinogenesis. Aberrant DNA methylation is implicated in smoking-related lung cancer. In this study, we have comprehensively investigated the modulation of DNA methylation consequent to chronic exposure to a prototype smoke-derived carcinogen, benzo[a]pyrene diol epoxide (B[a]PDE), in genomic regions of significance in lung cancer, in normal human cells. We have used a pulldown assay for enrichment of the CpG methylated fraction of cellular DNA combined with microarray platforms, followed by extensive validation through conventional bisulfite-based analysis. Here, we demonstrate strikingly similar patterns of DNA methylation in non-transformed B[a]PDE-treated cells vs control using high-throughput microarray-based DNA methylation profiling confirmed by conventional bisulfite-based DNA methylation analysis. The absence of aberrant DNA methylation in our model system within a timeframe that precedes cellular transformation suggests that following carcinogen exposure, other as yet unknown factors (secondary to carcinogen treatment) may help initiate global loss of DNA methylation and region-specific gain of DNA methylation, which can, in turn, contribute to lung cancer development. Unveiling the initiating events that cause aberrant DNA methylation in lung cancer has tremendous public health relevance, as it can help define future strategies for early detection and prevention of this highly lethal disease.

  12. Investigating the Epigenetic Effects of a Prototype Smoke-Derived Carcinogen in Human Cells

    PubMed Central

    Tommasi, Stella; Kim, Sang-in; Zhong, Xueyan; Wu, Xiwei; Pfeifer, Gerd P.; Besaratinia, Ahmad

    2010-01-01

    Global loss of DNA methylation and locus/gene-specific gain of DNA methylation are two distinct hallmarks of carcinogenesis. Aberrant DNA methylation is implicated in smoking-related lung cancer. In this study, we have comprehensively investigated the modulation of DNA methylation consequent to chronic exposure to a prototype smoke-derived carcinogen, benzo[a]pyrene diol epoxide (B[a]PDE), in genomic regions of significance in lung cancer, in normal human cells. We have used a pulldown assay for enrichment of the CpG methylated fraction of cellular DNA combined with microarray platforms, followed by extensive validation through conventional bisulfite-based analysis. Here, we demonstrate strikingly similar patterns of DNA methylation in non-transformed B[a]PDE-treated cells vs control using high-throughput microarray-based DNA methylation profiling confirmed by conventional bisulfite-based DNA methylation analysis. The absence of aberrant DNA methylation in our model system within a timeframe that precedes cellular transformation suggests that following carcinogen exposure, other as yet unknown factors (secondary to carcinogen treatment) may help initiate global loss of DNA methylation and region-specific gain of DNA methylation, which can, in turn, contribute to lung cancer development. Unveiling the initiating events that cause aberrant DNA methylation in lung cancer has tremendous public health relevance, as it can help define future strategies for early detection and prevention of this highly lethal disease. PMID:20485678

  13. DNA-based approaches to the treatment of allergies.

    PubMed

    Spiegelberg, Hans L; Raz, Eyal

    2002-02-01

    Although excellent pharmacological treatments for allergies exist, they do not change the underlying pathogenesis of allergic diseases and do not cure the disease. Only allergen-specific immunotherapy, the injection of small but increasing amounts of allergen, has been shown to change a pre-existing allergic Th2 immune response to a non-allergic Th1 response. However, since injection of allergen is associated with the risk of allergic and sometimes even life-threatening anaphylactic reactions, immunotherapy is no longer used as extensively as in the past. In the search for a novel immunotherapy having a low risk-to-benefit ratio, immunostimulatory CpG motif DNA sequences have recently been shown to provide an excellent tool for designing safer and more efficient forms of allergen immunotherapy. These DNA-based immunotherapeutics include allergen gene vaccines, immunization with allergen-DNA conjugates and immunomodulation with immunostimulatory oligodeoxynucleotides. All three DNA-based immunotherapeutics have been shown to be very effective in animal models of allergic diseases and, at present, allergen-DNA conjugates are being tested for their safety and efficacy in allergic patients. This review describes the preclinical findings and the data of the first clinical trials in allergic patients of DNA-based immunotherapeutics for allergic disorders.

  14. Design, synthesis and DNA interactions of a chimera between a platinum complex and an IHF mimicking peptide.

    PubMed

    Rao, Harita; Damian, Mariana S; Alshiekh, Alak; Elmroth, Sofi K C; Diederichsen, Ulf

    2015-12-28

    Conjugation of metal complexes with peptide scaffolds possessing high DNA binding affinity has shown to modulate their biological activities and to enhance their interaction with DNA. In this work, a platinum complex/peptide chimera was synthesized based on a model of the Integration Host Factor (IHF), an architectural protein possessing sequence specific DNA binding and bending abilities through its interaction with a minor groove. The model peptide consists of a cyclic unit resembling the minor grove binding subdomain of IHF, a positively charged lysine dendrimer for electrostatic interactions with the DNA phosphate backbone and a flexible glycine linker tethering the two units. A norvaline derived artificial amino acid was designed to contain a dimethylethylenediamine as a bidentate platinum chelating unit, and introduced into the IHF mimicking peptides. The interaction of the chimeric peptides with various DNA sequences was studied by utilizing the following experiments: thermal melting studies, agarose gel electrophoresis for plasmid DNA unwinding experiments, and native and denaturing gel electrophoresis to visualize non-covalent and covalent peptide-DNA adducts, respectively. By incorporation of the platinum metal center within the model peptide mimicking IHF we have attempted to improve its specificity and DNA targeting ability, particularly towards those sequences containing adjacent guanine residues.

  15. Patterning nanowire and micro-nanoparticle array on micropillar-structured surface: Experiment and modeling.

    PubMed

    Lin, Chung Hsun; Guan, Jingjiao; Chau, Shiu Wu; Chen, Shia Chung; Lee, L James

    2010-08-04

    DNA molecules in a solution can be immobilized and stretched into a highly ordered array on a solid surface containing micropillars by molecular combing technique. However, the mechanism of this process is not well understood. In this study, we demonstrated the generation of DNA nanostrand array with linear, zigzag, and fork-zigzag patterns and the microfluidic processes are modeled based on a deforming body-fitted grid approach. The simulation results provide insights for explaining the stretching, immobilizing, and patterning of DNA molecules observed in the experiments.

  16. Charge transport properties of poly(dA)-poly(dT) DNA in variation of backbone disorder and amplitude of base-pair twisting motion

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Rahmi, Kinanti Aldilla, E-mail: kinanti.aldilla@ui.ac.id; Yudiarsah, Efta

    By using tight binding Hamiltonian model, charge transport properties of poly(dA)-poly(dT) DNA in variation of backbone disorder and amplitude of base-pair twisting motion is studied. The DNA chain used is 32 base pairs long poly(dA)-poly(dT) molecule. The molecule is contacted to electrode at both ends. The influence of environment on charge transport in DNA is modeled as variation of backbone disorder. The twisting motion amplitude is taking into account by assuming that the twisting angle distributes following Gaussian distribution function with zero average and standard deviation proportional to square root of temperature and inversely proportional to the twisting motion frequency.more » The base-pair twisting motion influences both the onsite energy of the bases and electron hopping constant between bases. The charge transport properties are studied by calculating current using Landauer-Buttiker formula from transmission probabilities which is calculated by transfer matrix methods. The result shows that as the backbone disorder increases, the maximum current decreases. By decreasing the twisting motion frequency, the current increases rapidly at low voltage, but the current increases slower at higher voltage. The threshold voltage can increase or decrease with increasing backbone disorder and increasing twisting frequency.« less

  17. DNA Glycosylases Search for and Remove Oxidized DNA Bases

    PubMed Central

    Wallace, Susan S.

    2014-01-01

    The following mini review summarizes recent research from the Author’s laboratory as presented to the Environmental Mutagen Society in October 2012. It provides an overview of the DNA glycosylases that recognize oxidized DNA bases using the Fpg/Nei family of DNA glycosylases as models for how structure can inform function. For example, even though human NEIL1 and the plant and fungal orthologs lack the zinc finger shown to be required for binding, DNA crystal structures revealed a “zincless finger” with the same properties. Also the “lesion recognition loop” is not involved in lesion recognition rather stabilization of 8-oxoG in the active site pocket. Unlike the other Fpg/Nei family members, Neil3 lacks two of the three void-filling residues that stabilize the duplex and interact with the opposite strand which may account for its preference for lesions in single stranded DNA. We also showed, using single molecule approaches, that DNA glycosylases search for their substrates in a sea of undamaged DNA by using a wedge residue that is inserted into the DNA helix to probe for the presence of damage. PMID:24123395

  18. Homology modeling, docking and structure-based pharmacophore of inhibitors of DNA methyltransferase

    NASA Astrophysics Data System (ADS)

    Yoo, Jakyung; Medina-Franco, José L.

    2011-06-01

    DNA methyltransferase 1 (DNMT1) is an emerging epigenetic target for the treatment of cancer and other diseases. To date, several inhibitors from different structural classes have been published. In this work, we report a comprehensive molecular modeling study of 14 established DNTM1 inhibitors with a herein developed homology model of the catalytic domain of human DNTM1. The geometry of the homology model was in agreement with the proposed mechanism of DNA methylation. Docking results revealed that all inhibitors studied in this work have hydrogen bond interactions with a glutamic acid and arginine residues that play a central role in the mechanism of cytosine DNA methylation. The binding models of compounds such as curcumin and parthenolide suggest that these natural products are covalent blockers of the catalytic site. A pharmacophore model was also developed for all DNMT1 inhibitors considered in this work using the most favorable binding conformations and energetic terms of the docked poses. To the best of our knowledge, this is the first pharmacophore model proposed for compounds with inhibitory activity of DNMT1. The results presented in this work represent a conceptual advance for understanding the protein-ligand interactions and mechanism of action of DNMT1 inhibitors. The insights obtained in this work can be used for the structure-based design and virtual screening for novel inhibitors targeting DNMT1.

  19. Estimating Genomic Distance from DNA Sequence Location in Cell Nuclei by a Random Walk Model

    NASA Astrophysics Data System (ADS)

    van den Engh, Ger; Sachs, Rainer; Trask, Barbara J.

    1992-09-01

    The folding of chromatin in interphase cell nuclei was studied by fluorescent in situ hybridization with pairs of unique DNA sequence probes. The sites of DNA sequences separated by 100 to 2000 kilobase pairs (kbp) are distributed in interphase chromatin according to a random walk model. This model provides the basis for calculating the spacing of sequences along the linear DNA molecule from interphase distance measurements. An interphase mapping strategy based on this model was tested with 13 probes from a 4-megabase pair (Mbp) region of chromosome 4 containing the Huntington disease locus. The results confirmed the locations of the probes and showed that the remaining gap in the published maps of this region is negligible in size. Interphase distance measurements should facilitate construction of chromosome maps with an average marker density of one per 100 kbp, approximately ten times greater than that achieved by hybridization to metaphase chromosomes.

  20. Sub-Terrahertz Spectroscopy of E.COLI Dna: Experiment, Statistical Model, and MD Simulations

    NASA Astrophysics Data System (ADS)

    Sizov, I.; Dorofeeva, T.; Khromova, T.; Gelmont, B.; Globus, T.

    2012-06-01

    We will present result of combined experimental and computational study of sub-THz absorption spectra from Escherichia coli (E.coli) DNA. Measurements were conducted using a Bruker FTIR spectrometer with a liquid helium cooled bolometer and a recently developed frequency domain sensor operating at room temperature, with spectral resolution of 0.25 cm-1 and 0.03 cm-1, correspondingly. We have earlier demonstrated that molecular dynamics (MD) simulation can be effectively applied for characterizing relatively small biological molecules, such as transfer RNA or small protein thioredoxin from E. coli , and help to understand and predict their absorption spectra. Large size of DNA macromolecules ( 5 million base pairs for E. coli DNA) prevents, however, direct application of MD simulation at the current level of computational capabilities. Therefore, by applying a second order Markov chain approach and Monte-Carlo technique, we have developed a new statistical model to construct DNA sequences from biological cells. These short representative sequences (20-60 base pairs) are built upon the most frequently repeated fragments (2-10 base pairs) in the original DNA. Using this new approach, we constructed DNA sequences for several non-pathogenic strains of E.coli, including a well-known strain BL21, uro-pathogenic strain, CFT073, and deadly EDL933 strain (O157:H7), and used MD simulations to calculate vibrational absorption spectra of these strains. Significant differences are clearly present in spectra of strains in averaged spectra and in all components for particular orientations. The mechanism of interaction of THz radiation with a biological molecule is studied by analyzing dynamics of atoms and correlation of local vibrations in the modeled molecule. Simulated THz vibrational spectra of DNA are compared with experimental results. With the spectral resolution of 0.1 cm-1 or better, which is now available in experiments, the very easy discrimination between different strains of the same bacteria becomes possible.

  1. DNA Sequence-Dependent Ionic Currents in Ultra-Small Solid-State Nanopores†

    PubMed Central

    Comer, Jeffrey

    2016-01-01

    Measurements of ionic currents through nanopores partially blocked by DNA have emerged as a powerful method for characterization of the DNA nucleotide sequence. Although the effect of the nucleotide sequence on the nanopore blockade current has been experimentally demonstrated, prediction and interpretation of such measurements remain a formidable challenge. Using atomic resolution computational approaches, here we show how the sequence, molecular conformation, and pore geometry affect the blockade ionic current in model solid-state nanopores. We demonstrate that the blockade current from a DNA molecule is determined by the chemical identities and conformations of at least three consecutive nucleotides. We find the blockade currents produced by the nucleotide triplets to vary considerably with their nucleotide sequence despite having nearly identical molecular conformations. Encouragingly, we find blockade current differences as large as 25% for single-base substitutions in ultra small (1.6 nm × 1.1 nm cross section; 2 nm length) solid-state nanopores. Despite the complex dependence of the blockade current on the sequence and conformation of the DNA triplets, we find that, under many conditions, the number of thymine bases is positively correlated with the current, whereas the number of purine bases and the presence of both purine and pyrimidines in the triplet are negatively correlated with the current. Based on these observations, we construct a simple theoretical model that relates the ion current to the base content of a solid-state nanopore. Furthermore, we show that compact conformations of DNA in narrow pores provide the greatest signal-to-noise ratio for single base detection, whereas reduction of the nanopore length increases the ionic current noise. Thus, the sequence dependence of nanopore blockade current can be theoretically rationalized, although the predictions will likely need to be customized for each nanopore type. PMID:27103233

  2. Structure of an anti-HIV-1 hammerhead ribozyme complex with a 17-mer DNA substrate analog of HIV-1 gag RNA and a mechanism for the cleavage reaction: 750 MHz NMR and computer experiments

    NASA Technical Reports Server (NTRS)

    Ojha, R. P.; Dhingra, M. M.; Sarma, M. H.; Myer, Y. P.; Setlik, R. F.; Shibata, M.; Kazim, A. L.; Ornstein, R. L.; Rein, R.; Turner, C. J.; hide

    1997-01-01

    The structure of an anti-HIV-1 ribozyme-DNA abortive substrate complex was investigated by 750 MHz NMR and computer modeling experiments. The ribozyme was a chimeric molecule with 30 residues-18 DNA nucleotides, and 12 RNA residues in the conserved core. The DNA substrate analog had 17 residues. The chimeric ribozyme and the DNA substrate formed a shortened ribozyme-abortive substrate complex of 47 nucleotides with two DNA stems (stems I and III) and a loop consisting of the conserved core residues. Circular dichroism spectra showed that the DNA stems assume A-family conformation at the NMR concentration and a temperature of 15 degrees C, contrary to the conventional wisdom that DNA duplexes in aqueous solution populate entirely in the B-form. It is proposed that the A-family RNA residues at the core expand the A-family initiated at the core into the DNA stems because of the large free energy requirement for the formation of A/B junctions. Assignments of the base H8/H6 protons and H1' of the 47 residues were made by a NOESY walk. In addition to the methyl groups of all T's, the imino resonances of stems I and III and AH2's were assigned from appropriate NOESY walks. The extracted NMR data along with available crystallographic data, were used to derive a structural model of the complex. Stems I and III of the final model displayed a remarkable similarity to the A form of DNA; in stem III, a GC base pair was found to be moving into the floor of the minor groove defined by flanking AT pairs; data suggest the formation of a buckled rhombic structure with the adjacent pair; in addition, the base pair at the interface of stem III and the loop region displayed deformed geometry. The loop with the catalytic core, and the immediate region of the stems displayed conformational multiplicity within the NMR time scale. A catalytic mechanism for ribozyme action based on the derived structure, and consistent with biochemical data in the literature, is proposed. The complex between the anti HIV-1 gag ribozyme and its abortive DNA substrate manifests in the detection of a continuous track of A.T base pairs; this suggests that the interaction between the ribozyme and its DNA substrate is stronger than the one observed in the case of the free ribozyme where the bases in stem I and stem III regions interact strongly with the ribozyme core region (Sarma, R. H., et al. FEBS Letters 375, 317-23, 1995). The complex formation provides certain guidelines in the design of suitable therapeutic ribozymes. If the residues in the ribozyme stem regions interact with the conserved core, it may either prevent or interfere with the formation of a catalytically active tertiary structure.

  3. Structure of the EndoMS-DNA Complex as Mismatch Restriction Endonuclease.

    PubMed

    Nakae, Setsu; Hijikata, Atsushi; Tsuji, Toshiyuki; Yonezawa, Kouki; Kouyama, Ken-Ichi; Mayanagi, Kouta; Ishino, Sonoko; Ishino, Yoshizumi; Shirai, Tsuyoshi

    2016-11-01

    Archaeal NucS nuclease was thought to degrade the single-stranded region of branched DNA, which contains flapped and splayed DNA. However, recent findings indicated that EndoMS, the orthologous enzyme of NucS, specifically cleaves double-stranded DNA (dsDNA) containing mismatched bases. In this study, we determined the structure of the EndoMS-DNA complex. The complex structure of the EndoMS dimer with dsDNA unexpectedly revealed that the mismatched bases were flipped out into binding sites, and the overall architecture most resembled that of restriction enzymes. The structure of the apo form was similar to the reported structure of Pyrococcus abyssi NucS, indicating that movement of the C-terminal domain from the resting state was required for activity. In addition, a model of the EndoMS-PCNA-DNA complex was preliminarily verified with electron microscopy. The structures strongly support the idea that EndoMS acts in a mismatch repair pathway. Copyright © 2016 Elsevier Ltd. All rights reserved.

  4. Structure-affinity relationships for the binding of actinomycin D to DNA

    NASA Astrophysics Data System (ADS)

    Gallego, José; Ortiz, Angel R.; de Pascual-Teresa, Beatriz; Gago, Federico

    1997-03-01

    Molecular models of the complexes between actinomycin D and 14 different DNA hexamers were built based on the X-ray crystal structure of the actinomycin-d(GAAGCTTC)2 complex. The DNA sequences included the canonical GpC binding step flanked by different base pairs, nonclassical binding sites such as GpG and GpT, and sites containing 2,6-diamino- purine. A good correlation was found between the intermolecular interaction energies calculated for the refined complexes and the relative preferences of actinomycin binding to standard and modified DNA. A detailed energy decomposition into van der Waals and electrostatic components for the interactions between the DNA base pairs and either the chromophore or the peptidic part of the antibiotic was performed for each complex. The resulting energy matrix was then subjected to principal component analysis, which showed that actinomycin D discriminates among different DNA sequences by an interplay of hydrogen bonding and stacking interactions. The structure-affinity relationships for this important antitumor drug are thus rationalized and may be used to advantage in the design of novel sequence-specific DNA-binding agents.

  5. Generation of Gene-Engineered Chimeric DNA Molecules for Specific Therapy of Autoimmune Diseases

    PubMed Central

    Gesheva, Vera; Szekeres, Zsuzsanna; Mihaylova, Nikolina; Dimitrova, Iliyana; Nikolova, Maria; Erdei, Anna; Prechl, Jozsef

    2012-01-01

    Abstract Systemic lupus erythematosus (SLE) is an autoimmune disease characterized by the development of self-reactive B and T cells and autoantibody production. In particular, double-stranded DNA-specific B cells play an important role in lupus progression, and their selective elimination is a reasonable approach for effective therapy of SLE. DNA-based vaccines aim at the induction of immune response against the vector-encoded antigen. Here, we are exploring, as a new DNA-based therapy of SLE, a chimeric DNA molecule encoding a DNA-mimotope peptide, and the Fv but not the immunogenic Fc fragment of an FcγRIIb-specific monoclonal antibody. This DNA construct was inserted in the expression vector pNut and used as a naked DNA vaccine in a mouse model of lupus. The chimeric DNA molecule can be expressed in eukaryotic cells and cross-links cell surface receptors on DNA-specific B cells, delivering an inhibitory intracellular signal. Intramuscular administration of the recombinant DNA molecule to lupus-prone MRL/lpr mice prevented increase in IgG anti-DNA antibodies and was associated with a low degree of proteinuria, modulation of cytokine profile, and suppression of lupus nephritis. PMID:23075110

  6. Dynamics and control of DNA sequence amplification

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Marimuthu, Karthikeyan; Chakrabarti, Raj, E-mail: raj@pmc-group.com, E-mail: rajc@andrew.cmu.edu; Division of Fundamental Research, PMC Advanced Technology, Mount Laurel, New Jersey 08054

    2014-10-28

    DNA amplification is the process of replication of a specified DNA sequence in vitro through time-dependent manipulation of its external environment. A theoretical framework for determination of the optimal dynamic operating conditions of DNA amplification reactions, for any specified amplification objective, is presented based on first-principles biophysical modeling and control theory. Amplification of DNA is formulated as a problem in control theory with optimal solutions that can differ considerably from strategies typically used in practice. Using the Polymerase Chain Reaction as an example, sequence-dependent biophysical models for DNA amplification are cast as control systems, wherein the dynamics of the reactionmore » are controlled by a manipulated input variable. Using these control systems, we demonstrate that there exists an optimal temperature cycling strategy for geometric amplification of any DNA sequence and formulate optimal control problems that can be used to derive the optimal temperature profile. Strategies for the optimal synthesis of the DNA amplification control trajectory are proposed. Analogous methods can be used to formulate control problems for more advanced amplification objectives corresponding to the design of new types of DNA amplification reactions.« less

  7. Synchronization of DNA array replication kinetics

    NASA Astrophysics Data System (ADS)

    Manturov, Alexey O.; Grigoryev, Anton V.

    2016-04-01

    In the present work we discuss the features of the DNA replication kinetics at the case of multiplicity of simultaneously elongated DNA fragments. The interaction between replicated DNA fragments is carried out by free protons that appears at the every nucleotide attachment at the free end of elongated DNA fragment. So there is feedback between free protons concentration and DNA-polymerase activity that appears as elongation rate dependence. We develop the numerical model based on a cellular automaton, which can simulate the elongation stage (growth of DNA strands) for DNA elongation process with conditions pointed above and we study the possibility of the DNA polymerases movement synchronization. The results obtained numerically can be useful for DNA polymerase movement detection and visualization of the elongation process in the case of massive DNA replication, eg, under PCR condition or for DNA "sequencing by synthesis" sequencing devices evaluation.

  8. DNA cross-linking by dehydromonocrotaline lacks apparent base sequence preference.

    PubMed

    Rieben, W Kurt; Coulombe, Roger A

    2004-12-01

    Pyrrolizidine alkaloids (PAs) are ubiquitous plant toxins, many of which, upon oxidation by hepatic mixed-function oxidases, become reactive bifunctional pyrrolic electrophiles that form DNA-DNA and DNA-protein cross-links. The anti-mitotic, toxic, and carcinogenic action of PAs is thought to be caused, at least in part, by these cross-links. We wished to determine whether the activated PA pyrrole dehydromonocrotaline (DHMO) exhibits base sequence preferences when cross-linked to a set of model duplex poly A-T 14-mer oligonucleotides with varying internal and/or end 5'-d(CG), 5'-d(GC), 5'-d(TA), 5'-d(CGCG), or 5'-d(GCGC) sequences. DHMO-DNA cross-links were assessed by electrophoretic mobility shift assay (EMSA) of 32P endlabeled oligonucleotides and by HPLC analysis of cross-linked DNAs enzymatically digested to their constituent deoxynucleosides. The degree of DNA cross-links depended upon the concentration of the pyrrole, but not on the base sequence of the oligonucleotide target. Likewise, HPLC chromatograms of cross-linked and digested DNAs showed no discernible sequence preference for any nucleotide. Added glutathione, tyrosine, cysteine, and aspartic acid, but not phenylalanine, threonine, serine, lysine, or methionine competed with DNA as alternate nucleophiles for cross-linking by DHMO. From these data it appears that DHMO exhibits no strong base preference when forming cross-links with DNA, and that some cellular nucleophiles can inhibit DNA cross-link formation.

  9. Envisaging quantum transport phenomenon in a muddled base pair of DNA

    NASA Astrophysics Data System (ADS)

    Vohra, Rajan; Sawhney, Ravinder Singh

    2018-05-01

    The effect of muddled base pair on electron transfer through a deoxyribonucleic acid (DNA) molecule connected to the gold electrodes has been elucidated using tight binding model. The effect of hydrogen and nitrogen bonds on the resistance of the base pair has been minutely observed. Using the semiempirical extended Huckel approach within NEGF regime, we have determined the current and conductance vs. bias voltage for disordered base pairs of DNA made of thymine (T) and adenine (A). The asymmetrical behaviour amid five times depreciation in the current characteristics has been observed for deviated Au-AT base pair-Au devices. An interesting revelation is that the conductance of the intrinsic AT base pair configuration attains dramatically high values with the symmetrical zig-zag pattern of current, which clearly indicates the transformation of the bond length within the strands of base pair when compared with other samples. A thorough investigation of the transmission coefficients T( E) and HOMO-LUMO gap reveals the misalignment of the strands in base pairs of DNA. The observed results present an insight to extend this work to build biosensing devices to predict the abnormality with the DNA.

  10. DNA damage induced by the direct effect of radiation

    NASA Astrophysics Data System (ADS)

    Yokoya, A.; Shikazono, N.; Fujii, K.; Urushibara, A.; Akamatsu, K.; Watanabe, R.

    2008-10-01

    We have studied the nature of DNA damage induced by the direct effect of radiation. The yields of single- (SSB) and double-strand breaks (DSB), base lesions and clustered damage were measured using the agarose gel electrophoresis method after exposing to various kinds of radiations to a simple model DNA molecule, fully hydrated closed-circular plasmid DNA (pUC18). The yield of SSB does not show significant dependence on linear energy transfer (LET) values. On the other hand, the yields of base lesions revealed by enzymatic probes, endonuclease III (Nth) and formamidopyrimidine DNA glycosylase (Fpg), which excise base lesions and leave a nick at the damage site, strongly depend on LET values. Soft X-ray photon (150 kVp) irradiation gives a maximum yield of the base lesions detected by the enzymatic probes as SSB and clustered damage, which is composed of one base lesion and proximate other base lesions or SSBs. The clustered damage is visualized as an enzymatically induced DSB. The yields of the enzymatically additional damages strikingly decrease with increasing levels of LET. These results suggest that in higher LET regions, the repair enzymes used as probes are compromised because of the dense damage clustering. The studies using simple plasmid DNA as a irradiation sample, however, have a technical difficulty to detect multiple SSBs in a plasmid DNA. To detect the additional SSBs induced in opposite strand of the first SSB, we have also developed a novel technique of DNA-denaturation assay. This allows us to detect multiply induced SSBs in both strand of DNA, but not induced DSB.

  11. Utilizing Molecular Dynamics ' Multipotent Methodologies to Measure Microscopic Motions of DNA Molecules: A Magniloquent Manuscript On DNA's Means and Mannerisms

    NASA Astrophysics Data System (ADS)

    Kingsland, Addie

    DNA is an amazing molecule which is the basic template for all genetics. It is the primary molecule for storing biological information, and has many applications in nanotechnology. Double-stranded DNA may contain mismatched base pairs beyond the Watson-Crick pairs guanine-cytosine and adenine-thymine. To date, no one has found a physical property of base pair mismatches which describes the behavior of naturally occurring mismatch repair enzymes. Many materials properties of DNA are also unknown, for instance, when pulling DNA in different configurations, different energy differences are observed with no obvious reason why. DNA mismatches also affect their local environment, for instance changing the quantum yield of nearby azobenzene moieties. We utilize molecular dynamics computer simulations to study the structure and dynamics for both matched and mismatched base pairs, within both biological and materials contexts, and in both equilibrium and biased dynamics. We show that mismatched pairs shift further in the plane normal to the DNA strand and are more likely to exhibit non-canonical structures, including the e-motif. Base pair mismatches alter their local environment, affecting the trans- to cis- photoisomerization quantum yield of azobenzene, as well as increasing the likelihood of observing the e-motif. We also show that by using simulated data, we can give new insights on theoretical models to calculate the energetics of pulling DNA strands apart. These results, all relatively inexpensive on modern computer hardware, can help guide the design of DNA-based nanotechnologies, as well as give new insights into the functioning of mismatch repair systems in cancer prevention.

  12. Specificity and Catalytic Mechanism in Family 5 Uracil DNA Glycosylase*

    PubMed Central

    Xia, Bo; Liu, Yinling; Li, Wei; Brice, Allyn R.; Dominy, Brian N.; Cao, Weiguo

    2014-01-01

    UDGb belongs to family 5 of the uracil DNA glycosylase (UDG) superfamily. Here, we report that family 5 UDGb from Thermus thermophilus HB8 is not only a uracil DNA glycosyase acting on G/U, T/U, C/U, and A/U base pairs, but also a hypoxanthine DNA glycosylase acting on G/I, T/I, and A/I base pairs and a xanthine DNA glycosylase acting on all double-stranded and single-stranded xanthine-containing DNA. Analysis of potentials of mean force indicates that the tendency of hypoxanthine base flipping follows the order of G/I > T/I, A/I > C/I, matching the trend of hypoxanthine DNA glycosylase activity observed in vitro. Genetic analysis indicates that family 5 UDGb can also act as an enzyme to remove uracil incorporated into DNA through the existence of dUTP in the nucleotide pool. Mutational analysis coupled with molecular modeling and molecular dynamics analysis reveals that although hydrogen bonding to O2 of uracil underlies the UDG activity in a dissociative fashion, Tth UDGb relies on multiple catalytic residues to facilitate its excision of hypoxanthine and xanthine. This study underscores the structural and functional diversity in the UDG superfamily. PMID:24838246

  13. Anticancer drug-DNA interactions measured using a photoinduced electron-transfer mechanism based on luminescent quantum dots.

    PubMed

    Yuan, Jipei; Guo, Weiwei; Yang, Xiurong; Wang, Erkang

    2009-01-01

    A sensing system based on the photoinduced electron transfer of quantum dots (QDs) was designed to measure the interaction of anticancer drug and DNA, taking mitoxantrone (MTX) as a model drug. MTX adsorbed on the surface of QDs can quench the photoluminescence (PL) of QDs through the photoinduced electron-transfer process; and then the addition of DNA will bring the restoration of QDs PL intensity, as DNA can bind with MTX and remove it from QDs. Sensitive detection of MTX with the detection limit of 10 nmol L(-1) and a linear detection range from 10 nmol L(-1) to 4.5 micromol L(-1) was achieved. The dependence of PL intensity on DNA amount was successfully utilized to investigate the interactions between MTX and DNA. Both the binding constants and the sizes of binding site of MTX-DNA interactions were calculated based on the equations deduced for the PL recovery process. The binding constant obtained in our experiment was generally consistent with previous reports. The sensitive and speedy detection of MTX as well as the avoidance of modification or immobilization process made this system suitable and promising in the drug-DNA interaction studies.

  14. Dynamic Conformations of Nucleosome Arrays in Solution from Small-Angle X-ray Scattering

    NASA Astrophysics Data System (ADS)

    Howell, Steven C.

    Chromatin conformation and dynamics remains unsolved despite the critical role of the chromatin in fundamental genetic functions such as transcription, replication, and repair. At the molecular level, chromatin can be viewed as a linear array of nucleosomes, each consisting of 147 base pairs (bp) of double-stranded DNA (dsDNA) wrapped around a protein core and connected by 10 to 90 bp of linker dsDNA. Using small-angle X-ray scattering (SAXS), we investigated how the conformations of model nucleosome arrays in solution are modulated by ionic condition as well as the effect of linker histone proteins. To facilitate ensemble modeling of these SAXS measurements, we developed a simulation method that treats coarse-grained DNA as a Markov chain, then explores possible DNA conformations using Metropolis Monte Carlo (MC) sampling. This algorithm extends the functionality of SASSIE, a program used to model intrinsically disordered biological molecules, adding to the previous methods for simulating protein, carbohydrates, and single-stranded DNA. Our SAXS measurements of various nucleosome arrays together with the MC generated models provide valuable solution structure information identifying specific differences from the structure of crystallized arrays.

  15. Prereplicative repair of oxidized bases in the human genome is mediated by NEIL1 DNA glycosylase together with replication proteins

    PubMed Central

    Hegde, Muralidhar L.; Hegde, Pavana M.; Bellot, Larry J.; Mandal, Santi M.; Hazra, Tapas K.; Li, Guo-Min; Boldogh, Istvan; Tomkinson, Alan E.; Mitra, Sankar

    2013-01-01

    Base oxidation by endogenous and environmentally induced reactive oxygen species preferentially occurs in replicating single-stranded templates in mammalian genomes, warranting prereplicative repair of the mutagenic base lesions. It is not clear how such lesions (which, unlike bulky adducts, do not block replication) are recognized for repair. Furthermore, strand breaks caused by base excision from ssDNA by DNA glycosylases, including Nei-like (NEIL) 1, would generate double-strand breaks during replication, which are not experimentally observed. NEIL1, whose deficiency causes a mutator phenotype and is activated during the S phase, is present in the DNA replication complex isolated from human cells, with enhanced association with DNA in S-phase cells and colocalization with replication foci containing DNA replication proteins. Furthermore, NEIL1 binds to 5-hydroxyuracil, the oxidative deamination product of C, in replication protein A-coated ssDNA template and inhibits DNA synthesis by DNA polymerase δ. We postulate that, upon encountering an oxidized base during replication, NEIL1 initiates prereplicative repair by acting as a “cowcatcher” and preventing nascent chain growth. Regression of the stalled replication fork, possibly mediated by annealing helicases, then allows lesion repair in the reannealed duplex. This model is supported by our observations that NEIL1, whose deficiency slows nascent chain growth in oxidatively stressed cells, is stimulated by replication proteins in vitro. Furthermore, deficiency of the closely related NEIL2 alone does not affect chain elongation, but combined NEIL1/2 deficiency further inhibits DNA replication. These results support a mechanism of NEIL1-mediated prereplicative repair of oxidized bases in the replicating strand, with NEIL2 providing a backup function. PMID:23898192

  16. Colorimetric and dynamic light scattering detection of DNA sequences by using positively charged gold nanospheres: a comparative study with gold nanorods

    NASA Astrophysics Data System (ADS)

    Pylaev, T. E.; Khanadeev, V. A.; Khlebtsov, B. N.; Dykman, L. A.; Bogatyrev, V. A.; Khlebtsov, N. G.

    2011-07-01

    We introduce a new genosensing approach employing CTAB (cetyltrimethylammonium bromide)-coated positively charged colloidal gold nanoparticles (GNPs) to detect target DNA sequences by using absorption spectroscopy and dynamic light scattering. The approach is compared with a previously reported method employing unmodified CTAB-coated gold nanorods (GNRs). Both approaches are based on the observation that whereas the addition of probe and target ssDNA to CTAB-coated particles results in particle aggregation, no aggregation is observed after addition of probe and nontarget DNA sequences. Our goal was to compare the feasibility and sensitivity of both methods. A 21-mer ssDNA from the human immunodeficiency virus type 1 HIV-1 U5 long terminal repeat (LTR) sequence and a 23-mer ssDNA from the Bacillus anthracis cryptic protein and protective antigen precursor (pagA) genes were used as ssDNA models. In the case of GNRs, unexpectedly, the colorimetric test failed with perfect cigar-like particles but could be performed with dumbbell and dog-bone rods. By contrast, our approach with cationic CTAB-coated GNPs is easy to implement and possesses excellent feasibility with retention of comparable sensitivity—a 0.1 nM concentration of target cDNA can be detected with the naked eye and 10 pM by dynamic light scattering (DLS) measurements. The specificity of our method is illustrated by successful DLS detection of one-three base mismatches in cDNA sequences for both DNA models. These results suggest that the cationic GNPs and DLS can be used for genosensing under optimal DNA hybridization conditions without any chemical modifications of the particle surface with ssDNA molecules and signal amplification. Finally, we discuss a more than two-three-order difference in the reported estimations of the detection sensitivity of colorimetric methods (0.1 to 10-100 pM) to show that the existing aggregation models are inconsistent with the detection limits of about 0.1-1 pM DNA and that other explanations should be developed.

  17. Evaluation of Interindividual Human Variation in Bioactivation and DNA Adduct Formation of Estragole in Liver Predicted by Physiologically Based Kinetic/Dynamic and Monte Carlo Modeling.

    PubMed

    Punt, Ans; Paini, Alicia; Spenkelink, Albertus; Scholz, Gabriele; Schilter, Benoit; van Bladeren, Peter J; Rietjens, Ivonne M C M

    2016-04-18

    Estragole is a known hepatocarcinogen in rodents at high doses following metabolic conversion to the DNA-reactive metabolite 1'-sulfooxyestragole. The aim of the present study was to model possible levels of DNA adduct formation in (individual) humans upon exposure to estragole. This was done by extending a previously defined PBK model for estragole in humans to include (i) new data on interindividual variation in the kinetics for the major PBK model parameters influencing the formation of 1'-sulfooxyestragole, (ii) an equation describing the relationship between 1'-sulfooxyestragole and DNA adduct formation, (iii) Monte Carlo modeling to simulate interindividual human variation in DNA adduct formation in the population, and (iv) a comparison of the predictions made to human data on DNA adduct formation for the related alkenylbenzene methyleugenol. Adequate model predictions could be made, with the predicted DNA adduct levels at the estimated daily intake of estragole of 0.01 mg/kg bw ranging between 1.6 and 8.8 adducts in 10(8) nucleotides (nts) (50th and 99th percentiles, respectively). This is somewhat lower than values reported in the literature for the related alkenylbenzene methyleugenol in surgical human liver samples. The predicted levels seem to be below DNA adduct levels that are linked with tumor formation by alkenylbenzenes in rodents, which were estimated to amount to 188-500 adducts per 10(8) nts at the BMD10 values of estragole and methyleugenol. Although this does not seem to point to a significant health concern for human dietary exposure, drawing firm conclusions may have to await further validation of the model's predictions.

  18. Solving satisfiability problems using a novel microarray-based DNA computer.

    PubMed

    Lin, Che-Hsin; Cheng, Hsiao-Ping; Yang, Chang-Biau; Yang, Chia-Ning

    2007-01-01

    An algorithm based on a modified sticker model accompanied with an advanced MEMS-based microarray technology is demonstrated to solve SAT problem, which has long served as a benchmark in DNA computing. Unlike conventional DNA computing algorithms needing an initial data pool to cover correct and incorrect answers and further executing a series of separation procedures to destroy the unwanted ones, we built solutions in parts to satisfy one clause in one step, and eventually solve the entire Boolean formula through steps. No time-consuming sample preparation procedures and delicate sample applying equipment were required for the computing process. Moreover, experimental results show the bound DNA sequences can sustain the chemical solutions during computing processes such that the proposed method shall be useful in dealing with large-scale problems.

  19. Formation and processing of DNA damage substrates for the hNEIL enzymes.

    PubMed

    Fleming, Aaron M; Burrows, Cynthia J

    2017-06-01

    Reactive oxygen species (ROS) are harnessed by the cell for signaling at the same time as being detrimental to cellular components such as DNA. The genome and transcriptome contain instructions that can alter cellular processes when oxidized. The guanine (G) heterocycle in the nucleotide pool, DNA, or RNA is the base most prone to oxidation. The oxidatively-derived products of G consistently observed in high yields from hydroxyl radical, carbonate radical, or singlet oxygen oxidations under conditions modeling the cellular reducing environment are discussed. The major G base oxidation products are 8-oxo-7,8-dihydroguanine (OG), 5-carboxamido-5-formamido-2-iminohydantoin (2Ih), spiroiminodihydantoin (Sp), and 5-guanidinohydantoin (Gh). The yields of these products show dependency on the oxidant and the reaction context that includes nucleoside, single-stranded DNA (ssDNA), double-stranded DNA (dsDNA), and G-quadruplex DNA (G4-DNA) structures. Upon formation of these products in cells, they are recognized by the DNA glycosylases in the base excision repair (BER) pathway. This review focuses on initiation of BER by the mammalian Nei-like1-3 (NEIL1-3) glycosylases for removal of 2Ih, Sp, and Gh. The unique ability of the human NEILs to initiate removal of the hydantoins in ssDNA, bulge-DNA, bubble-DNA, dsDNA, and G4-DNA is outlined. Additionally, when Gh exists in a G4 DNA found in a gene promoter, NEIL-mediated repair is modulated by the plasticity of the G4-DNA structure provided by additional G-runs flanking the sequence. On the basis of these observations and cellular studies from the literature, the interplay between DNA oxidation and BER to alter gene expression is discussed. Copyright © 2017 Elsevier Inc. All rights reserved.

  20. One-electron oxidation reactions of purine and pyrimidine bases in cellular DNA

    PubMed Central

    Cadet, Jean; Wagner, J. Richard; Shafirovich, Vladimir; Geacintov, Nicholas E.

    2014-01-01

    Purpose The aim of this survey is to critically review the available information on one-electron oxidation reactions of nucleobases in cellular DNA with emphasis on damage induced through the transient generation of purine and pyrimidine radical cations. Since the indirect effect of ionizing radiation mediated by hydroxyl radical is predominant in cells, efforts have been made to selectively ionize bases using suitable one-electron oxidants that consist among others of high intensity UVC laser pulses. Thus, the main oxidation product in cellular DNA was found to be 8-oxo-7,8-dihydroguanine as a result of direct bi-photonic ionization of guanine bases and indirect formation of guanine radical cations through hole transfer reactions from other base radical cations. The formation of 8-oxo-7,8-dihydroguanine and other purine and pyrimidine degradation products was rationalized in terms of the initial generation of related radical cations followed by either hydration or deprotonation reactions in agreement with mechanistic pathways inferred from detailed mechanistic studies. The guanine radical cation has been shown to be implicated in three other nucleophilic additions that give rise to DNA-protein and DNA-DNA cross-links in model systems. Evidence was recently provided for the occurrence of these three reactions in cellular DNA. Conclusion There is growing evidence that one-electron oxidation reactions of nucleobases whose mechanisms have been characterized in model studies involving aqueous solutions take place in a similar way in cells. It may also be pointed out that the above cross-linked lesions are only produced from the guanine radical cation and may be considered as diagnostic products of the direct effect of ionizing radiation. PMID:24369822

  1. One-electron oxidation reactions of purine and pyrimidine bases in cellular DNA.

    PubMed

    Cadet, Jean; Wagner, J Richard; Shafirovich, Vladimir; Geacintov, Nicholas E

    2014-06-01

    The aim of this survey is to critically review the available information on one-electron oxidation reactions of nucleobases in cellular DNA with emphasis on damage induced through the transient generation of purine and pyrimidine radical cations. Since the indirect effect of ionizing radiation mediated by hydroxyl radical is predominant in cells, efforts have been made to selectively ionize bases using suitable one-electron oxidants that consist among others of high intensity UVC laser pulses. Thus, the main oxidation product in cellular DNA was found to be 8-oxo-7,8-dihydroguanine as a result of direct bi-photonic ionization of guanine bases and indirect formation of guanine radical cations through hole transfer reactions from other base radical cations. The formation of 8-oxo-7,8-dihydroguanine and other purine and pyrimidine degradation products was rationalized in terms of the initial generation of related radical cations followed by either hydration or deprotonation reactions in agreement with mechanistic pathways inferred from detailed mechanistic studies. The guanine radical cation has been shown to be implicated in three other nucleophilic additions that give rise to DNA-protein and DNA-DNA cross-links in model systems. Evidence was recently provided for the occurrence of these three reactions in cellular DNA. There is growing evidence that one-electron oxidation reactions of nucleobases whose mechanisms have been characterized in model studies involving aqueous solutions take place in a similar way in cells. It may also be pointed out that the above cross-linked lesions are only produced from the guanine radical cation and may be considered as diagnostic products of the direct effect of ionizing radiation.

  2. Modeling of genetic gain for single traits from marker-assisted seedling selection in clonally propagated crops

    PubMed Central

    Ru, Sushan; Hardner, Craig; Carter, Patrick A; Evans, Kate; Main, Dorrie; Peace, Cameron

    2016-01-01

    Seedling selection identifies superior seedlings as candidate cultivars based on predicted genetic potential for traits of interest. Traditionally, genetic potential is determined by phenotypic evaluation. With the availability of DNA tests for some agronomically important traits, breeders have the opportunity to include DNA information in their seedling selection operations—known as marker-assisted seedling selection. A major challenge in deploying marker-assisted seedling selection in clonally propagated crops is a lack of knowledge in genetic gain achievable from alternative strategies. Existing models based on additive effects considering seed-propagated crops are not directly relevant for seedling selection of clonally propagated crops, as clonal propagation captures all genetic effects, not just additive. This study modeled genetic gain from traditional and various marker-based seedling selection strategies on a single trait basis through analytical derivation and stochastic simulation, based on a generalized seedling selection scheme of clonally propagated crops. Various trait-test scenarios with a range of broad-sense heritability and proportion of genotypic variance explained by DNA markers were simulated for two populations with different segregation patterns. Both derived and simulated results indicated that marker-based strategies tended to achieve higher genetic gain than phenotypic seedling selection for a trait where the proportion of genotypic variance explained by marker information was greater than the broad-sense heritability. Results from this study provides guidance in optimizing genetic gain from seedling selection for single traits where DNA tests providing marker information are available. PMID:27148453

  3. Easi-CRISPR for creating knock-in and conditional knockout mouse models using long ssDNA donors.

    PubMed

    Miura, Hiromi; Quadros, Rolen M; Gurumurthy, Channabasavaiah B; Ohtsuka, Masato

    2018-01-01

    CRISPR/Cas9-based genome editing can easily generate knockout mouse models by disrupting the gene sequence, but its efficiency for creating models that require either insertion of exogenous DNA (knock-in) or replacement of genomic segments is very poor. The majority of mouse models used in research involve knock-in (reporters or recombinases) or gene replacement (e.g., conditional knockout alleles containing exons flanked by LoxP sites). A few methods for creating such models have been reported that use double-stranded DNA as donors, but their efficiency is typically 1-10% and therefore not suitable for routine use. We recently demonstrated that long single-stranded DNAs (ssDNAs) serve as very efficient donors, both for insertion and for gene replacement. We call this method efficient additions with ssDNA inserts-CRISPR (Easi-CRISPR) because it is a highly efficient technology (efficiency is typically 30-60% and reaches as high as 100% in some cases). The protocol takes ∼2 months to generate the founder mice.

  4. DNA cleavage site selection by Type III restriction enzymes provides evidence for head-on protein collisions following 1D bidirectional motion

    PubMed Central

    Schwarz, Friedrich W.; van Aelst, Kara; Tóth, Júlia; Seidel, Ralf; Szczelkun, Mark D.

    2011-01-01

    DNA cleavage by the Type III Restriction–Modification enzymes requires communication in 1D between two distant indirectly-repeated recognitions sites, yet results in non-specific dsDNA cleavage close to only one of the two sites. To test a recently proposed ATP-triggered DNA sliding model, we addressed why one site is selected over another during cleavage. We examined the relative cleavage of a pair of identical sites on DNA substrates with different distances to a free or protein blocked end, and on a DNA substrate using different relative concentrations of protein. Under these conditions a bias can be induced in the cleavage of one site over the other. Monte-Carlo simulations based on the sliding model reproduce the experimentally observed behaviour. This suggests that cleavage site selection simply reflects the dynamics of the preceding stochastic enzyme events that are consistent with bidirectional motion in 1D and DNA cleavage following head-on protein collision. PMID:21724613

  5. DNA packaging in viral capsids with peptide arms.

    PubMed

    Cao, Qianqian; Bachmann, Michael

    2017-01-18

    Strong chain rigidity and electrostatic self-repulsion of packed double-stranded DNA in viruses require a molecular motor to pull the DNA into the capsid. However, what is the role of electrostatic interactions between different charged components in the packaging process? Though various theories and computer simulation models were developed for the understanding of viral assembly and packaging dynamics of the genome, long-range electrostatic interactions and capsid structure have typically been neglected or oversimplified. By means of molecular dynamics simulations, we explore the effects of electrostatic interactions on the packaging dynamics of DNA based on a coarse-grained DNA and capsid model by explicitly including peptide arms (PAs), linked to the inner surface of the capsid, and counterions. Our results indicate that the electrostatic interactions between PAs, DNA, and counterions have a significant influence on the packaging dynamics. We also find that the packed DNA conformations are largely affected by the structure of the PA layer, but the packaging rate is insensitive to the layer structure.

  6. Circulating tumour DNA methylation markers for diagnosis and prognosis of hepatocellular carcinoma

    NASA Astrophysics Data System (ADS)

    Xu, Rui-Hua; Wei, Wei; Krawczyk, Michal; Wang, Wenqiu; Luo, Huiyan; Flagg, Ken; Yi, Shaohua; Shi, William; Quan, Qingli; Li, Kang; Zheng, Lianghong; Zhang, Heng; Caughey, Bennett A.; Zhao, Qi; Hou, Jiayi; Zhang, Runze; Xu, Yanxin; Cai, Huimin; Li, Gen; Hou, Rui; Zhong, Zheng; Lin, Danni; Fu, Xin; Zhu, Jie; Duan, Yaou; Yu, Meixing; Ying, Binwu; Zhang, Wengeng; Wang, Juan; Zhang, Edward; Zhang, Charlotte; Li, Oulan; Guo, Rongping; Carter, Hannah; Zhu, Jian-Kang; Hao, Xiaoke; Zhang, Kang

    2017-11-01

    An effective blood-based method for the diagnosis and prognosis of hepatocellular carcinoma (HCC) has not yet been developed. Circulating tumour DNA (ctDNA) carrying cancer-specific genetic and epigenetic aberrations may enable a noninvasive `liquid biopsy' for diagnosis and monitoring of cancer. Here, we identified an HCC-specific methylation marker panel by comparing HCC tissue and normal blood leukocytes and showed that methylation profiles of HCC tumour DNA and matched plasma ctDNA are highly correlated. Using cfDNA samples from a large cohort of 1,098 HCC patients and 835 normal controls, we constructed a diagnostic prediction model that showed high diagnostic specificity and sensitivity (P < 0.001) and was highly correlated with tumour burden, treatment response, and stage. Additionally, we constructed a prognostic prediction model that effectively predicted prognosis and survival (P < 0.001). Together, these findings demonstrate in a large clinical cohort the utility of ctDNA methylation markers in the diagnosis, surveillance, and prognosis of HCC.

  7. A HIV-Tat/C4-binding protein chimera encoded by a DNA vaccine is highly immunogenic and contains acute EcoHIV infection in mice.

    PubMed

    Tomusange, Khamis; Wijesundara, Danushka; Gummow, Jason; Garrod, Tamsin; Li, Yanrui; Gray, Lachlan; Churchill, Melissa; Grubor-Bauk, Branka; Gowans, Eric J

    2016-06-30

    DNA vaccines are cost-effective to manufacture on a global scale and Tat-based DNA vaccines have yielded protective outcomes in preclinical and clinical models of human immunodeficiency virus (HIV), highlighting the potential of such vaccines. However, Tat-based DNA vaccines have been poorly immunogenic, and despite the administration of multiple doses and/or the addition of adjuvants, these vaccines are not in general use. In this study, we improved Tat immunogenicity by fusing it with the oligomerisation domain of a chimeric C4-binding protein (C4b-p), termed IMX313, resulting in Tat heptamerisation and linked Tat to the leader sequence of tissue plasminogen activator (TPA) to ensure that the bulk of heptamerised Tat is secreted. Mice vaccinated with secreted Tat fused to IMX313 (pVAX-sTat-IMX313) developed higher titres of Tat-specific serum IgG, mucosal sIgA and cell-mediated immune (CMI) responses, and showed superior control of EcoHIV infection, a surrogate murine HIV challenge model, compared with animals vaccinated with other test vaccines. Given the crucial contribution of Tat to HIV-1 pathogenesis and the precedent of Tat-based DNA vaccines in conferring some level of protection in animal models, we believe that the virologic control demonstrated with this novel multimerised Tat vaccine highlights the promise of this vaccine candidate for humans.

  8. Persistent damaged bases in DNA allow mutagenic break repair in Escherichia coli.

    PubMed

    Moore, Jessica M; Correa, Raul; Rosenberg, Susan M; Hastings, P J

    2017-07-01

    Bacteria, yeast and human cancer cells possess mechanisms of mutagenesis upregulated by stress responses. Stress-inducible mutagenesis potentially accelerates adaptation, and may provide important models for mutagenesis that drives cancers, host pathogen interactions, antibiotic resistance and possibly much of evolution generally. In Escherichia coli repair of double-strand breaks (DSBs) becomes mutagenic, using low-fidelity DNA polymerases under the control of the SOS DNA-damage response and RpoS general stress response, which upregulate and allow the action of error-prone DNA polymerases IV (DinB), II and V to make mutations during repair. Pol IV is implied to compete with and replace high-fidelity DNA polymerases at the DSB-repair replisome, causing mutagenesis. We report that up-regulated Pol IV is not sufficient for mutagenic break repair (MBR); damaged bases in the DNA are also required, and that in starvation-stressed cells, these are caused by reactive-oxygen species (ROS). First, MBR is reduced by either ROS-scavenging agents or constitutive activation of oxidative-damage responses, both of which reduce cellular ROS levels. The ROS promote MBR other than by causing DSBs, saturating mismatch repair, oxidizing proteins, or inducing the SOS response or the general stress response. We find that ROS drive MBR through oxidized guanines (8-oxo-dG) in DNA, in that overproduction of a glycosylase that removes 8-oxo-dG from DNA prevents MBR. Further, other damaged DNA bases can substitute for 8-oxo-dG because ROS-scavenged cells resume MBR if either DNA pyrimidine dimers or alkylated bases are induced. We hypothesize that damaged bases in DNA pause the replisome and allow the critical switch from high fidelity to error-prone DNA polymerases in the DSB-repair replisome, thus allowing MBR. The data imply that in addition to the indirect stress-response controlled switch to MBR, a direct cis-acting switch to MBR occurs independently of DNA breakage, caused by ROS oxidation of DNA potentially regulated by ROS regulators.

  9. Persistent damaged bases in DNA allow mutagenic break repair in Escherichia coli

    PubMed Central

    Moore, Jessica M.; Correa, Raul; Rosenberg, Susan M.

    2017-01-01

    Bacteria, yeast and human cancer cells possess mechanisms of mutagenesis upregulated by stress responses. Stress-inducible mutagenesis potentially accelerates adaptation, and may provide important models for mutagenesis that drives cancers, host pathogen interactions, antibiotic resistance and possibly much of evolution generally. In Escherichia coli repair of double-strand breaks (DSBs) becomes mutagenic, using low-fidelity DNA polymerases under the control of the SOS DNA-damage response and RpoS general stress response, which upregulate and allow the action of error-prone DNA polymerases IV (DinB), II and V to make mutations during repair. Pol IV is implied to compete with and replace high-fidelity DNA polymerases at the DSB-repair replisome, causing mutagenesis. We report that up-regulated Pol IV is not sufficient for mutagenic break repair (MBR); damaged bases in the DNA are also required, and that in starvation-stressed cells, these are caused by reactive-oxygen species (ROS). First, MBR is reduced by either ROS-scavenging agents or constitutive activation of oxidative-damage responses, both of which reduce cellular ROS levels. The ROS promote MBR other than by causing DSBs, saturating mismatch repair, oxidizing proteins, or inducing the SOS response or the general stress response. We find that ROS drive MBR through oxidized guanines (8-oxo-dG) in DNA, in that overproduction of a glycosylase that removes 8-oxo-dG from DNA prevents MBR. Further, other damaged DNA bases can substitute for 8-oxo-dG because ROS-scavenged cells resume MBR if either DNA pyrimidine dimers or alkylated bases are induced. We hypothesize that damaged bases in DNA pause the replisome and allow the critical switch from high fidelity to error-prone DNA polymerases in the DSB-repair replisome, thus allowing MBR. The data imply that in addition to the indirect stress-response controlled switch to MBR, a direct cis-acting switch to MBR occurs independently of DNA breakage, caused by ROS oxidation of DNA potentially regulated by ROS regulators. PMID:28727736

  10. Analytical Debye-Huckel model for electrostatic potentials around dissolved DNA.

    PubMed Central

    Wagner, K; Keyes, E; Kephart, T W; Edwards, G

    1997-01-01

    We present an analytical, Green-function-based model for the electric potential of DNA in solution, treating the surrounding solvent with the Debye-Huckel approximation. The partial charge of each atom is accounted for by modeling DNA as linear distributions of atoms on concentric cylindrical surfaces. The condensed ions of the solvent are treated with the Debye-Huckel approximation. The resultant leading term of the potential is that of a continuous shielded line charge, and the higher order terms account for the helical structure. Within several angstroms of the surface there is sufficient information in the electric potential to distinguish features and symmetries of DNA. Plots of the potential and equipotential surfaces, dominated by the phosphate charges, reflect the structural differences between the A, B, and Z conformations and, to a smaller extent, the difference between base sequences. As the distances from the helices increase, the magnitudes of the potentials decrease. However, the bases and sugars account for a larger fraction of the double helix potential with increasing distance. We have found that when the solvent is treated with the Debye-Huckel approximation, the potential decays more rapidly in every direction from the surface than it did in the concentric dielectric cylinder approximation. Images FIGURE 1 FIGURE 2 FIGURE 3 FIGURE 4 FIGURE 5 FIGURE 7 PMID:9199767

  11. Nucleotide excision repair deficient mouse models and neurological disease

    PubMed Central

    Niedernhofer, Laura J.

    2008-01-01

    Nucleotide excision repair (NER) is a highly conserved mechanism to remove helix-distorting DNA base damage. A major substrate for NER is DNA damage caused by environmental genotoxins, most notably ultraviolet radiation. Xeroderma pigmentosum, Cockayne syndrome and trichothiodystrophy are three human diseases caused by inherited defects in NER. The symptoms and severity of these diseases vary dramatically, ranging from profound developmental delay to cancer predisposition and accelerated aging. All three syndromes include neurological disease, indicating an important role for NER in protecting against spontaneous DNA damage as well. To study the pathophysiology caused by DNA damage, numerous mouse models of NER deficiency were generated by knocking-out genes required for NER or knocking-in disease-causing human mutations. This review explores the utility of these mouse models to study neurological disease caused by NER deficiency. PMID:18272436

  12. Three job stress models/concepts and oxidative DNA damage in a sample of workers in Japan.

    PubMed

    Inoue, Akiomi; Kawakami, Norito; Ishizaki, Masao; Tabata, Masaji; Tsuchiya, Masao; Akiyama, Miki; Kitazume, Akiko; Kuroda, Mitsuyo; Shimazu, Akihito

    2009-04-01

    Three job stress models/concepts (the job demands-control [DC] model, the effort-reward imbalance [ERI] model, and organizational justice) have been linked to coronary heart disease (CHD) at work. In recent years, oxidative DNA damage has been identified as a new risk factor for CHD. However, evidence for the association between these job stressors and oxidative DNA damage is limited. The present cross-sectional study investigated the association between these job stress models/concepts and oxidative DNA damage as a possible mediator of the adverse health effects of job stress. A total of 166 male and 51 female workers of a manufacturing factory in Japan were surveyed using a mailed questionnaire regarding job stressors and demographic, occupational, and lifestyle variables. Urinary concentrations of 8-hydroxy-2'-deoxyguanosine (8-OHdG), a biomarker of oxidative DNA damage, were also measured. In male subjects, the urinary concentrations of 8-OHdG were significantly higher among the group with lower interactional justice, one of the two components of organizational justice; however, no association was observed with the DC model or the ERI model. In female subjects, high job demands/control ratio was significantly and positively associated with the urinary concentrations of 8-OHdG. Interactional justice among male workers and the DC model-based strain among female workers may be associated with increased urinary concentrations of 8-OHdG which possibly reflects oxidative DNA damage.

  13. Study on the interaction of triadimenol with calf thymus DNA by multispectroscopic methods and molecular modeling

    NASA Astrophysics Data System (ADS)

    Zhang, Yepeng; Zhang, Guowen; Fu, Peng; Ma, Yadi; Zhou, Jia

    2012-10-01

    The binding mechanism of triadimenol (NOL) to calf thymus DNA (ctDNA) in physiological buffer (pH 7.4) was investigated by multispectroscopic methods including UV-vis absorption, fluorescence, circular dichroism (CD), Fourier transform infrared (FT-IR), and nuclear magnetic resonance (1H NMR) spectroscopy, coupled with viscosity measurements and atomic force microscopy (AFM) technique. The results suggested that NOL interacted with ctDNA by intercalation mode. CD and AFM assays showed that NOL can damage the base stacking of ctDNA and result in regional cleavage of the two DNA strands. FT-IR and 1H NMR spectra coupled with molecular docking revealed that a specific binding mainly exists between NOL and G-C base pairs of the ctDNA where two hydrogen bonds form. Moreover, the association constants of NOL with DNA at three different temperatures were determined to be in the 103 L mol-1 range. The calculated thermodynamic parameters suggested that the binding of NOL to ctDNA was driven mainly by hydrogen bond and van der Waals.

  14. Probing Conformational Changes in Human DNA Topoisomerase IIα by Pulsed Alkylation Mass Spectrometry*

    PubMed Central

    Chen, Yu-tsung; Collins, Tammy R. L.; Guan, Ziqiang; Chen, Vincent B.; Hsieh, Tao-Shih

    2012-01-01

    Type II topoisomerases are essential enzymes for solving DNA topological problems by passing one segment of DNA duplex through a transient double-strand break in a second segment. The reaction requires the enzyme to precisely control DNA cleavage and gate opening coupled with ATP hydrolysis. Using pulsed alkylation mass spectrometry, we were able to monitor the solvent accessibilities around 13 cysteines distributed throughout human topoisomerase IIα by measuring the thiol reactivities with monobromobimane. Most of the measured reactivities are in accordance with the predicted ones based on a homology structural model generated from available crystal structures. However, these results reveal new information for both the residues not covered in the structural model and potential differences between the modeled and solution holoenzyme structures. Furthermore, on the basis of the reactivity changes of several cysteines located at the N-gate and DNA gate, we could monitor the movement of topoisomerase II in the presence of cofactors and detect differences in the DNA gate between two closed clamp enzyme conformations locked by either 5′-adenylyl β,γ-imidodiphosphate or the anticancer drug ICRF-193. PMID:22679013

  15. Is DNA a worm-like chain in Couette flow? In search of persistence length, a critical review.

    PubMed

    Rittman, Martyn; Gilroy, Emma; Koohya, Hashem; Rodger, Alison; Richards, Adair

    2009-01-01

    Persistence length is the foremost measure of DNA flexibility. Its origins lie in polymer theory which was adapted for DNA following the determination of BDNA structure in 1953. There is no single definition of persistence length used, and the links between published definitions are based on assumptions which may, or may not be, clearly stated. DNA flexibility is affected by local ionic strength, solvent environment, bound ligands and intrinsic sequence-dependent flexibility. This article is a review of persistence length providing a mathematical treatment of the relationships between four definitions of persistence length, including: correlation, Kuhn length, bending, and curvature. Persistence length has been measured using various microscopy, force extension and solution methods such as linear dichroism and transient electric birefringence. For each experimental method a model of DNA is required to interpret the data. The importance of understanding the underlying models, along with the assumptions required by each definition to determine a value of persistence length, is highlighted for linear dichroism data, where it transpires that no model is currently available for long DNA or medium to high shear rate experiments.

  16. Persistence of bacterial DNA in orthopedic infections.

    PubMed

    Kaplan, Heidi B; Miranda, Justin A; Gogola, Gloria R; Gomez, Karen; Ambrose, Catherine G

    2018-06-01

    Polymerase chain reaction (PCR) has been proposed as a method to identify bacteria in clinical samples because it is more sensitive than culture techniques and can produce results rapidly. However, PCR can detect DNA from dead cells and thus cannot distinguish between live and dead cells in a tissue sample. Killed Staphylococcus aureus cells were implanted into the femurs and knee joints of rats to determine the length of time that DNA from dead cells is detectable in a living animal under conditions similar to common orthopedic infections. In the joint infection model studied here, the DNA from the dead planktonic bacteria was detected using PCR immediately after injection or 24 h later, but was undetectable 48 and 72 h after injection. In the biofilm implanted-device model studied, the DNA from these dead biofilm cells was detected by PCR immediately after implantation and at 24 h, but not at 48 or 72 h. Thus, our results indicate that DNA from dead cells does not persist in these animal model systems for more than 2 days, which should reduce concerns about possible false positive results using molecular DNA-based techniques for the detection of pathogens. Copyright © 2018. Published by Elsevier Inc.

  17. Noncanonical substrate preference of lambda exonuclease for 5'-nonphosphate-ended dsDNA and a mismatch-induced acceleration effect on the enzymatic reaction.

    PubMed

    Wu, Tongbo; Yang, Yufei; Chen, Wei; Wang, Jiayu; Yang, Ziyu; Wang, Shenlin; Xiao, Xianjin; Li, Mengyuan; Zhao, Meiping

    2018-04-06

    Lambda exonuclease (λ exo) plays an important role in the resection of DNA ends for DNA repair. Currently, it is also a widely used enzymatic tool in genetic engineering, DNA-binding protein mapping, nanopore sequencing and biosensing. Herein, we disclose two noncanonical properties of this enzyme and suggest a previously undescribed hydrophobic interaction model between λ exo and DNA substrates. We demonstrate that the length of the free portion of the substrate strand in the dsDNA plays an essential role in the initiation of digestion reactions by λ exo. A dsDNA with a 5' non-phosphorylated, two-nucleotide-protruding end can be digested by λ exo with very high efficiency. Moreover, we show that when a conjugated structure is covalently attached to an internal base of the dsDNA, the presence of a single mismatched base pair at the 5' side of the modified base may significantly accelerate the process of digestion by λ exo. A detailed comparison study revealed additional π-π stacking interactions between the attached label and the amino acid residues of the enzyme. These new findings not only broaden our knowledge of the enzyme but will also be very useful for research on DNA repair and in vitro processing of nucleic acids.

  18. DNA interaction with platinum-based cytostatics revealed by DNA sequencing.

    PubMed

    Smerkova, Kristyna; Vaculovic, Tomas; Vaculovicova, Marketa; Kynicky, Jindrich; Brtnicky, Martin; Eckschlager, Tomas; Stiborova, Marie; Hubalek, Jaromir; Adam, Vojtech

    2017-12-15

    The main mechanism of action of platinum-based cytostatic drugs - cisplatin, oxaliplatin and carboplatin - is the formation of DNA cross-links, which restricts the transcription due to the disability of DNA to enter the active site of the polymerase. The polymerase chain reaction (PCR) was employed as a simplified model of the amplification process in the cell nucleus. PCR with fluorescently labelled dideoxynucleotides commonly employed for DNA sequencing was used to monitor the effect of platinum-based cytostatics on DNA in terms of decrease in labeling efficiency dependent on a presence of the DNA-drug cross-link. It was found that significantly different amounts of the drugs - cisplatin (0.21 μg/mL), oxaliplatin (5.23 μg/mL), and carboplatin (71.11 μg/mL) - were required to cause the same quenching effect (50%) on the fluorescent labelling of 50 μg/mL of DNA. Moreover, it was found that even though the amounts of the drugs was applied to the reaction mixture differing by several orders of magnitude, the amount of incorporated platinum, quantified by inductively coupled plasma mass spectrometry, was in all cases at the level of tenths of μg per 5 μg of DNA. Copyright © 2017 Elsevier Inc. All rights reserved.

  19. A Novel Model System to Examine Agents Used in Breast Cancer Therapy.

    DTIC Science & Technology

    1995-07-01

    We have recently characterized a multiprotein DNA replication complex (MRC) that was purified from NODA NIB 468 human breast cancer cells by a series...proliferating cell nuclear antigen (PCNA), RE-C RP-A and DNA topoisomerase I. Based upon its requirements for DNA replication activity and its...SV4O) origin sequences, the MRC executes all of the steps required for the in vitro, bidirectional replication of the SV4O genome. Several of the DNA

  20. Direct inhibition of excision/synthesis DNA repair activities by cadmium: analysis on dedicated biochips.

    PubMed

    Candéias, S; Pons, B; Viau, M; Caillat, S; Sauvaigo, S

    2010-12-10

    The well established toxicity of cadmium and cadmium compounds results from their additive effects on several key cellular processes, including DNA repair. Mammalian cells have evolved several biochemical pathways to repair DNA lesions and maintain genomic integrity. By interfering with the homeostasis of redox metals and antioxidant systems, cadmium promotes the development of an intracellular environment that results in oxidative DNA damage which can be mutagenic if unrepaired. Small base lesions are recognised by specialized glycosylases and excised from the DNA molecule. The resulting abasic sites are incised, and the correct sequences restored by DNA polymerases using the opposite strands as template. Bulky lesions are recognised by a different set of proteins and excised from DNA as part of an oligonucleotide. As in base repair, the resulting gaps are filled by DNA polymerases using the opposite strands as template. Thus, these two repair pathways consist in excision of the lesion followed by DNA synthesis. In this study, we analysed in vitro the direct effects of cadmium exposure on the functionality of base and nucleotide DNA repair pathways. To this end, we used recently described dedicated microarrays that allow the parallel monitoring in cell extracts of the repair activities directed against several model base and/or nucleotide lesions. Both base and nucleotide excision/repair pathways are inhibited by CdCl₂, with different sensitivities. The inhibitory effects of cadmium affect mainly the recognition and excision stages of these processes. Furthermore, our data indicate that the repair activities directed against different damaged bases also exhibit distinct sensitivities, and the direct comparison of cadmium effects on the excision of uracile in different sequences even allows us to propose a hierarchy of cadmium sensibility within the glycosylases removing U from DNA. These results indicate that, in our experimental conditions, cadmium is a very potent DNA repair poison. Copyright © 2010 Elsevier B.V. All rights reserved.

  1. Nuclear aggregates of polyamines in a radiation-induced DNA damage model.

    PubMed

    Iacomino, Giuseppe; Picariello, Gianluca; Stillitano, Ilaria; D'Agostino, Luciano

    2014-02-01

    Polyamines (PA) are believed to protect DNA minimizing the effect of radiation damage either by inducing DNA compaction and aggregation or acting as scavengers of free radicals. Using an in vitro pDNA double strand breakage assay based on gel electrophoretic mobility, we compared the protective capability of PA against γ-radiation with that of compounds generated by the supramolecular self-assembly of nuclear polyamines and phosphates, named Nuclear Aggregates of Polyamines (NAPs). Both unassembled PA and in vitro produced NAPs (ivNAPs) were ineffective in conferring pDNA protection at the sub-mM concentration. Single PA showed an appreciable protective effect only at high (mM) concentrations. However, concentrations of spermine (4+) within a critical range (0.481 mM) induced pDNA precipitation, an event that was not observed with NAPs-pDNA interaction. We conclude that the interaction of individual PA is ineffective to assure DNA protection, simultaneously preserving the flexibility and charge density of the double strand. Furthermore, data obtained by testing polyamine and ivNAPS with the current radiation-induced DNA damage model support the concept that PA-phosphate aggregates are the only forms through which PA interact with DNA. Copyright © 2013 Elsevier Ltd. All rights reserved.

  2. Criminal genomic pragmatism: prisoners' representations of DNA technology and biosecurity.

    PubMed

    Machado, Helena; Silva, Susana

    2012-01-01

    Within the context of the use of DNA technology in crime investigation, biosecurity is perceived by different stakeholders according to their particular rationalities and interests. Very little is known about prisoners' perceptions and assessments of the uses of DNA technology in solving crime. To propose a conceptual model that serves to analyse and interpret prisoners' representations of DNA technology and biosecurity. A qualitative study using an interpretative approach based on 31 semi-structured tape-recorded interviews was carried out between May and September 2009, involving male inmates in three prisons located in the north of Portugal. The content analysis focused on the following topics: the meanings attributed to DNA and assessments of the risks and benefits of the uses of DNA technology and databasing in forensic applications. DNA was described as a record of identity, an exceptional material, and a powerful biometric identifier. The interviewees believed that DNA can be planted to incriminate suspects. Convicted offenders argued for the need to extend the criteria for the inclusion of DNA profiles in forensic databases and to restrict the removal of profiles. The conceptual model entitled criminal genomic pragmatism allows for an understanding of the views of prison inmates regarding DNA technology and biosecurity.

  3. An integrative model links multiple inputs and signaling pathways to the onset of DNA synthesis in hepatocytes

    PubMed Central

    Huard, Jérémy; Mueller, Stephanie; Gilles, Ernst D; Klingmüller, Ursula; Klamt, Steffen

    2012-01-01

    During liver regeneration, quiescent hepatocytes re-enter the cell cycle to proliferate and compensate for lost tissue. Multiple signals including hepatocyte growth factor, epidermal growth factor, tumor necrosis factor α, interleukin-6, insulin and transforming growth factor β orchestrate these responses and are integrated during the G1 phase of the cell cycle. To investigate how these inputs influence DNA synthesis as a measure for proliferation, we established a large-scale integrated logical model connecting multiple signaling pathways and the cell cycle. We constructed our model based upon established literature knowledge, and successively improved and validated its structure using hepatocyte-specific literature as well as experimental DNA synthesis data. Model analyses showed that activation of the mitogen-activated protein kinase and phosphatidylinositol 3-kinase pathways was sufficient and necessary for triggering DNA synthesis. In addition, we identified key species in these pathways that mediate DNA replication. Our model predicted oncogenic mutations that were compared with the COSMIC database, and proposed intervention targets to block hepatocyte growth factor-induced DNA synthesis, which we validated experimentally. Our integrative approach demonstrates that, despite the complexity and size of the underlying interlaced network, logical modeling enables an integrative understanding of signaling-controlled proliferation at the cellular level, and thus can provide intervention strategies for distinct perturbation scenarios at various regulatory levels. PMID:22443451

  4. Molecular modelling study of changes induced by netropsin binding to nucleosome core particles.

    PubMed Central

    Pérez, J J; Portugal, J

    1990-01-01

    It is well known that certain sequence-dependent modulators in structure appear to determine the rotational positioning of DNA on the nucleosome core particle. That preference is rather weak and could be modified by some ligands as netropsin, a minor-groove binding antibiotic. We have undertaken a molecular modelling approach to calculate the relative energy of interaction between a DNA molecule and the protein core particle. The histones particle is considered as a distribution of positive charges on the protein surface that interacts with the DNA molecule. The molecular electrostatic potentials for the DNA, simulated as a discontinuous cylinder, were calculated using the values for all the base pairs. Computing these parameters, we calculated the relative energy of interaction and the more stable rotational setting of DNA. The binding of four molecules of netropsin to this model showed that a new minimum of energy is obtained when the DNA turns toward the protein surface by about 180 degrees, so a new energetically favoured structure appears where netropsin binding sites are located facing toward the histones surface. The effect of netropsin could be explained in terms of an induced change in the phasing of DNA on the core particle. The induced rotation is considered to optimize non-bonded contacts between the netropsin molecules and the DNA backbone. PMID:2165249

  5. Performing SELEX experiments in silico

    NASA Astrophysics Data System (ADS)

    Wondergem, J. A. J.; Schiessel, H.; Tompitak, M.

    2017-11-01

    Due to the sequence-dependent nature of the elasticity of DNA, many protein-DNA complexes and other systems in which DNA molecules must be deformed have preferences for the type of DNA sequence they interact with. SELEX (Systematic Evolution of Ligands by EXponential enrichment) experiments and similar sequence selection experiments have been used extensively to examine the (indirect readout) sequence preferences of, e.g., nucleosomes (protein spools around which DNA is wound for compactification) and DNA rings. We show how recently developed computational and theoretical tools can be used to emulate such experiments in silico. Opening up this possibility comes with several benefits. First, it allows us a better understanding of our models and systems, specifically about the roles played by the simulation temperature and the selection pressure on the sequences. Second, it allows us to compare the predictions made by the model of choice with experimental results. We find agreement on important features between predictions of the rigid base-pair model and experimental results for DNA rings and interesting differences that point out open questions in the field. Finally, our simulations allow application of the SELEX methodology to systems that are experimentally difficult to realize because they come with high energetic costs and are therefore unlikely to form spontaneously, such as very short or overwound DNA rings.

  6. Qualitative and quantitative assessment of DNA quality of frozen beef based on DNA yield, gel electrophoresis and PCR amplification and their correlations to beef quality.

    PubMed

    Zhao, Jing; Zhang, Ting; Liu, Yongfeng; Wang, Xingyu; Zhang, Lan; Ku, Ting; Quek, Siew Young

    2018-09-15

    Freezing is a practical method for meat preservation but the quality of frozen meat can deteriorate with storage time. This research investigated the effect of frozen storage time (up to 66 months) on changes in DNA yield, purity and integrity in beef, and further analyzed the correlation between beef quality (moisture content, protein content, TVB-N value and pH value) and DNA quality in an attempt to establish a reliable, high-throughput method for meat quality control. Results showed that frozen storage time influenced the yield and integrity of DNA significantly (p < 0.05). The DNA yield decreased as frozen storage time increased due to DNA degradation. The half-life (t 1/2  = ln2/0.015) was calculated as 46 months. The DNA quality degraded dramatically with the increased storage time based on gel electrophoresis results. Polymerase chain reaction (PCR) products from both mitochondrial DNA (mtDNA) and nuclear DNA (nDNA) were observed in all frozen beef samples. Using real-time PCR for quantitative assessment of DNA and meat quality revealed that correlations could be established successfully with mathematical models to evaluate frozen beef quality. Copyright © 2018 Elsevier Ltd. All rights reserved.

  7. Identification of small molecules capable of regulating conformational changes of telomeric G-quadruplex

    NASA Astrophysics Data System (ADS)

    Chen, Shuo-Bin; Liu, Guo-Cai; Gu, Lian-Quan; Huang, Zhi-Shu; Tan, Jia-Heng

    2018-02-01

    Design of small molecules targeted at human telomeric G-quadruplex DNA is an extremely active research area. Interestingly, the telomeric G-quadruplex is a highly polymorphic structure. Changes in its conformation upon small molecule binding may be a powerful method to achieve a desired biological effect. However, the rational development of small molecules capable of regulating conformational change of telomeric G-quadruplex structures is still challenging. In this study, we developed a reliable ligand-based pharmacophore model based on isaindigotone derivatives with conformational change activity toward telomeric G-quadruplex DNA. Furthermore, virtual screening of database was conducted using this pharmacophore model and benzopyranopyrimidine derivatives in the database were identified as a strong inducer of the telomeric G-quadruplex DNA conformation, transforming it from hybrid-type structure to parallel structure.

  8. The effects of temperature and magnetic flux on electron transport through a four-channel DNA model

    NASA Astrophysics Data System (ADS)

    Lee, Sunhee; Hedin, Eric; Joe, Yong

    2010-03-01

    The temperature dependence of the conductivity of lambda phage DNA has been measured by Tran et al [1] experimentally, where the conductivity displayed strong (weak) temperature dependence above (below) a threshold temperature. In order to understand the temperature effects of electron transport theoretically, we study a two-dimensional and four-channel DNA model using a tight-binding (TB) Hamiltonian. The thermal effects within a TB model are incorporated into the hopping integral and the relative twist angle from its equilibrium value between base-pairs. Since these thermal structural fluctuations localize the electronic wave functions in DNA, we examine a temperature-dependent localization length, a temperature-driven transmission, and current-voltage characteristics in this system. In addition, we incorporate magnetic field effects into the analysis of the transmission through DNA in order to modulate the quantum interference between the electron paths that comprise the 4-channel structure. [1] P. Tran, B. Alavi, and G. Gruner, PRL 85, 1564 (2000).

  9. Differential Deformability of the DNA Minor Groove and Altered BI/BII Backbone Conformational Equilibrium by the Monovalent Ions Li+, Na+, K+ and Rb+ via Water-Mediated Hydrogen Bonding

    PubMed Central

    Savelyev, Alexey; MacKerell, Alexander D.

    2015-01-01

    Recently, we reported the differential impact of the monovalent cations Li+, Na+, K+ and Rb+ on DNA conformational properties. These were identified from variations in the calculated solution-state X-ray DNA spectra as a function of the ion type in the solvation buffer in MD simulations using our recently developed polarizable force field based on the classical Drude oscillator. Changes in the DNA structure were found to mainly involve variations in the minor groove width. Because minor groove dimensions vary significantly in protein-DNA complexes and have been shown to play a critical role in both specific and nonspecific DNA readout, understanding the origins of the observed differential DNA modulation by the first-group monovalent ions is of great biological importance. In the present study we show that the primary microscopic mechanism for the phenomenon is the formation of the water-mediated hydrogen bonds between solvated cations located inside the minor groove and simultaneously to two DNA strands, a process whose intensity and impact on DNA structure depends on both the type of the ion and DNA sequence. Additionally, it is shown that formation of such ion-DNA hydrogen bond complexes appreciably modulates the conformation of the backbone by increasing the population of the BII substate. Notably, the differential impact of the ions on DNA conformational behavior is only predicted by the Drude polarizable model for DNA, with virtually no effect observed from MD simulations utilizing the additive CHARMM36 model. Analysis of dipole moments of the water shows the Drude SWM4 model to possess high sensitivity to changes in the local environment, which indicates the important role of electronic polarization in the salt-dependent conformational properties. This also suggests that inclusion of polarization effects is required to model even relatively simple biological systems such as DNA in various ionic solutions. PMID:26575937

  10. MethLAB: a graphical user interface package for the analysis of array-based DNA methylation data.

    PubMed

    Kilaru, Varun; Barfield, Richard T; Schroeder, James W; Smith, Alicia K; Conneely, Karen N

    2012-03-01

    Recent evidence suggests that DNA methylation changes may underlie numerous complex traits and diseases. The advent of commercial, array-based methods to interrogate DNA methylation has led to a profusion of epigenetic studies in the literature. Array-based methods, such as the popular Illumina GoldenGate and Infinium platforms, estimate the proportion of DNA methylated at single-base resolution for thousands of CpG sites across the genome. These arrays generate enormous amounts of data, but few software resources exist for efficient and flexible analysis of these data. We developed a software package called MethLAB (http://genetics.emory.edu/conneely/MethLAB) using R, an open source statistical language that can be edited to suit the needs of the user. MethLAB features a graphical user interface (GUI) with a menu-driven format designed to efficiently read in and manipulate array-based methylation data in a user-friendly manner. MethLAB tests for association between methylation and relevant phenotypes by fitting a separate linear model for each CpG site. These models can incorporate both continuous and categorical phenotypes and covariates, as well as fixed or random batch or chip effects. MethLAB accounts for multiple testing by controlling the false discovery rate (FDR) at a user-specified level. Standard output includes a spreadsheet-ready text file and an array of publication-quality figures. Considering the growing interest in and availability of DNA methylation data, there is a great need for user-friendly open source analytical tools. With MethLAB, we present a timely resource that will allow users with no programming experience to implement flexible and powerful analyses of DNA methylation data.

  11. [Study of Cervical Exfoliated Cell's DNA Quantitative Analysis Based on Multi-Spectral Imaging Technology].

    PubMed

    Wu, Zheng; Zeng, Li-bo; Wu, Qiong-shui

    2016-02-01

    The conventional cervical cancer screening methods mainly include TBS (the bethesda system) classification method and cellular DNA quantitative analysis, however, by using multiple staining method in one cell slide, which is staining the cytoplasm with Papanicolaou reagent and the nucleus with Feulgen reagent, the study of achieving both two methods in the cervical cancer screening at the same time is still blank. Because the difficulty of this multiple staining method is that the absorbance of the non-DNA material may interfere with the absorbance of DNA, so that this paper has set up a multi-spectral imaging system, and established an absorbance unmixing model by using multiple linear regression method based on absorbance's linear superposition character, and successfully stripped out the absorbance of DNA to run the DNA quantitative analysis, and achieved the perfect combination of those two kinds of conventional screening method. Through a series of experiment we have proved that between the absorbance of DNA which is calculated by the absorbance unmixxing model and the absorbance of DNA which is measured there is no significant difference in statistics when the test level is 1%, also the result of actual application has shown that there is no intersection between the confidence interval of the DNA index of the tetraploid cells which are screened by using this paper's analysis method when the confidence level is 99% and the DNA index's judging interval of cancer cells, so that the accuracy and feasibility of the quantitative DNA analysis with multiple staining method expounded by this paper have been verified, therefore this analytical method has a broad application prospect and considerable market potential in early diagnosis of cervical cancer and other cancers.

  12. Polymer brush coatings for DNA: fundamental polymer physics and nanofabrication applications

    NASA Astrophysics Data System (ADS)

    de Vries, Renko

    Recombinant DNA technology allows for the production of precisely defined self-assembling protein-based polymers. So far, the major applications for such protein-based polymers have been self-assembling hydrogels and micellar structures with biomedical application. Inspired by minimal models for the self-ssembly of rod-shaped viruses such as the tobacco mosaic virus, I have developed protein-polymers that co-assemble with DNA into rod-shaped virus-like particles, and protein-polymers that provide brush coatings around single DNA molecules. In this presentation I will focus on the latter, showing that on the one hand brush coated DNA is a rich model system for exploring the physics of bottle-brush polymers, while on the other hand brush coatings of DNA can also play an important practical role in nanofabrication. A key problem in the physics of bottle-brush polymers that I will address is the scale-dependence of bottle-brush elasticity. For long-wavelength thermal deformations probed by AFM imaging I will demonstrate that there is significant stiffening due to the brush coating, while for short wavelength thermal deformations probed by force spectroscopy, we find that stiffening due to the brush coating disappears completely. DNA brush coatings can also play an important practical role in nanofabrication by acting as a compatibilizer between chemically different building blocks. I will explore the example of DNA origami in combination with gold nanoparticles: while Mg2+ ions and high concentrations of monovalent salts are crucial for the stability of DNA origami, such solution conditions are typically incompatible with the colloidal stability of gold nanoparticles.I will show how DNA brush coatings can dramatically enhance the yield of formation of isolated DNA-gold nanoparticle composite nanostructures.

  13. Quantum-mechanical analysis of the energetic contributions to π stacking in nucleic acids versus rise, twist, and slide.

    PubMed

    Parker, Trent M; Hohenstein, Edward G; Parrish, Robert M; Hud, Nicholas V; Sherrill, C David

    2013-01-30

    Symmetry-adapted perturbation theory (SAPT) is applied to pairs of hydrogen-bonded nucleobases to obtain the energetic components of base stacking (electrostatic, exchange-repulsion, induction/polarization, and London dispersion interactions) and how they vary as a function of the helical parameters Rise, Twist, and Slide. Computed average values of Rise and Twist agree well with experimental data for B-form DNA from the Nucleic Acids Database, even though the model computations omitted the backbone atoms (suggesting that the backbone in B-form DNA is compatible with having the bases adopt their ideal stacking geometries). London dispersion forces are the most important attractive component in base stacking, followed by electrostatic interactions. At values of Rise typical of those in DNA (3.36 Å), the electrostatic contribution is nearly always attractive, providing further evidence for the importance of charge-penetration effects in π-π interactions (a term neglected in classical force fields). Comparison of the computed stacking energies with those from model complexes made of the "parent" nucleobases purine and 2-pyrimidone indicates that chemical substituents in DNA and RNA account for 20-40% of the base-stacking energy. A lack of correspondence between the SAPT results and experiment for Slide in RNA base-pair steps suggests that the backbone plays a larger role in determining stacking geometries in RNA than in B-form DNA. In comparisons of base-pair steps with thymine versus uracil, the thymine methyl group tends to enhance the strength of the stacking interaction through a combination of dispersion and electrosatic interactions.

  14. Fluorescence studies with DNA probes: dynamic aspects of DNA structure and DNA-protein interactions

    NASA Astrophysics Data System (ADS)

    Millar, David P.; Carver, Theodore E.

    1994-08-01

    Time-resolved fluorescence measurements of optical probes incorporated at specific sites in DNA provides a new approach to studies of DNA structure and DNA:protein interactions. This approach can be used to study complex multi-state behavior, such as the folding of DNA into alternative higher order structures or the transfer of DNA between multiple binding sites on a protein. In this study, fluorescence anisotropy decay of an internal dansyl probe attached to 17/27-mer oligonucleotides was used to monitor the distribution of DNA 3' termini bound at either the polymerase of 3' to 5' exonuclease sites of the Klenow fragment of DNA polymerase I. Partitioning of the primer terminus between the two active sites of the enzyme resulted in a heterogeneous probe environment, reflected in the associative behavior of the fluorescence anisotropy decay. Analysis of the anisotropy decay with a two state model of solvent-exposed and protein-associated dansyl probes was used to determine the fraction of DNA bound at each site. We examined complexes of Klenow fragment with DNAs containing various base mismatches. Single mismatches at the primer terminus caused a 3-fold increase in the equilibrium partitioning of DNA into the exonuclease site, while two or more consecutive G:G mismatches caused the DNA to bind exclusively at the exonuclease site, with a partitioning constant at least 250- fold greater than that of the corresponding matched DNA sequence. Internal single mismatches located up to four bases from the primer terminus produced larger effects than the same mismatch at the primer terminus. These results provide insight into the recognition mechanisms that enable DNA polymerases to proofread misincorporated bases during DNA replication.

  15. No Genetic Influence for Childhood Behavior Problems From DNA Analysis

    PubMed Central

    Trzaskowski, Maciej; Dale, Philip S.; Plomin, Robert

    2013-01-01

    Objective Twin studies of behavior problems in childhood point to substantial genetic influence. It is now possible to estimate genetic influence using DNA alone in samples of unrelated individuals, not relying on family-based designs such as twins. A linear mixed model, which incorporates DNA microarray data, has confirmed twin results by showing substantial genetic influence for diverse traits in adults. Here we present direct comparisons between twin and DNA heritability estimates for childhood behavior problems as rated by parents, teachers, and children themselves. Method Behavior problem data from 2,500 UK-representative 12-year-old twin pairs were used in twin analyses; DNA analyses were based on 1 member of the twin pair with genotype data for 1.7 million DNA markers. Diverse behavior problems were assessed, including autistic, depressive, and hyperactive symptoms. Genetic influence from DNA was estimated using genome-wide complex trait analysis (GCTA), and the twin estimates of heritability were based on standard twin model fitting. Results Behavior problems in childhood—whether rated by parents, teachers, or children themselves—show no significant genetic influence using GCTA, even though twin study estimates of heritability are substantial in the same sample, and even though both GCTA and twin study estimates of genetic influence are substantial for cognitive and anthropometric traits. Conclusions We suggest that this new type of “missing heritability,” that is, the gap between GCTA and twin study estimates for behavior problems in childhood, is due to nonadditive genetic influence, which will make it more difficult to identify genes responsible for heritability. PMID:24074471

  16. DNA dynamics in aqueous solution: opening the double helix

    NASA Technical Reports Server (NTRS)

    Pohorille, A.; Ross, W. S.; Tinoco, I. Jr; MacElroy, R. D. (Principal Investigator)

    1990-01-01

    The opening of a DNA base pair is a simple reaction that is a prerequisite for replication, transcription, and other vital biological functions. Understanding the molecular mechanisms of biological reactions is crucial for predicting and, ultimately, controlling them. Realistic computer simulations of the reactions can provide the needed understanding. To model even the simplest reaction in aqueous solution requires hundreds of hours of supercomputing time. We have used molecular dynamics techniques to simulate fraying of the ends of a six base pair double strand of DNA, [TCGCGA]2, where the four bases of DNA are denoted by T (thymine), C (cytosine), G (guanine), and A (adenine), and to estimate the free energy barrier to this process. The calculations, in which the DNA was surrounded by 2,594 water molecules, required 50 hours of CRAY-2 CPU time for every simulated 100 picoseconds. A free energy barrier to fraying, which is mainly characterized by the movement of adenine away from thymine into aqueous environment, was estimated to be 4 kcal/mol. Another fraying pathway, which leads to stacking between terminal adenine and thymine, was also observed. These detailed pictures of the motions and energetics of DNA base pair opening in water are a first step toward understanding how DNA will interact with any molecule.

  17. A Molecular Dynamics-Quantum Mechanics Theoretical Study of DNA-Mediated Charge Transport in Hydrated Ionic Liquids.

    PubMed

    Meng, Zhenyu; Kubar, Tomas; Mu, Yuguang; Shao, Fangwei

    2018-05-08

    Charge transport (CT) through biomolecules is of high significance in the research fields of biology, nanotechnology, and molecular devices. Inspired by our previous work that showed the binding of ionic liquid (IL) facilitated charge transport in duplex DNA, in silico simulation is a useful means to understand the microscopic mechanism of the facilitation phenomenon. Here molecular dynamics simulations (MD) of duplex DNA in water and hydrated ionic liquids were employed to explore the helical parameters. Principal component analysis was further applied to capture the subtle conformational changes of helical DNA upon different environmental impacts. Sequentially, CT rates were calculated by a QM/MM simulation of the flickering resonance model based upon MD trajectories. Herein, MD simulation illustrated that the binding of ionic liquids can restrain dynamic conformation and lower the on-site energy of the DNA base. Confined movement among the adjacent base pairs was highly related to the increase of electronic coupling among base pairs, which may lead DNA to a CT facilitated state. Sequentially combining MD and QM/MM analysis, the rational correlations among the binding modes, the conformational changes, and CT rates illustrated the facilitation effects from hydrated IL on DNA CT and supported a conformational-gating mechanism.

  18. Impact of Heterogeneity and Lattice Bond Strength on DNA Triangle Crystal Growth.

    PubMed

    Stahl, Evi; Praetorius, Florian; de Oliveira Mann, Carina C; Hopfner, Karl-Peter; Dietz, Hendrik

    2016-09-07

    One key goal of DNA nanotechnology is the bottom-up construction of macroscopic crystalline materials. Beyond applications in fields such as photonics or plasmonics, DNA-based crystal matrices could possibly facilitate the diffraction-based structural analysis of guest molecules. Seeman and co-workers reported in 2009 the first designed crystal matrices based on a 38 kDa DNA triangle that was composed of seven chains. The crystal lattice was stabilized, unprecedentedly, by Watson-Crick base pairing. However, 3D crystallization of larger designed DNA objects that include more chains such as DNA origami remains an unsolved problem. Larger objects would offer more degrees of freedom and design options with respect to tailoring lattice geometry and for positioning other objects within a crystal lattice. The greater rigidity of multilayer DNA origami could also positively influence the diffractive properties of crystals composed of such particles. Here, we rationally explore the role of heterogeneity and Watson-Crick interaction strengths in crystal growth using 40 variants of the original DNA triangle as model multichain objects. Crystal growth of the triangle was remarkably robust despite massive chemical, geometrical, and thermodynamical sample heterogeneity that we introduced, but the crystal growth sensitively depended on the sequences of base pairs next to the Watson-Crick sticky ends of the triangle. Our results point to weak lattice interactions and high concentrations as decisive factors for achieving productive crystallization, while sample heterogeneity and impurities played a minor role.

  19. Modeling the Sensitivity of Field Surveys for Detection of Environmental DNA (eDNA)

    PubMed Central

    Schultz, Martin T.; Lance, Richard F.

    2015-01-01

    The environmental DNA (eDNA) method is the practice of collecting environmental samples and analyzing them for the presence of a genetic marker specific to a target species. Little is known about the sensitivity of the eDNA method. Sensitivity is the probability that the target marker will be detected if it is present in the water body. Methods and tools are needed to assess the sensitivity of sampling protocols, design eDNA surveys, and interpret survey results. In this study, the sensitivity of the eDNA method is modeled as a function of ambient target marker concentration. The model accounts for five steps of sample collection and analysis, including: 1) collection of a filtered water sample from the source; 2) extraction of DNA from the filter and isolation in a purified elution; 3) removal of aliquots from the elution for use in the polymerase chain reaction (PCR) assay; 4) PCR; and 5) genetic sequencing. The model is applicable to any target species. For demonstration purposes, the model is parameterized for bighead carp (Hypophthalmichthys nobilis) and silver carp (H. molitrix) assuming sampling protocols used in the Chicago Area Waterway System (CAWS). Simulation results show that eDNA surveys have a high false negative rate at low concentrations of the genetic marker. This is attributed to processing of water samples and division of the extraction elution in preparation for the PCR assay. Increases in field survey sensitivity can be achieved by increasing sample volume, sample number, and PCR replicates. Increasing sample volume yields the greatest increase in sensitivity. It is recommended that investigators estimate and communicate the sensitivity of eDNA surveys to help facilitate interpretation of eDNA survey results. In the absence of such information, it is difficult to evaluate the results of surveys in which no water samples test positive for the target marker. It is also recommended that invasive species managers articulate concentration-based sensitivity objectives for eDNA surveys. In the absence of such information, it is difficult to design appropriate sampling protocols. The model provides insights into how sampling protocols can be designed or modified to achieve these sensitivity objectives. PMID:26509674

  20. Modeling the Sensitivity of Field Surveys for Detection of Environmental DNA (eDNA).

    PubMed

    Schultz, Martin T; Lance, Richard F

    2015-01-01

    The environmental DNA (eDNA) method is the practice of collecting environmental samples and analyzing them for the presence of a genetic marker specific to a target species. Little is known about the sensitivity of the eDNA method. Sensitivity is the probability that the target marker will be detected if it is present in the water body. Methods and tools are needed to assess the sensitivity of sampling protocols, design eDNA surveys, and interpret survey results. In this study, the sensitivity of the eDNA method is modeled as a function of ambient target marker concentration. The model accounts for five steps of sample collection and analysis, including: 1) collection of a filtered water sample from the source; 2) extraction of DNA from the filter and isolation in a purified elution; 3) removal of aliquots from the elution for use in the polymerase chain reaction (PCR) assay; 4) PCR; and 5) genetic sequencing. The model is applicable to any target species. For demonstration purposes, the model is parameterized for bighead carp (Hypophthalmichthys nobilis) and silver carp (H. molitrix) assuming sampling protocols used in the Chicago Area Waterway System (CAWS). Simulation results show that eDNA surveys have a high false negative rate at low concentrations of the genetic marker. This is attributed to processing of water samples and division of the extraction elution in preparation for the PCR assay. Increases in field survey sensitivity can be achieved by increasing sample volume, sample number, and PCR replicates. Increasing sample volume yields the greatest increase in sensitivity. It is recommended that investigators estimate and communicate the sensitivity of eDNA surveys to help facilitate interpretation of eDNA survey results. In the absence of such information, it is difficult to evaluate the results of surveys in which no water samples test positive for the target marker. It is also recommended that invasive species managers articulate concentration-based sensitivity objectives for eDNA surveys. In the absence of such information, it is difficult to design appropriate sampling protocols. The model provides insights into how sampling protocols can be designed or modified to achieve these sensitivity objectives.

  1. A sequence-dependent rigid-base model of DNA

    NASA Astrophysics Data System (ADS)

    Gonzalez, O.; Petkevičiutė, D.; Maddocks, J. H.

    2013-02-01

    A novel hierarchy of coarse-grain, sequence-dependent, rigid-base models of B-form DNA in solution is introduced. The hierarchy depends on both the assumed range of energetic couplings, and the extent of sequence dependence of the model parameters. A significant feature of the models is that they exhibit the phenomenon of frustration: each base cannot simultaneously minimize the energy of all of its interactions. As a consequence, an arbitrary DNA oligomer has an intrinsic or pre-existing stress, with the level of this frustration dependent on the particular sequence of the oligomer. Attention is focussed on the particular model in the hierarchy that has nearest-neighbor interactions and dimer sequence dependence of the model parameters. For a Gaussian version of this model, a complete coarse-grain parameter set is estimated. The parameterized model allows, for an oligomer of arbitrary length and sequence, a simple and explicit construction of an approximation to the configuration-space equilibrium probability density function for the oligomer in solution. The training set leading to the coarse-grain parameter set is itself extracted from a recent and extensive database of a large number of independent, atomic-resolution molecular dynamics (MD) simulations of short DNA oligomers immersed in explicit solvent. The Kullback-Leibler divergence between probability density functions is used to make several quantitative assessments of our nearest-neighbor, dimer-dependent model, which is compared against others in the hierarchy to assess various assumptions pertaining both to the locality of the energetic couplings and to the level of sequence dependence of its parameters. It is also compared directly against all-atom MD simulation to assess its predictive capabilities. The results show that the nearest-neighbor, dimer-dependent model can successfully resolve sequence effects both within and between oligomers. For example, due to the presence of frustration, the model can successfully predict the nonlocal changes in the minimum energy configuration of an oligomer that are consequent upon a local change of sequence at the level of a single point mutation.

  2. A sequence-dependent rigid-base model of DNA.

    PubMed

    Gonzalez, O; Petkevičiūtė, D; Maddocks, J H

    2013-02-07

    A novel hierarchy of coarse-grain, sequence-dependent, rigid-base models of B-form DNA in solution is introduced. The hierarchy depends on both the assumed range of energetic couplings, and the extent of sequence dependence of the model parameters. A significant feature of the models is that they exhibit the phenomenon of frustration: each base cannot simultaneously minimize the energy of all of its interactions. As a consequence, an arbitrary DNA oligomer has an intrinsic or pre-existing stress, with the level of this frustration dependent on the particular sequence of the oligomer. Attention is focussed on the particular model in the hierarchy that has nearest-neighbor interactions and dimer sequence dependence of the model parameters. For a Gaussian version of this model, a complete coarse-grain parameter set is estimated. The parameterized model allows, for an oligomer of arbitrary length and sequence, a simple and explicit construction of an approximation to the configuration-space equilibrium probability density function for the oligomer in solution. The training set leading to the coarse-grain parameter set is itself extracted from a recent and extensive database of a large number of independent, atomic-resolution molecular dynamics (MD) simulations of short DNA oligomers immersed in explicit solvent. The Kullback-Leibler divergence between probability density functions is used to make several quantitative assessments of our nearest-neighbor, dimer-dependent model, which is compared against others in the hierarchy to assess various assumptions pertaining both to the locality of the energetic couplings and to the level of sequence dependence of its parameters. It is also compared directly against all-atom MD simulation to assess its predictive capabilities. The results show that the nearest-neighbor, dimer-dependent model can successfully resolve sequence effects both within and between oligomers. For example, due to the presence of frustration, the model can successfully predict the nonlocal changes in the minimum energy configuration of an oligomer that are consequent upon a local change of sequence at the level of a single point mutation.

  3. Resistance to Nucleotide Excision Repair of Bulky Guanine Adducts Opposite Abasic Sites in DNA Duplexes and Relationships between Structure and Function

    PubMed Central

    Liu, Zhi; Ding, Shuang; Kropachev, Konstantin; Lei, Jia; Amin, Shantu; Broyde, Suse; Geacintov, Nicholas E.

    2015-01-01

    The nucleotide excision repair of certain bulky DNA lesions is abrogated in some specific non-canonical DNA base sequence contexts, while the removal of the same lesions by the nucleotide excision repair mechanism is efficient in duplexes in which all base pairs are complementary. Here we show that the nucleotide excision repair activity in human cell extracts is moderate-to-high in the case of two stereoisomeric DNA lesions derived from the pro-carcinogen benzo[a]pyrene (cis- and trans-B[a]P-N 2-dG adducts) in a normal DNA duplex. By contrast, the nucleotide excision repair activity is completely abrogated when the canonical cytosine base opposite the B[a]P-dG adducts is replaced by an abasic site in duplex DNA. However, base excision repair of the abasic site persists. In order to understand the structural origins of these striking phenomena, we used NMR and molecular spectroscopy techniques to evaluate the conformational features of 11mer DNA duplexes containing these B[a]P-dG lesions opposite abasic sites. Our results show that in these duplexes containing the clustered lesions, both B[a]P-dG adducts adopt base-displaced intercalated conformations, with the B[a]P aromatic rings intercalated into the DNA helix. To explain the persistence of base excision repair in the face of the opposed bulky B[a]P ring system, molecular modeling results suggest how the APE1 base excision repair endonuclease, that excises abasic lesions, can bind productively even with the trans-B[a]P-dG positioned opposite the abasic site. We hypothesize that the nucleotide excision repair resistance is fostered by local B[a]P residue—DNA base stacking interactions at the abasic sites, that are facilitated by the absence of the cytosine partner base in the complementary strand. More broadly, this study sets the stage for elucidating the interplay between base excision and nucleotide excision repair in processing different types of clustered DNA lesions that are substrates of nucleotide excision repair or base excision repair mechanisms. PMID:26340000

  4. The intrinsic combinatorial organization and information theoretic content of a sequence are correlated to the DNA encoded nucleosome organization of eukaryotic genomes.

    PubMed

    Utro, Filippo; Di Benedetto, Valeria; Corona, Davide F V; Giancarlo, Raffaele

    2016-03-15

    Thanks to research spanning nearly 30 years, two major models have emerged that account for nucleosome organization in chromatin: statistical and sequence specific. The first is based on elegant, easy to compute, closed-form mathematical formulas that make no assumptions of the physical and chemical properties of the underlying DNA sequence. Moreover, they need no training on the data for their computation. The latter is based on some sequence regularities but, as opposed to the statistical model, it lacks the same type of closed-form formulas that, in this case, should be based on the DNA sequence only. We contribute to close this important methodological gap between the two models by providing three very simple formulas for the sequence specific one. They are all based on well-known formulas in Computer Science and Bioinformatics, and they give different quantifications of how complex a sequence is. In view of how remarkably well they perform, it is very surprising that measures of sequence complexity have not even been considered as candidates to close the mentioned gap. We provide experimental evidence that the intrinsic level of combinatorial organization and information-theoretic content of subsequences within a genome are strongly correlated to the level of DNA encoded nucleosome organization discovered by Kaplan et al Our results establish an important connection between the intrinsic complexity of subsequences in a genome and the intrinsic, i.e. DNA encoded, nucleosome organization of eukaryotic genomes. It is a first step towards a mathematical characterization of this latter 'encoding'. Supplementary data are available at Bioinformatics online. futro@us.ibm.com. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  5. Comparison of direct DNA strand breaks induced by low energy electrons with different inelastic cross sections

    NASA Astrophysics Data System (ADS)

    Li, Jun-Li; Li, Chun-Yan; Qiu, Rui; Yan, Cong-Chong; Xie, Wen-Zhang; Zeng, Zhi; Tung, Chuan-Jong

    2013-09-01

    In order to study the influence of inelastic cross sections on the simulation of direct DNA strand breaks induced by low energy electrons, six different sets of inelastic cross section data were calculated and loaded into the Geant4-DNA code to calculate the DNA strand break yields under the same conditions. The six sets of the inelastic cross sections were calculated by applying the dielectric function method of Emfietzoglou's optical-data treatments, with two different optical datasets and three different dispersion models, using the same Born corrections. Results show that the inelastic cross sections have a notable influence on the direct DNA strand break yields. The yields simulated with the inelastic cross sections based on Hayashi's optical data are greater than those based on Heller's optical data. The discrepancies are about 30-45% for the single strand break yields and 45-80% for the double strand break yields. Among the yields simulated with cross sections of the three different dispersion models, generally the greatest are those of the extended-Drude dispersion model, the second are those of the extended-oscillator-Drude dispersion model, and the last are those of the Ashley's δ-oscillator dispersion model. For the single strand break yields, the differences between the first two are very little and the differences between the last two are about 6-57%. For the double strand break yields, the biggest difference between the first two can be about 90% and the differences between the last two are about 17-70%.

  6. DNA viewed as an out-of-equilibrium structure

    NASA Astrophysics Data System (ADS)

    Provata, A.; Nicolis, C.; Nicolis, G.

    2014-05-01

    The complexity of the primary structure of human DNA is explored using methods from nonequilibrium statistical mechanics, dynamical systems theory, and information theory. A collection of statistical analyses is performed on the DNA data and the results are compared with sequences derived from different stochastic processes. The use of χ2 tests shows that DNA can not be described as a low order Markov chain of order up to r =6. Although detailed balance seems to hold at the level of a binary alphabet, it fails when all four base pairs are considered, suggesting spatial asymmetry and irreversibility. Furthermore, the block entropy does not increase linearly with the block size, reflecting the long-range nature of the correlations in the human genomic sequences. To probe locally the spatial structure of the chain, we study the exit distances from a specific symbol, the distribution of recurrence distances, and the Hurst exponent, all of which show power law tails and long-range characteristics. These results suggest that human DNA can be viewed as a nonequilibrium structure maintained in its state through interactions with a constantly changing environment. Based solely on the exit distance distribution accounting for the nonequilibrium statistics and using the Monte Carlo rejection sampling method, we construct a model DNA sequence. This method allows us to keep both long- and short-range statistical characteristics of the native DNA data. The model sequence presents the same characteristic exponents as the natural DNA but fails to capture spatial correlations and point-to-point details.

  7. DNA viewed as an out-of-equilibrium structure.

    PubMed

    Provata, A; Nicolis, C; Nicolis, G

    2014-05-01

    The complexity of the primary structure of human DNA is explored using methods from nonequilibrium statistical mechanics, dynamical systems theory, and information theory. A collection of statistical analyses is performed on the DNA data and the results are compared with sequences derived from different stochastic processes. The use of χ^{2} tests shows that DNA can not be described as a low order Markov chain of order up to r=6. Although detailed balance seems to hold at the level of a binary alphabet, it fails when all four base pairs are considered, suggesting spatial asymmetry and irreversibility. Furthermore, the block entropy does not increase linearly with the block size, reflecting the long-range nature of the correlations in the human genomic sequences. To probe locally the spatial structure of the chain, we study the exit distances from a specific symbol, the distribution of recurrence distances, and the Hurst exponent, all of which show power law tails and long-range characteristics. These results suggest that human DNA can be viewed as a nonequilibrium structure maintained in its state through interactions with a constantly changing environment. Based solely on the exit distance distribution accounting for the nonequilibrium statistics and using the Monte Carlo rejection sampling method, we construct a model DNA sequence. This method allows us to keep both long- and short-range statistical characteristics of the native DNA data. The model sequence presents the same characteristic exponents as the natural DNA but fails to capture spatial correlations and point-to-point details.

  8. Concise Review: Heteroplasmic Mitochondrial DNA Mutations and Mitochondrial Diseases: Toward iPSC-Based Disease Modeling, Drug Discovery, and Regenerative Therapeutics.

    PubMed

    Hatakeyama, Hideyuki; Goto, Yu-Ichi

    2016-04-01

    Mitochondria contain multiple copies of their own genome (mitochondrial DNA; mtDNA). Once mitochondria are damaged by mutant mtDNA, mitochondrial dysfunction is strongly induced, followed by symptomatic appearance of mitochondrial diseases. Major genetic causes of mitochondrial diseases are defects in mtDNA, and the others are defects of mitochondria-associating genes that are encoded in nuclear DNA (nDNA). Numerous pathogenic mutations responsible for various types of mitochondrial diseases have been identified in mtDNA; however, it remains uncertain why mitochondrial diseases present a wide variety of clinical spectrum even among patients carrying the same mtDNA mutations (e.g., variations in age of onset, in affected tissues and organs, or in disease progression and phenotypic severity). Disease-relevant induced pluripotent stem cells (iPSCs) derived from mitochondrial disease patients have therefore opened new avenues for understanding the definitive genotype-phenotype relationship of affected tissues and organs in various types of mitochondrial diseases triggered by mtDNA mutations. In this concise review, we briefly summarize several recent approaches using patient-derived iPSCs and their derivatives carrying various mtDNA mutations for applications in human mitochondrial disease modeling, drug discovery, and future regenerative therapeutics. © 2016 AlphaMed Press.

  9. Sequence periodicity in nucleosomal DNA and intrinsic curvature.

    PubMed

    Nair, T Murlidharan

    2010-05-17

    Most eukaryotic DNA contained in the nucleus is packaged by wrapping DNA around histone octamers. Histones are ubiquitous and bind most regions of chromosomal DNA. In order to achieve smooth wrapping of the DNA around the histone octamer, the DNA duplex should be able to deform and should possess intrinsic curvature. The deformability of DNA is a result of the non-parallelness of base pair stacks. The stacking interaction between base pairs is sequence dependent. The higher the stacking energy the more rigid the DNA helix, thus it is natural to expect that sequences that are involved in wrapping around the histone octamer should be unstacked and possess intrinsic curvature. Intrinsic curvature has been shown to be dictated by the periodic recurrence of certain dinucleotides. Several genome-wide studies directed towards mapping of nucleosome positions have revealed periodicity associated with certain stretches of sequences. In the current study, these sequences have been analyzed with a view to understand their sequence-dependent structures. Higher order DNA structures and the distribution of molecular bend loci associated with 146 base nucleosome core DNA sequence from C. elegans and chicken have been analyzed using the theoretical model for DNA curvature. The curvature dispersion calculated by cyclically permuting the sequences revealed that the molecular bend loci were delocalized throughout the nucleosome core region and had varying degrees of intrinsic curvature. The higher order structures associated with nucleosomes of C.elegans and chicken calculated from the sequences revealed heterogeneity with respect to the deviation of the DNA axis. The results points to the possibility of context dependent curvature of varying degrees to be associated with nucleosomal DNA.

  10. Yeast Studies Lead to a New DNA-Based Model for Research on Development | Poster

    Cancer.gov

    A paper from Amar J. S. Klar, Ph.D., with the RNA Biology Laboratory in NCI’s Center for Cancer Research, has identified a model for DNA research that explains the congenital disorder of mirror hand movements in humans. A mirror movement is when an intentional movement on one side of the body is mirrored by an involuntary movement on the other.

  11. Environmental DNA (eDNA) Sampling Improves Occurrence and Detection Estimates of Invasive Burmese Pythons

    PubMed Central

    Hunter, Margaret E.; Oyler-McCance, Sara J.; Dorazio, Robert M.; Fike, Jennifer A.; Smith, Brian J.; Hunter, Charles T.; Reed, Robert N.; Hart, Kristen M.

    2015-01-01

    Environmental DNA (eDNA) methods are used to detect DNA that is shed into the aquatic environment by cryptic or low density species. Applied in eDNA studies, occupancy models can be used to estimate occurrence and detection probabilities and thereby account for imperfect detection. However, occupancy terminology has been applied inconsistently in eDNA studies, and many have calculated occurrence probabilities while not considering the effects of imperfect detection. Low detection of invasive giant constrictors using visual surveys and traps has hampered the estimation of occupancy and detection estimates needed for population management in southern Florida, USA. Giant constrictor snakes pose a threat to native species and the ecological restoration of the Florida Everglades. To assist with detection, we developed species-specific eDNA assays using quantitative PCR (qPCR) for the Burmese python (Python molurus bivittatus), Northern African python (P. sebae), boa constrictor (Boa constrictor), and the green (Eunectes murinus) and yellow anaconda (E. notaeus). Burmese pythons, Northern African pythons, and boa constrictors are established and reproducing, while the green and yellow anaconda have the potential to become established. We validated the python and boa constrictor assays using laboratory trials and tested all species in 21 field locations distributed in eight southern Florida regions. Burmese python eDNA was detected in 37 of 63 field sampling events; however, the other species were not detected. Although eDNA was heterogeneously distributed in the environment, occupancy models were able to provide the first estimates of detection probabilities, which were greater than 91%. Burmese python eDNA was detected along the leading northern edge of the known population boundary. The development of informative detection tools and eDNA occupancy models can improve conservation efforts in southern Florida and support more extensive studies of invasive constrictors. Generic sampling design and terminology are proposed to standardize and clarify interpretations of eDNA-based occupancy models. PMID:25874630

  12. Environmental DNA (eDNA) sampling improves occurrence and detection estimates of invasive Burmese pythons

    USGS Publications Warehouse

    Hunter, Margaret E.; Oyler-McCance, Sara J.; Dorazio, Robert M.; Fike, Jennifer A.; Smith, Brian J.; Hunter, Charles T.; Reed, Robert N.; Hart, Kristen M.

    2015-01-01

    Environmental DNA (eDNA) methods are used to detect DNA that is shed into the aquatic environment by cryptic or low density species. Applied in eDNA studies, occupancy models can be used to estimate occurrence and detection probabilities and thereby account for imperfect detection. However, occupancy terminology has been applied inconsistently in eDNA studies, and many have calculated occurrence probabilities while not considering the effects of imperfect detection. Low detection of invasive giant constrictors using visual surveys and traps has hampered the estimation of occupancy and detection estimates needed for population management in southern Florida, USA. Giant constrictor snakes pose a threat to native species and the ecological restoration of the Florida Everglades. To assist with detection, we developed species-specific eDNA assays using quantitative PCR (qPCR) for the Burmese python (Python molurus bivittatus), Northern African python (P. sebae), boa constrictor (Boa constrictor), and the green (Eunectes murinus) and yellow anaconda (E. notaeus). Burmese pythons, Northern African pythons, and boa constrictors are established and reproducing, while the green and yellow anaconda have the potential to become established. We validated the python and boa constrictor assays using laboratory trials and tested all species in 21 field locations distributed in eight southern Florida regions. Burmese python eDNA was detected in 37 of 63 field sampling events; however, the other species were not detected. Although eDNA was heterogeneously distributed in the environment, occupancy models were able to provide the first estimates of detection probabilities, which were greater than 91%. Burmese python eDNA was detected along the leading northern edge of the known population boundary. The development of informative detection tools and eDNA occupancy models can improve conservation efforts in southern Florida and support more extensive studies of invasive constrictors. Generic sampling design and terminology are proposed to standardize and clarify interpretations of eDNA-based occupancy models.

  13. Environmental DNA (eDNA) sampling improves occurrence and detection estimates of invasive burmese pythons.

    PubMed

    Hunter, Margaret E; Oyler-McCance, Sara J; Dorazio, Robert M; Fike, Jennifer A; Smith, Brian J; Hunter, Charles T; Reed, Robert N; Hart, Kristen M

    2015-01-01

    Environmental DNA (eDNA) methods are used to detect DNA that is shed into the aquatic environment by cryptic or low density species. Applied in eDNA studies, occupancy models can be used to estimate occurrence and detection probabilities and thereby account for imperfect detection. However, occupancy terminology has been applied inconsistently in eDNA studies, and many have calculated occurrence probabilities while not considering the effects of imperfect detection. Low detection of invasive giant constrictors using visual surveys and traps has hampered the estimation of occupancy and detection estimates needed for population management in southern Florida, USA. Giant constrictor snakes pose a threat to native species and the ecological restoration of the Florida Everglades. To assist with detection, we developed species-specific eDNA assays using quantitative PCR (qPCR) for the Burmese python (Python molurus bivittatus), Northern African python (P. sebae), boa constrictor (Boa constrictor), and the green (Eunectes murinus) and yellow anaconda (E. notaeus). Burmese pythons, Northern African pythons, and boa constrictors are established and reproducing, while the green and yellow anaconda have the potential to become established. We validated the python and boa constrictor assays using laboratory trials and tested all species in 21 field locations distributed in eight southern Florida regions. Burmese python eDNA was detected in 37 of 63 field sampling events; however, the other species were not detected. Although eDNA was heterogeneously distributed in the environment, occupancy models were able to provide the first estimates of detection probabilities, which were greater than 91%. Burmese python eDNA was detected along the leading northern edge of the known population boundary. The development of informative detection tools and eDNA occupancy models can improve conservation efforts in southern Florida and support more extensive studies of invasive constrictors. Generic sampling design and terminology are proposed to standardize and clarify interpretations of eDNA-based occupancy models.

  14. DNA Interactions Probed by Hydrogen-Deuterium Exchange (HDX) Fourier Transform Ion Cyclotron Resonance Mass Spectrometry Confirm External Binding Sites on the Minichromosomal Maintenance (MCM) Helicase*

    PubMed Central

    Graham, Brian W.; Tao, Yeqing; Dodge, Katie L.; Thaxton, Carly T.; Olaso, Danae; Young, Nicolas L.; Marshall, Alan G.

    2016-01-01

    The archaeal minichromosomal maintenance (MCM) helicase from Sulfolobus solfataricus (SsoMCM) is a model for understanding structural and mechanistic aspects of DNA unwinding. Although interactions of the encircled DNA strand within the central channel provide an accepted mode for translocation, interactions with the excluded strand on the exterior surface have mostly been ignored with regard to DNA unwinding. We have previously proposed an extension of the traditional steric exclusion model of unwinding to also include significant contributions with the excluded strand during unwinding, termed steric exclusion and wrapping (SEW). The SEW model hypothesizes that the displaced single strand tracks along paths on the exterior surface of hexameric helicases to protect single-stranded DNA (ssDNA) and stabilize the complex in a forward unwinding mode. Using hydrogen/deuterium exchange monitored by Fourier transform ion cyclotron resonance MS, we have probed the binding sites for ssDNA, using multiple substrates targeting both the encircled and excluded strand interactions. In each experiment, we have obtained >98.7% sequence coverage of SsoMCM from >650 peptides (5–30 residues in length) and are able to identify interacting residues on both the interior and exterior of SsoMCM. Based on identified contacts, positively charged residues within the external waist region were mutated and shown to generally lower DNA unwinding without negatively affecting the ATP hydrolysis. The combined data globally identify binding sites for ssDNA during SsoMCM unwinding as well as validating the importance of the SEW model for hexameric helicase unwinding. PMID:27044751

  15. Design Principles of DNA Enzyme-Based Walkers: Translocation Kinetics and Photoregulation.

    PubMed

    Cha, Tae-Gon; Pan, Jing; Chen, Haorong; Robinson, Heather N; Li, Xiang; Mao, Chengde; Choi, Jong Hyun

    2015-07-29

    Dynamic DNA enzyme-based walkers complete their stepwise movements along the prescribed track through a series of reactions, including hybridization, enzymatic cleavage, and strand displacement; however, their overall translocation kinetics is not well understood. Here, we perform mechanistic studies to elucidate several key parameters that govern the kinetics and processivity of DNA enzyme-based walkers. These parameters include DNA enzyme core type and structure, upper and lower recognition arm lengths, and divalent metal cation species and concentration. A theoretical model is developed within the framework of single-molecule kinetics to describe overall translocation kinetics as well as each reaction step. A better understanding of kinetics and design parameters enables us to demonstrate a walker movement near 5 μm at an average speed of ∼1 nm s(-1). We also show that the translocation kinetics of DNA walkers can be effectively controlled by external light stimuli using photoisomerizable azobenzene moieties. A 2-fold increase in the cleavage reaction is observed when the hairpin stems of enzyme catalytic cores are open under UV irradiation. This study provides general design guidelines to construct highly processive, autonomous DNA walker systems and to regulate their translocation kinetics, which would facilitate the development of functional DNA walkers.

  16. Phylogeography and conservation genetics of Hygrophila pogonocalyx (Acanthaceae) based on atpB-rbcL noncoding spacer cpDNA.

    PubMed

    Huang, Jao-Ching; Wang, Wei-Kuang; Peng, Ching-I; Chiang, Tzen-Yuh

    2005-02-01

    Genetic variation in the atpB-rbcL intergenic spacer region of chloroplast DNA (cpDNA) was investigated in Hygrophila pogonocalyx Hayata (Acanthaceae), an endangered and endemic species in Taiwan. In this aquatic species, seed dispersal from capsules via elasticity is constrained by gravity and is thereby confined within populations, resulting in limited gene flow between populations. In this study, a total of 849 bp of the cpDNA atpB-rbcL spacer were sequenced from eight populations of H. pogonocalyx. Nucleotide diversity in the cpDNA is low (theta = 0.00343+/-0.00041). The distribution of genetic variation among populations agrees with an "isolation-by-distance" model. Two geographically correlated groups, the western and eastern regions, were identified in a neighbor-joining tree and a minimum-spanning network. Phylogeographical analyses based on the cpDNA network suggest that the present-day differentiation between western and eastern groups of H. pogonocalyx resulted from past fragmentation. The differentiation between eastern and western populations may be ascribed to isolation since the formation of the Central Mountain Range about 5 million years ago, which is consistent with the rate estimates based on a molecular clock of cpDNA.

  17. Optimisation of DNA extraction from the crustacean Daphnia

    PubMed Central

    Athanasio, Camila Gonçalves; Chipman, James K.; Viant, Mark R.

    2016-01-01

    Daphnia are key model organisms for mechanistic studies of phenotypic plasticity, adaptation and microevolution, which have led to an increasing demand for genomics resources. A key step in any genomics analysis, such as high-throughput sequencing, is the availability of sufficient and high quality DNA. Although commercial kits exist to extract genomic DNA from several species, preparation of high quality DNA from Daphnia spp. and other chitinous species can be challenging. Here, we optimise methods for tissue homogenisation, DNA extraction and quantification customised for different downstream analyses (e.g., LC-MS/MS, Hiseq, mate pair sequencing or Nanopore). We demonstrate that if Daphnia magna are homogenised as whole animals (including the carapace), absorbance-based DNA quantification methods significantly over-estimate the amount of DNA, resulting in using insufficient starting material for experiments, such as preparation of sequencing libraries. This is attributed to the high refractive index of chitin in Daphnia’s carapace at 260 nm. Therefore, unless the carapace is removed by overnight proteinase digestion, the extracted DNA should be quantified with fluorescence-based methods. However, overnight proteinase digestion will result in partial fragmentation of DNA therefore the prepared DNA is not suitable for downstream methods that require high molecular weight DNA, such as PacBio, mate pair sequencing and Nanopore. In conclusion, we found that the MasterPure DNA purification kit, coupled with grinding of frozen tissue, is the best method for extraction of high molecular weight DNA as long as the extracted DNA is quantified with fluorescence-based methods. This method generated high yield and high molecular weight DNA (3.10 ± 0.63 ng/µg dry mass, fragments >60 kb), free of organic contaminants (phenol, chloroform) and is suitable for large number of downstream analyses. PMID:27190714

  18. Magnetic Propulsion of Microswimmers with DNA-Based Flagellar Bundles.

    PubMed

    Maier, Alexander M; Weig, Cornelius; Oswald, Peter; Frey, Erwin; Fischer, Peer; Liedl, Tim

    2016-02-10

    We show that DNA-based self-assembly can serve as a general and flexible tool to construct artificial flagella of several micrometers in length and only tens of nanometers in diameter. By attaching the DNA flagella to biocompatible magnetic microparticles, we provide a proof of concept demonstration of hybrid structures that, when rotated in an external magnetic field, propel by means of a flagellar bundle, similar to self-propelling peritrichous bacteria. Our theoretical analysis predicts that flagellar bundles that possess a length-dependent bending stiffness should exhibit a superior swimming speed compared to swimmers with a single appendage. The DNA self-assembly method permits the realization of these improved flagellar bundles in good agreement with our quantitative model. DNA flagella with well-controlled shape could fundamentally increase the functionality of fully biocompatible nanorobots and extend the scope and complexity of active materials.

  19. The Fanconi anemia associated protein FAAP24 uses two substrate specific binding surfaces for DNA recognition

    PubMed Central

    Wienk, Hans; Slootweg, Jack C.; Speerstra, Sietske; Kaptein, Robert; Boelens, Rolf; Folkers, Gert E.

    2013-01-01

    To maintain the integrity of the genome, multiple DNA repair systems exist to repair damaged DNA. Recognition of altered DNA, including bulky adducts, pyrimidine dimers and interstrand crosslinks (ICL), partially depends on proteins containing helix-hairpin-helix (HhH) domains. To understand how ICL is specifically recognized by the Fanconi anemia proteins FANCM and FAAP24, we determined the structure of the HhH domain of FAAP24. Although it resembles other HhH domains, the FAAP24 domain contains a canonical hairpin motif followed by distorted motif. The HhH domain can bind various DNA substrates; using nuclear magnetic resonance titration experiments, we demonstrate that the canonical HhH motif is required for double-stranded DNA (dsDNA) binding, whereas the unstructured N-terminus can interact with single-stranded DNA. Both DNA binding surfaces are used for binding to ICL-like single/double-strand junction-containing DNA substrates. A structural model for FAAP24 bound to dsDNA has been made based on homology with the translesion polymerase iota. Site-directed mutagenesis, sequence conservation and charge distribution support the dsDNA-binding model. Analogous to other HhH domain-containing proteins, we suggest that multiple FAAP24 regions together contribute to binding to single/double-strand junction, which could contribute to specificity in ICL DNA recognition. PMID:23661679

  20. Alchemical Free Energy Calculations for Nucleotide Mutations in Protein-DNA Complexes.

    PubMed

    Gapsys, Vytautas; de Groot, Bert L

    2017-12-12

    Nucleotide-sequence-dependent interactions between proteins and DNA are responsible for a wide range of gene regulatory functions. Accurate and generalizable methods to evaluate the strength of protein-DNA binding have long been sought. While numerous computational approaches have been developed, most of them require fitting parameters to experimental data to a certain degree, e.g., machine learning algorithms or knowledge-based statistical potentials. Molecular-dynamics-based free energy calculations offer a robust, system-independent, first-principles-based method to calculate free energy differences upon nucleotide mutation. We present an automated procedure to set up alchemical MD-based calculations to evaluate free energy changes occurring as the result of a nucleotide mutation in DNA. We used these methods to perform a large-scale mutation scan comprising 397 nucleotide mutation cases in 16 protein-DNA complexes. The obtained prediction accuracy reaches 5.6 kJ/mol average unsigned deviation from experiment with a correlation coefficient of 0.57 with respect to the experimentally measured free energies. Overall, the first-principles-based approach performed on par with the molecular modeling approaches Rosetta and FoldX. Subsequently, we utilized the MD-based free energy calculations to construct protein-DNA binding profiles for the zinc finger protein Zif268. The calculation results compare remarkably well with the experimentally determined binding profiles. The software automating the structure and topology setup for alchemical calculations is a part of the pmx package; the utilities have also been made available online at http://pmx.mpibpc.mpg.de/dna_webserver.html .

  1. On the binding of indeno[1,2-c]isoquinolines in the DNA-topoisomerase I cleavage complex.

    PubMed

    Xiao, Xiangshu; Antony, Smitha; Pommier, Yves; Cushman, Mark

    2005-05-05

    An ab initio quantum mechanics calculation is reported which predicts the orientation of indenoisoquinoline 4 in the ternary cleavage complex formed from DNA and topoisomerase I (top1). The results of this calculation are consistent with the hypothetical structures previously proposed for the indenoisoquinoline-DNA-top1 ternary complexes based on molecular modeling, the crystal structure of a recently reported ternary complex, and the biological results obtained with a pair of diaminoalkyl-substituted indenoisoquinoline enantiomers. The results of these studies indicate that the pi-pi stacking interactions between the indenoisoquinolines and the neighboring DNA base pairs play a major role in determining binding orientation. The calculation of the electrostatic potential surface maps of the indenoisoquinolines and the adjacent DNA base pairs shows electrostatic complementarity in the observed binding orientation, leading to the conclusion that electrostatic attraction between the intercalators and the base pairs in the cleavage complex plays a major stabilizing role. On the other hand, the calculation of LUMO and HOMO energies of indenoisoquinoline 13b and neighboring DNA base pairs in conjunction with NBO analysis indicates that charge transfer complex formation plays a relatively minor role in stabilizing the ternary complexes derived from indenoisoquinolines, DNA, and top1. The results of these studies are important in understanding the existing structure-activity relationships for the indenoisoquinolines as top1 inhibitors and as anticancer agents, and they will be important in the future design of indenoisoquinoline-based top1 inhibitors.

  2. A systematic molecular dynamics study of nearest-neighbor effects on base pair and base pair step conformations and fluctuations in B-DNA

    PubMed Central

    Lavery, Richard; Zakrzewska, Krystyna; Beveridge, David; Bishop, Thomas C.; Case, David A.; Cheatham, Thomas; Dixit, Surjit; Jayaram, B.; Lankas, Filip; Laughton, Charles; Maddocks, John H.; Michon, Alexis; Osman, Roman; Orozco, Modesto; Perez, Alberto; Singh, Tanya; Spackova, Nada; Sponer, Jiri

    2010-01-01

    It is well recognized that base sequence exerts a significant influence on the properties of DNA and plays a significant role in protein–DNA interactions vital for cellular processes. Understanding and predicting base sequence effects requires an extensive structural and dynamic dataset which is currently unavailable from experiment. A consortium of laboratories was consequently formed to obtain this information using molecular simulations. This article describes results providing information not only on all 10 unique base pair steps, but also on all possible nearest-neighbor effects on these steps. These results are derived from simulations of 50–100 ns on 39 different DNA oligomers in explicit solvent and using a physiological salt concentration. We demonstrate that the simulations are converged in terms of helical and backbone parameters. The results show that nearest-neighbor effects on base pair steps are very significant, implying that dinucleotide models are insufficient for predicting sequence-dependent behavior. Flanking base sequences can notably lead to base pair step parameters in dynamic equilibrium between two conformational sub-states. Although this study only provides limited data on next-nearest-neighbor effects, we suggest that such effects should be analyzed before attempting to predict the sequence-dependent behavior of DNA. PMID:19850719

  3. Testing a structural model for viral DNA packaging motor function by optical tweezers measurements, site directed mutagenesis, and molecular dynamics calculations

    NASA Astrophysics Data System (ADS)

    Keller, Nicholas A.; Migliori, Amy D.; Arya, Gaurav; Rao, Venigalla B.; Smith, Douglas E.

    2013-09-01

    Many double-stranded DNA viruses employ a molecular motor to package DNA into preformed capsid shells. Based on structures of phage T4 motor proteins determined by X-ray crystallography and cryo-electron microscopy, Rao, Rossmann and coworkers recently proposed a structural model for motor function. They proposed that DNA is ratcheted by a large conformational change driven by electrostatic interactions between charged residues at an interface between two globular domains of the motor protein. We have conducted experiments to test this model by studying the effect on packaging under applied load of site-directed changes altering these residues. We observe significant impairment of packaging activity including reductions in packaging rate, percent time packaging, and time active under high load. We show that these measured impairments correlate well with alterations in free energies associated with the conformational change predicted by molecular dynamics simulations.

  4. Structure and free energy of cholesteric DNA droplets

    NASA Astrophysics Data System (ADS)

    Strey, Helmut; Hong, Helen; Easwar, Nalini

    2000-03-01

    Liquid crystals of DNA are the simplest model systems for DNA packing in cell nuclei or in phage heads. With increasing concentration DNA solutions exhibit the following phases: hexagonal, line hexatic, cholesteric, blue phases. We will present measurements of defect structure and pitch of cholesteric spherulites of short fragment DNA (146 base pairs). DNA concentration as well as salt concentrations are controlled by bathing the spherulites in poly (ethylene glycol) (MW 35,000u) solutions of known osmotic pressure. Combining polarizing microscopy and x-ray scattering with the osmotic stress method allows us to monitor the cholesteric structure and pitch as a function of interaxial distance between DNA molecules as well as salt concentration and type. In particular, we present data on how the DNA cholesteric pitch unwinds when the line hexatic phase is approached.

  5. Measurement of pyrimidine (6-4) photoproducts in DNA by a mild acidic hydrolysis-HPLC fluorescence detection assay.

    PubMed

    Douki, T; Voituriez, L; Cadet, J

    1995-03-01

    Pyrimidine (6-4) pyrimidone photoproducts constitute one of the major classes of DNA lesions induced by far-UV irradiation. However, their biological role remains difficult to assess partly because of the lack of a specific and sensitive assay for monitoring their formation in DNA. Here is presented a measurement method based on the release of the (6-4) base adducts from DNA followed by an HPLC separation associated with a sensitive and specific fluorescence detection. The quantitative and mechanistic aspects of the chemical hydrolysis, based on the use of hydrogen fluoride stabilized in pyridine, were investigated, using dinucleoside monophosphate (6-4) photoproducts as model compounds. The final hydrolysis products were isolated and characterized by UV, fluorescence, mass, and 1H NMR spectroscopies. Application of the assay to far-UV irradiated calf thymus DNA provided information on the sequence effect on the rate of formation of three of the four possible bipyrimidine (6-4) photoproducts.

  6. Capillarity theory for the fly-casting mechanism

    PubMed Central

    Trizac, Emmanuel; Levy, Yaakov; Wolynes, Peter G.

    2010-01-01

    Biomolecular folding and function are often coupled. During molecular recognition events, one of the binding partners may transiently or partially unfold, allowing more rapid access to a binding site. We describe a simple model for this fly-casting mechanism based on the capillarity approximation and polymer chain statistics. The model shows that fly casting is most effective when the protein unfolding barrier is small and the part of the chain which extends toward the target is relatively rigid. These features are often seen in known examples of fly casting in protein–DNA binding. Simulations of protein–DNA binding based on well-funneled native-topology models with electrostatic forces confirm the trends of the analytical theory. PMID:20133683

  7. Electrical and Electron-Phonon Interactions in Graphene-Based Nanostructures and Aptamer-Based Electrical Sensors

    NASA Astrophysics Data System (ADS)

    Qian, Jun

    This research work contains two main parts: the theoretical study of confined phonon modes and electron states in confined graphene nanostructures; the experimental part including two topics about fabricating a graphene-FET aptamer-sensor for cocaine detection and the study of the electronic transport properties of dsDNA. In the theory part, we study the confined optical phonon modes in graphene nanoribbons (GNR) and rectangular graphene quantum dots (RGQD) by the elastic continuum model. The carrier states are studied by effective mass approximation. The phonon bottleneck effect is expected in general for RGQDs. The scattering rates are calculated for specific RGQDs with carefully chosen dimensions to fulfill the momentum and energy conservation conditions. In the experimental part, we have developed a combined technique of semiconductor processes and molecular biological protocols to fabricate a signal-off graphene-FET aptamer-sensor for cocaine. In addition, DNA transport properties were studied by STM on GNP-dsDNA-Au conjugates in atmospheric condition. The dsDNA-complexes exhibit as a slightly n-type semiconductor by simulated with a Landauer-type model. A geometrical model is proposed to explain the distinct I-V spectra.

  8. Quantum biological channel modeling and capacity calculation.

    PubMed

    Djordjevic, Ivan B

    2012-12-10

    Quantum mechanics has an important role in photosynthesis, magnetoreception, and evolution. There were many attempts in an effort to explain the structure of genetic code and transfer of information from DNA to protein by using the concepts of quantum mechanics. The existing biological quantum channel models are not sufficiently general to incorporate all relevant contributions responsible for imperfect protein synthesis. Moreover, the problem of determination of quantum biological channel capacity is still an open problem. To solve these problems, we construct the operator-sum representation of biological channel based on codon basekets (basis vectors), and determine the quantum channel model suitable for study of the quantum biological channel capacity and beyond. The transcription process, DNA point mutations, insertions, deletions, and translation are interpreted as the quantum noise processes. The various types of quantum errors are classified into several broad categories: (i) storage errors that occur in DNA itself as it represents an imperfect storage of genetic information, (ii) replication errors introduced during DNA replication process, (iii) transcription errors introduced during DNA to mRNA transcription, and (iv) translation errors introduced during the translation process. By using this model, we determine the biological quantum channel capacity and compare it against corresponding classical biological channel capacity. We demonstrate that the quantum biological channel capacity is higher than the classical one, for a coherent quantum channel model, suggesting that quantum effects have an important role in biological systems. The proposed model is of crucial importance towards future study of quantum DNA error correction, developing quantum mechanical model of aging, developing the quantum mechanical models for tumors/cancer, and study of intracellular dynamics in general.

  9. Methylene blue binding to DNA with alternating AT base sequence: minor groove binding is favored over intercalation.

    PubMed

    Rohs, Remo; Sklenar, Heinz

    2004-04-01

    The results presented in this paper on methylene blue (MB) binding to DNA with AT alternating base sequence complement the data obtained in two former modeling studies of MB binding to GC alternating DNA. In the light of the large amount of experimental data for both systems, this theoretical study is focused on a detailed energetic analysis and comparison in order to understand their different behavior. Since experimental high-resolution structures of the complexes are not available, the analysis is based on energy minimized structural models of the complexes in different binding modes. For both sequences, four different intercalation structures and two models for MB binding in the minor and major groove have been proposed. Solvent electrostatic effects were included in the energetic analysis by using electrostatic continuum theory, and the dependence of MB binding on salt concentration was investigated by solving the non-linear Poisson-Boltzmann equation. We find that the relative stability of the different complexes is similar for the two sequences, in agreement with the interpretation of spectroscopic data. Subtle differences, however, are seen in energy decompositions and can be attributed to the change from symmetric 5'-YpR-3' intercalation to minor groove binding with increasing salt concentration, which is experimentally observed for the AT sequence at lower salt concentration than for the GC sequence. According to our results, this difference is due to the significantly lower non-electrostatic energy for the minor groove complex with AT alternating DNA, whereas the slightly lower binding energy to this sequence is caused by a higher deformation energy of DNA. The energetic data are in agreement with the conclusions derived from different spectroscopic studies and can also be structurally interpreted on the basis of the modeled complexes. The simple static modeling technique and the neglect of entropy terms and of non-electrostatic solute-solvent interactions, which are assumed to be nearly constant for the compared complexes of MB with DNA, seem to be justified by the results.

  10. Noncanonical substrate preference of lambda exonuclease for 5′-nonphosphate-ended dsDNA and a mismatch-induced acceleration effect on the enzymatic reaction

    PubMed Central

    Yang, Yufei; Chen, Wei; Wang, Jiayu; Yang, Ziyu; Wang, Shenlin; Xiao, Xianjin; Li, Mengyuan

    2018-01-01

    Abstract Lambda exonuclease (λ exo) plays an important role in the resection of DNA ends for DNA repair. Currently, it is also a widely used enzymatic tool in genetic engineering, DNA-binding protein mapping, nanopore sequencing and biosensing. Herein, we disclose two noncanonical properties of this enzyme and suggest a previously undescribed hydrophobic interaction model between λ exo and DNA substrates. We demonstrate that the length of the free portion of the substrate strand in the dsDNA plays an essential role in the initiation of digestion reactions by λ exo. A dsDNA with a 5′ non-phosphorylated, two-nucleotide-protruding end can be digested by λ exo with very high efficiency. Moreover, we show that when a conjugated structure is covalently attached to an internal base of the dsDNA, the presence of a single mismatched base pair at the 5′ side of the modified base may significantly accelerate the process of digestion by λ exo. A detailed comparison study revealed additional π–π stacking interactions between the attached label and the amino acid residues of the enzyme. These new findings not only broaden our knowledge of the enzyme but will also be very useful for research on DNA repair and in vitro processing of nucleic acids. PMID:29490081

  11. A Polymerase Chain Reaction-Based Method for Isolating Clones from a Complimentary DNA Library in Sheep

    PubMed Central

    Friis, Thor Einar; Stephenson, Sally; Xiao, Yin; Whitehead, Jon

    2014-01-01

    The sheep (Ovis aries) is favored by many musculoskeletal tissue engineering groups as a large animal model because of its docile temperament and ease of husbandry. The size and weight of sheep are comparable to humans, which allows for the use of implants and fixation devices used in human clinical practice. The construction of a complimentary DNA (cDNA) library can capture the expression of genes in both a tissue- and time-specific manner. cDNA libraries have been a consistent source of gene discovery ever since the technology became commonplace more than three decades ago. Here, we describe the construction of a cDNA library using cells derived from sheep bones based on the pBluescript cDNA kit. Thirty clones were picked at random and sequenced. This led to the identification of a novel gene, C12orf29, which our initial experiments indicate is involved in skeletal biology. We also describe a polymerase chain reaction-based cDNA clone isolation method that allows the isolation of genes of interest from a cDNA library pool. The techniques outlined here can be applied in-house by smaller tissue engineering groups to generate tools for biomolecular research for large preclinical animal studies and highlights the power of standard cDNA library protocols to uncover novel genes. PMID:24447069

  12. Mechanisms for radiation damage in DNA. Progress report, January 1, 1980-December 31, 1980

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sevilla, M D

    1980-09-01

    In this project several mechanisms are proposed for radiation damage to DNA constituents and DNA, and a series of experiments detailed utilizing electron spin resonance spectrometry to test the proposed mechanisms. Under current investigation are irradiated systems of DNA constituents which may shed light on indirect effects. In addition, studies of radiation effects on lipids have been undertaken which will shed light on the only other proposed site for cell kill, the membrane. Studies completed during the past year are: (1) ..pi.. cations produced in DNA bases by attack of oxidizing radicals; (2) INDO studies of radicals produced in peptidesmore » and carboxylic acid model compounds; (3) electron reactions with carboxylic acids, ketones and aldehydes; and (4) ..gamma..-irradiation of esters and triglycerides. Progress has been made this year in a study of radicals generated in model compounds for the sugar-phosphate backbone.« less

  13. DNA Origami Reorganizes upon Interaction with Graphite: Implications for High-Resolution DNA Directed Protein Patterning

    PubMed Central

    Rahman, Masudur; Neff, David; Green, Nathaniel; Norton, Michael L.

    2016-01-01

    Although there is a long history of the study of the interaction of DNA with carbon surfaces, limited information exists regarding the interaction of complex DNA-based nanostructures with the important material graphite, which is closely related to graphene. In view of the capacity of DNA to direct the assembly of proteins and optical and electronic nanoparticles, the potential for combining DNA-based materials with graphite, which is an ultra-flat, conductive carbon substrate, requires evaluation. A series of imaging studies utilizing Atomic Force Microscopy has been applied in order to provide a unified picture of this important interaction of structured DNA and graphite. For the test structure examined, we observe a rapid destabilization of the complex DNA origami structure, consistent with a strong interaction of single-stranded DNA with the carbon surface. This destabilizing interaction can be obscured by an intentional or unintentional primary intervening layer of single-stranded DNA. Because the interaction of origami with graphite is not completely dissociative, and because the frustrated, expanded structure is relatively stable over time in solution, it is demonstrated that organized structures of pairs of the model protein streptavidin can be produced on carbon surfaces using DNA origami as the directing material. PMID:28335324

  14. The fractal based analysis of human face and DNA variations during aging.

    PubMed

    Namazi, Hamidreza; Akrami, Amin; Hussaini, Jamal; Silva, Osmar N; Wong, Albert; Kulish, Vladimir V

    2017-01-16

    Human DNA is the main unit that shapes human characteristics and features such as behavior. Thus, it is expected that changes in DNA (DNA mutation) influence human characteristics and features. Face is one of the human features which is unique and also dependent on his gen. In this paper, for the first time we analyze the variations of human DNA and face simultaneously. We do this job by analyzing the fractal dimension of DNA walk and face during human aging. The results of this study show the human DNA and face get more complex by aging. These complexities are mapped on fractal exponents of DNA walk and human face. The method discussed in this paper can be further developed in order to investigate the direct influence of DNA mutation on the face variations during aging, and accordingly making a model between human face fractality and the complexity of DNA walk.

  15. An evolution-based DNA-binding residue predictor using a dynamic query-driven learning scheme.

    PubMed

    Chai, H; Zhang, J; Yang, G; Ma, Z

    2016-11-15

    DNA-binding proteins play a pivotal role in various biological activities. Identification of DNA-binding residues (DBRs) is of great importance for understanding the mechanism of gene regulations and chromatin remodeling. Most traditional computational methods usually construct their predictors on static non-redundant datasets. They excluded many homologous DNA-binding proteins so as to guarantee the generalization capability of their models. However, those ignored samples may potentially provide useful clues when studying protein-DNA interactions, which have not obtained enough attention. In view of this, we propose a novel method, namely DQPred-DBR, to fill the gap of DBR predictions. First, a large-scale extensible sample pool was compiled. Second, evolution-based features in the form of a relative position specific score matrix and covariant evolutionary conservation descriptors were used to encode the feature space. Third, a dynamic query-driven learning scheme was designed to make more use of proteins with known structure and functions. In comparison with a traditional static model, the introduction of dynamic models could obviously improve the prediction performance. Experimental results from the benchmark and independent datasets proved that our DQPred-DBR had promising generalization capability. It was capable of producing decent predictions and outperforms many state-of-the-art methods. For the convenience of academic use, our proposed method was also implemented as a web server at .

  16. A highly pathogenic porcine reproductive and respiratory syndrome virus candidate vaccine based on Japanese encephalitis virus replicon system

    PubMed Central

    Huang, Lihong; Liu, Shukai; Zang, Fuyu; Xing, Jinchao; Zhang, Youyue; Liang, Jiaqi; Zhang, Guihong

    2017-01-01

    In the swine industry, porcine reproductive and respiratory syndrome (PRRS) is a highly contagious disease which causes heavy economic losses worldwide. Effective prevention and disease control is an important issue. In this study, we described the construction of a Japanese encephalitis virus (JEV) DNA-based replicon with a cytomegalovirus (CMV) promoter based on the genome of Japanese encephalitis live vaccine virus SA14-14-2, which is capable of offering a potentially novel way to develop and produce vaccines against a major pathogen of global health. This JEV DNA-based replicon contains a large deletion in the structural genes (C-prM-E). A PRRSV GP5/M was inserted into the deletion position of JEV DNA-based replicons to develop a chimeric replicon vaccine candidate for PRRSV. The results showed that BALB/c mice models with the replicon vaccines pJEV-REP-G-2A-M-IRES and pJEV-REP-G-2A-M stimulated antibody responses and induced a cellular immune response. Analysis of ELSA data showed that vaccination with the replicon vaccine expressing GP5/M induced a better antibodies response than traditional DNA vaccines. Therefore, the results suggested that this ectopic expression system based on JEV DNA-based replicons may represent a useful molecular platform for various biological applications, and the JEV DNA-based replicons expressing GP5/M can be further developed into a novel, safe vaccine candidate for PRRS. PMID:28740748

  17. Path-preference cellular-automaton model for traffic flow through transit points and its application to the transcription process in human cells.

    PubMed

    Ohta, Yoshihiro; Nishiyama, Akinobu; Wada, Yoichiro; Ruan, Yijun; Kodama, Tatsuhiko; Tsuboi, Takashi; Tokihiro, Tetsuji; Ihara, Sigeo

    2012-08-01

    We all use path routing everyday as we take shortcuts to avoid traffic jams, or by using faster traffic means. Previous models of traffic flow of RNA polymerase II (RNAPII) during transcription, however, were restricted to one dimension along the DNA template. Here we report the modeling and application of traffic flow in transcription that allows preferential paths of different dimensions only restricted to visit some transit points, as previously introduced between the 5' and 3' end of the gene. According to its position, an RNAPII protein molecule prefers paths obeying two types of time-evolution rules. One is an asymmetric simple exclusion process (ASEP) along DNA, and the other is a three-dimensional jump between transit points in DNA where RNAPIIs are staying. Simulations based on our model, and comparison experimental results, reveal how RNAPII molecules are distributed at the DNA-loop-formation-related protein binding sites as well as CTCF insulator proteins (or exons). As time passes after the stimulation, the RNAPII density at these sites becomes higher. Apparent far-distance jumps in one dimension are realized by short-range three-dimensional jumps between DNA loops. We confirm the above conjecture by applying our model calculation to the SAMD4A gene by comparing the experimental results. Our probabilistic model provides possible scenarios for assembling RNAPII molecules into transcription factories, where RNAPII and related proteins cooperatively transcribe DNA.

  18. Excess electron localization in solvated DNA bases.

    PubMed

    Smyth, Maeve; Kohanoff, Jorge

    2011-06-10

    We present a first-principles molecular dynamics study of an excess electron in condensed phase models of solvated DNA bases. Calculations on increasingly large microsolvated clusters taken from liquid phase simulations show that adiabatic electron affinities increase systematically upon solvation, as for optimized gas-phase geometries. Dynamical simulations after vertical attachment indicate that the excess electron, which is initially found delocalized, localizes around the nucleobases within a 15 fs time scale. This transition requires small rearrangements in the geometry of the bases.

  19. Excess Electron Localization in Solvated DNA Bases

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Smyth, Maeve; Kohanoff, Jorge

    2011-06-10

    We present a first-principles molecular dynamics study of an excess electron in condensed phase models of solvated DNA bases. Calculations on increasingly large microsolvated clusters taken from liquid phase simulations show that adiabatic electron affinities increase systematically upon solvation, as for optimized gas-phase geometries. Dynamical simulations after vertical attachment indicate that the excess electron, which is initially found delocalized, localizes around the nucleobases within a 15 fs time scale. This transition requires small rearrangements in the geometry of the bases.

  20. Higher impact of female than male migration on population structure in large mammals.

    PubMed

    Tiedemann, R; Hardy, O; Vekemans, X; Milinkovitch, M C

    2000-08-01

    We simulated large mammal populations using an individual-based stochastic model under various sex-specific migration schemes and life history parameters from the blue whale and the Asian elephant. Our model predicts that genetic structure at nuclear loci is significantly more influenced by female than by male migration. We identified requisite comigration of mother and offspring during gravidity and lactation as the primary cause of this phenomenon. In addition, our model predicts that the common assumption that geographical patterns of mitochondrial DNA (mtDNA) could be translated into female migration rates (Nmf) will cause biased estimates of maternal gene flow when extensive male migration occurs and male mtDNA haplotypes are included in the analysis.

  1. Real-time PCR machine system modeling and a systematic approach for the robust design of a real-time PCR-on-a-chip system.

    PubMed

    Lee, Da-Sheng

    2010-01-01

    Chip-based DNA quantification systems are widespread, and used in many point-of-care applications. However, instruments for such applications may not be maintained or calibrated regularly. Since machine reliability is a key issue for normal operation, this study presents a system model of the real-time Polymerase Chain Reaction (PCR) machine to analyze the instrument design through numerical experiments. Based on model analysis, a systematic approach was developed to lower the variation of DNA quantification and achieve a robust design for a real-time PCR-on-a-chip system. Accelerated lift testing was adopted to evaluate the reliability of the chip prototype. According to the life test plan, this proposed real-time PCR-on-a-chip system was simulated to work continuously for over three years with similar reproducibility in DNA quantification. This not only shows the robustness of the lab-on-a-chip system, but also verifies the effectiveness of our systematic method for achieving a robust design.

  2. Determination of fetal DNA fraction from the plasma of pregnant women using sequence read counts.

    PubMed

    Kim, Sung K; Hannum, Gregory; Geis, Jennifer; Tynan, John; Hogg, Grant; Zhao, Chen; Jensen, Taylor J; Mazloom, Amin R; Oeth, Paul; Ehrich, Mathias; van den Boom, Dirk; Deciu, Cosmin

    2015-08-01

    This study introduces a novel method, referred to as SeqFF, for estimating the fetal DNA fraction in the plasma of pregnant women and to infer the underlying mechanism that allows for such statistical modeling. Autosomal regional read counts from whole-genome massively parallel single-end sequencing of circulating cell-free DNA (ccfDNA) from the plasma of 25 312 pregnant women were used to train a multivariate model. The pretrained model was then applied to 505 pregnant samples to assess the performance of SeqFF against known methodologies for fetal DNA fraction calculations. Pearson's correlation between chromosome Y and SeqFF for pregnancies with male fetuses from two independent cohorts ranged from 0.932 to 0.938. Comparison between a single-nucleotide polymorphism-based approach and SeqFF yielded a Pearson's correlation of 0.921. Paired-end sequencing suggests that shorter ccfDNA, that is, less than 150 bp in length, is nonuniformly distributed across the genome. Regions exhibiting an increased proportion of short ccfDNA, which are more likely of fetal origin, tend to provide more information in the SeqFF calculations. SeqFF is a robust and direct method to determine fetal DNA fraction. Furthermore, the method is applicable to both male and female pregnancies and can greatly improve the accuracy of noninvasive prenatal testing for fetal copy number variation. © 2015 John Wiley & Sons, Ltd.

  3. Characterizing DNA Star-Tile-Based Nanostructures Using a Coarse-Grained Model.

    PubMed

    Schreck, John S; Romano, Flavio; Zimmer, Matthew H; Louis, Ard A; Doye, Jonathan P K

    2016-04-26

    We use oxDNA, a coarse-grained model of DNA at the nucleotide level, to simulate large nanoprisms that are composed of multi-arm star tiles, in which the size of bulge loops that have been incorporated into the tile design is used to control the flexibility of the tiles. The oxDNA model predicts equilibrium structures for several different nanoprism designs that are in excellent agreement with the experimental structures as measured by cryoTEM. In particular we reproduce the chiral twisting of the top and bottom faces of the nanoprisms, as the bulge sizes in these structures are varied due to the greater flexibility of larger bulges. We are also able to follow how the properties of the star tiles evolve as the prisms are assembled. Individual star tiles are very flexible, but their structures become increasingly well-defined and rigid as they are incorporated into larger assemblies. oxDNA also finds that the experimentally observed prisms are more stable than their inverted counterparts, but interestingly this preference for the arms of the tiles to bend in a given direction only emerges after they are part of larger assemblies. These results show the potential for oxDNA to provide detailed structural insight as well as to predict the properties of DNA nanostructures and hence to aid rational design in DNA nanotechnology.

  4. Multi-scale coarse-graining for the study of assembly pathways in DNA-brick self-assembly.

    PubMed

    Fonseca, Pedro; Romano, Flavio; Schreck, John S; Ouldridge, Thomas E; Doye, Jonathan P K; Louis, Ard A

    2018-04-07

    Inspired by recent successes using single-stranded DNA tiles to produce complex structures, we develop a two-step coarse-graining approach that uses detailed thermodynamic calculations with oxDNA, a nucleotide-based model of DNA, to parametrize a coarser kinetic model that can reach the time and length scales needed to study the assembly mechanisms of these structures. We test the model by performing a detailed study of the assembly pathways for a two-dimensional target structure made up of 334 unique strands each of which are 42 nucleotides long. Without adjustable parameters, the model reproduces a critical temperature for the formation of the assembly that is close to the temperature at which assembly first occurs in experiments. Furthermore, the model allows us to investigate in detail the nucleation barriers and the distribution of critical nucleus shapes for the assembly of a single target structure. The assembly intermediates are compact and highly connected (although not maximally so), and classical nucleation theory provides a good fit to the height and shape of the nucleation barrier at temperatures close to where assembly first occurs.

  5. Multi-scale coarse-graining for the study of assembly pathways in DNA-brick self-assembly

    NASA Astrophysics Data System (ADS)

    Fonseca, Pedro; Romano, Flavio; Schreck, John S.; Ouldridge, Thomas E.; Doye, Jonathan P. K.; Louis, Ard A.

    2018-04-01

    Inspired by recent successes using single-stranded DNA tiles to produce complex structures, we develop a two-step coarse-graining approach that uses detailed thermodynamic calculations with oxDNA, a nucleotide-based model of DNA, to parametrize a coarser kinetic model that can reach the time and length scales needed to study the assembly mechanisms of these structures. We test the model by performing a detailed study of the assembly pathways for a two-dimensional target structure made up of 334 unique strands each of which are 42 nucleotides long. Without adjustable parameters, the model reproduces a critical temperature for the formation of the assembly that is close to the temperature at which assembly first occurs in experiments. Furthermore, the model allows us to investigate in detail the nucleation barriers and the distribution of critical nucleus shapes for the assembly of a single target structure. The assembly intermediates are compact and highly connected (although not maximally so), and classical nucleation theory provides a good fit to the height and shape of the nucleation barrier at temperatures close to where assembly first occurs.

  6. A rapid assessment method to estimate the distribution of juvenile Chinook Salmon in tributary habitats using eDNA and occupancy estimation

    USGS Publications Warehouse

    Matter, A.; Falke, Jeffrey A.; López, J. Andres; Savereide, James W.

    2018-01-01

    Identification and protection of water bodies used by anadromous species are critical in light of increasing threats to fish populations, yet often challenging given budgetary and logistical limitations. Noninvasive, rapid‐assessment, sampling techniques may reduce costs and effort while increasing species detection efficiencies. We used an intrinsic potential (IP) habitat model to identify high‐quality rearing habitats for Chinook Salmon Oncorhynchus tshawytscha and select sites to sample throughout the Chena River basin, Alaska, for juvenile occupancy using an environmental DNA (eDNA) approach. Water samples were collected from 75 tributary sites in 2014 and 2015. The presence of Chinook Salmon DNA in water samples was assessed using a species‐specific quantitative PCR (qPCR) assay. The IP model predicted over 900 stream kilometers in the basin to support high‐quality (IP ≥ 0.75) rearing habitat. Occupancy estimation based on eDNA samples indicated that 80% and 56% of previously unsampled sites classified as high or low IP (IP < 0.75), respectively, were occupied. The probability of detection (p) of Chinook Salmon DNA from three replicate water samples was high (p = 0.76) but varied with drainage area (km2). A power analysis indicated high power to detect proportional changes in occupancy based on parameter values estimated from eDNA occupancy models, although power curves were not symmetrical around zero, indicating greater power to detect positive than negative proportional changes in occupancy. Overall, the combination of IP habitat modeling and occupancy estimation provided a useful, rapid‐assessment method to predict and subsequently quantify the distribution of juvenile salmon in previously unsampled tributary habitats. Additionally, these methods are flexible and can be modified for application to other species and in other locations, which may contribute towards improved population monitoring and management.

  7. Next-Generation Sequencing-Based Detection of Circulating Tumour DNA After Allogeneic Stem Cell Transplantation for Lymphoma

    PubMed Central

    Herrera, Alex F.; Kim, Haesook T.; Kong, Katherine A.; Faham, Malek; Sun, Heather; Sohani, Aliyah R.; Alyea, Edwin P.; Carlton, Victoria E.; Chen, Yi-Bin; Cutler, Corey S.; Ho, Vincent T.; Koreth, John; Kotwaliwale, Chitra; Nikiforow, Sarah; Ritz, Jerome; Rodig, Scott J.; Soiffer, Robert J.; Antin, Joseph H.; Armand, Philippe

    2016-01-01

    Summary Next-generation sequencing (NGS)-based circulating tumour DNA (ctDNA) detection is a promising monitoring tool for lymphoid malignancies. We evaluated whether the presence of ctDNA was associated with outcome after allogeneic haematopoietic stem cell transplantation (HSCT) in lymphoma patients. We studied 88 patients drawn from a phase 3 clinical trial of reduced-intensity conditioning HSCT in lymphoma. Conventional restaging and collection of peripheral blood samples occurred at pre-specified time points before and after HSCT and were assayed for ctDNA by sequencing of the immunoglobulin or T-cell receptor genes. Tumour clonotypes were identified in 87% of patients with adequate tumour samples. Sixteen of 19 (84%) patients with disease progression after HSCT had detectable ctDNA prior to progression at a median of 3.7 months prior to relapse/progression. Patients with detectable ctDNA 3 months after HSCT had inferior progression-free survival (PFS) (2-year PFS 58% versus 84% in ctDNA-negative patients, p=0.033). In multivariate models, detectable ctDNA was associated with increased risk of progression/death (Hazard ratio 3.9, p=0.003) and increased risk of relapse/progression (Hazard ratio 10.8, p=0.0006). Detectable ctDNA is associated with an increased risk of relapse/progression, but further validation studies are necessary to confirm these findings and determine the clinical utility of NGS-based minimal residual disease monitoring in lymphoma patients after HSCT. PMID:27711974

  8. The steric gate of DNA polymerase ι regulates ribonucleotide incorporation and deoxyribonucleotide fidelity.

    PubMed

    Donigan, Katherine A; McLenigan, Mary P; Yang, Wei; Goodman, Myron F; Woodgate, Roger

    2014-03-28

    Accurate DNA synthesis in vivo depends on the ability of DNA polymerases to select dNTPs from a nucleotide pool dominated by NTPs. High fidelity replicative polymerases have evolved to efficiently exclude NTPs while copying long stretches of undamaged DNA. However, to bypass DNA damage, cells utilize specialized low fidelity polymerases to perform translesion DNA synthesis (TLS). Of interest is human DNA polymerase ι (pol ι), which has been implicated in TLS of oxidative and UV-induced lesions. Here, we evaluate the ability of pol ι to incorporate NTPs during DNA synthesis. pol ι incorporates and extends NTPs opposite damaged and undamaged template bases in a template-specific manner. The Y39A "steric gate" pol ι mutant is considerably more active in the presence of Mn(2+) compared with Mg(2+) and exhibits a marked increase in NTP incorporation and extension, and surprisingly, it also exhibits increased dNTP base selectivity. Our results indicate that a single residue in pol ι is able to discriminate between NTPs and dNTPs during DNA synthesis. Because wild-type pol ι incorporates NTPs in a template-specific manner, certain DNA sequences may be "at risk" for elevated mutagenesis during pol ι-dependent TLS. Molecular modeling indicates that the constricted active site of wild-type pol ι becomes more spacious in the Y39A variant. Therefore, the Y39A substitution not only permits incorporation of ribonucleotides but also causes the enzyme to favor faithful Watson-Crick base pairing over mutagenic configurations.

  9. A novel cell culture model as a tool for forensic biology experiments and validations.

    PubMed

    Feine, Ilan; Shpitzen, Moshe; Roth, Jonathan; Gafny, Ron

    2016-09-01

    To improve and advance DNA forensic casework investigation outcomes, extensive field and laboratory experiments are carried out in a broad range of relevant branches, such as touch and trace DNA, secondary DNA transfer and contamination confinement. Moreover, the development of new forensic tools, for example new sampling appliances, by commercial companies requires ongoing validation and assessment by forensic scientists. A frequent challenge in these kinds of experiments and validations is the lack of a stable, reproducible and flexible biological reference material. As a possible solution, we present here a cell culture model based on skin-derived human dermal fibroblasts. Cultured cells were harvested, quantified and dried on glass slides. These slides were used in adhesive tape-lifting experiments and tests of DNA crossover confinement by UV irradiation. The use of this model enabled a simple and concise comparison between four adhesive tapes, as well as a straightforward demonstration of the effect of UV irradiation intensities on DNA quantity and degradation. In conclusion, we believe this model has great potential to serve as an efficient research tool in forensic biology. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  10. Molecular Sticker Model Stimulation on Silicon for a Maximum Clique Problem

    PubMed Central

    Ning, Jianguo; Li, Yanmei; Yu, Wen

    2015-01-01

    Molecular computers (also called DNA computers), as an alternative to traditional electronic computers, are smaller in size but more energy efficient, and have massive parallel processing capacity. However, DNA computers may not outperform electronic computers owing to their higher error rates and some limitations of the biological laboratory. The stickers model, as a typical DNA-based computer, is computationally complete and universal, and can be viewed as a bit-vertically operating machine. This makes it attractive for silicon implementation. Inspired by the information processing method on the stickers computer, we propose a novel parallel computing model called DEM (DNA Electronic Computing Model) on System-on-a-Programmable-Chip (SOPC) architecture. Except for the significant difference in the computing medium—transistor chips rather than bio-molecules—the DEM works similarly to DNA computers in immense parallel information processing. Additionally, a plasma display panel (PDP) is used to show the change of solutions, and helps us directly see the distribution of assignments. The feasibility of the DEM is tested by applying it to compute a maximum clique problem (MCP) with eight vertices. Owing to the limited computing sources on SOPC architecture, the DEM could solve moderate-size problems in polynomial time. PMID:26075867

  11. Electrokinetic transport of rigid macroions in the thin double layer limit: a boundary element approach.

    PubMed

    Allison, Stuart A; Xin, Yao

    2005-08-15

    A boundary element (BE) procedure is developed to numerically calculate the electrophoretic mobility of highly charged, rigid model macroions in the thin double layer regime based on the continuum primitive model. The procedure is based on that of O'Brien (R.W. O'Brien, J. Colloid Interface Sci. 92 (1983) 204). The advantage of the present procedure over existing BE methodologies that are applicable to rigid model macroions in general (S. Allison, Macromolecules 29 (1996) 7391) is that computationally time consuming integrations over a large number of volume elements that surround the model particle are completely avoided. The procedure is tested by comparing the mobilities derived from it with independent theory of the mobility of spheres of radius a in a salt solution with Debye-Huckel screening parameter, kappa. The procedure is shown to yield accurate mobilities provided (kappa)a exceeds approximately 50. The methodology is most relevant to model macroions of mean linear dimension, L, with 1000>(kappa)L>100 and reduced absolute zeta potential (q|zeta|/k(B)T) greater than 1.0. The procedure is then applied to the compact form of high molecular weight, duplex DNA that is formed in the presence of the trivalent counterion, spermidine, under low salt conditions. For T4 DNA (166,000 base pairs), the compact form is modeled as a sphere (diameter=600 nm) and as a toroid (largest linear dimension=600 nm). In order to reconcile experimental and model mobilities, approximately 95% of the DNA phosphates must be neutralized by bound counterions. This interpretation, based on electrokinetics, is consistent with independent studies.

  12. Chromosomal instability mediated by non-B DNA: cruciform conformation and not DNA sequence is responsible for recurrent translocation in humans.

    PubMed

    Inagaki, Hidehito; Ohye, Tamae; Kogo, Hiroshi; Kato, Takema; Bolor, Hasbaira; Taniguchi, Mariko; Shaikh, Tamim H; Emanuel, Beverly S; Kurahashi, Hiroki

    2009-02-01

    Chromosomal aberrations have been thought to be random events. However, recent findings introduce a new paradigm in which certain DNA segments have the potential to adopt unusual conformations that lead to genomic instability and nonrandom chromosomal rearrangement. One of the best-studied examples is the palindromic AT-rich repeat (PATRR), which induces recurrent constitutional translocations in humans. Here, we established a plasmid-based model that promotes frequent intermolecular rearrangements between two PATRRs in HEK293 cells. In this model system, the proportion of PATRR plasmid that extrudes a cruciform structure correlates to the levels of rearrangement. Our data suggest that PATRR-mediated translocations are attributable to unusual DNA conformations that confer a common pathway for chromosomal rearrangements in humans.

  13. Hidden Markov Model-Based CNV Detection Algorithms for Illumina Genotyping Microarrays.

    PubMed

    Seiser, Eric L; Innocenti, Federico

    2014-01-01

    Somatic alterations in DNA copy number have been well studied in numerous malignancies, yet the role of germline DNA copy number variation in cancer is still emerging. Genotyping microarrays generate allele-specific signal intensities to determine genotype, but may also be used to infer DNA copy number using additional computational approaches. Numerous tools have been developed to analyze Illumina genotype microarray data for copy number variant (CNV) discovery, although commonly utilized algorithms freely available to the public employ approaches based upon the use of hidden Markov models (HMMs). QuantiSNP, PennCNV, and GenoCN utilize HMMs with six copy number states but vary in how transition and emission probabilities are calculated. Performance of these CNV detection algorithms has been shown to be variable between both genotyping platforms and data sets, although HMM approaches generally outperform other current methods. Low sensitivity is prevalent with HMM-based algorithms, suggesting the need for continued improvement in CNV detection methodologies.

  14. Multivalent Lipid--DNA Complexes: Distinct DNA Compaction Regimes

    NASA Astrophysics Data System (ADS)

    Evans, Heather M.; Ahmad, A.; Ewert, K.; Safinya, C. R.

    2004-03-01

    Cationic liposomes (CL), while intrinsically advantageous in comparison to viruses, still have limited success for gene therapy and require more study. CL spontaneously self-assemble with DNA via counterion release, forming small particles approximately 200nm in diameter. X-ray diffraction reveals CL-DNA structures that are typically a multilamellar organization of lipids with DNA intercalated between the layers. We explore the structural properties of CL-DNA complexes formed with new multivalent lipids (Ewert et al, J. Med. Chem. 2002; 45:5023) that range from 2+ to 16+. Contrary to a simple prediction for the DNA interaxial spacing d_DNA based on a geometrical space-filling model, these lipids show dramatic DNA compaction, down to d_DNA ˜ 25 ÅVariations in the membrane charge density, σ _M, lead to distinct spacing regimes. We propose that this DNA condensation is controlled by a unique locking mechanism between the DNA double helix and the large, multivalent lipid head groups. Funded by NSF DMR-0203755 and NIH GM-59288.

  15. Quantitative Assessment of the Interplay Between DNA Elasticity and Cooperative Binding of Ligands

    NASA Astrophysics Data System (ADS)

    Siman, L.; Carrasco, I. S. S.; da Silva, J. K. L.; de Oliveira, M. C.; Rocha, M. S.; Mesquita, O. N.

    2012-12-01

    Binding of ligands to DNA can be studied by measuring the change of the persistence length of the complex formed, in single-molecule assays. We propose a methodology for persistence length data analysis based on a quenched disorder statistical model and describing the binding isotherm by a Hill-type equation. We obtain an expression for the effective persistence length as a function of the total ligand concentration, which we apply to our data of the DNA-cationic β-cyclodextrin and to the DNA-HU protein data available in the literature, determining the values of the local persistence lengths, the dissociation constant, and the degree of cooperativity for each set of data. In both cases the persistence length behaves nonmonotonically as a function of ligand concentration and based on the results obtained we discuss some physical aspects of the interplay between DNA elasticity and cooperative binding of ligands.

  16. Sequence periodicity in nucleosomal DNA and intrinsic curvature

    PubMed Central

    2010-01-01

    Background Most eukaryotic DNA contained in the nucleus is packaged by wrapping DNA around histone octamers. Histones are ubiquitous and bind most regions of chromosomal DNA. In order to achieve smooth wrapping of the DNA around the histone octamer, the DNA duplex should be able to deform and should possess intrinsic curvature. The deformability of DNA is a result of the non-parallelness of base pair stacks. The stacking interaction between base pairs is sequence dependent. The higher the stacking energy the more rigid the DNA helix, thus it is natural to expect that sequences that are involved in wrapping around the histone octamer should be unstacked and possess intrinsic curvature. Intrinsic curvature has been shown to be dictated by the periodic recurrence of certain dinucleotides. Several genome-wide studies directed towards mapping of nucleosome positions have revealed periodicity associated with certain stretches of sequences. In the current study, these sequences have been analyzed with a view to understand their sequence-dependent structures. Results Higher order DNA structures and the distribution of molecular bend loci associated with 146 base nucleosome core DNA sequence from C. elegans and chicken have been analyzed using the theoretical model for DNA curvature. The curvature dispersion calculated by cyclically permuting the sequences revealed that the molecular bend loci were delocalized throughout the nucleosome core region and had varying degrees of intrinsic curvature. Conclusions The higher order structures associated with nucleosomes of C.elegans and chicken calculated from the sequences revealed heterogeneity with respect to the deviation of the DNA axis. The results points to the possibility of context dependent curvature of varying degrees to be associated with nucleosomal DNA. PMID:20487515

  17. Internal twisting motion dependent conductance of an aperiodic DNA molecule

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wiliyanti, Vandan, E-mail: vandan.wiliyanti@ui.ac.id; Yudiarsah, Efta

    The influence of internal twisting motion of base-pair on conductance of an aperiodic DNA molecule has been studied. Double-stranded DNA molecule with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. The molecule is modeled using Hamiltonian Tight Binding, in which the effect of twisting motion on base onsite energy and between bases electron hopping constant was taking into account. Semi-empirical theory of Slater-Koster is employed in bringing the twisting motion effect on the hopping constants. In addition to the ability to hop from one base to other base, electron can also hop from amore » base to sugar-phosphate backbone and vice versa. The current flowing through DNA molecule is calculated using Landauer–Büttiker formula from transmission probability, which is calculated using transfer matrix technique and scattering matrix method, simultaneously. Then, the differential conductance is calculated from the I-V curve. The calculation result shows at some region of voltages, the conductance increases as the frequency increases, but in other region it decreases with the frequency.« less

  18. A Role for Single-Stranded Exonucleases in the Use of DNA as a Nutrient▿

    PubMed Central

    Palchevskiy, Vyacheslav; Finkel, Steven E.

    2009-01-01

    Nutritional competence is the ability of bacterial cells to utilize exogenous double-stranded DNA molecules as a nutrient source. We previously identified several genes in Escherichia coli that are important for this process and proposed a model, based on models of natural competence and transformation in bacteria, where it is assumed that single-stranded DNA (ssDNA) is degraded following entry into the cytoplasm. Since E. coli has several exonucleases, we determined whether they play a role in the long-term survival and the catabolism of DNA as a nutrient. We show here that mutants lacking either ExoI, ExoVII, ExoX, or RecJ are viable during all phases of the bacterial life cycle yet cannot compete with wild-type cells during long-term stationary-phase incubation. We also show that nuclease mutants, alone or in combination, are defective in DNA catabolism, with the exception of the ExoX− single mutant. The ExoX− mutant consumes double-stranded DNA better than wild-type cells, possibly implying the presence of two pathways in E. coli for the processing of ssDNA as it enters the cytoplasm. PMID:19329645

  19. Chiral pathways in DNA dinucleotides using gradient optimized refinement along metastable borders

    NASA Astrophysics Data System (ADS)

    Romano, Pablo; Guenza, Marina

    We present a study of DNA breathing fluctuations using Markov state models (MSM) with our novel refinement procedure. MSM have become a favored method of building kinetic models, however their accuracy has always depended on using a significant number of microstates, making the method costly. We present a method which optimizes macrostates by refining borders with respect to the gradient along the free energy surface. As the separation between macrostates contains highest discretization errors, this method corrects for any errors produced by limited microstate sampling. Using our refined MSM methods, we investigate DNA breathing fluctuations, thermally induced conformational changes in native B-form DNA. Running several microsecond MD simulations of DNA dinucleotides of varying sequences, to include sequence and polarity effects, we've analyzed using our refined MSM to investigate conformational pathways inherent in the unstacking of DNA bases. Our kinetic analysis has shown preferential chirality in unstacking pathways that may be critical in how proteins interact with single stranded regions of DNA. These breathing dynamics can help elucidate the connection between conformational changes and key mechanisms within protein-DNA recognition. NSF Chemistry Division (Theoretical Chemistry), the Division of Physics (Condensed Matter: Material Theory), XSEDE.

  20. Effect of structure variation of the aptamer-DNA duplex probe on the performance of displacement-based electrochemical aptamer sensors.

    PubMed

    Pang, Jie; Zhang, Ziping; Jin, Haizhu

    2016-03-15

    Electrochemical aptamer-based (E-AB) sensors employing electrode-immobilized, redox-tagged aptamer probes have emerged as a promising platform for the sensitive and quick detection of target analytes ranging from small molecules to proteins. Signal generation in this class of sensor is linked to change in electron transfer efficiency upon binding-induced change in flexibility/conformation of the aptamer probe. Because of this signaling mechanism, signal gains of these sensors can be improved by employing a displacement-based recognition system, which links target binding with a large-scale flexibility/conformation shift from the aptamer-DNA duplex to the single-stranded DNA or the native aptamer. Despite the relatively large number of displacement-based E-AB sensor samples, little attention has been paid to the structure variation of the aptamer-DNA duplex probe. Here we detail the effects of complementary length and position of the aptamer-DNA duplex probe on the performance of a model displacement-based E-AB sensor for ATP. We find that, greater background suppression and signal gain are observed with longer complementary length of the aptamer-DNA duplex probe. However, sensor equilibration time slows monotonically with increasing complementary length; and with too many target binding sites in aptamer sequence being occupied by the complementary DNA, the aptamer-target binding does not occur and no signal gain observed. We also demonstrate that signal gain of the displacement-based E-AB sensor is strongly dependent on the complementary position of the aptamer-DNA duplex probe, with complementary position located at the electrode-attached or redox-tagged end of the duplex probe, larger background suppression and signal increase than that of the middle position are observed. These results highlight the importance of rational structure design of the aptamer-DNA duplex probe and provide new insights into the optimization of displacement-based E-AB sensors. Copyright © 2015 Elsevier B.V. All rights reserved.

  1. Kr-86 Ion-Beam Irradiation of Hydrated DNA: Free Radical and Unaltered Base Yields

    PubMed Central

    Becker, David; Adhikary, Amitava; Tetteh, Smedley T.; Bull, Arthur W.; Sevilla, Michael D.

    2012-01-01

    This work reports an ESR and product analysis investigation of Kr-86 ion-beam irradiation of hydrated DNA at 77 K. The irradiation results in the formation and trapping of both base radicals and sugar phosphate radicals (DNA backbone radicals). The absolute yields (G, μmol/J) of the base radicals are smaller than the yields found in similarly prepared γ-irradiated DNA samples, and the relative yields of backbone radicals relative to base radicals are much higher than that found in γ-irradiated samples. From these results, we have elaborated our radiation chemical model of the track structure for ion-beam irradiated DNA as it applies to krypton ion-beams. The base radicals, which are trapped as ion radicals or reversibly protonated or deprotonated ion radicals, are formed almost entirely in the track penumbra, a region in which radiation chemical effects are similar to those found in γ-irradiated samples. By comparing the yields of base radicals in ion-beam samples to the yields of the same radicals in γ-irradiated samples, the partition of energy between the low-LET region (penumbra) and the core is experimentally determined. The neutral sugar and other backbone radicals, which are not as susceptible to recombination as are ion radicals, are formed largely in the track core. The backbone radicals show a linear dose response up to very high doses. Unaltered base release yields in Kr-86 irradiated hydrated DNA are equal to sugar radical yields within experimental error limits, consistent with radiation-chemical processes in which all base release originates with sugar radicals. Two phosphorus-centered radicals from fragmentation of the DNA backbone are found in low yields. PMID:23106211

  2. Kr-86 ion-beam irradiation of hydrated DNA: free radical and unaltered base yields.

    PubMed

    Becker, David; Adhikary, Amitava; Tetteh, Smedley T; Bull, Arthur W; Sevilla, Michael D

    2012-12-01

    This work reports an ESR and product analysis investigation of Kr-86 ion-beam irradiation of hydrated DNA at 77 K. The irradiation results in the formation and trapping of both base radicals and sugar phosphate radicals (DNA backbone radicals). The absolute yields (G, μmol/J) of the base radicals are smaller than the yields found in similarly prepared γ-irradiated DNA samples, and the relative yields of backbone radicals relative to base radicals are much higher than that found in γ-irradiated samples. From these results, we have elaborated our radiation chemical model of the track structure for ion-beam irradiated DNA as it applies to krypton ion-beams. The base radicals, which are trapped as ion radicals or reversibly protonated or deprotonated ion radicals, are formed almost entirely in the track penumbra, a region in which radiation chemical effects are similar to those found in γ-irradiated samples. By comparing the yields of base radicals in ion-beam samples to the yields of the same radicals in γ-irradiated samples, the partition of energy between the low-LET region (penumbra) and the core is experimentally determined. The neutral sugar and other backbone radicals, which are not as susceptible to recombination as are ion radicals, are formed largely in the track core. The backbone radicals show a linear dose response up to very high doses. Unaltered base release yields in Kr-86 irradiated hydrated DNA are equal to sugar radical yields within experimental error limits, consistent with radiation-chemical processes in which all base release originates with sugar radicals. Two phosphorus-centered radicals from fragmentation of the DNA backbone are found in low yields.

  3. Exploring the Feasibility of a DNA Computer: Design of an ALU Using Sticker-Based DNA Model.

    PubMed

    Sarkar, Mayukh; Ghosal, Prasun; Mohanty, Saraju P

    2017-09-01

    Since its inception, DNA computing has advanced to offer an extremely powerful, energy-efficient emerging technology for solving hard computational problems with its inherent massive parallelism and extremely high data density. This would be much more powerful and general purpose when combined with other existing well-known algorithmic solutions that exist for conventional computing architectures using a suitable ALU. Thus, a specifically designed DNA Arithmetic and Logic Unit (ALU) that can address operations suitable for both domains can mitigate the gap between these two. An ALU must be able to perform all possible logic operations, including NOT, OR, AND, XOR, NOR, NAND, and XNOR; compare, shift etc., integer and floating point arithmetic operations (addition, subtraction, multiplication, and division). In this paper, design of an ALU has been proposed using sticker-based DNA model with experimental feasibility analysis. Novelties of this paper may be in manifold. First, the integer arithmetic operations performed here are 2s complement arithmetic, and the floating point operations follow the IEEE 754 floating point format, resembling closely to a conventional ALU. Also, the output of each operation can be reused for any next operation. So any algorithm or program logic that users can think of can be implemented directly on the DNA computer without any modification. Second, once the basic operations of sticker model can be automated, the implementations proposed in this paper become highly suitable to design a fully automated ALU. Third, proposed approaches are easy to implement. Finally, these approaches can work on sufficiently large binary numbers.

  4. Genetic models reveal historical patterns of sea lamprey population fluctuations within Lake Champlain

    PubMed Central

    Azodi, Christina B.; Sheldon, Sallie P.; Trombulak, Stephen C.; Ardren, William R.

    2015-01-01

    The origin of sea lamprey (Petromyzon marinus) in Lake Champlain has been heavily debated over the past decade. Given the lack of historical documentation, two competing hypotheses have emerged in the literature. First, it has been argued that the relatively recent population size increase and concomitant rise in wounding rates on prey populations are indicative of an invasive population that entered the lake through the Champlain Canal. Second, recent genetic evidence suggests a post-glacial colonization at the end of the Pleistocene, approximately 11,000 years ago. One limitation to resolving the origin of sea lamprey in Lake Champlain is a lack of historical and current measures of population size. In this study, the issue of population size was explicitly addressed using nuclear (nDNA) and mitochondrial DNA (mtDNA) markers to estimate historical demography with genetic models. Haplotype network analysis, mismatch analysis, and summary statistics based on mtDNA noncoding sequences for NCI (479 bp) and NCII (173 bp) all indicate a recent population expansion. Coalescent models based on mtDNA and nDNA identified two potential demographic events: a population decline followed by a very recent population expansion. The decline in effective population size may correlate with land-use and fishing pressure changes post-European settlement, while the recent expansion may be associated with the implementation of the salmonid stocking program in the 1970s. These results are most consistent with the hypothesis that sea lamprey are native to Lake Champlain; however, the credibility intervals around parameter estimates demonstrate that there is uncertainty regarding the magnitude and timing of past demographic events. PMID:26539334

  5. How a short double-stranded DNA bends

    NASA Astrophysics Data System (ADS)

    Shin, Jaeoh; Lee, O.-Chul; Sung, Wokyung

    2015-04-01

    A recent experiment using fluorescence microscopy showed that double-stranded DNA fragments shorter than 100 base pairs loop with the probabilities higher by the factor of 102-106 than predicted by the worm-like chain (WLC) model [R. Vafabakhsh and T. Ha, Science 337, 1101(2012)]. Furthermore, the looping probabilities were found to be nearly independent of the loop size. The results signify a breakdown of the WLC model for DNA mechanics which works well on long length scales and calls for fundamental understanding for stressed DNA on shorter length scales. We develop an analytical, statistical mechanical model to investigate what emerges to the short DNA under a tight bending. A bending above a critical level initiates nucleation of a thermally induced bubble, which could be trapped for a long time, in contrast to the bubbles in both free and uniformly bent DNAs, which are either transient or unstable. The trapped bubble is none other than the previously hypothesized kink, which releases the bending energy more easily as the contour length decreases. It leads to tremendous enhancement of the cyclization probabilities, in a reasonable agreement with experiment.

  6. DNA Interactions Probed by Hydrogen-Deuterium Exchange (HDX) Fourier Transform Ion Cyclotron Resonance Mass Spectrometry Confirm External Binding Sites on the Minichromosomal Maintenance (MCM) Helicase.

    PubMed

    Graham, Brian W; Tao, Yeqing; Dodge, Katie L; Thaxton, Carly T; Olaso, Danae; Young, Nicolas L; Marshall, Alan G; Trakselis, Michael A

    2016-06-10

    The archaeal minichromosomal maintenance (MCM) helicase from Sulfolobus solfataricus (SsoMCM) is a model for understanding structural and mechanistic aspects of DNA unwinding. Although interactions of the encircled DNA strand within the central channel provide an accepted mode for translocation, interactions with the excluded strand on the exterior surface have mostly been ignored with regard to DNA unwinding. We have previously proposed an extension of the traditional steric exclusion model of unwinding to also include significant contributions with the excluded strand during unwinding, termed steric exclusion and wrapping (SEW). The SEW model hypothesizes that the displaced single strand tracks along paths on the exterior surface of hexameric helicases to protect single-stranded DNA (ssDNA) and stabilize the complex in a forward unwinding mode. Using hydrogen/deuterium exchange monitored by Fourier transform ion cyclotron resonance MS, we have probed the binding sites for ssDNA, using multiple substrates targeting both the encircled and excluded strand interactions. In each experiment, we have obtained >98.7% sequence coverage of SsoMCM from >650 peptides (5-30 residues in length) and are able to identify interacting residues on both the interior and exterior of SsoMCM. Based on identified contacts, positively charged residues within the external waist region were mutated and shown to generally lower DNA unwinding without negatively affecting the ATP hydrolysis. The combined data globally identify binding sites for ssDNA during SsoMCM unwinding as well as validating the importance of the SEW model for hexameric helicase unwinding. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  7. Space Radiation Effects on Human Cells: Modeling DNA Breakage, DNA Damage Foci Distribution, Chromosomal Aberrations and Tissue Effects

    NASA Technical Reports Server (NTRS)

    Ponomarev, A. L.; Huff, J. L.; Cucinotta, F. A.

    2011-01-01

    Future long-tem space travel will face challenges from radiation concerns as the space environment poses health risk to humans in space from radiations with high biological efficiency and adverse post-flight long-term effects. Solar particles events may dramatically affect the crew performance, while Galactic Cosmic Rays will induce a chronic exposure to high-linear-energy-transfer (LET) particles. These types of radiation, not present on the ground level, can increase the probability of a fatal cancer later in astronaut life. No feasible shielding is possible from radiation in space, especially for the heavy ion component, as suggested solutions will require a dramatic increase in the mass of the mission. Our research group focuses on fundamental research and strategic analysis leading to better shielding design and to better understanding of the biological mechanisms of radiation damage. We present our recent effort to model DNA damage and tissue damage using computational models based on the physics of heavy ion radiation, DNA structure and DNA damage and repair in human cells. Our particular area of expertise include the clustered DNA damage from high-LET radiation, the visualization of DSBs (DNA double strand breaks) via DNA damage foci, image analysis and the statistics of the foci for different experimental situations, chromosomal aberration formation through DSB misrepair, the kinetics of DSB repair leading to a model-derived spectrum of chromosomal aberrations, and, finally, the simulation of human tissue and the pattern of apoptotic cell damage. This compendium of theoretical and experimental data sheds light on the complex nature of radiation interacting with human DNA, cells and tissues, which can lead to mutagenesis and carcinogenesis later in human life after the space mission.

  8. Prediction of gestational age based on genome-wide differentially methylated regions.

    PubMed

    Bohlin, J; Håberg, S E; Magnus, P; Reese, S E; Gjessing, H K; Magnus, M C; Parr, C L; Page, C M; London, S J; Nystad, W

    2016-10-07

    We explored the association between gestational age and cord blood DNA methylation at birth and whether DNA methylation could be effective in predicting gestational age due to limitations with the presently used methods. We used data from the Norwegian Mother and Child Birth Cohort study (MoBa) with Illumina HumanMethylation450 data measured for 1753 newborns in two batches: MoBa 1, n = 1068; and MoBa 2, n = 685. Gestational age was computed using both ultrasound and the last menstrual period. We evaluated associations between DNA methylation and gestational age and developed a statistical model for predicting gestational age using MoBa 1 for training and MoBa 2 for predictions. The prediction model was additionally used to compare ultrasound and last menstrual period-based gestational age predictions. Furthermore, both CpGs and associated genes detected in the training models were compared to those detected in a published prediction model for chronological age. There were 5474 CpGs associated with ultrasound gestational age after adjustment for a set of covariates, including estimated cell type proportions, and Bonferroni-correction for multiple testing. Our model predicted ultrasound gestational age more accurately than it predicted last menstrual period gestational age. DNA methylation at birth appears to be a good predictor of gestational age. Ultrasound gestational age is more strongly associated with methylation than last menstrual period gestational age. The CpGs linked with our gestational age prediction model, and their associated genes, differed substantially from the corresponding CpGs and genes associated with a chronological age prediction model.

  9. Similarities and Differences between RNA and DNA Double-Helical Structures in Circular Dichroism Spectroscopy: A SAC-CI Study.

    PubMed

    Miyahara, Tomoo; Nakatsuji, Hiroshi; Sugiyama, Hiroshi

    2016-11-17

    The helical structures of DNA and RNA are investigated experimentally using circular dichroism (CD) spectroscopy. The signs and the shapes of the CD spectra are much different between the right- and left-handed structures as well as between DNA and RNA. The main difference lies in the sign at around 295 nm of the CD spectra: it is positive for the right-handed B-DNA and the left-handed Z-RNA but is negative for the left-handed Z-DNA and the right-handed A-RNA. We calculated the SAC-CI CD spectra of DNA and RNA using the tetramer models, which include both hydrogen-bonding and stacking interactions that are important in both DNA and RNA. The SAC-CI results reproduced the features at around 295 nm of the experimental CD spectra of each DNA and RNA, and elucidated that the strong stacking interaction between the two base pairs is the origin of the negative peaks at 295 nm of the CD spectra for both DNA and RNA. On the basis of these facts, we discuss the similarities and differences between RNA and DNA double-helical structures in the CD spectroscopy based on the ChiraSac methodology.

  10. Theoretical Analysis of Competing Conformational Transitions in Superhelical DNA

    PubMed Central

    Zhabinskaya, Dina; Benham, Craig J.

    2012-01-01

    We develop a statistical mechanical model to analyze the competitive behavior of transitions to multiple alternate conformations in a negatively supercoiled DNA molecule of kilobase length and specified base sequence. Since DNA superhelicity topologically couples together the transition behaviors of all base pairs, a unified model is required to analyze all the transitions to which the DNA sequence is susceptible. Here we present a first model of this type. Our numerical approach generalizes the strategy of previously developed algorithms, which studied superhelical transitions to a single alternate conformation. We apply our multi-state model to study the competition between strand separation and B-Z transitions in superhelical DNA. We show this competition to be highly sensitive to temperature and to the imposed level of supercoiling. Comparison of our results with experimental data shows that, when the energetics appropriate to the experimental conditions are used, the competition between these two transitions is accurately captured by our algorithm. We analyze the superhelical competition between B-Z transitions and denaturation around the c-myc oncogene, where both transitions are known to occur when this gene is transcribing. We apply our model to explore the correlation between stress-induced transitions and transcriptional activity in various organisms. In higher eukaryotes we find a strong enhancement of Z-forming regions immediately 5′ to their transcription start sites (TSS), and a depletion of strand separating sites in a broad region around the TSS. The opposite patterns occur around transcript end locations. We also show that susceptibility to each type of transition is different in eukaryotes and prokaryotes. By analyzing a set of untranscribed pseudogenes we show that the Z-susceptibility just downstream of the TSS is not preserved, suggesting it may be under selection pressure. PMID:22570598

  11. The effect of microscopic attractive interactions on piezoelectric coefficients of nanoscale DNA films and its resultant mirocantilever-based biosensor signals

    NASA Astrophysics Data System (ADS)

    Wu, Jun-Zheng; Zhou, Mei-Hong; Zhang, Neng-Hui

    2017-10-01

    The adsorption of charged biomolecules on a substrate will trigger a self-induced electric potential field that could deflect microcantilever biosensors in the nanometer regime. The paper is devoted to a multiscale characterization of the piezoelectric coefficient of double-stranded DNA (dsDNA) films with microscopic attractive interactions in multivalence salt solutions, which has a close relationship with biosensor signals. First, two different analytical models of cantilever deflections based on macroscopic piezoelectric theories or mesoscopic liquid crystal theories were combined in the sense of equivalent deformation in order to bridge the relation between the macroscopic piezoelectric coefficient of an adsorbate film and the sensitivity of its microstructure to surrounding conditions. Second, two interaction potentials of the free energy for repulsion-dominated DNA films in NaCl solution or attraction-repulsion-coexisted DNA films in multivalent salt solutions were used to compare the piezoelectric effect and the resultant cantilever deformation at various packing conditions, such as different packing density, various nucleotide numbers and two packing technologies, i.e. nano-grafting or self-assembling technology. The variational tendency of microcantilever deflections predicted by the present multiscale analytical model agrees well with the related DNA-mirocantilever experiments. Negative piezoelectric coefficient of dsDNA film exists in multivalent salt solutions, and its distinctive size effect with different packing densities and nucleotide numbers provides us with an opportunity to obtain a more sensitive microcantilever sensor by careful control of packing conditions.

  12. A discriminatory function for prediction of protein-DNA interactions based on alpha shape modeling.

    PubMed

    Zhou, Weiqiang; Yan, Hong

    2010-10-15

    Protein-DNA interaction has significant importance in many biological processes. However, the underlying principle of the molecular recognition process is still largely unknown. As more high-resolution 3D structures of protein-DNA complex are becoming available, the surface characteristics of the complex become an important research topic. In our work, we apply an alpha shape model to represent the surface structure of the protein-DNA complex and developed an interface-atom curvature-dependent conditional probability discriminatory function for the prediction of protein-DNA interaction. The interface-atom curvature-dependent formalism captures atomic interaction details better than the atomic distance-based method. The proposed method provides good performance in discriminating the native structures from the docking decoy sets, and outperforms the distance-dependent formalism in terms of the z-score. Computer experiment results show that the curvature-dependent formalism with the optimal parameters can achieve a native z-score of -8.17 in discriminating the native structure from the highest surface-complementarity scored decoy set and a native z-score of -7.38 in discriminating the native structure from the lowest RMSD decoy set. The interface-atom curvature-dependent formalism can also be used to predict apo version of DNA-binding proteins. These results suggest that the interface-atom curvature-dependent formalism has a good prediction capability for protein-DNA interactions. The code and data sets are available for download on http://www.hy8.com/bioinformatics.htm kenandzhou@hotmail.com.

  13. Physical principles for DNA tile self-assembly.

    PubMed

    Evans, Constantine G; Winfree, Erik

    2017-06-19

    DNA tiles provide a promising technique for assembling structures with nanoscale resolution through self-assembly by basic interactions rather than top-down assembly of individual structures. Tile systems can be programmed to grow based on logical rules, allowing for a small number of tile types to assemble large, complex assemblies that can retain nanoscale resolution. Such algorithmic systems can even assemble different structures using the same tiles, based on inputs that seed the growth. While programming and theoretical analysis of tile self-assembly often makes use of abstract logical models of growth, experimentally implemented systems are governed by nanoscale physical processes that can lead to very different behavior, more accurately modeled by taking into account the thermodynamics and kinetics of tile attachment and detachment in solution. This review discusses the relationships between more abstract and more physically realistic tile assembly models. A central concern is how consideration of model differences enables the design of tile systems that robustly exhibit the desired abstract behavior in realistic physical models and in experimental implementations. Conversely, we identify situations where self-assembly in abstract models can not be well-approximated by physically realistic models, putting constraints on physical relevance of the abstract models. To facilitate the discussion, we introduce a unified model of tile self-assembly that clarifies the relationships between several well-studied models in the literature. Throughout, we highlight open questions regarding the physical principles for DNA tile self-assembly.

  14. Measuring DNA hybridization using fluorescent DNA-stabilized silver clusters to investigate mismatch effects on therapeutic oligonucleotides.

    PubMed

    de Bruin, Donny; Bossert, Nelli; Aartsma-Rus, Annemieke; Bouwmeester, Dirk

    2018-04-06

    Short nucleic acid oligomers have found a wide range of applications in experimental physics, biology and medicine, and show potential for the treatment of acquired and genetic diseases. These applications rely heavily on the predictability of hybridization through Watson-Crick base pairing to allow positioning on a nanometer scale, as well as binding to the target transcripts, but also off-target binding to transcripts with partial homology. These effects are of particular importance in the development of therapeutic oligonucleotides, where off-target effects caused by the binding of mismatched sequences need to be avoided. We employ a novel method of probing DNA hybridization using optically active DNA-stabilized silver clusters (Ag-DNA) to measure binding efficiencies through a change in fluorescence intensity. In this way we can determine their location-specific sensitivity to individual mismatches in the sequence. The results reveal a strong dependence of the hybridization on the location of the mismatch, whereby mismatches close to the edges and center show a relatively minor impact. In parallel, we propose a simple model for calculating the annealing ratios of mismatched DNA sequences, which supports our experimental results. The primary result shown in this work is a demonstration of a novel technique to measure DNA hybridization using fluorescent Ag-DNA. With this technique, we investigated the effect of mismatches on the hybridization efficiency, and found a significant dependence on the location of individual mismatches. These effects are strongly influenced by the length of the used oligonucleotides. The novel probe method based on fluorescent Ag-DNA functions as a reliable tool in measuring this behavior. As a secondary result, we formulated a simple model that is consistent with the experimental data.

  15. Assessment and characterisation of yeast-based products intended to mitigate ochratoxin exposure using in vitro and in vivo models.

    PubMed

    Pfohl-Leszkowicz, A; Hadjeba-Medjdoub, K; Ballet, N; Schrickx, J; Fink-Gremmels, J

    2015-01-01

    The aim of this paper was to evaluate the capacity of several yeast-based products, derived from baker's and brewer's yeasts, to sequester the mycotoxin ochratoxin A (OTA) and to decrease its rate of absorption and DNA adduct formation in vivo. The experimental protocol included in vitro binding studies using isotherm models, in vivo chicken experiments, in which the serum and tissue concentrations of OTA were analysed in the absence and presence of the test compounds, and the profile of OTA-derived metabolites and their associated DNA adducts were determined. Additionally in vitro cell culture studies (HK2 cells) were applied to assess further the effects for yeast cell product enriched with glutathione (GSH) or selenium. Results of the in vitro binding assay in a buffer system indicated the ability of the yeast-based products, as sequester of OTA, albeit at a different level. In the in vitro experiments in chickens, decreased serum and tissue concentrations of treated animals confirmed that yeast-based products are able to prevent the absorption of OTA. A comparison of the binding affinity in a standard in vitro binding assay with the results obtained in an in vivo chicken experiment, however, showed a poor correlation and resulted in a different ranking of the products. More importantly, we could show that yeast-based products actively modulate the biotransformation of OTA in vivo as well as in vitro in a cell culture model. This effect seems to be attributable to residual enzymatic activities in the yeast-based products. An enrichment of yeast cell wall products with GSH or selenium further modulated the profile of the generated OTA metabolites and the associated pattern of OTA-induced DNA adducts by increasing the conversion of OTA into less toxic metabolites such as OTA, OTB and 4-OH-OTA. A reduced absorption and DNA adduct formation was particularly observed with GSH-enriched yeast, whereas selenium-enriched yeasts could counteract the OTA-induced decrease in cell viability, but at the same time increased the OTA-DNA adducts formation. These findings indicate the need for an in-depth characterisation of yeast-based products used as mycotoxin-mitigating feed additives, in in vivo models with target animal species taking into account not only their ability to sequester toxins in the gastrointestinal tract but also their potential effects on the biotransformation of mycotoxins.

  16. Nanopore-CMOS Interfaces for DNA Sequencing

    PubMed Central

    Magierowski, Sebastian; Huang, Yiyun; Wang, Chengjie; Ghafar-Zadeh, Ebrahim

    2016-01-01

    DNA sequencers based on nanopore sensors present an opportunity for a significant break from the template-based incumbents of the last forty years. Key advantages ushered by nanopore technology include a simplified chemistry and the ability to interface to CMOS technology. The latter opportunity offers substantial promise for improvement in sequencing speed, size and cost. This paper reviews existing and emerging means of interfacing nanopores to CMOS technology with an emphasis on massively-arrayed structures. It presents this in the context of incumbent DNA sequencing techniques, reviews and quantifies nanopore characteristics and models and presents CMOS circuit methods for the amplification of low-current nanopore signals in such interfaces. PMID:27509529

  17. Nanopore-CMOS Interfaces for DNA Sequencing.

    PubMed

    Magierowski, Sebastian; Huang, Yiyun; Wang, Chengjie; Ghafar-Zadeh, Ebrahim

    2016-08-06

    DNA sequencers based on nanopore sensors present an opportunity for a significant break from the template-based incumbents of the last forty years. Key advantages ushered by nanopore technology include a simplified chemistry and the ability to interface to CMOS technology. The latter opportunity offers substantial promise for improvement in sequencing speed, size and cost. This paper reviews existing and emerging means of interfacing nanopores to CMOS technology with an emphasis on massively-arrayed structures. It presents this in the context of incumbent DNA sequencing techniques, reviews and quantifies nanopore characteristics and models and presents CMOS circuit methods for the amplification of low-current nanopore signals in such interfaces.

  18. Different Amounts of DNA in Newborn Cells of Escherichia coli Preclude a Role for the Chromosome in Size Control According to the "Adder" Model.

    PubMed

    Huls, Peter G; Vischer, Norbert O E; Woldringh, Conrad L

    2018-01-01

    According to the recently-revived adder model for cell size control, newborn cells of Escherichia coli will grow and divide after having added a constant size or length, ΔL , irrespective of their size at birth. Assuming exponential elongation, this implies that large newborns will divide earlier than small ones. The molecular basis for the constant size increment is still unknown. As DNA replication and cell growth are coordinated, the constant ΔL could be based on duplication of an equal amount of DNA, ΔG , present in newborn cells. To test this idea, we measured amounts of DNA and lengths of nucleoids in DAPI-stained cells growing in batch culture at slow and fast rates. Deeply-constricted cells were divided in two subpopulations of longer and shorter lengths than average; these were considered to represent large and small prospective daughter cells, respectively. While at slow growth, large and small prospective daughter cells contained similar amounts of DNA, fast growing cells with multiforked replicating chromosomes, showed a significantly higher amount of DNA (20%) in the larger cells. This observation precludes the hypothesis that Δ L is based on the synthesis of a constant ΔG . Growth curves were constructed for siblings generated by asymmetric division and growing according to the adder model. Under the assumption that all cells at the same growth rate exhibit the same time between initiation of DNA replication and cell division (i.e., constant C+D -period), the constructions predict that initiation occurs at different sizes ( Li ) and that, at fast growth, large newborn cells transiently contain more DNA than small newborns, in accordance with the observations. Because the state of segregation, measured as the distance between separated nucleoids, was found to be more advanced in larger deeply-constricted cells, we propose that in larger newborns nucleoid separation occurs faster and at a shorter length, allowing them to divide earlier. We propose a composite model in which both differential initiation and segregation leads to an adder-like behavior of large and small newborn cells.

  19. Electrochemical study of quinone redox cycling: A novel application of DNA-based biosensors for monitoring biochemical reactions.

    PubMed

    Ensafi, Ali A; Jamei, Hamid Reza; Heydari-Bafrooei, Esmaeil; Rezaei, B

    2016-10-01

    This paper presents the results of an experimental investigation of voltammetric and impedimetric DNA-based biosensors for monitoring biological and chemical redox cycling reactions involving free radical intermediates. The concept is based on associating the amounts of radicals generated with the electrochemical signals produced, using differential pulse voltammetry (DPV) and electrochemical impedance spectroscopy (EIS). For this purpose, a pencil graphite electrode (PGE) modified with multiwall carbon nanotubes and poly-diallydimethlammonium chloride decorated with double stranded fish sperm DNA was prepared to detect DNA damage induced by the radicals generated from a redox cycling quinone (i.e., menadione (MD; 2-methyl-1,4-naphthoquinone)). Menadione was employed as a model compound to study the redox cycling of quinones. A direct relationship was found between free radical production and DNA damage. The relationship between MD-induced DNA damage and free radical generation was investigated in an attempt to identify the possible mechanism(s) involved in the action of MD. Results showed that DPV and EIS were appropriate, simple and inexpensive techniques for the quantitative and qualitative comparisons of different reducing reagents. These techniques may be recommended for monitoring DNA damages and investigating the mechanisms involved in the production of redox cycling compounds. Copyright © 2016 Elsevier B.V. All rights reserved.

  20. Machine Learning–Based Differential Network Analysis: A Study of Stress-Responsive Transcriptomes in Arabidopsis[W

    PubMed Central

    Ma, Chuang; Xin, Mingming; Feldmann, Kenneth A.; Wang, Xiangfeng

    2014-01-01

    Machine learning (ML) is an intelligent data mining technique that builds a prediction model based on the learning of prior knowledge to recognize patterns in large-scale data sets. We present an ML-based methodology for transcriptome analysis via comparison of gene coexpression networks, implemented as an R package called machine learning–based differential network analysis (mlDNA) and apply this method to reanalyze a set of abiotic stress expression data in Arabidopsis thaliana. The mlDNA first used a ML-based filtering process to remove nonexpressed, constitutively expressed, or non-stress-responsive “noninformative” genes prior to network construction, through learning the patterns of 32 expression characteristics of known stress-related genes. The retained “informative” genes were subsequently analyzed by ML-based network comparison to predict candidate stress-related genes showing expression and network differences between control and stress networks, based on 33 network topological characteristics. Comparative evaluation of the network-centric and gene-centric analytic methods showed that mlDNA substantially outperformed traditional statistical testing–based differential expression analysis at identifying stress-related genes, with markedly improved prediction accuracy. To experimentally validate the mlDNA predictions, we selected 89 candidates out of the 1784 predicted salt stress–related genes with available SALK T-DNA mutagenesis lines for phenotypic screening and identified two previously unreported genes, mutants of which showed salt-sensitive phenotypes. PMID:24520154

  1. Comparing Charge Transport in Oligonucleotides: RNA:DNA Hybrids and DNA Duplexes.

    PubMed

    Li, Yuanhui; Artés, Juan M; Qi, Jianqing; Morelan, Ian A; Feldstein, Paul; Anantram, M P; Hihath, Joshua

    2016-05-19

    Understanding the electronic properties of oligonucleotide systems is important for applications in nanotechnology, biology, and sensing systems. Here the charge-transport properties of guanine-rich RNA:DNA hybrids are compared to double-stranded DNA (dsDNA) duplexes with identical sequences. The conductance of the RNA:DNA hybrids is ∼10 times higher than the equivalent dsDNA, and conformational differences are determined to be the primary reason for this difference. The conductance of the RNA:DNA hybrids is also found to decrease more rapidly than dsDNA when the length is increased. Ab initio electronic structure and Green's function-based density of states calculations demonstrate that these differences arise because the energy levels are more spatially distributed in the RNA:DNA hybrid but that the number of accessible hopping sites is smaller. These combination results indicate that a simple hopping model that treats each individual guanine as a hopping site is insufficient to explain both a higher conductance and β value for RNA:DNA hybrids, and larger delocalization lengths must be considered.

  2. Quantitative analysis and prediction of G-quadruplex forming sequences in double-stranded DNA

    PubMed Central

    Kim, Minji; Kreig, Alex; Lee, Chun-Ying; Rube, H. Tomas; Calvert, Jacob; Song, Jun S.; Myong, Sua

    2016-01-01

    Abstract G-quadruplex (GQ) is a four-stranded DNA structure that can be formed in guanine-rich sequences. GQ structures have been proposed to regulate diverse biological processes including transcription, replication, translation and telomere maintenance. Recent studies have demonstrated the existence of GQ DNA in live mammalian cells and a significant number of potential GQ forming sequences in the human genome. We present a systematic and quantitative analysis of GQ folding propensity on a large set of 438 GQ forming sequences in double-stranded DNA by integrating fluorescence measurement, single-molecule imaging and computational modeling. We find that short minimum loop length and the thymine base are two main factors that lead to high GQ folding propensity. Linear and Gaussian process regression models further validate that the GQ folding potential can be predicted with high accuracy based on the loop length distribution and the nucleotide content of the loop sequences. Our study provides important new parameters that can inform the evaluation and classification of putative GQ sequences in the human genome. PMID:27095201

  3. Resolution of model Holliday junctions by yeast endonuclease: effect of DNA structure and sequence.

    PubMed Central

    Parsons, C A; Murchie, A I; Lilley, D M; West, S C

    1989-01-01

    The resolution of Holliday junctions in DNA involves specific cleavage at or close to the site of the junction. A nuclease from Saccharomyces cerevisiae cleaves model Holliday junctions in vitro by the introduction of nicks in regions of duplex DNA adjacent to the crossover point. In previous studies [Parsons and West (1988) Cell, 52, 621-629] it was shown that cleavage occurred within homologous arm sequences with precise symmetry across the junction. In contrast, junctions with heterologous arm sequences were cleaved asymmetrically. In this work, we have studied the effect of sequence changes and base modification upon the site of cleavage. It is shown that the specificity of cleavage is unchanged providing that perfect homology is maintained between opposing arm sequences. However, in the absence of homology, cleavage depends upon sequence context and is affected by minor changes such as base modification. These data support the proposed mechanism for cleavage of a Holliday junction, which requires homologous alignment of arm sequences in an enzyme--DNA complex as a prerequisite for symmetrical cleavage by the yeast endonuclease. Images PMID:2653810

  4. Miscoding and mutagenic properties of 8-oxoguanine and abasic sites: Ubiquitous lesions in damaged DNA

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Grollman, A.P.; Takeshita, Masaru

    1995-12-31

    More than twenty oxidatively-damaged bases, including 8-oxoguanine, have been found to occur in genomic DNA. Some of these lesions block DNA replication and are potentially lethal; others generate mutations which can initiate carcinogenesis and promote cellular aging. In this report, the authors focus attention on the mutagenicity and repair of 8-oxoguanine. Kasai and Nishimura`s discovery that hydroxyl radicals react with guanine residues in DNA to form 8-oxoguanine and the development of sensitive methods for the detection and quantitation of this modified base led to the observation that approximately 1 in 10{sup 5} guanine residues in mammalian DNA are oxidized atmore » the C-8 position. DNA containing 8-oxoguanine and synthetic analogs of the abasic site have been used to investigate the miscoding and mutagenic potential of these ubiquitous lesions. Studies in the laboratory were facilitated by the development of solid state synthetic methods by which these lesions could be introduced at defined positions in DNA. In this paper, the authors review studies in which 8-oxoguanine and abasic sites have been used in model systems to explore various early events in the replication of selectively damaged DNA.« less

  5. Lamellar cationic lipid-DNA complexes from lipids with a strong preference for planar geometry: A Minimal Electrostatic Model.

    PubMed

    Perico, Angelo; Manning, Gerald S

    2014-11-01

    We formulate and analyze a minimal model, based on condensation theory, of the lamellar cationic lipid (CL)-DNA complex of alternately charged lipid bilayers and DNA monolayers in a salt solution. Each lipid bilayer, composed by a random mixture of cationic and neutral lipids, is assumed to be a rigid uniformly charged plane. Each DNA monolayer, located between two lipid bilayers, is formed by the same number of parallel DNAs with a uniform separation distance. For the electrostatic calculation, the model lipoplex is collapsed to a single plane with charge density equal to the net lipid and DNA charge. The free energy difference between the lamellar lipoplex and a reference state of the same number of free lipid bilayers and free DNAs, is calculated as a function of the fraction of CLs, of the ratio of the number of CL charges to the number of negative charges of the DNA phosphates, and of the total number of planes. At the isoelectric point the free energy difference is minimal. The complex formation, already favoured by the decrease of the electrostatic charging free energy, is driven further by the free energy gain due to the release of counterions from the DNAs and from the lipid bilayers, if strongly charged. This minimal model compares well with experiment for lipids having a strong preference for planar geometry and with major features of more detailed models of the lipoplex. © 2014 Wiley Periodicals, Inc.

  6. Molecular dynamics simulations revealed structural differences among WRKY domain-DNA interaction in barley (Hordeum vulgare).

    PubMed

    Pandey, Bharati; Grover, Abhinav; Sharma, Pradeep

    2018-02-12

    The WRKY transcription factors are a class of DNA-binding proteins involved in diverse plant processes play critical roles in response to abiotic and biotic stresses. Genome-wide divergence analysis of WRKY gene family in Hordeum vulgare provided a framework for molecular evolution and functional roles. So far, the crystal structure of WRKY from barley has not been resolved; moreover, knowledge of the three-dimensional structure of WRKY domain is pre-requisites for exploring the protein-DNA recognition mechanisms. Homology modelling based approach was used to generate structures for WRKY DNA binding domain (DBD) and its variants using AtWRKY1 as a template. Finally, the stability and conformational changes of the generated model in unbound and bound form was examined through atomistic molecular dynamics (MD) simulations for 100 ns time period. In this study, we investigated the comparative binding pattern of WRKY domain and its variants with W-box cis-regulatory element using molecular docking and dynamics (MD) simulations assays. The atomic insight into WRKY domain exhibited significant variation in the intermolecular hydrogen bonding pattern, leading to the structural anomalies in the variant type and differences in the DNA-binding specificities. Based on the MD analysis, residual contribution and interaction contour, wild-type WRKY (HvWRKY46) were found to interact with DNA through highly conserved heptapeptide in the pre- and post-MD simulated complexes, whereas heptapeptide interaction with DNA was missing in variants (I and II) in post-MD complexes. Consequently, through principal component analysis, wild-type WRKY was also found to be more stable by obscuring a reduced conformational space than the variant I (HvWRKY34). Lastly, high binding free energy for wild-type and variant II allowed us to conclude that wild-type WRKY-DNA complex was more stable relative to variants I. The results of our study revealed complete dynamic and structural information about WRKY domain-DNA interactions. However, no structure base information reported to date for WRKY variants and their mechanism of interaction with DNA. Our findings highlighted the importance of selecting a sequence to generate newer transgenic plants that would be increasingly tolerance to stress conditions.

  7. Different rates of DNA replication at early versus late S-phase sections: multiscale modeling of stochastic events related to DNA content/EdU (5-ethynyl-2'deoxyuridine) incorporation distributions.

    PubMed

    Li, Biao; Zhao, Hong; Rybak, Paulina; Dobrucki, Jurek W; Darzynkiewicz, Zbigniew; Kimmel, Marek

    2014-09-01

    Mathematical modeling allows relating molecular events to single-cell characteristics assessed by multiparameter cytometry. In the present study we labeled newly synthesized DNA in A549 human lung carcinoma cells with 15-120 min pulses of EdU. All DNA was stained with DAPI and cellular fluorescence was measured by laser scanning cytometry. The frequency of cells in the ascending (left) side of the "horseshoe"-shaped EdU/DAPI bivariate distributions reports the rate of DNA replication at the time of entrance to S phase while their frequency in the descending (right) side is a marker of DNA replication rate at the time of transition from S to G2 phase. To understand the connection between molecular-scale events and scatterplot asymmetry, we developed a multiscale stochastic model, which simulates DNA replication and cell cycle progression of individual cells and produces in silico EdU/DAPI scatterplots. For each S-phase cell the time points at which replication origins are fired are modeled by a non-homogeneous Poisson Process (NHPP). Shifted gamma distributions are assumed for durations of cell cycle phases (G1, S and G2 M), Depending on the rate of DNA synthesis being an increasing or decreasing function, simulated EdU/DAPI bivariate graphs show predominance of cells in left (early-S) or right (late-S) side of the horseshoe distribution. Assuming NHPP rate estimated from independent experiments, simulated EdU/DAPI graphs are nearly indistinguishable from those experimentally observed. This finding proves consistency between the S-phase DNA-replication rate based on molecular-scale analyses, and cell population kinetics ascertained from EdU/DAPI scatterplots and demonstrates that DNA replication rate at entrance to S is relatively slow compared with its rather abrupt termination during S to G2 transition. Our approach opens a possibility of similar modeling to study the effect of anticancer drugs on DNA replication/cell cycle progression and also to quantify other kinetic events that can be measured during S-phase. © 2014 International Society for Advancement of Cytometry.

  8. Run-length encoding graphic rules, biochemically editable designs and steganographical numeric data embedment for DNA-based cryptographical coding system.

    PubMed

    Kawano, Tomonori

    2013-03-01

    There have been a wide variety of approaches for handling the pieces of DNA as the "unplugged" tools for digital information storage and processing, including a series of studies applied to the security-related area, such as DNA-based digital barcodes, water marks and cryptography. In the present article, novel designs of artificial genes as the media for storing the digitally compressed data for images are proposed for bio-computing purpose while natural genes principally encode for proteins. Furthermore, the proposed system allows cryptographical application of DNA through biochemically editable designs with capacity for steganographical numeric data embedment. As a model case of image-coding DNA technique application, numerically and biochemically combined protocols are employed for ciphering the given "passwords" and/or secret numbers using DNA sequences. The "passwords" of interest were decomposed into single letters and translated into the font image coded on the separate DNA chains with both the coding regions in which the images are encoded based on the novel run-length encoding rule, and the non-coding regions designed for biochemical editing and the remodeling processes revealing the hidden orientation of letters composing the original "passwords." The latter processes require the molecular biological tools for digestion and ligation of the fragmented DNA molecules targeting at the polymerase chain reaction-engineered termini of the chains. Lastly, additional protocols for steganographical overwriting of the numeric data of interests over the image-coding DNA are also discussed.

  9. The role of the C-domain of bacteriophage T4 gene 32 protein in ssDNA binding and dsDNA helix-destabilization: Kinetic, single-molecule, and cross-linking studies

    PubMed Central

    Pant, Kiran; Anderson, Brian; Perdana, Hendrik; Malinowski, Matthew A.; Win, Aye T.; Williams, Mark C.

    2018-01-01

    The model single-stranded DNA binding protein of bacteriophage T4, gene 32 protein (gp32) has well-established roles in DNA replication, recombination, and repair. gp32 is a single-chain polypeptide consisting of three domains. Based on thermodynamics and kinetics measurements, we have proposed that gp32 can undergo a conformational change where the acidic C-terminal domain binds internally to or near the single-stranded (ss) DNA binding surface in the core (central) domain, blocking ssDNA interaction. To test this model, we have employed a variety of experimental approaches and gp32 variants to characterize this conformational change. Utilizing stopped-flow methods, the association kinetics of wild type and truncated forms of gp32 with ssDNA were measured. When the C-domain is present, the log-log plot of k vs. [NaCl] shows a positive slope, whereas when it is absent (*I protein), there is little rate change with salt concentration, as expected for this model.A gp32 variant lacking residues 292–296 within the C-domain, ΔPR201, displays kinetic properties intermediate between gp32 and *I. The single molecule force-induced DNA helix-destabilizing activitiesas well as the single- and double-stranded DNA affinities of ΔPR201 and gp32 truncated at residue 295 also fall between full-length protein and *I. Finally, chemical cross-linking of recombinant C-domain and gp32 lacking both N- and C-terminal domains is inhibited by increasing concentrations of a short single-stranded oligonucleotide, and the salt dependence of cross-linking mirrors that expected for the model. Taken together, these results provide the first evidence in support of this model that have been obtained through structural probes. PMID:29634784

  10. An algebraic hypothesis about the primeval genetic code architecture.

    PubMed

    Sánchez, Robersy; Grau, Ricardo

    2009-09-01

    A plausible architecture of an ancient genetic code is derived from an extended base triplet vector space over the Galois field of the extended base alphabet {D,A,C,G,U}, where symbol D represents one or more hypothetical bases with unspecific pairings. We hypothesized that the high degeneration of a primeval genetic code with five bases and the gradual origin and improvement of a primeval DNA repair system could make possible the transition from ancient to modern genetic codes. Our results suggest that the Watson-Crick base pairing G identical with C and A=U and the non-specific base pairing of the hypothetical ancestral base D used to define the sum and product operations are enough features to determine the coding constraints of the primeval and the modern genetic code, as well as, the transition from the former to the latter. Geometrical and algebraic properties of this vector space reveal that the present codon assignment of the standard genetic code could be induced from a primeval codon assignment. Besides, the Fourier spectrum of the extended DNA genome sequences derived from the multiple sequence alignment suggests that the called period-3 property of the present coding DNA sequences could also exist in the ancient coding DNA sequences. The phylogenetic analyses achieved with metrics defined in the N-dimensional vector space (B(3))(N) of DNA sequences and with the new evolutionary model presented here also suggest that an ancient DNA coding sequence with five or more bases does not contradict the expected evolutionary history.

  11. B-DNA Structure and Stability as Function of Nucleic Acid Composition: Dispersion-Corrected DFT Study of Dinucleoside Monophosphate Single and Double Strands

    PubMed Central

    Barone, Giampaolo; Fonseca Guerra, Célia; Bickelhaupt, F Matthias

    2013-01-01

    We have computationally investigated the structure and stability of all 16 combinations of two out of the four natural DNA bases A, T, G and C in a di-2′-deoxyribonucleoside-monophosphate model DNA strand as well as in 10 double-strand model complexes thereof, using dispersion-corrected density functional theory (DFT-D). Optimized geometries with B-DNA conformation were obtained through the inclusion of implicit water solvent and, in the DNA models, of sodium counterions, to neutralize the negative charge of the phosphate groups. The results obtained allowed us to compare the relative stability of isomeric single and double strands. Moreover, the energy of the Watson–Crick pairing of complementary single strands to form double-helical structures was calculated. The latter furnished the following increasing stability trend of the double-helix formation energy: d(TpA)2

  12. Theoretical determination of one-electron redox potentials for DNA bases, base pairs, and stacks.

    PubMed

    Paukku, Y; Hill, G

    2011-05-12

    Electron affinities, ionization potentials, and redox potentials for DNA bases, base pairs, and N-methylated derivatives are computed at the DFT/M06-2X/6-31++G(d,p) level of theory. Redox properties of a guanine-guanine stack model are explored as well. Reduction and oxidation potentials are in good agreement with the experimental ones. Electron affinities of base pairs were found to be negative. Methylation of canonical bases affects the ionization potentials the most. Base pair formation and base stacking lower ionization potentials by 0.3 eV. Pairing of guanine with the 5-methylcytosine does not seem to influence the redox properties of this base pair much.

  13. MethLAB

    PubMed Central

    Kilaru, Varun; Barfield, Richard T; Schroeder, James W; Smith, Alicia K

    2012-01-01

    Recent evidence suggests that DNA methylation changes may underlie numerous complex traits and diseases. The advent of commercial, array-based methods to interrogate DNA methylation has led to a profusion of epigenetic studies in the literature. Array-based methods, such as the popular Illumina GoldenGate and Infinium platforms, estimate the proportion of DNA methylated at single-base resolution for thousands of CpG sites across the genome. These arrays generate enormous amounts of data, but few software resources exist for efficient and flexible analysis of these data. We developed a software package called MethLAB (http://genetics.emory.edu/conneely/MethLAB) using R, an open source statistical language that can be edited to suit the needs of the user. MethLAB features a graphical user interface (GUI) with a menu-driven format designed to efficiently read in and manipulate array-based methylation data in a user-friendly manner. MethLAB tests for association between methylation and relevant phenotypes by fitting a separate linear model for each CpG site. These models can incorporate both continuous and categorical phenotypes and covariates, as well as fixed or random batch or chip effects. MethLAB accounts for multiple testing by controlling the false discovery rate (FDR) at a user-specified level. Standard output includes a spreadsheet-ready text file and an array of publication-quality figures. Considering the growing interest in and availability of DNA methylation data, there is a great need for user-friendly open source analytical tools. With MethLAB, we present a timely resource that will allow users with no programming experience to implement flexible and powerful analyses of DNA methylation data. PMID:22430798

  14. Bio-activity of aminosulfonyl ureas in the light of nucleic acid bases and DNA base pair interaction.

    PubMed

    Mondal Roy, Sutapa

    2018-08-01

    The quantum chemical descriptors based on density functional theory (DFT) are applied to predict the biological activity (log IC 50 ) of one class of acyl-CoA: cholesterol O-acyltransferase (ACAT) inhibitors, viz. aminosulfonyl ureas. ACAT are very effective agents for reduction of triglyceride and cholesterol levels in human body. Successful two parameter quantitative structure-activity relationship (QSAR) models are developed with a combination of relevant global and local DFT based descriptors for prediction of biological activity of aminosulfonyl ureas. The global descriptors, electron affinity of the ACAT inhibitors (EA) and/or charge transfer (ΔN) between inhibitors and model biosystems (NA bases and DNA base pairs) along with the local group atomic charge on sulfonyl moiety (∑Q Sul ) of the inhibitors reveals more than 90% efficacy of the selected descriptors for predicting the experimental log (IC 50 ) values. Copyright © 2018 Elsevier Ltd. All rights reserved.

  15. Mapping DNA methylation by transverse current sequencing: Reduction of noise from neighboring nucleotides

    NASA Astrophysics Data System (ADS)

    Alvarez, Jose; Massey, Steven; Kalitsov, Alan; Velev, Julian

    Nanopore sequencing via transverse current has emerged as a competitive candidate for mapping DNA methylation without needed bisulfite-treatment, fluorescent tag, or PCR amplification. By eliminating the error producing amplification step, long read lengths become feasible, which greatly simplifies the assembly process and reduces the time and the cost inherent in current technologies. However, due to the large error rates of nanopore sequencing, single base resolution has not been reached. A very important source of noise is the intrinsic structural noise in the electric signature of the nucleotide arising from the influence of neighboring nucleotides. In this work we perform calculations of the tunneling current through DNA molecules in nanopores using the non-equilibrium electron transport method within an effective multi-orbital tight-binding model derived from first-principles calculations. We develop a base-calling algorithm accounting for the correlations of the current through neighboring bases, which in principle can reduce the error rate below any desired precision. Using this method we show that we can clearly distinguish DNA methylation and other base modifications based on the reading of the tunneling current.

  16. Structural features based genome-wide characterization and prediction of nucleosome organization

    PubMed Central

    2012-01-01

    Background Nucleosome distribution along chromatin dictates genomic DNA accessibility and thus profoundly influences gene expression. However, the underlying mechanism of nucleosome formation remains elusive. Here, taking a structural perspective, we systematically explored nucleosome formation potential of genomic sequences and the effect on chromatin organization and gene expression in S. cerevisiae. Results We analyzed twelve structural features related to flexibility, curvature and energy of DNA sequences. The results showed that some structural features such as DNA denaturation, DNA-bending stiffness, Stacking energy, Z-DNA, Propeller twist and free energy, were highly correlated with in vitro and in vivo nucleosome occupancy. Specifically, they can be classified into two classes, one positively and the other negatively correlated with nucleosome occupancy. These two kinds of structural features facilitated nucleosome binding in centromere regions and repressed nucleosome formation in the promoter regions of protein-coding genes to mediate transcriptional regulation. Based on these analyses, we integrated all twelve structural features in a model to predict more accurately nucleosome occupancy in vivo than the existing methods that mainly depend on sequence compositional features. Furthermore, we developed a novel approach, named DLaNe, that located nucleosomes by detecting peaks of structural profiles, and built a meta predictor to integrate information from different structural features. As a comparison, we also constructed a hidden Markov model (HMM) to locate nucleosomes based on the profiles of these structural features. The result showed that the meta DLaNe and HMM-based method performed better than the existing methods, demonstrating the power of these structural features in predicting nucleosome positions. Conclusions Our analysis revealed that DNA structures significantly contribute to nucleosome organization and influence chromatin structure and gene expression regulation. The results indicated that our proposed methods are effective in predicting nucleosome occupancy and positions and that these structural features are highly predictive of nucleosome organization. The implementation of our DLaNe method based on structural features is available online. PMID:22449207

  17. A Feature-Based Approach to Modeling Protein–DNA Interactions

    PubMed Central

    Segal, Eran

    2008-01-01

    Transcription factor (TF) binding to its DNA target site is a fundamental regulatory interaction. The most common model used to represent TF binding specificities is a position specific scoring matrix (PSSM), which assumes independence between binding positions. However, in many cases, this simplifying assumption does not hold. Here, we present feature motif models (FMMs), a novel probabilistic method for modeling TF–DNA interactions, based on log-linear models. Our approach uses sequence features to represent TF binding specificities, where each feature may span multiple positions. We develop the mathematical formulation of our model and devise an algorithm for learning its structural features from binding site data. We also developed a discriminative motif finder, which discovers de novo FMMs that are enriched in target sets of sequences compared to background sets. We evaluate our approach on synthetic data and on the widely used TF chromatin immunoprecipitation (ChIP) dataset of Harbison et al. We then apply our algorithm to high-throughput TF ChIP data from mouse and human, reveal sequence features that are present in the binding specificities of mouse and human TFs, and show that FMMs explain TF binding significantly better than PSSMs. Our FMM learning and motif finder software are available at http://genie.weizmann.ac.il/. PMID:18725950

  18. On the biophysics and kinetics of toehold-mediated DNA strand displacement

    PubMed Central

    Srinivas, Niranjan; Ouldridge, Thomas E.; Šulc, Petr; Schaeffer, Joseph M.; Yurke, Bernard; Louis, Ard A.; Doye, Jonathan P. K.; Winfree, Erik

    2013-01-01

    Dynamic DNA nanotechnology often uses toehold-mediated strand displacement for controlling reaction kinetics. Although the dependence of strand displacement kinetics on toehold length has been experimentally characterized and phenomenologically modeled, detailed biophysical understanding has remained elusive. Here, we study strand displacement at multiple levels of detail, using an intuitive model of a random walk on a 1D energy landscape, a secondary structure kinetics model with single base-pair steps and a coarse-grained molecular model that incorporates 3D geometric and steric effects. Further, we experimentally investigate the thermodynamics of three-way branch migration. Two factors explain the dependence of strand displacement kinetics on toehold length: (i) the physical process by which a single step of branch migration occurs is significantly slower than the fraying of a single base pair and (ii) initiating branch migration incurs a thermodynamic penalty, not captured by state-of-the-art nearest neighbor models of DNA, due to the additional overhang it engenders at the junction. Our findings are consistent with previously measured or inferred rates for hybridization, fraying and branch migration, and they provide a biophysical explanation of strand displacement kinetics. Our work paves the way for accurate modeling of strand displacement cascades, which would facilitate the simulation and construction of more complex molecular systems. PMID:24019238

  19. On the biophysics and kinetics of toehold-mediated DNA strand displacement.

    PubMed

    Srinivas, Niranjan; Ouldridge, Thomas E; Sulc, Petr; Schaeffer, Joseph M; Yurke, Bernard; Louis, Ard A; Doye, Jonathan P K; Winfree, Erik

    2013-12-01

    Dynamic DNA nanotechnology often uses toehold-mediated strand displacement for controlling reaction kinetics. Although the dependence of strand displacement kinetics on toehold length has been experimentally characterized and phenomenologically modeled, detailed biophysical understanding has remained elusive. Here, we study strand displacement at multiple levels of detail, using an intuitive model of a random walk on a 1D energy landscape, a secondary structure kinetics model with single base-pair steps and a coarse-grained molecular model that incorporates 3D geometric and steric effects. Further, we experimentally investigate the thermodynamics of three-way branch migration. Two factors explain the dependence of strand displacement kinetics on toehold length: (i) the physical process by which a single step of branch migration occurs is significantly slower than the fraying of a single base pair and (ii) initiating branch migration incurs a thermodynamic penalty, not captured by state-of-the-art nearest neighbor models of DNA, due to the additional overhang it engenders at the junction. Our findings are consistent with previously measured or inferred rates for hybridization, fraying and branch migration, and they provide a biophysical explanation of strand displacement kinetics. Our work paves the way for accurate modeling of strand displacement cascades, which would facilitate the simulation and construction of more complex molecular systems.

  20. On-chip concentration of bacteria using a 3D dielectrophoretic chip and subsequent laser-based DNA extraction in the same chip

    NASA Astrophysics Data System (ADS)

    Cho, Yoon-Kyoung; Kim, Tae-hyeong; Lee, Jeong-Gun

    2010-06-01

    We report the on-chip concentration of bacteria using a dielectrophoretic (DEP) chip with 3D electrodes and subsequent laser-based DNA extraction in the same chip. The DEP chip has a set of interdigitated Au post electrodes with 50 µm height to generate a network of non-uniform electric fields for the efficient trapping by DEP. The metal post array was fabricated by photolithography and subsequent Ni and Au electroplating. Three model bacteria samples (Escherichia coli, Staphylococcus epidermidis, Streptococcus mutans) were tested and over 80-fold concentrations were achieved within 2 min. Subsequently, on-chip DNA extraction from the concentrated bacteria in the 3D DEP chip was performed by laser irradiation using the laser-irradiated magnetic bead system (LIMBS) in the same chip. The extracted DNA was analyzed with silicon chip-based real-time polymerase chain reaction (PCR). The total process of on-chip bacteria concentration and the subsequent DNA extraction can be completed within 10 min including the manual operation time.

  1. Altering DNA-Programmable Colloidal Crystallization Paths by Modulating Particle Repulsion

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wang, Mary X.; Brodin, Jeffrey D.; Millan, Jaime A.

    Colloidal crystal engineering with DNA can be used to realize precise control over nanoparticle (NP) arrangement. Here, we investigate a case of DNA-based assembly where the properties of DNA as a polyelectrolyte brush are employed to alter a hybridization-driven NP crystallization pathway. Using the co-assembly of DNA-conjugated proteins and spherical gold 2 nanoparticles (AuNPs) as a model system, we explore how steric repulsion between non-complementary, neighboring DNA-NPs due to overlapping DNA shells can influence their ligand-directed behavior. Specifically, our experimental data coupled with coarse-grained molecular dynamics (MD) simulations reveal that by changing factors related to NP repulsion, two structurally distinctmore » outcomes can be achieved. When steric repulsion between DNA-AuNPs is significantly greater than that between DNA-proteins, a lower packing density crystal lattice is favored over the structure that is predicted by design rules based on DNA-hybridization considerations alone. This is enabled by the large difference in DNA density on AuNPs versus proteins and can be tuned by modulating the flexibility, and thus conformational entropy, of the DNA on the constituent particles. At intermediate ligand flexibility, the crystallization pathways are energetically similar and the structural outcome can be adjusted using the density of DNA duplexes on DNA-AuNPs and by screening the Coulomb potential between them. Such lattices are shown to undergo dynamic reorganization upon changing salt concentration. These data help elucidate the structural considerations necessary for understanding repulsive forces in DNA-assembly and lay the groundwork for using them to increase architectural diversity in engineering colloidal crystals.« less

  2. Highlighting the DNA damage response with ultrashort laser pulses in the near infrared and kinetic modeling

    PubMed Central

    Ferrando-May, Elisa; Tomas, Martin; Blumhardt, Philipp; Stöckl, Martin; Fuchs, Matthias; Leitenstorfer, Alfred

    2013-01-01

    Our understanding of the mechanisms governing the response to DNA damage in higher eucaryotes crucially depends on our ability to dissect the temporal and spatial organization of the cellular machinery responsible for maintaining genomic integrity. To achieve this goal, we need experimental tools to inflict DNA lesions with high spatial precision at pre-defined locations, and to visualize the ensuing reactions with adequate temporal resolution. Near-infrared femtosecond laser pulses focused through high-aperture objective lenses of advanced scanning microscopes offer the advantage of inducing DNA damage in a 3D-confined volume of subnuclear dimensions. This high spatial resolution results from the highly non-linear nature of the excitation process. Here we review recent progress based on the increasing availability of widely tunable and user-friendly technology of ultrafast lasers in the near infrared. We present a critical evaluation of this approach for DNA microdamage as compared to the currently prevalent use of UV or VIS laser irradiation, the latter in combination with photosensitizers. Current and future applications in the field of DNA repair and DNA-damage dependent chromatin dynamics are outlined. Finally, we discuss the requirement for proper simulation and quantitative modeling. We focus in particular on approaches to measure the effect of DNA damage on the mobility of nuclear proteins and consider the pros and cons of frequently used analysis models for FRAP and photoactivation and their applicability to non-linear photoperturbation experiments. PMID:23882280

  3. Next-generation sequencing-based detection of circulating tumour DNA After allogeneic stem cell transplantation for lymphoma.

    PubMed

    Herrera, Alex F; Kim, Haesook T; Kong, Katherine A; Faham, Malek; Sun, Heather; Sohani, Aliyah R; Alyea, Edwin P; Carlton, Victoria E; Chen, Yi-Bin; Cutler, Corey S; Ho, Vincent T; Koreth, John; Kotwaliwale, Chitra; Nikiforow, Sarah; Ritz, Jerome; Rodig, Scott J; Soiffer, Robert J; Antin, Joseph H; Armand, Philippe

    2016-12-01

    Next-generation sequencing (NGS)-based circulating tumour DNA (ctDNA) detection is a promising monitoring tool for lymphoid malignancies. We evaluated whether the presence of ctDNA was associated with outcome after allogeneic haematopoietic stem cell transplantation (HSCT) in lymphoma patients. We studied 88 patients drawn from a phase 3 clinical trial of reduced-intensity conditioning HSCT in lymphoma. Conventional restaging and collection of peripheral blood samples occurred at pre-specified time points before and after HSCT and were assayed for ctDNA by sequencing of the immunoglobulin or T-cell receptor genes. Tumour clonotypes were identified in 87% of patients with adequate tumour samples. Sixteen of 19 (84%) patients with disease progression after HSCT had detectable ctDNA prior to progression at a median of 3·7 months prior to relapse/progression. Patients with detectable ctDNA 3 months after HSCT had inferior progression-free survival (PFS) (2-year PFS 58% vs. 84% in ctDNA-negative patients, P = 0·033). In multivariate models, detectable ctDNA was associated with increased risk of progression/death (Hazard ratio 3·9, P = 0·003) and increased risk of relapse/progression (Hazard ratio 10·8, P = 0·0006). Detectable ctDNA is associated with an increased risk of relapse/progression, but further validation studies are necessary to confirm these findings and determine the clinical utility of NGS-based minimal residual disease monitoring in lymphoma patients after HSCT. © 2016 John Wiley & Sons Ltd.

  4. The Steric Gate of DNA Polymerase ι Regulates Ribonucleotide Incorporation and Deoxyribonucleotide Fidelity*

    PubMed Central

    Donigan, Katherine A.; McLenigan, Mary P.; Yang, Wei; Goodman, Myron F.; Woodgate, Roger

    2014-01-01

    Accurate DNA synthesis in vivo depends on the ability of DNA polymerases to select dNTPs from a nucleotide pool dominated by NTPs. High fidelity replicative polymerases have evolved to efficiently exclude NTPs while copying long stretches of undamaged DNA. However, to bypass DNA damage, cells utilize specialized low fidelity polymerases to perform translesion DNA synthesis (TLS). Of interest is human DNA polymerase ι (pol ι), which has been implicated in TLS of oxidative and UV-induced lesions. Here, we evaluate the ability of pol ι to incorporate NTPs during DNA synthesis. pol ι incorporates and extends NTPs opposite damaged and undamaged template bases in a template-specific manner. The Y39A “steric gate” pol ι mutant is considerably more active in the presence of Mn2+ compared with Mg2+ and exhibits a marked increase in NTP incorporation and extension, and surprisingly, it also exhibits increased dNTP base selectivity. Our results indicate that a single residue in pol ι is able to discriminate between NTPs and dNTPs during DNA synthesis. Because wild-type pol ι incorporates NTPs in a template-specific manner, certain DNA sequences may be “at risk” for elevated mutagenesis during pol ι-dependent TLS. Molecular modeling indicates that the constricted active site of wild-type pol ι becomes more spacious in the Y39A variant. Therefore, the Y39A substitution not only permits incorporation of ribonucleotides but also causes the enzyme to favor faithful Watson-Crick base pairing over mutagenic configurations. PMID:24532793

  5. Conformational and mechanical changes of DNA upon transcription factor binding detected by a QCM and transmission line model.

    PubMed

    de-Carvalho, Jorge; Rodrigues, Rogério M M; Tomé, Brigitte; Henriques, Sílvia F; Mira, Nuno P; Sá-Correia, Isabel; Ferreira, Guilherme N M

    2014-04-21

    A novel quartz crystal microbalance (QCM) analytical method is developed based on the transmission line model (TLM) algorithm to analyze the binding of transcription factors (TFs) to immobilized DNA oligoduplexes. The method is used to characterize the mechanical properties of biological films through the estimation of the film dynamic shear moduli, G and G, and the film thickness. Using the Saccharomyces cerevisiae transcription factor Haa1 (Haa1DBD) as a biological model two sensors were prepared by immobilizing DNA oligoduplexes, one containing the Haa1 recognition element (HRE(wt)) and another with a random sequence (HRE(neg)) used as a negative control. The immobilization of DNA oligoduplexes was followed in real time and we show that DNA strands initially adsorb with low or non-tilting, laying flat close to the surface, which then lift-off the surface leading to final film tilting angles of 62.9° and 46.7° for HRE(wt) and HRE(neg), respectively. Furthermore we show that the binding of Haa1DBD to HRE(wt) leads to a more ordered and compact film, and forces a 31.7° bending of the immobilized HRE(wt) oligoduplex. This work demonstrates the suitability of the QCM to monitor the specific binding of TFs to immobilized DNA sequences and provides an analytical methodology to study protein-DNA biophysics and kinetics.

  6. Epigenetic Studies Point to DNA Replication/Repair Genes as a Basis for the Heritable Nature of Long Term Complications in Diabetes.

    PubMed

    Leontovich, Alexey A; Intine, Robert V; Sarras, Michael P

    2016-01-01

    Metabolic memory (MM) is defined as the persistence of diabetic (DM) complications even after glycemic control is pharmacologically achieved. Using a zebrafish diabetic model that induces a MM state, we previously reported that, in this model, tissue dysfunction was of a heritable nature based on cell proliferation studies in limb tissue and this correlated with epigenetic DNA methylation changes that paralleled alterations in gene expression. In the current study, control, DM, and MM excised fin tissues were further analyzed by MeDIP sequencing and microarray techniques. Bioinformatics analysis of the data found that genes of the DNA replication/DNA metabolism process group (with upregulation of the apex1, mcm2, mcm4, orc3, lig1, and dnmt1 genes) were altered in the DM state and these molecular changes continued into MM. Interestingly, DNA methylation changes could be found as far as 6-13 kb upstream of the transcription start site for these genes suggesting potential higher levels of epigenetic control. In conclusion, DNA methylation changes in members of the DNA replication/repair process group best explain the heritable nature of cell proliferation impairment found in the zebrafish DM/MM model. These results are consistent with human diabetic epigenetic studies and provide one explanation for the persistence of long term tissue complications as seen in diabetes.

  7. Magnetophoresis of flexible DNA-based dumbbell structures

    NASA Astrophysics Data System (ADS)

    Babić, B.; Ghai, R.; Dimitrov, K.

    2008-02-01

    Controlled movement and manipulation of magnetic micro- and nanostructures using magnetic forces can give rise to important applications in biomedecine, diagnostics, and immunology. We report controlled magnetophoresis and stretching, in aqueous solution, of a DNA-based dumbbell structure containing magnetic and diamagnetic microspheres. The velocity and stretching of the dumbbell were experimentally measured and correlated with a theoretical model based on the forces acting on individual magnetic beads or the entire dumbbell structures. The results show that precise and predictable manipulation of dumbbell structures is achievable and can potentially be applied to immunomagnetic cell separators.

  8. Action at a Distance in the Cell's Nucleus

    NASA Astrophysics Data System (ADS)

    Kondev, Jane

    Various functions performed by chromosomes involve long-range communication between DNA sequences that are tens of thousands of bases apart along the genome, and microns apart in the nucleus. In this talk I will discuss experiments and theory relating to two distinct modes of long-range communication in the nucleus, chromosome looping and protein hopping along the chromosome, both in the context of DNA-break repair in yeast. Yeast is an excellent model system for studies that link chromosome conformations to their function as there is ample experimental evidence that yeast chromosome conformations are well described by a simple, random-walk polymer model. Using a combination of polymer physics theory and experiments on yeast cells, I will demonstrate that loss of polymer entropy due to chromosome looping is the driving force for homology search during repair of broken DNA by homologous recombination. I will also discuss the spread of histone modifications along the chromosome and away from the DNA break point in the context of simple physics models based on chromosome looping and kinase hopping, and show how combining physics theory and cell-biology experiment can be used to dissect the molecular mechanism of the spreading process. These examples demonstrate how combined theoretical and experimental studies can reveal physical principles of long-range communication in the nucleus, which play important roles in regulation of gene expression, DNA recombination, and chromatin modification. This work was supported by the NSF DMR-1206146.

  9. Acetone facilitated DNA sampling from electrical tapes improves DNA recovery and enables latent fingerprints development.

    PubMed

    Feine, Ilan; Shpitzen, Moshe; Geller, Boris; Salmon, Eran; Peleg, Tsach; Roth, Jonathan; Gafny, Ron

    2017-07-01

    Electrical tapes (ETs) are a common component of improvised explosive devices (IEDs) used by terrorists or criminal organizations and represent a valuable forensic resource for DNA and latent fingerprints recovery. However, DNA recovery rates are typically low and usually below the minimal amount required for amplification. In addition, most DNA extraction methods are destructive and do not allow further latent fingerprints development. In the present study a cell culture based touch DNA model was used to demonstrate a two-step acetone-water DNA recovery protocol from ETs. This protocol involves only the adhesive side of the ET and increases DNA recovery rates by up to 70%. In addition, we demonstrated partially successful latent fingerprints development from the non-sticky side of the ETs. Taken together, this protocol maximizes the forensic examination of ETs and is recommended for routine casework processing. Copyright © 2017 Elsevier B.V. All rights reserved.

  10. Radiation breakage of DNA: a model based on random-walk chromatin structure

    NASA Technical Reports Server (NTRS)

    Ponomarev, A. L.; Sachs, R. K.

    2001-01-01

    Monte Carlo computer software, called DNAbreak, has recently been developed to analyze observed non-random clustering of DNA double strand breaks in chromatin after exposure to densely ionizing radiation. The software models coarse-grained configurations of chromatin and radiation tracks, small-scale details being suppressed in order to obtain statistical results for larger scales, up to the size of a whole chromosome. We here give an analytic counterpart of the numerical model, useful for benchmarks, for elucidating the numerical results, for analyzing the assumptions of a more general but less mechanistic "randomly-located-clusters" formalism, and, potentially, for speeding up the calculations. The equations characterize multi-track DNA fragment-size distributions in terms of one-track action; an important step in extrapolating high-dose laboratory results to the much lower doses of main interest in environmental or occupational risk estimation. The approach can utilize the experimental information on DNA fragment-size distributions to draw inferences about large-scale chromatin geometry during cell-cycle interphase.

  11. Base pairing among three cis-acting sequences contributes to template switching during hepadnavirus reverse transcription.

    PubMed

    Liu, Ning; Tian, Ru; Loeb, Daniel D

    2003-02-18

    Synthesis of the relaxed-circular (RC) DNA genome of hepadnaviruses requires two template switches during plus-strand DNA synthesis: primer translocation and circularization. Although primer translocation and circularization use different donor and acceptor sequences, and are distinct temporally, they share the common theme of switching from one end of the minus-strand template to the other end. Studies of duck hepatitis B virus have indicated that, in addition to the donor and acceptor sequences, three other cis-acting sequences, named 3E, M, and 5E, are required for the synthesis of RC DNA by contributing to primer translocation and circularization. The mechanism by which 3E, M, and 5E act was not known. We present evidence that these sequences function by base pairing with each other within the minus-strand template. 3E base-pairs with one portion of M (M3) and 5E base-pairs with an adjacent portion of M (M5). We found that disrupting base pairing between 3E and M3 and between 5E and M5 inhibited primer translocation and circularization. More importantly, restoring base pairing with mutant sequences restored the production of RC DNA. These results are consistent with the model that, within duck hepatitis B virus capsids, the ends of the minus-strand template are juxtaposed via base pairing to facilitate the two template switches during plus-strand DNA synthesis.

  12. Quantitative characterization of conformational-specific protein-DNA binding using a dual-spectral interferometric imaging biosensor

    NASA Astrophysics Data System (ADS)

    Zhang, Xirui; Daaboul, George G.; Spuhler, Philipp S.; Dröge, Peter; Ünlü, M. Selim

    2016-03-01

    DNA-binding proteins play crucial roles in the maintenance and functions of the genome and yet, their specific binding mechanisms are not fully understood. Recently, it was discovered that DNA-binding proteins recognize specific binding sites to carry out their functions through an indirect readout mechanism by recognizing and capturing DNA conformational flexibility and deformation. High-throughput DNA microarray-based methods that provide large-scale protein-DNA binding information have shown effective and comprehensive analysis of protein-DNA binding affinities, but do not provide information of DNA conformational changes in specific protein-DNA complexes. Building on the high-throughput capability of DNA microarrays, we demonstrate a quantitative approach that simultaneously measures the amount of protein binding to DNA and nanometer-scale DNA conformational change induced by protein binding in a microarray format. Both measurements rely on spectral interferometry on a layered substrate using a single optical instrument in two distinct modalities. In the first modality, we quantitate the amount of binding of protein to surface-immobilized DNA in each DNA spot using a label-free spectral reflectivity technique that accurately measures the surface densities of protein and DNA accumulated on the substrate. In the second modality, for each DNA spot, we simultaneously measure DNA conformational change using a fluorescence vertical sectioning technique that determines average axial height of fluorophores tagged to specific nucleotides of the surface-immobilized DNA. The approach presented in this paper, when combined with current high-throughput DNA microarray-based technologies, has the potential to serve as a rapid and simple method for quantitative and large-scale characterization of conformational specific protein-DNA interactions.DNA-binding proteins play crucial roles in the maintenance and functions of the genome and yet, their specific binding mechanisms are not fully understood. Recently, it was discovered that DNA-binding proteins recognize specific binding sites to carry out their functions through an indirect readout mechanism by recognizing and capturing DNA conformational flexibility and deformation. High-throughput DNA microarray-based methods that provide large-scale protein-DNA binding information have shown effective and comprehensive analysis of protein-DNA binding affinities, but do not provide information of DNA conformational changes in specific protein-DNA complexes. Building on the high-throughput capability of DNA microarrays, we demonstrate a quantitative approach that simultaneously measures the amount of protein binding to DNA and nanometer-scale DNA conformational change induced by protein binding in a microarray format. Both measurements rely on spectral interferometry on a layered substrate using a single optical instrument in two distinct modalities. In the first modality, we quantitate the amount of binding of protein to surface-immobilized DNA in each DNA spot using a label-free spectral reflectivity technique that accurately measures the surface densities of protein and DNA accumulated on the substrate. In the second modality, for each DNA spot, we simultaneously measure DNA conformational change using a fluorescence vertical sectioning technique that determines average axial height of fluorophores tagged to specific nucleotides of the surface-immobilized DNA. The approach presented in this paper, when combined with current high-throughput DNA microarray-based technologies, has the potential to serve as a rapid and simple method for quantitative and large-scale characterization of conformational specific protein-DNA interactions. Electronic supplementary information (ESI) available: DNA sequences and nomenclature (Table 1S); SDS-PAGE assay of IHF stock solution (Fig. 1S); determination of the concentration of IHF stock solution by Bradford assay (Fig. 2S); equilibrium binding isotherm fitting results of other DNA sequences (Table 2S); calculation of dissociation constants (Fig. 3S, 4S; Table 2S); geometric model for quantitation of DNA bending angle induced by specific IHF binding (Fig. 4S); customized flow cell assembly (Fig. 5S); real-time measurement of average fluorophore height change by SSFM (Fig. 6S); summary of binding parameters obtained from additive isotherm model fitting (Table 3S); average surface densities of 10 dsDNA spots and bound IHF at equilibrium (Table 4S); effects of surface densities on the binding and bending of dsDNA (Tables 5S, 6S and Fig. 7S-10S). See DOI: 10.1039/c5nr06785e

  13. Communication: Electron ionization of DNA bases.

    PubMed

    Rahman, M A; Krishnakumar, E

    2016-04-28

    No reliable experimental data exist for the partial and total electron ionization cross sections for DNA bases, which are very crucial for modeling radiation damage in genetic material of living cell. We have measured a complete set of absolute partial electron ionization cross sections up to 500 eV for DNA bases for the first time by using the relative flow technique. These partial cross sections are summed to obtain total ion cross sections for all the four bases and are compared with the existing theoretical calculations and the only set of measured absolute cross sections. Our measurements clearly resolve the existing discrepancy between the theoretical and experimental results, thereby providing for the first time reliable numbers for partial and total ion cross sections for these molecules. The results on fragmentation analysis of adenine supports the theory of its formation in space.

  14. Quantitative Analysis of the Mutagenic Potential of 1-Aminopyrene-DNA Adduct Bypass Catalyzed by Y-Family DNA Polymerases

    PubMed Central

    Sherrer, Shanen M.; Taggart, David J.; Pack, Lindsey R.; Malik, Chanchal K.; Basu, Ashis K.; Suo, Zucai

    2012-01-01

    N- (deoxyguanosin-8-yl)-1-aminopyrene (dGAP) is the predominant nitro polyaromatic hydrocarbon product generated from the air pollutant 1-nitropyrene reacting with DNA. Previous studies have shown that dGAP induces genetic mutations in bacterial and mammalian cells. One potential source of these mutations is the error-prone bypass of dGAP lesions catalyzed by the low-fidelity Y-family DNA polymerases. To provide a comparative analysis of the mutagenic potential of the translesion DNA synthesis (TLS) of dGAP, we employed short oligonucleotide sequencing assays (SOSAs) with the model Y-family DNA polymerase from Sulfolobus solfataricus, DNA Polymerase IV (Dpo4), and the human Y-family DNA polymerases eta (hPolη), kappa (hPolκ), and iota (hPolι). Relative to undamaged DNA, all four enzymes generated far more mutations (base deletions, insertions, and substitutions) with a DNA template containing a site-specifically placed dGAP. Opposite dGAP and at an immediate downstream template position, the most frequent mutations made by the three human enzymes were base deletions and the most frequent base substitutions were dAs for all enzymes. Based on the SOSA data, Dpo4 was the least error-prone Y-family DNA polymerase among the four enzymes during the TLS of dGAP. Among the three human Y-family enzymes, hPolκ made the fewest mutations at all template positions except opposite the lesion site. hPolκ was significantly less error-prone than hPolι and hPolη during the extension of dGAP bypass products. Interestingly, the most frequent mutations created by hPolι at all template positions were base deletions. Although hRev1, the fourth human Y-family enzyme, could not extend dGAP bypass products in our standing start assays, it preferentially incorporated dCTP opposite the bulky lesion. Collectively, these mutagenic profiles suggest that hPolkk and hRev1 are the most suitable human Y-family DNA polymerases to perform TLS of dGAP in humans. PMID:22917544

  15. Chiron: translating nanopore raw signal directly into nucleotide sequence using deep learning.

    PubMed

    Teng, Haotian; Cao, Minh Duc; Hall, Michael B; Duarte, Tania; Wang, Sheng; Coin, Lachlan J M

    2018-05-01

    Sequencing by translocating DNA fragments through an array of nanopores is a rapidly maturing technology that offers faster and cheaper sequencing than other approaches. However, accurately deciphering the DNA sequence from the noisy and complex electrical signal is challenging. Here, we report Chiron, the first deep learning model to achieve end-to-end basecalling and directly translate the raw signal to DNA sequence without the error-prone segmentation step. Trained with only a small set of 4,000 reads, we show that our model provides state-of-the-art basecalling accuracy, even on previously unseen species. Chiron achieves basecalling speeds of more than 2,000 bases per second using desktop computer graphics processing units.

  16. BioWires: Conductive DNA Nanowires in a Computationally-Optimized, Synthetic Biological Platform for Nanoelectronic Fabrication

    NASA Technical Reports Server (NTRS)

    Vecchioni, Simon; Toomey, Emily; Capece, Mark C.; Rothschild, Lynn; Wind, Shalom

    2017-01-01

    DNA is an ideal template for a biological nanowire-it has a linear structure several atoms thick; it possesses addressable nucleobase geometry that can be precisely defined; and it is massively scalable into branched networks. Until now, the drawback of DNA as a conducting nanowire been, simply put, its low conductance. To address this deficiency, we extensively characterize a chemical variant of canonical DNA that exploits the affinity of natural cytosine bases for silver ions. We successfully construct chains of single silver ions inside double-stranded DNA, confirm the basic dC-Ag+-dC bond geometry and kinetics, and show length-tunability dependent on mismatch distribution, ion availability and enzyme activity. An analysis of the absorbance spectra of natural DNA and silver-binding, poly-cytosine DNA demonstrates the heightened thermostability of the ion chain and its resistance to aqueous stresses such as precipitation, dialysis and forced reduction. These chemically critical traits lend themselves to an increase in electrical conductivity of over an order of magnitude for 11-base silver-paired duplexes over natural strands when assayed by STM break junction. We further construct and implement a genetic pathway in the E. coli bacterium for the biosynthesis of highly ionizable DNA sequences. Toward future circuits, we construct a model of transcription network architectures to determine the most efficient and robust connectivity for cell-based fabrication, and we perform sequence optimization with a genetic algorithm to identify oligonucleotides robust to changes in the base-pairing energy landscape. We propose that this system will serve as a synthetic biological fabrication platform for more complex DNA nanotechnology and nanoelectronics with applications to deep space and low resource environments.

  17. Petri net modeling of high-order genetic systems using grammatical evolution.

    PubMed

    Moore, Jason H; Hahn, Lance W

    2003-11-01

    Understanding how DNA sequence variations impact human health through a hierarchy of biochemical and physiological systems is expected to improve the diagnosis, prevention, and treatment of common, complex human diseases. We have previously developed a hierarchical dynamic systems approach based on Petri nets for generating biochemical network models that are consistent with genetic models of disease susceptibility. This modeling approach uses an evolutionary computation approach called grammatical evolution as a search strategy for optimal Petri net models. We have previously demonstrated that this approach routinely identifies biochemical network models that are consistent with a variety of genetic models in which disease susceptibility is determined by nonlinear interactions between two DNA sequence variations. In the present study, we evaluate whether the Petri net approach is capable of identifying biochemical networks that are consistent with disease susceptibility due to higher order nonlinear interactions between three DNA sequence variations. The results indicate that our model-building approach is capable of routinely identifying good, but not perfect, Petri net models. Ideas for improving the algorithm for this high-dimensional problem are presented.

  18. A molecular model for illegitimate recombination in Bacillus subtilis.

    PubMed

    Temeyer, K B; Hopkins, K M; Chapman, L F

    1991-01-01

    The recombinant DNA junctions at which pUB110 and Bacillus subtilis chromosomal DNA were joined to form the plasmid pKBT1 were cloned and sequenced. From the sequencing data we conclude that the pUB110 sequence is intact in the pair of cloned pKBT1 fragments and pTL12 sequences are not present. A molecular model for the formation of pKBT1 based on structural motifs characteristic of the joint sites is presented.

  19. SLAP deficiency decreases dsDNA autoantibody production

    PubMed Central

    Peterson, Lisa K.; Pennington, Luke F.; Shaw, Laura A.; Brown, Meredith; Treacy, Eric C.; Friend, Samantha F.; Hatlevik, Øyvind; Rubtsova, Kira; Rubtsov, Anatoly V.; Dragone, Leonard L.

    2014-01-01

    Src-like adaptor protein (SLAP) adapts c-Cbl, an E3 ubiquitin ligase, to activated components of the BCR signaling complex regulating BCR levels and signaling in developing B cells. Based on this function, we asked whether SLAP deficiency could decrease the threshold for tolerance and eliminate development of autoreactive B cells in two models of autoantibody production. First, we sensitized mice with a dsDNA mimetope that causes an anti-dsDNA response. Despite equivalent production of anti-peptide antibodies compared to BALB/c controls, SLAP−/− mice did not produce anti-dsDNA. Second, we used the 56R tolerance model. SLAP−/− 56R mice had decreased levels of dsDNA-reactive antibodies compared to 56R mice due to skewed light chain usage. Thus, SLAP is a critical regulator of B-cell development and function and its deficiency leads to decreased autoreactive B cells that are otherwise maintained by inefficient receptor editing or failed negative selection. PMID:24440645

  20. SLAP deficiency decreases dsDNA autoantibody production.

    PubMed

    Peterson, Lisa K; Pennington, Luke F; Shaw, Laura A; Brown, Meredith; Treacy, Eric C; Friend, Samantha F; Hatlevik, Øyvind; Rubtsova, Kira; Rubtsov, Anatoly V; Dragone, Leonard L

    2014-02-01

    Src-like adaptor protein (SLAP) adapts c-Cbl, an E3 ubiquitin ligase, to activated components of the BCR signaling complex regulating BCR levels and signaling in developing B cells. Based on this function, we asked whether SLAP deficiency could decrease the threshold for tolerance and eliminate development of autoreactive B cells in two models of autoantibody production. First, we sensitized mice with a dsDNA mimetope that causes an anti-dsDNA response. Despite equivalent production of anti-peptide antibodies compared to BALB/c controls, SLAP(-/-) mice did not produce anti-dsDNA. Second, we used the 56R tolerance model. SLAP(-/-) 56R mice had decreased levels of dsDNA-reactive antibodies compared to 56R mice due to skewed light chain usage. Thus, SLAP is a critical regulator of B-cell development and function and its deficiency leads to decreased autoreactive B cells that are otherwise maintained by inefficient receptor editing or failed negative selection. Copyright © 2013 Elsevier Inc. All rights reserved.

  1. Characterization of the molecular defect in a feline model for type II GM2-gangliosidosis (Sandhoff disease).

    PubMed Central

    Muldoon, L. L.; Neuwelt, E. A.; Pagel, M. A.; Weiss, D. L.

    1994-01-01

    The Korat cat provides an animal model for type II GM2-gangliosidosis (Sandhoff disease) that may be suitable for tests of gene replacement therapy with the HEXB gene encoding the beta subunit of the beta-hexosaminidases. In the present report, we examined the brain and liver pathology of a typical Sandhoff-affected cat. We characterized the feline HEXB complementary DNA (cDNA) and determined the molecular defect in this feline model. cDNA libraries were produced from one normal and one affected animal, and cDNA clones homologous to human HEXB were sequenced. In the affected cDNA clone, the deletion of a cytosine residue at position +39 of the putative coding region results in a frame shift and a stop codon at base +191. This disease-related deletion was consistently detected by sequencing of cloned polymerase chain reaction amplified reverse transcribed messenger RNA from one more normal Korat and two additional affected animals. The defect was further demonstrated using single-strand conformational polymorphism analysis of the polymerase chain reaction products. In addition, alternative splicing of both normal and affected messenger RNAs was demonstrated. These results should facilitate the use of this animal model to assess gene therapy. Images Figure 1 Figure 3 Figure 4 Figure 5 PMID:8178934

  2. Characterization of the molecular defect in a feline model for type II GM2-gangliosidosis (Sandhoff disease).

    PubMed

    Muldoon, L L; Neuwelt, E A; Pagel, M A; Weiss, D L

    1994-05-01

    The Korat cat provides an animal model for type II GM2-gangliosidosis (Sandhoff disease) that may be suitable for tests of gene replacement therapy with the HEXB gene encoding the beta subunit of the beta-hexosaminidases. In the present report, we examined the brain and liver pathology of a typical Sandhoff-affected cat. We characterized the feline HEXB complementary DNA (cDNA) and determined the molecular defect in this feline model. cDNA libraries were produced from one normal and one affected animal, and cDNA clones homologous to human HEXB were sequenced. In the affected cDNA clone, the deletion of a cytosine residue at position +39 of the putative coding region results in a frame shift and a stop codon at base +191. This disease-related deletion was consistently detected by sequencing of cloned polymerase chain reaction amplified reverse transcribed messenger RNA from one more normal Korat and two additional affected animals. The defect was further demonstrated using single-strand conformational polymorphism analysis of the polymerase chain reaction products. In addition, alternative splicing of both normal and affected messenger RNAs was demonstrated. These results should facilitate the use of this animal model to assess gene therapy.

  3. Mitochondrial base excision repair in mouse synaptosomes during normal aging and in a model of Alzheimer’s disease

    PubMed Central

    Gredilla, Ricardo; Weissman, Lior; Yang, Jenq-Lin; Bohr, Vilhelm A.; Stevnsner, Tinna

    2010-01-01

    Brain aging is associated with synaptic decline and cognitive impairment. Increased levels of oxidative DNA base damage and accumulation of mitochondrial DNA (mtDNA) mutations or deletions lead to mitochondrial dysfunction, playing an important role in the aging process and the pathogenesis of neurodegenerative diseases such as Alzheimer’s disease (AD). In mitochondria, base excision repair (BER) is the main DNA repair pathway for base modifications such as deamination and oxidation, and constitutes an important mechanism to avoid accumulation of mtDNA mutations. Synaptic function is highly dependent on mitochondria, and in the current study we have investigated BER in synaptosomes of mouse brain during normal aging and in an AD model. Synaptosomes are isolated synapses in membranous structures produced by subcellular fractionation of brain tissue. They include the whole presynaptic terminal as well as portions of the postsynaptic terminal. Synaptosomes contain the molecular machinery necessary for uptake, storage, and release of neurotransmitters, including synaptic vesicles and mitochondria. BER activities were measured in synaptosomal fractions from young and old mice and from pre-symptomatic and symptomatic AD mice harboring mutated APP, Tau and PS1 (3xTgAD). During normal aging, a reduction in the BER capacity was observed in the synaptosomal fraction, which was associated with a decrease in the level of BER proteins. However, we did not observe changes between the synaptosomal BER activities of pre-symptomatic and symptomatic AD mice. Our findings suggest that the age-related reduction in BER capacity in the synaptosomal fraction might contribute to mitochondrial and synaptic dysfunction during aging. The development of AD-like pathology in the 3xTgAD mouse model was, however, not associated with deficiencies of the BER mechanisms in the synaptosomal fraction when the whole brain was analyzed. PMID:20708822

  4. Ligation Bias in Illumina Next-Generation DNA Libraries: Implications for Sequencing Ancient Genomes

    PubMed Central

    Seguin-Orlando, Andaine; Schubert, Mikkel; Clary, Joel; Stagegaard, Julia; Alberdi, Maria T.; Prado, José Luis; Prieto, Alfredo; Willerslev, Eske; Orlando, Ludovic

    2013-01-01

    Ancient DNA extracts consist of a mixture of endogenous molecules and contaminant DNA templates, often originating from environmental microbes. These two populations of templates exhibit different chemical characteristics, with the former showing depurination and cytosine deamination by-products, resulting from post-mortem DNA damage. Such chemical modifications can interfere with the molecular tools used for building second-generation DNA libraries, and limit our ability to fully characterize the true complexity of ancient DNA extracts. In this study, we first use fresh DNA extracts to demonstrate that library preparation based on adapter ligation at AT-overhangs are biased against DNA templates starting with thymine residues, contrarily to blunt-end adapter ligation. We observe the same bias on fresh DNA extracts sheared on Bioruptor, Covaris and nebulizers. This contradicts previous reports suggesting that this bias could originate from the methods used for shearing DNA. This also suggests that AT-overhang adapter ligation efficiency is affected in a sequence-dependent manner and results in an uneven representation of different genomic contexts. We then show how this bias could affect the base composition of ancient DNA libraries prepared following AT-overhang ligation, mainly by limiting the ability to ligate DNA templates starting with thymines and therefore deaminated cytosines. This results in particular nucleotide misincorporation damage patterns, deviating from the signature generally expected for authenticating ancient sequence data. Consequently, we show that models adequate for estimating post-mortem DNA damage levels must be robust to the molecular tools used for building ancient DNA libraries. PMID:24205269

  5. Previous Estimates of Mitochondrial DNA Mutation Level Variance Did Not Account for Sampling Error: Comparing the mtDNA Genetic Bottleneck in Mice and Humans

    PubMed Central

    Wonnapinij, Passorn; Chinnery, Patrick F.; Samuels, David C.

    2010-01-01

    In cases of inherited pathogenic mitochondrial DNA (mtDNA) mutations, a mother and her offspring generally have large and seemingly random differences in the amount of mutated mtDNA that they carry. Comparisons of measured mtDNA mutation level variance values have become an important issue in determining the mechanisms that cause these large random shifts in mutation level. These variance measurements have been made with samples of quite modest size, which should be a source of concern because higher-order statistics, such as variance, are poorly estimated from small sample sizes. We have developed an analysis of the standard error of variance from a sample of size n, and we have defined error bars for variance measurements based on this standard error. We calculate variance error bars for several published sets of measurements of mtDNA mutation level variance and show how the addition of the error bars alters the interpretation of these experimental results. We compare variance measurements from human clinical data and from mouse models and show that the mutation level variance is clearly higher in the human data than it is in the mouse models at both the primary oocyte and offspring stages of inheritance. We discuss how the standard error of variance can be used in the design of experiments measuring mtDNA mutation level variance. Our results show that variance measurements based on fewer than 20 measurements are generally unreliable and ideally more than 50 measurements are required to reliably compare variances with less than a 2-fold difference. PMID:20362273

  6. Dynamics of Charge Transfer in DNA Wires: A Proton-Coupled Approach

    NASA Astrophysics Data System (ADS)

    Behnia, Sohrab; Fathizadeh, Samira; Ziaei, Javid; Akhshani, Afshin

    2017-12-01

    The advent of molecular electronics has fueled interest in studying DNA as a nanowire. The well-known Peyrard-Bishop-Dauxois (PBD) model, which was proposed for the purpose of understanding the mechanism of DNA denaturation, has a limited number of degrees of freedom. In addition, considering the Peyrard-Bishop-Holstein (PBH) model as a means of studying the charge transfer effect, in which the dynamical motion is described via the PBD model, may apply limitations on observing all the phenomena. Therefore, we have attempted to add the mutual interaction of a proton and electron in the form of proton-coupled electron transfer (PCET) to the PBH model. PCET has been implicated in a variety of oxidative processes that ultimately lead to mutations. When we have considered the PCET approach to DNA based on a proton-combined PBH model, we were able to extract the electron and proton currents independently. In this case, the reciprocal influence of electron and proton current is considered. This interaction does not affect the general form of the electronic current in DNA, but it changes the threshold of the occurrence of phenomena such as negative differential resistance. It is worth mentioning that perceiving the structural properties of the attractors in phase space via the Rényi dimension and concentrating on the critical regions through a scalogram can present a clear picture of the critical points in such phenomena.

  7. Computer-Aided Drug Discovery: Molecular Docking of Diminazene Ligands to DNA Minor Groove

    ERIC Educational Resources Information Center

    Kholod, Yana; Hoag, Erin; Muratore, Katlynn; Kosenkov, Dmytro

    2018-01-01

    The reported project-based laboratory unit introduces upper-division undergraduate students to the basics of computer-aided drug discovery as a part of a computational chemistry laboratory course. The students learn to perform model binding of organic molecules (ligands) to the DNA minor groove with computer-aided drug discovery (CADD) tools. The…

  8. Surface-enhanced Raman scattering detection of DNA derived from the West Nile virus genome using magnetic capture of Raman-active gold nanoparticles

    USDA-ARS?s Scientific Manuscript database

    A model paramagnetic nanoparticle (MNP) assay is demonstrated for surface-enhanced Raman scattering (SERS) detection of DNA oligonucleotides derived from the West Nile virus (WNV) genome. Detection is based on the capture of WNV target sequences by hybridization with complementary oligonucleotide pr...

  9. Sub-Ensemble Monitoring of DNA Strand Displacement Using Multiparameter Single-Molecule FRET.

    PubMed

    Baltierra-Jasso, Laura E; Morten, Michael J; Magennis, Steven W

    2018-03-05

    Non-enzymatic DNA strand displacement is an important mechanism in dynamic DNA nanotechnology. Here, we show that the large parameter space that is accessible by single-molecule FRET is ideal for the simultaneous monitoring of multiple reactants and products of DNA strand exchange reactions. We monitored the strand displacement from double-stranded DNA (dsDNA) by single-stranded DNA (ssDNA) at 37 °C; the data were modelled as a second-order reaction approaching equilibrium, with a rate constant of 10 m -1  s -1 . We also followed the displacement from a DNA three-way junction (3WJ) by ssDNA. The presence of three internal mismatched bases in the middle of the invading strand did not prevent displacement from the 3WJ, but reduced the second-order rate constant by about 50 %. We attribute strand exchange in the dsDNA and 3WJ to a zero-toehold pathway from the blunt-ended duplex arms. The single-molecule approach demonstrated here will be useful for studying complex DNA networks. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  10. Environmental DNA as a ‘Snapshot’ of Fish Distribution: A Case Study of Japanese Jack Mackerel in Maizuru Bay, Sea of Japan

    PubMed Central

    Takahashi, Kohji; Sawada, Hideki; Murakami, Hiroaki; Tsuji, Satsuki; Hashizume, Hiroki; Kubonaga, Shou; Horiuchi, Tomoya; Hongo, Masamichi; Nishida, Jo; Okugawa, Yuta; Fujiwara, Ayaka; Fukuda, Miho; Hidaka, Shunsuke; Suzuki, Keita W.; Miya, Masaki; Araki, Hitoshi; Yamanaka, Hiroki; Maruyama, Atsushi; Miyashita, Kazushi; Masuda, Reiji; Minamoto, Toshifumi; Kondoh, Michio

    2016-01-01

    Recent studies in streams and ponds have demonstrated that the distribution and biomass of aquatic organisms can be estimated by detection and quantification of environmental DNA (eDNA). In more open systems such as seas, it is not evident whether eDNA can represent the distribution and biomass of aquatic organisms because various environmental factors (e.g., water flow) are expected to affect eDNA distribution and concentration. To test the relationships between the distribution of fish and eDNA, we conducted a grid survey in Maizuru Bay, Sea of Japan, and sampled surface and bottom waters while monitoring biomass of the Japanese jack mackerel (Trachurus japonicus) using echo sounder technology. A linear model showed a high R2 value (0.665) without outlier data points, and the association between estimated eDNA concentrations from the surface water samples and echo intensity was significantly positive, suggesting that the estimated spatial variation in eDNA concentration can reflect the local biomass of the jack mackerel. We also found that a best-fit model included echo intensity obtained within 10–150 m from water sampling sites, indicating that the estimated eDNA concentration most likely reflects fish biomass within 150 m in the bay. Although eDNA from a wholesale fish market partially affected eDNA concentration, we conclude that eDNA generally provides a ‘snapshot’ of fish distribution and biomass in a large area. Further studies in which dynamics of eDNA under field conditions (e.g., patterns of release, degradation, and diffusion of eDNA) are taken into account will provide a better estimate of fish distribution and biomass based on eDNA. PMID:26933889

  11. Branchpoint expansion in a fully complementary three-way DNA junction.

    PubMed

    Sabir, Tara; Toulmin, Anita; Ma, Long; Jones, Anita C; McGlynn, Peter; Schröder, Gunnar F; Magennis, Steven W

    2012-04-11

    Branched nucleic acid molecules serve as key intermediates in DNA replication, recombination, and repair; architectural elements in RNA; and building blocks and functional components for nanoscience applications. Using a combination of high-resolution single-molecule FRET, time-resolved spectroscopy, and molecular modeling, we have probed the local and global structure of a DNA three-way junction (3WJ) in solution. We found that it adopts a Y-shaped, pyramidal structure, in which the bases adjacent to the branchpoint are unpaired, despite the full Watson-Crick complementarity of the molecule. The unpairing allows a nanoscale cavity to form at the junction center. Our structure accounts for earlier observations made of the structure, flexibility, and reactivity of 3WJs. We anticipate that these results will guide the development of new DNA-based supramolecular receptors and nanosystems. © 2012 American Chemical Society

  12. Charge transport and ac response under light illumination in gate-modulated DNA molecular junctions.

    PubMed

    Zhang, Yan; Zhu, Wen-Huan; Ding, Guo-Hui; Dong, Bing; Wang, Xue-Feng

    2015-05-22

    Using a two-strand tight-binding model and within nonequilibrium Green's function approach, we study charge transport through DNA sequences (GC)NGC and (GC)1(TA)NTA (GC)3 sandwiched between two Pt electrodes. We show that at low temperature DNA sequence (GC)NGC exhibits coherent charge carrier transport at very small bias, since the highest occupied molecular orbital in the GC base pair can be aligned with the Fermi energy of the metallic electrodes by a gate voltage. A weak distance dependent conductance is found in DNA sequence (GC)1(TA)NTA (GC)3 with large NTA. Different from the mechanism of thermally induced hopping of charges proposed by the previous experiments, we find that this phenomenon is dominated by quantum tunnelling through discrete quantum well states in the TA base pairs. In addition, ac response of this DNA junction under light illumination is also investigated. The suppression of ac conductances of the left and right lead of DNA sequences at some particular frequencies is attributed to the excitation of electrons in the DNA to the lead Fermi surface by ac potential, or the excitation of electrons in deep DNA energy levels to partially occupied energy levels in the transport window. Therefore, measuring ac response of DNA junctions can reveal a wealth of information about the intrinsic dynamics of DNA molecules.

  13. Introducing a model of pairing based on base pair specific interactions between identical DNA sequences

    NASA Astrophysics Data System (ADS)

    (O' Lee, Dominic J.

    2018-02-01

    At present, there have been suggested two types of physical mechanism that may facilitate preferential pairing between DNA molecules, with identical or similar base pair texts, without separation of base pairs. One mechanism solely relies on base pair specific patterns of helix distortion being the same on the two molecules, discussed extensively in the past. The other mechanism proposes that there are preferential interactions between base pairs of the same composition. We introduce a model, built on this second mechanism, where both thermal stretching and twisting fluctuations are included, as well as the base pair specific helix distortions. Firstly, we consider an approximation for weak pairing interactions, or short molecules. This yields a dependence of the energy on the square root of the molecular length, which could explain recent experimental data. However, analysis suggests that this approximation is no longer valid at large DNA lengths. In a second approximation, for long molecules, we define two adaptation lengths for twisting and stretching, over which the pairing interaction can limit the accumulation of helix disorder. When the pairing interaction is sufficiently strong, both adaptation lengths are finite; however, as we reduce pairing strength, the stretching adaptation length remains finite but the torsional one becomes infinite. This second state persists to arbitrarily weak values of the pairing strength; suggesting that, if the molecules are long enough, the pairing energy scales as length. To probe differences between the two pairing mechanisms, we also construct a model of similar form. However, now, pairing between identical sequences solely relies on the intrinsic helix distortion patterns. Between the two models, we see interesting qualitative differences. We discuss our findings, and suggest new work to distinguish between the two mechanisms.

  14. Clusters of DNA induced by ionizing radiation: formation of short DNA fragments. I. Theoretical modeling

    NASA Technical Reports Server (NTRS)

    Holley, W. R.; Chatterjee, A.

    1996-01-01

    We have developed a general theoretical model for the interaction of ionizing radiation with chromatin. Chromatin is modeled as a 30-nm-diameter solenoidal fiber comprised of 20 turns of nucleosomes, 6 nucleosomes per turn. Charged-particle tracks are modeled by partitioning the energy deposition between primary track core, resulting from glancing collisions with 100 eV or less per event, and delta rays due to knock-on collisions involving energy transfers >100 eV. A Monte Carlo simulation incorporates damages due to the following molecular mechanisms: (1) ionization of water molecules leading to the formation of OH, H, eaq, etc.; (2) OH attack on sugar molecules leading to strand breaks: (3) OH attack on bases; (4) direct ionization of the sugar molecules leading to strand breaks; (5) direct ionization of the bases. Our calculations predict significant clustering of damage both locally, over regions up to 40 bp and over regions extending to several kilobase pairs. A characteristic feature of the regional damage predicted by our model is the production of short fragments of DNA associated with multiple nearby strand breaks. The shapes of the spectra of DNA fragment lengths depend on the symmetries or approximate symmetries of the chromatin structure. Such fragments have subsequently been detected experimentally and are reported in an accompanying paper (B. Rydberg, Radiat, Res. 145, 200-209, 1996) after exposure to both high- and low-LET radiation. The overall measured yields agree well quantitatively with the theoretical predictions. Our theoretical results predict the existence of a strong peak at about 85 bp, which represents the revolution period about the nucleosome. Other peaks at multiples of about 1,000 bp correspond to the periodicity of the particular solenoid model of chromatin used in these calculations. Theoretical results in combination with experimental data on fragmentation spectra may help determine the consensus or average structure of the chromatin fibers in mammalian DNA.

  15. Real-time PCR Machine System Modeling and a Systematic Approach for the Robust Design of a Real-time PCR-on-a-Chip System

    PubMed Central

    Lee, Da-Sheng

    2010-01-01

    Chip-based DNA quantification systems are widespread, and used in many point-of-care applications. However, instruments for such applications may not be maintained or calibrated regularly. Since machine reliability is a key issue for normal operation, this study presents a system model of the real-time Polymerase Chain Reaction (PCR) machine to analyze the instrument design through numerical experiments. Based on model analysis, a systematic approach was developed to lower the variation of DNA quantification and achieve a robust design for a real-time PCR-on-a-chip system. Accelerated lift testing was adopted to evaluate the reliability of the chip prototype. According to the life test plan, this proposed real-time PCR-on-a-chip system was simulated to work continuously for over three years with similar reproducibility in DNA quantification. This not only shows the robustness of the lab-on-a-chip system, but also verifies the effectiveness of our systematic method for achieving a robust design. PMID:22315563

  16. Computational design and multiscale modeling of a nanoactuator using DNA actuation.

    PubMed

    Hamdi, Mustapha

    2009-12-02

    Developments in the field of nanobiodevices coupling nanostructures and biological components are of great interest in medical nanorobotics. As the fundamentals of bio/non-bio interaction processes are still poorly understood in the design of these devices, design tools and multiscale dynamics modeling approaches are necessary at the fabrication pre-project stage. This paper proposes a new concept of optimized carbon nanotube based servomotor design for drug delivery and biomolecular transport applications. The design of an encapsulated DNA-multi-walled carbon nanotube actuator is prototyped using multiscale modeling. The system is parametrized by using a quantum level approach and characterized by using a molecular dynamics simulation. Based on the analysis of the simulation results, a servo nanoactuator using ionic current feedback is simulated and analyzed for application as a drug delivery carrier.

  17. Statistical and linguistic features of DNA sequences

    NASA Technical Reports Server (NTRS)

    Havlin, S.; Buldyrev, S. V.; Goldberger, A. L.; Mantegna, R. N.; Peng, C. K.; Simons, M.; Stanley, H. E.

    1995-01-01

    We present evidence supporting the idea that the DNA sequence in genes containing noncoding regions is correlated, and that the correlation is remarkably long range--indeed, base pairs thousands of base pairs distant are correlated. We do not find such a long-range correlation in the coding regions of the gene. We resolve the problem of the "non-stationary" feature of the sequence of base pairs by applying a new algorithm called Detrended Fluctuation Analysis (DFA). We address the claim of Voss that there is no difference in the statistical properties of coding and noncoding regions of DNA by systematically applying the DFA algorithm, as well as standard FFT analysis, to all eukaryotic DNA sequences (33 301 coding and 29 453 noncoding) in the entire GenBank database. We describe a simple model to account for the presence of long-range power-law correlations which is based upon a generalization of the classic Levy walk. Finally, we describe briefly some recent work showing that the noncoding sequences have certain statistical features in common with natural languages. Specifically, we adapt to DNA the Zipf approach to analyzing linguistic texts, and the Shannon approach to quantifying the "redundancy" of a linguistic text in terms of a measurable entropy function. We suggest that noncoding regions in plants and invertebrates may display a smaller entropy and larger redundancy than coding regions, further supporting the possibility that noncoding regions of DNA may carry biological information.

  18. A trap potential model investigation of the optical activity induced in dye-DNA intercalation complexes

    NASA Astrophysics Data System (ADS)

    Kamiya, Mamoru

    1988-02-01

    The fundamental features of the optical activity induced in dye-DNA intercalation complexes are studied by application of the trap potential model which is useful to evaluate the induced rotational strength without reference to detailed geometrical information about the intercalation complexes. The specific effect of the potential depth upon the induced optical activity is explained in terms of the relative magnitudes of the wave-phase and helix-phase variations in the path of an electron moving on a restricted helical segment just like an exciton trapped around the dye intercalation site. The parallel and perpendicular components of the induced rotational strength well reflect basic properties of the helicity effects about the longitudinal and tangential axes of the DNA helical cylinder. The trap potential model is applied to optimize the potential parameters so as to reproduce the ionic strength effect upon the optical activity induced to proflavine-DNA intercalation complexes. From relationships between the optimized potential parameters and ionic strengths, it is inferred that increase in the ionic strength contributes to the optical activity induced by the nearest-neighbour interaction between intercalated proflavine and DNA base pairs.

  19. Analysis of conserved noncoding DNA in Drosophila reveals similar constraints in intergenic and intronic sequences.

    PubMed

    Bergman, C M; Kreitman, M

    2001-08-01

    Comparative genomic approaches to gene and cis-regulatory prediction are based on the principle that differential DNA sequence conservation reflects variation in functional constraint. Using this principle, we analyze noncoding sequence conservation in Drosophila for 40 loci with known or suspected cis-regulatory function encompassing >100 kb of DNA. We estimate the fraction of noncoding DNA conserved in both intergenic and intronic regions and describe the length distribution of ungapped conserved noncoding blocks. On average, 22%-26% of noncoding sequences surveyed are conserved in Drosophila, with median block length approximately 19 bp. We show that point substitution in conserved noncoding blocks exhibits transition bias as well as lineage effects in base composition, and occurs more than an order of magnitude more frequently than insertion/deletion (indel) substitution. Overall, patterns of noncoding DNA structure and evolution differ remarkably little between intergenic and intronic conserved blocks, suggesting that the effects of transcription per se contribute minimally to the constraints operating on these sequences. The results of this study have implications for the development of alignment and prediction algorithms specific to noncoding DNA, as well as for models of cis-regulatory DNA sequence evolution.

  20. Heat-transfer resistance at solid-liquid interfaces: a tool for the detection of single-nucleotide polymorphisms in DNA.

    PubMed

    van Grinsven, Bart; Vanden Bon, Natalie; Strauven, Hannelore; Grieten, Lars; Murib, Mohammed; Monroy, Kathia L Jiménez; Janssens, Stoffel D; Haenen, Ken; Schöning, Michael J; Vermeeren, Veronique; Ameloot, Marcel; Michiels, Luc; Thoelen, Ronald; De Ceuninck, Ward; Wagner, Patrick

    2012-03-27

    In this article, we report on the heat-transfer resistance at interfaces as a novel, denaturation-based method to detect single-nucleotide polymorphisms in DNA. We observed that a molecular brush of double-stranded DNA grafted onto synthetic diamond surfaces does not notably affect the heat-transfer resistance at the solid-to-liquid interface. In contrast to this, molecular brushes of single-stranded DNA cause, surprisingly, a substantially higher heat-transfer resistance and behave like a thermally insulating layer. This effect can be utilized to identify ds-DNA melting temperatures via the switching from low- to high heat-transfer resistance. The melting temperatures identified with this method for different DNA duplexes (29 base pairs without and with built-in mutations) correlate nicely with data calculated by modeling. The method is fast, label-free (without the need for fluorescent or radioactive markers), allows for repetitive measurements, and can also be extended toward array formats. Reference measurements by confocal fluorescence microscopy and impedance spectroscopy confirm that the switching of heat-transfer resistance upon denaturation is indeed related to the thermal on-chip denaturation of DNA. © 2012 American Chemical Society

  1. Bubbles and denaturation in DNA

    NASA Astrophysics Data System (ADS)

    van Erp, T. S.; Cuesta-López, S.; Peyrard, M.

    2006-08-01

    The local opening of DNA is an intriguing phenomenon from a statistical-physics point of view, but is also essential for its biological function. For instance, the transcription and replication of our genetic code cannot take place without the unwinding of the DNA double helix. Although these biological processes are driven by proteins, there might well be a relation between these biological openings and the spontaneous bubble formation due to thermal fluctuations. Mesoscopic models, like the Peyrard-Bishop-Dauxois (PBD) model, have fairly accurately reproduced some experimental denaturation curves and the sharp phase transition in the thermodynamic limit. It is, hence, tempting to see whether these models could be used to predict the biological activity of DNA. In a previous study, we introduced a method that allows to obtain very accurate results on this subject, which showed that some previous claims in this direction, based on molecular-dynamics studies, were premature. This could either imply that the present PBD model should be improved or that biological activity can only be predicted in a more complex framework that involves interactions with proteins and super helical stresses. In this article, we give a detailed description of the statistical method introduced before. Moreover, for several DNA sequences, we give a thorough analysis of the bubble-statistics as a function of position and bubble size and the so-called l-denaturation curves that can be measured experimentally. These show that some important experimental observations are missing in the present model. We discuss how the present model could be improved.

  2. Correcting for Sample Contamination in Genotype Calling of DNA Sequence Data

    PubMed Central

    Flickinger, Matthew; Jun, Goo; Abecasis, Gonçalo R.; Boehnke, Michael; Kang, Hyun Min

    2015-01-01

    DNA sample contamination is a frequent problem in DNA sequencing studies and can result in genotyping errors and reduced power for association testing. We recently described methods to identify within-species DNA sample contamination based on sequencing read data, showed that our methods can reliably detect and estimate contamination levels as low as 1%, and suggested strategies to identify and remove contaminated samples from sequencing studies. Here we propose methods to model contamination during genotype calling as an alternative to removal of contaminated samples from further analyses. We compare our contamination-adjusted calls to calls that ignore contamination and to calls based on uncontaminated data. We demonstrate that, for moderate contamination levels (5%–20%), contamination-adjusted calls eliminate 48%–77% of the genotyping errors. For lower levels of contamination, our contamination correction methods produce genotypes nearly as accurate as those based on uncontaminated data. Our contamination correction methods are useful generally, but are particularly helpful for sample contamination levels from 2% to 20%. PMID:26235984

  3. The Five Immune Forces Impacting DNA-Based Cancer Immunotherapeutic Strategy

    PubMed Central

    Amara, Suneetha; Tiriveedhi, Venkataswarup

    2017-01-01

    DNA-based vaccine strategy is increasingly realized as a viable cancer treatment approach. Strategies to enhance immunogenicity utilizing tumor associated antigens have been investigated in several pre-clinical and clinical studies. The promising outcomes of these studies have suggested that DNA-based vaccines induce potent T-cell effector responses and at the same time cause only minimal side-effects to cancer patients. However, the immune evasive tumor microenvironment is still an important hindrance to a long-term vaccine success. Several options are currently under various stages of study to overcome immune inhibitory effect in tumor microenvironment. Some of these approaches include, but are not limited to, identification of neoantigens, mutanome studies, designing fusion plasmids, vaccine adjuvant modifications, and co-treatment with immune-checkpoint inhibitors. In this review, we follow a Porter’s analysis analogy, otherwise commonly used in business models, to analyze various immune-forces that determine the potential success and sustainable positive outcomes following DNA vaccination using non-viral tumor associated antigens in treatment against cancer. PMID:28304339

  4. Low-concentration exposure to BPA, BPF and BPAF induces oxidative DNA bases lesions in human peripheral blood mononuclear cells.

    PubMed

    Mokra, Katarzyna; Woźniak, Katarzyna; Bukowska, Bożena; Sicińska, Paulina; Michałowicz, Jaromir

    2018-06-01

    Because bisphenol A (BPA) and some of its analogs have been supposed to influence development of cancer, we have assessed the effect of BPA, bisphenol S (BPS), bisphenol F (BPF) and bisphenol AF (BPAF) on DNA bases oxidation, which is a key process in cancer initiation. The analysis was conducted on human peripheral blood mononuclear cells (PBMCs), which are very useful model to assess genotoxic potential of various toxicants in different cell types. In order to determine oxidative damage to DNA pyrimidines and purines, alkaline version of the comet assay with DNA glycosylases, i.e. endonuclease III (Nth) and human 8-oxoguanine DNA glycosylase (hOGG1) was used. PBMCs were exposed to BPA or its analogs in the concentrations of 0.01, 0.1 and 1 μg/mL for 4 h and 0.001, 0.01 and 0.1 μg/mL for 48 h. We have observed that BPA, BPS, BPF and particularly BPAF caused oxidative damage to DNA pyrimidines and more strongly to purines in human PBMCs. The results have also shown that BPS, which is the most commonly used as a substitute for BPA in the manufacture induced definitely the smallest oxidative DNA bases lesions in PBMCs. Moreover, we have noticed that BPA, BPF and BPAF caused DNA damage at very low concentration of 1 ng/mL. Copyright © 2018 Elsevier Ltd. All rights reserved.

  5. Ab initio electron propagator calculations of transverse conduction through DNA nucleotide bases in 1-nm nanopore corroborate third generation sequencing.

    PubMed

    Kletsov, Aleksey A; Glukhovskoy, Evgeny G; Chumakov, Aleksey S; Ortiz, Joseph V

    2016-01-01

    The conduction properties of DNA molecule, particularly its transverse conductance (electron transfer through nucleotide bridges), represent a point of interest for DNA chemistry community, especially for DNA sequencing. However, there is no fully developed first-principles theory for molecular conductance and current that allows one to analyze the transverse flow of electrical charge through a nucleotide base. We theoretically investigate the transverse electron transport through all four DNA nucleotide bases by implementing an unbiased ab initio theoretical approach, namely, the electron propagator theory. The electrical conductance and current through DNA nucleobases (guanine [G], cytosine [C], adenine [A] and thymine [T]) inserted into a model 1-nm Ag-Ag nanogap are calculated. The magnitudes of the calculated conductance and current are ordered in the following hierarchies: gA>gG>gC>gT and IG>IA>IT>IC correspondingly. The new distinguishing parameter for the nucleobase identification is proposed, namely, the onset bias magnitude. Nucleobases exhibit the following hierarchy with respect to this parameter: Vonset(A)

  6. Mechanism of Microhomology-Mediated End-Joining Promoted by Human DNA Polymerase Theta

    PubMed Central

    Kent, Tatiana; Chandramouly, Gurushankar; McDevitt, Shane Michael; Ozdemir, Ahmet Y.; Pomerantz, Richard T.

    2014-01-01

    Microhomology-mediated end-joining (MMEJ) is an error-prone alternative double-strand break repair pathway that utilizes sequence microhomology to recombine broken DNA. Although MMEJ is implicated in cancer development, the mechanism of this pathway is unknown. We demonstrate that purified human DNA polymerase θ (Polθ) performs MMEJ of DNA containing 3’ single-strand DNA overhangs with two or more base-pairs of homology, including DNA modeled after telomeres, and show that MMEJ is dependent on Polθ in human cells. Our data support a mechanism whereby Polθ facilitates end-joining and microhomology annealing then utilizes the opposing overhang as a template in trans which stabilizes the DNA synapse. Polθ exhibits a preference for DNA containing a 5’-terminal phosphate, similar to polymerases involved in non-homologous end-joining. Lastly, we identify a conserved loop domain that is essential for MMEJ and higher-order structures of Polθ which likely promote DNA synapse formation. PMID:25643323

  7. RecA binding to a single double-stranded DNA molecule: A possible role of DNA conformational fluctuations

    PubMed Central

    Leger, J. F.; Robert, J.; Bourdieu, L.; Chatenay, D.; Marko, J. F.

    1998-01-01

    Most genetic regulatory mechanisms involve protein–DNA interactions. In these processes, the classical Watson–Crick DNA structure sometimes is distorted severely, which in turn enables the precise recognition of the specific sites by the protein. Despite its key importance, very little is known about such deformation processes. To address this general question, we have studied a model system, namely, RecA binding to double-stranded DNA. Results from micromanipulation experiments indicate that RecA binds strongly to stretched DNA; based on this observation, we propose that spontaneous thermal stretching fluctuations may play a role in the binding of RecA to DNA. This has fundamental implications for the protein–DNA binding mechanism, which must therefore rely in part on a combination of flexibility and thermal fluctuations of the DNA structure. We also show that this mechanism is sequence sensitive. Theoretical simulations support this interpretation of our experimental results, and it is argued that this is of broad relevance to DNA–protein interactions. PMID:9770480

  8. Effects of sequence on DNA wrapping around histones

    NASA Astrophysics Data System (ADS)

    Ortiz, Vanessa

    2011-03-01

    A central question in biophysics is whether the sequence of a DNA strand affects its mechanical properties. In epigenetics, these are thought to influence nucleosome positioning and gene expression. Theoretical and experimental attempts to answer this question have been hindered by an inability to directly resolve DNA structure and dynamics at the base-pair level. In our previous studies we used a detailed model of DNA to measure the effects of sequence on the stability of naked DNA under bending. Sequence was shown to influence DNA's ability to form kinks, which arise when certain motifs slide past others to form non-native contacts. Here, we have now included histone-DNA interactions to see if the results obtained for naked DNA are transferable to the problem of nucleosome positioning. Different DNA sequences interacting with the histone protein complex are studied, and their equilibrium and mechanical properties are compared among themselves and with the naked case. NLM training grant to the Computation and Informatics in Biology and Medicine Training Program (NLM T15LM007359).

  9. Click nucleic acid ligation: applications in biology and nanotechnology.

    PubMed

    El-Sagheer, Afaf H; Brown, Tom

    2012-08-21

    Biochemical strategies that use a combination of synthetic oligonucleotides, thermostable DNA polymerases, and DNA ligases can produce large DNA constructs up to 1 megabase in length. Although these ambitious targets are feasible biochemically, comparable technologies for the chemical synthesis of long DNA strands lag far behind. The best available chemical approach is the solid-phase phosphoramidite method, which can be used to assemble DNA strands up to 150 bases in length. Beyond this point, deficiencies in the chemistry make it impossible to produce pure DNA. A possible alternative approach to the chemical synthesis of large DNA strands is to join together carefully purified synthetic oligonucleotides by chemical methods. Click ligation by the copper-catalyzed azide-alkyne (CuAAC) reaction could facilitate this process. In this Account, we describe the synthesis, characterization, and applications of oligonucleotides prepared by click ligation. The alkyne and azide oligonucleotide strands can be prepared by standard protocols, and the ligation reaction is compatible with a wide range of chemical modifications to DNA and RNA. We have employed click ligation to synthesize DNA constructs up to 300 bases in length and much longer sequences are feasible. When the resulting triazole linkage is placed in a PCR template, various DNA polymerases correctly copy the entire base sequence. We have also successfully demonstrated both in vitro transcription and rolling circle amplification through the modified linkage. This linkage has shown in vivo biocompatibility: an antibiotic resistance gene containing triazole linkages functions in E. coli . Using click ligation, we have synthesized hairpin ribozymes up to 100 nucleotides in length and a hammerhead ribozyme with the triazole linkage located at the substrate cleavage site. At the opposite end of the length scale, click-ligated, cyclic mini-DNA duplexes have been used as models to study base pairing. Cyclic duplexes have potential therapeutic applications. They have extremely high thermodynamic stability, have increased resistance to enzymatic degradation, and have been investigated as decoys for regulatory proteins. For potential nanotechnology applications, we have synthesized double stranded DNA catenanes by click ligation. Other researchers have studied covalently fixed multistranded DNA constructs including triplexes and quadruplexes.

  10. In vitro DNA binding, pBR322 plasmid cleavage and molecular modeling study of chiral benzothiazole Schiff-base-valine Cu(II) and Zn(II) complexes to evaluate their enantiomeric biological disposition for molecular target DNA

    NASA Astrophysics Data System (ADS)

    Alizadeh, Rahman; Afzal, Mohd; Arjmand, Farukh

    2014-10-01

    Bicyclic heterocyclic compounds viz. benzothiazoles are key components of deoxyribonucleic acid (DNA) molecules and participate directly in the encoding of genetic information. Benzothiazoles, therefore, represent a potent and selective class of antitumor compounds. The design and synthesis of chiral antitumor chemotherapeutic agents of Cu(II) and Zn(II), L- and -D benzothiazole Schiff base-valine complexes 1a &b and 2a &b, respectively were carried out and thoroughly characterized by spectroscopic and analytical techniques. Interaction of 1a and b and 2a and b with CT DNA by employing UV-vis, florescence, circular dichroic methods and cleavage studies of 1a with pBR322 plasmid, molecular docking were done in order to demonstrate their enantiomeric disposition toward the molecular drug target DNA. Interestingly, these studies unambiguously demonstrated the greater potency of L-enantiomer in comparison to D-enantiomer.

  11. Structural Mechanism of Replication Stalling on a Bulky Amino-Polycyclic Aromatic Hydrocarbon DNA Adduct by a Y Family DNA Polymerase

    PubMed Central

    Kirouac, Kevin N.; Basu, Ashis K.; Ling, Hong

    2013-01-01

    Polycyclic aromatic hydrocarbons and their nitro derivatives are culprits of the detrimental health effects of environmental pollution. These hydrophobic compounds metabolize to reactive species and attach to DNA producing bulky lesions, such as N-[deoxyguanosine-8-yl]-1-aminopyrene (APG), in genomic DNA. The bulky adducts block DNA replication by high-fidelity polymerases and compromise replication fidelities and efficiencies by specialized lesion bypass polymerases. Here we present three crystal structures of the DNA polymerase Dpo4, a model translesion DNA polymerase of the Y family, in complex with APG-lesion-containing DNA in pre-insertion and extension stages. APG is captured in two conformations in the pre-insertion complex; one is highly exposed to the solvent, whereas the other is harbored in a shallow cleft between the finger and unique Y family little finger domain. In contrast, APG is in a single conformation at the extension stage, in which the pyrene ring is sandwiched between the little finger domain and a base from the turning back single-stranded template strand. Strikingly, a nucleotide intercalates the DNA helix to form a quaternary complex with Dpo4, DNA, and an incoming nucleotide, which stabilizes the distorted DNA structure at the extension stage. The unique APG DNA conformations in Dpo4 inhibit DNA translocation through the polymerase active site for APG bypass. We also modeled an insertion complex that illustrates a solvent-exposed pyrene ring contributing to an unstable insertion state. The structural work combined with our lesion replication assays provides a novel structural mechanism on bypass of DNA adducts containing polycyclic aromatic hydrocarbon moieties. PMID:23876706

  12. Structural mechanism of replication stalling on a bulky amino-polycyclic aromatic hydrocarbon DNA adduct by a y family DNA polymerase.

    PubMed

    Kirouac, Kevin N; Basu, Ashis K; Ling, Hong

    2013-11-15

    Polycyclic aromatic hydrocarbons and their nitro derivatives are culprits of the detrimental health effects of environmental pollution. These hydrophobic compounds metabolize to reactive species and attach to DNA producing bulky lesions, such as N-[deoxyguanosine-8-yl]-1-aminopyrene (APG), in genomic DNA. The bulky adducts block DNA replication by high-fidelity polymerases and compromise replication fidelities and efficiencies by specialized lesion bypass polymerases. Here we present three crystal structures of the DNA polymerase Dpo4, a model translesion DNA polymerase of the Y family, in complex with APG-lesion-containing DNA in pre-insertion and extension stages. APG is captured in two conformations in the pre-insertion complex; one is highly exposed to the solvent, whereas the other is harbored in a shallow cleft between the finger and unique Y family little finger domain. In contrast, APG is in a single conformation at the extension stage, in which the pyrene ring is sandwiched between the little finger domain and a base from the turning back single-stranded template strand. Strikingly, a nucleotide intercalates the DNA helix to form a quaternary complex with Dpo4, DNA, and an incoming nucleotide, which stabilizes the distorted DNA structure at the extension stage. The unique APG DNA conformations in Dpo4 inhibit DNA translocation through the polymerase active site for APG bypass. We also modeled an insertion complex that illustrates a solvent-exposed pyrene ring contributing to an unstable insertion state. The structural work combined with our lesion replication assays provides a novel structural mechanism on bypass of DNA adducts containing polycyclic aromatic hydrocarbon moieties. © 2013.

  13. Clinical evaluation of the branched DNA assay for hepatitis B virus DNA detection in patients with chronic hepatitis B lacking hepatitis B e antigen and treated with interferon-alpha.

    PubMed

    Habersetzer, F; Zoulim, F; Jusot, J F; Zhang, X; Trabaud, M A; Chevallier, P; Chevallier, M; Ahmed, S N; Sepetjan, M; Comanor, L; Minor, J; Trépo, C

    1998-11-01

    The aim of this study was to evaluate the Chiron branched DNA (bDNA) assay for detection of serum hepatitis B virus (HBV) DNA in patients with chronic hepatitis B lacking hepatitis B e antigen (HBeAg) and undergoing interferon (IFN) therapy. Results obtained with the bDNA assay were compared with those obtained using the Abbott liquid hybridization (LH) assay and the polymerase chain reaction (PCR). Serial samples (274) from 34 patients were analysed. Analysis of variance results indicated that bDNA values were more significantly correlated than LH values with both PCR positive/negative results (probability of artifact (Prob > F) = 0.7 and 0.09 for LH and bDNA assays, respectively) and presence/absence of precore mutations (Prob > F = 0.21 and 0.001 for LH and bDNA assays, respectively). Both bDNA and LH results correlated highly with alanine aminotransferase (ALT) values (both had Prob > F values of 0.0) while PCR was not correlated with ALT (Prob > F = 0.05). In 26 evaluable patients, a model based on a generalized Knodell score was used to predict response to IFN therapy, as defined by normalization of ALT values during therapy. This model discriminated well between non-responders and responders. The bDNA results correlated well with the generalized Knodell score, while the LH results did not (Prob > F = 0.04 and 0.19 for the bDNA and LH assays, respectively). In conclusion, the bDNA assay appears to be useful for quantification of HBV DNA levels in HBeAg-negative chronic hepatitis as it correlates with biochemical and histological indications of disease severity as well as with response to IFN therapy.

  14. Raman spectroscopy of DNA-metal complexes. II. The thermal denaturation of DNA in the presence of Sr2+, Ba2+, Mg2+, Ca2+, Mn2+, Co2+, Ni2+, and Cd2+.

    PubMed

    Duguid, J G; Bloomfield, V A; Benevides, J M; Thomas, G J

    1995-12-01

    Differential scanning calorimetry, laser Raman spectroscopy, optical densitometry, and pH potentiometry have been used to investigate DNA melting profiles in the presence of the chloride salts of Ba2+, Sr2+, Mg2+, Ca2+, Mn2+, Co2+, Ni2+, and Cd2+. Metal-DNA interactions have been observed for the molar ratio [M2+]/[PO2-] = 0.6 in aqueous solutions containing 5% by weight of 160 bp mononucleosomal calf thymus DNA. All of the alkaline earth metals, plus Mn2+, elevate the melting temperature of DNA (Tm > 75.5 degrees C), whereas the transition metals Co2+, Ni2+, and Cd2+ lower Tm. Calorimetric (delta Hcal) and van't Hoff (delta HVH) enthalpies of melting range from 6.2-8.7 kcal/mol bp and 75.6-188.6 kcal/mol cooperative unit, respectively, and entropies from 17.5 to 24.7 cal/K mol bp. The average number of base pairs in a cooperative melting unit () varied from 11.3 to 28.1. No dichotomy was observed between alkaline earth and transition DNA-metal complexes for any of the thermodynamic parameters other than their effects on Tm. These results complement Raman difference spectra, which reveal decreases in backbone order, base unstacking, distortion of glycosyl torsion angles, and rupture of hydrogen bonds, which occur after thermal denaturation. Raman difference spectroscopy shows that transition metals interact with the N7 atom of guanine in duplex DNA. A broader range of interaction sites with single-stranded DNA includes ionic phosphates, the N1 and N7 atoms of purines, and the N3 atom of pyrimidines. For alkaline earth metals, very little interaction was observed with duplex DNA, whereas spectra of single-stranded complexes are very similar to those of melted DNA without metal. However, difference spectra reveal some metal-specific perturbations at 1092 cm-1 (nPO2-), 1258 cm-1 (dC, dA), and 1668 cm-1 (nC==O, dNH2 dT, dG, dC). Increased spectral intensity could also be observed near 1335 cm-1 (dA, dG) for CaDNA. Optical densitometry, employed to detect DNA aggregation, reveals increased turbidity during the melting transition for all divalent DNA-metal complexes, except SrDNA and BaDNA. Turbidity was not observed for DNA in the absence of metal. A correlation was made between DNA melting, aggregation, and the ratio of Raman intensities I1335/I1374. At room temperature, DNA-metal interactions result in a pH drop of 1.2-2.2 units for alkaline earths and more than 2.5 units for transition metals. Sr2+, Ba2+, and Mg2+ cause protonated sites on the DNA to become thermally labile. These results lead to a model that describes DNA aggregation and denaturation during heating in the presence of divalent metal cations; 1) The cations initially interact with the DNA at phosphate and/or base sites, resulting in proton displacement. 2) A combination of metal-base interactions and heating disrupts the base pairing within the DNA duplex. This allows divalent metals and protons to bind to additional sites on the DNA bases during the aggregation/melting process. 3) Strands whose bases have swung open upon disruption are linked to neighboring strands by metal ion bridges. 4) Near the midpoint of the melting transition, thermal energy breaks up the aggregate. We have no evidence to indicate whether metal ion cross-bridges or direct base-base interactions rupture first. 5) Finally, all cross-links break, resulting in single-stranded DNA complexed with metal ions.

  15. Run-length encoding graphic rules, biochemically editable designs and steganographical numeric data embedment for DNA-based cryptographical coding system

    PubMed Central

    Kawano, Tomonori

    2013-01-01

    There have been a wide variety of approaches for handling the pieces of DNA as the “unplugged” tools for digital information storage and processing, including a series of studies applied to the security-related area, such as DNA-based digital barcodes, water marks and cryptography. In the present article, novel designs of artificial genes as the media for storing the digitally compressed data for images are proposed for bio-computing purpose while natural genes principally encode for proteins. Furthermore, the proposed system allows cryptographical application of DNA through biochemically editable designs with capacity for steganographical numeric data embedment. As a model case of image-coding DNA technique application, numerically and biochemically combined protocols are employed for ciphering the given “passwords” and/or secret numbers using DNA sequences. The “passwords” of interest were decomposed into single letters and translated into the font image coded on the separate DNA chains with both the coding regions in which the images are encoded based on the novel run-length encoding rule, and the non-coding regions designed for biochemical editing and the remodeling processes revealing the hidden orientation of letters composing the original “passwords.” The latter processes require the molecular biological tools for digestion and ligation of the fragmented DNA molecules targeting at the polymerase chain reaction-engineered termini of the chains. Lastly, additional protocols for steganographical overwriting of the numeric data of interests over the image-coding DNA are also discussed. PMID:23750303

  16. Fluctuation Pressure Assisted Ejection of DNA From Bacteriophage

    NASA Astrophysics Data System (ADS)

    Harrison, Michael J.

    2011-03-01

    The role of thermal pressure fluctuations excited within tightly packaged DNA while it is ejected from protein capsid shells is discussed in a model calculation. At equilibrium before ejection we assume the DNA is folded many times into a bundle of parallel segments that forms an equilibrium conformation at minimum free energy, which presses tightly against capsid walls. Using a canonical ensemble at temperature T we calculate internal pressure fluctuations against a slowly moving or static capsid mantle for an elastic continuum model of the folded DNA bundle. It is found that fluctuating pressures on the capsid from thermal excitation of longitudinal acoustic vibrations in the bundle whose wavelengths are exceeded by the bend persistence length may have root-mean-square values that are several tens of atmospheres for typically small phage dimensions. Comparisons are given with measured data on three mutants of lambda phage with different base pair lengths and total genome ejection pressures.

  17. Interactions of the SAP Domain of Human Ku70 with DNA Substrate: A Molecular Dynamics Study

    NASA Technical Reports Server (NTRS)

    Hu, Shaowen; Carra, Claudio; Huff, Janice; Pluth, Janice M.; Cucinotta, Francis A.

    2007-01-01

    NASA is developing a systems biology approach to improve the assessment of health risks associated with space radiation. The primary toxic and mutagenic lesion following radiation exposure is the DNA double strand break (DSB), thus a model incorporating proteins and pathways important in response and repair of this lesion is critical. One key protein heterodimer for systems models of radiation effects is the Ku70/80 complex. The Ku70/80 complex is important in the initial binding of DSB ends following DNA damage, and is a component of nonhomologous end joining repair, the primary pathway for DSB repair in mammalian cells. The SAP domain of Ku70 (residues 556-609), contains an a helix-extended strand-helix motif and similar motifs have been found in other nucleic acid-binding proteins critical for DNA repair. However, the exact mechanism of damage recognition and substrate specificity for the Ku heterodimer remains unclear in part due to the absence of a high-resolution structure of the SAP/DNA complex. We performed a series of molecular dynamics (MD) simulations on a system with the SAP domain of Ku70 and a 10 base pairs DNA duplex. Large-scale conformational changes were observed and some putative binding modes were suggested based on energetic analysis. These modes are consistent with previous experimental investigations. In addition, the results indicate that cooperation of SAP with other domains of Ku70/80 is necessary to explain the high affinity of binding as observed in experiments.

  18. Blind Predictions of DNA and RNA Tweezers Experiments with Force and Torque

    PubMed Central

    Chou, Fang-Chieh; Lipfert, Jan; Das, Rhiju

    2014-01-01

    Single-molecule tweezers measurements of double-stranded nucleic acids (dsDNA and dsRNA) provide unprecedented opportunities to dissect how these fundamental molecules respond to forces and torques analogous to those applied by topoisomerases, viral capsids, and other biological partners. However, tweezers data are still most commonly interpreted post facto in the framework of simple analytical models. Testing falsifiable predictions of state-of-the-art nucleic acid models would be more illuminating but has not been performed. Here we describe a blind challenge in which numerical predictions of nucleic acid mechanical properties were compared to experimental data obtained recently for dsRNA under applied force and torque. The predictions were enabled by the HelixMC package, first presented in this paper. HelixMC advances crystallography-derived base-pair level models (BPLMs) to simulate kilobase-length dsDNAs and dsRNAs under external forces and torques, including their global linking numbers. These calculations recovered the experimental bending persistence length of dsRNA within the error of the simulations and accurately predicted that dsRNA's “spring-like” conformation would give a two-fold decrease of stretch modulus relative to dsDNA. Further blind predictions of helix torsional properties, however, exposed inaccuracies in current BPLM theory, including three-fold discrepancies in torsional persistence length at the high force limit and the incorrect sign of dsRNA link-extension (twist-stretch) coupling. Beyond these experiments, HelixMC predicted that ‘nucleosome-excluding’ poly(A)/poly(T) is at least two-fold stiffer than random-sequence dsDNA in bending, stretching, and torsional behaviors; Z-DNA to be at least three-fold stiffer than random-sequence dsDNA, with a near-zero link-extension coupling; and non-negligible effects from base pair step correlations. We propose that experimentally testing these predictions should be powerful next steps for understanding the flexibility of dsDNA and dsRNA in sequence contexts and under mechanical stresses relevant to their biology. PMID:25102226

  19. Acute inactivation of the replicative helicase in human cells triggers MCM8–9-dependent DNA synthesis

    PubMed Central

    Natsume, Toyoaki; Nishimura, Kohei; Minocherhomji, Sheroy; Bhowmick, Rahul; Hickson, Ian D.; Kanemaki, Masato T.

    2017-01-01

    DNA replication fork progression can be disrupted at difficult to replicate loci in the human genome, which has the potential to challenge chromosome integrity. This replication fork disruption can lead to the dissociation of the replisome and the formation of DNA damage. To model the events stemming from replisome dissociation during DNA replication perturbation, we used a degron-based system for inducible proteolysis of a subunit of the replicative helicase. We show that MCM2-depleted cells activate a DNA damage response pathway and generate replication-associated DNA double-strand breaks (DSBs). Remarkably, these cells maintain some DNA synthesis in the absence of MCM2, and this requires the MCM8–9 complex, a paralog of the MCM2–7 replicative helicase. We show that MCM8–9 functions in a homologous recombination-based pathway downstream from RAD51, which is promoted by DSB induction. This RAD51/MCM8–9 axis is distinct from the recently described RAD52-dependent DNA synthesis pathway that operates in early mitosis at common fragile sites. We propose that stalled replication forks can be restarted in S phase via homologous recombination using MCM8–9 as an alternative replicative helicase. PMID:28487407

  20. Imaging chromatin nanostructure with binding-activated localization microscopy based on DNA structure fluctuations

    PubMed Central

    Szczurek, Aleksander; Klewes, Ludger; Xing, Jun; Gourram, Amine; Birk, Udo; Knecht, Hans; Dobrucki, Jurek W.; Mai, Sabine

    2017-01-01

    Abstract Advanced light microscopy is an important tool for nanostructure analysis of chromatin. In this report we present a general concept for Single Molecule localization Microscopy (SMLM) super-resolved imaging of DNA-binding dyes based on modifying the properties of DNA and the dye. By careful adjustment of the chemical environment leading to local, reversible DNA melting and hybridization control over the fluorescence signal of the DNA-binding dye molecules can be introduced. We postulate a transient binding as the basis for our variation of binding-activated localization microscopy (BALM). We demonstrate that several intercalating and minor-groove binding DNA dyes can be used to register (optically isolate) only a few DNA-binding dye signals at a time. To highlight this DNA structure fluctuation-assisted BALM (fBALM), we applied it to measure, for the first time, nanoscale differences in nuclear architecture in model ischemia with an anticipated structural resolution of approximately 50 nm. Our data suggest that this approach may open an avenue for the enhanced microscopic analysis of chromatin nano-architecture and hence the microscopic analysis of nuclear structure aberrations occurring in various pathological conditions. It may also become possible to analyse nuclear nanostructure differences in different cell types, stages of development or environmental stress conditions. PMID:28082388

  1. An improved method for large-scale preparation of negatively and positively supercoiled plasmid DNA.

    PubMed

    Barth, Marita; Dederich, Debra; Dedon, Peter

    2009-07-01

    A rigorous understanding of the biological function of superhelical tension in cellular DNA requires the development of new tools and model systems for study. To this end, an ethidium bromide[#x02013]free method has been developed to prepare large quantities of either negatively or positively super-coiled plasmid DNA. The method is based upon the known effects of ionic strength on the direction of binding of DNA to an archaeal histone, rHMfB, with low and high salt concentrations leading to positive and negative DNA supercoiling, respectively. In addition to fully optimized conditions for large-scale (>500 microg) supercoiling reactions, the method is advantageous in that it avoids the use of mutagenic ethidium bromide, is applicable to chemically modified plasmid DNA substrates, and produces both positively and negatively supercoiled DNA using a single set of reagents.

  2. Physical signals for protein-DNA recognition

    NASA Astrophysics Data System (ADS)

    Cao, Xiao-Qin; Zeng, Jia; Yan, Hong

    2009-09-01

    This paper discovers consensus physical signals around eukaryotic splice sites, transcription start sites, and replication origin start and end sites on a genome-wide scale based on their DNA flexibility profiles calculated by three different flexibility models. These salient physical signals are localized highly rigid and flexible DNAs, which may play important roles in protein-DNA recognition by the sliding search mechanism. The found physical signals lead us to a detailed hypothetical view of the search process in which a DNA-binding protein first finds a genomic region close to the target site from an arbitrary starting location by three-dimensional (3D) hopping and intersegment transfer mechanisms for long distances, and subsequently uses the one-dimensional (1D) sliding mechanism facilitated by the localized highly rigid DNAs to accurately locate the target flexible binding site within 30 bp (base pair) short distances. Guided by these physical signals, DNA-binding proteins rapidly search the entire genome to recognize a specific target site from the 3D to 1D pathway. Our findings also show that current promoter prediction programs (PPPs) based on DNA physical properties may suffer from lots of false positives because other functional sites such as splice sites and replication origins have similar physical signals as promoters do.

  3. Mutation detection by mismatch binding protein, MutS, in amplified DNA: Application to the cystic fibrosis gene

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lishanski, A.; Ostrander, E.A.; Rine, J.

    1994-03-29

    An experimental strategy for detecting heterozygosity in genomic DNA has been developed based on preferential binding of Escherichia coli MutS protein to DNA molecules containing mismatched bases. The binding was detected by a gel mobility-shift assay. This approach was tested by using as a model the most commonly occurring mutations within the cystic fibrosis (CFTR) gene. Genomic DNA samples were amplified with 5{prime}-end-labeled primers that bracket the site of the {Delta}F508 3-bp deletion in exon 10 of the CFTR gene. The renatured PCR products from homozygotes produced homoduplexes; the PCR products from heterozygotes produced heteroduplexes and homoduplexes (1:1). MutS proteinmore » bound more strongly to heteroduplexes that correspond to heterozygous carriers of {Delta}F508 and contain a CTT or a GAA loop in one of the strands than to homoduplexes corresponding to homozygotes. The ability of MutS protein to detect heteroduplexes in PCR-amplified DNA extended to fragments {approximately} 500 bp long. The method was also able to detect carriers of the point mutations in exon 11 of the CFTR gene by a preferential binding of MutS to single-base mismatches in PCR-amplified DNA.« less

  4. Assessment of primer/template mismatch effects on real-time PCR amplification of target taxa for GMO quantification.

    PubMed

    Ghedira, Rim; Papazova, Nina; Vuylsteke, Marnik; Ruttink, Tom; Taverniers, Isabel; De Loose, Marc

    2009-10-28

    GMO quantification, based on real-time PCR, relies on the amplification of an event-specific transgene assay and a species-specific reference assay. The uniformity of the nucleotide sequences targeted by both assays across various transgenic varieties is an important prerequisite for correct quantification. Single nucleotide polymorphisms (SNPs) frequently occur in the maize genome and might lead to nucleotide variation in regions used to design primers and probes for reference assays. Further, they may affect the annealing of the primer to the template and reduce the efficiency of DNA amplification. We assessed the effect of a minor DNA template modification, such as a single base pair mismatch in the primer attachment site, on real-time PCR quantification. A model system was used based on the introduction of artificial mismatches between the forward primer and the DNA template in the reference assay targeting the maize starch synthase (SSIIb) gene. The results show that the presence of a mismatch between the primer and the DNA template causes partial to complete failure of the amplification of the initial DNA template depending on the type and location of the nucleotide mismatch. With this study, we show that the presence of a primer/template mismatch affects the estimated total DNA quantity to a varying degree.

  5. MethBank: a database integrating next-generation sequencing single-base-resolution DNA methylation programming data.

    PubMed

    Zou, Dong; Sun, Shixiang; Li, Rujiao; Liu, Jiang; Zhang, Jing; Zhang, Zhang

    2015-01-01

    DNA methylation plays crucial roles during embryonic development. Here we present MethBank (http://dnamethylome.org), a DNA methylome programming database that integrates the genome-wide single-base nucleotide methylomes of gametes and early embryos in different model organisms. Unlike extant relevant databases, MethBank incorporates the whole-genome single-base-resolution methylomes of gametes and early embryos at multiple different developmental stages in zebrafish and mouse. MethBank allows users to retrieve methylation levels, differentially methylated regions, CpG islands, gene expression profiles and genetic polymorphisms for a specific gene or genomic region. Moreover, it offers a methylome browser that is capable of visualizing high-resolution DNA methylation profiles as well as other related data in an interactive manner and thus is of great helpfulness for users to investigate methylation patterns and changes of gametes and early embryos at different developmental stages. Ongoing efforts are focused on incorporation of methylomes and related data from other organisms. Together, MethBank features integration and visualization of high-resolution DNA methylation data as well as other related data, enabling identification of potential DNA methylation signatures in different developmental stages and accordingly providing an important resource for the epigenetic and developmental studies. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  6. DNA Mismatch Binding and Antiproliferative Activity of Rhodium Metalloinsertors

    PubMed Central

    Ernst, Russell J.; Song, Hang; Barton, Jacqueline K.

    2009-01-01

    Deficiencies in mismatch repair (MMR) are associated with carcinogenesis. Rhodium metalloinsertors bind to DNA base mismatches with high specificity and inhibit cellular proliferation preferentially in MMR-deficient cells versus MMR-proficient cells. A family of chrysenequinone diimine complexes of rhodium with varying ancillary ligands that serve as DNA metalloinsertors has been synthesized, and both DNA mismatch binding affinities and antiproliferative activities against the human colorectal carcinoma cell lines HCT116N and HCT116O, an isogenic model system for MMR deficiency, have been determined. DNA photocleavage experiments reveal that all complexes bind to the mismatch sites with high specificities; DNA binding affinities to oligonucleotides containing single base CA and CC mismatches, obtained through photocleavage titration or competition, vary from 104 to 108 M−1 for the series of complexes. Significantly, binding affinities are found to be inversely related to ancillary ligand size and directly related to differential inhibition of the HCT116 cell lines. The observed trend in binding affinity is consistent with the metalloinsertion mode where the complex binds from the minor groove with ejection of mismatched base pairs. The correlation between binding affinity and targeting of the MMR-deficient cell line suggests that rhodium metalloinsertors exert their selective biological effects on MMR-deficient cells through mismatch binding in vivo. PMID:19175313

  7. Multiply Intercalator-Substituted Cu(II) Cyclen Complexes as DNA Condensers and DNA/RNA Synthesis Inhibitors.

    PubMed

    Hormann, Jan; Malina, Jaroslav; Lemke, Oliver; Hülsey, Max J; Wedepohl, Stefanie; Potthoff, Jan; Schmidt, Claudia; Ott, Ingo; Keller, Bettina G; Brabec, Viktor; Kulak, Nora

    2018-05-07

    Many drugs that are applied in anticancer therapy such as the anthracycline doxorubicin contain DNA-intercalating 9,10-anthraquinone (AQ) moieties. When Cu(II) cyclen complexes were functionalized with up to three (2-anthraquinonyl)methyl substituents, they efficiently inhibited DNA and RNA synthesis resulting in high cytotoxicity (selective for cancer cells) accompanied by DNA condensation/aggregation phenomena. Molecular modeling suggests an unusual bisintercalation mode with only one base pair between the two AQ moieties and the metal complex as a linker. A regioisomer, in which the AQ moieties point in directions unfavorable for such an interaction, had a much weaker biological activity. The ligands alone and corresponding Zn(II) complexes (used as redox inert control compounds) also exhibited lower activity.

  8. Effect of marine derived deoxyribonucleic acid on nonlinear optical properties of PicoGreen dye

    NASA Astrophysics Data System (ADS)

    Pradeep, C.; Mathew, S.; Nithyaja, B.; Radhakrishnan, P.; Nampoori, V. P. N.

    2013-06-01

    We have investigated the effect of DNA on nonlinear absorption of PicoGreen dye using single beam open aperture Z-scan technique in nanosecond regime. We observed reverse saturable absorption at 532 nm for PicoGreen without DNA. In the presence of DNA, the sample begins to behave like saturable absorbers and this effect increased as the concentration of DNA was increased. The dye-intercalated DNA showed SA characteristics near the focus but exhibited RSA characteristics at the focus. Theoretical analysis has been performed using a two-photon absorption model based on nonlinear absorption coefficient and saturation intensity. Such tailoring of optical nonlinear absorption in PicoGreen makes it a potential candidate for photonic application.

  9. π-Stacking between Casiopeinas® and DNA bases.

    PubMed

    Galindo-Murillo, Rodrigo; Hernandez-Lima, Joseelyne; González-Rendón, Mayra; Cortés-Guzmán, Fernando; Ruíz-Azuara, Lena; Moreno-Esparza, Rafael

    2011-08-28

    Casiopeínas® are copper complexes with the general formula [Cu(N-N)(N-O)]NO(3) and [Cu(N-N)(O-O)]NO(3) where N-N denotes a substituted bipyridine or phenanthroline, N-O indicates α-aminoacidate or peptide and O-O represents acetylacetonate or salicylaldehyde. This family of compounds has been evaluated in vitro and in vivo showing cytotoxic, genotoxic, and antineoplastic activity. The action mechanism is still not completely elucidated, but the possibility exists that these compounds interact with DNA by intercalation due to the aromatic moiety. In this work we found, using the properties of the electron density of a π-complex model base-Casiopeína®-base, that the stacking mechanism between Casiopeínas® and DNA bases is due to an electron density deficiency of the ligand of the Casiopeína® which is compensated for by an electron transfer from adenines by a π-π interaction.

  10. Communication: Electron ionization of DNA bases

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Rahman, M. A.; Krishnakumar, E., E-mail: ekkumar@tifr.res.in

    2016-04-28

    No reliable experimental data exist for the partial and total electron ionization cross sections for DNA bases, which are very crucial for modeling radiation damage in genetic material of living cell. We have measured a complete set of absolute partial electron ionization cross sections up to 500 eV for DNA bases for the first time by using the relative flow technique. These partial cross sections are summed to obtain total ion cross sections for all the four bases and are compared with the existing theoretical calculations and the only set of measured absolute cross sections. Our measurements clearly resolve themore » existing discrepancy between the theoretical and experimental results, thereby providing for the first time reliable numbers for partial and total ion cross sections for these molecules. The results on fragmentation analysis of adenine supports the theory of its formation in space.« less

  11. Compression of strings with approximate repeats.

    PubMed

    Allison, L; Edgoose, T; Dix, T I

    1998-01-01

    We describe a model for strings of characters that is loosely based on the Lempel Ziv model with the addition that a repeated substring can be an approximate match to the original substring; this is close to the situation of DNA, for example. Typically there are many explanations for a given string under the model, some optimal and many suboptimal. Rather than commit to one optimal explanation, we sum the probabilities over all explanations under the model because this gives the probability of the data under the model. The model has a small number of parameters and these can be estimated from the given string by an expectation-maximization (EM) algorithm. Each iteration of the EM algorithm takes O(n2) time and a few iterations are typically sufficient. O(n2) complexity is impractical for strings of more than a few tens of thousands of characters and a faster approximation algorithm is also given. The model is further extended to include approximate reverse complementary repeats when analyzing DNA strings. Tests include the recovery of parameter estimates from known sources and applications to real DNA strings.

  12. Exploring the Interactions of the Dietary Plant Flavonoids Fisetin and Naringenin with G-Quadruplex and Duplex DNA, Showing Contrasting Binding Behavior: Spectroscopic and Molecular Modeling Approaches.

    PubMed

    Bhattacharjee, Snehasish; Chakraborty, Sandipan; Sengupta, Pradeep K; Bhowmik, Sudipta

    2016-09-01

    Guanine-rich sequences have the propensity to fold into a four-stranded DNA structure known as a G-quadruplex (G4). G4 forming sequences are abundant in the promoter region of several oncogenes and become a key target for anticancer drug binding. Here we have studied the interactions of two structurally similar dietary plant flavonoids fisetin and naringenin with G4 as well as double stranded (duplex) DNA by using different spectroscopic and modeling techniques. Our study demonstrates the differential binding ability of the two flavonoids with G4 and duplex DNA. Fisetin more strongly interacts with parallel G4 structure than duplex DNA, whereas naringenin shows stronger binding affinity to duplex rather than G4 DNA. Molecular docking results also corroborate our spectroscopic results, and it was found that both of the ligands are stacked externally in the G4 DNA structure. C-ring planarity of the flavonoid structure appears to be a crucial factor for preferential G4 DNA recognition of flavonoids. The goal of this study is to explore the critical effects of small differences in the structure of closely similar chemical classes of such small molecules (flavonoids) which lead to the contrasting binding properties with the two different forms of DNA. The resulting insights may be expected to facilitate the designing of the highly selective G4 DNA binders based on flavonoid scaffolds.

  13. A Cross-Cancer Genetic Association Analysis of the DNA Repair and DNA Damage Signaling Pathways for Lung, Ovary, Prostate, Breast, and Colorectal Cancer.

    PubMed

    Scarbrough, Peter M; Weber, Rachel Palmieri; Iversen, Edwin S; Brhane, Yonathan; Amos, Christopher I; Kraft, Peter; Hung, Rayjean J; Sellers, Thomas A; Witte, John S; Pharoah, Paul; Henderson, Brian E; Gruber, Stephen B; Hunter, David J; Garber, Judy E; Joshi, Amit D; McDonnell, Kevin; Easton, Doug F; Eeles, Ros; Kote-Jarai, Zsofia; Muir, Kenneth; Doherty, Jennifer A; Schildkraut, Joellen M

    2016-01-01

    DNA damage is an established mediator of carcinogenesis, although genome-wide association studies (GWAS) have identified few significant loci. This cross-cancer site, pooled analysis was performed to increase the power to detect common variants of DNA repair genes associated with cancer susceptibility. We conducted a cross-cancer analysis of 60,297 single nucleotide polymorphisms, at 229 DNA repair gene regions, using data from the NCI Genetic Associations and Mechanisms in Oncology (GAME-ON) Network. Our analysis included data from 32 GWAS and 48,734 controls and 51,537 cases across five cancer sites (breast, colon, lung, ovary, and prostate). Because of the unavailability of individual data, data were analyzed at the aggregate level. Meta-analysis was performed using the Association analysis for SubSETs (ASSET) software. To test for genetic associations that might escape individual variant testing due to small effect sizes, pathway analysis of eight DNA repair pathways was performed using hierarchical modeling. We identified three susceptibility DNA repair genes, RAD51B (P < 5.09 × 10(-6)), MSH5 (P < 5.09 × 10(-6)), and BRCA2 (P = 5.70 × 10(-6)). Hierarchical modeling identified several pleiotropic associations with cancer risk in the base excision repair, nucleotide excision repair, mismatch repair, and homologous recombination pathways. Only three susceptibility loci were identified, which had all been previously reported. In contrast, hierarchical modeling identified several pleiotropic cancer risk associations in key DNA repair pathways. Results suggest that many common variants in DNA repair genes are likely associated with cancer susceptibility through small effect sizes that do not meet stringent significance testing criteria. ©2015 American Association for Cancer Research.

  14. Identifying sensitive windows for prenatal particulate air pollution exposure and mitochondrial DNA content in cord blood.

    PubMed

    Rosa, Maria José; Just, Allan C; Guerra, Marco Sánchez; Kloog, Itai; Hsu, Hsiao-Hsien Leon; Brennan, Kasey J; García, Adriana Mercado; Coull, Brent; Wright, Rosalind J; Téllez Rojo, Martha María; Baccarelli, Andrea A; Wright, Robert O

    2017-01-01

    Changes in mitochondrial DNA (mtDNA) can serve as a marker of cumulative oxidative stress (OS) due to the mitochondria's unique genome and relative lack of repair systems. In utero particulate matter ≤2.5μm (PM 2.5 ) exposure can enhance oxidative stress. Our objective was to identify sensitive windows to predict mtDNA damage experienced in the prenatal period due to PM 2.5 exposure using mtDNA content measured in cord blood. Women affiliated with the Mexican social security system were recruited during pregnancy in the Programming Research in Obesity, Growth, Environment and Social Stressors (PROGRESS) study. Mothers with cord blood collected at delivery and complete covariate data were included (n=456). Mothers' prenatal daily exposure to PM 2.5 was estimated using a satellite-based spatio-temporally resolved prediction model and place of residence during pregnancy. DNA was extracted from umbilical cord leukocytes. Quantitative real-time polymerase chain reaction (qPCR) was used to determine mtDNA content. A distributive lag regression model (DLM) incorporating weekly averages of daily PM 2.5 predictions was constructed to plot the association between exposure and OS over the length of pregnancy. In models that included child's sex, mother's age at delivery, prenatal environmental tobacco smoke exposure, birth year, maternal education, and assay batch, we found significant associations between higher PM 2.5 exposure during late pregnancy (35-40weeks) and lower mtDNA content in cord blood. Increased PM 2.5 during a specific prenatal window in the third trimester was associated with decreased mtDNA content suggesting heightened sensitivity to PM-induced OS during this life stage. Copyright © 2016 Elsevier Ltd. All rights reserved.

  15. A biokinetic model to describe consequences of inhibition/stimulation in DNA-proofreading and repair-1. Development of the model.

    PubMed

    Haschke, H

    2001-10-21

    A biokinetic model is described which deals with the mathematical consequences of the inhibition or stimulation of DNA proofreading. It demonstrates the development of the number of DNA mismatch-dependent cells (e.g. cells with a malignant phenotype), where such mismatches arise by the in situ interaction of various substances with nucleotides of the DNA. The model can test for consequences by a logic gating on an "if-then" type of analysis in relation to the separate and consecutive processes of proofreading and repair. In particular, the consequences are considered in cases where either (i) the efficacy of proofreading and repair are reduced/prevented (inhibited) or (ii) are increased by some form of stimulation. On the chosen kinetic parameters, the model is accessible to manipulation as new data arising from further investigations become available and are introduced. The model is based on recently published data which show that an increased "mutant fraction" (see note on terms) arises in DNA replication when intracellular nucleotide pools show "asymmetries" (see note on terms). Extraordinarily high mutant fractions can be predicted/have been recorded in the presence of proofreading inhibitors. The model expresses data in mathematical terms of the competition between the development of mismatch-dependent cells and those with authentic genetic information. (Feedback and metastasis-effects and those of wild-type replicates are included.) A computerized (numerical) integration of the corresponding set of differential equations is offered. (A diskette with the program CANCER.xls is available upon request.) Copyright 2001 Academic Press

  16. DNA bases assembled on the Au(110)/electrolyte interface: a combined experimental and theoretical study.

    PubMed

    Salvatore, Princia; Nazmutdinov, Renat R; Ulstrup, Jens; Zhang, Jingdong

    2015-02-19

    Among the low-index single-crystal gold surfaces, the Au(110) surface is the most active toward molecular adsorption and the one with fewest electrochemical adsorption data reported. Cyclic voltammetry (CV), electrochemically controlled scanning tunneling microscopy (EC-STM), and density functional theory (DFT) calculations have been employed in the present study to address the adsorption of the four nucleobases adenine (A), cytosine (C), guanine (G), and thymine (T), on the Au(110)-electrode surface. Au(110) undergoes reconstruction to the (1 × 3) surface in electrochemical environment, accompanied by a pair of strong voltammetry peaks in the double-layer region in acid solutions. Adsorption of the DNA bases gives featureless voltammograms with lower double-layer capacitance, suggesting that all the bases are chemisorbed on the Au(110) surface. Further investigation of the surface structures of the adlayers of the four DNA bases by EC-STM disclosed lifting of the Au(110) reconstruction, specific molecular packing in dense monolayers, and pH dependence of the A and G adsorption. DFT computations based on a cluster model for the Au(110) surface were performed to investigate the adsorption energy and geometry of the DNA bases in different adsorbate orientations. The optimized geometry is further used to compute models for STM images which are compared with the recorded STM images. This has provided insight into the physical nature of the adsorption. The specific orientations of A, C, G, and T on Au(110) and the nature of the physical adsorbate/surface interaction based on the combination of the experimental and theoretical studies are proposed, and differences from nucleobase adsorption on Au(111)- and Au(100)-electrode surfaces are discussed.

  17. Chemical repair of base lesions, AP-sites, and strand breaks on plasmid DNA in dilute aqueous solution by ascorbic acid

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hata, Kuniki; Advanced Science Research Center, Japan Atomic Energy Agency, 2-4 Shirakatashirane, Tokai-mura, Naka-gun, Ibaraki 319-1195; Urushibara, Ayumi

    Highlights: •We report a novel mechanism of radiation protection of DNA by chemical activity of ascorbic acid. •The “chemical repair” of DNA damage was revealed using biochemical assay and chemical kinetics analysis. •We found that ascorbic acid significantly repairs precursors of nucleobase lesions and abasic sites. •However, ascorbic acid seldom repairs precursors of DNA-strand breaks. -- Abstract: We quantified the damage yields produced in plasmid DNA by γ-irradiation in the presence of low concentrations (10–100 μM) of ascorbic acid, which is a major antioxidant in living systems, to clarify whether it chemically repairs radiation damage in DNA. The yield ofmore » DNA single strand breaks induced by irradiation was analyzed with agarose gel electrophoresis as conformational changes in closed circular plasmids. Base lesions and abasic sites were also observed as additional conformational changes by treating irradiated samples with glycosylase proteins. By comparing the suppression efficiencies to the induction of each DNA lesion, in addition to scavenging of the OH radicals derived from water radiolysis, it was found that ascorbic acid promotes the chemical repair of precursors of AP-sites and base lesions more effectively than those of single strand breaks. We estimated the efficiency of the chemical repair of each lesion using a kinetic model. Approximately 50–60% of base lesions and AP-sites were repaired by 10 μM ascorbic acid, although strand breaks were largely unrepaired by ascorbic acid at low concentrations. The methods in this study will provide a route to understanding the mechanistic aspects of antioxidant activity in living systems.« less

  18. Type III restriction-modification enzymes: a historical perspective.

    PubMed

    Rao, Desirazu N; Dryden, David T F; Bheemanaik, Shivakumara

    2014-01-01

    Restriction endonucleases interact with DNA at specific sites leading to cleavage of DNA. Bacterial DNA is protected from restriction endonuclease cleavage by modifying the DNA using a DNA methyltransferase. Based on their molecular structure, sequence recognition, cleavage position and cofactor requirements, restriction-modification (R-M) systems are classified into four groups. Type III R-M enzymes need to interact with two separate unmethylated DNA sequences in inversely repeated head-to-head orientations for efficient cleavage to occur at a defined location (25-27 bp downstream of one of the recognition sites). Like the Type I R-M enzymes, Type III R-M enzymes possess a sequence-specific ATPase activity for DNA cleavage. ATP hydrolysis is required for the long-distance communication between the sites before cleavage. Different models, based on 1D diffusion and/or 3D-DNA looping, exist to explain how the long-distance interaction between the two recognition sites takes place. Type III R-M systems are found in most sequenced bacteria. Genome sequencing of many pathogenic bacteria also shows the presence of a number of phase-variable Type III R-M systems, which play a role in virulence. A growing number of these enzymes are being subjected to biochemical and genetic studies, which, when combined with ongoing structural analyses, promise to provide details for mechanisms of DNA recognition and catalysis.

  19. Structure of a DNA glycosylase that unhooks interstrand cross-links

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Mullins, Elwood A.; Warren, Garrett M.; Bradley, Noah P.

    DNA glycosylases are important editing enzymes that protect genomic stability by excising chemically modified nucleobases that alter normal DNA metabolism. These enzymes have been known only to initiate base excision repair of small adducts by extrusion from the DNA helix. However, recent reports have described both vertebrate and microbial DNA glycosylases capable of unhooking highly toxic interstrand cross-links (ICLs) and bulky minor groove adducts normally recognized by Fanconi anemia and nucleotide excision repair machinery, although the mechanisms of these activities are unknown. Here we report the crystal structure of Streptomyces sahachiroi AlkZ (previously Orf1), a bacterial DNA glycosylase that protectsmore » its host by excising ICLs derived from azinomycin B (AZB), a potent antimicrobial and antitumor genotoxin. AlkZ adopts a unique fold in which three tandem winged helix-turn-helix motifs scaffold a positively charged concave surface perfectly shaped for duplex DNA. Through mutational analysis, we identified two glutamine residues and a β-hairpin within this putative DNA-binding cleft that are essential for catalytic activity. Additionally, we present a molecular docking model for how this active site can unhook either or both sides of an AZB ICL, providing a basis for understanding the mechanisms of base excision repair of ICLs. Given the prevalence of this protein fold in pathogenic bacteria, this work also lays the foundation for an emerging role of DNA repair in bacteria-host pathogenesis.« less

  20. Base pairing among three cis-acting sequences contributes to template switching during hepadnavirus reverse transcription

    PubMed Central

    Liu, Ning; Tian, Ru; Loeb, Daniel D.

    2003-01-01

    Synthesis of the relaxed-circular (RC) DNA genome of hepadnaviruses requires two template switches during plus-strand DNA synthesis: primer translocation and circularization. Although primer translocation and circularization use different donor and acceptor sequences, and are distinct temporally, they share the common theme of switching from one end of the minus-strand template to the other end. Studies of duck hepatitis B virus have indicated that, in addition to the donor and acceptor sequences, three other cis-acting sequences, named 3E, M, and 5E, are required for the synthesis of RC DNA by contributing to primer translocation and circularization. The mechanism by which 3E, M, and 5E act was not known. We present evidence that these sequences function by base pairing with each other within the minus-strand template. 3E base-pairs with one portion of M (M3) and 5E base-pairs with an adjacent portion of M (M5). We found that disrupting base pairing between 3E and M3 and between 5E and M5 inhibited primer translocation and circularization. More importantly, restoring base pairing with mutant sequences restored the production of RC DNA. These results are consistent with the model that, within duck hepatitis B virus capsids, the ends of the minus-strand template are juxtaposed via base pairing to facilitate the two template switches during plus-strand DNA synthesis. PMID:12578983

  1. Human DNA ligase III recognizes DNA ends by dynamic switching between two DNA-bound states.

    PubMed

    Cotner-Gohara, Elizabeth; Kim, In-Kwon; Hammel, Michal; Tainer, John A; Tomkinson, Alan E; Ellenberger, Tom

    2010-07-27

    Human DNA ligase III has essential functions in nuclear and mitochondrial DNA replication and repair and contains a PARP-like zinc finger (ZnF) that increases the extent of DNA nick joining and intermolecular DNA ligation, yet the bases for ligase III specificity and structural variation among human ligases are not understood. Here combined crystal structure and small-angle X-ray scattering results reveal dynamic switching between two nick-binding components of ligase III: the ZnF-DNA binding domain (DBD) forms a crescent-shaped surface used for DNA end recognition which switches to a ring formed by the nucleotidyl transferase (NTase) and OB-fold (OBD) domains for catalysis. Structural and mutational analyses indicate that high flexibility and distinct DNA binding domain features in ligase III assist both nick sensing and the transition from nick sensing by the ZnF to nick joining by the catalytic core. The collective results support a "jackknife model" in which the ZnF loads ligase III onto nicked DNA and conformational changes deliver DNA into the active site. This work has implications for the biological specificity of DNA ligases and functions of PARP-like zinc fingers.

  2. Probing structure and dynamics of DNA with 2-aminopurine: effects of local environment on fluorescence.

    PubMed

    Rachofsky, E L; Osman, R; Ross, J B

    2001-01-30

    2-Aminopurine (2AP) is an analogue of adenine that has been utilized widely as a fluorescence probe of protein-induced local conformational changes in DNA. Within a DNA strand, this fluorophore demonstrates characteristic decreases in quantum yield and emission decay lifetime that vary sensitively with base sequence, temperature, and helix conformation but that are accompanied by only small changes in emission wavelength. However, the molecular interactions that give rise to these spectroscopic changes have not been established. To develop a molecular model for interpreting the fluorescence measurements, we have investigated the effects of environmental polarity, hydrogen bonding, and the purine and pyrimidine bases of DNA on the emission energy, quantum yield, and intensity decay kinetics of 2AP in simple model systems. The effects of environmental polarity were examined in a series of solvents of varying dielectric constant, and hydrogen bonding was investigated in binary mixtures of water with 1,4-dioxane or N,N-dimethylformamide (DMF). The effects of the purine and pyrimidine bases were studied by titrating 2AP deoxyriboside (d2AP) with the nucleosides adenosine (rA), cytidine (rC), guanosine (rG), and deoxythymidine (dT), and the nucleoside triphosphates ATP and GTP in neutral aqueous solution. The nucleosides and NTPs each quench the fluorescence of d2AP by a combination of static (affecting only the quantum yield) and dynamic (affecting both the quantum yield and the lifetime, proportionately) mechanisms. The peak wavelength and shape of the emission spectrum are not altered by either of these effects. The static quenching is saturable and has half-maximal effect at approximately 20 mM nucleoside or NTP, consistent with an aromatic stacking interaction. The rate constant for dynamic quenching is near the diffusion limit for collisional interaction (k(q) approximately 2 x 10(9) M(-1) s(-1)). Neither of these effects varies significantly between the various nucleosides and NTPs studied. In contrast, hydrogen bonding with water was observed to have a negligible effect on the emission wavelength, fluorescence quantum yield, or lifetime of 2AP in either dioxane or DMF. In nonpolar solvents, the fluorescence lifetime and quantum yield decrease dramatically, accompanied by significant shifts in the emission spectrum to shorter wavelengths. However, these effects of polarity do not coincide with the observed emission wavelength-independent quenching of 2AP fluorescence in DNA. Therefore, we conclude that the fluorescence quenching of 2AP in DNA arises from base stacking and collisions with neighboring bases only but is insensitive to base-pairing or other hydrogen bonding interactions. These results implicate both structural and dynamic properties of DNA in quenching of 2AP and constitute a simple model within which the fluorescence changes induced by protein-DNA binding or other perturbations may be interpreted.

  3. Effect of Watson-Crick and Hoogsteen base pairing on the conformational stability of C8-phenoxyl-2'-deoxyguanosine adducts.

    PubMed

    Millen, Andrea L; Churchill, Cassandra D M; Manderville, Richard A; Wetmore, Stacey D

    2010-10-14

    Bulky DNA addition products (adducts) formed through attack at the C8 site of guanine can adopt the syn orientation about the glycosidic bond due to changes in conformational stability or hydrogen-bonding preferences directly arising from the bulky group. Indeed, the bulky substituent may improve the stability of (non-native) Hoogsteen pairs. Therefore, such adducts often result in mutations upon DNA replication. This work examines the hydrogen-bonded pairs between the Watson-Crick and Hoogsteen faces of the ortho or para C8-phenoxyl-2'-deoxyguanosine adduct and each natural (undamaged) nucleobase with the goal to clarify the conformational preference of this type of damage, as well as provide insight into the likelihood of subsequent mutation events. B3LYP/6-311+G(2df,p)//B3LYP/6-31G(d) hydrogen-bond strengths were determined using both nucleobase and nucleoside models for adduct pairs, as well as the corresponding complexes involving natural 2'-deoxyguanosine. In addition to the magnitude of the binding strengths, the R(C1'···C1') distances and ∠(N9C1'C1') angles, as well as the degree of propeller-twist and buckle distortions, were carefully compared to the values observed in natural DNA strands. Due to structural changes in the adduct monomer upon inclusion of the sugar moiety, the monomer deformation energy significantly affects the relative hydrogen-bond strengths calculated with the nucleobase and nucleoside models. Therefore, we recommend the use of at least a nucleoside model to accurately evaluate hydrogen-bond strengths of base pairs involving flexible, bulky nucleobase adducts. Our results also emphasize the importance of considering both the magnitude of the hydrogen-bond strength and the structure of the base pair when predicting the preferential binding patterns of nucleobases. Using our best models, we conclude that the Watson-Crick face of the ortho phenoxyl adduct forms significantly more stable complexes than the Hoogsteen face, which implies that the anti orientation of the damaged base will be favored by hydrogen bonding in DNA helices. Additionally, regardless of the hydrogen-bonding face involved, cytosine forms the most stable base pair with the ortho adduct, which implies that misincorporation due to this type of damage is unlikely. Similarly, cytosine is the preferred binding partner for the Watson-Crick face of the para adduct. However, Hoogsteen interactions with the para adduct are stronger than those with natural 2'-deoxyguanosine or the ortho adduct, and this form of damage binds with nearly equal stability to both cytosine and guanine in the Hoogsteen orientation. Therefore, the para adduct may adopt multiple orientations in DNA helices and potentially cause mutations by forming pairs with different natural bases. Models of oligonucleotide duplexes must be used in future work to further evaluate other factors (stacking, major groove contacts) that may influence the conformation and binding preference of these adducts in DNA helices.

  4. Explicit ions/implicit water generalized Born model for nucleic acids

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tolokh, Igor S.; Thomas, Dennis G.; Onufriev, Alexey V.

    Ion atmosphere around highly charged nucleic acid molecules plays a significant role in their dynamics, structure and interactions. Here we utilized the implicit solvent framework to develop a model for the explicit treatment of ions interacting with nucleic acid molecules. The proposed explicit ions/implicit water model is based on a significantly modified generalized Born (GB) model, and utilizes a non-standard approach to defining the solute/solvent dielectric boundary. Specifically, the model includes modifications to the GB interaction terms for the case of multiple interacting solutes – disconnected dielectric boundary around the solute-ion or ion-ion pairs. Fully analytical description of all energymore » components for charge-charge interactions is provided. The effectiveness of the approach is demonstrated by calculating the potential of mean force (PMF) for Na+-Cl− ion pair and by carrying out a set of Monte Carlo (MC) simulations of mono- and trivalent ions interacting with DNA and RNA duplexes. The monovalent (Na+) and trivalent (CoHex3+) counterion distributions predicted by the model are in close quantitative agreement with all-atom explicit water molecular dynamics simulations used as reference. Expressed in the units of energy, the maximum deviations of local ion concentrations from the reference are within kBT. The proposed explicit ions/implicit water GB model is able to resolve subtle features and differences of CoHex distributions around DNA and RNA duplexes. These features include preferential CoHex binding inside the major groove of RNA duplex, in contrast to CoHex biding at the "external" surface of the sugar-phosphate backbone of DNA duplex; these differences in the counterion binding patters were shown earlier to be responsible for the observed drastic differences in condensation propensities between short DNA and RNA duplexes. MC simulations of CoHex ions interacting with homopolymeric poly(dA·dT) DNA duplex with modified (de-methylated) and native Thymine bases are used to explore the physics behind CoHex-Thymine interactions. The simulations suggest that the ion desolvation penalty due to proximity to the low dielectric volume of the methyl group can contribute significantly to CoHex-Thymine interactions. Compared to the steric repulsion between the ion and the methyl group, the desolvation penalty interaction has a longer range, and may be important to consider in the context of methylation effects on DNA condensation.« less

  5. Explicit ions/implicit water generalized Born model for nucleic acids

    NASA Astrophysics Data System (ADS)

    Tolokh, Igor S.; Thomas, Dennis G.; Onufriev, Alexey V.

    2018-05-01

    The ion atmosphere around highly charged nucleic acid molecules plays a significant role in their dynamics, structure, and interactions. Here we utilized the implicit solvent framework to develop a model for the explicit treatment of ions interacting with nucleic acid molecules. The proposed explicit ions/implicit water model is based on a significantly modified generalized Born (GB) model and utilizes a non-standard approach to define the solute/solvent dielectric boundary. Specifically, the model includes modifications to the GB interaction terms for the case of multiple interacting solutes—disconnected dielectric boundary around the solute-ion or ion-ion pairs. A fully analytical description of all energy components for charge-charge interactions is provided. The effectiveness of the approach is demonstrated by calculating the potential of mean force for Na+-Cl- ion pair and by carrying out a set of Monte Carlo (MC) simulations of mono- and trivalent ions interacting with DNA and RNA duplexes. The monovalent (Na+) and trivalent (CoHex3+) counterion distributions predicted by the model are in close quantitative agreement with all-atom explicit water molecular dynamics simulations used as reference. Expressed in the units of energy, the maximum deviations of local ion concentrations from the reference are within kBT. The proposed explicit ions/implicit water GB model is able to resolve subtle features and differences of CoHex distributions around DNA and RNA duplexes. These features include preferential CoHex binding inside the major groove of the RNA duplex, in contrast to CoHex biding at the "external" surface of the sugar-phosphate backbone of the DNA duplex; these differences in the counterion binding patters were earlier shown to be responsible for the observed drastic differences in condensation propensities between short DNA and RNA duplexes. MC simulations of CoHex ions interacting with the homopolymeric poly(dA.dT) DNA duplex with modified (de-methylated) and native thymine bases are used to explore the physics behind CoHex-thymine interactions. The simulations suggest that the ion desolvation penalty due to proximity to the low dielectric volume of the methyl group can contribute significantly to CoHex-thymine interactions. Compared to the steric repulsion between the ion and the methyl group, the desolvation penalty interaction has a longer range and may be important to consider in the context of methylation effects on DNA condensation.

  6. DNA damage may drive nucleosomal reorganization to facilitate damage detection

    NASA Astrophysics Data System (ADS)

    LeGresley, Sarah E.; Wilt, Jamie; Antonik, Matthew

    2014-03-01

    One issue in genome maintenance is how DNA repair proteins find lesions at rates that seem to exceed diffusion-limited search rates. We propose a phenomenon where DNA damage induces nucleosomal rearrangements which move lesions to potential rendezvous points in the chromatin structure. These rendezvous points are the dyad and the linker DNA between histones, positions in the chromatin which are more likely to be accessible by repair proteins engaged in a random search. The feasibility of this mechanism is tested by considering the statistical mechanics of DNA containing a single lesion wrapped onto the nucleosome. We consider lesions which make the DNA either more flexible or more rigid by modeling the lesion as either a decrease or an increase in the bending energy. We include this energy in a partition function model of nucleosome breathing. Our results indicate that the steady state for a breathing nucleosome will most likely position the lesion at the dyad or in the linker, depending on the energy of the lesion. A role for DNA binding proteins and chromatin remodelers is suggested based on their ability to alter the mechanical properties of the DNA and DNA-histone binding, respectively. We speculate that these positions around the nucleosome potentially serve as rendezvous points where DNA lesions may be encountered by repair proteins which may be sterically hindered from searching the rest of the nucleosomal DNA. The strength of the repositioning is strongly dependent on the structural details of the DNA lesion and the wrapping and breathing of the nucleosome. A more sophisticated evaluation of this proposed mechanism will require detailed information about breathing dynamics, the structure of partially wrapped nucleosomes, and the structural properties of damaged DNA.

  7. Controlling the surface‐mediated release of DNA using ‘mixed multilayers’

    PubMed Central

    Appadoo, Visham; Carter, Matthew C. D.

    2016-01-01

    Abstract We report the design of erodible ‘mixed multilayer’ coatings fabricated using plasmid DNA and combinations of both hydrolytically degradable and charge‐shifting cationic polymer building blocks. Films fabricated layer‐by‐layer using combinations of a model poly(β‐amino ester) (polymer 1) and a model charge‐shifting polymer (polymer 2) exhibited DNA release profiles that were substantially different than those assembled using DNA and either polymer 1 or polymer 2 alone. In addition, the order in which layers of these two cationic polymers were deposited during assembly had a profound impact on DNA release profiles when these materials were incubated in physiological buffer. Mixed multilayers ∼225 nm thick fabricated by depositing layers of polymer 1/DNA onto films composed of polymer 2/DNA released DNA into solution over ∼60 days, with multi‐phase release profiles intermediate to and exhibiting some general features of polymer 1/DNA or polymer 2/DNA films (e.g., a period of rapid release, followed by a more extended phase). In sharp contrast, ‘inverted’ mixed multilayers fabricated by depositing layers of polymer 2/DNA onto films composed of polymer 1/DNA exhibited release profiles that were almost completely linear over ∼60‐80 days. These and other results are consistent with substantial interdiffusion and commingling (or mixing) among the individual components of these compound materials. Our results reveal this mixing to lead to new, unanticipated, and useful release profiles and provide guidance for the design of polymer‐based coatings for the local, surface‐mediated delivery of DNA from the surfaces of topologically complex interventional devices, such as intravascular stents, with predictable long‐term release profiles. PMID:27981243

  8. LuxGLM: a probabilistic covariate model for quantification of DNA methylation modifications with complex experimental designs

    PubMed Central

    Äijö, Tarmo; Yue, Xiaojing; Rao, Anjana; Lähdesmäki, Harri

    2016-01-01

    Motivation: 5-methylcytosine (5mC) is a widely studied epigenetic modification of DNA. The ten-eleven translocation (TET) dioxygenases oxidize 5mC into oxidized methylcytosines (oxi-mCs): 5-hydroxymethylcytosine (5hmC), 5-formylcytosine (5fC) and 5-carboxylcytosine (5caC). DNA methylation modifications have multiple functions. For example, 5mC is shown to be associated with diseases and oxi-mC species are reported to have a role in active DNA demethylation through 5mC oxidation and DNA repair, among others, but the detailed mechanisms are poorly understood. Bisulphite sequencing and its various derivatives can be used to gain information about all methylation modifications at single nucleotide resolution. Analysis of bisulphite based sequencing data is complicated due to the convoluted read-outs and experiment-specific variation in biochemistry. Moreover, statistical analysis is often complicated by various confounding effects. How to analyse 5mC and oxi-mC data sets with arbitrary and complex experimental designs is an open and important problem. Results: We propose the first method to quantify oxi-mC species with arbitrary covariate structures from bisulphite based sequencing data. Our probabilistic modeling framework combines a previously proposed hierarchical generative model for oxi-mC-seq data and a general linear model component to account for confounding effects. We show that our method provides accurate methylation level estimates and accurate detection of differential methylation when compared with existing methods. Analysis of novel and published data gave insights into to the demethylation of the forkhead box P3 (Foxp3) locus during the induced T regulatory cell differentiation. We also demonstrate how our covariate model accurately predicts methylation levels of the Foxp3 locus. Collectively, LuxGLM method improves the analysis of DNA methylation modifications, particularly for oxi-mC species. Availability and Implementation: An implementation of the proposed method is available under MIT license at https://github.org/tare/LuxGLM/ Contact: taijo@simonsfoundation.org or harri.lahdesmaki@aalto.fi Supplementary information: Supplementary data are available at Bioinformatics online. PMID:27587669

  9. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Egli, Martin; Pallan, Pradeep S.; Pattanayek, Rekha

    An experimental rationalization of the structure type encountered in DNA and RNA by systematically investigating the chemical and physical properties of alternative nucleic acids has identified systems with a variety of sugar-phosphate backbones that are capable of Watson-Crick base pairing and in some cases cross-pairing with the natural nucleic acids. The earliest among the model systems tested to date, (4{prime} {yields} 6{prime})-linked oligo(2{prime},3{prime}-dideoxy-{beta}-d-glucopyranosyl)nucleotides or homo-DNA, shows stable self-pairing, but the pairing rules for the four natural bases are not the same as those in DNA. However, a complete interpretation and understanding of the properties of the hexapyranosyl (4{prime} {yields} 6{prime})more » family of nucleic acids has been impeded until now by the lack of detailed 3D-structural data. We have determined the crystal structure of a homo-DNA octamer. It reveals a weakly twisted right-handed duplex with a strong inclination between the hexose-phosphate backbones and base-pair axes, and highly irregular values for helical rise and twist at individual base steps. The structure allows a rationalization of the inability of allo-, altro-, and glucopyranosyl-based oligonucleotides to form stable pairing systems.« less

  10. Characterization of DNA-protein interactions using high-throughput sequencing data from pulldown experiments

    NASA Astrophysics Data System (ADS)

    Moreland, Blythe; Oman, Kenji; Curfman, John; Yan, Pearlly; Bundschuh, Ralf

    Methyl-binding domain (MBD) protein pulldown experiments have been a valuable tool in measuring the levels of methylated CpG dinucleotides. Due to the frequent use of this technique, high-throughput sequencing data sets are available that allow a detailed quantitative characterization of the underlying interaction between methylated DNA and MBD proteins. Analyzing such data sets, we first found that two such proteins cannot bind closer to each other than 2 bp, consistent with structural models of the DNA-protein interaction. Second, the large amount of sequencing data allowed us to find rather weak but nevertheless clearly statistically significant sequence preferences for several bases around the required CpG. These results demonstrate that pulldown sequencing is a high-precision tool in characterizing DNA-protein interactions. This material is based upon work supported by the National Science Foundation under Grant No. DMR-1410172.

  11. An electrochemical sensing platform based on local repression of electrolyte diffusion for single-step, reagentless, sensitive detection of a sequence-specific DNA-binding protein.

    PubMed

    Zhang, Yun; Liu, Fang; Nie, Jinfang; Jiang, Fuyang; Zhou, Caibin; Yang, Jiani; Fan, Jinlong; Li, Jianping

    2014-05-07

    In this paper, we report for the first time an electrochemical biosensor for single-step, reagentless, and picomolar detection of a sequence-specific DNA-binding protein using a double-stranded, electrode-bound DNA probe terminally modified with a redox active label close to the electrode surface. This new methodology is based upon local repression of electrolyte diffusion associated with protein-DNA binding that leads to reduction of the electrochemical response of the label. In the proof-of-concept study, the resulting electrochemical biosensor was quantitatively sensitive to the concentrations of the TATA binding protein (TBP, a model analyte) ranging from 40 pM to 25.4 nM with an estimated detection limit of ∼10.6 pM (∼80 to 400-fold improvement on the detection limit over previous electrochemical analytical systems).

  12. Posterior Predictive Bayesian Phylogenetic Model Selection

    PubMed Central

    Lewis, Paul O.; Xie, Wangang; Chen, Ming-Hui; Fan, Yu; Kuo, Lynn

    2014-01-01

    We present two distinctly different posterior predictive approaches to Bayesian phylogenetic model selection and illustrate these methods using examples from green algal protein-coding cpDNA sequences and flowering plant rDNA sequences. The Gelfand–Ghosh (GG) approach allows dissection of an overall measure of model fit into components due to posterior predictive variance (GGp) and goodness-of-fit (GGg), which distinguishes this method from the posterior predictive P-value approach. The conditional predictive ordinate (CPO) method provides a site-specific measure of model fit useful for exploratory analyses and can be combined over sites yielding the log pseudomarginal likelihood (LPML) which is useful as an overall measure of model fit. CPO provides a useful cross-validation approach that is computationally efficient, requiring only a sample from the posterior distribution (no additional simulation is required). Both GG and CPO add new perspectives to Bayesian phylogenetic model selection based on the predictive abilities of models and complement the perspective provided by the marginal likelihood (including Bayes Factor comparisons) based solely on the fit of competing models to observed data. [Bayesian; conditional predictive ordinate; CPO; L-measure; LPML; model selection; phylogenetics; posterior predictive.] PMID:24193892

  13. Large exon size does not limit splicing in vivo.

    PubMed

    Chen, I T; Chasin, L A

    1994-03-01

    Exon sizes in vertebrate genes are, with a few exceptions, limited to less than 300 bases. It has been proposed that this limitation may derive from the exon definition model of splice site recognition. In this model, a downstream donor site enhances splicing at the upstream acceptor site of the same exon. This enhancement may require contact between factors bound to each end of the exon; an exon size limitation would promote such contact. To test the idea that proximity was required for exon definition, we inserted random DNA fragments from Escherichia coli into a central exon in a three-exon dihydrofolate reductase minigene and tested whether the expanded exons were efficiently spliced. DNA from a plasmid library of expanded minigenes was used to transfect a CHO cell deletion mutant lacking the dhfr locus. PCR analysis of DNA isolated from the pooled stable cotransfectant populations displayed a range of DNA insert sizes from 50 to 1,500 nucleotides. A parallel analysis of the RNA from this population by reverse transcription followed by PCR showed a similar size distribution. Central exons as large as 1,400 bases could be spliced into mRNA. We also tested individual plasmid clones containing exon inserts of defined sizes. The largest exon included in mRNA was 1,200 bases in length, well above the 300-base limit implied by the survey of naturally occurring exons. We conclude that a limitation in exon size is not part of the exon definition mechanism.

  14. Investigation of sliding DNA clamp dynamics by single-molecule fluorescence, mass spectrometry and structure-based modeling

    PubMed Central

    Gadkari, Varun V; Harvey, Sophie R; Raper, Austin T; Chu, Wen-Ting; Wang, Jin; Wysocki, Vicki H; Suo, Zucai

    2018-01-01

    Abstract Proliferating cell nuclear antigen (PCNA) is a trimeric ring-shaped clamp protein that encircles DNA and interacts with many proteins involved in DNA replication and repair. Despite extensive structural work to characterize the monomeric, dimeric, and trimeric forms of PCNA alone and in complex with interacting proteins, no structure of PCNA in a ring-open conformation has been published. Here, we use a multidisciplinary approach, including single-molecule Förster resonance energy transfer (smFRET), native ion mobility-mass spectrometry (IM-MS), and structure-based computational modeling, to explore the conformational dynamics of a model PCNA from Sulfolobus solfataricus (Sso), an archaeon. We found that Sso PCNA samples ring-open and ring-closed conformations even in the absence of its clamp loader complex, replication factor C, and transition to the ring-open conformation is modulated by the ionic strength of the solution. The IM-MS results corroborate the smFRET findings suggesting that PCNA dynamics are maintained in the gas phase and further establishing IM-MS as a reliable strategy to investigate macromolecular motions. Our molecular dynamic simulations agree with the experimental data and reveal that ring-open PCNA often adopts an out-of-plane left-hand geometry. Collectively, these results implore future studies to define the roles of PCNA dynamics in DNA loading and other PCNA-mediated interactions. PMID:29529283

  15. Development of an intradermal DNA vaccine delivery strategy to achieve single-dose immunity against respiratory syncytial virus.

    PubMed

    Smith, Trevor R F; Schultheis, Katherine; Morrow, Matthew P; Kraynyak, Kimberly A; McCoy, Jay R; Yim, Kevin C; Muthumani, Karuppiah; Humeau, Laurent; Weiner, David B; Sardesai, Niranjan Y; Broderick, Kate E

    2017-05-15

    Respiratory syncytial virus (RSV) is a massive medical burden in infants, children and the elderly worldwide, and an effective, safe RSV vaccine remains an unmet need. Here we assess a novel vaccination strategy based on the intradermal delivery of a SynCon® DNA-based vaccine encoding engineered RSV-F antigen using a surface electroporation device (SEP) to target epidermal cells, in clinically relevant experimental models. We demonstrate the ability of this strategy to elicit robust immune responses. Importantly we demonstrate complete resistance to pulmonary infection at a single low dose of vaccine in the cotton rat RSV/A challenge model. In contrast to the formalin-inactivated RSV (FI-RSV) vaccine, there was no enhanced lung inflammation upon virus challenge after DNA vaccination. In summary the data presented outline the pre-clinical development of a highly efficacious, tolerable and safe non-replicating vaccine delivery strategy. Copyright © 2017. Published by Elsevier Ltd.

  16. Paramagnetic 19F NMR and Electrospray Ionization Mass Spectrometric Studies of Substituted Pyridine Complexes of Chromium(III): Models for Potential Use of 19F NMR to Probe Cr(III)-Nucleotide Interaction1

    PubMed Central

    Rhodes, Nicholas R.; Belmore, Ken; Cassady, Carolyn J.; Vincent, John B.

    2013-01-01

    The synthesis and characterization of chromium basic carboxylate complexes, [Cr3(O2CR)6L3]+, containing trifluoroacetate, 3-fluoropyridine, 3-trifluoromethylpyridine, and 4-trifluoromethylpyridine are described. The substituted pyridine ligands are used as models of DNA bases to determine whether 19F NMR would be a potentially useful probe of the binding of Cr3+ to DNA. The 19F NMR resonances of the coordinated ligands, while broadened by delocalization of unpaired electron density from the S=3/2 chromic centers, are readily discernable, and the contact shifts are of sufficient magnitude that the signals from coordinated and free ligands can easily be differentiated. Thus, 19F NMR appears to be a potentially useful probe of the binding of Cr3+ to DNA containing F-labeled bases. Additionally, electrospray MS is shown to be a convenient method to establish the identity of chromium basic carboxylate assemblies. PMID:24222929

  17. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Shin, J; Park, S; Jeong, J

    Purpose: In particle therapy and radiobiology, the investigation of mechanisms leading to the death of target cancer cells induced by ionising radiation is an active field of research. Recently, several studies based on Monte Carlo simulation codes have been initiated in order to simulate physical interactions of ionising particles at cellular scale and in DNA. Geant4-DNA is the one of them; it is an extension of the general purpose Geant4 Monte Carlo simulation toolkit for the simulation of physical interactions at sub-micrometre scale. In this study, we present Geant4-DNA Monte Carlo simulations for the prediction of DNA strand breakage usingmore » a geometrical modelling of DNA structure. Methods: For the simulation of DNA strand breakage, we developed a specific DNA geometrical structure. This structure consists of DNA components, such as the deoxynucleotide pairs, the DNA double helix, the nucleosomes and the chromatin fibre. Each component is made of water because the cross sections models currently available in Geant4-DNA for protons apply to liquid water only. Also, at the macroscopic-scale, protons were generated with various energies available for proton therapy at the National Cancer Center, obtained using validated proton beam simulations developed in previous studies. These multi-scale simulations were combined for the validation of Geant4-DNA in radiobiology. Results: In the double helix structure, the deposited energy in a strand allowed to determine direct DNA damage from physical interaction. In other words, the amount of dose and frequency of damage in microscopic geometries was related to direct radiobiological effect. Conclusion: In this report, we calculated the frequency of DNA strand breakage using Geant4- DNA physics processes for liquid water. This study is now on-going in order to develop geometries which use realistic DNA material, instead of liquid water. This will be tested as soon as cross sections for DNA material become available in Geant4-DNA.« less

  18. The Effects of Modeled Microgravity on Nucleocytoplasmic Localization of Human Apurinic/Apyrimidinic

    NASA Technical Reports Server (NTRS)

    Gonda, Steve; Jackson, E.B.

    2004-01-01

    Exposure to space radiation and microgravity occurs to humans during space flight. In order to have accurate risk estimations, answering questions to whether increased DNA damage seen during space flight in modified by microgravity are important. Several studies have examined whether intercellular repair of radiation-induced DNA lesions are modified by microgravity. Results from these studies show no modification of the repair processes due to microgravity. However, it is known that in studies not involving radiation that microgravity interferes with normal development. Interestingly, there is no data that attempts to analyze the possible effects of microgravity on the trafficking of DNA repair proteins. In this study, we analyze the effects of modeled microgravity on nucleocytoplasmic shuttling of the human DNA repair enzyme apurinic/apyrimidinic endonuclease 1 (APE1/Ref1) which is involved in base excision repair. We examined nuclear translocation of APE1 using enhanced green fluorescent protein (EGFP) fused to APE1 as a reporter. While APE1 under normal gravity showed normal nuclear localization, APE1 nuclear localization under modeled microgravity was decreased. These results suggest that nucleocytoplasmic translocation of APE1 is modified under modeled microgravity.

  19. DNA Microarray-based Ecotoxicological Biomarker Discovery in a Small Fish Model Species

    EPA Science Inventory

    This paper addresses several issues critical to use of zebrafish oligonucleotide microarrays for computational toxicology research on endocrine disrupting chemicals using small fish models, and more generally, the use of microarrays in aquatic toxicology.

  20. XLS (c9orf142) is a new component of mammalian DNA double-stranded break repair.

    PubMed

    Craxton, A; Somers, J; Munnur, D; Jukes-Jones, R; Cain, K; Malewicz, M

    2015-06-01

    Repair of double-stranded DNA breaks (DSBs) in mammalian cells primarily occurs by the non-homologous end-joining (NHEJ) pathway, which requires seven core proteins (Ku70/Ku86, DNA-PKcs (DNA-dependent protein kinase catalytic subunit), Artemis, XRCC4-like factor (XLF), XRCC4 and DNA ligase IV). Here we show using combined affinity purification and mass spectrometry that DNA-PKcs co-purifies with all known core NHEJ factors. Furthermore, we have identified a novel evolutionary conserved protein associated with DNA-PKcs-c9orf142. Computer-based modelling of c9orf142 predicted a structure very similar to XRCC4, hence we have named c9orf142-XLS (XRCC4-like small protein). Depletion of c9orf142/XLS in cells impaired DSB repair consistent with a defect in NHEJ. Furthermore, c9orf142/XLS interacted with other core NHEJ factors. These results demonstrate the existence of a new component of the NHEJ DNA repair pathway in mammalian cells.

Top