Sample records for model linear chain

  1. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Suhara, Tadahiro; Kanada-En'yo, Yoshiko

    We investigate the linear-chain structures in highly excited states of {sup 14}C using a generalized molecular-orbital model, by which we incorporate an asymmetric configuration of three {alpha} clusters in the linear-chain states. By applying this model to the {sup 14}C system, we study the {sup 10}Be+{alpha} correlation in the linear-chain state of {sup 14}C. To clarify the origin of the {sup 10}Be+{alpha} correlation in the {sup 14}C linear-chain state, we analyze linear 3 {alpha} and 3{alpha} + n systems in a similar way. We find that a linear 3{alpha} system prefers the asymmetric 2{alpha} + {alpha} configuration, whose origin ismore » the many-body correlation incorporated by the parity projection. This configuration causes an asymmetric mean field for two valence neutrons, which induces the concentration of valence neutron wave functions around the correlating 2{alpha}. A linear-chain structure of {sup 16}C is also discussed.« less

  2. Monte Carlo simulation of star/linear and star/star blends with chemically identical monomers

    NASA Astrophysics Data System (ADS)

    Theodorakis, P. E.; Avgeropoulos, A.; Freire, J. J.; Kosmas, M.; Vlahos, C.

    2007-11-01

    The effects of chain size and architectural asymmetry on the miscibility of blends with chemically identical monomers, differing only in their molecular weight and architecture, are studied via Monte Carlo simulation by using the bond fluctuation model. Namely, we consider blends composed of linear/linear, star/linear and star/star chains. We found that linear/linear blends are more miscible than the corresponding star/star mixtures. In star/linear blends, the increase in the volume fraction of the star chains increases the miscibility. For both star/linear and star/star blends, the miscibility decreases with the increase in star functionality. When we increase the molecular weight of linear chains of star/linear mixtures the miscibility decreases. Our findings are compared with recent analytical and experimental results.

  3. Life cycle cost optimization of biofuel supply chains under uncertainties based on interval linear programming.

    PubMed

    Ren, Jingzheng; Dong, Liang; Sun, Lu; Goodsite, Michael Evan; Tan, Shiyu; Dong, Lichun

    2015-01-01

    The aim of this work was to develop a model for optimizing the life cycle cost of biofuel supply chain under uncertainties. Multiple agriculture zones, multiple transportation modes for the transport of grain and biofuel, multiple biofuel plants, and multiple market centers were considered in this model, and the price of the resources, the yield of grain and the market demands were regarded as interval numbers instead of constants. An interval linear programming was developed, and a method for solving interval linear programming was presented. An illustrative case was studied by the proposed model, and the results showed that the proposed model is feasible for designing biofuel supply chain under uncertainties. Copyright © 2015 Elsevier Ltd. All rights reserved.

  4. Lattice model of linear telechelic polymer melts. II. Influence of chain stiffness on basic thermodynamic properties

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Xu, Wen-Sheng, E-mail: wsxu@uchicago.edu; Freed, Karl F., E-mail: freed@uchicago.edu; Department of Chemistry, The University of Chicago, Chicago, Illinois 60637

    2015-07-14

    The lattice cluster theory (LCT) for semiflexible linear telechelic melts, developed in Paper I, is applied to examine the influence of chain stiffness on the average degree of self-assembly and the basic thermodynamic properties of linear telechelic polymer melts. Our calculations imply that chain stiffness promotes self-assembly of linear telechelic polymer melts that assemble on cooling when either polymer volume fraction ϕ or temperature T is high, but opposes self-assembly when both ϕ and T are sufficiently low. This allows us to identify a boundary line in the ϕ-T plane that separates two regions of qualitatively different influence of chainmore » stiffness on self-assembly. The enthalpy and entropy of self-assembly are usually treated as adjustable parameters in classical Flory-Huggins type theories for the equilibrium self-assembly of polymers, but they are demonstrated here to strongly depend on chain stiffness. Moreover, illustrative calculations for the dependence of the entropy density of linear telechelic polymer melts on chain stiffness demonstrate the importance of including semiflexibility within the LCT when exploring the nature of glass formation in models of linear telechelic polymer melts.« less

  5. A Linear Regression and Markov Chain Model for the Arabian Horse Registry

    DTIC Science & Technology

    1993-04-01

    as a tax deduction? Yes No T-4367 68 26. Regardless of previous equine tax deductions, do you consider your current horse activities to be... (Mark one...E L T-4367 A Linear Regression and Markov Chain Model For the Arabian Horse Registry Accesion For NTIS CRA&I UT 7 4:iC=D 5 D-IC JA" LI J:13tjlC,3 lO...the Arabian Horse Registry, which needed to forecast its future registration of purebred Arabian horses . A linear regression model was utilized to

  6. Nonmetallic electronegativity equalization and point-dipole interaction model including exchange interactions for molecular dipole moments and polarizabilities.

    PubMed

    Smalø, Hans S; Astrand, Per-Olof; Jensen, Lasse

    2009-07-28

    The electronegativity equalization model (EEM) has been combined with a point-dipole interaction model to obtain a molecular mechanics model consisting of atomic charges, atomic dipole moments, and two-atom relay tensors to describe molecular dipole moments and molecular dipole-dipole polarizabilities. The EEM has been phrased as an atom-atom charge-transfer model allowing for a modification of the charge-transfer terms to avoid that the polarizability approaches infinity for two particles at infinite distance and for long chains. In the present work, these shortcomings have been resolved by adding an energy term for transporting charges through individual atoms. A Gaussian distribution is adopted for the atomic charge distributions, resulting in a damping of the electrostatic interactions at short distances. Assuming that an interatomic exchange term may be described as the overlap between two electronic charge distributions, the EEM has also been extended by a short-range exchange term. The result is a molecular mechanics model where the difference of charge transfer in insulating and metallic systems is modeled regarding the difference in bond length between different types of system. For example, the model is capable of modeling charge transfer in both alkanes and alkenes with alternating double bonds with the same set of carbon parameters only relying on the difference in bond length between carbon sigma- and pi-bonds. Analytical results have been obtained for the polarizability of a long linear chain. These results show that the model is capable of describing the polarizability scaling both linearly and nonlinearly with the size of the system. Similarly, a linear chain with an end atom with a high electronegativity has been analyzed analytically. The dipole moment of this model system can either be independent of the length or increase linearly with the length of the chain. In addition, the model has been parametrized for alkane and alkene chains with data from density functional theory calculations, where the polarizability behaves differently with the chain length. For the molecular dipole moment, the same two systems have been studied with an aldehyde end group. Both the molecular polarizability and the dipole moment are well described as a function of the chain length for both alkane and alkene chains demonstrating the power of the presented model.

  7. Confined dynamics of grafted polymer chains in solutions of linear polymer

    DOE PAGES

    Poling-Skutvik, Ryan D.; Olafson, Katy N.; Narayanan, Suresh; ...

    2017-09-11

    Here, we measure the dynamics of high molecular weight polystyrene grafted to silica nanoparticles dispersed in semidilute solutions of linear polymer. Structurally, the linear free chains do not penetrate the grafted corona but increase the osmotic pressure of the solution, collapsing the grafted polymer and leading to eventual aggregation of the grafted particles at high matrix concentrations. Dynamically, the relaxations of the grafted polymer are controlled by the solvent viscosity according to the Zimm model on short time scales. On longer time scales, the grafted chains are confined by neighboring grafted chains, preventing full relaxation over the experimental time scale.more » Adding free linear polymer to the solution does not affect the initial Zimm relaxations of the grafted polymer but does increase the confinement of the grafted chains. Finally, our results elucidate the physics underlying the slow relaxations of grafted polymer.« less

  8. Confined dynamics of grafted polymer chains in solutions of linear polymer

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Poling-Skutvik, Ryan D.; Olafson, Katy N.; Narayanan, Suresh

    Here, we measure the dynamics of high molecular weight polystyrene grafted to silica nanoparticles dispersed in semidilute solutions of linear polymer. Structurally, the linear free chains do not penetrate the grafted corona but increase the osmotic pressure of the solution, collapsing the grafted polymer and leading to eventual aggregation of the grafted particles at high matrix concentrations. Dynamically, the relaxations of the grafted polymer are controlled by the solvent viscosity according to the Zimm model on short time scales. On longer time scales, the grafted chains are confined by neighboring grafted chains, preventing full relaxation over the experimental time scale.more » Adding free linear polymer to the solution does not affect the initial Zimm relaxations of the grafted polymer but does increase the confinement of the grafted chains. Finally, our results elucidate the physics underlying the slow relaxations of grafted polymer.« less

  9. Propagating synchrony in feed-forward networks

    PubMed Central

    Jahnke, Sven; Memmesheimer, Raoul-Martin; Timme, Marc

    2013-01-01

    Coordinated patterns of precisely timed action potentials (spikes) emerge in a variety of neural circuits but their dynamical origin is still not well understood. One hypothesis states that synchronous activity propagating through feed-forward chains of groups of neurons (synfire chains) may dynamically generate such spike patterns. Additionally, synfire chains offer the possibility to enable reliable signal transmission. So far, mostly densely connected chains, often with all-to-all connectivity between groups, have been theoretically and computationally studied. Yet, such prominent feed-forward structures have not been observed experimentally. Here we analytically and numerically investigate under which conditions diluted feed-forward chains may exhibit synchrony propagation. In addition to conventional linear input summation, we study the impact of non-linear, non-additive summation accounting for the effect of fast dendritic spikes. The non-linearities promote synchronous inputs to generate precisely timed spikes. We identify how non-additive coupling relaxes the conditions on connectivity such that it enables synchrony propagation at connectivities substantially lower than required for linearly coupled chains. Although the analytical treatment is based on a simple leaky integrate-and-fire neuron model, we show how to generalize our methods to biologically more detailed neuron models and verify our results by numerical simulations with, e.g., Hodgkin Huxley type neurons. PMID:24298251

  10. A multichain polymer slip-spring model with fluctuating number of entanglements for linear and nonlinear rheology

    DOE PAGES

    Ramírez-Hernández, Abelardo; Peters, Brandon L.; Andreev, Marat; ...

    2015-12-15

    A theoretically informed entangled polymer simulation approach is presented for description of the linear and non-linear rheology of entangled polymer melts. The approach relies on a many-chain representation and introduces the topological effects that arise from the non-crossability of molecules through effective fluctuating interactions, mediated by slip-springs, between neighboring pairs of macromolecules. The total number of slip-springs is not preserved but, instead, it is controlled through a chemical potential that determines the average molecular weight between entanglements. The behavior of the model is discussed in the context of a recent theory for description of homogeneous materials, and its relevance ismore » established by comparing its predictions to experimental linear and non-linear rheology data for a series of well-characterized linear polyisoprene melts. Furthermore, the results are shown to be in quantitative agreement with experiment and suggest that the proposed formalism may also be used to describe the dynamics of inhomogeneous systems, such as composites and copolymers. Importantly, the fundamental connection made here between our many-chain model and the well-established, thermodynamically consistent single-chain mean-field models provides a path to systematic coarse-graining for prediction of polymer rheology in structurally homogeneous and heterogeneous materials.« less

  11. Linear and Nonlinear Elasticity of Networks Made of Comb-like Polymers and Bottle-Brushes

    NASA Astrophysics Data System (ADS)

    Liang, H.; Dobrynin, A.; Everhart, M.; Daniel, W.; Vatankhah-Varnoosfaderani, M.; Sheiko, S.

    We study mechanical properties of networks made of combs and bottle-brushes by computer simulations, theoretical calculations and experimental techniques. The networks are prepared by cross-linking backbones of combs or bottle-brushes with linear chains. This results in ``hybrid'' networks consisting of linear chains and strands of combs or bottle-brushes. In the framework of the phantom network model, the network modulus at small deformations G0 can be represented as a sum of contributions from linear chains, G0 , l, and strands of comb or bottle-brush, G0 , bb. If the length of extended backbone between crosslinks, Rmax, is much longer than the Kuhn length, bk, the modulus scales with the degree of polymerization of the side chains, nsc, and number of monomers between side chains, ng, as G0 , bb (nsc/ng + 1)-1. In the limit when bk becomes of the order of Rmax, the combs and bottle-brushes can be considered as semiflexible chains, resulting in a network modulus to be G0 , bb (nsc/ng + 1)-1(nsc2/2/ng) . In the nonlinear deformation regime, the strain-hardening behavior is described by the nonlinear network deformation model, which predicts that the true stress is a universal function of the structural modulus, G, first strain invariant, I1, and deformation ratio, β. The results of the computer simulations and predictions of the theoretical model are in a good agreement with experimental results. NSF DMR-1409710, DMR-1407645, DMR-1624569, DMR-1436201.

  12. Rheology modification with ring polymers

    NASA Astrophysics Data System (ADS)

    Vlassopoulos, Dimitris

    It is now established that experimental unconcatenated ring polymers can be purified effectively by means of fractionation at the critical condition. For molecular weights well above the entanglement threshold, purified rings relax stress via power-law (with an exponent of about -0.4), sharply departing from their linear counterparts. Experimental results are in harmony with modeling predictions and simulations. Here, we present results from recent interdisciplinary efforts and discuss two challenges: (i) the nonlinear shear rheology of purified ring melts is also very different from that of unlinked chains. Whereas the latter exhibit features that can be explained, to a first approach, in the framework in the tube model, the former behave akin to unentangled chains with finite extensibility and exhibit much small deformation at steady state. (ii) blends of rings and linear polymers exhibit unique features in different regimes: The addition of minute amounts of linear chains drastically affects ring dynamics. This relates to ring purity and the ability of unlinked linear chains to thread rings. With the help of simulations, it is possible to rationalize the observed surprisingly slow viscoelastic relaxation, which is attributed to ring-linear and ring-ring penetrations. On the other hand, adding small amounts of rings to linear polymers of different molecular weights influences their linear and nonlinear rheology in an unprecedented way. The blend viscosity exceeds that of the slower component (linear) in this non-interacting mixture, and its dependencies on composition and molecular weight ratio are examined, whereas the role of molecular architecture is also addressed. Consequently, closing the ends of a linear chain can serve as a powerful means for molecular manipulation of its rheology. This presentation reflects collaborative efforts with S. Costanzo, Z-C. Yan, R. Pasquino, M. Kaliva, S. Kamble, Y. Jeong, P. Lutz, J. Allgaier, T. Chang, D. Talikis, V. Mavrantzas and M. Rubinstein.

  13. Linear viscoelasticity of a single semiflexible polymer with internal friction.

    PubMed

    Hiraiwa, Tetsuya; Ohta, Takao

    2010-07-28

    The linear viscoelastic behaviors of single semiflexible chains with internal friction are studied based on the wormlike-chain model. It is shown that the frequency dependence of the complex compliance in the high frequency limit is the same as that of the Voigt model. This asymptotic behavior appears also for the Rouse model with internal friction. We derive the characteristic times for both the high frequency limit and the low frequency limit and compare the results with those obtained by Khatri et al.

  14. Macromolecular 'size' and 'hardness' drives structure in solvent-swollen blends of linear, cyclic, and star polymers.

    PubMed

    Gartner, Thomas E; Jayaraman, Arthi

    2018-01-17

    In this paper, we apply molecular simulation and liquid state theory to uncover the structure and thermodynamics of homopolymer blends of the same chemistry and varying chain architecture in the presence of explicit solvent species. We use hybrid Monte Carlo (MC)/molecular dynamics (MD) simulations in the Gibbs ensemble to study the swelling of ∼12 000 g mol -1 linear, cyclic, and 4-arm star polystyrene chains in toluene. Our simulations show that the macroscopic swelling response is indistinguishable between the various architectures and matches published experimental data for the solvent annealing of linear polystyrene by toluene vapor. We then use standard MD simulations in the NPT ensemble along with polymer reference interaction site model (PRISM) theory to calculate effective polymer-solvent and polymer-polymer Flory-Huggins interaction parameters (χ eff ) in these systems. As seen in the macroscopic swelling results, there are no significant differences in the polymer-solvent and polymer-polymer χ eff between the various architectures. Despite similar macroscopic swelling and effective interaction parameters between various architectures, the pair correlation function between chain centers-of-mass indicates stronger correlations between cyclic or star chains in the linear-cyclic blends and linear-star blends, compared to linear chain-linear chain correlations. Furthermore, we note striking similarities in the chain-level correlations and the radius of gyration of cyclic and 4-arm star architectures of identical molecular weight. Our results indicate that the cyclic and star chains are 'smaller' and 'harder' than their linear counterparts, and through comparison with MD simulations of blends of soft spheres with varying hardness and size we suggest that these macromolecular characteristics are the source of the stronger cyclic-cyclic and star-star correlations.

  15. Linear Equating for the NEAT Design: Parameter Substitution Models and Chained Linear Relationship Models

    ERIC Educational Resources Information Center

    Kane, Michael T.; Mroch, Andrew A.; Suh, Youngsuk; Ripkey, Douglas R.

    2009-01-01

    This paper analyzes five linear equating models for the "nonequivalent groups with anchor test" (NEAT) design with internal anchors (i.e., the anchor test is part of the full test). The analysis employs a two-dimensional framework. The first dimension contrasts two general approaches to developing the equating relationship. Under a "parameter…

  16. Modelling a flows in supply chain with analytical models: Case of a chemical industry

    NASA Astrophysics Data System (ADS)

    Benhida, Khalid; Azougagh, Yassine; Elfezazi, Said

    2016-02-01

    This study is interested on the modelling of the logistics flows in a supply chain composed on a production sites and a logistics platform. The contribution of this research is to develop an analytical model (integrated linear programming model), based on a case study of a real company operating in the phosphate field, considering a various constraints in this supply chain to resolve the planning problems for a better decision-making. The objectives of this model is to determine and define the optimal quantities of different products to route, to and from the various entities in the supply chain studied.

  17. Nonequilibrium generalised Langevin equation for the calculation of heat transport properties in model 1D atomic chains coupled to two 3D thermal baths.

    PubMed

    Ness, H; Stella, L; Lorenz, C D; Kantorovich, L

    2017-04-28

    We use a generalised Langevin equation scheme to study the thermal transport of low dimensional systems. In this approach, the central classical region is connected to two realistic thermal baths kept at two different temperatures [H. Ness et al., Phys. Rev. B 93, 174303 (2016)]. We consider model Al systems, i.e., one-dimensional atomic chains connected to three-dimensional baths. The thermal transport properties are studied as a function of the chain length N and the temperature difference ΔT between the baths. We calculate the transport properties both in the linear response regime and in the non-linear regime. Two different laws are obtained for the linear conductance versus the length of the chains. For large temperatures (T≳500 K) and temperature differences (ΔT≳500 K), the chains, with N>18 atoms, present a diffusive transport regime with the presence of a temperature gradient across the system. For lower temperatures (T≲500 K) and temperature differences (ΔT≲400 K), a regime similar to the ballistic regime is observed. Such a ballistic-like regime is also obtained for shorter chains (N≤15). Our detailed analysis suggests that the behaviour at higher temperatures and temperature differences is mainly due to anharmonic effects within the long chains.

  18. A theoretical investigation of symmetry-origin unidirectional energy gradient in light-harvesting dendrimers.

    PubMed

    Koda, Shin-ichi

    2016-03-21

    We theoretically investigate a possibility that the symmetry of the repetitively branched structure of light-harvesting dendrimers creates the energy gradient descending toward inner generations (layers of pigment molecules) of the dendrimers. In the first half of this paper, we define a model system using the Frenkel exciton Hamiltonian that focuses only on the topology of dendrimers and numerically show that excitation energy tends to gather at inner generations of the model system at a thermal equilibrium state. This indicates that an energy gradient is formed in the model system. In the last half, we attribute this result to the symmetry of the model system and propose two symmetry-origin mechanisms creating the energy gradient. The present analysis and proposition are based on the theory of the linear chain (LC) decomposition [S. Koda, J. Chem. Phys. 142, 204112 (2015)], which equivalently transforms the model system into a set of one-dimensional systems on the basis of the symmetry of dendrimers. In the picture of the LC decomposition, we find that energy gradient is formed both in each linear chain and among linear chains, and these two mechanisms explain the numerical results well.

  19. A theoretical investigation of symmetry-origin unidirectional energy gradient in light-harvesting dendrimers

    NASA Astrophysics Data System (ADS)

    Koda, Shin-ichi

    2016-03-01

    We theoretically investigate a possibility that the symmetry of the repetitively branched structure of light-harvesting dendrimers creates the energy gradient descending toward inner generations (layers of pigment molecules) of the dendrimers. In the first half of this paper, we define a model system using the Frenkel exciton Hamiltonian that focuses only on the topology of dendrimers and numerically show that excitation energy tends to gather at inner generations of the model system at a thermal equilibrium state. This indicates that an energy gradient is formed in the model system. In the last half, we attribute this result to the symmetry of the model system and propose two symmetry-origin mechanisms creating the energy gradient. The present analysis and proposition are based on the theory of the linear chain (LC) decomposition [S. Koda, J. Chem. Phys. 142, 204112 (2015)], which equivalently transforms the model system into a set of one-dimensional systems on the basis of the symmetry of dendrimers. In the picture of the LC decomposition, we find that energy gradient is formed both in each linear chain and among linear chains, and these two mechanisms explain the numerical results well.

  20. Numerical methods in Markov chain modeling

    NASA Technical Reports Server (NTRS)

    Philippe, Bernard; Saad, Youcef; Stewart, William J.

    1989-01-01

    Several methods for computing stationary probability distributions of Markov chains are described and compared. The main linear algebra problem consists of computing an eigenvector of a sparse, usually nonsymmetric, matrix associated with a known eigenvalue. It can also be cast as a problem of solving a homogeneous singular linear system. Several methods based on combinations of Krylov subspace techniques are presented. The performance of these methods on some realistic problems are compared.

  1. Inhibition of telomerase by linear-chain fatty acids: a structural analysis.

    PubMed Central

    Oda, Masako; Ueno, Takamasa; Kasai, Nobuyuki; Takahashi, Hirotada; Yoshida, Hiromi; Sugawara, Fumio; Sakaguchi, Kengo; Hayashi, Hideya; Mizushina, Yoshiyuki

    2002-01-01

    In the present study, we have found that mono-unsaturated linear-chain fatty acids in the cis configuration with C(18) hydrocarbon chains (i.e. oleic acid) strongly inhibited the activity of human telomerase in a cell-free enzymic assay, with an IC(50) value of 8.6 microM. Interestingly, fatty acids with hydrocarbon chain lengths below 16 or above 20 carbons substantially decreased the potency of inhibition of telomerase. Moreover, the cis-mono-unsaturated C(18) linear-chain fatty acid oleic acid was the strongest inhibitor of all the fatty acids tested. A kinetic study revealed that oleic acid competitively inhibited the activity of telomerase ( K (i)=3.06 microM) with respect to the telomerase substrate primer. The energy-minimized three-dimensional structure of the linear-chain fatty acid was calculated and modelled. A molecule width of 11.53-14.26 A (where 1 A=0.1 nm) in the C(16) to C(20) fatty acid structure was suggested to be important for telomerase inhibition. The three-dimensional structure of the telomerase active site (i.e. the substrate primer-binding site) appears to have a pocket that could bind oleic acid, with the pocket being 8.50 A long and 12.80 A wide. PMID:12121150

  2. Linear-algebraic bath transformation for simulating complex open quantum systems

    DOE PAGES

    Huh, Joonsuk; Mostame, Sarah; Fujita, Takatoshi; ...

    2014-12-02

    In studying open quantum systems, the environment is often approximated as a collection of non-interacting harmonic oscillators, a configuration also known as the star-bath model. It is also well known that the star-bath can be transformed into a nearest-neighbor interacting chain of oscillators. The chain-bath model has been widely used in renormalization group approaches. The transformation can be obtained by recursion relations or orthogonal polynomials. Based on a simple linear algebraic approach, we propose a bath partition strategy to reduce the system-bath coupling strength. As a result, the non-interacting star-bath is transformed into a set of weakly coupled multiple parallelmore » chains. Furthermore, the transformed bath model allows complex problems to be practically implemented on quantum simulators, and it can also be employed in various numerical simulations of open quantum dynamics.« less

  3. Optimal clinical trial design based on a dichotomous Markov-chain mixed-effect sleep model.

    PubMed

    Steven Ernest, C; Nyberg, Joakim; Karlsson, Mats O; Hooker, Andrew C

    2014-12-01

    D-optimal designs for discrete-type responses have been derived using generalized linear mixed models, simulation based methods and analytical approximations for computing the fisher information matrix (FIM) of non-linear mixed effect models with homogeneous probabilities over time. In this work, D-optimal designs using an analytical approximation of the FIM for a dichotomous, non-homogeneous, Markov-chain phase advanced sleep non-linear mixed effect model was investigated. The non-linear mixed effect model consisted of transition probabilities of dichotomous sleep data estimated as logistic functions using piecewise linear functions. Theoretical linear and nonlinear dose effects were added to the transition probabilities to modify the probability of being in either sleep stage. D-optimal designs were computed by determining an analytical approximation the FIM for each Markov component (one where the previous state was awake and another where the previous state was asleep). Each Markov component FIM was weighted either equally or by the average probability of response being awake or asleep over the night and summed to derive the total FIM (FIM(total)). The reference designs were placebo, 0.1, 1-, 6-, 10- and 20-mg dosing for a 2- to 6-way crossover study in six dosing groups. Optimized design variables were dose and number of subjects in each dose group. The designs were validated using stochastic simulation/re-estimation (SSE). Contrary to expectations, the predicted parameter uncertainty obtained via FIM(total) was larger than the uncertainty in parameter estimates computed by SSE. Nevertheless, the D-optimal designs decreased the uncertainty of parameter estimates relative to the reference designs. Additionally, the improvement for the D-optimal designs were more pronounced using SSE than predicted via FIM(total). Through the use of an approximate analytic solution and weighting schemes, the FIM(total) for a non-homogeneous, dichotomous Markov-chain phase advanced sleep model was computed and provided more efficient trial designs and increased nonlinear mixed-effects modeling parameter precision.

  4. A novel framework to simulating non-stationary, non-linear, non-Normal hydrological time series using Markov Switching Autoregressive Models

    NASA Astrophysics Data System (ADS)

    Birkel, C.; Paroli, R.; Spezia, L.; Tetzlaff, D.; Soulsby, C.

    2012-12-01

    In this paper we present a novel model framework using the class of Markov Switching Autoregressive Models (MSARMs) to examine catchments as complex stochastic systems that exhibit non-stationary, non-linear and non-Normal rainfall-runoff and solute dynamics. Hereby, MSARMs are pairs of stochastic processes, one observed and one unobserved, or hidden. We model the unobserved process as a finite state Markov chain and assume that the observed process, given the hidden Markov chain, is conditionally autoregressive, which means that the current observation depends on its recent past (system memory). The model is fully embedded in a Bayesian analysis based on Markov Chain Monte Carlo (MCMC) algorithms for model selection and uncertainty assessment. Hereby, the autoregressive order and the dimension of the hidden Markov chain state-space are essentially self-selected. The hidden states of the Markov chain represent unobserved levels of variability in the observed process that may result from complex interactions of hydroclimatic variability on the one hand and catchment characteristics affecting water and solute storage on the other. To deal with non-stationarity, additional meteorological and hydrological time series along with a periodic component can be included in the MSARMs as covariates. This extension allows identification of potential underlying drivers of temporal rainfall-runoff and solute dynamics. We applied the MSAR model framework to streamflow and conservative tracer (deuterium and oxygen-18) time series from an intensively monitored 2.3 km2 experimental catchment in eastern Scotland. Statistical time series analysis, in the form of MSARMs, suggested that the streamflow and isotope tracer time series are not controlled by simple linear rules. MSARMs showed that the dependence of current observations on past inputs observed by transport models often in form of the long-tailing of travel time and residence time distributions can be efficiently explained by non-stationarity either of the system input (climatic variability) and/or the complexity of catchment storage characteristics. The statistical model is also capable of reproducing short (event) and longer-term (inter-event) and wet and dry dynamical "hydrological states". These reflect the non-linear transport mechanisms of flow pathways induced by transient climatic and hydrological variables and modified by catchment characteristics. We conclude that MSARMs are a powerful tool to analyze the temporal dynamics of hydrological data, allowing for explicit integration of non-stationary, non-linear and non-Normal characteristics.

  5. Mixed Integer Linear Programming model for Crude Palm Oil Supply Chain Planning

    NASA Astrophysics Data System (ADS)

    Sembiring, Pasukat; Mawengkang, Herman; Sadyadharma, Hendaru; Bu'ulolo, F.; Fajriana

    2018-01-01

    The production process of crude palm oil (CPO) can be defined as the milling process of raw materials, called fresh fruit bunch (FFB) into end products palm oil. The process usually through a series of steps producing and consuming intermediate products. The CPO milling industry considered in this paper does not have oil palm plantation, therefore the FFB are supplied by several public oil palm plantations. Due to the limited availability of FFB, then it is necessary to choose from which plantations would be appropriate. This paper proposes a mixed integer linear programming model the supply chain integrated problem, which include waste processing. The mathematical programming model is solved using neighborhood search approach.

  6. A mixed integer linear programming model for operational planning of a biodiesel supply chain network from used cooking oil

    NASA Astrophysics Data System (ADS)

    Jonrinaldi, Hadiguna, Rika Ampuh; Salastino, Rades

    2017-11-01

    Environmental consciousness has paid many attention nowadays. It is not only about how to recycle, remanufacture or reuse used end products but it is also how to optimize the operations of the reverse system. A previous research has proposed a design of reverse supply chain of biodiesel network from used cooking oil. However, the research focused on the design of the supply chain strategy not the operations of the supply chain. It only decided how to design the structure of the supply chain in the next few years, and the process of each stage will be conducted in the supply chain system in general. The supply chain system has not considered operational policies to be conducted by the companies in the supply chain. Companies need a policy for each stage of the supply chain operations to be conducted so as to produce the optimal supply chain system, including how to use all the resources that have been designed in order to achieve the objectives of the supply chain system. Therefore, this paper proposes a model to optimize the operational planning of a biodiesel supply chain network from used cooking oil. A mixed integer linear programming is developed to model the operational planning of biodiesel supply chain in order to minimize the total operational cost of the supply chain. Based on the implementation of the model developed, the total operational cost of the biodiesel supply chain incurred by the system is less than the total operational cost of supply chain based on the previous research during seven days of operational planning about amount of 2,743,470.00 or 0.186%. Production costs contributed to 74.6 % of total operational cost and the cost of purchasing the used cooking oil contributed to 24.1 % of total operational cost. So, the system should pay more attention to these two aspects as changes in the value of these aspects will cause significant effects to the change in the total operational cost of the supply chain.

  7. Relaxation dynamics of internal segments of DNA chains in nanochannels

    NASA Astrophysics Data System (ADS)

    Jain, Aashish; Muralidhar, Abhiram; Dorfman, Kevin; Dorfman Group Team

    We will present relaxation dynamics of internal segments of a DNA chain confined in nanochannel. The results have direct application in genome mapping technology, where long DNA molecules containing sequence-specific fluorescent probes are passed through an array of nanochannels to linearize them, and then the distances between these probes (the so-called ``DNA barcode'') are measured. The relaxation dynamics of internal segments set the experimental error due to dynamic fluctuations. We developed a multi-scale simulation algorithm, combining a Pruned-Enriched Rosenbluth Method (PERM) simulation of a discrete wormlike chain model with hard spheres with Brownian dynamics (BD) simulations of a bead-spring chain. Realistic parameters such as the bead friction coefficient and spring force law parameters are obtained from PERM simulations and then mapped onto the bead-spring model. The BD simulations are carried out to obtain the extension autocorrelation functions of various segments, which furnish their relaxation times. Interestingly, we find that (i) corner segments relax faster than the center segments and (ii) relaxation times of corner segments do not depend on the contour length of DNA chain, whereas the relaxation times of center segments increase linearly with DNA chain size.

  8. Semiflexible macromolecules in quasi-one-dimensional confinement: Discrete versus continuous bond angles.

    PubMed

    Huang, Aiqun; Hsu, Hsiao-Ping; Bhattacharya, Aniket; Binder, Kurt

    2015-12-28

    The conformations of semiflexible polymers in two dimensions confined in a strip of width D are studied by computer simulations, investigating two different models for the mechanism by which chain stiffness is realized. One model (studied by molecular dynamics) is a bead-spring model in the continuum, where stiffness is controlled by a bond angle potential allowing for arbitrary bond angles. The other model (studied by Monte Carlo) is a self-avoiding walk chain on the square lattice, where only discrete bond angles (0° and ±90°) are possible, and the bond angle potential then controls the density of kinks along the chain contour. The first model is a crude description of DNA-like biopolymers, while the second model (roughly) describes synthetic polymers like alkane chains. It is first demonstrated that in the bulk the crossover from rods to self-avoiding walks for both models is very similar, when one studies average chain linear dimensions, transverse fluctuations, etc., despite their differences in local conformations. However, in quasi-one-dimensional confinement two significant differences between both models occur: (i) The persistence length (extracted from the average cosine of the bond angle) gets renormalized for the lattice model when D gets less than the bulk persistence length, while in the continuum model it stays unchanged. (ii) The monomer density near the repulsive walls for semiflexible polymers is compatible with a power law predicted for the Kratky-Porod model in the case of the bead-spring model, while for the lattice case it tends to a nonzero constant across the strip. However, for the density of chain ends, such a constant behavior seems to occur for both models, unlike the power law observed for flexible polymers. In the regime where the bulk persistence length ℓp is comparable to D, hairpin conformations are detected, and the chain linear dimensions are discussed in terms of a crossover from the Daoud/De Gennes "string of blobs"-picture to the flexible rod picture when D decreases and/or the chain stiffness increases. Introducing a suitable further coarse-graining of the chain contours of the continuum model, direct estimates for the deflection length and its distribution could be obtained.

  9. Tuning the thermal conductivity of solar cell polymers through side chain engineering.

    PubMed

    Guo, Zhi; Lee, Doyun; Liu, Yi; Sun, Fangyuan; Sliwinski, Anna; Gao, Haifeng; Burns, Peter C; Huang, Libai; Luo, Tengfei

    2014-05-07

    Thermal transport is critical to the performance and reliability of polymer-based energy devices, ranging from solar cells to thermoelectrics. This work shows that the thermal conductivity of a low band gap conjugated polymer, poly(4,8-bis-alkyloxybenzo[1,2-b:4,5-b']dithiophene-2,6-diyl-alt-(alkylthieno[3,4-b]thiophene-2-carboxylate)-2,6-diyl) (PBDTTT), for photovoltaic applications can be actively tuned through side chain engineering. Compared to the original polymer modified with short branched side chains, the engineered polymer using all linear and long side chains shows a 160% increase in thermal conductivity. The thermal conductivity of the polymer exhibits a good correlation with the side chain lengths as well as the crystallinity of the polymer characterized using small-angle X-ray scattering (SAXS) experiments. Molecular dynamics simulations and atomic force microscopy are used to further probe the molecular level local order of different polymers. It is found that the linear side chain modified polymer can facilitate the formation of more ordered structures, as compared to the branched side chain modified ones. The effective medium theory modelling also reveals that the long linear side chain enables a larger heat carrier propagation length and the crystalline phase in the bulk polymer increases the overall thermal conductivity. It is concluded that both the length of the side chains and the induced polymer crystallization are important for thermal transport. These results offer important guidance for actively tuning the thermal conductivity of conjugated polymers through molecular level design.

  10. Softening of the stiffness of bottle-brush polymers by mutual interaction

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bolisetty, S.; Airaud, C.; Rosenfeldt, S.

    2007-04-15

    We study bottle-brush macromolecules in a good solvent by small-angle neutron scattering (SANS), static light scattering (SLS), and dynamic light scattering (DLS). These polymers consist of a linear backbone to which long side chains are chemically grafted. The backbone contains about 1600 monomer units (weight average) and every second monomer unit carries side chains with approximately 60 monomer units. The SLS and SANS data extrapolated to infinite dilution lead to the form factor of the polymer that can be described in terms of a wormlike chain with a contour length of 380 nm and a persistence length of 17.5 nm.more » An analysis of the DLS data confirms these model parameters. The scattering intensities taken at finite concentration can be modeled using the polymer reference interaction site model. It reveals a softening of the bottle-brush polymers caused by their mutual interaction. We demonstrate that the persistence decreases from 17.5 nm down to 5 nm upon increasing the concentration from dilute solution to the highest concentration (40.59 g/l) under consideration. The observed softening of the chains is comparable to the theoretically predicted decrease of the electrostatic persistence length of linear polyelectrolyte chains at finite concentrations.« less

  11. Small Angle Neutron Scattering Observation of Chain Retraction after a Large Step Deformation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Blanchard, A.; Heinrich, M.; Pyckhout-Hintzen, W.

    The process of retraction in entangled linear chains after a fast nonlinear stretch was detected from time-resolved but quenched small angle neutron scattering (SANS) experiments on long, well-entangled polyisoprene chains. The statically obtained SANS data cover the relevant time regime for retraction, and they provide a direct, microscopic verification of this nonlinear process as predicted by the tube model. Clear, quantitative agreement is found with recent theories of contour length fluctuations and convective constraint release, using parameters obtained mainly from linear rheology. The theory captures the full range of scattering vectors once the crossover to fluctuations on length scales belowmore » the tube diameter is accounted for.« less

  12. Energy level alignment of self-assembled linear chains of benzenediamine on Au(111) from first principles

    DOE PAGES

    Li, Guo; Rangel, Tonatiuh; Liu, Zhen -Fei; ...

    2016-03-24

    Using density functional theory (DFT) with van der Waals functionals, we calculate the adsorption energetics and geometry of benzenediamine (BDA) molecules on Au(111) surfaces. Our results demonstrate that the reported self-assembled linear chain structure of BDA, stabilized via hydrogen bonds between amine groups, is energetically favored over previously-studied monomeric phases. Moreover, using a model based on many-body perturbation theory within the GW approximation, we obtain approximate self-energy corrections to the DFT highest occupied molecular orbital (HOMO) energy associated with BDA adsorbate phases. As a result, we find that, independent of coverage, the HOMO energy of the linear chain phase ismore » lower relative to the Fermi energy than that of the monomer phase, and in good agreement with values measured with ultraviolet photoelectron spectroscopy and X-ray photoelectron spectroscopy.« less

  13. Energy level alignment of self-assembled linear chains of benzenediamine on Au(111) from first principles

    NASA Astrophysics Data System (ADS)

    Li, Guo; Rangel, Tonatiuh; Liu, Zhen-Fei; Cooper, Valentino R.; Neaton, Jeffrey B.

    2016-03-01

    Using density functional theory (DFT) with a van der Waals density functional, we calculate the adsorption energetics and geometry of benzenediamine (BDA) molecules on Au(111) surfaces. Our results demonstrate that the reported self-assembled linear chain structure of BDA, stabilized via hydrogen bonds between amine groups, is energetically favored over previously studied monomeric phases. Moreover, using a model, which includes nonlocal polarization effects from the substrate and the neighboring molecules and incorporates many-body perturbation theory calculations within the GW approximation, we obtain approximate self-energy corrections to the DFT highest occupied molecular orbital (HOMO) energy associated with BDA adsorbate phases. We find that, independent of coverage, the HOMO energy of the linear chain phase is lower relative to the Fermi energy than that of the monomer phase, and in good agreement with values measured with ultraviolet photoelectron spectroscopy and x-ray photoelectron spectroscopy.

  14. Linear rheology and structure of molecular bottlebrushes with short side chains

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    López-Barrón, Carlos R., E-mail: carlos.r.lopez-barron@exxonmobil.com; Brant, Patrick; Crowther, Donna J.

    We investigate the microstructure and linear viscoelasticity of model molecular bottlebrushes (BBs) using rheological and small-angle X-ray and neutron scattering measurements. Our polymers have short atactic polypropylene (aPP) side chains of molecular weight ranging from 119 g/mol to 259 g/mol and narrow molecular weight distribution (M{sub w}/M{sub n} 1.02–1.05). The side chain molecular weights are a small fraction of the entanglement molecular weight of the corresponding linear polymer (M{sub e,aPP}= 7.05 kg/mol), and as such, they are unentangled. The morphology of the aPP BBs is characterized as semiflexible thick chains with small side chain interdigitation. Their dynamic master curves, obtained by time-temperature superposition,more » reveal two sequential relaxation processes corresponding to the segmental relaxation and the relaxation of the BB backbone. Due to the short length of the side chains, their fast relaxation could not be distinguished from the glassy relaxation. The fractional free volume is an increasing function of the side chain length (N{sub SC}). Therefore, the glassy behavior of these polymers as well as their molecular friction and dynamic properties are influenced by their N{sub SC} values. The apparent flow activation energies are a decreasing function of N{sub SC}, and their values explain the differences in zero-shear viscosity measured at different temperatures.« less

  15. Markov and semi-Markov switching linear mixed models used to identify forest tree growth components.

    PubMed

    Chaubert-Pereira, Florence; Guédon, Yann; Lavergne, Christian; Trottier, Catherine

    2010-09-01

    Tree growth is assumed to be mainly the result of three components: (i) an endogenous component assumed to be structured as a succession of roughly stationary phases separated by marked change points that are asynchronous among individuals, (ii) a time-varying environmental component assumed to take the form of synchronous fluctuations among individuals, and (iii) an individual component corresponding mainly to the local environment of each tree. To identify and characterize these three components, we propose to use semi-Markov switching linear mixed models, i.e., models that combine linear mixed models in a semi-Markovian manner. The underlying semi-Markov chain represents the succession of growth phases and their lengths (endogenous component) whereas the linear mixed models attached to each state of the underlying semi-Markov chain represent-in the corresponding growth phase-both the influence of time-varying climatic covariates (environmental component) as fixed effects, and interindividual heterogeneity (individual component) as random effects. In this article, we address the estimation of Markov and semi-Markov switching linear mixed models in a general framework. We propose a Monte Carlo expectation-maximization like algorithm whose iterations decompose into three steps: (i) sampling of state sequences given random effects, (ii) prediction of random effects given state sequences, and (iii) maximization. The proposed statistical modeling approach is illustrated by the analysis of successive annual shoots along Corsican pine trunks influenced by climatic covariates. © 2009, The International Biometric Society.

  16. Tunnel current across linear homocatenated germanium chains

    NASA Astrophysics Data System (ADS)

    Matsuura, Yukihito

    2014-01-01

    The electronic transport properties of germanium oligomers catenating into linear chains (linear Ge chains) have been theoretically studied using first principle methods. The conduction mechanism of a Ge chain sandwiched between gold electrodes was analyzed based on the density of states and the eigenstates of the molecule in a two-probe environment. Like that of silicon chains (Si chains), the highest occupied molecular orbital of Ge chains contains the extended σ-conjugation of Ge 4p orbitals at energy levels close to the Fermi level; this is in contrast to the electronic properties of linear carbon chains. Furthermore, the conductance of a Ge chain is expected to decrease exponentially with molecular length L. The decay constant β, which is defined as e-βL, of a Ge chain is similar to that of a Si chain, whereas the conductance of the Ge chains is higher than that of Si chains even though the Ge-Ge bond length is longer than the Si-Si bond length.

  17. An analytical approach to top predator interference on the dynamics of a food chain model

    NASA Astrophysics Data System (ADS)

    Senthamarai, R.; Vijayalakshmi, T.

    2018-04-01

    In this paper, a nonlinear mathematical model is proposed and analyzed to study of top predator interference on the dynamics of a food chain model. The mathematical model is formulated using the system of non-linear ordinary differential equations. In this model, there are three state dimensionless variables, viz, size of prey population x, size of intermediate predator y and size of top predator population z. The analytical results are compared with the numerical simulation using MATLAB software and satisfactory results are noticed.

  18. Mechanism Underlying IκB Kinase Activation Mediated by the Linear Ubiquitin Chain Assembly Complex

    PubMed Central

    Fujita, Hiroaki; Akita, Mariko; Kato, Ryuichi; Sasaki, Yoshiteru; Wakatsuki, Soichi

    2014-01-01

    The linear ubiquitin chain assembly complex (LUBAC) ligase, consisting of HOIL-1L, HOIP, and SHARPIN, specifically generates linear polyubiquitin chains. LUBAC-mediated linear polyubiquitination has been implicated in NF-κB activation. NEMO, a component of the IκB kinase (IKK) complex, is a substrate of LUBAC, but the precise molecular mechanism underlying linear chain-mediated NF-κB activation has not been fully elucidated. Here, we demonstrate that linearly polyubiquitinated NEMO activates IKK more potently than unanchored linear chains. In mutational analyses based on the crystal structure of the complex between the HOIP NZF1 and NEMO CC2-LZ domains, which are involved in the HOIP-NEMO interaction, NEMO mutations that impaired linear ubiquitin recognition activity and prevented recognition by LUBAC synergistically suppressed signal-induced NF-κB activation. HOIP NZF1 bound to NEMO and ubiquitin simultaneously, and HOIP NZF1 mutants defective in interaction with either NEMO or ubiquitin could not restore signal-induced NF-κB activation. Furthermore, linear chain-mediated activation of IKK2 involved homotypic interaction of the IKK2 kinase domain. Collectively, these results demonstrate that linear polyubiquitination of NEMO plays crucial roles in IKK activation and that this modification involves the HOIP NZF1 domain and recognition of NEMO-conjugated linear ubiquitin chains by NEMO on another IKK complex. PMID:24469399

  19. UMAP Modules-Units 105, 107-109, 111-112, 158-162.

    ERIC Educational Resources Information Center

    Keller, Mary K.; And Others

    This collection of materials includes six units dealing with applications of matrix methods. These are: 105-Food Service Management; 107-Markov Chains; 108-Electrical Circuits; 109-Food Service and Dietary Requirements; 111-Fixed Point and Absorbing Markov Chains; and 112-Analysis of Linear Circuits. The units contain exercises and model exams,…

  20. Optimal design of supply chain network under uncertainty environment using hybrid analytical and simulation modeling approach

    NASA Astrophysics Data System (ADS)

    Chiadamrong, N.; Piyathanavong, V.

    2017-12-01

    Models that aim to optimize the design of supply chain networks have gained more interest in the supply chain literature. Mixed-integer linear programming and discrete-event simulation are widely used for such an optimization problem. We present a hybrid approach to support decisions for supply chain network design using a combination of analytical and discrete-event simulation models. The proposed approach is based on iterative procedures until the difference between subsequent solutions satisfies the pre-determined termination criteria. The effectiveness of proposed approach is illustrated by an example, which shows closer to optimal results with much faster solving time than the results obtained from the conventional simulation-based optimization model. The efficacy of this proposed hybrid approach is promising and can be applied as a powerful tool in designing a real supply chain network. It also provides the possibility to model and solve more realistic problems, which incorporate dynamism and uncertainty.

  1. Molecular weight kinetics and chain scission models for dextran polymers during ultrasonic degradation.

    PubMed

    Pu, Yuanyuan; Zou, Qingsong; Hou, Dianzhi; Zhang, Yiping; Chen, Shan

    2017-01-20

    Ultrasonic degradation of six dextran samples with different initial molecular weights (IMW) has been performed to investigate the degradation behavior and chain scission mechanism of dextrans. The weight-average molecular weight (Mw) and polydispersity index (D value) were monitored by High Performance Gel Permeation Chromatography (HPGPC). Results showed that Mw and D value decreased with increasing ultrasonic time, resulting in a more homologous dextran solution with lower molecular weight. A significant degradation occurred in dextrans with higher IMW, particularly at the initial stage of the ultrasonic treatment. The Malhotra model was found to well describe the molecular weight kinetics for all dextran samples. Experimental data was fitted into two chain scission models to study dextran chain scission mechanism and the model performance was compared. Results indicated that the midpoint scission model agreed well with experimental results, with a linear regression factor of R 2 >0.99. Copyright © 2016 Elsevier Ltd. All rights reserved.

  2. Single-polymer dynamics under constraints: scaling theory and computer experiment.

    PubMed

    Milchev, Andrey

    2011-03-16

    The relaxation, diffusion and translocation dynamics of single linear polymer chains in confinement is briefly reviewed with emphasis on the comparison between theoretical scaling predictions and observations from experiment or, most frequently, from computer simulations. Besides cylindrical, spherical and slit-like constraints, related problems such as the chain dynamics in a random medium and the translocation dynamics through a nanopore are also considered. Another particular kind of confinement is imposed by polymer adsorption on attractive surfaces or selective interfaces--a short overview of single-chain dynamics is also contained in this survey. While both theory and numerical experiments consider predominantly coarse-grained models of self-avoiding linear chain molecules with typically Rouse dynamics, we also note some recent studies which examine the impact of hydrodynamic interactions on polymer dynamics in confinement. In all of the aforementioned cases we focus mainly on the consequences of imposed geometric restrictions on single-chain dynamics and try to check our degree of understanding by assessing the agreement between theoretical predictions and observations.

  3. Optimizing decentralized production-distribution planning problem in a multi-period supply chain network under uncertainty

    NASA Astrophysics Data System (ADS)

    Nourifar, Raheleh; Mahdavi, Iraj; Mahdavi-Amiri, Nezam; Paydar, Mohammad Mahdi

    2017-09-01

    Decentralized supply chain management is found to be significantly relevant in today's competitive markets. Production and distribution planning is posed as an important optimization problem in supply chain networks. Here, we propose a multi-period decentralized supply chain network model with uncertainty. The imprecision related to uncertain parameters like demand and price of the final product is appropriated with stochastic and fuzzy numbers. We provide mathematical formulation of the problem as a bi-level mixed integer linear programming model. Due to problem's convolution, a structure to solve is developed that incorporates a novel heuristic algorithm based on Kth-best algorithm, fuzzy approach and chance constraint approach. Ultimately, a numerical example is constructed and worked through to demonstrate applicability of the optimization model. A sensitivity analysis is also made.

  4. Model systems for single molecule polymer dynamics

    PubMed Central

    Latinwo, Folarin

    2012-01-01

    Double stranded DNA (dsDNA) has long served as a model system for single molecule polymer dynamics. However, dsDNA is a semiflexible polymer, and the structural rigidity of the DNA double helix gives rise to local molecular properties and chain dynamics that differ from flexible chains, including synthetic organic polymers. Recently, we developed single stranded DNA (ssDNA) as a new model system for single molecule studies of flexible polymer chains. In this work, we discuss model polymer systems in the context of “ideal” and “real” chain behavior considering thermal blobs, tension blobs, hydrodynamic drag and force–extension relations. In addition, we present monomer aspect ratio as a key parameter describing chain conformation and dynamics, and we derive dynamical scaling relations in terms of this molecular-level parameter. We show that asymmetric Kuhn segments can suppress monomer–monomer interactions, thereby altering global chain dynamics. Finally, we discuss ssDNA in the context of a new model system for single molecule polymer dynamics. Overall, we anticipate that future single polymer studies of flexible chains will reveal new insight into the dynamic behavior of “real” polymers, which will highlight the importance of molecular individualism and the prevalence of non-linear phenomena. PMID:22956980

  5. A mechanical comparison of linear and double-looped hung supplemental heavy chain resistance to the back squat: a case study.

    PubMed

    Neelly, Kurt R; Terry, Joseph G; Morris, Martin J

    2010-01-01

    A relatively new and scarcely researched technique to increase strength is the use of supplemental heavy chain resistance (SHCR) in conjunction with plate weights to provide variable resistance to free weight exercises. The purpose of this case study was to determine the actual resistance being provided by a double-looped versus a linear hung SHCR to the back squat exercise. The linear technique simply hangs the chain directly from the bar, whereas the double-looped technique uses a smaller chain to adjust the height of the looped chain. In both techniques, as the squat descends, chain weight is unloaded onto the floor, and as the squat ascends, chain weight is progressively loaded back as resistance. One experienced and trained male weight lifter (age = 33 yr; height = 1.83 m; weight = 111.4 kg) served as the subject. Plate weight was set at 84.1 kg, approximately 50% of the subject's 1 repetition maximum. The SHCR was affixed to load cells, sampling at a frequency of 500 Hz, which were affixed to the Olympic bar. Data were collected as the subject completed the back squat under the following conditions: double-looped 1 chain (9.6 kg), double-looped 2 chains (19.2 kg), linear 1 chain, and linear 2 chains. The double-looped SHCR resulted in a 78-89% unloading of the chain weight at the bottom of the squat, whereas the linear hanging SHCR resulted in only a 36-42% unloading. The double-looped technique provided nearly 2 times the variable resistance at the top of the squat compared with the linear hanging technique, showing that attention must be given to the technique used to hang SHCR.

  6. Self-Assembly of Emulsion Droplets into Polymer Chains

    NASA Astrophysics Data System (ADS)

    Bargteil, Dylan; McMullen, Angus; Brujic, Jasna

    We experimentally investigate `beads-on-a-string' models of polymers using the spontaneous assembly of emulsion droplets into linear chains. Droplets functionalized with surface-mobile DNA allow for programmable 'monomers' through which we can influence the three-dimensional structure of the assembled 'polymer'. Such model polymers can be used to study conformational changes of polypeptides and the principles governing protein folding. In our system, we find that droplets bind via complementary DNA strands that are recruited into adhesion patches. Recruitment is driven by the DNA hybridization energy, and is limited by the energy cost of surface deformation and the entropy loss of the mobile linkers, yielding adhesion patches of a characteristic size with a given number of linkers. By tuning the initial surface coverage of linkers, we control valency between the droplets to create linear or branched polymer chains. We additionally control the flexibility of the model polymers by varying the salt concentration and study their dynamics between extended and collapsed states. This system opens the possibility of programming stable three-dimensional structures, such as those found within folded proteins.

  7. Modeling of Interfacial Modification Effects on Thermal Conductivity of Carbon Nanotube Composites

    NASA Technical Reports Server (NTRS)

    Clancy, Thomas C.; Gates, Thomas S.

    2006-01-01

    The effect of functionalization of carbon nanotubes on the thermal conductivity of nanocomposites has been studied using a multi-scale modeling approach. These results predict that grafting linear hydrocarbon chains to the surface of a single wall carbon nanotube with covalent chemical bonds should result in a significant increase in the thermal conductivity of these nanocomposites. This is due to the decrease in the interfacial thermal (Kapitza) resistance between the single wall carbon nanotube and the surrounding polymer matrix upon chemical functionalization. The nanocomposites studied here consist of single wall carbon nanotubes in a bulk poly(ethylene vinyl acetate) matrix. The nanotubes are functionalized by end-grafting linear hydrocarbon chains of varying length to the surface of the nanotube. The effect which this functionalization has on the interfacial thermal resistance is studied by molecular dynamics simulation. Interfacial thermal resistance values are calculated for a range of chemical grafting densities and with several chain lengths. These results are subsequently used in an analytical model to predict the resulting effect on the bulk thermal conductivity of the nanocomposite.

  8. Stochastic thermodynamics for Ising chain and symmetric exclusion process.

    PubMed

    Toral, R; Van den Broeck, C; Escaff, D; Lindenberg, Katja

    2017-03-01

    We verify the finite-time fluctuation theorem for a linear Ising chain in contact with heat reservoirs at its ends. Analytic results are derived for a chain consisting of two spins. The system can be mapped onto a model for particle transport, namely, the symmetric exclusion process in contact with thermal and particle reservoirs. We modify the symmetric exclusion process to represent a thermal engine and reproduce universal features of the efficiency at maximum power.

  9. Electrostatic persistence length.

    PubMed

    Fixman, Marshall

    2010-03-11

    The persistence length is calculated for polyelectrolyte chains with fixed bond lengths and bond angles (pi-theta), and a potential energy consisting of the screened Coulomb interaction between beads, potential wells alpha phi(i)2 for the dihedral angles phi(i), and coupling terms beta phi(i) phi(i+/-1). This model defines a librating chain that reduces in appropriate limits to the freely rotating or wormlike chains, it can accommodate local crumpling or extreme stiffness, and it is easy to simulate. A planar-quadratic (pq), analytic approximation is based on an expansion of the electrostatic energy in eigenfunctions of the quadratic form that describes the backbone energy, and on the assumption that the quadratic form not only is positive but also adequately confines the chain in an infinite phase space of dihedral angles to the physically unique part with all |phi(i)| < pi. The pq approximation is available under these weak constraints, but the simulations confirm its quantitative accuracy only under the expected condition that alpha is large, that is, for very stiff chains. Stiff chains can also be simulated with small alpha and small theta and compared to an OSF approximation suitably generalized to chains with finite rather than vanishing theta, and increasing agreement with OSF is found the smaller is theta. The two approximations, one becoming exact as alpha --> infinity with fixed theta, the other as theta --> 0 with fixed alpha, are quantitatively similar in behavior, both giving a persistence length P = P0 + aD2 for stiff chains, where D is the Debye length. However, the coefficient apq is about twice the value of aOSF. Under other conditions the simulations show that P may or not be linear in D2 at small or moderate D, depending on the magnitudes of alpha, beta, theta, and the charge density but always becomes linear at large D. Even at a moderately low charge density, corresponding to fewer than 20% of the beads being charged, and with strong crumpling induced by large beta, increasing D dissolves blobs and recovers a linear dependence of P on D2, although a lower power of D gives an adequate fit at moderate D. For the class of models considered, it is concluded that the only universal feature is the asymptotic linearity of P in D2, regardless of flexibility or stiffness.

  10. Analysis of Nuclear Factor-κB (NF-κB) Essential Modulator (NEMO) Binding to Linear and Lysine-linked Ubiquitin Chains and Its Role in the Activation of NF-κB*

    PubMed Central

    Kensche, Tobias; Tokunaga, Fuminori; Ikeda, Fumiyo; Goto, Eiji; Iwai, Kazuhiro; Dikic, Ivan

    2012-01-01

    Nuclear factor-κB (NF-κB) essential modulator (NEMO), a component of the inhibitor of κB kinase (IKK) complex, controls NF-κB signaling by binding to ubiquitin chains. Structural studies of NEMO provided a rationale for the specific binding between the UBAN (ubiquitin binding in ABIN and NEMO) domain of NEMO and linear (Met-1-linked) di-ubiquitin chains. Full-length NEMO can also interact with Lys-11-, Lys-48-, and Lys-63-linked ubiquitin chains of varying length in cells. Here, we show that purified full-length NEMO binds preferentially to linear ubiquitin chains in competition with lysine-linked ubiquitin chains of defined length, including long Lys-63-linked deca-ubiquitins. Linear di-ubiquitins were sufficient to activate both the IKK complex in vitro and to trigger maximal NF-κB activation in cells. In TNFα-stimulated cells, NEMO chimeras engineered to bind exclusively to Lys-63-linked ubiquitin chains mediated partial NF-κB activation compared with cells expressing NEMO that binds to linear ubiquitin chains. We propose that NEMO functions as a high affinity receptor for linear ubiquitin chains and a low affinity receptor for long lysine-linked ubiquitin chains. This phenomenon could explain quantitatively distinct NF-κB activation patterns in response to numerous cell stimuli. PMID:22605335

  11. Integrated forward and reverse supply chain: A tire case study.

    PubMed

    Pedram, Ali; Yusoff, Nukman Bin; Udoncy, Olugu Ezutah; Mahat, Abu Bakar; Pedram, Payam; Babalola, Ayo

    2017-02-01

    This paper attempts to integrate both a forward and reverse supply chain to design a closed-loop supply chain network (CLSC). The problem in the design of a CLSC network is uncertainty in demand, return products and the quality of return products. Scenario analyses are generated to overcome this uncertainty. In contrast to the existing supply chain network design models, a new application of a CLSC network was studied in this paper to reduce waste. A multi-product, multi-tier mixed integer linear model is developed for a CLSC network design. The main objective is to maximize profit and provide waste management decision support in order to minimize pollution. The result shows applicability of the model in the tire industry. The model determines the number and the locations of facilities and the material flows between these facilities. Copyright © 2016 Elsevier Ltd. All rights reserved.

  12. Decision on risk-averse dual-channel supply chain under demand disruption

    NASA Astrophysics Data System (ADS)

    Yan, Bo; Jin, Zijie; Liu, Yanping; Yang, Jianbo

    2018-02-01

    We studied dual-channel supply chains using centralized and decentralized decision-making models. We also conducted a comparative analysis of the decisions before and after demand disruption. The study shows that the amount of change in decision-making is a linear function of the amount of demand disruption, and it is independent of the risk-averse coefficient. The optimal sales volume decision of the disturbing supply chain is related to market share and demand disruption in the decentralized decision-making model. The optimal decision is only influenced by demand disruption in the centralized decision-making model. The stability of the sales volume of the two models is related to market share and demand disruption. The optimal system production of the two models shows robustness, but their stable internals are different.

  13. Development and evaluation of a reservoir model for the Chain of Lakes in Illinois

    USGS Publications Warehouse

    Domanski, Marian M.

    2017-01-27

    Forecasts of flows entering and leaving the Chain of Lakes reservoir on the Fox River in northeastern Illinois are critical information to water-resource managers who determine the optimal operation of the dam at McHenry, Illinois, to help minimize damages to property and loss of life because of flooding on the Fox River. In 2014, the U.S. Geological Survey; the Illinois Department of Natural Resources, Office of Water Resources; and National Weather Service, North Central River Forecast Center began a cooperative study to develop a system to enable engineers and planners to simulate and communicate flows and to prepare proactively for precipitation events in near real time in the upper Fox River watershed. The purpose of this report is to document the development and evaluation of the Chain of Lakes reservoir model developed in this study.The reservoir model for the Chain of Lakes was developed using the Hydrologic Engineering Center–Reservoir System Simulation program. Because of the complex relation between the dam headwater and reservoir pool elevations, the reservoir model uses a linear regression model that relates dam headwater elevation to reservoir pool elevation. The linear regression model was developed using 17 U.S. Geological Survey streamflow measurements, along with the gage height in the reservoir pool and the gage height at the dam headwater. The Nash-Sutcliffe model efficiency coefficients for all three linear regression model variables ranged from 0.90 to 0.98.The reservoir model performance was evaluated by graphically comparing simulated and observed reservoir pool elevation time series during nine periods of high pool elevation. In addition, the peak elevations during these time periods were graphically compared to the closest-in-time observed pool elevation peak. The mean difference in the simulated and observed peak elevations was -0.03 feet, with a standard deviation of 0.19 feet. The Nash-Sutcliffe coefficient for peak prediction was calculated as 0.94. Evaluation of the model based on accuracy of peak prediction and the ability to simulate an elevation time series showed the performance of the model was satisfactory.

  14. Representing Lumped Markov Chains by Minimal Polynomials over Field GF(q)

    NASA Astrophysics Data System (ADS)

    Zakharov, V. M.; Shalagin, S. V.; Eminov, B. F.

    2018-05-01

    A method has been proposed to represent lumped Markov chains by minimal polynomials over a finite field. The accuracy of representing lumped stochastic matrices, the law of lumped Markov chains depends linearly on the minimum degree of polynomials over field GF(q). The method allows constructing the realizations of lumped Markov chains on linear shift registers with a pre-defined “linear complexity”.

  15. Constructing and decoding unconventional ubiquitin chains.

    PubMed

    Behrends, Christian; Harper, J Wade

    2011-05-01

    One of the most notable discoveries in the ubiquitin system during the past decade is the extensive use of diverse chain linkages to control signaling networks. Although the utility of Lys48- and Lys63-linked chains in protein turnover and molecular assembly, respectively, are well known, we are only beginning to understand how unconventional chain linkages are formed on target proteins and how such linkages are decoded by specific binding proteins. In this review, we summarize recent efforts to elucidate the machinery and mechanisms controlling assembly of Lys11-linked and linear (or Met1-linked) ubiquitin chains, and describe current models for how these chain types function in immune signaling and cell-cycle control.

  16. Using state variables to model the response of tumour cells to radiation and heat: a novel multi-hit-repair approach.

    PubMed

    Scheidegger, Stephan; Fuchs, Hans U; Zaugg, Kathrin; Bodis, Stephan; Füchslin, Rudolf M

    2013-01-01

    In order to overcome the limitations of the linear-quadratic model and include synergistic effects of heat and radiation, a novel radiobiological model is proposed. The model is based on a chain of cell populations which are characterized by the number of radiation induced damages (hits). Cells can shift downward along the chain by collecting hits and upward by a repair process. The repair process is governed by a repair probability which depends upon state variables used for a simplistic description of the impact of heat and radiation upon repair proteins. Based on the parameters used, populations up to 4-5 hits are relevant for the calculation of the survival. The model describes intuitively the mathematical behaviour of apoptotic and nonapoptotic cell death. Linear-quadratic-linear behaviour of the logarithmic cell survival, fractionation, and (with one exception) the dose rate dependencies are described correctly. The model covers the time gap dependence of the synergistic cell killing due to combined application of heat and radiation, but further validation of the proposed approach based on experimental data is needed. However, the model offers a work bench for testing different biological concepts of damage induction, repair, and statistical approaches for calculating the variables of state.

  17. The E3 ligase HOIP specifies linear ubiquitin chain assembly through its RING-IBR-RING domain and the unique LDD extension

    PubMed Central

    Smit, Judith J; Monteferrario, Davide; Noordermeer, Sylvie M; van Dijk, Willem J; van der Reijden, Bert A; Sixma, Titia K

    2012-01-01

    Activation of the NF-κB pathway requires the formation of Met1-linked ‘linear' ubiquitin chains on NEMO, which is catalysed by the Linear Ubiquitin Chain Assembly Complex (LUBAC) E3 consisting of HOIP, HOIL-1L and Sharpin. Here, we show that both LUBAC catalytic activity and LUBAC specificity for linear ubiquitin chain formation are embedded within the RING-IBR-RING (RBR) ubiquitin ligase subunit HOIP. Linear ubiquitin chain formation by HOIP proceeds via a two-step mechanism involving both RING and HECT E3-type activities. RING1-IBR catalyses the transfer of ubiquitin from the E2 onto RING2, to transiently form a HECT-like covalent thioester intermediate. Next, the ubiquitin is transferred from HOIP onto the N-terminus of a target ubiquitin. This transfer is facilitated by a unique region in the C-terminus of HOIP that we termed ‘Linear ubiquitin chain Determining Domain' (LDD), which may coordinate the acceptor ubiquitin. Consistent with this mechanism, the RING2-LDD region was found to be important for NF-κB activation in cellular assays. These data show how HOIP combines a general RBR ubiquitin ligase mechanism with unique, LDD-dependent specificity for producing linear ubiquitin chains. PMID:22863777

  18. Nonlinear ball chain waveguides for acoustic emission and ultrasound sensing of ablation

    NASA Astrophysics Data System (ADS)

    Pearson, Stephen H.

    Harsh environment acoustic emission and ultrasonic wave sensing applications often benefit from placing the sensor in a remote and more benign physical location by using waveguides to transmit elastic waves between the structural location under test and the transducer. Waveguides are normally designed to have high fidelity over broad frequency ranges to minimize distortion -- often difficult to achieve in practice. This thesis reports on an examination of using nonlinear ball chain waveguides for the transmission of acoustic emission and ultrasonic waves for the monitoring of thermal protection systems undergoing severe heat loading, leading to ablation and similar processes. Experiments test the nonlinear propagation of solitary, harmonic and mixed harmonic elastic waves through a copper tube filled with steel and elastomer balls and various other waveguides. Triangulation of pencil lead breaks occurs on a steel plate. Data are collected concerning the usage of linear waveguides and a water-cooled linear waveguide. Data are collected from a second water-cooled waveguide monitoring Atmospheric Reentry Materials in UVM's Inductively-Coupled Plasma Torch Facility. The motion of the particles in the dimer waveguides is linearly modeled with a three ball and spring chain model and the results are compared per particle. A theoretical nonlinear model is presented which is capable of exactly modeling the motion of the dimer chains. The shape of the waveform propagating through the dimer chain is modeled in a sonic vacuum. Mechanical pulses of varying time widths and amplitudes are launched into one end of the ball chain waveguide and observed at the other end in both time and frequency domains. Similarly, harmonic and mixed harmonic mechanical loads are applied to one end of the waveguide. Balls of different materials are analyzed and discriminated into categories. A copper tube packed with six steel particles, nine steel or marble particles and a longer copper tube packed with 17 steel particles are studied with a frequency sweep. The deformation experienced by a single steel particle in the dimer chain is approximated. Steel ball waveguides and steel rods are fitted with piezoelectric sensors to monitor the force at different points inside the waveguide during testing. The corresponding frequency responses, including intermodulation products, are compared based on amplitude and preloads. A nonlinear mechanical model describes the motion of the dimer chains in a vacuum. Based on the results of these studies it is anticipated that a nonlinear waveguide will be designed, built, and tested as a possible replacement for the high-fidelity waveguides presently being used in an Inductively Coupled Plasma Torch facility for high heat flux thermal protection system testing. The design is intended to accentuate acoustic emission signals of interest, while suppressing other forms of elastic wave noise.

  19. Stochastic differential equation model for linear growth birth and death processes with immigration and emigration

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Granita, E-mail: granitafc@gmail.com; Bahar, A.

    This paper discusses on linear birth and death with immigration and emigration (BIDE) process to stochastic differential equation (SDE) model. Forward Kolmogorov equation in continuous time Markov chain (CTMC) with a central-difference approximation was used to find Fokker-Planckequation corresponding to a diffusion process having the stochastic differential equation of BIDE process. The exact solution, mean and variance function of BIDE process was found.

  20. The knowledge-value chain: A conceptual framework for knowledge translation in health.

    PubMed

    Landry, Réjean; Amara, Nabil; Pablos-Mendes, Ariel; Shademani, Ramesh; Gold, Irving

    2006-08-01

    This article briefly discusses knowledge translation and lists the problems associated with it. Then it uses knowledge-management literature to develop and propose a knowledge-value chain framework in order to provide an integrated conceptual model of knowledge management and application in public health organizations. The knowledge-value chain is a non-linear concept and is based on the management of five dyadic capabilities: mapping and acquisition, creation and destruction, integration and sharing/transfer, replication and protection, and performance and innovation.

  1. Transition records of stationary Markov chains.

    PubMed

    Naudts, Jan; Van der Straeten, Erik

    2006-10-01

    In any Markov chain with finite state space the distribution of transition records always belongs to the exponential family. This observation is used to prove a fluctuation theorem, and to show that the dynamical entropy of a stationary Markov chain is linear in the number of steps. Three applications are discussed. A known result about entropy production is reproduced. A thermodynamic relation is derived for equilibrium systems with Metropolis dynamics. Finally, a link is made with recent results concerning a one-dimensional polymer model.

  2. The knowledge-value chain: A conceptual framework for knowledge translation in health.

    PubMed Central

    Landry, Réjean; Amara, Nabil; Pablos-Mendes, Ariel; Shademani, Ramesh; Gold, Irving

    2006-01-01

    This article briefly discusses knowledge translation and lists the problems associated with it. Then it uses knowledge-management literature to develop and propose a knowledge-value chain framework in order to provide an integrated conceptual model of knowledge management and application in public health organizations. The knowledge-value chain is a non-linear concept and is based on the management of five dyadic capabilities: mapping and acquisition, creation and destruction, integration and sharing/transfer, replication and protection, and performance and innovation. PMID:16917645

  3. Linear ubiquitin chains: enzymes, mechanisms and biology

    PubMed Central

    2017-01-01

    Ubiquitination is a versatile post-translational modification that regulates a multitude of cellular processes. Its versatility is based on the ability of ubiquitin to form multiple types of polyubiquitin chains, which are recognized by specific ubiquitin receptors to induce the required cellular response. Linear ubiquitin chains are linked through Met 1 and have been established as important players of inflammatory signalling and apoptotic cell death. These chains are generated by a ubiquitin E3 ligase complex called the linear ubiquitin chain assembly complex (LUBAC) that is thus far the only E3 ligase capable of forming linear ubiquitin chains. The complex consists of three subunits, HOIP, HOIL-1L and SHARPIN, each of which have specific roles in the observed biological functions of LUBAC. Furthermore, LUBAC has been found to be associated with OTULIN and CYLD, deubiquitinases that disassemble linear chains and counterbalance the E3 ligase activity of LUBAC. Gene mutations in HOIP, HOIL-1L and OTULIN are found in human patients who suffer from autoimmune diseases, and HOIL-1L mutations are also found in myopathy patients. In this paper, we discuss the mechanisms of linear ubiquitin chain generation and disassembly by their respective enzymes and review our current understanding of their biological functions and association with human diseases. PMID:28446710

  4. Linear ubiquitin chains: enzymes, mechanisms and biology.

    PubMed

    Rittinger, Katrin; Ikeda, Fumiyo

    2017-04-01

    Ubiquitination is a versatile post-translational modification that regulates a multitude of cellular processes. Its versatility is based on the ability of ubiquitin to form multiple types of polyubiquitin chains, which are recognized by specific ubiquitin receptors to induce the required cellular response. Linear ubiquitin chains are linked through Met 1 and have been established as important players of inflammatory signalling and apoptotic cell death. These chains are generated by a ubiquitin E3 ligase complex called the linear ubiquitin chain assembly complex (LUBAC) that is thus far the only E3 ligase capable of forming linear ubiquitin chains. The complex consists of three subunits, HOIP, HOIL-1L and SHARPIN, each of which have specific roles in the observed biological functions of LUBAC. Furthermore, LUBAC has been found to be associated with OTULIN and CYLD, deubiquitinases that disassemble linear chains and counterbalance the E3 ligase activity of LUBAC. Gene mutations in HOIP, HOIL-1L and OTULIN are found in human patients who suffer from autoimmune diseases, and HOIL-1L mutations are also found in myopathy patients. In this paper, we discuss the mechanisms of linear ubiquitin chain generation and disassembly by their respective enzymes and review our current understanding of their biological functions and association with human diseases. © 2017 The Authors.

  5. Quality tracing in meat supply chains

    PubMed Central

    Mack, Miriam; Dittmer, Patrick; Veigt, Marius; Kus, Mehmet; Nehmiz, Ulfert; Kreyenschmidt, Judith

    2014-01-01

    The aim of this study was the development of a quality tracing model for vacuum-packed lamb that is applicable in different meat supply chains. Based on the development of relevant sensory parameters, the predictive model was developed by combining a linear primary model and the Arrhenius model as the secondary model. Then a process analysis was conducted to define general requirements for the implementation of the temperature-based model into a meat supply chain. The required hardware and software for continuous temperature monitoring were developed in order to use the model under practical conditions. Further on a decision support tool was elaborated in order to use the model as an effective tool in combination with the temperature monitoring equipment for the improvement of quality and storage management within the meat logistics network. Over the long term, this overall procedure will support the reduction of food waste and will improve the resources efficiency of food production. PMID:24797136

  6. Quality tracing in meat supply chains.

    PubMed

    Mack, Miriam; Dittmer, Patrick; Veigt, Marius; Kus, Mehmet; Nehmiz, Ulfert; Kreyenschmidt, Judith

    2014-06-13

    The aim of this study was the development of a quality tracing model for vacuum-packed lamb that is applicable in different meat supply chains. Based on the development of relevant sensory parameters, the predictive model was developed by combining a linear primary model and the Arrhenius model as the secondary model. Then a process analysis was conducted to define general requirements for the implementation of the temperature-based model into a meat supply chain. The required hardware and software for continuous temperature monitoring were developed in order to use the model under practical conditions. Further on a decision support tool was elaborated in order to use the model as an effective tool in combination with the temperature monitoring equipment for the improvement of quality and storage management within the meat logistics network. Over the long term, this overall procedure will support the reduction of food waste and will improve the resources efficiency of food production.

  7. An integrated supply chain model for new products with imprecise production and supply under scenario dependent fuzzy random demand

    NASA Astrophysics Data System (ADS)

    Nagar, Lokesh; Dutta, Pankaj; Jain, Karuna

    2014-05-01

    In the present day business scenario, instant changes in market demand, different source of materials and manufacturing technologies force many companies to change their supply chain planning in order to tackle the real-world uncertainty. The purpose of this paper is to develop a multi-objective two-stage stochastic programming supply chain model that incorporates imprecise production rate and supplier capacity under scenario dependent fuzzy random demand associated with new product supply chains. The objectives are to maximise the supply chain profit, achieve desired service level and minimise financial risk. The proposed model allows simultaneous determination of optimum supply chain design, procurement and production quantities across the different plants, and trade-offs between inventory and transportation modes for both inbound and outbound logistics. Analogous to chance constraints, we have used the possibility measure to quantify the demand uncertainties and the model is solved using fuzzy linear programming approach. An illustration is presented to demonstrate the effectiveness of the proposed model. Sensitivity analysis is performed for maximisation of the supply chain profit with respect to different confidence level of service, risk and possibility measure. It is found that when one considers the service level and risk as robustness measure the variability in profit reduces.

  8. Monte Carlo simulations of lattice models for single polymer systems

    NASA Astrophysics Data System (ADS)

    Hsu, Hsiao-Ping

    2014-10-01

    Single linear polymer chains in dilute solutions under good solvent conditions are studied by Monte Carlo simulations with the pruned-enriched Rosenbluth method up to the chain length N ˜ O(10^4). Based on the standard simple cubic lattice model (SCLM) with fixed bond length and the bond fluctuation model (BFM) with bond lengths in a range between 2 and sqrt{10}, we investigate the conformations of polymer chains described by self-avoiding walks on the simple cubic lattice, and by random walks and non-reversible random walks in the absence of excluded volume interactions. In addition to flexible chains, we also extend our study to semiflexible chains for different stiffness controlled by a bending potential. The persistence lengths of chains extracted from the orientational correlations are estimated for all cases. We show that chains based on the BFM are more flexible than those based on the SCLM for a fixed bending energy. The microscopic differences between these two lattice models are discussed and the theoretical predictions of scaling laws given in the literature are checked and verified. Our simulations clarify that a different mapping ratio between the coarse-grained models and the atomistically realistic description of polymers is required in a coarse-graining approach due to the different crossovers to the asymptotic behavior.

  9. Parameterization of a mesoscopic model for the self-assembly of linear sodium alkyl sulfates

    NASA Astrophysics Data System (ADS)

    Mai, Zhaohuan; Couallier, Estelle; Rakib, Mohammed; Rousseau, Bernard

    2014-05-01

    A systematic approach to develop mesoscopic models for a series of linear anionic surfactants (CH3(CH2)n - 1OSO3Na, n = 6, 9, 12, 15) by dissipative particle dynamics (DPD) simulations is presented in this work. The four surfactants are represented by coarse-grained models composed of the same head group and different numbers of identical tail beads. The transferability of the DPD model over different surfactant systems is carefully checked by adjusting the repulsive interaction parameters and the rigidity of surfactant molecules, in order to reproduce key equilibrium properties of the aqueous micellar solutions observed experimentally, including critical micelle concentration (CMC) and average micelle aggregation number (Nag). We find that the chain length is a good index to optimize the parameters and evaluate the transferability of the DPD model. Our models qualitatively reproduce the essential properties of these surfactant analogues with a set of best-fit parameters. It is observed that the logarithm of the CMC value decreases linearly with the surfactant chain length, in agreement with Klevens' rule. With the best-fit and transferable set of parameters, we have been able to calculate the free energy contribution to micelle formation per methylene unit of -1.7 kJ/mol, very close to the experimentally reported value.

  10. Primitive-path statistics of entangled polymers: mapping multi-chain simulations onto single-chain mean-field models

    NASA Astrophysics Data System (ADS)

    Steenbakkers, Rudi J. A.; Tzoumanekas, Christos; Li, Ying; Liu, Wing Kam; Kröger, Martin; Schieber, Jay D.

    2014-01-01

    We present a method to map the full equilibrium distribution of the primitive-path (PP) length, obtained from multi-chain simulations of polymer melts, onto a single-chain mean-field ‘target’ model. Most previous works used the Doi-Edwards tube model as a target. However, the average number of monomers per PP segment, obtained from multi-chain PP networks, has consistently shown a discrepancy of a factor of two with respect to tube-model estimates. Part of the problem is that the tube model neglects fluctuations in the lengths of PP segments, the number of entanglements per chain and the distribution of monomers among PP segments, while all these fluctuations are observed in multi-chain simulations. Here we use a recently proposed slip-link model, which includes fluctuations in all these variables as well as in the spatial positions of the entanglements. This turns out to be essential to obtain qualitative and quantitative agreement with the equilibrium PP-length distribution obtained from multi-chain simulations. By fitting this distribution, we are able to determine two of the three parameters of the model, which govern its equilibrium properties. This mapping is executed for four different linear polymers and for different molecular weights. The two parameters are found to depend on chemistry, but not on molecular weight. The model predicts a constant plateau modulus minus a correction inversely proportional to molecular weight. The value for well-entangled chains, with the parameters determined ab initio, lies in the range of experimental data for the materials investigated.

  11. Multivalency of Sonic hedgehog conjugated to linear polymer chains modulates protein potency.

    PubMed

    Wall, Samuel T; Saha, Krishanu; Ashton, Randolph S; Kam, Kimberly R; Schaffer, David V; Healy, Kevin E

    2008-04-01

    A potently active multivalent form of the protein Sonic hedgehog (Shh) was produced by bioconjugation of a modified recombinant form of Shh to the linear polymers poly(acrylic acid) (pAAc) and hyaluronic acid (HyA) via a two-step reaction exploiting carboimiide and maleimide chemistry. Efficiency of the conjugation was approximately 75% even at stoichiometric ratios of 30 Shh molecules per linear HyA chain (i.e., 30:1 Shh/HyA). Bioactivity of the conjugates was tested via a cellular assay across a range of stoichiometric ratios of Shh molecules to HyA linear chains, which was varied from 0.6:1 Shh/HyA to 22:1 Shh/HyA. Results indicate that low conjugation ratios decrease Shh bioactivity and high ratios increase this activity beyond the potency of monomeric Shh, with approximately equal activity between monomeric soluble Shh and conjugated Shh at 7:1 Shh/HyA. In addition, high-ratio constructs increased angiogenesis determined by the in vivo chick chorioallantoic membrane (CAM) assay. These results are captured by a kinetic model of multiple interactions between the Shh/HyA conjugates and cell surface receptors resulting in higher cell signaling at lower bulk Shh concentrations.

  12. Appraisal of jump distributions in ensemble-based sampling algorithms

    NASA Astrophysics Data System (ADS)

    Dejanic, Sanda; Scheidegger, Andreas; Rieckermann, Jörg; Albert, Carlo

    2017-04-01

    Sampling Bayesian posteriors of model parameters is often required for making model-based probabilistic predictions. For complex environmental models, standard Monte Carlo Markov Chain (MCMC) methods are often infeasible because they require too many sequential model runs. Therefore, we focused on ensemble methods that use many Markov chains in parallel, since they can be run on modern cluster architectures. Little is known about how to choose the best performing sampler, for a given application. A poor choice can lead to an inappropriate representation of posterior knowledge. We assessed two different jump moves, the stretch and the differential evolution move, underlying, respectively, the software packages EMCEE and DREAM, which are popular in different scientific communities. For the assessment, we used analytical posteriors with features as they often occur in real posteriors, namely high dimensionality, strong non-linear correlations or multimodality. For posteriors with non-linear features, standard convergence diagnostics based on sample means can be insufficient. Therefore, we resorted to an entropy-based convergence measure. We assessed the samplers by means of their convergence speed, robustness and effective sample sizes. For posteriors with strongly non-linear features, we found that the stretch move outperforms the differential evolution move, w.r.t. all three aspects.

  13. Linear and nonlinear dynamics of isospectral granular chains

    NASA Astrophysics Data System (ADS)

    Chaunsali, R.; Xu, H.; Yang, J.; Kevrekidis, P. G.

    2017-04-01

    We study the dynamics of isospectral granular chains that are highly tunable due to the nonlinear Hertz contact law interaction between the granular particles. The system dynamics can thus be tuned easily from being linear to strongly nonlinear by adjusting the initial compression applied to the chain. In particular, we introduce both discrete and continuous spectral transformation schemes to generate a family of granular chains that are isospectral in their linear limit. Inspired by the principle of supersymmetry in quantum systems, we also introduce a methodology to add or remove certain eigenfrequencies, and we demonstrate numerically that the corresponding physical system can be constructed in the setting of one-dimensional granular crystals. In the linear regime, we highlight the similarities in the elastic wave transmission characteristics of such isospectral systems, and emphasize that the presented mathematical framework allows one to suitably tailor the wave transmission through a general class of granular chains, both ordered and disordered. Moreover, we show how the dynamic response of these structures deviates from its linear limit as we introduce Hertzian nonlinearity in the chain and how nonlinearity breaks the notion of linear isospectrality.

  14. A novel approach for inventory problem in the pharmaceutical supply chain.

    PubMed

    Candan, Gökçe; Yazgan, Harun Reşit

    2016-02-24

    In pharmaceutical enterprises, keeping up with global market conditions is possible with properly selected supply chain management policies. Generally; demand-driven classical supply chain model is used in the pharmaceutical industry. In this study, a new mathematical model is developed to solve an inventory problem in the pharmaceutical supply chain. Unlike the studies in literature, the "shelf life and product transition times" constraints are considered, simultaneously, first time in the pharmaceutical production inventory problem. The problem is formulated as a mixed-integer linear programming (MILP) model with a hybrid time representation. The objective is to maximize total net profit. Effectiveness of the proposed model is illustrated considering a classical and a vendor managed inventory (VMI) supply chain on an experimental study. To show the effectiveness of the model, an experimental study is performed; which contains 2 different supply chain policy (Classical and VMI), 24 and 30 months planning horizon, 10 and 15 different cephalosporin products. Finally the mathematical model is compared to another model in literature and the results show that proposed model is superior. This study suggest a novel approach for solving pharmaceutical inventory problem. The developed model is maximizing total net profit while determining optimal production plan under shelf life and product transition constraints in the pharmaceutical industry. And we believe that the proposed model is much more closed to real life unlike the other studies in literature.

  15. Packing C60 in Boron Nitride Nanotubes

    NASA Astrophysics Data System (ADS)

    Mickelson, W.; Aloni, S.; Han, Wei-Qiang; Cumings, John; Zettl, A.

    2003-04-01

    We have created insulated C60 nanowire by packing C60 molecules into the interior of insulating boron nitride nanotubes (BNNTs). For small-diameter BNNTs, the wire consists of a linear chain of C60 molecules. With increasing BNNT inner diameter, unusual C60 stacking configurations are obtained (including helical, hollow core, and incommensurate) that are unknown for bulk or thin-film forms of C60. C60 in BNNTs thus presents a model system for studying the properties of dimensionally constrained ``silo'' crystal structures. For the linear-chain case, we have fused the C60 molecules to form a single-walled carbon nanotube inside the insulating BNNT.

  16. Application of Nearly Linear Solvers to Electric Power System Computation

    NASA Astrophysics Data System (ADS)

    Grant, Lisa L.

    To meet the future needs of the electric power system, improvements need to be made in the areas of power system algorithms, simulation, and modeling, specifically to achieve a time frame that is useful to industry. If power system time-domain simulations could run in real-time, then system operators would have situational awareness to implement online control and avoid cascading failures, significantly improving power system reliability. Several power system applications rely on the solution of a very large linear system. As the demands on power systems continue to grow, there is a greater computational complexity involved in solving these large linear systems within reasonable time. This project expands on the current work in fast linear solvers, developed for solving symmetric and diagonally dominant linear systems, in order to produce power system specific methods that can be solved in nearly-linear run times. The work explores a new theoretical method that is based on ideas in graph theory and combinatorics. The technique builds a chain of progressively smaller approximate systems with preconditioners based on the system's low stretch spanning tree. The method is compared to traditional linear solvers and shown to reduce the time and iterations required for an accurate solution, especially as the system size increases. A simulation validation is performed, comparing the solution capabilities of the chain method to LU factorization, which is the standard linear solver for power flow. The chain method was successfully demonstrated to produce accurate solutions for power flow simulation on a number of IEEE test cases, and a discussion on how to further improve the method's speed and accuracy is included.

  17. Design and analysis of linear cascade DNA hybridization chain reactions using DNA hairpins

    NASA Astrophysics Data System (ADS)

    Bui, Hieu; Garg, Sudhanshu; Miao, Vincent; Song, Tianqi; Mokhtar, Reem; Reif, John

    2017-01-01

    DNA self-assembly has been employed non-conventionally to construct nanoscale structures and dynamic nanoscale machines. The technique of hybridization chain reactions by triggered self-assembly has been shown to form various interesting nanoscale structures ranging from simple linear DNA oligomers to dendritic DNA structures. Inspired by earlier triggered self-assembly works, we present a system for controlled self-assembly of linear cascade DNA hybridization chain reactions using nine distinct DNA hairpins. NUPACK is employed to assist in designing DNA sequences and Matlab has been used to simulate DNA hairpin interactions. Gel electrophoresis and ensemble fluorescence reaction kinetics data indicate strong evidence of linear cascade DNA hybridization chain reactions. The half-time completion of the proposed linear cascade reactions indicates a linear dependency on the number of hairpins.

  18. An Exactly Solvable Spin Chain Related to Hahn Polynomials

    NASA Astrophysics Data System (ADS)

    Stoilova, Neli I.; van der Jeugt, Joris

    2011-03-01

    We study a linear spin chain which was originally introduced by Shi et al. [Phys. Rev. A 71 (2005), 032309, 5 pages], for which the coupling strength contains a parameter α and depends on the parity of the chain site. Extending the model by a second parameter β, it is shown that the single fermion eigenstates of the Hamiltonian can be computed in explicit form. The components of these eigenvectors turn out to be Hahn polynomials with parameters (α,β) and (α+1,β-1). The construction of the eigenvectors relies on two new difference equations for Hahn polynomials. The explicit knowledge of the eigenstates leads to a closed form expression for the correlation function of the spin chain. We also discuss some aspects of a q-extension of this model.

  19. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Nekrasov, Nikita; ITEP, Moscow; Shatashvili, Samson

    Supersymmetric vacua of two dimensional N = 4 gauge theories with matter, softly broken by the twisted masses down to N = 2, are shown to be in one-to-one correspondence with the eigenstates of integrable spin chain Hamiltonians. Examples include: the Heisenberg SU(2)XXX spin chain which is mapped to the two dimensional U(N) theory with fundamental hypermultiplets, the XXZ spin chain which is mapped to the analogous three dimensional super-Yang-Mills theory compactified on a circle, the XYZ spin chain and eight-vertex model which are related to the four dimensional theory compactified on T{sup 2}. A consequence of our correspondence ismore » the isomorphism of the quantum cohomology ring of various quiver varieties, such as cotangent bundles to (partial) flag varieties and the ring of quantum integrals of motion of various spin chains. The correspondence extends to any spin group, representations, boundary conditions, and inhomogeneity, it includes Sinh-Gordon and non-linear Schroedinger models as well as the dynamical spin chains like Hubbard model. Compactifications of four dimensional N = 2 theories on a two-sphere lead to the instanton-corrected Bethe equations.« less

  20. Plastic deformation in a metallic granular chain

    NASA Astrophysics Data System (ADS)

    Musson, Ryan W.; Carlson, William

    2016-03-01

    Solitary wave response was investigated in a metallic granular chain-piston system using LS-DYNA. A power law hardening material model was used to show that localized plastic deformation is present in a metallic granular chain for an impact velocity of 0.5 m/s. This loss due to plastic deformation was quantified via impulse, and it was shown that the loss scales nearly linearly with impact velocity. Therefore, metallic grains may not be suitable for devices that require high-amplitude solitary waves. There would be too much energy lost to plastic deformation. One can assume that ceramics will behave elastically; therefore, the response of an aluminum oxide granular chain was compared to that of a steel chain.

  1. DNA compaction by poly (amido amine) dendrimers of ammonia cored and ethylene diamine cored

    NASA Astrophysics Data System (ADS)

    Qamhieh, K.; Al-Shawwa, J.

    2017-06-01

    The complexes build-up of DNA and soft particles poly amidoamine (PAMAM) dendrimers of ammonia cored of generations (G1-G6) and ethylenediamine cored of generations (G1-G10) have been studied, using a new theoretical model developed by Qamhieh and coworkers. The model describes the interaction between linear polyelectrolyte (LPE) chain and ion-penetrable spheres. Many factors affecting LPE/dendrimer complex have been investigated such as dendrimer generation, the Bjerrum length, salt concentration, and rigidity of the LPE chain represented by the persistence length. It is found that the wrapping chain length around dendrimer increases by increasing dendrimer`s generation, Bjerrum length, and salt concentration, while decreases by increasing the persistence length of the LPE chain. Also we can conclude that the wrapping length of LPE chain around ethylenediamine cored dendrimers is larger than its length around ammonia cored dendrimers.

  2. Are human spontaneous otoacoustic emissions generated by a chain of coupled nonlinear oscillators?

    PubMed

    Wit, Hero P; van Dijk, Pim

    2012-08-01

    Spontaneous otoacoustic emissions (SOAEs) are generated by self-sustained cochlear oscillators. Properties of a computational model for a linear array of active oscillators with nearest neighbor coupling are investigated. The model can produce many experimentally well-established properties of SOAEs.

  3. Structural and optical properties of self-assembled chains of plasmonic nanocubes

    DOE PAGES

    Klinkova, Anna; Gang, Oleg; Therien-Aubin, Heloise; ...

    2014-10-10

    Solution-based linear self-assembly of metal nanoparticles offers a powerful strategy for creating plasmonic polymers, which, so far, have been formed from spherical nanoparticles and nanorods. Here, we report linear solution-based self-assembly of metal nanocubes (NCs), examine the structural characteristics of the NC chains and demonstrate their advanced optical characteristics. Predominant face-to-face assembly of large NCs coated with short polymer ligands led to a larger volume of hot spots in the chains, a nearly uniform E-field enhancement in the gaps between co-linear NCs and a new coupling mode for NC chains, in comparison with chains of nanospheres with similar dimensions, compositionmore » and surface chemistry. The NC chains exhibited a stronger surface enhanced Raman scattering (SERS) signal, in comparison with linear assemblies of nanospheres. The experimental results were in agreement with finite difference time domain (FDTD) simulations.« less

  4. ChainMail based neural dynamics modeling of soft tissue deformation for surgical simulation.

    PubMed

    Zhang, Jinao; Zhong, Yongmin; Smith, Julian; Gu, Chengfan

    2017-07-20

    Realistic and real-time modeling and simulation of soft tissue deformation is a fundamental research issue in the field of surgical simulation. In this paper, a novel cellular neural network approach is presented for modeling and simulation of soft tissue deformation by combining neural dynamics of cellular neural network with ChainMail mechanism. The proposed method formulates the problem of elastic deformation into cellular neural network activities to avoid the complex computation of elasticity. The local position adjustments of ChainMail are incorporated into the cellular neural network as the local connectivity of cells, through which the dynamic behaviors of soft tissue deformation are transformed into the neural dynamics of cellular neural network. Experiments demonstrate that the proposed neural network approach is capable of modeling the soft tissues' nonlinear deformation and typical mechanical behaviors. The proposed method not only improves ChainMail's linear deformation with the nonlinear characteristics of neural dynamics but also enables the cellular neural network to follow the principle of continuum mechanics to simulate soft tissue deformation.

  5. Bottlebrush-Guided Polymer Crystallization Resulting in Supersoft and Reversibly Moldable Physical Networks

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Daniel, William F. M.; Xie, Guojun; Vatankhah Varnoosfaderani, Mohammad

    The goal of this study is to use ABA triblock copolymers with central bottlebrush B segments and crystalline linear chain A segments to demonstrate the effect of side chains on the formation and mechanical properties of physical networks cross-linked by crystallites. For this purpose, a series of bottlebrush copolymers was synthesized consisting of central amorphous bottlebrush polymer segments with a varying degree of polymerization (DP) of poly(n-butyl acrylate) (PnBA) side chains and linear tail blocks of crystallizable poly(octadecyl acrylate-stat-docosyl acrylate) (poly(ODA-stat-DA)). The materials were generated by sequential atom transfer radical polymerization (ATRP) steps starting with a series of bifunctional macroinitiatorsmore » followed by the growth of two ODA-stat-DA linear-chain tails and eventually growing poly(nBA) side chains with increasing DPs. Crystallization of the poly(ODA-stat-DA) tails resulted in a series of reversible physical networks with bottlebrush strands bridging crystalline cross-links. They displayed very low moduli of elasticity of the order of 10 3–10 4 Pa. These distinct properties are due to the bottlebrush architecture, wherein densely grafted side chains play a dual role by facilitating disentanglement of the network strands and confining crystallization of the linear-chain tails. This combination leads to physical cross-linking of supersoft networks without percolation of the crystalline phase. The cross-link density was effectively controlled by the DP of the side chains with respect to the DP of the linear tails (n A). Furthermore, shorter side chains allowed for crystallization of the linear tails of neighboring bottlebrushes, while steric repulsion between longer side chains hindered the phase separation and crystallization process and prevented network formation.« less

  6. Bottlebrush-Guided Polymer Crystallization Resulting in Supersoft and Reversibly Moldable Physical Networks

    DOE PAGES

    Daniel, William F. M.; Xie, Guojun; Vatankhah Varnoosfaderani, Mohammad; ...

    2017-02-24

    The goal of this study is to use ABA triblock copolymers with central bottlebrush B segments and crystalline linear chain A segments to demonstrate the effect of side chains on the formation and mechanical properties of physical networks cross-linked by crystallites. For this purpose, a series of bottlebrush copolymers was synthesized consisting of central amorphous bottlebrush polymer segments with a varying degree of polymerization (DP) of poly(n-butyl acrylate) (PnBA) side chains and linear tail blocks of crystallizable poly(octadecyl acrylate-stat-docosyl acrylate) (poly(ODA-stat-DA)). The materials were generated by sequential atom transfer radical polymerization (ATRP) steps starting with a series of bifunctional macroinitiatorsmore » followed by the growth of two ODA-stat-DA linear-chain tails and eventually growing poly(nBA) side chains with increasing DPs. Crystallization of the poly(ODA-stat-DA) tails resulted in a series of reversible physical networks with bottlebrush strands bridging crystalline cross-links. They displayed very low moduli of elasticity of the order of 10 3–10 4 Pa. These distinct properties are due to the bottlebrush architecture, wherein densely grafted side chains play a dual role by facilitating disentanglement of the network strands and confining crystallization of the linear-chain tails. This combination leads to physical cross-linking of supersoft networks without percolation of the crystalline phase. The cross-link density was effectively controlled by the DP of the side chains with respect to the DP of the linear tails (n A). Furthermore, shorter side chains allowed for crystallization of the linear tails of neighboring bottlebrushes, while steric repulsion between longer side chains hindered the phase separation and crystallization process and prevented network formation.« less

  7. Structure of gel phase saturated lecithin bilayers: temperature and chain length dependence.

    PubMed Central

    Sun, W J; Tristram-Nagle, S; Suter, R M; Nagle, J F

    1996-01-01

    Systematic low-angle and wide-angle x-ray scattering studies have been performed on fully hydrated unoriented multilamamellar vesicles of saturated lecithins with even chain lengths N = 16, 18, 20, 22, and 24 as a function of temperature T in the normal gel (L beta') phase. For all N, the area per chain Ac increases linearly with T with an average slope dAc/dT = 0.027 A2/degree C, and the lamellar D-spacings also increase linearly with an average slope dD/dT = 0.040 A/degree C. At the same T, longer chain length lecithins have more densely packed chains, i.e., smaller Ac's, than shorter chain lengths. The chain packing of longer chain lengths is found to be more distorted from hexagonal packing than that of smaller N, and the distortion epsilon of all N approaches the same value at the respective transition temperatures. The thermal volume expansion of these lipids is accounted for by the expansion in the hydrocarbon chain region. Electron density profiles are constructed using four orders of low-angle lamellar peaks. These show that most of the increase in D with increasing T is due to thickening of the bilayers that is consistent with a decrease in tilt angle theta and with little change in water spacing with either T or N. Because of the opposing effects of temperature on area per chain Ac and tilt angle 0, the area expansivity alpha A is quite small. A qualitative theoretical model based on competing head and chain interactions accounts for our results. PMID:8842227

  8. Specific heat of (C 6H 11NH 3) CuCl 3 (CHAC), a system of ferromagnetic chains

    NASA Astrophysics Data System (ADS)

    Schouten, J. C.; van der Geest, G. J.; de Jonge, W. J. M.; Kopinga, K.

    1980-08-01

    The heat capacity of (C 6H 11NH 3) CuCl 3 (CHAC) has been measured for 0.45 < T < 60 K. Three-dimensional ordering is observed at T = 2.214 K. The data in the paramagnetic region can be described by a ferromagnetic S = {1}/{2} Heisenberg linear chain model system with J/ k = +45 ± 5K.

  9. Modeling the formation of ordered nano-assemblies comprised by dendrimers and linear polyelectrolytes: The role of Coulombic interactions

    NASA Astrophysics Data System (ADS)

    Eleftheriou, E.; Karatasos, K.

    2012-10-01

    Models of mixtures of peripherally charged dendrimers with oppositely charged linear polyelectrolytes in the presence of explicit solvent are studied by means of molecular dynamics simulations. Under the influence of varying strength of electrostatic interactions, these systems appear to form dynamically arrested film-like interconnected structures in the polymer-rich phase. Acting like a pseudo-thermodynamic inverse temperature, the increase of the strength of the Coulombic interactions drive the polymeric constituents of the mixture to a gradual dynamic freezing-in. The timescale of the average density fluctuations of the formed complexes initially increases in the weak electrostatic regime reaching a finite limit as the strength of electrostatic interactions grow. Although the models are overall electrically neutral, during this process the dendrimer/linear complexes develop a polar character with an excess charge mainly close to the periphery of the dendrimers. The morphological characteristics of the resulted pattern are found to depend on the size of the polymer chains on account of the distinct conformational features assumed by the complexed linear polyelectrolytes of different length. In addition, the length of the polymer chain appears to affect the dynamics of the counterions, thus affecting the ionic transport properties of the system. It appears, therefore, that the strength of electrostatic interactions together with the length of the linear polyelectrolytes are parameters to which these systems are particularly responsive, offering thus the possibility for a better control of the resulted structure and the electric properties of these soft-colloidal systems.

  10. Self assembled linear polymeric chains with tuneable semiflexibility using isotropic interactions.

    PubMed

    Abraham, Alex; Chatterji, Apratim

    2018-04-21

    We propose a two-body spherically symmetric (isotropic) potential such that particles interacting by the potential self-assemble into linear semiflexible polymeric chains without branching. By suitable control of the potential parameters, we can control the persistence length of the polymer and can even introduce a controlled number of branches. Thus we show how to achieve effective directional interactions starting from spherically symmetric potentials. The self-assembled polymers have an exponential distribution of chain lengths akin to what is observed for worm-like micellar systems. On increasing particle density, the polymeric chains self-organize to an ordered line-hexagonal phase where every chain is surrounded by six parallel chains, the transition is first order. On further increase in monomer density, the order is destroyed and we get a branched gel-like phase. This potential can be used to model semi-flexible equilibrium polymers with tunable semiflexibility and excluded volume. The use of the potential is computationally cheap and hence can be used to simulate and probe equilibrium polymer dynamics with long chains. The potential also gives a plausible method of tuning colloidal interactions in experiments such that one can obtain self-assembling polymeric chains made up of colloids and probe polymer dynamics using an optical microscope. Furthermore, we show how a modified potential leads to the observation of an intermediate nematic phase of self-assembled chains in between the low density disordered phase and the line-ordered hexagonal phase.

  11. Self assembled linear polymeric chains with tuneable semiflexibility using isotropic interactions

    NASA Astrophysics Data System (ADS)

    Abraham, Alex; Chatterji, Apratim

    2018-04-01

    We propose a two-body spherically symmetric (isotropic) potential such that particles interacting by the potential self-assemble into linear semiflexible polymeric chains without branching. By suitable control of the potential parameters, we can control the persistence length of the polymer and can even introduce a controlled number of branches. Thus we show how to achieve effective directional interactions starting from spherically symmetric potentials. The self-assembled polymers have an exponential distribution of chain lengths akin to what is observed for worm-like micellar systems. On increasing particle density, the polymeric chains self-organize to an ordered line-hexagonal phase where every chain is surrounded by six parallel chains, the transition is first order. On further increase in monomer density, the order is destroyed and we get a branched gel-like phase. This potential can be used to model semi-flexible equilibrium polymers with tunable semiflexibility and excluded volume. The use of the potential is computationally cheap and hence can be used to simulate and probe equilibrium polymer dynamics with long chains. The potential also gives a plausible method of tuning colloidal interactions in experiments such that one can obtain self-assembling polymeric chains made up of colloids and probe polymer dynamics using an optical microscope. Furthermore, we show how a modified potential leads to the observation of an intermediate nematic phase of self-assembled chains in between the low density disordered phase and the line-ordered hexagonal phase.

  12. N-soliton interactions: Effects of linear and nonlinear gain and loss

    NASA Astrophysics Data System (ADS)

    Carretero-González, R.; Gerdjikov, V. S.; Todorov, M. D.

    2017-10-01

    We analyze the dynamical behavior of the N-soliton train in the adiabatic approximation of the nonlinear Schrödinger equation perturbed simultaneously by linear and nonlinear gain/loss terms. We derive the corresponding perturbed complex Toda chain in the case of a combination of linear, cubic, and/or quintic terms. We show that the soliton interactions dynamics for this reduced PCTC model compares favorably to full numerical results of the original perturbed nonlinear Schrödinger equation.

  13. Phase properties of elastic waves in systems constituted of adsorbed diatomic molecules on the (001) surface of a simple cubic crystal

    NASA Astrophysics Data System (ADS)

    Deymier, P. A.; Runge, K.

    2018-03-01

    A Green's function-based numerical method is developed to calculate the phase of scattered elastic waves in a harmonic model of diatomic molecules adsorbed on the (001) surface of a simple cubic crystal. The phase properties of scattered waves depend on the configuration of the molecules. The configurations of adsorbed molecules on the crystal surface such as parallel chain-like arrays coupled via kinks are used to demonstrate not only linear but also non-linear dependency of the phase on the number of kinks along the chains. Non-linear behavior arises for scattered waves with frequencies in the vicinity of a diatomic molecule resonance. In the non-linear regime, the variation in phase with the number of kinks is formulated mathematically as unitary matrix operations leading to an analogy between phase-based elastic unitary operations and quantum gates. The advantage of elastic based unitary operations is that they are easily realizable physically and measurable.

  14. Simulating the performance of a distance-3 surface code in a linear ion trap

    NASA Astrophysics Data System (ADS)

    Trout, Colin J.; Li, Muyuan; Gutiérrez, Mauricio; Wu, Yukai; Wang, Sheng-Tao; Duan, Luming; Brown, Kenneth R.

    2018-04-01

    We explore the feasibility of implementing a small surface code with 9 data qubits and 8 ancilla qubits, commonly referred to as surface-17, using a linear chain of 171Yb+ ions. Two-qubit gates can be performed between any two ions in the chain with gate time increasing linearly with ion distance. Measurement of the ion state by fluorescence requires that the ancilla qubits be physically separated from the data qubits to avoid errors on the data due to scattered photons. We minimize the time required to measure one round of stabilizers by optimizing the mapping of the two-dimensional surface code to the linear chain of ions. We develop a physically motivated Pauli error model that allows for fast simulation and captures the key sources of noise in an ion trap quantum computer including gate imperfections and ion heating. Our simulations showed a consistent requirement of a two-qubit gate fidelity of ≥99.9% for the logical memory to have a better fidelity than physical two-qubit operations. Finally, we perform an analysis of the error subsets from the importance sampling method used to bound the logical error rates to gain insight into which error sources are particularly detrimental to error correction.

  15. Graphite grain-size spectrum and molecules from core-collapse supernovae

    NASA Astrophysics Data System (ADS)

    Clayton, Donald D.; Meyer, Bradley S.

    2018-01-01

    Our goal is to compute the abundances of carbon atomic complexes that emerge from the C + O cores of core-collapse supernovae. We utilize our chemical reaction network in which every atomic step of growth employs a quantum-mechanically guided reaction rate. This tool follows step-by-step the growth of linear carbon chain molecules from C atoms in the oxygen-rich C + O cores. We postulate that once linear chain molecules reach a sufficiently large size, they isomerize to ringed molecules, which serve as seeds for graphite grain growth. We demonstrate our technique for merging the molecular reaction network with a parallel program that can follow 1017 steps of C addition onto the rare seed species. Due to radioactivity within the C + O core, abundant ambient oxygen is unable to convert C to CO, except to a limited degree that actually facilitates carbon molecular ejecta. But oxygen severely minimizes the linear-carbon-chain abundances. Despite the tiny abundances of these linear-carbon-chain molecules, they can give rise to a small abundance of ringed-carbon molecules that serve as the nucleations on which graphite grain growth builds. We expand the C + O-core gas adiabatically from 6000 K for 109 s when reactions have essentially stopped. These adiabatic tracks emulate the actual expansions of the supernova cores. Using a standard model of 1056 atoms of C + O core ejecta having O/C = 3, we calculate standard ejection yields of graphite grains of all sizes produced, of the CO molecular abundance, of the abundances of linear-carbon molecules, and of Buckminsterfullerene. None of these except CO was expected from the C + O cores just a few years past.

  16. Theory of polyelectrolytes in solvents.

    PubMed

    Chitanvis, Shirish M

    2003-12-01

    Using a continuum description, we account for fluctuations in the ionic solvent surrounding a Gaussian, charged chain and derive an effective short-ranged potential between the charges on the chain. This potential is repulsive at short separations and attractive at longer distances. The chemical potential can be derived from this potential. When the chemical potential is positive, it leads to a meltlike state. For a vanishingly low concentration of segments, this state exhibits scaling behavior for long chains. The Flory exponent characterizing the radius of gyration for long chains is calculated to be approximately 0.63, close to the classical value obtained for second order phase transitions. For short chains, the radius of gyration varies linearly with N, the chain length, and is sensitive to the parameters in the interaction potential. The linear dependence on the chain length N indicates a stiff behavior. The chemical potential associated with this interaction changes sign, when the screening length in the ionic solvent exceeds a critical value. This leads to condensation when the chemical potential is negative. In this state, it is shown using the mean-field approximation that spherical and toroidal condensed shapes can be obtained. The thickness of the toroidal polyelectrolyte is studied as a function of the parameters of the model, such as the ionic screening length. The predictions of this theory should be amenable to experimental verification.

  17. Simulation-optimization model for production planning in the blood supply chain.

    PubMed

    Osorio, Andres F; Brailsford, Sally C; Smith, Honora K; Forero-Matiz, Sonia P; Camacho-Rodríguez, Bernardo A

    2017-12-01

    Production planning in the blood supply chain is a challenging task. Many complex factors such as uncertain supply and demand, blood group proportions, shelf life constraints and different collection and production methods have to be taken into account, and thus advanced methodologies are required for decision making. This paper presents an integrated simulation-optimization model to support both strategic and operational decisions in production planning. Discrete-event simulation is used to represent the flows through the supply chain, incorporating collection, production, storing and distribution. On the other hand, an integer linear optimization model running over a rolling planning horizon is used to support daily decisions, such as the required number of donors, collection methods and production planning. This approach is evaluated using real data from a blood center in Colombia. The results show that, using the proposed model, key indicators such as shortages, outdated units, donors required and cost are improved.

  18. Electronic band gaps of confined linear carbon chains ranging from polyyne to carbyne

    NASA Astrophysics Data System (ADS)

    Shi, Lei; Rohringer, Philip; Wanko, Marius; Rubio, Angel; Waßerroth, Sören; Reich, Stephanie; Cambré, Sofie; Wenseleers, Wim; Ayala, Paola; Pichler, Thomas

    2017-12-01

    Ultralong linear carbon chains of more than 6000 carbon atoms have recently been synthesized within double-walled carbon nanotubes (DWCNTs), and they show a promising route to one-atom-wide semiconductors with a direct band gap. Theoretical studies predicted that this band gap can be tuned by the length of the chains, the end groups, and their interactions with the environment. However, different density functionals lead to very different values of the band gap of infinitely long carbyne. In this work, we applied resonant Raman excitation spectroscopy with more than 50 laser wavelengths to determine the band gap of long carbon chains encapsulated inside DWCNTs. The experimentally determined band gaps ranging from 2.253 to 1.848 eV follow a linear relation with Raman frequency. This lower bound is the smallest band gap of linear carbon chains observed so far. The comparison with experimental data obtained for short chains in gas phase or in solution demonstrates the effect of the DWCNT encapsulation, leading to an essential downshift of the band gap. This is explained by the interaction between the carbon chain and the host tube, which greatly modifies the chain's bond-length alternation.

  19. Integrated supply chain design for commodity chemicals production via woody biomass fast pyrolysis and upgrading.

    PubMed

    Zhang, Yanan; Hu, Guiping; Brown, Robert C

    2014-04-01

    This study investigates the optimal supply chain design for commodity chemicals (BTX, etc.) production via woody biomass fast pyrolysis and hydroprocessing pathway. The locations and capacities of distributed preprocessing hubs and integrated biorefinery facilities are optimized with a mixed integer linear programming model. In this integrated supply chain system, decisions on the biomass chipping methods (roadside chipping vs. facility chipping) are also explored. The economic objective of the supply chain model is to maximize the profit for a 20-year chemicals production system. In addition to the economic objective, the model also incorporates an environmental objective of minimizing life cycle greenhouse gas emissions, analyzing the trade-off between the economic and environmental considerations. The capital cost, operating cost, and revenues for the biorefinery facilities are based on techno-economic analysis, and the proposed approach is illustrated through a case study of Minnesota, with Minneapolis-St. Paul serving as the chemicals distribution hub. Copyright © 2014 Elsevier Ltd. All rights reserved.

  20. Localization in finite vibroimpact chains: Discrete breathers and multibreathers.

    PubMed

    Grinberg, Itay; Gendelman, Oleg V

    2016-09-01

    We explore the dynamics of strongly localized periodic solutions (discrete solitons or discrete breathers) in a finite one-dimensional chain of oscillators. Localization patterns with both single and multiple localization sites (breathers and multibreathers) are considered. The model involves parabolic on-site potential with rigid constraints (the displacement domain of each particle is finite) and a linear nearest-neighbor coupling. When the particle approaches the constraint, it undergoes an inelastic impact according to Newton's impact model. The rigid nonideal impact constraints are the only source of nonlinearity and damping in the system. We demonstrate that this vibro-impact model allows derivation of exact analytic solutions for the breathers and multibreathers with an arbitrary set of localization sites, both in conservative and in forced-damped settings. Periodic boundary conditions are considered; exact solutions for other types of boundary conditions are also available. Local character of the nonlinearity permits explicit derivation of a monodromy matrix for the breather solutions. Consequently, the stability of the derived breather and multibreather solutions can be efficiently studied in the framework of simple methods of linear algebra, and with rather moderate computational efforts. One reveals that that the finiteness of the chain fragment and possible proximity of the localization sites strongly affect both the existence and the stability patterns of these localized solutions.

  1. Long-time behavior and Turing instability induced by cross-diffusion in a three species food chain model with a Holling type-II functional response.

    PubMed

    Haile, Dawit; Xie, Zhifu

    2015-09-01

    In this paper, we study a strongly coupled reaction-diffusion system describing three interacting species in a food chain model, where the third species preys on the second one and simultaneously the second species preys on the first one. An intra-species competition b2 among the second predator is introduced to the food chain model. This parameter produces some very interesting result in linear stability and Turing instability. We first show that the unique positive equilibrium solution is locally asymptotically stable for the corresponding ODE system when the intra-species competition exists among the second predator. The positive equilibrium solution remains linearly stable for the reaction diffusion system without cross diffusion, hence it does not belong to the classical Turing instability scheme. But it becomes linearly unstable only when cross-diffusion also plays a role in the reaction-diffusion system, hence the instability is driven solely from the effect of cross diffusion. Our results also exhibit some interesting combining effects of cross-diffusion, intra-species competitions and inter-species interactions. Numerically, we conduct a one parameter analysis which illustrate how the interactions change the existence of stable equilibrium, limit cycle, and chaos. Some interesting dynamical phenomena occur when we perform analysis of interactions in terms of self-production of prey and intra-species competition of the middle predator. By numerical simulations, it illustrates the existence of nonuniform steady solutions and new patterns such as spot patterns, strip patterns and fluctuations due to the diffusion and cross diffusion in two-dimension. Published by Elsevier Inc.

  2. A mathematical/physics carbon emission reduction strategy for building supply chain network based on carbon tax policy

    NASA Astrophysics Data System (ADS)

    Li, Xueying; Peng, Ying; Zhang, Jing

    2017-03-01

    Under the background of a low carbon economy, this paper examines the impact of carbon tax policy on supply chain network emission reduction. The integer linear programming method is used to establish a supply chain network emission reduction such a model considers the cost of CO2 emissions, and analyses the impact of different carbon price on cost and carbon emissions in supply chains. The results show that the implementation of a carbon tax policy can reduce CO2 emissions in building supply chain, but the increase in carbon price does not produce a reduction effect, and may bring financial burden to the enterprise. This paper presents a reasonable carbon price range and provides decision makers with strategies towards realizing a low carbon building supply chain in an economical manner.

  3. Robust optimization on sustainable biodiesel supply chain produced from waste cooking oil under price uncertainty.

    PubMed

    Zhang, Yong; Jiang, Yunjian

    2017-02-01

    Waste cooking oil (WCO)-for-biodiesel conversion is regarded as the "waste-to-wealthy" industry. This paper addresses the design of a WCO-for-biodiesel supply chain at both strategic and tactical levels. The supply chain of this problem is studied, which is based on a typical mode of the waste collection (from restaurants' kitchen) and conversion in the cities. The supply chain comprises three stakeholders: WCO supplier, integrated bio-refinery and demand zone. Three key problems should be addressed for the optimal design of the supply chain: (1) the number, sizes and locations of bio-refinery; (2) the sites and amount of WCO collected; (3) the transportation plans of WCO and biodiesel. A robust mixed integer linear model with muti-objective (economic, environmental and social objectives) is proposed for these problems. Finally, a large-scale practical case study is adopted based on Suzhou, a city in the east of China, to verify the proposed models. Copyright © 2016 Elsevier Ltd. All rights reserved.

  4. Light Scattering Study of Mixed Micelles Made from Elastin-Like Polypeptide Linear Chains and Trimers

    NASA Astrophysics Data System (ADS)

    Terrano, Daniel; Tsuper, Ilona; Maraschky, Adam; Holland, Nolan; Streletzky, Kiril

    Temperature sensitive nanoparticles were generated from a construct (H20F) of three chains of elastin-like polypeptides (ELP) linked to a negatively charged foldon domain. This ELP system was mixed at different ratios with linear chains of ELP (H40L) which lacks the foldon domain. The mixed system is soluble at room temperature and at a transition temperature (Tt) will form swollen micelles with the hydrophobic linear chains hidden inside. This system was studied using depolarized dynamic light scattering (DDLS) and static light scattering (SLS) to determine the size, shape, and internal structure of the mixed micelles. The mixed micelle in equal parts of H20F and H40L show a constant apparent hydrodynamic radius of 40-45 nm at the concentration window from 25:25 to 60:60 uM (1:1 ratio). At a fixed 50 uM concentration of the H20F, varying H40L concentration from 5 to 80 uM resulted in a linear growth in the hydrodynamic radius from about 11 to about 62 nm, along with a 1000-fold increase in VH signal. A possible simple model explaining the growth of the swollen micelles is considered. Lastly, the VH signal can indicate elongation in the geometry of the particle or could possibly be a result from anisotropic properties from the core of the micelle. SLS was used to study the molecular weight, and the radius of gyration of the micelle to help identify the structure and morphology of mixed micelles and the tangible cause of the VH signal.

  5. Direction-dependent secondary bonds and their stepwise melting in a uracil-based molecular crystal studied by infrared spectroscopy and theoretical modeling

    NASA Astrophysics Data System (ADS)

    Szekrényes, Zsolt; Nagy, Péter R.; Tarczay, György; Maggini, Laura; Bonifazi, Davide; Kamarás, Katalin

    2018-01-01

    Three types of supramolecular interactions are identified in the three crystallographic directions in crystals of 1,4-bis[(1-hexylurac-6-yl) ethynyl]benzene, a uracil-based molecule with a linear backbone. These three interactions, characterized by their strongest component, are: intermolecular double H-bonds along the molecular axis, London dispersion interaction of hexyl chains connecting these linear assemblies, and π - π stacking of the aromatic rings perpendicular to the molecular planes. On heating, two transitions happen, disordering of hexyl chains at 473 K, followed by H-bond melting at 534 K. The nature of the bonds and transitions was established by matrix-isolation and temperature-dependent infrared spectroscopy and supported by theoretical computations.

  6. Conformational statistics of stiff macromolecules as solutions to partial differential equations on the rotation and motion groups

    PubMed

    Chirikjian; Wang

    2000-07-01

    Partial differential equations (PDE's) for the probability density function (PDF) of the position and orientation of the distal end of a stiff macromolecule relative to its proximal end are derived and solved. The Kratky-Porod wormlike chain, the Yamakawa helical wormlike chain, and the original and revised Marko-Siggia models are examples of stiffness models to which the present formulation is applied. The solution technique uses harmonic analysis on the rotation and motion groups to convert PDE's governing the PDF's of interest into linear algebraic equations which have mathematically elegant solutions.

  7. Ward identities and chiral anomalies for coupled fermionic chains

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Costa, L. C.; Ferraz, A.; Mastropietro, Vieri

    2013-12-15

    Coupled fermionic chains are usually described by an effective model written in terms of bonding and anti-bonding fermionic fields with linear dispersion in the vicinities of the respective Fermi points. We derive for the first time exact Ward Identities (WI) for this model, proving the existence of chiral anomalies which verify the Adler-Bardeen non-renormalization property. Such WI are expected to play a crucial role in the understanding of the thermodynamic properties of the system. Our results are non-perturbative and are obtained analyzing Grassmann functional integrals by means of constructive quantum field theory methods.

  8. Accessible, almost ab initio multi-scale modeling of entangled polymers via slip-links

    NASA Astrophysics Data System (ADS)

    Andreev, Marat

    It is widely accepted that dynamics of entangled polymers can be described by the tube model. Here we advocate for an alternative approach to entanglement modeling known as slip-links. Recently, slip-links were shown to possess important advantages over tube models, namely they have strong connections to atomistic, multichain levels of description, agree with non-equilibrium thermodynamics, are applicable to any chain architecture and can be used in linear or non-linear rheology. We present a hierarchy of slip-link models that are connected to each other through successive coarse graining. Models in the hierarchy are consistent in their overlapping domains of applicability in order to allow a straightforward mapping of parameters. In particular, the most--detailed level of description has four parameters, three of which can be determined directly from atomistic simulations. On the other hand, the least--detailed member of the hierarchy is numerically accessible, and allows for non-equilibrium flow predictions of complex chain architectures. Using GPU implementation these predictions can be obtained in minutes of computational time on a single desktop equipped with a mainstream gaming GPU. The GPU code is available online for free download.

  9. Characteristic α and 6He decays of linear-chain structures in 16C

    NASA Astrophysics Data System (ADS)

    Baba, T.; Kimura, M.

    2018-05-01

    The linear-chain states of 16C and their decay modes are theoretically investigated by using the antisymmetrized molecular dynamics. It is found that the positive-parity linear-chain states have the (3/2π-) 2(1/2σ-) 2 configuration and primary decay to 12Be(21+) as well as to 12Be(g.s.) by α -particle emission. Moreover, we show that they also decay via the 6He+10Be channel. In the negative-parity states, it is found that two types of linear chains exist. One has the valence neutrons occupying the molecular orbits (3/2π-) 2(1 /2σ-) (3 /2π+) , while the other's configuration cannot be explained in terms of the molecular orbits because of the strong parity mixing. Both configurations constitute the rotational bands with a large moment of inertia and intraband E 2 transitions. Their α and 6He reduced widths are sufficiently large to be distinguished from other noncluster states although they are smaller than those of the positive-parity linear chain.

  10. Free energy and internal energy of electron-screened plasmas in a modified hypernetted-chain approximation

    NASA Astrophysics Data System (ADS)

    Perrot, F.

    1991-12-01

    We report results of Helmholtz-free-energy and internal-energy calculations using the modified hypernetted-chain (MHNC) equation method, in the formulation of Lado, Foiles, and Ashcroft [Phys. Rev. A 28, 2374 (1983)], for a model plasma of ions linearly screened by electrons. The results are compared with HNC calculations (no Bridge term), with variational calculations using a hard-spheres reference system, and with a numerical fit of Monte Carlo simulations.

  11. Semiflexible polymer dynamics with a bead-spring model

    NASA Astrophysics Data System (ADS)

    Barkema, Gerard T.; Panja, Debabrata; van Leeuwen, J. M. J.

    2014-11-01

    We study the dynamical properties of semiflexible polymers with a recently introduced bead-spring model. We focus on double-stranded DNA (dsDNA). The two parameters of the model, T* and ν, are chosen to match its experimental force-extension curve. In comparison to its groundstate value, the bead-spring Hamiltonian is approximated in the first order by the Hessian that is quadratic in the bead positions. The eigenmodes of the Hessian provide the longitudinal (stretching) and transverse (bending) eigenmodes of the polymer, and the corresponding eigenvalues match well with the established phenomenology of semiflexible polymers. At the Hessian approximation of the Hamiltonian, the polymer dynamics is linear. Using the longitudinal and transverse eigenmodes, for the linearized problem, we obtain analytical expressions of (i) the autocorrelation function of the end-to-end vector, (ii) the autocorrelation function of a bond (i.e. a spring, or a tangent) vector at the middle of the chain, and (iii) the mean-square displacement of a tagged bead in the middle of the chain, as the sum over the contributions from the modes—the so-called ‘mode sums’. We also perform simulations with the full dynamics of the model. The simulations yield numerical values of the correlations functions (i-iii) that agree very well with the analytical expressions for the linearized dynamics. This does not however mean that the nonlinearities are not present. In fact, we also study the mean-square displacement of the longitudinal component of the end-to-end vector that showcases strong nonlinear effects in the polymer dynamics, and we identify at least an effective t7/8 power-law regime in its time-dependence. Nevertheless, in comparison to the full mean-square displacement of the end-to-end vector the nonlinear effects remain small at all times—it is in this sense we state that our results demonstrate that the linearized dynamics suffices for dsDNA fragments that are shorter than or comparable to the persistence length. Our results are consistent with those of the wormlike chain (WLC) model, the commonly used descriptive tool of semiflexible polymers.

  12. Influence of chain ordering on the selectivity of dipalmitoylphosphatidylcholine bilayer membranes for permeant size and shape.

    PubMed Central

    Xiang, T X; Anderson, B D

    1998-01-01

    The effects of lipid chain packing and permeant size and shape on permeability across lipid bilayers have been investigated in gel and liquid crystalline dipalmitoylphosphatidylcholine (DPPC) bilayers by a combined NMR line-broadening/dynamic light scattering method using seven short-chain monocarboxylic acids (formic acid, acetic acid, propionic acid, butyric acid, valeric acid, isovaleric acid, and trimethylacetic acid) as permeants. The experimental permeability coefficients are compared with the predictions of a bulk solubility diffusion model in which the bilayer membrane is represented as a slab of bulk hexadecane. Deviations of the observed permeability coefficients (Pm) from the values predicted from solubility diffusion theory (Po) lead to the determination of a correction factor, the permeability decrement f (= Pm/Po), to account for the effects of chain ordering. The natural logarithm of f has been found to correlate linearly with the inverse of the bilayer free surface area with slopes of 25 +/- 2, 36 +/- 3, 45 +/- 8, 32 +/- 12, 33 +/- 4, 49 +/- 12, and 75 +/- 6 A2 for formic acid, acetic acid, propionic acid, butyric acid, valeric acid, isovaleric acid, and trimethylacetic acid, respectively. The slope, which measures the sensitivity of the permeability coefficient of a given permeant to bilayer chain packing, exhibits an excellent linear correlation (r = 0.94) with the minimum cross-sectional area of the permeant and a poor correlation (r = 0.59) with molecular volume, suggesting that in the bilayer interior the permeants prefer to move with their long principal axis along the bilayer normal. Based on these studies, a permeability model combining the effects of bilayer chain packing and permeant size and shape on permeability across lipid membranes is developed. PMID:9826590

  13. Flexible polyelectrolyte chain in a strong electrolyte solution: Insight into equilibrium properties and force-extension behavior from mesoscale simulation

    NASA Astrophysics Data System (ADS)

    Malekzadeh Moghani, Mahdy; Khomami, Bamin

    2016-01-01

    Macromolecules with ionizable groups are ubiquitous in biological and synthetic systems. Due to the complex interaction between chain and electrostatic decorrelation lengths, both equilibrium properties and micro-mechanical response of dilute solutions of polyelectrolytes (PEs) are more complex than their neutral counterparts. In this work, the bead-rod micromechanical description of a chain is used to perform hi-fidelity Brownian dynamics simulation of dilute PE solutions to ascertain the self-similar equilibrium behavior of PE chains with various linear charge densities, scaling of the Kuhn step length (lE) with salt concentration cs and the force-extension behavior of the PE chain. In accord with earlier theoretical predictions, our results indicate that for a chain with n Kuhn segments, lE ˜ cs-0.5 as linear charge density approaches 1/n. Moreover, the constant force ensemble simulation results accurately predict the initial non-linear force-extension region of PE chain recently measured via single chain experiments. Finally, inspired by Cohen's extraction of Warner's force law from the inverse Langevin force law, a novel numerical scheme is developed to extract a new elastic force law for real chains from our discrete set of force-extension data similar to Padè expansion, which accurately depicts the initial non-linear region where the total Kuhn length is less than the thermal screening length.

  14. Flexible polyelectrolyte chain in a strong electrolyte solution: Insight into equilibrium properties and force-extension behavior from mesoscale simulation.

    PubMed

    Malekzadeh Moghani, Mahdy; Khomami, Bamin

    2016-01-14

    Macromolecules with ionizable groups are ubiquitous in biological and synthetic systems. Due to the complex interaction between chain and electrostatic decorrelation lengths, both equilibrium properties and micro-mechanical response of dilute solutions of polyelectrolytes (PEs) are more complex than their neutral counterparts. In this work, the bead-rod micromechanical description of a chain is used to perform hi-fidelity Brownian dynamics simulation of dilute PE solutions to ascertain the self-similar equilibrium behavior of PE chains with various linear charge densities, scaling of the Kuhn step length (lE) with salt concentration cs and the force-extension behavior of the PE chain. In accord with earlier theoretical predictions, our results indicate that for a chain with n Kuhn segments, lE ∼ cs (-0.5) as linear charge density approaches 1/n. Moreover, the constant force ensemble simulation results accurately predict the initial non-linear force-extension region of PE chain recently measured via single chain experiments. Finally, inspired by Cohen's extraction of Warner's force law from the inverse Langevin force law, a novel numerical scheme is developed to extract a new elastic force law for real chains from our discrete set of force-extension data similar to Padè expansion, which accurately depicts the initial non-linear region where the total Kuhn length is less than the thermal screening length.

  15. Evaluation of drought using SPEI drought class transitions and log-linear models for different agro-ecological regions of India

    NASA Astrophysics Data System (ADS)

    Alam, N. M.; Sharma, G. C.; Moreira, Elsa; Jana, C.; Mishra, P. K.; Sharma, N. K.; Mandal, D.

    2017-08-01

    Markov chain and 3-dimensional log-linear models were attempted to model drought class transitions derived from the newly developed drought index the Standardized Precipitation Evapotranspiration Index (SPEI) at a 12 month time scale for six major drought prone areas of India. Log-linear modelling approach has been used to investigate differences relative to drought class transitions using SPEI-12 time series derived form 48 yeas monthly rainfall and temperature data. In this study, the probabilities of drought class transition, the mean residence time, the 1, 2 or 3 months ahead prediction of average transition time between drought classes and the drought severity class have been derived. Seasonality of precipitation has been derived for non-homogeneous Markov chains which could be used to explain the effect of the potential retreat of drought. Quasi-association and Quasi-symmetry log-linear models have been fitted to the drought class transitions derived from SPEI-12 time series. The estimates of odds along with their confidence intervals were obtained to explain the progression of drought and estimation of drought class transition probabilities. For initial months as the drought severity increases the calculated odds shows lower value and the odds decreases for the succeeding months. This indicates that the ratio of expected frequencies of occurrence of transition from drought class to the non-drought class decreases as compared to transition to any drought class when the drought severity of the present class increases. From 3-dimensional log-linear model it is clear that during the last 24 years the drought probability has increased for almost all the six regions. The findings from the present study will immensely help to assess the impact of drought on the gross primary production and to develop future contingent planning in similar regions worldwide.

  16. The role of nanoparticle rigidity on the diffusion of linear polystyrene in a polymer nanocomposite

    DOE PAGES

    Miller, Brad; Imel, Adam E.; Holley, Wade; ...

    2015-11-12

    The impact of the inclusion of a nanoparticle in a polymer matrix on the dynamics of the polymer chains is an area of recent interest. In this article, we describe the role of nanoparticle rigidity or softness on the impact of the presence of that nanoparticle on the diffusive behavior of linear polymer chains. The neutron reflectivity results clearly show that the inclusion of 10 nm soft nanoparticles in a polymer matrix (R g ~ 20 nm) increases the diffusion coefficient of the linear polymer chain. Surprisingly, thermal analysis shows that these nanocomposites exhibit an increase in their glass transitionmore » temperature, which is incommensurate with an increase in free volume. Therefore, it appears that this effect is more complex than a simple plasticizing effect. Results from small-angle neutron scattering of the nanoparticles in solution show a structure that consists of a gel like core with a corona of free chain ends and loops. Furthermore, the increase in linear polymer diffusion may be related to an increase in constraint release mechanisms in the reptation of the polymer chain, in a similar manner to that which has been reported for the diffusion of linear polymer chains in the presence of star polymers.« less

  17. The role of nanoparticle rigidity on the diffusion of linear polystyrene in a polymer nanocomposite

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Miller, Brad; Imel, Adam E.; Holley, Wade

    The impact of the inclusion of a nanoparticle in a polymer matrix on the dynamics of the polymer chains is an area of recent interest. In this article, we describe the role of nanoparticle rigidity or softness on the impact of the presence of that nanoparticle on the diffusive behavior of linear polymer chains. The neutron reflectivity results clearly show that the inclusion of 10 nm soft nanoparticles in a polymer matrix (R g ~ 20 nm) increases the diffusion coefficient of the linear polymer chain. Surprisingly, thermal analysis shows that these nanocomposites exhibit an increase in their glass transitionmore » temperature, which is incommensurate with an increase in free volume. Therefore, it appears that this effect is more complex than a simple plasticizing effect. Results from small-angle neutron scattering of the nanoparticles in solution show a structure that consists of a gel like core with a corona of free chain ends and loops. Furthermore, the increase in linear polymer diffusion may be related to an increase in constraint release mechanisms in the reptation of the polymer chain, in a similar manner to that which has been reported for the diffusion of linear polymer chains in the presence of star polymers.« less

  18. Describing a Strongly Correlated Model System with Density Functional Theory.

    PubMed

    Kong, Jing; Proynov, Emil; Yu, Jianguo; Pachter, Ruth

    2017-07-06

    The linear chain of hydrogen atoms, a basic prototype for the transition from a metal to Mott insulator, is studied with a recent density functional theory model functional for nondynamic and strong correlation. The computed cohesive energy curve for the transition agrees well with accurate literature results. The variation of the electronic structure in this transition is characterized with a density functional descriptor that yields the atomic population of effectively localized electrons. These new methods are also applied to the study of the Peierls dimerization of the stretched even-spaced Mott insulator to a chain of H 2 molecules, a different insulator. The transitions among the two insulating states and the metallic state of the hydrogen chain system are depicted in a semiquantitative phase diagram. Overall, we demonstrate the capability of studying strongly correlated materials with a mean-field model at the fundamental level, in contrast to the general pessimistic view on such a feasibility.

  19. Biomass supply chain optimisation for Organosolv-based biorefineries.

    PubMed

    Giarola, Sara; Patel, Mayank; Shah, Nilay

    2014-05-01

    This work aims at providing a Mixed Integer Linear Programming modelling framework to help define planning strategies for the development of sustainable biorefineries. The up-scaling of an Organosolv biorefinery was addressed via optimisation of the whole system economics. Three real world case studies were addressed to show the high-level flexibility and wide applicability of the tool to model different biomass typologies (i.e. forest fellings, cereal residues and energy crops) and supply strategies. Model outcomes have revealed how supply chain optimisation techniques could help shed light on the development of sustainable biorefineries. Feedstock quality, quantity, temporal and geographical availability are crucial to determine biorefinery location and the cost-efficient way to supply the feedstock to the plant. Storage costs are relevant for biorefineries based on cereal stubble, while wood supply chains present dominant pretreatment operations costs. Copyright © 2014 Elsevier Ltd. All rights reserved.

  20. Chemistry of anthracene-acetylene oligomers XXV: on-surface chirality of a self-assembled molecular network of a fan-blade-shaped anthracene-acetylene macrocycle with a long alkyl chain.

    PubMed

    Tsuya, Takuya; Iritani, Kohei; Tahara, Kazukuni; Tobe, Yoshito; Iwanaga, Tetsuo; Toyota, Shinji

    2015-03-27

    An anthracene cyclic dimer with two different linkers and a dodecyl group was synthesized by means of coupling reactions. The calculated structure had a planar macrocyclic π core and a linear alkyl chain. Scanning tunneling microscopy observations at the 1-phenyloctane/graphite interface revealed that the molecules formed a self-assembled monolayer that consisted of linear striped bright and dark bands. In each domain, the molecular network consisted of either Re or Si molecules that differed in the two-dimensional chirality about the macrocyclic faces, which led to a unique conglomerate-type self-assembly. The molecular packing mode and the conformation of the alkyl chains are discussed in terms of the intermolecular interactions and the interactions between the molecules and the graphite surface with the aid of MM3 simulations of a model system. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  1. Self-assembly and glass-formation in a lattice model of telechelic polymer melts: Influence of stiffness of the sticky bonds

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Xu, Wen-Sheng, E-mail: wsxu@uchicago.edu; Freed, Karl F., E-mail: freed@uchicago.edu; Department of Chemistry, The University of Chicago, Chicago, Illinois 60637

    2016-06-07

    Telechelic polymers are chain macromolecules that may self-assemble through the association of their two mono-functional end groups (called “stickers”). A deep understanding of the relation between microscopic molecular details and the macroscopic physical properties of telechelic polymers is important in guiding the rational design of telechelic polymer materials with desired properties. The lattice cluster theory (LCT) for strongly interacting, self-assembling telechelic polymers provides a theoretical tool that enables establishing the connections between important microscopic molecular details of self-assembling polymers and their bulk thermodynamics. The original LCT for self-assembly of telechelic polymers considers a model of fully flexible linear chains [J.more » Dudowicz and K. F. Freed, J. Chem. Phys. 136, 064902 (2012)], while our recent work introduces a significant improvement to the LCT by including a description of chain semiflexibility for the bonds within each individual telechelic chain [W.-S. Xu and K. F. Freed, J. Chem. Phys. 143, 024901 (2015)], but the physically associative (or called “sticky”) bonds between the ends of the telechelics are left as fully flexible. Motivated by the ubiquitous presence of steric constraints on the association of real telechelic polymers that impart an additional degree of bond stiffness (or rigidity), the present paper further extends the LCT to permit the sticky bonds to be semiflexible but to have a stiffness differing from that within each telechelic chain. An analytical expression for the Helmholtz free energy is provided for this model of linear telechelic polymer melts, and illustrative calculations demonstrate the significant influence of the stiffness of the sticky bonds on the self-assembly and thermodynamics of telechelic polymers. A brief discussion is also provided for the impact of self-assembly on glass-formation by combining the LCT description for this extended model of telechelic polymers with the Adam-Gibbs relation between the structural relaxation time and the configurational entropy.« less

  2. DOS cones along atomic chains

    NASA Astrophysics Data System (ADS)

    Kwapiński, Tomasz

    2017-03-01

    The electron transport properties of a linear atomic chain are studied theoretically within the tight-binding Hamiltonian and the Green’s function method. Variations of the local density of states (DOS) along the chain are investigated. They are crucial in scanning tunnelling experiments and give important insight into the electron transport mechanism and charge distribution inside chains. It is found that depending on the chain parity the local DOS at the Fermi level can form cone-like structures (DOS cones) along the chain. The general condition for the local DOS oscillations is obtained and the linear behaviour of the local density function is confirmed analytically. DOS cones are characterized by a linear decay towards the chain which is in contrast to the propagation properties of charge density waves, end states and Friedel oscillations in one-dimensional systems. We find that DOS cones can appear due to non-resonant electron transport, the spin-orbit scattering or for chains fabricated on a substrate with localized electrons. It is also shown that for imperfect chains (e.g. with a reduced coupling strength between two neighboring sites) a diamond-like structure of the local DOS along the chain appears.

  3. A recurrent neural network for solving bilevel linear programming problem.

    PubMed

    He, Xing; Li, Chuandong; Huang, Tingwen; Li, Chaojie; Huang, Junjian

    2014-04-01

    In this brief, based on the method of penalty functions, a recurrent neural network (NN) modeled by means of a differential inclusion is proposed for solving the bilevel linear programming problem (BLPP). Compared with the existing NNs for BLPP, the model has the least number of state variables and simple structure. Using nonsmooth analysis, the theory of differential inclusions, and Lyapunov-like method, the equilibrium point sequence of the proposed NNs can approximately converge to an optimal solution of BLPP under certain conditions. Finally, the numerical simulations of a supply chain distribution model have shown excellent performance of the proposed recurrent NNs.

  4. Valence-bond theory of linear Hubbard and Pariser-Parr-Pople models

    NASA Astrophysics Data System (ADS)

    Soos, Z. G.; Ramasesha, S.

    1984-05-01

    The ground and low-lying states of finite quantum-cell models with one state per site are obtained exactly through a real-space basis of valence-bond (VB) diagrams that explicitly conserve the total spin. Regular and alternating Hubbard and Pariser-Parr-Pople (PPP) chains and rings with Ne electrons on N(<=12) sites are extrapolated to infinite arrays. The ground-state energy and optical gap of regular U=4|t| Hubbard chains agree with exact results, suggesting comparable accuracy for alternating Hubbard and PPP models, but differ from mean-field results. Molecular PPP parameters describe well the excitations of finite polyenes, odd polyene ions, linear cyanine dyes, and slightly overestimate the absorption peaks in polyacetylene (CH)x. Molecular correlations contrast sharply with uncorrelated descriptions of topological solitons, which are modeled by regular polyene radicals and their ions for both wide and narrow alternation crossovers. Neutral solitons have no midgap absorption and negative spin densities, while the intensity of the in-gap excitation of charged solitons is not enhanced. The properties of correlated states in quantum-cell models with one valence state per site are discussed in the adiabatic limit for excited-state geometries and instabilities to dimerization.

  5. Comparison of Modeling Methods to Determine Liver-to-blood Inocula and Parasite Multiplication Rates During Controlled Human Malaria Infection

    PubMed Central

    Douglas, Alexander D.; Edwards, Nick J.; Duncan, Christopher J. A.; Thompson, Fiona M.; Sheehy, Susanne H.; O'Hara, Geraldine A.; Anagnostou, Nicholas; Walther, Michael; Webster, Daniel P.; Dunachie, Susanna J.; Porter, David W.; Andrews, Laura; Gilbert, Sarah C.; Draper, Simon J.; Hill, Adrian V. S.; Bejon, Philip

    2013-01-01

    Controlled human malaria infection is used to measure efficacy of candidate malaria vaccines before field studies are undertaken. Mathematical modeling using data from quantitative polymerase chain reaction (qPCR) parasitemia monitoring can discriminate between vaccine effects on the parasite's liver and blood stages. Uncertainty regarding the most appropriate modeling method hinders interpretation of such trials. We used qPCR data from 267 Plasmodium falciparum infections to compare linear, sine-wave, and normal-cumulative-density-function models. We find that the parameters estimated by these models are closely correlated, and their predictive accuracy for omitted data points was similar. We propose that future studies include the linear model. PMID:23570846

  6. Helping Students Assess the Relative Importance of Different Intermolecular Interactions

    ERIC Educational Resources Information Center

    Jasien, Paul G.

    2008-01-01

    A semi-quantitative model has been developed to estimate the relative effects of dispersion, dipole-dipole interactions, and H-bonding on the normal boiling points ("T[subscript b]") for a subset of simple organic systems. The model is based upon a statistical analysis using multiple linear regression on a series of straight-chain organic…

  7. Stress stiffening and approximate equations in flexible multibody dynamics

    NASA Technical Reports Server (NTRS)

    Padilla, Carlos E.; Vonflotow, Andreas H.

    1993-01-01

    A useful model for open chains of flexible bodies undergoing large rigid body motions, but small elastic deformations, is one in which the equations of motion are linearized in the small elastic deformations and deformation rates. For slow rigid body motions, the correctly linearized, or consistent, set of equations can be compared to prematurely linearized, or inconsistent, equations and to 'oversimplified,' or ruthless, equations through the use of open loop dynamic simulations. It has been shown that the inconsistent model should never be used, while the ruthless model should be used whenever possible. The consistent and inconsistent models differ by stress stiffening terms. These are due to zeroth-order stresses effecting virtual work via nonlinear strain-displacement terms. In this paper we examine in detail the nature of these stress stiffening terms and conclude that they are significant only when the associated zeroth-order stresses approach 'buckling' stresses. Finally it is emphasized that when the stress stiffening terms are negligible the ruthlessly linearized equations should be used.

  8. Survival condition for low-frequency quasi-one-dimensional breathers in a two-dimensional strongly anisotropic crystal

    NASA Astrophysics Data System (ADS)

    Savin, A. V.; Zubova, E. A.; Manevitch, L. I.

    2005-06-01

    We investigate a two-dimensional (2D) strongly anisotropic crystal (2D SAC) on substrate: 2D system of coupled linear chains of particles with strong intrachain and weak interchain interactions, each chain being subjected to the sine background potential. Nonlinear dynamics of one of these chains when the rest of them are fixed is reduced to the well known Frenkel-Kontorova (FK) model. Depending on strengh of the substrate, the 2D SAC models a variety of physical systems: polymer crystals with identical chains having light side groups, an array of inductively coupled long Josephson junctions, anisotropic crystals having light and heavy sublattices. Continuum limit of the FK model, the sine-Gordon (sG) equation, allows two types of soliton solutions: topological solitons and breathers. It is known that the quasi-one-dimensional topological solitons can propagate also in a chain of 2D system of coupled chains and even in a helix chain in a three-dimensional model of polymer crystal. In contrast to this, numerical simulation shows that the long-living breathers inherent to the FK model do not exist in the 2D SAC with weak background potential. The effect changes scenario of kink-antikink collision with small relative velocity: at weak background potential the collision always results only in intensive phonon radiation while kink-antikink recombination in the FK model results in long-living low-frequency sG breather creation. We found the survival condition for breathers in the 2D SAC on substrate depending on breather frequency and strength of the background potential. The survival condition bears no relation to resonances between breather frequency and frequencies of phonon band—contrary to the case of the FK model.

  9. Local rectification of heat flux

    NASA Astrophysics Data System (ADS)

    Pons, M.; Cui, Y. Y.; Ruschhaupt, A.; Simón, M. A.; Muga, J. G.

    2017-09-01

    We present a chain-of-atoms model where heat is rectified, with different fluxes from the hot to the cold baths located at the chain boundaries when the temperature bias is reversed. The chain is homogeneous except for boundary effects and a local modification of the interactions at one site, the “impurity”. The rectification mechanism is due here to the localized impurity, the only asymmetrical element of the structure, apart from the externally imposed temperature bias, and does not rely on putting in contact different materials or other known mechanisms such as grading or long-range interactions. The effect survives if all interaction forces are linear except the ones for the impurity.

  10. Self-organization and stability of magnetosome chains—A simulation study

    PubMed Central

    Faivre, Damien; Klumpp, Stefan

    2018-01-01

    Magnetotactic bacteria orient in magnetic fields with the help of their magnetosome chain, a linear structure of membrane enclosed magnetic nanoparticles (magnetosomes) anchored to a cytoskeletal filament. Here, we use simulations to study the assembly and the stability of magnetosome chains. We introduce a computational model describing the attachment of the magnetosomes to the filament and their magnetic interactions. We show that the filamentous backbone is crucial for the robust assembly of the magnetic particles into a linear chain, which in turn is key for the functionality of the chain in cellular orientation and magnetically directed swimming. In addition, we simulate the response to an external magnetic field that is rotated away from the axis of the filament, an experimental method used to probe the mechanical stability of the chain. The competition between alignment along the filament and alignment with the external fields leads to the rupture of a chain if the applied field exceeeds a threshold value. These observations are in agreement with previous experiments at the population level. Beyond that, our simulations provide a detailed picture of chain rupture at the single cell level, which is found to happen through two abrupt events, which both depend on the field strength and orientation. The re-formation of the chain structure after such rupture is found to be strongly sped up in the presence of a magnetic field parallel to the filament, an observation that may also be of interest for the design of self-healing materials. Our simulations underline the dynamic nature of the magnetosome chain. More generally, they show the rich complexity of self-assembly in systems with competing driving forces for alignment. PMID:29315342

  11. Room temperature structures and odd even behaviour of a homologous series of anhydrous lithium n-alkanoates

    NASA Astrophysics Data System (ADS)

    White, Nicole A. S.; Ellis, Henry A.

    2008-10-01

    The molecular structures of a homologous series of lithium n-alkanoates have been determined at room temperature using infrared spectroscopy, polarizing light microscopy and X-ray powder diffraction in conjunction with density and melting point measurements. For all the compounds investigated, asymmetric ionic metal-carboxylate coordination is proposed, with the molecules located within a triclinic crystal system with P1¯ space group. The molecules are nearly all of similar structure and are arranged within lamellar layers with four molecules per unit cell. The hydrocarbon chains, in nearly all trans conformation, are arranged tail-to-tail and tilted at an average angle of 55 ο to the planes containing lithium ions. The unit cell parameters such as sides: b and c increase linearly with increasing chain length whilst side a shows a linear decrease. Furthermore, the measured densities and melting points show odd-even behaviour, suggesting differences in molecular packing between odd and even chain length homologues. Geometric models are proposed to explain molecular orientation within a lamella and odd-even behaviour, involving the influence of terminal groups on the packing geometry of hydrocarbon chains within the lattice.

  12. Stochastic model of template-directed elongation processes in biology.

    PubMed

    Schilstra, Maria J; Nehaniv, Chrystopher L

    2010-10-01

    We present a novel modular, stochastic model for biological template-based linear chain elongation processes. In this model, elongation complexes (ECs; DNA polymerase, RNA polymerase, or ribosomes associated with nascent chains) that span a finite number of template units step along the template, one after another, with semaphore constructs preventing overtaking. The central elongation module is readily extended with modules that represent initiation and termination processes. The model was used to explore the effect of EC span on motor velocity and dispersion, and the effect of initiation activator and repressor binding kinetics on the overall elongation dynamics. The results demonstrate that (1) motors that move smoothly are able to travel at a greater velocity and closer together than motors that move more erratically, and (2) the rate at which completed chains are released is proportional to the occupancy or vacancy of activator or repressor binding sites only when initiation or activator/repressor dissociation is slow in comparison with elongation. Copyright © 2010 Elsevier Ireland Ltd. All rights reserved.

  13. Estimating a graphical intra-class correlation coefficient (GICC) using multivariate probit-linear mixed models.

    PubMed

    Yue, Chen; Chen, Shaojie; Sair, Haris I; Airan, Raag; Caffo, Brian S

    2015-09-01

    Data reproducibility is a critical issue in all scientific experiments. In this manuscript, the problem of quantifying the reproducibility of graphical measurements is considered. The image intra-class correlation coefficient (I2C2) is generalized and the graphical intra-class correlation coefficient (GICC) is proposed for such purpose. The concept for GICC is based on multivariate probit-linear mixed effect models. A Markov Chain Monte Carlo EM (mcm-cEM) algorithm is used for estimating the GICC. Simulation results with varied settings are demonstrated and our method is applied to the KIRBY21 test-retest dataset.

  14. A descriptive model of resting-state networks using Markov chains.

    PubMed

    Xie, H; Pal, R; Mitra, S

    2016-08-01

    Resting-state functional connectivity (RSFC) studies considering pairwise linear correlations have attracted great interests while the underlying functional network structure still remains poorly understood. To further our understanding of RSFC, this paper presents an analysis of the resting-state networks (RSNs) based on the steady-state distributions and provides a novel angle to investigate the RSFC of multiple functional nodes. This paper evaluates the consistency of two networks based on the Hellinger distance between the steady-state distributions of the inferred Markov chain models. The results show that generated steady-state distributions of default mode network have higher consistency across subjects than random nodes from various RSNs.

  15. A comparison of the solvation structure and dynamics of the lithium ion in linear organic carbonates with different alkyl chain lengths.

    PubMed

    Fulfer, K D; Kuroda, D G

    2017-09-20

    The structure and dynamics of electrolytes composed of lithium hexafluorophosphate (LiPF 6 ) in dimethyl carbonate, ethyl methyl carbonate, and diethyl carbonate were investigated using a combination of linear and two-dimensional infrared spectroscopies. The solutions studied here have a LiPF 6 concentration of X(LiPF 6 ) = 0.09, which is typically found in commercial lithium ion batteries. This study focuses on comparing the differences in the solvation shell structure and dynamics produced by linear organic carbonates of different alkyl chain lengths. The IR experiments show that either linear carbonate forms a tetrahedral solvation shell (coordination number of 4) around the lithium ion irrespective of whether the solvation shell has anions in close proximity to the carbonates. Moreover, analysis of the absorption cross sections via FTIR and DFT computations reveals a distortion in the angle formed by Li + -O[double bond, length as m-dash]C which decreases from the expected 180° when the alkyl chains of the carbonate are lengthened. In addition, our findings also reveal that, likely due to its asymmetric structure, ethyl methyl carbonate has a significantly more distorted tetrahedral lithium ion solvation shell than either of the other two investigated carbonates. IR photon echo studies further demonstrate that the motions of the solvation shell have a time scale of a few picoseconds for all three linear carbonates. Interestingly, a slowdown of the in place-motions of the first solvation shell is observed when the carbonate has a longer alkyl chain length irrespective of the symmetry. In addition, vibrational energy transfer with a time scale of tens of picoseconds is observed between strongly coupled modes arising from the solvation shell structure of the Li + which corroborates the modeling of these solvation shells in terms of highly coupled vibrational states. Results of this study provide new insights into the molecular structure and dynamics of the lithium ion electrolyte components as a function of solvent structure.

  16. Supply chain network design problem for a new market opportunity in an agile manufacturing system

    NASA Astrophysics Data System (ADS)

    Babazadeh, Reza; Razmi, Jafar; Ghodsi, Reza

    2012-08-01

    The characteristics of today's competitive environment, such as the speed with which products are designed, manufactured, and distributed, and the need for higher responsiveness and lower operational cost, are forcing companies to search for innovative ways to do business. The concept of agile manufacturing has been proposed in response to these challenges for companies. This paper copes with the strategic and tactical level decisions in agile supply chain network design. An efficient mixed-integer linear programming model that is able to consider the key characteristics of agile supply chain such as direct shipments, outsourcing, different transportation modes, discount, alliance (process and information integration) between opened facilities, and maximum waiting time of customers for deliveries is developed. In addition, in the proposed model, the capacity of facilities is determined as decision variables, which are often assumed to be fixed. Computational results illustrate that the proposed model can be applied as a power tool in agile supply chain network design as well as in the integration of strategic decisions with tactical decisions.

  17. Exact mapping between system-reservoir quantum models and semi-infinite discrete chains using orthogonal polynomials

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chin, Alex W.; Rivas, Angel; Huelga, Susana F.

    2010-09-15

    By using the properties of orthogonal polynomials, we present an exact unitary transformation that maps the Hamiltonian of a quantum system coupled linearly to a continuum of bosonic or fermionic modes to a Hamiltonian that describes a one-dimensional chain with only nearest-neighbor interactions. This analytical transformation predicts a simple set of relations between the parameters of the chain and the recurrence coefficients of the orthogonal polynomials used in the transformation and allows the chain parameters to be computed using numerically stable algorithms that have been developed to compute recurrence coefficients. We then prove some general properties of this chain systemmore » for a wide range of spectral functions and give examples drawn from physical systems where exact analytic expressions for the chain properties can be obtained. Crucially, the short-range interactions of the effective chain system permit these open-quantum systems to be efficiently simulated by the density matrix renormalization group methods.« less

  18. Accessing the dynamics of end-grafted flexible polymer chains by atomic force-electrochemical microscopy. Theoretical modeling of the approach curves by the elastic bounded diffusion model and Monte Carlo simulations. Evidence for compression-induced lateral chain escape.

    PubMed

    Abbou, Jeremy; Anne, Agnès; Demaille, Christophe

    2006-11-16

    The dynamics of a molecular layer of linear poly(ethylene glycol) (PEG) chains of molecular weight 3400, bearing at one end a ferrocene (Fc) label and thiol end-grafted at a low surface coverage onto a gold substrate, is probed using combined atomic force-electrochemical microscopy (AFM-SECM), at the scale of approximately 100 molecules. Force and current approach curves are simultaneously recorded as a force-sensing microelectrode (tip) is inserted within the approximately 10 nm thick, redox labeled, PEG chain layer. Whereas the force approach curve gives access to the structure of the compressed PEG layer, the tip-current, resulting from tip-to-substrate redox cycling of the Fc head of the chain, is controlled by chain dynamics. The elastic bounded diffusion model, which considers the motion of the Fc head as diffusion in a conformational field, complemented by Monte Carlo (MC) simulations, from which the chain conformation can be derived for any degree of confinement, allows the theoretical tip-current approach curve to be calculated. The experimental current approach curve can then be very satisfyingly reproduced by theory, down to a tip-substrate separation of approximately 2 nm, using only one adjustable parameter characterizing the chain dynamics: the effective diffusion coefficient of the chain head. At closer tip-substrate separations, an unpredicted peak is observed in the experimental current approach curve, which is shown to find its origin in a compression-induced escape of the chain from within the narrowing tip-substrate gap. MC simulations provide quantitative support for lateral chain elongation as the escape mechanism.

  19. Transit and lifespan in neutrophil production: implications for drug intervention.

    PubMed

    Câmara De Souza, Daniel; Craig, Morgan; Cassidy, Tyler; Li, Jun; Nekka, Fahima; Bélair, Jacques; Humphries, Antony R

    2018-02-01

    A comparison of the transit compartment ordinary differential equation modelling approach to distributed and discrete delay differential equation models is studied by focusing on Quartino's extension to the Friberg transit compartment model of myelosuppression, widely relied upon in the pharmaceutical sciences to predict the neutrophil response after chemotherapy, and on a QSP delay differential equation model of granulopoiesis. An extension to the Quartino model is provided by considering a general number of transit compartments and introducing an extra parameter that allows for the decoupling of the maturation time from the production rate of cells. An overview of the well established linear chain technique, used to reformulate transit compartment models with constant transit rates as distributed delay differential equations (DDEs), is then given. A state-dependent time rescaling of the Quartino model is performed to apply the linear chain technique and rewrite the Quartino model as a distributed DDE, yielding a discrete DDE model in a certain parameter limit. Next, stability and bifurcation analyses are undertaken in an effort to situate such studies in a mathematical pharmacology context. We show that both the original Friberg and the Quartino extension models incorrectly define the mean maturation time, essentially treating the proliferative pool as an additional maturation compartment. This misspecification can have far reaching consequences on the development of future models of myelosuppression in PK/PD.

  20. Shear and elongational rheology of photo-oxidative degraded HDPE and LLDPE

    NASA Astrophysics Data System (ADS)

    Wagner, Manfred Hermann; Zheng, Wang; Wang, Peng; Talamante, Sebastián Ramos; Narimissa, Esmaeil

    2017-05-01

    The effect of photo-oxidative degradation of high-density polyethylene (HDPE) and linear low-density polyethylene (LLDPE) was investigated by linear and non-linear rheological measurements. The linear-viscoelastic rheological measurements were performed at different temperatures, while the elongational viscosity was measured at 170°C and at different strain rates. The rheological data are indicative of structural changes caused by photo-oxidative degradation including formation of long-chain branches (LCB), cross-linking, and chain scission, and they revealed a cyclic and continuing competition between chain scission and LCB/gel formation. These findings are supported by additional FTIR measurements and direct measurements of the gel content of the degraded samples.

  1. A High-Dimensional, Multivariate Copula Approach to Modeling Multivariate Agricultural Price Relationships and Tail Dependencies

    Treesearch

    Xuan Chi; Barry Goodwin

    2012-01-01

    Spatial and temporal relationships among agricultural prices have been an important topic of applied research for many years. Such research is used to investigate the performance of markets and to examine linkages up and down the marketing chain. This research has empirically evaluated price linkages by using correlation and regression models and, later, linear and...

  2. Effect of magnetic dipolar interactions on nanoparticle heating efficiency: Implications for cancer hyperthermia

    PubMed Central

    Branquinho, Luis C.; Carrião, Marcus S.; Costa, Anderson S.; Zufelato, Nicholas; Sousa, Marcelo H.; Miotto, Ronei; Ivkov, Robert; Bakuzis, Andris F.

    2013-01-01

    Nanostructured magnetic systems have many applications, including potential use in cancer therapy deriving from their ability to heat in alternating magnetic fields. In this work we explore the influence of particle chain formation on the normalized heating properties, or specific loss power (SLP) of both low- (spherical) and high- (parallelepiped) anisotropy ferrite-based magnetic fluids. Analysis of ferromagnetic resonance (FMR) data shows that high particle concentrations correlate with increasing chain length producing decreasing SLP. Monte Carlo simulations corroborate the FMR results. We propose a theoretical model describing dipole interactions valid for the linear response regime to explain the observed trends. This model predicts optimum particle sizes for hyperthermia to about 30% smaller than those previously predicted, depending on the nanoparticle parameters and chain size. Also, optimum chain lengths depended on nanoparticle surface-to-surface distance. Our results might have important implications to cancer treatment and could motivate new strategies to optimize magnetic hyperthermia. PMID:24096272

  3. Energy exchange and transition to localization in the asymmetric Fermi-Pasta-Ulam oscillatory chain

    NASA Astrophysics Data System (ADS)

    Smirnov, Valeri V.; Shepelev, Denis S.; Manevitch, Leonid I.

    2013-01-01

    A finite (periodic) FPU chain is chosen as a convenient model for investigating the energy exchange phenomenon in nonlinear oscillatory systems. As we have recently shown, this phenomenon may occur as a consequence of the resonant interaction between high-frequency nonlinear normal modes. This interaction determines both the complete energy exchange between different parts of the chain and the transition to energy localization in an excited group of particles. In the paper, we demonstrate that this mechanism can exist in realistic (asymmetric) models of atomic or molecular oscillatory chains. Also, we study the resonant interaction of conjugated nonlinear normal modes and prove a possibility of linearization of the equations of motion. The theoretical constructions developed in this paper are based on the concepts of "effective particles" and Limiting Phase Trajectories. In particular, an analytical description of energy exchange between the "effective particles" in the terms of non-smooth functions is presented. The analytical results are confirmed with numerical simulations.

  4. Did the ever dead outnumber the living and when? A birth-and-death approach

    NASA Astrophysics Data System (ADS)

    Avan, Jean; Grosjean, Nicolas; Huillet, Thierry

    2015-02-01

    This paper is an attempt to formalize analytically the question raised in 'World Population Explained: Do Dead People Outnumber Living, Or Vice Versa?' Huffington Post, Howard (2012). We start developing simple deterministic Malthusian growth models of the problem (with birth and death rates either constant or time-dependent) before running into both linear birth and death Markov chain models and age-structured models.

  5. Increase of Long-chain Branching by Thermo-oxidative Treatment of LDPE

    NASA Astrophysics Data System (ADS)

    Rolón-Garrido, Víctor H.; Luo, Jinji; Wagner, Manfred H.

    2011-07-01

    Low-density polyethylene (LDPE) was exposed to thermal and thermo-oxidative treatment at 170 °C, and subsequently characterized by linear-viscoelastic measurements and in uniaxial extension. The Molecular Stress Function (MSF) model was used to quantify the elongational viscosities measured. For the thermally treated samples, exposure times between 2 and 6 hours were applied. Formation of long-chain branching (LCB) was found to occur only during the first two hours of thermal treatment. At longer exposure times, no difference in the level of strain hardening was observed. This was quantified by use of the MSF model: the nonlinear parameter fmax2 increased from fmax2 = 14 for the virgin sample to fmax2 = 22 for the samples thermally treated between 2 and 6 hours. For the thermo-oxidatively treated samples, which were exposed to air during thermal treatment between 30 and 90 minutes, the level of strain hardening increases drastically up to fmax2 = 55 with increasing exposure times from 30 up to 75 min due to LCB formation, and then decreases for an exposure time of 90 minutes due to chain scission dominating LCB formation. The nonlinear parameter β of the MSF model was found to be β = 2 for all samples, indicating that the general type of the random branching structure remains the same under all thermal conditions. Consequently only the parameter fmax2 of the MSF model and the linear-viscoelastic spectra were required to describe quantitatively the experimental observations. The strain hardening index, which is sometimes used to quantify strain hardening, follows accurately the trend of the MSF model parameter fmax2.

  6. Theory of optical transitions in conjugated polymers. II. Real systems

    NASA Astrophysics Data System (ADS)

    Marcus, Max; Tozer, Oliver Robert; Barford, William

    2014-10-01

    The theory of optical transitions developed in Barford and Marcus ["Theory of optical transitions in conjugated polymers. I. Ideal systems," J. Chem. Phys. 141, 164101 (2014)] for linear, ordered polymer chains is extended in this paper to model conformationally disordered systems. Our key result is that in the Born-Oppenheimer regime the emission intensities are proportional to S(1)/⟨IPR⟩, where S(1) is the Huang-Rhys parameter for a monomer. ⟨IPR⟩ is the average inverse participation ratio for the emitting species, i.e., local exciton ground states (LEGSs). Since the spatial coherence of LEGSs determines the spatial extent of chromophores, the significance of this result is that it directly relates experimental observables to chromophore sizes (where ⟨IPR⟩ is half the mean chromophore size in monomer units). This result is independent of the chromophore shape, because of the Born-Oppenheimer factorization of the many body wavefunction. We verify this prediction by density matrix renormalization group (DMRG) calculations of the Frenkel-Holstein model in the adiabatic limit for both linear, disordered chains and for coiled, ordered chains. We also model optical spectra for poly(p-phenylene) and poly(p-phenylene-vinylene) oligomers and polymers. For oligomers, we solve the fully quantized Frenkel-Holstein model via the DMRG method. For polymers, we use the much simpler method of solving the one-particle Frenkel model and employ the Born-Oppenheimer expressions relating the effective Franck-Condon factor of a chromophore to its inverse participation ratio. We show that increased disorder decreases chromophore sizes and increases the inhomogeneous broadening, but has a non-monotonic effect on transition energies. We also show that as planarizing the polymer chain increases the exciton band width, it causes the chromophore sizes to increase, the transition energies to decrease, and the broadening to decrease. Finally, we show that the absorption spectra are more broadened than the emission spectra and that the broadening of the absorption spectra increases as the chains become more coiled. This is primarily because absorption occurs to both LEGSs and quasi-extended exciton states (QEESs), and QEES acquire increased intensity as chromophores bend, while emission only occurs from LEGSs.

  7. Effect of molecular topology on the transport properties of dendrimers in dilute solution at Θ temperature: A Brownian dynamics study

    NASA Astrophysics Data System (ADS)

    Bosko, Jaroslaw T.; Ravi Prakash, J.

    2008-01-01

    Structure and transport properties of dendrimers in dilute solution are studied with the aid of Brownian dynamics simulations. To investigate the effect of molecular topology on the properties, linear chain, star, and dendrimer molecules of comparable molecular weights are studied. A bead-spring chain model with finitely extensible springs and fluctuating hydrodynamic interactions is used to represent polymer molecules under Θ conditions. Structural properties as well as the diffusivity and zero-shear-rate intrinsic viscosity of polymers with varied degrees of branching are analyzed. Results for the free-draining case are compared to and found in very good agreement with the Rouse model predictions. Translational diffusivity is evaluated and the difference between the short-time and long-time behavior due to dynamic correlations is observed. Incorporation of hydrodynamic interactions is found to be sufficient to reproduce the maximum in the intrinsic viscosity versus molecular weight observed experimentally for dendrimers. Results of the nonequilibrium Brownian dynamics simulations of dendrimers and linear chain polymers subjected to a planar shear flow in a wide range of strain rates are also reported. The flow-induced molecular deformation of molecules is found to decrease hydrodynamic interactions and lead to the appearance of shear thickening. Further, branching is found to suppress flow-induced molecular alignment and deformation.

  8. The Considere Condition and Rapid Stretching of Linear and Branched Polymer Melts

    NASA Technical Reports Server (NTRS)

    McKinley, Gareth H.; Hassager, Ole

    1999-01-01

    We analyze the onset of "necking" and subsequent filament failure during the transient uniaxial elongation of viscoelastic fluid samples in extensional rheometers. In the limit of rapid elongation (such that no molecular relaxation occurs), the external work applied is all stored elastically and the Considere criterion originally developed in solid mechanics can be used to quantitatively predict the critical Hencky strain to failure. By comparing the predictions of the Doi-Edwards model for linear homopolymer melts with those of the "Pom-Pom" model for prototypical branched melts we show that the critical strain to failure in rapid elongation of a rubbery material is intimately linked to the molecular topology of the chain, especially the degree of chain branching. The onset of necking instability is monotonically shifted to larger Hencky strains as the number of branches is increased. Numerical computations at finite Deborah numbers also show that there is an optimal range of deformation rates over which homogeneous extensions can be maintained to large strain. We also consider other rapid homogeneous stretching deformations, such as biaxial and planar stretching, and show that the degree of stabilization afforded by inclusion of material with long-chain branching is a sensitive function of the imposed mode of deformation.

  9. Non-detection of HC11N towards TMC-1: constraining the chemistry of large carbon-chain molecules

    NASA Astrophysics Data System (ADS)

    Loomis, Ryan A.; Shingledecker, Christopher N.; Langston, Glen; McGuire, Brett A.; Dollhopf, Niklaus M.; Burkhardt, Andrew M.; Corby, Joanna; Booth, Shawn T.; Carroll, P. Brandon; Turner, Barry; Remijan, Anthony J.

    2016-12-01

    Bell et al. reported the first detection of the cyanopolyyne HC11N towards the cold dark cloud TMC-1; no subsequent detections have been reported towards any source. Additional observations of cyanopolyynes and other carbon-chain molecules towards TMC-1 have shown a log-linear trend between molecule size and column density, and in an effort to further explore the underlying chemical processes driving this trend, we have analysed Green Bank Telescope observations of HC9N and HC11N towards TMC-1. Although we find an HC9N column density consistent with previous values, HC11N is not detected and we derive an upper limit column density significantly below that reported in Bell et al. Using a state-of-the-art chemical model, we have investigated possible explanations of non-linearity in the column density trend. Despite updating the chemical model to better account for ion-dipole interactions, we are not able to explain the non-detection of HC11N, and we interpret this as evidence of previously unknown carbon-chain chemistry. We propose that cyclization reactions may be responsible for the depleted HC11N abundance, and that products of these cyclization reactions should be investigated as candidate interstellar molecules.

  10. A unifying model for elongational flow of polymer melts and solutions based on the interchain tube pressure concept

    NASA Astrophysics Data System (ADS)

    Wagner, Manfred Hermann; Rolón-Garrido, Víctor Hugo

    2015-04-01

    An extended interchain tube pressure model for polymer melts and concentrated solutions is presented, based on the idea that the pressures exerted by a polymer chain on the walls of an anisotropic confinement are anisotropic (M. Doi and S. F. Edwards, The Theory of Polymer Dynamics, Oxford University Press, New York, 1986). In a tube model with variable tube diameter, chain stretch and tube diameter reduction are related, and at deformation rates larger than the inverse Rouse time τR, the chain is stretched and its confining tube becomes increasingly anisotropic. Tube diameter reduction leads to an interchain pressure in the lateral direction of the tube, which is proportional to the 3rd power of stretch (G. Marrucci and G. Ianniruberto. Macromolecules 37, 3934-3942, 2004). In the extended interchain tube pressure (EIP) model, it is assumed that chain stretch is balanced by interchain tube pressure in the lateral direction, and by a spring force in the longitudinal direction of the tube, which is linear in stretch. The scaling relations established for the relaxation modulus of concentrated solutions of polystyrene in oligomeric styrene (M. H. Wagner, Rheol. Acta 53, 765-777, 2014, M. H. Wagner, J. Non-Newtonian Fluid Mech. http://dx.doi.org/10.1016/j.jnnfm.2014.09.017, 2014) are applied to the solutions of polystyrene (PS) in diethyl phthalate (DEP) investigated by Bhattacharjee et al. (P. K. Bhattacharjee et al., Macromolecules 35, 10131-10148, 2002) and Acharya et al. (M. V. Acharya et al. AIP Conference Proceedings 1027, 391-393, 2008). The scaling relies on the difference ΔTg between the glass-transition temperatures of the melt and the glass-transition temperatures of the solutions. ΔTg can be inferred from the reported zero-shear viscosities, and the BSW spectra of the solutions are obtained from the BSW spectrum of the reference melt with good accuracy. Predictions of the EIP model are compared to the steady-state elongational viscosity data of PS/DEP solutions. Except for a possible influence of solvent quality, linear and nonlinear viscoelasticity of entangled polystyrene solutions can thus be obtained from the linear-viscoelastic characteristics of a reference polymer melt and the shift of the glass transition temperature between melt and solution.

  11. Chain-Length-Dependent Exciton Dynamics in Linear Oligothiophenes Probed Using Ensemble and Single-Molecule Spectroscopy.

    PubMed

    Kim, Tae-Woo; Kim, Woojae; Park, Kyu Hyung; Kim, Pyosang; Cho, Jae-Won; Shimizu, Hideyuki; Iyoda, Masahiko; Kim, Dongho

    2016-02-04

    Exciton dynamics in π-conjugated molecular systems is highly susceptible to conformational disorder. Using time-resolved and single-molecule spectroscopic techniques, the effect of chain length on the exciton dynamics in a series of linear oligothiophenes, for which the conformational disorder increased with increasing chain length, was investigated. As a result, extraordinary features of the exciton dynamics in longer-chain oligothiophene were revealed. Ultrafast fluorescence depolarization processes were observed due to exciton self-trapping in longer and bent chains. Increase in exciton delocalization during dynamic planarization processes was also observed in the linear oligothiophenes via time-resolved fluorescence spectra but was restricted in L-10T because of its considerable conformational disorder. Exciton delocalization was also unexpectedly observed in a bent chain using single-molecule fluorescence spectroscopy. Such delocalization modulates the fluorescence spectral shape by attenuating the 0-0 peak intensity. Collectively, these results provide significant insights into the exciton dynamics in conjugated polymers.

  12. Generalized theory of semiflexible polymers.

    PubMed

    Wiggins, Paul A; Nelson, Philip C

    2006-03-01

    DNA bending on length scales shorter than a persistence length plays an integral role in the translation of genetic information from DNA to cellular function. Quantitative experimental studies of these biological systems have led to a renewed interest in the polymer mechanics relevant for describing the conformational free energy of DNA bending induced by protein-DNA complexes. Recent experimental results from DNA cyclization studies have cast doubt on the applicability of the canonical semiflexible polymer theory, the wormlike chain (WLC) model, to DNA bending on biologically relevant length scales. This paper develops a theory of the chain statistics of a class of generalized semiflexible polymer models. Our focus is on the theoretical development of these models and the calculation of experimental observables. To illustrate our methods, we focus on a specific, illustrative model of DNA bending. We show that the WLC model generically describes the long-length-scale chain statistics of semiflexible polymers, as predicted by renormalization group arguments. In particular, we show that either the WLC or our present model adequately describes force-extension, solution scattering, and long-contour-length cyclization experiments, regardless of the details of DNA bend elasticity. In contrast, experiments sensitive to short-length-scale chain behavior can in principle reveal dramatic departures from the linear elastic behavior assumed in the WLC model. We demonstrate this explicitly by showing that our toy model can reproduce the anomalously large short-contour-length cyclization factors recently measured by Cloutier and Widom. Finally, we discuss the applicability of these models to DNA chain statistics in the context of future experiments.

  13. Point-by-point model calculation of the prompt neutron multiplicity distribution ν(A) in the incident neutron energy range of multi-chance fission

    NASA Astrophysics Data System (ADS)

    Tudora, Anabella; Hambsch, Franz-Josef; Tobosaru, Viorel

    2017-09-01

    Prompt neutron multiplicity distributions ν(A) are required for prompt emission correction of double energy (2E) measurements of fission fragments to determine pre-neutron fragment properties. The lack of experimental ν(A) data especially at incident neutron energies (En) where the multi-chance fission occurs impose the use of ν(A) predicted by models. The Point-by-Point model of prompt emission is able to provide the individual ν(A) of the compound nuclei of the main and secondary nucleus chains undergoing fission at a given En. The total ν(A) is obtained by averaging these individual ν(A) over the probabilities of fission chances (expressed as total and partial fission cross-section ratios). An indirect validation of the total ν(A) results is proposed. At high En, above 70 MeV, the PbP results of individual ν(A) of the first few nuclei of the main and secondary nucleus chains exhibit an almost linear increase. This shape is explained by the damping of shell effects entering the super-fluid expression of the level density parameters. They tend to approach the asymptotic values for most of the fragments. This fact leads to a smooth and almost linear increase of fragment excitation energy with the mass number that is reflected in a smooth and almost linear behaviour of ν(A).

  14. Improved prediction of residue flexibility by embedding optimized amino acid grouping into RSA-based linear models.

    PubMed

    Zhang, Hua; Kurgan, Lukasz

    2014-12-01

    Knowledge of protein flexibility is vital for deciphering the corresponding functional mechanisms. This knowledge would help, for instance, in improving computational drug design and refinement in homology-based modeling. We propose a new predictor of the residue flexibility, which is expressed by B-factors, from protein chains that use local (in the chain) predicted (or native) relative solvent accessibility (RSA) and custom-derived amino acid (AA) alphabets. Our predictor is implemented as a two-stage linear regression model that uses RSA-based space in a local sequence window in the first stage and a reduced AA pair-based space in the second stage as the inputs. This method is easy to comprehend explicit linear form in both stages. Particle swarm optimization was used to find an optimal reduced AA alphabet to simplify the input space and improve the prediction performance. The average correlation coefficients between the native and predicted B-factors measured on a large benchmark dataset are improved from 0.65 to 0.67 when using the native RSA values and from 0.55 to 0.57 when using the predicted RSA values. Blind tests that were performed on two independent datasets show consistent improvements in the average correlation coefficients by a modest value of 0.02 for both native and predicted RSA-based predictions.

  15. Evidence for the interior evolution of Ceres from geologic analysis of fractures

    USGS Publications Warehouse

    Scully, Jennifer E. C.; Buczkowski, Debra; Schmedemann, Nico; Raymond, Carol A.; Castillo-Rogez, Julie C.; Scott King,; Bland, Michael T.; Ermakov, Anton; O'Brien, D.P.; Marchi, S.; Longobardo, A.; Russell, C.T.; Fu, R.R.; Neveu, M.

    2017-01-01

    Ceres is the largest asteroid belt object, and the Dawn spacecraft observed Ceres since 2015. Dawn observed two morphologically distinct linear features on Ceres's surface: secondary crater chains and pit chains. Pit chains provide unique insights into Ceres's interior evolution. We interpret pit chains called the Samhain Catenae as the surface expression of subsurface fractures. Using the pit chains' spacings, we estimate that the localized thickness of Ceres's fractured, outer layer is approximately ≥58 km, at least ~14 km greater than the global average. We hypothesize that extensional stresses, induced by a region of upwelling material arising from convection/diapirism, formed the Samhain Catenae. We derive characteristics for this upwelling material, which can be used as constraints in future interior modeling studies. For example, its predicted location coincides with Hanami Planum, a high-elevation region with a negative residual gravity anomaly, which may be surficial evidence for this proposed region of upwelling material.

  16. Design starch: stochastic modeling of starch granule biogenesis.

    PubMed

    Raguin, Adélaïde; Ebenhöh, Oliver

    2017-08-15

    Starch is the most widespread and abundant storage carbohydrate in plants and the main source of carbohydrate in the human diet. Owing to its remarkable properties and commercial applications, starch is still of growing interest. Its unique granular structure made of intercalated layers of amylopectin and amylose has been unraveled thanks to recent progress in microscopic imaging, but the origin of such periodicity is still under debate. Both amylose and amylopectin are made of linear chains of α-1,4-bound glucose residues, with branch points formed by α-1,6 linkages. The net difference in the distribution of chain lengths and the branching pattern of amylose (mainly linear), compared with amylopectin (racemose structure), leads to different physico-chemical properties. Amylose is an amorphous and soluble polysaccharide, whereas amylopectin is insoluble and exhibits a highly organized structure of densely packed double helices formed between neighboring linear chains. Contrarily to starch degradation that has been investigated since the early 20th century, starch production is still poorly understood. Most enzymes involved in starch growth (elongation, branching, debranching, and partial hydrolysis) are now identified. However, their specific action, their interplay (cooperative or competitive), and their kinetic properties are still largely unknown. After reviewing recent results on starch structure and starch growth and degradation enzymatic activity, we discuss recent results and current challenges for growing polysaccharides on granular surface. Finally, we highlight the importance of novel stochastic models to support the analysis of recent and complex experimental results, and to address how macroscopic properties emerge from enzymatic activity and structural rearrangements. © 2017 The Author(s).

  17. An Alternative Derivation of the Energy Levels of the "Particle on a Ring" System

    NASA Astrophysics Data System (ADS)

    Vincent, Alan

    1996-10-01

    All acceptable wave functions must be continuous mathematical functions. This criterion limits the acceptable functions for a particle in a linear 1-dimensional box to sine functions. If, however, the linear box is bent round into a ring, acceptable wave functions are those which are continuous at the 'join'. On this model some acceptable linear functions become unacceptable for the ring and some unacceptable cosine functions become acceptable. This approach can be used to produce a straightforward derivation of the energy levels and wave functions of the particle on a ring. These simple wave mechanical systems can be used as models of linear and cyclic delocalised systems such as conjugated hydrocarbons or the benzene ring. The promotion energy of an electron can then be used to calculate the wavelength of absorption of uv light. The simple model gives results of the correct order of magnitude and shows that, as the chain length increases, the uv maximum moves to longer wavelengths, as found experimentally.

  18. The growth of carbon chains in IRC +10216 mapped with ALMA⋆

    PubMed Central

    Agúndez, M.; Cernicharo, J.; Quintana-Lacaci, G.; Castro-Carrizo, A.; Velilla Prieto, L.; Marcelino, N.; Guélin, M.; Joblin, C.; Martín-Gago, J. A.; Gottlieb, C. A.; Patel, N. A.; McCarthy, M. C.

    2017-01-01

    Linear carbon chains are common in various types of astronomical molecular sources. Possible formation mechanisms involve both bottom-up and top-down routes. We have carried out a combined observational and modeling study of the formation of carbon chains in the C-star envelope IRC +10216, where the polymerization of acetylene and hydrogen cyanide induced by ultraviolet photons can drive the formation of linear carbon chains of increasing length. We have used ALMA to map the emission of λ 3 mm rotational lines of the hydrocarbon radicals C2H, C4H, and C6H, and the CN-containing species CN, C3N, HC3N, and HC5N with an angular resolution of ~1″. The spatial distribution of all these species is a hollow, 5-10″ wide, spherical shell located at a radius of 10-20″ from the star, with no appreciable emission close to the star. Our observations resolve the broad shell of carbon chains into thinner sub-shells which are 1-2″ wide and not fully concentric, indicating that the mass loss process has been discontinuous and not fully isotropic. The radial distributions of the species mapped reveal subtle differences: while the hydrocarbon radicals have very similar radial distributions, the CN-containing species show more diverse distributions, with HC3N appearing earlier in the expansion and the radical CN extending later than the rest of the species. The observed morphology can be rationalized by a chemical model in which the growth of polyynes is mainly produced by rapid gas-phase chemical reactions of C2H and C4H radicals with unsaturated hydrocarbons, while cyanopolyynes are mainly formed from polyynes in gas-phase reactions with CN and C3N radicals. PMID:28469283

  19. Exotic states of matter with polariton chains

    NASA Astrophysics Data System (ADS)

    Kalinin, Kirill P.; Lagoudakis, Pavlos G.; Berloff, Natalia G.

    2018-04-01

    We consider linear periodic chains of exciton-polariton condensates formed by pumping polaritons nonresonantly into a linear network. To the leading order such a sequence of condensates establishes relative phases as to minimize a classical one-dimensional X Y Hamiltonian with nearest and next-to-nearest neighbors. We show that the low-energy states of polaritonic linear chains demonstrate various classical regimes: ferromagnetic, antiferromagnetic, and frustrated spiral phases where quantum or thermal fluctuations are expected to give rise to a spin-liquid state. At the same time nonlinear interactions at higher pumping intensities bring about phase chaos and novel exotic phases.

  20. Computer Simulations of Bottlebrush Melts and Soft Networks

    NASA Astrophysics Data System (ADS)

    Cao, Zhen; Carrillo, Jan-Michael; Sheiko, Sergei; Dobrynin, Andrey

    We have studied dense bottlebrush systems in a melt and network state using a combination of the molecular dynamics simulations and analytical calculations. Our simulations show that the bottlebrush macromolecules in a melt behave as ideal chains with the effective Kuhn length bK. The bottlebrush induced bending rigidity is due to redistribution of the side chains upon backbone bending. Kuhn length of the bottlebrushes increases with increasing the side-chain degree of polymerization nsc as bK ~nsc0 . 46 . This model of bottlebrush macromolecules is extended to describe mechanical properties of bottlebrush networks in linear and nonlinear deformation regimes. In the linear deformation regime, the network shear modulus scales with the degree of polymerization of the side chains as G0 ~nsc + 1 - 1 as long as the ratio of the Kuhn length to the size of the fully extended bottlebrush backbone between crosslinks, Rmax, is smaller than unity, bK /Rmax < < 1 . Bottlebrush networks with bK /Rmax ~ 1 demonstrate behavior similar to that of networks of semiflexible chains with G0 ~nsc- 0 . 5 . In the nonlinear deformation regime, the deformation dependent shear modulus is a universal function of the first strain invariant I1 and bottlebrush backbone deformation ratio β describing stretching ability of the bottlebrush backbone between crosslinks. Nsf DMR-1409710 DMR-1436201.

  1. Chain stiffness, salt valency, and concentration influences on titration curves of polyelectrolytes: Monte Carlo simulations

    NASA Astrophysics Data System (ADS)

    Carnal, Fabrice; Stoll, Serge

    2011-01-01

    Monte Carlo simulations have been used to study two different models of a weak linear polyelectrolyte surrounded by explicit counterions and salt particles: (i) a rigid rod and (ii) a flexible chain. We focused on the influence of the pH, chain stiffness, salt concentration, and valency on the polyelectrolyte titration process and conformational properties. It is shown that chain acid-base properties and conformational properties are strongly modified when multivalent salt concentration variation ranges below the charge equivalence. Increasing chain stiffness allows to minimize intramolecular electrostatic monomer interactions hence improving the deprotonation process. The presence of di and trivalent salt cations clearly promotes the chain degree of ionization but has only a limited effect at very low salt concentration ranges. Moreover, folded structures of fully charged chains are only observed when multivalent salt at a concentration equal or above charge equivalence is considered. Long-range electrostatic potential is found to influence the distribution of charges along and around the polyelectrolyte backbones hence resulting in a higher degree of ionization and a lower attraction of counterions and salt particles at the chain extremities.

  2. Chain stiffness, salt valency, and concentration influences on titration curves of polyelectrolytes: Monte Carlo simulations.

    PubMed

    Carnal, Fabrice; Stoll, Serge

    2011-01-28

    Monte Carlo simulations have been used to study two different models of a weak linear polyelectrolyte surrounded by explicit counterions and salt particles: (i) a rigid rod and (ii) a flexible chain. We focused on the influence of the pH, chain stiffness, salt concentration, and valency on the polyelectrolyte titration process and conformational properties. It is shown that chain acid-base properties and conformational properties are strongly modified when multivalent salt concentration variation ranges below the charge equivalence. Increasing chain stiffness allows to minimize intramolecular electrostatic monomer interactions hence improving the deprotonation process. The presence of di and trivalent salt cations clearly promotes the chain degree of ionization but has only a limited effect at very low salt concentration ranges. Moreover, folded structures of fully charged chains are only observed when multivalent salt at a concentration equal or above charge equivalence is considered. Long-range electrostatic potential is found to influence the distribution of charges along and around the polyelectrolyte backbones hence resulting in a higher degree of ionization and a lower attraction of counterions and salt particles at the chain extremities.

  3. The effect of polymer architecture on the interdiffusion in thin polymer films

    NASA Astrophysics Data System (ADS)

    Caglayan, Ayse; Yuan, Guangcui; Satija, Sushil K.; Uhrig, David; Hong, Kunlun; Akgun, Bulent

    Branched polymer chains have been traditionally used in industrial applications as additives. Recently they have found applications in electrochromic displays, lithography, biomedical coatings and targeting multidrug resistant bacteria. In some of these applications where they are confined in thin layers, it is important to understand the relation between the mobility and polymer chain architecture to optimize the processing conditions. Earlier interdiffusion measurements on linear and cyclic polymer chains demonstrated the key role of chain architecture on mobility. We have determined the vertical diffusion coefficients of the star polystyrene chains in thin films as a function of number of polymer arms, molecular weight per arm, and film thickness using neutron reflectivity (NR) and compare our results with linear chains of identical total molecular weight. Bilayer samples of 4-arm and 8-arm protonated polystyrenes (hPS) and deuterated polystyrenes (dPS) were used to elucidate the effect of polymer chain architecture on polymer diffusion. NR measurements indicate that the mobility of polymer chains in thin films get faster as the number of polymer arms increases and the arm molecular weight decreases. Both star polymers showed faster interdiffusion compared to their linear analog. Diffusion coefficient of branched PS chains has a weak dependence on the film thickness.

  4. Predicting the Performance of Chain Saw Machines Based on Shore Scleroscope Hardness

    NASA Astrophysics Data System (ADS)

    Tumac, Deniz

    2014-03-01

    Shore hardness has been used to estimate several physical and mechanical properties of rocks over the last few decades. However, the number of researches correlating Shore hardness with rock cutting performance is quite limited. Also, rather limited researches have been carried out on predicting the performance of chain saw machines. This study differs from the previous investigations in the way that Shore hardness values (SH1, SH2, and deformation coefficient) are used to determine the field performance of chain saw machines. The measured Shore hardness values are correlated with the physical and mechanical properties of natural stone samples, cutting parameters (normal force, cutting force, and specific energy) obtained from linear cutting tests in unrelieved cutting mode, and areal net cutting rate of chain saw machines. Two empirical models developed previously are improved for the prediction of the areal net cutting rate of chain saw machines. The first model is based on a revised chain saw penetration index, which uses SH1, machine weight, and useful arm cutting depth as predictors. The second model is based on the power consumed for only cutting the stone, arm thickness, and specific energy as a function of the deformation coefficient. While cutting force has a strong relationship with Shore hardness values, the normal force has a weak or moderate correlation. Uniaxial compressive strength, Cerchar abrasivity index, and density can also be predicted by Shore hardness values.

  5. A Brownian dynamics program for the simulation of linear and circular DNA and other wormlike chain polyelectrolytes.

    PubMed Central

    Klenin, K; Merlitz, H; Langowski, J

    1998-01-01

    For the interpretation of solution structural and dynamic data of linear and circular DNA molecules in the kb range, and for the prediction of the effect of local structural changes on the global conformation of such DNAs, we have developed an efficient and easy way to set up a program based on a second-order explicit Brownian dynamics algorithm. The DNA is modeled by a chain of rigid segments interacting through harmonic spring potentials for bending, torsion, and stretching. The electrostatics are handled using precalculated energy tables for the interactions between DNA segments as a function of relative orientation and distance. Hydrodynamic interactions are treated using the Rotne-Prager tensor. While maintaining acceptable precision, the simulation can be accelerated by recalculating this tensor only once in a certain number of steps. PMID:9533691

  6. Experimental linear-optics simulation of ground-state of an Ising spin chain.

    PubMed

    Xue, Peng; Zhan, Xian; Bian, Zhihao

    2017-05-19

    We experimentally demonstrate a photonic quantum simulator: by using a two-spin Ising chain (an isolated dimer) as an example, we encode the wavefunction of the ground state with a pair of entangled photons. The effect of magnetic fields, leading to a critical modification of the correlation between two spins, can be simulated by just local operations. With the ratio of simulated magnetic fields and coupling strength increasing, the ground state of the system changes from a product state to an entangled state and back to another product state. The simulated ground states can be distinguished and the transformations between them can be observed by measuring correlations between photons. This simulation of the Ising model with linear quantum optics opens the door to the future studies which connect quantum information and condensed matter physics.

  7. Computerized implementation of higher-order electron-correlation methods and their linear-scaling divide-and-conquer extensions.

    PubMed

    Nakano, Masahiko; Yoshikawa, Takeshi; Hirata, So; Seino, Junji; Nakai, Hiromi

    2017-11-05

    We have implemented a linear-scaling divide-and-conquer (DC)-based higher-order coupled-cluster (CC) and Møller-Plesset perturbation theories (MPPT) as well as their combinations automatically by means of the tensor contraction engine, which is a computerized symbolic algebra system. The DC-based energy expressions of the standard CC and MPPT methods and the CC methods augmented with a perturbation correction were proposed for up to high excitation orders [e.g., CCSDTQ, MP4, and CCSD(2) TQ ]. The numerical assessment for hydrogen halide chains, polyene chains, and first coordination sphere (C1) model of photoactive yellow protein has revealed that the DC-based correlation methods provide reliable correlation energies with significantly less computational cost than that of the conventional implementations. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

  8. Traveling solitons in long-range oscillator chains

    NASA Astrophysics Data System (ADS)

    Miloshevich, George; Nguenang, Jean Pierre; Dauxois, Thierry; Khomeriki, Ramaz; Ruffo, Stefano

    2017-03-01

    We investigate the existence and propagation of solitons in a long-range extension of the quartic Fermi-Pasta-Ulam (FPU) chain of anharmonic oscillators. The coupling in the linear term decays as a power-law with an exponent 1<α ≤slant 3 . We obtain an analytic perturbative expression of traveling envelope solitons by introducing a non linear Schrödinger equation for the slowly varying amplitude of short wavelength modes. Due to the non analytic properties of the dispersion relation, it is crucial to develop the theory using discrete difference operators. Those properties are also the ultimate reason why kink-solitons may exist but are unstable, at variance with the short-range FPU model. We successfully compare these approximate analytic results with numerical simulations for the value α =2 which was chosen as a case study.

  9. Neutrino masses and cosmological parameters from a Euclid-like survey: Markov Chain Monte Carlo forecasts including theoretical errors

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Audren, Benjamin; Lesgourgues, Julien; Bird, Simeon

    2013-01-01

    We present forecasts for the accuracy of determining the parameters of a minimal cosmological model and the total neutrino mass based on combined mock data for a future Euclid-like galaxy survey and Planck. We consider two different galaxy surveys: a spectroscopic redshift survey and a cosmic shear survey. We make use of the Monte Carlo Markov Chains (MCMC) technique and assume two sets of theoretical errors. The first error is meant to account for uncertainties in the modelling of the effect of neutrinos on the non-linear galaxy power spectrum and we assume this error to be fully correlated in Fouriermore » space. The second error is meant to parametrize the overall residual uncertainties in modelling the non-linear galaxy power spectrum at small scales, and is conservatively assumed to be uncorrelated and to increase with the ratio of a given scale to the scale of non-linearity. It hence increases with wavenumber and decreases with redshift. With these two assumptions for the errors and assuming further conservatively that the uncorrelated error rises above 2% at k = 0.4 h/Mpc and z = 0.5, we find that a future Euclid-like cosmic shear/galaxy survey achieves a 1-σ error on M{sub ν} close to 32 meV/25 meV, sufficient for detecting the total neutrino mass with good significance. If the residual uncorrelated errors indeed rises rapidly towards smaller scales in the non-linear regime as we have assumed here then the data on non-linear scales does not increase the sensitivity to the total neutrino mass. Assuming instead a ten times smaller theoretical error with the same scale dependence, the error on the total neutrino mass decreases moderately from σ(M{sub ν}) = 18 meV to 14 meV when mildly non-linear scales with 0.1 h/Mpc < k < 0.6 h/Mpc are included in the analysis of the galaxy survey data.« less

  10. Thermodynamics of alternate Ising chains of spins 1 and 3/2 with dipolar, biquadratic, and single ion interactions

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Fireman, E.C.; dos Santos, R.J.

    1997-04-01

    Within a recently developed extended decoration-transformation formalism we study the thermodynamic properties of a linear chain of alternate Ising {sigma}=1 and S=3/2 spins. We allow for different anisotropy fields on each subchain of different spins. For some range of the parameter space we show the existence of a crossover from a ferromagnetic to an antiferromagnetic-like behavior of the model, as explicitly captured in the susceptibility results. {copyright} {ital 1997 American Institute of Physics.}

  11. The bond rupture force for sulfur chains calculated from quantum chemistry simulations and its relevance to the tensile strength of vulcanized rubber

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hanson, David Edward; Barber, John L.

    From quantum chemistry simulations using density functional theory, we obtain the total electronic energy of an eight-atom sulfur chain as its end-to-end distance is extended until S–S bond rupture occurs. We find that a sulfur chain can be extended by about 40% beyond its nominally straight conformation, where it experiences rupture at an end-to-end tension of about 1.5 nN. Using this rupture force as the chain failure limit in an explicit polymer network simulation model (EPnet), we predict the tensile failure stress for sulfur crosslinked (vulcanized) natural rubber. Furthermore, quantitative agreement with published experimental data for the failure stress ismore » obtained in these simulations if we assume that only about 30% of the sulfur chains produce viable network crosslinks. Surprisingly, we also find that the failure stress of a rubber network does not scale linearly with the chain failure force limit.« less

  12. Phosphorylated ubiquitin chain is the genuine Parkin receptor

    PubMed Central

    Okatsu, Kei; Koyano, Fumika; Kimura, Mayumi; Kosako, Hidetaka; Saeki, Yasushi

    2015-01-01

    PINK1 selectively recruits Parkin to depolarized mitochondria for quarantine and removal of damaged mitochondria via ubiquitylation. Dysfunction of this process predisposes development of familial recessive Parkinson’s disease. Although various models for the recruitment process have been proposed, none of them adequately explain the accumulated data, and thus the molecular basis for PINK1 recruitment of Parkin remains to be fully elucidated. In this study, we show that a linear ubiquitin chain of phosphomimetic tetra-ubiquitin(S65D) recruits Parkin to energized mitochondria in the absence of PINK1, whereas a wild-type tetra-ubiquitin chain does not. Under more physiologically relevant conditions, a lysosomal phosphorylated polyubiquitin chain recruited phosphomimetic Parkin to the lysosome. A cellular ubiquitin replacement system confirmed that ubiquitin phosphorylation is indeed essential for Parkin translocation. Furthermore, physical interactions between phosphomimetic Parkin and phosphorylated polyubiquitin chain were detected by immunoprecipitation from cells and in vitro reconstitution using recombinant proteins. We thus propose that the phosphorylated ubiquitin chain functions as the genuine Parkin receptor for recruitment to depolarized mitochondria. PMID:25847540

  13. The bond rupture force for sulfur chains calculated from quantum chemistry simulations and its relevance to the tensile strength of vulcanized rubber

    DOE PAGES

    Hanson, David Edward; Barber, John L.

    2017-11-20

    From quantum chemistry simulations using density functional theory, we obtain the total electronic energy of an eight-atom sulfur chain as its end-to-end distance is extended until S–S bond rupture occurs. We find that a sulfur chain can be extended by about 40% beyond its nominally straight conformation, where it experiences rupture at an end-to-end tension of about 1.5 nN. Using this rupture force as the chain failure limit in an explicit polymer network simulation model (EPnet), we predict the tensile failure stress for sulfur crosslinked (vulcanized) natural rubber. Furthermore, quantitative agreement with published experimental data for the failure stress ismore » obtained in these simulations if we assume that only about 30% of the sulfur chains produce viable network crosslinks. Surprisingly, we also find that the failure stress of a rubber network does not scale linearly with the chain failure force limit.« less

  14. Notes from the field: the economic value chain in disease management organizations.

    PubMed

    Fetterolf, Donald

    2006-12-01

    The disease management (DM) "value chain" is composed of a linear series of steps that include operational milestones in the development of knowledge, each stage evolving from the preceding one. As an adaptation of Michael Porter's "value chain" model, the process flow in DM moves along the following path: (1) data/information technology, (2) information generation, (3) analysis, (4) assessment/recommendations, (5) actionable customer plan, and (6) program assessment/reassessment. Each of these stages is managed as a major line of product operations within a DM company or health plan. Metrics around each of the key production variables create benchmark milestones, ongoing management insight into program effectiveness, and potential drivers for activity-based cost accounting pricing models. The value chain process must remain robust from early entry of data and information into the system, through the final presentation and recommendations for our clients if the program is to be effective. For individuals involved in the evaluation or review of DM programs, this framework is an excellent method to visualize the key components and sequence in the process. The value chain model is an excellent way to establish the value of a formal DM program and to create a consultancy relationship with a client involved in purchasing these complex services.

  15. Asymptotic study of pulsating evolution of overdriven and CJ detonation with a chain-branching kinetics model

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Short, Mark; Chliquete, Carlos

    2011-01-20

    The pulsating dynamics of gaseous detonations with a model two-step chain-branching kinetic mechanism are studied both numerically and asymptotically. The model studied here was also used in [4], [3] and [2] and mimics the attributes of some chain-branching reaction mechanisms. Specifically, the model comprises a chain-initiationlbranching zone with an Arrhenius temperature-sensitive rate behind the detonation shock where fuel is converted into chain-radical with no heat release. This is followed by a chain-termination zone having a temperature insensitive rate where the exothermic heat of reaction is released. The lengths of these two zones depend on the relative rates of each stage.more » It was determined in [4] and [3] via asymptotic and numerical analysis that the ratio of the length of the chain-branching zone to that of the chain-initation zone relative to the size of the von Neumann state scaled activation energy in the chain initiation/branching zone has a primary influence of the stability of one-dimensional pulsating instability behavior for this model. In [2], the notion of a specific stability parameter related to this ratio was proposed that determines the boundary between stable and unstable waves. In [4], a slow-time varying asymptotic study was conducted of pulsating instability of Chapman-Jouguet (CJ) detonations with the above two-step rate model, assuming a large activation energy for the chain-initiation zone and a chain-termination zone longer than the chain-initiation zone. Deviations D{sub n}{sup (1)} ({tau}) of the detonation velocity from Chapman-Jouguet were of the order of the non-dimensional activation energy. Solutions were sought for a pulsation timescale of the order of the non-dimensional activation energy times the particle transit time through the induction zone. On this time-scale, the evolution of the chain-initation zone is quasi-steady. In [4], a time-dependent non-linear evolution equation for D{sub n}{sup (1)} ({tau}) was then constructed via a perturbation procedure for cases where the ratio of the length of the chain-termination zone to chain-initiation zone was less than the non-dimensional activation energy. To leading order, the steady CJ detonation was found to be unstable; higher-order corrections lead to the construction of a stability limit between stable and unsteady pulsating solutions. One conclusion from this study is that for a stability limit to occur at leading order, the period of pulsation of the detonation must occur on the time scale of particle passage through the longer chain-termination zone, while the length of the chain-termination zone must be of order of the non-dimensional activation energy longer than the chain-initiation zone. The relevance of these suggested scalings was verified via numerical solutions of the full Euler system in [3], and formed the basis of the stability parameter criteria suggested in [2]. In the following, we formulate an asymptotic study based on these new suggested scales, studying the implications for describing pulsating behavior in gaseous chain-branching detonations. Specifically, we find that the chain-induction zone structure is the same as that studied in [4]. However, the study of unsteady evolution in the chain-termination region is now governed by a set of asymptotically derived nonlinear POEs. Equations for the linear stablity behavior of this set of POE's is obtained, while the nonlinear POEs are solved numerically using a shock-attached, shock-fitting method developed by Henrick et aJ. [1]. The results thus far show that the stability threshold calculated using the new ratio of the chain-termination zone length to that of the chain-initiation zone yields a marked improvement over [2]. Additionally, solutions will be compared with predictions obtained from the solution of the full Euler system. Finally, the evolution equation previously derived in [4] has been generalized to consider both arbitrary reaction orders and any degree of overdrive.« less

  16. Improving the Fitness of High-Dimensional Biomechanical Models via Data-Driven Stochastic Exploration

    PubMed Central

    Bustamante, Carlos D.; Valero-Cuevas, Francisco J.

    2010-01-01

    The field of complex biomechanical modeling has begun to rely on Monte Carlo techniques to investigate the effects of parameter variability and measurement uncertainty on model outputs, search for optimal parameter combinations, and define model limitations. However, advanced stochastic methods to perform data-driven explorations, such as Markov chain Monte Carlo (MCMC), become necessary as the number of model parameters increases. Here, we demonstrate the feasibility and, what to our knowledge is, the first use of an MCMC approach to improve the fitness of realistically large biomechanical models. We used a Metropolis–Hastings algorithm to search increasingly complex parameter landscapes (3, 8, 24, and 36 dimensions) to uncover underlying distributions of anatomical parameters of a “truth model” of the human thumb on the basis of simulated kinematic data (thumbnail location, orientation, and linear and angular velocities) polluted by zero-mean, uncorrelated multivariate Gaussian “measurement noise.” Driven by these data, ten Markov chains searched each model parameter space for the subspace that best fit the data (posterior distribution). As expected, the convergence time increased, more local minima were found, and marginal distributions broadened as the parameter space complexity increased. In the 36-D scenario, some chains found local minima but the majority of chains converged to the true posterior distribution (confirmed using a cross-validation dataset), thus demonstrating the feasibility and utility of these methods for realistically large biomechanical problems. PMID:19272906

  17. Evaluating opportunities to improve material and energy impacts in commodity supply chains

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hanes, Rebecca J.; Carpenter, Alberta

    When evaluated at the scale of individual processes, next-generation technologies may be more energy and emissions intensive than current technology. Furthermore, many advanced technologies have the potential to reduce material and energy consumption in upstream or downstream processing stages. In order to fully understand the benefits and consequences of technology deployment, next-generation technologies should be evaluated in context, as part of a supply chain. This work presents the Materials Flow through Industry (MFI) supply chain modeling tool. The MFI tool is a cradle-to-gate linear network model of the US industrial sector that can model a wide range of manufacturing scenarios,more » including changes in production technology and increases in industrial energy efficiency. The MFI tool was developed to perform supply chain scale analyses in order to quantify the impacts and benefits of next-generation technologies and materials at that scale. For the analysis presented in this paper, the MFI tool is utilized to explore a case study comparing three lightweight vehicle supply chains to the supply chain of a conventional, standard weight vehicle. Several of the lightweight vehicle supply chains are evaluated under manufacturing scenarios that include next-generation production technologies and next-generation materials. Results indicate that producing lightweight vehicles is more energy and emission intensive than producing the non-lightweight vehicle, but the fuel saved during vehicle use offsets this increase. In this case study, greater reductions in supply chain energy and emissions were achieved through the application of the next-generation technologies than from application of energy efficiency increases.« less

  18. Evaluating opportunities to improve material and energy impacts in commodity supply chains

    DOE PAGES

    Hanes, Rebecca J.; Carpenter, Alberta

    2017-01-10

    When evaluated at the scale of individual processes, next-generation technologies may be more energy and emissions intensive than current technology. Furthermore, many advanced technologies have the potential to reduce material and energy consumption in upstream or downstream processing stages. In order to fully understand the benefits and consequences of technology deployment, next-generation technologies should be evaluated in context, as part of a supply chain. This work presents the Materials Flow through Industry (MFI) supply chain modeling tool. The MFI tool is a cradle-to-gate linear network model of the US industrial sector that can model a wide range of manufacturing scenarios,more » including changes in production technology and increases in industrial energy efficiency. The MFI tool was developed to perform supply chain scale analyses in order to quantify the impacts and benefits of next-generation technologies and materials at that scale. For the analysis presented in this paper, the MFI tool is utilized to explore a case study comparing three lightweight vehicle supply chains to the supply chain of a conventional, standard weight vehicle. Several of the lightweight vehicle supply chains are evaluated under manufacturing scenarios that include next-generation production technologies and next-generation materials. Results indicate that producing lightweight vehicles is more energy and emission intensive than producing the non-lightweight vehicle, but the fuel saved during vehicle use offsets this increase. In this case study, greater reductions in supply chain energy and emissions were achieved through the application of the next-generation technologies than from application of energy efficiency increases.« less

  19. Integrated strategic and tactical biomass-biofuel supply chain optimization.

    PubMed

    Lin, Tao; Rodríguez, Luis F; Shastri, Yogendra N; Hansen, Alan C; Ting, K C

    2014-03-01

    To ensure effective biomass feedstock provision for large-scale biofuel production, an integrated biomass supply chain optimization model was developed to minimize annual biomass-ethanol production costs by optimizing both strategic and tactical planning decisions simultaneously. The mixed integer linear programming model optimizes the activities range from biomass harvesting, packing, in-field transportation, stacking, transportation, preprocessing, and storage, to ethanol production and distribution. The numbers, locations, and capacities of facilities as well as biomass and ethanol distribution patterns are key strategic decisions; while biomass production, delivery, and operating schedules and inventory monitoring are key tactical decisions. The model was implemented to study Miscanthus-ethanol supply chain in Illinois. The base case results showed unit Miscanthus-ethanol production costs were $0.72L(-1) of ethanol. Biorefinery related costs accounts for 62% of the total costs, followed by biomass procurement costs. Sensitivity analysis showed that a 50% reduction in biomass yield would increase unit production costs by 11%. Copyright © 2014 Elsevier Ltd. All rights reserved.

  20. Gaussian solitary waves and compactons in Fermi–Pasta–Ulam lattices with Hertzian potentials

    PubMed Central

    James, Guillaume; Pelinovsky, Dmitry

    2014-01-01

    We consider a class of fully nonlinear Fermi–Pasta–Ulam (FPU) lattices, consisting of a chain of particles coupled by fractional power nonlinearities of order α>1. This class of systems incorporates a classical Hertzian model describing acoustic wave propagation in chains of touching beads in the absence of precompression. We analyse the propagation of localized waves when α is close to unity. Solutions varying slowly in space and time are searched with an appropriate scaling, and two asymptotic models of the chain of particles are derived consistently. The first one is a logarithmic Korteweg–de Vries (KdV) equation and possesses linearly orbitally stable Gaussian solitary wave solutions. The second model consists of a generalized KdV equation with Hölder-continuous fractional power nonlinearity and admits compacton solutions, i.e. solitary waves with compact support. When , we numerically establish the asymptotically Gaussian shape of exact FPU solitary waves with near-sonic speed and analytically check the pointwise convergence of compactons towards the limiting Gaussian profile. PMID:24808748

  1. Characterizing Plasmonic Excitations of Quasi-2D Chains

    NASA Astrophysics Data System (ADS)

    Townsend, Emily; Bryant, Garnett

    A quantum description of the optical response of nanostructures and other atomic-scale systems is desirable for modeling systems that use plasmons for quantum information transfer, or coherent transport and interference of quantum states, as well as systems small enough for electron tunneling or quantum confinement to affect the electronic states of the system. Such a quantum description is complicated by the fact that collective and single-particle excitations can have similar energies and thus will mix. We seek to better understand the excitations of nanosystems to identify which characteristics of the excitations are most relevant to modeling their behavior. In this work we use a quasi 2-dimensional linear atomic chain as a model system, and exact diagonalization of the many-body Hamiltonian to obtain its excitations. We compare this to previous work in 1-d chains which used a combination of criteria involving a many-body state's transfer dipole moment, balance, transfer charge, dynamical response, and induced-charge distribution to identify which excitations are plasmonic in character.

  2. BFLCRM: A BAYESIAN FUNCTIONAL LINEAR COX REGRESSION MODEL FOR PREDICTING TIME TO CONVERSION TO ALZHEIMER’S DISEASE*

    PubMed Central

    Lee, Eunjee; Zhu, Hongtu; Kong, Dehan; Wang, Yalin; Giovanello, Kelly Sullivan; Ibrahim, Joseph G

    2015-01-01

    The aim of this paper is to develop a Bayesian functional linear Cox regression model (BFLCRM) with both functional and scalar covariates. This new development is motivated by establishing the likelihood of conversion to Alzheimer’s disease (AD) in 346 patients with mild cognitive impairment (MCI) enrolled in the Alzheimer’s Disease Neuroimaging Initiative 1 (ADNI-1) and the early markers of conversion. These 346 MCI patients were followed over 48 months, with 161 MCI participants progressing to AD at 48 months. The functional linear Cox regression model was used to establish that functional covariates including hippocampus surface morphology and scalar covariates including brain MRI volumes, cognitive performance (ADAS-Cog), and APOE status can accurately predict time to onset of AD. Posterior computation proceeds via an efficient Markov chain Monte Carlo algorithm. A simulation study is performed to evaluate the finite sample performance of BFLCRM. PMID:26900412

  3. Sampling schemes and parameter estimation for nonlinear Bernoulli-Gaussian sparse models

    NASA Astrophysics Data System (ADS)

    Boudineau, Mégane; Carfantan, Hervé; Bourguignon, Sébastien; Bazot, Michael

    2016-06-01

    We address the sparse approximation problem in the case where the data are approximated by the linear combination of a small number of elementary signals, each of these signals depending non-linearly on additional parameters. Sparsity is explicitly expressed through a Bernoulli-Gaussian hierarchical model in a Bayesian framework. Posterior mean estimates are computed using Markov Chain Monte-Carlo algorithms. We generalize the partially marginalized Gibbs sampler proposed in the linear case in [1], and build an hybrid Hastings-within-Gibbs algorithm in order to account for the nonlinear parameters. All model parameters are then estimated in an unsupervised procedure. The resulting method is evaluated on a sparse spectral analysis problem. It is shown to converge more efficiently than the classical joint estimation procedure, with only a slight increase of the computational cost per iteration, consequently reducing the global cost of the estimation procedure.

  4. Thermal response of a Fermi-Pasta-Ulam chain with Andersen thermostats

    NASA Astrophysics Data System (ADS)

    D'Ambrosio, Federico; Baiesi, Marco

    2017-11-01

    The linear response to temperature variations is well characterised for equilibrium systems but a similar theory is not available, for example, for inertial heat conducting systems, whose paradigm is the Fermi-Pasta-Ulam (FPU) model driven by two different boundary temperatures. For models of inertial systems out of equilibrium, including relaxing systems, we show that Andersen thermostats are a natural tool for studying the thermal response. We derive a fluctuation-response relation that allows to predict thermal expansion coefficients or the heat capacitance in nonequilibrium regimes. Simulations of the FPU chain of oscillators suggest that estimates of susceptibilities obtained with our relation are better than those obtained via a small perturbation.

  5. Soliton-impurity interaction in two Ablowitz-Ladik chains with different coupling

    NASA Astrophysics Data System (ADS)

    Kamburova, R. S.; Primatarowa, M. T.

    2014-12-01

    The interaction of solitons with point defects in a system of coupled Ablowitz- Ladik (AL) chains is studied numerically. The system is a discrete analog of coupled nonlinear Schrodinger equations. Two types of interchain coupling are investigated: one which admits reduction of the system to the standard integrable AL model (dispersive coupling) and one which couples opposite sites of the chains and does not admit reduction to the AL model (nondispersive coupling). The action of the two coupling types is additive and they can compensate each other in some cases. We have obtained that the single-peak bound soliton-defect solution (attractive impurity) is stable against perturbations, while the double-peak bound soliton-defect solution (repulsive impurity) is unstable and can be easily destroyed. Linear point defects do not influence the period of energy transfer and it is close to the period for the homogeneous case.

  6. Nanoprobe diffusion in entangled polymer solutions: Linear vs. unconcatenated ring chains

    NASA Astrophysics Data System (ADS)

    Nahali, Negar; Rosa, Angelo

    2018-05-01

    We employ large-scale molecular dynamics computer simulations to study the problem of nanoprobe diffusion in entangled solutions of linear polymers and unknotted and unconcatenated circular (ring) polymers. By tuning both the diameter of the nanoprobe and the density of the solution, we show that nanoprobes of diameter smaller than the entanglement distance (tube diameter) of the solution display the same (Rouse-like) behavior in solutions of both polymer architectures. Instead, nanoprobes with larger diameters appear to diffuse markedly faster in solutions of rings than in solutions of linear chains. Finally, by analysing the distribution functions of spatial displacements, we find that nanoprobe motion in rings' solutions shows both Gaussian and ergodic behaviors, in all regimes considered, while, in solutions of linear chains, nanoprobes exceeding the size of the tube diameter show a transition to non-Gaussian and non-ergodic motion. Our results emphasize the role of chain architecture in the motion of nanoprobes dispersed in polymer solutions.

  7. Optimal Linear Responses for Markov Chains and Stochastically Perturbed Dynamical Systems

    NASA Astrophysics Data System (ADS)

    Antown, Fadi; Dragičević, Davor; Froyland, Gary

    2018-03-01

    The linear response of a dynamical system refers to changes to properties of the system when small external perturbations are applied. We consider the little-studied question of selecting an optimal perturbation so as to (i) maximise the linear response of the equilibrium distribution of the system, (ii) maximise the linear response of the expectation of a specified observable, and (iii) maximise the linear response of the rate of convergence of the system to the equilibrium distribution. We also consider the inhomogeneous, sequential, or time-dependent situation where the governing dynamics is not stationary and one wishes to select a sequence of small perturbations so as to maximise the overall linear response at some terminal time. We develop the theory for finite-state Markov chains, provide explicit solutions for some illustrative examples, and numerically apply our theory to stochastically perturbed dynamical systems, where the Markov chain is replaced by a matrix representation of an approximate annealed transfer operator for the random dynamical system.

  8. Excess entropy scaling for the segmental and global dynamics of polyethylene melts.

    PubMed

    Voyiatzis, Evangelos; Müller-Plathe, Florian; Böhm, Michael C

    2014-11-28

    The range of validity of the Rosenfeld and Dzugutov excess entropy scaling laws is analyzed for unentangled linear polyethylene chains. We consider two segmental dynamical quantities, i.e. the bond and the torsional relaxation times, and two global ones, i.e. the chain diffusion coefficient and the viscosity. The excess entropy is approximated by either a series expansion of the entropy in terms of the pair correlation function or by an equation of state for polymers developed in the context of the self associating fluid theory. For the whole range of temperatures and chain lengths considered, the two estimates of the excess entropy are linearly correlated. The scaled bond and torsional relaxation times fall into a master curve irrespective of the chain length and the employed scaling scheme. Both quantities depend non-linearly on the excess entropy. For a fixed chain length, the reduced diffusion coefficient and viscosity scale linearly with the excess entropy. An empirical reduction to a chain length-independent master curve is accessible for both dynamic quantities. The Dzugutov scheme predicts an increased value of the scaled diffusion coefficient with increasing chain length which contrasts physical expectations. The origin of this trend can be traced back to the density dependence of the scaling factors. This finding has not been observed previously for Lennard-Jones chain systems (Macromolecules, 2013, 46, 8710-8723). Thus, it limits the applicability of the Dzugutov approach to polymers. In connection with diffusion coefficients and viscosities, the Rosenfeld scaling law appears to be of higher quality than the Dzugutov approach. An empirical excess entropy scaling is also proposed which leads to a chain length-independent correlation. It is expected to be valid for polymers in the Rouse regime.

  9. Diverging conductance at the contact between random and pure quantum XX spin chains

    NASA Astrophysics Data System (ADS)

    Chatelain, Christophe

    2017-11-01

    A model consisting of two quantum XX spin chains, one homogeneous and the second with random couplings drawn from a binary distribution, is considered. The two chains are coupled to two different non-local thermal baths and their dynamics is governed by a Lindblad equation. In the steady state, a current J is induced between the two chains by coupling them together by their edges and imposing different chemical potentials μ to the two baths. While a regime of linear characteristics J versus Δμ is observed in the absence of randomness, a gap opens as the disorder strength is increased. In the infinite-randomness limit, this behavior is related to the density of states of the localized states contributing to the current. The conductance is shown to diverge in this limit.

  10. First-principles study on electron transport properties of carbon-silicon mixed chains

    NASA Astrophysics Data System (ADS)

    Hu, Wei; Zhou, Qinghua; Liang, Yan; Liu, Wenhua; Wang, Tao; Wan, Haiqing

    2018-03-01

    In this paper, the transport properties of carbon-silicon mixed chains are studied by using the first-principles. We studied five atomic chain models. In these studies, we found that the equilibrium conductances of atomic chains appear to oscillate, the maximum conductance and the minimum conductance are more than twice the difference. Their I-V curves are linear and show the behavior of metal resistance, M5 system and M2 system current ratio is the largest in 0.9 V, which is 3.3, showing a good molecular switch behavior. In the case of bias, while the bias voltage increases, the transmission peaks move from the Fermi level. The resonance transmission peak height is reduced near the Fermi level. In the higher energy range, a large resonance transmission peak reappears, there is still no energy cut-off range.

  11. Detections of Long Carbon Chains CH_{3}CCCCH, C_{6}H, LINEAR-C_{6}H_{2} and C_{7}H in the Low-Mass Star Forming Region L1527

    NASA Astrophysics Data System (ADS)

    Araki, Mitsunori; Takano, Shuro; Sakai, Nami; Yamamoto, Satoshi; Oyama, Takahiro; Kuze, Nobuhiko; Tsukiyama, Koichi

    2017-06-01

    Carbon chains in the warm carbon chain chemistry (WCCC) region has been searched in the 42-44 GHz region by using Green Bank 100 m telescope. Long carbon chains C_{7}H, C_{6}H, CH_{3}CCCCH, and linear-C_{6}H_{2} and cyclic species C_{3}H and C_{3}H_{2}O have been detected in the low-mass star forming region L1527, performing the WCCC. C_{7}H was detected for the first time in molecular clouds. The column density of C_{7}H is derived to be 6.2 × 10^{10} cm^{-2} by using the detected J = 24.5-23.5 and 25.5-24.5 rotational lines. The ^{2}Π_{1/2} electronic state of C_{6}H, locating 21.6 K above the ^{2}Π_{3/2} electronic ground state, and the K_a = 0 line of the para species of linear-C_{6}H_{2} were also detected firstly in molecular clouds. The column densities of the ^{2}Π_{1/2} and ^{2}Π_{3/2} states of C_{6}H in L1527 were derived to be 1.6 × 10^{11} and 1.1 × 10^{12} cm^{-2}, respectively. The total column density of linear-C_{6}H_{2} is obtained to be 1.86 × 10^{11} cm^{-2}. While the abundance ratios of carbon chains in between L1527 and the starless dark cloud Taurus Molecular Cloud-1 Cyanopolyyne Peak (TMC-1 CP) have a trend of decrease by extension of carbon-chain length, column densities of CH_{3}CCCCH and C_{6}H are on the trend. However, the column densities of linear-C_{6}H_{2}, and C_{7}H are as abundant as those of TMC-1 CP in spite of long carbon chain, i.e., they are not on the trend. The abundances of linear-C_{6}H_{2} and C_{7}H show that L1527 is rich for long carbon chains as well as TMC-1 CP.

  12. Reciprocal Sliding Friction Model for an Electro-Deposited Coating and Its Parameter Estimation Using Markov Chain Monte Carlo Method

    PubMed Central

    Kim, Kyungmok; Lee, Jaewook

    2016-01-01

    This paper describes a sliding friction model for an electro-deposited coating. Reciprocating sliding tests using ball-on-flat plate test apparatus are performed to determine an evolution of the kinetic friction coefficient. The evolution of the friction coefficient is classified into the initial running-in period, steady-state sliding, and transition to higher friction. The friction coefficient during the initial running-in period and steady-state sliding is expressed as a simple linear function. The friction coefficient in the transition to higher friction is described with a mathematical model derived from Kachanov-type damage law. The model parameters are then estimated using the Markov Chain Monte Carlo (MCMC) approach. It is identified that estimated friction coefficients obtained by MCMC approach are in good agreement with measured ones. PMID:28773359

  13. Voltage dependency of transmission probability of aperiodic DNA molecule

    NASA Astrophysics Data System (ADS)

    Wiliyanti, V.; Yudiarsah, E.

    2017-07-01

    Characteristics of electron transports in aperiodic DNA molecules have been studied. Double stranded DNA model with the sequences of bases, GCTAGTACGTGACGTAGCTAGGATATGCCTGA, in one chain and its complements on the other chains has been used. Tight binding Hamiltonian is used to model DNA molecules. In the model, we consider that on-site energy of the basis has a linearly dependency on the applied electric field. Slater-Koster scheme is used to model electron hopping constant between bases. The transmission probability of electron from one electrode to the next electrode is calculated using a transfer matrix technique and scattering matrix method simultaneously. The results show that, generally, higher voltage gives a slightly larger value of the transmission probability. The applied voltage seems to shift extended states to lower energy. Meanwhile, the value of the transmission increases with twisting motion frequency increment.

  14. Influence of chain topology on polymer crystallization: poly(ethylene oxide) (PEO) rings vs. linear chains.

    PubMed

    Zardalidis, George; Mars, Julian; Allgaier, Jürgen; Mezger, Markus; Richter, Dieter; Floudas, George

    2016-10-04

    The absence of entanglements, the more compact structure and the faster diffusion in melts of cyclic poly(ethylene oxide) (PEO) chains have consequences on their crystallization behavior at the lamellar and spherulitic length scales. Rings with molecular weight below the entanglement molecular weight (M < M e ), attain the equilibrium configuration composed from twice-folded chains with a lamellar periodicity that is half of the corresponding linear chains. Rings with M > M e undergo distinct step-like conformational changes to a crystalline lamellar with the equilibrium configuration. Rings melt from this configuration in the absence of crystal thickening in sharp contrast to linear chains. In general, rings more easily attain their extended equilibrium configuration due to strained segments and the absence of entanglements. In addition, rings have a higher equilibrium melting temperature. At the level of the spherulitic superstructure, growth rates are much faster for rings reflecting the faster diffusion and more compact structure. With respect to the segmental dynamics in their semi-crystalline state, ring PEOs with a steepness index of ∼34 form some of the "strongest" glasses.

  15. Singlet fission in linear chains of molecules

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ambrosio, Francesco, E-mail: F.Ambrosio@warwick.ac.uk, E-mail: A.Troisi@warwick.ac.uk; Troisi, Alessandro, E-mail: F.Ambrosio@warwick.ac.uk, E-mail: A.Troisi@warwick.ac.uk

    2014-11-28

    We develop a model configuration interaction Hamiltonian to study the electronic structure of a chain of molecules undergoing singlet fission. We first consider models for dimer and trimer and then we use a matrix partitioning technique to build models of arbitrary size able to describe the relevant electronic structure for singlet fission in linear aggregates. We find that the multi-excitonic state (ME) is stabilized at short inter-monomer distance and the extent of this stabilization depends upon the size of orbital coupling between neighboring monomers. We also find that the coupling between ME states located on different molecules is extremely smallmore » leading to bandwidths in the order of ∼10 meV. This observation suggests that multi-exciton states are extremely localized by electron-phonon coupling and that singlet fission involves the transition between a relatively delocalized Frenkel exciton and a strongly localized multi-exciton state. We adopt the methodology commonly used to study non-radiative transitions to describe the singlet fission dynamics in these aggregates and we discuss the limit of validity of the approach. The results indicate that the phenomenology of singlet fission in molecular crystals is different in many important ways from what is observed in isolated dimers.« less

  16. a Multi Objective Model for Optimization of a Green Supply Chain Network

    NASA Astrophysics Data System (ADS)

    Paksoy, Turan; Özceylan, Eren; Weber, Gerhard-Wilhelm

    2010-06-01

    This study develops a model of a closed-loop supply chain (CLSC) network which starts with the suppliers and recycles with the decomposition centers. As a traditional network design, we consider minimizing the all transportation costs and the raw material purchasing costs. To pay attention for the green impacts, different transportation choices are presented between echelons according to their CO2 emissions. The plants can purchase different raw materials in respect of their recyclable ratios. The focuses of this paper are conducting the minimizing total CO2 emissions. Also we try to encourage the customers to use recyclable materials as an environmental performance viewpoint besides minimizing total costs. A multi objective linear programming model is developed via presenting a numerical example. We close the paper with recommendations for future researches.

  17. Theoretical analysis of flux amplification by soft magnetic material in a putative biological magnetic-field receptor.

    PubMed

    Shcherbakov, Valera P; Winklhofer, Michael

    2010-03-01

    Birds are endowed with a magnetic sense that allows them to detect Earth's magnetic field and to use it for orientation. Physiological and behavioral experiments have shown the upper beak to host a magnetoreceptor. Putative magnetoreceptive structures in the beak are nerve terminals that each contain a dozen or so of micrometer-sized clusters of superparamagnetic nanocrystals made of magnetite/maghemite and numerous electron-opaque platelets filled with a so far unidentified, amorphous ferric iron compound. The platelets typically form chainlike structures, which have been proposed to function as magnetic flux focusers for detecting the intensity of the geomagnetic field. Here, we test that proposition from first principles and develop an unconstrained model to determine the equilibrium distribution of magnetization along a linear chain of platelets which we assume to behave magnetically soft and to have no magnetic remanence. Our analysis, which is valid for arbitrary values of the intrinsic magnetic susceptibility chi , shows that chi needs to be much greater than unity to amplify the external field by two orders of magnitude in a chain of platelets. However, the high amplification is confined to the central region of the chain and subsides quadratically toward the ends of the chain. For large values of chi , the possibility opens up of realizing magnetoreceptor mechanisms on the basis of attraction forces between adjacent platelets in a linear chain. The force in the central region of the chain may amount to several pN, which would be sufficient to convert magnetic input energy into mechanical output energy. The striking feature of an ensemble of platelets is its ability to organize into tightly spaced chains under the action of an external field of given strength. We discuss how this property can be exploited for a magnetoreception mechanism.

  18. ALARA: The next link in a chain of activation codes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wilson, P.P.H.; Henderson, D.L.

    1996-12-31

    The Adaptive Laplace and Analytic Radioactivity Analysis [ALARA] code has been developed as the next link in the chain of DKR radioactivity codes. Its methods address the criticisms of DKR while retaining its best features. While DKR ignored loops in the transmutation/decay scheme to preserve the exactness of the mathematical solution, ALARA incorporates new computational approaches without jeopardizing the most important features of DKR`s physical modelling and mathematical methods. The physical model uses `straightened-loop, linear chains` to achieve the same accuracy in the loop solutions as is demanded in the rest of the scheme. In cases where a chain hasmore » no loops, the exact DKR solution is used. Otherwise, ALARA adaptively chooses between a direct Laplace inversion technique and a Laplace expansion inversion technique to optimize the accuracy and speed of the solution. All of these methods result in matrix solutions which allow the fastest and most accurate solution of exact pulsing histories. Since the entire history is solved for each chain as it is created, ALARA achieves the optimum combination of high accuracy, high speed and low memory usage. 8 refs., 2 figs.« less

  19. Monte Carlo simulations of polyelectrolytes inside viral capsids.

    PubMed

    Angelescu, Daniel George; Bruinsma, Robijn; Linse, Per

    2006-04-01

    Structural features of polyelectrolytes as single-stranded RNA or double-stranded DNA confined inside viral capsids and the thermodynamics of the encapsidation of the polyelectrolyte into the viral capsid have been examined for various polyelectrolyte lengths by using a coarse-grained model solved by Monte Carlo simulations. The capsid was modeled as a spherical shell with embedded charges and the genome as a linear jointed chain of oppositely charged beads, and their sizes corresponded to those of a scaled-down T=3 virus. Counterions were explicitly included, but no salt was added. The encapisdated chain was found to be predominantly located at the inner capsid surface, in a disordered manner for flexible chains and in a spool-like structure for stiff chains. The distribution of the small ions was strongly dependent on the polyelectrolyte-capsid charge ratio. The encapsidation enthalpy was negative and its magnitude decreased with increasing polyelectrolyte length, whereas the encapsidation entropy displayed a maximum when the capsid and polyelectrolyte had equal absolute charge. The encapsidation process remained thermodynamically favorable for genome charges ca. 3.5 times the capsid charge. The chain stiffness had only a relatively weak effect on the thermodynamics of the encapsidation.

  20. Ground states of linear rotor chains via the density matrix renormalization group

    NASA Astrophysics Data System (ADS)

    Iouchtchenko, Dmitri; Roy, Pierre-Nicholas

    2018-04-01

    In recent years, experimental techniques have enabled the creation of ultracold optical lattices of molecules and endofullerene peapod nanomolecular assemblies. It was previously suggested that the rotor model resulting from the placement of dipolar linear rotors in one-dimensional lattices at low temperature has a transition between ordered and disordered phases. We use the density matrix renormalization group (DMRG) to compute ground states of chains of up to 100 rotors and provide further evidence of the phase transition in the form of a diverging entanglement entropy. We also propose two methods and present some first steps toward rotational spectra of such molecular assemblies using DMRG. The present work showcases the power of DMRG in this new context of interacting molecular rotors and opens the door to the study of fundamental questions regarding criticality in systems with continuous degrees of freedom.

  1. Sesquinary catenae on the Martian satellite Phobos from reaccretion of escaping ejecta

    PubMed Central

    Nayak, M.; Asphaug, E.

    2016-01-01

    The Martian satellite Phobos is criss-crossed by linear grooves and crater chains whose origin is unexplained. Anomalous grooves are relatively young, and crosscut tidally predicted stress fields as Phobos spirals towards Mars. Here we report strong correspondence between these anomalous features and reaccretion patterns of sesquinary ejecta from impacts on Phobos. Escaping ejecta persistently imprint Phobos with linear, low-velocity crater chains (catenae) that match the geometry and morphology of prominent features that do not fit the tidal model. We prove that these cannot be older than Phobos' current orbit inside Mars' Roche limit. Distinctive reimpact patterns allow sesquinary craters to be traced back to their source, for the first time across any planetary body, creating a novel way to probe planetary surface characteristics. For example, we show that catena-producing craters likely formed in the gravity regime, providing constraints on the ejecta velocity field and knowledge of source crater material properties. PMID:27575002

  2. Linear-to-λ-Shape P-O-P Bond Transmutation in Polyphosphates with Infinite (PO3)∞ Chain.

    PubMed

    Wang, Ying; Li, Lin; Han, Shujuan; Lei, Bing-Hua; Abudoureheman, Maierhaba; Yang, Zhihua; Pan, Shilie

    2017-09-05

    A new metal polyphosphate, α-CsBa 2 (PO 3 ) 5 , exhibiting the first example of a linear P-O-P bond angle in a one-dimensional (PO 3 ) ∞ chain has been reported. Interestingly, α → β phase transition occurs in CsBa 2 (PO 3 ) 5 along with the P-O-P bonds varying from linear to λ-shape, suggesting that α-CsBa 2 (PO 3 ) 5 with unfavorable linear P-O-P bonds is more stable at ambient temperature.

  3. A Study of Oil Viscosity Mental Model

    NASA Astrophysics Data System (ADS)

    Albaiti; Liliasari; Sumarna, Omay; Abdulkadir Martoprawiro, Muhamad

    2017-02-01

    There is no study regarding on how to learn viscosity of the liquid (e.g. oil) by interconnecting macroscopic, sub-microscopic and symbolic levels. Therefore, the purpose of this research was to study the mental model of the oil viscosity. Intermolecular attractive force of oil constituent on the sub-microscopic level is depicted in the form of mental models. In this research, the viscosity data for some types of oil was measured by using Hoppler method. Viscosity of mineral oil SAE 20W-50, mineral oil SAE 15W-40 and synthetic oil SAE 10W-40 were 1.75, 1.31, and 1.03 Pa s, and the densities of these oils were 908.64, 885.04, and 877.02 kg/m3, respectively. The results showed that the greater density of the mineral oil that is assumed to be composed of linear chains of hydrocarbons, the longer the chain of hydrocarbon linear. Consequently, there are stronger the London force and greater the oil viscosity. The density and viscosity of synthetic oil are lower than that of both mineral oils. Synthetic oil structurally forms polymers with large branching. This structure affects a lower synthetic oil viscosity. This study contributes to construct a mental model of pre-service chemistry teachers.

  4. Strong coupling effects in the polarized IR spectra of the chain hydrogen bond systems in imidazole crystals: H/D isotopic ?self-organization? effects in the IR spectra of isotopically diluted imidazole single crystals

    NASA Astrophysics Data System (ADS)

    Flakus, Henryk T.; Michta, Anna

    2004-11-01

    This paper presents the investigation results of the polarized IR spectra of H1245 imidazole crystals and of D1H245, D1245 and H1D245 imidazole deuterium derivative crystals. The spectra were measured using polarized light at the room temperature and at 77 K by a transmission method, for two different crystalline faces. Theoretical analysis of the results concerned linear dichroic effects, H/D isotopic and temperature effects, observed in the spectra of the hydrogen and of the deuterium bonds in imidazole crystals, at the frequency ranges of νN-H and νN-D bands. The basic crystal spectral properties can be satisfactorily interpreted in a quantitative way for a hydrogen bond linear dimer model. Such a model explains not only a two-branch structure of the νN-H and νN-D bands in crystalline spectra, but also some essential linear dichroic effects in the band frequency ranges, for isotopically diluted crystals. Model calculations, performed within the limits of the strong-coupling model, allowed for quantitative interpretation and for understanding of the basic properties of the hydrogen bond IR spectra of imidazole crystals, H/D isotopic, temperature and dichroic effects included. The results allowed verification of theoretical models proposed recently for the imidazole crystal spectra generation mechanisms. In the scope of our studies, the mechanism of H/D isotopic self-organization processes, taking place in the crystal hydrogen bond lattices, was also recognized. It was proved that for isotopically diluted crystalline samples of imidazole, a non-random distribution of protons and deuterons exclusively occurs in some restricted fragments (domains) of open chains of the hydrogen-bonded molecules. Nevertheless, these co-operative interactions between the hydrogen bonds do not concern adjacent fragments of neighboring hydrogen bond chains in the lattice. Analysis of the isotopic self-organization effects in the spectra of imidazole crystals delivered crucial arguments for understanding of the nature of the hydrogen bond spectra generation mechanisms.

  5. Effect of short-chain branching on interfacial polymer structure and dynamics under shear flow.

    PubMed

    Jeong, Sohdam; Kim, Jun Mo; Cho, Soowon; Baig, Chunggi

    2017-11-22

    We present a detailed analysis on the effect of short-chain branches on the structure and dynamics of interfacial chains using atomistic nonequilibrium molecular dynamics simulations of confined polyethylene melts in a wide range of shear rates. The intrinsically fast random motions of the short branches constantly disturb the overall chain conformation, leading to a more compact and less deformed chain structure of the short-chain branched (SCB) polymer against the imposed flow field in comparison with the corresponding linear polymer. Moreover, such highly mobile short branches along the backbone of the SCB polymer lead to relatively weaker out-of-plane wagging dynamics of interfacial chains, with highly curvy backbone structures in the intermediate flow regime. In conjunction with the contribution of short branches (as opposed to that of the backbone) to the total interfacial friction between the chains and the wall, the SCB polymer shows a nearly constant behavior in the degree of slip (d s ) with respect to shear rate in the weak-to-intermediate flow regimes. On the contrary, in the strong flow regime where irregular chain rotation and tumbling dynamics occur via intensive dynamical collisions between interfacial chains and the wall, an enhancement effect on the chain detachment from the wall, caused by short branches, leads to a steeper increase in d s for the SCB polymer than for the linear polymer. Remarkably, the SCB chains at the interface exhibit two distinct types of rolling mechanisms along the backbone, with a half-dumbbell mesoscopic structure at strong flow fields, in addition to the typical hairpin-like tumbling behavior displayed by the linear chains.

  6. Study of fracture and stress-induced morphological instabilities in polymeric materials

    NASA Astrophysics Data System (ADS)

    Sabouri-Ghomi, Mohsen

    We study the phenomena of fracture in polymers at the molecular and continuum level. At a molecular level, we study the failure of polymer/polymer interfaces. Our main focus is on a specific mode of failure known as chain pull-out fracture, which is common to weak adhesive junctions, and polymer blends and mixtures. In the case of the interface between incompatible polymers, reinforcement is achieved by adding a block copolymer to the interface. We introduce a microscopic model based on Brownian dynamics to investigate the effect of the polymerization index N, of the block connector chain, on fracture toughness of such reinforced polymeric junctions. We consider the mushroom regime, where connector chains are grafted with low surface density, for the case of large pulling velocity. We find that for short chains the interface fracture toughness depends linearly on the polymerization index N of the connector chains, while for longer chains the dependence becomes N 3/2. We propose a scaling argument, based on the geometry of the initial configuration, that accounts for both short and long chains and the crossover between them. At the continuum level, we study the pattern selection mechanism of finger-like crack growth phenomena in gradient driven growth problems in general, and the structure of stress-induced morphological instabilities in crazing of polymer glasses in particular. We simulate solidification in a narrow channel through the use of a phase-field model with an adaptive grid. By tuning a dimensionless parameter, the Peclet number, we show a continuous crossover from a free dendrite at high Peclet numbers to anisotropic viscous fingering at low Peclet numbers. At low Peclet numbers we find good agreement between our results, theoretical predictions, and experiment, providing the first quantitative test of solvability theory for anisotropic viscous fingers. For high undercoolings, we find new phenomena, a solid forger which satisfies stability and thermodynamic criterion. We further provide an analytical form for the shape of these fingers, based on local models of solidification, which fits our numerical results from simulation. Later we study the growth of crazes in polymer glasses by deriving the equations of motion of plastic flow at the craze tip, and the steady-state velocity profile of this flow. By developing a phenomenological model, we solve the full time-dependent equations of motion of this highly non-linear phenomena. Our simulation produces the steady-state cellular pattern observed in experiments. We further show that polymer glasses with lower yield stress produce cellular patterns with sharper tips and more cells, indicating instabilities with smaller wavelengths.

  7. Bone conduction responses of middle ear structures in Thiel embalmed heads

    NASA Astrophysics Data System (ADS)

    Arnold, Andreas; Stieger, Christof; Caversaccio, Marco; Kompis, Martin; Guignard, Jérémie

    2015-12-01

    Thiel-embalmed human whole-head specimens offer a promising alternative model for bone conduction (BC) studies of middle ear structures. In this work we present the Thiel model's linearity and stability over time as well as its possible use in the study of a fixed ossicle chain. Using laser Doppler vibrometry (LDV), the motion of the retroauricular skull, the promontory, the stapes footplate and the round window (RW) were measured. A bone-anchored hearing aid stimulated the ears with step sinus tones logarithmically spread between 0.1 and 10 kHz. Linearity of the model was verified using input levels in steps of 10 dBV. The stability of the Thiel model over time was examined with measurements repeated after hours and weeks. The influence of a cement-fixed stapes was assessed. The middle ear elements measured responded linearly in amplitude for the applied input levels (100, 32.6, and 10 mV). The variability of measurements for both short- (2 h) and long-term (4-16 weeks) repetitions in the same ear was lower than the interindividual difference. The fixation of the stapes induced a lowered RW displacement for frequencies near 750 Hz (-4 dB) and an increased displacement for frequencies above 1 kHz (max. +3.7 dB at 4 kHz). LDV assessment of BC-induced middle ear motion in Thiel heads can be performed with stable results. The vibratory RW response is affected by the fixation of the stapes, indicating a measurable effect of ossicle chain inertia on BC response in Thiel embalmed heads.

  8. Evaluating Opportunities to Improve Material and Energy Impacts in Commodity Supply Chains.

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hanes, Rebecca J.; Carpenter, Alberta

    When evaluated at the process level, next-generation technologies may be more energy and emissions intensive than current technology. However, many advanced technologies have the potential to reduce material and energy consumption in upstream or downstream processing stages. In order to fully understand the benefits and consequences of technology deployment, next-generation technologies should be evaluated in context, as part of a supply chain. This work presents the Material Flows through Industry (MFI) scenario modeling tool. The MFI tool is a cradle-to-gate linear network model of the U.S. industrial sector that can model a wide range of manufacturing scenarios, including changes inmore » production technology, increases in industrial energy efficiency, and substitution between functionally equivalent materials. The MFI tool was developed to perform supply chain scale analyses in order to quantify the impacts and benefits of next-generation technologies and materials at that scale. For the analysis presented in this paper, the MFI tool is utilized to explore a case study comparing a steel supply chain to the supply chains of several functionally equivalent materials. Several of the alternatives to the baseline steel supply chain include next-generation production technologies and materials. Results of the case study show that aluminum production scenarios can out-perform the steel supply chain by using either an advanced smelting technology or an increased aluminum recycling rate. The next-generation material supply chains do not perform as well as either aluminum or steel, but may offer additional use phase reductions in energy and emissions that are outside the scope of the MFI tool. Future work will combine results from the MFI tool with a use phase analysis.« less

  9. Reliable design of a closed loop supply chain network under uncertainty: An interval fuzzy possibilistic chance-constrained model

    NASA Astrophysics Data System (ADS)

    Vahdani, Behnam; Tavakkoli-Moghaddam, Reza; Jolai, Fariborz; Baboli, Arman

    2013-06-01

    This article seeks to offer a systematic approach to establishing a reliable network of facilities in closed loop supply chains (CLSCs) under uncertainties. Facilities that are located in this article concurrently satisfy both traditional objective functions and reliability considerations in CLSC network designs. To attack this problem, a novel mathematical model is developed that integrates the network design decisions in both forward and reverse supply chain networks. The model also utilizes an effective reliability approach to find a robust network design. In order to make the results of this article more realistic, a CLSC for a case study in the iron and steel industry has been explored. The considered CLSC is multi-echelon, multi-facility, multi-product and multi-supplier. Furthermore, multiple facilities exist in the reverse logistics network leading to high complexities. Since the collection centres play an important role in this network, the reliability concept of these facilities is taken into consideration. To solve the proposed model, a novel interactive hybrid solution methodology is developed by combining a number of efficient solution approaches from the recent literature. The proposed solution methodology is a bi-objective interval fuzzy possibilistic chance-constraint mixed integer linear programming (BOIFPCCMILP). Finally, computational experiments are provided to demonstrate the applicability and suitability of the proposed model in a supply chain environment and to help decision makers facilitate their analyses.

  10. Hopf and Bautin Bifurcation in a Tritrophic Food Chain Model with Holling Functional Response Types III and IV

    NASA Astrophysics Data System (ADS)

    Castellanos, Víctor; Castillo-Santos, Francisco Eduardo; Dela-Rosa, Miguel Angel; Loreto-Hernández, Iván

    In this paper, we analyze the Hopf and Bautin bifurcation of a given system of differential equations, corresponding to a tritrophic food chain model with Holling functional response types III and IV for the predator and superpredator, respectively. We distinguish two cases, when the prey has linear or logistic growth. In both cases we guarantee the existence of a limit cycle bifurcating from an equilibrium point in the positive octant of ℝ3. In order to do so, for the Hopf bifurcation we compute explicitly the first Lyapunov coefficient, the transversality Hopf condition, and for the Bautin bifurcation we also compute the second Lyapunov coefficient and verify the regularity conditions.

  11. Symplectic integration of closed chain rigid body dynamics with internal coordinate equations of motion

    NASA Astrophysics Data System (ADS)

    Mazur, Alexey K.

    1999-07-01

    Internal coordinate molecular dynamics (ICMD) is a recent efficient method for modeling polymer molecules which treats them as chains of rigid bodies rather than ensembles of point particles as in Cartesian MD. Unfortunately, it is readily applicable only to linear or tree topologies without closed flexible loops. Important examples violating this condition are sugar rings of nucleic acids, proline residues in proteins, and also disulfide bridges. This paper presents the first complete numerical solution of the chain closure problem within the context of ICMD. The method combines natural implicit fixation of bond lengths and bond angles by the choice of internal coordinates with explicit constraints similar to Cartesian dynamics used to maintain the chain closure. It is affordable for large molecules and makes possible 3-5 times faster dynamics simulations of molecular systems with flexible rings, including important biological objects like nucleic acids and disulfide-bonded proteins.

  12. Canonical Structure and Orthogonality of Forces and Currents in Irreversible Markov Chains

    NASA Astrophysics Data System (ADS)

    Kaiser, Marcus; Jack, Robert L.; Zimmer, Johannes

    2018-03-01

    We discuss a canonical structure that provides a unifying description of dynamical large deviations for irreversible finite state Markov chains (continuous time), Onsager theory, and Macroscopic Fluctuation Theory (MFT). For Markov chains, this theory involves a non-linear relation between probability currents and their conjugate forces. Within this framework, we show how the forces can be split into two components, which are orthogonal to each other, in a generalised sense. This splitting allows a decomposition of the pathwise rate function into three terms, which have physical interpretations in terms of dissipation and convergence to equilibrium. Similar decompositions hold for rate functions at level 2 and level 2.5. These results clarify how bounds on entropy production and fluctuation theorems emerge from the underlying dynamical rules. We discuss how these results for Markov chains are related to similar structures within MFT, which describes hydrodynamic limits of such microscopic models.

  13. A supply chain model to improve the beef quality distribution using investment analysis: A case study

    NASA Astrophysics Data System (ADS)

    Lupita, Alessandra; Rangkuti, Sabrina Heriza; Sutopo, Wahyudi; Hisjam, Muh.

    2017-11-01

    There are significant differences related to the quality and price of the beef commodity in traditional market and modern market in Indonesia. Those are caused by very different treatments of the commodity. The different treatments are in the slaughter lines, the transportation from the abattoir to the outlet, the display system, and the control system. If the problem is not solved by the Government, the gap will result a great loss of the consumer regarding to the quality and sustainability of traditional traders business because of the declining interest in purchasing beef in the traditional markets. This article aims to improve the quality of beef in traditional markets. This study proposed A Supply Chain Model that involves the schemes of investment and government incentive for improving the distribution system. The supply chain model is can be formulated using the Mix Integer Linear Programming (MILP) and solved using the IBM®ILOG®CPLEX software. The results show that the proposed model can be used to determine the priority of programs for improving the quality and sustainability business of traditional beef merchants. By using the models, The Government can make a decision to consider incentives for improving the condition.

  14. DFT Modeling of Cross-Linked Polyethylene: Role of Gold Atoms and Dispersion Interactions.

    PubMed

    Blaško, Martin; Mach, Pavel; Antušek, Andrej; Urban, Miroslav

    2018-02-08

    Using DFT modeling, we analyze the concerted action of gold atoms and dispersion interactions in cross-linked polyethylene. Our model consists of two oligomer chains (PEn) with 7, 11, 15, 19, or 23 carbon atoms in each oligomer cross-linked with one to three Au atoms through C-Au-C bonds. In structures with a single gold atom the C-Au-C bond is located in the central position of the oligomer. Binding energies (BEs) with respect to two oligomer radical fragments and Au are as high as 362-489 kJ/mol depending on the length of the oligomer chain. When the dispersion contribution in PEn-Au-PEn oligomers is omitted, BE is almost independent of the number of carbon atoms, lying between 293 and 296 kJ/mol. The dispersion energy contributions to BEs in PEn-Au-PEn rise nearly linearly with the number of carbon atoms in the PEn chain. The carbon-carbon distance in the C-Au-C moiety is around 4.1 Å, similar to the bond distance between saturated closed shell chains in the polyethylene crystal. BEs of pure saturated closed shell PEn-PEn oligomers are 51-187 kJ/mol. Both Au atoms and dispersion interactions contribute considerably to the creation of nearly parallel chains of oligomers with reasonably high binding energies.

  15. Thermodynamics and mechanics of stretch-induced crystallization in rubbers

    NASA Astrophysics Data System (ADS)

    Guo, Qiang; Zaïri, Fahmi; Guo, Xinglin

    2018-05-01

    The aim of the present paper is to provide a quantitative prediction of the stretch-induced crystallization in natural rubber, the exclusive reason for its history-dependent thermomechanical features. A constitutive model based on a micromechanism inspired molecular chain approach is formulated within the context of the thermodynamic framework. The molecular configuration of the partially crystallized single chain is analyzed and calculated by means of some statistical mechanical methods. The random thermal oscillation of the crystal orientation, considered as a continuous random variable, is treated by means of a representative angle. The physical expression of the chain free energy is derived according to a two-step strategy by separating crystallization and stretching. This strategy ensures that the stretch-induced part of the thermodynamic crystallization force is null at the initial instant and allows, without any additional constraint, the formulation of a simple linear relationship for the crystallinity evolution law. The model contains very few physically interpretable material constants to simulate the complex mechanism: two chain-scale constants, one crystallinity kinetics constant, three thermodynamic constants related to the newly formed crystallites, and a function controlling the crystal orientation with respect to the chain. The model is used to discuss some important aspects of the micromechanism and the macroresponse under the equilibrium state and the nonequilibrium state involved during stretching and recovery, and continuous relaxation.

  16. Unexpected power-law stress relaxation of entangled ring polymers

    PubMed Central

    KAPNISTOS, M.; LANG, M.; PYCKHOUT-HINTZEN, W.; RICHTER, D.; CHO, D.; CHANG, T.

    2016-01-01

    After many years of intense research, most aspects of the motion of entangled polymers have been understood. Long linear and branched polymers have a characteristic entanglement plateau and their stress relaxes by chain reptation or branch retraction, respectively. In both mechanisms, the presence of chain ends is essential. But how do entangled polymers without ends relax their stress? Using properly purified high-molar-mass ring polymers, we demonstrate that these materials exhibit self-similar dynamics, yielding a power-law stress relaxation. However, trace amounts of linear chains at a concentration almost two decades below their overlap cause an enhanced mechanical response. An entanglement plateau is recovered at higher concentrations of linear chains. These results constitute an important step towards solving an outstanding problem of polymer science and are useful for manipulating properties of materials ranging from DNA to polycarbonate. They also provide possible directions for tuning the rheology of entangled polymers. PMID:18953345

  17. Crystal structure and magnetic properties of a unique 3D coordination polymer constructed from flexible aliphatic tricarballylic acid ligands featuring linear trimeric Manganese(II)-based, metal carboxylate chains

    NASA Astrophysics Data System (ADS)

    Zou, Hua-Hong; Zhang, Shu-Hua; Zeng, Ming-Hua; Zhou, Yan-Ling; Liang, Hong

    2008-08-01

    A novel linear trimeric-based, Mn(II)-carboxylate chain well separated by long-linking flexible aliphatic tricarballylic acid ligands in a 3D coordination polymer [Mn 3(C 6H 5O 6) 2(H 2O) 4] n ( 1, C 6H 5O 6dbnd CH (COO -)(CH 2COO -) 2, TCA) exhibits low-dimensional antiferromagnetic order at 3.0 K. Such magnetic behavior is arises from the alternate Antiferro-Antiferro-Antiferro' ( J1J1J2) repeating interactions sequence, based on the nature of the binding modes of Mn(II)-carboxylate chain and the effect of interchains arrangement of 1. The reported carboxylate-bridged metal chain systems display a new structurally authenticated example of linear homometallic spin arranged antiferromagnet among metal carboxylates.

  18. Lattice vibrations in the Frenkel-Kontorova model. I. Phonon dispersion, number density, and energy

    NASA Astrophysics Data System (ADS)

    Meng, Qingping; Wu, Lijun; Welch, David O.; Zhu, Yimei

    2015-06-01

    We studied the lattice vibrations of two interpenetrating atomic sublattices via the Frenkel-Kontorova (FK) model of a linear chain of harmonically interacting atoms subjected to an on-site potential using the technique of thermodynamic Green's functions based on quantum field-theoretical methods. General expressions were deduced for the phonon frequency-wave-vector dispersion relations, number density, and energy of the FK model system. As the application of the theory, we investigated in detail cases of linear chains with various periods of the on-site potential of the FK model. Some unusual but interesting features for different amplitudes of the on-site potential of the FK model are discussed. In the commensurate structure, the phonon spectrum always starts at a finite frequency, and the gaps of the spectrum are true ones with a zero density of modes. In the incommensurate structure, the phonon spectrum starts from zero frequency, but at a nonzero wave vector; there are some modes inside these gap regions, but their density is very low. In our approximation, the energy of a higher-order commensurate state of the one-dimensional system at a finite temperature may become indefinitely close to the energy of an incommensurate state. This finding implies that the higher-order incommensurate-commensurate transitions are continuous ones and that the phase transition may exhibit a "devil's staircase" behavior at a finite temperature.

  19. Isomalto/malto-polysaccharide, a novel soluble dietary fiber made via enzymatic conversion of starch.

    PubMed

    Leemhuis, Hans; Dobruchowska, Justyna M; Ebbelaar, Monique; Faber, Folkert; Buwalda, Pieter L; van der Maarel, Marc J E C; Kamerling, Johannis P; Dijkhuizen, Lubbert

    2014-12-10

    Dietary fibers are at the forefront of nutritional research because they positively contribute to human health. Much of our processed foods contain, however, only small quantities of dietary fiber, because their addition often negatively affects the taste, texture, and mouth feel. There is thus an urge for novel types of dietary fibers that do not cause unwanted sensory effects when applied as ingredient, while still positively contributing to the health of consumers. Here, we report the generation and characterization of a novel type of soluble dietary fiber with prebiotic properties, derived from starch via enzymatic modification, yielding isomalto/malto-polysaccharides (IMMPs), which consist of linear (α1 → 6)-glucan chains attached to the nonreducing ends of starch fragments. The applied Lactobacillus reuteri 121 GTFB 4,6-α-glucanotransferase enzyme synthesizes these molecules by transferring the nonreducing glucose moiety of an (α1 → 4)-glucan chain to the nonreducing end of another (α1 → 4)-α-glucan chain, forming an (α1 → 6)-glycosidic linkage. Once elongated in this way, the molecule becomes a better acceptor substrate and is then further elongated with (α1 → 6)-linked glucose residues in a linear way. Comparison of 30 starches, maltodextrins, and α-glucans of various botanical sources, demonstrated that substrates with long and linear (α1 → 4)-glucan chains deliver products with the highest percentage of (α1 → 6) linkages, up to 92%. In vitro experiments, serving as model of the digestive power of the gastrointestinal tract, revealed that the IMMPs, or more precisely the IMMP fraction rich in (α1 → 6) linkages, will largely pass the small intestine undigested and therefore end up in the large intestine. IMMPs are a novel type of dietary fiber that may have health promoting activity.

  20. Dynamics of a linear system coupled to a chain of light nonlinear oscillators analyzed through a continuous approximation

    NASA Astrophysics Data System (ADS)

    Charlemagne, S.; Ture Savadkoohi, A.; Lamarque, C.-H.

    2018-07-01

    The continuous approximation is used in this work to describe the dynamics of a nonlinear chain of light oscillators coupled to a linear main system. A general methodology is applied to an example where the chain has local nonlinear restoring forces. The slow invariant manifold is detected at fast time scale. At slow time scale, equilibrium and singular points are sought around this manifold in order to predict periodic regimes and strongly modulated responses of the system. Analytical predictions are in good accordance with numerical results and represent a potent tool for designing nonlinear chains for passive control purposes.

  1. Biofuel supply chain, market, and policy analysis

    NASA Astrophysics Data System (ADS)

    Zhang, Leilei

    Renewable fuel is receiving an increasing attention as a substitute for fossil based energy. The US Department of Energy (DOE) has employed increasing effort on promoting the advanced biofuel productions. Although the advanced biofuel remains at its early stage, it is expected to play an important role in climate policy in the future in the transportation sector. This dissertation studies the emerging biofuel supply chain and markets by analyzing the production cost, and the outcomes of the biofuel market, including blended fuel market price and quantity, biofuel contract price and quantity, profitability of each stakeholder (farmers, biofuel producers, biofuel blenders) in the market. I also address government policy impacts on the emerging biofuel market. The dissertation is composed with three parts, each in a paper format. The first part studies the supply chain of emerging biofuel industry. Two optimization-based models are built to determine the number of facilities to deploy, facility locations, facility capacities, and operational planning within facilities. Cost analyses have been conducted under a variety of biofuel demand scenarios. It is my intention that this model will shed light on biofuel supply chain design considering operational planning under uncertain demand situations. The second part of the dissertation work focuses on analyzing the interaction between the key stakeholders along the supply chain. A bottom-up equilibrium model is built for the emerging biofuel market to study the competition in the advanced biofuel market, explicitly formulating the interactions between farmers, biofuel producers, blenders, and consumers. The model simulates the profit maximization of multiple market entities by incorporating their competitive decisions in farmers' land allocation, biomass transportation, biofuel production, and biofuel blending. As such, the equilibrium model is capable of and appropriate for policy analysis, especially for those policies that have complex ramifications and result in sophisticate interactions among multiple stakeholders. The third part of the dissertation investigates the impacts of flexible fuel vehicles (FFVs) market penetration levels on the market outcomes, including cellulosic biofuel production and price, blended fuel market price, and profitability of each stakeholder in the biofuel supply chain for imperfectly competitive biofuel markets. In this paper, I investigate the penetration levels of FFVs by incorporating the substitution among different fuels in blended fuel demand functions through "cross price elasticity" in a bottom-up equilibrium model framework. The complementarity based problem is solved by a Taylor expansion-based iterative procedure. At each step of the iteration, the highly nonlinear complementarity problems with constant elasticity of demand functions are linearized into linear complimentarity problems and solved until it converges. This model can be applied to investigate the interaction between the stakeholders in the biofuel market, and to assist decision making for both cellulosic biofuel investors and government.

  2. Topology of polymer chains under nanoscale confinement.

    PubMed

    Satarifard, Vahid; Heidari, Maziar; Mashaghi, Samaneh; Tans, Sander J; Ejtehadi, Mohammad Reza; Mashaghi, Alireza

    2017-08-24

    Spatial confinement limits the conformational space accessible to biomolecules but the implications for bimolecular topology are not yet known. Folded linear biopolymers can be seen as molecular circuits formed by intramolecular contacts. The pairwise arrangement of intra-chain contacts can be categorized as parallel, series or cross, and has been identified as a topological property. Using molecular dynamics simulations, we determine the contact order distributions and topological circuits of short semi-flexible linear and ring polymer chains with a persistence length of l p under a spherical confinement of radius R c . At low values of l p /R c , the entropy of the linear chain leads to the formation of independent contacts along the chain and accordingly, increases the fraction of series topology with respect to other topologies. However, at high l p /R c , the fraction of cross and parallel topologies are enhanced in the chain topological circuits with cross becoming predominant. At an intermediate confining regime, we identify a critical value of l p /R c , at which all topological states have equal probability. Confinement thus equalizes the probability of more complex cross and parallel topologies to the level of the more simple, non-cooperative series topology. Moreover, our topology analysis reveals distinct behaviours for ring- and linear polymers under weak confinement; however, we find no difference between ring- and linear polymers under strong confinement. Under weak confinement, ring polymers adopt parallel and series topologies with equal likelihood, while linear polymers show a higher tendency for series arrangement. The radial distribution analysis of the topology reveals a non-uniform effect of confinement on the topology of polymer chains, thereby imposing more pronounced effects on the core region than on the confinement surface. Additionally, our results reveal that over a wide range of confining radii, loops arranged in parallel and cross topologies have nearly the same contact orders. Such degeneracy implies that the kinetics and transition rates between the topological states cannot be solely explained by contact order. We expect these findings to be of general importance in understanding chaperone assisted protein folding, chromosome architecture, and the evolution of molecular folds.

  3. Blob-Spring Model for the Dynamics of Ring Polymer in Obstacle Environment

    NASA Astrophysics Data System (ADS)

    Lele, Ashish K.; Iyer, Balaji V. S.; Juvekar, Vinay A.

    2008-07-01

    The dynamical behavior of cyclic macromolecules in a fixed obstacle (FO) environment is very different than the behavior of linear chains in the same topological environment; while the latter relax by a snake-like reptational motion from their chain ends the former can relax only by contour length fluctuations since they are endless. Duke, Obukhov and Rubinstein proposed a scaling model (the DOR model) to interpret the dynamical scaling exponents shown by Monte Carlo simulations of rings in a FO environment. We present a model (blob-spring model) to describe the dynamics of flexible and non-concatenated ring polymer in FO environment based on a theoretical formulation developed for the dynamics of an unentangled fractal polymer. We argue that the perpetual evolution of ring perimeter by the motion of contour segments results in an extra frictional load. Our model predicts self-similar dynamics with scaling exponents for the molecular weight dependence of diffusion coefficient and relaxation times that are in agreement with the scaling model proposed by Obukhov et al.

  4. Long-Chain Perfluoroalkyl acids (PFAAs) Affect the Bioconcentration and Tissue Distribution of Short-Chain PFAAs in Zebrafish (Danio rerio).

    PubMed

    Wen, Wu; Xia, Xinghui; Hu, Diexuan; Zhou, Dong; Wang, Haotian; Zhai, Yawei; Lin, Hui

    2017-11-07

    Short- and long-chain perfluoroalkyl acids (PFAAs), ubiquitously coexisting in the environment, can be accumulated in organisms by binding with proteins and their binding affinities generally increase with their chain length. Therefore, we hypothesized that long-chain PFAAs will affect the bioconcentration of short-chain PFAAs in organisms. To testify this hypothesis, the bioconcentration and tissue distribution of five short-chain PFAAs (linear C-F = 3-6) were investigated in zebrafish in the absence and presence of six long-chain PFAAs (linear C-F = 7-11). The results showed that the concentrations of the short-chain PFAAs in zebrafish tissues increased with exposure time until steady states reached in the absence of long-chain PFAAs. However, in the presence of long-chain PFAAs, these short-chain PFAAs in tissues increased until peak values reached and then decreased until steady states, and the uptake and elimination rate constants of short-chain PFAAs declined in all tissues and their BCF ss decreased by 24-89%. The inhibitive effect of long-chain PFAAs may be attributed to their competition for transporters and binding sites of proteins in zebrafish with short-chain PFAAs. These results suggest that the effect of long-chain PFAAs on the bioconcentration of short-chain PFAAs should be taken into account in assessing the ecological and environmental effects of short-chain PFAAs.

  5. Traveling waves in a spring-block chain sliding down a slope

    NASA Astrophysics Data System (ADS)

    Morales, J. E.; James, G.; Tonnelier, A.

    2017-07-01

    Traveling waves are studied in a spring slider-block model. We explicitly construct front waves (kinks) for a piecewise-linear spinodal friction force. Pulse waves are obtained as the matching of two traveling fronts with identical speeds. Explicit formulas are obtained for the wavespeed and the wave form in the anticontinuum limit. The link with localized waves in a Burridge-Knopoff model of an earthquake fault is briefly discussed.

  6. Traveling waves in a spring-block chain sliding down a slope.

    PubMed

    Morales, J E; James, G; Tonnelier, A

    2017-07-01

    Traveling waves are studied in a spring slider-block model. We explicitly construct front waves (kinks) for a piecewise-linear spinodal friction force. Pulse waves are obtained as the matching of two traveling fronts with identical speeds. Explicit formulas are obtained for the wavespeed and the wave form in the anticontinuum limit. The link with localized waves in a Burridge-Knopoff model of an earthquake fault is briefly discussed.

  7. The Ultra-filtration of Macromolecules with Different Conformations and Configurations through Nanopores

    NASA Astrophysics Data System (ADS)

    Ge, Hui

    This Ph. D. thesis presents our study on the ultrafiltration of polymers with different configurations and conformations; namly, theoretically, the passing of polymer chains through a nanopore under an elongational flow filed has been studied for years, but experimental studies are rare because of two following reasons: (1) lacks a precise method to investigate how individual single polymer chain pass through a nanopore; (2) it is difficult, if not impossible, to obtain a set of polymer samples with a narrow molar mass distribution and a uniform structures; except for linear chains. The central question in this study is to find the critical (minimum) flow rate (qc) for each kind of chains, at which the chains can pass through a given nanopore. A comparison of the measured and calculated qc leads to a better understanding how different chains are deformed, stretched and pulled through a nanopore. We have developed a novel method of combinating static and dynamic laser light scattering (LLS) to precisely measure the relative retention concentration ((C0 - C)/C0). Chapter 1 briefly introduces the theoretical background of how applications and lists some of resent research progresses in this area. Polymer with various configurations and conformations pass through nanopores; including polymer linear chains, stars polymer, branched polymers, polymer micelles are introduced. Among them, the de Gennes and Brochard-Wyart's predictions of polymer linear and star chains passing through nanopores are emphasized, in which they predicted that qc of linear chain is qc ≃ kBT/(3pieta), where kB, T and eta are the Boltzmann constant, the absolutely temperature, and the viscosity of solvent, respectively, independent of both the chain length and the pore size; and for star chains passing through nanopores, there exist a optimal entering arm numbers, namely, the star chains passing through nanopores. Chapter 2 details basic theory of static and dynamic laser light scattering (LLS), including its instrumentation and our ultrafiltration setup. Chapter 3 briefly introduces the sample preparation, including the history and mechanism of anionic living polymerization, as well as how we used a novel home-made set-up to prepare linear polystyrene with different chain lengths and star polystyrene with various arm numbers and lengths. Chapter 4 summarizes our measured critical flow rates (qc) of linear polymer chains with different lengths for nanopores with different sizes, since the flow rate is directly related to the hydrodynamic force, we have developed a sensitive method (down to tens fN) to directly assess how much the hydrodynamic force (Fh) is required to overcome the weak entropy elasticity and stretch individual coiled chains in solution. Our method is completely different from the using existing optical tweezers or AFM, because they measure the relatively stronger enthalpy elasticity. Our results confirm that qc is indeed independent of the chain length, but decreases as the pore size increases. The value of qc is ˜10--200 times smaller than kBT/(3pieta). Such a discrepancy has been attributed to the rough assumption made by de Gennes and his coworkers; namely, each chain segment "blob" confined inside the pore is not a hard sphere so that the effective length along the flow direction is much longer than the pore diameter. Finally, using the solution temperature, we varied the chain conformation, our result shows that q c has a minimum which is near, but not exactly located at the theta temperature, might leading to a better way to determine the true ideal state of a polymer solution, at which all viral coefficients, not only the second vanish. Chapter 5 uses polymer solutions made of different mixtures of linear and star chains, we have demonstrated that flushing these solution mixtures through a nanopore with a properly chosen flow rate can effectively and cleanly separate linear and star chains no matter whether linear chains are larger or smaller than star chains. Chapter 6 further investigates how star-like polystyrene pass through a given nanopore under the flow field. Star polystyrene chains with different arm lengths (LA) and numbers (f) passing through a nanopore (20 nm) under an elongational flow field was investigated in terms of the flow-rate dependent relative retention ((C0 - C)/C0), where C 0 and C are the polymer concentrations before and after the ultrafiltration. Our results reveal that for a given arm length (LA), the critical flow rate (qc,star), below which star chains are blocked, dramatically increases with the total arm numbers (f); but for a given f, is nearly independent on LA, contradictory to the previous prediction made by de Gennes and Brochard-Wyart. We have revised their theory in the region fin < fout and also accounted for the effective length of each blob, where fin and fout are the numbers of arms inside and outside the pore, respectively. In the revision, we show that qc,star is indeed independent of LA but related to f and f in in two different ways, depending on whether fin ≤ f/2 or ≥ f/2. A comparison of our experimental and calculated results reveals that most of star chains pass through the nanopores with fin ˜ f/2. Further study of the temperature dependent (C0 - C)/C 0 of polystyrene in cyclohexane reveals that there exists a minimum of qc,star at ˜38 °C, close to its theta temperature (-34.5 °C).

  8. Nonlinear conduction via solitons in a topological mechanical insulator.

    PubMed

    Chen, Bryan Gin-ge; Upadhyaya, Nitin; Vitelli, Vincenzo

    2014-09-09

    Networks of rigid bars connected by joints, termed linkages, provide a minimal framework to design robotic arms and mechanical metamaterials built of folding components. Here, we investigate a chain-like linkage that, according to linear elasticity, behaves like a topological mechanical insulator whose zero-energy modes are localized at the edge. Simple experiments we performed using prototypes of the chain vividly illustrate how the soft motion, initially localized at the edge, can in fact propagate unobstructed all of the way to the opposite end. Using real prototypes, simulations, and analytical models, we demonstrate that the chain is a mechanical conductor, whose carriers are nonlinear solitary waves, not captured within linear elasticity. Indeed, the linkage prototype can be regarded as the simplest example of a topological metamaterial whose protected mechanical excitations are solitons, moving domain walls between distinct topological mechanical phases. More practically, we have built a topologically protected mechanism that can perform basic tasks such as transporting a mechanical state from one location to another. Our work paves the way toward adopting the principle of topological robustness in the design of robots assembled from activated linkages as well as in the fabrication of complex molecular nanostructures.

  9. Comparison of the Single Molecule Dynamics of Linear and Circular DNAs in Planar Extensional Flows

    NASA Astrophysics Data System (ADS)

    Li, Yanfei; Hsiao, Kai-Wen; Brockman, Christopher; Yates, Daniel; McKenna, Gregory; Schroeder, Charles; San Francisco, Michael; Kornfield, Julie; Anderson, Rae

    2015-03-01

    Chain topology has a profound impact on the flow behaviors of single macromolecules. The absence of free ends separates circular polymers from other chain architectures, i.e., linear, star, and branched. In the present work, we study the single chain dynamics of large circular and linear DNA molecules by comparing the relaxation dynamics, steady state coil-stretch transition, and transient molecular individualism behaviors for the two types of macromolecules. To this end, large circular DNA molecules were biologically synthesized and studied in a microfluidic device that has a cross-slot geometry to develop a stagnation point extensional flow. Although the relaxation time of rings scales in the same way as for the linear analog, the circular polymers show quantitatively different behaviors in the steady state extension and qualitatively different behaviors during a transient stretch. The existence of some commonality between these two topologies is proposed. Texas Tech University John R. Bradford Endowment.

  10. Self-Consistent Field Theories for the Role of Large Length-Scale Architecture in Polymers

    NASA Astrophysics Data System (ADS)

    Wu, David

    At large length-scales, the architecture of polymers can be described by a coarse-grained specification of the distribution of branch points and monomer types within a molecule. This includes molecular topology (e.g., cyclic or branched) as well as distances between branch points or chain ends. Design of large length-scale molecular architecture is appealing because it offers a universal strategy, independent of monomer chemistry, to tune properties. Non-linear analogs of linear chains differ in molecular-scale properties, such as mobility, entanglements, and surface segregation in blends that are well-known to impact rheological, dynamical, thermodynamic and surface properties including adhesion and wetting. We have used Self-Consistent Field (SCF) theories to describe a number of phenomena associated with large length-scale polymer architecture. We have predicted the surface composition profiles of non-linear chains in blends with linear chains. These predictions are in good agreement with experimental results, including from neutron scattering, on a range of well-controlled branched (star, pom-pom and end-branched) and cyclic polymer architectures. Moreover, the theory allows explanation of the segregation and conformations of branched polymers in terms of effective surface potentials acting on the end and branch groups. However, for cyclic chains, which have no end or junction points, a qualitatively different topological mechanism based on conformational entropy drives cyclic chains to a surface, consistent with recent neutron reflectivity experiments. We have also used SCF theory to calculate intramolecular and intermolecular correlations for polymer chains in the bulk, dilute solution, and trapped at a liquid-liquid interface. Predictions of chain swelling in dilute star polymer solutions compare favorably with existing PRISM theory and swelling at an interface helps explain recent measurements of chain mobility at an oil-water interface. In collaboration with: Renfeng Hu, Colorado School of Mines, and Mark Foster, University of Akron. This work was supported by NSF Grants No. CBET- 0730692 and No. CBET-0731319.

  11. An optimization model to agroindustrial sector in antioquia (Colombia, South America)

    NASA Astrophysics Data System (ADS)

    Fernandez, J.

    2015-06-01

    This paper develops a proposal of a general optimization model for the flower industry, which is defined by using discrete simulation and nonlinear optimization, whose mathematical models have been solved by using ProModel simulation tools and Gams optimization. It defines the operations that constitute the production and marketing of the sector, statistically validated data taken directly from each operation through field work, the discrete simulation model of the operations and the linear optimization model of the entire industry chain are raised. The model is solved with the tools described above and presents the results validated in a case study.

  12. Looping probabilities of elastic chains: a path integral approach.

    PubMed

    Cotta-Ramusino, Ludovica; Maddocks, John H

    2010-11-01

    We consider an elastic chain at thermodynamic equilibrium with a heat bath, and derive an approximation to the probability density function, or pdf, governing the relative location and orientation of the two ends of the chain. Our motivation is to exploit continuum mechanics models for the computation of DNA looping probabilities, but here we focus on explaining the novel analytical aspects in the derivation of our approximation formula. Accordingly, and for simplicity, the current presentation is limited to the illustrative case of planar configurations. A path integral formalism is adopted, and, in the standard way, the first approximation to the looping pdf is obtained from a minimal energy configuration satisfying prescribed end conditions. Then we compute an additional factor in the pdf which encompasses the contributions of quadratic fluctuations about the minimum energy configuration along with a simultaneous evaluation of the partition function. The original aspects of our analysis are twofold. First, the quadratic Lagrangian describing the fluctuations has cross-terms that are linear in first derivatives. This, seemingly small, deviation from the structure of standard path integral examples complicates the necessary analysis significantly. Nevertheless, after a nonlinear change of variable of Riccati type, we show that the correction factor to the pdf can still be evaluated in terms of the solution to an initial value problem for the linear system of Jacobi ordinary differential equations associated with the second variation. The second novel aspect of our analysis is that we show that the Hamiltonian form of these linear Jacobi equations still provides the appropriate correction term in the inextensible, unshearable limit that is commonly adopted in polymer physics models of, e.g. DNA. Prior analyses of the inextensible case have had to introduce nonlinear and nonlocal integral constraints to express conditions on the relative displacement of the end points. Our approximation formula for the looping pdf is of quite general applicability as, in contrast to most prior approaches, no assumption is made of either uniformity of the elastic chain, nor of a straight intrinsic shape. If the chain is uniform the Jacobi system evaluated at certain minimum energy configurations has constant coefficients. In such cases our approximate pdf can be evaluated in an entirely explicit, closed form. We illustrate our analysis with a planar example of this type and compute an approximate probability of cyclization, i.e., of forming a closed loop, from a uniform elastic chain whose intrinsic shape is an open circular arc.

  13. Brownian dynamics simulations of a flexible polymer chain which includes continuous resistance and multibody hydrodynamic interactions

    NASA Astrophysics Data System (ADS)

    Butler, Jason E.; Shaqfeh, Eric S. G.

    2005-01-01

    Using methods adapted from the simulation of suspension dynamics, we have developed a Brownian dynamics algorithm with multibody hydrodynamic interactions for simulating the dynamics of polymer molecules. The polymer molecule is modeled as a chain composed of a series of inextensible, rigid rods with constraints at each joint to ensure continuity of the chain. The linear and rotational velocities of each segment of the polymer chain are described by the slender-body theory of Batchelor [J. Fluid Mech. 44, 419 (1970)]. To include hydrodynamic interactions between the segments of the chain, the line distribution of forces on each segment is approximated by making a Legendre polynomial expansion of the disturbance velocity on the segment, where the first two terms of the expansion are retained in the calculation. Thus, the resulting linear force distribution is specified by a center of mass force, couple, and stresslet on each segment. This method for calculating the hydrodynamic interactions has been successfully used to simulate the dynamics of noncolloidal suspensions of rigid fibers [O. G. Harlen, R. R. Sundararajakumar, and D. L. Koch, J. Fluid Mech. 388, 355 (1999); J. E. Butler and E. S. G. Shaqfeh, J. Fluid Mech. 468, 204 (2002)]. The longest relaxation time and center of mass diffusivity are among the quantities calculated with the simulation technique. Comparisons are made for different levels of approximation of the hydrodynamic interactions, including multibody interactions, two-body interactions, and the "freely draining" case with no interactions. For the short polymer chains studied in this paper, the results indicate a difference in the apparent scaling of diffusivity with polymer length for the multibody versus two-body level of approximation for the hydrodynamic interactions.

  14. Brownian dynamics simulations of a flexible polymer chain which includes continuous resistance and multibody hydrodynamic interactions.

    PubMed

    Butler, Jason E; Shaqfeh, Eric S G

    2005-01-01

    Using methods adapted from the simulation of suspension dynamics, we have developed a Brownian dynamics algorithm with multibody hydrodynamic interactions for simulating the dynamics of polymer molecules. The polymer molecule is modeled as a chain composed of a series of inextensible, rigid rods with constraints at each joint to ensure continuity of the chain. The linear and rotational velocities of each segment of the polymer chain are described by the slender-body theory of Batchelor [J. Fluid Mech. 44, 419 (1970)]. To include hydrodynamic interactions between the segments of the chain, the line distribution of forces on each segment is approximated by making a Legendre polynomial expansion of the disturbance velocity on the segment, where the first two terms of the expansion are retained in the calculation. Thus, the resulting linear force distribution is specified by a center of mass force, couple, and stresslet on each segment. This method for calculating the hydrodynamic interactions has been successfully used to simulate the dynamics of noncolloidal suspensions of rigid fibers [O. G. Harlen, R. R. Sundararajakumar, and D. L. Koch, J. Fluid Mech. 388, 355 (1999); J. E. Butler and E. S. G. Shaqfeh, J. Fluid Mech. 468, 204 (2002)]. The longest relaxation time and center of mass diffusivity are among the quantities calculated with the simulation technique. Comparisons are made for different levels of approximation of the hydrodynamic interactions, including multibody interactions, two-body interactions, and the "freely draining" case with no interactions. For the short polymer chains studied in this paper, the results indicate a difference in the apparent scaling of diffusivity with polymer length for the multibody versus two-body level of approximation for the hydrodynamic interactions. (c) 2005 American Institute of Physics.

  15. Structure of Irreversibly Adsorbed Star Polymers

    NASA Astrophysics Data System (ADS)

    Akgun, Bulent; Aykan, Meryem Seyma; Canavar, Seda; Satija, Sushil K.; Uhrig, David; Hong, Kunlun

    Formation of irreversibly adsorbed polymer chains on solid substrates have a huge impact on the wetting, glass transition, aging and polymer chain mobility in thin films. In recent years there has been many reports on the formation, kinetics and dynamics of these layers formed by linear homopolymers. Recent studies showed that by varying the number of polymer arms and arm molecular weight one can tune the glass transition temperature of thin polymer films. Using polymer architecture as a tool, the behavior of thin films can be tuned between the behavior of linear chains and soft colloids. We have studied the effect of polymer chain architecture on the structure of dead layer using X-ray reflectivity (XR) and atomic force microscopy. Layer thicknesses and densities of flattened and loosely adsorbed chains has been measured for linear, 4-arm, and 8-arm star polymers with identical total molecular weight as a function of substrate surface energy, annealing temperature and annealing time. Star polymers have been synthesized using anionic polymerization. XR measurements showed that 8-arm star PS molecules form the densest and the thickest dead layers among these three molecules.

  16. QSAR Study and Molecular Design of Open-Chain Enaminones as Anticonvulsant Agents

    PubMed Central

    Garro Martinez, Juan C.; Duchowicz, Pablo R.; Estrada, Mario R.; Zamarbide, Graciela N.; Castro, Eduardo A.

    2011-01-01

    Present work employs the QSAR formalism to predict the ED50 anticonvulsant activity of ringed-enaminones, in order to apply these relationships for the prediction of unknown open-chain compounds containing the same types of functional groups in their molecular structure. Two different modeling approaches are applied with the purpose of comparing the consistency of our results: (a) the search of molecular descriptors via multivariable linear regressions; and (b) the calculation of flexible descriptors with the CORAL (CORrelation And Logic) program. Among the results found, we propose some potent candidate open-chain enaminones having ED50 values lower than 10 mg·kg−1 for corresponding pharmacological studies. These compounds are classified as Class 1 and Class 2 according to the Anticonvulsant Selection Project. PMID:22272137

  17. Thermal conductivity in one-dimensional nonlinear systems

    NASA Astrophysics Data System (ADS)

    Politi, Antonio; Giardinà, Cristian; Livi, Roberto; Vassalli, Massimo

    2000-03-01

    Thermal conducitivity of one-dimensional nonlinear systems typically diverges in the thermodynamic limit, whenever the momentum is conserved (i.e. in the absence of interactions with an external substrate). Evidence comes from detailed studies of Fermi-Pasta-Ulam and diatomic Toda chains. Here, we discuss the first example of a one-dimensional system obeying Fourier law : a chain of coupled rotators. Numerical estimates of the thermal conductivity obtained by simulating a chain in contact with two thermal baths at different temperatures are found to be consistent with those ones based on linear response theory. The dynamics of the Fourier modes provides direct evidence of energy diffusion. The finiteness of the conductivity is traced back to the occurrence of phase-jumps. Our conclusions are confirmed by the analysis of two variants of the rotator model.

  18. Rheological characterization of thermal, thermo-oxidative and photo-oxidative degradation of LDPE

    NASA Astrophysics Data System (ADS)

    Rolón-Garrido, Víctor Hugo; Wagner, Manfred Hermann

    2015-04-01

    Rheology has been used to study thermal degradation (V. H. Rolón-Garrido et al., Rheol. Acta 50, 519-535, 2011), thermo-oxidative degradation (V. H. Rolón-Garrido et al., Rheol. Acta 50, 519-535, 2011; V. H. Rolón-Garrido et al., J. Rheol. 57, 105-129, 2013) and photo-oxidative degradation (V. H. Rolón-Garrido and M. H. Wagner, Polym. Degrad. Stab. 99, 136-145, 2014; V. H. Rolón-Garrido and M. H. Wagner, J. Rheol. 58, 199-22 2, 2014; V. H. Rolón-Garrido et al., Polym. Degrad. Stab. 111, 46-54, 2015) of low-density polyethylene (LDPE). This contribution presents the analogies and differences between these types of degradations of LDPE on the linear (by use of van-Gurp Palmen plots) and non-linear viscoelastic properties (by use of the parameters of the MSF model, fmax2 and β), as well as on the failure mode of the samples (through the maximum strain and stress achieved experimentally). In contrast to thermal and thermo-oxidative degradation, the linear viscoelastic properties of photo-oxidated samples were more affected by degradation. In the non-linear regime, for thermal and thermo-oxidative treated samples, the elongational measurements elucidated the role of chain scission and long-chain branching (LCB) formation, while for photo-oxidated LDPE even the competition between chain scission, LCB formation, and gel formation was demonstrated. The failure behavior was found to be determined by a constant maximum strain in thermo-oxidative degradation, if the LDPE has high content in branching points, or in photo-oxidative degraded LDPE, if a considerable portion of gel structure is present. Otherwise, either the maximum strain or stress measured was found to be strain-rate dependent.

  19. New nonlinear control algorithms for multiple robot arms

    NASA Technical Reports Server (NTRS)

    Tarn, T. J.; Bejczy, A. K.; Yun, X.

    1988-01-01

    Multiple coordinated robot arms are modeled by considering the arms as closed kinematic chains and as a force-constrained mechanical system working on the same object simultaneously. In both formulations, a novel dynamic control method is discussed. It is based on feedback linearization and simultaneous output decoupling technique. By applying a nonlinear feedback and a nonlinear coordinate transformation, the complicated model of the multiple robot arms in either formulation is converted into a linear and output decoupled system. The linear system control theory and optimal control theory are used to design robust controllers in the task space. The first formulation has the advantage of automatically handling the coordination and load distribution among the robot arms. In the second formulation, it was found that by choosing a general output equation it became possible simultaneously to superimpose the position and velocity error feedback with the force-torque error feedback in the task space.

  20. Synthesis and characterization of shape memory poly (epsilon-caprolactone) polyurethane-ureas

    NASA Astrophysics Data System (ADS)

    Ren, Hongfeng

    Shape memory polymers (SMPs) have attracted significant interest in recent times because of their potential applications in a number of areas, such as medical devices and textiles. However, there are some major drawbacks of SMPs, such as their relatively low moduli resulting in small recovery stresses, and their long response times compared with shape memory alloys (SMAs). A suitable recovery stress which comes from the elastic recovery stress generated in the deformation process is critical in some medical devices. To address some of these shortcomings, the work in this dissertation mainly focuses on the design and synthesis of linear shape memory polymers with higher recovery stress. A series of segmented poly (epsilon-caprolactone) polyurethane-ureas (PCLUUs) were prepared from poly (epsilon-caprolactone) (PCL) diol, different dissociates and chain extenders. NMR and FT-IR were used to identify the structure of the synthesized shape memory polyurethane-ureas. Parameters such as soft segment content (molecular weight and content), chain extender and the rigidity of the main chain were investigated to understand the structure-property relationships of the shape memory polymer systems through DSC, DMA, physical property test, etc. Cyclic thermal mechanic tests were applied to measure the shape memory properties which showed that the recovery stress can be improved above 200% simply by modifying the chain extender. Meanwhile, the synthesis process was optimized to be similar to that of Spandex /LYCRA®. Continuous fibers form shape memory polyurethane-ureas were made from a wet spinning process, which indicated excellent spinnability of the polymer solution. Small angle neutron scattering (SANS) was used to study the morphology of the hard segment at different temperatures and stretch rates and found that the monodisperse rigid cylinder model fit the SANS data quite well. From the cylinder model, the radius of the cylinder increased with increasing hard segment content. The SANS results revealed phase separation of hard and soft segments into nano scale domains. The overall objectives of this dissertation were: ■ To improve the recovery stress of linear shape memory polymers. ■ To study the morphology and structure property relationships of shape memory polymers. Chapter 1 reviews the literature on SMAs and SMPs, especially on linear SMPs. Chapter 2 is devoted to SMPUUs with the aliphatic amine 1, 4-Butanediamine (BDA) as chain extender. Chapter 3 reports the effects of different aliphatic diamines as the chain extenders. Chapter 4 covers the results for shape memory polyurethane-ureas with aromatic diamine 4, 4’-Methylenedianiline (MDA) as the chain extender. The effect of different diisocyanates is covered in Chapter 5. Chapter 6-7 show some synthesized polymer systems with unimproved recovery stress or even no shape memory properties. The overall conclusions of this work are reported in Chapter 8.

  1. Methodical fitting for mathematical models of rubber-like materials

    NASA Astrophysics Data System (ADS)

    Destrade, Michel; Saccomandi, Giuseppe; Sgura, Ivonne

    2017-02-01

    A great variety of models can describe the nonlinear response of rubber to uniaxial tension. Yet an in-depth understanding of the successive stages of large extension is still lacking. We show that the response can be broken down in three steps, which we delineate by relying on a simple formatting of the data, the so-called Mooney plot transform. First, the small-to-moderate regime, where the polymeric chains unfold easily and the Mooney plot is almost linear. Second, the strain-hardening regime, where blobs of bundled chains unfold to stiffen the response in correspondence to the `upturn' of the Mooney plot. Third, the limiting-chain regime, with a sharp stiffening occurring as the chains extend towards their limit. We provide strain-energy functions with terms accounting for each stage that (i) give an accurate local and then global fitting of the data; (ii) are consistent with weak nonlinear elasticity theory and (iii) can be interpreted in the framework of statistical mechanics. We apply our method to Treloar's classical experimental data and also to some more recent data. Our method not only provides models that describe the experimental data with a very low quantitative relative error, but also shows that the theory of nonlinear elasticity is much more robust that seemed at first sight.

  2. Mass dependence of the activation enthalpy and entropy of unentangled linear alkane chains

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Jeong, Cheol; Douglas, Jack F.

    2015-10-14

    The mass scaling of the self-diffusion coefficient D of polymers in the liquid state, D ∼ M{sup β}, is one of the most basic characteristics of these complex fluids. Although traditional theories such as the Rouse and reptation models of unentangled and entangled polymer melts, respectively, predict that β is constant, this exponent for alkanes has been estimated experimentally to vary from −1.8 to −2.7 upon cooling. Significantly, β changes with temperature T under conditions where the chains are not entangled and at temperatures far above the glass transition temperature T{sub g} where dynamic heterogeneity does not complicate the descriptionmore » of the liquid dynamics. Based on atomistic molecular dynamics simulations on unentangled linear alkanes in the melt, we find that the variation of β with T can be directly attributed to the dependence of the enthalpy ΔH{sub a} and entropy ΔS{sub a} of activation on the number of alkane backbone carbon atoms, n. In addition, we find a sharp change in the melt dynamics near a “critical” chain length, n ≈ 17. A close examination of this phenomenon indicates that a “buckling transition” from rod-like to coiled chain configurations occurs at this characteristic chain length and distinct entropy-enthalpy compensation relations, ΔS{sub a} ∝ ΔH{sub a}, hold on either side of this polymer conformational transition. We conclude that the activation free energy parameters exert a significant influence on the dynamics of polymer melts that is not anticipated by either the Rouse and reptation models. In addition to changes of ΔH{sub a} and ΔS{sub a} with M, we expect changes in these free energy parameters to be crucial for understanding the dynamics of polymer blends, nanocomposites, and confined polymers because of changes of the fluid free energy by interfacial interactions and geometrical confinement.« less

  3. Rational design and dynamics of self-propelled colloidal bead chains: from rotators to flagella.

    PubMed

    Vutukuri, Hanumantha Rao; Bet, Bram; van Roij, René; Dijkstra, Marjolein; Huck, Wilhelm T S

    2017-12-01

    The quest for designing new self-propelled colloids is fuelled by the demand for simple experimental models to study the collective behaviour of their more complex natural counterparts. Most synthetic self-propelled particles move by converting the input energy into translational motion. In this work we address the question if simple self-propelled spheres can assemble into more complex structures that exhibit rotational motion, possibly coupled with translational motion as in flagella. We exploit a combination of induced dipolar interactions and a bonding step to create permanent linear bead chains, composed of self-propelled Janus spheres, with a well-controlled internal structure. Next, we study how flexibility between individual swimmers in a chain can affect its swimming behaviour. Permanent rigid chains showed only active rotational or spinning motion, whereas longer semi-flexible chains showed both translational and rotational motion resembling flagella like-motion, in the presence of the fuel. Moreover, we are able to reproduce our experimental results using numerical calculations with a minimal model, which includes full hydrodynamic interactions with the fluid. Our method is general and opens a new way to design novel self-propelled colloids with complex swimming behaviours, using different complex starting building blocks in combination with the flexibility between them.

  4. Improved zeolite regeneration processes for preparing saturated branched-chain fatty acids

    USDA-ARS?s Scientific Manuscript database

    Ferrierite zeolite solid is an excellent catalyst for the skeletal isomerization of unsaturated linear-chain fatty acids (i.e., oleic acid) to unsaturated branched-chain fatty acids (i.e., iso-oleic acid) follow by hydrogenation to give saturated branched-chain fatty acids (i.e., isostearic acid). ...

  5. Quantum conductance oscillation in linear monatomic silicon chains

    NASA Astrophysics Data System (ADS)

    Liu, Fu-Ti; Cheng, Yan; Yang, Fu-Bin; Chen, Xiang-Rong

    2014-02-01

    The conductance of linear silicon atomic chains with n=1-8 atoms sandwiched between Au electrodes is investigated by using the density functional theory combined with non-equilibrium Green's function. The results show that the conductance oscillates with a period of two atoms as the number of atoms in the chain is varied. We optimize the geometric structure of nanoscale junctions in different distances, and obtain that the average bond-length of silicon atoms in each chain at equilibrium positions is 2.15±0.03 Å. The oscillation of average Si-Si bond-length can explain the conductance oscillation from the geometric structure of atomic chains. We calculate the transmission spectrum of the chains in the equilibrium positions, and explain the conductance oscillation from the electronic structure. The transport channel is mainly contributed by px and py orbital electrons of silicon atoms. The even-odd oscillation is robust under external voltage up to 1.2 V.

  6. Functional Effects of Parasites on Food Web Properties during the Spring Diatom Bloom in Lake Pavin: A Linear Inverse Modeling Analysis

    PubMed Central

    Niquil, Nathalie; Jobard, Marlène; Saint-Béat, Blanche; Sime-Ngando, Télesphore

    2011-01-01

    This study is the first assessment of the quantitative impact of parasitic chytrids on a planktonic food web. We used a carbon-based food web model of Lake Pavin (Massif Central, France) to investigate the effects of chytrids during the spring diatom bloom by developing models with and without chytrids. Linear inverse modelling procedures were employed to estimate undetermined flows in the lake. The Monte Carlo Markov chain linear inverse modelling procedure provided estimates of the ranges of model-derived fluxes. Model results support recent theories on the probable impact of parasites on food web function. In the lake, during spring, when ‘inedible’ algae (unexploited by planktonic herbivores) were the dominant primary producers, the epidemic growth of chytrids significantly reduced the sedimentation loss of algal carbon to the detritus pool through the production of grazer-exploitable zoospores. We also review some theories about the potential influence of parasites on ecological network properties and argue that parasitism contributes to longer carbon path lengths, higher levels of activity and specialization, and lower recycling. Considering the “structural asymmetry” hypothesis as a stabilizing pattern, chytrids should contribute to the stability of aquatic food webs. PMID:21887240

  7. Synthesis and antimalarial activity of new chloroquine analogues carrying a multifunctional linear side chain.

    PubMed

    Iwaniuk, Daniel P; Whetmore, Eric D; Rosa, Nicholas; Ekoue-Kovi, Kekeli; Alumasa, John; de Dios, Angel C; Roepe, Paul D; Wolf, Christian

    2009-09-15

    We report the synthesis and in vitro antimalarial activity of several new 4-amino- and 4-alkoxy-7-chloroquinolines carrying a linear dibasic side chain. Many of these chloroquine analogues have submicromolar antimalarial activity versus HB3 (chloroquine sensitive) and Dd2 (chloroquine resistant strain of Plasmodium falciparum) and low resistance indices were obtained in most cases. Importantly, compounds 11-15 and 24 proved to be more potent against Dd2 than chloroquine. Branching of the side chain structure proved detrimental to the activity against the CQR strain.

  8. From Comb-like Polymers to Bottle-Brushes

    NASA Astrophysics Data System (ADS)

    Liang, Heyi; Cao, Zhen; Dobrynin, Andrey; Sheiko, Sergei

    We use a combination of the coarse-grained molecular dynamics simulations and scaling analysis to study conformations of bottle-brushes and comb-like polymers in a melt. Our analysis show that bottle-brushes and comb-like polymers can be in four different conformation regimes depending on the number of monomers between grafted side chains and side chain degree of polymerization. In loosely-grafted comb regime (LC) the degree of polymerization between side chains is longer than side chain degree of polymerization, such that the side chains belonging to the same macromolecule do not overlap. Crossover to a new densely-grafted comb regime (DC) takes place when side chains begin to overlap reducing interpenetration of side chains belonging to different macromolecules. In these two regimes both side-chains and backbone behave as unperturbed linear chains with the effective Kuhn length of the backbone being close to that of linear chain. Further decrease spacer degree of polymerization results in crossover to loosely-grafted bottle-brush regime (LB). In this regime, the bottle-brush backbone is stretched while the side-chains still maintain ideal chain conformation. Finally, for even shorter spacer between grafted side chains, which corresponds to densely-grafted bottle-brush regime (DB), the backbone adopts a fully extended chain conformation, and side-chains begin to stretch to maintain a constant monomer density. NSF DMR-1409710, DMR-1407645, DMR-1624569, DMR-1436201.

  9. Computer Simulations of Bottle Brushes: From Melts to Soft Networks

    DOE PAGES

    Cao, Zhen; Carrillo, Jan-Michael Y.; Sheiko, Sergei S.; ...

    2015-07-13

    We use a combination of Molecular dynamics simulations and analytical calculations, and study dens bottle-brush systems in a melt and network State. Analysis of our simulation results shows that bottle-brush macromolecules in melt behave as ideal chains with effective Kuhn length b K. Simulations show that the bottle-brush-induced bending rigidity is due to an entropy decrease caused by redistribution of the side chains upon backbone bending. The Kuhn length of the bottle:brushes increases with increasing the side-chain degree of polymerization n sc as b K proportional to n sc 0.46. Moreover, this model of bottle brush macromolecules is extended tomore » describe mechanical properties of bottle brush networks in linear and nonlinear deformation regimes. In the linear deformation regime, the network shear modulus scales with the degree of polymerization of the side chains as G 0 proportional to (n sc + 1) -1 as long as the ratio of the Kuhn length, b K, to the size of the fully extended bottle-brush backbone between cross-links, R-max, is smaller than unity, b K/R max << 1. Bottle-brush networks With b K/R max proportional to 1 demonstrate behavior similar to that of networks Of semiflexible chains with G 0 proportional to n sc -0.5. Finally, in the nonlinear network deformation regime, the deformation-dependent shear modulus is a universal function of the first strain invariant I 1 and bottle-brush backbone deformation ratio beta describing stretching ability of the bottle-brush backbone between cross-links.« less

  10. Serum long-chain omega-3 polyunsaturated Fatty acids and future blood pressure in an ageing population.

    PubMed

    Nyantika, A N; Tuomainen, T-P; Kauhanen, J; Voutilainen, S; Virtanen, J K

    2015-05-01

    To investigate the associations of serum long-chain omega-3 polyunsaturated fatty acids (PUFA) and hair mercury with future blood pressure in an ageing population. Prospective study with baseline measurements in 1998-2001 and follow-up measurements in 2005-2008. The linear relationships (β) of baseline serum fatty acids and hair mercury with future systolic and diastolic blood pressure and pulse pressure were analyzed with multiple linear regression models, using log-transformed values. 181 men and 200 women aged 53-73 y from the Kuopio Ischemic Heart Disease Risk Factor Study (KIHD) population in Eastern Finland, who were free of cardiovascular disease, diabetes or hypertension at baseline. Total serum esterified and nonesterified fatty acids and pubic hair mercury were used as markers for exposure. Anthropometric and other lifestyle and health-related data were collected. The mean serum concentrations were 1.67% (SD 0.92) for eicosapentaenoic acid (EPA), 0.79% (SD 0.16) for docosapentaenoic acid (DPA) and 2.78 (SD 0.92) for docosahexaenoic acid (DHA), of all serum fatty acids. The mean hair mercury concentration was 1.5 µg/g (SD 1.6). We did not find statistically significant associations between the baseline serum long-chain omega-3 PUFA concentrations or hair mercury content and future blood pressure. Hair mercury did not modify the associations with the long-chain omega-3 PUFAs, either. Higher serum long-chain omega-3 PUFA concentration, a biomarker of fish or fish oil consumption, may not have an impact on future blood pressure in an ageing population.

  11. Multiscale Modeling of Thermal Conductivity of Polymer/Carbon Nanocomposites

    NASA Technical Reports Server (NTRS)

    Clancy, Thomas C.; Frankland, Sarah-Jane V.; Hinkley, Jeffrey A.; Gates, Thomas S.

    2010-01-01

    Molecular dynamics simulation was used to estimate the interfacial thermal (Kapitza) resistance between nanoparticles and amorphous and crystalline polymer matrices. Bulk thermal conductivities of the nanocomposites were then estimated using an established effective medium approach. To study functionalization, oligomeric ethylene-vinyl alcohol copolymers were chemically bonded to a single wall carbon nanotube. The results, in a poly(ethylene-vinyl acetate) matrix, are similar to those obtained previously for grafted linear hydrocarbon chains. To study the effect of noncovalent functionalization, two types of polyethylene matrices. -- aligned (extended-chain crystalline) vs. amorphous (random coils) were modeled. Both matrices produced the same interfacial thermal resistance values. Finally, functionalization of edges and faces of plate-like graphite nanoparticles was found to be only modestly effective in reducing the interfacial thermal resistance and improving the composite thermal conductivity

  12. Projection methods for the numerical solution of Markov chain models

    NASA Technical Reports Server (NTRS)

    Saad, Youcef

    1989-01-01

    Projection methods for computing stationary probability distributions for Markov chain models are presented. A general projection method is a method which seeks an approximation from a subspace of small dimension to the original problem. Thus, the original matrix problem of size N is approximated by one of dimension m, typically much smaller than N. A particularly successful class of methods based on this principle is that of Krylov subspace methods which utilize subspaces of the form span(v,av,...,A(exp m-1)v). These methods are effective in solving linear systems and eigenvalue problems (Lanczos, Arnoldi,...) as well as nonlinear equations. They can be combined with more traditional iterative methods such as successive overrelaxation, symmetric successive overrelaxation, or with incomplete factorization methods to enhance convergence.

  13. Biologically relevant conformational features of linear and cyclic proteolipid protein (PLP) peptide analogues obtained by high-resolution nuclear magnetic resonance and molecular dynamics

    NASA Astrophysics Data System (ADS)

    Kordopati, Golfo G.; Tzoupis, Haralambos; Troganis, Anastassios N.; Tsivgoulis, Gerasimos M.; Golic Grdadolnik, Simona; Simal, Carmen; Tselios, Theodore V.

    2017-09-01

    Proteolipid protein (PLP) is one of the main proteins of myelin sheath that are destroyed during the progress of multiple sclerosis (MS). The immunodominant PLP139-151 epitope is known to induce experimental autoimmune encephalomyelitis (EAE, animal model of MS), wherein residues 144 and 147 are recognized by T cell receptor (TCR) during the formation of trimolecular complex with peptide-antigen and major histocompability complex. The conformational behavior of linear and cyclic peptide analogues of PLP, namely PLP139-151 and cyclic (139-151) (L144, R147) PLP139-151, have been studied in solution by means of nuclear magnetic resonance (NMR) methods in combination with unrestrained molecular dynamics simulations. The results indicate that the side chains of mutated amino acids in the cyclic analogue have different spatial orientation compared with the corresponding side chains of the linear analogue, which can lead to reduced affinity to TCR. NMR experiments combined with theoretical calculations pave the way for the design and synthesis of potent restricted peptides of immunodominant PLP139-151 epitope as well as non peptide mimetics that rises as an ultimate goal.

  14. Bayesian inversion of seismic and electromagnetic data for marine gas reservoir characterization using multi-chain Markov chain Monte Carlo sampling

    NASA Astrophysics Data System (ADS)

    Ren, Huiying; Ray, Jaideep; Hou, Zhangshuan; Huang, Maoyi; Bao, Jie; Swiler, Laura

    2017-12-01

    In this study we developed an efficient Bayesian inversion framework for interpreting marine seismic Amplitude Versus Angle and Controlled-Source Electromagnetic data for marine reservoir characterization. The framework uses a multi-chain Markov-chain Monte Carlo sampler, which is a hybrid of DiffeRential Evolution Adaptive Metropolis and Adaptive Metropolis samplers. The inversion framework is tested by estimating reservoir-fluid saturations and porosity based on marine seismic and Controlled-Source Electromagnetic data. The multi-chain Markov-chain Monte Carlo is scalable in terms of the number of chains, and is useful for computationally demanding Bayesian model calibration in scientific and engineering problems. As a demonstration, the approach is used to efficiently and accurately estimate the porosity and saturations in a representative layered synthetic reservoir. The results indicate that the seismic Amplitude Versus Angle and Controlled-Source Electromagnetic joint inversion provides better estimation of reservoir saturations than the seismic Amplitude Versus Angle only inversion, especially for the parameters in deep layers. The performance of the inversion approach for various levels of noise in observational data was evaluated - reasonable estimates can be obtained with noise levels up to 25%. Sampling efficiency due to the use of multiple chains was also checked and was found to have almost linear scalability.

  15. Spectral likelihood expansions for Bayesian inference

    NASA Astrophysics Data System (ADS)

    Nagel, Joseph B.; Sudret, Bruno

    2016-03-01

    A spectral approach to Bayesian inference is presented. It pursues the emulation of the posterior probability density. The starting point is a series expansion of the likelihood function in terms of orthogonal polynomials. From this spectral likelihood expansion all statistical quantities of interest can be calculated semi-analytically. The posterior is formally represented as the product of a reference density and a linear combination of polynomial basis functions. Both the model evidence and the posterior moments are related to the expansion coefficients. This formulation avoids Markov chain Monte Carlo simulation and allows one to make use of linear least squares instead. The pros and cons of spectral Bayesian inference are discussed and demonstrated on the basis of simple applications from classical statistics and inverse modeling.

  16. Determination of the pKa of the N-terminal amino group of ubiquitin by NMR

    PubMed Central

    Oregioni, Alain; Stieglitz, Benjamin; Kelly, Geoffrey; Rittinger, Katrin; Frenkiel, Tom

    2017-01-01

    Ubiquitination regulates nearly every aspect of cellular life. It is catalysed by a cascade of three enzymes and results in the attachment of the C-terminal carboxylate of ubiquitin to a lysine side chain in the protein substrate. Chain extension occurs via addition of subsequent ubiquitin molecules to either one of the seven lysine residues of ubiquitin, or via its N-terminal α-amino group to build linear ubiquitin chains. The pKa of lysine side chains is around 10.5 and hence E3 ligases require a mechanism to deprotonate the amino group at physiological pH to produce an effective nucleophile. In contrast, the pKa of N-terminal α-amino groups of proteins can vary significantly, with reported values between 6.8 and 9.1, raising the possibility that linear chain synthesis may not require a general base. In this study we use NMR spectroscopy to determine the pKa for the N-terminal α-amino group of methionine1 of ubiquitin for the first time. We show that it is 9.14, one of the highest pKa values ever reported for this amino group, providing a rational for the observed need for a general base in the E3 ligase HOIP, which synthesizes linear ubiquitin chains. PMID:28252051

  17. Competing Thermodynamic and Dynamic Factors Select Molecular Assemblies on a Gold Surface

    NASA Astrophysics Data System (ADS)

    Haxton, Thomas K.; Zhou, Hui; Tamblyn, Isaac; Eom, Daejin; Hu, Zonghai; Neaton, Jeffrey B.; Heinz, Tony F.; Whitelam, Stephen

    2013-12-01

    Controlling the self-assembly of surface-adsorbed molecules into nanostructures requires understanding physical mechanisms that act across multiple length and time scales. By combining scanning tunneling microscopy with hierarchical ab initio and statistical mechanical modeling of 1,4-substituted benzenediamine (BDA) molecules adsorbed on a gold (111) surface, we demonstrate that apparently simple nanostructures are selected by a subtle competition of thermodynamics and dynamics. Of the collection of possible BDA nanostructures mechanically stabilized by hydrogen bonding, the interplay of intermolecular forces, surface modulation, and assembly dynamics select at low temperature a particular subset: low free energy oriented linear chains of monomers and high free energy branched chains.

  18. Overhead longwave infrared hyperspectral material identification using radiometric models

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zelinski, M. E.

    Material detection algorithms used in hyperspectral data processing are computationally efficient but can produce relatively high numbers of false positives. Material identification performed as a secondary processing step on detected pixels can help separate true and false positives. This paper presents a material identification processing chain for longwave infrared hyperspectral data of solid materials collected from airborne platforms. The algorithms utilize unwhitened radiance data and an iterative algorithm that determines the temperature, humidity, and ozone of the atmospheric profile. Pixel unmixing is done using constrained linear regression and Bayesian Information Criteria for model selection. The resulting product includes an optimalmore » atmospheric profile and full radiance material model that includes material temperature, abundance values, and several fit statistics. A logistic regression method utilizing all model parameters to improve identification is also presented. This paper details the processing chain and provides justification for the algorithms used. Several examples are provided using modeled data at different noise levels.« less

  19. Tuning conductivity in boron nanowire by edge geometry

    NASA Astrophysics Data System (ADS)

    Bhuyan, Prabal Dev; Gupta, Sanjeev K.; Sonvane, Yogesh; Gajjar, P. N.

    2018-04-01

    In present study, we have investigated electronic and temperature dependent transport properties of carbyne like linear chain and ribbon like zigzag structures of Boron (B) nanowire. The linear chain structure showed higher electric and thermal conductivity, as it is sp-hybridized, than its counterpart ribbon (R) structure. However the conductivity of ribbon structure increases with increases in width due to edge geometry effect. The ribbon (3R) structure showed high electric and thermal conductivity of 8.0×1019 1/Ω m s and 0.59×1015 W/ m K respectively. Interestingly we have observed that B linear chain showed higher thermal conductivity of 0.23×1015 W/ m K than its ribbon R and 2R structure above 600K. Because of high Seebeck co-efficient of boron chain and ribbon (R) structures at low temperature, they could find applications in thermoelectric sensors. Our results show that tuning conductivity property of boron nanowire could be of great interest in research for future electric connector in nanodevices.

  20. Target Specificity of the E3 Ligase LUBAC for Ubiquitin and NEMO Relies on Different Minimal Requirements*

    PubMed Central

    Smit, Judith J.; van Dijk, Willem J.; El Atmioui, Dris; Merkx, Remco; Ovaa, Huib; Sixma, Titia K.

    2013-01-01

    The ubiquitination of NEMO with linear ubiquitin chains by the E3-ligase LUBAC is important for the activation of the canonical NF-κB pathway. NEMO ubiquitination requires a dual target specificity of LUBAC, priming on a lysine on NEMO and chain elongation on the N terminus of the priming ubiquitin. Here we explore the minimal requirements for these specificities. Effective linear chain formation requires a precise positioning of the ubiquitin N-terminal amine in a negatively charged environment on the top of ubiquitin. Whereas the RBR-LDD region on HOIP is sufficient for targeting the ubiquitin N terminus, the priming lysine modification on NEMO requires catalysis by the RBR domain of HOIL-1L as well as the catalytic machinery of the RBR-LDD domains of HOIP. Consequently, target specificity toward NEMO is determined by multiple LUBAC components, whereas linear ubiquitin chain elongation is realized by a specific interplay between HOIP and ubiquitin. PMID:24030825

  1. Renormalized charge in a two-dimensional model of colloidal suspension from hypernetted chain approach.

    PubMed

    Camargo, Manuel; Téllez, Gabriel

    2008-04-07

    The renormalized charge of a simple two-dimensional model of colloidal suspension was determined by solving the hypernetted chain approximation and Ornstein-Zernike equations. At the infinite dilution limit, the asymptotic behavior of the correlation functions is used to define the effective interactions between the components of the system and these effective interactions were compared to those derived from the Poisson-Boltzmann theory. The results we obtained show that, in contrast to the mean-field theory, the renormalized charge does not saturate, but exhibits a maximum value and then decays monotonically as the bare charge increases. The results also suggest that beyond the counterion layer near to the macroion surface, the ionic cloud is not a diffuse layer which can be handled by means of the linearized theory, as the two-state model claims, but a more complex structure is settled by the correlations between microions.

  2. Charge Mobility Enhancement for Conjugated DPP-Selenophene Polymer by Simply Replacing One Bulky Branching Alkyl Chain with Linear One at Each DPP Unit

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wang, Zhijie; Liu, Zitong; Ning, Lu

    Here, we demonstrate a simple, but efficient, approach for improving the semiconducting performances of DPP-based conjugated D-A polymers. This approach involves the replacement of one bulky branching alkyl chain with the linear one at each DPP unit in regular polymer PDPPSe-10 and PDPPSe-12. The UV–vis absorption, Raman spectra, PDS data, and theoretical calculations support that the replacement of bulky branching chains with linear ones can weaken the steric hindrance, and accordingly conjugated backbones become more planar and rigid. GIWAXS data show that the incorporation of linear alkyl chains as in PDPPSe-10 and PDPPSe-12 is beneficial for side-chain interdigitation and interchainmore » dense packing, leading to improvement of interchain packing order and thin film crystallinity by comparing with PDPPSe, which contains branching alkyl chains. On the basis of field-effect transistor (FET) studies, charge mobilities of PDPPSe-10 and PDPPSe-12 are remarkably enhanced. Hole mobilities of PDPPSe-10 and PDPPSe-12 in air are boosted to 8.1 and 9.4 cm 2 V –1 s –1, which are about 6 and 7 times, respectively, than that of PDPPSe (1.35 cm 2 V –1 s –1). Furthermore, both PDPPSe-10 and PDPPSe-12 behave as ambipolar semiconductors under a nitrogen atmosphere with increased hole/electron mobilities up to 6.5/0.48 cm 2 V –1 s –1 and 7.9/0.79 cm 2 V –1 s –1, respectively.« less

  3. Charge Mobility Enhancement for Conjugated DPP-Selenophene Polymer by Simply Replacing One Bulky Branching Alkyl Chain with Linear One at Each DPP Unit

    DOE PAGES

    Wang, Zhijie; Liu, Zitong; Ning, Lu; ...

    2018-04-17

    Here, we demonstrate a simple, but efficient, approach for improving the semiconducting performances of DPP-based conjugated D-A polymers. This approach involves the replacement of one bulky branching alkyl chain with the linear one at each DPP unit in regular polymer PDPPSe-10 and PDPPSe-12. The UV–vis absorption, Raman spectra, PDS data, and theoretical calculations support that the replacement of bulky branching chains with linear ones can weaken the steric hindrance, and accordingly conjugated backbones become more planar and rigid. GIWAXS data show that the incorporation of linear alkyl chains as in PDPPSe-10 and PDPPSe-12 is beneficial for side-chain interdigitation and interchainmore » dense packing, leading to improvement of interchain packing order and thin film crystallinity by comparing with PDPPSe, which contains branching alkyl chains. On the basis of field-effect transistor (FET) studies, charge mobilities of PDPPSe-10 and PDPPSe-12 are remarkably enhanced. Hole mobilities of PDPPSe-10 and PDPPSe-12 in air are boosted to 8.1 and 9.4 cm 2 V –1 s –1, which are about 6 and 7 times, respectively, than that of PDPPSe (1.35 cm 2 V –1 s –1). Furthermore, both PDPPSe-10 and PDPPSe-12 behave as ambipolar semiconductors under a nitrogen atmosphere with increased hole/electron mobilities up to 6.5/0.48 cm 2 V –1 s –1 and 7.9/0.79 cm 2 V –1 s –1, respectively.« less

  4. Spatial generalised linear mixed models based on distances.

    PubMed

    Melo, Oscar O; Mateu, Jorge; Melo, Carlos E

    2016-10-01

    Risk models derived from environmental data have been widely shown to be effective in delineating geographical areas of risk because they are intuitively easy to understand. We present a new method based on distances, which allows the modelling of continuous and non-continuous random variables through distance-based spatial generalised linear mixed models. The parameters are estimated using Markov chain Monte Carlo maximum likelihood, which is a feasible and a useful technique. The proposed method depends on a detrending step built from continuous or categorical explanatory variables, or a mixture among them, by using an appropriate Euclidean distance. The method is illustrated through the analysis of the variation in the prevalence of Loa loa among a sample of village residents in Cameroon, where the explanatory variables included elevation, together with maximum normalised-difference vegetation index and the standard deviation of normalised-difference vegetation index calculated from repeated satellite scans over time. © The Author(s) 2013.

  5. How can we make stable linear monoatomic chains? Gold-cesium binary subnanowires as an example of a charge-transfer-driven approach to alloying.

    PubMed

    Choi, Young Cheol; Lee, Han Myoung; Kim, Woo Youn; Kwon, S K; Nautiyal, Tashi; Cheng, Da-Yong; Vishwanathan, K; Kim, Kwang S

    2007-02-16

    On the basis of first-principles calculations of clusters and one dimensional infinitely long subnanowires of the binary systems, we find that alkali-noble metal alloy wires show better linearity and stability than either pure alkali metal or noble metal wires. The enhanced alternating charge buildup on atoms by charge transfer helps the atoms line up straight. The cesium doped gold wires showing significant charge transfer from cesium to gold can be stabilized as linear or circular monoatomic chains.

  6. The linear transformation model with frailties for the analysis of item response times.

    PubMed

    Wang, Chun; Chang, Hua-Hua; Douglas, Jeffrey A

    2013-02-01

    The item response times (RTs) collected from computerized testing represent an underutilized source of information about items and examinees. In addition to knowing the examinees' responses to each item, we can investigate the amount of time examinees spend on each item. In this paper, we propose a semi-parametric model for RTs, the linear transformation model with a latent speed covariate, which combines the flexibility of non-parametric modelling and the brevity as well as interpretability of parametric modelling. In this new model, the RTs, after some non-parametric monotone transformation, become a linear model with latent speed as covariate plus an error term. The distribution of the error term implicitly defines the relationship between the RT and examinees' latent speeds; whereas the non-parametric transformation is able to describe various shapes of RT distributions. The linear transformation model represents a rich family of models that includes the Cox proportional hazards model, the Box-Cox normal model, and many other models as special cases. This new model is embedded in a hierarchical framework so that both RTs and responses are modelled simultaneously. A two-stage estimation method is proposed. In the first stage, the Markov chain Monte Carlo method is employed to estimate the parametric part of the model. In the second stage, an estimating equation method with a recursive algorithm is adopted to estimate the non-parametric transformation. Applicability of the new model is demonstrated with a simulation study and a real data application. Finally, methods to evaluate the model fit are suggested. © 2012 The British Psychological Society.

  7. Buckling behaviors of single-walled carbon nanotubes inserted with a linear carbon-atom chain.

    PubMed

    Zhu, Chunhua; Chen, Yinfeng; Liu, Rumeng; Zhao, Junhua

    2018-08-17

    Buckling behaviors of single-walled carbon nanotubes (SWCNTs) inserted with a linear carbon-atom chain (CAC) (the composite structures are also called carbon nanowires (CNWs)) under torsion and bending as well as compression are studied using molecular dynamics (MD) simulations, respectively. Our MD results show that the critical buckling angles (or strains) of CNWs under the three presented kinds of loading patterns can be two times those of corresponding independent SWCNTs for long CNWs, while the buckling improvement is not obvious for short ones. The main reason is that the radial van der Waals force between the CAC and the SWCNT is very small for a short CNW, while it increases with increasing length and then tends to a constant for a long CNW. The obtained MD results agree well with those from available theoretical models. These findings will be a great help towards understanding the stability and reliability of the special CNT structures, and designing flexible CNT-based devices.

  8. Lattice vibrations in the Frenkel-Kontorova model. I. Phonon dispersion, number density, and energy

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Meng, Qingping; Wu, Lijun; Welch, David O.

    2015-06-17

    We studied the lattice vibrations of two inter-penetrating atomic sublattices via the Frenkel-Kontorova (FK) model of a linear chain of harmonically interacting atoms subjected to an on-site potential, using the technique of thermodynamic Green's functions based on quantum field-theoretical methods. General expressions were deduced for the phonon frequency-wave-vector dispersion relations, number density, and energy of the FK model system. In addition, as the application of the theory, we investigated in detail cases of linear chains with various periods of the on-site potential of the FK model. Some unusual but interesting features for different amplitudes of the on-site potential of themore » FK model are discussed. In the commensurate structure, the phonon spectrum always starts at a finite frequency, and the gaps of the spectrum are true ones with a zero density of modes. In the incommensurate structure, the phonon spectrum starts from zero frequency, but at a non-zero wave vector; there are some modes inside these gap regions, but their density is very low. In our approximation, the energy of a higher-order commensurate state of the one-dimensional system at a finite temperature may become indefinitely close to the energy of an incommensurate state. This finding implies that the higher-order incommensurate-commensurate transitions are continuous ones and that the phase transition may exhibit a “devil's staircase” behavior at a finite temperature.« less

  9. Momentum-Based Dynamics for Spacecraft with Chained Revolute Appendages

    NASA Technical Reports Server (NTRS)

    Queen, Steven; London, Ken; Gonzalez, Marcelo

    2005-01-01

    An efficient formulation is presented for a sub-class of multi-body dynamics problems that involve a six degree-of-freedom base body and a chain of N rigid linkages connected in series by single degree-of-freedom revolute joints. This general method is particularly well suited for simulations of spacecraft dynamics and control that include the modeling of an orbiting platform with or without internal degrees of freedom such as reaction wheels, dampers, and/or booms. In the present work, particular emphasis is placed on dynamic simulation of multi-linkage robotic manipulators. The differential equations of motion are explicitly given in terms of linear and angular momentum states, which can be evaluated recursively along a serial chain of linkages for an efficient real-time solution on par with the best of the O(N3) methods.

  10. Symmetry-Breaking Phase Transition without a Peierls Instability in Conducting Monoatomic Chains

    NASA Astrophysics Data System (ADS)

    Blumenstein, C.; Schäfer, J.; Morresi, M.; Mietke, S.; Matzdorf, R.; Claessen, R.

    2011-10-01

    The one-dimensional (1D) model system Au/Ge(001), consisting of linear chains of single atoms on a surface, is scrutinized for lattice instabilities predicted in the Peierls paradigm. By scanning tunneling microscopy and electron diffraction we reveal a second-order phase transition at 585 K. It leads to charge ordering with transversal and vertical displacements and complex interchain correlations. However, the structural phase transition is not accompanied by the electronic signatures of a charge density wave, thus precluding a Peierls instability as origin. Instead, this symmetry-breaking transition exhibits three-dimensional critical behavior. This reflects a dichotomy between the decoupled 1D electron system and the structural elements that interact via the substrate. Such substrate-mediated coupling between the wires thus appears to have been underestimated also in related chain systems.

  11. Butyric acid esterification kinetics over Amberlyst solid acid catalysts: the effect of alcohol carbon chain length.

    PubMed

    Pappu, Venkata K S; Kanyi, Victor; Santhanakrishnan, Arati; Lira, Carl T; Miller, Dennis J

    2013-02-01

    The liquid phase esterification of butyric acid with a series of linear and branched alcohols is examined. Four strong cation exchange resins, Amberlyst™ 15, Amberlyst™ 36, Amberlyst™ BD 20, and Amberlyst™ 70, were used along with para-toluenesulfonic acid as a homogeneous catalyst. The effect of increasing alcohol carbon chain length and branching on esterification rate at 60°C is presented. For all catalysts, the decrease in turnover frequency (TOF) with increasing carbon chain length of the alcohol is described in terms of steric hindrance, alcohol polarity, and hydroxyl group concentration. The kinetics of butyric acid esterification with 2-ethylhexanol using Amberlyst™ 70 catalyst is described with an activity-based, pseudo-homogeneous kinetic model that includes autocatalysis by butyric acid. Copyright © 2012 Elsevier Ltd. All rights reserved.

  12. Intrachain exciton dynamics in conjugated polymer chains in solution.

    PubMed

    Tozer, Oliver Robert; Barford, William

    2015-08-28

    We investigate exciton dynamics on a polymer chain in solution induced by the Brownian rotational motion of the monomers. Poly(para-phenylene) is chosen as the model system and excitons are modeled via the Frenkel exciton Hamiltonian. The Brownian fluctuations of the torsional modes were modeled via the Langevin equation. The rotation of monomers in polymer chains in solution has a number of important consequences for the excited state properties. First, the dihedral angles assume a thermal equilibrium which causes off-diagonal disorder in the Frenkel Hamiltonian. This disorder Anderson localizes the Frenkel exciton center-of-mass wavefunctions into super-localized local exciton ground states (LEGSs) and higher-energy more delocalized quasi-extended exciton states (QEESs). LEGSs correspond to chromophores on polymer chains. The second consequence of rotations-that are low-frequency-is that their coupling to the exciton wavefunction causes local planarization and the formation of an exciton-polaron. This torsional relaxation causes additional self-localization. Finally, and crucially, the torsional dynamics cause the Frenkel Hamiltonian to be time-dependent, leading to exciton dynamics. We identify two distinct types of dynamics. At low temperatures, the torsional fluctuations act as a perturbation on the polaronic nature of the exciton state. Thus, the exciton dynamics at low temperatures is a small-displacement diffusive adiabatic motion of the exciton-polaron as a whole. The temperature dependence of the diffusion constant has a linear dependence, indicating an activationless process. As the temperature increases, however, the diffusion constant increases at a faster than linear rate, indicating a second non-adiabatic dynamics mechanism begins to dominate. Excitons are thermally activated into higher energy more delocalized exciton states (i.e., LEGSs and QEESs). These states are not self-localized by local torsional planarization. During the exciton's temporary occupation of a LEGS-and particularly a quasi-band QEES-its motion is semi-ballistic with a large group velocity. After a short period of rapid transport, the exciton wavefunction collapses again into an exciton-polaron state. We present a simple model for the activated dynamics which is in agreement with the data.

  13. Design of supply chain in fuzzy environment

    NASA Astrophysics Data System (ADS)

    Rao, Kandukuri Narayana; Subbaiah, Kambagowni Venkata; Singh, Ganja Veera Pratap

    2013-05-01

    Nowadays, customer expectations are increasing and organizations are prone to operate in an uncertain environment. Under this uncertain environment, the ultimate success of the firm depends on its ability to integrate business processes among supply chain partners. Supply chain management emphasizes cross-functional links to improve the competitive strategy of organizations. Now, companies are moving from decoupled decision processes towards more integrated design and control of their components to achieve the strategic fit. In this paper, a new approach is developed to design a multi-echelon, multi-facility, and multi-product supply chain in fuzzy environment. In fuzzy environment, mixed integer programming problem is formulated through fuzzy goal programming in strategic level with supply chain cost and volume flexibility as fuzzy goals. These fuzzy goals are aggregated using minimum operator. In tactical level, continuous review policy for controlling raw material inventories in supplier echelon and controlling finished product inventories in plant as well as distribution center echelon is considered as fuzzy goals. A non-linear programming model is formulated through fuzzy goal programming using minimum operator in the tactical level. The proposed approach is illustrated with a numerical example.

  14. Stability analysis and stabilization strategies for linear supply chains

    NASA Astrophysics Data System (ADS)

    Nagatani, Takashi; Helbing, Dirk

    2004-04-01

    Due to delays in the adaptation of production or delivery rates, supply chains can be dynamically unstable with respect to perturbations in the consumption rate, which is known as “bull-whip effect”. Here, we study several conceivable production strategies to stabilize supply chains, which is expressed by different specifications of the management function controlling the production speed in dependence of the stock levels. In particular, we will investigate, whether the reaction to stock levels of other producers or suppliers has a stabilizing effect. We will also demonstrate that the anticipation of future stock levels can stabilize the supply system, given the forecast horizon τ is long enough. To show this, we derive linear stability conditions and carry out simulations for different control strategies. The results indicate that the linear stability analysis is a helpful tool for the judgement of the stabilization effect, although unexpected deviations can occur in the non-linear regime. There are also signs of phase transitions and chaotic behavior, but this remains to be investigated more thoroughly in the future.

  15. Do Nursing Home Chain Size and Proprietary Status Affect Experiences With Care?

    PubMed

    You, Kai; Li, Yue; Intrator, Orna; Stevenson, David; Hirth, Richard; Grabowski, David; Banaszak-Holl, Jane

    2016-03-01

    In 2012, over half of nursing homes were operated by corporate chains. Facilities owned by the largest for-profit chains were reported to have lower quality of care. However, it is unknown how nursing home chain ownerships are related with experiences of care. To study the relationship between nursing home chain characteristics (chain size and profit status) with patients' family member reported ratings on experiences with care. Maryland nursing home care experience reports, the Online Survey, Certification, And Reporting (OSCAR) files, and Area Resource Files are used. Our sample consists of all nongovernmental nursing homes in Maryland from 2007 to 2010. Consumer ratings were reported for: overall care; recommendation of the facility; staff performance; care provided; food and meals; physical environment; and autonomy and personal rights. We identified chain characteristics from OSCAR, and estimated multivariate random effect linear models to test the effects of chain ownership on care experience ratings. Independent nonprofit nursing homes have the highest overall rating score of 8.9, followed by 8.6 for facilities in small nonprofit chains, and 8.5 for independent for-profit facilities. Facilities in small, medium, and large for-profit chains have even lower overall ratings of 8.2, 7.9, and 8.0, respectively. We find similar patterns of differences in terms of recommendation rate, and important areas such as staff communication and quality of care. Evidence suggests that Maryland nursing homes affiliated with large-for-profit and medium-for-profit chains had lower ratings of family reported experience with care.

  16. Defects in regular nanosystems and interference spectra at reemission of electromagnetic field attosecond pulses

    NASA Astrophysics Data System (ADS)

    Matveev, V. I.; Makarov, D. N.

    2017-01-01

    The effect of defects in nanostructured targets on interference spectra at the reemission of attosecond electromagnetic pulses has been considered. General expressions have been obtained for calculations of spectral distributions for one-, two-, and three-dimensional multiatomic nanosystems consisting of identical complex atoms with defects such as bends, vacancies, and breaks. Changes in interference spectra by a linear chain with several removed atoms (chain with breaks) and by a linear chain with a bend have been calculated as examples allowing a simple analytical representation. Generalization to two- and three-dimensional nanosystems has been developed.

  17. Synthesis and antimalarial activity of new chloroquine analogues carrying a multifunctional linear side chain

    PubMed Central

    Iwaniuk, Daniel P.; Whetmore, Eric D.; Rosa, Nicholas; Ekoue-Kovi, Kekeli; Alumasa, John; de Dios, Angel C.; Roepe, Paul D.; Wolf, Christian

    2009-01-01

    We report the synthesis and in vitro antimalarial activity of several new 4-amino-and 4-alkoxy-7-chloroquinolines carrying a linear dibasic side chain. Many of these chloroquine analogues have submicromolar antimalarial activity versus HB3 (chloroquine sensitive) and Dd2 (chloroquine resistant strain of P. falciparum) and low resistance indices were obtained in most cases. Importantly, compounds 11–15 and 24 proved to be more potent against Dd2 than chloroquine. Branching of the side chain structure proved detrimental to the activity against the CQR strain. PMID:19703776

  18. Time-domain induced polarization - an analysis of Cole-Cole parameter resolution and correlation using Markov Chain Monte Carlo inversion

    NASA Astrophysics Data System (ADS)

    Madsen, Line Meldgaard; Fiandaca, Gianluca; Auken, Esben; Christiansen, Anders Vest

    2017-12-01

    The application of time-domain induced polarization (TDIP) is increasing with advances in acquisition techniques, data processing and spectral inversion schemes. An inversion of TDIP data for the spectral Cole-Cole parameters is a non-linear problem, but by applying a 1-D Markov Chain Monte Carlo (MCMC) inversion algorithm, a full non-linear uncertainty analysis of the parameters and the parameter correlations can be accessed. This is essential to understand to what degree the spectral Cole-Cole parameters can be resolved from TDIP data. MCMC inversions of synthetic TDIP data, which show bell-shaped probability distributions with a single maximum, show that the Cole-Cole parameters can be resolved from TDIP data if an acquisition range above two decades in time is applied. Linear correlations between the Cole-Cole parameters are observed and by decreasing the acquisitions ranges, the correlations increase and become non-linear. It is further investigated how waveform and parameter values influence the resolution of the Cole-Cole parameters. A limiting factor is the value of the frequency exponent, C. As C decreases, the resolution of all the Cole-Cole parameters decreases and the results become increasingly non-linear. While the values of the time constant, τ, must be in the acquisition range to resolve the parameters well, the choice between a 50 per cent and a 100 per cent duty cycle for the current injection does not have an influence on the parameter resolution. The limits of resolution and linearity are also studied in a comparison between the MCMC and a linearized gradient-based inversion approach. The two methods are consistent for resolved models, but the linearized approach tends to underestimate the uncertainties for poorly resolved parameters due to the corresponding non-linear features. Finally, an MCMC inversion of 1-D field data verifies that spectral Cole-Cole parameters can also be resolved from TD field measurements.

  19. Nanoporous poly(3-hexylthiophene) thin film structures from self-organization of a tunable molecular bottlebrush scaffold

    DOE PAGES

    Ahn, Suk-kyun; Carrillo, Jan-Michael Y.; Keum, Jong K.; ...

    2017-04-07

    The ability to widely tune the design of macromolecular bottlebrushes provides access to self-assembled nanostructures formed by microphase segregation in melt, thin film and solution that depart from structures adopted by simple linear copolymers. A series of random bottlebrush copolymers containing poly(3-hexylthiophene) (P3HT) and poly(D,L-lactide) (PLA) side chains grafted on a poly(norbornene) backbone were synthesized via ring-opening metathesis polymerization (ROMP) using the grafting through approach. P3HT side chains induce a physical aggregation of the bottlebrush copolymers upon solvent removal by vacuum drying, primarily driven by attractive π–π interactions; however, the amount of aggregation can be controlled by adjusting side chainmore » composition or by adding linear P3HT chains to the bottlebrush copolymers. Coarse-grained molecular dynamics simulations reveal that linear P3HT chains preferentially associate with P3HT side chains of bottlebrush copolymers, which tends to reduce the aggregation. The nanoscale morphology of microphase segregated thin films created by casting P3HT–PLA random bottlebrush copolymers is highly dependent on the composition of P3HT and PLA side chains, while domain spacing of nanostructures is mainly determined by the length of the side chains. The selective removal of PLA side chains under alkaline conditions generates nanoporous P3HT structures that can be tuned by manipulating molecular design of the bottlebrush scaffold, which is affected by molecular weight and grafting density of the side chains, and their sequence. Furthermore, the ability to exploit the unusual architecture of bottlebrushes to fabricate tunable nanoporous P3HT thin film structures may be a useful way to design templates for optoelectronic applications or membranes for separations.« less

  20. Nanoporous poly(3-hexylthiophene) thin film structures from self-organization of a tunable molecular bottlebrush scaffold

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ahn, Suk-kyun; Carrillo, Jan-Michael Y.; Keum, Jong K.

    The ability to widely tune the design of macromolecular bottlebrushes provides access to self-assembled nanostructures formed by microphase segregation in melt, thin film and solution that depart from structures adopted by simple linear copolymers. A series of random bottlebrush copolymers containing poly(3-hexylthiophene) (P3HT) and poly(D,L-lactide) (PLA) side chains grafted on a poly(norbornene) backbone were synthesized via ring-opening metathesis polymerization (ROMP) using the grafting through approach. P3HT side chains induce a physical aggregation of the bottlebrush copolymers upon solvent removal by vacuum drying, primarily driven by attractive π–π interactions; however, the amount of aggregation can be controlled by adjusting side chainmore » composition or by adding linear P3HT chains to the bottlebrush copolymers. Coarse-grained molecular dynamics simulations reveal that linear P3HT chains preferentially associate with P3HT side chains of bottlebrush copolymers, which tends to reduce the aggregation. The nanoscale morphology of microphase segregated thin films created by casting P3HT–PLA random bottlebrush copolymers is highly dependent on the composition of P3HT and PLA side chains, while domain spacing of nanostructures is mainly determined by the length of the side chains. The selective removal of PLA side chains under alkaline conditions generates nanoporous P3HT structures that can be tuned by manipulating molecular design of the bottlebrush scaffold, which is affected by molecular weight and grafting density of the side chains, and their sequence. Furthermore, the ability to exploit the unusual architecture of bottlebrushes to fabricate tunable nanoporous P3HT thin film structures may be a useful way to design templates for optoelectronic applications or membranes for separations.« less

  1. Primitive Path Analysis and Stress Distribution in Highly Strained Macromolecules

    PubMed Central

    2017-01-01

    Polymer material properties are strongly affected by entanglement effects. For long polymer chains and composite materials, they are expected to be at the origin of many technically important phenomena, such as shear thinning or the Mullins effect, which microscopically can be related to topological constraints between chains. Starting from fully equilibrated highly entangled polymer melts, we investigate the effect of isochoric elongation on the entanglement structure and force distribution of such systems. Theoretically, the related viscoelastic response usually is discussed in terms of the tube model. We relate stress relaxation in the linear and nonlinear viscoelastic regimes to a primitive path analysis (PPA) and show that tension forces both along the original paths and along primitive paths, that is, the backbone of the tube, in the stretching direction correspond to each other. Unlike homogeneous relaxation along the chain contour, the PPA reveals a so far not observed long-lived clustering of topological constraints along the chains in the deformed state. PMID:29503762

  2. A Scheme for the Evaluation of Electron Delocalization and Conjugation Efficiency in Linearly π-Conjugated Systems.

    PubMed

    Bruschi, Maurizio; Limacher, Peter A; Hutter, Jürg; Lüthi, Hans Peter

    2009-03-10

    In this study, we present a scheme for the evaluation of electron delocalization and conjugation efficiency in lineraly π-conjugated systems. The scheme, based on the natural bond orbital theory, allows monitoring the evolution of electron delocalization along an extended conjugation path as well as its response to chemical modification. The scheme presented is evaluated and illustrated by means of a computational investigation of π-conjugation in all-trans polyacetylene [PA; H(-CH═CH)n-H], polydiacetylene [PDA, H(-C≡C-CH═CH)n-H], and polytriacetylene [PTA, H(-C≡C-CH═CH-C≡C)n-H] with up to 180 carbon atoms, all related by the number of ethynyl units incorporated in the chain. We are able to show that for short oligomers the incorporation of ethynyl spacers into the PA chain increases the π-delocalization energy, but, on the other hand, reduces the efficiency with which π-electron delocalization is promoted along the backbone. This explains the generally shorter effective conjugation lengths observed for the properties of the polyeneynes (PDA and PTA) relative to the polyenes (PA). It will also be shown that the reduced conjugation efficiency, within the NBO-based model presented in this work, can be related to the orbital interaction pattern along the π-conjugated chain. We will show that the orbital interaction energy pattern is characteristic for the type and the length of the backbone and may therefore serve as a descriptor for linearly π-conjugated chains.

  3. Non-Linear Dependence of the Height of a Chain Fountain on Drop Height

    ERIC Educational Resources Information Center

    Andrew, Y.; Kearns, F.; Mustafa, T.; Salih, R.; Ioratim-Uba, A.; Udall, I.; Usama, M.

    2015-01-01

    If the end of a long chain, which is contained in an elevated beaker, is dropped over the edge of the beaker and falls, it is observed that as the speed of the chain increases the chain rises to form a loop well above the top of the beaker. The name "chain fountain" has been applied to this phenomenon. In this study the dependence of the…

  4. Searching for low percolation thresholds within amphiphilic polymer membranes: The effect of side chain branching

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Dorenbos, G., E-mail: dorenbos@ny.thn.ne.jp

    Percolation thresholds for solvent diffusion within hydrated model polymeric membranes are derived from dissipative particle dynamics in combination with Monte Carlo (MC) tracer diffusion calculations. The polymer backbones are composed of hydrophobic A beads to which at regular intervals Y-shaped side chains are attached. Each side chain is composed of eight A beads and contains two identical branches that are each terminated with a pendant hydrophilic C bead. Four types of side chains are considered for which the two branches (each represented as [C], [AC], [AAC], or [AAAC]) are splitting off from the 8th, 6th, 4th, or 2nd A bead,more » respectively. Water diffusion through the phase separated water containing pore networks is deduced from MC tracer diffusion calculations. The percolation threshold for the architectures containing the [C] and [AC] branches is at a water volume fraction of ∼0.07 and 0.08, respectively. These are much lower than those derived earlier for linear architectures of various side chain length and side chain distributions. Control of side chain architecture is thus a very interesting design parameter to decrease the percolation threshold for solvent and proton transports within flexible amphiphilic polymer membranes.« less

  5. Bayesian inversion of seismic and electromagnetic data for marine gas reservoir characterization using multi-chain Markov chain Monte Carlo sampling

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ren, Huiying; Ray, Jaideep; Hou, Zhangshuan

    In this study we developed an efficient Bayesian inversion framework for interpreting marine seismic amplitude versus angle (AVA) and controlled source electromagnetic (CSEM) data for marine reservoir characterization. The framework uses a multi-chain Markov-chain Monte Carlo (MCMC) sampler, which is a hybrid of DiffeRential Evolution Adaptive Metropolis (DREAM) and Adaptive Metropolis (AM) samplers. The inversion framework is tested by estimating reservoir-fluid saturations and porosity based on marine seismic and CSEM data. The multi-chain MCMC is scalable in terms of the number of chains, and is useful for computationally demanding Bayesian model calibration in scientific and engineering problems. As a demonstration,more » the approach is used to efficiently and accurately estimate the porosity and saturations in a representative layered synthetic reservoir. The results indicate that the seismic AVA and CSEM joint inversion provides better estimation of reservoir saturations than the seismic AVA-only inversion, especially for the parameters in deep layers. The performance of the inversion approach for various levels of noise in observational data was evaluated – reasonable estimates can be obtained with noise levels up to 25%. Sampling efficiency due to the use of multiple chains was also checked and was found to have almost linear scalability.« less

  6. Development of closed-loop supply chain network in terms of corporate social responsibility.

    PubMed

    Pedram, Ali; Pedram, Payam; Yusoff, Nukman Bin; Sorooshian, Shahryar

    2017-01-01

    Due to the rise in awareness of environmental issues and the depletion of virgin resources, many firms have attempted to increase the sustainability of their activities. One efficient way to elevate sustainability is the consideration of corporate social responsibility (CSR) by designing a closed loop supply chain (CLSC). This paper has developed a mathematical model to increase corporate social responsibility in terms of job creation. Moreover the model, in addition to increasing total CLSC profit, provides a range of strategic decision solutions for decision makers to select a best action plan for a CLSC. A proposed multi-objective mixed-integer linear programming (MILP) model was solved with non-dominated sorting genetic algorithm II (NSGA-II). Fuzzy set theory was employed to select the best compromise solution from the Pareto-optimal solutions. A numerical example was used to validate the potential application of the proposed model. The results highlight the effect of CSR in the design of CLSC.

  7. Development of closed–loop supply chain network in terms of corporate social responsibility

    PubMed Central

    Pedram, Payam; Yusoff, Nukman Bin; Sorooshian, Shahryar

    2017-01-01

    Due to the rise in awareness of environmental issues and the depletion of virgin resources, many firms have attempted to increase the sustainability of their activities. One efficient way to elevate sustainability is the consideration of corporate social responsibility (CSR) by designing a closed loop supply chain (CLSC). This paper has developed a mathematical model to increase corporate social responsibility in terms of job creation. Moreover the model, in addition to increasing total CLSC profit, provides a range of strategic decision solutions for decision makers to select a best action plan for a CLSC. A proposed multi-objective mixed-integer linear programming (MILP) model was solved with non-dominated sorting genetic algorithm II (NSGA-II). Fuzzy set theory was employed to select the best compromise solution from the Pareto-optimal solutions. A numerical example was used to validate the potential application of the proposed model. The results highlight the effect of CSR in the design of CLSC. PMID:28384250

  8. Synthesis, Crystal Structure, and Magnetic Properties of the Linear-Chain Cobalt Oxide Sr 5Pb 3CoO 12

    NASA Astrophysics Data System (ADS)

    Yamaura, K.; Huang, Q.; Takayama-Muromachi, E.

    2002-02-01

    The novel spin-chain cobalt oxide Sr5Pb3CoO12 [Poverline6×2m, a=10.1093(2) Å and c=3.562 51(9) Å at 295 K] is reported. A polycrystalline sample of the compound was studied by neutron diffraction (at 6 and 295 K) and magnetic susceptibility measurements (5 to 390 K). The cobalt oxide was found to be analogous to the copper oxide Sr5Pb3CuO12, which is comprised of magnetic-linear chains at an interchain distance of 10 Å. Although the cobalt oxide chains (μeff of 3.64 μB per Co) are substantially antiferromagnetic (θW=-38.8 K), neither low-dimensional magnetism nor long-range ordering has been found; a local-structure disorder in the chains might have an impact on the magnetism. This compound is highly electrically insulating.

  9. From bead to rod: Comparison of theories by measuring translational drag coefficients of micron-sized magnetic bead-chains in Stokes flow

    PubMed Central

    Lu, Chen; Zhao, Xiaodan; Kawamura, Ryo

    2017-01-01

    Frictional drag force on an object in Stokes flow follows a linear relationship with the velocity of translation and a translational drag coefficient. This drag coefficient is related to the size, shape, and orientation of the object. For rod-like objects, analytical solutions of the drag coefficients have been proposed based on three rough approximations of the rod geometry, namely the bead model, ellipsoid model, and cylinder model. These theories all agree that translational drag coefficients of rod-like objects are functions of the rod length and aspect ratio, but differ among one another on the correction factor terms in the equations. By tracking the displacement of the particles through stationary fluids of calibrated viscosity in magnetic tweezers setup, we experimentally measured the drag coefficients of micron-sized beads and their bead-chain formations with chain length of 2 to 27. We verified our methodology with analytical solutions of dimers of two touching beads, and compared our measured drag coefficient values of rod-like objects with theoretical calculations. Our comparison reveals several analytical solutions that used more appropriate approximation and derived formulae that agree with our measurement better. PMID:29145447

  10. Modeling AFM-induced PEVK extension and the reversible unfolding of Ig/FNIII domains in single and multiple titin molecules.

    PubMed Central

    Zhang, B; Evans, J S

    2001-01-01

    Molecular elasticity is associated with a select number of polypeptides and proteins, such as titin, Lustrin A, silk fibroin, and spider silk dragline protein. In the case of titin, the globular (Ig) and non-globular (PEVK) regions act as extensible springs under stretch; however, their unfolding behavior and force extension characteristics are different. Using our time-dependent macroscopic method for simulating AFM-induced titin Ig domain unfolding and refolding, we simulate the extension and relaxation of hypothetical titin chains containing Ig domains and a PEVK region. Two different models are explored: 1) a series-linked WLC expression that treats the PEVK region as a distinct entropic spring, and 2) a summation of N single WLC expressions that simulates the extension and release of a discrete number of parallel titin chains containing constant or variable amounts of PEVK. In addition to these simulations, we also modeled the extension of a hypothetical PEVK domain using a linear Hooke's spring model to account for "enthalpic" contributions to PEVK elasticity. We find that the modified WLC simulations feature chain length compensation, Ig domain unfolding/refolding, and force-extension behavior that more closely approximate AFM, laser tweezer, and immunolocalization experimental data. In addition, our simulations reveal the following: 1) PEVK extension overlaps with the onset of Ig domain unfolding, and 2) variations in PEVK content within a titin chain ensemble lead to elastic diversity within that ensemble. PMID:11159428

  11. Posttranslational Modification of HOIP Blocks Toll-Like Receptor 4-Mediated Linear-Ubiquitin-Chain Formation

    PubMed Central

    Bowman, James; Rodgers, Mary A.; Shi, Mude; Amatya, Rina; Hostager, Bruce; Iwai, Kazuhiro; Gao, Shou-Jiang

    2015-01-01

    ABSTRACT Linear ubiquitination is an atypical posttranslational modification catalyzed by the linear-ubiquitin-chain assembly complex (LUBAC), containing HOIP, HOIL-1L, and Sharpin. LUBAC facilitates NF-κB activation and inflammation upon receptor stimulation by ligating linear ubiquitin chains to critical signaling molecules. Indeed, linear-ubiquitination-dependent signaling is essential to prevent pyogenic bacterial infections that can lead to death. While linear ubiquitination is essential for intracellular receptor signaling upon microbial infection, this response must be measured and stopped to avoid tissue damage and autoimmunity. While LUBAC is activated upon bacterial stimulation, the mechanisms regulating LUBAC activity in response to bacterial stimuli have remained elusive. We demonstrate that LUBAC activity itself is downregulated through ubiquitination, specifically, ubiquitination of the catalytic subunit HOIP at the carboxyl-terminal lysine 1056. Ubiquitination of Lys1056 dynamically altered HOIP conformation, resulting in the suppression of its catalytic activity. Consequently, HOIP Lys1056-to-Arg mutation led not only to persistent LUBAC activity but also to prolonged NF-κB activation induced by bacterial lipopolysaccharide-mediated Toll-like receptor 4 (TLR4) stimulation, whereas it showed no effect on NF-κB activation induced by CD40 stimulation. This study describes a novel posttranslational regulation of LUBAC-mediated linear ubiquitination that is critical for specifically directing TLR4-mediated NF-κB activation. PMID:26578682

  12. An approach to simultaneous control of trajectory and interaction forces in dual-arm configurations

    NASA Technical Reports Server (NTRS)

    Yun, Xiaoping; Kumar, Vijay R.

    1991-01-01

    An approach to the control of constrained dynamic systems such as multiple arm systems, multifingered grippers, and walking vehicles is described. The basic philosophy is to utilize a minimal set of inputs to control the trajectory and the surplus input to control the constraint or interaction forces and moments in the closed chain. A dynamic control model for the closed chain is derived that is suitable for designing a controller in which the trajectory and the interaction forces and moments are explicitly controlled. Nonlinear feedback techniques derived from differential geometry are then applied to linearize and decouple the nonlinear model. These ideas are illustrated through a planar example in which two arms are used for cooperative manipulation. Results from a simulation are used to illustrate the efficacy of the method.

  13. An ab initio time-dependent Hartree Fock study of solvent effects on the polarizability and second hyperpolarizability of polyacetylene chains within the polarizable continuum model

    NASA Astrophysics Data System (ADS)

    Champagne, Benoı̂t; Mennucci, Benedetta; Cossi, Maurizio; Cammi, Roberto; Tomasi, Jacopo

    1998-11-01

    The solvent effects upon the longitudinal polarizability ( αL) and second hyperpolarizability ( γL) of small all-trans polyacetylene (PA) chains ranging from C 2H 4 to C 10H 12 have been evaluated at the time-dependent Hartree-Fock (TDHF) level within the framework of the polarizable continuum model. The solvent effects, which correspond to the solvent-induced modifications of the solute properties, result in large increases of the linear and nonlinear responses even for solvents with low dielectric constants. When the dielectric constant is increased, the αL values tend to saturate at values 30%-40% larger than in vacuo, whereas for γL it ranges from 100% to 400% depending upon the nonlinear optical process and the length of the PA chain. These solvent-induced αL and γL enhancements can partially be accounted for by the corresponding decrease of the energy of the lowest optically-allowed electronic excitation. The geometrical parameters of the ground state of the PA chains are almost unaffected by the solvent. This shows that the solvent effects are mainly of electronic nature. In addition, the local field factors, which relate the macroscopic or Maxwell field to the field experienced by the solute, tend towards unity with increasing chain length for the longitudinal PA axis.

  14. Chained versus Post-Stratification Equating in a Linear Context: An Evaluation Using Empirical Data. Research Report. ETS RR-10-06

    ERIC Educational Resources Information Center

    Puhan, Gautam

    2010-01-01

    This study used real data to construct testing conditions for comparing results of chained linear, Tucker, and Levine-observed score equatings. The comparisons were made under conditions where the new- and old-form samples were similar in ability and when they differed in ability. The length of the anchor test was also varied to enable examination…

  15. Structure of the conversion laws in quantum integrable spin chains with short range interactions

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Grabowski, M.P.; Mathieu, P.

    1995-11-01

    The authors present a detailed analysis of the structure of the conservation laws in quantum integrable chains of the XYZ-type and in the Hubbard model. The essential tool for the former class of models is the boost operator, which provides a recursive way of calculating the integrals of motion. With its help, they establish the general form of the XYZ conserved charges in terms of simple polynomials in spin variables and derive recursion relations for the relative coefficients of these polynomials. Although these relations are difficult to solve in general, a subset of the coefficients can be determined. Moreover, formore » two submodels of the XYZ chain, namely the XXX and XY cases, all the charges can be calculated in closed form. Using this approach, the authors rederive the known expressions for the XY charges in a novel way. For the XXX case. a simple description of conserved charges is found in terms of a Catalan tree. This construction is generalized for the su(M) invariant integrable chain. They also investigate the circumstances permitting the existence of a recursive (ladder) operator in general quantum integrable systems. They indicate that a quantum ladder operator can be traced back to the presence of a Hamiltonian mastersymmetry of degree one in the classical continuous version of the model. In this way, quantum chains endowed with a recursive structure can be identified from the properties of their classical relatives. The authors also show that in the quantum continuous limits of the XYZ model, the ladder property of the boost operator disappears. For the Hubbard model they demonstrate the nonexistence of a ladder operator. Nevertheless, the general structure of the conserved charges is indicated, and the expression for the terms linear in the model`s free parameter for all charges is derived in closed form. 62 refs., 4 figs.« less

  16. Bayesian reconstruction of projection reconstruction NMR (PR-NMR).

    PubMed

    Yoon, Ji Won

    2014-11-01

    Projection reconstruction nuclear magnetic resonance (PR-NMR) is a technique for generating multidimensional NMR spectra. A small number of projections from lower-dimensional NMR spectra are used to reconstruct the multidimensional NMR spectra. In our previous work, it was shown that multidimensional NMR spectra are efficiently reconstructed using peak-by-peak based reversible jump Markov chain Monte Carlo (RJMCMC) algorithm. We propose an extended and generalized RJMCMC algorithm replacing a simple linear model with a linear mixed model to reconstruct close NMR spectra into true spectra. This statistical method generates samples in a Bayesian scheme. Our proposed algorithm is tested on a set of six projections derived from the three-dimensional 700 MHz HNCO spectrum of a protein HasA. Copyright © 2014 Elsevier Ltd. All rights reserved.

  17. A Bayes linear Bayes method for estimation of correlated event rates.

    PubMed

    Quigley, John; Wilson, Kevin J; Walls, Lesley; Bedford, Tim

    2013-12-01

    Typically, full Bayesian estimation of correlated event rates can be computationally challenging since estimators are intractable. When estimation of event rates represents one activity within a larger modeling process, there is an incentive to develop more efficient inference than provided by a full Bayesian model. We develop a new subjective inference method for correlated event rates based on a Bayes linear Bayes model under the assumption that events are generated from a homogeneous Poisson process. To reduce the elicitation burden we introduce homogenization factors to the model and, as an alternative to a subjective prior, an empirical method using the method of moments is developed. Inference under the new method is compared against estimates obtained under a full Bayesian model, which takes a multivariate gamma prior, where the predictive and posterior distributions are derived in terms of well-known functions. The mathematical properties of both models are presented. A simulation study shows that the Bayes linear Bayes inference method and the full Bayesian model provide equally reliable estimates. An illustrative example, motivated by a problem of estimating correlated event rates across different users in a simple supply chain, shows how ignoring the correlation leads to biased estimation of event rates. © 2013 Society for Risk Analysis.

  18. Adequacy of Si:P chains as Fermi-Hubbard simulators

    NASA Astrophysics Data System (ADS)

    Dusko, Amintor; Delgado, Alain; Saraiva, André; Koiller, Belita

    2018-01-01

    The challenge of simulating many-body models with analogue physical systems requires both experimental precision and very low operational temperatures. Atomically precise placement of dopants in Si permits the construction of nanowires by design. We investigate the suitability of these interacting electron systems as simulators of a fermionic extended Hubbard model on demand. We describe the single-particle wavefunctions as a linear combination of dopant orbitals (LCDO). The electronic states are calculated within configuration interaction (CI). Due to the peculiar oscillatory behavior of each basis orbital, properties of these chains are strongly affected by the interdonor distance R0, in a non-monotonic way. Ground state (T = 0 K) properties such as charge and spin correlations are shown to remain robust under temperatures up to 4 K for specific values of R0. The robustness of the model against disorder is also tested, allowing some fluctuation of the placement site around the target position. We suggest that finite donor chains in Si may serve as an analog simulator for strongly correlated model Hamiltonians. This simulator is, in many ways, complementary to those based on cold atoms in optical lattices—the trade-off between the tunability achievable in the latter and the survival of correlation at higher operation temperatures for the former suggests that both technologies are applicable for different regimes.

  19. Bayesian inversion of seismic and electromagnetic data for marine gas reservoir characterization using multi-chain Markov chain Monte Carlo sampling

    DOE PAGES

    Ren, Huiying; Ray, Jaideep; Hou, Zhangshuan; ...

    2017-10-17

    In this paper we developed an efficient Bayesian inversion framework for interpreting marine seismic Amplitude Versus Angle and Controlled-Source Electromagnetic data for marine reservoir characterization. The framework uses a multi-chain Markov-chain Monte Carlo sampler, which is a hybrid of DiffeRential Evolution Adaptive Metropolis and Adaptive Metropolis samplers. The inversion framework is tested by estimating reservoir-fluid saturations and porosity based on marine seismic and Controlled-Source Electromagnetic data. The multi-chain Markov-chain Monte Carlo is scalable in terms of the number of chains, and is useful for computationally demanding Bayesian model calibration in scientific and engineering problems. As a demonstration, the approach ismore » used to efficiently and accurately estimate the porosity and saturations in a representative layered synthetic reservoir. The results indicate that the seismic Amplitude Versus Angle and Controlled-Source Electromagnetic joint inversion provides better estimation of reservoir saturations than the seismic Amplitude Versus Angle only inversion, especially for the parameters in deep layers. The performance of the inversion approach for various levels of noise in observational data was evaluated — reasonable estimates can be obtained with noise levels up to 25%. Sampling efficiency due to the use of multiple chains was also checked and was found to have almost linear scalability.« less

  20. Bayesian inversion of seismic and electromagnetic data for marine gas reservoir characterization using multi-chain Markov chain Monte Carlo sampling

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ren, Huiying; Ray, Jaideep; Hou, Zhangshuan

    In this paper we developed an efficient Bayesian inversion framework for interpreting marine seismic Amplitude Versus Angle and Controlled-Source Electromagnetic data for marine reservoir characterization. The framework uses a multi-chain Markov-chain Monte Carlo sampler, which is a hybrid of DiffeRential Evolution Adaptive Metropolis and Adaptive Metropolis samplers. The inversion framework is tested by estimating reservoir-fluid saturations and porosity based on marine seismic and Controlled-Source Electromagnetic data. The multi-chain Markov-chain Monte Carlo is scalable in terms of the number of chains, and is useful for computationally demanding Bayesian model calibration in scientific and engineering problems. As a demonstration, the approach ismore » used to efficiently and accurately estimate the porosity and saturations in a representative layered synthetic reservoir. The results indicate that the seismic Amplitude Versus Angle and Controlled-Source Electromagnetic joint inversion provides better estimation of reservoir saturations than the seismic Amplitude Versus Angle only inversion, especially for the parameters in deep layers. The performance of the inversion approach for various levels of noise in observational data was evaluated — reasonable estimates can be obtained with noise levels up to 25%. Sampling efficiency due to the use of multiple chains was also checked and was found to have almost linear scalability.« less

  1. Cuticular hydrocarbons as a tool for the identification of insect species: Puparial cases from Sarcophagidae

    PubMed Central

    Braga, Marina Vianna; Pinto, Zeneida Teixeira; de Carvalho Queiroz, Margareth Maria; Matsumoto, Nana; Blomquist, Gary James

    2013-01-01

    The external surface of all insects is covered by a species-specific complex mixture of highly stable, very long chain cuticular hydrocarbons (CHCs). Gas chromatography coupled to mass spectrometry was used to identify CHCs from four species of Sarcophagidae, Peckia (Peckia) chrysostoma, Peckia (Pattonella) intermutans, Sarcophaga (Liopygia) ruficornis and Sarcodexia lambens. The identified CHCs were mostly a mixture of n-alkanes, monomethylalkanes and dimethylalkanes with linear chain lengths varying from 23 to 33 carbons. Only two alkenes were found in all four species. S. lambens had a composition of CHCs with linear chain lengths varying from C23 to C33, while the other three species linear chain lengths from 24 to 31 carbons. n-Heptacosane, n-nonacosane and 3-methylnonacosane, n-triacontane and n-hentriacontane occurred in all four species. The results show that these hydrocarbon profiles may be used for the taxonomic differentiation of insect species and are a useful additional tool for taxonomic classification, especially when only parts of the insect specimen are available. PMID:23932943

  2. Biodiesel production from triolein and short chain alcohols through biocatalysis.

    PubMed

    Salis, Andrea; Pinna, Marcella; Monduzzi, Maura; Solinas, Vincenzo

    2005-09-29

    Oleic acid alkyl esters (biodiesel) were synthesised by biocatalysis in solvent-free conditions. Different commercial immobilised lipases, namely Candida antarctica B, Rizhomucor miehei, and Pseudomonas cepacia, were tested towards the reaction between triolein and butanol to produce butyl oleate. Pseudomonas cepacia lipase resulted to be the most active enzyme reaching 100% of conversion after 6h. Different operative conditions such as reaction temperature, water activity, and reagent stoichiometric ratio were investigated and optimised. These conditions were then used to investigate the effect of linear and branched short chain alcohols. Methanol and 2-butanol were the worst alcohols: the former, probably, due to its low miscibility with the oil and the latter because secondary alcohols usually are less reactive than primary alcohols. Conversely, linear and branched primary alcohols with short alkyl chains (C(2)--C(4)) showed high reaction rate and conversion. A mixture of linear and branched short chain alcohols that mimics the residual of ethanol distillation (fusel oil) was successfully used for oleic acid ester synthesis. These compounds are important in biodiesel mixtures since they improve low temperature properties.

  3. Molecular Simulation Evaluation of Macromolecular Transport through Nanofiltration Membranes

    NASA Astrophysics Data System (ADS)

    Almodovar Arbelo, Noelia; Boudouris, Bryan; Corti, David

    A hybrid Monte Carlo and Molecular Dynamics simulation technique was implemented to elucidate the equilibrium behavior and transport properties of a model macromolecule as it navigated across a nanoporous polymer thin film (i.e., a nanofiltration membrane). The model linear homopolymer chosen was one that had interactions that were representative of poly(ethylene oxide) (PEO) due to the known interactions of PEO with solution molecules when a PEO chain is dissolved in an aqueous environment. The structural rearrangements of the PEO chain as it passes through the nanopore under an imposed chemical potential gradient was quantified as a function of solvent quality, polymer chain length, nanopore diameter and shape, and PEO-nanopore wall interactions. Thus, these computational studies provide a more detailed picture of the underlying physical mechanisms that drive macromolecular transport through nanopores, and, in particular, how dimensionally-large macromolecules (i.e., with large radii of gyration) enter and move through dimensionally-small pores (i.e., small radii nanopores). The insights gained from these studies will aid in the development of more cost-effective water purification systems in separation technologies for myriad industrial applications.

  4. High sensitivity of positrons to oxygen vacancies and to copper-oxygen chain disorder in YBa2Cu3O(7-x)

    NASA Astrophysics Data System (ADS)

    von Stetten, E. C.; Berko, S.; Li, X. S.; Lee, R. R.; Brynestad, J.

    1988-05-01

    Temperature-dependent positron-electron momentum densities have been studied by two-dimensional angular correlation of annihilation radiation from 10 to 320 K in YBa2Cu3O(7-x) samples. The positron ground-state charge density, computed by the linearized augmented-plane-wave method, indicates that in YBa2Cu3O7 delocalized positrons sample preferentially the linear copper-oxygen chains. Positron localization due to disorder in these chains is invoked to explain the striking differences observed between superconducting (x = about 0.02) and nonsuperconducting (x = about 0.70) samples.

  5. Spin-wave dynamics and exchange interactions in multiferroic NdFe3(BO3)4 explored by inelastic neutron scattering

    NASA Astrophysics Data System (ADS)

    Golosovsky, I. V.; Ovsyanikov, A. K.; Aristov, D. N.; Matveeva, P. G.; Mukhin, A. A.; Boehm, M.; Regnault, L.-P.; Bezmaternykh, L. N.

    2018-04-01

    Magnetic excitations and exchange interactions in multiferroic NdFe3(BO3)4 were studied by inelastic neutron scattering in the phase with commensurate antiferromagnetic structure. The observed spectra were analyzed in the frame of the linear spin-wave theory. It was shown that only the model, which includes the exchange interactions within eight coordination spheres, describes satisfactorily all observed dispersion curves. The calculation showed that the spin-wave dynamics is governed by the strongest antiferromagnetic intra-chain interaction and three almost the same inter-chain interactions. Other interactions, including ferromagnetic exchange, appeared to be insignificant. The overall energy balance of the antiferromagnetic inter-chain exchange interactions, which couple the moments from the adjacent ferromagnetic layers as well as within a layer, stabilizes ferromagnetic arrangement in the latter. It demonstrates that the pathway geometry plays a crucial role in forming of the magnetic structure.

  6. Conformational stability and thermodynamic characterization of the lipoic acid bearing domain of human mitochondrial branched chain α-ketoacid dehydrogenase

    PubMed Central

    Naik, Mandar T.; Huang, Tai-Huang

    2004-01-01

    The lipoic acid bearing domain (hbLBD) of human mitochondrial branched chain α-ketoacid dehydrogenase (BCKD) plays important role of substrate channeling in oxidative decarboxylation of the branched chain α-ketoacids. Recently hbLBD has been found to follow two-step folding mechanism without detectable presence of stable or kinetic intermediates. The present study describes the conformational stability underlying the folding of this small β-barrel domain. Thermal denaturation in presence of urea and isothermal urea denaturation titrations are used to evaluate various thermodynamic parameters defining the equilibrium unfolding. The linear extrapolation model successfully describes the two-step; native state ↔denatured state unfolding transition of hbLBD. The average temperature of maximum stability of hbLBD is estimated as 295.6 ± 0.9 K. Cold denaturation of hbLBD is also predicted and discussed. PMID:15322287

  7. Magnetic-field control of electric polarization in coupled spin chains with three-site interactions

    NASA Astrophysics Data System (ADS)

    Sznajd, Jozef

    2018-06-01

    The linear perturbation renormalization group (LPRG) is used to study coupled X Y chains with Dzyaloshinskii-Moriya (DM) and three-spin interactions in a magnetic field. Starting with a minimal model exhibiting the magnetoelectric effect, a spin-1/2 X Y chain with nearest, next-nearest (J2x) , and DM (D1y) interactions in a magnetic field, the recursion relations for all effective interactions generated by the LPRG transformation are found. The evaluation of these relations allows us to analyze, among others, the influence of J2x,D1y , three-spin (SixSi+1 ySi+2 z-SiySi+1 xSi+2 z ), and interchain interactions on the thermodynamic properties. The field and temperature dependences of the polarization, specific heat, and correlation functions are found. It is shown that an interchain coupling triggers a phase transition indicated by the divergence of the renormalized coupling parameters.

  8. Information content of the space-frequency filtering of blood plasma layers laser images in the diagnosis of pathological changes

    NASA Astrophysics Data System (ADS)

    Ushenko, A. G.; Boychuk, T. M.; Mincer, O. P.; Bodnar, G. B.; Kushnerick, L. Ya.; Savich, V. O.

    2013-12-01

    The bases of method of the space-frequency of the filtering phase allocation of blood plasma pellicle are given here. The model of the optical-anisotropic properties of the albumen chain of blood plasma pellicle with regard to linear and circular double refraction of albumen and globulin crystals is proposed. Comparative researches of the effectiveness of methods of the direct polarized mapping of the azimuth images of blood plasma pcllicle layers and space-frequency polarimetry of the laser radiation transformed by divaricate and holelikc optical-anisotropic chains of blood plasma pellicles were held. On the basis of the complex statistic, correlative and fracta.1 analysis of the filtered frcquencydimensional polarizing azimuth maps of the blood plasma pellicles structure a set of criteria of the change of the double refraction of the albumen chains caused by the prostate cancer was traced and proved.

  9. Effect of Molecular Architecture on Polymer Melt Surface Dynamics

    NASA Astrophysics Data System (ADS)

    Foster, Mark

    The dynamics of the thermally stimulated surface height fluctuations in a polymer melt dictate wetting, adhesion, and tribology at that surface. These surface fluctuations can be profoundly altered by tethering of the chains. One type of tethering is the tethering of one part of a molecule to another part of the same molecule. This tethering is found in both long chain branched polymers and in macrocycles. We have studied the surface fluctuations with X-ray Photon Correlation Spectroscopy for melts of well-defined, anionically polymerized polystyrenes of various architectures, including linear, 6 arm star, pom-pom, comb and cyclic architectures. For linear chains, the variation of surface relaxation time with in-plane scattering vector can be fit using a hydrodynamic continuum theory (HCT) of thermally stimulated capillary waves that knows nothing of the chain architecture. Assuming the theory is applicable, apparent viscosities of the films may then be inferred from the XPCS data. For unentangled linear chains, the viscosity inferred from XPCS data in this manner is the same as that measured by conventional bulk rheometry. The HCT does a reasonable job of describing the variation of relaxation time with scattering vector for long branched chains also, but only if a viscosity much larger than that of the bulk is assumed. The discrepancy between the viscosity inferred from surface relaxation times using the HCT and that derived from conventional rheometry grows larger as the bulk Tg is approached and is different for each long chain branched architecture. However, for densely branched combs and cyclic chains different behaviors are found. Acknowledgement: Thanks to NSF (CBET 0730692) and the Advanced Photon Source, supported by the U.S. Department of Energy, Office of Science, Office of Basic Energy Science, under Contract No. W-31-109-ENG-38.

  10. Searching for a 4 α linear-chain structure in excited states of 16O with covariant density functional theory

    NASA Astrophysics Data System (ADS)

    Yao, J. M.; Itagaki, N.; Meng, J.

    2014-11-01

    A study of the 4 α linear-chain structure in high-lying collective excitation states of 16O with covariant density functional theory is presented. The low-spin states are obtained by configuration mixing of particle-number and angular-momentum projected quadrupole deformed mean-field states with the generator coordinate method. The high-spin states are determined by cranking calculations. These two calculations are based on the same energy density functional PC-PK1. We have found a rotational band at low spin with the dominant intrinsic configuration considered to be the one whereby 4 α clusters stay along a common axis. The strongly deformed rod shape also appears in the high-spin region with the angular momentum 13 ℏ to18 ℏ ; however, whether the state is a pure 4 α linear chain is less obvious than for the low-spin states.

  11. The Linear ubiquitin chain assembly complex acts as a liver tumor suppressor and inhibits hepatocyte apoptosis and hepatitis.

    PubMed

    Shimizu, Yutaka; Peltzer, Nieves; Sevko, Alexandra; Lafont, Elodie; Sarr, Aida; Draberova, Helena; Walczak, Henning

    2017-06-01

    Linear ubiquitination is a key posttranslational modification that regulates immune signaling and cell death pathways, notably tumor necrosis factor receptor 1 (TNFR1) signaling. The only known enzyme complex capable of forming linear ubiquitin chains under native conditions to date is the linear ubiquitin chain assembly complex, of which the catalytic core component is heme-oxidized iron regulatory protein 2 ubiquitin ligase-1-interacting protein (HOIP). To understand the underlying mechanisms of maintenance of liver homeostasis and the role of linear ubiquitination specifically in liver parenchymal cells, we investigated the physiological role of HOIP in the liver parenchyma. To do so, we created mice harboring liver parenchymal cell-specific deletion of HOIP (Hoip Δhep mice) by crossing Hoip-floxed mice with albumin-Cre mice. HOIP deficiency in liver parenchymal cells triggered tumorigenesis at 18 months of age preceded by spontaneous hepatocyte apoptosis and liver inflammation within the first month of life. In line with the emergence of inflammation, Hoip Δhep mice displayed enhanced liver regeneration and DNA damage. In addition, consistent with increased apoptosis, HOIP-deficient hepatocytes showed enhanced caspase activation and endogenous formation of a death-inducing signaling complex which activated caspase-8. Unexpectedly, exacerbated caspase activation and apoptosis were not dependent on TNFR1, whereas ensuing liver inflammation and tumorigenesis were promoted by TNFR1 signaling. The linear ubiquitin chain assembly complex serves as a previously undescribed tumor suppressor in the liver, restraining TNFR1-independent apoptosis in hepatocytes which, in its absence, is causative of TNFR1-mediated inflammation, resulting in hepatocarcinogenesis. (Hepatology 2017;65:1963-1978). © 2017 The Authors. Hepatology published by Wiley Periodicals, Inc., on behalf of the American Association for the Study of Liver Diseases.

  12. Do nursing home chain size and proprietary status affect experiences with care?

    PubMed Central

    You, Kai; Li, Yue; Intrator, Orna; Stevenson, David; Hirth, Richard; Grabowski, David; Banaszak-Holl, Jane

    2015-01-01

    Background In 2012, over half of nursing homes were operated by corporate chains. Facilities owned by the largest for-profit chains were reported to have lower quality of care. However, it is unknown how nursing home chain ownerships are related with experiences of care. Objectives To study the relationship between nursing home chain characteristics (chain size and profit status) with patients' family member reported ratings on experiences with care. Data Sources and Study Design Maryland nursing home care experience reports, the Online Survey, Certification, And Reporting (OSCAR) files, and Area Resource Files are used. Our sample consists of all non-governmental nursing homes in Maryland from 2007 to 2010. Consumer ratings were reported for: overall care; recommendation of the facility; staff performance; care provided; food and meals; physical environment; and autonomy and personal rights. We identified chain characteristics from OSCAR, and estimated multivariate random effect linear models to test the effects of chain ownership on care experience ratings. Results Independent nonprofit nursing homes have the highest overall rating score of 8.9, followed by 8.6 for facilities in small nonprofit chains, and 8.5 for independent for-profit facilities. Facilities in small, medium and large for-profit chains have even lower overall ratings of 8.2, 7.9, and 8.0, respectively. We find similar patterns of differences in terms of recommendation rate, and important areas such as staff communication and quality of care. Conclusions Evidence suggests that Maryland nursing homes affiliated with large- and medium- for-profit chains had lower ratings of family reported experience with care. PMID:26765147

  13. Epitope mapping of the alpha-chain of the insulin-like growth factor I receptor using antipeptide antibodies.

    PubMed

    Delafontaine, P; Ku, L; Ververis, J J; Cohen, C; Runge, M S; Alexander, R W

    1994-12-01

    Insulin-like growth factor I (IGF I) is an important mitogen for vascular smooth muscle cells (VSMC). The IGF I receptor (IGF IR) is a heterotetramer composed of two cross-linked extracellular alpha-chains and two membrane-spanning beta-chains that contain a tyrosine-kinase domain. It has a high degree of sequence similarity to the insulin receptor (IR), and the putative ligand-specific binding site has been localized to a cysteine-rich region (CRR) of the alpha-chain. To obtain insights into antigenic determinants of the IGF IR, we raised a panel of site-specific polyclonal antibodies against short peptide sequences N-terminal to and within the CRR. Several antibodies raised against linear epitopes within the CRR bound to solubilized and native rat and human IGF IR by ELISA, did not cross-react with IR, but unexpectedly failed to inhibit 125I-IGF I binding. A polyclonal antibody directed against a 48-amino acid synthetic peptide, corresponding to a region of the CRR postulated to be essential for ligand binding, failed to react with either solubilized, reduced or intact IGF IR. Three antibodies specific for the N-terminus of the alpha-chain reacted with solubilized and native IGF IR. One of these, RAB 6, directed against amino acids 38-44 of the IGF IR, inhibited 125I-IGF I binding to rat aortic smooth muscle cells (RASM) and to IGF IR/3T3 cells (overexpressing human IGF IR) by up to 45%. Immunohistochemical analysis revealed strong IGF IR staining in the medial smooth muscle cell layer of rat aorta. These findings are consistent with a model wherein conformational epitopes within the CRR and linear epitopes within the N-terminus of the alpha-chain contribute to the IGF I binding pocket. These antibodies should provide a valuable tool to study structure-function relationships and in vivo regulation of the IGF IR.

  14. On the thermodynamic and kinetic investigations of a [c2]daisy chain polymer

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hmadeh, Mohamad; Fang, Lei; Trabolsi, Ali

    2010-01-01

    We report a variety of [c2]daisy chain molecules which undergo quantitative, efficient, and fully reversible molecular movements upon the addition of base/acid in organic solvents. Such externally triggered molecular movements can induce the contraction and extension of the [c2]daisy chain molecule as a whole. A linear polymer of such a bistable [c2]daisy chain exerts similar types of movements and can be looked upon as a candidate for the development of artificial muscles. The spectrophotometric investigations of both the monomeric and polymeric bistable [c2]daisy chains, as well as the corresponding model compounds, were performed in MeCN at room temperature, in ordermore » to obtain the thermodynamic parameters for these mechanically interlocked molecules. Based on their spectrophotometric and thermodynamic characteristics, kinetic analysis of the acid/base-induced contraction and extension of the [c2]daisy chain monomer and polymer were conducted by employing a stopped-flow technique. These kinetic data suggest that the rates of contraction and extension for these [c2]daisy chain molecules are determined by the thermodynamic stabilities of the corresponding kinetic intermediates. Faster switching rates for both the contraction and extension processes of the polymeric [c2]daisy chain were observed when compared to those of its monomeric counterpart. These kinetic and thermodynamic investigations on [c2]daisy chain-based muscle-like compounds provide important information for those seeking an understanding of the mechanisms of actuation in mechanically interlocked macromolecules.« less

  15. Stretching of a polymer chain anchored to a surface: the massive field theory approach

    NASA Astrophysics Data System (ADS)

    Usatenko, Zoryana

    2014-09-01

    Taking into account the well-known correspondence between the field theoretical φ4 O(n)-vector model in the limit n → 0 and the behaviour of long-flexible polymer chains, the investigation of stretching of an ideal and a real polymer chain with excluded volume interactions in a good solvent anchored to repulsive and inert surfaces is performed. The calculations of the average stretching force which arises when the free end of a polymer chain moves away from a repulsive or inert surface are performed up to one-loop order of the massive field theory approach in fixed space dimensions d = 3. The analysis of the obtained results indicates that the average stretching force for a real polymer chain anchored to a repulsive surface demonstrates different behaviour for the cases \\tilde{z}\\ll1 and \\tilde{z}\\gg1 , where \\tilde{z}=z^\\prime/Rz . Besides, the results obtained in the framework of the massive field theory approach are in good agreement with previous theoretical results for an ideal polymer chain and results of a density functional theory approach for the region of small applied forces when deformation of a polymer chain in the direction of the applied force is not bigger than the linear extension of a polymer chain in this direction. The better agreement between these two methods is observed in the case where the number of monomers increases and the polymer chain becomes longer.

  16. Cometary Nuclei and Tidal Disruption: The Geologic Record of Crater Chains on Callisto and Ganymede

    NASA Technical Reports Server (NTRS)

    Schenk, Paul M.; Asphaug, Erik; McKinnon, William B.; Melosh, H. J.; Weissman, Paul R.

    1996-01-01

    Prominent crater chains on Ganymede and Callisto are most likely the impact scars of comets tidally disrupted by Jupiter and are not secondary crater chains. We have examined the morphology of these chains in detail in order to place constraints on the properties of the comets that formed them and the disruption process. In these chains, intercrater spacing varies by no more than a factor of 2 and the craters within a given chain show almost no deviation from linearity (although the chains themselves are on gently curved small circles). All of these crater chains occur on or very near the Jupiter-facing hemisphere. For a given chain, the estimated masses of the fragments that formed each crater vary by no more than an order of magnitude. The mean fragment masses for all the chains vary by over four orders of magnitude (W. B. McKinnon and P. M. Schenk 1995, Geophys. Res. Lett. 13, 1829-1832), however. The mass of the parent comet for each crater chain is not correlated with the number of fragments produced during disruption but is correlated with the mean mass of the fragments produced in a given disruption event. Also, the larger fragments are located near the center of each chain. All of these characteristics are consistent with those predicted by disruption simulations based on the rubble pile cometary nucleus model (in which nuclei are composed on numerous small fragments weakly bound by self-gravity), and with those observed in Comet D/Shoemaker-Levy 9. Similar crater chains have not been found on the other icy satellites, but the impact record of disrupted comets on Callisto and Ganymede indicates that disruption events occur within the Jupiter system roughly once every 200 to 400 years.

  17. About Block Dynamic Model of Earthquake Source.

    NASA Astrophysics Data System (ADS)

    Gusev, G. A.; Gufeld, I. L.

    One may state the absence of a progress in the earthquake prediction papers. The short-term prediction (diurnal period, localisation being also predicted) has practical meaning. Failure is due to the absence of the adequate notions about geological medium, particularly, its block structure and especially in the faults. Geological and geophysical monitoring gives the basis for the notion about geological medium as open block dissipative system with limit energy saturation. The variations of the volume stressed state close to critical states are associated with the interaction of the inhomogeneous ascending stream of light gases (helium and hydrogen) with solid phase, which is more expressed in the faults. In the background state small blocks of the fault medium produce the sliding of great blocks in the faults. But for the considerable variations of ascending gas streams the formation of bound chains of small blocks is possible, so that bound state of great blocks may result (earthquake source). Recently using these notions we proposed a dynamical earthquake source model, based on the generalized chain of non-linear bound oscillators of Fermi-Pasta-Ulam type (FPU). The generalization concerns its in homogeneity and different external actions, imitating physical processes in the real source. Earlier weak inhomogeneous approximation without dissipation was considered. Last has permitted to study the FPU return (return to initial state). Probabilistic properties in quasi periodic movement were found. The chain decay problem due to non-linearity and external perturbations was posed. The thresholds and dependence of life- time of the chain are studied. The great fluctuations of life-times are discovered. In the present paper the rigorous consideration of the inhomogeneous chain including the dissipation is considered. For the strong dissipation case, when the oscillation movements are suppressed, specific effects are discovered. For noise action and constantly arising deformation the dependence of life-time on noise amplitude is investigated. Also for the initial shock we have chosen the amplitudes, when it determined the life-time, as principal cause. For this case it appeared, that life-time had non-monotonous dependence on the noise amplitude ("temperature"). There was the domain of the "temperatures", where the life-time reached a maximum. The comparison of different dissipation intensities was performed.

  18. Contribution to the modelling and analysis of logistics system performance by Petri nets and simulation models: Application in a supply chain

    NASA Astrophysics Data System (ADS)

    Azougagh, Yassine; Benhida, Khalid; Elfezazi, Said

    2016-02-01

    In this paper, the focus is on studying the performance of complex systems in a supply chain context by developing a structured modelling approach based on the methodology ASDI (Analysis, Specification, Design and Implementation) by combining the modelling by Petri nets and simulation using ARENA. The linear approach typically followed in conducting of this kind of problems has to cope with a difficulty of modelling due to the complexity and the number of parameters of concern. Therefore, the approach used in this work is able to structure modelling a way to cover all aspects of the performance study. The modelling structured approach is first introduced before being applied to the case of an industrial system in the field of phosphate. Results of the performance indicators obtained from the models developed, permitted to test the behaviour and fluctuations of this system and to develop improved models of the current situation. In addition, in this paper, it was shown how Arena software can be adopted to simulate complex systems effectively. The method in this research can be applied to investigate various improvements scenarios and their consequences before implementing them in reality.

  19. Non-Linear Dynamics of Saturn’s Rings

    NASA Astrophysics Data System (ADS)

    Esposito, Larry W.

    2015-11-01

    Non-linear processes can explain why Saturn’s rings are so active and dynamic. Ring systems differ from simple linear systems in two significant ways: 1. They are systems of granular material: where particle-to-particle collisions dominate; thus a kinetic, not a fluid description needed. We find that stresses are strikingly inhomogeneous and fluctuations are large compared to equilibrium. 2. They are strongly forced by resonances: which drive a non-linear response, pushing the system across thresholds that lead to persistent states.Some of this non-linearity is captured in a simple Predator-Prey Model: Periodic forcing from the moon causes streamline crowding; This damps the relative velocity, and allows aggregates to grow. About a quarter phase later, the aggregates stir the system to higher relative velocity and the limit cycle repeats each orbit.Summary of Halo Results: A predator-prey model for ring dynamics produces transient structures like ‘straw’ that can explain the halo structure and spectroscopy: This requires energetic collisions (v ≈ 10m/sec, with throw distances about 200km, implying objects of scale R ≈ 20km).Transform to Duffing Eqn : With the coordinate transformation, z = M2/3, the Predator-Prey equations can be combined to form a single second-order differential equation with harmonic resonance forcing.Ring dynamics and history implications: Moon-triggered clumping at perturbed regions in Saturn’s rings creates both high velocity dispersion and large aggregates at these distances, explaining both small and large particles observed there. We calculate the stationary size distribution using a cell-to-cell mapping procedure that converts the phase-plane trajectories to a Markov chain. Approximating the Markov chain as an asymmetric random walk with reflecting boundaries allows us to determine the power law index from results of numerical simulations in the tidal environment surrounding Saturn. Aggregates can explain many dynamic aspects of the rings and can renew rings by shielding and recycling the material within them, depending on how long the mass is sequestered. We can ask: Are Saturn’s rings a chaotic non-linear driven system?

  20. A computer program for uncertainty analysis integrating regression and Bayesian methods

    USGS Publications Warehouse

    Lu, Dan; Ye, Ming; Hill, Mary C.; Poeter, Eileen P.; Curtis, Gary

    2014-01-01

    This work develops a new functionality in UCODE_2014 to evaluate Bayesian credible intervals using the Markov Chain Monte Carlo (MCMC) method. The MCMC capability in UCODE_2014 is based on the FORTRAN version of the differential evolution adaptive Metropolis (DREAM) algorithm of Vrugt et al. (2009), which estimates the posterior probability density function of model parameters in high-dimensional and multimodal sampling problems. The UCODE MCMC capability provides eleven prior probability distributions and three ways to initialize the sampling process. It evaluates parametric and predictive uncertainties and it has parallel computing capability based on multiple chains to accelerate the sampling process. This paper tests and demonstrates the MCMC capability using a 10-dimensional multimodal mathematical function, a 100-dimensional Gaussian function, and a groundwater reactive transport model. The use of the MCMC capability is made straightforward and flexible by adopting the JUPITER API protocol. With the new MCMC capability, UCODE_2014 can be used to calculate three types of uncertainty intervals, which all can account for prior information: (1) linear confidence intervals which require linearity and Gaussian error assumptions and typically 10s–100s of highly parallelizable model runs after optimization, (2) nonlinear confidence intervals which require a smooth objective function surface and Gaussian observation error assumptions and typically 100s–1,000s of partially parallelizable model runs after optimization, and (3) MCMC Bayesian credible intervals which require few assumptions and commonly 10,000s–100,000s or more partially parallelizable model runs. Ready access allows users to select methods best suited to their work, and to compare methods in many circumstances.

  1. Degradation of 4-n-nonylphenol under nitrate reducing conditions

    PubMed Central

    Viñas, Marc; Grotenhuis, Tim; Rijnaarts, Huub H. M.; Langenhoff, Alette A. M.

    2010-01-01

    Nonylphenol (NP) is an endocrine disruptor present as a pollutant in river sediment. Biodegradation of NP can reduce its toxicological risk. As sediments are mainly anaerobic, degradation of linear (4-n-NP) and branched nonylphenol (tNP) was studied under methanogenic, sulphate reducing and denitrifying conditions in NP polluted river sediment. Anaerobic bioconversion was observed only for linear NP under denitrifying conditions. The microbial population involved herein was further studied by enrichment and molecular characterization. The largest change in diversity was observed between the enrichments of the third and fourth generation, and further enrichment did not affect the diversity. This implies that different microorganisms are involved in the degradation of 4-n-NP in the sediment. The major degrading bacteria were most closely related to denitrifying hexadecane degraders and linear alkyl benzene sulphonate (LAS) degraders. The molecular structures of alkanes and LAS are similar to the linear chain of 4-n-NP, this might indicate that the biodegradation of linear NP under denitrifying conditions starts at the nonyl chain. Initiation of anaerobic NP degradation was further tested using phenol as a structure analogue. Phenol was chosen instead of an aliphatic analogue, because phenol is the common structure present in all NP isomers while the structure of the aliphatic chain differs per isomer. Phenol was degraded in all cases, but did not affect the linear NP degradation under denitrifying conditions and did not initiate the degradation of tNP and linear NP under the other tested conditions. PMID:20640878

  2. A mixed integer bi-level DEA model for bank branch performance evaluation by Stackelberg approach

    NASA Astrophysics Data System (ADS)

    Shafiee, Morteza; Lotfi, Farhad Hosseinzadeh; Saleh, Hilda; Ghaderi, Mehdi

    2016-03-01

    One of the most complicated decision making problems for managers is the evaluation of bank performance, which involves various criteria. There are many studies about bank efficiency evaluation by network DEA in the literature review. These studies do not focus on multi-level network. Wu (Eur J Oper Res 207:856-864, 2010) proposed a bi-level structure for cost efficiency at the first time. In this model, multi-level programming and cost efficiency were used. He used a nonlinear programming to solve the model. In this paper, we have focused on multi-level structure and proposed a bi-level DEA model. We then used a liner programming to solve our model. In other hand, we significantly improved the way to achieve the optimum solution in comparison with the work by Wu (2010) by converting the NP-hard nonlinear programing into a mixed integer linear programming. This study uses a bi-level programming data envelopment analysis model that embodies internal structure with Stackelberg-game relationships to evaluate the performance of banking chain. The perspective of decentralized decisions is taken in this paper to cope with complex interactions in banking chain. The results derived from bi-level programming DEA can provide valuable insights and detailed information for managers to help them evaluate the performance of the banking chain as a whole using Stackelberg-game relationships. Finally, this model was applied in the Iranian bank to evaluate cost efficiency.

  3. Circuit topology of self-interacting chains: implications for folding and unfolding dynamics.

    PubMed

    Mugler, Andrew; Tans, Sander J; Mashaghi, Alireza

    2014-11-07

    Understanding the relationship between molecular structure and folding is a central problem in disciplines ranging from biology to polymer physics and DNA origami. Topology can be a powerful tool to address this question. For a folded linear chain, the arrangement of intra-chain contacts is a topological property because rearranging the contacts requires discontinuous deformations. Conversely, the topology is preserved when continuously stretching the chain while maintaining the contact arrangement. Here we investigate how the folding and unfolding of linear chains with binary contacts is guided by the topology of contact arrangements. We formalize the topology by describing the relations between any two contacts in the structure, which for a linear chain can either be in parallel, in series, or crossing each other. We show that even when other determinants of folding rate such as contact order and size are kept constant, this 'circuit' topology determines folding kinetics. In particular, we find that the folding rate increases with the fractions of parallel and crossed relations. Moreover, we show how circuit topology constrains the conformational phase space explored during folding and unfolding: the number of forbidden unfolding transitions is found to increase with the fraction of parallel relations and to decrease with the fraction of series relations. Finally, we find that circuit topology influences whether distinct intermediate states are present, with crossed contacts being the key factor. The approach presented here can be more generally applied to questions on molecular dynamics, evolutionary biology, molecular engineering, and single-molecule biophysics.

  4. Stick-slip nanofriction in cold-ion traps

    NASA Astrophysics Data System (ADS)

    Mandelli, Davide; Vanossi, Andrea; Tosatti, Erio

    2013-03-01

    Trapped cold ions are known to form linear or planar zigzag chains, helices or clusters depending on trapping conditions. They may be forced to slide over a laser induced corrugated potential, a mimick of sliding friction. We present MD simulations of an incommensurate 101 ions chain sliding subject to an external electric field. As expected with increasing corrugation, we observe the transition from a smooth-sliding, highly lubric regime to a strongly dissipative stick-slip regime. Owing to inhomogeneity the dynamics shows features reminiscent of macroscopic frictional behaviors. While the chain extremities are pinned, the incommensurate central part is initially free to slide. The onset of global sliding is preceded by precursor events consisting of partial slips of chain portions further from the center. We also look for frictional anomalies expected for the chain sliding across the linear-zigzag structural phase transition. Although the chain is too short for a proper critical behavior, the sliding friction displays a frank rise near the transition, due to opening of a new dissipative channel via excitations of transverse modes. Research partly sponsored by Sinergia Project CRSII2 136287/1.

  5. Exploring Alkyl Chains in Benzobisthiazole-Naphthobisthiadiazole Polymers: Impact on Solar-Cell Performance, Crystalline Structures, and Optoelectronics.

    PubMed

    Al-Naamani, Eman; Gopal, Anesh; Ide, Marina; Osaka, Itaru; Saeki, Akinori

    2017-11-01

    The shapes and lengths of the alkyl chains of conjugated polymers greatly affect the efficiencies of organic photovoltaic devices. This often results in a trade-off between solubility and self-organizing behavior; however, each material has specific optimal chains. Here we report on the effect of alkyl side chains on the film morphologies, crystallinities, and optoelectronic properties of new benzobisthiazole-naphthobisthiadiazole (PBBT-NTz) polymers. The power conversion efficiencies (PCEs) of linear-branched and all-branched polymers range from 2.5% to 6.6%; the variations in these PCEs are investigated by atomic force microscopy, two-dimensional X-ray diffraction (2D-GIXRD), and transient photoconductivity techniques. The best-performing linear-branched polymer, bearing dodecyl and decyltetradecyl chains (C12-DT), exhibits nanometer-scale fibers along with the highest crystallinity, comprising predominant edge-on and partial face-on orientations. This morphology leads to the highest photoconductivity and the longest carrier lifetime. These results highlight the importance of long alkyl chains for inducing intermolecular stacking, which is in contrast to observations made for analogous previously reported polymers.

  6. Structural properties of thiophenes investigated with simulations of a coarse-grained model

    NASA Astrophysics Data System (ADS)

    Luettmer-Strathmann, Jutta; Almutairi, Amani

    Thiophenes have important applications in organic electronics, energy conversion, and storage. The interfacial layer of an organic semiconductor in contact with a metal electrode has important effects on the performance of thin-film devices. However, the structure of this layer is not easy to model. In recent work, we developed a coarse-grained model for alpha-oligothiophenes in the bulk and near gold surfaces. We describe the molecules as linear chains of bonded, discotic particles with Gay-Berne potential interactions between non-bonded ellipsoids. In this work, we investigate structural properties of thiophenes with simulations of our coarse-grained model.

  7. Maximally reliable Markov chains under energy constraints.

    PubMed

    Escola, Sean; Eisele, Michael; Miller, Kenneth; Paninski, Liam

    2009-07-01

    Signal-to-noise ratios in physical systems can be significantly degraded if the outputs of the systems are highly variable. Biological processes for which highly stereotyped signal generations are necessary features appear to have reduced their signal variabilities by employing multiple processing steps. To better understand why this multistep cascade structure might be desirable, we prove that the reliability of a signal generated by a multistate system with no memory (i.e., a Markov chain) is maximal if and only if the system topology is such that the process steps irreversibly through each state, with transition rates chosen such that an equal fraction of the total signal is generated in each state. Furthermore, our result indicates that by increasing the number of states, it is possible to arbitrarily increase the reliability of the system. In a physical system, however, an energy cost is associated with maintaining irreversible transitions, and this cost increases with the number of such transitions (i.e., the number of states). Thus, an infinite-length chain, which would be perfectly reliable, is infeasible. To model the effects of energy demands on the maximally reliable solution, we numerically optimize the topology under two distinct energy functions that penalize either irreversible transitions or incommunicability between states, respectively. In both cases, the solutions are essentially irreversible linear chains, but with upper bounds on the number of states set by the amount of available energy. We therefore conclude that a physical system for which signal reliability is important should employ a linear architecture, with the number of states (and thus the reliability) determined by the intrinsic energy constraints of the system.

  8. Traveling wave solutions in a chain of periodically forced coupled nonlinear oscillators

    NASA Astrophysics Data System (ADS)

    Duanmu, M.; Whitaker, N.; Kevrekidis, P. G.; Vainchtein, A.; Rubin, J. E.

    2016-06-01

    Motivated by earlier studies of artificial perceptions of light called phosphenes, we analyze traveling wave solutions in a chain of periodically forced coupled nonlinear oscillators modeling this phenomenon. We examine the discrete model problem in its co-traveling frame and systematically obtain the corresponding traveling waves in one spatial dimension. Direct numerical simulations as well as linear stability analysis are employed to reveal the parameter regions where the traveling waves are stable, and these waves are, in turn, connected to the standing waves analyzed in earlier work. We also consider a two-dimensional extension of the model and demonstrate the robust evolution and stability of planar fronts. Our simulations also suggest the radial fronts tend to either annihilate or expand and flatten out, depending on the phase value inside and the parameter regime. Finally, we observe that solutions that initially feature two symmetric fronts with bulged centers evolve in qualitative agreement with experimental observations of phosphenes.

  9. A single particle model to simulate the dynamics of entangled polymer melts.

    PubMed

    Kindt, P; Briels, W J

    2007-10-07

    We present a computer simulation model of polymer melts representing each chain as one single particle. Besides the position coordinate of each particle, we introduce a parameter n(ij) for each pair of particles i and j within a specified distance from each other. These numbers, called entanglement numbers, describe the deviation of the system of ignored coordinates from its equilibrium state for the given configuration of the centers of mass of the polymers. The deviations of the entanglement numbers from their equilibrium values give rise to transient forces, which, together with the conservative forces derived from the potential of mean force, govern the displacements of the particles. We have applied our model to a melt of C(800)H(1602) chains at 450 K and have found good agreement with experiments and more detailed simulations. Properties addressed in this paper are radial distribution functions, dynamic structure factors, and linear as well as nonlinear rheological properties.

  10. Traveling wave solutions in a chain of periodically forced coupled nonlinear oscillators

    DOE PAGES

    Duanmu, M.; Whitaker, N.; Kevrekidis, P. G.; ...

    2016-02-27

    Artificial perceptions of light called phosphenes were motivated by earlier studies. We analyze traveling wave solutions in a chain of periodically forced coupled nonlinear oscillators modeling this phenomenon. We examine the discrete model problem in its co-traveling frame and systematically obtain the corresponding traveling waves in one spatial dimension. Direct numerical simulations as well as linear stability analysis are employed to reveal the parameter regions where the traveling waves are stable, and these waves are, in turn, connected to the standing waves analyzed in earlier work. We also consider a two-dimensional extension of the model and demonstrate the robust evolutionmore » and stability of planar fronts. Moreover, our simulations also suggest the radial fronts tend to either annihilate or expand and flatten out, depending on the phase value inside and the parameter regime. Finally, we observe that solutions that initially feature two symmetric fronts with bulged centers evolve in qualitative agreement with experimental observations of phosphenes.« less

  11. Traveling wave solutions in a chain of periodically forced coupled nonlinear oscillators

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Duanmu, M.; Whitaker, N.; Kevrekidis, P. G.

    Artificial perceptions of light called phosphenes were motivated by earlier studies. We analyze traveling wave solutions in a chain of periodically forced coupled nonlinear oscillators modeling this phenomenon. We examine the discrete model problem in its co-traveling frame and systematically obtain the corresponding traveling waves in one spatial dimension. Direct numerical simulations as well as linear stability analysis are employed to reveal the parameter regions where the traveling waves are stable, and these waves are, in turn, connected to the standing waves analyzed in earlier work. We also consider a two-dimensional extension of the model and demonstrate the robust evolutionmore » and stability of planar fronts. Moreover, our simulations also suggest the radial fronts tend to either annihilate or expand and flatten out, depending on the phase value inside and the parameter regime. Finally, we observe that solutions that initially feature two symmetric fronts with bulged centers evolve in qualitative agreement with experimental observations of phosphenes.« less

  12. Reductions in finite-dimensional integrable systems and special points of classical r-matrices

    NASA Astrophysics Data System (ADS)

    Skrypnyk, T.

    2016-12-01

    For a given 𝔤 ⊗ 𝔤-valued non-skew-symmetric non-dynamical classical r-matrices r(u, v) with spectral parameters, we construct the general form of 𝔤-valued Lax matrices of finite-dimensional integrable systems satisfying linear r-matrix algebra. We show that the reduction in the corresponding finite-dimensional integrable systems is connected with "the special points" of the classical r-matrices in which they become degenerated. We also propose a systematic way of the construction of additional integrals of the Lax-integrable systems associated with the symmetries of the corresponding r-matrices. We consider examples of the Lax matrices and integrable systems that are obtained in the framework of the general scheme. Among them there are such physically important systems as generalized Gaudin systems in an external magnetic field, ultimate integrable generalization of Toda-type chains (including "modified" or "deformed" Toda chains), generalized integrable Jaynes-Cummings-Dicke models, integrable boson models generalizing Bose-Hubbard dimer models, etc.

  13. The effects of intraparticle and interparticle interactions on the magnetic hysteresis loop of frozen suspensions of bionized nanoferrite particles

    NASA Astrophysics Data System (ADS)

    Boekelheide, Zoe; Gruettner, Cordula; Dennis, Cindi

    Bionized nano-ferrite (iron oxide/dextran) nanoparticles have been shown to have a large heating response in an alternating magnetic field, making them very promising for applications in magnetic nanoparticle hyperthermia cancer treatment. Magnetic hysteresis loop measurements of these particles provide insight into the magnetic reversal behavior of these particles, and thus their heating response. Measurements have been performed on frozen suspensions of nanoparticles dispersed in H2O, which have been frozen in a range of applied fields in order to tune the interparticle dipolar interactions through formation of linear chains. These experimental results are compared with micromagnetic models of both monolithic (single-domain) and internally structured (multi-grain) particles. It is found that the internal structure of the nanoparticles, which are made up of parallelepiped-shaped grains, is important for describing the magnetic reversal behavior of the particles and the resulting shape of the hysteresis loops. In addition to this, interparticle interactions between particles in a linear chain modify the reversal behavior and thus the shape of the hysteresis loop.

  14. A correlated ab initio study of linear carbon-chain radicals CnH (n = 2-7)

    NASA Technical Reports Server (NTRS)

    Woon, D. E.; Loew, G. H. (Principal Investigator)

    1995-01-01

    Linear carbon-chain radicals CnH for n = 2-7 have been studied with correlation consistent valence and core-valence basis sets and the coupled cluster method RCCSD(T). Equilibrium structures, rotational constants, and dipole moments are reported and compared with available experimental data. The ground state of the even-n series changes from 2 sigma+ to 2 pi as the chain is extended. For C4H, the 2 sigma+ state was found to lie only 72 cm-1 below the 2 pi state in the estimated complete basis set limit for valence correlation. The C2H- and C3H- anions have also been characterized.

  15. Permeation of protons, potassium ions, and small polar molecules through phospholipid bilayers as a function of membrane thickness.

    PubMed Central

    Paula, S; Volkov, A G; Van Hoek, A N; Haines, T H; Deamer, D W

    1996-01-01

    Two mechanisms have been proposed to account for solute permeation of lipid bilayers. Partitioning into the hydrophobic phase of the bilayer, followed by diffusion, is accepted by many for the permeation of water and other small neutral solutes, but transient pores have also been proposed to account for both water and ionic solute permeation. These two mechanisms make distinctively different predictions about the permeability coefficient as a function of bilayer thickness. Whereas the solubility-diffusion mechanism predicts only a modest variation related to bilayer thickness, the pore model predicts an exponential relationship. To test these models, we measured the permeability of phospholipid bilayers to protons, potassium ions, water, urea, and glycerol. Bilayers were prepared as liposomes, and thickness was varied systematically by using unsaturated lipids with chain lengths ranging from 14 to 24 carbon atoms. The permeability coefficient of water and neutral polar solutes displayed a modest dependence on bilayer thickness, with an approximately linear fivefold decrease as the carbon number varied from 14 to 24 atoms. In contrast, the permeability to protons and potassium ions decreased sharply by two orders of magnitude between 14 and 18 carbon atoms, and leveled off, when the chain length was further extended to 24 carbon atoms. The results for water and the neutral permeating solutes are best explained by the solubility-diffusion mechanism. The results for protons and potassium ions in shorter-chain lipids are consistent with the transient pore model, but better fit the theoretical line predicted by the solubility-diffusion model at longer chain lengths. PMID:8770210

  16. Permeation of protons, potassium ions, and small polar molecules through phospholipid bilayers as a function of membrane thickness

    NASA Technical Reports Server (NTRS)

    Paula, S.; Volkov, A. G.; Van Hoek, A. N.; Haines, T. H.; Deamer, D. W.

    1996-01-01

    Two mechanisms have been proposed to account for solute permeation of lipid bilayers. Partitioning into the hydrophobic phase of the bilayer, followed by diffusion, is accepted by many for the permeation of water and other small neutral solutes, but transient pores have also been proposed to account for both water and ionic solute permeation. These two mechanisms make distinctively different predictions about the permeability coefficient as a function of bilayer thickness. Whereas the solubility-diffusion mechanism predicts only a modest variation related to bilayer thickness, the pore model predicts an exponential relationship. To test these models, we measured the permeability of phospholipid bilayers to protons, potassium ions, water, urea, and glycerol. Bilayers were prepared as liposomes, and thickness was varied systematically by using unsaturated lipids with chain lengths ranging from 14 to 24 carbon atoms. The permeability coefficient of water and neutral polar solutes displayed a modest dependence on bilayer thickness, with an approximately linear fivefold decrease as the carbon number varied from 14 to 24 atoms. In contrast, the permeability to protons and potassium ions decreased sharply by two orders of magnitude between 14 and 18 carbon atoms, and leveled off, when the chain length was further extended to 24 carbon atoms. The results for water and the neutral permeating solutes are best explained by the solubility-diffusion mechanism. The results for protons and potassium ions in shorter-chain lipids are consistent with the transient pore model, but better fit the theoretical line predicted by the solubility-diffusion model at longer chain lengths.

  17. Structure of resonances and formation of stationary points in symmetrical chains of bilinear oscillators

    NASA Astrophysics Data System (ADS)

    Dyskin, Arcady V.; Pasternak, Elena; Shufrin, Igor

    2014-12-01

    Dynamics of strongly nonlinear systems can in many cases be modelled by bilinear oscillators, which are the oscillators whose springs have different stiffnesses in compression and tension. This underpins the analysis of a wide range of phenomena, from oscillations of fragmented structures, connections and mooring lines to deformation of geological media. Single bilinear oscillators were studied previously and the presence of multiple resonances both super- and sub-harmonic was found. Less attention was paid to systems of multiple bilinear oscillators that describe many natural and engineering processes such as for example the behaviour of fragmented solids. Here we fill this gap concentrating on the simplest case - 1D symmetrical chains of bilinear oscillators. We show that the presence and structure of resonances in a symmetric chain of bilinear oscillators with fixed ends depends upon the number of oscillating masses. Two elementary chains act as the basic ones: a single mass bilinear chain (a mass connected to the fixed points by two bilinear springs) that behaves as a linear oscillator with a single resonance and a two mass chain that is a coupled bilinear oscillator (two masses connected by three bilinear springs). The latter has multiple resonances. We demonstrate that longer chains either do not have resonances or get decomposed, in the resonance, into either the single mass or two mass elementary chains with stationary masses in between. The resonance frequencies are inherited from the basic chains of decomposition. We show that if the number of masses is odd the chain can be decomposed into the single mass bilinear chains separated by stationary masses. It then inherits the resonances of the single mass bilinear chain. The chains with the number of masses minus 2 divisible by 3 can be decomposed into the two mass bilinear chains separated by stationary masses and inherit the resonances of the two mass chains. The chains whose lengths satisfy both criteria (such as chains with 5, 11, 17 … masses) allow both types of resonances.

  18. Spinning Rocket Simulator Turntable Design

    NASA Technical Reports Server (NTRS)

    Miles, Robert W.

    2001-01-01

    Contained herein is the research and data acquired from the Turntable Design portion of the Spinning Rocket Simulator (SRS) project. The SRS Project studies and eliminates the effect of coning on thrust-propelled spacecraft. This design and construction of the turntable adds a structural support for the SRS model and two degrees of freedom. The two degrees of freedom, radial and circumferential, will help develop a simulated thrust force perpendicular to the plane of the spacecraft model while undergoing an unstable coning motion. The Turntable consists of a ten-foot linear track mounted to a sprocket and press-fit to a thrust bearing. A two-inch high column grounded by a Triangular Baseplate supports this bearing and houses the slip rings and pressurized, air-line swivel. The thrust bearing allows the entire system to rotate under the moment applied through the chain-driven sprocket producing a circumferential degree of freedom. The radial degree of freedom is given to the model through the helically threaded linear track. This track allows the Model Support and Counter Balance to simultaneously reposition according to the coning motion of the Model. Two design factors that hinder the linear track are bending and twist due to torsion. A Standard Aluminum "C" channel significantly reduces these two deflections. Safety considerations dictate the design of all the components involved in this project.

  19. Interfacial free energy governs single polystyrene chain collapse in water and aqueous solutions.

    PubMed

    Li, Isaac T S; Walker, Gilbert C

    2010-05-12

    The hydrophobic interaction is significantly responsible for driving protein folding and self-assembly. To understand it, the thermodynamics, the role of water structure, the dewetting process surrounding hydrophobes, and related aspects have undergone extensive investigations. Here, we examine the hypothesis that polymer-solvent interfacial free energy is adequate to describe the energetics of the collapse of a hydrophobic homopolymer chain at fixed temperature, which serves as a much simplified model for studying the hydrophobic collapse of a protein. This implies that changes in polymer-solvent interfacial free energy should be directly proportional to the force to extend a collapsed polymer into a bad solvent. To test this hypothesis, we undertook single-molecule force spectroscopy on a collapsed, single, polystyrene chain in water-ethanol and water-salt mixtures where we measured the monomer solvation free energy from an ensemble average conformations. Different proportions within the binary mixture were used to create solvents with different interfacial free energies with polystyrene. In these mixed solvents, we observed a linear correlation between the interfacial free energy and the force required to extend the chain into solution, which is a direct measure of the solvation free energy per monomer on a single chain at room temperature. A simple analytical model compares favorably with the experimental results. This knowledge supports a common assumption that explicit water solvent may not be necessary for cases whose primary concerns are hydrophobic interactions and hydrophobic hydration.

  20. Arrangement at the nanoscale: Effect on magnetic particle hyperthermia

    NASA Astrophysics Data System (ADS)

    Myrovali, E.; Maniotis, N.; Makridis, A.; Terzopoulou, A.; Ntomprougkidis, V.; Simeonidis, K.; Sakellari, D.; Kalogirou, O.; Samaras, T.; Salikhov, R.; Spasova, M.; Farle, M.; Wiedwald, U.; Angelakeris, M.

    2016-11-01

    In this work, we present the arrangement of Fe3O4 magnetic nanoparticles into 3D linear chains and its effect on magnetic particle hyperthermia efficiency. The alignment has been performed under a 40 mT magnetic field in an agarose gel matrix. Two different sizes of magnetite nanoparticles, 10 and 40 nm, have been examined, exhibiting room temperature superparamagnetic and ferromagnetic behavior, in terms of DC magnetic field, respectively. The chain formation is experimentally visualized by scanning electron microscopy images. A molecular Dynamics anisotropic diffusion model that outlines the role of intrinsic particle properties and inter-particle distances on dipolar interactions has been used to simulate the chain formation process. The anisotropic character of the aligned samples is also reflected to ferromagnetic resonance and static magnetometry measurements. Compared to the non-aligned samples, magnetically aligned ones present enhanced heating efficiency increasing specific loss power value by a factor of two. Dipolar interactions are responsible for the chain formation of controllable density and thickness inducing shape anisotropy, which in turn enhances magnetic particle hyperthermia efficiency.

  1. Phi-value analysis of a linear, sequential reaction mechanism: theory and application to ion channel gating.

    PubMed

    Zhou, Yu; Pearson, John E; Auerbach, Anthony

    2005-12-01

    We derive the analytical form of a rate-equilibrium free-energy relationship (with slope Phi) for a bounded, linear chain of coupled reactions having arbitrary connecting rate constants. The results confirm previous simulation studies showing that Phi-values reflect the position of the perturbed reaction within the chain, with reactions occurring earlier in the sequence producing higher Phi-values than those occurring later in the sequence. The derivation includes an expression for the transmission coefficients of the overall reaction based on the rate constants of an arbitrary, discrete, finite Markov chain. The results indicate that experimental Phi-values can be used to calculate the relative heights of the energy barriers between intermediate states of the chain but provide no information about the energies of the wells along the reaction path. Application of the equations to the case of diliganded acetylcholine receptor channel gating suggests that the transition-state ensemble for this reaction is nearly flat. Although this mechanism accounts for many of the basic features of diliganded and unliganded acetylcholine receptor channel gating, the experimental rate-equilibrium free-energy relationships appear to be more linear than those predicted by the theory.

  2. The molecular kink paradigm for rubber elasticity: Numerical simulations of explicit polyisoprene networks at low to moderate tensile strains

    NASA Astrophysics Data System (ADS)

    Hanson, David E.

    2011-08-01

    Based on recent molecular dynamics and ab initio simulations of small isoprene molecules, we propose a new ansatz for rubber elasticity. We envision a network chain as a series of independent molecular kinks, each comprised of a small number of backbone units, and the strain as being imposed along the contour of the chain. We treat chain extension in three distinct force regimes: (Ia) near zero strain, where we assume that the chain is extended within a well defined tube, with all of the kinks participating simultaneously as entropic elastic springs, (II) when the chain becomes sensibly straight, giving rise to a purely enthalpic stretching force (until bond rupture occurs) and, (Ib) a linear entropic regime, between regimes Ia and II, in which a force limit is imposed by tube deformation. In this intermediate regime, the molecular kinks are assumed to be gradually straightened until the chain becomes a series of straight segments between entanglements. We assume that there exists a tube deformation tension limit that is inversely proportional to the chain path tortuosity. Here we report the results of numerical simulations of explicit three-dimensional, periodic, polyisoprene networks, using these extension-only force models. At low strain, crosslink nodes are moved affinely, up to an arbitrary node force limit. Above this limit, non-affine motion of the nodes is allowed to relax unbalanced chain forces. Our simulation results are in good agreement with tensile stress vs. strain experiments.

  3. The molecular kink paradigm for rubber elasticity: numerical simulations of explicit polyisoprene networks at low to moderate tensile strains.

    PubMed

    Hanson, David E

    2011-08-07

    Based on recent molecular dynamics and ab initio simulations of small isoprene molecules, we propose a new ansatz for rubber elasticity. We envision a network chain as a series of independent molecular kinks, each comprised of a small number of backbone units, and the strain as being imposed along the contour of the chain. We treat chain extension in three distinct force regimes: (Ia) near zero strain, where we assume that the chain is extended within a well defined tube, with all of the kinks participating simultaneously as entropic elastic springs, (II) when the chain becomes sensibly straight, giving rise to a purely enthalpic stretching force (until bond rupture occurs) and, (Ib) a linear entropic regime, between regimes Ia and II, in which a force limit is imposed by tube deformation. In this intermediate regime, the molecular kinks are assumed to be gradually straightened until the chain becomes a series of straight segments between entanglements. We assume that there exists a tube deformation tension limit that is inversely proportional to the chain path tortuosity. Here we report the results of numerical simulations of explicit three-dimensional, periodic, polyisoprene networks, using these extension-only force models. At low strain, crosslink nodes are moved affinely, up to an arbitrary node force limit. Above this limit, non-affine motion of the nodes is allowed to relax unbalanced chain forces. Our simulation results are in good agreement with tensile stress vs. strain experiments.

  4. Optical solitons and modulation instability analysis of an integrable model of (2+1)-Dimensional Heisenberg ferromagnetic spin chain equation

    NASA Astrophysics Data System (ADS)

    Inc, Mustafa; Aliyu, Aliyu Isa; Yusuf, Abdullahi; Baleanu, Dumitru

    2017-12-01

    This paper addresses the nonlinear Schrödinger type equation (NLSE) in (2+1)-dimensions which describes the nonlinear spin dynamics of Heisenberg ferromagnetic spin chains (HFSC) with anisotropic and bilinear interactions in the semiclassical limit. Two integration schemes are employed to study the equation. These are the complex envelope function ansatz and the generalized tanh methods. Dark, dark-bright or combined optical and singular soliton solutions of the equation are derived. Furthermore, the modulational instability (MI) is studied based on the standard linear-stability analysis and the MI gain is got. Numerical simulation of the obtained results are analyzed with interesting figures showing the physical meaning of the solutions.

  5. The integrated model for solving the single-period deterministic inventory routing problem

    NASA Astrophysics Data System (ADS)

    Rahim, Mohd Kamarul Irwan Abdul; Abidin, Rahimi; Iteng, Rosman; Lamsali, Hendrik

    2016-08-01

    This paper discusses the problem of efficiently managing inventory and routing problems in a two-level supply chain system. Vendor Managed Inventory (VMI) policy is an integrating decisions between a supplier and his customers. We assumed that the demand at each customer is stationary and the warehouse is implementing a VMI. The objective of this paper is to minimize the inventory and the transportation costs of the customers for a two-level supply chain. The problem is to determine the delivery quantities, delivery times and routes to the customers for the single-period deterministic inventory routing problem (SP-DIRP) system. As a result, a linear mixed-integer program is developed for the solutions of the SP-DIRP problem.

  6. Activated-Sludge Nitrification in the Presence of Linear and Branched-Chain Alkyl Benzene Sulfonates

    PubMed Central

    Baillod, Charles R.; Boyle, W. C.

    1968-01-01

    The effects of biodegradable linear alkyl benzene sulfonate and branched-chain alkyl benzene sulfonate detergents on activated-sludge nitrification were investigated by administering a synthetic waste containing up to 23 mg of each detergent per liter to eight bench-scale, batch, activated-sludge units. It was found that both detergents tended to promote complete oxidation of ammonia to nitrate, whereas control units produced approximately equal amounts of nitrite and nitrate. Various hypotheses are offered to explain the phenomenon. PMID:5636474

  7. Influence of macromolecular architecture on necking in polymer extrusion film casting process

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Pol, Harshawardhan; Banik, Sourya; Azad, Lal Busher

    2015-05-22

    Extrusion film casting (EFC) is an important polymer processing technique that is used to produce several thousand tons of polymer films/coatings on an industrial scale. In this research, we are interested in understanding quantitatively how macromolecular chain architecture (for example long chain branching (LCB) or molecular weight distribution (MWD or PDI)) influences the necking and thickness distribution of extrusion cast films. We have used different polymer resins of linear and branched molecular architecture to produce extrusion cast films under controlled experimental conditions. The necking profiles of the films were imaged and the velocity profiles during EFC were monitored using particlemore » tracking velocimetry (PTV) technique. Additionally, the temperature profiles were captured using an IR thermography and thickness profiles were calculated. The experimental results are compared with predictions of one-dimensional flow model of Silagy et al{sup 1} wherein the polymer resin rheology is modeled using molecular constitutive equations such as the Rolie-Poly (RP) and extended Pom Pom (XPP). We demonstrate that the 1-D flow model containing the molecular constitutive equations provides new insights into the role of macromolecular chain architecture on film necking.{sup 1}D. Silagy, Y. Demay, and J-F. Agassant, Polym. Eng. Sci., 36, 2614 (1996)« less

  8. Analysis of the relationship between end-to-end distance and activity of single-chain antibody against colorectal carcinoma.

    PubMed

    Zhang, Jianhua; Liu, Shanhong; Shang, Zhigang; Shi, Li; Yun, Jun

    2012-08-22

    We investigated the relationship of End-to-end distance between VH and VL with different peptide linkers and the activity of single-chain antibodies by computer-aided simulation. First, we developed (G4S)n (where n = 1-9) as the linker to connect VH and VL, and estimated the 3D structure of single-chain Fv antibody (scFv) by homologous modeling. After molecular models were evaluated and optimized, the coordinate system of every protein was built and unified into one coordinate system, and End-to-end distances calculated using 3D space coordinates. After expression and purification of scFv-n with (G4S)n as n = 1, 3, 5, 7 or 9, the immunoreactivity of purified ND-1 scFv-n was determined by ELISA. A multi-factorial relationship model was employed to analyze the structural factors affecting scFv: rn=ABn-ABO2+CDn-CDO2+BCn-BCst2. The relationship between immunoreactivity and r-values revealed that fusion protein structure approached the desired state when the r-value = 3. The immunoreactivity declined as the r-value increased, but when the r-value exceeded a certain threshold, it stabilized. We used a linear relationship to analyze structural factors affecting scFv immunoreactivity.

  9. Stochastic Modelling of Seafloor Morphology

    DTIC Science & Technology

    1990-06-01

    trenches, and linear island chains to the point that many of the interesting questions of marine geology now concern the processes which have shaped...are all located near the Easter Island Microplate (Figure 5.2), a region with a complex tectonic history [Hey et al., 19851, and may be anomalous...the Clipperton Transform Fault [Macdonald and Fox, 1988]. Just south of Clipperton , the ridge crest is shallow (-2550 m) and the crestal horst is broad

  10. Transfer Learning for Adaptive Relation Extraction

    DTIC Science & Technology

    2011-09-13

    other NLP tasks, however, supervised learning approach fails when there is not a sufficient amount of labeled data for training, which is often the case...always 12 Syntactic Pattern Relation Instance Relation Type (Subtype) arg-2 arg-1 Arab leaders OTHER-AFF (Ethnic) his father PER-SOC (Family) South...for x. For sequence labeling tasks in NLP , linear-chain conditional random field has been rather suc- cessful. It is an undirected graphical model in

  11. Traveling and Standing Waves in Coupled Pendula and Newton's Cradle

    NASA Astrophysics Data System (ADS)

    García-Azpeitia, Carlos

    2016-12-01

    The existence of traveling and standing waves is investigated for chains of coupled pendula with periodic boundary conditions. The results are proven by applying topological methods to subspaces of symmetric solutions. The main advantage of this approach comes from the fact that only properties of the linearized forces are required. This allows to cover a wide range of models such as Newton's cradle, the Fermi-Pasta-Ulam lattice, and the Toda lattice.

  12. A chain reaction approach to modelling gene pathways.

    PubMed

    Cheng, Gary C; Chen, Dung-Tsa; Chen, James J; Soong, Seng-Jaw; Lamartiniere, Coral; Barnes, Stephen

    2012-08-01

    BACKGROUND: Of great interest in cancer prevention is how nutrient components affect gene pathways associated with the physiological events of puberty. Nutrient-gene interactions may cause changes in breast or prostate cells and, therefore, may result in cancer risk later in life. Analysis of gene pathways can lead to insights about nutrient-gene interactions and the development of more effective prevention approaches to reduce cancer risk. To date, researchers have relied heavily upon experimental assays (such as microarray analysis, etc.) to identify genes and their associated pathways that are affected by nutrient and diets. However, the vast number of genes and combinations of gene pathways, coupled with the expense of the experimental analyses, has delayed the progress of gene-pathway research. The development of an analytical approach based on available test data could greatly benefit the evaluation of gene pathways, and thus advance the study of nutrient-gene interactions in cancer prevention. In the present study, we have proposed a chain reaction model to simulate gene pathways, in which the gene expression changes through the pathway are represented by the species undergoing a set of chemical reactions. We have also developed a numerical tool to solve for the species changes due to the chain reactions over time. Through this approach we can examine the impact of nutrient-containing diets on the gene pathway; moreover, transformation of genes over time with a nutrient treatment can be observed numerically, which is very difficult to achieve experimentally. We apply this approach to microarray analysis data from an experiment which involved the effects of three polyphenols (nutrient treatments), epigallo-catechin-3-O-gallate (EGCG), genistein, and resveratrol, in a study of nutrient-gene interaction in the estrogen synthesis pathway during puberty. RESULTS: In this preliminary study, the estrogen synthesis pathway was simulated by a chain reaction model. By applying it to microarray data, the chain reaction model computed a set of reaction rates to examine the effects of three polyphenols (EGCG, genistein, and resveratrol) on gene expression in this pathway during puberty. We first performed statistical analysis to test the time factor on the estrogen synthesis pathway. Global tests were used to evaluate an overall gene expression change during puberty for each experimental group. Then, a chain reaction model was employed to simulate the estrogen synthesis pathway. Specifically, the model computed the reaction rates in a set of ordinary differential equations to describe interactions between genes in the pathway (A reaction rate K of A to B represents gene A will induce gene B per unit at a rate of K; we give details in the "method" section). Since disparate changes of gene expression may cause numerical error problems in solving these differential equations, we used an implicit scheme to address this issue. We first applied the chain reaction model to obtain the reaction rates for the control group. A sensitivity study was conducted to evaluate how well the model fits to the control group data at Day 50. Results showed a small bias and mean square error. These observations indicated the model is robust to low random noises and has a good fit for the control group. Then the chain reaction model derived from the control group data was used to predict gene expression at Day 50 for the three polyphenol groups. If these nutrients affect the estrogen synthesis pathways during puberty, we expect discrepancy between observed and expected expressions. Results indicated some genes had large differences in the EGCG (e.g., Hsd3b and Sts) and the resveratrol (e.g., Hsd3b and Hrmt12) groups. CONCLUSIONS: In the present study, we have presented (I) experimental studies of the effect of nutrient diets on the gene expression changes in a selected estrogen synthesis pathway. This experiment is valuable because it allows us to examine how the nutrient-containing diets regulate gene expression in the estrogen synthesis pathway during puberty; (II) global tests to assess an overall association of this particular pathway with time factor by utilizing generalized linear models to analyze microarray data; and (III) a chain reaction model to simulate the pathway. This is a novel application because we are able to translate the gene pathway into the chemical reactions in which each reaction channel describes gene-gene relationship in the pathway. In the chain reaction model, the implicit scheme is employed to efficiently solve the differential equations. Data analysis results show the proposed model is capable of predicting gene expression changes and demonstrating the effect of nutrient-containing diets on gene expression changes in the pathway. One of the objectives of this study is to explore and develop a numerical approach for simulating the gene expression change so that it can be applied and calibrated when the data of more time slices are available, and thus can be used to interpolate the expression change at a desired time point without conducting expensive experiments for a large amount of time points. Hence, we are not claiming this is either essential or the most efficient way for simulating this problem, rather a mathematical/numerical approach that can model the expression change of a large set of genes of a complex pathway. In addition, we understand the limitation of this experiment and realize that it is still far from being a complete model of predicting nutrient-gene interactions. The reason is that in the present model, the reaction rates were estimated based on available data at two time points; hence, the gene expression change is dependent upon the reaction rates and a linear function of the gene expressions. More data sets containing gene expression at various time slices are needed in order to improve the present model so that a non-linear variation of gene expression changes at different time can be predicted.

  13. Linear and nonlinear susceptibilities from diffusion quantum Monte Carlo: application to periodic hydrogen chains.

    PubMed

    Umari, P; Marzari, Nicola

    2009-09-07

    We calculate the linear and nonlinear susceptibilities of periodic longitudinal chains of hydrogen dimers with different bond-length alternations using a diffusion quantum Monte Carlo approach. These quantities are derived from the changes in electronic polarization as a function of applied finite electric field--an approach we recently introduced and made possible by the use of a Berry-phase, many-body electric-enthalpy functional. Calculated susceptibilities and hypersusceptibilities are found to be in excellent agreement with the best estimates available from quantum chemistry--usually extrapolations to the infinite-chain limit of calculations for chains of finite length. It is found that while exchange effects dominate the proper description of the susceptibilities, second hypersusceptibilities are greatly affected by electronic correlations. We also assess how different approximations to the nodal surface of the many-body wave function affect the accuracy of the calculated susceptibilities.

  14. Lithium/organosulfur redox cell having protective solid electrolyte barrier formed on anode and method of making same

    DOEpatents

    De Jonghe, Lutgard C.; Visco, Steven J.; Liu, Meilin; Mailhe, Catherine C.

    1990-01-01

    A lithium/organosulfur redox cell is disclosed which comprises a solid lium anode, a liquid organosulfur cathode, and a barrier layer formed adjacent a surface of the solid lithium anode facing the liquid organosulfur cathode consisting of a reaction product of the lithium anode with the organosulfur cathode. The organosulfur cathode comprises a material having the formula (R(S).sub.y).sub.N where y=1 to 6, n=2 to 20 and R is one or more different aliphatic or aromatic organic moieties having 1 to 20 carbon atoms, which may include one or more oxygen, sulfur, nitrogen, or fluorine atoms associated with the chain when R comprises an aliphatic chain, wherein the linear chain may be linear or branched, saturated or unsaturated, and wherein either the aliphatic chain or the aromatic ring may have substituted groups thereon.

  15. HTLV-1 Tax Induces Formation of the Active Macromolecular IKK Complex by Generating Lys63- and Met1-Linked Hybrid Polyubiquitin Chains.

    PubMed

    Shibata, Yuri; Tokunaga, Fuminori; Goto, Eiji; Komatsu, Ginga; Gohda, Jin; Saeki, Yasushi; Tanaka, Keiji; Takahashi, Hirotaka; Sawasaki, Tatsuya; Inoue, Satoshi; Oshiumi, Hiroyuki; Seya, Tsukasa; Nakano, Hiroyasu; Tanaka, Yuetsu; Iwai, Kazuhiro; Inoue, Jun-Ichiro

    2017-01-01

    The Tax protein of human T-cell leukemia virus type 1 (HTLV-1) is crucial for the development of adult T-cell leukemia (ATL), a highly malignant CD4+ T cell neoplasm. Among the multiple aberrant Tax-induced effects on cellular processes, persistent activation of transcription factor NF-κB, which is activated only transiently upon physiological stimulation, is essential for leukemogenesis. We and others have shown that Tax induces activation of the IκB kinase (IKK) complex, which is a critical step in NF-κB activation, by generating Lys63-linked polyubiquitin chains. However, the molecular mechanism underlying Tax-induced IKK activation is controversial and not fully understood. Here, we demonstrate that Tax recruits linear (Met1-linked) ubiquitin chain assembly complex (LUBAC) to the IKK complex and that Tax fails to induce IKK activation in cells that lack LUBAC activity. Mass spectrometric analyses revealed that both Lys63-linked and Met1-linked polyubiquitin chains are associated with the IKK complex. Furthermore, treatment of the IKK-associated polyubiquitin chains with Met1-linked-chain-specific deubiquitinase (OTULIN) resulted in the reduction of high molecular weight polyubiquitin chains and the generation of short Lys63-linked ubiquitin chains, indicating that Tax can induce the generation of Lys63- and Met1-linked hybrid polyubiquitin chains. We also demonstrate that Tax induces formation of the active macromolecular IKK complex and that the blocking of Tax-induced polyubiquitin chain synthesis inhibited formation of the macromolecular complex. Taken together, these results lead us to propose a novel model in which the hybrid-chain-dependent oligomerization of the IKK complex triggered by Tax leads to trans-autophosphorylation-mediated IKK activation.

  16. HTLV-1 Tax Induces Formation of the Active Macromolecular IKK Complex by Generating Lys63- and Met1-Linked Hybrid Polyubiquitin Chains

    PubMed Central

    Tokunaga, Fuminori; Goto, Eiji; Komatsu, Ginga; Saeki, Yasushi; Tanaka, Keiji; Takahashi, Hirotaka; Sawasaki, Tatsuya; Inoue, Satoshi; Oshiumi, Hiroyuki; Seya, Tsukasa; Nakano, Hiroyasu; Tanaka, Yuetsu; Iwai, Kazuhiro

    2017-01-01

    The Tax protein of human T-cell leukemia virus type 1 (HTLV-1) is crucial for the development of adult T-cell leukemia (ATL), a highly malignant CD4+ T cell neoplasm. Among the multiple aberrant Tax-induced effects on cellular processes, persistent activation of transcription factor NF-κB, which is activated only transiently upon physiological stimulation, is essential for leukemogenesis. We and others have shown that Tax induces activation of the IκB kinase (IKK) complex, which is a critical step in NF-κB activation, by generating Lys63-linked polyubiquitin chains. However, the molecular mechanism underlying Tax-induced IKK activation is controversial and not fully understood. Here, we demonstrate that Tax recruits linear (Met1-linked) ubiquitin chain assembly complex (LUBAC) to the IKK complex and that Tax fails to induce IKK activation in cells that lack LUBAC activity. Mass spectrometric analyses revealed that both Lys63-linked and Met1-linked polyubiquitin chains are associated with the IKK complex. Furthermore, treatment of the IKK-associated polyubiquitin chains with Met1-linked-chain-specific deubiquitinase (OTULIN) resulted in the reduction of high molecular weight polyubiquitin chains and the generation of short Lys63-linked ubiquitin chains, indicating that Tax can induce the generation of Lys63- and Met1-linked hybrid polyubiquitin chains. We also demonstrate that Tax induces formation of the active macromolecular IKK complex and that the blocking of Tax-induced polyubiquitin chain synthesis inhibited formation of the macromolecular complex. Taken together, these results lead us to propose a novel model in which the hybrid-chain-dependent oligomerization of the IKK complex triggered by Tax leads to trans-autophosphorylation-mediated IKK activation. PMID:28103322

  17. Integrating complexity into data-driven multi-hazard supply chain network strategies

    USGS Publications Warehouse

    Long, Suzanna K.; Shoberg, Thomas G.; Ramachandran, Varun; Corns, Steven M.; Carlo, Hector J.

    2013-01-01

    Major strategies in the wake of a large-scale disaster have focused on short-term emergency response solutions. Few consider medium-to-long-term restoration strategies that reconnect urban areas to the national supply chain networks (SCN) and their supporting infrastructure. To re-establish this connectivity, the relationships within the SCN must be defined and formulated as a model of a complex adaptive system (CAS). A CAS model is a representation of a system that consists of large numbers of inter-connections, demonstrates non-linear behaviors and emergent properties, and responds to stimulus from its environment. CAS modeling is an effective method of managing complexities associated with SCN restoration after large-scale disasters. In order to populate the data space large data sets are required. Currently access to these data is hampered by proprietary restrictions. The aim of this paper is to identify the data required to build a SCN restoration model, look at the inherent problems associated with these data, and understand the complexity that arises due to integration of these data.

  18. Photografting of perfluoroalkanes onto polyethylene surfaces via azide/nitrene chemistry

    NASA Astrophysics Data System (ADS)

    Siegmann, Konstantin; Inauen, Jan; Villamaina, Diego; Winkler, Martin

    2017-02-01

    The purpose of this study is to render polyethylene surfaces strongly and permanently hydrophobic. Polyethylene is a common plastic and, because of its inertness, difficult to graft. We chose polyethylene as example because of its ubiquity and model character. As graft chains linear perfluoroalkyl residues (-C4F9, -C6F13, -C8F17 and -C10F21) were chosen, and photografting was selected as grafting method. Photolytically generated nitrenes can insert into carbon-hydrogen bonds and are therefore suited for binding to polyethylene. Hydrophobic photo reactive surface modifiers based on azide/nitrene chemistry are designed, synthesized in high yield and characterized. Four new molecules are described. Water contact angles exceeding 110° were achieved on grafted polyethylene. One problem is to demonstrate that the photografted surface modifiers are bound covalently to the polyethylene. Abrasion tests show that all new molecules, when photografted to polyethylene, have a higher abrasion resistance than a polyethylene surface coated with a long-chain perfluoroalkane. Relative abrasion resitances of 1.4, 2.0, 2.1 and 2.5 compared to the fluoroalkane coating were obtained for the four compounds. An abrasion model using ice is developed. Although all four compounds have the same λmax of 266 nm in acetonitrile solution, their molar extincition coefficients increase from 1.6·104 to 2.2·104 with increasing length of the fluorotelomer chain. Exitonic coupling of the chromophores of the surface modifiers is observed for specific molecules in the neat state. A linear correlation of water contact angle with fluorine surface content, as measured by photoelectron spectroscopy, in grafted polyethylene surfaces is established.

  19. Manipulation strategies for massive space payloads

    NASA Technical Reports Server (NTRS)

    Book, Wayne J.

    1989-01-01

    Control for the bracing strategy is being examined. It was concluded earlier that trajectory planning must be improved to best achieve the bracing motion. Very interesting results were achieved which enable the inverse dynamics of flexible arms to be calculated for linearized motion in a more efficient manner than previously published. The desired motion of the end point beginning at t=0 and ending at t=t sub f is used to calculate the required torque at the joint. The solution is separated into a causal function that is zero for t is less than 0 and an accusal function which is zero for t is greater than t sub f. A number of alternative end point trajectories were explored in terms of the peak torque required, the amount of anticipatory action, and other issues. The single link case is the immediate subject and an experimental verification of that case is being performed. Modeling with experimental verification of closed chain dynamics continues. Modeling effort has pointed out inaccuracies that result from the choice of numerical techniques used to incorporate the closed chain constraints when modeling our experimental prototype RALF (Robotic Arm Large and Flexible). Results were compared to TREETOPS, a multi body code. The experimental verification work is suggesting new ways to make comparisons with systems having structural linearity and joint and geometric nonlinearity. The generation of inertial forces was studied with a small arm that will damp the large arm's vibration.

  20. Tight-binding chains with off-diagonal disorder: Bands of extended electronic states induced by minimal quasi-one-dimensionality

    NASA Astrophysics Data System (ADS)

    Nandy, Atanu; Pal, Biplab; Chakrabarti, Arunava

    2016-08-01

    It is shown that an entire class of off-diagonally disordered linear lattices composed of two basic building blocks and described within a tight-binding model can be tailored to generate absolutely continuous energy bands. It can be achieved if linear atomic clusters of an appropriate size are side-coupled to a suitable subset of sites in the backbone, and if the nearest-neighbor hopping integrals, in the backbone and in the side-coupled cluster, bear a certain ratio. We work out the precise relationship between the number of atoms in one of the building blocks in the backbone and that in the side attachment. In addition, we also evaluate the definite correlation between the numerical values of the hopping integrals at different subsections of the chain, that can convert an otherwise point spectrum (or a singular continuous one for deterministically disordered lattices) with exponentially (or power law) localized eigenfunctions to an absolutely continuous spectrum comprising one or more bands (subbands) populated by extended, totally transparent eigenstates. The results, which are analytically exact, put forward a non-trivial variation of the Anderson localization (Anderson P. W., Phys. Rev., 109 (1958) 1492), pointing towards its unusual sensitivity to the numerical values of the system parameters and, go well beyond the other related models such as the Random Dimer Model (RDM) (Dunlap D. H. et al., Phys. Rev. Lett., 65 (1990) 88).

  1. Enlarged symmetry algebras of spin chains, loop models, and S-matrices

    NASA Astrophysics Data System (ADS)

    Read, N.; Saleur, H.

    2007-08-01

    The symmetry algebras of certain families of quantum spin chains are considered in detail. The simplest examples possess m states per site ( m⩾2), with nearest-neighbor interactions with U(m) symmetry, under which the sites transform alternately along the chain in the fundamental m and its conjugate representation m¯. We find that these spin chains, even with arbitrary coefficients of these interactions, have a symmetry algebra A much larger than U(m), which implies that the energy eigenstates fall into sectors that for open chains (i.e., free boundary conditions) can be labeled by j=0,1,…,L, for the 2 L-site chain such that the degeneracies of all eigenvalues in the jth sector are generically the same and increase rapidly with j. For large j, these degeneracies are much larger than those that would be expected from the U(m) symmetry alone. The enlarged symmetry algebra A(2L) consists of operators that commute in this space of states with the Temperley-Lieb algebra that is generated by the set of nearest-neighbor interaction terms; A(2L) is not a Yangian. There are similar results for supersymmetric chains with gl(m+n|n) symmetry of nearest-neighbor interactions, and a richer representation structure for closed chains (i.e., periodic boundary conditions). The symmetries also apply to the loop models that can be obtained from the spin chains in a spacetime or transfer matrix picture. In the loop language, the symmetries arise because the loops cannot cross. We further define tensor products of representations (for the open chains) by joining chains end to end. The fusion rules for decomposing the tensor product of representations labeled j and j take the same form as the Clebsch-Gordan series for SU(2). This and other structures turn the symmetry algebra A into a ribbon Hopf algebra, and we show that this is "Morita equivalent" to the quantum group U(sl) for m=q+q. The open-chain results are extended to the cases |m|<2 for which the algebras are no longer semisimple; these possess continuum limits that are critical (conformal) field theories, or massive perturbations thereof. Such models, for open and closed boundary conditions, arise in connection with disordered fermions, percolation, and polymers (self-avoiding walks), and certain non-linear sigma models, all in two dimensions. A product operation is defined in a related way for the Temperley-Lieb representations also, and the fusion rules for this are related to those for A or U(sl) representations; this is useful for the continuum limits also, as we discuss in a companion paper.

  2. Gushing metal chain

    NASA Astrophysics Data System (ADS)

    Belyaev, Alexander; Sukhanov, Alexander; Tsvetkov, Alexander

    2016-03-01

    This article addresses the problem in which a chain falls from a glass from some height. This phenomenon demonstrates a paradoxical rise of the chain over the glass. To explain this effect, an initial hypothesis and an appropriate theory are proposed for calculating the steady fall parameters of the chain. For this purpose, the modified Cayley's problem of falling chain given its rise due to the centrifugal force of upward inertia is solved. Results show that the lift caused by an increase in linear density at the part of chain where it is being bent (the upper part) is due to the convergence of the chain balls to one another. The experiments confirm the obtained estimates of the lifting chain.

  3. Learning how the electron transport chain works: independent and interactive effects of instructional strategies and learners' characteristics.

    PubMed

    Darabi, Aubteen; Arrastia-Lloyd, Meagan C; Nelson, David W; Liang, Xinya; Farrell, Jennifer

    2015-12-01

    In order to develop an expert-like mental model of complex systems, causal reasoning is essential. This study examines the differences between forward and backward instructional strategies' in terms of efficiency, students' learning and progression of their mental models of the electronic transport chain in an undergraduate metabolism course (n = 151). Additionally, the participants' cognitive flexibility, prior knowledge, and mental effort in the learning process are also investigated. The data were analyzed using a series of general linear models to compare the strategies. Although the two strategies did not differ significantly in terms of mental model progression and learning outcomes, both groups' mental models progressed significantly. Mental effort and prior knowledge were identified as significant predictors of mental model progression. An interaction between instructional strategy and cognitive flexibility revealed that the backward instruction was more efficient than the conventional (forward) strategy for students with lower cognitive flexibility, whereas the conventional instruction was more efficient for students with higher cognitive flexibility. The results are discussed and suggestions for future research on the possible moderating role of cognitive flexibility in the area of health education are presented.

  4. Aqueous solubilities, vapor pressures, and 1-octanol-water partition coefficients for C9-C14 linear alkylbenzenes

    USGS Publications Warehouse

    Sherblom, P.M.; Gschwend, P.M.; Eganhouse, R.P.

    1992-01-01

    Measurements and estimates of aqueous solubilities, 1-octanol-water partition coefficients (Kow), and vapor pressures were made for 29 linear alkylbenzenes having alkyl chain lengths of 9-14 carbons. The ranges of values observed were vapor pressures from 0.002 to 0.418 Pa, log Kow, from 6.83 to 9.95, and aqueous solubilities from 4 to 38 nmol??L-1. Measured values exhibited a relationship to both the alkyl chain length and the position of phenyl substitution on the alkyl chain. Measurement of the aqueous concentrations resulting from equilibration of a mixture of alkylbenzenes yielded higher than expected values, indicating cosolute or other interactive effects caused enhanced aqueous concentrations of these compounds. ?? 1992 American Chemical Society.

  5. A Correlated Ab Initio Study of Linear Carbon-Chain Radicals C(sub n)H (n=2-7)

    NASA Technical Reports Server (NTRS)

    Woon, David E.

    1995-01-01

    Linear carbon-chain radicals C(sub n) H for n = 2-7 have been studied with correlation consistent valence and core-valence basis sets and the coupled cluster method RCCSD(T). Equilibrium structures, rotational constants, and dipole moments are reported and compared with available experimental data. The ground state of the even-n series changes from 2Sigma(+) to 2Pi as the chain is extended. For C4H, the 2Sigma(+) state was found to lie only 72 cm(exp -1) below the 2Pi state in the estimated complete basis set limit for valence correlation. The C2H(-) and C3H(-) anions have also been characterized.

  6. Combining measurements to estimate properties and characterization extent of complex biochemical mixtures; applications to Heparan Sulfate

    PubMed Central

    Pradines, Joël R.; Beccati, Daniela; Lech, Miroslaw; Ozug, Jennifer; Farutin, Victor; Huang, Yongqing; Gunay, Nur Sibel; Capila, Ishan

    2016-01-01

    Complex mixtures of molecular species, such as glycoproteins and glycosaminoglycans, have important biological and therapeutic functions. Characterization of these mixtures with analytical chemistry measurements is an important step when developing generic drugs such as biosimilars. Recent developments have focused on analytical methods and statistical approaches to test similarity between mixtures. The question of how much uncertainty on mixture composition is reduced by combining several measurements still remains mostly unexplored. Mathematical frameworks to combine measurements, estimate mixture properties, and quantify remaining uncertainty, i.e. a characterization extent, are introduced here. Constrained optimization and mathematical modeling are applied to a set of twenty-three experimental measurements on heparan sulfate, a mixture of linear chains of disaccharides having different levels of sulfation. While this mixture has potentially over two million molecular species, mathematical modeling and the small set of measurements establish the existence of nonhomogeneity of sulfate level along chains and the presence of abundant sulfate repeats. Constrained optimization yields not only estimations of sulfate repeats and sulfate level at each position in the chains but also bounds on these levels, thereby estimating the extent of characterization of the sulfation pattern which is achieved by the set of measurements. PMID:27112127

  7. Combining measurements to estimate properties and characterization extent of complex biochemical mixtures; applications to Heparan Sulfate.

    PubMed

    Pradines, Joël R; Beccati, Daniela; Lech, Miroslaw; Ozug, Jennifer; Farutin, Victor; Huang, Yongqing; Gunay, Nur Sibel; Capila, Ishan

    2016-04-26

    Complex mixtures of molecular species, such as glycoproteins and glycosaminoglycans, have important biological and therapeutic functions. Characterization of these mixtures with analytical chemistry measurements is an important step when developing generic drugs such as biosimilars. Recent developments have focused on analytical methods and statistical approaches to test similarity between mixtures. The question of how much uncertainty on mixture composition is reduced by combining several measurements still remains mostly unexplored. Mathematical frameworks to combine measurements, estimate mixture properties, and quantify remaining uncertainty, i.e. a characterization extent, are introduced here. Constrained optimization and mathematical modeling are applied to a set of twenty-three experimental measurements on heparan sulfate, a mixture of linear chains of disaccharides having different levels of sulfation. While this mixture has potentially over two million molecular species, mathematical modeling and the small set of measurements establish the existence of nonhomogeneity of sulfate level along chains and the presence of abundant sulfate repeats. Constrained optimization yields not only estimations of sulfate repeats and sulfate level at each position in the chains but also bounds on these levels, thereby estimating the extent of characterization of the sulfation pattern which is achieved by the set of measurements.

  8. Combining measurements to estimate properties and characterization extent of complex biochemical mixtures; applications to Heparan Sulfate

    NASA Astrophysics Data System (ADS)

    Pradines, Joël R.; Beccati, Daniela; Lech, Miroslaw; Ozug, Jennifer; Farutin, Victor; Huang, Yongqing; Gunay, Nur Sibel; Capila, Ishan

    2016-04-01

    Complex mixtures of molecular species, such as glycoproteins and glycosaminoglycans, have important biological and therapeutic functions. Characterization of these mixtures with analytical chemistry measurements is an important step when developing generic drugs such as biosimilars. Recent developments have focused on analytical methods and statistical approaches to test similarity between mixtures. The question of how much uncertainty on mixture composition is reduced by combining several measurements still remains mostly unexplored. Mathematical frameworks to combine measurements, estimate mixture properties, and quantify remaining uncertainty, i.e. a characterization extent, are introduced here. Constrained optimization and mathematical modeling are applied to a set of twenty-three experimental measurements on heparan sulfate, a mixture of linear chains of disaccharides having different levels of sulfation. While this mixture has potentially over two million molecular species, mathematical modeling and the small set of measurements establish the existence of nonhomogeneity of sulfate level along chains and the presence of abundant sulfate repeats. Constrained optimization yields not only estimations of sulfate repeats and sulfate level at each position in the chains but also bounds on these levels, thereby estimating the extent of characterization of the sulfation pattern which is achieved by the set of measurements.

  9. Comparison of methods for calculating conditional expectations of sufficient statistics for continuous time Markov chains.

    PubMed

    Tataru, Paula; Hobolth, Asger

    2011-12-05

    Continuous time Markov chains (CTMCs) is a widely used model for describing the evolution of DNA sequences on the nucleotide, amino acid or codon level. The sufficient statistics for CTMCs are the time spent in a state and the number of changes between any two states. In applications past evolutionary events (exact times and types of changes) are unaccessible and the past must be inferred from DNA sequence data observed in the present. We describe and implement three algorithms for computing linear combinations of expected values of the sufficient statistics, conditioned on the end-points of the chain, and compare their performance with respect to accuracy and running time. The first algorithm is based on an eigenvalue decomposition of the rate matrix (EVD), the second on uniformization (UNI), and the third on integrals of matrix exponentials (EXPM). The implementation in R of the algorithms is available at http://www.birc.au.dk/~paula/. We use two different models to analyze the accuracy and eight experiments to investigate the speed of the three algorithms. We find that they have similar accuracy and that EXPM is the slowest method. Furthermore we find that UNI is usually faster than EVD.

  10. Rheology of wormlike micellar fluids from Brownian and molecular dynamics simulations

    NASA Astrophysics Data System (ADS)

    Padding, J. T.; Boek, E. S.; Briels, W. J.

    2005-11-01

    There is a great need for understanding the link between the detailed chemistry of surfactants, forming wormlike micelles, and their macroscopic rheological properties. In this paper we show how this link may be explored through particle simulations. First we review an existing bead-spring model. We find that shear flow enhances the formation of rings at the expense of linear chains. The shear viscosity of this model is dominated by solvent contributions, however, and the link with the chemistry of the surfactants is missing. We introduce a more realistic Brownian dynamics model, the parameters of which are measured from atomistic molecular dynamics simulations.

  11. Identifying ontogenetic, environmental and individual components of forest tree growth

    PubMed Central

    Chaubert-Pereira, Florence; Caraglio, Yves; Lavergne, Christian; Guédon, Yann

    2009-01-01

    Background and Aims This study aimed to identify and characterize the ontogenetic, environmental and individual components of forest tree growth. In the proposed approach, the tree growth data typically correspond to the retrospective measurement of annual shoot characteristics (e.g. length) along the trunk. Methods Dedicated statistical models (semi-Markov switching linear mixed models) were applied to data sets of Corsican pine and sessile oak. In the semi-Markov switching linear mixed models estimated from these data sets, the underlying semi-Markov chain represents both the succession of growth phases and their lengths, while the linear mixed models represent both the influence of climatic factors and the inter-individual heterogeneity within each growth phase. Key Results On the basis of these integrative statistical models, it is shown that growth phases are not only defined by average growth level but also by growth fluctuation amplitudes in response to climatic factors and inter-individual heterogeneity and that the individual tree status within the population may change between phases. Species plasticity affected the response to climatic factors while tree origin, sampling strategy and silvicultural interventions impacted inter-individual heterogeneity. Conclusions The transposition of the proposed integrative statistical modelling approach to cambial growth in relation to climatic factors and the study of the relationship between apical growth and cambial growth constitute the next steps in this research. PMID:19684021

  12. Global reverse supply chain design for solid waste recycling under uncertainties and carbon emission constraint.

    PubMed

    Xu, Zhitao; Elomri, Adel; Pokharel, Shaligram; Zhang, Qin; Ming, X G; Liu, Wenjie

    2017-06-01

    The emergence of concerns over environmental protection, resource conservation as well as the development of logistics operations and manufacturing technology has led several countries to implement formal collection and recycling systems of solid waste. Such recycling system has the benefits of reducing environmental pollution, boosting the economy by creating new jobs, and generating income from trading the recyclable materials. This leads to the formation of a global reverse supply chain (GRSC) of solid waste. In this paper, we investigate the design of such a GRSC with a special emphasis on three aspects; (1) uncertainty of waste collection levels, (2) associated carbon emissions, and (3) challenges posed by the supply chain's global aspect, particularly the maritime transportation costs and currency exchange rates. To the best of our knowledge, this paper is the first attempt to integrate the three above-mentioned important aspects in the design of a GRSC. We have used mixed integer-linear programming method along with robust optimization to develop the model which is validated using a sample case study of e-waste management. Our results show that using a robust model by taking the complex interactions characterizing global reverse supply chain networks into account, we can create a better GRSC. The effect of uncertainties and carbon constraints on decisions to reduce costs and emissions are also shown. Copyright © 2017 Elsevier Ltd. All rights reserved.

  13. Information management in DNA replication modeled by directional, stochastic chains with memory

    NASA Astrophysics Data System (ADS)

    Arias-Gonzalez, J. Ricardo

    2016-11-01

    Stochastic chains represent a key variety of phenomena in many branches of science within the context of information theory and thermodynamics. They are typically approached by a sequence of independent events or by a memoryless Markov process. Stochastic chains are of special significance to molecular biology, where genes are conveyed by linear polymers made up of molecular subunits and transferred from DNA to proteins by specialized molecular motors in the presence of errors. Here, we demonstrate that when memory is introduced, the statistics of the chain depends on the mechanism by which objects or symbols are assembled, even in the slow dynamics limit wherein friction can be neglected. To analyze these systems, we introduce a sequence-dependent partition function, investigate its properties, and compare it to the standard normalization defined by the statistical physics of ensembles. We then apply this theory to characterize the enzyme-mediated information transfer involved in DNA replication under the real, non-equilibrium conditions, reproducing measured error rates and explaining the typical 100-fold increase in fidelity that is experimentally found when proofreading and edition take place. Our model further predicts that approximately 1 kT has to be consumed to elevate fidelity in one order of magnitude. We anticipate that our results are necessary to interpret configurational order and information management in many molecular systems within biophysics, materials science, communication, and engineering.

  14. The effect of the cation alkyl chain branching on mutual solubilities with water and toxicities.

    PubMed

    Kurnia, Kiki A; Sintra, Tânia E; Neves, Catarina M S S; Shimizu, Karina; Canongia Lopes, José N; Gonçalves, Fernando; Ventura, Sónia P M; Freire, Mara G; Santos, Luís M N B F; Coutinho, João A P

    2014-10-07

    The design of ionic liquids has been focused on the cation-anion combinations but other more subtle approaches can be used. In this work the effect of the branching of the cation alkyl chain on the design of ionic liquids (ILs) is evaluated. The mutual solubilities with water and toxicities of a series of bis(trifluoromethylsulfonyl)-based ILs, combined with imidazolium, pyridinium, pyrrolidinium, and piperidinium cations with linear or branched alkyl chains, are reported. The mutual solubility measurements were carried out in the temperature range from (288.15 to 323.15) K. From the obtained experimental data, the thermodynamic properties of the solution (in the water-rich phase) were determined and discussed. The COnductor like Screening MOdel for Real Solvents (COSMO-RS) was used to predict the liquid-liquid equilibrium. Furthermore, molecular dynamic simulations were also carried out aiming to get a deeper understanding of these fluids at the molecular level. The results show that the increase in the number of atoms at the cation ring (from five to six) leads to a decrease in the mutual solubilities with water while increasing their toxicity, and as expected from the well-established relationship between toxicities and hydrophobicities of ILs. The branching of the alkyl chain was observed to decrease the water solubility in ILs, while increasing the ILs solubility in water. The inability of COSMO-RS to correctly predict the effect of branching alkyl chains toward water solubility on them was confirmed using molecular dynamic simulations to be due to the formation of nano-segregated structures of the ILs that are not taken into account by the COSMO-RS model. In addition, the impact of branched alkyl chains on the toxicity is shown to be not trivial and to depend on the aromatic nature of the ILs.

  15. Unreliable gut feelings can lead to correct decisions: the somatic marker hypothesis in non-linear decision chains.

    PubMed

    Bedia, Manuel G; Di Paolo, Ezequiel

    2012-01-01

    Dual-process approaches of decision-making examine the interaction between affective/intuitive and deliberative processes underlying value judgment. From this perspective, decisions are supported by a combination of relatively explicit capabilities for abstract reasoning and relatively implicit evolved domain-general as well as learned domain-specific affective responses. One such approach, the somatic markers hypothesis (SMH), expresses these implicit processes as a system of evolved primary emotions supplemented by associations between affect and experience that accrue over lifetime, or somatic markers. In this view, somatic markers are useful only if their local capability to predict the value of an action is above a baseline equal to the predictive capability of the combined rational and primary emotional subsystems. We argue that decision-making has often been conceived of as a linear process: the effect of decision sequences is additive, local utility is cumulative, and there is no strong environmental feedback. This widespread assumption can have consequences for answering questions regarding the relative weight between the systems and their interaction within a cognitive architecture. We introduce a mathematical formalization of the SMH and study it in situations of dynamic, non-linear decision chains using a discrete-time stochastic model. We find, contrary to expectations, that decision-making events can interact non-additively with the environment in apparently paradoxical ways. We find that in non-lethal situations, primary emotions are represented globally over and above their local weight, showing a tendency for overcautiousness in situated decision chains. We also show that because they tend to counteract this trend, poorly attuned somatic markers that by themselves do not locally enhance decision-making, can still produce an overall positive effect. This result has developmental and evolutionary implications since, by promoting exploratory behavior, somatic markers would seem to be beneficial even at early stages when experiential attunement is poor. Although the model is formulated in terms of the SMH, the implications apply to dual systems theories in general since it makes minimal assumptions about the nature of the processes involved.

  16. Magnetic field directed assembly of superstructures of ferrite-ferroelectric core-shell nanoparticles and studies on magneto-electric interactions

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Srinivasan, G., E-mail: srinivas@oakland.edu; Sreenivasulu, G.; Benoit, Crystal

    2015-05-07

    Composites of ferromagnetic and ferroelectric are of interest for studies on mechanical strain mediated magneto-electric (ME) interactions and for useful technologies. Here, we report on magnetic-field-assisted-assembly of barium titanate (BTO)-nickel ferrite (NFO) core-shell particles into linear chains and 2D/3D arrays and measurements of ME effects in such assemblies. First, we synthesized the core-shell nano-particles with 50–600 nm BTO and 10–200 nm NFO by chemical self-assembly by coating the ferroic particles with complementary coupling groups and allowing them to self-assemble in the presence of a catalyst via the “click” reaction. The core-shell structure was confirmed with electron microscopy and scanning probe microscopy. Wemore » obtained superstructure of the core-shell particles by subjecting them to a magnetic field gradient that exerts an attractive force on the particles and align them toward the regions of high field strengths. At low particle concentration, linear chains were formed and they evolved into 2D and 3D arrays at high particle concentrations. Magnetoelectric characterization on unassembled films and assembled arrays has been performed through measurements of low-frequency ME voltage coefficient (MEVC) by subjecting the sample to a bias magnetic field and an ac magnetic field. The MEVC is higher for field-assembled samples than for unassembled films and is found to be sensitive to field orientation with a higher MEVC for magnetic fields parallel to the array direction than for magnetic fields perpendicular to the array. A maximum MEVC of 20 mV/cm Oe, one of the highest reported for any bulk nanocomposite, is measured across the array thickness. A model is provided for ME coupling in the superstructures of BTO-NFO particulate composites. First, we estimated the MEVC for a free-standing BTO-NFO core-shell particle and then extended the model to include an array of linear chains of the particles. The theoretical estimates are in qualitative agreement with the data.« less

  17. Unreliable Gut Feelings Can Lead to Correct Decisions: The Somatic Marker Hypothesis in Non-Linear Decision Chains

    PubMed Central

    Bedia, Manuel G.; Di Paolo, Ezequiel

    2012-01-01

    Dual-process approaches of decision-making examine the interaction between affective/intuitive and deliberative processes underlying value judgment. From this perspective, decisions are supported by a combination of relatively explicit capabilities for abstract reasoning and relatively implicit evolved domain-general as well as learned domain-specific affective responses. One such approach, the somatic markers hypothesis (SMH), expresses these implicit processes as a system of evolved primary emotions supplemented by associations between affect and experience that accrue over lifetime, or somatic markers. In this view, somatic markers are useful only if their local capability to predict the value of an action is above a baseline equal to the predictive capability of the combined rational and primary emotional subsystems. We argue that decision-making has often been conceived of as a linear process: the effect of decision sequences is additive, local utility is cumulative, and there is no strong environmental feedback. This widespread assumption can have consequences for answering questions regarding the relative weight between the systems and their interaction within a cognitive architecture. We introduce a mathematical formalization of the SMH and study it in situations of dynamic, non-linear decision chains using a discrete-time stochastic model. We find, contrary to expectations, that decision-making events can interact non-additively with the environment in apparently paradoxical ways. We find that in non-lethal situations, primary emotions are represented globally over and above their local weight, showing a tendency for overcautiousness in situated decision chains. We also show that because they tend to counteract this trend, poorly attuned somatic markers that by themselves do not locally enhance decision-making, can still produce an overall positive effect. This result has developmental and evolutionary implications since, by promoting exploratory behavior, somatic markers would seem to be beneficial even at early stages when experiential attunement is poor. Although the model is formulated in terms of the SMH, the implications apply to dual systems theories in general since it makes minimal assumptions about the nature of the processes involved. PMID:23087655

  18. Magnetic field directed assembly of superstructures of ferrite-ferroelectric core-shell nanoparticles and studies on magneto-electric interactions

    NASA Astrophysics Data System (ADS)

    Srinivasan, G.; Sreenivasulu, G.; Benoit, Crystal; Petrov, V. M.; Chavez, F.

    2015-05-01

    Composites of ferromagnetic and ferroelectric are of interest for studies on mechanical strain mediated magneto-electric (ME) interactions and for useful technologies. Here, we report on magnetic-field-assisted-assembly of barium titanate (BTO)-nickel ferrite (NFO) core-shell particles into linear chains and 2D/3D arrays and measurements of ME effects in such assemblies. First, we synthesized the core-shell nano-particles with 50-600 nm BTO and 10-200 nm NFO by chemical self-assembly by coating the ferroic particles with complementary coupling groups and allowing them to self-assemble in the presence of a catalyst via the "click" reaction. The core-shell structure was confirmed with electron microscopy and scanning probe microscopy. We obtained superstructure of the core-shell particles by subjecting them to a magnetic field gradient that exerts an attractive force on the particles and align them toward the regions of high field strengths. At low particle concentration, linear chains were formed and they evolved into 2D and 3D arrays at high particle concentrations. Magnetoelectric characterization on unassembled films and assembled arrays has been performed through measurements of low-frequency ME voltage coefficient (MEVC) by subjecting the sample to a bias magnetic field and an ac magnetic field. The MEVC is higher for field-assembled samples than for unassembled films and is found to be sensitive to field orientation with a higher MEVC for magnetic fields parallel to the array direction than for magnetic fields perpendicular to the array. A maximum MEVC of 20 mV/cm Oe, one of the highest reported for any bulk nanocomposite, is measured across the array thickness. A model is provided for ME coupling in the superstructures of BTO-NFO particulate composites. First, we estimated the MEVC for a free-standing BTO-NFO core-shell particle and then extended the model to include an array of linear chains of the particles. The theoretical estimates are in qualitative agreement with the data.

  19. Abstract Linguistic Structure Correlates with Temporal Activity during Naturalistic Comprehension

    PubMed Central

    Brennan, Jonathan R.; Stabler, Edward P.; Van Wagenen, Sarah E.; Luh, Wen-Ming; Hale, John T.

    2016-01-01

    Neurolinguistic accounts of sentence comprehension identify a network of relevant brain regions, but do not detail the information flowing through them. We investigate syntactic information. Does brain activity implicate a computation over hierarchical grammars or does it simply reflect linear order, as in a Markov chain? To address this question, we quantify the cognitive states implied by alternative parsing models. We compare processing-complexity predictions from these states against fMRI timecourses from regions that have been implicated in sentence comprehension. We find that hierarchical grammars independently predict timecourses from left anterior and posterior temporal lobe. Markov models are predictive in these regions and across a broader network that includes the inferior frontal gyrus. These results suggest that while linear effects are wide-spread across the language network, certain areas in the left temporal lobe deal with abstract, hierarchical syntactic representations. PMID:27208858

  20. Polymerase chain reaction system

    DOEpatents

    Benett, William J.; Richards, James B.; Stratton, Paul L.; Hadley, Dean R.; Milanovich, Fred P.; Belgrader, Phil; Meyer, Peter L.

    2004-03-02

    A portable polymerase chain reaction DNA amplification and detection system includes one or more chamber modules. Each module supports a duplex assay of a biological sample. Each module has two parallel interrogation ports with a linear optical system. The system is capable of being handheld.

  1. Price Strategies between a Dominant Retailer and Manufacturers

    NASA Astrophysics Data System (ADS)

    Cho, Hsun Jung; Mak, Hou Kit

    2009-08-01

    Supply chain-related game theoretical applications have been discussed for decades. This research accounts for the emergence of a dominant retailer, and the retailer Stackelberg pricing models of distribution channels. Research in the channel pricing game may use different definitions of pricing decision variables. In this research, we pay attentions to the retailer Stackelberg pricing game, and discuss the effects when choosing different decision variables. According the literature it was shown that the strategies between channel members depend critically on the form of the demand function. Two different demand forms—linear and non-linear—will be considered in our numerical example respectively. Our major finding is the outcomes are not relative to manufacturers' pricing decisions but to the retailer's pricing decision and choosing percentage margin as retailer's decision variable is the best strategy for the retailer but worst for manufacturers. The numerical results show that it is consistence between linear and non-linear demand form.

  2. The isotropic-nematic phase transition of tangent hard-sphere chain fluids—Pure components

    NASA Astrophysics Data System (ADS)

    van Westen, Thijs; Oyarzún, Bernardo; Vlugt, Thijs J. H.; Gross, Joachim

    2013-07-01

    An extension of Onsager's second virial theory is developed to describe the isotropic-nematic phase transition of tangent hard-sphere chain fluids. Flexibility is introduced by the rod-coil model. The effect of chain-flexibility on the second virial coefficient is described using an accurate, analytical approximation for the orientation-dependent pair-excluded volume. The use of this approximation allows for an analytical treatment of intramolecular flexibility by using a single pure-component parameter. Two approaches to approximate the effect of the higher virial coefficients are considered, i.e., the Vega-Lago rescaling and Scaled Particle Theory (SPT). The Onsager trial function is employed to describe the orientational distribution function. Theoretical predictions for the equation of state and orientational order parameter are tested against the results from Monte Carlo (MC) simulations. For linear chains of length 9 and longer, theoretical results are in excellent agreement with MC data. For smaller chain lengths, small errors introduced by the approximation of the higher virial coefficients become apparent, leading to a small under- and overestimation of the pressure and density difference at the phase transition, respectively. For rod-coil fluids of reasonable rigidity, a quantitative comparison between theory and MC simulations is obtained. For more flexible chains, however, both the Vega-Lago rescaling and SPT lead to a small underestimation of the location of the phase transition.

  3. 1D spin chain of Cu2+ in Sr3CuPtO6 with possible Haldane physics

    NASA Astrophysics Data System (ADS)

    Leiner, Jonathan; Oh, Joosung; Kolesnikov, Alexander; Stone, Matthew; Le, Manh Duc; Cheong, Sang-Wook; Park, Je-Geun

    Antiferromagnetic spin chain systems have attracted considerable attention since the discovery of fractional spinon excitations in spin-half chain systems and Haldane gap phases in spin-one chain systems. It has been reported from bulk susceptibility and heat capacity measurements that the magnetic Cu2+ ions in Sr3CuPtO6 exhibit S=1/2 Heisenberg spin chain behavior with a substantial amount of AFM interchain coupling. Using the modern time-of-flight inelastic neutron scattering spectrometer SEQUOIA at the SNS, we have probed the magnetic excitation spectrum for a polycrystalline sample of Sr3CuPtO6. Modeling with linear spin wave theory accounts for the major features of the spinwave spectra, including a nondispersive intense magnon band at 8meV. The magnetic excitations broaden considerably as temperature is increased, persisting up to above 100K and displaying a broad transition as previously seen in the susceptibility data. No spin gap is observed in the dispersive spin excitations at low momentum transfer, which we argue is consistent with Haldane physics in an ideal uniform S=1/2 spin-chain system. The work at the IBS CCES (South Korea) was supported by the research program of the Institute for Basic Science (IBS-R009-G1). Research at the Spallation Neutron Source was sponsored by the Scientific User Facilities Division, US Department of Energy.

  4. RDC-enhanced structure calculation of a β-heptapeptide in methanol.

    PubMed

    Rigling, Carla; Ebert, Marc-Olivier

    2017-07-01

    Residual dipolar couplings (RDCs) are a rich source of structural information that goes beyond the range covered by the nuclear Overhauser effect or scalar coupling constants. They can only be measured in partially oriented samples. RDC studies of peptides in organic solvents have so far been focused on samples in chloroform or DMSO. Here, we show that stretched poly(vinyl acetate) can be used for the partial alignment of a linear β-peptide with proteinogenic side chains in methanol. 1 D CH , 1 D NH , and 2 D HH RDCs were collected with this sample and included as restraints in a simulated annealing calculation. Incorporation of RDCs in the structure calculation process improves the long-range definition in the backbone of the resulting 3 14 -helix and uncovers side-chain mobility. Experimental side-chain RDCs of the central leucine and valine residues are in good agreement with predicted values from a local three-state model. Copyright © 2016 John Wiley & Sons, Ltd. Copyright © 2016 John Wiley & Sons, Ltd.

  5. Self-interacting polymer chains terminally anchored to adsorbing surfaces of three-dimensional fractal lattices

    NASA Astrophysics Data System (ADS)

    Živić, I.; Elezović-Hadžić, S.; Milošević, S.

    2018-01-01

    We have studied the adsorption problem of self-attracting linear polymers, modeled by self-avoiding walks (SAWs), situated on three-dimensional fractal structures, exemplified by 3d Sierpinski gasket (SG) family of fractals as containers of a poor solvent. Members of SG family are enumerated by an integer b (b ≥ 2), and it is assumed that one side of each SG fractal is an impenetrable adsorbing surface. We calculate the critical exponents γ1 ,γ11, and γs, which are related to the numbers of all possible SAWs with one, both, and no ends anchored to the adsorbing boundary, respectively. By applying the exact renormalization group (RG) method (for the first three members of the SG fractal family, b = 2 , 3, and 4), we have obtained specific values of these exponents, for θ-chain and globular polymer phase. We discuss their mutual relations and relations with corresponding values pertinent to extended polymer chain phase.

  6. Optimization of the Synthesis of Structured Phosphatidylcholine with Medium Chain Fatty Acid.

    PubMed

    Ochoa-Flores, Angélica A; Hernández-Becerra, Josafat A; Cavazos-Garduño, Adriana; Vernon-Carter, Eduardo J; García, Hugo S

    2017-11-01

    Structured phosphatidylcholine was successfully produced by acidolysis between phosphatidylcholine and free medium chain fatty acid, using phospholipase A 1 immobilized on Duolite A568. Response surface methodology was applied to optimize the reaction system using three process parameters: molar ratio of substrates (phosphatidylcholine to free medium chain fatty acid), enzyme loading, and reaction temperature. All parameters evaluated showed linear and quadratic significant effects on the production of modified phosphatidylcholine; molar ratio of substrates contributed positively, but temperature influenced negatively. Increased enzyme loading also led to increased production of modified phosphatidylcholine but only during the first 9 hours of the acidolysis reaction. Optimal conditions obtained from the model were a ratio of phosphatidylcholine to free medium chain fatty acid of 1:15, an enzyme loading of 12%, and a temperature of 45°C. Under these conditions a production of modified phosphatidylcholine of 52.98 % were obtained after 24 h of reaction. The prediction was confirmed from the verification experiments; the production of modified phosphatidylcholine was 53.02%, the total yield of phosphatidylcholine 64.28% and the molar incorporation of medium chain fatty acid was 42.31%. The acidolysis reaction was scaled-up in a batch reactor with a similar production of modified phosphatidylcholine, total yield of phosphatidylcholine and molar incorporation of medium chain fatty acid. Purification by column chromatography of the structured phosphatidylcholine yielded 62.53% of phosphatidylcholine enriched with 42.52% of medium chain fatty acid.

  7. A virtual image chain for perceived image quality of medical display

    NASA Astrophysics Data System (ADS)

    Marchessoux, Cédric; Jung, Jürgen

    2006-03-01

    This paper describes a virtual image chain for medical display (project VICTOR: granted in the 5th framework program by European commission). The chain starts from raw data of an image digitizer (CR, DR) or synthetic patterns and covers image enhancement (MUSICA by Agfa) and both display possibilities, hardcopy (film on viewing box) and softcopy (monitor). Key feature of the chain is a complete image wise approach. A first prototype is implemented in an object-oriented software platform. The display chain consists of several modules. Raw images are either taken from scanners (CR-DR) or from a pattern generator, in which characteristics of DR- CR systems are introduced by their MTF and their dose-dependent Poisson noise. The image undergoes image enhancement and comes to display. For soft display, color and monochrome monitors are used in the simulation. The image is down-sampled. The non-linear response of a color monitor is taken into account by the GOG or S-curve model, whereas the Standard Gray-Scale-Display-Function (DICOM) is used for monochrome display. The MTF of the monitor is applied on the image in intensity levels. For hardcopy display, the combination of film, printer, lightbox and viewing condition is modeled. The image is up-sampled and the DICOM-GSDF or a Kanamori Look-Up-Table is applied. An anisotropic model for the MTF of the printer is applied on the image in intensity levels. The density-dependent color (XYZ) of the hardcopy film is introduced by Look-Up-tables. Finally a Human Visual System Model is applied to the intensity images (XYZ in terms of cd/m2) in order to eliminate nonvisible differences. Comparison leads to visible differences, which are quantified by higher order image quality metrics. A specific image viewer is used for the visualization of the intensity image and the visual difference maps.

  8. Targeted energy transfers and passive acoustic wave redirection in a two-dimensional granular network under periodic excitation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhang, Yijing, E-mail: yzhng123@illinois.edu; Moore, Keegan J.; Vakakis, Alexander F.

    2015-12-21

    We study passive pulse redirection and nonlinear targeted energy transfer in a granular network composed of two semi-infinite, ordered homogeneous granular chains mounted on linear elastic foundations and coupled by weak linear stiffnesses. Periodic excitation in the form of repetitive half-sine pulses is applied to one of the chains, designated as the “excited chain,” whereas the other chain is initially at rest and is regarded as the “absorbing chain.” We show that passive pulse redirection and targeted energy transfer from the excited to the absorbing chain can be achieved by macro-scale realization of the spatial analog of the Landau-Zener quantummore » tunneling effect. This is realized by finite stratification of the elastic foundation of the excited chain and depends on the system parameters (e.g., the percentage of stratification) and on the parameters of the periodic excitation. Utilizing empirical mode decomposition and numerical Hilbert transforms, we detect the existence of two distinct nonlinear phenomena in the periodically forced network; namely, (i) energy localization in the absorbing chain due to sustained 1:1 resonance capture leading to irreversible pulse redirection from the excited chain, and (ii) continuous energy exchanges in the form of nonlinear beats between the two chains in the absence of resonance capture. Our results extend previous findings of transient passive energy redirection in impulsively excited granular networks and demonstrate that steady state passive pulse redirection in these networks can be robustly achieved under periodic excitation.« less

  9. Surface structure evolution in a homologous series of ionic liquids.

    PubMed

    Haddad, Julia; Pontoni, Diego; Murphy, Bridget M; Festersen, Sven; Runge, Benjamin; Magnussen, Olaf M; Steinrück, Hans-Georg; Reichert, Harald; Ocko, Benjamin M; Deutsch, Moshe

    2018-02-06

    Interfaces of room temperature ionic liquids (RTILs) are important for both applications and basic science and are therefore intensely studied. However, the evolution of their interface structure with the cation's alkyl chain length [Formula: see text] from Coulomb to van der Waals interaction domination has not yet been studied for even a single broad homologous RTIL series. We present here such a study of the liquid-air interface for [Formula: see text], using angstrom-resolution X-ray methods. For [Formula: see text], a typical "simple liquid" monotonic surface-normal electron density profile [Formula: see text] is obtained, like those of water and organic solvents. For [Formula: see text], increasingly more pronounced nanoscale self-segregation of the molecules' charged moieties and apolar chains yields surface layering with alternating regions of headgroups and chains. The layering decays into the bulk over a few, to a few tens, of nanometers. The layering periods and decay lengths, their linear [Formula: see text] dependence, and slopes are discussed within two models, one with partial-chain interdigitation and the other with liquid-like chains. No surface-parallel long-range order is found within the surface layer. For [Formula: see text], a different surface phase is observed above melting. Our results also impact general liquid-phase issues like supramolecular self-aggregation and bulk-surface structure relations.

  10. Turbulent drag reduction and degradation of DNA.

    PubMed

    Choi, H J; Lim, S T; Lai, Pik-Yin; Chan, C K

    2002-08-19

    Turbulent drag reduction induced by lambda-DNA is studied. The double-stranded DNA is found to be a good drag reducer when compared with the other normal linear polymers. However, this drag reducing power disappears when the DNA denatures to form two single-strand molecules. Mechanical degradation of DNA is also different from that of the normal linear-chain polymers: DNA is always cut in half by the turbulence. Our results suggest that the mechanism for turbulent degradation of DNA is different from that of the normal flexible long-chain polymers.

  11. Typed Linear Chain Conditional Random Fields and Their Application to Intrusion Detection

    NASA Astrophysics Data System (ADS)

    Elfers, Carsten; Horstmann, Mirko; Sohr, Karsten; Herzog, Otthein

    Intrusion detection in computer networks faces the problem of a large number of both false alarms and unrecognized attacks. To improve the precision of detection, various machine learning techniques have been proposed. However, one critical issue is that the amount of reference data that contains serious intrusions is very sparse. In this paper we present an inference process with linear chain conditional random fields that aims to solve this problem by using domain knowledge about the alerts of different intrusion sensors represented in an ontology.

  12. The possibility of a new resonance of three-body linear chain structure in the reaction 12C+16O at Ec.mapprox-33.5MeV

    NASA Astrophysics Data System (ADS)

    Kong, Xiangjing; P, L. Li; J, J. Kolata; A, Morsad; L, Goetting; R, A. Kryger; S, Dixit; R, Tighe; W, Chune

    1990-05-01

    There is a peak in the excitation function of total cross section of low energy α-particles in the reaction 12C+16O at Ec.m approx33.5MeV. The experimental distribution of α-particle emitted event has been obtained. The result of theoretical calculation roughly agrees with experimental data, gives an orientation where three-body resonances can be expected, and the information on internal structure of three-body linear chain molecule.

  13. Structure and dynamics of solvated polyethylenimine chains

    NASA Astrophysics Data System (ADS)

    Beu, Titus A.; Farcaş, Alexandra

    2017-12-01

    Polimeric gene-delivery carriers have attracted great interest in recent years, owing to their applicability in gene therapy. In particular, cationic polymers represent the most promising delivery vectors for nucleic acids into the cells. This study presents extensive atomistic molecular dynamics simulations of linear polyethylenimine chains. The simulations show that the variation of the chain size and protonation fraction causes a substantial change of the diffusion coefficient. Examination of the solvated chains suggests the possibility of controlling the polymer diffusion mobility in solution.

  14. Viscoelastic properties of dendrimers in the melt from nonequlibrium molecular dynamics

    NASA Astrophysics Data System (ADS)

    Bosko, Jaroslaw T.; Todd, B. D.; Sadus, Richard J.

    2004-12-01

    The viscoelastic properties of dendrimers of generation 1-4 are studied using nonequilibrium molecular dynamics. Flow properties of dendrimer melts under shear are compared to systems composed of linear chain polymers of the same molecular weight, and the influence of molecular architecture is discussed. Rheological material properties, such as the shear viscosity and normal stress coefficients, are calculated and compared for both systems. We also calculate and compare the microscopic properties of both linear chain and dendrimer molecules, such as their molecular alignment, order parameters and rotational velocities. We find that the highly symmetric shape of dendrimers and their highly constrained geometry allows for substantial differences in their material properties compared to traditional linear polymers of equivalent molecular weight.

  15. Structure and thermodynamics of core-softened models for alcohols

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Munaò, Gianmarco, E-mail: gmunao@unime.it; Urbic, Tomaz

    The phase behavior and the fluid structure of coarse-grain models for alcohols are studied by means of reference interaction site model (RISM) theory and Monte Carlo simulations. Specifically, we model ethanol and 1-propanol as linear rigid chains constituted by three (trimers) and four (tetramers) partially fused spheres, respectively. Thermodynamic properties of these models are examined in the RISM context, by employing closed formulæ for the calculation of free energy and pressure. Gas-liquid coexistence curves for trimers and tetramers are reported and compared with already existing data for a dimer model of methanol. Critical temperatures slightly increase with the number ofmore » CH{sub 2} groups in the chain, while critical pressures and densities decrease. Such a behavior qualitatively reproduces the trend observed in experiments on methanol, ethanol, and 1-propanol and suggests that our coarse-grain models, despite their simplicity, can reproduce the essential features of the phase behavior of such alcohols. The fluid structure of these models is investigated by computing radial distribution function g{sub ij}(r) and static structure factor S{sub ij}(k); the latter shows the presence of a low−k peak at intermediate-high packing fractions and low temperatures, suggesting the presence of aggregates for both trimers and tetramers.« less

  16. Integration of environmental aspects in modelling and optimisation of water supply chains.

    PubMed

    Koleva, Mariya N; Calderón, Andrés J; Zhang, Di; Styan, Craig A; Papageorgiou, Lazaros G

    2018-04-26

    Climate change becomes increasingly more relevant in the context of water systems planning. Tools are necessary to provide the most economic investment option considering the reliability of the infrastructure from technical and environmental perspectives. Accordingly, in this work, an optimisation approach, formulated as a spatially-explicit multi-period Mixed Integer Linear Programming (MILP) model, is proposed for the design of water supply chains at regional and national scales. The optimisation framework encompasses decisions such as installation of new purification plants, capacity expansion, and raw water trading schemes. The objective is to minimise the total cost incurring from capital and operating expenditures. Assessment of available resources for withdrawal is performed based on hydrological balances, governmental rules and sustainable limits. In the light of the increasing importance of reliability of water supply, a second objective, seeking to maximise the reliability of the supply chains, is introduced. The epsilon-constraint method is used as a solution procedure for the multi-objective formulation. Nash bargaining approach is applied to investigate the fair trade-offs between the two objectives and find the Pareto optimality. The models' capability is addressed through a case study based on Australia. The impact of variability in key input parameters is tackled through the implementation of a rigorous global sensitivity analysis (GSA). The findings suggest that variations in water demand can be more disruptive for the water supply chain than scenarios in which rainfalls are reduced. The frameworks can facilitate governmental multi-aspect decision making processes for the adequate and strategic investments of regional water supply infrastructure. Copyright © 2018. Published by Elsevier B.V.

  17. An analytical approach to the rise velocity of periodic bubble trains in non-Newtonian fluids.

    PubMed

    Frank, X; Li, H Z; Funfschilling, D

    2005-01-01

    The present study aims at providing insight into the acceleration mechanism of a bubble chain rising in shear-thinning viscoelastic fluids. The experimental investigation by the Particle Image Velocimetry (PIV), birefringence visualisation and rheological simulation shows that two aspects are central to bubble interactions in such media: the stress creation by the passage of bubbles, and their relaxation due to the fluid's memory forming an evanescent corridor of reduced viscosity. Interactions between bubbles were taken into account mainly through a linear superposition of the stress evolution behind each bubble. An analytical approach together with the rheological consideration was developed to compute the rise velocity of a bubble chain in function of the injection period and bubble volume. The model predictions compare satisfactorily with the experimental investigation.

  18. SCM: A method to improve network service layout efficiency with network evolution.

    PubMed

    Zhao, Qi; Zhang, Chuanhao; Zhao, Zheng

    2017-01-01

    Network services are an important component of the Internet, which are used to expand network functions for third-party developers. Network function virtualization (NFV) can improve the speed and flexibility of network service deployment. However, with the evolution of the network, network service layout may become inefficient. Regarding this problem, this paper proposes a service chain migration (SCM) method with the framework of "software defined network + network function virtualization" (SDN+NFV), which migrates service chains to adapt to network evolution and improves the efficiency of the network service layout. SCM is modeled as an integer linear programming problem and resolved via particle swarm optimization. An SCM prototype system is designed based on an SDN controller. Experiments demonstrate that SCM could reduce the network traffic cost and energy consumption efficiently.

  19. Global exponential stability of neutral high-order stochastic Hopfield neural networks with Markovian jump parameters and mixed time delays.

    PubMed

    Huang, Haiying; Du, Qiaosheng; Kang, Xibing

    2013-11-01

    In this paper, a class of neutral high-order stochastic Hopfield neural networks with Markovian jump parameters and mixed time delays is investigated. The jumping parameters are modeled as a continuous-time finite-state Markov chain. At first, the existence of equilibrium point for the addressed neural networks is studied. By utilizing the Lyapunov stability theory, stochastic analysis theory and linear matrix inequality (LMI) technique, new delay-dependent stability criteria are presented in terms of linear matrix inequalities to guarantee the neural networks to be globally exponentially stable in the mean square. Numerical simulations are carried out to illustrate the main results. © 2013 ISA. Published by ISA. All rights reserved.

  20. Use of milk fatty acids to estimate plasma nonesterified fatty acid concentrations as an indicator of animal energy balance.

    PubMed

    Dórea, J R R; French, E A; Armentano, L E

    2017-08-01

    Negative energy balance is an important part of the lactation cycle, and measuring the current energy balance of a cow is useful in both applied and research settings. The objectives of this study were (1) to determine if milk fatty acid (FA) proportions were consistently related to plasma nonesterified fatty acids (NEFA); (2) to determine if an individual cow with a measured milk FA profile is above or below a NEFA concentration, (3) to test the universality of the models developed within the University of Wisconsin and US Dairy Forage Research Center cows. Blood samples were collected on the same day as milk sampling from 105 Holstein cows from 3 studies. Plasma NEFA was quantified and a threshold of 600 µEq/L was applied to classify animals above this concentration as having high NEFA (NEFA high ). Thirty milk FA proportions and 4 milk FA ratios were screened to evaluate their capacity to classify cows with NEFA high according to determined milk FA threshold. In addition, 6 linear regression models were created using individual milk FA proportions and ratios. To evaluate the universality of the linear relationship between milk FA and plasma NEFA found in the internal data set, 90 treatment means from 21 papers published in the literature were compiled to test the model predictions. From the 30 screened milk FA, the odd short-chain fatty acids (C7:0, C9:0, C11:0, and C13:0) had sensitivity slightly greater than the other short-chain fatty acids (83.3, 94.8, 80.0, and 85.9%, respectively). The sensitivities for milk FA C6:0, C8:0, C10:0, and C12:0 were 78.8, 85.3, 80.1, and 83.9%, respectively. The threshold values to detect NEFA high cows for the last group of milk FA were ≤2.0, ≤0.94, ≤1.4, and ≤1.8 g/100 g of FA, respectively. The milk FA C14:0 and C15:0 had sensitivities of 88.7 and 85.0% and a threshold of ≤6.8 and ≤0.53 g/100 g of FA, respectively. The linear regressions using the milk FA ratios C18:1 to C15:0 and C17:0 to C15:0 presented lower root mean square error (RMSE = 191 and 179 µEq/L, respectively) in comparison with individual milk FA proportions (RMSE = 194 µEq/L), C18:1 to even short-medium-chain fatty acid (C4:0-C12:0) ratio (RMSE = 220 µEq/L), and C18:1 to C14:0 (RMSE = 199 µEq/L). Models using milk FA ratios C18:1 to C15:0 and C17:0 to C15:0 had a better fit with the external data set in comparison with the other models. Plasma NEFA can be predicted by linear regression models using milk FA ratios. Copyright © 2017 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  1. Preparation of a polymeric ionic liquid-coated solid-phase microextraction fiber by surface radical chain-transfer polymerization with stainless steel wire as support.

    PubMed

    Feng, Juanjuan; Sun, Min; Xu, Lili; Li, Jubai; Liu, Xia; Jiang, Shengxiang

    2011-10-28

    Polymeric 1-vinyl-3-octylimidazolium hexafluorophosphate was synthesized in situ on stainless steel wire by surface radical chain-transfer polymerization and used as sensitive coatings in solid-phase microextraction. The outer surface of the stainless steel wire was firstly coated with microstructured silver layer via silver mirror reaction and then functionalized with self-assembled monolayers of 1,8-octanedithiol, which acted as chain transfer agent in the polymerization. Coupled to gas chromatography, extraction performance of the fiber was studied with both headspace and direct-immersion modes using benzene, toluene, ethylbenzene and xylenes (BTEX), phenols and polycyclic aromatic hydrocarbon (PAHs) as model analytes. In combination with the microstructured silver layer, the PIL-coated fiber exhibited high extraction efficiency. Linear ranges for BTEX with headspace mode were in the range of 0.2-1000 μg L(-1) for benzene, and 0.1-1000 μg L(-1) for toluene, ethylbenzene and xylenes. Limits of detection (LODs) were from 0.02 to 0.05 μg L(-1). Wide linear ranges of direct-immersion mode for the extraction of several phenols and PAHs were also obtained with correlation coefficients (R) from 0.9943 to 0.9997. The proposed fiber showed good durability with long lifetime. RSDs of 56 times extraction were still in an acceptable range, from 8.85 to 22.8%. Copyright © 2011 Elsevier B.V. All rights reserved.

  2. Vibrational Markovian modelling of footprints after the interaction of antibiotics with the packaging region of HIV type 1.

    PubMed

    Díaz, Humberto González; de Armas, Ronal Ramos; Molina, Reinaldo

    2003-11-01

    The design of novel anti-HIV compounds has now become a crucial area for scientists working in numerous interrelated fields of science such as molecular biology, medicinal chemistry, mathematical biology, molecular modelling and bioinformatics. In this context, the development of simple but physically meaningful mathematical models to represent the interaction between anti-HIV drugs and their biological targets is of major interest. One such area currently under investigation involves the targets in the HIV-RNA-packaging region. In the work described here, we applied Markov chain theory in an attempt to describe the interaction between the antibiotic paromomycin and the packaging region of the RNA in Type-1 HIV. In this model, a nucleic acid squeezed graph is used. The vertices of the graph represent the nucleotides while the edges are the phosphodiester bonds. A stochastic (Markovian) matrix was subsequently defined on this graph, an operation that codifies the probabilities of interaction between specific nucleotides of HIV-RNA and the antibiotic. The strength of these local interactions can be calculated through an inelastic vibrational model. The successive power of this matrix codifies the probabilities with which the vibrations after drug-RNA interactions vanish along the polynucleotide main chain. The sums of self-return probabilities in the k-vicinity of each nucleotide represent physically meaningful descriptors. A linear discriminant function was developed and gave rise to excellent discrimination in 80.8% of interacting and footprinted nucleotides. The Jackknife method was employed to assess the stability and predictability of the model. On the other hand, a linear regression model predicted the local binding affinity constants between a specific nucleotide and the antibiotic (R(2)=0.91, Q(2)=0.86). These kinds of models could play an important role either in the discovery of new anti-HIV compounds or the study of their mode of action.

  3. On the formation of suspended noble-metal monatomic chains

    NASA Astrophysics Data System (ADS)

    Hasmy, A.; Rincón, L.; Hernández, R.; Mujica, V.; Márquez, M.; González, C.

    2008-09-01

    We present a tight-binding molecular-dynamics investigation of the geometrical and the electronic structure of suspended monatomic noble-metal chains. We show that linear monatomic chains are formed at temperatures equal to or smaller than 500 K for Au, 200 K for Ag, and 4 K for Cu and that they are stable for at least 10 ns. We also evidence that such stability is associated with the persisting sd orbital hybridization along the chains. The study highlights fundamental limitations of conductance measurement experiments to detect these chains in the breaking process of nanowires.

  4. Probability density of spatially distributed soil moisture inferred from crosshole georadar traveltime measurements

    NASA Astrophysics Data System (ADS)

    Linde, N.; Vrugt, J. A.

    2009-04-01

    Geophysical models are increasingly used in hydrological simulations and inversions, where they are typically treated as an artificial data source with known uncorrelated "data errors". The model appraisal problem in classical deterministic linear and non-linear inversion approaches based on linearization is often addressed by calculating model resolution and model covariance matrices. These measures offer only a limited potential to assign a more appropriate "data covariance matrix" for future hydrological applications, simply because the regularization operators used to construct a stable inverse solution bear a strong imprint on such estimates and because the non-linearity of the geophysical inverse problem is not explored. We present a parallelized Markov Chain Monte Carlo (MCMC) scheme to efficiently derive the posterior spatially distributed radar slowness and water content between boreholes given first-arrival traveltimes. This method is called DiffeRential Evolution Adaptive Metropolis (DREAM_ZS) with snooker updater and sampling from past states. Our inverse scheme does not impose any smoothness on the final solution, and uses uniform prior ranges of the parameters. The posterior distribution of radar slowness is converted into spatially distributed soil moisture values using a petrophysical relationship. To benchmark the performance of DREAM_ZS, we first apply our inverse method to a synthetic two-dimensional infiltration experiment using 9421 traveltimes contaminated with Gaussian errors and 80 different model parameters, corresponding to a model discretization of 0.3 m × 0.3 m. After this, the method is applied to field data acquired in the vadose zone during snowmelt. This work demonstrates that fully non-linear stochastic inversion can be applied with few limiting assumptions to a range of common two-dimensional tomographic geophysical problems. The main advantage of DREAM_ZS is that it provides a full view of the posterior distribution of spatially distributed soil moisture, which is key to appropriately treat geophysical parameter uncertainty and infer hydrologic models.

  5. Towards a physics-based multiscale modelling of the electro-mechanical coupling in electro-active polymers.

    PubMed

    Cohen, Noy; Menzel, Andreas; deBotton, Gal

    2016-02-01

    Owing to the increasing number of industrial applications of electro-active polymers (EAPs), there is a growing need for electromechanical models which accurately capture their behaviour. To this end, we compare the predicted behaviour of EAPs undergoing homogeneous deformations according to three electromechanical models. The first model is a phenomenological continuum-based model composed of the mechanical Gent model and a linear relationship between the electric field and the polarization. The electrical and the mechanical responses according to the second model are based on the physical structure of the polymer chain network. The third model incorporates a neo-Hookean mechanical response and a physically motivated microstructurally based long-chains model for the electrical behaviour. In the microstructural-motivated models, the integration from the microscopic to the macroscopic levels is accomplished by the micro-sphere technique. Four types of homogeneous boundary conditions are considered and the behaviours determined according to the three models are compared. For the microstructurally motivated models, these analyses are performed and compared with the widely used phenomenological model for the first time. Some of the aspects revealed in this investigation, such as the dependence of the intensity of the polarization field on the deformation, highlight the need for an in-depth investigation of the relationships between the structure and the behaviours of the EAPs at the microscopic level and their overall macroscopic response.

  6. Thermodynamic and dynamic behaviors of self-organizing polymeric systems

    NASA Astrophysics Data System (ADS)

    Zhao, Yiqiang

    Two topics of self-organizing polymeric systems are explored in this work: thermodynamic and dynamic properties of liquid crystal polymers in solutions and rheological behaviors of self-organizing gels. For dilute nematic solutions of end-on side-chain liquid crystal polysiloxanes (SCLCP) dissolved in 5CB, the chain anisotropies R∥/R ⊥, obtained from electrorheological(ER) analysis based on the Brochard model, are consistent with independent measurements of Rg∥/R g⊥ via small-angle neutron scattering (SANS), which unambiguously demonstrating a slightly prolate SCLCP chain conformation. Dissolution of this prolate SCLCP in flow-aligning 5CB produces a tumbling flow, clearly indicating a discrepancy with the Brochard hydrodynamic theory which predicts such a transition only for oblate conformation. A numerical comparison using a modified version of the Brochard model leads to improved self-consistent agreement between SANS, ER and shear transient experiments. The molecular weight dependence of the chain conformational relaxation time it indicates an extended SCLCP chain conformation in 5CB. SANS analysis suggests that the SCLCP conformation is sensitive to the solvent interaction, i.e. a more extended conformation is observed in isotropic acetone-d6 than in nematic 5CB. A SANS conformational study of SCLCCs with methoxyphenylbenzoate mesogenic side group in CDC13 demonstrates that the form factor of a single comb-like SCLCP chain is well described by a wormlike chain model with finite cross-sectional thickness over the entire q range, taking into account the molecular weight polydispersity. Consistent with measurement of a large R g from low q analysis, the resulting persistence length lp is in the range 28˜32 A, substantially larger than that of unsubstituted polydimethylsiloxane (PDMS) chain (l p =5.8 A), which suggests a relatively rigid SCLCP chain due to the influence of densely attached mesogenic groups. For nematic mixtures of copolysiloxane SCLCP in 5OCB, a metastably extended miscible nematic range is observed at low SCLCP concentration upon cooling. Onset of an induced smectic phase occurs upon cooling at 60%wt SCLCP concentration which corresponds to 48:52 molar ratio of mesogens. Dielectric spectra of these mixtures over a wide concentration range exhibit two distinct regimes of relaxation behavior reflecting the crossover from dilute and semidilute to concentrated regime. Rheological behavior of a metallo-supramolecular gel with thixotropic feature is explored to understand the viscoelastic behaviors of self-assembling networks consisting of "living polymers". A well-defined yield point and non-linear viscoelasticity at small strain are probed via the controlled-stress and controlled-strain measurements, respectively. The self-assembled network is readily presheared into a Newtonian sol and displays a three-stage kinetic recovery process, closely associated with the metal ion-ligand binding kinetics and related phase behaviors. Finally, we investigate the viscoelastic properties of a novel colloidal gel in which macrocycles self-assemble into interconnected self-organized clusters. A series of rheological experiments are combined to reveal the shear responsive nature as well as linear and nonlinear viscoelasticity of this gel. Certain features of observed viscoelastic properties demonstrate the characteristics of the behavior of colloidal gels which show slow glassy dynamics. The negative temperature dependence of the storage modulus at low frequency suggests that enthalpic contributions to elasticity need to be considered, presumably due to internal energy changes upon deformation.

  7. Continuous-time discrete-space models for animal movement

    USGS Publications Warehouse

    Hanks, Ephraim M.; Hooten, Mevin B.; Alldredge, Mat W.

    2015-01-01

    The processes influencing animal movement and resource selection are complex and varied. Past efforts to model behavioral changes over time used Bayesian statistical models with variable parameter space, such as reversible-jump Markov chain Monte Carlo approaches, which are computationally demanding and inaccessible to many practitioners. We present a continuous-time discrete-space (CTDS) model of animal movement that can be fit using standard generalized linear modeling (GLM) methods. This CTDS approach allows for the joint modeling of location-based as well as directional drivers of movement. Changing behavior over time is modeled using a varying-coefficient framework which maintains the computational simplicity of a GLM approach, and variable selection is accomplished using a group lasso penalty. We apply our approach to a study of two mountain lions (Puma concolor) in Colorado, USA.

  8. Analysis of laser energy characteristics of laser guided weapons based on the hardware-in-the-loop simulation system

    NASA Astrophysics Data System (ADS)

    Zhu, Yawen; Cui, Xiaohong; Wang, Qianqian; Tong, Qiujie; Cui, Xutai; Li, Chenyu; Zhang, Le; Peng, Zhong

    2016-11-01

    The hardware-in-the-loop simulation system, which provides a precise, controllable and repeatable test conditions, is an important part of the development of the semi-active laser (SAL) guided weapons. In this paper, laser energy chain characteristics were studied, which provides a theoretical foundation for the SAL guidance technology and the hardware-in-the-loop simulation system. Firstly, a simplified equation was proposed to adjust the radar equation according to the principles of the hardware-in-the-loop simulation system. Secondly, a theoretical model and calculation method were given about the energy chain characteristics based on the hardware-in-the-loop simulation system. We then studied the reflection characteristics of target and the distance between the missile and target with major factors such as the weather factors. Finally, the accuracy of modeling was verified by experiment as the values measured experimentally generally follow the theoretical results from the model. And experimental results revealed that ratio of attenuation of the laser energy exhibited a non-linear change vs. pulse number, which were in accord with the actual condition.

  9. Cytochrome b 6 f function and localization, phosphorylation state of thylakoid membrane proteins and consequences on cyclic electron flow.

    PubMed

    Dumas, Louis; Chazaux, Marie; Peltier, Gilles; Johnson, Xenie; Alric, Jean

    2016-09-01

    Both the structure and the protein composition of thylakoid membranes have an impact on light harvesting and electron transfer in the photosynthetic chain. Thylakoid membranes form stacks and lamellae where photosystem II and photosystem I localize, respectively. Light-harvesting complexes II can be associated to either PSII or PSI depending on the redox state of the plastoquinone pool, and their distribution is governed by state transitions. Upon state transitions, the thylakoid ultrastructure and lateral distribution of proteins along the membrane are subject to significant rearrangements. In addition, quinone diffusion is limited to membrane microdomains and the cytochrome b 6 f complex localizes either to PSII-containing grana stacks or PSI-containing stroma lamellae. Here, we discuss possible similarities or differences between green algae and C3 plants on the functional consequences of such heterogeneities in the photosynthetic electron transport chain and propose a model in which quinones, accepting electrons either from PSII (linear flow) or NDH/PGR pathways (cyclic flow), represent a crucial control point. Our aim is to give an integrated description of these processes and discuss their potential roles in the balance between linear and cyclic electron flows.

  10. Complete structural characterization of ceramides as [M – H]− ions by multiple-stage linear ion trap mass spectrometry

    PubMed Central

    Hsu, Fong-Fu

    2016-01-01

    Ceramide is a huge lipid family consisting of diversified structures including various modifications in the fatty acyl chain and the long chain base (LCB). In this contribution, negative-ion ESI linear ion-trap multiple-stage mass spectrometric method (LIT MSn) towards complete structural determination of ceramides in ten major families characterized as the [M – H]− ions is described. Multiple sets of fragment ions reflecting the fatty acyl chain and LCB were observed in the CID MS2 spectrum, while the sequential MS3 and MS4 spectra contain structural information for locating the double bond and the functional groups, permitting realization of the fragmentation processes. Thereby, differentiation of ceramide molecules varied by chain length, the LCB (sphingosine, phytosphigosine, 6-hydroxy-sphingosine), and by the modification (α-hydroxy-, β-hydroxy-, ω-hydroxy-FA) can be achieved; and many isomeric structures in the biological specimen can be revealed in detail. PMID:27523779

  11. Improving proton conduction pathways in di- and triblock copolymer membranes: Branched versus linear side chains

    NASA Astrophysics Data System (ADS)

    Dorenbos, G.

    2017-06-01

    Phase separation within a series of polymer membranes in the presence of water is studied by dissipative particle dynamics. Each polymer contains hydrophobic A beads and hydrophilic C beads. Three parent architectures are constructed from a backbone composed of connected hydrophobic A beads to which short ([C]), long ([A3C]), or symmetrically branched A5[AC][AC] side chains spring off. Three di-block copolymer derivatives are constructed by covalently bonding an A30 block to each parent architecture. Also three tri-blocks with A15 blocks attached to both ends of each parent architecture are modeled. Monte Carlo tracer diffusion calculations through the water containing pores for 1226 morphologies reveal that water diffusion for parent architectures is slowest and diffusion through the di-blocks is fastest. Furthermore, diffusion increases with side chain length and is highest for branched side chains. This is explained by the increase of water pore size with , which is the average number of bonds that A beads are separated from a nearest C bead. Optimization of within the amphiphilic parent architecture is expected to be essential in improving proton conduction in polymer electrolyte membranes.

  12. Global quantum discord and matrix product density operators

    NASA Astrophysics Data System (ADS)

    Huang, Hai-Lin; Cheng, Hong-Guang; Guo, Xiao; Zhang, Duo; Wu, Yuyin; Xu, Jian; Sun, Zhao-Yu

    2018-06-01

    In a previous study, we have proposed a procedure to study global quantum discord in 1D chains whose ground states are described by matrix product states [Z.-Y. Sun et al., Ann. Phys. 359, 115 (2015)]. In this paper, we show that with a very simple generalization, the procedure can be used to investigate quantum mixed states described by matrix product density operators, such as quantum chains at finite temperatures and 1D subchains in high-dimensional lattices. As an example, we study the global discord in the ground state of a 2D transverse-field Ising lattice, and pay our attention to the scaling behavior of global discord in 1D sub-chains of the lattice. We find that, for any strength of the magnetic field, global discord always shows a linear scaling behavior as the increase of the length of the sub-chains. In addition, global discord and the so-called "discord density" can be used to indicate the quantum phase transition in the model. Furthermore, based upon our numerical results, we make some reliable predictions about the scaling of global discord defined on the n × n sub-squares in the lattice.

  13. In situ microscopy of the self-assembly of branched nanocrystals in solution

    DOE PAGES

    Sutter, Eli; Tkachenko, Alexei V.; Sutter, Peter; ...

    2016-04-04

    Here, solution-phase self-assembly of nanocrystals into mesoscale structures is a promising strategy for constructing functional materials from nanoscale components. Liquid environments are key to self-assembly since they allow suspended nanocrystals to diffuse and interact freely, but they also complicate experiments. Real-time observations with single-particle resolution could have transformative impact on our understanding of nanocrystal self-assembly. Here we use real-time in situ imaging by liquid-cell electron microscopy to elucidate the nucleation and growth mechanism and properties of linear chains of octapod-shaped nanocrystals in their native solution environment. Statistical mechanics modelling based on these observations and using the measured chain-length distribution clarifiesmore » the relative importance of dipolar and entropic forces in the assembly process and gives direct access to the interparticle interaction. Our results suggest that monomer-resolved in situ imaging combined with modelling can provide unprecedented quantitative insight into the microscopic processes and interactions that govern nanocrystal self-assembly in solution.« less

  14. In situ microscopy of the self-assembly of branched nanocrystals in solution

    NASA Astrophysics Data System (ADS)

    Sutter, Eli; Sutter, Peter; Tkachenko, Alexei V.; Krahne, Roman; de Graaf, Joost; Arciniegas, Milena; Manna, Liberato

    2016-04-01

    Solution-phase self-assembly of nanocrystals into mesoscale structures is a promising strategy for constructing functional materials from nanoscale components. Liquid environments are key to self-assembly since they allow suspended nanocrystals to diffuse and interact freely, but they also complicate experiments. Real-time observations with single-particle resolution could have transformative impact on our understanding of nanocrystal self-assembly. Here we use real-time in situ imaging by liquid-cell electron microscopy to elucidate the nucleation and growth mechanism and properties of linear chains of octapod-shaped nanocrystals in their native solution environment. Statistical mechanics modelling based on these observations and using the measured chain-length distribution clarifies the relative importance of dipolar and entropic forces in the assembly process and gives direct access to the interparticle interaction. Our results suggest that monomer-resolved in situ imaging combined with modelling can provide unprecedented quantitative insight into the microscopic processes and interactions that govern nanocrystal self-assembly in solution.

  15. Novel Crystal Structure C60 Nanowire

    NASA Astrophysics Data System (ADS)

    Mickelson, William; Aloni, Shaul; Han, Weiqiang; Cumings, John; Zettl, Alex

    2003-03-01

    We have created insulated C60 nanowire by packing C60 molecules into the interior of insulating boron nitride (BN) nanotubes. For small-diameter BN tubes, the wire consists of a linear chain of C60's. With increasing BN tube inner diameter, novel C60 stacking configurations are obtained (including helical, hollow core, and incommensurate) which are unknown for bulk or thin film forms of C60. C60 in BN nanotubes presents a model system for studying the properties of new dimensionally-constrained "silo" crystal structures.

  16. Automating spectral unmixing of AVIRIS data using convex geometry concepts

    NASA Technical Reports Server (NTRS)

    Boardman, Joseph W.

    1993-01-01

    Spectral mixture analysis, or unmixing, has proven to be a useful tool in the semi-quantitative interpretation of AVIRIS data. Using a linear mixing model and a set of hypothesized endmember spectra, unmixing seeks to estimate the fractional abundance patterns of the various materials occurring within the imaged area. However, the validity and accuracy of the unmixing rest heavily on the 'user-supplied' set of endmember spectra. Current methods for emdmember determination are the weak link in the unmixing chain.

  17. Quantifying chain reptation in entangled polymer melts: Topological and dynamical mapping of atomistic simulation results onto the tube model

    NASA Astrophysics Data System (ADS)

    Stephanou, Pavlos S.; Baig, Chunggi; Tsolou, Georgia; Mavrantzas, Vlasis G.; Kröger, Martin

    2010-03-01

    The topological state of entangled polymers has been analyzed recently in terms of primitive paths which allowed obtaining reliable predictions of the static (statistical) properties of the underlying entanglement network for a number of polymer melts. Through a systematic methodology that first maps atomistic molecular dynamics (MD) trajectories onto time trajectories of primitive chains and then documents primitive chain motion in terms of a curvilinear diffusion in a tubelike region around the coarse-grained chain contour, we are extending these static approaches here even further by computing the most fundamental function of the reptation theory, namely, the probability ψ(s,t) that a segment s of the primitive chain remains inside the initial tube after time t, accounting directly for contour length fluctuations and constraint release. The effective diameter of the tube is independently evaluated by observing tube constraints either on atomistic displacements or on the displacement of primitive chain segments orthogonal to the initial primitive path. Having computed the tube diameter, the tube itself around each primitive path is constructed by visiting each entanglement strand along the primitive path one after the other and approximating it by the space of a small cylinder having the same axis as the entanglement strand itself and a diameter equal to the estimated effective tube diameter. Reptation of the primitive chain longitudinally inside the effective constraining tube as well as local transverse fluctuations of the chain driven mainly from constraint release and regeneration mechanisms are evident in the simulation results; the latter causes parts of the chains to venture outside their average tube surface for certain periods of time. The computed ψ(s,t) curves account directly for both of these phenomena, as well as for contour length fluctuations, since all of them are automatically captured in the atomistic simulations. Linear viscoelastic properties such as the zero shear rate viscosity and the spectra of storage and loss moduli obtained on the basis of the obtained ψ(s,t) curves for three different polymer melts (polyethylene, cis-1,4-polybutadiene, and trans-1,4-polybutadiene) are consistent with experimental rheological data and in qualitative agreement with the double reptation and dual constraint models. The new methodology is general and can be routinely applied to analyze primitive path dynamics and chain reptation in atomistic trajectories (accumulated through long MD simulations) of other model polymers or polymeric systems (e.g., bidisperse, branched, grafted, etc.); it is thus believed to be particularly useful in the future in evaluating proposed tube models and developing more accurate theories for entangled systems.

  18. New Paenibacillus strain produces a family of linear and cyclic antimicrobial lipopeptides: cyclization is not essential for their antimicrobial activity.

    PubMed

    Huang, En; Yang, Xu; Zhang, Liwen; Moon, Sun Hee; Yousef, Ahmed E

    2017-04-01

    A new bacterial isolate, Paenibacillus sp. OSY-N, showed potent antimicrobial activity against Gram-negative and Gram-positive bacteria. Antimicrobials produced by this strain were purified by reverse-phase high-performance liquid chromatography. Structural analysis, using mass spectrometry, of a single active HPLC fraction revealed two known cyclic lipopeptides (BMY-28160 and permetin A), a new cyclic lipopeptide, and the linear counterparts of these cyclic compounds. The latter were designated as paenipeptins A, B and C, respectively. The paenipeptins have not been reported before as naturally occurring products. Paenipeptins B and C differ at the acyl side chain; paenipeptin C contains a C8-, instead of C7-fatty acyl side chain. To demonstrate unequivocally the antimicrobial activity of the linear forms of this family of cyclic lipopeptides, analogs of the paenipeptins were synthesized chemically and their antimicrobial activity was tested individually. The synthetic linear lipopeptide with an octanoic acid side chain (designated as paenipeptin C΄) showed potent antimicrobial activity with minimum inhibitory concentrations of 0.5-4.0 μg/mL for Gram-negative and 0.5-32 μg/mL for Gram-positive bacteria. Findings demonstrated that peptide cyclization in this lipopeptide family is not essential for their antimicrobial activity. Most importantly, linear lipopeptides are more accessible than their cyclic counterparts through chemical synthesis. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  19. Quantum gap and spin-wave excitations in the Kitaev model on a triangular lattice

    NASA Astrophysics Data System (ADS)

    Avella, Adolfo; Di Ciolo, Andrea; Jackeli, George

    2018-05-01

    We study the effects of quantum fluctuations on the dynamical generation of a gap and on the evolution of the spin-wave spectra of a frustrated magnet on a triangular lattice with bond-dependent Ising couplings, analog of the Kitaev honeycomb model. The quantum fluctuations lift the subextensive degeneracy of the classical ground-state manifold by a quantum order-by-disorder mechanism. Nearest-neighbor chains remain decoupled and the surviving discrete degeneracy of the ground state is protected by a hidden model symmetry. We show how the four-spin interaction, emergent from the fluctuations, generates a spin gap shifting the nodal lines of the linear spin-wave spectrum to finite energies.

  20. Bayesian spatial transformation models with applications in neuroimaging data

    PubMed Central

    Miranda, Michelle F.; Zhu, Hongtu; Ibrahim, Joseph G.

    2013-01-01

    Summary The aim of this paper is to develop a class of spatial transformation models (STM) to spatially model the varying association between imaging measures in a three-dimensional (3D) volume (or 2D surface) and a set of covariates. Our STMs include a varying Box-Cox transformation model for dealing with the issue of non-Gaussian distributed imaging data and a Gaussian Markov Random Field model for incorporating spatial smoothness of the imaging data. Posterior computation proceeds via an efficient Markov chain Monte Carlo algorithm. Simulations and real data analysis demonstrate that the STM significantly outperforms the voxel-wise linear model with Gaussian noise in recovering meaningful geometric patterns. Our STM is able to reveal important brain regions with morphological changes in children with attention deficit hyperactivity disorder. PMID:24128143

  1. Free flowing and cohesive powders agitation in a cylindrical convective blender- kinetics experiments and Markov chain modelling

    NASA Astrophysics Data System (ADS)

    Legoix, Léonard; Milhé, Mathieu; Gatumel, Cendrine; Berthiaux, Henri

    2017-06-01

    An original methodology for studying powder flow in a cylindrical convective blender has been developed. A free-flowing and a cohesive powder were studied, at a fixed stirring speed, in rolling regime. For both powders, three apparent flow mechanisms were evidenced: convection in the volume swept by the blades, diffusion/shearing between the agitated zone and the stagnant one, as well as in the stagnant zone itself, and avalanches at the powder bed surface between agitated and stagnant zones. After defining six zones in the blender, tracing experiments were carried out by placing appropriate tracers in different starting zones and sampling the whole bed at different stirring times, which lead to mixing kinetics of the powders into themselves. A Markov chains model of the blender allowed the quantification of the three mechanisms respective magnitude by fitting the experimental data. This simple model has a good agreement with the free-flowing powder data, but is not able to represent well the observations for the cohesive powder. Bed consolidation should probably be taken into account for this kind of powders and thus a linear Markov model is not sufficient.

  2. Molecular structure of dextran sulphate sodium in aqueous environment

    NASA Astrophysics Data System (ADS)

    Yu, Miao; Every, Hayley A.; Jiskoot, Wim; Witkamp, Geert-Jan; Buijs, Wim

    2018-03-01

    Here we propose a 3D-molecular structural model for dextran sulphate sodium (DSS) in a neutral aqueous environment based on the results of a molecular modelling study. The DSS structure is dominated by the stereochemistry of the 1,6-linked α-glucose units and the presence of two sulphate groups on each α-glucose unit. The structure of DSS can be best described as a helix with various patterns of di-sulphate substitution on the glucose rings. The presence of a side chain does not alter the 3D-structure of the linear main chain much, but affects the overall spatial dimension of the polymer. The simulated polymers have a diameter similar to or in some cases even larger than model α-hemolysin nano-pores for macromolecule transport in many biological processes, indicating a size-limited translocation through such pores. All results of the molecular modelling study are in line with previously reported experimental data. This study establishes the three-dimensional structure of DSS and summarizes the spatial dimension of the polymer, serving as the basis for a better understanding on the molecular level of DSS-involved electrostatic interaction processes with biological components like proteins and cell pores.

  3. Monte-Carlo simulations of a coarse-grained model for α-oligothiophenes

    NASA Astrophysics Data System (ADS)

    Almutairi, Amani; Luettmer-Strathmann, Jutta

    The interfacial layer of an organic semiconductor in contact with a metal electrode has important effects on the performance of thin-film devices. However, the structure of this layer is not easy to model. Oligothiophenes are small, π-conjugated molecules with applications in organic electronics that also serve as small-molecule models for polythiophenes. α-hexithiophene (6T) is a six-ring molecule, whose adsorption on noble metal surfaces has been studied extensively (see, e.g., Ref.). In this work, we develop a coarse-grained model for α-oligothiophenes. We describe the molecules as linear chains of bonded, discotic particles with Gay-Berne potential interactions between non-bonded ellipsoids. We perform Monte Carlo simulations to study the structure of isolated and adsorbed molecules

  4. Seeing the order in a mess: optical signature of periodicity in a cloud of plasmonic nanowires.

    PubMed

    Natarov, Denys M; Marciniak, Marian; Sauleau, Ronan; Nosich, Alexander I

    2014-11-17

    We consider the two-dimensional (2-D) problem of the H-polarized plane wave scattering by a linear chain of silver nanowires in a cloud of similar pseudo-randomly located wires, in the visible range. Numerical solution uses the field expansions in local coordinates and addition theorems for cylindrical functions and has a guaranteed convergence. The total scattering cross-sections and near- and far-zone field patterns are presented. The observed resonance effects are studied and compared with their counterparts in the scattering by the same linear chain of wires in free space.

  5. Collision of Identical Solitary Waves in Hertzian Chains

    NASA Astrophysics Data System (ADS)

    Sen, Surajit; Manciu, Marian; Hurd, Alan J.

    2000-03-01

    We consider a chain of elastic beads, which repel upon contact according to the non-linear Hertz potential. We further assume that the chain is under zero loading, i.e., the grains have zero initial overlap. We show via careful numerical solution of the equations of motion that an impulse propagates as a solitary wave and that the collision of identical solitary waves propagating in opposite directions along the chain spawns a hierarchy of multiple weak solitary waves [1]. [1] M. Manciu, S. Sen and A.J. Hurd, Phys Lett A (submitted).

  6. The influence of polymer architectures on the dewetting behavior of thin polymer films: from linear chains to ring chains.

    PubMed

    Wang, Lina; Xu, Lin; Liu, Binyuan; Shi, Tongfei; Jiang, Shichun; An, Lijia

    2017-05-03

    The dewetting behavior of ring polystyrene (RPS) film and linear polystyrene (LPS) film on silanized Si substrates with different grafting densities and PDMS substrate was investigated. Results showed that polymer architectures greatly influenced the dewetting behavior of the thin polymer film. On the silanized Si substrate with 69% grafting density, RPS chains exhibited stronger adsorption compared with LPS chains, and as a result the wetting layer formed more easily. For LPS films, with a decreased annealing temperature, the stability of the polymer film changed from non-slip dewetting via apparent slip dewetting to apparently stable. However, for RPS films, the polymer film stability switched from apparent slip dewetting to apparently stable. On the silanized Si substrate with 94% grafting density, the chain adsorption became weaker and the dewetting processes were faster than that on the substrate with 69% grafting density at the same experimental temperature for both the LPS and RPS films. Moreover, on the PDMS substrate, LPS films always showed non-slip dewetting, while the dewetting kinetics of RPS films switched from non-slip dewetting to slip dewetting behaviour. Forming the wetting layer strongly influenced the stability and dewetting behavior of the thin polymer films.

  7. Endocrine disrupting alkylphenols: structural requirements for their adverse effects on Ca2+ pumps, Ca2+ homeostasis & Sertoli TM4 cell viability.

    PubMed

    Michelangeli, Francesco; Ogunbayo, Oluseye A; Wootton, Laura L; Lai, Pei F; Al-Mousa, Fawaz; Harris, Robert M; Waring, Rosemary H; Kirk, Christopher J

    2008-11-25

    Alkylphenols such as nonylphenol are pollutants that are widely dispersed within our environment. They bio-accumulate within man, with levels in the muM concentration range reported in human tissues. These chemicals act as endocrine disruptors, having xenoestrogenic activity. More recently alkylphenols have also been shown to affect Ca2+ signalling pathways. Here we show that alkylphenols are potent inhibitors of sarcoplasmic-endoplasmic reticulum Ca2+-ATPase (SERCA) activity. For linear chain alkylphenols the potency of inhibition is related to chain length, with the IC50 values for inhibition ranging from 8 microM for 4-n-nonylphenol (C9) to 1.3 mM for 4-n-propylphenol (C3). Branched chain alkylphenols generally had lower potencies than their linear chain counterparts, however, good correlations for all alkylphenols were observed between their Ca2+ pump inhibition and hydrophobicity, molecular volume and flexibility, indicating that these parameters are all important factors. Alkylphenols cause abnormal elevations of intracellular [Ca2+] within TM4 Sertoli cells (cells involved in sperm maturation) depolarise their mitochondria and induce cell death in these cells, in an alkyl chain size-dependent manner.

  8. First principles study of hydrogen adsorption on carbon nanowires.

    NASA Astrophysics Data System (ADS)

    Tapia, Alejandro; Aguilera, Luis; Murrieta, Gabriel; de Coss, Romeo

    2007-03-01

    Recently has been reported a new type of one-dimensional carbon structures. Carbon nanowires formed by a linear carbon-atom chain inside an armchair (5,5) carbon nanotube has been observed using high-resolution transmission electron microscopy. In the present work we have studied the changes in the electronic structure of a carbon nanowires and (5,5) single-walled carbon nanotubes (SWCN) when a hydrogen atom is adsorbed. We used the Density Functional Theory and the calculations where performed by the pseudopotentials LCAO method (SIESTA code) and the Generalized Gradient Approximation (GGA) for the exchange-correlation potential. We have analyzed the changes in the atomic structure, density of states (LDOS), and the local orbital population. We found charge transfer from the nanotube to the linear chain and the hydrogen atom, the electronic character of the chain and nanotube sub-systems in chain@SWCN is the same that in the corresponding isolated systems, chain or SWCN. But the hydrogen adsorption produced changes in the atomic estructure and the electronic properties. This research was supported by PRIORI-UADY under Grant No. FING-05-004 and Consejo Nacional de Ciencia y Tecnolog'ia (Conacyt) under Grants No. 43830-F and 49985-J.

  9. Circuit topology of proteins and nucleic acids.

    PubMed

    Mashaghi, Alireza; van Wijk, Roeland J; Tans, Sander J

    2014-09-02

    Folded biomolecules display a bewildering structural complexity and diversity. They have therefore been analyzed in terms of generic topological features. For instance, folded proteins may be knotted, have beta-strands arranged into a Greek-key motif, or display high contact order. In this perspective, we present a method to formally describe the topology of all folded linear chains and hence provide a general classification and analysis framework for a range of biomolecules. Moreover, by identifying the fundamental rules that intrachain contacts must obey, the method establishes the topological constraints of folded linear chains. We also briefly illustrate how this circuit topology notion can be applied to study the equivalence of folded chains, the engineering of artificial RNA structures and DNA origami, the topological structure of genomes, and the role of topology in protein folding. Copyright © 2014 Elsevier Ltd. All rights reserved.

  10. The weight hierarchies and chain condition of a class of codes from varieties over finite fields

    NASA Technical Reports Server (NTRS)

    Wu, Xinen; Feng, Gui-Liang; Rao, T. R. N.

    1996-01-01

    The generalized Hamming weights of linear codes were first introduced by Wei. These are fundamental parameters related to the minimal overlap structures of the subcodes and very useful in several fields. It was found that the chain condition of a linear code is convenient in studying the generalized Hamming weights of the product codes. In this paper we consider a class of codes defined over some varieties in projective spaces over finite fields, whose generalized Hamming weights can be determined by studying the orbits of subspaces of the projective spaces under the actions of classical groups over finite fields, i.e., the symplectic groups, the unitary groups and orthogonal groups. We give the weight hierarchies and generalized weight spectra of the codes from Hermitian varieties and prove that the codes satisfy the chain condition.

  11. Calorie changes in chain restaurant menu items: implications for obesity and evaluations of menu labeling.

    PubMed

    Bleich, Sara N; Wolfson, Julia A; Jarlenski, Marian P

    2015-01-01

    Supply-side reductions to the calories in chain restaurants are a possible benefit of upcoming menu labeling requirements. To describe trends in calories available in large U.S. restaurants. Data were obtained from the MenuStat project, a census of menu items in 66 of the 100 largest U.S. restaurant chains, for 2012 and 2013 (N=19,417 items). Generalized linear models were used to calculate (1) the mean change in calories from 2012 to 2013, among items on the menu in both years; and (2) the difference in mean calories, comparing newly introduced items to those on the menu in 2012 only (overall and between core versus non-core items). Data were analyzed in 2014. Mean calories among items on menus in both 2012 and 2013 did not change. Large restaurant chains in the U.S. have recently had overall declines in calories in newly introduced menu items (-56 calories, 12% decline). These declines were concentrated mainly in new main course items (-67 calories, 10% decline). New beverage (-26 calories, 8% decline) and children's (-46 calories, 20% decline) items also had fewer mean calories. Among chain restaurants with a specific focus (e.g., burgers), average calories in new menu items not core to the business declined more than calories in core menu items. Large chain restaurants significantly reduced the number of calories in newly introduced menu items. Supply-side changes to the calories in chain restaurants may have a significant impact on obesity prevention. Copyright © 2015 American Journal of Preventive Medicine. Published by Elsevier Inc. All rights reserved.

  12. Calorie Changes in Chain Restaurant Menu Items: Implications for Obesity and Evaluations of Menu Labeling

    PubMed Central

    Bleich, Sara N.; Wolfson, Julia A.; Jarlenski, Marian P.

    2014-01-01

    Background Supply-side reductions to the calories in chain restaurants are a possible benefit of upcoming menu labeling requirements. Purpose To describe trends in calories available in large U.S. restaurants. Methods Data were obtained from the MenuStat project, a census of menu items in 66 of the 100 largest U.S. restaurant chains, for 2012 and 2013 (N=19,417 items). Generalized linear models were used to calculate: (1) the mean change in calories from 2012 to 2013, among items on the menu in both years; and (2) the difference in mean calories, comparing newly introduced items to those on the menu in 2012 only (overall and between core versus non-core items). Data were analyzed in 2014. Results Mean calories among items on menus in both 2012 and 2013 did not change. Large restaurant chains in the U.S. have recently had overall declines in calories in newly introduced menu items (−56 calories, 12% decline). These declines were concentrated mainly in new main course items (−67 calories, 10% decline). New beverage (−26 calories, 8% decline) and children’s (−46 calories, 20% decline) items also had fewer mean calories. Among chain restaurants with a specific focus (e.g., burgers), average calories in new menu items not core to the business declined more than calories in core menu items. Conclusions Large chain restaurants significantly reduced the number of calories in newly introduced menu items. Supply-side changes to the calories in chain restaurants may have a significant impact on obesity prevention. PMID:25306397

  13. Organometallic macromolecules with piano stool coordination repeating units: chain configuration and stimulated solution behaviour.

    PubMed

    Cao, Kai; Ward, Jonathan; Amos, Ryan C; Jeong, Moon Gon; Kim, Kyoung Taek; Gauthier, Mario; Foucher, Daniel; Wang, Xiaosong

    2014-09-11

    Theoretical calculations illustrate that organometallic macromolecules with piano stool coordination repeating units (Fe-acyl complex) adopt linear chain configuration with a P-Fe-C backbone surrounded by aromatic groups. The macromolecules show molecular weight-dependent and temperature stimulated solution behaviour in DMSO.

  14. Optimal planning for the sustainable utilization of municipal solid waste.

    PubMed

    Santibañez-Aguilar, José Ezequiel; Ponce-Ortega, José María; Betzabe González-Campos, J; Serna-González, Medardo; El-Halwagi, Mahmoud M

    2013-12-01

    The increasing generation of municipal solid waste (MSW) is a major problem particularly for large urban areas with insufficient landfill capacities and inefficient waste management systems. Several options associated to the supply chain for implementing a MSW management system are available, however to determine the optimal solution several technical, economic, environmental and social aspects must be considered. Therefore, this paper proposes a mathematical programming model for the optimal planning of the supply chain associated to the MSW management system to maximize the economic benefit while accounting for technical and environmental issues. The optimization model simultaneously selects the processing technologies and their location, the distribution of wastes from cities as well as the distribution of products to markets. The problem was formulated as a multi-objective mixed-integer linear programing problem to maximize the profit of the supply chain and the amount of recycled wastes, where the results are showed through Pareto curves that tradeoff economic and environmental aspects. The proposed approach is applied to a case study for the west-central part of Mexico to consider the integration of MSW from several cities to yield useful products. The results show that an integrated utilization of MSW can provide economic, environmental and social benefits. Copyright © 2013 Elsevier Ltd. All rights reserved.

  15. A generalized electro-elastic theory of polymer networks

    NASA Astrophysics Data System (ADS)

    Cohen, Noy

    2018-01-01

    A rigorous multi-scale analysis of the electromechanical coupling in dielectric polymers is conducted. The body couples stemming from a misalignment between the electric field and the electric-dipole density vector are studied and the conservation laws for polymer networks are derived. Using variational principles, expressions for the polarization and the stress are determined. Interestingly, it is found that the stress tensor resulting from coupled loadings in which the electric field is misaligned with the principal stretch directions is not symmetric and the asymmetry arises from the body couples. Next, the electro-mechanical response of a chain is analyzed. The deformations of the individual polymer chains are related to the macroscopic deformation via two highly non-linear constraints - the first pertaining to the compatibility of the local deformations with the imposed macroscopic one and the second stems from the symmetric part of the stress at equilibrium. In accord with the proposed framework, an amended three-chains model is introduced. The predictions of this model are found to be in excellent agreement with experimental findings. Lastly, the behavior of a polymer subjected to a simple shear and an electric field is studied. The offset between the electric field and the principal directions gives rise to body couples, a polarization that is not aligned with the electric field, and an asymmetric stress tensor.

  16. Allele Age Under Non-Classical Assumptions is Clarified by an Exact Computational Markov Chain Approach.

    PubMed

    De Sanctis, Bianca; Krukov, Ivan; de Koning, A P Jason

    2017-09-19

    Determination of the age of an allele based on its population frequency is a well-studied problem in population genetics, for which a variety of approximations have been proposed. We present a new result that, surprisingly, allows the expectation and variance of allele age to be computed exactly (within machine precision) for any finite absorbing Markov chain model in a matter of seconds. This approach makes none of the classical assumptions (e.g., weak selection, reversibility, infinite sites), exploits modern sparse linear algebra techniques, integrates over all sample paths, and is rapidly computable for Wright-Fisher populations up to N e  = 100,000. With this approach, we study the joint effect of recurrent mutation, dominance, and selection, and demonstrate new examples of "selective strolls" where the classical symmetry of allele age with respect to selection is violated by weakly selected alleles that are older than neutral alleles at the same frequency. We also show evidence for a strong age imbalance, where rare deleterious alleles are expected to be substantially older than advantageous alleles observed at the same frequency when population-scaled mutation rates are large. These results highlight the under-appreciated utility of computational methods for the direct analysis of Markov chain models in population genetics.

  17. 10B+α states with chain-like structures in 14N

    NASA Astrophysics Data System (ADS)

    Kanada-En'yo, Yoshiko

    2015-12-01

    I investigate 10B+α -cluster states of 14N with a 10B+α -cluster model. Near the α -decay threshold energy, I obtain Kπ=3+ and Kπ=1+ rotational bands having 10B(3+) +α and 10B(1+) +α components, respectively. I assign the bandhead state of the Kπ=3+ band to the experimental 3+ at Ex=13.19 MeV of 14N observed in α scattering reactions by 10B and show that the calculated α -decay width is consistent with the experimental data. I discuss an α -cluster motion around the 10B cluster and show that the Kπ=3+ and Kπ=1+ rotational bands contain an enhanced component of a linear-chain 3 α configuration, in which an α cluster is localized in the longitudinal direction around the deformed 10B cluster.

  18. Multiple spatially localized dynamical states in friction-excited oscillator chains

    NASA Astrophysics Data System (ADS)

    Papangelo, A.; Hoffmann, N.; Grolet, A.; Stender, M.; Ciavarella, M.

    2018-03-01

    Friction-induced vibrations are known to affect many engineering applications. Here, we study a chain of friction-excited oscillators with nearest neighbor elastic coupling. The excitation is provided by a moving belt which moves at a certain velocity vd while friction is modelled with an exponentially decaying friction law. It is shown that in a certain range of driving velocities, multiple stable spatially localized solutions exist whose dynamical behavior (i.e. regular or irregular) depends on the number of oscillators involved in the vibration. The classical non-repeatability of friction-induced vibration problems can be interpreted in light of those multiple stable dynamical states. These states are found within a "snaking-like" bifurcation pattern. Contrary to the classical Anderson localization phenomenon, here the underlying linear system is perfectly homogeneous and localization is solely triggered by the friction nonlinearity.

  19. SCM: A method to improve network service layout efficiency with network evolution

    PubMed Central

    Zhao, Qi; Zhang, Chuanhao

    2017-01-01

    Network services are an important component of the Internet, which are used to expand network functions for third-party developers. Network function virtualization (NFV) can improve the speed and flexibility of network service deployment. However, with the evolution of the network, network service layout may become inefficient. Regarding this problem, this paper proposes a service chain migration (SCM) method with the framework of “software defined network + network function virtualization” (SDN+NFV), which migrates service chains to adapt to network evolution and improves the efficiency of the network service layout. SCM is modeled as an integer linear programming problem and resolved via particle swarm optimization. An SCM prototype system is designed based on an SDN controller. Experiments demonstrate that SCM could reduce the network traffic cost and energy consumption efficiently. PMID:29267299

  20. A new way of visualising quantum fields

    NASA Astrophysics Data System (ADS)

    Linde, Helmut

    2018-05-01

    Quantum field theory (QFT) is the basis of some of the most fundamental theories in modern physics, but it is not an easy subject to learn. In the present article we intend to pave the way from quantum mechanics to QFT for students at early graduate or advanced undergraduate level. More specifically, we propose a new way of visualising the wave function Ψ of a linear chain of interacting quantum harmonic oscillators, which can be seen as a model for a simple one-dimensional bosonic quantum field. The main idea is to draw randomly chosen classical states of the chain superimposed upon each other and use a grey scale to represent the value of Ψ at the corresponding coordinates of the quantised system. Our goal is to establish a better intuitive understanding of the mathematical objects underlying quantum field theories and solid state physics.

  1. Expansion Potentials for Exact Far-from-Equilibrium Spreading of Particles and Energy

    DOE PAGES

    Vasseur, Romain; Karrasch, Christoph; Moore, Joel E.

    2015-12-01

    We report that the rates at which energy and particle densities move to equalize arbitrarily large temperature and chemical potential differences in an isolated quantum system have an emergent thermodynamical description whenever energy or particle current commutes with the Hamiltonian. Concrete examples include the energy current in the 1D spinless fermion model with nearest-neighbor interactions (XXZ spin chain), energy current in Lorentz-invariant theories or particle current in interacting Bose gases in arbitrary dimension. Even far from equilibrium, these rates are controlled by state functions, which we call "expansion potentials", expressed as integrals of equilibrium Drude weights. This relation between nonequilibriummore » quantities and linear response implies non-equilibrium Maxwell relations for the Drude weights. Lastly, we verify our results via DMRG calculations for the XXZ chain.« less

  2. Parasitic chytrids sustain zooplankton growth during inedible algal bloom

    PubMed Central

    Rasconi, Serena; Grami, Boutheina; Niquil, Nathalie; Jobard, Marlène; Sime-Ngando, Télesphore

    2014-01-01

    This study assesses the quantitative impact of parasitic chytrids on the planktonic food web of two contrasting freshwater lakes during different algal bloom situations. Carbon-based food web models were used to investigate the effects of chytrids during the spring diatom bloom in Lake Pavin (oligo-mesotrophic) and the autumn cyanobacteria bloom in Lake Aydat (eutrophic). Linear inverse modeling was employed to estimate undetermined flows in both lakes. The Monte Carlo Markov chain linear inverse modeling procedure provided estimates of the ranges of model-derived fluxes. Model results confirm recent theories on the impact of parasites on food web function through grazers and recyclers. During blooms of “inedible” algae (unexploited by planktonic herbivores), the epidemic growth of chytrids channeled 19–20% of the primary production in both lakes through the production of grazer exploitable zoospores. The parasitic throughput represented 50% and 57% of the zooplankton diet, respectively, in the oligo-mesotrophic and in the eutrophic lakes. Parasites also affected ecological network properties such as longer carbon path lengths and loop strength, and contributed to increase the stability of the aquatic food web, notably in the oligo-mesotrophic Lake Pavin. PMID:24904543

  3. Carbon Chain Anions and the Growth of Complex Organic Molecules in Titan’s Ionosphere

    NASA Astrophysics Data System (ADS)

    Desai, R. T.; Coates, A. J.; Wellbrock, A.; Vuitton, V.; Crary, F. J.; González-Caniulef, D.; Shebanits, O.; Jones, G. H.; Lewis, G. R.; Waite, J. H.; Cordiner, M.; Taylor, S. A.; Kataria, D. O.; Wahlund, J.-E.; Edberg, N. J. T.; Sittler, E. C.

    2017-08-01

    Cassini discovered a plethora of neutral and ionized molecules in Titan’s ionosphere including, surprisingly, anions and negatively charged molecules extending up to 13,800 u q-1. In this Letter, we forward model the Cassini electron spectrometer response function to this unexpected ionospheric component to achieve an increased mass resolving capability for negatively charged species observed at Titan altitudes of 950-1300 km. We report on detections consistently centered between 25.8 and 26.0 u q-1 and between 49.0-50.1 u q-1 which are identified as belonging to the carbon chain anions, CN-/C3N- and/or C2H-/C4H-, in agreement with chemical model predictions. At higher ionospheric altitudes, detections at 73-74 u q-1 could be attributed to the further carbon chain anions C5N-/C6H- but at lower altitudes and during further encounters extend over a higher mass/charge range. This, as well as further intermediary anions detected at >100 u, provide the first evidence for efficient anion chemistry in space involving structures other than linear chains. Furthermore, at altitudes below <1100 km, the low-mass anions (<150 u q-1) were found to deplete at a rate proportional to the growth of the larger molecules, a correlation that indicates the anions are tightly coupled to the growth process. This study adds Titan to an increasing list of astrophysical environments where chain anions have been observed and shows that anion chemistry plays a role in the formation of complex organics within a planetary atmosphere as well as in the interstellar medium.

  4. Microbial synthesis of medium-chain chemicals from renewables.

    PubMed

    Sarria, Stephen; Kruyer, Nicholas S; Peralta-Yahya, Pamela

    2017-12-01

    Linear, medium-chain (C8-C12) hydrocarbons are important components of fuels as well as commodity and specialty chemicals. As industrial microbes do not contain pathways to produce medium-chain chemicals, approaches such as overexpression of endogenous enzymes or deletion of competing pathways are not available to the metabolic engineer; instead, fatty acid synthesis and reversed β-oxidation are manipulated to synthesize medium-chain chemical precursors. Even so, chain lengths remain difficult to control, which means that purification must be used to obtain the desired products, titers of which are typically low and rarely exceed milligrams per liter. By engineering the substrate specificity and activity of the pathway enzymes that generate the fatty acyl intermediates and chain-tailoring enzymes, researchers can boost the type and yield of medium-chain chemicals. Development of technologies to both manipulate chain-tailoring enzymes and to assay for products promises to enable the generation of g/L yields of medium-chain chemicals.

  5. Theoretical study of structure and stability of small gadolinium carboxylate complexes in liquid scintillator solvents.

    PubMed

    Huang, Pin-Wen

    2014-09-01

    The structural properties of three small gadolinium carboxylate complexes in three liquid scintillator solvents (pseudocumene, linear alkylbenzene, and phenyl xylylethane) were theoretically investigated using density functional theory (B3LYP/LC-RECP) and polarizable continuum model (PCM). The average interaction energy between gadolinium atom and carboxylate ligand (E(int)) and the energy difference of the highest singly occupied molecular orbital and lowest unoccupied molecular orbital (Δ(SL)) were calculated to evaluate and compare the relative stability of these complexes in solvents. The calculation results show that the larger (with a longer alkyl chain) gadolinium carboxylate complex has greater stability than the smaller one, while these gadolinium carboxylates in linear alkylbenzene were found to have greater stability than those in the other two solvents.

  6. Surface structure evolution in a homologous series of ionic liquids

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Haddad, Julia; Pontoni, Diego; Murphy, Bridget M.

    Interfaces of room temperature ionic liquids (RTILs) are important for both applications and basic science and are therefore intensely studied. However, the evolution of their interface structure with the cation’s alkyl chain length n from Coulomb to van der Waals interaction domination has not yet been studied for even a single broad homologous RTIL series. We present in this paper such a study of the liquid–air interface for n = 2 to 22, using angstrom-resolution X-ray methods. For n < 6, a typical “simple liquid” monotonic surface-normal electron density profile ρ e more » ( z ) is obtained, like those of water and organic solvents. For n > 6, increasingly more pronounced nanoscale self-segregation of the molecules’ charged moieties and apolar chains yields surface layering with alternating regions of headgroups and chains. The layering decays into the bulk over a few, to a few tens, of nanometers. The layering periods and decay lengths, their linear n dependence, and slopes are discussed within two models, one with partial-chain interdigitation and the other with liquid-like chains. No surface-parallel long-range order is found within the surface layer. For n = 22, a different surface phase is observed above melting. Finally, our results also impact general liquid-phase issues like supramolecular self-aggregation and bulk–surface structure relations.« less

  7. Electrostatic stiffening and induced persistence length for coassembled molecular bottlebrushes

    NASA Astrophysics Data System (ADS)

    Storm, Ingeborg M.; Stuart, Martien A. Cohen; de Vries, Renko; Leermakers, Frans A. M.

    2018-03-01

    A self-consistent field analysis for tunable contributions to the persistence length of isolated semiflexible polymer chains including electrostatically driven coassembled deoxyribonucleic acid (DNA) bottlebrushes is presented. When a chain is charged, i.e., for polyelectrolytes, there is, in addition to an intrinsic rigidity, an electrostatic stiffening effect, because the electric double layer resists bending. For molecular bottlebrushes, there is an induced contribution due to the grafts. We explore cases beyond the classical phantom main-chain approximation and elaborate molecularly more realistic models where the backbone has a finite volume, which is necessary for treating coassembled bottlebrushes. We find that the way in which the linear charge density or the grafting density is regulated is important. Typically, the stiffening effect is reduced when there is freedom for these quantities to adapt to the curvature stresses. Electrostatically driven coassembled bottlebrushes, however, are relatively stiff because the chains have a low tendency to escape from the compressed regions and the electrostatic binding force is largest in the convex part. For coassembled bottlebrushes, the induced persistence length is a nonmonotonic function of the polymer concentration: For low polymer concentrations, the stiffening grows quadratically with coverage; for semidilute polymer concentrations, the brush chains retract and regain their Gaussian size. When doing so, they lose their induced persistence length contribution. Our results correlate well with observed physical characteristics of electrostatically driven coassembled DNA-bioengineered protein-polymer bottlebrushes.

  8. Surface structure evolution in a homologous series of ionic liquids

    DOE PAGES

    Haddad, Julia; Pontoni, Diego; Murphy, Bridget M.; ...

    2018-01-22

    Interfaces of room temperature ionic liquids (RTILs) are important for both applications and basic science and are therefore intensely studied. However, the evolution of their interface structure with the cation’s alkyl chain length n from Coulomb to van der Waals interaction domination has not yet been studied for even a single broad homologous RTIL series. We present in this paper such a study of the liquid–air interface for n = 2 to 22, using angstrom-resolution X-ray methods. For n < 6, a typical “simple liquid” monotonic surface-normal electron density profile ρ e more » ( z ) is obtained, like those of water and organic solvents. For n > 6, increasingly more pronounced nanoscale self-segregation of the molecules’ charged moieties and apolar chains yields surface layering with alternating regions of headgroups and chains. The layering decays into the bulk over a few, to a few tens, of nanometers. The layering periods and decay lengths, their linear n dependence, and slopes are discussed within two models, one with partial-chain interdigitation and the other with liquid-like chains. No surface-parallel long-range order is found within the surface layer. For n = 22, a different surface phase is observed above melting. Finally, our results also impact general liquid-phase issues like supramolecular self-aggregation and bulk–surface structure relations.« less

  9. Growing ethanol sector drives corn supply chain shift for the last decade

    NASA Astrophysics Data System (ADS)

    Kim, T.; Schmitt, J.; Brauman, K. A.; Smith, T. M.; Suh, K.

    2017-12-01

    The US is the largest producer in the world, 89% of corn production uses in domestic demands in 2012. Carbon emission and irrigated water usage in the corn farming stage are hot-spot in the meat production sectors, comprise 37% of all US corn demand. The annual capacity of the ethanol sector increases from 6.5 billion gallons to 15.3 billion gallons for the last decade. The growth of corn demand in ethanol sector makes corn supply chain shift. Most of the ethanol plants located in the Mid-west where is the top 12 corn producing states. Therefore animal feeds take more supply from the other states. The purpose of this study is to estimate environmental impacts and water scarcity associated embedded corn by the temporal and spatial corn supply chain model based on a cost minimization. We use publicly available county-level data on corn production, feed demands, aggregative carbon emission and irrigated water usage in farming state, and a water depletion index as a metric for determining water scarcity. The water stressed counties produce 23.3% of US total corn production in 2012, and the irrigated corn is 14.2%. We simulated the corn supply chain using linear programming and developed the web-based visualization tools called FoodS3 (Food Systems Supply-chain Sustainability tool, http://foods3.org).

  10. Chunking dynamics: heteroclinics in mind

    PubMed Central

    Rabinovich, Mikhail I.; Varona, Pablo; Tristan, Irma; Afraimovich, Valentin S.

    2014-01-01

    Recent results of imaging technologies and non-linear dynamics make possible to relate the structure and dynamics of functional brain networks to different mental tasks and to build theoretical models for the description and prediction of cognitive activity. Such models are non-linear dynamical descriptions of the interaction of the core components—brain modes—participating in a specific mental function. The dynamical images of different mental processes depend on their temporal features. The dynamics of many cognitive functions are transient. They are often observed as a chain of sequentially changing metastable states. A stable heteroclinic channel (SHC) consisting of a chain of saddles—metastable states—connected by unstable separatrices is a mathematical image for robust transients. In this paper we focus on hierarchical chunking dynamics that can represent several forms of transient cognitive activity. Chunking is a dynamical phenomenon that nature uses to perform information processing of long sequences by dividing them in shorter information items. Chunking, for example, makes more efficient the use of short-term memory by breaking up long strings of information (like in language where one can see the separation of a novel on chapters, paragraphs, sentences, and finally words). Chunking is important in many processes of perception, learning, and cognition in humans and animals. Based on anatomical information about the hierarchical organization of functional brain networks, we propose a cognitive network architecture that hierarchically chunks and super-chunks switching sequences of metastable states produced by winnerless competitive heteroclinic dynamics. PMID:24672469

  11. Chunking dynamics: heteroclinics in mind.

    PubMed

    Rabinovich, Mikhail I; Varona, Pablo; Tristan, Irma; Afraimovich, Valentin S

    2014-01-01

    Recent results of imaging technologies and non-linear dynamics make possible to relate the structure and dynamics of functional brain networks to different mental tasks and to build theoretical models for the description and prediction of cognitive activity. Such models are non-linear dynamical descriptions of the interaction of the core components-brain modes-participating in a specific mental function. The dynamical images of different mental processes depend on their temporal features. The dynamics of many cognitive functions are transient. They are often observed as a chain of sequentially changing metastable states. A stable heteroclinic channel (SHC) consisting of a chain of saddles-metastable states-connected by unstable separatrices is a mathematical image for robust transients. In this paper we focus on hierarchical chunking dynamics that can represent several forms of transient cognitive activity. Chunking is a dynamical phenomenon that nature uses to perform information processing of long sequences by dividing them in shorter information items. Chunking, for example, makes more efficient the use of short-term memory by breaking up long strings of information (like in language where one can see the separation of a novel on chapters, paragraphs, sentences, and finally words). Chunking is important in many processes of perception, learning, and cognition in humans and animals. Based on anatomical information about the hierarchical organization of functional brain networks, we propose a cognitive network architecture that hierarchically chunks and super-chunks switching sequences of metastable states produced by winnerless competitive heteroclinic dynamics.

  12. Biosensor Architectures for High-Fidelity Reporting of Cellular Signaling

    PubMed Central

    Dushek, Omer; Lellouch, Annemarie C.; Vaux, David J.; Shahrezaei, Vahid

    2014-01-01

    Understanding mechanisms of information processing in cellular signaling networks requires quantitative measurements of protein activities in living cells. Biosensors are molecular probes that have been developed to directly track the activity of specific signaling proteins and their use is revolutionizing our understanding of signal transduction. The use of biosensors relies on the assumption that their activity is linearly proportional to the activity of the signaling protein they have been engineered to track. We use mechanistic mathematical models of common biosensor architectures (single-chain FRET-based biosensors), which include both intramolecular and intermolecular reactions, to study the validity of the linearity assumption. As a result of the classic mechanism of zero-order ultrasensitivity, we find that biosensor activity can be highly nonlinear so that small changes in signaling protein activity can give rise to large changes in biosensor activity and vice versa. This nonlinearity is abolished in architectures that favor the formation of biosensor oligomers, but oligomeric biosensors produce complicated FRET states. Based on this finding, we show that high-fidelity reporting is possible when a single-chain intermolecular biosensor is used that cannot undergo intramolecular reactions and is restricted to forming dimers. We provide phase diagrams that compare various trade-offs, including observer effects, which further highlight the utility of biosensor architectures that favor intermolecular over intramolecular binding. We discuss challenges in calibrating and constructing biosensors and highlight the utility of mathematical models in designing novel probes for cellular signaling. PMID:25099816

  13. A Bayesian model averaging method for the derivation of reservoir operating rules

    NASA Astrophysics Data System (ADS)

    Zhang, Jingwen; Liu, Pan; Wang, Hao; Lei, Xiaohui; Zhou, Yanlai

    2015-09-01

    Because the intrinsic dynamics among optimal decision making, inflow processes and reservoir characteristics are complex, functional forms of reservoir operating rules are always determined subjectively. As a result, the uncertainty of selecting form and/or model involved in reservoir operating rules must be analyzed and evaluated. In this study, we analyze the uncertainty of reservoir operating rules using the Bayesian model averaging (BMA) model. Three popular operating rules, namely piecewise linear regression, surface fitting and a least-squares support vector machine, are established based on the optimal deterministic reservoir operation. These individual models provide three-member decisions for the BMA combination, enabling the 90% release interval to be estimated by the Markov Chain Monte Carlo simulation. A case study of China's the Baise reservoir shows that: (1) the optimal deterministic reservoir operation, superior to any reservoir operating rules, is used as the samples to derive the rules; (2) the least-squares support vector machine model is more effective than both piecewise linear regression and surface fitting; (3) BMA outperforms any individual model of operating rules based on the optimal trajectories. It is revealed that the proposed model can reduce the uncertainty of operating rules, which is of great potential benefit in evaluating the confidence interval of decisions.

  14. Multijoint kinetic chain analysis of knee extension during the soccer instep kick.

    PubMed

    Naito, Kozo; Fukui, Yosuke; Maruyama, Takeo

    2010-04-01

    Although previous studies have shown that motion-dependent interactions between adjacent segments play an important role in producing knee extension during the soccer instep kick, detailed knowledge about the mechanisms underlying those interactions is lacking. The present study aimed to develop a 3-D dynamical model for the multijoint kinetic chain of the instep kick in order to quantify the contributions of the causal dynamical factors to the production of maximum angular velocity during knee extension. Nine collegiate soccer players volunteered to participate in the experiment and performed instep kicking movements while 3-D positional data and the ground reaction force were measured. A dynamical model was developed in the form of a linked system containing 8 segments and 18 joint rotations, and the knee extension/flexion motion was decomposed into causal factors related to muscular moment, gyroscopic moment, centrifugal force, Coriolis force, gravity, proximal endpoint linear acceleration, and external force-dependent terms. The rapid knee extension during instep kicking was found to result almost entirely from kicking leg centrifugal force, trunk rotation muscular moment, kicking leg Coriolis force, and trunk rotation gyroscopic-dependent components. Based on the finding that rapid knee extension during instep kicking stems from multiple dynamical factors, it is suggested that the multijoint kinetic chain analysis used in the present study is more useful for achieving a detailed understanding of the cause of rapid kicking leg movement than the previously used 2-D, two-segment kinetic chain model. The present results also indicated that the centrifugal effect due to the kicking hip flexion angular velocity contributed substantially to the generation of a rapid knee extension, suggesting that the adjustment between the kicking hip flexion angular velocity and the leg configuration (knee flexion angle) is more important for effective instep kicking than other joint kinematics.

  15. PolyUbiquitin Chain Linkage Topology Selects the Functions from the Underlying Binding Landscape

    PubMed Central

    Wang, Yong; Tang, Chun; Wang, Erkang; Wang, Jin

    2014-01-01

    Ubiquitin (Ub) can generate versatile molecular signals and lead to different celluar fates. The functional poly-valence of Ub is believed to be resulted from its ability to form distinct polymerized chains with eight linkage types. To provide a full picture of ubiquitin code, we explore the binding landscape of two free Ub monomers and also the functional landscapes of of all eight linkage types by theoretical modeling. Remarkably, we found that most of the compact structures of covalently connected dimeric Ub chains (diUbs) pre-exist on the binding landscape. These compact functional states were subsequently validated by corresponding linkage models. This leads to the proposal that the folding architecture of Ub monomer has encoded all functional states into its binding landscape, which is further selected by different topologies of polymeric Ub chains. Moreover, our results revealed that covalent linkage leads to symmetry breaking of interfacial interactions. We further propose that topological constraint not only limits the conformational space for effective switching between functional states, but also selects the local interactions for realizing the corresponding biological function. Therefore, the topological constraint provides a way for breaking the binding symmetry and reaching the functional specificity. The simulation results also provide several predictions that qualitatively and quantitatively consistent with experiments. Importantly, the K48 linkage model successfully predicted intermediate states. The resulting multi-state energy landscape was further employed to reconcile the seemingly contradictory experimental data on the conformational equilibrium of K48-diUb. Our results further suggest that hydrophobic interactions are dominant in the functional landscapes of K6-, K11-, K33- and K48 diUbs, while electrostatic interactions play a more important role in the functional landscapes of K27, K29, K63 and linear linkages. PMID:24992446

  16. PolyUbiquitin chain linkage topology selects the functions from the underlying binding landscape.

    PubMed

    Wang, Yong; Tang, Chun; Wang, Erkang; Wang, Jin

    2014-07-01

    Ubiquitin (Ub) can generate versatile molecular signals and lead to different celluar fates. The functional poly-valence of Ub is believed to be resulted from its ability to form distinct polymerized chains with eight linkage types. To provide a full picture of ubiquitin code, we explore the binding landscape of two free Ub monomers and also the functional landscapes of of all eight linkage types by theoretical modeling. Remarkably, we found that most of the compact structures of covalently connected dimeric Ub chains (diUbs) pre-exist on the binding landscape. These compact functional states were subsequently validated by corresponding linkage models. This leads to the proposal that the folding architecture of Ub monomer has encoded all functional states into its binding landscape, which is further selected by different topologies of polymeric Ub chains. Moreover, our results revealed that covalent linkage leads to symmetry breaking of interfacial interactions. We further propose that topological constraint not only limits the conformational space for effective switching between functional states, but also selects the local interactions for realizing the corresponding biological function. Therefore, the topological constraint provides a way for breaking the binding symmetry and reaching the functional specificity. The simulation results also provide several predictions that qualitatively and quantitatively consistent with experiments. Importantly, the K48 linkage model successfully predicted intermediate states. The resulting multi-state energy landscape was further employed to reconcile the seemingly contradictory experimental data on the conformational equilibrium of K48-diUb. Our results further suggest that hydrophobic interactions are dominant in the functional landscapes of K6-, K11-, K33- and K48 diUbs, while electrostatic interactions play a more important role in the functional landscapes of K27, K29, K63 and linear linkages.

  17. Uniaxial Extensional Behavior of A--B--A Thermoplastic Elastomers: Structure-Properties Relationship and Modeling

    NASA Astrophysics Data System (ADS)

    Martinetti, Luca

    At service temperatures, A--B--A thermoplastic elastomers (TPEs) behave similarly to filled (and often entangled) B-rich rubbers since B block ends are anchored on rigid A domains. Therefore, their viscoelastic behavior is largely dictated by chain mobility of the B block rather than by microstructural order. Relating the small- and large-strain response of undiluted A--B--A triblocks to molecular parameters is a prerequisite for designing associated TPE-based systems that can meet the desired linear and nonlinear rheological criteria. This dissertation was aimed at connecting the chemical and topological structure of A--B--A TPEs with their viscoelastic properties, both in the linear and in the nonlinear regime. Since extensional deformations are relevant for the processing and often the end-use applications of thermoplastic elastomers, the behavior was investigated predominantly in uniaxial extension. The unperturbed size of polymer coils is one of the most fundamental properties in polymer physics, affecting both the thermodynamics of macromolecules and their viscoelastic properties. Literature results on poly(D,L-lactide) (PLA) unperturbed chain dimensions, plateau modulus, and critical molar mass for entanglement effect in viscosity were reviewed and discussed in the framework of the coil packing model. Self-consistency between experimental estimates of melt chain dimensions and viscoelastic properties was discussed, and the scaling behaviors predicted by the coil packing model were identified. Contrary to the widespread belief that amorphous polylactide must be intrinsically stiff, the coil packing model and accurate experimental measurements undoubtedly support the flexible nature of PLA. The apparent brittleness of PLA in mechanical testing was attributed to a potentially severe physical aging occurring at room temperature and to the limited extensibility of the PLA tube statistical segment. The linear viscoelastic response of A--B--A TPEs was first examined at temperatures where the A domains are glassy. Characteristic length scales and tube model parameters were determined, and the role of the glassy A domains on the entangled rubbery B network was assessed. Thermo-rheological complexity, observed near and below Tg,A, was attributed to augmented motional freedom of the B block ends at the corresponding A/B interfaces, in harmony with the theoretical treatment of thermo-rheological complexity for two-phase materials developed by Fesko and Tschoegl. When the magnitude of the steepness index was taken into account, the shift behavior was analogous to the response measured for pure B melts. Building upon the procedure proposed by Ferry and co-workers for entangled and unfilled polymer melts, a new method was developed to extract the matrix monomeric friction coefficient zeta0 from the linear response behavior of a filled system in the rubber-glass transition region, and to estimate the size of Gaussian submolecules. Stress relaxation beyond the path equilibration time was found qualitatively and quantitatively compatible with dynamically undiluted arm retraction dynamics of entangled dangling structures (originating either from a fraction of triblock chains having one end residing outside A domains or from diblock impurities). By employing tube models and rubber elasticity theories, suitably modified to account for microphase-segregation, the linear elastic behavior across the rubbery plateau and up to the entanglement time was modeled, and a simple analytical expression relating the Langley trapping factor with the fraction of entangled and unentangled dangling structures of the material was obtained. The critical-gel-like behavior typical of A--B--A TPEs at service temperatures approaching Tg,A was analyzed in terms of a power-law distribution of relaxation times derived from the wedge distribution, shown to be equivalent to Chambon--Winter's critical gel model and to the mechanical behavior of a fractional element. A relation between the observed power-law exponent and molecular structure was established. The measured low-frequency response, originating from the incipient glass transition of the A domains, was exploited and extrapolated to lower frequencies via a sequential application of the fractional Maxwell model and the fractional Zener model. With only a few, physically meaningful material parameters a realistic description of the A--B--A self-similar relaxation was obtained over a frequency range much broader than the experimental window and not accessible via time-temperature superposition. The relationship between large-strain response and network structure of A--B--A triblocks was investigated, by examining (1) the effect of linear relaxation mechanisms on the tensile behavior, (2) the sources of elastic and viscoelastic nonlinearities, and (3) the strain rate dependence of the ultimate properties. For the first time in the literature, the complex high-dimensional rheological signature of chewing gum was analyzed, especially in response to nonlinear and unsteady deformations in both shear and extension. A unique rheological fingerprint was obtained that is sufficient to provide a new robust definition of chewing gum that is independent of specific molecular composition. (Abstract shortened by ProQuest.).

  18. A binding energy study of the Atomic Mass Evaluation 2012 and an updated beta-decay study of neutron-rich 74Cu

    NASA Astrophysics Data System (ADS)

    Tracy, James L., Jr.

    A study of ground state binding energy values listed in the Atomic Mass Evaluation 2012 (AME2012) using an interpretive approach, as opposed to the exploratory methods of previous models, is presented. This model is based on a postulate requiring all protons to pair with available neutrons to form bound alpha clusters as the ground state for an N = Z core upon which excess neutrons are added. For each core, the trend of the binding energy as a function of excess neutrons in the isotopic chain can be fit with a three-term quadratic function. The quadratic parameter reveals a smooth decaying exponential function. By re-envisioning the determination of mass excess, the constant-term fit parameters, representing N = Z nuclei, reveal a near-symmetry around Z = 50. The linear fit parameters exhibit trends which are linear functions of core size. A neutron drip-line prediction is compared against current models. By considering the possibility of an alpha-cluster core, a new ground-state structure grouping scheme is presented; nucleon-nucleon pairing is shown to have a greater role in level filling. This model, referred to as the Alpha-Deuteron-Neutron Model, yields promising first results when considering root-mean-square variances from the AME2012. The beta-decay of the neutron-rich isotope 74Cu has been studied using three high-purity Germanium clover detectors at the Holifield Radioactive Ion Beam Facility at Oak Ridge National Laboratory. A high-resolution mass separator greatly improved the purity of the 74Cu beam by removing isobaric contaminants, thus allowing decay through its isobar chain to the stable 74Ge at the center of the LeRIBSS detector array without any decay chain member dominating. Using coincidence gating techniques, 121 gamma-rays associated with 74Cu were isolated from the collective singles spectrum. Eighty-seven of these were placed in an expanded level scheme, and updated beta-feeding level intensities and log( ft) values are presented based on multiple newly-placed excited states up to 6.8 MeV. The progression of simulated Total Absorption gamma-ray Spectroscopy (TAGS) based on known levels and beta feeding values from previous measurements to this evaluation are presented and demonstrate the need for a TAGS measurement of this isotope to gain a more complete understanding of its decay scheme.

  19. Collective effect of personal behavior induced preventive measures and differential rate of transmission on spread of epidemics

    NASA Astrophysics Data System (ADS)

    Sagar, Vikram; Zhao, Yi

    2017-02-01

    In the present work, the effect of personal behavior induced preventive measures is studied on the spread of epidemics over scale free networks that are characterized by the differential rate of disease transmission. The role of personal behavior induced preventive measures is parameterized in terms of variable λ, which modulates the number of concurrent contacts a node makes with the fraction of its neighboring nodes. The dynamics of the disease is described by a non-linear Susceptible Infected Susceptible model based upon the discrete time Markov Chain method. The network mean field approach is generalized to account for the effect of non-linear coupling between the aforementioned factors on the collective dynamics of nodes. The upper bound estimates of the disease outbreak threshold obtained from the mean field theory are found to be in good agreement with the corresponding non-linear stochastic model. From the results of parametric study, it is shown that the epidemic size has inverse dependence on the preventive measures (λ). It has also been shown that the increase in the average degree of the nodes lowers the time of spread and enhances the size of epidemics.

  20. Mum, why do you keep on growing? Impacts of environmental variability on optimal growth and reproduction allocation strategies of annual plants.

    PubMed

    De Lara, Michel

    2006-05-01

    In their 1990 paper Optimal reproductive efforts and the timing of reproduction of annual plants in randomly varying environments, Amir and Cohen considered stochastic environments consisting of i.i.d. sequences in an optimal allocation discrete-time model. We suppose here that the sequence of environmental factors is more generally described by a Markov chain. Moreover, we discuss the connection between the time interval of the discrete-time dynamic model and the ability of the plant to rebuild completely its vegetative body (from reserves). We formulate a stochastic optimization problem covering the so-called linear and logarithmic fitness (corresponding to variation within and between years), which yields optimal strategies. For "linear maximizers'', we analyse how optimal strategies depend upon the environmental variability type: constant, random stationary, random i.i.d., random monotonous. We provide general patterns in terms of targets and thresholds, including both determinate and indeterminate growth. We also provide a partial result on the comparison between ;"linear maximizers'' and "log maximizers''. Numerical simulations are provided, allowing to give a hint at the effect of different mathematical assumptions.

  1. Determination of linear short chain aliphatic aldehyde and ketone vapors in air using a polystyrene-coated quartz crystal nanobalance sensor.

    PubMed

    Mirmohseni, Abdolreza; Olad, Ali

    2010-01-01

    A polystyrene coated quartz crystal nanobalance (QCN) sensor was developed for use in the determination of a number of linear short-chain aliphatic aldehyde and ketone vapors contained in air. The quartz crystal was modified by a thin-layer coating of a commercial grade general purpose polystyrene (GPPS) from Tabriz petrochemical company using a solution casting method. Determination was based on frequency shifts of the modified quartz crystal due to the adsorption of analytes at the surface of modified electrode in exposure to various concentrations of analytes. The frequency shift was found to have a linear relation to the concentration of analytes. Linear calibration curves were obtained for 7-70 mg l(-1) of analytes with correlation coefficients in the range of 0.9935-0.9989 and sensitivity factors in the range of 2.07-6.74 Hz/mg l(-1). A storage period of over three months showed no loss in the sensitivity and performance of the sensor.

  2. Non-Destructive Evaluation of Material System Using Highly Nonlinear Acoustic Waves

    NASA Astrophysics Data System (ADS)

    Khatri, Devvrath

    A chain of granular particles is one of the most studied examples of highly nonlinear systems deriving its response from the nonlinear Hertzian contact interaction between particles. Interest in these systems derives from their tunable dynamic response, encompassing linear, weakly nonlinear, and strongly nonlinear regimes, controlled by varying the static and dynamic load applied. In chains with a very weak (or zero) static precompression, the system supports the formation and propagation of highly nonlinear solitary waves (HNSWs). The dual-nonlinear interaction between particles (i.e., a power-law type contact potential in compression, and zero strength in tension) combined with discreteness of the system, makes the granular system highly tunable. The propagation properties of these waves, such as traveling pulse width, wave speed, number of separated pulses (single or train of pulses), etc., can be controlled by modifying one or many of the parameters, like the particle's dimension, material properties, static and dynamic force amplitude, the type and duration of the initial excitation applied to the system, and/or the periodicity of the chain. The ability to control the wave properties in such chains has been proposed for several different practical engineering applications. The dynamic properties of these granular chains have been conventionally studied using discrete particle models (DPMs) which consider the particles in the chains as point masses connected by nonlinear Hertzian springs with the neighboring particles. Although, this is a good approximation under proper circumstances, it does not capture many features of the three dimensional elastic particles such as the elastic wave propagation within the particles, the local deformation of the particles in the vicinity of the contact point, the corresponding changes in the contact area, and the collective vibrations of the particles among others. This thesis focuses on the development of a finite element model (FEM) using the commercially available software Abaqus, which takes into account many of these characteristic features. The finite element model discretizes particles by considering them as three-dimensional deformable bodies of revolution and describes the nonlinear dynamic response of one-dimensional granular chains composed of particles with various geometries and orientations. We showed that particles' geometries and orientations provide additional design parameters for controlling the dynamic response of the system, compared to chains composed of spherical particles. We also showed that the tunable and compact nature of these waves can be used to tailor the properties of HNSWs for specific application, such as information carriers for actuation and sensing of mechanical properties and boundary effects of adjoining media in Non-Destructive Evaluation (NDE) and Structural Health Monitoring (SHM). Using experiments and numerics, we characterized interface dynamics between granular media and adjoining linear elastic media, and found that the coupling produced temporary localization of the incident waves at the boundaries between the two media and their decomposition into reflected waves. We monitored the formation of reflected solitary waves propagating back from the interface and found that their properties are sensitive to the geometric and material properties of the adjoining media. The work done in this research enhances our understanding of the basic physics and tunability of nonlinear granular media, and further establishes a theoretical and numerical foundation in the applications of HNSWs as information carriers.

  3. Challenges in Materials Transformation Modeling for Polyolefins Industry

    NASA Astrophysics Data System (ADS)

    Lai, Shih-Yaw; Swogger, Kurt W.

    2004-06-01

    Unlike most published polymer processing and/or forming research, the transformation of polyolefins to fabricated articles often involves non-confined flow or so-called free surface flow (e.g. fiber spinning, blown films, and cast films) in which elongational flow takes place during a fabrication process. Obviously, the characterization and validation of extensional rheological parameters and their use to develop rheological constitutive models are the focus of polyolefins materials transformation research. Unfortunately, there are challenges that remain with limited validation for non-linear, non-isothermal constitutive models for polyolefins. Further complexity arises in the transformation of polyolefins in the elongational flow system as it involves stress-induced crystallization process. The complicated nature of elongational, non-linear rheology and non-isothermal crystallization kinetics make the development of numerical methods very challenging for the polyolefins materials forming modeling. From the product based company standpoint, the challenges of materials transformation research go beyond elongational rheology, crystallization kinetics and its numerical modeling. In order to make models useful for the polyolefin industry, it is critical to develop links between molecular parameters to both equipment and materials forming parameters. The recent advances in the constrained geometry catalysis and materials sciences understanding (INSITE technology and molecular design capability) has made industrial polyolefinic materials forming modeling more viable due to the fact that the molecular structure of the polymer can be well predicted and controlled during the polymerization. In this paper, we will discuss inter-relationship (models) among molecular parameters such as polymer molecular weight (Mw), molecular weight distribution (MWD), long chain branching (LCB), short chain branching (SCB or comonomer types and distribution) and their affects on shear and elongational rheologies, on tie-molecules probabilities, on non-isothermal stress-induced crystallization, on crystalline/amorphous orientation vs. mechanical property relationship, etc. All of the above mentioned inter-relationships (models) are critical to the successful development of a knowledge based industrial model. Dow Polyolefins and Elastomers business is one of the world largest polyolefins resin producers with the most advanced INSITE technology and a "6-Day model" molecular design capability. Dow also offers one of the broadest polyolefinic product ranges and applications to the market.

  4. Dewetting Kinetics in Polymer Grafted Nanoparticle Thin Films: Impact of Architecture and Viscosity on Thermal Stability

    NASA Astrophysics Data System (ADS)

    Che, Justin; Jawaid, Ali; Grabowski, Christopher; Yi, Yoon-Jae; Vaia, Richard; AFRL Collaboration

    Rapid formation of ordered monolayers of polymer grafted nanoparticles (PGN) directly onto solid surfaces has spurred interest in using these materials for additive manufacturing of optical devices and energy storage. Herein, we discuss dewetting of polystyrene grafted Au nanoparticles (PS@Au) with an increased thermal (10-25oC) and energetic (5-15 mN/m) stability relative to linear polymer films of comparable thickness. Analogous to star macromolecules, the enhanced stability is related to the conformations of chains in the grafted canopy. Mechanistically, dewetting of PS@Au is similar to linear PS, however, the thickness transition from spinodal to heterogeneous nucleation is at least 5-6x larger. Time resolved optical microscopy during dewetting at 160oC revealed that the zero shear viscosity for linear PS scaled as η0 Mn3. 3 , consistent with reptation of entangled polymers. In contrast, PS@Au showed η0 Mn2. 2 where Mn reflects the molecular weight of the grafted chains. Overall, PS@Au exhibited significantly slower dewetting rates, consistent with a 100x increase in viscosity relative to the linear chain analogues. Quantification of the relationship between PGN architecture (e.g. nanoparticle size, graft density, polymer molecular weight) and dewetting processes is crucial to optimize the order of these assemblies via post-processing, as well as design the PGN canopy to maximize stability for devices.

  5. Modeling pH-Responsive Adsorption of Polyelectrolytes at Oil-Water Interfaces

    NASA Astrophysics Data System (ADS)

    Qin, Shiyi; Yong, Xin

    We use dissipative particle dynamics (DPD) to discover the interfacial adsorption of pH-responsive polyelectrolytes in oil-water binary systems under different pH values. The electrostatic interactions between charged beads and the dielectric discontinuity across the interface are modeled by exploiting a modified Particle-Particle-Particle-Mesh (PPPM) method, which uses an iterative method to solve the Poisson equation on a uniform grid. We first model the adsorption behavior of a single linear polyelectrolyte from the aqueous phase. The Henderson-Hasselbalch equation describes the relation between pH and the degree of ionization of the modeled polyelectrolytes. Through changing the degree of ionization, we explore the influence of pH on the adsorption behavior and show that the electrostatic interactions significantly modulate the adsorption. Time evolutions of the position and conformation of the polyelectrolytes and the variation in the oil-water surface tension will be measured to characterize the adsorption behavior. Furthermore, we model the pH-dependent adsorption behavior of polyelectrolytes with more complicated structures, namely, branched polyelectrolytes with hydrophobic backbones and hydrophilic side chains. We also find that the addition of salts in the medium and the lengths of the backbone and ionized side chain affect the adsorption. This research supported by the American Chemical Society Petroleum Research Fund (Award 56884-DNI9).

  6. Distribution and congener profiles of short-chain chlorinated paraffins in indoor/outdoor glass window surface films and their film-air partitioning in Beijing, China.

    PubMed

    Gao, Wei; Wu, Jing; Wang, Yawei; Jiang, Guibin

    2016-02-01

    Short-chain chlorinated paraffins (SCCPs) are a group of n-alkanes with carbon chain length of 10-13. In this work, paired indoor/outdoor samples of organic films on window glass surfaces from urban buildings in Beijing, China, were collected to measure the concentrations and congener distributions of SCCPs. The total SCCP levels ranged from 337 ng/m(2) to 114 μg/m(2), with total organic carbon (TOC) normalized concentrations of 365 μg/m(2)-365 mg/m(2). Overall, the concentrations of SCCPs on the interior films were higher than the concentrations on the exterior films, suggesting an important indoor environmental exposure of SCCPs to the general public. A significant linear relationship was found between the SCCP concentrations and TOC, with a correlation coefficient of R = 0.34 (p < 0.01). A film-air partitioning model suggests that the indoor gas-phase SCCPs are related to their corresponding window film levels. Copyright © 2015 Elsevier Ltd. All rights reserved.

  7. Thermomechanical Properties and Glass Dynamics of Polymer-Tethered Colloidal Particles and Films

    PubMed Central

    2017-01-01

    Polymer-tethered colloidal particles (aka “particle brush materials”) have attracted interest as a platform for innovative material technologies and as a model system to elucidate glass formation in complex structured media. In this contribution, Brillouin light scattering is used to sequentially evaluate the role of brush architecture on the dynamical properties of brush particles in both the individual and assembled (film) state. In the former state, the analysis reveals that brush–brush interactions as well as global chain relaxation sensitively depend on grafting density; i.e., more polymer-like behavior is observed in sparse brush systems. This is interpreted to be a consequence of more extensive chain entanglement. In contrast, the local relaxation of films does not depend on grafting density. The results highlight that relaxation processes in particle brush-based materials span a wider range of time and length scales as compared to linear chain polymers. Differentiation between relaxation on local and global scale is necessary to reveal the influence of molecular structure and connectivity on the aging behavior of these complex systems. PMID:29755139

  8. Thermomechanical Properties and Glass Dynamics of Polymer-Tethered Colloidal Particles and Films.

    PubMed

    Cang, Yu; Reuss, Anna N; Lee, Jaejun; Yan, Jiajun; Zhang, Jianan; Alonso-Redondo, Elena; Sainidou, Rebecca; Rembert, Pascal; Matyjaszewski, Krzysztof; Bockstaller, Michael R; Fytas, George

    2017-11-14

    Polymer-tethered colloidal particles (aka "particle brush materials") have attracted interest as a platform for innovative material technologies and as a model system to elucidate glass formation in complex structured media. In this contribution, Brillouin light scattering is used to sequentially evaluate the role of brush architecture on the dynamical properties of brush particles in both the individual and assembled (film) state. In the former state, the analysis reveals that brush-brush interactions as well as global chain relaxation sensitively depend on grafting density; i.e., more polymer-like behavior is observed in sparse brush systems. This is interpreted to be a consequence of more extensive chain entanglement. In contrast, the local relaxation of films does not depend on grafting density. The results highlight that relaxation processes in particle brush-based materials span a wider range of time and length scales as compared to linear chain polymers. Differentiation between relaxation on local and global scale is necessary to reveal the influence of molecular structure and connectivity on the aging behavior of these complex systems.

  9. Imaging Metastasis Using an Integrin-Targeting Chain-Shaped Nanoparticle

    PubMed Central

    Peiris, Pubudu M.; Toy, Randall; Doolittle, Elizabeth; Pansky, Jenna; Abramowski, Aaron; Tam, Morgan; Vicente, Peter; Tran, Emily; Hayden, Elliott; Camann, Andrew; Mayer, Aaron; Erokwu, Bernadette O.; Berman, Zachary; Wilson, David; Baskaran, Harihara; Flask, Chris A.; Keri, Ruth A.; Karathanasis, Efstathios

    2012-01-01

    While the enhanced permeability and retention effect may promote the preferential accumulation of nanoparticles into well-vascularized primary tumors, it is ineffective in the case of metastases hidden within a large population of normal cells. Due to their small size, high dispersion to organs, and low vascularization, metastatic tumors are less accessible to targeted nanoparticles. To tackle these challenges, we designed a nanoparticle for vascular targeting based on an αvβ3 integrin-targeted nanochain particle composed of four iron oxide nanospheres chemically linked in a linear assembly. The chain-shaped nanoparticles enabled enhanced ‘sensing’ of the tumor-associated remodeling of the vascular bed offering increased likelihood of specific recognition of metastatic tumors. Compared to spherical nanoparticles, the chain-shaped nanoparticles resulted in superior targeting of αvβ3 integrin due to geometrically enhanced multivalent docking. We performed multimodal in vivo imaging (Fluorescence Molecular Tomography and Magnetic Resonance Imaging) in a non-invasive and quantitative manner, which showed that the nanoparticles targeted metastases in the liver and lungs with high specificity in a highly aggressive breast tumor model in mice. PMID:23005348

  10. Radiative transfer calculated from a Markov chain formalism

    NASA Technical Reports Server (NTRS)

    Esposito, L. W.; House, L. L.

    1978-01-01

    The theory of Markov chains is used to formulate the radiative transport problem in a general way by modeling the successive interactions of a photon as a stochastic process. Under the minimal requirement that the stochastic process is a Markov chain, the determination of the diffuse reflection or transmission from a scattering atmosphere is equivalent to the solution of a system of linear equations. This treatment is mathematically equivalent to, and thus has many of the advantages of, Monte Carlo methods, but can be considerably more rapid than Monte Carlo algorithms for numerical calculations in particular applications. We have verified the speed and accuracy of this formalism for the standard problem of finding the intensity of scattered light from a homogeneous plane-parallel atmosphere with an arbitrary phase function for scattering. Accurate results over a wide range of parameters were obtained with computation times comparable to those of a standard 'doubling' routine. The generality of this formalism thus allows fast, direct solutions to problems that were previously soluble only by Monte Carlo methods. Some comparisons are made with respect to integral equation methods.

  11. Summer-winter concentrations and gas-particle partitioning of short chain chlorinated paraffins in the atmosphere of an urban setting.

    PubMed

    Wang, Thanh; Han, Shanlong; Yuan, Bo; Zeng, Lixi; Li, Yingming; Wang, Yawei; Jiang, Guibin

    2012-12-01

    Short chain chlorinated paraffins (SCCPs) are semi-volatile chemicals that are considered persistent in the environment, potential toxic and subject to long-range transport. This study investigates the concentrations and gas-particle partitioning of SCCPs at an urban site in Beijing during summer and wintertime. The total atmospheric SCCP levels ranged 1.9-33.0 ng/m(3) during wintertime. Significantly higher levels were found during the summer (range 112-332 ng/m(3)). The average fraction of total SCCPs in the particle phase (ϕ) was 0.67 during wintertime but decreased significantly during the summer (ϕ = 0.06). The ten and eleven carbon chain homologues with five to eight chlorine atoms were the predominant SCCP formula groups in air. Significant linear correlations were found between the gas-particle partition coefficients and the predicted subcooled vapor pressures and octanol-air partition coefficients. The gas-particle partitioning of SCCPs was further investigated and compared with both the Junge-Pankow adsorption and K(oa)-based absorption models. Copyright © 2012 Elsevier Ltd. All rights reserved.

  12. High temperature spin dynamics in linear magnetic chains, molecular rings, and segments by nuclear magnetic resonance

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Adelnia, Fatemeh; Lascialfari, Alessandro; Dipartimento di Fisica, Università degli Studi di Pavia and INSTM, Pavia

    2015-05-07

    We present the room temperature proton nuclear magnetic resonance (NMR) nuclear spin-lattice relaxation rate (NSLR) results in two 1D spin chains: the Heisenberg antiferromagnetic (AFM) Eu(hfac){sub 3}NITEt and the magnetically frustrated Gd(hfac){sub 3}NITEt. The NSLR as a function of external magnetic field can be interpreted very well in terms of high temperature spin dynamics dominated by a long time persistence of the decay of the two-spin correlation function due to the conservation of the total spin value for isotropic Heisenberg chains. The high temperature spin dynamics are also investigated in Heisenberg AFM molecular rings. In both Cr{sub 8} closed ringmore » and in Cr{sub 7}Cd and Cr{sub 8}Zn open rings, i.e., model systems for a finite spin segment, an enhancement of the low frequency spectral density is found consistent with spin diffusion but the high cut-off frequency due to intermolecular anisotropic interactions prevents a detailed analysis of the spin diffusion regime.« less

  13. Quantifying and Reducing Curve-Fitting Uncertainty in Isc

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Campanelli, Mark; Duck, Benjamin; Emery, Keith

    2015-06-14

    Current-voltage (I-V) curve measurements of photovoltaic (PV) devices are used to determine performance parameters and to establish traceable calibration chains. Measurement standards specify localized curve fitting methods, e.g., straight-line interpolation/extrapolation of the I-V curve points near short-circuit current, Isc. By considering such fits as statistical linear regressions, uncertainties in the performance parameters are readily quantified. However, the legitimacy of such a computed uncertainty requires that the model be a valid (local) representation of the I-V curve and that the noise be sufficiently well characterized. Using more data points often has the advantage of lowering the uncertainty. However, more data pointsmore » can make the uncertainty in the fit arbitrarily small, and this fit uncertainty misses the dominant residual uncertainty due to so-called model discrepancy. Using objective Bayesian linear regression for straight-line fits for Isc, we investigate an evidence-based method to automatically choose data windows of I-V points with reduced model discrepancy. We also investigate noise effects. Uncertainties, aligned with the Guide to the Expression of Uncertainty in Measurement (GUM), are quantified throughout.« less

  14. Is DNA a worm-like chain in Couette flow? In search of persistence length, a critical review.

    PubMed

    Rittman, Martyn; Gilroy, Emma; Koohya, Hashem; Rodger, Alison; Richards, Adair

    2009-01-01

    Persistence length is the foremost measure of DNA flexibility. Its origins lie in polymer theory which was adapted for DNA following the determination of BDNA structure in 1953. There is no single definition of persistence length used, and the links between published definitions are based on assumptions which may, or may not be, clearly stated. DNA flexibility is affected by local ionic strength, solvent environment, bound ligands and intrinsic sequence-dependent flexibility. This article is a review of persistence length providing a mathematical treatment of the relationships between four definitions of persistence length, including: correlation, Kuhn length, bending, and curvature. Persistence length has been measured using various microscopy, force extension and solution methods such as linear dichroism and transient electric birefringence. For each experimental method a model of DNA is required to interpret the data. The importance of understanding the underlying models, along with the assumptions required by each definition to determine a value of persistence length, is highlighted for linear dichroism data, where it transpires that no model is currently available for long DNA or medium to high shear rate experiments.

  15. Quantifying and Reducing Curve-Fitting Uncertainty in Isc: Preprint

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Campanelli, Mark; Duck, Benjamin; Emery, Keith

    Current-voltage (I-V) curve measurements of photovoltaic (PV) devices are used to determine performance parameters and to establish traceable calibration chains. Measurement standards specify localized curve fitting methods, e.g., straight-line interpolation/extrapolation of the I-V curve points near short-circuit current, Isc. By considering such fits as statistical linear regressions, uncertainties in the performance parameters are readily quantified. However, the legitimacy of such a computed uncertainty requires that the model be a valid (local) representation of the I-V curve and that the noise be sufficiently well characterized. Using more data points often has the advantage of lowering the uncertainty. However, more data pointsmore » can make the uncertainty in the fit arbitrarily small, and this fit uncertainty misses the dominant residual uncertainty due to so-called model discrepancy. Using objective Bayesian linear regression for straight-line fits for Isc, we investigate an evidence-based method to automatically choose data windows of I-V points with reduced model discrepancy. We also investigate noise effects. Uncertainties, aligned with the Guide to the Expression of Uncertainty in Measurement (GUM), are quantified throughout.« less

  16. Serum neurofilament as a predictor of disease worsening and brain and spinal cord atrophy in multiple sclerosis.

    PubMed

    Barro, Christian; Benkert, Pascal; Disanto, Giulio; Tsagkas, Charidimos; Amann, Michael; Naegelin, Yvonne; Leppert, David; Gobbi, Claudio; Granziera, Cristina; Yaldizli, Özgür; Michalak, Zuzanna; Wuerfel, Jens; Kappos, Ludwig; Parmar, Katrin; Kuhle, Jens

    2018-05-30

    Neuro-axonal injury is a key factor in the development of permanent disability in multiple sclerosis. Neurofilament light chain in peripheral blood has recently emerged as a biofluid marker reflecting neuro-axonal damage in this disease. We aimed at comparing serum neurofilament light chain levels in multiple sclerosis and healthy controls, to determine their association with measures of disease activity and their ability to predict future clinical worsening as well as brain and spinal cord volume loss. Neurofilament light chain was measured by single molecule array assay in 2183 serum samples collected as part of an ongoing cohort study from 259 patients with multiple sclerosis (189 relapsing and 70 progressive) and 259 healthy control subjects. Clinical assessment, serum sampling and MRI were done annually; median follow-up time was 6.5 years. Brain volumes were quantified by structural image evaluation using normalization of atrophy, and structural image evaluation using normalization of atrophy, cross-sectional, cervical spinal cord volumes using spinal cord image analyser (cordial). Results were analysed using ordinary linear regression models and generalized estimating equation modelling. Serum neurofilament light chain was higher in patients with a clinically isolated syndrome or relapsing remitting multiple sclerosis as well as in patients with secondary or primary progressive multiple sclerosis than in healthy controls (age adjusted P < 0.001 for both). Serum neurofilament light chain above the 90th percentile of healthy controls values was an independent predictor of Expanded Disability Status Scale worsening in the subsequent year (P < 0.001). The probability of Expanded Disability Status Scale worsening gradually increased by higher serum neurofilament light chain percentile category. Contrast enhancing and new/enlarging lesions were independently associated with increased serum neurofilament light chain (17.8% and 4.9% increase per lesion respectively; P < 0.001). The higher the serum neurofilament light chain percentile level, the more pronounced was future brain and cervical spinal volume loss: serum neurofilament light chain above the 97.5th percentile was associated with an additional average loss in brain volume of 1.5% (P < 0.001) and spinal cord volume of 2.5% over 5 years (P = 0.009). Serum neurofilament light chain correlated with concurrent and future clinical and MRI measures of disease activity and severity. High serum neurofilament light chain levels were associated with both brain and spinal cord volume loss. Neurofilament light chain levels are a real-time, easy to measure marker of neuro-axonal injury that is conceptually more comprehensive than brain MRI.

  17. Reversible geling co-polymer and method of making

    DOEpatents

    Gutowska, Anna

    2005-12-27

    The present invention is a thereapeutic agent carrier having a thermally reversible gel or geling copolymer that is a linear random copolymer of an [meth-]acrylamide derivative and a hydrophilic comonomer, wherein the linear random copolymer is in the form of a plurality of linear chains having a plurality of molecular weights greater than or equal to a minimum geling molecular weight cutoff and a therapeutic agent.

  18. Effects of dietary valine:lysine ratio on the performance, amino acid composition of tissues and mRNA expression of genes involved in branched-chain amino acid metabolism of weaned piglets

    PubMed Central

    Xu, Ye Tong; Ma, Xiao Kang; Wang, Chun Lin; Yuan, Ming Feng; Piao, Xiang Shu

    2018-01-01

    Objective The goal of this study was to investigate the effects of dietary standard ileal digestible (SID) valine:lysine ratios on performance, intestinal morphology, amino acids of liver and muscle, plasma indices and mRNA expression of branched-chain amino acid (BCAA) metabolism enzymes. Methods A total of 144 crossbred pigs (Duroc×Landrace×Large White) weaned at 28±4 days of age (8.79±0.02 kg body weight) were randomly allotted to 1 of 4 diets formulated to provide SID valine:lysine ratios of 50%, 60%, 70%, or 80%. Each diet was fed to 6 pens of pigs with 6 pigs per pen (3 gilts and 3 barrows) for 28 days. Results Average daily gain increased quadratically (p<0.05), the villous height of the duodenum, jejunum and ileum increased linearly (p<0.05) as the SID valine:lysine ratio increased. The concentrations of plasma α-keto isovaleric and valine increased linearly (p<0.05), plasma aspartate, asparagine and cysteine decreased (p<0.05) as the SID valine:lysine ratio increased. An increase in SID lysine:valine levels increased mRNA expression levels of mitochondrial BCAA transaminase and branched-chain α-keto acid dehydrogenase in the longissimus dorsi muscle (p<0.05). Conclusion Using a quadratic model, a SID valine:lysine ratio of 68% was shown to maximize the growth of weaned pigs which is slightly higher than the level recommended by the National Research Council [6]. PMID:28728397

  19. Asteroid mass estimation with Markov-chain Monte Carlo

    NASA Astrophysics Data System (ADS)

    Siltala, L.; Granvik, M.

    2017-09-01

    We have developed a new Markov-chain Monte Carlo-based algorithm for asteroid mass estimation based on mutual encounters and tested it for several different asteroids. Our results are in line with previous literature values but suggest that uncertainties of prior estimates may be misleading as a consequence of using linearized methods.

  20. KymoKnot: A web server and software package to identify and locate knots in trajectories of linear or circular polymers.

    PubMed

    Tubiana, Luca; Polles, Guido; Orlandini, Enzo; Micheletti, Cristian

    2018-06-07

    The KymoKnot software package and web server identifies and locates physical knots or proper knots in a series of polymer conformations. It is mainly intended as an analysis tool for trajectories of linear or circular polymers, but it can be used on single instances too, e.g. protein structures in PDB format. A key element of the software package is the so-called minimally interfering chain closure algorithm that is used to detect physical knots in open chains and to locate the knotted region in both open and closed chains. The web server offers a user-friendly graphical interface that identifies the knot type and highlights the knotted region on each frame of the trajectory, which the user can visualize interactively from various viewpoints. The dynamical evolution of the knotted region along the chain contour is presented as a kymograph. All data can be downloaded in text format. The KymoKnot package is licensed under the BSD 3-Clause licence. The server is publicly available at http://kymoknot.sissa.it/kymoknot/interactive.php .

  1. Nanoparticle amount, and not size, determines chain alignment and nonlinear hardening in polymer nanocomposites

    PubMed Central

    Varol, H. Samet; Meng, Fanlong; Hosseinkhani, Babak; Malm, Christian; Bonn, Daniel; Bonn, Mischa; Zaccone, Alessio

    2017-01-01

    Polymer nanocomposites—materials in which a polymer matrix is blended with nanoparticles (or fillers)—strengthen under sufficiently large strains. Such strain hardening is critical to their function, especially for materials that bear large cyclic loads such as car tires or bearing sealants. Although the reinforcement (i.e., the increase in the linear elasticity) by the addition of filler particles is phenomenologically understood, considerably less is known about strain hardening (the nonlinear elasticity). Here, we elucidate the molecular origin of strain hardening using uniaxial tensile loading, microspectroscopy of polymer chain alignment, and theory. The strain-hardening behavior and chain alignment are found to depend on the volume fraction, but not on the size of nanofillers. This contrasts with reinforcement, which depends on both volume fraction and size of nanofillers, potentially allowing linear and nonlinear elasticity of nanocomposites to be tuned independently. PMID:28377517

  2. rf design of a pulse compressor with correction cavity chain for klystron-based compact linear collider

    NASA Astrophysics Data System (ADS)

    Wang, Ping; Zha, Hao; Syratchev, Igor; Shi, Jiaru; Chen, Huaibi

    2017-11-01

    We present an X-band high-power pulse compression system for a klystron-based compact linear collider. In this system design, one rf power unit comprises two klystrons, a correction cavity chain, and two SLAC Energy Doubler (SLED)-type X-band pulse compressors (SLEDX). An rf pulse passes the correction cavity chain, by which the pulse shape is modified. The rf pulse is then equally split into two ways, each deploying a SLEDX to compress the rf power. Each SLEDX produces a short pulse with a length of 244 ns and a peak power of 217 MW to power four accelerating structures. With the help of phase-to-amplitude modulation, the pulse has a dedicated shape to compensate for the beam loading effect in accelerating structures. The layout of this system and the rf design and parameters of the new pulse compressor are described in this work.

  3. The fidelity of paleomagnetic records carried by magnetosome chains

    NASA Astrophysics Data System (ADS)

    Paterson, Greig; Wang, Yinzhao; Pan, Yongxin

    2013-04-01

    Magnetotactic bacteria (MTB) and their fossilized magnetosomes are being increasingly identified in geological records from a broad range of environments and are believed to be a dominant carrier of magnetic remanence in sediments. Despite their prevalence, little is known about how well chains of biomineralized magnetic particles record the geomagnetic field. Using cultured Magnetospirillum magneticum strain AMB-1, we have conducted simple 2D (i.e., zero inclination) experiments to simulate NRM acquisition in order to assess the efficiency with which magnetosome chains align along magnetic field lines and the implications that this has for paleomagnetic records. Our results indicate that the NRM acquired by deposited MTB is near linear with the applied field, but that deviations from linearity up to 10% are discernible at high fields (120 μT). This slight non-linearity is propagated through into the calculation of both ARM and IRM normalized relative paleointensity (RPI) variations. RPI records, carried by magnetofossils, which vary by more than a factor of 5-6, are likely to misestimate the extreme values by ~10-15 % due to non-linear effects. This degree of non-linearity, however, is comparable or smaller than measured from redeposition experiments using detrital material, which suggests that over the range of typical geomagnetic field strengths explored here, MTB appear to be good recorders of the paleomagnetic field. The RPI discrepancies between nearby geological records, which have been inferred to be the result of abundant biogenic magnetic minerals, are likely to be related to the mixing of biogenic and detrital magnetic components, or through chemical processes that may subsequently affect the NRM carried by fossil magnetosomes.

  4. Nonequilibrium molecular dynamics study of ring polymer melts under shear and elongation flows: A comparison with their linear analogs

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Yoon, Jeongha; Kim, Jinseong; Baig, Chunggi, E-mail: cbaig@unist.ac.kr

    We present detailed results for the structural and rheological properties of unknotted and unconcatenated ring polyethylene (PE) melts under shear and elongation flows via direct atomistic nonequilibrium molecular dynamics simulations. Short (C{sub 78}H{sub 156}) and long (C{sub 400}H{sub 800}) ring PE melts were subjected to planar Couette flow (PCF) and planar elongational flow (PEF) across a wide range of strain rates from linear to highly nonlinear flow regimes. The results are analyzed in detail through a direct comparison with those of the corresponding linear polymers. We found that, in comparison to their linear analogs, ring melts possess rather compact chainmore » structures at or near the equilibrium state and exhibit a considerably lesser degree of structural deformation with respect to the applied flow strength under both PCF and PEF. The large structural resistance of ring polymers against an external flow field is attributed to the intrinsic closed-loop configuration of the ring and the topological constraint of nonconcatenation between ring chains in the melt. As a result, there appears to be a substantial discrepancy between ring and linear systems in terms of their structural and rheological properties such as chain orientation, the distribution of chain dimensions, viscosity, flow birefringence, hydrostatic pressure, the pair correlation function, and potential interaction energies. The findings and conclusions drawn in this work would be a useful guide in future exploration of the characteristic dynamical and relaxation mechanisms of ring polymers in bulk or confined systems under flowing conditions.« less

  5. Bayesian inference of radiation belt loss timescales.

    NASA Astrophysics Data System (ADS)

    Camporeale, E.; Chandorkar, M.

    2017-12-01

    Electron fluxes in the Earth's radiation belts are routinely studied using the classical quasi-linear radial diffusion model. Although this simplified linear equation has proven to be an indispensable tool in understanding the dynamics of the radiation belt, it requires specification of quantities such as the diffusion coefficient and electron loss timescales that are never directly measured. Researchers have so far assumed a-priori parameterisations for radiation belt quantities and derived the best fit using satellite data. The state of the art in this domain lacks a coherent formulation of this problem in a probabilistic framework. We present some recent progress that we have made in performing Bayesian inference of radial diffusion parameters. We achieve this by making extensive use of the theory connecting Gaussian Processes and linear partial differential equations, and performing Markov Chain Monte Carlo sampling of radial diffusion parameters. These results are important for understanding the role and the propagation of uncertainties in radiation belt simulations and, eventually, for providing a probabilistic forecast of energetic electron fluxes in a Space Weather context.

  6. Geometrically induced nonlinear dynamics in one-dimensional lattices

    NASA Astrophysics Data System (ADS)

    Hamilton, Merle D.; de Alcantara Bonfim, O. F.

    2006-03-01

    We present a lattice model consisting of a single one-dimensional chain, where the masses are interconnected by linear springs and allowed to move in a horizontal direction only, as in a monorail. In the transverse direction each mass is also attached to two other linear springs, one on each side of the mass. The ends of these springs are kept at fixed positions. The nonlinearity in the model arises from the geometric constraints imposed on the motion of the masses, as well as from the configuration of the springs, where in the transverse direction the springs are either in the extended or compressed state depending on the position of the masses. Under these conditions we show that solitary waves are present in the system. In the long wavelength limit an analytic solution for these nonlinear waves is found. Numerical integrations of the equations of motion in the full system are also performed to analyze the conditions for the existence and stability of the nonlinear waves.

  7. Giant Linear Dunes as the Formation Pathway to Megabarchan Chains: Titan and the Rub 'Al Khali

    NASA Astrophysics Data System (ADS)

    Lorenz, R. D.; Radebaugh, J.

    2015-05-01

    We suggest megabarchans cannot grow from barchans. Rather sand accumulates as giant linear dunes in a bidirectional regime which has since become more unidirectional. We see this pattern on Titan and in the field in the .United Arab Emirates.

  8. Bayesian spatial transformation models with applications in neuroimaging data.

    PubMed

    Miranda, Michelle F; Zhu, Hongtu; Ibrahim, Joseph G

    2013-12-01

    The aim of this article is to develop a class of spatial transformation models (STM) to spatially model the varying association between imaging measures in a three-dimensional (3D) volume (or 2D surface) and a set of covariates. The proposed STM include a varying Box-Cox transformation model for dealing with the issue of non-Gaussian distributed imaging data and a Gaussian Markov random field model for incorporating spatial smoothness of the imaging data. Posterior computation proceeds via an efficient Markov chain Monte Carlo algorithm. Simulations and real data analysis demonstrate that the STM significantly outperforms the voxel-wise linear model with Gaussian noise in recovering meaningful geometric patterns. Our STM is able to reveal important brain regions with morphological changes in children with attention deficit hyperactivity disorder. © 2013, The International Biometric Society.

  9. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Park, I.Y.; Tirziu, A.; Tseytlin, A.A.

    We consider circular strings rotating with equal spins S{sub 1}=S{sub 2}=S in two orthogonal planes in AdS{sub 5} and suggest that they may be dual to long gauge-theory operators built out of self-dual components of gauge field strength. As was found in hep-th/0404187, the one-loop anomalous dimensions of the such gauge-theory operators are described by an antiferromagnetic XXX{sub 1} spin chain and scale linearly with length L>>1. We find that in the case of rigid rotating string both the classical energy E{sub 0} and the 1-loop string correction E{sub 1} depend linearly on the spin S (within the stability regionmore » of the solution). This supports the identification of the rigid rotating string with the gauge-theory operator corresponding to the maximal-spin (ferromagnetic) state of the XXX{sub 1} spin chain. The energy of more general rotating and pulsating strings also happens to scale linearly with both the spin and the oscillation number. Such solutions should be dual to other lower-spin states of the spin chain, with the antiferromagnetic ground state presumably corresponding to the string pulsating in two planes with no rotation.« less

  10. Gas chromatography-mass spectrometry of carbonyl compounds in cigarette mainstream smoke after derivatization with 2,4-dinitrophenylhydrazine.

    PubMed

    Dong, Ji-Zhou; Moldoveanu, Serban C

    2004-02-20

    An improved gas chromatography-mass spectrometry (GC-MS) method was described for the analysis of carbonyl compounds in cigarette mainstream smoke (CMS) after 2,4-dinitrophenylhydrazine (DNPH) derivatization. Besides formaldehyde, acetaldehyde, acetone, acrolein, propionaldehyde, methyl ethyl ketone, butyraldehyde, and crotonaldehyde that are routinely analyzed in cigarette smoke, this technique separates and allows the analysis of several C4, C5 and C6 isomeric carbonyl compounds. Differentiation could be made between the linear and branched carbon chain components. In cigarette smoke, the branched chain carbonyls are found at higher level than the linear chain carbonyls. Also, several trace carbonyl compounds such as methoxyacetaldehyde were found for the first time in cigarette smoke. For the analysis, cigarette smoke was collected using DNPH-treated pads, which is a simpler procedure compared to conventional impinger collection. Thermal decomposition of DNPH-carbonyl compounds was minimized by the optimization of the GC conditions. The linear range of the method was significantly improved by using a standard mixture of DNPH-carbonyl compounds instead of individual compounds for calibration. The minimum detectable quantity for the carbonyls ranged from 1.4 to 5.6 microg/cigarette.

  11. Molecular Mobility in Phase Segregated Bottlebrush Block Copolymer Melts

    NASA Astrophysics Data System (ADS)

    Yavitt, Benjamin; Gai, Yue; Song, Dongpo; Winter, H. Henning; Watkins, James

    We investigate the linear viscoelastic behavior of poly(styrene)-block-poly(ethylene oxide) (PS-b-PEO) brush block copolymer (BBCP) materials over a range of vol. fractions and with side chain lengths below the entanglement molecular weights. The high chain mobility of the brush architecture results in rapid micro-phase segregation of the brush copolymer segments, which occurs during thermal annealing at mild temperatures. Master curves of the dynamic moduli were obtained by time-temperature superposition. The reduced degree of chain entanglements leads to a unique liquid-like rheology similar to that of bottlebrush homopolymers, even in the phase segregated state. We also explore the alignment of phase segregated domains at exceptionally low strain amplitudes (γ = 0.01) and mild processing temperatures using small angle X-ray scattering (SAXS). Domain orientation occurred readily at strains within the linear viscoelastic regime without noticeable effect on the moduli. This interplay of high molecular mobility and rapid phase segregation that are exhibited simultaneously in BBCPs is in contrast to the behavior of conventional linear block copolymer (LBCP) analogs and opens up new possibilities for processing BBCP materials for a wide range of nanotechnology applications. NSF Center for Hierarchical Manufacturing at the University of Massachusetts, Amherst (CMMI-1025020).

  12. Acetanilide mediated reversible assembly and disassembly of Au nanoparticles.

    PubMed

    Murugadoss, A; Kar, Manoranjan; Chattopadhyay, Arun

    2008-08-01

    Herein we report the generation of Au nanoparticles (NPs) by sparingly soluble acetanilide in water. We also report the formation of linear chain-like superstructures of self-assembled Au NPs, in the presence of excess acetanilide. This was achieved in two different ways. In the first method, acetanilide was added, with increasing concentration, into aqueous HAuCl(4) to produce Au NPs as well as for the formation of assembly, which varied according to the concentration of acetanilide. The other route involved formation of spherical Au NPs at the lowest concentration of acetanilide, which was followed by the formation of assembly of various lengths upon further addition of variable amount of acetanilide. The assemblies were stable in aqueous solution for days with characteristic UV-vis absorption spectra consisting of two peaks. While the wavelength of the first peak remained the same, the position of the second peak changed to longer wavelength with increasing acetanilide concentration. Interestingly, the linear chain-like arrays could be broken into individual particles by first dilution of the solution concentration followed by treatment with ultrasonic waves. The individual Au NPs again formed linear chain-like arrays upon addition of excess acetanilide.

  13. An MCMC method for the evaluation of the Fisher information matrix for non-linear mixed effect models.

    PubMed

    Riviere, Marie-Karelle; Ueckert, Sebastian; Mentré, France

    2016-10-01

    Non-linear mixed effect models (NLMEMs) are widely used for the analysis of longitudinal data. To design these studies, optimal design based on the expected Fisher information matrix (FIM) can be used instead of performing time-consuming clinical trial simulations. In recent years, estimation algorithms for NLMEMs have transitioned from linearization toward more exact higher-order methods. Optimal design, on the other hand, has mainly relied on first-order (FO) linearization to calculate the FIM. Although efficient in general, FO cannot be applied to complex non-linear models and with difficulty in studies with discrete data. We propose an approach to evaluate the expected FIM in NLMEMs for both discrete and continuous outcomes. We used Markov Chain Monte Carlo (MCMC) to integrate the derivatives of the log-likelihood over the random effects, and Monte Carlo to evaluate its expectation w.r.t. the observations. Our method was implemented in R using Stan, which efficiently draws MCMC samples and calculates partial derivatives of the log-likelihood. Evaluated on several examples, our approach showed good performance with relative standard errors (RSEs) close to those obtained by simulations. We studied the influence of the number of MC and MCMC samples and computed the uncertainty of the FIM evaluation. We also compared our approach to Adaptive Gaussian Quadrature, Laplace approximation, and FO. Our method is available in R-package MIXFIM and can be used to evaluate the FIM, its determinant with confidence intervals (CIs), and RSEs with CIs. © The Author 2016. Published by Oxford University Press. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  14. Non-Linear Dynamics of Saturn's Rings

    NASA Astrophysics Data System (ADS)

    Esposito, L. W.

    2015-12-01

    Non-linear processes can explain why Saturn's rings are so active and dynamic. Some of this non-linearity is captured in a simple Predator-Prey Model: Periodic forcing from the moon causes streamline crowding; This damps the relative velocity, and allows aggregates to grow. About a quarter phase later, the aggregates stir the system to higher relative velocity and the limit cycle repeats each orbit, with relative velocity ranging from nearly zero to a multiple of the orbit average: 2-10x is possible. Summary of Halo Results: A predator-prey model for ring dynamics produces transient structures like 'straw' that can explain the halo structure and spectroscopy: Cyclic velocity changes cause perturbed regions to reach higher collision speeds at some orbital phases, which preferentially removes small regolith particles; Surrounding particles diffuse back too slowly to erase the effect: this gives the halo morphology; This requires energetic collisions (v ≈ 10m/sec, with throw distances about 200km, implying objects of scale R ≈ 20km); We propose 'straw', as observed ny Cassini cameras. Transform to Duffing Eqn : With the coordinate transformation, z = M2/3, the Predator-Prey equations can be combined to form a single second-order differential equation with harmonic resonance forcing. Ring dynamics and history implications: Moon-triggered clumping at perturbed regions in Saturn's rings creates both high velocity dispersion and large aggregates at these distances, explaining both small and large particles observed there. This confirms the triple architecture of ring particles: a broad size distribution of particles; these aggregate into temporary rubble piles; coated by a regolith of dust. We calculate the stationary size distribution using a cell-to-cell mapping procedure that converts the phase-plane trajectories to a Markov chain. Approximating the Markov chain as an asymmetric random walk with reflecting boundaries allows us to determine the power law index from results of numerical simulations in the tidal environment surrounding Saturn. Aggregates can explain many dynamic aspects of the rings and can renew rings by shielding and recycling the material within them, depending on how long the mass is sequestered. We can ask: Are Saturn's rings a chaotic non-linear driven system?

  15. Multiple attractors and boundary crises in a tri-trophic food chain.

    PubMed

    Boer, M P; Kooi, B W; Kooijman, S A

    2001-02-01

    The asymptotic behaviour of a model of a tri-trophic food chain in the chemostat is analysed in detail. The Monod growth model is used for all trophic levels, yielding a non-linear dynamical system of four ordinary differential equations. Mass conservation makes it possible to reduce the dimension by 1 for the study of the asymptotic dynamic behaviour. The intersections of the orbits with a Poincaré plane, after the transient has died out, yield a two-dimensional Poincaré next-return map. When chaotic behaviour occurs, all image points of this next-return map appear to lie close to a single curve in the intersection plane. This motivated the study of a one-dimensional bi-modal, non-invertible map of which the graph resembles this curve. We will show that the bifurcation structure of the food chain model can be understood in terms of the local and global bifurcations of this one-dimensional map. Homoclinic and heteroclinic connecting orbits and their global bifurcations are discussed also by relating them to their counterparts for a two-dimensional map which is invertible like the next-return map. In the global bifurcations two homoclinic or two heteroclinic orbits collide and disappear. In the food chain model two attractors coexist; a stable limit cycle where the top-predator is absent and an interior attractor. In addition there is a saddle cycle. The stable manifold of this limit cycle forms the basin boundary of the interior attractor. We will show that this boundary has a complicated structure when there are heteroclinic orbits from a saddle equilibrium to this saddle limit cycle. A homoclinic bifurcation to a saddle limit cycle will be associated with a boundary crisis where the chaotic attractor disappears suddenly when a bifurcation parameter is varied. Thus, similar to a tangent local bifurcation for equilibria or limit cycles, this homoclinic global bifurcation marks a region in the parameter space where the top-predator goes extinct. The 'Paradox of Enrichment' says that increasing the concentration of nutrient input can cause destabilization of the otherwise stable interior equilibrium of a bi-trophic food chain. For a tri-trophic food chain enrichment of the environment can even lead to extinction of the highest trophic level.

  16. Predicting spatio-temporal failure in large scale observational and micro scale experimental systems

    NASA Astrophysics Data System (ADS)

    de las Heras, Alejandro; Hu, Yong

    2006-10-01

    Forecasting has become an essential part of modern thought, but the practical limitations still are manifold. We addressed future rates of change by comparing models that take into account time, and models that focus more on space. Cox regression confirmed that linear change can be safely assumed in the short-term. Spatially explicit Poisson regression, provided a ceiling value for the number of deforestation spots. With several observed and estimated rates, it was decided to forecast using the more robust assumptions. A Markov-chain cellular automaton thus projected 5-year deforestation in the Amazonian Arc of Deforestation, showing that even a stable rate of change would largely deplete the forest area. More generally, resolution and implementation of the existing models could explain many of the modelling difficulties still affecting forecasting.

  17. Collinear swimmer propelling a cargo sphere at low Reynolds number.

    PubMed

    Felderhof, B U

    2014-11-01

    The swimming velocity and rate of dissipation of a linear chain consisting of two or three little spheres and a big sphere is studied on the basis of low Reynolds number hydrodynamics. The big sphere is treated as a passive cargo, driven by the tail of little spheres via hydrodynamic and direct elastic interaction. The fundamental solution of Stokes equations in the presence of a sphere with a no-slip boundary condition, as derived by Oseen, is used to model the hydrodynamic interactions between the big sphere and the little spheres.

  18. Single ricin detection by atomic force microscopy chemomechanical mapping

    NASA Astrophysics Data System (ADS)

    Chen, Guojun; Zhou, Jianfeng; Park, Bosoon; Xu, Bingqian

    2009-07-01

    The authors report on a study of detecting ricin molecules immobilized on chemically modified Au (111) surface by chemomechanically mapping the molecular interactions with a chemically modified atomic force microscopy (AFM) tip. AFM images resolved the different fold-up conformations of single ricin molecule as well as their intramolecule structure of A- and B-chains. AFM force spectroscopy study of the interaction indicates that the unbinding force has a linear relation with the logarithmic force loading rate, which agrees well with calculations using one-barrier bond dissociation model.

  19. Interfacial friction and adhesion of cross-linked polymer thin films swollen with linear chains.

    PubMed

    Zhang, Qing; Archer, Lynden A

    2007-07-03

    The preparation and interfacial properties of a new type of tethered, thin-film lubricant coating are presented. These coatings are composed of three components: a dense self-assembled monolayer (SAM) underlayer that presents reactive vinyl groups at its surface; a cross-linked polydimethylsiloxane (PDMS) overlayer that is covalently tethered to the SAM; and free, mobile linear PDMS chains dispersed in the network. We investigate the influence of the molecular weight (Ms) and concentration of the free PDMS chains on the structure and equilibrium swelling properties of the cross-linked films. Using a bead-probe lateral force microscopy measurement technique, we also quantify the interfacial friction and adhesion characteristics of surfaces functionalized with these coatings. We find that both the volume fraction and the molecular weight of free PDMS molecules in the coatings influence their interfacial friction and adhesion properties. For example, the addition of short PDMS chains in dry, cross-linked PDMS thin films yields tethered surface coatings with ultralow friction coefficients (mu = 5.2 x 10(-3)). An analysis based on classical lubrication theory suggests that the reduction in friction force produced by free polymer is a consequence of the gradual separation of asperities on opposing surfaces and the consequent substitution of solid-solid friction by viscous drag of the free polymer chains in the network.

  20. Encapsidation of Linear Polyelectrolyte in a Viral Nanocontainer

    NASA Astrophysics Data System (ADS)

    Hu, Yufang

    2005-03-01

    We present the results from a combined experimental and theoretical study on the self-assembly of a model icosahedral virus, Cowpea Chlorotic Mottle Virus (CCMV). The formation of native CCMV capsids is believed to be driven primarily by the electrostatic interactions between the viral RNA and the positively charged capsid interior, as well as by the hydrophobic interactions between capsid protein subunits. To probe these molecular interactions, in vitro self-assembly reactions are carried out using the CCMV capsid protein and a synthetic linear polyelectrolyte, sodium polystyrene sulfonate (NaPSS), which functions as the analog of viral RNA. Under appropriate solutions conditions, NaPSS is encapsidated by the viral capsid. The molecular weight of NaPSS is systematically varied and the resulting average capsid size, size distribution, and particle morphology are measured by transmission electron microscopy. The correlation between capsid size and packaged cargo size, as well as the upper limit of capsid packaging capacity, are characterized. To elucidate the physical role played by the encapsidated polyelectrolyte in determining the preferred size of spherical viruses, we have used a mean-field approach to calculate the free energy of the virus-like particle as a function of chain length (and of the strength of chain/capsid attractive interaction). We find good agreement with our analytical calculations and experimental results.

Top